WorldWideScience

Sample records for cellulolytic actinomycetethermobifida fusca

  1. Genome Sequence and Analysis of the Soil Cellulolytic ActinomyceteThermobifida fusca

    Energy Technology Data Exchange (ETDEWEB)

    Lykidis, Athanasios; Mavromatis, Konstantinos; Ivanova, Natalia; Anderson, Iain; Land, Miriam; DiBartolo, Genevieve; Martinez, Michele; Lapidus, Alla; Lucas, Susan; Copeland, Alex; Richardson, Paul; Wilson,David B.; Kyrpides, Nikos

    2007-02-01

    Thermobifida fusca is a moderately thermophilic soilbacterium that belongs to Actinobacteria. 3 It is a major degrader ofplant cell walls and has been used as a model organism for the study of 4secreted, thermostable cellulases. The complete genome sequence showedthat T. fusca has a 5 single circular chromosome of 3642249 bp predictedto encode 3117 proteins and 65 RNA6 species with a coding densityof 85percent. Genome analysis revealed the existence of 29 putative 7glycoside hydrolases in addition to the previously identified cellulasesand xylanases. The 8 glycosyl hydrolases include enzymes predicted toexhibit mainly dextran/starch and xylan 9 degrading functions. T. fuscapossesses two protein secretion systems: the sec general secretion 10system and the twin-arginine translocation system. Several of thesecreted cellulases have 11 sequence signatures indicating theirsecretion may be mediated by the twin-arginine12 translocation system. T.fusca has extensive transport systems for import of carbohydrates 13coupled to transcriptional regulators controlling the expression of thetransporters and14 glycosylhydrolases. In addition to providing anoverview of the physiology of a soil 15 actinomycete, this study presentsinsights on the transcriptional regulation and secretion of16 cellulaseswhich may facilitate the industrial exploitation of thesesystems.

  2. Hydrophobic nature and effects of culture conditions on biofilm formation by the cellulolytic actinomycete Thermobifida fusca

    Directory of Open Access Journals (Sweden)

    Almaris N. Alonso

    2015-09-01

    Full Text Available Thermobifida fusca produces a firmly attached biofilm on nutritive and non-nutritive surfaces, such as cellulose, glass, plastic, metal and Teflon®. The ability to bind to surfaces has been suggested as a competitive advantage for microbes in soil environments. Results of previous investigations indicated that a Gram-positive cellulolytic soil bacteria, Cellulomonas uda, a facultative aerobe, specifically adhered to nutritive surfaces forming biofilms, but cells did not colonize non-nutritive surfaces. Cell surface hydrophobicity has been implicated in the interactions between bacteria and the adhesion to surfaces. It was recently described that the cellulolytic actinomycete T. fusca cells hydrophobicity was measured and compared to the cellulolytic soil bacteria C. uda. Also, T. fusca biofilm formation on non-nutritive surface, such as polyvinyl chloride, was examined by testing various culture ingredients to determine a possible trigger mechanism for biofilm formation. Experimental results showed that partitioning of bacterial cells to various hydrocarbons was higher in T. fusca cells than in C. uda. The results of this study suggest that the attachment to multiple surfaces by T. fusca could depend on nutrient availability, pH, salt concentrations, and the higher hydrophobic nature of bacterial cells. Possibly, these characteristics may confer T. fusca a selective advantage to compete and survive among the many environments it thrives.

  3. Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca.

    Science.gov (United States)

    Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

    2016-09-01

    Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene encoding a putative membrane-anchored GH18 chitinase (Tfu0868) from T. fusca has been cloned and overexpressed in Escherichia coli. The protein was produced as SUMO fusion protein and, upon removal of the SUMO domain, soluble pure TfChi18A was obtained with yields typically amounting to 150mg per litre of culture. The enzyme was found to be relatively thermostable (apparent Tm=57.5°C) but not particularly thermoactive, the optimum temperature being 40-45°C. TfChi18A bound to α- and β-chitin and degraded both these substrates. Interestingly, activity towards colloidal chitin was minimal and in this case, substrate inhibition was observed. TfChi18A also cleaved soluble chito-oligosaccharides and showed a clear preference for substrates having five sugars or more. While these results show that TfChi18A is a catalytically competent GH18 chitinase, the observed catalytic rates were low compared to those of well-studied GH18 chitinases. This suggests that TfChi18A is not a true chitinase and not likely to endow T. fusca with the ability to grow on chitin. PMID:27108953

  4. Regulation of Biosynthesis of Individual Cellulases in Thermomonospora fusca

    OpenAIRE

    Spiridonov, Nikolay A.; Wilson, David B.

    1998-01-01

    Regulation of the biosynthesis of the six cellulases comprising the cellulolytic system of the thermophilic soil bacterium Thermomonospora fusca ER1 was studied. The levels of the individual enzymes produced on different noninducing and inducing carbon sources were determined. The lowest level of cellulase synthesis (3 nM) was observed with xylose as a carbon source, and the highest level (247 to 1,670 nM for different enzymes) was found in cultures grown on microcrystalline cellulose. Endoce...

  5. Gut microbiota of Busseola fusca (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Snyman, Maxi; Gupta, Arvind Kumar; Bezuidenhout, Cornelius Carlos; Claassens, Sarina; van den Berg, Johnnie

    2016-07-01

    Busseola fusca (Fuller) (Lepidoptera: Noctuidae) is a stemborer pest that attacks maize (Zea mays) throughout sub-Saharan Africa. Genetically modified maize has been shown to be effective against B. fusca. However, resistance of B. fusca against Bt-maize has developed and spread throughout South Africa. Previous studies suggested that gut microbiota contribute to mortality across a range of Lepidoptera. To fully assess the role of microbiota within the gut, it is essential to understand the microbiota harboured by natural B. fusca populations. This study aimed to identify the gut-associated bacteria by 16S rRNA gene sequencing. A total of 78 bacterial strains were characterised from the midgut of B. fusca larvae that were collected from 30 sites across the maize producing region of South Africa. Molecular phylogenetic analyses revealed bacteria affiliated to Proteobacteria, Actinobacteria, and Firmicutes. Taxonomic distribution placed these isolates into 15 different genera representing 20 species. The majority of bacteria identified belong to the genera Bacillus, Enterococcus, and Klebsiella. The B. fusca gut represents an intriguing and unexplored niche for analysing microbial ecology. The study could provide opportunities for developing new targets for pest management and contribute to understanding the phenomenon of resistance evolution of this species. PMID:27263010

  6. Ferrofluid and cellulolytic fungi

    Science.gov (United States)

    Manoliu, Al.; Oprica, Lacramioara; Creanga, Dorina-Emilia

    2005-03-01

    The study of petroleum ferrofluid influence upon the biology of the cellulolytic fungus Chaetomium globosum, with implications in cellulose biotechnology, was carried out. Taking into account previous results revealing the ferrofluid effects on the cellulose enzyme complex as well as on the dehydrogenases, the results of the investigation of catalase and peroxidase behavior are presented in this paper. The intensification of catalase biosynthesis in response to the increase of hydrogen peroxide after fungus cell interference with the petroleum ferrofluid was the main issue of the experiments.

  7. Management of winter weeds affects Frankliniella fusca (Thysanoptera: Thripidae) dispersal.

    Science.gov (United States)

    Beaudoin, A L P; Kennedy, G G

    2012-04-01

    Frankliniella fusca (Hinds) naturally disperses from winter weeds to crops in spring, causing direct and indirect damage. Field preparation before planting includes use of herbicides or cultivation to kill unwanted vegetation, which adversely affects F. fusca host plants and potentially influences F. fusca dispersal. Common chickweed, Stellaria media (L.), infested with F. fusca, was used as a model to study effects of timing and type of vegetation management on adult dispersal. Infested weeds were caged and F. fusca weekly dispersal was monitored using sticky traps. Weed management treatments performed at an early (14 April-11 May) or late (2 wk after early treatment) date consisted of glyphosate, paraquat, disking, hoeing, or untreated control. Late glyphosate and hoeing treatments resulted in cumulative dispersal statistically similar to or greater than from control plots. Compared with the control, significantly more F. fusca dispersed from the glyphosate and hoeing plots during the 3 wk after treatment. More thrips dispersed from the late paraquat treatment 1 wk post-application than from the control. Dispersal from the disked treatment and early paraquat treatment was similar to that of the control 1- to 3-wk post-treatment. Early treatments resulted in significantly smaller cumulative dispersal than the control in all but one instance. Late disking and paraquat treatments resulted in cumulative F. fusca captures that were statistically similar or less than that in the control. Winter weed management type and timing affect F. fusca dispersal magnitude and duration.

  8. EXTRACELLULAR CELLULOLYTIC COMPLEXES PRODUCTION BY MICROSCOPIC FUNGI

    Directory of Open Access Journals (Sweden)

    S. O. Syrchin

    2015-10-01

    Full Text Available The aim of this work was to screen and to study the effect of inducers on the synthesis of the cellulolytic enzyme complexes by microscopic fungi. Cellulolytic and xylanolytic activities were determined by reducing sugar with DNS reagent, and β-glucosidase activity by pNPG hydrolysis. The enzyme preparations were obtained by ammonium sulphate precipitation. Among 32 studied strains of microscopic fungi 14 produced cellulo- and xylanolytic enzyme complexes. Fusarium sp. 5 and Fennellia sp. 2806 demonstrated the highest levels of all studied enzyme activities. Enzyme preparations with high endo-, exoglucanase, xylanase and β-glucosidase activities were obtained from these strains. Fusarium sp. 5 and Fennellia sp. 2806 were active producers of cellulase enzyme complexes during growth on natural substrates. It was shown that inductors of cellulolytic enzymes in Fusarium sp. 5 and Fennellia sp. 2806 differed from the ones in Trichoderma reesei.

  9. Not so monofunctional-a case of thermostable Thermobifida fusca catalase with peroxidase activity

    NARCIS (Netherlands)

    Lončar, Nikola; Fraaije, Marco W

    2014-01-01

    Thermobifida fusca is a mesothermophilic organism known for its ability to degrade plant biomass and other organics, and it was demonstrated that it represents a rich resource of genes encoding for potent enzymes for biocatalysis. The thermostable catalase from T. fusca has been cloned and overexpre

  10. Screening genus Penicillium for producers of cellulolytic and xylanolytic enzymes

    DEFF Research Database (Denmark)

    Krogh, Kristian Bertel Rømer; Mørkeberg, Astrid; Frisvad, Jens Christian;

    2004-01-01

    For enzymatic hydrolysis of lignocellulosic material, cellulolytic enzymes from Trichoderma reesei are most commenly used, but, there is a need for more efficient enzyme cocktails. In this study, the production of cellulolytic and xylanolytic enzymes was investigated in 12 filamentous fungi from...

  11. Effects of the ant Formica fusca on the transmission of microsporidia infecting gypsy moth larvae.

    Science.gov (United States)

    Goertz, Dörte; Hoch, Gernot

    2013-06-01

    Transmission plays an integral part in the intimate relationship between a host insect and its pathogen that can be altered by abiotic or biotic factors. The latter include other pathogens, parasitoids, or predators. Ants are important species in food webs that act on various levels in a community structure. Their social behavior allows them to prey on and transport larger prey, or they can dismember the prey where it was found. Thereby they can also influence the horizontal transmission of a pathogen in its host's population. We tested the hypothesis that an ant species like Formica fusca L. (Hymenoptera: Formicidae) can affect the horizontal transmission of two microsporidian pathogens, Nosema lymantriae Weiser (Microsporidia: Nosematidae) and Vairimorpha disparis (Timofejeva) (Microsporidia: Burenellidae), infecting the gypsy moth, Lymantria dispar L. (Lepidoptera: Erebidae: Lymantriinae). Observational studies showed that uninfected and infected L. dispar larvae are potential prey items for F. fusca. Laboratory choice experiments led to the conclusion that F. fusca did not prefer L. dispar larvae infected with N. lymantriae and avoided L. dispar larvae infected with V. disparis over uninfected larvae when given the choice. Experiments carried out on small potted oak, Quercus petraea (Mattuschka) Liebl. (Fagaceae), saplings showed that predation of F. fusca on infected larvae did not significantly change the transmission of either microsporidian species to L. dispar test larvae. Microscopic examination indicated that F. fusca workers never became infected with N. lymantriae or V. disparis after feeding on infected prey. PMID:23926361

  12. Bactericidal and cytotoxic effects of Erythrina fusca leaves aquadest extract

    Directory of Open Access Journals (Sweden)

    Janti Sudiono

    2013-03-01

    Full Text Available Background: Empirically, Erythrina fusca has been used as traditional herb for its antibacterial and antiinflammation properties. Periodontal disease is one of the most oral infectious diseases with microorganism predominated as the contributing factors. Porphyromonas gingivalis (P. gingivalis is one of the main bacteria pathogen found in periodontal diseases. Purpose: The purpose of this study was to examine the bactericidal effect of Erythrina fusca Leaves Aquadest Extract (EFLAE at various concentrations on P. gingivalis and cytotoxic effect on fibroblast. Methods: Pure P. gingivalis was cultured in Brain Heart Infusion (BHI medium for 24 hours with or without various concentrations of treatment of EFLAE. Calculation and statistical analysis of remaining bacteria were performed by inhibitory zone method to evaluate the EFLAE bactericidal effect and compared to chlorhexidine as positive control. To evaluate the cytotoxic effect, NIH 3T3 cells were cultured in Dulbecco’s Modification of Eagle’s Medium (DMEM containing of 10% fetal bovine serum (FBS and 1% penicillin-streptomycin, pH 7.2, in 5% CO2, and stored in humidified incubator under temperature 370 C. Cells were treated with/without various concentrations of EFLAE for 48 hours. The viable cells were then counted using 3-(4,5- Dimethylthiazol-2-yl-2,5 diphenyl tetrazodium bromide (MTT method. Results: EFLAE have bactericidal effect on P. gingivalis in a concentration dependent manner starting from 78%. The concentration of 90% EFLAE had stronger bactericidal effect (35.004 ± 1.546 than those of chlorhexidine as positive control (32.313 ± 1.619. One-way ANOVA showed significant bactericidal effect differences among concentrations of EFLAE and chlorhexidine (p<0.05 while Tuckey HSD test showed significant difference only between lower concentration of EFLAE (78%, 79% and chlorhexidine. With the highest concentration of EFLAE (100% applied in the bactericidal test, no cytotoxic effect

  13. Production of a polyester degrading extracellular hydrolase from Thermomonospora fusca.

    Science.gov (United States)

    Gouda, Mona K; Kleeberg, Ilona; van den Heuvel, Joop; Müller, Rolf-Joachim; Deckwer, Wolf-Dieter

    2002-01-01

    The production of a polyester-degrading hydrolase from the thermophilic actinomycete Thermomonospora fusca was investigated with regard to its potential technical application. Only in the presence of a polyester (random aliphatic-aromatic copolyester from 1,4-butanediol, terephthalic acid, and adipic acid with around 40-50 mol % terephthalic acid in the acid component), the excretion of the extracellular enzyme could be achieved with an optimized synthetic medium using pectin and NH(4)Cl as nitrogen source. Compared to complex media, a significantly higher specific activity at comparable volumetric yields could be obtained, thus reducing the expenditure for purification. The activity profile in the medium is controlled by a complex process involving (1) induction of enzyme excretion, (2) enzyme adsorption on the hydrophobic polyester surface, (3) inhibition of enzyme generation by monomers produced by polyester cleavage, and (4) enzyme denaturation. Diafiltration with cellulose acetate membranes as the sole downstream processing step led to a product of high purity and with sufficient yield (60% of total activity). Scaling-up from shaking flasks to a fermentor scale of 100 L revealed no specific problems. However, the excretion of the hydrolase by the actinomycete turned out to be inhibited by the degradation products (monomers) of the aliphatic-aromatic copolyester used as inductor for the enzyme production. The crude enzyme exhibited generally similar properties (temperature and pH optimum) as the highly purified hydrolase described previously; however, the storage capability and thermal stability is improved when the crude enzyme solution is diafiltrated.

  14. Evaluation of cellulolytic activity in insect digestive fluids.

    Science.gov (United States)

    Su, L-J; Zhang, H-F; Yin, X-M; Chen, M; Wang, F-Q; Xie, H; Zhang, G-Z; Song, A-D

    2013-01-01

    Efficient and low-cost cellulolytic enzymes are urgently needed to degrade recalcitrant plant biomass during the industrial production of lignocellulosic biofuels. Here, the cellulolytic activities in the gut fluids of 54 insect species that belong to 7 different taxonomic orders were determined using 2 different substrates, carboxymethyl cellulose (CMC) (approximating endo-β-1,4-glucanase) and filter paper (FP) (total cellulolytic activities). The use of CMC as the substrate in the zymogram analysis resulted in the detection of distinct cellulolytic protein bands. The cellulolytic activities in the digestive system of all the collected samples were detected using cellulolytic activity analysis. The highest CMC gut fluid activities were found in Coleoptera and Orthoptera, while FP analysis indicated that higher gut fluid activities were found in several species of Coleoptera and Lepidoptera. In most cases, gut fluid activities were higher with CMC than with FP substrate, except for individual Lepidoptera species. Our data indicate that the origin of cellulolytic enzymes probably reflects the phylogenetic relationship and feeding strategies of different insects. PMID:23315870

  15. An Efficient and Improved Methodology for the Screening of Industrially Valuable Xylano-Pectino-Cellulolytic Microbes

    OpenAIRE

    Avtar Singh; Amanjot Kaur; Anita Dua; Ritu Mahajan

    2015-01-01

    Xylano-pectino-cellulolytic enzymes are valuable enzymes of the industrial sector. In our earlier study, we have reported a novel and cost effective methodology for the qualitative screening of cellulase-free xylano-pectinolytic microorganisms by replacing the commercial, highly expensive substrates with agricultural residues, but the microorganisms with xylanolytic, pectinolytic, cellulolytic, xylano-pectinolytic, xylano-cellulolytic, pectino-cellulolytic, and xylano-pectino-cellulolytic pot...

  16. Production of cellulolytic enzymes from ascomycetes

    DEFF Research Database (Denmark)

    Hansen, Gustav Hammerich; Lübeck, Mette; Frisvad, Jens Christian;

    2015-01-01

    Optimizing production of cellulose degrading enzymes is of great interest in order to increase the feasibility of constructing biorefinery facilities for a sustainable supply of energy and chemical products. The ascomycete phylum has a large potential for the production of cellulolytic enzymes....... Although numerous enzymatic profiles have already been unraveled, the research has been covering only a limited number of species and genera, thus leaving many ascomycetes to be analyzed. Such analysis requires choosing appropriate media and cultivation methods that ensure enzyme profiles with high...... specificities and activities. However, the choice of media, cultivation methods and enzyme assays highly affect the enzyme activity profile observed. This review provides an overview of enzymatic profiles for several ascomycetes covering phylogenetically distinct genera and species. The profiles of cellulose...

  17. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu; Tang, Lan; Henriksen, Svend Hostgaard Bang

    2016-05-17

    The present invention provides isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Cellulase production from treated oil palm empty fruit bunch degradation by locally isolated Thermobifida fusca

    Directory of Open Access Journals (Sweden)

    M. Nazli Naim

    2013-02-01

    Full Text Available The aim of this research was to evaluate the production of cellulases from locally isolated bacteria, Thermobifida fusca, using thermal and chemical treated oil palm empty fruit bunch (OPEFB as substrate in liquid-state fermentation (LSF. T. fusca was successfully isolated and was a dominant cellulase producer in OPEFB composting at the thermophilic stage. Analysis of the surface morphology of OPEFB samples using Scanning Electron Microscopy (SEM showed that the most significant changes after the combination of thermal and chemical pretreatment was the removal of silica bodies, and this observation was supported by X-ray Diffraction analysis (XRD, Fourier Transform Infrared (FTIR, and Thermogravimetric analysis (TG showing changes on the hemicelluloses, cellulose, and lignin structures throughout the pretreatment process. As a result of the pretreatment, higher cellulase production by T. fusca was obtained. The highest activity for CMCase, FPase, and β-glucosidase using optimally treated OPEFB were 0.24 U/mL, 0.34 U/mL, and 0.04 U/mL, respectively. Therefore, it can be suggested that the combination of chemical and thermal pretreatments enhances the degradation of OPEFB for subsequent use as fermentation substrate, contributing to a higher cellulases yield by T. fusca.

  19. Cellulolytic Enzymes Production by Solid State Culture

    Directory of Open Access Journals (Sweden)

    Miguel A. Medina-Morales

    2011-01-01

    Full Text Available Problem statement: Great interest in the use of lignocellulosic biomass is increasing in order to diminish the accumulation of residues, such as pecan nut shells. One of the alternatives is the fungal degradation of these residues. Approach: The capacity of Trichoderma (coded as T1, T2 and T3 strains to produce cellulase and xylonite was evaluated. Results: Pecan nut shell fibers were used as sole carbon source. The fiber characterization study showed that cellulose levels were of 0.1% while hemicellulose was up to 25 %. Three Trichoderma strains were used on solid fungal cultures using the fibers as sole carbon and inductor source for the production of cellulolytic enzymes. The behavior of the sugars liberated by the fungi showed that the strain T2 is able to accumulate more monomeric reducing sugars than the other two strains, this could be attributed at this strain has a higher sugar liberation rate and slower sugar consumption rate. This strain also expressed more cellulase and xylanase activity. The low quantity of cellulose registered in the fibers can still be used to induce cellulase activity. Conclusion: The T2 strain had the highest level of enzymatic activity both cellulase and xylanase.

  20. Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca.

    Science.gov (United States)

    Irwin, Diana C; Cheng, Mark; Xiang, Bosong; Rose, Jocelyn K C; Wilson, David B

    2003-07-01

    Thermobifida fusca xyloglucan-specific endo-beta-1,4-glucanase (Xeg)74 and the Xeg74 catalytic domain (CD) were cloned, expressed in Escherichia coli, purified and characterized. This enzyme has a glycohydrolase family-74 CD that is a specific xyloglucanase followed by a family-2 carbohydrate binding module at the C terminus. The Michaelis constant (Km) and maximal rate (Vmax) values for hydrolysis of tamarind seed xyloglucan (tamXG) are 2.4 micro m and 966 micro mol xyloglucan oligosaccharides (XGOs) min-1. micro mol protein-1. More than 75% of the activity was retained after a 16-h incubation at temperatures up to 60 degrees C. The enzyme was most active at pH 6.0-9.4. NMR analysis showed that its catalytic mechanism is inverting. The oligosaccharide products from hydrolysis of tamXG were determined by MS analysis. Cel9B, an active carboxymethylcellulose (CMC)ase from T. fusca, was also found to have activity on xyloglucan (XG) at 49 micro mol.min-1. micro mol protein-1, but it could not hydrolyze XG units containing galactose. An XG/cellulose composite was prepared by growing Gluconacetobacterxylinus on glucose with tamXG in the medium. Although a mixture of purified cellulases was unable to degrade this material, the composite material was fully hydrolyzed when Xeg74 was added. T. fusca was not able to grow on tamXG, but Xeg74 was found in the culture supernatant at the same level as was found in cultures grown on Solka Floc. The function of this enzyme appears to be to break down the XG surrounding cellulose fibrils found in biomass so that T. fusca can utilize the cellulose as a carbon source.

  1. Bioaccumulation and Depuration of Copper in the Kidney and Liver of a Freshwater Fish, Capoeta fusca

    Directory of Open Access Journals (Sweden)

    Borhan Mansouri

    2016-07-01

    Full Text Available Background: This study aims to investigate the patterns of bioaccumulation and depuration of copper in the selected kidney and liver of Capoeta fusca. Methods: The fish were collected between September and November 2010 from a qanat in Birjand. They were exposed to two types treatments with copper (0.25 and 0.75 mg/L for a period of 41 days. The fish under study were exposed to the above-mentioned sub-lethal concentrations separately for 14 and 21 days (accumulation period. At the end of this period, the remaining fish were kept in tap water (elimination period for 31 and 41 days. Results: The findings showed that the accumulation of copper in lower and higher sub-lethal concentrations was higher in kidney as the mean accumulation of copper on day 21 was 1.9±0.1 μg/g and 2.93±0.47 μg/g respectively, in 0.25 μg/g and 0.75 μg/g concentrations. On the other hand, the results also showed that the depuration level of copper in the given concentrations was higher in liver than kidney. The bioaccumulation and depuration of copper significantly increased in the kidney and liver of C. fusca (P<0.01. Conclusion: Based on the present work, it is concluded that C. fusca has a potential for the rapid accumulation and depuration of copper in freshwater. Also, the results indicate that the fish C. fusca, as representative fish species in the East of Iran, can be a useful bioindicator organism of water contamination with copper.

  2. Plant regeneration from immature inflorescence derived callus cultures of salt tolerant kallar grass (Leptochloa fusca L.)

    OpenAIRE

    M.Praveena; Giri, C. C.

    2012-01-01

    Efficient plant regeneration has been achieved from immature inflorescence derived callus cultures of salt tolerant grass Leptochloa fusca (L.). Young inflorescence explants displayed wide-ranging responses for callus induction and plant regeneration when subjected to different cold treatment durations and without cold treatment exposure (control) prior to its inoculation to MS medium supplemented with different concentrations/combinations of plant growth regulators (PGRs). The PGRs included ...

  3. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping

    2016-06-14

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Cellulolytic and xylanolytic activities of common indoor fungi

    DEFF Research Database (Denmark)

    Andersen, Birgitte; Poulsen, Rehab; Hansen, Gustav Hammerich

    2016-01-01

    or no cellulolytic and xylanolytic activities using AZCL-assays. On the other hand, both Cladosporium sphaerospermum and Penicillium chrysogenum showed the highest cellulase, β-glucosidase, mannase, β-galactanase and arabinanase activities and would be good candidates for over-producers of enzymes needed...

  5. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    Science.gov (United States)

    Schnorr, Kirk; Kramer, Randall

    2016-04-05

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Schnorr, Kirk; Kramer, Randall

    2016-08-09

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2016-08-09

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  8. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo

    2014-09-30

    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  9. BIOTECHNOLOGY OF TRICHODERMA-BASED FEED ADDITIVE WITH CELLULOLYTIC PROPERTIES

    Directory of Open Access Journals (Sweden)

    Koshchayev A. G.

    2013-11-01

    Full Text Available In the work, we have presented the information of elaboration of a manufacturing process of Mycocel feed additive with the cellulolytic activity for poul-try industry. Manufacturing process includes follow-ing steps: stock culture maintenance and storage of Trichoderma lignorum 81-17, growing fluid culture of microscopic fungus in sucrose yeast extract me-dium, feed additive with cellulolytic properties out-put and quality control, packaging, storage and disposal of waste. We have shown that the Mycocel is non-toxic feed additive for protozoa and warm-blooded animals (laboratory mice and quails. This study demonstrated total population livability in the experimental group with feed additive. Quail body-weight of experimental group was higher by 6% as compared to the control and feed consumption per 1 kg of live weight of bird was 3,58 kg, 7,5% lower than the control

  10. Responses of the tropical gorgonian coral Eunicea fusca to ocean acidification conditions

    Science.gov (United States)

    Gómez, C. E.; Paul, V. J.; Ritson-Williams, R.; Muehllehner, N.; Langdon, C.; Sánchez, J. A.

    2015-06-01

    Ocean acidification can have negative repercussions from the organism to ecosystem levels. Octocorals deposit high-magnesium calcite in their skeletons, and according to different models, they could be more susceptible to the depletion of carbonate ions than either calcite or aragonite-depositing organisms. This study investigated the response of the gorgonian coral Eunicea fusca to a range of CO2 concentrations from 285 to 4,568 ppm (pH range 8.1-7.1) over a 4-week period. Gorgonian growth and calcification were measured at each level of CO2 as linear extension rate and percent change in buoyant weight and calcein incorporation in individual sclerites, respectively. There was a significant negative relationship for calcification and CO2 concentration that was well explained by a linear model regression analysis for both buoyant weight and calcein staining. In general, growth and calcification did not stop in any of the concentrations of pCO2; however, some of the octocoral fragments experienced negative calcification at undersaturated levels of calcium carbonate (>4,500 ppm) suggesting possible dissolution effects. These results highlight the susceptibility of the gorgonian coral E. fusca to elevated levels of carbon dioxide but suggest that E. fusca could still survive well in mid-term ocean acidification conditions expected by the end of this century, which provides important information on the effects of ocean acidification on the dynamics of coral reef communities. Gorgonian corals can be expected to diversify and thrive in the Atlantic-Eastern Pacific; as scleractinian corals decline, it is likely to expect a shift in these reef communities from scleractinian coral dominated to octocoral/soft coral dominated under a "business as usual" scenario of CO2 emissions.

  11. Ecology of the African Maize Stalk Borer, Busseola fusca (Lepidoptera: Noctuidae with Special Reference to Insect-Plant Interactions

    Directory of Open Access Journals (Sweden)

    Paul-André Calatayud

    2014-07-01

    Full Text Available Busseola fusca (Lepidoptera: Noctuidae is an important pest of maize and sorghum in sub-Saharan Africa. One century after its first description by Fuller in 1901, inaccurate information based on earlier reports are still propagated on its distribution (e.g., absent from the lower altitudes in East Africa and host plant range (e.g., feeding on a large range of wild grass species. This review provides updated information on the biology, distribution and genetics of B. fusca with emphasis on insect-plant interactions. Related to this, new avenues of stem borer management are proposed.

  12. Karyological observations on Turbellaria Proseriata: karyometric analysis of Monocelis fusca, M. lineata (Monocelididae) and Parotoplana macrostyla (Otoplanidae)

    Science.gov (United States)

    Curini-Galletti, M.; Galleni, L.; Puccinelli, I.

    1984-03-01

    A karyometric analysis of the chromosome set of the marine turbellarians Monocelis fusca, M. lineata and Parotoplana macrostyla has been carried out. The karyotype of the two Monocelis species investigated (2n=6) is formed by three pairs of small and similarly sized chromosomes: In M. fusca, chromosome 1 is metacentric, chromosome 2 acrocentric and chromosome 3 is subtelocentric. M. lineata also presents one pair of metacentric chromosomes (chromosome 2), while chromosomes 1 and 3 are submetacentric. P. macrostyla (2n=12) reveals two pairs of large metacentric and four pairs of small chromosomes, three of which are metacentric, whereas the last is subtelocentric.

  13. Cuticular chemistry of males and females in the ant Formica fusca

    DEFF Research Database (Denmark)

    Chernenko, Anton; Holman, Luke; Helanterä, Heikki;

    2012-01-01

    Communication between organisms involves visual, auditory, and olfactory pathways. In solitary insects, chemical recognition cues are influenced mainly by selection regimes related to species recognition and sexual selection. In social insects, chemical recognition cues have an additional role...... in mediating recognition of society members and, thereby, allowing kin selection to operate. Here, we examined whether cuticular hydrocarbon profiles are sex-specific and whether males and young queens of the ant Formica fusca have colony-specific profiles. We also investigated whether there is a relationship...

  14. IDENTIFICATION AND CHARACTERIZATION OF THERMOBIFIDA FUSCA GENES INVOLVED IN PLANT CELL WALL DEGRADATION.

    Energy Technology Data Exchange (ETDEWEB)

    David B. Wilson

    2006-01-23

    Micro-array experiments identified a number of Thermobifida fusca genes which were upregulated by growth on cellulose or plant biomass. Five of these genes were cloned, overexpressed in E. coli and the expressed proteins were purified and characterized. These were a xyloglucanase,a 1-3,beta glucanase, a family 18 hydrolase and twocellulose binding proteins that contained no catalytic domains. The catalyic domain of the family 74 endoxyloglucanase with a C-terminal, cellulose binding module was crystalized and its 3-dimensional structure was determined by X-ray crystallography.

  15. Assessment of cellulolytic microorganisms in soils of Nevados Park, Colombia

    Directory of Open Access Journals (Sweden)

    Lizeth Manuela Avellaneda-Torres

    2014-12-01

    Full Text Available A systematized survey was conducted to find soil-borne microbes that degrade cellulose in soils from unique ecosystems, such as the Superpáramo, Páramo, and the High Andean Forest in the Nevados National Natural Park (NNNP, Colombia. These high mountain ecosystems represent extreme environments, such as high levels of solar radiation, low atmospheric pressure, and extreme daily changes in temperature. Cellulolytic activity of the microorganisms was evaluated using qualitative tests, such as growth in selective media followed by staining with congo red and iodine, and quantitative tests to determine the activity of endoglucanase, β-glucosidase, exoglucanase, and total cellulase. Microorganisms were identified using molecular markers, such as the 16S rRNA gene for bacteria and the internal transcribed spacer region (ITS of ribosomal DNA for fungi. Multivariate statistical analysis (MVA was used to select microorganisms with high cellulolytic capacity. A total of 108 microorganisms were isolated from the soils and, in general, the enzymatic activities of fungi were higher than those of bacteria. Our results also found that none of the organisms studied were able to degrade all the components of the cellulose and it is therefore suggested that a combination of bacteria and/or fungi with various enzymatic activities be used to obtain high total cellulolytic activity. This study gives an overview of the potential microorganism that could be used for cellulose degradation in various biotechnological applications and for sustainable agricultural waste treatment.

  16. Compositions comprising a polypeptide having cellulolytic enhancing activity and a dioxy compound and uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Sweeney, Matthew; Xu, Feng; Quinlan, Jason

    2016-07-19

    The present invention relates to compositions comprising: a polypeptide having cellulolytic enhancing activity and a dioxy compound. The present invention also relates to methods of using the compositions.

  17. Compositions comprising a polypeptide having cellulolytic enhancing activity and a bicyclic compound and uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Quinlan, Jason; Xu, Feng; Sweeney, Matthew

    2016-10-04

    The present invention relates to compositions comprising: a polypeptide having cellulolytic enhancing activity and a bicyclic compound. The present invention also relates to methods of using the compositions.

  18. Compositions comprising a polypeptide having cellulolytic enhancing activity and a heterocyclic compound and uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Feng; Sweeney, Matthew; Quinlan, Jason

    2016-08-02

    The present invention relates to compositions comprising: a polypeptide having cellulolytic enhancing activity and a heterocyclic compound. The present invention also relates to methods of using the compositions.

  19. Compositions comprising a polypeptide having cellulolytic enhancing activity and a bicycle compound and uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Feng; Sweeney, Matthew; Quinlan, Jason

    2015-06-16

    The present invention relates to compositions comprising: a polypeptide having cellulolytic enhancing activity and a bicyclic compound. The present invention also relates to methods of using the compositions.

  20. Heterologous expression and biochemical characterization of glucose isomerase from Thermobifida fusca.

    Science.gov (United States)

    Deng, Hui; Chen, Sheng; Wu, Dan; Chen, Jian; Wu, Jing

    2014-06-01

    Glucose isomerase (GIase) catalyzes the isomerization of D-glucose to D-fructose. The GIase from Thermobifida fusca WSH03-11 was expressed in Escherichia coli BL21(DE3), and the purified enzyme took the form of a tetramer in solution and displayed a pI value of 5.05. The temperature optimum of GIase was 80 °C and its half life was about 2 h at 80 °C or 15 h at 70 °C. The pH optimum of GIase was 10 and the enzyme retained 95 % activity over the pH range of 5-10 after incubating at 4 °C for 24 h. Kinetic studies showed that the K m and K cat values of the enzyme are 197 mM and 1,688 min(-1), respectively. The maximum conversion yield of glucose (45 %, w/v) to fructose of the enzyme was 53 % at pH 7.5 and 70 °C. The present study provides the basis for the industrial application of recombinant T. fusca GIase in the production of high fructose syrup.

  1. Not so monofunctional--a case of thermostable Thermobifida fusca catalase with peroxidase activity.

    Science.gov (United States)

    Lončar, Nikola; Fraaije, Marco W

    2015-03-01

    Thermobifida fusca is a mesothermophilic organism known for its ability to degrade plant biomass and other organics, and it was demonstrated that it represents a rich resource of genes encoding for potent enzymes for biocatalysis. The thermostable catalase from T. fusca has been cloned and overexpressed in Escherichia coli with a yield of 400 mg/L. Heat treatment of disrupted cells at 60 °C for 1 h resulted in enzyme preparation of high purity; hence, no chromatography steps are needed for large-scale production. Except for catalyzing the dismutation of hydrogen peroxide, TfuCat was also found to catalyze oxidations of phenolic compounds. The catalase activity was comparable to other described catalases while peroxidase activity was quite remarkable with a k obs of nearly 1000 s(-1) for catechol. Site directed mutagenesis was used to alter the ratio of peroxidase/catalase activity. Resistance to inhibition by classic catalase inhibitors and an apparent melting temperature of 74 °C classifies this enzyme as a robust biocatalyst. As such, it could compete with other commercially available catalases while the relatively high peroxidase activity also offers new biocatalytic possibilities.

  2. Heterologous expression and biochemical characterization of glucose isomerase from Thermobifida fusca.

    Science.gov (United States)

    Deng, Hui; Chen, Sheng; Wu, Dan; Chen, Jian; Wu, Jing

    2014-06-01

    Glucose isomerase (GIase) catalyzes the isomerization of D-glucose to D-fructose. The GIase from Thermobifida fusca WSH03-11 was expressed in Escherichia coli BL21(DE3), and the purified enzyme took the form of a tetramer in solution and displayed a pI value of 5.05. The temperature optimum of GIase was 80 °C and its half life was about 2 h at 80 °C or 15 h at 70 °C. The pH optimum of GIase was 10 and the enzyme retained 95 % activity over the pH range of 5-10 after incubating at 4 °C for 24 h. Kinetic studies showed that the K m and K cat values of the enzyme are 197 mM and 1,688 min(-1), respectively. The maximum conversion yield of glucose (45 %, w/v) to fructose of the enzyme was 53 % at pH 7.5 and 70 °C. The present study provides the basis for the industrial application of recombinant T. fusca GIase in the production of high fructose syrup. PMID:24317483

  3. Characterization of cytochrome P450 monooxygenase CYP154H1 from the thermophilic soil bacterium Thermobifida fusca

    NARCIS (Netherlands)

    Schallmey, Anett; den Besten, Gijs; Teune, Ite G. P.; Kembaren, Roga F.; Janssen, Dick B.

    2011-01-01

    Cytochrome P450 monooxygenases are valuable biocatalysts due to their ability to hydroxylate unactivated carbon atoms using molecular oxygen. We have cloned the gene for a new cytochrome P450 monooxygenase, named CYP154H1, from the moderately thermophilic soil bacterium Thermobifida fusca. The enzym

  4. The iturin and fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis toward Podosphaera fusca

    NARCIS (Netherlands)

    Romero, Diego; de Vicente, Antonio; Rakotoaly, Rivo H.; Dufour, Samuel E.; Veening, Jan-Willem; Arrebola, Eva; Cazorla, Francisco M.; Kuipers, Oscar P.; Paquot, Michel; Perez-Garcia, Alejandro; Stacey, Gary

    2007-01-01

    Podosphaera fusca is the main causal agent of cucurbit powdery mildew in Spain. Four Bacillus subtilis strains, UMAF6614, UMAF6619, UMAF6639, and UMAF8561, with proven ability to suppress the disease on melon in detached leaf and seedling assays, were subjected to further analyses to elucidate the m

  5. Cellulose hydrolysis by fungi. 1. Screening of cellulolytic strains

    Energy Technology Data Exchange (ETDEWEB)

    Roussos, S.; Raimbault, M. (Laboratoire de Microbiologie ORSTOM, Centre de Recherche IRCHA, 91 - Vert-le-Petit (France))

    Trichoderma harzianum was selected from 30 strains of cellulolytic fungi with the aim of producing cellulases by solid state fermentation of lignocellulosic substrates. Special attention was paid to cellulase production (i. e. carboxymethylcellulase and filter paper activity), apical growth and conidia production. Under the conditions of our experiments, T. harzianum exhibited the highest cellulasic activities with 1,315 IU/I of carboxymethyl cellulose and 80 IU/l of filter paper activity. Apical growth (1 mm/h) and yield of conidial production (3.25 X 10/sup 10/ conidia/g of substrate dry weight) were also valuable characteristics of this strain in the use of solid state fermentation.

  6. Influence of Host-Plant Surface Chemicals on the Oviposition of the Cereal Stemborer Busseola Fusca.

    Science.gov (United States)

    Juma, Gerald; Clément, Gilles; Ahuya, Peter; Hassanali, Ahmed; Derridj, Sylvie; Gaertner, Cyrile; Linard, Romain; Le Ru, Bruno; Frérot, Brigitte; Calatayud, Paul-André

    2016-05-01

    The chemical composition of plant surfaces plays a role in selection of host plants by herbivorous insects. Once the insect reaches the plant, these cues determine host acceptance. Laboratory studies have shown that the stem borer Busseola fusca (Lepidoptera: Noctuidae), an important pest of sorghum and maize in sub-Saharan Africa, is able to differentiate between host and non-host plant species. However, no information is available on the cues used by this insect to seek and accept the host plant. Thus, the role of surface phytochemical stimuli on host selection and oviposition by B. fusca was studied in the laboratory using two host plants, sorghum, Sorghum bicolor, and maize, Zea mays, and one non-host plant, Napier grass, Pennisetum purpureum. The numbers of eggs and egg masses deposited on the three plant species were compared first under no-choice and choice conditions. In both cases, more eggs and egg masses were laid on maize and sorghum than on the non-host. Artificial surrogate stems treated with a water or chloroform surface extract of each plant were then compared with surrogate stems treated with, respectively, water or chloroform as controls, under similar conditions. Surrogate stems treated with plant water extracts did not show an increase in oviposition when compared to controls, indicating that the major compounds in these extracts, i.e., simple sugars and free amino acids, are not significantly responsible for the oviposition preference. By contrast, a chloroform extract of sorghum enhanced oviposition on the surrogate stems compared to the control, while those of maize and Napier grass showed no significant effects. Analysis of the chloroform extract of sorghum showed higher amounts of α-amyrin, ß-amyrin, and n-nonacosane compared to those of maize and Napier grass. A blend of the three chemicals significantly increased oviposition compared to the chloroform-treated control, indicating that these compounds are part of the surface chemical

  7. Culturable epibacteria of the marine sponge Ircinia fusca: Temporal variations and their possible role in the epibacterial defense of the host

    Digital Repository Service at National Institute of Oceanography (India)

    Thakur, N.L.; Anil, A.C.; Muller, W.E.G.

    The influence of environmental changes on the epibacterial population of the marine sponge Ircinia fusca (Carter) was evaluated by using a bacterial culture-based approach. Sponge surface-associated bacteria were isolated, enumerated and cultured...

  8. Isolation and characterization of plasma membrane Na+/H+ antiporter (SOS1) gene during salinity stress in kallar grass (Leptochloa fusca)

    OpenAIRE

    Banafsheh Taherinia; Hamid Reza Kavousi; Sara Dehghan

    2015-01-01

    Background: Leptochloa fusca is a halophyte plant which is highly tolerant to saline and sodic soils and water. Moreover, L. fusca is an attractive model plant to study the mechanism of salt tolerance mainly due to its characteristics as a typical euhalophyte, having both accumulating and excreting salt properties. Soil salinity adversely affects plant growth, development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1) gene encodes a ...

  9. Fuscoside E: a strong anti-inflammatory diterpene from Caribbean octocoral Eunicea fusca.

    Science.gov (United States)

    Reina, Eduardo; Puentes, Carlos; Rojas, Juan; García, Josué; Ramos, Freddy A; Castellanos, Leonardo; Aragón, Marcela; Ospina, Luis F

    2011-10-01

    The screen of 10 soft coral extracts collected from the Colombian Caribbean Sea in the TPA-induced ear edema model allowed us to identify Eunicea fusca extract among others as an interesting source of active compounds. The new diterpene, fuscoside E (1), along with the known fuscoside B (2), fuscol (3), (+)-germacrene D (4) and a mixture of six sterols (5-10), were isolated from this soft coral. Their structures were elucidated by 1D and 2D NMR spectroscopy techniques. Fuscoside E (1) absolute stereochemistry was determined by chiroptical methods. Fuscoside E (1) and B (2) showed strong anti-inflammatory in the above mentioned bioassay. Additionally, fuscoside E (1) and the sterol mixture (5-10) presented antifouling activity against bacterial strains involved in surface colonization. PMID:21865038

  10. Effect of Nutrient Starvation under High Irradiance on Lipid and Starch Accumulation in Chlorella fusca (Chlorophyta).

    Science.gov (United States)

    Jerez, Celia G; Malapascua, José R; Sergejevová, Magda; Figueroa, Félix L; Masojídek

    2016-02-01

    The effect of nitrogen and sulphur limitation under high irradiance (PAR) was studied in the green microalga Chlorella fusca (Chlorophyta) in order to follow lipid and/or starch accumulation. Growth, biomass composition and the changes in photosynthetic activity (in vivo chlorophyll a fluorescence) were followed in the trials. The full nutrient culture showed high biomass production and starch accumulation at Day 1, when photosynthetic activity was high. Gradual deprivation (no nutrients added) became evident when photosynthesis was significantly suppressed (Day 3 onwards), which entailed a decrease of maximum relative electron transport rate (rETRmax) and increase of non-photochemical quenching (NPQ), accompanied by the onset of lipid accumulation and decline in starch content. In N- and S-starved cultures, rETRmax significantly decreased by Day 3, which caused a substantial drop in biomass production, cell number, biovolume and induction of lipid and starch accumulation. High starch content (45-50 % of DW) was found at the initial stage in full nutrient culture and at the stationary phase in nutrient-starved cultures. By the end of the trial, all treatments showed high lipid content (~30 % of DW). The full nutrient culture had higher biomass yield than starved treatments although starch (~0.2 g L(-1) day(-1)) and lipid (~0.15 g L(-1) day(-1) productivities were fairly similar in all the cultures. Our results showed that we could enrich biomass of C. fusca (% DW) in lipids using a two-stage strategy (a nutrient replete stage followed by gradual nutrient limitation) while under either procedure, N- or S-starvation, both high lipid and starch contents could be achieved.

  11. Processivity, substrate binding, and mechanism of cellulose hydrolysis by Thermobifida fusca Cel9A.

    Science.gov (United States)

    Li, Yongchao; Irwin, Diana C; Wilson, David B

    2007-05-01

    Thermobifida fusca Cel9A-90 is a processive endoglucanase consisting of a family 9 catalytic domain (CD), a family 3c cellulose binding module (CBM3c), a fibronectin III-like domain, and a family 2 CBM. This enzyme has the highest activity of any individual T. fusca enzyme on crystalline substrates, particularly bacterial cellulose (BC). Mutations were introduced into the CD or the CBM3c of Cel9A-68 using site-directed mutagenesis. The mutant enzymes were expressed in Escherichia coli; purified; and tested for activity on four substrates, ligand binding, and processivity. The results show that H125 and Y206 play an important role in activity by forming a hydrogen bonding network with the catalytic base, D58; another important supporting residue, D55; and Glc(-1) O1. R378, a residue interacting with Glc(+1), plays an important role in processivity. Several enzymes with mutations in the subsites Glc(-2) to Glc(-4) had less than 15% activity on BC and markedly reduced processivity. Mutant enzymes with severalfold-higher activity on carboxymethyl cellulose (CMC) were found in the subsites from Glc(-2) to Glc(-4). The CBM3c mutant enzymes, Y520A, R557A/E559A, and R563A, had decreased activity on BC but had wild-type or improved processivity. Mutation of D513, a conserved residue at the end of the CBM, increased activity on crystalline cellulose. Previous work showed that deletion of the CBM3c abolished crystalline activity and processivity. This study shows that it is residues in the catalytic cleft that control processivity while the CBM3c is important for loose binding of the enzyme to the crystalline cellulose substrate. PMID:17369336

  12. An Efficient and Improved Methodology for the Screening of Industrially Valuable Xylano-Pectino-Cellulolytic Microbes

    Directory of Open Access Journals (Sweden)

    Avtar Singh

    2015-01-01

    Full Text Available Xylano-pectino-cellulolytic enzymes are valuable enzymes of the industrial sector. In our earlier study, we have reported a novel and cost effective methodology for the qualitative screening of cellulase-free xylano-pectinolytic microorganisms by replacing the commercial, highly expensive substrates with agricultural residues, but the microorganisms with xylanolytic, pectinolytic, cellulolytic, xylano-pectinolytic, xylano-cellulolytic, pectino-cellulolytic, and xylano-pectino-cellulolytic potential were obtained. The probability of getting the desired combination was low, so efforts were made to further improve this cost effective methodology for obtaining the high yield of the microbes capable of producing desired combination of enzymes. By inclusion of multiple enrichment steps in sequence, using only practically low cost substrates and without any nutrient media till primary screening stage, this improved novel protocol for screening gave only the desired microorganisms with xylano-pectino-cellulolytic activity. Using this rapid, efficient, cost effective, and improved methodology, microbes with required combination of enzymes can be obtained and the probability of getting the desired microorganisms is cent percent. This is the first report presenting the methodology for the isolation of xylano-pectino-cellulolytic positive microorganisms at low cost and consuming less time.

  13. An efficient and improved methodology for the screening of industrially valuable xylano-pectino-cellulolytic microbes.

    Science.gov (United States)

    Singh, Avtar; Kaur, Amanjot; Dua, Anita; Mahajan, Ritu

    2015-01-01

    Xylano-pectino-cellulolytic enzymes are valuable enzymes of the industrial sector. In our earlier study, we have reported a novel and cost effective methodology for the qualitative screening of cellulase-free xylano-pectinolytic microorganisms by replacing the commercial, highly expensive substrates with agricultural residues, but the microorganisms with xylanolytic, pectinolytic, cellulolytic, xylano-pectinolytic, xylano-cellulolytic, pectino-cellulolytic, and xylano-pectino-cellulolytic potential were obtained. The probability of getting the desired combination was low, so efforts were made to further improve this cost effective methodology for obtaining the high yield of the microbes capable of producing desired combination of enzymes. By inclusion of multiple enrichment steps in sequence, using only practically low cost substrates and without any nutrient media till primary screening stage, this improved novel protocol for screening gave only the desired microorganisms with xylano-pectino-cellulolytic activity. Using this rapid, efficient, cost effective, and improved methodology, microbes with required combination of enzymes can be obtained and the probability of getting the desired microorganisms is cent percent. This is the first report presenting the methodology for the isolation of xylano-pectino-cellulolytic positive microorganisms at low cost and consuming less time. PMID:25692034

  14. 暗棕羊海绵Ircinia fusca Carter 1880.化学成分的研究%Research on the Chemical Compositions of Ircinia Fusca Carter, 1880.

    Institute of Scientific and Technical Information of China (English)

    袁霞; 罗轩; 欧冰凝

    2012-01-01

      首次对暗棕羊海绵Ircinia fusca Carter 1880.化学成分进行研究,从该属海绵中分离得到4个单体化合物,经过波谱等手段鉴别为胸腺嘧啶、尿嘧啶、次黄嘌呤、黄嘌呤.%  In this paper the chemical compositions of Ircinia fusca Carter 1880. were researched for the first time. Four compounds were separated by the silica gel column, the structures of which were determined as thymine, uracil, hypoxanthine and xanthine by means of UV, IR, EI-MS, 1H and 13C NMR.

  15. Compositions for enhancing hydroysis of cellulosic material by cellulolytic enzyme compositions

    Science.gov (United States)

    Quinlan, Jason; Xu, Feng; Sweeney, Matthew; Johansen, Katja Salomon

    2014-09-30

    The present invention relates to compositions comprising a GH61 polypeptide having cellulolytic enhancing activity and an organic compound comprising a carboxylic acid moiety, a lactone moiety, a phenolic moiety, a flavonoid moiety, or a combination thereof, wherein the combination of the GH61 polypeptide having cellulolytic enhancing activity and the organic compound enhances hydrolysis of a cellulosic material by a cellulolytic enzyme compared to the GH61 polypeptide alone or the organic compound alone. The present invention also relates to methods of using the compositions.

  16. Phylogeography and population genetics of the maize stalk borer Busseola fusca (Lepidoptera, Noctuidae) in sub-Saharan Africa

    OpenAIRE

    Sezonlin, Michel; Dupas, Stéphane; Le Ru, Bruno; Le Gall, Philippe; Moyal, Pascal; Calatayud, Paul-André; Giffard, I; Faure, N; Silvain, Jean-François

    2006-01-01

    The population genetics and phylogeography of African phytophagous insects have received little attention. Some, such as the maize stalk borer Busseola fusca, display significant geographic differences in ecological preferences that may be congruent with patterns of molecular variation. To test this, we collected 307 individuals of this species from maize and cultivated sorghum at 52 localities in West, Central and East Africa during the growing season. For all collected individuals, we seque...

  17. NREL Explains the Higher Cellulolytic Activity of a Vital Microorganism

    Energy Technology Data Exchange (ETDEWEB)

    2016-06-01

    The discovery of a new mode of action by C. thermocellum to convert biomass to biofuels is significant because the bacterium is already recognized as one of the most effective in the biosphere. Researchers found that, in addition to using common cellulase degradation mechanisms attached to cells, C. thermocellum also uses a new category of cell-free scaffolded enzymes. The new discovery will influence the strategies used to improve the cellulolytic activity of biomass degrading microbes going forward. Better understanding of this bacterium could lead to cheaper production of ethanol and drop-in fuels. Also, this discovery demonstrates that nature's biomass conversion behaviors are not fully understood and remain as opportunities for future microbial/enzyme engineering efforts.

  18. SACCHARIFICATION OF CORNCOB USING CELLULOLYTIC BACTERIA FOR BIOETHANOL PRODUCTION

    Directory of Open Access Journals (Sweden)

    TITI CANDRA SUNARTI

    2010-08-01

    Full Text Available The use of cellulose degrading enzyme (cellulases for hydrolysis of lignocellulosic material is a part of bioethanol production process. In this experiment, delignified corncob, its cellulose fraction and alpha cellulose were used as substrates to produce fermentable sugar by using three local isolates of celluloytic bacteria (C5-1, C4-4, C11-1 and Cmix ; mixed cultures of three isolates, and Saccharomyces cereviseae to produce ethanol. The results showed that all isolates of cellulolytic bacteria can grow on cellulose fraction better than on delignified corncob, and alpha cellulose. The highest hydrolytic activity produced from cellulose fraction was by isolate C4-4, which liberated 3.50 g/l of total sugar. Ethanol can be produced by mixed culture of bacteria and yeast, but because of competitive growth, the fermentation only produced 0.39-0.47 g/l of ethanol.

  19. Characterization of cellulolytic activities of environmental bacterial consortia from an Argentinian native forest.

    Science.gov (United States)

    Romano, Nelson; Gioffré, Andrea; Sede, Silvana M; Campos, Eleonora; Cataldi, Angel; Talia, Paola

    2013-08-01

    Cellulolytic activities of three bacterial consortia derived from a forest soil sample from Chaco region, Argentina, were characterized. The phylogenetic analysis of consortia revealed two main highly supported groups including Achromobacter and Pseudomonas genera. All three consortia presented cellulolytic activity. The carboxymethylcellulase (CMCase) and total cellulase activities were studied both quantitatively and qualitatively and optimal enzymatic conditions were characterized and compared among the three consortia. Thermal and pH stability were analyzed. Based on its cellulolytic activity, one consortium was selected for further characterization by zymography. We detected a specific protein of 55 kDa with CMCase activity. In this study, we have shown that these consortia encode for cellulolytic enzymes. These enzymes could be useful for lignocellulosic biomass degradation into simple components and for different industrial applications. PMID:23471693

  20. Insight into Dominant Cellulolytic Bacteria from Two Biogas Digesters and Their Glycoside Hydrolase Genes

    OpenAIRE

    Yongjun Wei; Haokui Zhou; Jun Zhang; Lei Zhang; Alei Geng; Fanghua Liu; Guoping Zhao; Shengyue Wang; Zhihua Zhou; Xing Yan

    2015-01-01

    Diverse cellulolytic bacteria are essential for maintaining high lignocellulose degradation ability in biogas digesters. However, little was known about functional genes and gene clusters of dominant cellulolytic bacteria in biogas digesters. This is the foundation to understand lignocellulose degradation mechanisms of biogas digesters and apply these gene resource for optimizing biofuel production. A combination of metagenomic and 16S rRNA gene clone library methods was used to investigate t...

  1. The significance of cellulolytic enzymes produced by Trichoderma in opportunistic lifestyle of this fungus.

    Science.gov (United States)

    Strakowska, Judyta; Błaszczyk, Lidia; Chełkowski, Jerzy

    2014-07-01

    The degradation of native cellulose to glucose monomers is a complex process, which requires the synergistic action of the extracellular enzymes produced by cellulolytic microorganisms. Among fungi, the enzymatic systems that can degrade native cellulose have been extensively studied for species belonging to the genera of Trichoderma. The majority of the cellulolytic enzymes described so far have been examples of Trichoderma reesei, extremely specialized in the efficient degradation of plant cell wall cellulose. Other Trichoderma species, such as T. harzianum, T. koningii, T. longibrachiatum, and T. viride, known for their capacity to produce cellulolytic enzymes, have been isolated from various ecological niches, where they have proved successful in various heterotrophic interactions. As saprotrophs, these species are considered to make a contribution to the degradation of lignocellulosic plant material. Their cellulolytic potential is also used in interactions with plants, especially in plant root colonization. However, the role of cellulolytic enzymes in species forming endophytic associations with plants or in those existing in the substratum for mushroom cultivation remains unknown. The present review discusses the current state of knowledge about cellulolytic enzymes production by Trichoderma species and the encoding genes, as well as the involvement of these proteins in the lifestyle of Trichoderma.

  2. Constitutive Expression of Thermobifida fusca Thermostable Acetylxylan Esterase Gene in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Yu-Chun Huang

    2010-12-01

    Full Text Available A gene encoding the thermostable acetylxylan esterase (AXE in Thermobifida fusca NTU22 was amplified by PCR, sequenced and cloned into the Pichia pastoris X-33 host strain using the vector pGAPZαA, allowing constitutive expression and secretion of the protein. Recombinant expression resulted in high levels of extracellular AXE production, as high as 526 U/mL in the Hinton flask culture broth. The purified enzyme showed a single band at about 28 kDa by SDS-polyacrylamide gel electrophoresis after being treated with endo-β-N-acetylglycosaminidase H; this agrees with the predicted size based on the nucleotide sequence. About 70% of the original activity remained after heat treatment at 60 °C for three hours. The optimal pH and temperature of the purified enzyme were 8.0 and 60 °C, respectively. The properties of the purified AXE from the P. pastoris transformant are similar to those of the AXE from an E. coli transformant.

  3. Kinetic studies of Thermobifida fusca Cel9A active site mutant enzymes.

    Science.gov (United States)

    Zhou, Weilin; Irwin, Diana C; Escovar-Kousen, Jose; Wilson, David B

    2004-08-01

    Thermobifida fusca Cel9A-90, an unusual family 9 enzyme, is a processive endoglucanase containing a catalytic domain closely linked to a family 3c cellulose binding domain (Cel9A-68) followed by a fibronectin III-like domain and a family 2 cellulose binding domain. To study its catalytic mechanism, 12 mutant genes with changes in five conserved residues of Cel9A-68 were constructed, cloned, and expressed in Escherichia coli. The purified mutant enzymes were assayed for their activities on (carboxymethyl)cellulose, phosphoric acid-swollen cellulose, bacterial microcrystalline cellulose, and 2,4-dinitrophenyl beta-D-cellobioside. They were also tested for ligand binding, enzyme processivity, and thermostability. The results clearly show that E424 functions as the catalytic acid, D55 and D58 are both required for catalytic base activity, and Y206 plays an important role in binding, catalysis, and processivity, while Y318 plays an important role in binding of crystalline cellulose substrates and is required for processivity. Several amino acids located in a loop at the end of the catalytic cleft (T245-L251) were deleted from Cel9A-68, and this enzyme showed slightly improved filter paper activity and binding to BMCC but otherwise behaved like the wild-type enzyme. The FnIII-like domain was deleted from Cel9A-90, reducing BMCC activity to 43% of the wild type. PMID:15274620

  4. Cloning, Expression and Identification of a New Trehalose Synthase Gene from Thermobifida fusca Genome

    Institute of Scientific and Technical Information of China (English)

    Yu-Tuo WEI; Ri-Bo HUANG; Qi-Xia ZHU; Zhao-Fei LUO; Fu-Shen LU; Fa-Zhong CHEN; Qing-Yan WANG; Kun HUANG; Jian-Zhong MENG; Rong WANG

    2004-01-01

    A new open reading frame in Thermobifida fusca sequenced genome was identified to encode a new trehalose synthase, annotated as "glycosidase" in the GenBank database, by bioinformatics searching and experimental validation. The gene had a length of 1830 bp with about 65% GC content and encoded for a new trehalose synthase with 610 amino acids and deduced molecular weight of 66 kD. The high GC content seemed not to affect its good expression in E. coli BL21 in which the target protein could account for as high as 15% of the total cell proteins. The recombinant enzyme showed its optimal activities at 25 ℃ and pH 6.5 when it converted substrate maltose into trehalose. However it would divert a high proportion of its substrate into glucose when the temperature was increased to 37 ℃, or when the enzyme concentration was high Its activity was not inhibited by 5 mM heavy metals such as Cu2+, Mn2+, and Zn2+ but affected by high concentration of glucose. Blasting against the database indicated that amino acid sequence of this protein had maximal 69% homology with the known trehalose synthases, and two highly conserved segments of the protein sequence were identified and their possible linkage with functions was discussed.

  5. Insight into Dominant Cellulolytic Bacteria from Two Biogas Digesters and Their Glycoside Hydrolase Genes.

    Directory of Open Access Journals (Sweden)

    Yongjun Wei

    Full Text Available Diverse cellulolytic bacteria are essential for maintaining high lignocellulose degradation ability in biogas digesters. However, little was known about functional genes and gene clusters of dominant cellulolytic bacteria in biogas digesters. This is the foundation to understand lignocellulose degradation mechanisms of biogas digesters and apply these gene resource for optimizing biofuel production. A combination of metagenomic and 16S rRNA gene clone library methods was used to investigate the dominant cellulolytic bacteria and their glycoside hydrolase (GH genes in two biogas digesters. The 16S rRNA gene analysis revealed that the dominant cellulolytic bacteria were strains closely related to Clostridium straminisolvens and an uncultured cellulolytic bacterium designated BG-1. To recover GH genes from cellulolytic bacteria in general, and BG-1 in particular, a refined assembly approach developed in this study was used to assemble GH genes from metagenomic reads; 163 GH-containing contigs ≥ 1 kb in length were obtained. Six recovered GH5 genes that were expressed in E. coli demonstrated multiple lignocellulase activities and one had high mannanase activity (1255 U/mg. Eleven fosmid clones harboring the recovered GH-containing contigs were sequenced and assembled into 10 fosmid contigs. The composition of GH genes in the 163 assembled metagenomic contigs and 10 fosmid contigs indicated that diverse GHs and lignocellulose degradation mechanisms were present in the biogas digesters. In particular, a small portion of BG-1 genome information was recovered by PhyloPythiaS analysis. The lignocellulase gene clusters in BG-1 suggested that it might use a possible novel lignocellulose degradation mechanism to efficiently degrade lignocellulose. Dominant cellulolytic bacteria of biogas digester possess diverse GH genes, not only in sequences but also in their functions, which may be applied for production of biofuel in the future.

  6. Insight into Dominant Cellulolytic Bacteria from Two Biogas Digesters and Their Glycoside Hydrolase Genes.

    Science.gov (United States)

    Wei, Yongjun; Zhou, Haokui; Zhang, Jun; Zhang, Lei; Geng, Alei; Liu, Fanghua; Zhao, Guoping; Wang, Shengyue; Zhou, Zhihua; Yan, Xing

    2015-01-01

    Diverse cellulolytic bacteria are essential for maintaining high lignocellulose degradation ability in biogas digesters. However, little was known about functional genes and gene clusters of dominant cellulolytic bacteria in biogas digesters. This is the foundation to understand lignocellulose degradation mechanisms of biogas digesters and apply these gene resource for optimizing biofuel production. A combination of metagenomic and 16S rRNA gene clone library methods was used to investigate the dominant cellulolytic bacteria and their glycoside hydrolase (GH) genes in two biogas digesters. The 16S rRNA gene analysis revealed that the dominant cellulolytic bacteria were strains closely related to Clostridium straminisolvens and an uncultured cellulolytic bacterium designated BG-1. To recover GH genes from cellulolytic bacteria in general, and BG-1 in particular, a refined assembly approach developed in this study was used to assemble GH genes from metagenomic reads; 163 GH-containing contigs ≥ 1 kb in length were obtained. Six recovered GH5 genes that were expressed in E. coli demonstrated multiple lignocellulase activities and one had high mannanase activity (1255 U/mg). Eleven fosmid clones harboring the recovered GH-containing contigs were sequenced and assembled into 10 fosmid contigs. The composition of GH genes in the 163 assembled metagenomic contigs and 10 fosmid contigs indicated that diverse GHs and lignocellulose degradation mechanisms were present in the biogas digesters. In particular, a small portion of BG-1 genome information was recovered by PhyloPythiaS analysis. The lignocellulase gene clusters in BG-1 suggested that it might use a possible novel lignocellulose degradation mechanism to efficiently degrade lignocellulose. Dominant cellulolytic bacteria of biogas digester possess diverse GH genes, not only in sequences but also in their functions, which may be applied for production of biofuel in the future.

  7. Study of artificial propagation technology of Megalonibea fusca%褐毛鲿全人工繁殖技术研究

    Institute of Scientific and Technical Information of China (English)

    陈朴贤; 曾志南

    2013-01-01

      In order to master reproductive biology of Megalonibea fusca, and break through its artificial propaga-tion technology, the paper introduced the researches on Megalonibea fusca during the project periods from 1998 to 2002, such as the research of sexual mature age, breeding seasons, spawning temperature, gonadic development and reproductive periods, spawning pattern and fecundity, induced spawning indoor pond, induced spawning in marine cage, spawning rate and fertilization rate of parent fish, hormones and dose, artificial propagation technology and so on. We discussed and summarized the methods and measures on intensive culture and induced spawning of parent fish.%  为了掌握褐毛鲿(Megalonibea fusca)繁殖生物学特性并突破全人工繁殖技术,作者介绍了1998~2002年项目实施期间,对褐毛鲿的性成熟年龄、生殖季节、产卵水温、性腺发育与性周期、产卵类型与产卵量、室内产卵池催产、海上网箱催产、亲鱼产卵率、受精率、催产激素与剂量、全人工繁殖技术等所做的研究,讨论和总结了褐毛鲿亲鱼的强化培育,人工催产的方法与措施。

  8. Extracellular overexpression of recombinant Thermobifida fusca cutinase by alpha-hemolysin secretion system in E. coli BL21(DE3

    Directory of Open Access Journals (Sweden)

    Su Lingqia

    2012-01-01

    Full Text Available Abstract Background Extracellular expression of proteins has an absolute advantage in a large-scale industrial production. In our previous study, Thermobifida fusca cutinase, an enzyme mainly utilized in textile industry, was expressed via type II secretory system in Escherichia coli BL21(DE3, and it was found that parts of the expressed protein was accumulated in the periplasmic space. Due to the fact that alpha-hemolysin secretion system can export target proteins directly from cytoplasm across both cell membrane of E. coli to the culture medium, thus in the present study we investigated the expression of cutinase using this alpha-hemolysin secretion system. Results T. fusca cutinase was fused with the specific signal peptide of alpha-hemolysin scretion system and expressed in E. coli BL21(DE3. In addition, HlyB and HlyD, strain-specific translocation components of alpha-hemolysin secretion system, were coexpressed to facilitate the enzyme expression. The cultivation of this engineered cell showed that cutinase activity in the culture medium reached 334 U/ml, which is 2.5 times that from type II secretion pathway under the same culture condition. The recombinant cutinase was further purified. Biochemical characterization of purified enzyme, which had an α-hemolysin secretion pathway signal peptide attached, had substrate specificity, pH and temperature profile, as well as application capability in bioscouring similar to that of wild-type cutinase. Conclusions In the present study, T. fusca cutinase was successfully secreted to the culture media by α-hemolysin secretion system. This is the first report of cutinase being efficiently secreted by this pathway. Due to the limited cases of successful expression of industrial enzyme by E. coli α-hemolysin secretion system, our study further explored the utilization of this pathway in industrial enzymes.

  9. Study of artificial propagation technology of Megalonibea fusca%褐毛鲿全人工繁殖技术研究

    Institute of Scientific and Technical Information of China (English)

    陈朴贤; 曾志南

    2013-01-01

      为了掌握褐毛鲿(Megalonibea fusca)繁殖生物学特性并突破全人工繁殖技术,作者介绍了1998~2002年项目实施期间,对褐毛鲿的性成熟年龄、生殖季节、产卵水温、性腺发育与性周期、产卵类型与产卵量、室内产卵池催产、海上网箱催产、亲鱼产卵率、受精率、催产激素与剂量、全人工繁殖技术等所做的研究,讨论和总结了褐毛鲿亲鱼的强化培育,人工催产的方法与措施。%  In order to master reproductive biology of Megalonibea fusca, and break through its artificial propaga-tion technology, the paper introduced the researches on Megalonibea fusca during the project periods from 1998 to 2002, such as the research of sexual mature age, breeding seasons, spawning temperature, gonadic development and reproductive periods, spawning pattern and fecundity, induced spawning indoor pond, induced spawning in marine cage, spawning rate and fertilization rate of parent fish, hormones and dose, artificial propagation technology and so on. We discussed and summarized the methods and measures on intensive culture and induced spawning of parent fish.

  10. Isolation and Identification of Cellulolytic Bacteria from the Gut of Three Phytophagus Insect Species

    Directory of Open Access Journals (Sweden)

    Rajib Kumar Shil

    2014-12-01

    Full Text Available The cellulolytic bacteria from the gut of three different phytophagous insects were studied to isolate novel cellulolytic organism for biofuel industry. Among the threse, gut of P. quatuordecimpunctata larvae contained both highest no of total bacterial count (6.8x107CFU/gut and cellulolytic bacteria (5.42x103CFU/gut. Fifteen different isolates were obtained from the gut of O. velox, A. miliarisand P. quatuordecimpunctata. All the isolates produced clear zone in CMC medium staining with Congo red. The isolates included Gram positive Enterococcus, Microbacterium and Gram negative Aeromonas, Erwinia, Serretia, Flavobacterium, Acenitobacter, Klebsiella, Yersinia, Xenorhabdus, Psedomonas and Photorhabdus. Out of the fifteen isolated and identified bacterial species, twelve bacterial species were novel being reported for first time as having cellulase activity.

  11. PGASO: A synthetic biology tool for engineering a cellulolytic yeast

    Directory of Open Access Journals (Sweden)

    Chang Jui-Jen

    2012-07-01

    Full Text Available Abstract Background To achieve an economical cellulosic ethanol production, a host that can do both cellulosic saccharification and ethanol fermentation is desirable. However, to engineer a non-cellulolytic yeast to be such a host requires synthetic biology techniques to transform multiple enzyme genes into its genome. Results A technique, named Promoter-based Gene Assembly and Simultaneous Overexpression (PGASO, that employs overlapping oligonucleotides for recombinatorial assembly of gene cassettes with individual promoters, was developed. PGASO was applied to engineer Kluyveromycesmarxianus KY3, which is a thermo- and toxin-tolerant yeast. We obtained a recombinant strain, called KR5, that is capable of simultaneously expressing exoglucanase and endoglucanase (both of Trichodermareesei, a beta-glucosidase (from a cow rumen fungus, a neomycin phosphotransferase, and a green fluorescent protein. High transformation efficiency and accuracy were achieved as ~63% of the transformants was confirmed to be correct. KR5 can utilize beta-glycan, cellobiose or CMC as the sole carbon source for growth and can directly convert cellobiose and beta-glycan to ethanol. Conclusions This study provides the first example of multi-gene assembly in a single step in a yeast species other than Saccharomyces cerevisiae. We successfully engineered a yeast host with a five-gene cassette assembly and the new host is capable of co-expressing three types of cellulase genes. Our study shows that PGASO is an efficient tool for simultaneous expression of multiple enzymes in the kefir yeast KY3 and that KY3 can serve as a host for developing synthetic biology tools.

  12. Technique for preparation of anaerobic microbes: Rodshaped cellulolytic bacteria

    Directory of Open Access Journals (Sweden)

    Amlius Thalib

    2001-10-01

    Full Text Available Preparation of anaerobic-rod cellulolytic bacteria with coating technique has been conducted. Steps of the processes involved were cultivation, coating, evaporation, and drying. Coating agent used was Gum Arabic, and drying techniquesconducted were freeze drying and sun drying. pH of culture media was firstly optimized to obtain the maximal population ofbacteria. Both coated and uncoated preparates were subjected to drying. Morphological and Gram type identifications showed that uncoated preparate dried with freeze drying is not contaminated (ie. all bacteria are rod shape with Gram-negative type while the one dried with sun drying is not morphologically pure (ie. containing of both rod and coccus shapes with Gram negative and positive. The coated preparates dried by both freeze and sun drying, were not contaminated (ie. all are rods with Gram-negative. The coating and drying processes decreased viability of preparates significantly. However, the decreasing of viability of coated preparate are lower than uncoated preparate (ie. 89 vs. 97%. Total count of bacteria in sun-drying coated preparate are higher (P<0.05 than the uncoated preparate (ie. 3.38 x 1010 vs. 1.97 x 1010 colony/g DM. Activity of sun-drying coated preparate to digest elephant grass and rice straw was higher (P<0.01 than the sun-drying uncoated preparate with the in vitro DMD values were 42.7 vs. 35.5% for elephant grass substrate and 29.3 vs. 24.6% for rice straw substrate. Therefore, it is concluded that coating technique has a positive effects on the preparation of rumen bacteria.

  13. Utilization of simulated flue gas containing CO2, SO2, NO and ash for Chlorella fusca cultivation.

    Science.gov (United States)

    Duarte, Jessica Hartwig; Fanka, Letícia Schneider; Costa, Jorge Alberto Vieira

    2016-08-01

    Microalgae can use the CO2 from coal power plants in their metabolic pathways. However, these microorganisms must be able to tolerate other residues produced from burning coal. This study evaluated the wastes addition (CO2, SO2, NO and ash) present in the flue gas from a coal power plant on the growth parameters during culture, CO2 biofixation and on the biomass characterization of Chlorella fusca LEB 111. The SO2 and NO injection (until 400ppm) in cultivations did not markedly affect CO2 biofixation by microalga. The best CO2 biofixation efficiency was obtained with 10% CO2, 200ppm SO2 and NO and 40ppm ash (50.0±0.8%, w w(-1)), showing a specific growth rate of 0.18±0.01 d(-1). The C. fusca LEB 111 biomass composition was similar in all experiments with around 19.7% (w w(-1)) carbohydrates, 15.5% (w w(-1)) lipids and 50.2% (w w(-1)) proteins. PMID:27132223

  14. Utilization of simulated flue gas containing CO2, SO2, NO and ash for Chlorella fusca cultivation.

    Science.gov (United States)

    Duarte, Jessica Hartwig; Fanka, Letícia Schneider; Costa, Jorge Alberto Vieira

    2016-08-01

    Microalgae can use the CO2 from coal power plants in their metabolic pathways. However, these microorganisms must be able to tolerate other residues produced from burning coal. This study evaluated the wastes addition (CO2, SO2, NO and ash) present in the flue gas from a coal power plant on the growth parameters during culture, CO2 biofixation and on the biomass characterization of Chlorella fusca LEB 111. The SO2 and NO injection (until 400ppm) in cultivations did not markedly affect CO2 biofixation by microalga. The best CO2 biofixation efficiency was obtained with 10% CO2, 200ppm SO2 and NO and 40ppm ash (50.0±0.8%, w w(-1)), showing a specific growth rate of 0.18±0.01 d(-1). The C. fusca LEB 111 biomass composition was similar in all experiments with around 19.7% (w w(-1)) carbohydrates, 15.5% (w w(-1)) lipids and 50.2% (w w(-1)) proteins.

  15. Relationship between soil cellulolytic activity and suppression of seedling blight of barley in arable soils

    DEFF Research Database (Denmark)

    Rasmussen, Peter Have; Knudsen, I.; Elmholt, S.;

    2002-01-01

    The objective was to investigate the relationship between soil suppression of seedling blight of barley caused by Fusarium culmorum (W.G. Smith) Sacc. and the soil cellulolytic activity of beta-glucosidase, cellobiohydrolase and endocellulase. Disease suppression was investigated in bioassays....... From the preliminary results obtained, it is proposed that the cellulolytic activity can be used as an enzymatic approach to study the microbial turnover of organic matter in soils and as indicator of seedling blight of barley caused by F. culmorum. (C) 2002 Elsevier Science B.V. All rights reserved....

  16. Effects of Water Miscible Organic Solvents on the Activity and Conformation of the Baeyer-Villiger Monooxygenases From Thermobifida fusca and Acinetobacter calcoaceticus : A Comparative Study

    NARCIS (Netherlands)

    Secundo, Francesco; Fiala, Stefano; Fraaije, Marco W.; de Gonzalo, Gonzalo; Meli, Massimiliano; Zambianchi, Francesca; Ottolina, Gianluca

    2011-01-01

    A broader exploitation of enzymes in organic synthesis can be achieved by increasing their tolerance toward organic solvents. In this study, the stability and activity of Baeyer-Villiger monooxygenases from Thermobifida fusca (PAMO) and Acinetobacter sp. (CHMO) in the presence of water miscible orga

  17. The impact of a parasitic nematode Thripinema fuscum (Tylenchida: Allantonematidae) on the feeding behavior and vector competence of Frankliniella fusca (Thysanoptera: Thripidae)

    Science.gov (United States)

    Frankliniella fusca (Hinds) (Thysanoptera: Thripidae) is the predominant thrips species found inhabiting and reproducing in peanut (Arachis hypogaea L.) and is one of at least seven thrips species reported to transmit Tomato spotted wilt virus (TSWV). The entomogenous nematode Thripinema fuscum Tipp...

  18. Sample handling factors affecting the enumeration of lactobacilli and cellulolytic bacteria in equine feces

    Science.gov (United States)

    The objectives were to compare media types and evaluate the effects of fecal storage time and temperature on the enumeration of cellulolytic bacteria and lactobacilli from horses. Fecal samples were collected from horses (n = 3) and transported to the lab (CO2, 37 ºC, 0.5 h). The samples were assign...

  19. [Biosynthesis of cellulolytic enzymes and xylanase during submerged cultivation of the fungus Aspergillus terreus 17P].

    Science.gov (United States)

    Loginova, L G; Guzhova, E P; Ismanlova, D Iu; Burdenko, L G

    1978-01-01

    The fungus Aspergillus terreus 17P--producer of cellulolytic enzymes--was cultivated in the Biotec 10 l fermenter on the medium containing minced and heated (at 200 degrees) wheat straw aerated with a different rate. At the mixing rate of 350 rpm and aeration rate of 0.7 r/rpm on the fourth day the culture liquid was obtained whose filtrate contained an active complex of cellulolytic enzymes and xylanase: CI--3.4; APB--1.1, Cx--35.7, cellobiase--0.23, xylanase--73.8 units/ml. The fractionation of the culture liquid filtrate with ammonium sulphate showed that the fraction precipitated at an interval of saturation of 0.3--0.7 contained the largest portion of cellulolytic enzymes and xylanase. The isolated enzymic preparations had a cellulolytic and xylanase activity and contained lipase, pectinase, laminarinase. They also contained low quantities of amylase, protease, beta-1,4- and beta-1,6-glucanase. Enzymic hylrolysis by the Asp. terreus 17P preparation of straw yielded glucose and xylose, of cotton, Na-KMC, cellobiose--glucose, Xylane hydrolyzate contained xylose and arabinose.

  20. Determination of the cellulolytic activities of microorganisms isolated from poultry litter for sawdust degradation

    Directory of Open Access Journals (Sweden)

    Akpomie O.OF

    2013-03-01

    Full Text Available Cellulolytic activities of bacterial and fungal isolates obtained from poultry droppings were determined using the ability of each isolate to produce clear zones on Carboxyl Methyl Cellulose Agar plates. The bacterial isolates were Klebsiella, Streptococcus, Celulomonas, Escherichia coli and Micrococus species. The cellulolytic counts ranged from 5.02 x 104 + 3.42 to 7.20 x 109 + 6.12 cfu/g. The cellulolytic activities of the bacterial isolates ranged from 0.04 to 0.26 iu/m with Cellulomonas having the highest cellulose activity. The fungal isolates were Aspergillus niger, Mucor mucedo, Trichoderma sp. and Penicllium chrysogenum with cellulose activities of 0.24 + 0.021 0.19 + 0.031, 0.23 + 0.05 and 0.23 + 0.028iu/ml respectively. All the isolates were able to degrade the sawdust to varying extent. The percentage degradation was highest with Micrococcus sp. (78.20% and least with Trichoderma sp. (65.83%. The study shows that is a potential source of cellulolytic microorganisms which could be employed in the degradation of sawdust.

  1. The occurrence and distribution of cellulolytic fungi and Fusarium in seven Montagu’s Harrier (Circus pygargus

    Directory of Open Access Journals (Sweden)

    Teresa Korniłłowicz-Kowalska

    2013-12-01

    Full Text Available A total of 45 species of cellulolytic fungi and ten Fusarium species were identified. Three genera (Chaetomium, Trichoderma, Fusarium represented 80% of the frequency of cellulolytic fungi. Of them, Chaetomium globosum, Trichoderma viride and T. koningii were some of the most frequent species. A high differentiation of the richness and frequency of species of cellulolytic fungi depending on the nest and its individual layers was observed. Reasons for the differences in the frequency and species composition of the fungi were discussed.

  2. The first record of the genus Allacma Börner and the species Allacma fusca (L. (Collembola: Sminthuridae from Iran

    Directory of Open Access Journals (Sweden)

    Saeid\tSaeid Bakhshi

    2014-04-01

    Full Text Available In order to identify the epigeic Collembola fauna of Shahid Zare forest (Latitude 36° 32' 2" N, Longitude 52° 7' 45" E and elevation of 40-116 meters above mean sea level, located in the east of Sari city (Mazandaran Province, Iran, some pit fall traps were placed in several sites of this forest, in April 2012. Then, the trapped springtails were separated after being transported to the entomology laboratory of Sari University of agricultural sciences and natural resources. The microscopic slides were prepared and the species were identified using verified identification keys. Among the collected specimens, the genus Allacma Börner and the species Allacma fusca (Linnaeus were recorded from Iran for the first time.

  3. Compositions comprising a polypeptide having cellulolytic enhancing activity and a nitrogen-containing compound and uses thereof

    Energy Technology Data Exchange (ETDEWEB)

    Quinlan, Jason; Xu, Feng; Sweeney, Matthew

    2016-05-31

    The present invention relates to compositions comprising: a polypeptide having cellulolytic enhancing activity and a nitrogen-containing compound. The present invention also relates to methods of using the compositions.

  4. Toxicity and antifeedant activity of essential oils from three aromatic plants grown in Colombia against Euprosterna elaeasa and Acharia fusca(Lepidoptera:Limacodidae)

    Institute of Scientific and Technical Information of China (English)

    Ricardo; Hernández-Lambrao; Karina; Caballero-Gallardo; Jesus; Olivero-Verbel

    2014-01-01

    Objective:To determine the biological effects of essential oils(EOs) isolated from Cymbopogon iiardus,Cymbopogon Jlexuosus and Cvrnbopogon marlinii grown in Colombia against two Lepidoptera larvae,common pests in the oil palm.Methods:Specimens were captured in the field and the antifeedant activity and dermal contact lethality of EOs were measured against Acharia fusca and Euprosterna elaeasa(Lepidoptera:I.imacodidae) at various concentrations 0.002-0.600 μL/cm~3 and 0.002-8 μL/g,respectively.Results:All EOs exhibited strong antifeedant and toxicity activity toward Acharia fusca and Euprosterna elaeasa larvae.Cymbopogon marlinii oil was llie most active againsl both pest insect species,although all tested EOs were better than the synthetic;repellent IR535 on both insects.Conclusions:Colombian EOs have potential for integrated pest management programs in the oil palm industry.

  5. Toxicity and antifeedant activity of essential oils from three aromatic plants grown in Colombia against Euprosterna elaeasa and Acharia fusca (Lepidoptera:Limacodidae)

    Institute of Scientific and Technical Information of China (English)

    Ricardo Hernández-Lambraño; Karina Caballero-Gallardo; Jesus Olivero-Verbel

    2014-01-01

    Objective:To determine the biological effects of essential oils (EOs) isolated from Cymbopogon nardus, Cymbopogon flexuosus and Cymbopogon martinii grown in Colombia against two Lepidoptera larvae, common pests in the oil palm. Methods:Specimens were captured in the field and the antifeedant activity and dermal contact lethality of EOs were measured against Acharia fusca and Euprosterna elaeasa (Lepidoptera:Limacodidae) at various concentrations 0.002-0.600 μL/cm2 and 0.002-8 μL/g, respectively. Results: All EOs exhibited strong antifeedant and toxicity activity toward Acharia fusca and Euprosterna elaeasa larvae. Cymbopogon martinii oil was the most active against both pest insect species, although all tested EOs were better than the synthetic repellent IR3535 on both insects. Conclusions:Colombian EOs have potential for integrated pest management programs in the oil palm industry.

  6. Biodiversity characterization of cellulolytic bacteria present on native Chaco soil by comparison of ribosomal RNA genes.

    Science.gov (United States)

    Talia, Paola; Sede, Silvana M; Campos, Eleonora; Rorig, Marcela; Principi, Dario; Tosto, Daniela; Hopp, H Esteban; Grasso, Daniel; Cataldi, Angel

    2012-04-01

    Sequence analysis of the 16S ribosomal RNA gene was used to study bacterial diversity of a pristine forest soil and of two cultures of the same soil enriched with cellulolytic bacteria. Our analysis revealed high bacterial diversity in the native soil sample, evidencing at least 10 phyla, in which Actinobacteria, Proteobacteria and Acidobacteria accounted for more than 76% of all sequences. In both enriched samples, members of Proteobacteria were the most frequently represented. The majority of bacterial genera in both enriched samples were identified as Brevundimonas and Caulobacter, but members of Devosia, Sphingomonas, Variovorax, Acidovorax, Pseudomonas, Xanthomonas, Stenotrophomonas, Achromobacter and Delftia were also found. In addition, it was possible to identify cellulolytic taxa such as Acidothermus, Micromonospora, Streptomyces, Paenibacillus and Pseudomonas, which indicates that this ecosystem could be an attractive source for study of novel enzymes for cellulose degradation. PMID:22202170

  7. Deciphering the molecular mechanisms behind cellulase production in Trichoderma reesei, the hyper-cellulolytic filamentous fungus.

    Science.gov (United States)

    Shida, Yosuke; Furukawa, Takanori; Ogasawara, Wataru

    2016-09-01

    The filamentous fungus Trichoderma reesei is a potent cellulase producer and the best-studied cellulolytic fungus. A lot of investigations not only on glycoside hydrolases produced by T. reesei, but also on the machinery controlling gene expression of these enzyme have made this fungus a model organism for cellulolytic fungi. We have investigated the T. reesei strain including mutants developed in Japan in detail to understand the molecular mechanisms that control the cellulase gene expression, the biochemical and morphological aspects that could favor this phenotype, and have attempted to generate novel strains that may be appropriate for industrial use. Subsequently, we developed recombinant strains by combination of these insights and the heterologous-efficient saccharifing enzymes. Resulting enzyme preparations were highly effective for saccharification of various biomass. In this review, we present some of the salient findings from the recent biochemical, morphological, and molecular analyses of this remarkable cellulase hyper-producing fungus. PMID:27075508

  8. Isolation and characterization of plasma membrane Na+/H+ antiporter (SOS1 gene during salinity stress in kallar grass (Leptochloa fusca

    Directory of Open Access Journals (Sweden)

    Banafsheh Taherinia

    2015-03-01

    Full Text Available Background: Leptochloa fusca is a halophyte plant which is highly tolerant to saline and sodic soils and water. Moreover, L. fusca is an attractive model plant to study the mechanism of salt tolerance mainly due to its characteristics as a typical euhalophyte, having both accumulating and excreting salt properties. Soil salinity adversely affects plant growth, development and disturbs intracellular ion homeostasis resulting cellular toxicity. The Salt Overly Sensitive 1 (SOS1 gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in imparting salt stress tolerance of plants. Material and Methods: Using conserved sequences of SOS1, the coding sequence of plasma membrane Na+/H+ antiporter (SOS1 in kallar grass was partially isolated and its expression profile during salinity stress was investigated. Results: The aa (amino acid sequence of the isolated region of LfSOS1 possesses the maximum identity up to 96% of its orthologue in Distichlis spicata. The results of semi-quantitative RT-PCR revealed that salinization was affected SOS1 transcript level positively. The expression of LfSOS1 in leaves of kallar grass progressively increased under all salinity levels compared to control. Conclusions: The results suggest that LfSOS1 may play an essential role in the salt tolerance of L. fusca and may be useful for improving salt tolerance in other crop species.

  9. Paenibacillus curdlanolyticus Strain B-6 Xylanolytic-Cellulolytic Enzyme System That Degrades Insoluble Polysaccharides

    OpenAIRE

    Pason, Patthra; Kyu, Khin Lay; Ratanakhanokchai, Khanok

    2006-01-01

    A facultatively anaerobic bacterium, Paenibacillus curdlanolyticus B-6, isolated from an anaerobic digester produces an extracellular xylanolytic-cellulolytic enzyme system containing xylanase, β-xylosidase, arabinofuranosidase, acetyl esterase, mannanase, carboxymethyl cellulase (CMCase), avicelase, cellobiohydrolase, β-glucosidase, amylase, and chitinase when grown on xylan under aerobic conditions. During growth on xylan, the bacterial cells were found to adhere to xylan from the early exp...

  10. Cloning, expression and characterization of glycoside hydrolases from the thermophilic cellulolytic anaerobic bacterium Caldicellulosiruptor kristjanssonii

    OpenAIRE

    Skalman, Lars Nygård

    2010-01-01

    Lignocellulosic biomass has great potential as a substrate for ethanol production as it is a renewable and rather abundant energy source. However, the rigid and complex structure of lignocellulose is a major bottleneck preventing the development of cost-effective production methods. By the use of thermostable cellulolytic enzymes, hydrolysis of cellulose and fermentation of glucose to ethanol could be performed at high temperatures and this would lower the production cost of ethanol significa...

  11. Cellulolytic enzymes on lignocellulosic substrates in solid state fermentation by Aspergillus niger

    OpenAIRE

    Chandra, M. Subhosh; Viswanath, Buddolla; Reddy, B. Rajasekhar

    2007-01-01

    The production of cellulolytic enzymes by Aspergillus niger on lignocellulosic substrates groundnut fodder, wheat bran, rice bran and sawdust in solid state fermentation in a laboratory scale was compared. Czapek Dox liquid broth amended with cellulose (0.5%) was used to moisten lignocellulosic solid supports for cultivation of Aspergillus niger. The production of filter paperase, carboxymethyl cellulase and -glucosidase were monitored at daily intervals for 5 days. The peak production of the...

  12. Enrichment and characterization of an anaerobic cellulolytic microbial consortium SQD-1.1 from mangrove soil.

    Science.gov (United States)

    Gao, Zhao-Ming; Xu, Xun; Ruan, Ling-Wei

    2014-01-01

    Enrichment of microbial consortia provides an approach to simulate and investigate microbial communities in natural environments. In this study, a cellulolytic microbial consortium SQD-1.1 was enriched from mangrove soil of Qinglan port (Hainan, China) by 27 times continuous subcultivation under anaerobic static conditions. The consortium could completely degrade 0.2% (w/v) filter paper within 3 days and utilized it as the sole carbon source. PCR-denaturing gradient gel electrophoresis analysis revealed a stable microbial community structure in the incubation process of 10 days and in the procedure of subcultivation. Twenty-four operational taxonomic units belonging to seven phyla were obtained from the full-length 16S rRNA gene library. Five clones, closest related to the genera Alkaliflexus, Clostridium, Alistipes, Spirochaeta, and Trichococcus, were the predominant ones. Among them, M117, phylogeneticly showing high similarity (16S rRNA gene identity, 95.3%) with the cellulolytic anaerobic bacterium Clostridium straminisolvens CSK1(T), was the potential key cellulolytic bacterium. Using the plate cultivation method, 12 strains, including one potential new species and four potential new species of new genera, were isolated. The strain P2, corresponding to the most frequently detected clone (M05) in the 16S rRNA gene library, showed both CMCase and xylanase activity and may be another important cellulolytic bacterium. The findings of cellulase activity in cell pellet and cohesion and dockerin domains in metagenome data further suggested the potential of utilization of cellulosomes by the consortium to degrade cellulose. Consortium SQD-1.1 provides a candidate for investigating the mechanism of cellulose degradation under anoxic conditions in natural environments. PMID:23529681

  13. Enhancing the cellulose-degrading activity of cellulolytic bacteria CTL-6 (Clostridium thermocellum) by co-culture with non-cellulolytic bacteria W2-10 (Geobacillus sp.).

    Science.gov (United States)

    Lü, Yucai; Li, Ning; Yuan, Xufeng; Hua, Binbin; Wang, Jungang; Ishii, Masaharu; Igarashi, Yasuo; Cui, Zongjun

    2013-12-01

    The effect of a non-cellulolytic bacterium W2-10 (Geobacillus sp.) on the cellulose-degrading activity of a cellulolytic bacterium CTL-6 (Clostridium thermocellum) was determined using cellulose materials (paper and straw) in peptone cellulose solution (PCS) medium under aerobic conditions. The results indicated that in the co-culture, addition of W2-10 resulted in a balanced medium pH, and may provide the required anaerobic environment for CTL-6. Overall, addition of W2-10 was beneficial to CTL-6 growth in the adverse environment of the PCS medium. In co-culture with W2-10, the CTL-6 cellulose degradation efficiency of filter paper and alkaline-treated wheat straw significantly increased up to 72.45 and 37.79 %, respectively. The CMCase activity and biomass of CTL-6 also increased from 0.23 U ml(-1) and 45.1 μg ml(-1) (DNA content) up to 0.47 U ml(-1) and 112.2 μg ml(-1), respectively. In addition, co-culture resulted in accumulation of acetate and propionate up to 4.26 and 2.76 mg ml(-1). This was a respective increase of 2.58 and 4.45 times, in comparison to the monoculture with CTL-6.

  14. Recombination of thermo-alkalistable, high xylooligosaccharides producing endo-xylanase from Thermobifida fusca and expression in Pichia pastoris.

    Science.gov (United States)

    Wang, Qian; Du, Wen; Weng, Xiao-Yan; Liu, Ming-Qi; Wang, Jia-Kun; Liu, Jian-Xin

    2015-02-01

    For xylooligosaccharide (XO) production, endo-xylanase from Thermobifida fusca was modified by error-prone PCR and DNA shuffling. The G4SM1 mutant (S62T, S144C, N198D, and A217V) showed the most improved hydrolytic activity and was two copies expressed in Pichia pastoris under the control of GAP promoter. The maximum xylanase activity in culture supernatants was 165 ± 5.5 U/ml, and the secreted protein concentration reached 493 mg/l in a 2-l baffled shake flask. After 6× His-tagged protein purification, the specific activity of G4SM1 was 2036 ± 45.8 U/mg, 2.12 times greater than that of wild-type enzyme. Additionally, G4SM1 was stable over a wide pH range from 5.0 to 9.0. Meanwhile, half-life of G4SM1 thermal inactivation at 70 °C increased 8.5-fold. Three-dimensional structures suggest that two amino acid substitutions, S62T and S144C, located at catalytic domain may be responsible for the enhanced activity and thermostability of xylanase. Xylobiose was the dominant end product of xylan hydrolysis by G4SM1. Due to its attractive biochemical properties, G4SM1 has potential value in commercial XO production. PMID:25384545

  15. Leopard Panthera pardus fusca Density in the Seasonally Dry, Subtropical Forest in the Bhabhar of Terai Arc, Nepal

    Directory of Open Access Journals (Sweden)

    Kanchan Thapa

    2014-01-01

    Full Text Available We estimated leopard (Panthera pardus fusca abundance and density in the Bhabhar physiographic region in Parsa Wildlife Reserve, Nepal. The camera trap grid, covering sampling area of 289 km2 with 88 locations, accumulated 1,342 trap nights in 64 days in the winter season of 2008-2009 and photographed 19 individual leopards. Using models incorporating heterogeneity, we estimated 28 (±SE 6.07 and 29.58 (±SE 10.44 leopards in Programs CAPTURE and MARK. Density estimates via 1/2 MMDM methods were 5.61 (±SE 1.30 and 5.93 (±SE 2.15 leopards per 100 km2 using abundance estimates from CAPTURE and MARK, respectively. Spatially explicit capture recapture (SECR models resulted in lower density estimates, 3.78 (±SE 0.85 and 3.48 (±SE 0.83 leopards per 100 km2, in likelihood based program DENSITY and Bayesian based program SPACECAP, respectively. The 1/2 MMDM methods have been known to provide much higher density estimates than SECR modelling techniques. However, our SECR models resulted in high leopard density comparable to areas considered better habitat in Nepal indicating a potentially dense population compared to other sites. We provide the first density estimates for leopards in the Bhabhar and a baseline for long term population monitoring of leopards in Parsa Wildlife Reserve and across the Terai Arc.

  16. Nitric oxide and heat shock protein 90 co-regulate temperature-induced bleaching in the soft coral Eunicea fusca

    Science.gov (United States)

    Ross, Cliff

    2014-06-01

    Coral bleaching represents a complex physiological process that is affected not only by environmental conditions but by the dynamic internal cellular biology of symbiotic dinoflagellates ( Symbiodinium spp.) and their cnidarian hosts. Recently, nitric oxide (NO) has emerged as a key molecule involved with the expulsion of Symbiodinium from host cnidarian cells. However, the site of production remains under debate, and the corresponding signaling pathways within and between host and endosymbiont remain elusive. In this study, using freshly isolated Symbiodinium from the soft coral Eunicea fusca, I demonstrate that thermally induced stress causes an upregulation in Symbiodinium heat shock protein 90 (Hsp90). In turn, Hsp90 shows a concomitant ability to enhance the activity of a constitutively expressed isoform of NO synthase. The resulting production of NO constitutes a signaling molecule capable of inducing Symbiodinium expulsion. Using nitric oxide synthase (NOS) and Hsp90 polyclonal antibodies, thermal stress-induced Hsp90 was shown to co-immunoprecipitate with a constitutive isoform of NOS. The specific blocking of Hsp90 activity, with the Hsp90 inhibitor geldanamycin, was capable of inhibiting NO production implicating the involvement of a coordinated regulatory system. These results have strong evolutionary implications for Hsp90-NOS chaperone complexes among biological kingdoms and provide evidence for a new functional role in symbiotic associations.

  17. Enzymatic activity of the cellulolytic complex produced by Trichoderma reesei. Enzymatic hydrolysis of cellulose

    International Nuclear Information System (INIS)

    The enzymatic activity characterization of the cellulolytic complex obtained from Trichoderma reesei QM 9414 and the influence of the enzymatic hydrolysis conditions on the hydrolysis yield are studied. Pure cellulose and native or alkali pretreated biomass Onopordum nervosum have been used as substrates. The values of pH, temperature, substrate concentration and enzyme-substrate ratio for the optimum activity of that complex, evaluated as glucose and reducing sugars production, have been selected. Previous studies on enzymatic hydrolysis of 0. nervosum have shown a remarkable effect of the alkaline pretreatments on the final hydrolysis yield. (Author) 10 refs

  18. Enzymatic activity of the cellulolytic complex produced by trichoderma reesei. Enzymatic hydrolysis of cellulose

    International Nuclear Information System (INIS)

    The enzymatic activity characterization of the cellulolytic complex obtained from Trichoderma reese QM 9414 and the influence of the enzymatic hydrolysis conditions on the hydrolysis yield are studied. Pure cellulose and native or alkali pretreated biomass from Onopordum nervosum have been used as substrates. The values of pH, temperature, substrate concentration and enzyme-substrate ratio for the optimum activity of that complex, evaluated as glucose and reducing sugars productions, have been selected. Previous studies on enzymatic hydrolysis of O. nervosum have shown a remarkable effect of the alkaline pretreatments on the final hydrolysis yield. (author). 10 figs.; 10 refs

  19. Cloning of the Thermomonospora fusca Endoglucanase E2 gene in Streptomyces lividans: Affinity purification and functional domains of the cloned gene product

    Energy Technology Data Exchange (ETDEWEB)

    Ghangas, G.S.; Wilson, D.B. (Cornell Univ., Ithaca, NY (USA))

    1988-10-01

    Thermomonospora fusca YX grown in the presence of cellulose produces a number of {beta}-1-4-endoglucanases, some of which bind to microcrystalline cellulose. By using a multicopy plasmid, pIJ702, a gene coding for one of these enzymes (E2) was cloned into Streptomyces lividans and then mobilized into both Escherichia coli and Streptomyces albus. The gene was localized to a 1.6-kilobase PvuII-ClaI segment of the originally cloned 3.0-kilobase SstI fragment of Thermomonospora DNA. The culture supernatants of Streptomyces transformants contain a major endoglucanase that cross-reacts with antibody against Thermomonospora cellulase E2 and has the same molecular weight (43,000) as T. fusca E2. This protein binds quickly and tightly to Avicel. It also binds to filter paper but at a slower rate than to Avicel. Several large proteolytic degradation products of this enzyme generated in vivo lose the ability to bind to Avicel and have higher activity on carboxymethyl cellulose than the native enzyme. Other smaller products bind to Avicel but lack activity. A weak cellobiose-binding site not observed in the native enzyme was present in one of the degradation products. In E. coli, the cloned gene produced a cellulase that also binds tightly to Avicel but appeared to be slightly larger than T. fusca E2. The activity of intact E2 from all organisms can be inactivated by Hg{sup 2+} ions. Dithiothreitol protected against Hg{sup 2+} inactivation and reactivated both unbound and Avicel-bound Hg{sub 2+}-inhibited E2, but at different rates.

  20. Acute Toxicity and the Effects of Copper Sulphate (CuSO4.5H2O on the Behavior of the Black Fish (Capoeta Fusca

    Directory of Open Access Journals (Sweden)

    Iman Zarei

    2013-02-01

    Full Text Available Background: The development of toxicity tests regarding toxic responses of different fish species could be more effectively used in predictive toxicology and risk assessment. In this study lethal concentrations (LC50-96 h values of copper sulphate; an important toxic industrial pollutant, on Capoeta fusca were determined. Behavioral changes at different concentrations of CuSO4 were determined for the C.fusca. Methods: The sample fishes were collected from Qanat in Birjand and were transported to the laboratory in polythene bags. The exposure time of fish to CuSO4 was 96 hours. Mortalities were recorded at 24, 48, 72, and 96 hours of exposure, and the dead fish were removed regularly from the test aquariums. Physicochemical parameters, such as dissolved oxygen, pH and Total hardness of aquaria were monitored daily. Results: The LC50 values for CuSO4 at 24, 48, 72, and 96 h of exposure, were 43.62, 12.6, 7.66, and 6.85 mg/L, respectively. The median LC50 value of CuSO4 for C.fusca was found to be 6.928 mg/L by EPA method and estimated to be 6.787 mg/L with SPSS statistical software. Conclusion: The mortality decreased with time, and most of the deaths occurred during the first 24 h. In addition, behavioural changes increased with increased concentration. This metal is an important constituent in industrial effluents discharged into freshwaters. The results obtained in this study clearly revealed the fact that it is necessary to control the use of a heavy metal such as copper.

  1. Bridging Theory and Experiment to Address Structural Properties of Truncated Haemoglobins: Insights from Thermobifida fusca HbO.

    Science.gov (United States)

    Howes, Barry D; Boechi, Leonardo; Boffi, Alberto; Estrin, Dario E; Smulevich, Giulietta

    2015-01-01

    In this chapter, we will discuss the paradigmatic case of Thermobifida fusca (Tf-trHb) HbO in its ferrous and ferric states and its behaviour towards a battery of possible ligands. This choice was dictated by the fact that it has been one of the most extensively studied truncated haemoglobins, both in terms of spectroscopic and molecular dynamics studies. Tf-trHb typifies the structural properties of group II trHbs, as the active site is characterized by a highly polar distal environment in which TrpG8, TyrCD1, and TyrB10 provide three potential H-bond donors in the distal cavity capable of stabilizing the incoming ligands. The role of these residues in key topological positions, and their interplay with the iron-bound ligands, has been addressed in studies carried out on the CO, F(-), OH(-), CN(-), and HS(-) adducts formed with the wild-type protein and a combinatorial set of mutants, in which the distal polar residues, TrpG8, TyrCD1, and TyrB10, have been singly, doubly, or triply replaced by a Phe residue. In this context, such a complete analysis provides an excellent benchmark for the investigation of the relationship between protein structure and function, allowing one to translate physicochemical properties of the active site into the observed functional behaviour. Tf-trHb will be compared with other members of the group II trHbs and, more generally, with members of the other trHb subgroups. PMID:26616516

  2. A potential source for cellulolytic enzyme discovery and environmental aspects revealed through metagenomics of Brazilian mangroves.

    Science.gov (United States)

    Thompson, Claudia Elizabeth; Beys-da-Silva, Walter Orlando; Santi, Lucélia; Berger, Markus; Vainstein, Marilene Henning; Guima Rães, Jorge Almeida; Vasconcelos, Ana Tereza Ribeiro

    2013-01-01

    The mangroves are among the most productive and biologically important environments. The possible presence of cellulolytic enzymes and microorganisms useful for biomass degradation as well as taxonomic and functional aspects of two Brazilian mangroves were evaluated using cultivation and metagenomic approaches. From a total of 296 microorganisms with visual differences in colony morphology and growth (including bacteria, yeast and filamentous fungus), 179 (60.5%) and 117 (39.5%) were isolated from the Rio de Janeiro (RJ) and Bahia (BA) samples, respectively. RJ metagenome showed the higher number of microbial isolates, which is consistent with its most conserved state and higher diversity. The metagenomic sequencing data showed similar predominant bacterial phyla in the BA and RJ mangroves with an abundance of Proteobacteria (57.8% and 44.6%), Firmicutes (11% and 12.3%) and Actinobacteria (8.4% and 7.5%). A higher number of enzymes involved in the degradation of polycyclic aromatic compounds were found in the BA mangrove. Specific sequences involved in the cellulolytic degradation, belonging to cellulases, hemicellulases, carbohydrate binding domains, dockerins and cohesins were identified, and it was possible to isolate cultivable fungi and bacteria related to biomass decomposition and with potential applications for the production of biofuels. These results showed that the mangroves possess all fundamental molecular tools required for building the cellulosome, which is required for the efficient degradation of cellulose material and sugar release.

  3. Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them

    Science.gov (United States)

    Gray, Kevin A.; Zhao, Lishan; Cayouette, Michelle H.

    2012-01-24

    The invention provides polypeptides having any cellulolytic activity, e.g., a cellulase activity, a endoglucanase, a cellobiohydrolase, a beta-glucosidase, a xylanase, a mannanse, a .beta.-xylosidase, an arabinofuranosidase, and/or an oligomerase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. In one aspect, the invention provides polypeptides having an oligomerase activity, e.g., enzymes that convert recalcitrant soluble oligomers to fermentable sugars in the saccharification of biomass. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  4. Flow cytometry community fingerprinting and amplicon sequencing for the assessment of landfill leachate cellulolytic bioaugmentation.

    Science.gov (United States)

    Kinet, R; Dzaomuho, P; Baert, J; Taminiau, B; Daube, G; Nezer, C; Brostaux, Y; Nguyen, F; Dumont, G; Thonart, P; Delvigne, F

    2016-08-01

    Flow cytometry (FCM) is a high throughput single cell technology that is actually becoming widely used for studying phenotypic and genotypic diversity among microbial communities. This technology is considered in this work for the assessment of a bioaugmentation treatment in order to enhance cellulolytic potential of landfill leachate. The experimental results reveal the relevant increase of leachate cellulolytic potential due to bioaugmentation. Cytometric monitoring of microbial dynamics along these assays is then realized. The flow FP package is used to establish microbial samples fingerprint from initial 2D cytometry histograms. This procedure allows highlighting microbial communities' variation along the assays. Cytometric and 16S rRNA gene sequencing fingerprinting methods are then compared. The two approaches give same evidence about microbial dynamics throughout digestion assay. There are however a lack of significant correlation between cytometric and amplicon sequencing fingerprint at genus or species level. Same phenotypical profiles of microbiota during assays matched to several 16S rRNA gene sequencing ones. Flow cytometry fingerprinting can thus be considered as a promising routine on-site method suitable for the detection of stability/variation/disturbance of complex microbial communities involved in bioprocesses. PMID:27160955

  5. Comparative investigations on wood decay and cellulolytic and xylanolytic activity of some basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Hegarty, B.; Steinfurth, A.; Liese, W.; Schmidt, O.

    1987-10-01

    To evaluate physiological differences between various wood-decay fungi and especially different strains per species, comparative investigations were performed with 13 brown-rot and 6 white-rot fungi with respect to their wood decay as well as cellulolytic and xylanolytic capacities. Pine wood samples were considerably decayed by the brown-rot fungi with the two Poria placenta strains showing highest and the two Serpula himantioides isolates lowest mass losses. Most white-rot fungi degraded beech wood samples stronger than pine. Schizophyllum commune was inactive on both substrates. Whereas cellulolytic activity measurement using the clearing of Walseth cellulose gave negative results for some brownrotters, all white-rotters, especially Merulius tremellosus produced cellulase. The decay of Remazol Brilliant Blue stained Avicel in liquid medium proved to be an unsuitable test method for most Serpula lacrymans strains, one P. placenta isolate and for Coriolus versicolor and M. tremellosus. The new method of quantitative photometrical determination of dye release from stained cellulose in agar provided a suitable cellulase assay for most fungi, although the whiterotters C. versicolor, Heterobasidion annosum and M. tremellosus could metabolise the stain. In shake culture, carboxymethylcellulase was not produced by S. lacrymans, P. placenta, Laetiporus sulphureus of Gloeophyllum abietinum, whereas all fungi were xylanolytic. There was only a slight relation between wood decay and enzymatic capacity and, altogether, a great physiological diversity within the fungi was evident.

  6. In vitro Cellulose Rich Organic Material Degradation by Cellulolytic Streptomyces albospinus (MTCC 8768

    Directory of Open Access Journals (Sweden)

    Pinky Prasad

    2012-09-01

    Full Text Available Aims: Cellulosic biomass is the only foreseeable sustainable source of fuels and is also one of the dominating waste materials in nature resulting from human activities. Keeping in view the environmental problems like disposal of large volumes of cellulosic wastes and shortage of fossil fuel in the world, the main aim of the present investigation was to characterize and study the cellulolytic activity of Streptomyces albospinus (MTCC 8768, isolated from municipal wastes, on natural cellulosic substrates viz. straw powder, wood powder and finely grated vegetable peels.Methodology and Result: Stanier’s Basal broth with 100 mg of each of the substrates was inoculated separately with S. albospinus (MTCC No. 8768 and incubated at 37 °C for 8 days. The cellulosic substrates were re-weighed at an interval of 2 days and the difference between the initial weight and the final weight gave the amount of substratesdegraded by the isolate. It was observed that maximum degradation was observed in the grated vegetable peels (64 mg followed by straw powder (38 mg and wood powder (28 mg over a period of 8 days.Conclusion, significance and impact of study: By the selection of efficient cellulolytic microorganisms and cost-effective operational techniques, the production of useful end products from the biodegradation of the low cost enormous stock of cellulose in nature can be very beneficial.

  7. Biodegradation of Palm Kernel Cake by Cellulolytic and Hemicellulolytic Bacterial Cultures through Solid State Fermentation

    Directory of Open Access Journals (Sweden)

    Mohamed Idris Alshelmani

    2014-01-01

    Full Text Available Four cellulolytic and hemicellulolytic bacterial cultures were purchased from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Culture (DSMZ and the American Type Culture Collection (ATCC. Two experiments were conducted; the objective of the first experiment was to determine the optimum time period required for solid state fermentation (SSF of palm kernel cake (PKC, whereas the objective of the second experiment was to investigate the effect of combinations of these cellulolytic and hemicellulolytic bacteria on the nutritive quality of the PKC. In the first experiment, the SSF was lasted for 12 days with inoculum size of 10% (v/w on different PKC to moisture ratios. In the second experiment, fifteen combinations were created among the four microbes with one untreated PKC as a control. The SSF lasted for 9 days, and the samples were autoclaved, dried, and analyzed for proximate analysis. Results showed that bacterial cultures produced high enzymes activities at the 4th day of SSF, whereas their abilities to produce enzymes tended to be decreased to reach zero at the 8th day of SSF. Findings in the second experiment showed that hemicellulose and cellulose was significantly P<0.05 decreased, whereas the amount of reducing sugars were significantly P<0.05 increased in the fermented PKC (FPKC compared with untreated PKC.

  8. Complete genome sequence of Desulfurococcus fermentans, a hyperthermophilic cellulolytic crenarchaeon isolated from a freshwater hot spring in Kamchatka, Russia.

    Science.gov (United States)

    Susanti, Dwi; Johnson, Eric F; Rodriguez, Jason R; Anderson, Iain; Perevalova, Anna A; Kyrpides, Nikos; Lucas, Susan; Han, James; Lapidus, Alla; Cheng, Jan-Fang; Goodwin, Lynne; Pitluck, Sam; Mavrommatis, Konstantinos; Peters, Lin; Land, Miriam L; Hauser, Loren; Gopalan, Venkat; Chan, Patricia P; Lowe, Todd M; Atomi, Haruyuki; Bonch-Osmolovskaya, Elizaveta A; Woyke, Tanja; Mukhopadhyay, Biswarup

    2012-10-01

    Desulfurococcus fermentans is the first known cellulolytic archaeon. This hyperthermophilic and strictly anaerobic crenarchaeon produces hydrogen from fermentation of various carbohydrates and peptides without inhibition by accumulating hydrogen. The complete genome sequence reported here suggested that D. fermentans employs membrane-bound hydrogenases and novel glycohydrolases for hydrogen production from cellulose.

  9. Complete Genome Sequence of Desulfurococcus fermentans, a Hyperthermophilic Cellulolytic Crenarchaeon Isolated from a Freshwater Hot Spring in Kamchatka, Russia

    Energy Technology Data Exchange (ETDEWEB)

    Susanti, Dwi [Virginia Polytechnic Institute and State University (Virginia Tech); Johnson, Eric F [Virginia Polytechnic Institute and State University (Virginia Tech); Rodriquez, Jason [Virginia Polytechnic Institute and State University (Virginia Tech); Anderson, Iain [U.S. Department of Energy, Joint Genome Institute; Perevalova, Anna [Virginia Polytechnic Institute and State University (Virginia Tech); Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Gopapan, Venkay [Ohio State University; Chan, Patricia [University of California, Santa Cruz; Atomi, Haruyuki [Kyoto University, Japan; Bonch-Osmolovskaya, Elizaveta [Russian Academy of Sciences, Moscow; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Mukhopadhyay, Biswarup [Virginia Polytechnic Institute and State University (Virginia Tech)

    2012-01-01

    Desulfurococcus fermentans is the first known cellulolytic archaeon. This hyperthermophilic and strictly anaerobic crenarchaeon produces hydrogen from fermentation of various carbohydrates and peptides without inhibition by accumulating hydrogen. The complete genome sequence reported here suggested that D. fermentans employs membrane-bound hydrogenases and novel glycohydrolases for hydrogen production from cellulose.

  10. Production of cellulolytic enzymes by Pleurotus species on lignocellulosic wastes using novel pretreatments.

    Science.gov (United States)

    Singh, M P; Pandey, A K; Vishwakarma, S K; Srivastava, A K; Pandey, V K; Singh, V K

    2014-01-01

    In the present investigation three species of Pleurotus i.e. P. sajor—caju (P1), P. florida (P2) and P. flabellatus (P3) along with two lignocellulosic substrates namely paddy straw and wheat straw were selected for evaluation of production of extracellular cellulolytic enzymes. During the cultivation of three species of Pleurotus under in vivo condition, the two lignocellulosic substrates were treated with plants extracts (aqueous extracts of ashoka leaves (A) and neem oil (B)), hot water (H) and chemicals (C).Among all treatments, neem oil treated substrates supported better enzyme production followed by aqueous extract of ashoka leaves, hot water and chemical treatment. Between the two substrates paddy straw supported better enzyme production than wheat straw. P. flabellatus showed maximum activity of exoglucanase, endoglucanase and β—glucosidase followed by P. florida and P. sajor—caju. PMID:25535714

  11. Biological pre-treatment: Enhancing biogas production using the highly cellulolytic fungus Trichoderma viride.

    Science.gov (United States)

    Mutschlechner, Mira; Illmer, Paul; Wagner, Andreas Otto

    2015-09-01

    With regard to renewable sources of energy, bioconversion of lignocellulosic biomass has long been recognized as a desirable endeavor. However, the highly heterogeneous structure of lignocellulose restricts the exploitation of its promising potential in biogas plants. Hence, effective pre-treatment methods are decisive prerequisites to overcome these challenges in order to improve the utilization ratio of (ligno) cellulosic substrates during fermentation. In the present study, the application of Trichoderma viride in an aerobic upstream process prior to anaerobic digestion led up to a threefold increase in the yield of methane and total gas in a lab-scale investigation. Due to its highly efficient cellulolytic activities, T. viride seemed to be responsible for an improved nutrient availability that positively influenced the anaerobic microbiocenosis. Aerobic pre-treatment of organic matter with T. viride is therefore a promising solution to achieve higher methane yields and degradation performances without any additional energy demand, nor undesired by-product inhibition. PMID:26013693

  12. Study of cellulolytic soil fungi and two nova species and new medium

    Institute of Scientific and Technical Information of China (English)

    KHALID Mahmood; YANG Wei-jun; KISHWAR Nazir; RAJPUT Zahid Iqbal; ARIJO Abdullah G.

    2006-01-01

    This study is aimed at identifying and determining the percentage of occurrence frequency of cellulose decomposing soil fungi. The soil samples were inoculated into culture plates prepared in Sabouraud medium under sterilized conditions and incubated at 30 ℃ for 4 to 7 d. The identified fungal species were incubated in self-designed cellulose medium for testing their cellulolytic ability. Forty-two species, including 2 nova species, representing sixteen genera showed growth and sporulation in the cellulose medium. Most of the isolated species were from genus Aspergillus and Penicillium. Aspergillus niger and Mucor hiemalis showed highest occurrence frequency (45% and 36% respectively), as these species were collected from about 80% of soil samples. Being agar free and cheaper, the new fungal medium designed showed results equivalent to Sabouraud medium.

  13. Microbial Consortium with High Cellulolytic Activity (MCHCA for enhanced biogas production.

    Directory of Open Access Journals (Sweden)

    Krzysztof ePoszytek

    2016-03-01

    Full Text Available The use of lignocellulosic biomass as a substrate in agricultural biogas plants is very popular and yields good results. However, the efficiency of anaerobic digestion, and thus biogas production, is not always satisfactory due to the slow or incomplete degradation (hydrolysis of plant matter. To enhance the solubilization of the lignocellulosic biomass various physical, chemical and biological pretreatment methods are used.The aim of this study was to select and characterize cellulose-degrading bacteria, and to construct a microbial consortium, dedicated for degradation of maize silage and enhancing biogas production from this substrate.Over one hundred strains of cellulose-degrading bacteria were isolated from: sewage sludge, hydrolyzer from an agricultural biogas plant, cattle slurry and manure. After physiological characterization of the isolates, sixteen strains (representatives of Bacillus, Providencia and Ochrobactrum genera were chosen for the construction of a Microbial Consortium with High Cellulolytic Activity, called MCHCA. The selected strains had a high endoglucanase activity (exceeding 0.21 IU/mL CMCase activity and a wide range of tolerance to various physical and chemical conditions. Lab-scale simulation of biogas production using the selected strains for degradation of maize silage was carried out in a two-bioreactor system, similar to those used in agricultural biogas plants.The obtained results showed that the constructed MCHCA consortium is capable of efficient hydrolysis of maize silage, and increases biogas production by even 38%, depending on the inoculum used for methane fermentation. The results in this work indicate that the mesophilic Microbial Consortium with High Cellulolytic Activity has a great potential for application on industrial scale in agricultural biogas plants.

  14. Cellulolytic and xylanolytic potential of high β-glucosidase-producing Trichoderma from decaying biomass.

    Science.gov (United States)

    Okeke, Benedict C

    2014-10-01

    Availability, cost, and efficiency of microbial enzymes for lignocellulose bioconversion are central to sustainable biomass ethanol technology. Fungi enriched from decaying biomass and surface soil mixture displayed an array of strong cellulolytic and xylanolytic activities. Strains SG2 and SG4 produced a promising array of cellulolytic and xylanolytic enzymes including β-glucosidase, usually low in cultures of Trichoderma species. Nucleotide sequence analysis of internal transcribed spacer 2 (ITS2) region of rRNA gene revealed that strains SG2 and SG4 are closely related to Trichoderma inhamatum, Trichoderma piluliferum, and Trichoderma aureoviride. Trichoderma sp. SG2 crude culture supernatant correspondingly displayed as much as 9.84 ± 1.12, 48.02 ± 2.53, and 30.10 ± 1.11 units mL(-1) of cellulase, xylanase, and β-glucosidase in 30 min assay. Ten times dilution of culture supernatant of strain SG2 revealed that total activities were about 5.34, 8.45, and 2.05 orders of magnitude higher than observed in crude culture filtrate for cellulase, xylanase, and β-glucosidase, respectively, indicating that more enzymes are present to contact with substrates in biomass saccharification. In parallel experiments, Trichoderma species SG2 and SG4 produced more β-glucosidase than the industrial strain Trichoderma reesei RUT-C30. Results indicate that strains SG2 and SG4 have potential for low cost in-house production of primary lignocellulose-hydrolyzing enzymes for production of biomass saccharides and biofuel in the field.

  15. Genes regulated by AoXlnR, the xylanolytic and cellulolytic transcriptional regulator, in Aspergillus oryzae.

    Science.gov (United States)

    Noguchi, Yuji; Sano, Motoaki; Kanamaru, Kyoko; Ko, Taro; Takeuchi, Michio; Kato, Masashi; Kobayashi, Tetsuo

    2009-11-01

    XlnR is a Zn(II)2Cys6 transcriptional activator of xylanolytic and cellulolytic genes in Aspergillus. Overexpression of the aoxlnR gene in Aspergillus oryzae (A. oryzae xlnR gene) resulted in elevated xylanolytic and cellulolytic activities in the culture supernatant, in which nearly 40 secreted proteins were detected by two-dimensional electrophoresis. DNA microarray analysis to identify the transcriptional targets of AoXlnR led to the identification of 75 genes that showed more than fivefold increase in their expression in the AoXlnR overproducer than in the disruptant. Of these, 32 genes were predicted to encode a glycoside hydrolase, highlighting the biotechnological importance of AoXlnR in biomass degradation. The 75 genes included the genes previously identified as AoXlnR targets (xynF1, xynF3, xynG2, xylA, celA, celB, celC, and celD). Thirty-six genes were predicted to be extracellular, which was consistent with the number of proteins secreted, and 61 genes possessed putative XlnR-binding sites (5'-GGCTAA-3', 5'-GGCTAG-3', and 5'-GGCTGA-3') in their promoter regions. Functional annotation of the genes revealed that AoXlnR regulated the expression of hydrolytic genes for degradation of beta-1,4-xylan, arabinoxylan, cellulose, and xyloglucan and of catabolic genes for the conversion of D-xylose to xylulose-5-phosphate. In addition, genes encoding glucose-6-phosphate 1-dehydrogenase and L-arabinitol-4- dehydrogenase involved in D-glucose and L-arabinose catabolism also appeared to be targets of AoXlnR.

  16. CO2 Biofixation by the Cyanobacterium Spirulina sp. LEB 18 and the Green Alga Chlorella fusca LEB 111 Grown Using Gas Effluents and Solid Residues of Thermoelectric Origin.

    Science.gov (United States)

    da Silva Vaz, Bruna; Costa, Jorge Alberto Vieira; de Morais, Michele Greque

    2016-01-01

    The concentration of carbon dioxide (CO2) in the atmosphere has increased from 280 to 400 ppm in the last 10 years, and the coal-fired power plants are responsible for approximately 22 % of these emissions. The burning of fossil fuel also produces a great amount of solid waste that causes serious industrial and environmental problems. The biological processes become interesting alternative in combating pollution and developing new products. The objective of this study was to evaluate the CO2 biofixation potential of microalgae that were grown using gaseous effluents and solid residues of thermoelectric origin. The microalgae Chlorella fusca LEB 111 presented higher rate of CO2 biofixation (42.8 %) (p coal combustion, using the minerals present in this residue as the source of the essential metals required for their growth and the CO2 derived from the combustion gas as their carbon source. PMID:26453033

  17. The Tomato Spotted Wilt Virus Genome Is Processed Differentially in its Plant Host Arachis hypogaea and its Thrips Vector Frankliniella fusca.

    Science.gov (United States)

    Fletcher, Stephen J; Shrestha, Anita; Peters, Jonathan R; Carroll, Bernard J; Srinivasan, Rajagopalbabu; Pappu, Hanu R; Mitter, Neena

    2016-01-01

    Thrips-transmitted tospoviruses are economically important viruses affecting a wide range of field and horticultural crops worldwide. Tomato spotted wilt virus (TSWV) is the type member of the Tospovirus genus with a broad host range of more than 900 plant species. Interactions between these viruses and their plant hosts and insect vectors via RNAi pathways are likely a key determinant of pathogenicity. The current investigation, for the first time, compares biogenesis of small RNAs between the plant host and insect vector in the presence or absence of TSWV. Unique viral small interfering RNA (vsiRNA) profiles are evident for Arachis hypogaea (peanut) and Frankliniella fusca (thrips vector) following infection with TSWV. Differences between vsiRNA profiles for these plant and insect species, such as the relative abundance of 21 and 22 nt vsiRNAs and locations of alignment hotspots, reflect the diverse siRNA biosynthesis pathways of their respective kingdoms. The presence of unique vsiRNAs in F. fusca samples indicates that vsiRNA generation takes place within the thrips, and not solely through uptake via feeding on vsiRNAs produced in infected A. hypogaea. The study also shows key vsiRNA profile differences for TSWV among plant families, which are evident in the case of A. hypogaea, a legume, and members of Solanaceae (S. lycopersicum and Nicotiana benthamiana). Distinctively, overall small RNA (sRNA) biogenesis in A. hypogaea is markedly affected with an absence of the 24 nt sRNAs in TSWV-infected plants, possibly leading to wide-spread molecular and phenotypic perturbations specific to this species. These findings add significant information on the host-virus-vector interaction in terms of RNAi pathways and may lead to better crop and vector specific control strategies. PMID:27656190

  18. Evolution of High Cellulolytic Activity in Symbiotic Streptomyces through Selection of Expanded Gene Content and Coordinated Gene Expression.

    Science.gov (United States)

    Book, Adam J; Lewin, Gina R; McDonald, Bradon R; Takasuka, Taichi E; Wendt-Pienkowski, Evelyn; Doering, Drew T; Suh, Steven; Raffa, Kenneth F; Fox, Brian G; Currie, Cameron R

    2016-06-01

    The evolution of cellulose degradation was a defining event in the history of life. Without efficient decomposition and recycling, dead plant biomass would quickly accumulate and become inaccessible to terrestrial food webs and the global carbon cycle. On land, the primary drivers of plant biomass deconstruction are fungi and bacteria in the soil or associated with herbivorous eukaryotes. While the ecological importance of plant-decomposing microbes is well established, little is known about the distribution or evolution of cellulolytic activity in any bacterial genus. Here we show that in Streptomyces, a genus of Actinobacteria abundant in soil and symbiotic niches, the ability to rapidly degrade cellulose is largely restricted to two clades of host-associated strains and is not a conserved characteristic of the Streptomyces genus or host-associated strains. Our comparative genomics identify that while plant biomass degrading genes (CAZy) are widespread in Streptomyces, key enzyme families are enriched in highly cellulolytic strains. Transcriptomic analyses demonstrate that cellulolytic strains express a suite of multi-domain CAZy enzymes that are coregulated by the CebR transcriptional regulator. Using targeted gene deletions, we verify the importance of a highly expressed cellulase (GH6 family cellobiohydrolase) and the CebR transcriptional repressor to the cellulolytic phenotype. Evolutionary analyses identify complex genomic modifications that drive plant biomass deconstruction in Streptomyces, including acquisition and selective retention of CAZy genes and transcriptional regulators. Our results suggest that host-associated niches have selected some symbiotic Streptomyces for increased cellulose degrading activity and that symbiotic bacteria are a rich biochemical and enzymatic resource for biotechnology. PMID:27276034

  19. Selection and molecular characterization of cellulolytic-xylanolytic fungi from surface soil-biomass mixtures from Black Belt sites.

    Science.gov (United States)

    Okeke, Benedict C; Hall, Rosine W; Nanjundaswamy, Ananda; Thomson, M Sue; Deravi, Yasaman; Sawyer, Leah; Prescott, Andrew

    2015-06-01

    Plant biomass is an abundant renewable natural resource that can be transformed into chemical feedstocks. Enzymes used in saccharification of lignocellulosic biomass are a major part of biofuel production costs. A cocktail of cellulolytic and xylanolytic enzymes are required for optimal saccharification of biomass. Accordingly, thirty-two fungal pure cultures were obtained from surface soil-biomass mixtures collected from Black Belt sites in Alabama by culturing on lignocellulosic biomass medium. The fungal strains were screened for the coproduction of cellulolytic and xylanolytic enzymes. Strains that displayed promising levels of cellulolytic and xylanolytic enzymes were characterized by molecular analysis of DNA sequences from the large subunit and internal transcribed spacer (ITS) of their ribosomal RNA gene. Nucleotide sequence analysis revealed that two most promising isolates FS22A and FS5A were most similar to Penicillium janthinellum and Trichoderma virens. Production dynamics of cellulolytic and xylanolytic enzymes from these two strains were explored in submerged fermentation. Volumetric productivity after 120 h incubation was 121.08 units/L/h and 348 units/L/h for the filter paper cellulase and xylanase of strain FS22A, and 90.83 units/L/h and 359 units/L/h, respectively for strain FS5A. Assays with 10 times dilution of enzymes revealed that the activities were much higher than that observed in the crude culture supernatant. Additionally, both FS22A and FS5A also produced amylase in lignocellulose medium. The enzyme profiles of these strains and their activities suggest potential applications in cost effective biomass conversion and biodegradation. PMID:25817459

  20. Evolution of High Cellulolytic Activity in Symbiotic Streptomyces through Selection of Expanded Gene Content and Coordinated Gene Expression.

    Science.gov (United States)

    Book, Adam J; Lewin, Gina R; McDonald, Bradon R; Takasuka, Taichi E; Wendt-Pienkowski, Evelyn; Doering, Drew T; Suh, Steven; Raffa, Kenneth F; Fox, Brian G; Currie, Cameron R

    2016-06-01

    The evolution of cellulose degradation was a defining event in the history of life. Without efficient decomposition and recycling, dead plant biomass would quickly accumulate and become inaccessible to terrestrial food webs and the global carbon cycle. On land, the primary drivers of plant biomass deconstruction are fungi and bacteria in the soil or associated with herbivorous eukaryotes. While the ecological importance of plant-decomposing microbes is well established, little is known about the distribution or evolution of cellulolytic activity in any bacterial genus. Here we show that in Streptomyces, a genus of Actinobacteria abundant in soil and symbiotic niches, the ability to rapidly degrade cellulose is largely restricted to two clades of host-associated strains and is not a conserved characteristic of the Streptomyces genus or host-associated strains. Our comparative genomics identify that while plant biomass degrading genes (CAZy) are widespread in Streptomyces, key enzyme families are enriched in highly cellulolytic strains. Transcriptomic analyses demonstrate that cellulolytic strains express a suite of multi-domain CAZy enzymes that are coregulated by the CebR transcriptional regulator. Using targeted gene deletions, we verify the importance of a highly expressed cellulase (GH6 family cellobiohydrolase) and the CebR transcriptional repressor to the cellulolytic phenotype. Evolutionary analyses identify complex genomic modifications that drive plant biomass deconstruction in Streptomyces, including acquisition and selective retention of CAZy genes and transcriptional regulators. Our results suggest that host-associated niches have selected some symbiotic Streptomyces for increased cellulose degrading activity and that symbiotic bacteria are a rich biochemical and enzymatic resource for biotechnology.

  1. Evolution of High Cellulolytic Activity in Symbiotic Streptomyces through Selection of Expanded Gene Content and Coordinated Gene Expression.

    Directory of Open Access Journals (Sweden)

    Adam J Book

    2016-06-01

    Full Text Available The evolution of cellulose degradation was a defining event in the history of life. Without efficient decomposition and recycling, dead plant biomass would quickly accumulate and become inaccessible to terrestrial food webs and the global carbon cycle. On land, the primary drivers of plant biomass deconstruction are fungi and bacteria in the soil or associated with herbivorous eukaryotes. While the ecological importance of plant-decomposing microbes is well established, little is known about the distribution or evolution of cellulolytic activity in any bacterial genus. Here we show that in Streptomyces, a genus of Actinobacteria abundant in soil and symbiotic niches, the ability to rapidly degrade cellulose is largely restricted to two clades of host-associated strains and is not a conserved characteristic of the Streptomyces genus or host-associated strains. Our comparative genomics identify that while plant biomass degrading genes (CAZy are widespread in Streptomyces, key enzyme families are enriched in highly cellulolytic strains. Transcriptomic analyses demonstrate that cellulolytic strains express a suite of multi-domain CAZy enzymes that are coregulated by the CebR transcriptional regulator. Using targeted gene deletions, we verify the importance of a highly expressed cellulase (GH6 family cellobiohydrolase and the CebR transcriptional repressor to the cellulolytic phenotype. Evolutionary analyses identify complex genomic modifications that drive plant biomass deconstruction in Streptomyces, including acquisition and selective retention of CAZy genes and transcriptional regulators. Our results suggest that host-associated niches have selected some symbiotic Streptomyces for increased cellulose degrading activity and that symbiotic bacteria are a rich biochemical and enzymatic resource for biotechnology.

  2. Pyrosequencing reveals high-temperature cellulolytic microbial consortia in Great Boiling Spring after in situ lignocellulose enrichment.

    Directory of Open Access Journals (Sweden)

    Joseph P Peacock

    Full Text Available To characterize high-temperature cellulolytic microbial communities, two lignocellulosic substrates, ammonia fiber-explosion-treated corn stover and aspen shavings, were incubated at average temperatures of 77 and 85°C in the sediment and water column of Great Boiling Spring, Nevada. Comparison of 109,941 quality-filtered 16S rRNA gene pyrosequences (pyrotags from eight enrichments to 37,057 quality-filtered pyrotags from corresponding natural samples revealed distinct enriched communities dominated by phylotypes related to cellulolytic and hemicellulolytic Thermotoga and Dictyoglomus, cellulolytic and sugar-fermenting Desulfurococcales, and sugar-fermenting and hydrogenotrophic Archaeoglobales. Minor enriched populations included close relatives of hydrogenotrophic Thermodesulfobacteria, the candidate bacterial phylum OP9, and candidate archaeal groups C2 and DHVE3. Enrichment temperature was the major factor influencing community composition, with a negative correlation between temperature and richness, followed by lignocellulosic substrate composition. This study establishes the importance of these groups in the natural degradation of lignocellulose at high temperatures and suggests that a substantial portion of the diversity of thermophiles contributing to consortial cellulolysis may be contained within lineages that have representatives in pure culture.

  3. Cellulosic Ethanol Production by Recombinant Cellulolytic Bacteria Harbouring pdc and adh II Genes of Zymomonas mobilis.

    Science.gov (United States)

    Piriya, P Sobana; Vasan, P Thirumalai; Padma, V S; Vidhyadevi, U; Archana, K; Vennison, S John

    2012-01-01

    The ethanol fermenting genes such as pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adh II) were cloned from Zymomonas mobilis and transformed into three different cellulolytic bacteria, namely Enterobacter cloacae JV, Proteus mirabilis JV and Erwinia chrysanthemi and their cellulosic ethanol production capability was studied. Recombinant E. cloacae JV was found to produce 4.5% and 3.5% (v/v) ethanol, respectively, when CMC and 4% NaOH pretreated bagasse were used as substrates, whereas recombinant P. mirabilis and E. chrysanthemi with the same substrates could only produce 4%, 3.5%, 1%, and 1.5 % of ethanol, respectively. The recombinant E. cloacae strain produced twofold higher percentage of ethanol than the wild type. The recombinant E. cloacae strain could be improved further by increasing its ethanol tolerance capability through media optimization and also by combining multigene cellulase expression for enhancing ethanol production from various types of lignocellulosic biomass so that it can be used for industrial level ethanol production.

  4. Streptomyces abietis sp. nov., a cellulolytic bacterium isolated from soil of a pine forest.

    Science.gov (United States)

    Fujii, Katsuhiko; Satomi, Masataka; Fukui, Youhei; Matsunobu, Shun; Morifuku, Youji; Enokida, Yuya

    2013-12-01

    Cellulolytic bacteria A191(T), A192 and A193 isolated from the soil of Sakhalin fir forest in Hokkaido, Japan were studied phenotypically, genotypically and phylogenetically. Analysis of their 16S rRNA gene and gyrB sequences and DNA base composition suggested that these isolates were conspecific and members of the genus Streptomyces. However, levels of 16S rRNA gene and gyrB sequence similarity between the isolates and the type strains of their closest relatives in the genus Streptomyces were no higher than 97.9 and 95.0 %, respectively, implying that these isolates were distinctive. Moreover, the results of DNA-DNA hybridization experiments and physiological characterization clearly differentiated these isolates from their closest neighbours. It is therefore concluded that these isolates represent a novel species of the genus Streptomyces, for which the name Streptomyces abietis is proposed. The type strain is A191(T) ( = NBRC 109094(T) = DSM 42080(T)). PMID:23990653

  5. Cellulosic Ethanol Production by Recombinant Cellulolytic Bacteria Harbouring pdc and adh II Genes of Zymomonas mobilis

    Directory of Open Access Journals (Sweden)

    P. Sobana Piriya

    2012-01-01

    Full Text Available The ethanol fermenting genes such as pyruvate decarboxylase (pdc and alcohol dehydrogenase II (adh II were cloned from Zymomonas mobilis and transformed into three different cellulolytic bacteria, namely Enterobacter cloacae JV, Proteus mirabilis JV and Erwinia chrysanthemi and their cellulosic ethanol production capability was studied. Recombinant E. cloacae JV was found to produce 4.5% and 3.5% (v/v ethanol, respectively, when CMC and 4% NaOH pretreated bagasse were used as substrates, whereas recombinant P. mirabilis and E. chrysanthemi with the same substrates could only produce 4%, 3.5%, 1%, and 1.5 % of ethanol, respectively. The recombinant E. cloacae strain produced twofold higher percentage of ethanol than the wild type. The recombinant E. cloacae strain could be improved further by increasing its ethanol tolerance capability through media optimization and also by combining multigene cellulase expression for enhancing ethanol production from various types of lignocellulosic biomass so that it can be used for industrial level ethanol production.

  6. Vertical zonation and seed germination indices of chromium resistant cellulolytic and nitrogen fixing bacteria from a chronically metal exposed land area

    International Nuclear Information System (INIS)

    Twenty eight cellulolytic and 25 nitrogen fixing bacteria were isolated from 20, 40 and 60 cm depths of the chromium contaminated land area. The cellulolytic as well as nitrogen fixing microbial communities in soil profiles were dominated by genus Bacillus. More diverse nitrogen fixing bacterial isolates belonging to different genera Paenibacillus, Corynebacterium and Pseudomonas were observed as compared to cellulolytic bacterial community. Majority of the cellulolytic bacteria were found inhabitants of 20 cm soil layer while 40 cm depth was the preferred zone for the nitrogen fixing bacteria. Screening of the bacterial isolates for chromium resistance showed that isolates designated as ASK15 and ASK16 were able to resist up to 1800 mg/l of chromium while the nitrogen fixing isolates which offered a maximum resistant level up to 1650 mg/l of chromium were ASNt10 and ASNS13. Nitrogen fixing isolates enhanced seed germination by 33% and expressed efficient nitrogenase activity up to 0.80 (C/sub 2/H/sub 2/ nmol/ml/hr). Growth promoting assay proved ASNt10 a potential isolate which produced 90 meu g/ml of indoleacetic acid (IAA). Though cellulolytic isolates did not affect seed germination, a significant influence on root length similar to that of ASNt10 and ASNS13 with nearly 5-fold increase in comparison with uninoculated control was observed. The isolates ASK15, ASK16 were identified as Bacillus cereus while ASNt10 and ASNS13 as Paenibacillus barcinonensis and Bacillus megaterium, respectively. (author)

  7. Microbial Consortium with High Cellulolytic Activity (MCHCA) for Enhanced Biogas Production.

    Science.gov (United States)

    Poszytek, Krzysztof; Ciezkowska, Martyna; Sklodowska, Aleksandra; Drewniak, Lukasz

    2016-01-01

    The use of lignocellulosic biomass as a substrate in agricultural biogas plants is very popular and yields good results. However, the efficiency of anaerobic digestion, and thus biogas production, is not always satisfactory due to the slow or incomplete degradation (hydrolysis) of plant matter. To enhance the solubilization of the lignocellulosic biomass various physical, chemical and biological pretreatment methods are used. The aim of this study was to select and characterize cellulose-degrading bacteria, and to construct a microbial consortium, dedicated for degradation of maize silage and enhancing biogas production from this substrate. Over 100 strains of cellulose-degrading bacteria were isolated from: sewage sludge, hydrolyzer from an agricultural biogas plant, cattle slurry and manure. After physiological characterization of the isolates, 16 strains (representatives of Bacillus, Providencia, and Ochrobactrum genera) were chosen for the construction of a Microbial Consortium with High Cellulolytic Activity, called MCHCA. The selected strains had a high endoglucanase activity (exceeding 0.21 IU/mL CMCase activity) and a wide range of tolerance to various physical and chemical conditions. Lab-scale simulation of biogas production using the selected strains for degradation of maize silage was carried out in a two-bioreactor system, similar to those used in agricultural biogas plants. The obtained results showed that the constructed MCHCA consortium is capable of efficient hydrolysis of maize silage, and increases biogas production by even 38%, depending on the inoculum used for methane fermentation. The results in this work indicate that the mesophilic MCHCA has a great potential for application on industrial scale in agricultural biogas plants.

  8. Microbial Consortium with High Cellulolytic Activity (MCHCA) for Enhanced Biogas Production.

    Science.gov (United States)

    Poszytek, Krzysztof; Ciezkowska, Martyna; Sklodowska, Aleksandra; Drewniak, Lukasz

    2016-01-01

    The use of lignocellulosic biomass as a substrate in agricultural biogas plants is very popular and yields good results. However, the efficiency of anaerobic digestion, and thus biogas production, is not always satisfactory due to the slow or incomplete degradation (hydrolysis) of plant matter. To enhance the solubilization of the lignocellulosic biomass various physical, chemical and biological pretreatment methods are used. The aim of this study was to select and characterize cellulose-degrading bacteria, and to construct a microbial consortium, dedicated for degradation of maize silage and enhancing biogas production from this substrate. Over 100 strains of cellulose-degrading bacteria were isolated from: sewage sludge, hydrolyzer from an agricultural biogas plant, cattle slurry and manure. After physiological characterization of the isolates, 16 strains (representatives of Bacillus, Providencia, and Ochrobactrum genera) were chosen for the construction of a Microbial Consortium with High Cellulolytic Activity, called MCHCA. The selected strains had a high endoglucanase activity (exceeding 0.21 IU/mL CMCase activity) and a wide range of tolerance to various physical and chemical conditions. Lab-scale simulation of biogas production using the selected strains for degradation of maize silage was carried out in a two-bioreactor system, similar to those used in agricultural biogas plants. The obtained results showed that the constructed MCHCA consortium is capable of efficient hydrolysis of maize silage, and increases biogas production by even 38%, depending on the inoculum used for methane fermentation. The results in this work indicate that the mesophilic MCHCA has a great potential for application on industrial scale in agricultural biogas plants. PMID:27014244

  9. The complete genome sequence of Fibrobacter succinogenes S85 reveals a cellulolytic and metabolic specialist.

    Directory of Open Access Journals (Sweden)

    Garret Suen

    Full Text Available Fibrobacter succinogenes is an important member of the rumen microbial community that converts plant biomass into nutrients usable by its host. This bacterium, which is also one of only two cultivated species in its phylum, is an efficient and prolific degrader of cellulose. Specifically, it has a particularly high activity against crystalline cellulose that requires close physical contact with this substrate. However, unlike other known cellulolytic microbes, it does not degrade cellulose using a cellulosome or by producing high extracellular titers of cellulase enzymes. To better understand the biology of F. succinogenes, we sequenced the genome of the type strain S85 to completion. A total of 3,085 open reading frames were predicted from its 3.84 Mbp genome. Analysis of sequences predicted to encode for carbohydrate-degrading enzymes revealed an unusually high number of genes that were classified into 49 different families of glycoside hydrolases, carbohydrate binding modules (CBMs, carbohydrate esterases, and polysaccharide lyases. Of the 31 identified cellulases, none contain CBMs in families 1, 2, and 3, typically associated with crystalline cellulose degradation. Polysaccharide hydrolysis and utilization assays showed that F. succinogenes was able to hydrolyze a number of polysaccharides, but could only utilize the hydrolytic products of cellulose. This suggests that F. succinogenes uses its array of hemicellulose-degrading enzymes to remove hemicelluloses to gain access to cellulose. This is reflected in its genome, as F. succinogenes lacks many of the genes necessary to transport and metabolize the hydrolytic products of non-cellulose polysaccharides. The F. succinogenes genome reveals a bacterium that specializes in cellulose as its sole energy source, and provides insight into a novel strategy for cellulose degradation.

  10. Interactions between Cellulolytic Enzymes with Native, Autohydrolysis, and Technical Lignins and the Effect of a Polysorbate Amphiphile in Reducing Nonproductive Binding.

    Science.gov (United States)

    Fritz, Consuelo; Ferrer, Ana; Salas, Carlos; Jameel, Hasan; Rojas, Orlando J

    2015-12-14

    Understanding enzyme-substrate interactions is critical in designing strategies for bioconversion of lignocellulosic biomass. In this study we monitored molecular events, in situ and in real time, including the adsorption and desorption of cellulolytic enzymes on lignins and cellulose, by using quartz crystal microgravimetry and surface plasmon resonance. The effect of a nonionic surface active molecule was also elucidated. Three lignin substrates relevant to the sugar platform in biorefinery efforts were considered, namely, hardwood autohydrolysis cellulolytic (HWAH), hardwood native cellulolytic (MPCEL), and nonwood native cellulolytic (WSCEL) lignin. In addition, Kraft lignins derived from softwoods (SWK) and hardwoods (HWK) were used as references. The results indicated a high affinity between the lignins with both, monocomponent and multicomponent enzymes. More importantly, the addition of nonionic surfactants at concentrations above their critical micelle concentration reduced remarkably (by over 90%) the nonproductive interactions between the cellulolytic enzymes and the lignins. This effect was hypothesized to be a consequence of the balance of hydrophobic and hydrogen bonding interactions. Moreover, the reduction of surface roughness and increased wettability of lignin surfaces upon surfactant treatment contributed to a lower affinity with the enzymes. Conformational changes of cellulases were observed upon their adsorption on lignin carrying preadsorbed surfactant. Weak electrostatic interactions were determined in aqueous media at pH between 4.8 and 5.5 for the native cellulolytic lignins (MPCEL and WSCEL), whereby a ∼20% reduction in the enzyme affinity was observed. This was mainly explained by electrostatic interactions (osmotic pressure effects) between charged lignins and cellulases. Noteworthy, adsorption of nonionic surfactants onto cellulose, in the form cellulose nanofibrils, did not affect its hydrolytic conversion. Overall, our results

  11. Temporal variations in microbial biomass C and cellulolytic enzyme activity in arable soils: effects of organic matter input

    DEFF Research Database (Denmark)

    Debosz, K.; Rasmussen, Peter Have; Pedersen, A. R.

    1999-01-01

    -OM). The cultivation systems differed in whether their source of fertiliser was mainly mineral or organic, in whether a winter cover crop was grown, and whether straw was mulched or removed. Sampling occurred at approximately monthly intervals, over a period of two years. Distinct temporal variations in microbial...... biomass C concentration and activity of extracellular enzymes of the cellulolytic complex were observed. The temporal pattern was generally similar in the low-OM and high-OM cultivation systems. Temporal variations may have been driven by environmental factors (e.g., temperature and moisture) and crop...

  12. A 24.7-kDa copper-containing oxidase, secreted by Thermobifida fusca, significantly increasing the xylanase/cellulase-catalyzed hydrolysis of sugarcane bagasse.

    Science.gov (United States)

    Chen, Cheng-Yu; Hsieh, Zhi-Shen; Cheepudom, Jatuporn; Yang, Chao-Hsun; Meng, Menghsiao

    2013-10-01

    Thermobifida fusca is a moderately thermophilic soil bacterium belonging to Actinobacteria. It has been known for its capability to degrade plant cell wall polymers except lignin and pectin. To know whether it can produce enzymes to facilitate lignin degradation, the extracellular proteins bound to sugarcane bagasse were harvested and identified by liquid chromatography tandem mass spectrometry. Among the identified proteins, a putative copper-containing polyphenol oxidase of 241 amino acids, encoded by the locus Tfu_1114, was thought to presumably play a role in lignin degradation. This protein (Tfu1114) was thus expressed in E. coli and characterized. Similarly to common laccases, Tfu1114 is able to catalyze the oxidation reaction of phenolic and nonphenolic lignin related compounds such as 2,6-dimethoxyphenol and veratryl alcohol. More interestingly, it can significantly enhance the enzymatic hydrolysis of bagasse by xylanase and cellulase. Tfu1114 is stable against heat, with a half-life of 4.7 h at 90 °C, and organic solvents. It is sensitive to ethylenediaminetetraacetic acid and reducing agents but resistant to sodium azide, a potent inhibitor of laccases. Atomic absorption spectroscopy indicated that the ratio of copper to the protein monomer is 1, instead of 4, a feature of classical laccases. All these data suggest that Tfu1114 is a novel oxidase with laccase-like activity, potentially useful in biotechnology application. PMID:23377789

  13. Investigations on the feeding habits of the rocky-shore mite Hyadesia fusca (Acari: Astigmata: Hyadesiidae): diet range, food preference, food quality, and the implications for distribution patterns

    Science.gov (United States)

    Bücking, Jens

    1998-06-01

    Within the food web of estuarine and marine rocky shore ecosystems phytophagous mites of terrestrial and marine origin constitute an important part as grazers on algae and as a food source for certain arthropods, especially zoophagous mites. This investigation deals with the feeding biology of Hyadesia fusca taking as an example a population located on an artificial rocky shore of the middle Weser estuary in Northern Germany. The species is characterized by a broad diet range; in feeding experiments diatoms, lichens, detritus as well as blue, red and green algae were accepted. Even analyses of faecal pellets produced by field specimen suggest a non-specific feeding habit. However, the influence of certain diets on mortality, offspring number and rearing success showed that the food quality differs significantly. The most suitable food, the Ulvaceae Blidingia, was clearly preferred in a series of pairwise choice tests. These findings correlate with the vertical zonation of the field population i.e.: higher population densities in the vegetation zone dominated by Blidingia. It can be concluded that in addition to abiotic factors food supply could play an important role for distribution patterns of phytophagous mites.

  14. Characterization of cellulolytic enzymes and bioH2 production from anaerobic thermophilic Clostridium sp. TCW1.

    Science.gov (United States)

    Lo, Yung-Chung; Huang, Chi-Yu; Cheng, Chieh-Lun; Lin, Chiu-Yue; Chang, Jo-Shu

    2011-09-01

    A thermophilic anaerobic bacterium Clostridium sp. TCW1 was isolated from dairy cow dung and was used to produce hydrogen from cellulosic feedstock. Extracellular cellulolytic enzymes produced from TCW1 strain were identified as endoglucanases (45, 53 and 70 kDa), exoglucanase (70 kDa), xylanases (53 and 60 kDa), and β-glucosidase (45 kDa). The endoglucanase and xylanase were more abundant. The optimal conditions for H2 production and enzyme production of the TCW1 strain were the same (60 °C, initial pH 7, agitation rate of 200 rpm). Ten cellulosic feedstock, including pure or natural cellulosic materials, were used as feedstock for hydrogen production by Clostridium strain TCW1 under optimal culture conditions. Using filter paper at 5.0 g/L resulted in the most effective hydrogen production performance, achieving a H2 production rate and yield of 57.7 ml/h/L and 2.03 mol H2/mol hexose, respectively. Production of cellulolytic enzyme activities was positively correlated with the efficiency of dark-H2 fermentation.

  15. Comparative genotyping of Clostridium thermocellum strains isolated from biogas plants: genetic markers and characterization of cellulolytic potential.

    Science.gov (United States)

    Koeck, Daniela E; Zverlov, Vladimir V; Liebl, Wolfgang; Schwarz, Wolfgang H

    2014-07-01

    Clostridium thermocellum is among the most prevalent of known anaerobic cellulolytic bacteria. In this study, genetic and phenotypic variations among C. thermocellum strains isolated from different biogas plants were determined and different genotyping methods were evaluated on these isolates. At least two C. thermocellum strains were isolated independently from each of nine different biogas plants via enrichment on cellulose. Various DNA-based genotyping methods such as ribotyping, RAPD (Random Amplified Polymorphic DNA) and VNTR (Variable Number of Tandem Repeats) were applied to these isolates. One novel approach - the amplification of unknown target sequences between copies of a previously discovered Random Inserted Mobile Element (RIME) - was also tested. The genotyping method with the highest discriminatory power was found to be the amplification of the sequences between the insertion elements, where isolates from each biogas plant yielded a different band pattern. Cellulolytic potentials, optimal growth conditions and substrate spectra of all isolates were characterized to help identify phenotypic variations. Irrespective of the genotyping method used, the isolates from each individual biogas plant always exhibited identical patterns. This is suggestive of a single C. thermocellum strain exhibiting dominance in each biogas plant. The genotypic groups reflect the results of the physiological characterization of the isolates like substrate diversity and cellulase activity. Conversely, strains isolated across a range of biogas plants differed in their genotyping results and physiological properties. Both strains isolated from one biogas plant had the best specific cellulose-degrading properties and might therefore achieve superior substrate utilization yields in biogas fermenters.

  16. RICHNESS, CELLULOLYTIC ACTIVITY, AND FUNGICIDE SUSCEPTIBILITY OF FUNGI FROM A BIRD BIOLOGICAL COLLECTION

    Directory of Open Access Journals (Sweden)

    Henry Arenas-Castro

    2015-11-01

    Full Text Available ABSTRACTBiological collections in natural history museums serve important purposes to the scientific community and the general public, however, their value and utility might be diminished by biodeterioration. We studied a biological collection that represents more than sixty years of avifauna sampling of Colombia, the country with the highest bird diversity. An initial inspection of the collection showed that the general appearance of some specimens was compromised by mold-like growth on their surfaces. We aimed at (i identifying the taxonomic affiliation of these fungi, (ii evaluating their cellulolytic activity, and (iii probing chemical agents that could be utilized to control their growth. The most common fungi genera were Aspergillus, Penicillium, Chaetomium, and Trichophyton, most of which can degrade cellulose. Zinc chloride and salicylic acid showed to be effective fungicides. Based on this, we propose some actions to control the fungi-pest in this biological collection of birds.RESUMENLas colecciones biológicas en los museos de historia natural juegan un papel importante tanto para la comunidad científica como para el público en general. Sin embargo, su valor y utilidad pueden verse afectados por la biodeterioración de sus ejemplares. Se estudio una colección biológica de aves que representa más de sesenta años de esfuerzo de muestreo de la avifauna del país más rico en aves. Una inspección inicial mostró que la apariencia general de algunos de los especímenes de la colección se encontraba afectada por hongos. Los objetivos de este estudio fueron (i identificar la afiliación taxonómica de los hongos, (ii determinar la actividad celulolítica y (iii probar agentes químicos que puedan ser utilizados para controlar su desarrollo. Los géneros de hongos más comunes fueron Aspergillus, Penicillium, Chaetomium y Trichophyton, de los cuales la mayoría presentan la capacidad de degradar celulosa. Adicionalmente, el cloruro de

  17. Identification and molecular modeling of a family 5 endocellulase from Thermus caldophilus GK24, a cellulolytic strain of Thermus thermophilus

    Directory of Open Access Journals (Sweden)

    Dae-Sil Lee

    2006-12-01

    Full Text Available The genome of T. caldophilus GK24 was recently sequenced and annotated as 14contigs, equivalent to 2.3 mega basepairs (Mbp of DNA. In the current study, we identifieda unique 13.7 kbp DNA sequence, which included the endocellulase gene of T. caldophilusGK24, which did not appear to be present in the complete genomic sequence of the closelyrelated species T. thermophilus HB27 and HB8. Congo-red staining revealed a uniquephenotype of cellulose degradation by strain GK24 that was distinct from other closelyrelated Thermus strains. The results showed that strain GK24 is an aerobic, thermophilic,cellulolytic eubacterium which belongs to the group T. thermophilus. In order to understandthe mechanism of production of cellobiose in T. caldophilus GK24, a three-dimensionalmodel of the endocellulase, TcCel5A, was generated based on known crystal structures.Using this model, we carried out a flexible cellotetraose docking study.

  18. Enhanced cell-surface display and secretory production of cellulolytic enzymes with Saccharomyces cerevisiae Sed1 signal peptide.

    Science.gov (United States)

    Inokuma, Kentaro; Bamba, Takahiro; Ishii, Jun; Ito, Yoichiro; Hasunuma, Tomohisa; Kondo, Akihiko

    2016-11-01

    Recombinant yeast strains displaying aheterologous cellulolytic enzymes on their cell surfaces using a glycosylphosphatidylinositol (GPI) anchoring system are a promising strategy for bioethanol production from lignocellulosic materials. A crucial step for cell wall localization of the enzymes is the intracellular transport of proteins in yeast cells. Therefore, the addition of a highly efficient secretion signal sequence is important to increase the amount of the enzymes on the yeast cell surface. In this study, we demonstrated the effectiveness of a novel signal peptide (SP) sequence derived from the Saccharomyces cerevisiae SED1 gene for cell-surface display and secretory production of cellulolytic enzymes. Gene cassettes with SP sequences derived from S. cerevisiae SED1 (SED1SP), Rhizopus oryzae glucoamylase (GLUASP), and S. cerevisiae α-mating pheromone (MFα1SP) were constructed for cell-surface display of Aspergillus aculeatus β-glucosidase (BGL1) and Trichoderma reesei endoglucanase II (EGII). These gene cassettes were integrated into the S. cerevisiae genome. The recombinant strains with the SED1SP showed higher cell-surface BGL and EG activities than those with the conventional SP sequences (GLUASP and MFα1SP). The novel SP sequence also improved the secretory production of BGL and EG in S. cerevisiae. The extracellular BGL activity of the recombinant strains with the SED1SP was 1.3- and 1.9-fold higher than the GLUASP and MFα1SP strains, respectively. Moreover, the utilization of SED1SP successfully enhanced the secretory production of BGL in Pichia pastoris. The utilization of the novel SP sequence is a promising option for highly efficient cell-surface display and secretory production of heterologous proteins in various yeast species. Biotechnol. Bioeng. 2016;113: 2358-2366. © 2016 Wiley Periodicals, Inc. PMID:27183011

  19. Structural insights into cellulolytic and chitinolytic enzymes revealing crucial residues of insect β-N-acetyl-D-hexosaminidase.

    Directory of Open Access Journals (Sweden)

    Tian Liu

    Full Text Available The chemical similarity of cellulose and chitin supports the idea that their corresponding hydrolytic enzymes would bind β-1,4-linked glucose residues in a similar manner. A structural and mutational analysis was performed for the plant cellulolytic enzyme BGlu1 from Oryza sativa and the insect chitinolytic enzyme OfHex1 from Ostrinia furnacalis. Although BGlu1 shows little amino-acid sequence or topological similarity with OfHex1, three residues (Trp(490, Glu(328, Val(327 in OfHex1, and Trp(358, Tyr(131 and Ile(179 in BGlu1 were identified as being conserved in the +1 sugar binding site. OfHex1 Glu(328 together with Trp(490 was confirmed to be necessary for substrate binding. The mutant E328A exhibited a 8-fold increment in K(m for (GlcNAc(2 and a 42-fold increment in K(i for TMG-chitotriomycin. A crystal structure of E328A in complex with TMG-chitotriomycin was resolved at 2.5 Å, revealing the obvious conformational changes of the catalytic residues (Glu(368 and Asp(367 and the absence of the hydrogen bond between E328A and the C3-OH of the +1 sugar. V327G exhibited the same activity as the wild-type, but acquired the ability to efficiently hydrolyse β-1,2-linked GlcNAc in contrast to the wild-type. Thus, Glu(328 and Val(327 were identified as important for substrate-binding and as glycosidic-bond determinants. A structure-based sequence alignment confirmed the spatial conservation of these three residues in most plant cellulolytic, insect and bacterial chitinolytic enzymes.

  20. Engineering cellulase mixtures by varying the mole fraction of Thermomonospora fusca E[sub 5] and E[sub 3], Trichoderma reesei CBHI, and Caldocellum saccharolyticum [beta]-glucosidase

    Energy Technology Data Exchange (ETDEWEB)

    Walker, L.P.; Belair, C.D.; Wilson, D.B.; Irwin, D.C. (Cornell Univ., Ithaca, NY (United States))

    1993-11-05

    In this study, different mole fractions of pure Thermomonospora fusca E[sub 5] and E[sub 3], plus Trichoderma reesei CBHI were studied for reducing sugar production at 2 h, degree of synergism, and cellulose binding. In addition, the effects of introducing the Caldocellum saccharolyticum [Beta]-glucosidase into this cellulase system were investigated. The cellulases used were purified to homogeneity. Avicel PH 102 was the substrate. Reactions were run at 50 C for 2 h using total cellulase concentrations of 8.3 or 12.2 [mu]M. A bimixture of T. fusca E[sub 3] and T. reesei CBHI was very effective in hydrolyzing microcrystalline cellulose. The addition of endoglucanase E[sub 5] to the mixture only increased conversion to 9.8%. However, when both E[sub 5] and [Beta]-glucosidase were added, conversion increased to 14%. It was also observed that increasing total cellulase concentration beyond 8.3 [mu]M did little to increase percent conversion of cellulose into glucose. The results of the binding studies indicate no competition for binding sites between the endo- and exocellulases.

  1. Effect of Feeding Palm Oil By-Products Based Diets on Total Bacteria, Cellulolytic Bacteria and Methanogenic Archaea in the Rumen of Goats

    OpenAIRE

    Abubakr, Abdelrahim; Alimon, Abdul Razak; Yaakub, Halimatun; Abdullah, Norhani; Ivan, Michael

    2014-01-01

    Rumen microorganisms are responsible for digestion and utilization of dietary feeds by host ruminants. Unconventional feed resources could be used as alternatives in tropical areas where feed resources are insufficient in terms of quality and quantity. The objective of the present experiment was to evaluate the effect of diets based on palm oil (PO), decanter cake (DC) or palm kernel cake (PKC) on rumen total bacteria, selected cellulolytic bacteria, and methanogenic archaea. Four diets: cont...

  2. Dominant ectosymbiotic bacteria of cellulolytic protists in the termite gut also have the potential to digest lignocellulose.

    Science.gov (United States)

    Yuki, Masahiro; Kuwahara, Hirokazu; Shintani, Masaki; Izawa, Kazuki; Sato, Tomoyuki; Starns, David; Hongoh, Yuichi; Ohkuma, Moriya

    2015-12-01

    Wood-feeding lower termites harbour symbiotic gut protists that support the termite nutritionally by degrading recalcitrant lignocellulose. These protists themselves host specific endo- and ectosymbiotic bacteria, functions of which remain largely unknown. Here, we present draft genomes of a dominant, uncultured ectosymbiont belonging to the order Bacteroidales, 'Candidatus Symbiothrix dinenymphae', which colonizes the cell surface of the cellulolytic gut protists Dinenympha spp. We analysed four single-cell genomes of Ca. S. dinenymphae, the highest genome completeness was estimated to be 81.6-82.3% with a predicted genome size of 4.28-4.31 Mb. The genome retains genes encoding large parts of the amino acid, cofactor and nucleotide biosynthetic pathways. In addition, the genome contains genes encoding various glycoside hydrolases such as endoglucanases and hemicellulases. The genome indicates that Ca. S. dinenymphae ferments lignocellulose-derived monosaccharides to acetate, a major carbon and energy source of the host termite. We suggest that the ectosymbiont digests lignocellulose and provides nutrients to the host termites, and hypothesize that the hydrolytic activity might also function as a pretreatment for the host protist to effectively decompose the crystalline cellulose components. PMID:26079531

  3. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen.

    Science.gov (United States)

    Denman, Stuart E; McSweeney, Christopher S

    2006-12-01

    Traditional methods for enumerating and identifying microbial populations within the rumen can be time consuming and cumbersome. Methods that involve culturing and microscopy can also be inconclusive, particularly when studying anaerobic rumen fungi. A real-time PCR SYBR Green assay, using PCR primers to target total rumen fungi and the cellulolytic bacteria Ruminococcus flavefaciens and Fibrobacter succinogenes, is described, including design and validation. The DNA and crude protein contents with respect to the fungal biomass of both polycentric and monocentric fungal isolates were investigated across the fungal growth stages to aid in standard curve generation. The primer sets used were found to be target specific with no detectable cross-reactivity. Subsequently, the real-time PCR assay was employed in a study to detect these populations within cattle rumen. The anaerobic fungal target was observed to increase 3.6-fold from 0 to 12 h after feeding. The results also indicated a 5.4-fold increase in F. succinogenes target between 0 and 12 h after feeding, whereas R. flavefaciens was observed to maintain more or less consistent levels. This is the first report of a real-time PCR assay to estimate the rumen anaerobic fungal population. PMID:17117998

  4. ISOLATION AND PHYSICO-CHEMICAL CHARACTERIZATION OF EXTRACELLULAR LIGNO-CELLULOLYTIC ENZYMES OF PLEUROTUS PULMONARIUS IN SUBMERGED FERMENTATION

    Directory of Open Access Journals (Sweden)

    Nirmalendu Das

    2015-07-01

    Full Text Available Pleurotus pulmonarius, a member of oyster mushroom can produced lignocellulosic enzymes laccase, peroxidise and cellulase in liquid potato-dextrose medium in submerged stationary condition. The lignocellulolytic activities were assayed using the extracellular culture filtrate which was partially purified using 0- 80% ammonium sulphate saturation. Different physico-chemical studies were performed using the partially purified culture filtrate. The fungus produced more laccase and peroxidase than the cellulase. The optimum laccase production was found on 17th day whereas cellulase & peroxidase productions were found on 9th& 10th day, respectively. Km of laccase is 4.1mM against guaiacol and 1.25 mM against o-dianisidine whereas Km of peroxidase was 0.72mM and cellulase was 0.06 mM. Optimum pH of laccase was 6.0 but for peroxidase and cellulase it was 7.0. The temperature optima of cellulase (50?C was more than laccase (40?C and peroxidase (30?C. All the lignocellulosic enzymes showed a wide range of temperature and pH stabilities. Laccase and peroxidase were fully inhibited by NaCl but it was not so effective against cellulase. P. pulmonarius showed higher ligninolytic (Laccase and peroxidase activity than cellulolytic (cellulase activity. The lignocellulosic enzymes isolated from submerged fermentation of P. pulmonarius might be industrially significant as they showed a wide range of temperature and pH stabilities.

  5. Caldicellulosiruptor obsidiansis sp. nov., an anaerobic, extremely thermophilic, cellulolytic bacterium isolated from Obsidian Pool, Yellowstone National Park

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton-Brehm, Scott [ORNL; Elkins, James G [ORNL; Phelps, Tommy Joe [ORNL; Keller, Martin [ORNL; Carroll, Sue L [ORNL; Allman, Steve L [ORNL; Podar, Mircea [ORNL; Mosher, Jennifer J [ORNL; Vishnivetskaya, Tatiana A [ORNL

    2010-01-01

    A novel, obligately anaerobic, extremely thermophilic, cellulolytic bacterium, designated OB47T, was isolated from Obsidian Pool, Yellowstone National Park, WY, USA. The isolate was a non-motile, non-spore forming, Gram-positive rod approximately 2 m long by 0.2 m wide and grew at temperatures between 55-85oC with the optimum at 78oC. The pH range for growth was 6.0-8.0 with values of near 7.0 being optimal. Growth on cellobiose produced the fastest specific growth rates at 0.75 hr-1. The organism also displayed fermentative growth on glucose, maltose, arabinose, fructose, starch, lactose, mannose, sucrose, galactose, xylose, arabinogalactan, Avicel, xylan, filter paper, processed cardboard, pectin, dilute acid-pretreated switchgrass and Populus. OB47T was unable to grow on mannitol, fucose, lignin, Gelrite, acetate, glycerol, ribose, sorbital, carboxymethylcellulose and casein. Yeast extract stimulated growth and thiosulfate, sulfate, nitrate, and sulfur were not reduced. Fermentation end products were mainly acetate, H2, and CO2 although lactate and ethanol were produced in 5 l batch fermentations. The G+C content of the DNA was 35 mol% and sequence analysis of the small subunit ribosomal RNA gene placed OB47T within the genus Caldicellulosiruptor. Based on its phylogenetic and phenotypic properties, the isolate is proposed to be designated Caldicellulosiruptor obsidiansis sp. nov. and OB47T is the type stain (ATCC = ____, JCM = ____).

  6. Complete genome of the cellulolytic thermophile Acidothermus cellulolyticus 11B provides insights into its ecophysiological and evolutionary adaptations

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Gary [Los Alamos National Laboratory; Detter, Chris [Los Alamos National Laboratory; Bruce, David [Los Alamos National Laboratory; Challacome, Jean F [Los Alamos National Laboratory; Brettin, Thomas S [Los Alamos National Laboratory; Barabote, Ravi D [UC DAVIS; Leu, David [UC DAVIS; Normand, Philippe [CNRS, UNIV LYON; Necsula, Anamaria [CNRS, UNIV LYON; Daubin, Vincent [CNRS, UNIV LYON; Medigue, Claudine [CNRS/GENOSCOPE; Adney, William S [NREL; Xu, Xin C [UC DAVIS; Lapidus, Alla [DOE JOINT GENOME INST.; Pujic, Pierre [CNRS, UNIV LYON; Richardson, Paul [DOE JOINT GENOME INST; Berry, Alison M [UC DAVIS

    2008-01-01

    We present here the complete 2.4 MB genome of the actinobacterial thermophile, Acidothermus cellulolyticus lIB, that surprisingly reveals thermophilic amino acid usage in only the cytosolic subproteome rather than its whole proteome. Thermophilic amino acid usage in the partial proteome implies a recent, ongoing evolution of the A. cellulolyticus genome since its divergence about 200-250 million years ago from its closest phylogenetic neighbor Frankia, a mesophilic plant symbiont. Differential amino acid usage in the predicted subproteomes of A. cellulolyticus likely reflects a stepwise evolutionary process of modern thermophiles in general. An unusual occurrence of higher G+C in the non-coding DNA than in the transcribed genome reinforces a late evolution from a higher G+C common ancestor. Comparative analyses of the A. cellulolyticus genome with those of Frankia and other closely-related actinobacteria revealed that A. cellulolyticus genes exhibit reciprocal purine preferences at the first and third codon positions, perhaps reflecting a subtle preference for the dinucleotide AG in its mRNAs, a possible adaptation to a thermophilic environment. Other interesting features in the genome of this cellulolytic, hot-springs dwelling prokaryote reveal streamlining for adaptation to its specialized ecological niche. These include a low occurrence of pseudogenes or mobile genetic elements, a flagellar gene complement previously unknown in this organism, and presence of laterally-acquired genomic islands of likely ecophysiological value. New glycoside hydrolases relevant for lignocellulosic biomass deconstruction were identified in the genome, indicating a diverse biomass-degrading enzyme repertoire several-fold greater than previously characterized, and significantly elevating the industrial value of this organism.

  7. Complete genome of the cellulolytic thermophile Acidothermus cellulolyticus 11B provides insights into its ecophysiological and evolutionary adaptations

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Gary [Los Alamos National Laboratory; Detter, John C [Los Alamos National Laboratory; Bruce, David C [Los Alamos National Laboratory; Challacombe, Jean F [Los Alamos National Laboratory; Brettin, Thomas S [Los Alamos National Laboratory; Necsulea, Anamaria [UNIV LYON; Daubin, Vincent [UNIV LYON; Medigue, Claudine [GENOSCOPE; Adney, William S [NREL; Xu, Xin C [UC DAVIS; Lapidus, Alla [JGI; Pujic, Pierre [UNIV LYON; Berry, Alison M [UC DAVIS; Barabote, Ravi D [UC DAVIS; Leu, David [UC DAVIS; Normand, Phillipe [UNIV LYON

    2009-01-01

    We present here the complete 2.4 MB genome of the actinobacterial thermophile, Acidothermus cellulolyticus 11B, that surprisingly reveals thermophilic amino acid usage in only the cytosolic subproteome rather than its whole proteome. Thermophilic amino acid usage in the partial proteome implies a recent, ongoing evolution of the A. cellulolyticus genome since its divergence about 200-250 million years ago from its closest phylogenetic neighbor Frankia, a mesophilic plant symbiont. Differential amino acid usage in the predicted subproteomes of A. cellulolyticus likely reflects a stepwise evolutionary process of modern thermophiles in general. An unusual occurrence of higher G+C in the non-coding DNA than in the transcribed genome reinforces a late evolution from a higher G+C common ancestor. Comparative analyses of the A. cellulolyticus genome with those of Frankia and other closely-related actinobacteria revealed that A. cellulolyticus genes exhibit reciprocal purine preferences at the first and third codon positions, perhaps reflecting a subtle preference for the dinucleotide AG in its mRNAs, a possible adaptation to a thermophilic environment. Other interesting features in the genome of this cellulolytic, hot-springs dwelling prokaryote reveal streamlining for adaptation to its specialized ecological niche. These include a low occurrence of pseudo genes or mobile genetic elements, a flagellar gene complement previously unknown in this organism, and presence of laterally-acquired genomic islands of likely ecophysiological value. New glycoside hydrolases relevant for lignocellulosic biomass deconstruction were identified in the genome, indicating a diverse biomass-degrading enzyme repertoire several-fold greater than previously characterized, and significantly elevating the industrial value of this organism.

  8. Enzymatic activity of the cellulolytic complex produced by Trichoderma reesei. Enzymatic hydrolysis of cellulose; Actividad enzimatica del complejo celulolitico producido por Trichoderma reesei. Hidrolisis enzimatica de la celulosa

    Energy Technology Data Exchange (ETDEWEB)

    Alfonsel, M.; Negro, M. J.; Saez, R.; Martin, C.

    1986-07-01

    The enzymatic activity characterization of the cellulolytic complex obtained from Trichoderma reesei QM 9414 and the influence of the enzymatic hydrolysis conditions on the hydrolysis yield are studied. Pure cellulose and native or alkali pretreated biomass Onopordum nervosum have been used as substrates. The values of pH, temperature, substrate concentration and enzyme-substrate ratio for the optimum activity of that complex, evaluated as glucose and reducing sugars production, have been selected. Previous studies on enzymatic hydrolysis of 0. nervosum have shown a remarkable effect of the alkaline pretreatments on the final hydrolysis yield. (Author) 10 refs.

  9. Influence of an aerobic fungus grown on solid culture on ruminal degradability and on a mixture culture of anaerobic cellulolytic bacteria.

    Science.gov (United States)

    Hernández-Díaz, R; Pimentel-González, D J; Figueira, A C; Viniegra-González, G; Campos-Montiel, R G

    2010-06-01

    In this work, the effect of a solid fungal culture of Aspergillus niger (An) grown on coffee pulp on the in situ ruminal degradability (RD) of corn stover was evaluated. In addition, the effect of its extracts on the in vitro dry matter disappearance (IVDMD) and on a mixed culture of anaerobic cellulolytic bacteria (MCACB) was also investigated. The solid ferment was a crude culture of An, grown on coffee pulp. Regarding in situ RD, a significant difference (p < 0.05) was found between treatment with 200 g/day of the solid culture and control (no solid culture added) on dry matter, crude protein and neutral detergent fibre on RD. All the water extracts (pH 4, 7 and 10) enhanced IVDMD and stimulated the cellulolytic activity on a MCACB. Ultrafiltration results showed that active compounds with a molecular weight lower than 30 kDa were responsible for the effect on MCACB. Such results suggest that the effects of the solid An culture in RD are related to the presence of water soluble compounds having a molecular weight lower than 30 kDa.

  10. Production and assay of cellulolytic enzyme activity of Enterobacter cloacae WPL 214 isolated from bovine rumen fluid waste of Surabaya abbatoir, Indonesia

    Directory of Open Access Journals (Sweden)

    W. P. Lokapirnasari

    2015-03-01

    Full Text Available Aim: This study aims to produce and assay cellulolytic enzyme activity (endo-(1,4-β-D-glucanase, exo-(1,4-β-Dglucanase, and β-glucosidase, at optimum temperature and optimum pH of Enterobacter cloacae WPL 214 isolated from bovine rumen fluid waste of Surabaya Abbatoir, Indonesia. Materials and Methods: To produce enzyme from a single colony of E. cloacae WPL 214, 98 × 1010 CFU/ml of isolates was put into 20 ml of liquid medium and incubated in a shaker incubator for 16 h at 35°C in accordance with growth time and optimum temperature of E. cloacae WPL 214. Further on, culture was centrifuged at 6000 rpm at 4°C for 15 min. Pellet was discarded while supernatant containing cellulose enzyme activity was withdrawn to assay endo-(1,4-β-D-glucanase, exo-(1,4-β-D-glucanase, and β-glucosidase. Results: Cellulase enzyme of E. cloacae WPL 214 isolates had endoglucanase activity of 0.09 U/ml, exoglucanase of 0.13 U/ml, and cellobiase of 0.10 U/ml at optimum temperature 35°C and optimum pH 5. Conclusion: E. cloacae WPL 214 isolated from bovine rumen fluid waste produced cellulose enzyme with activity as cellulolytic enzyme of endo-(1,4-β-D-glucanase, exo-(1,4-β-D-glucanase and β-glucosidase.

  11. A semi-continuous culture system for production of cellulolytic and xylanolytic enzymes by the anaerobic fungus Piromyces sp. strain E2

    Energy Technology Data Exchange (ETDEWEB)

    Teunissen, M.J.; Baerends, R.J.S.; Knelissen, R.A.G.; Camp, H.J.M. op den; Vogels, G.D. (Katholieke Univ., Nijmegen (Netherlands). Dept. of Microbiology)

    1992-10-01

    A system was developed for the semi-continous cultivation of an anaerobic fungus, Piromyces sp. strain E2 (isolated from an Indian elephant), on Avicel (microcrystalline cellulose). The fungus was grown in a semi-continuous culture system: Solids and fungal biomass was retained by means of a simple filter construction whereas the culture fluid was removed continuously. The production of fermentation products (acetate, ethanol, formate, lactate, hydrogen or methane), cellulolytic and xylanolytic enzymes, and protein by the fungus in monoculture or co-culture with Methanobacterium formicicum during growth on Avicel was monitored up to 45 days. These productions stabilized after an adaptation period of 24 and 30 days in the semi-continuous co-culture and monoculture, respectively. After this period the average ([+-]SD) avicelase, [beta]-glucosidase, endoglucanase, and xylanase production in the semicontinuous monoculture were 27[+-]6, 140[+-]16, 1057[+-]120 and 5012[+-]583 IUxl[sup -1]xday[sup -1], respectively. Co-culture with the methanogen caused a shift in fermentation products to more acetate, and less ethanol and lactate. Furthermore, the production of all cellulolytic enzymes increased (40%) and xylanolytic enzyme production decreased (35%). (orig.).

  12. Effect of feeding palm oil by-products based diets on total bacteria, cellulolytic bacteria and methanogenic archaea in the rumen of goats.

    Directory of Open Access Journals (Sweden)

    Abdelrahim Abubakr

    Full Text Available Rumen microorganisms are responsible for digestion and utilization of dietary feeds by host ruminants. Unconventional feed resources could be used as alternatives in tropical areas where feed resources are insufficient in terms of quality and quantity. The objective of the present experiment was to evaluate the effect of diets based on palm oil (PO, decanter cake (DC or palm kernel cake (PKC on rumen total bacteria, selected cellulolytic bacteria, and methanogenic archaea. Four diets: control diet (CD, decanter cake diet (DCD, palm kernel cake diet (PKCD and CD plus 5% PO diet (CPOD were fed to rumen cannulated goats and rumen samples were collected at the start of the experimental diets (day 0 and on days 4, 6, 8, 12, 18, 24 and 30 post dietary treatments. Feeding DCD and PKCD resulted in significantly higher (P<0.05 DNA copy number of total bacteria, Fibrobacter succinogenes, Ruminococcus flavefeciens, and Ruminococcus albus. Rumen methanogenic archaea was significantly lower (P<0.05 in goats fed PKCD and CPOD and the trend showed a severe reduction on days 4 and 6 post experimental diets. In conclusion, results indicated that feeding DCD and PKC increased the populations of cellulolytic bacteria and decreased the density of methanogenic archaea in the rumen of goats.

  13. Interação com os pais e o uso do espaço por um infante de Alouatta fusca (Geoffroy Saint-Hilaire, 1812 em cativeiro Interaction with parents and use of space by an infant of Alouatta fusca (Geoffroy Saint Hilaire, 1812 in captivity

    Directory of Open Access Journals (Sweden)

    Fernanda Keley Silva Pereira Navarro

    2012-09-01

    significant departure (P < 0.05 compared to the puppy's maternal contact with increasing age and greater independence. The most used during the first 3 months of captivity was the pergola. In December, a period of higher rainfall, the chick ventral increased interactions with the mother, and stayed longer in the barrel. Information obtained here will contribute to a better understanding in relation to infants of Alouatta fusca, their social interactions and use of space that can be used to improve the ex-situ management of animals, creating better conditions for the stay of those in captivity, using appropriate structures that mimic the natural environment, to ensure the welfare of apes and thus the survival of the species.

  14. The genome sequences of Cellulomonas fimi and "Cellvibrio gilvus" reveal the cellulolytic strategies of two facultative anaerobes, transfer of "Cellvibrio gilvus" to the genus Cellulomonas, and proposal of Cellulomonas gilvus sp. nov.

    Directory of Open Access Journals (Sweden)

    Melissa R Christopherson

    Full Text Available Actinobacteria in the genus Cellulomonas are the only known and reported cellulolytic facultative anaerobes. To better understand the cellulolytic strategy employed by these bacteria, we sequenced the genome of the Cellulomonas fimi ATCC 484(T. For comparative purposes, we also sequenced the genome of the aerobic cellulolytic "Cellvibrio gilvus" ATCC 13127(T. An initial analysis of these genomes using phylogenetic and whole-genome comparison revealed that "Cellvibrio gilvus" belongs to the genus Cellulomonas. We thus propose to assign "Cellvibrio gilvus" to the genus Cellulomonas. A comparative genomics analysis between these two Cellulomonas genome sequences and the recently completed genome for Cellulomonas flavigena ATCC 482(T showed that these cellulomonads do not encode cellulosomes but appear to degrade cellulose by secreting multi-domain glycoside hydrolases. Despite the minimal number of carbohydrate-active enzymes encoded by these genomes, as compared to other known cellulolytic organisms, these bacteria were found to be proficient at degrading and utilizing a diverse set of carbohydrates, including crystalline cellulose. Moreover, they also encode for proteins required for the fermentation of hexose and xylose sugars into products such as ethanol. Finally, we found relatively few significant differences between the predicted carbohydrate-active enzymes encoded by these Cellulomonas genomes, in contrast to previous studies reporting differences in physiological approaches for carbohydrate degradation. Our sequencing and analysis of these genomes sheds light onto the mechanism through which these facultative anaerobes degrade cellulose, suggesting that the sequenced cellulomonads use secreted, multidomain enzymes to degrade cellulose in a way that is distinct from known anaerobic cellulolytic strategies.

  15. Investigations on potato pulp as a dietary fiber source. The influence of pectolytic and cellulolytic enzymes. Untersuchungen an Kartoffelpuelpe als Ballaststoffquelle. Zum Einfluss von pektolytischen und cellulolytischen Enzymen

    Energy Technology Data Exchange (ETDEWEB)

    Dongowski, G. (Deutsches Inst. fuer Ernaehrungsforschung Potsdam-Rehbruecke, Bergholz-Rehbruecke (Germany))

    1993-05-01

    The influence of treatment with pectolytic and cellulolytic enzyme preparations was investigated with reference to the separation of water and the composition of potato pulp. In contrast to pectinesterase, pectate lyase or cellulase it was found an intensive action on the pulp after incubation with Pectinex Ultra SP-L or pectinase/cellulase combinations. The content of pectin, starch and protein as well as the water binding capacity are varied in dependence of the used enzyme preparations. The occurring changes in the supermolecular structure of the potato pulp tissue are investigated by scanning electron microscopy. The grown biological structure is partly or extensive destroyed especially after action of pectinases and cellulases. The content of starch in the potato pulp preparations remains relatively high even after intensive treatment with cell wall degrading enzymes. (orig.)

  16. [Display cellulolytic enzymes on Saccharomyces cerevisiae cell surface by using Flo1p as an anchor protein for cellulosic ethanol production].

    Science.gov (United States)

    Mo, Chunling; Yang, Yueyue; Chen, Ning; Yang, Xiushan; Tian, Shen

    2014-09-01

    In this study, we constructed a yeast consortium surface-display expression system by using Flo1 as an anchor protein. Endoglucanase II (EGII) and cellobiohydrolase II (CBHII) from Trichoderma reesei, and β3-glucosidase 1 (BGLI) from Aspergillus aculeatus were immobilized on Saccharomyces cerevisiae Y5. We constructed the cellulose-displaying expression yeast consortium (Y5/fEGII:Y5/fCBHII:Y5/fBGLI = 1:1:1) and investigated the enzymatic ability and ethanol fermentation. The displayed cellulolytic enzymes was stabile during the 96-h fermentation. The yeast consortium produced 0.77 g/L ethanol from 10 g/L phosphoric acid swollen cellulose (PASC) within 96 h. The yield (in grams of ethanol produced per gram of carbohydrate consumed) was 0.35 g/g, which correspond to 68.6% of the theoretical yield. PMID:25720155

  17. Activity-based protein profiling of secreted cellulolytic enzyme activity dynamics in Trichoderma reesei QM6a, NG14, and RUT-C30

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Lindsey N.; Culley, David E.; Hofstad, Beth A.; Chauvigne-Hines, Lacie M.; Zink, Erika M.; Purvine, Samuel O.; Smith, Richard D.; Callister, Stephen J.; Magnuson, Jon M.; Wright, Aaron T.

    2013-12-01

    Development of alternative, non-petroleum based sources of bioenergy that can be applied in the short-term find great promise in the use of highly abundant and renewable lignocellulosic plant biomass.1 This material obtained from different feedstocks, such as forest litter or agricultural residues, can yield liquid fuels and other chemical products through biorefinery processes.2 Biofuels are obtained from lignocellulosic materials by chemical pretreatment of the biomass, followed by enzymatic decomposition of cellulosic and hemicellulosic compounds into soluble sugars that are converted to desired chemical products via microbial metabolism and fermentation.3, 4 To release soluble sugars from polymeric cellulose multiple enzymes are required, including endoglucanase, exoglucanase, and β-glucosidase.5, 6 However, the enzymatic hydrolysis of cellulose into soluble sugars remains a significant limiting factor to the efficient and economically viable utilization of lignocellulosic biomass for transport fuels.7, 8 The primary industrial source of cellulose and hemicellulases is the mesophilic soft-rot fungus Trichoderma reesei,9 having widespread applications in food, feed, textile, pulp, and paper industries.10 The genome encodes 200 glycoside hydrolases, including 10 cellulolytic and 16 hemicellulolytic enzymes.11 The hypercellulolytic catabolite derepressed strain RUT-C30 was obtained through a three-step UV and chemical mutagenesis of the original T. reesei strain QM6a,12, 13 in which strains M7 and NG14 were intermediate, having higher cellulolytic activity than the parent strain but less activity and higher catabolite repression than RUT-C30.14 Numerous methods have been employed to optimize the secreted enzyme cocktail of T. reesei including cultivation conditions, operational parameters, and mutagenesis.3 However, creating an optimal and economical enzyme mixture for production-scale biofuels synthesis may take thousands of experiments to identify.

  18. Effects of Neutral Detergent Soluble Fiber and Sucrose Supplementation on Ruminal Fermentation, Microbial Synthesis, and Populations of Ruminal Cellulolytic Bacteria Using the Rumen Simulation Technique (RUSITEC)

    Institute of Scientific and Technical Information of China (English)

    ZHAO Xiang-hui; LIU Chan-juan; LI Chao-yun; YAO Jun-hu

    2013-01-01

    We evaluated the effects of neutral detergent soluble fiber (NDSF) and sucrose supplementation on ruminal fermentation, microbial synthesis, and populations of ruminal cellulolytic bacteria using the rumen simulation technique (RUSITEC). The experiment had a 2×2 factorial design with two dosages of sucrose, low (ca. 0.26 g d-1, low-sucrose) and high (ca. 1.01 g d-1, high-sucrose), and two dosages of supplied NDSF, low (1.95 g d-1, low-NDSF) and high (2.70 g d-1, high-NDSF). Interactions between NDSF and sucrose were detected for xylanase activity from solid fraction and apparent disappearance of neutral detergent fiber (NDF) and hemicellulose, with the lowest values observed for high-NDSF and high-sucrose treatment. Supplemental NDSF appeared to increase the molar proportion of acetate and reduce that of butyrate;however, the effects of supplemental sucrose on VFA profiles depended upon NDSF amount. There was a NDSF×sucrose interaction for the production of methane. High-NDSF fermenters had lower ammonia-N production, greater daily N flow of solid-associated microbial pellets and total microorganisms, and greater microbial synthesis efficiency compared with low-NDSF fermenters. Supplementation with NDSF resulted in an increase in 16S rDNA copies of Ruminococcus flavefaciens and a reduction in copies of Ruminococcus albus. Supplementation with sucrose tended to increase the 16S rDNA copies of R. albus from liquid fraction, but did not affect daily total microbial N flow and cellulolytic bacterium populations from solid fraction. These data indicate that the effects of the interaction between NDSF and sugars on ruminal fermentation and fiber digestion should be taken into account in diet formulation. Ruminal fermentation and metabolism of sugars warrant further investigation.

  19. Kallotenue papyrolyticum gen. nov., sp. nov., a cellulolytic and filamentous thermophile that represents a novel lineage (Kallotenuales ord. nov., Kallotenuaceae fam. nov.) within the class Chloroflexia

    Energy Technology Data Exchange (ETDEWEB)

    Cole, Jesse; Gieler, Brandon; Heisler, Devon; Palisoc, Maryknoll; Williams, Amanda; Dohnalkova, Alice; Ming, Hong; Yu, Tian T.; Dodsworth, Jeremy A.; Li, Wen J.; Hedlund, Brian P.

    2013-08-15

    Several closely-related, thermophilic, and cellulolytic bacterial strains, designated JKG1T, JKG2, JKG3, JKG4, and JKG5, were isolated from a cellulolytic enrichment (corn stover) incubated in the water column of Great Boiling Spring, NV. Strain JKG1T had cells of a diameter of 0.7 - 0.9 μm and length of ~2.0 μm that formed non-branched multicellular filaments reaching >300 μm. Spores were not formed and dense liquid cultures were red. The temperature range for growth was 45-65 °C, with an optimum of 55 °C. The pH range for growth was 5.6-9.0, with an optimum of 7.5. JKG1T grew as an aerobic heterotroph, utilizing glucose, sucrose, xylose, arabinose, cellobiose, carboxymethylcellulose, filter paper, microcrystalline cellulose, xylan, starch, casamino acids, tryptone, peptone, yeast extract, acetate, citrate, lactate, pyruvate, and glycerol as sole carbon sources, and was not observed to photosynthesize. The cells stained Gram-negative. Phylogenetic analysis using 16S rRNA gene sequences placed the new isolates in the class Chloroflexia, but distant from other cultivated members, with the highest sequence identity of 82.5% to Roseiflexus castenholzii. The major quinone was menaquinone-9; no ubiquinones were detected. The major cellular fatty acids (>5%) were C18:0, anteiso-C17:0, iso-C18:0, and iso-C17:0. C16:0, iso-C16:0, and C17:0. The peptidoglycan amino acids were alanine, ornithine, glutamic acid, serine, and asparagine. Whole-cell sugars included mannose, rhamnose, glucose, galactose, ribose, arabinose, and xylose. Morphological, phylogenetic, and chemotaxonomic results suggest that JKG1T is representative of a new lineage within the class Chloroflexia, which we propose to designate Kallotenue papyrolyticum gen. nov., sp. nov., Kallotenuaceae fam. nov., Kallotenuales ord. nov.

  20. Paracelsin; characterization by NMR spectroscopy and circular dichroism, and hemolytic properties of a peptaibol antibiotic from the cellulolytically active mold Trichoderma reesei. Part B.

    Science.gov (United States)

    Brückner, H; Graf, H; Bokel, M

    1984-11-15

    Paracelsin, a hemolytic and membrane active polypeptide antibiotic of the peptaibol class which is excreted by the mold Trichoderma reesei, was obtained by a simplified and rapid isolation procedure utilizing hydrophobic adsorber resins. Investigation by 13C nuclear magnetic resonance spectroscopy and circular dichroism revealed considerable helical portions in solution, and the very recently accomplished sequence determination of paracelsin allows the discussion of the results with regard to the closely related analogues, alamethicin and suzukacillin. A selective cleavage of the peptide was achieved by careful treatment with various acids, and a buffer of pH 8.25 and of high ionic strength made possible the quantitative determination of the C-terminal phenylalaninol released by means of ion-exchange chromatography. The significance of the production of paracelsin and related mycotoxins of the peptaibol class, exhibiting various kinds of biological activity, is discussed with respect to the extensive effort being made towards biotechnological applications of species, strains and cellulolytically highly active mutants of the fungus Trichoderma. PMID:6500005

  1. Identification and characterization of an anaerobic ethanol-producing cellulolytic bacterial consortium from Great Basin hot springs with agricultural residues and energy crops.

    Science.gov (United States)

    Zhao, Chao; Deng, Yunjin; Wang, Xingna; Li, Qiuzhe; Huang, Yifan; Liu, Bin

    2014-09-01

    In order to obtain the cellulolytic bacterial consortia, sediments from Great Basin hot springs (Nevada, USA) were sampled and enriched with cellulosic biomass as the sole carbon source. The bacterial composition of the resulting anaerobic ethanol-producing celluloytic bacterial consortium, named SV79, was analyzed. With methods of the full-length 16S rRNA librarybased analysis and denaturing gradient gel electrophoresis, 21 bacteria belonging to eight genera were detected from this consortium. Clones with closest relation to the genera Acetivibrio, Clostridium, Cellulosilyticum, Ruminococcus, and Sporomusa were predominant. The cellulase activities and ethanol productions of consortium SV79 using different agricultural residues (sugarcane bagasse and spent mushroom substrate) and energy crops (Spartina anglica, Miscanthus floridulus, and Pennisetum sinese Roxb) were studied. During cultivation, consortium SV79 produced the maximum filter paper activity (FPase, 9.41 U/ml), carboxymethylcellulase activity (CMCase, 6.35 U/ml), and xylanase activity (4.28 U/ml) with sugarcane bagasse, spent mushroom substrate, and S. anglica, respectively. The ethanol production using M. floridulus as substrate was up to 2.63 mM ethanol/g using gas chromatography analysis. It has high potential to be a new candidate for producing ethanol with cellulosic biomass under anoxic conditions in natural environments.

  2. Isolation, Screening, and Identification of Cellulolytic Bacteria from Natural Reserves in the Subtropical Region of China and Optimization of Cellulase Production by Paenibacillus terrae ME27-1

    Directory of Open Access Journals (Sweden)

    Yan-Ling Liang

    2014-01-01

    Full Text Available From different natural reserves in the subtropical region of China, a total of 245 aerobic bacterial strains were isolated on agar plates containing sugarcane bagasse pulp as the sole carbon source. Of the 245 strains, 22 showed hydrolyzing zones on agar plates containing carboxymethyl cellulose after Congo-red staining. Molecular identification showed that the 22 strains belonged to 10 different genera, with the Burkholderia genus exhibiting the highest strain diversity and accounting for 36.36% of all the 22 strains. Three isolates among the 22 strains showed higher carboxymethyl cellulase (CMCase activity, and isolate ME27-1 exhibited the highest CMCase activity in liquid culture. The strain ME27-1 was identified as Paenibacillus terrae on the basis of 16S rRNA gene sequence analysis as well as physiological and biochemical properties. The optimum pH and temperature for CMCase activity produced by the strain ME27-1 were 5.5 and 50°C, respectively, and the enzyme was stable at a wide pH range of 5.0–9.5. A 12-fold improvement in the CMCase activity (2.08 U/mL of ME27-1 was obtained under optimal conditions for CMCase production. Thus, this study provided further information about the diversity of cellulose-degrading bacteria in the subtropical region of China and found P. terrae ME27-1 to be highly cellulolytic.

  3. Cellulolytic potential of probiotic Bacillus Subtilis AMS6 isolated from traditional fermented soybean (Churpi): An in-vitro study with regards to application as an animal feed additive.

    Science.gov (United States)

    Manhar, Ajay K; Bashir, Yasir; Saikia, Devabrata; Nath, Dhrubajyoti; Gupta, Kuldeep; Konwar, Bolin K; Kumar, Rahul; Namsa, Nima D; Mandal, Manabendra

    2016-01-01

    The aim of the present study is to evaluate the probiotic attributes of Bacillus subtilis AMS6 isolated from fermented soybean (Churpi). This isolate exhibited tolerance to low pH (pH 2.0) and bile salt (0.3%), capability to autoaggregate and coaggregate. AMS6 also showed highest antibacterial activity against the pathogenic indicator strain Salmonella enterica typhimurium (MTCC 1252) and susceptibility towards different antibiotics tested. The isolate was effective in inhibiting the adherence of food borne pathogens to Caco-2 epithelial cell lines, and was also found to be non-hemolytic which further strengthen the candidature of the isolate as a potential probiotic. Further studies revealed B. subtilis AMS6 showed cellulolytic activity (0.54±0.05 filter paper units mL(-1)) at 37°C. The isolate was found to hydrolyze carboxymethyl cellulose, filter paper and maize (Zea mays) straw. The maize straw digestion was confirmed by scanning electron microscopy studies. The isolate was able to degrade filter paper within 96h of incubation. A full length cellulase gene of AMS6 was amplified using degenerate primers consisting of 1499 nucleotides. The ORF encoded for a protein of 499 amino acids residues with a predicted molecular mass of 55.04kDa. The amino acids sequence consisted of a glycosyl hydrolase family 5 domain at N-terminal; Glycosyl hydrolase catalytic core and a CBM-3 cellulose binding domain at its C terminal. The study suggests potential probiotic B. subtilis AMS6 as a promising candidate envisaging its application as an animal feed additive for enhanced fiber digestion and gut health of animal.

  4. Isolation, Screening and Identification of Thermophilic Cellulolytic Bacteria in Old Stalk of Asparagus Compost%芦笋老茎堆肥中高温纤维素分解菌的分离、筛选及鉴定

    Institute of Scientific and Technical Information of China (English)

    李欣欣; 王琳琳; 申挺挺; 宋志刚; 韩建荣

    2012-01-01

    采用纤维素刚果红培养基在45℃下从芦笋老茎堆肥中分离筛选出52株高温纤维素分解菌.通过水解圈直径与菌落直径比值的比较,进一步获得了6株纤维素分解能力较强的菌株.经菌落形态观察、革兰氏染色、芽孢染色和生理生化试验,6株高温纤维素分解菌初步鉴定为需氧芽孢杆菌(Bacillus spp.).%In this experiment, 52 strains of thermophilic cellulolytic bacteria were isolated and screened from the old stalk of asparagus compost using cellulose - congo red culture medium at 451. By comparing the ratio of hydrolytic circle diameter to colony diameter, 6 strains of cellulolytic bacteria with higher efficient were selected, and they were identified as Bacillus spp. through morphological observation, Gram' s staining, spore staining and physiological - biochemical experiments.

  5. Isolation,Identification and Optimization of Enzyme Production of Cellulolytic Bacteria from the Goose Gut%鹅肠道纤维素分解菌的分离鉴定及其产酶条件的优化

    Institute of Scientific and Technical Information of China (English)

    高云航; 张喜宏; 刘佳丽; 战利; 李长亮

    2011-01-01

    A strain of highly cellulolytic bacteria was obtained from goose gut, and the conditions in enzyme production have been studied in this study. The strain of highly cellulolytic bacterial E2 has been isolated by the Congo red ( primary screening) and shaking flask method ( secondary screening) . The 16S rDNA sequence analysis indicated that strain E2 was Bacillus pumilus sp. On the basis of single factor experiment, the optimal carbon source, nitrogen source, initial pH, fermentation temperature and fermentation time of strain E2 for enzyme production were maizena, beef extract and peptone mixture, 6.0, 42℃ , and 48 h, respectively. [ Chinese Journal of Animal Nutrition ,2011 ,23 ( 3) : 466-472 ]%本研究拟在鹅肠道筛选1株高效降解纤维素的菌株,并对该菌株的产酶条件进行研究.通过对鹅肠道菌群进行富集培养、分离纯化,利用刚果红法(初筛)和摇瓶法(复筛)得到1株产酶活较高的纤维素分解菌E2.经16S rDNA核苷酸序列比对分析表明,该菌株为芽孢杆菌属的短小芽孢杆菌.单因素试验得出菌株E2的产酶最适碳源为玉米粉,最适氮源为牛肉膏和蛋白胨混合物,最适初始pH为6.0,最适发酵温度为42 ℃,最适发酵时间为48 h.

  6. Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, David B.

    2008-04-02

    This grant provided the basic funding that enabled me to carry out a detailed characterization of the proteins used by the aerobic soil bacterium, Thermobifida fusca, to degrade cellulose and to study the mechanisms used by T. fusca to regulate cellulase synthesis. This work resulted in 53 publications and led to the decision by The DOE Joint Genome Institute to sequence the T. fusca genome. T. fusca is now recognized as one of the best studied cellulolytic microorganisms and our work led to the discovery of a novel class of cellulases, processive endoglucanases, which are found in many cellulolytic bacteria including both aerobes and anaerobes. In addition, we were able to determine the mechanism by which Cel9A caused processive hydrolysis of cellulose. This research also helped to explain why many cellulolytic microorganisms produce two different exocellulases, as we showed that these enzymes have different specificities, with one attacking the reducing end of a cellulose chain and the other attacking the nonreducing end. Our work also provided additional evidence for the importance of a cellulose binding domain (carbohydrate binding module) [CBM] in the hydrolysis of crystalline cellulose.

  7. 纤维素分解酶处理玉米秸秆对肉牛生产性能和经济效益的影响%Effects of corn stover fermented by cellulolytic enzyme on production performance and economic benefit in beef cattle

    Institute of Scientific and Technical Information of China (English)

    高月平; 张贵花; 王聪; 刘强; 白元生; 师周戈; 刘晓妮

    2013-01-01

    研究玉米秸秆经纤维素分解酶(纤维素酶和木聚糖酶)处理后的化学成分变化以及对肉牛生产性能和经济效益的影响.选用12月龄左右的西门塔尔牛36头,对照组饲喂基础日粮(混合精料十玉米秸秆,精粗比45∶55),试验组分别以0.5%、1.0%和1.5%的纤维素分解酶处理玉米秸秆替代基础饲粮中的玉米秸秆进行为期70 d的试验.结果表明:采用纤维素分解酶处理玉米秸秆后化学成分发生变化,粗蛋白质含量增加显著,中性洗涤纤维和酸性洗涤纤维降低显著,1.5%的纤维素分解酶处理组中性洗涤纤维和酸性洗涤纤维显著低于1.0%的纤维素分解酶处理组.1.0%、1.5%的纤维素分解酶处理组西门塔尔牛干物质采食量、平均日增重和经济效益提高显著(P<0.05).适宜的纤维素分解酶添加水平为1.0%.%The objective was to evaluate the effects of corn stover fermented by cellulolytic enzyme on nutrition of corn stover,production performance of beef cattles and economic benefit.Thirty-six Simmenta beef cattles (12-month-old) were randomly divided into 4 groups.The control group was fed the basal diet (mixed concentrate and corn stover,concentrate to roughage as 45 to 55).Treatments lasted for 70 days were fed corn stover fermented by cellulolytic enzyme at 0.5%,1.0% and 1.5 %,respectively.The results showed that chemical composition of corn stover changed with the addition of cellulolytic enzymes.The crude protein content increased significantly,neutral detergent fiber and acid detergent fiber decreased significantly.neutral detergent fiber and acid detergent fiber of 1.5 % cellulolytic enzyme treatment were significantly lower than that of 1% cellulolytic enzyme treatment.The dry matter intake,average daily gain and economic benefit of 1.0%,1.5% cellulolytic enzyme treatment increased significantly (P<0.05).The cellulolytic enzyme addition level as 1% was good.

  8. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia

    1998-10-01

    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  9. 嗜热厌氧纤维素分解菌的分离、鉴定及其酶学特性%Isolation, identification and enzyme characterization of a thermophilic cellulolytic anaerobic bacterium

    Institute of Scientific and Technical Information of China (English)

    赵银瓶; 马诗淳; 孙颖杰; 黄艳; 邓宇

    2012-01-01

    [目的]分离高效降解纤维素的嗜热厌氧菌,通过与嗜热产乙醇菌株联合培养的方式,为生产纤维素乙醇提供微生物资源.[方法]利用厌氧分离技术从降解纤维素的马粪富集物中分离到一株嗜热厌氧细菌HCp.采用形态学观察、生理生化鉴定、结合16S rDNA序列的系统发育学分析确定该菌株的分类地位,利用DNS酶活分析方法测定此分离菌株的酶学性质.[结果]分离菌株HCp革兰氏染色阴性,直杆,细胞单个或成对出现,菌体大小为(0.35 -0.50) μm×(2.42 -6.40) μm,严格厌氧,形成芽胞,能运动,对新霉素有一定的抗性.此菌能利用滤纸纤维素、纤维素粉、微晶纤维素、脱脂棉和水稻秸秆、明胶等,还可以利用葡萄糖、纤维二糖、木糖、木聚糖、果糖、蔗糖、核糖、半乳糖、麦芽糖、山梨糖、海藻糖、蜜二糖、甘露糖等.该菌株在pH6.5 -8.5、温度35 - 70℃、盐浓度0% - 1.0%范围内利用纤维素生长,最适pH为6.85,最适温度为60℃,最适NaCl浓度为0.2%,最佳生长条件下,在10 d内滤纸纤维素降解率可达90.40%.在HCp的纤维小体中,滤纸酶、羧甲基纤维素酶、β-葡萄糖苷酶、木聚糖酶的最适作用温度分别为70℃、70℃、70℃、60℃,并且羧甲基纤维素酶具有较高的热稳定性.部分长度的16S rDNA序列分析表明,分离菌株HCp与Acetivibrio cellulolyticus、A.cellulosolvens相似性为97.5%.[结论]分离菌株HCp是从马粪富集物中分离到的一株嗜热厌氧细菌,该菌具有较强的降解纤维素能力,生长温度范围广,酶的热稳定性好,纤维素底物利用广泛等特性,为纤维素降解产乙醇提供了良好的材料.%[Objective ] To identify a thermophilic bacterium from horse manure to degrade cellulose efficiently, and to enrich microbial resources producing cellulolytic ethanol by co-culturing with thermophilic ethanol producing bacterium. [Methods] We used Hungate anaerobic

  10. IMPACTS OF BIOFILM FORMATION ON CELLULOSE FERMENTATION

    Energy Technology Data Exchange (ETDEWEB)

    Leschine, Susan

    2009-10-31

    This project addressed four major areas of investigation: i) characterization of formation of Cellulomonas uda biofilms on cellulose; ii) characterization of Clostridium phytofermentans biofilm development; colonization of cellulose and its regulation; iii) characterization of Thermobifida fusca biofilm development; colonization of cellulose and its regulation; and iii) description of the architecture of mature C. uda, C. phytofermentans, and T. fusca biofilms. This research is aimed at advancing understanding of biofilm formation and other complex processes involved in the degradation of the abundant cellulosic biomass, and the biology of the microbes involved. Information obtained from these studies is invaluable in the development of practical applications, such as the single-step bioconversion of cellulose-containing residues to fuels and other bioproducts. Our results have clearly shown that cellulose-decomposing microbes rapidly colonize cellulose and form complex structures typical of biofilms. Furthermore, our observations suggest that, as cells multiply on nutritive surfaces during biofilms formation, dramatic cell morphological changes occur. We speculated that morphological changes, which involve a transition from rod-shaped cells to more rounded forms, might be more apparent in a filamentous microbe. In order to test this hypothesis, we included in our research a study of biofilm formation by T. fusca, a thermophilic cellulolytic actinomycete commonly found in compost. The cellulase system of T. fusca has been extensively detailed through the work of David Wilson and colleagues at Cornell, and also, genome sequence of a T. fusca strain has been determine by the DOE Joint Genome Institute. Thus, T. fusca is an excellent subject for studies of biofilm development and its potential impacts on cellulose degradation. We also completed a study of the chitinase system of C. uda. This work provided essential background information for understanding how C. uda

  11. Structure/function relationships in cellulolytic enzymes

    Institute of Scientific and Technical Information of China (English)

    Marc Claeyssens

    2004-01-01

    @@ Cellulose and hemicellulose (mostly xylan), together with lignin, are the major polymeric constituents of plant cell walls and from the largest reservoir of fixed carbon in nature. The enzymatic hydrolysis of polymeric substances by extracellular enzymes, such as cellulases, hemicellulases and laccases, is preferred to chemical depolymerisation to avoid the production of toxic by-products and waste that are expensive to treat. The monosaccharides released through enzymatic hydrolysis can subsequently be microbially converted to commercial commodities, such as bio-ethanol (fuel extender) or microbial protein as feed supplements. The individual depolymerisering enzymes used, such as cellulases,xylanases and laccases, also have industrial application in (i) biobleaching in the paper and pulp industry, (ii) improvement of animal feed (poultry and ruminants) digestibility in feed industries, and (iii) dough rheology and bread volume in the baking process, and beer viscosity and filtration velocity during brewing. The cloning of the genes, coding for several xylan degrading enzymes, and their expression in Baker' s yeast (Saccharomyces cerevisiae) and filamentous fungi (Aspergillus species)opened the possibility to study the pure enzymes, without contaminating activity.Trichoderma reesei produces several of these enzymes and detailed information on their specificity,synergies and structure/activity relationships is known. An overview will be presented.

  12. Isolation of anaerobic bacterial strains from cellulolytic bacterial com- munity WSC-9%纤维素分解复合菌系WSC-9中厌氧细菌的分离

    Institute of Scientific and Technical Information of China (English)

    温雪; 付博锐; 王彦杰; 高亚梅; 刘权; 晏磊; 王伟东

    2013-01-01

    The microbial community WSC-9 capable of degrading lignocellulose with high efficiency was enriched from composting of cattle manure and rice straw. The aims of this study were to isolate and identify the anaerobic bacterial strains from the cellulose-degrading bacterial community. An anaerobic, thermophilic and cellulolytic bacterium was isolated, which was named WSC-9-7. More than 47% of rice straw was degraded within 10 days of inoculation at 50 ° C by WSC-9-7. WSC-9-7 is a spore-forming and straight rod. Cellobiose, cellulose, filter paper and rice straw can be utilized as sole carbon and energy sources by WSC-9-7 in medium. On the basis of 16S rDNA gene sequence similarity, WSC-9-7 was mapped to the genus Clostridium. It is closely related to HAW-RM37-2-B-1600d-W (99%), and Clostridium islandicum AK1(98%). Clostridium islandicum AK1 was a new anaerobic, saccharolytic, thermophilic bacterium, isolated from hot spring in Iceland. HAW-RM37-2-B-1600d-W was uncultured clone from compost environmental samples. All of them were thermophilic and anaerobic bacterium. Hence, WSC-9-7 represents a novel species is proposed.%  复合菌系WSC-9是一组具高效稳定分解纤维素能力的细菌复合群体.为了研究其微生物组成,以纤维素分解情况为依据,分离复合菌系中具有纤维素分解能力的厌氧纯培养菌株,通过16S rDNA基因序列初步分析确定系统发育地位.从WSC-9中获得1株可有效降解纤维素的严格厌氧细菌WSC-9-7,50℃培养10 d,稻秆的总干重减少了47%.WSC-9-7为杆菌,产孢,能够利用纤维二糖、纤维素、滤纸、稻秆等.经数据库比对,与菌株HAW-RM37-2-B-1600d-W(FN563295)的相似性达到99%,与Clostridium islandicum AK1(EF088328)的相似性为98%.其中,Clostridium islandicum AK1厌氧且可以分解多糖类物质,获于冰岛的热泉;HAW-RM37-2-B-1600d-W在堆肥样品的克隆结果中获得,未获得纯培养.菌株WSC-9-7与这两株细菌均为嗜高温的严格

  13. Genomics of aerobic cellulose utilization systems in actinobacteria.

    Directory of Open Access Journals (Sweden)

    Iain Anderson

    Full Text Available Cellulose degrading enzymes have important functions in the biotechnology industry, including the production of biofuels from lignocellulosic biomass. Anaerobes including Clostridium species organize cellulases and other glycosyl hydrolases into large complexes known as cellulosomes. In contrast, aerobic actinobacteria utilize systems comprised of independently acting enzymes, often with carbohydrate binding domains. Numerous actinobacterial genomes have become available through the Genomic Encyclopedia of Bacteria and Archaea (GEBA project. We identified putative cellulose-degrading enzymes belonging to families GH5, GH6, GH8, GH9, GH12, GH48, and GH51 in the genomes of eleven members of the actinobacteria. The eleven organisms were tested in several assays for cellulose degradation, and eight of the organisms showed evidence of cellulase activity. The three with the highest cellulase activity were Actinosynnema mirum, Cellulomonas flavigena, and Xylanimonas cellulosilytica. Cellobiose is known to induce cellulolytic enzymes in the model organism Thermobifida fusca, but only Nocardiopsis dassonvillei showed higher cellulolytic activity in the presence of cellobiose. In T. fusca, cellulases and a putative cellobiose ABC transporter are regulated by the transcriptional regulator CelR. Nine organisms appear to use the CelR site or a closely related binding site to regulate an ABC transporter. In some, CelR also regulates cellulases, while cellulases are controlled by different regulatory sites in three organisms. Mining of genome data for cellulose degradative enzymes followed by experimental verification successfully identified several actinobacteria species which were not previously known to degrade cellulose as cellulolytic organisms.

  14. 单宁和聚乙二醇对绵羊和山羊瘤胃纤维降解菌数量的影响%Effects of Tannin and Polyethylene Glycol on Ruminal Cellulolytic Bacteria Quantity in Sheep and Goats

    Institute of Scientific and Technical Information of China (English)

    李大彪; 张梅梅; 于永强; 李红磊; 塔娜; 邢媛媛; 王卫云

    2015-01-01

    本文旨在研究饲粮中添加不同水平的单宁和高单宁饲粮条件下添加聚乙二醇( PEG )对绵羊和山羊瘤胃纤维降解菌数量的影响。试验选用1.5岁、体重约45 kg、安装永久性瘤胃瘘管的绵羊和绒山羊各4只,采用自身对照试验设计,分4期进行。第1期饲喂基础饲粮(Ⅰ组),第2期在基础饲粮中添加2%的单宁(Ⅱ组),第3期在基础饲粮中添加6%的单宁(Ⅲ组),第4期在基础饲粮中添加6%单宁+12% PEG(Ⅳ组)。每期试验30 d,其中预试期12 d,正试期18 d。每个正试期第1天,采集绵羊和山羊瘤胃内容物,测定瘤胃液pH、氨态氮( NH3-N)和菌体蛋白( MCP)浓度;运用实时定量PCR技术对固相、液相及全食糜中所附着的白色瘤胃球菌、黄色瘤胃球菌、产琥珀酸拟杆菌进行定量检测。结果表明:1)与Ⅰ组相比,添加6%单宁显著降低了山羊瘤胃液NH3-N浓度和绵羊瘤胃液MCP浓度( P<0.05)。添加6%单宁+12% PEG后,这2个指标恢复至与Ⅰ组相当的水平。2)与Ⅰ组相比,添加6%单宁显著降低了绵羊和山羊瘤胃固相、绵羊瘤胃液相白色瘤胃球菌数量( P<0.05);添加2%和6%单宁显著降低了绵羊和山羊固相黄色瘤胃球菌数量( P<0.05),添加6%单宁显著降低了绵羊和山羊瘤胃液相黄色瘤胃球菌数量( P<0.05);添加6%单宁显著降低了绵羊和山羊瘤胃固相、绵羊全食糜产琥珀酸拟杆菌数量( P<0.05)。添加6%单宁+12% PEG后,绵羊和山羊瘤胃这3株纤维降解菌数量恢复至Ⅰ组水平或高于Ⅰ组。由此可见,饲粮单宁添加量达到6%时降低了瘤胃液NH3-N的浓度,影响MCP的合成,抑制瘤胃固相纤维降解菌的增殖;添加PEG可以削弱单宁对瘤胃纤维降解菌生长的负面影响,促进瘤胃发酵。%This paper studied the effects of different dietary tannin levels and high tannin diets supplemented with polyethylene glycol ( PEG) on ruminal cellulolytic bacteria quantity in sheep and

  15. Cellulase variants

    Energy Technology Data Exchange (ETDEWEB)

    Blazej, Robert; Toriello, Nicholas; Emrich, Charles; Cohen, Richard N.; Koppel, Nitzan

    2015-07-14

    This invention provides novel variant cellulolytic enzymes having improved activity and/or stability. In certain embodiments the variant cellulotyic enzymes comprise a glycoside hydrolase with or comprising a substitution at one or more positions corresponding to one or more of residues F64, A226, and/or E246 in Thermobifida fusca Cel9A enzyme. In certain embodiments the glycoside hydrolase is a variant of a family 9 glycoside hydrolase. In certain embodiments the glycoside hydrolase is a variant of a theme B family 9 glycoside hydrolase.

  16. Utilization of individual cellodextrins by three predominant ruminal cellulolytic bacteria.

    OpenAIRE

    Shi, Y; Weimer, P.J.

    1996-01-01

    Growth of the ruminal bacteria Fibrobacter succinogenes S85, Ruminococcus flavefaciens FD-1, and R. albus 7 followed Monod kinetics with respect to concentrations of individual pure cellodextrins (cellobiose, cellotriose, cellotetraose, cellopentaose, and cellohexaose). Under the conditions tested, R. flavefaciens FD-1 possesses the greatest capacity to compete for low concentrations of these cellodextrins.

  17. FERROFLUIDS INFLUENCE ON DEHYDROGENASES ACTIVITY IN CELLULOLYTIC FUNGUS CHAETOMIUM GLOBOSUM

    Directory of Open Access Journals (Sweden)

    Alexandru Manoliu

    2003-08-01

    Different results were noticed for different ferrofluids concentrations: 20, 40, 60, 80 and 100 μl/L. Inhibitory or stimulatory ferrofluids effect was obtained depending on the nature of the investigated enzyme.

  18. FERROFLUIDS INFLUENCE ON DEHYDROGENASES ACTIVITY IN CELLULOLYTIC FUNGUS CHAETOMIUM GLOBOSUM

    OpenAIRE

    Alexandru Manoliu; Lacramioara Oprica; Zenovia Olteanu; Dorina Creanga

    2003-01-01

    he activity of dehy drogenases was studied after ferrofluids supply ing in the culture medium of Chaetomium globosum. Spectral measurements were carried out after 7 and, respectively , 11 day s of growth. Different results were noticed for different ferrofluids concentrations: 20, 40, 60, 80 and 100 μl/L. Inhibitory or stimulatory ferrofluids effect was obtained depending on the nature of the investigated enzyme.

  19. Isolation of Cellulolytic Bacteria and Characterization of the Enzyme

    Directory of Open Access Journals (Sweden)

    Nisa Rachmania

    2009-04-01

    Full Text Available Four of cellulolitic bacteria isolates had beencharacterized. The determination of cellulase activity was conducted at the highest production time, using crudeenzymes with the modification of Miller methods (1959 on pure cellulose substrates such as CMC (Carboxymethylcellulose, Avicel and Filter paper Whatman No. 1 as well as agriculture waste such as rice straw, corn cob and bananapeel. Cellulase from C4-4, C5-1, C5-3 and C11-1 showed optimum activity at pH 5, 70°C, pH 3.5, 90°C, pH 5, 80°Cand pH 8, 70°C, respectively. Avicel is a appropriate substrate for C4-4 cellulase whereas CMC for the other three.C11-1 cellulase has the highest cellulase enzyme activity on rice straw substrate whereas C4-4 cellulase on banana peelsubstrates. C5-1 and C5-3 cellulase have relatively low cellulase activities in degrading substrates of agriculture waste.However, isolates of C5-1 and C5-3 have high cellulase activities on banana peel substrates.

  20. 饲粮物理有效中性洗涤纤维水平对8~10月龄奶牛瘤胃发酵参数和纤维降解菌的影响%Effects of Dietary Physically Effective Neutral Detergent Fiber Level on Rumen Fermentation Parameters and Cellulolytic Bacteria of 8 to 10-Month-Old Heifers

    Institute of Scientific and Technical Information of China (English)

    陈青; 王洪荣; 葛汝方; 崔慧慧; 王梦芝; 喻礼怀; 林淼

    2015-01-01

    The objective of this experiment was to evaluate effects of dietary physically effective neutral deter⁃gent fiber ( peNDF) level on rumen fermentation parameters and cellulolytic bacteria of 8 to 10⁃month⁃old heif⁃ers. Twenty⁃four Chinese Holstein heifers with similar month of age and body weight were randomly divided into 4 groups. Heifers were offered one of four diets, which were chemically identical but included different peNDF levels [22.73%, 23.92%, 25.85% and 28.39%] through cutting the roughage of Chinese wildrye into different lengths. The pre⁃test lasted for 10 days, and the test lasted for 60 days. The results showed as fol⁃lows:1) the intakes of dry matter, neutral detergent fiber and acid detergent fiber of heifers were not signifi⁃cantly affected by peNDF level (P>0.05). 2) Rumen fluid pH increased with the increasing peNDF level, 22.73% group was significantly lower than the other 3 groups ( P0.05) , however, with the in⁃creasing of peNDF level, propionate content decreased, and 22. 73% group was significantly higher than 23.92% group (P<0.01) and 28.39% group (P<0.05); the ratio of acetate to propionate of 23.92% group was significantly higher than that of 22.73% group ( P<0.01) and 25.85% group( P<0.05);ammonia⁃N con⁃centration of 25.85% group was significantly higher than that of the other 3 groups ( P<0.01 or P<0.01) . 3) Using 22.73% group as control, the relative content of Fibrobacter succinogene of the other 3 groups was in⁃creased with increasing peNDF level, and that of 28. 39% group was the highest, but was still significantly lower than that of 22.73% group ( P<0.01);with the increasing of peNDF level, the relative content of Rumi⁃nococcus flave faciensk, Ruminococcus Albus and Prevotella rumicola increased initially and then decreased, and the highest contents all appeared in 25.85% group, which were significantly higher than those of the other 3 groups ( P<0.05 or P<0.01) . It is concluded that properly

  1. Unusual nocturnal feeding by Brown Rock-chat Cercomela fusca (Passeriformes: Muscicapidae in Bikaner, Rajasthan, India

    Directory of Open Access Journals (Sweden)

    P. Singh

    2009-04-01

    Full Text Available Brown Rock-chat is a diurnal insectivorous bird commonly associated with human habitations. I report here nocturnal foraging of the species in and around Bikaner in Rajasthan. The birds showed a marked bimodal activity during their nocturnal foraging which peaked in early morning and late evening hours. Bright sodium-vapour lights that attracted a horde of insects during monsoons offered ideal foraging opportunities for the birds. This behavior is explained here as an adaptation to maximize their food intake during the period when the birds breed and their nutritional requirements are naturally high.

  2. Are you my mother? Kin recognition in the ant Formica fusca

    DEFF Research Database (Denmark)

    El-Showk, S; van Zweden, J S; d'Ettorre, P;

    2010-01-01

    In social insects, workers trade personal reproduction for indirect fitness returns from helping their mother rear collateral kin. Colony membership is generally used as a proxy for kin discrimination, but the question remains whether recognition allows workers to discriminate between kin and non...

  3. Effects of the ant Formica fusca on the transmission of microsporidia infecting gypsy moth larvae

    OpenAIRE

    Goertz, Dörte; Hoch, Gernot

    2013-01-01

    Transmission plays an integral part in the intimate relationship between a host insect and its pathogen that can be altered by abiotic or biotic factors. The latter include other pathogens, parasitoids, or predators. Ants are important species in food webs that act on various levels in a community structure. Their social behavior allows them to prey on and transport larger prey, or they can dismember the prey where it was found. Thereby they can also influence the horizontal transmission of a...

  4. Temporal variation in macroinvertebrates associated with intertidal sponge Ircinia fusca (Carter 1880) from Ratnagiri, West coast, India.

    Digital Repository Service at National Institute of Oceanography (India)

    Sivadas, S.K.; Redij, A.G.S.; Sagare, P.; Thakur, N.L.; Ingole, B.S.

    shelter and food2-6. Most of the studies on the sponge-associated fauna have been carried out from the temperate region6. Studies on the sponge-associated organism from Indian coast focussed primarily on microbes and their antimicrobial activity7. Further... the rocks with a scalpel and quickly transferred to plastic bags to prevent the escape of fast-moving associated fauna. In the laboratory, the sponge was macerated to remove the macrofauna present in the pores. Sample was washed on 0.5 mm sieve. Fauna...

  5. A robust and extracellular heme-containing peroxidase from Thermobifida fusca as prototype of a bacterial peroxidase superfamily

    NARCIS (Netherlands)

    van Bloois, Edwin; Pazmino, Daniel E. Torres; Winter, Remko T.; Fraaije, Marco W.

    2010-01-01

    DyP-type peroxidases comprise a novel superfamily of heme-containing peroxidases which is unrelated to the superfamilies of known peroxidases and of which only a few members have been characterized in some detail. Here, we report the identification and characterization of a DyP-type peroxidase (TfuD

  6. Hyper secretion of Thermobifida fusca β-glucosidase via a Tat-dependent signal peptide using Streptomyces lividans

    OpenAIRE

    Miyazaki, Takaya; Noda, Shuhei; Tanaka, Tsutomu; Kondo, Akihiko

    2013-01-01

    Background Protein production as secretory-form is a powerful tool in industrial enzyme production due to the simple purification procedure. Streptomyces lividans is a versatile host for secretory production of useful proteins. In order to expand the amount of secreted protein, signal peptide sequences, which encourage protein secretion from inside cell to extracellular environment, are one of the most significant factors. In this study, we focused on Streptomyces lividans as a host strain to...

  7. Exploring and integrating cellulolytic systems of insects to advance biofuel technology

    Institute of Scientific and Technical Information of China (English)

    Jian-Zhong Sun; Michael E. Scharf

    2010-01-01

    @@ In line with the requirements for sustainable economics and clean environments, cellulose-based biofuels have recently received tremendous attention both in industry and academic communities worldwide.Alternative and renewable fuels derived from lignocellulosic biomass of-fer the potential to reduce our dependence on fossil fuels and mitigate global climate change.

  8. Quantitative analysis of cellulose degradation and growth of cellulolytic bacteria in the rumen

    Science.gov (United States)

    Ruminant animals digest cellulose via a symbiotic relationship with ruminal microorganisms. Because feedstuffs only remain in the rumen for a short time, the rate of cellulose digestion must be very rapid. This speed is facilitated by rumination, a process that returns food to the mouth to be re-...

  9. Diversity of Cellulolytic Microbes and the Biodegradation of Municipal Solid Waste by a Potential Strain

    Directory of Open Access Journals (Sweden)

    S. P. Gautam

    2012-01-01

    Full Text Available Municipal solid waste contains high amounts of cellulose, which is an ideal organic waste for the growth of most of microorganism as well as composting by potential microbes. In the present study, Congo red test was performed for screening of microorganism, and, after selecting a potential strains, it was further used for biodegradation of organic municipal solid waste. Forty nine out of the 250 different microbes tested (165 belong to fungi and 85 to bacteria produced cellulase enzyme and among these Trichoderma viride was found to be a potential strain in the secondary screening. During the biodegradation of organic waste, after 60 days, the average weight losses were 20.10% in the plates and 33.35% in the piles. There was an increase in pH until 20 days. pH however, stabilized after 30 days in the piles. Temperature also stabilized as the composting process progressed in the piles. The high temperature continued until 30 days of decomposition, after which the temperature dropped to 40°C and below during the maturation. Good quality compost was obtained in 60 days.

  10. Linking Hydrolysis Performance to Trichoderma reesei Cellulolytic Enzyme Profile

    DEFF Research Database (Denmark)

    Lehmann, Linda Olkjær; Petersen, Nanna; I. Jørgensen, Christian;

    2016-01-01

    Trichoderma reesei expresses a large number of enzymes involved in lignocellulose hydrolysis and the mechanism of how these enzymes work together is too complex to study by traditional methods, e.g. by spiking with single enzymes and monitoring hydrolysis performance. In this study a multivariate...... approach, partial least squares regression, was used to see if it could help explain the correlation between enzyme profile and hydrolysis performance. Diverse enzyme mixtures were produced by Trichoderma reesei Rut-C30 by exploiting various fermentation conditions and used for hydrolysis of washed...

  11. Do new cellulolytic enzyme preparations affect the industrial strategies for high solids lignocellulosic ethanol production?

    Science.gov (United States)

    Cannella, David; Jørgensen, Henning

    2014-01-01

    Production of ethanol from lignocellulosic materials has a promising market potential, but the process is still only at pilot/demonstration scale due to the technical and economical difficulties of the process. Operating the process at very high solids concentrations (above 20% dry matter-DM) has proven essential for economic feasibility at industrial scale. Historically, simultaneous saccharification and fermentation (SSF) was found to give better ethanol yields compared to separate hydrolysis and fermentation (SHF), but data in literature are typically based on operating the process at low dry matter conditions. In this work the impact of selected enzyme preparation and processing strategy (SHF, presaccharification and simultaneous saccharification and fermentation-PSSF, and SSF) on final ethanol yield and overall performance was investigated with pretreated wheat straw up to 30% DM. The experiments revealed that an SSF strategy was indeed better than SHF when applying an older generation enzyme cocktail (Celluclast-Novozym 188). In case of the newer product Cellic CTec 2, SHF resulted in 20% higher final ethanol yield compared to SSF. It was possible to close the mass balance around cellulose to around 94%, revealing that the most relevant products could be accounted for. One observation was the presence of oxidized sugar (gluconic acid) upon enzymatic hydrolysis with the latest enzyme preparation. Experiments showed gluconic acid formation by recently discovered enzymatic class of lytic polysaccharides monoxygenases (LPMO's) to be depending on the processing strategy. The lowest concentration was achieved in SSF, which could be correlated with less available oxygen due to simultaneous oxygen consumption by the yeast. Quantity of glycerol and cell mass was also depending on the selected processing strategy.

  12. Comparison of different cellulolytic fungi for bioconversion of apple distillery waste

    Energy Technology Data Exchange (ETDEWEB)

    Friedrich, J.; Cimerman, A.; Perdih, A.

    1986-08-01

    The suitability of three ascomycetous fungi, Aspergillus niger, A. awamori and Trichoderma reesei, as well as two basidiomycetes, Pleurotus ostreatus and Phanerochaete chrysosporium, for bioconversion of apple distillery slop was compared. Trichoderma and Phanerochaete degraded raw fibres by 20%, producing filter cakes with 17% to 22% raw protein contents. Aspergillus spp. were superior in filtration time and COD reduction and were of the same efficiency in protein synthesis as Trichoderma and Phanerochaete, but did not degrade fibres. Pleurotus ostreatus did not degrade lignin under fermentation conditions used and could not compete with other fungi due to its slower growth.

  13. [Special effects of a complex probiotic containing cellulolytic bacteria Cellulomonas on actively growing rabbits].

    Science.gov (United States)

    Ushakova, N A; Laktionov, K S; Kozlova, A A; Ratnikova, I A; Gavrilova, N N

    2013-01-01

    It was shown that the association of probiotic bacteria of the genuses Bacillus and Cellulomonas form biolayers on the surface of beet marc particles. The positive effect of a fodder additive that contained the biolayer on the basis of a phytomatrix on the growth and development of young rabbits was shown. Feeding of animals with a mixed fodder that contained 0.1% preparation resulted in stimulation of digestion of all components of the food. Among other components of the mixed fodder, cellulose was digested most effectively. An increase in the biomass of symbiotic bacteria and enzymatic activity in the blindgut chymus was also observed. The positive nitrogen balance demonstrated an increase in the nitrogen content in animals and a decrease of its losses with excretion. The mechanism of response of the rabbit's organism to introduction of the complex probiotic preparation into the digestive tract is discussed.

  14. Diarrhea-associated pathogens, lactobacilli and cellulolytic bacteria in equine feces: responses to antibiotic challenge

    Science.gov (United States)

    Antibiotics are important to equine medicine, but antibiotic-associated diarrhea (AAD) can lead to poor performance and even mortality. AAD is attributed to disruption of the hindgut microbiota, which permits proliferation of pathogenic microbes. The goal of this study was to evaluate the effects o...

  15. Isolation and characterization of Caldicellulosiruptor lactoaceticus sp. nov., an extremely thermophilic, cellulolytic, anaerobic bacterium

    DEFF Research Database (Denmark)

    Mladenovska, Zuzana; Mathrani, Indra M.; Ahring, Birgitte Kiær

    1995-01-01

    and ethanol occurred as minor fermentation products. Only a restricted number of carbon sources (cellulose, xylan, starch, pectin, cellobiose, xylose, maltose and lactose) were used as substrates. During growth on Avicel, the bacterium produced free cellulases with carboxymethylcellulase and avicelase...

  16. Cellulolytic activity of some cellulose-decomposing fungi in salinized soils

    Directory of Open Access Journals (Sweden)

    R. A. Badran

    2014-08-01

    Full Text Available Maximum evolution of CO2 was marked in control soil inoculated by tested fungi but its rate decreased with the increasing salinity. The period of 10 days was most suitable for cellulose degradation by A. niger and P. chrysoecnum and 15 days by A. flavus and C. globosum in control soil. High salinity levels affected greatly the cellulolylic activities of tesled fungi. Carbon content of saline soils increased white the nitrogen content decreased.

  17. Do new cellulolytic enzyme preparations affect the industrial strategies for high solids lignocellulosic ethanol production?

    DEFF Research Database (Denmark)

    Cannella, David; Jørgensen, Henning

    2014-01-01

    Production of ethanol from lignocellulosic materials has a promising market potential, but the process is still only at pilot/demonstration scale due to the technical and economical difficulties of the process. Operating the process at very high solids concentrations (above 20% dry matter—DM) has....... The experiments revealed that an SSF strategy was indeed better than SHF when applying an older generation enzyme cocktail (Celluclast-Novozym 188). In case of the newer product Cellic CTec 2, SHF resulted in 20% higher final ethanol yield compared to SSF. It was possible to close the mass balance around...... matter conditions. In this work the impact of selected enzyme preparation and processing strategy (SHF, presaccharification and simultaneous saccharification and fermentation—PSSF, and SSF) on final ethanol yield and overall performance was investigated with pretreated wheat straw up to 30% DM...

  18. Genomic analysis of the hydrocarbon-producing, cellulolytic, endophytic fungus Ascocoryne sarcoides.

    Directory of Open Access Journals (Sweden)

    Tara A Gianoulis

    Full Text Available The microbial conversion of solid cellulosic biomass to liquid biofuels may provide a renewable energy source for transportation fuels. Endophytes represent a promising group of organisms, as they are a mostly untapped reservoir of metabolic diversity. They are often able to degrade cellulose, and they can produce an extraordinary diversity of metabolites. The filamentous fungal endophyte Ascocoryne sarcoides was shown to produce potential-biofuel metabolites when grown on a cellulose-based medium; however, the genetic pathways needed for this production are unknown and the lack of genetic tools makes traditional reverse genetics difficult. We present the genomic characterization of A. sarcoides and use transcriptomic and metabolomic data to describe the genes involved in cellulose degradation and to provide hypotheses for the biofuel production pathways. In total, almost 80 biosynthetic clusters were identified, including several previously found only in plants. Additionally, many transcriptionally active regions outside of genes showed condition-specific expression, offering more evidence for the role of long non-coding RNA in gene regulation. This is one of the highest quality fungal genomes and, to our knowledge, the only thoroughly annotated and transcriptionally profiled fungal endophyte genome currently available. The analyses and datasets contribute to the study of cellulose degradation and biofuel production and provide the genomic foundation for the study of a model endophyte system.

  19. Isolation of Cellulose-Degrading Bacteria and Determination of Their Cellulolytic Potential

    Directory of Open Access Journals (Sweden)

    Pratima Gupta

    2012-01-01

    Full Text Available Eight isolates of cellulose-degrading bacteria (CDB were isolated from four different invertebrates (termite, snail, caterpillar, and bookworm by enriching the basal culture medium with filter paper as substrate for cellulose degradation. To indicate the cellulase activity of the organisms, diameter of clear zone around the colony and hydrolytic value on cellulose Congo Red agar media were measured. CDB 8 and CDB 10 exhibited the maximum zone of clearance around the colony with diameter of 45 and 50 mm and with the hydrolytic value of 9 and 9.8, respectively. The enzyme assays for two enzymes, filter paper cellulase (FPC, and cellulase (endoglucanase, were examined by methods recommended by the International Union of Pure and Applied Chemistry (IUPAC. The extracellular cellulase activities ranged from 0.012 to 0.196 IU/mL for FPC and 0.162 to 0.400 IU/mL for endoglucanase assay. All the cultures were also further tested for their capacity to degrade filter paper by gravimetric method. The maximum filter paper degradation percentage was estimated to be 65.7 for CDB 8. Selected bacterial isolates CDB 2, 7, 8, and 10 were co-cultured with Saccharomyces cerevisiae for simultaneous saccharification and fermentation. Ethanol production was positively tested after five days of incubation with acidified potassium dichromate.

  20. Improved cellulolytic efficacy in Penicilium decumbens via heterologous expression of Hypocrea jecorina endoglucanase II

    Directory of Open Access Journals (Sweden)

    Qin Yuqi

    2013-01-01

    Full Text Available Hypocrea jecorina endoglucanase II (Hjegl2 was heterologously expressed in Penicillium decumbens (yielding strain Pd::Hjegl2. After induction in cellulose containing media, strain Pd::Hjeg2 displayed increased carboxymethylcellulase activity (CMCase, 5.77 IU/ml, representing a 21% increase and cellulose degradation determined with a filter paper assay (FPA, 0.40 IU/ml, 67% increase, as compared to the parent strain. In media supplemented with glucose (2%, Pd::Hjegl2, displayed 51.2-fold and 3-fold higher CMCase and FPA activities, respectively, as compared to the parent strain. No changes in the expression levels of the four main native cellulase genes of P. decumbens (Pdegl1, Pdegl2, Pdcbh1, and Pdcbh2 were noted between the transformant and wild-type strains. These data support the idea that Hjegl2 cleaves both internal and terminal glycosidic residues, in a relatively random and processive manner. In situ polyacrylamide gelactivity staining of extracts derived from wild-type and Pd::Hjegl2 revealed two additional active fractions in the latter strain; one with a molecular mass ~50-65 KDa and another ~80-116 kDa.

  1. Production of ethanol from lepthochloa fusca L. (kallar grass) and panicum maximum using cellulases from trichoderma SSP and cultures of saccharomyces carlsbergensis

    International Nuclear Information System (INIS)

    Saline sodic soils have been used for production of biomass using salt tolerant grass, kallar grass followed by lesser tolerant plants, namely, sasbania aculeata or Panicum maximum or to provide biomass throughout the year for it utilization for microbial conversion. These substrates have been utilized to produce single cell protein and cellases or hemicellulases. The enzyme titer obtained after growth of cellulomonas biazotea on kallar grass could saccharify wheat straw ad bagasse for subsequent conversion to ethanol but kallar grass itself was saccharified to lesser extent, however, enzyme titres from different fungi could saccherify the biomass produced on saline lands to monomeric sugars. In these studies, the enzyme titre from Trichoderma spp. were used for saccharification purpose. (author)

  2. Genomic, proteomic, and biochemical analyses of oleaginous Mucor circinelloides: evaluating its capability in utilizing cellulolytic substrates for lipid production.

    Directory of Open Access Journals (Sweden)

    Hui Wei

    Full Text Available Lipid production by oleaginous microorganisms is a promising route to produce raw material for the production of biodiesel. However, most of these organisms must be grown on sugars and agro-industrial wastes because they cannot directly utilize lignocellulosic substrates. We report the first comprehensive investigation of Mucor circinelloides, one of a few oleaginous fungi for which genome sequences are available, for its potential to assimilate cellulose and produce lipids. Our genomic analysis revealed the existence of genes encoding 13 endoglucanases (7 of them secretory, 3 β-D-glucosidases (2 of them secretory and 243 other glycoside hydrolase (GH proteins, but not genes for exoglucanases such as cellobiohydrolases (CBH that are required for breakdown of cellulose to cellobiose. Analysis of the major PAGE gel bands of secretome proteins confirmed expression of two secretory endoglucanases and one β-D-glucosidase, along with a set of accessory cell wall-degrading enzymes and 11 proteins of unknown function. We found that M. circinelloides can grow on CMC (carboxymethyl cellulose and cellobiose, confirming the enzymatic activities of endoglucanases and β-D-glucosidases, respectively. The data suggested that M. circinelloides could be made usable as a consolidated bioprocessing (CBP strain by introducing a CBH (e.g. CBHI into the microorganism. This proposal was validated by our demonstration that M. circinelloides growing on Avicel supplemented with CBHI produced about 33% of the lipid that was generated in glucose medium. Furthermore, fatty acid methyl ester (FAME analysis showed that when growing on pre-saccharified Avicel substrates, it produced a higher proportion of C14 fatty acids, which has an interesting implication in that shorter fatty acid chains have characteristics that are ideal for use in jet fuel. This substrate-specific shift in FAME profile warrants further investigation.

  3. Suberin Regulates the Production of Cellulolytic Enzymes in Streptomyces scabiei, the Causal Agent of Potato Common Scab.

    Science.gov (United States)

    Padilla-Reynaud, Rebeca; Simao-Beaunoir, Anne-Marie; Lerat, Sylvain; Bernards, Mark A; Beaulieu, Carole

    2015-01-01

    Suberin, a major constituent of the potato periderm, is known to promote the production of thaxtomins, the key virulence factors of the common scab-causing agent Streptomyces scabiei. In the present study, we speculated that suberin affected the production of glycosyl hydrolases, such as cellulases, by S. scabiei, and demonstrated that suberin promoted glycosyl hydrolase activity when added to cellulose-, xylan-, or lichenin-containing media. Furthermore, secretome analyses revealed that the addition of suberin to a cellulose-containing medium increased the production of glycosyl hydrolases. For example, the production of 13 out of the 14 cellulases produced by S. scabiei in cellulose-containing medium was stimulated by the presence of suberin. In most cases, the transcription of the corresponding cellulase-encoding genes was also markedly increased when the bacterium was grown in the presence of suberin and cellulose. The level of a subtilase-like protease inhibitor was markedly decreased by the presence of suberin. We proposed a model for the onset of S. scabiei virulence mechanisms by both cellulose and suberin, the main degradation product of cellulose that acts as an inducer of thaxtomin biosynthetic genes, and suberin promoting the biosynthesis of secondary metabolites including thaxtomins. PMID:26330095

  4. Effect of extracellular pH on growth and proton motive force of Bacteroides succinogenes, a cellulolytic ruminal bacterium.

    OpenAIRE

    Russell, J B

    1987-01-01

    The utilization of cellulose or cellobiose by Bacteroides succinogenes S85 was severely inhibited at pH values of less than 5.7. Since low pH inhibited the utilization of both cellobiose and cellulose, changes in cellulase activity could not explain the effect. At an extracellular pH of 6.9, the pH gradient (delta pH) across the cell membrane was only 0.07 U. As extracellular pH declined from 6.9 to 5.7, intracellular pH decreased to a smaller extent than extracellular pH and delta pH increas...

  5. Bacterial succession on decomposing leaf litter exhibits a specific occurrence pattern of cellulolytic taxa and potential decomposers of fungal mycelia.

    Science.gov (United States)

    Tláskal, Vojtěch; Voříšková, Jana; Baldrian, Petr

    2016-11-01

    The decomposition of dead plant biomass contributes to the carbon cycle and is one of the key processes in temperate forests. While fungi in litter decomposition drive the chemical changes occurring in litter, the bacterial community appears to be important as well, especially later in the decomposition process when its abundance increases. In this paper, we describe the bacterial community composition in live Quercus petraea leaves and during the subsequent two years of litter decomposition. Members of the classes Alpha-, Beta- and Gammaproteobacteria and the phyla Actinobacteria, Bacteroidetes and Acidobacteria were dominant throughout the experiment. Bacteria present in the oak phyllosphere were rapidly replaced by other taxa after leaf senescence. There were dynamic successive changes in community composition, in which the early-stage (months 2-4), mid-stage (months 6-8) and late-stage (months 10-24) decomposer communities could be distinguished, and the diversity increased with time. Bacteria associated with dead fungal mycelium were important during initial decomposition, with sequence relative abundances of up to 40% of the total bacterial community in months 2 and 4 when the highest fungal biomass was observed. Cellulose-decomposing bacteria were less frequent, with abundance ranging from 4% to 15%. The bacterial community dynamics reflects changes in the availability of possible resources either of the plant or microbial origin. PMID:27543318

  6. In Vitro Inhibition of Cellulolytic Enzymes of Fusarium Oxysporum by Trichoderma spp and Pseudomonas Fluorescens on Arachis Hypogaea L

    OpenAIRE

    P.Rajeswari

    2015-01-01

    In an attempt to develop biocontrol system for management of Fusarium wilt in groundnut, Trichoderma viride, Trichoderma harzianum,and Pseudomonas fluorescens were evaluated for their antagonistic activity against Fusarium oxysporum in vitro. .Fusarium wilt diseasescaused by the fungus Fusarium oxysporum lead to significant yield losses of crops. Experiments were conducted on the effect of culture filtratesof T.viride (1%), T. harzianum (1.5%), and P. fluorescens (2%) on the in vitro inhibiti...

  7. Draft Genome Sequence of Cellulolytic and Xylanolytic Cellulomonas sp. Strain B6 Isolated from Subtropical Forest Soil

    Science.gov (United States)

    Piccinni, Florencia; Murua, Yanina; Ghio, Silvina; Talia, Paola; Rivarola, Máximo

    2016-01-01

    Cellulomonas sp. strain B6 was isolated from a subtropical forest soil sample and presented (hemi)cellulose-degrading activity. We report here its draft genome sequence, with an estimated genome size of 4 Mb, a G+C content of 75.1%, and 3,443 predicted protein-coding sequences, 92 of which are glycosyl hydrolases involved in polysaccharide degradation. PMID:27563050

  8. Temperature and substrate chemistry as major drivers of interregional variability of leaf microbial decomposition and cellulolytic activity in headwater streams.

    Science.gov (United States)

    Fenoy, Encarnación; Casas, J Jesús; Díaz-López, Manuel; Rubio, Juan; Guil-Guerrero, J Luís; Moyano-López, Francisco J

    2016-11-01

    Abiotic factors, substrate chemistry and decomposers community composition are primary drivers of leaf litter decomposition. In soil, much of the variation in litter decomposition is explained by climate and substrate chemistry, but with a significant contribution of the specialisation of decomposer communities to degrade specific substrates (home-field advantage, HFA). In streams, however, HFA effects on litter decomposition have not been explicitly tested. We evaluated responses of microbial decomposition and β-glucosidase activity to abiotic factors, substrate and decomposer assemblages, using a reciprocal litter transplant experiment: 'ecosystem type' (mountain vs lowland streams) × 'litter chemistry' (alder vs reed). Temperature, pH and ionic concentration were higher in lowland streams. Decomposition for both species was faster in lowland streams. Decomposition of reed was more accelerated in lowland compared with mountain streams than that of alder, suggesting higher temperature sensitivity of decomposition in reed. Q10 (5°C-15°C) values of β-glucosidase activity were over 2. The alkaline pH and high ionic concentration of lowland streams depleted enzyme activity. We found similar relationships of decomposition or enzyme activity with abiotic factors for both species, suggesting limited support to the HFA hypothesis. Overall, our results suggest a prime role of temperature interacting with substrate chemistry on litter decomposition. PMID:27515735

  9. Identification of novel glycosyl hydrolases with cellulolytic activity against crystalline cellulose from metagenomic libraries constructed from bacterial enrichment cultures

    OpenAIRE

    Mori, Toshio; Kamei, Ichiro; Hirai, Hirofumi; Kondo, Ryuichiro

    2014-01-01

    To obtain cellulases that are capable of degrading crystalline cellulose and cedar wood, metagenomic libraries were constructed from raw soil sample which was covered to pile of cedar wood sawdust or from its enrichment cultures. The efficiency of screening of metagenomic library was improved more than 3 times by repeating enrichment cultivation using crystalline cellulose as a carbon source, compared with the library constructed from raw soil. Four cellulase genes were obtained from the meta...

  10. Extracellular cellulolytic enzyme system of Aspergillus japonicus: Pt. 2. Purification and characterization of an inducible extracellular. beta. -glucosidase

    Energy Technology Data Exchange (ETDEWEB)

    Sanyal, Arunik; Kundu, R.K.; Dube, S.; Dube, D.K.

    1988-02-01

    A high molecular weight ..beta..-glucosidase (mol. wt. > 240 000 daltons) was isolated from the culture filtrate of Aspergillus japonicus and was finally purified to 86-fold by alcohol precipitation, gel filtration and ion exchange chromatography on Whatman DE-52. An apparently homogeneous form of the enzyme appeared in the polyacrylamide gel electrophoresis. It is capable of utilizing cellobiose, salicin, o-nitrophenyl-..beta..-D-glucoside (ONPG), methyl-..beta..-D-glucoside and amygdalin effectively as substrates but not arbutin, esculin hydrate and phloridzin. No metal ion is required for its catalytic activity. Hg/sup ++/ and p-chloromercuricbenzoate (PCMB) are strong inhibitors for the enzyme. Nojirimycin and glucono-delta-lactone are two competitive inhibitors of the same enzyme, and nojirimycin is the more potent of the two.

  11. WITHDRAWN: Bioaugmentation strategies to improve cellulolytic and hydrogen-producing characteristics of CSTR intermittent fed with vegetable kitchen waste and napiergrass.

    Science.gov (United States)

    Kuo, Wen-Chien; Chao, Yu-Chieh; Wang, Ying-Chi; Hsieh, Ping-Heng; Cheng, Sheng-Shung

    2012-11-15

    This article has been withdrawn at the request of the author(s) and/or editor. The Publisher apologizes for any inconvenience this may cause. The full Elsevier Policy on Article Withdrawal can be found at http://www.elsevier.com/locate/withdrawalpolicy.

  12. The anaerobic fungus Neocallimastix sp. strain L2 : Growth and production of (Hemi)cellulolytic enzymes on a range of carbohydrate substrates

    NARCIS (Netherlands)

    Dijkerman, R; Ledeboer, J; op den Camp, H.J M; Prins, R.A; van der Drift, C

    1997-01-01

    The anaerobic fungus Neocallimastix sp. strain L2, isolated from the feces of a Ilama, was tested for growth on a range of soluble and insoluble carbohydrate substrates. The fungus was able to ferment glucose, cellobiose, fructose, lactose, maltose, sucrose, soluble starch, inulin, filter paper cell

  13. 堆肥中高效纤维素降解菌的筛选与鉴定%Isolation and Identification of Cellulolytic Bacteria for Composting

    Institute of Scientific and Technical Information of China (English)

    李丹花; 乔莉娟; 岳丹; 昝立峰; 段保宁; 白兰所

    2015-01-01

    从邯郸地区堆肥中分离出5株具有纤维素降解能力的菌株,纤维素降解能力的初步鉴定结果显示,M1菌株具有较强的纤维素降解能力.对M1菌株进行分子鉴定和生长特性的初步鉴定,结果表明,M1菌株应当归属于假单胞菌属(Pseudomonas sp.),菌株的温度生长范围为10~45℃,最适生长温度为30℃,pH 6~8菌株均可生长,最适条件为pH 6.

  14. 白蚁肠道共生体的纤维素代谢体系%The termite intestinal symbiont cellulolytic system

    Institute of Scientific and Technical Information of China (English)

    曾文慧; 刘瑞娴; 钟俊鸿

    2010-01-01

    白蚁是大陆生态系统中木质纤维素降解的生力军,其肠道共生系统纤维素酶对纤维素的消化起到了关键的作用.本文概述了白蚁自身及其肠道共生微生物的纤维素水解系统的特点、相互关系以及相互作用的研究进展.

  15. Differential cellulolytic activity of native-form and C-terminal tagged-form cellulase derived from coptotermes formosanus and expressed in E. coli

    Science.gov (United States)

    The endogenous cellulase gene (CfEG3a) of Coptotermes formosanus, an economically important pest termite, was cloned and overexpressed in both native form (nCfEG) and C-terminal His-tagged form (tCfEG) in E.coli. Both forms of recombinant cellulases showed hydrolytic activity on cellulosic substrate...

  16. Characterization of the cellulolytic secretome of Trichoderma harzianum during growth on sugarcane bagasse and analysis of the activity boosting effects of swollenin.

    Science.gov (United States)

    A L Rocha, Vanessa; N Maeda, Roberto; Pereira, Nei; F Kern, Marcelo; Elias, Luisa; Simister, Rachael; Steele-King, Clare; Gómez, Leonardo D; McQueen-Mason, Simon J

    2016-03-01

    This study demonstrates the production of an active enzyme cocktail produced by growing Trichoderma harzianum on sugarcane bagasse. The component enzymes were identified by LCMS-MS. Glycosyl hydrolases were the most abundant class of proteins, representing 67% of total secreted protein. Other carbohydrate active enzymes involved in cell wall deconstruction included lytic polysaccharide mono-oxygenases (AA9), carbohydrate-binding modules, carbohydrate esterases and swollenin, all present at levels of 1%. In total, proteases and lipases represented 5 and 1% of the total secretome, respectively, with the rest of the secretome being made up of proteins of unknown or putative function. This enzyme cocktail was efficient in catalysing the hydrolysis of sugarcane bagasse cellulolignin to fermentable sugars for potential use in ethanol production. Apart from mapping the secretome of T. harzianum, which is a very important tool to understand the catalytic performance of enzyme cocktails, the gene coding for T. harzianum swollenin was expressed in Aspergillus niger. This novel aspect in this work, allowed increasing the swollenin concentration by 95 fold. This is the first report about the heterologous expression of swollenin from T. harzianum, and the findings are of interest in enriching enzyme cocktail with this important accessory protein which takes part in the cellulose amorphogenesis. Despite lacking detectable glycoside activity, the addition of swollenin of T. harzianum increased by two-fold the hydrolysis efficiency of a commercial cellulase cocktail. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:327-336, 2016. PMID:26697775

  17. COMPARED ANALYSIS OF CATALASE AND PEROXIDASE ACTIVITY IN CELLULOLYTIC FUNGUS TRICHODERMA REESEI GROWN ON MEDIUM WITH DIFFERENT CONCENTRATIONS OF GRINDED WHEAT AND BARLEY STRAWS

    Directory of Open Access Journals (Sweden)

    Mihaela Cristica

    2010-09-01

    Full Text Available The purpose of this study was to assess the evolution of catalase and peroxidase activity in Trichoderma reesei grown on medium containing grinded wheat and barley straws. Carbon source of cultivation medium - glucose was replaced by various concentrations of grinded wheat and barley straws, finally resulting three experimental variants as follows: V1 = 20 g/l, V2 = 30 g/l, V3 = 40 g/l. ĂŽn addition to these variants a control sample was added in which composition remainded unchanged. The catalase activity was determined by spectrophotometric Sinha method (Artenie et al., 2008 while peroxidase activity was assesed using the o-dianisidine method (Cojocaru, 2009. Enzymatic determinations were carried out at 7 and 14 days from inoculation, in both fungus mycelium and culture liquid. The enzymatic assay showed significant differences between determinations intervals and work variants. Enzyme activity is influenced by the age of fungus and by the different nature of the substrate used.

  18. Reactor design for minimizing product inhibition during enzymatic lignocellulose hydrolysis: I. Significance and mechanism of cellobiose and glucose inhibition on cellulolytic enzymes

    DEFF Research Database (Denmark)

    Andric, Pavle; Meyer, Anne S.; Jensen, Peter Arendt;

    2010-01-01

    on enzyme-catalyzed cellulose hydrolysis reactions impose significant limitations on the efficiency of lignocellulose conversion especially at high-biomass dry matter conditions. To provide the base for selecting the optimal reactor conditions, this paper reviews the reaction kinetics, mechanisms...... inhibition mechanisms and kinetics. The data show that new strategies that place the bioreactor design at the center stage are required to alleviate the product inhibition and in turn to enhance the efficiency of enzymatic cellulose hydrolysis. Accomplishment of the enzymatic hydrolysis at medium substrate...... concentration in separate hydrolysis reactors that allow continuous glucose removal is proposed to be the way forward for obtaining feasible enzymatic degradation in lignocellulose processing. (C) 2010 Elsevier Inc. All rights reserved....

  19. Persistance of a surrogate for a genetically engineered cellulolytic microorganism and effects on aquatic community and ecosystem properties: Mesocosm and stream comparisons

    International Nuclear Information System (INIS)

    The accidental or deliberate release of genetically engineered microorganisms (GEMs) into the environment raises concerns related to their potential to alter natural processes and biological communities. Research was conducted to determine the persistance of an introduced surrogate for a GEM in lotic habitats, to test the responses to the introduced bacterial, and to evaluate the utility of flowing water mesocosms as tools for assessing the fates and effects of bacteria introduced into streams. Cellulolomonas cellulose-degrading bacteria were selcted as the GEM surrogate because cellulose superdegrader bacteria are being genetically engineered and are of interest to the food and paper industries and in the conversion of biomass to fuels. Cellulomonas densities were determined using fluorescent antibodies, and declined from postinoculation maxima faster in sediments than in Chlorophyta growths and leaf packs. Cellulomonas persisted in leaf packs at densities much greater than background. Cellulomonas had no statistically significant effects on primary productivity, community respiration, photosynthesis/respiration ratios, assimilation ratios, bacterial productivity, and rates of leaf litter decomposition. Cellulase concentrations were positively correlated with Cellulolomonas densities ≥7x108 cells/g dry mass in fresh leaf litter for 2 d following exposure. Mesocosms were good tools for studying bacterial population dynamics in leaf litter and physiological aspects of litter degradation. 45 refs., 8 figs., 5 tabs

  20. Production of cellulolytic enzymes by Aspergillus fumigatus ABK9 in wheat bran-rice straw mixed substrate and use of cocktail enzymes for deinking of waste office paper pulp.

    Science.gov (United States)

    Das, Arpan; Paul, Tanmay; Halder, Suman K; Jana, Arijit; Maity, Chiranjit; Das Mohapatra, Pradeep K; Pati, Bikas R; Mondal, Keshab C

    2013-01-01

    Response surface methodology was employed to optimize mixed substrate solid state fermentation for the production of cellulases and xylanase by Aspergillus fumigatus ABK9. Among 11 different parameters, fermentation time (86-88 h), medium pH (6.1-6.2), substrate amount (10.0-10.5 g) and substrate ratio (wheat bran:rice straw) (1.1) had significantly influences on enzyme production. Under these conditions endoglucanase, β-glucosidase, FPase (filter paper degrading activity) and xylanase activities of 826.2, 255.16, 102.5 and 1130.4 U/g, respectively were obtained. The enzyme cocktail extracted (solid to water ratio of 1:10) from the ferments increased brightness of waste office paper pulp by 82.8% ISO, Ink(D) value by 82.1%, removed chromophores (2.53 OD; A(237)nm) and hydrophobic compounds (1.15 OD; A(465)nm) and also decreased the kappa number to 13.5 from 16.8. PMID:23196251

  1. Draft Genome Sequence of Acinetobacter sp. Strain BMW17, a Cellulolytic and Plant Growth-Promoting Bacterium Isolated from the Rhizospheric Region of Phragmites karka of Chilika Lake, India.

    Science.gov (United States)

    Mishra, Samir R; Ray, Lopamudra; Panda, Ananta Narayan; Sahu, Neha; Xess, Sonal S; Jadhao, Sudhir; Suar, Mrutyunjay; Adhya, Tapan Kumar; Rastogi, Gurdeep; Pattnaik, Ajit Kumar; Raina, Vishakha

    2016-01-01

    We report the 3.16 Mb draft genome of Acinetobacter sp. strain BMW17, a Gram-negative bacterium in the class of Gammaproteobacteria, isolated from the rhizospheric region of Phragmites karka, an invasive weed in Chilika Lake, Odisha, India. The strain BMW17(T) is capable of degrading cellulose and is also an efficient plant growth promoter that can be useful for various phytoremedial and commercial applications. PMID:27365343

  2. Draft Genome Sequence of Acinetobacter sp. Strain BMW17, a Cellulolytic and Plant Growth-Promoting Bacterium Isolated from the Rhizospheric Region of Phragmites karka of Chilika Lake, India

    Science.gov (United States)

    Mishra, Samir R.; Ray, Lopamudra; Panda, Ananta Narayan; Sahu, Neha; Xess, Sonal S.; Jadhao, Sudhir; Suar, Mrutyunjay; Adhya, Tapan Kumar; Rastogi, Gurdeep; Pattnaik, Ajit Kumar

    2016-01-01

    We report the 3.16 Mb draft genome of Acinetobacter sp. strain BMW17, a Gram-negative bacterium in the class of Gammaproteobacteria, isolated from the rhizospheric region of Phragmites karka, an invasive weed in Chilika Lake, Odisha, India. The strain BMW17T is capable of degrading cellulose and is also an efficient plant growth promoter that can be useful for various phytoremedial and commercial applications. PMID:27365343

  3. A standardized description of European Sminthuridae (Collembola, Symphypleona), 2: review of four species of the genera Allacma and Spatulosminthurus

    NARCIS (Netherlands)

    Nayrolles, Pierre

    1994-01-01

    According to our standard of the appendicular chaetotaxy, the following species are redescribed: Allacma fusca (Linné, 1758), Allacma gallica (Carl, 1899), Spatulosminthurus lesnei (Carl, 1899), and Spatulosminthurus betschi Nayrolles, 1990.

  4. Foraminifera from the Chilka Lake on the east coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Rao, K.K.; Jayalakshmy, K.V.; Venugopal, P.; Gopalakrishnan, T.C.; Rajagopal, M.D.

    A total of sixtynine foraminiferal species belonging to 27 genera and 19 families have been identified from the sediment samples of the Chilka lake collected during three faunal surveys representing different seasons. Miliammina fusca, Ammobaculites...

  5. Florae Malseianae Precursores XXV. Notes on Malaysian and some S.E. Asian Cyperaceae VIII

    NARCIS (Netherlands)

    Kern, J.H.

    1960-01-01

    1. Fimbristylis savannicola Kern, spec. nov. — Sect. Fuscae Ohwi. — Fig. 1. Herba perennis, rhizomate lignoso brevissimo vaginis brunneis parce dissolutis circumdato. Culmi caespitosi, erecti, graciles sed firmuli, compressi, sulcati, dense puncticulati, glabri laevesque vel praesertim basin versus

  6. Nepenthes Vogelii (Nepenthaceae): a new species from Sarawak

    NARCIS (Netherlands)

    Schuiteman, A.; Vogel, de E.F.

    2002-01-01

    Nepenthes vogelii Schuit. & de Vogel is described as a new species from Sarawak. It is compared with N. fusca Danser, from which it differs e.g. in the much smaller pitchers, of which the lid lacks appendages.

  7. Enzymatic hydrolysis of PTT polymers and oligomers

    OpenAIRE

    Eberl, A.; Heumann, Sonja; Kotek, R.; Kaufmann, F; Mitscher, S.; Paulo, Artur Cavaco; Gübitz, Georg M.

    2008-01-01

    Oligomers and polymers (film, fabrics) of the linear aromatic polyester poly(trimethylene terephthalate) (PTT) were treated with polyesterases from Thermomyces lanuginosus, Penicillium citrinum, Thermobifida fusca and Fusarium solani pisi. The cutinase from T. fusca was found to release the highest amounts of hydrolysis products from PTT materials and was able to open and hydrolyse a cyclic PTT dimer according to RP-HPLC–UV detection. In contrast, the lipase from T. lanuginosus also showed ac...

  8. DISEÑO DE OLIGONUCLEÓTIDOS PARA EL ESTUDIO DE GENES CELULOLÍTICOS Y SOLVENTOGÉNICOS EN CEPAS COLOMBIANAS DE Clostridiumsp. (CLOSTRIDIACEAE Oligonucleotide Probe Design for the Study of Cellulolytic and Solventogenic Genes in Colombian Clostridiumsp. strains (Clostridiaceae

    Directory of Open Access Journals (Sweden)

    JOSÉ DAVID MONTOYA SOLANO

    Full Text Available El objetivo de este estudio fue analizar las rutas metabólicas para la producción de solventes y degradación de celulosa en cepas colombianas promisorias del género Clostridium. Para ello se diseñaron sondas de hibridación que sirvieran para posteriores estudios de mejoramiento genético de las cepas. Se construyó la base de datos denominada MULTICLOST en Microsoft Access® con las secuencias de 485 genes involucrados en las rutas metabólicas arriba mencionadas, provenientes de 45 especies bacterianas y 10 especies fúngicas. Los genes fueron agrupados de acuerdo al tipo de enzima y a los dominios catalíticos o de unión a sustrato en el caso de las celulasas. Cada grupo se sometió a alineamiento múltiple en ClustalW 1.83 y con base en los resultados se crearon subgrupos de similitud mayor al 50%. Se localizaron secuencias conservadas de longitud mayor a 19 nucleótidos en GeneDoc 2.6.002 y sus valores termodinámicos fueron estimados con GeneRunner v3.05, mientras que la sensibilidad y especificidad fue verificada por búsquedas en GenBank usando BLASTN 2.2.8. En total se obtuvieron 94 secuencias conservadas con las siguientes características: longitud promedio de 24 nucleótidos, Tm promedio de 65,8 ºC y contenido de (G+C entre 14,3 y 60,0%. Se determinó que ninguna de las sondas diseñadas forma estructuras secundarias estables con Tm superior a 36,1 ºC. De acuerdo a sus características y valores termodinámicos, todas las sondas podrían ser utilizadas en la construcción de un microarreglo o en reacciones de PCR para la identificación de regiones relevantes en el mejoramiento del proceso por ingeniería metabólica.The goal of the present study was to analyze the metabolic pathways involved in solvent production and cellulose consumption by promising Colombian native strains of the genus Clostridium. Therefore a set of oligonucleotide probes was designed, with the aim of analyzing potential targets for genetic improvement of the Colombian strains. The database named MULTICLOST was created in Microsoft Access® using the sequences from 485 genes involved in solventogenesis, 1,3propanodiol production and cellulolysis from 45 bacterial and 10 fungal species. The genes were grouped according to their respective enzyme function and to the catalytic domain or the substrate binding domain in the case of cellulases. ClustalW 1.83 was used for multiple alignment of every group. Subgroups of sequences with more than 50% identity among themselves were created. Conserved sequences longer than 19 nucleotides were identified using GeneDoc 2.6.002 and their thermodynamic values were calculated with GeneRunner v3.05, while their sensitivity and specificity were verified by searching in GenBank with BLASTN 2.2.8. Ninetyfour conserved sequences were obtained with an average 24nucleotide length, 65.8ºC average Tm and a (G+C content between 14.3% and 60.0%. None of these probes forms stable secondary structures at temperatures higher than 36.1ºC. According to the former results, all of the probes could be used in an oligonucleotide microarray or in PCR reactions for the identification of metabolic targets for improvement of the industrial process.

  9. Diseño de oligonucléotidos para el estudio de genes celulolíticos y solventogénicos en cepas colombianas de Clostridium sp. (CLOSTRIDIACEAE Oligonucleotide Probe Design for the Study of Cellulolytic and Solventogenic Genes in Colombian Clostridiumsp. strains (Clostridiaceae

    Directory of Open Access Journals (Sweden)

    Suárez Moreno Zulma Rocío

    2007-12-01

    Full Text Available El objetivo de este estudio fue analizar las rutas metabólicas para la producción de solventes y degradación de celulosa en cepas colombianas promisorias del género Clostridium. Para ello se diseñaron sondas de hibridación que sirvieran para posteriores estudios de mejoramiento genético de las cepas. Se construyó la base de datos denominada MULTICLOST en Microsoft Access® con las secuencias de 485 genes involucrados en las rutas metabólicas arriba mencionadas, provenientes de 45 especies bacterianas y 10 especies fúngicas. Los genes fueron agrupados de acuerdo al tipo de enzima y a los dominios catalíticos o de unión a sustrato en el caso de las celulasas. Cada grupo se sometió a alineamiento múltiple en ClustalW 1.83 y con base en los resultados se crearon subgrupos de similitud mayor al 50%. Se localizaron secuencias conservadas de longitud mayor a 19 nucleótidos en GeneDoc 2.6.002 y sus valores termodinámicos fueron estimados con GeneRunner v3.05, mientras que la sensibilidad y especificidad fue verificada por búsquedas en GenBank usando BLASTN 2.2.8. En total se obtuvieron 94 secuencias conservadas con las siguientes características: longitud promedio de 24 nucleótidos, Tm promedio de 65,8 ºC y contenido de (G+C entre 14,3 y 60,0%. Se determinó que ninguna de las sondas diseñadas forma estructuras secundarias estables con Tm superior a 36,1 ºC. De acuerdo a sus características y valores termodinámicos, todas las sondas podrían ser utilizadas en la construcción de un microarreglo o en reacciones de PCR para la identificación de regiones relevantes en el mejoramiento del proceso por ingeniería metabólica.The goal of the present study was to analyze the metabolic pathways involved in solvent production and cellulose consumption by promising Colombian native strains of the genus Clostridium. Therefore a set of oligonucleotide probes was designed, with the aim of analyzing potential targets for genetic improvement of the Colombian strains. The database named MULTICLOST was created in Microsoft Access® using the sequences from 485 genes involved in solventogenesis, 1,3propanodiol production and cellulolysis from 45 bacterial and 10 fungal species. The genes were grouped according to their respective enzyme function and to the catalytic domain or the substrate binding domain in the case of cellulases. ClustalW 1.83 was used for multiple alignment of every group. Subgroups of sequences with more than 50% identity among themselves were created. Conserved sequences longer than 19 nucleotides were identified using GeneDoc 2.6.002 and their thermodynamic values were calculated with GeneRunner v3.05, while their sensitivity and specificity were verified by searching in GenBank with BLASTN 2.2.8. Ninetyfour conserved sequences were obtained with an average 24nucleotide length, 65.8ºC average Tm and a (G+C content between 14.3% and 60.0%. None of these probes forms stable secondary structures at temperatures higher than 36.1ºC. According to the former results, all of the probes could be used in an oligonucleotide microarray or in PCR reactions for the identification of metabolic targets for improvement of the industrial process.

  10. Phylogeny and biogeography of the genus Taractrocera Butler, 1870 (Lepidoptera: Hesperiidae), an example of Southeast Asian-Australian interchange

    NARCIS (Netherlands)

    Jong, de R.

    2004-01-01

    The genus Taractrocera is distributed throughout the Oriental and Australian Regions. It contains 16 species, of which two, T. fusca and T. trikora, are described as new in this paper. All species are briefly characterized and the new species are described in full. The phylogeny of the genus is infe

  11. Two new Grasses from Paraguay

    NARCIS (Netherlands)

    Henrard, J.Th.

    1922-01-01

    Paspalum plumosum, HENR. nov. spec., — Perenne, dense caespitosum. Culmi stricte erecti, 6—9 dm alti, graciles, simplices, teretes, laeves pauci-nodes, nodis paullulo pilosis. Foliorum vaginae subarctae, apice hiantes, leviter compressae, laeves, glabrae, nitentes, striatae, sordide stramineo-fuscae

  12. New xenophytes from Gran Canaria (Canary Islands, Spain), with emphasis on naturalized and (potentially) invasive species

    OpenAIRE

    Verloove, F

    2013-01-01

    Trabajos recientes de campo en Gran Canaria han facilitado el descubrimiento de nuevas localidades para plantas vasculares no nativas. Agave attenuata, Antigonon leptopus, Atriplex nummularia, Cascabela thevetia, Cenchrus echinatus, Cuscuta campestris, Diplachne fusca subsp. uninervia, Diplotaxis tenuifolia, Dysphania anthelmintica (hasta ahora confundida con D. ambrosioides), Eclipta prostrata, Euphorbia pulcherrima, Fagopyrum esculentum, Gossypium barbadense, Lablab purpureus, Lemna minuta,...

  13. Light acclimation and pH perturbations affect photosynthetic performance in

    NARCIS (Netherlands)

    Ihnken, S.; Beardall, J.; Kromkamp, J.C.; Gómez Serrano, C.; Torres, M.A.; Masojídek, J.; Malpartida, I.; Abdala, R.; Gil Jerez, C.; Malapascua, J.R.; Navarro, E.; Rico, R.M.; Peralta, E.; Ferreira Ezequil, J.P.; Lopez Figueroa, F

    2014-01-01

    Chlorella spp. are robust chlorophyte microalgal species frequently used in mass culture. The pH optimum for growth is close to neutrality; at this pH, theoretically little energy is required to maintain homeostasis. In the present study, we grew Chlorella fusca cells in an open, outdoor, thin-layer

  14. Five new species in the idiocerine genus Busonia Distant (Hemiptera: Cicadellidae: Idiocerinae) from Thailand and Malaysia, with one new record from China.

    Science.gov (United States)

    Xue, Qingquan; Zhang, Yalin

    2015-01-01

    Six species in the genus Busonia Distant are described and illustrated, including five new species from Thailand and Malaysia: Busonia curvata, B. fusca, B. lactata, B. micrata, B. serrata, spp. nov., and one newly recorded species from China: Busonia albilateralis Maldonado-Capriles. A redescription of this genus is provided together with a key to species for separation of males.

  15. Phylogenetic relationships among Brazilian howler monkeys, genus Alouatta (Platyrrhini, Atelidae, based on g1-globin pseudogene sequences

    Directory of Open Access Journals (Sweden)

    Carla Maria Meireles

    1999-09-01

    Full Text Available The genus Alouatta (howler monkeys is the most widely distributed of New World primates, and has been arranged in three species groups: the Central American Alouatta palliata group and the South American Alouatta seniculus and Alouatta caraya groups. While the latter is monotypic, the A. seniculus group encompasses at least three species (A. seniculus, A. belzebul and A. fusca. In the present study, approximately 600 base pairs of the g1-globin pseudogene were sequenced in the four Brazilian species (A. seniculus, A. belzebul, A. fusca and A. caraya. Maximum parsimony and maximum likelihood methods yielded phylogenetic trees with the same arrangement: {A. caraya [A. seniculus (A. fusca, A. belzebul]}. The most parsimonious tree had bootstrap values greater than 82% for all groupings, and strength of grouping values of at least 2, supporting the sister clade of A. fusca and A. belzebul. The study also confirmed the presence of a 150-base pair Alu insertion element and a 1.8-kb deletion in the g1-globin pseudogene in A. fusca, features found previously in the remaining three species. The cladistic classification based on molecular data agrees with those of morphological studies, with the monospecific A. caraya group being clearly differentiated from the A. seniculus group.Os guaribas, do gênero Alouatta, que são os primatas do Novo Mundo com maior distribuição geográfica, têm sido colocados em três grupos de espécies: o grupo Alouatta palliata da América central, e os grupos sulamericanos Alouatta seniculus e Alouatta caraya. Este último é monotípico, mas o grupo A. seniculus inclui pelo menos três espécies (A. seniculus, A. belzebul e A. fusca. Neste estudo, foram seqüenciados aproximadamente 600 pares de base do pseudogene globina g1 nas quatro espécies brasileiras (A. seniculus, A. belzebul, A. fusca e A. caraya. Os métodos de máxima parcimônia e máxima verossimilhança produziram árvores filogenéticas com o mesmo arranjo

  16. Novel glycoside hydrolases from thermophilic fungi

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to isolated polypeptides having cellulolytic activity or hemicellulolytic activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of produ...

  17. Draft Genome Sequence of Paenibacillus pini JCM 16418T, Isolated from the Rhizosphere of Pine Tree

    OpenAIRE

    Yuki, Masahiro; Oshima, Kenshiro; Suda, Wataru; Oshida, Yumi; Kitamura, Keiko; Iida, Toshiya; Hattori, Masahira; Ohkuma, Moriya

    2014-01-01

    Paenibacillus pini strain JCM 16418T is a cellulolytic bacterium isolated from the rhizosphere of pine trees. Here, we report the draft genome sequence of this strain. This genome information will be useful for studies of rhizosphere bacteria.

  18. Common and Distant Structural Characteristics of Feruloyl Esterase Families from Aspergillus oryzae

    DEFF Research Database (Denmark)

    Udatha, D. B. R. K. Gupta; Mapelli, Valeria; Panagiotou, Gianni;

    2012-01-01

    Background: Feruloyl esterases (FAEs) are important biomass degrading accessory enzymes due to their capability of cleaving the ester links between hemicellulose and pectin to aromatic compounds of lignin, thus enhancing the accessibility of plant tissues to cellulolytic and hemicellulolytic enzy...

  19. Isolation of Paenibacillus sp. and Variovorax sp. strains from decaying woods and characterization of their potential for cellulose deconstruction

    OpenAIRE

    Ghio, Silvina; Lorenzo, Gonzalo Sabarís Di; Lia, Verónica; Talia, Paola; Cataldi, Angel; Grasso, Daniel; Campos, Eleonora

    2012-01-01

    Prospection of cellulose-degrading bacteria in natural environments allows the identification of novel cellulases and hemicellulases that could be useful in second-generation bioethanol production. In this work, cellulolytic bacteria were isolated from decaying native forest soils by enrichment on cellulose as sole carbon source. There was a predominance of Gram positive isolates that belonged to the phyla Proteobacteria and Firmicutes. Many primary isolates with cellulolytic activity were no...

  20. Isolation and Characterization of Cellulose-decomposing Bacteria Inhabiting Sawdust and Coffee Residue Composts

    OpenAIRE

    Eida, Mohamed Fathallh; Nagaoka, Toshinori; Wasaki, Jun; Kouno, Kenji

    2012-01-01

    Clarifying the identity and enzymatic activities of microorganisms associated with the decomposition of organic materials is expected to contribute to the evaluation and improvement of composting processes. In this study, we examined the cellulolytic and hemicellulolytic abilities of bacteria isolated from sawdust compost (SDC) and coffee residue compost (CRC). Cellulolytic bacteria were isolated using Dubos mineral salt agar containing azurine cross-linked (AZCL) HE-cellulose. Bacterial iden...

  1. Cellulose and hemicellulose decomposition by forest soil bacteria proceeds by the action of structurally variable enzymatic systems

    OpenAIRE

    Rubén López-Mondéjar; Daniela Zühlke; Dörte Becher; Katharina Riedel; Petr Baldrian

    2016-01-01

    Evidence shows that bacteria contribute actively to the decomposition of cellulose and hemicellulose in forest soil; however, their role in this process is still unclear. Here we performed the screening and identification of bacteria showing potential cellulolytic activity from litter and organic soil of a temperate oak forest. The genomes of three cellulolytic isolates previously described as abundant in this ecosystem were sequenced and their proteomes were characterized during the growth o...

  2. Wellington Quaternary palynology

    International Nuclear Information System (INIS)

    Pollen samples from a profile at Taita indicate a grassland environment prior to and immediately after the deposition of the Aokautere Ash (Kawakawa Tephra) approximately 21,000 years B.P. This grassland gradually gave way to a Nothofagus menziesii montane forest followed by an abrupt change to a N. ''Fusca'' group dominant forest which continues to the top of the section. The top few centimetres of the profile may have been deposited in post-European time. The abrupt change in the species of beech represents an unconformity of unknown duration. Pollen samples from a number of profiles at Mangaroa (Wallaceville Swamp) indicate a change from a cool environment (Gramineae plus Phyllocladus) through successive phases of Nothofagus menziesii, Podocarpus species, Dacrydium cupressinum to Nothofagus ''fusca'' group close to the present day. These results are presented in an historical context based on notes left by Dr W.F. Harris, supplemented with additional data by the junior author

  3. Enzymatic hydrolysis of PTT polymers and oligomers.

    Science.gov (United States)

    Eberl, A; Heumann, S; Kotek, R; Kaufmann, F; Mitsche, S; Cavaco-Paulo, A; Gübitz, G M

    2008-05-20

    Oligomers and polymers (film, fabrics) of the linear aromatic polyester poly(trimethylene terephthalate) (PTT) were treated with polyesterases from Thermomyces lanuginosus, Penicillium citrinum, Thermobifida fusca and Fusarium solani pisi. The cutinase from T. fusca was found to release the highest amounts of hydrolysis products from PTT materials and was able to open and hydrolyse a cyclic PTT dimer according to RP-HPLC-UV detection. In contrast, the lipase from T. lanuginosus also showed activity on the PTT fibres and on bis(3-hydroxypropyl) terephthalate (BHPT) but was not able to hydrolyse the polymer film, mono(3-hydroxypropyl) terephthalate (MHPT) nor the cyclic dimer of PTT. As control enzymes inhibited with mercury chloride were used. Surface hydrophilicity changes were investigated with contact angle measurements and the degree of crystallinity changes were determined with DSC. PMID:18405994

  4. New Report on Two Species of the Genus Nipponomysis (Crustacea: Mysida: Mysidae from Korean Waters

    Directory of Open Access Journals (Sweden)

    Kim, Mijin

    2015-01-01

    Full Text Available Two species of mysid, Nipponomysis fusca (Ii, 1936 and N. tenuiculus (Ii, 1940, are newly recorded in Korean fauna. These two species were collected using a light or a bait trap from all coasts of the Korean peninsula. The genus Nipponomysis can be distinguished from allied genus by the following morphological characteristics: third to eighth thoracic endopods with carpopropodus divided into five to six subsegments compared to three subsegments, and anterior four pairs of pleopod in female subequal in length and fifth pair elongated. Nipponomysis fusca is characterized by its acute rostral plate and armature of telson, and N. tenuiculus differs from other species by the number of spine in ventral statocyst region and the shape of the fourth pleopod in male. Herein, we present detailed descriptions of two species from Korean waters with illustrations of morphology. In addition, an identification key to the Korean species of the genus is provided.

  5. Accumulation of recombinant cellobiohydrolase and endoglucanase in the leaves of mature transgenic sugar cane.

    Science.gov (United States)

    Harrison, Mark D; Geijskes, Jason; Coleman, Heather D; Shand, Kylie; Kinkema, Mark; Palupe, Anthony; Hassall, Rachael; Sainz, Manuel; Lloyd, Robyn; Miles, Stacy; Dale, James L

    2011-10-01

    A major strategic goal in making ethanol from lignocellulosic biomass a cost-competitive liquid transport fuel is to reduce the cost of production of cellulolytic enzymes that hydrolyse lignocellulosic substrates to fermentable sugars. Current production systems for these enzymes, namely microbes, are not economic. One way to substantially reduce production costs is to express cellulolytic enzymes in plants at levels that are high enough to hydrolyse lignocellulosic biomass. Sugar cane fibre (bagasse) is the most promising lignocellulosic feedstock for conversion to ethanol in the tropics and subtropics. Cellulolytic enzyme production in sugar cane will have a substantial impact on the economics of lignocellulosic ethanol production from bagasse. We therefore generated transgenic sugar cane accumulating three cellulolytic enzymes, fungal cellobiohydrolase I (CBH I), CBH II and bacterial endoglucanase (EG), in leaves using the maize PepC promoter as an alternative to maize Ubi1 for controlling transgene expression. Different subcellular targeting signals were shown to have a substantial impact on the accumulation of these enzymes; the CBHs and EG accumulated to higher levels when fused to a vacuolar-sorting determinant than to an endoplasmic reticulum-retention signal, while EG was produced in the largest amounts when fused to a chloroplast-targeting signal. These results are the first demonstration of the expression and accumulation of recombinant CBH I, CBH II and EG in sugar cane and represent a significant first step towards the optimization of cellulolytic enzyme expression in sugar cane for the economic production of lignocellulosic ethanol.

  6. Fungal bioconversion of lignocellulosic residues; opportunities & perspectives.

    Science.gov (United States)

    Dashtban, Mehdi; Schraft, Heidi; Qin, Wensheng

    2009-01-01

    The development of alternative energy technology is critically important because of the rising prices of crude oil, security issues regarding the oil supply, and environmental issues such as global warming and air pollution. Bioconversion of biomass has significant advantages over other alternative energy strategies because biomass is the most abundant and also the most renewable biomaterial on our planet. Bioconversion of lignocellulosic residues is initiated primarily by microorganisms such as fungi and bacteria which are capable of degrading lignocellulolytic materials. Fungi such as Trichoderma reesei and Aspergillus niger produce large amounts of extracellular cellulolytic enzymes, whereas bacterial and a few anaerobic fungal strains mostly produce cellulolytic enzymes in a complex called cellulosome, which is associated with the cell wall. In filamentous fungi, cellulolytic enzymes including endoglucanases, cellobiohydrolases (exoglucanases) and beta-glucosidases work efficiently on cellulolytic residues in a synergistic manner. In addition to cellulolytic/hemicellulolytic activities, higher fungi such as basidiomycetes (e.g. Phanerochaete chrysosporium) have unique oxidative systems which together with ligninolytic enzymes are responsible for lignocellulose degradation. This review gives an overview of different fungal lignocellulolytic enzymatic systems including extracellular and cellulosome-associated in aerobic and anaerobic fungi, respectively. In addition, oxidative lignocellulose-degradation mechanisms of higher fungi are discussed. Moreover, this paper reviews the current status of the technology for bioconversion of biomass by fungi, with focus on mutagenesis, co-culturing and heterologous gene expression attempts to improve fungal lignocellulolytic activities to create robust fungal strains. PMID:19774110

  7. Fungal Bioconversion of Lignocellulosic Residues; Opportunities & Perspectives

    Directory of Open Access Journals (Sweden)

    Mehdi Dashtban, Heidi Schraft, Wensheng Qin

    2009-01-01

    Full Text Available The development of alternative energy technology is critically important because of the rising prices of crude oil, security issues regarding the oil supply, and environmental issues such as global warming and air pollution. Bioconversion of biomass has significant advantages over other alternative energy strategies because biomass is the most abundant and also the most renewable biomaterial on our planet. Bioconversion of lignocellulosic residues is initiated primarily by microorganisms such as fungi and bacteria which are capable of degrading lignocellulolytic materials. Fungi such as Trichoderma reesei and Aspergillus niger produce large amounts of extracellular cellulolytic enzymes, whereas bacterial and a few anaerobic fungal strains mostly produce cellulolytic enzymes in a complex called cellulosome, which is associated with the cell wall. In filamentous fungi, cellulolytic enzymes including endoglucanases, cellobiohydrolases (exoglucanases and β-glucosidases work efficiently on cellulolytic residues in a synergistic manner. In addition to cellulolytic/hemicellulolytic activities, higher fungi such as basidiomycetes (e.g. Phanerochaete chrysosporium have unique oxidative systems which together with ligninolytic enzymes are responsible for lignocellulose degradation. This review gives an overview of different fungal lignocellulolytic enzymatic systems including extracellular and cellulosome-associated in aerobic and anaerobic fungi, respectively. In addition, oxidative lignocellulose-degradation mechanisms of higher fungi are discussed. Moreover, this paper reviews the current status of the technology for bioconversion of biomass by fungi, with focus on mutagenesis, co-culturing and heterologous gene expression attempts to improve fungal lignocellulolytic activities to create robust fungal strains.

  8. Phytochemical investigation and antimicrobial activity of Derris scandens

    Directory of Open Access Journals (Sweden)

    Hidayat Hussain

    2015-10-01

    Full Text Available Different fractions of root and stem of Derris scandens demonstrated good antibacterial (Escherichia coli, and Bacillus megaterium, antialgal (Chlorella fusca, and antifungal (Microbotryum violaceum activities. Phytochemical investigation resulted in isolation of scandenin, scandenin A, betulinic acid, lupeol, β-amyran-3-one, β-amyrin, β-sitosterol and ß-sitosterol glucopyranoside. Study showed that scandenin has strong antibacterial activity against B. megaterium and good antifungal and antialgal properties. Scandenin A showed good antibacterial, antifungal and antialgal properties.

  9. Is parasite pressure a driver of chemical cue diversity in ants?

    OpenAIRE

    Martin, Stephen J.; Helanterä, Heikki; Drijfhout, Falko P.

    2010-01-01

    Parasites and pathogens are possibly key evolutionary forces driving recognition systems. However, empirical evidence remains sparse. The ubiquitous pioneering ant Formica fusca is exploited by numerous socially parasitic ant species. We compared the chemical cue diversity, egg and nest mate recognition abilities in two Finnish and two UK populations where parasite pressure is high or absent, respectively. Finnish populations had excellent egg and nest mate discrimination abilities, which wer...

  10. Phylogenetic relationships among Brazilian howler monkeys, genus Alouatta (Platyrrhini, Atelidae), based on g1-globin pseudogene sequences

    OpenAIRE

    Carla Maria Meireles; John Czelusniak; STEPHEN F. FERRARI; Maria Paula Cruz Schneider; Morris Goodman

    1999-01-01

    The genus Alouatta (howler monkeys) is the most widely distributed of New World primates, and has been arranged in three species groups: the Central American Alouatta palliata group and the South American Alouatta seniculus and Alouatta caraya groups. While the latter is monotypic, the A. seniculus group encompasses at least three species (A. seniculus, A. belzebul and A. fusca). In the present study, approximately 600 base pairs of the g1-globin pseudogene were sequenced in the four Brazilia...

  11. ASPECTS CONCERNING THE ENZYMATIC ACTIVITY IN SEVERAL THERMOACTINOMYCETE STRAINS

    Directory of Open Access Journals (Sweden)

    Simona Dunca

    2003-08-01

    Full Text Available In the thermoactinomycete strains subjected to examination the values of their recorded enzymatic activities (i.e. α-amy lase, protease, exo-β-1,4 – glucanase, endo -β-1,4 – glucanase and β-glucosidase were lower in the stationary cultures as compared to the stirred ones. The strain Thermomonospora fusca BB255 was found to be highly cellulase- producing and at the same time able to synthesize α-amy lases and proteases.

  12. Karyological study of three Monocelis-species, and description of a new species from the Mediterranean, Monocelis longistyla sp.n. (Monocelididae, Plathelminthes)

    OpenAIRE

    Martens, P.M.; Curini-Galletti, M.C.

    1987-01-01

    Monocelis longistyla sp.n. from littoral sandy habitats of the Mediterranean is described. The karyotypes of Monocelis fusca, M. lineata and M. longistyla sp.n. were analysed. A basic karyotype for the genus Monocelis is postulated and its probable evolution from the basic karyotype of the family Monocelididae and within the genus is discussed. The karyotype of M. longistyla seems to have evolved from the basic Monocelis karyotype by pericentric inversions. However from the analysis of the ka...

  13. Optimizing cellulase mixtures for maximum rate and extent of hydrolysis. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Walker, L.P.; Wilson, D.B. [Cornell Univ., Ithaca, NY (United States)

    1997-03-01

    Pure Thomomonospora fusca and Trichoderma reesei cellulases and their mixtures were studied to determine the optimal set of cellulases for biomass hydrolysis. The objective was to reduce the cost of cellulase in order to help lower the overall processing cost of the enzymatic conversion of biomass cellulose to sugars, which can then be fermented into fuels and other energy-intensive chemicals. No cellulase mixture was obtained that was much better than the best commercially available preparations. However, the study has greatly increased knowledge of T. fusca cellulases, synergism, and cellulose binding, and provide evidence that future work will produce cellulases with higher activity in degrading crystalline cellulose. T. fusca cellulases may have good industrial potential because: (1) they are compatible with industrial processes that operate at elevated temperatures; (2) they retain 90% of their activity under neutral or basic conditions, which provides a great deal of flexibility in reactor design and operation; and (3) tools are now available to change specific amino acid residues in their catalytic domains and to assess how these changes influence catalysis. 74 refs.

  14. Dominant inheritance of field-evolved resistance to Bt corn in Busseolafusca.

    Directory of Open Access Journals (Sweden)

    Pascal Campagne

    Full Text Available Transgenic crops expressing Bacillus thuringiensis (Bt toxins have been adopted worldwide, notably in developing countries. In spite of their success in controlling target pests while allowing a substantial reduction of insecticide use, the sustainable control of these pest populations is threatened by the evolution of resistance. The implementation of the "high dose/refuge" strategy for managing insect resistance in transgenic crops aims at delaying the evolution of resistance to Bt crops in pest populations by promoting survival of susceptible insects. However, a crucial condition for the "high dose/refuge" strategy to be efficient is that the inheritance of resistance should be functionally recessive. Busseolafusca developed high levels of resistance to the Bt toxin Cry 1Ab expressed in Bt corn in South Africa. To test whether the inheritance of B. fusca resistance to the Bt toxin could be considered recessive we performed controlled crosses with this pest and evaluated its survival on Bt and non-Bt corn. Results show that resistance of B. fusca to Bt corn is dominant, which refutes the hypothesis of recessive inheritance. Survival on Bt corn was not lower than on non-Bt corn for both resistant larvae and the F1 progeny from resistant × susceptible parents. Hence, resistance management strategies of B. fusca to Bt corn must address non-recessive resistance.

  15. Cellulase production by halophytic fungi. Pt. 1. Screening experiments and salt relations

    Energy Technology Data Exchange (ETDEWEB)

    Sallam, L.A.R.; EL-Refai, A.M.H.; El-Sayed, S.M.

    1988-01-01

    The potentiality of 3 local halophytic fungi, isolated from the salt marshes at Burg El-Arab area in the Western Mediterranean Coast of Egypt, to produce cellulose-hydrolysing enzymes has been studied under static culture conditions using 4 different media charged with avicel as a sole carbon source. Ulocladium chartarum was selected as the most potent for cellulase production. This fungus has not been proviously reported to possess cellulolytic activities. Dispensing the basal medium 2 mm depth and incubation of U. chartarum for 3 weeks were the most favourable conditions for best cellulolytic activities. The production of cellulolytic enzymes was markedly affected by the salt supplied and its concentration. Best CMCase and FPase activities (0.289 and 0.043 unit/ml respectively) were noticed on using 60 g Na/sub 2/SO/sub 4//l.

  16. MICROBIAL FERMENTATION OF ABUNDANT BIOPOLYMERS: CELLULOSE AND CHITIN

    Energy Technology Data Exchange (ETDEWEB)

    Leschine, Susan

    2009-10-31

    Our research has dealt with seven major areas of investigation: i) characterization of cellulolytic members of microbial consortia, with special attention recently given to Clostridium phytofermentans, a bacterium that decomposes cellulose and produces uncommonly large amounts of ethanol, ii) investigations of the chitinase system of Cellulomonas uda; including the purification and characterization of ChiA, the major component of this enzyme system, iii) molecular cloning, sequence and structural analysis of the gene that encodes ChiA in C. uda, iv) biofilm formation by C. uda on nutritive surfaces, v) investigations of the effects of humic substances on cellulose degradation by anaerobic cellulolytic microbes, vi) studies of nitrogen metabolism in cellulolytic anaerobes, and vii) understanding the molecular architecture of the multicomplex cellulase-xylanase system of Clostridium papyrosolvens. Also, progress toward completing the research of more recent projects is briefly summarized. Major accomplishments include: 1. Characterization of Clostridium phytofermentans, a cellulose-fermenting, ethanol-producing bacterium from forest soil. The characterization of a new cellulolytic species isolated from a cellulose-decomposing microbial consortium from forest soil was completed. This bacterium is remarkable for the high concentrations of ethanol produced during cellulose fermentation, typically more than twice the concentration produced by other species of cellulolytic clostridia. 2. Examination of the use of chitin as a source of carbon and nitrogen by cellulolytic microbes. We discovered that many cellulolytic anaerobes and facultative aerobes are able to use chitin as a source of both carbon and nitrogen. This major discovery expands our understanding of the biology of cellulose-fermenting bacteria and may lead to new applications for these microbes. 3. Comparative studies of the cellulase and chitinase systems of Cellulomonas uda. Results of these studies indicate

  17. Cultivable microflora and endo mycorrhizas obtained in litter forest (Paramo Guerrero - Finca Puente de Tierra) Zipaquira, Colombia

    International Nuclear Information System (INIS)

    The count of cultivable microorganisms (bacteria and fungi), cellulolytic microorganisms and endo mycorrhizas present in litter forest (property Puente de Tierra) in the Guerrero's moor, Colombia was made. The most frequently isolated microorganisms belonged to the staphylococcus, bacillus, pseudomonas, micrococcus, penicillium and rhodotorulagenus and cladosporium sp., which is a cellulolytic microorganism, was isolated in carboxymethyl cellulose agar. In addition eight morphotypes of endomycorrhizas were found, species of glomus and acaulospora predominated among them. This study contributes with the knowledge of the cultivable microorganisms of litter that have been little explored in moor ecosystems

  18. Development of microorganisms for cellulose-biofuel consolidated bioprocessings: metabolic engineers’ tricks

    Directory of Open Access Journals (Sweden)

    Roberto Mazzoli

    2012-10-01

    Full Text Available Cellulose waste biomass is the most abundant and attractive substrate for "biorefinery strategies" that are aimed to produce high-value products (e.g. solvents, fuels, building blocks by economically and environmentally sustainable fermentation processes. However, cellulose is highly recalcitrant to biodegradation and its conversion by biotechnological strategies currently requires economically inefficient multistep industrial processes. The need for dedicated cellulase production continues to be a major constraint to cost-effective processing of cellulosic biomass.Research efforts have been aimed at developing recombinant microorganisms with suitable characteristics for single step biomass fermentation (consolidated bioprocessing, CBP. Two paradigms have been applied for such, so far unsuccessful, attempts: a “native cellulolytic strategies”, aimed at conferring high-value product properties to natural cellulolytic microorganisms; b “recombinant cellulolytic strategies”, aimed to confer cellulolytic ability to microorganisms exhibiting high product yields and titers.By starting from the description of natural enzyme systems for plant biomass degradation and natural metabolic pathways for some of the most valuable product (i.e. butanol, ethanol, and hydrogen biosynthesis, this review describes state-of-the-art bottlenecks and solutions for the development of recombinant microbial strains for cellulosic biofuel CBP by metabolic engineering. Complexed cellulases (i.e. cellulosomes benefit from stronger proximity effects and show enhanced synergy on insoluble substrates (i.e. crystalline cellulose with respect to free enzymes. For this reason, special attention was held on strategies involving cellulosome/designer cellulosome-bearing recombinant microorganisms.

  19. Screening for cellulose and hemicellulose degrading enzymes from the fungal genus Ulocladium

    DEFF Research Database (Denmark)

    Pedersen, Mads; Hollensted, Morten; Lange, L.;

    2009-01-01

    The fungal genus Ulocladium consists mostly of saprotrophic species and can readily be isolated from dead vegetation, rotten wood. paper, textiles and other cellulose containing materials. Thus, they must produce cellulolytic and hemicellulolytic enzymes. In this study fifty Ulocladium strains fr...

  20. The fate of lignin during hydrothermal pretreatment

    OpenAIRE

    Trajano, Heather L.; Engle, Nancy L.; Foston, Marcus; Ragauskas, Arthur J.; Tschaplinski, Timothy J; Wyman, Charles E

    2013-01-01

    Abstract Background Effective enzymatic hydrolysis of lignocellulosic biomass benefits from lignin removal, relocation, and/or modification during hydrothermal pretreatment. Phase transition, depolymerization/repolymerization, and solubility effects may all influence these lignin changes. To better understand how lignin is altered, Populus trichocarpa x P. deltoides wood samples and cellulolytic enzyme lignin (CEL) isolated from P. trichocarpa x P. de...

  1. Xylanase XYN IV from Trichoderma reesei showing exo- and endo-xylanase activity

    Science.gov (United States)

    A novel xylanase from Trichoderma reesei Rut C30, named XYN IV, was purified from the cellulolytic system of the fungus. The enzyme was discovered on its ability to attack aldotetraohexenuronic acid (HexA-2Xyl-4Xyl-4Xyl, HexA3Xyl3), releasing the reducing-end xylose residue. XYN IV exhibited catalyt...

  2. Evaluation of Minimal Trichoderma reesei Cellulase Mixtures on Differently Pretreated Barley Straw Substrate

    DEFF Research Database (Denmark)

    Rosgaard, Lisa; Pedersen, Sven; Langston, J;

    2007-01-01

    The commercial cellulase product Celluclast 1.5, derived from Trichoderma reesei (Novozymes A/S, Bagsv ae rd, Denmark), is widely employed for hydrolysis of lignocellulosic biomass feedstocks. This enzyme preparation contains a broad spectrum of cellulolytic enzyme activities, most notably...

  3. Evaluation of minimal Trichoderma reesei cellulase mixtures on differently pretreated barley straw substrates

    DEFF Research Database (Denmark)

    Rosgaard, Lisa; Pedersen, Sven; Langston, Jim;

    2007-01-01

    The commercial cellulase product Celluclast 1.5, derived from Trichoderma reesei (Novozymes A/S, Bagsv ae rd, Denmark), is widely employed for hydrolysis of lignocellulosic biomass feedstocks. This enzyme preparation contains a broad spectrum of cellulolytic enzyme activities, most notably...

  4. Draft Genome Sequence of Clostridium sp. Strain W14A Isolated from a Cellulose-Degrading Biofilm in a Landfill Leachate Microcosm

    Science.gov (United States)

    2016-01-01

    Here, we report the draft genome of Clostridium sp. strain W14A, isolated from the anaerobic, cellulolytic biofilm of a cotton string sample incubated in a landfill leachate microcosm. The draft genome comprises 131 contigs, 3,823,510 bp, 51.5% G+C content, and 4,119 predicted coding domain sequences. PMID:27660778

  5. Isolation of Paenibacillus sp. and Variovorax sp. strains from decaying woods and characterization of their potential for cellulose deconstruction.

    Science.gov (United States)

    Ghio, Silvina; Lorenzo, Gonzalo Sabarís Di; Lia, Verónica; Talia, Paola; Cataldi, Angel; Grasso, Daniel; Campos, Eleonora

    2012-01-01

    Prospection of cellulose-degrading bacteria in natural environments allows the identification of novel cellulases and hemicellulases that could be useful in second-generation bioethanol production. In this work, cellulolytic bacteria were isolated from decaying native forest soils by enrichment on cellulose as sole carbon source. There was a predominance of Gram positive isolates that belonged to the phyla Proteobacteria and Firmicutes. Many primary isolates with cellulolytic activity were not pure cultures. From these consortia, isolation of pure constituents was attempted in order to test the hypothesis whether microbial consortia are needed for full degradation of complex substrates. Two isolates, CB1-2-A-5 and VG-4-A-2, were obtained as the pure constituents of CB1-2 and VG-4 consortia, respectively. Based on 16S RNA sequence, they could be classified as Variovorax paradoxus and Paenibacillus alvei. Noteworthy, only VG-4 consortium showed measurable xylan degrading capacity and signs of filter paper degradation. However, no xylan or filter paper degrading capacities were observed for the pure cultures isolated from it, suggesting that other members of this consortium were necessary for these hydrolyzing activities. Our results indicated that Paenibacillus sp. and Variovorax sp. as well as VG-4 consortium, might be a useful source of hydrolytic enzymes. Moreover, although Variovorax sp. had been previously identified in metagenomic studies of cellulolytic communities, this is the first report on the isolation and characterization of this microorganism as a cellulolytic genus. PMID:23301200

  6. Genome Sequence of Citrobacter sp. CtB7.12, Isolated from the Gut of the Desert Subterranean Termite Heterotermes aureus

    Science.gov (United States)

    Fontes-Perez, Héctor; Olvera-García, Myrna; Chávez-Martínez, America; Rodriguez-Almeida, Felipe A.; Arzola-Alvarez, Claudio A.

    2015-01-01

    The draft genome of Citrobacter sp. CtB7.12, isolated from termite gut, is presented here. This organism has been reported as a cellulolytic bacterium, which is biotechnologically important because it can be used as a gene donor for the ethanol and biofuel industries. PMID:26543121

  7. Draft Genome Sequence of Clostridium sp. Strain W14A Isolated from a Cellulose-Degrading Biofilm in a Landfill Leachate Microcosm.

    Science.gov (United States)

    Ransom-Jones, Emma; McDonald, James E

    2016-01-01

    Here, we report the draft genome of Clostridium sp. strain W14A, isolated from the anaerobic, cellulolytic biofilm of a cotton string sample incubated in a landfill leachate microcosm. The draft genome comprises 131 contigs, 3,823,510 bp, 51.5% G+C content, and 4,119 predicted coding domain sequences. PMID:27660778

  8. Biohydrogen Production by the Thermophilic Bacterium Caldicellulosiruptor saccharolyticus: Current Status and Perspectives

    NARCIS (Netherlands)

    Bielen, A.A.M.; Verhaart, M.R.A.; Oost, van der J.; Kengen, S.W.M.

    2013-01-01

    Caldicellulosiruptor saccharolyticus is one of the most thermophilic cellulolytic organisms known to date. This Gram-positive anaerobic bacterium ferments a broad spectrum of mono-, di- and polysaccharides to mainly acetate, CO2 and hydrogen. With hydrogen yields approaching the theoretical limit fo

  9. Correlation between the abundance of cellulolitic fungi and selected soil properties

    Directory of Open Access Journals (Sweden)

    Teresa Korniłłowicz-Kowalska

    2014-08-01

    Full Text Available The study conducted has revealed the general abundance of cellulolytic fungi in the soil is significantly correlated only with the phosphors content. The correlation with specific soil properties was found in the case of the genera Humicola, Penicillium, Fusarium and Chrysosporium of the 10 genera of these fungi isolated most often.

  10. Cellulase hydrolysis of unsorted MSW

    DEFF Research Database (Denmark)

    Jensen, Jacob Wagner; Felby, Claus; Jørgensen, Henning

    2011-01-01

    of calcium, potassium, sodium, chloride and others that may affect cellulolytic enzymes. Cellulase performance showed no effect of adding the metal ion-chelating agent EDTA to the solution. The cellulases were stable, tolerated and functioned in the presence of several contaminants....

  11. Biodegradation of Aliphatic-aromatic Coplyester under Thermophilic Conditions

    Directory of Open Access Journals (Sweden)

    Elsayed B. Belal

    2013-11-01

    Full Text Available The biodegradation of poly (tetramethylene adipate-co-tetramethylene terephthalate (BTA-copolyester as synthetic polyester was investigated under thermophilic conditions. Two efficient BTA degrading actinomycetes were isolated from compost at thermophilic phase. These strains were identified as Thermobifida fusca and Thermobispora bispora. The degradation rate for BTA films within 7 days was 17.12 and 16.96 mg/week.cm2 by T. fusca and T. bispora, respectively. The optimum BTA40:60 degradation conditions are obtained as pH7 and 55°C. The both strains exhibited a wider substrate spectrum as they are able to degrade synthetic polyesters (BTA40:60, PCL-S MaterBi ZF03U/A and natural polymers (poly-&beta-hydroxybutyric acid (PHB and carboxymethyl cellulose. It was shown that the extracellular hydrolyases activity from the both strains was induced in the presence of BTA-copolyester, while the presence of additional carbon sources such as glucose or a complex medium suppressed enzyme formation. Tributyrin as triglycerides was degraded by the both crude concentrated BTA-hydrolases. In contrast the enzyme was not capable to depolymerize the natural polymers PHB and carboxymethyl cellulose, although the organism itself degraded both types of polymers. The obtained results showed that the degradation rate with T. fusca BTA40:60-hydrolase was 3.67 mg/day.cm2 and was 3.5 mg/day.cm2 with T. bispora BTA40:60-hydrolase. The pH optimum for BTA-hydrolases was 7 with 20 and 100 mM phosphate buffer and it was 6 with 150 mM citrate buffer. Finally, it could be concluded that actinomycetes and their hydrolases play an outstanding role in recycling of biodegradable plastics under thermophilic phase during composting process.

  12. Effect of OX-VIRIN versus phytoplankton; Eficacia de OX.VIRIN frente a fitoplancton

    Energy Technology Data Exchange (ETDEWEB)

    Sevilla Miguel, E.; Peleato Sanchez, M. L.; Gomez-Moreno Calera, C.; Oros Monje, J.; Vergara Larrayad, Y.

    2003-07-01

    The effect of the peroxide biocides OX-VIRIN has been tested on the survival of several representative phytoplankton species. Scenedesmus vacuolatus green algae, Anabaena sp. PCC7120 filamentous cyanobacteria and Microcystis aeruginosa PCC7005 unicellular cyanobacteria have been used. The parameters used to control the effectiveness of the biocide have been the chlorophyll determination and re culture. It has been shown that OX-VIRIN at dosages of 0.2, 0.5 and 1% is lethal against Microcystis, Anabaena, and Scenedesmus vacuolatus (formerly called Chlorella fusca), being the first mentioned organisms the most sensible to the biocide. (Author)

  13. The rice GERMINATION DEFECTIVE 1, encoding a B3 domain transcriptional repressor, regulates seed germination and seedling development by integrating GA and carbohydrate metabolism

    OpenAIRE

    Guo, Xiaoli; Hou, Xiaomei; FANG, JUN; Wei, Piwei; Xu, Bo; Chen, Mingluan; Feng, Yuqi; Chu, Chengcai

    2013-01-01

    It has been shown that seed development is regulated by a network of transcription factors in Arabidopsis including LEC1 (LEAFY COTYLEDON1), L1L (LEC1-like) and the B3 domain factors LEC2, FUS3 (FUSCA3) and ABI3 (ABA-INSENSITIVE3); however, molecular and genetic regulation of seed development in cereals is poorly understood. To understand seed development and seed germination in cereals, a large-scale screen was performed using our T–DNA mutant population, and a mutant germination-defective1 ...

  14. Use of Solid Waste from Thermoelectric Plants for the Cultivation of Microalgae

    Directory of Open Access Journals (Sweden)

    Bruna da Silva Vaz

    2016-01-01

    Full Text Available ABSTRACT The aim of this study was to analyze the influence of solid waste on the cultivation of the microalgae Spirulina sp. LEB 18 and Chlorella fusca LEB 111 with 0, 40, 80 and 120 ppm of mineral coal ash. The addition of the ash did not inhibit the cultivation of microalgae at the tested concentrations, showing that it could be used for the cultivation of these microalgae due to the minerals present in the ash, which might substitute the nutrients needed for their growth.

  15. Novos táxons de Lamiinae (Coleoptera, Cerambycidae da América do Sul

    Directory of Open Access Journals (Sweden)

    Maria Helena M. Galileo

    2012-06-01

    Full Text Available Novos táxons descritos: Acanthoderini, Nesozineus osorioensis sp. nov., do Brasil (Rio Grande do Sul; Calliini, Drycothaea clara sp. nov., do Brasil (Rondônia e Drycothaea hovorei sp. nov., do Equador (Napo; Forsteriini, Itacolomi gen. nov., espécie-tipo I. letiziae sp. nov., do Brasil (Minas Gerais; Yapyguara gen. nov., espécie-tipo Y. fusca sp. nov., da Bolívia (Santa Cruz; Xenofreini, Xenofrea zischkai sp. nov., do Equador (Napo e da Bolívia (Santa Cruz.

  16. Basic chromosome numbers and polyploid levels in some South African and Australian grasses (Poaceae

    Directory of Open Access Journals (Sweden)

    J. J. Spies

    1991-12-01

    Full Text Available Chromosome numbers of 46 specimens of grasses, involving 24 taxa from South Africa and Australia, have been determined during the present study. For the first time chromosome numbers are given for Eragrostis sarmentosa (Thunb. Trin. (n = 20. Panicum aequinerve Nees (n = 18,  Digitaria argyrograpta (Nees Stapf (n = 9 and D. maitlandii Stapf & C.E. Hubb. (n = 9. Additional polyploid levels are described for Diplachne fusca (L. Beauv. ex Roem. & Schult. (n = 10 and Digitaria diagonalis (Nees Stapf var.  diagonalis (n = 9.B-chromosomes were observed in several different specimens. The presence of B-chromosomes often results in abnormal chromosomal behaviour during meiosis.

  17. Cloning, Expression and Biochemical Characterization of Endomannanases from Thermobifida Species Isolated from Different Niches.

    Directory of Open Access Journals (Sweden)

    Ákos Tóth

    Full Text Available Thermobifidas are thermotolerant, compost inhabiting actinomycetes which have complex polysaccharide hydrolyzing enzyme systems. The best characterized enzymes of these hydrolases are cellulases from T. fusca, while other important enzymes especially hemicellulases are not deeply explored. To fill this gap we cloned and investigated endomannanases from those reference strains of the Thermobifida genus, which have published data on other hydrolases (T. fusca TM51, T. alba CECT3323, T. cellulosilytica TB100T and T. halotolerans YIM90462T. Our phylogenetic analyses of 16S rDNA and endomannanase sequences revealed that T. alba CECT3323 is miss-classified; it belongs to the T. fusca species. The cloned and investigated endomannanases belong to the family of glycosyl hydrolases 5 (GH5, their size is around 50 kDa and they are modular enzymes. Their catalytic domains are extended by a C-terminal carbohydrate binding module (CBM of type 2 with a 23-25 residues long interdomain linker region consisting of Pro, Thr and Glu/Asp rich repetitive tetrapeptide motifs. Their polypeptide chains exhibit high homology, interdomain sequence, which don't show homology to each other, but all of them are built up from 3-6 times repeated tetrapeptide motifs (PTDP-Tc, TEEP-Tf, DPGT-Th. All of the heterologously expressed Man5A enzymes exhibited activity only on mannan. The pH optima of Man5A enzymes from T. halotolerans, T. cellulosilytica and T. fusca are slightly different (7.0, 7.5 and 8.0, respectively while their temperature optima span within the range of 70-75°C. The three endomannanases exhibited very similar kinetic performances on LBG-mannan substrate: 0.9-1.7mM of KM and 80-120 1/sec of turnover number. We detected great variability in heat stability at 70°C, which was influenced by the presence of Ca2+. The investigated endomannanases might be important subjects for studying the structure/function relation behind the heat stability and for industrial

  18. NUTRITIONAL EVALUATION OF VARIOUS FEEDSTUFFS FOR LIVESTOCK PRODUCTION USING IN VITRO GAS METHOD

    Directory of Open Access Journals (Sweden)

    S. A. KHANUM, T. YAQOOB1, S. SADAF1, M. HUSSAIN, M. A. JABBAR1, H. N. HUSSAIN, R. KAUSAR AND S. REHMAN1

    2007-07-01

    Full Text Available A study was undertaken to evaluate the nutritional quality of some conventional and non-conventional feed resources by using in vitro gas method. Samples of various feedstuffs were analyzed chemically, as well as by in vitro gas method. The feedstuffs having different digestibilities showed significant (P<0.05 differences in the rate and amount of gas production, metabolizable energy (ME and digestibility of organic matter. Predicted metabolizable energy values were very low in feedstuffs having high fiber and low protein contents. These feedstuffs included various grasses, crop residues and wheal straw. Lowest ME value of 4.7 MJ/kg of dry matter (DM was found in wheat straw. Many of the roughages (Sorghum vulgare, Kochia indica, Leptochloa fusca studied were found to be deficient in fermentable carbohydrates, resulting in low organic matter digestibility. Concentrate feed stuffs like cotton seed meal, sunflower meal, cotton seed cakes, rice polish, rapeseed meal and Zea mays (maize grains had higher ME values (9.27 – 12.44 MJ/kg DM. The difference of ME of various feedstuffs reflects different contents of fermentable carbohydrates and available nitrogen in cereals and protein supplements. Among the non-conventional feedstuffs, Acacia ampliceps, Acacia nilotica, Sesbania aculeata, Leptochloa fusca and Prosopis juliflora were found potential fodders. Extensive use of in vitro gas method proved its potential as a tool to evaluate various ruminant feeds for energy component.

  19. On the Amazonian species of the genus Scytodes Latreille (Arachnida, Araneae, Scytodidae

    Directory of Open Access Journals (Sweden)

    Cristina A. Rheims

    2004-09-01

    Full Text Available Eight species of Scytodes Latreille, 1804 are newly described: Scytodes iara sp. nov. and S. caure sp. nov. from Amazonas; S. mapinguari sp. nov. from Amazonas and Roraima; S. curupira sp. nov. from Amazonas and Rondônia; S. saci sp. nov. from Roraima; and S. jurupari sp. nov., S. tinkuan sp. nov. and S. caipora sp. nov. from Acre. In addition, the female of S. altamira Rheims & Brescovit, 2000 is described and new records are presented for S. auricula Rheims & Brescovit, 2000, S. fusca Walckenaer, 1837, S. longipes Lucas, 1844, S. martiusi Brescovit & Höfer, 1999, S. piroca Rheims & Brescovit, 2000, S. romitii Caporiacco, 1947 and S. vieirae Rheims & Brescovit, 2000.Oito novas espécies de Scytodes Latreille, 1804 são descritas: Scytodes iara sp. nov. e S. caure sp. nov. do Amazonas; S. mapinguari sp. nov. do Amazonas e de Roraima; S. curupira sp. nov. do Amazonas e de Rondônia; S. saci sp. nov. de Roraima; e S. jurupari sp. nov., S. tinkuan sp. nov. e S. caipora sp. nov. do Acre. A fêmea de S. altamira Rheims & Brescovit, 2000 é descrita e novos registros são apresentados para S. auricula Rheims & Brescovit, 2000, S. fusca Walckenaer, 1837, S. longipes Lucas, 1844, S. martiusi Brescovit & Höfer, 1999, S. piroca Rheims & Brescovit, 2000, S. romitii Caporiacco, 1947 e S. vieirae Rheims & Brescovit, 2000.

  20. Synergistic effect and application of xylanases as accessory enzymes to enhance the hydrolysis of pretreated bagasse.

    Science.gov (United States)

    Gonçalves, Geisa A L; Takasugi, Yusaku; Jia, Lili; Mori, Yutaro; Noda, Shuhei; Tanaka, Tsutomu; Ichinose, Hirofumi; Kamiya, Noriho

    2015-05-01

    Recently, the new trend in the second-generation ethanol industry is to use mild pretreatments, in order to reduce costs and to keep higher content of hemicellulose in the biomass. Nevertheless, a high enzyme dosage is still required in the conversion of (hemi)cellulose. The interaction between cellulases and xylanases seems to be an effective alternative to reduce enzyme loading in the saccharification process. At first, to evaluate the synergism of xylanases on bagasse degradation, we have produced two xylanases from glycoside hydrolase family 10 (GH10) and three xylanases from glycoside hydrolase family 11 (GH11), from two thermophilic organisms, Thermobifida fusca and Clostridium thermocellum, and one mesophilic organism, Streptomyces lividans. Peracetic acid (PAA) pretreated bagasse was used as substrate. The combination of XynZ-C (GH10, from C. thermocellum), and XlnB (GH11, from S. lividans) presented the highest degree of synergy after 6h (3.62). However, the combination of XynZ-C and Xyn11A (GH11, from T. fusca) resulted in the highest total yield of reducing sugars. To evaluate the synergism between xylanases and cellulases, commercial cellulase preparation from Trichoderma reesei was combined with the selected xylanases, XynZ-C and Xyn11A. About 2-fold increase was observed in the concentration of reducing sugars, when both xylanases, XynZ-C and Xyn11A, were added together with T. reesei cellulases in the reaction mixture.

  1. The antagonistic strain Bacillus subtilis UMAF6639 also confers protection to melon plants against cucurbit powdery mildew by activation of jasmonate- and salicylic acid-dependent defence responses.

    Science.gov (United States)

    García-Gutiérrez, Laura; Zeriouh, Houda; Romero, Diego; Cubero, Jaime; de Vicente, Antonio; Pérez-García, Alejandro

    2013-05-01

    Biological control of plant diseases has gained acceptance in recent years. Bacillus subtilis UMAF6639 is an antagonistic strain specifically selected for the efficient control of the cucurbit powdery mildew fungus Podosphaera fusca, which is a major threat to cucurbits worldwide. The antagonistic activity relies on the production of the antifungal compounds iturin and fengycin. In a previous study, we found that UMAF6639 was able to induce systemic resistance (ISR) in melon and provide additional protection against powdery mildew. In the present work, we further investigated in detail this second mechanism of biocontrol by UMAF6639. First, we examined the signalling pathways elicited by UMAF6639 in melon plants, as well as the defence mechanisms activated in response to P. fusca. Second, we analysed the role of the lipopeptides produced by UMAF6639 as potential determinants for ISR activation. Our results demonstrated that UMAF6639 confers protection against cucurbit powdery mildew by activation of jasmonate- and salicylic acid-dependent defence responses, which include the production of reactive oxygen species and cell wall reinforcement. We also showed that surfactin lipopeptide is a major determinant for stimulation of the immune response. These results reinforce the biotechnological potential of UMAF6639 as a biological control agent.

  2. Is parasite pressure a driver of chemical cue diversity in ants?

    Science.gov (United States)

    Martin, Stephen J; Helanterä, Heikki; Drijfhout, Falko P

    2011-02-22

    Parasites and pathogens are possibly key evolutionary forces driving recognition systems. However, empirical evidence remains sparse. The ubiquitous pioneering ant Formica fusca is exploited by numerous socially parasitic ant species. We compared the chemical cue diversity, egg and nest mate recognition abilities in two Finnish and two UK populations where parasite pressure is high or absent, respectively. Finnish populations had excellent egg and nest mate discrimination abilities, which were lost in the UK populations. The loss of discrimination behaviour correlates with a loss in key recognition compounds (C(25)-dimethylalkanes). This was not owing to genetic drift or different ecotypes since neutral gene diversity was the same in both countries. Furthermore, it is known that the cuticular hydrocarbon profiles of non-host ant species remain stable between Finland and the UK. The most parsimonious explanation for the striking difference in the cue diversity (number of C(25)-dimethylalkanes isomers) between the UK and Finland populations is the large differences in parasite pressure experienced by F. fusca in the two countries. These results have strong parallels with bird (cuckoo) studies and support the hypothesis that parasites are driving recognition cue diversity. PMID:20610426

  3. A dual enzyme system composed of a polyester hydrolase and a carboxylesterase enhances the biocatalytic degradation of polyethylene terephthalate films.

    Science.gov (United States)

    Barth, Markus; Honak, Annett; Oeser, Thorsten; Wei, Ren; Belisário-Ferrari, Matheus R; Then, Johannes; Schmidt, Juliane; Zimmermann, Wolfgang

    2016-08-01

    TfCut2 from Thermobifida fusca KW3 and the metagenome-derived LC-cutinase are bacterial polyester hydrolases capable of efficiently degrading polyethylene terephthalate (PET) films. Since the enzymatic PET hydrolysis is inhibited by the degradation intermediate mono-(2-hydroxyethyl) terephthalate (MHET), a dual enzyme system consisting of a polyester hydrolase and the immobilized carboxylesterase TfCa from Thermobifida fusca KW3 was employed for the hydrolysis of PET films at 60°C. HPLC analysis of the reaction products obtained after 24 h of hydrolysis showed an increased amount of soluble products with a lower proportion of MHET in the presence of the immobilized TfCa. The results indicated a continuous hydrolysis of the inhibitory MHET by the immobilized TfCa and demonstrated its advantage as a second biocatalyst in combination with a polyester hydrolase for an efficient degradation oft PET films. The dual enzyme system with LC-cutinase produced a 2.4-fold higher amount of degradation products compared to TfCut2 after a reaction time of 24 h confirming the superior activity of his polyester hydrolase against PET films. PMID:27214855

  4. The phylogeny of howler monkeys (Alouatta, Platyrrhini): reconstruction by multicolor cross-species chromosome painting.

    Science.gov (United States)

    de Oliveira, Edivaldo H C; Neusser, Michaela; Figueiredo, Wilsea B; Nagamachi, Cleusa; Pieczarka, Julio Cesar; Sbalqueiro, Ives J; Wienberg, Johannes; Müller, Stefan

    2002-01-01

    We performed multidirectional chromosome painting in a comparative cytogenetic study of the three howler monkey species Alouatta fusca, A. caraya and A. seniculus macconnelli (Atelinae, Platyrrhini) in order to reconstruct phylogenetic relationships within this genus. Comparative genome maps between these species were established by multicolor fluorescence in-situ hybridization (FISH) employing human, Saguinus oedipus and Lagothrix lagothricha chromosome-specific probes. The three species included in this study and previously analyzed howler monkey species were subjected to a phylogenetic analysis on the basis of a data matrix comprised of 98 discrete molecular cytogenetic characters. The results revealed that howler monkeys represent the genus with the most extensive karyotype diversity within Platyrrhini so far analyzed with high levels of intraspecific chromosomal variability. Two different multiple sex chromosome systems were identified. The phylogenetic analysis indicated that Alouatta is a monophyletic clade which can be derived from a proposed ancestral Atelinae karyotype of 2n = 62 chromosomes by a chromosome fusion, a fission, a Y-autosomal translocation and a pericentric inversion. Following these suggestions, the genus Alouatta can be divided into two distinct species groups: the first includes A. caraya and A. belzebul, the second A. s. macconnelli, A. sara, A. s. arctoidea and A. fusca. PMID:12575795

  5. Thermophilic, lignocellulolytic bacteria for ethanol production: current state and perspectives

    DEFF Research Database (Denmark)

    Chang, Tinghong; Yao, Shuo

    2011-01-01

    for efficient biomass hydrolysis. Secondly, thermophilic bacteria ferment a broad range of carbohydrates into ethanol, and some of them display potential for ethanologenic fermentation at high yield. Thirdly, the establishment of the genetic tools for thermophilic bacteria has allowed metabolic engineering...... of cellulolytic and saccharolytic thermophilic bacteria for lignocellulosic ethanol production because of their unique properties. First of all, thermophilic bacteria possess unique cellulolytic and hemicellulolytic systems and are considered as potential sources of highly active and thermostable enzymes......, in particular with emphasis on improving ethanol yield, and this facilitates their employment for ethanol production. Finally, different processes for second-generation ethanol production based on thermophilic bacteria have been proposed with the aim to achieve cost-competitive processes. However, thermophilic...

  6. Third Generation Biofuels via Direct Cellulose Fermentation

    Directory of Open Access Journals (Sweden)

    David B. Levin

    2008-07-01

    Full Text Available Consolidated bioprocessing (CBP is a system in which cellulase production, substrate hydrolysis, and fermentation are accomplished in a single process step by cellulolytic microorganisms. CBP offers the potential for lower biofuel production costs due to simpler feedstock processing, lower energy inputs, and higher conversion efficiencies than separate hydrolysis and fermentation processes, and is an economically attractive near-term goal for “third generation” biofuel production. In this review article, production of third generation biofuels from cellulosic feedstocks will be addressed in respect to the metabolism of cellulolytic bacteria and the development of strategies to increase biofuel yields through metabolic engineering.

  7. Degradation of cellulosic biomass and its subsequent utilization for the production of chemical feedstocks. Final report, February 1, 1978-January 31, 1979

    Energy Technology Data Exchange (ETDEWEB)

    None

    1979-01-01

    This is a coordinated program to effect the microbiological degradation of cellulosic biomasses and will focus on the use of anaerobic microorganisms which possess cellulolytic enzyme. The studies will attempt to increase the enzyme levels through genetics, mutation and strain selection. In addition, the direct conversion from cellulosic biomasses to liquid fuel (ethanol) and/or soluble sugars by the cellulolytic, anaerobic organism is also within the scope of this program. Process and engineering scale-up, along with economic analyses, will be performed throughout the course of the program. The second area of our major effort is devoted to the production of chemical feedstocks. In particular, three fermentations have been identified for exploration. These are: acrylic acid, acetone/butanol and acetic acid. The main efforts in these fermentations will address means for the reduction of the cost of manufacturing for these large volume chemicals.

  8. Cellulose digestion in Monochamus marmorator Kby. (coleoptera: Cerambycidae): role of acquired fungal enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Kukol, J.J.; Martin, M.M.

    1986-05-01

    Larvae of the balsam fir sawyer, Monochamus marmorator Kby. (Coleoptera, Cerambycidae), contain midgut digestive enzymes active against hemicellulose and cellulose. Cellulases from larvae fed on balsam fir wood infected with the fungus, Trichoderma harzianum Rifai (Deuteromycetes, Moniliales, Moniliaceae), were found to be identical to those of the cellulase complex produced by this fungus when compared using chromatography, electrophoresis, and isofocusing. When larvae are maintained on a fungusfree diet, their midgut fluids lack cellulolytic activity, and they are unable to digest cellulose. Cellulolytic capacity can be restored by feeding the larvae wood permeated by fungi. We conclude that the enzymes which enable M. marmorator larvae to digest cellulose are not produced by the larvae. Instead, the larvae acquire the capacity to digest cellulose by ingesting active fungal cellulases while feeding in fungus-infected wood.

  9. High-Yield Endoglucanase Production by Trichoderma harzianum IOC-3844 Cultivated in Pretreated Sugarcane Mill Byproduct

    Directory of Open Access Journals (Sweden)

    Aline Machado de Castro

    2010-01-01

    Full Text Available The low-cost production of cellulolytic complexes presenting high action at mild conditions and well-balanced cellulase activities is one of the major bottlenecks for the economical viability of the production of cellulosic ethanol. In the present paper, the filamentous fungus Trichoderma harzianum IOC-3844 was used for the production of cellulases from a pretreated sugarcane bagasse (namely, cellulignin, by submerged fermentation. This fungal strain produced high contents of endoglucanase activity (6,358 U·L−1 after 72 hours of process, and further relevant β-glucosidase and FPase activities (742 and 445 U·L−1, resp.. The crude enzyme extract demonstrated appropriate characteristics for its application in cellulose hydrolysis, such as high thermal stability at up to 50∘C, accessory xylanase activity, and absence of proteolytic activity towards azocasein. This strain showed, therefore, potential for the production of complete cellulolytic complexes aiming at the saccharification of lignocellulosic materials.

  10. Enzyme-Assisted Extraction of Polyphenols From Rose (Rosa Damascena Mill.) Petals

    OpenAIRE

    Kalcheva-Karadzhova Krasimira; Shikov Vasil; Mihalev Kiril; Dobrev Georgi; Ludneva Danka; Penov Nikolai

    2014-01-01

    : The efficiency of enzyme-assisted extraction for the recovery of polyphenols from rose (Rosa damascena Mill.) petals was evaluated performing a simplex centroid experimental design for mixture with three components (pectinolytic, cellulolytic and hemicellulolytic preparation). The ternary enzyme combinations leaded to the highest contents of total polyphenols, reaching 43% higher average value as compared to the control (without enzymatic treatment) sample. Enzymatic treatments also enhance...

  11. Overcoming restriction as a barrier to DNA transformation in Caldicellulosiruptor species results in efficient marker replacement

    OpenAIRE

    Chung, Daehwan; Farkas, Joel; Westpheling, Janet

    2013-01-01

    Background Thermophilic microorganisms have special advantages for the conversion of plant biomass to fuels and chemicals. Members of the genus Caldicellulosiruptor are the most thermophilic cellulolytic bacteria known. They have the ability to grow on a variety of non-pretreated biomass substrates at or near ~80°C and hold promise for converting biomass to bioproducts in a single step. As for all such relatively uncharacterized organisms with desirable traits, the ability to genetically mani...

  12. Selection and a 3-Year Field Trial of Sorangium cellulosum KYC 3262 Against Anthracnose in Hot Pepper

    OpenAIRE

    Yun, Sung-Chul

    2014-01-01

    KYC 3262 was selected as a biocontrol agent against anthracnose on hot pepper from 813 extracts of myxobacterial isolates. Dual culture with Colletotrichum acutatum and 813 myxobacterial extracts was conducted, and 19 extracts were selected that inhibited germination and mycelial growth of C. acutatum. All selections were Sorangium cellulosum, which are cellulolytic myxobacteria from soil. With the infection bioassay on detached fruits in airtight containers, KYC 3262, KYC 3512, KYC 3279, and...

  13. Effects of Condensed Tannins on Endoglucanase Activity and Filter Paper Digestion by Fibrobacter succinogenes S85 †

    OpenAIRE

    Bae, Hee Dong; McAllister, Tim A; Yanke, Jay; Cheng, K.-J.; Muir, A. D.

    1993-01-01

    The effect of condensed tannins from birdsfoot trefoil (Lotus corniculatus L.) on the cellulolytic rumen bacterium Fibrobacter succinogenes S85 was examined. Condensed tannins inhibited endoglucanase activity in the extracellular culture fluid, at concentrations as low as 25 μg ml-1. In contrast, cell-associated endoglucanase activity increased in concentrations of condensed tannins between 100 and 300 μg ml-1. Inhibition of endoglucanase activity in both the extracellular and the cell-associ...

  14. Hidden cellulases in termites: revision of an old hypothesis

    OpenAIRE

    Tokuda, Gaku; Watanabe, Hirofumi

    2007-01-01

    The intestinal flagellates of termites produce cellulases that contribute to cellulose digestion of their host termites. However, 75% of all termite species do not harbour the cellulolytic flagellates; the endogenous cellulase secreted from the midgut tissue has been considered a sole source of cellulases in these termites. Using the xylophagous flagellate-free termites Nasutitermes takasagoensis and Nasutitermes walkeri, we successfully solubilized cellulases present in the hindgut pellets. ...

  15. Identification of thermostable beta-xylosidase activities produced by Aspergillus brasiliensis and Aspergillus niger

    DEFF Research Database (Denmark)

    Pedersen, Mads; Lauritzen, H.K.; Frisvad, Jens Christian;

    2007-01-01

    Twenty Aspergillus strains were evaluated for production of extracellular cellulolytic and xylanolytic activities. Aspergillus brasiliensis, A. niger and A. japonicus produced the highest xylanase activities with the A. brasiliensis and A. niger strains producing thermostable beta-xylosidases. Th...... is a well known enzyme producer, this is the first report of xylanase and thermostable beta-xylosidase production from the newly identified, non-ochratoxin-producing species A. brasiliensis....

  16. Identification of thermostable β-xylosidase activities produced by Aspergillus brasiliensis and Aspergillus niger

    DEFF Research Database (Denmark)

    Pedersen, Mads; Lauritzen, Henrik Klitgaard; Frisvad, Jens Christian;

    2007-01-01

    Twenty Aspergillus strains were evaluated for production of extracellular cellulolytic and xylanolytic activities. Aspergillus brasiliensis, A. niger and A. japonicus produced the highest xylanase activities with the A. brasiliensis and A. niger strains producing thermostable beta-xylosidases. Th...... is a well known enzyme producer, this is the first report of xylanase and thermostable beta-xylosidase production from the newly identified, non-ochratoxin-producing species A. brasiliensis....

  17. Impact of the supramolecular structure of cellulose on the efficiency of enzymatic hydrolysis

    OpenAIRE

    Peciulyte, Ausra; Karlström, Katarina; Larsson, Per Tomas; Olsson, Lisbeth

    2015-01-01

    Background The efficiency of enzymatic hydrolysis is reduced by the structural properties of cellulose. Although efforts have been made to explain the mechanism of enzymatic hydrolysis of cellulose by considering the interaction of cellulolytic enzymes with cellulose or the changes in the structure of cellulose during enzymatic hydrolysis, the process of cellulose hydrolysis is not yet fully understood. We have analysed the characteristics of the complex supramolecular structure of cellulose ...

  18. Study of enzymatic hydrolysis of pretreated biomass at increased solids loading

    OpenAIRE

    Michael Ioelovich; Ely Morag

    2012-01-01

    The effect of biomass loading from 50 to 200 g/L on enzymatic hydrolysis was studied using switchgrass samples pretreated by dilute acid and hypochlorite-alkaline methods. It was confirmed that an increase of initial loading of the pretreated biomass leads to a decrease of enzymatic digestibility, probably due to difficulty of mass transfer of cellulolytic enzymes in the high-viscous substrate slurry and also because of an inhibiting effect of the formed sugars. An additional sharp problem co...

  19. Effort of Increasing Production of Livestock Feed out of Cassava Waste by Identifying the more Suitable Cellulotic Degrading Fungi

    Directory of Open Access Journals (Sweden)

    Yani Suryani

    2012-09-01

    Full Text Available In the bioethanol production process, as much as 90% of waste was produced. The availability of waste production is very important since waste can be processed to become livestock feed. The solid bioethanol waste contains cyanide (HCN 5.8177 mg/kg, water 95,21%, ash 0,39%, protein 8,16%, crude fiber 5,45%, crude fat 2.06%, and carbohydrates 83,94%. Processing bioethanol solid waste into livestock feed can be done by utilizing the existing fungi on bioethanol solid waste. Crude fiber (cellulose and carbohydrates are a source of cellulolytic fungi. Cellulolytic fungi can degrade the role of organic materials contained in bioethanol solid waste, so that it can be made as a source of highly nutritious livestock feed. This study aims to determine the types of cellulolytic fungal isolates contained in bioethanol solid waste which is potentially processed to become livestock woof. Descriptive analysis was employed as a method of the study. Furthermore, Potato Dextrose Agar (PDA was used as a medium for culturing and isolating the fungus. Dilution series and pour plate method were employed to isolate the fungus. And, Moist Chamber method was employed to identify it. In addition, Carboxy Methyl Cellulose (CMC was used as medium to identify cellulolytic fungi. The process was carried out up to the level of genus based on macroscopic and microscopic characterization. 10 fungal isolates from the genus of Aspergillus sp 1, Aspergillus sp 2, Aspergillus sp 3, Aspergillus niger, Cladosporium sp, Mucor sp, Penicillium sp 1, Penicillium sp 2, Rhizopus sp and Trichoderma viride were yielded in this study. The results of examining cellulose enzyme activity revealed that 9 of 10 isolates of the fungus were capable of degrading cellulose. Isolates yielding the largest cellulose enzyme were Trichoderma viride, Penicillium sp 1, Cladosporium sp and Aspergillus niger.

  20. PRODUCTION OF BIOETHANOL FROM AGRICULTURAL WASTE

    OpenAIRE

    W. Braide; I. A. Kanu; S.U. Oranusi; S. A. Adeleye

    2016-01-01

    This study investigates the potential of ethanol production from agro wastes. Agro waste from sugarcane Saccharum officinarum (sugarcane baggasse, sugarcane bark) and maize plant Zea mays (corncob, corn stalk, corn husk) was subjected to a pretreatment process using acid hydrolysis was applied to remove lignin which acts as physical barrier to cellulolytic enzymes. Ethanolic fermentation was done using Saccharomyces cerevisiae for 5days and the ethanol yield, specific gravity, pH and total re...

  1. Influence of Forage Phenolics on Ruminal Fibrolytic Bacteria and In Vitro Fiber Degradation

    OpenAIRE

    Varel, Vincent H.; Jung, Hans-Joachim G.

    1986-01-01

    In vitro cultures of ruminal microorganisms were used to determine the effect of cinnamic acid and vanillin on the digestibility of cellulose and xylan. Cinnamic acid and vanillin depressed in vitro dry matter disappearance of cellulose 14 and 49%, respectively, when rumen fluid was the inoculum. The number of viable Bacteroides succinogenes cells, the predominant cellulolytic organism, was threefold higher for fermentations which contained vanillin than for control fermentations. When xylan ...

  2. Complete Genome Sequence of Herbinix luporum SD1D, a New Cellulose-Degrading Bacterium Isolated from a Thermophilic Biogas Reactor

    Science.gov (United States)

    Koeck, Daniela E.; Maus, Irena; Wibberg, Daniel; Winkler, Anika; Zverlov, Vladimir V.; Liebl, Wolfgang; Pühler, Alfred; Schwarz, Wolfgang H.

    2016-01-01

    A novel cellulolytic bacterial strain was isolated from an industrial-scale biogas plant. The 16S rRNA gene sequence of the strain SD1D showed 96.4% similarity to Herbinix hemicellulosilytica T3/55T, indicating a novel species within the genus Herbinix (family Lachnospiraceae). Here, the complete genome sequence of Herbinix luporum SD1D is reported. PMID:27445379

  3. Requirement of the Type II Secretion System for Utilization of Cellulosic Substrates by Cellvibrio japonicus▿ † ‡

    OpenAIRE

    Gardner, Jeffrey G.; Keating, David H.

    2010-01-01

    Cellulosic biofuels represent a powerful alternative to petroleum but are currently limited by the inefficiencies of the conversion process. While Gram-positive and fungal organisms have been widely explored as sources of cellulases and hemicellulases for biomass degradation, Gram-negative organisms have received less experimental attention. We investigated the ability of Cellvibrio japonicus, a recently sequenced Gram-negative cellulolytic bacterium, to degrade bioenergy-related feedstocks. ...

  4. Cellulase, Clostridia, and Ethanol†

    OpenAIRE

    Demain, Arnold L.; Newcomb, Michael; Wu, J. H. David

    2005-01-01

    Biomass conversion to ethanol as a liquid fuel by the thermophilic and anaerobic clostridia offers a potential partial solution to the problem of the world's dependence on petroleum for energy. Coculture of a cellulolytic strain and a saccharolytic strain of Clostridium on agricultural resources, as well as on urban and industrial cellulosic wastes, is a promising approach to an alternate energy source from an economic viewpoint. This review discusses the need for such a process, the cellulas...

  5. PROTOZOÁRIOS RUMINAIS DE NOVILHOS DE CORTE CRIADOS EM PASTAGEM TROPICAL DURANTE O PERÍODO SECO

    OpenAIRE

    Kellerson Luiz da Silva; Eduardo Robson Duarte; Claudio Eduardo Silva Freitas; Flávia Oliveira Abrão; Luciana Castro Geraseev

    2014-01-01

    Protozoa of the rumen can represent 40% of total nitrogen and 60% of the final product of fermentation and it has cellulolytic activity. This study aimed to quantify and identify the ruminal protozoa populations from steers, raised exclusively on pastures during the dry season in the north of Minas Gerais, Brazil. Samples of ruminal fluid of 36 Nellore steers were collected directly from the rumen immediately after slaughter, during the early, middle or end of the dry season. For protozoa con...

  6. Cellulosomics, a Gene-Centric Approach to Investigating the Intraspecific Diversity and Adaptation of Ruminococcus flavefaciens within the Rumen

    OpenAIRE

    Brulc, Jennifer M; Yeoman, Carl J.; Wilson, Melissa K.; Berg Miller, Margret E.; Patricio Jeraldo; Sadanari Jindou; Nigel Goldenfeld; Flint, Harry J; Raphael Lamed; Ilya Borovok; Maša Vodovnik; Karen E Nelson; Edward A Bayer; Bryan A White

    2011-01-01

    BACKGROUND: The bovine rumen maintains a diverse microbial community that serves to break down indigestible plant substrates. However, those bacteria specifically adapted to degrade cellulose, the major structural component of plant biomass, represent a fraction of the rumen microbiome. Previously, we proposed scaC as a candidate for phylotyping Ruminococcus flavefaciens, one of three major cellulolytic bacterial species isolated from the rumen. In the present report we examine the dynamics a...

  7. Optimisation of Cellulase Production by Penicillium funiculosum in a Stirred Tank Bioreactor Using Multivariate Response Surface Analysis

    OpenAIRE

    Marcelle Lins de Albuquerque de Carvalho; Daniele Fernandes Carvalho; Edelvio de Barros Gomes; Roberto Nobuyuki Maeda; Lidia Maria Melo Santa Anna; Aline Machado de Castro; Nei Pereira

    2014-01-01

    Increasing interest in the production of second-generation ethanol necessitates the low-cost production of enzymes from the cellulolytic complex (endoglucanases, exoglucanases, and β-glucosidases), which act synergistically in cellulose breakdown. The present work aimed to optimise a bioprocess to produce these biocatalysts from the fungus Penicillium funiculosum ATCC11797. A statistical full factorial design (FFD) was employed to determine the optimal conditions for cellulase production. The...

  8. The bacterial population adherent to plant particles in the rumen of reindeer fed lichen, timothy hay or silage

    Directory of Open Access Journals (Sweden)

    Monica Alterskjær Olsen

    1998-02-01

    Full Text Available Male reindeer (Rangifer tarandus tarandus calves taken from a natural winter pasture were given ad lib. access to lichen (n = 3, timothy silage (n = 3 and hay (n = 3 for 7 weeks. Median numbers of viable anaerobic bacteria adherent to the plant particles (cells/g wet weight of rumen solids, growing on a habitat simulating medium (M8V, were significantly higher (P = 0.05 in the rumen of reindeer fed lichen (26.5 x 109- 53.0 x 109 and hay (4.0 x 109- 40.5 x 109, compared to reindeer fed silage (1.15 x 109 - 3.25 x 109. Anaerobic bacterial strains (n = 551 from the plant particles obtained from the rumen of the nine reindeer examined, were isolated using an acid swollen cellulose medium (M8SC and tested for their ability to hydrolyse carboxymethyl cellulose (CMC. The proportion of CMC hydrolysing adherent bacteria isolated from M8SC was significantly higher in reindeer fed hay (21.5% compared ro animals fed lichen (5.3% and silage (2.7% (P = 0.05. The CMC hydrolysing bacterial srrains (n=42 isolated from reindeer fed hay where characterised as non-cellulolytic Butyrivibrio fibrisolvens (9.5%, cellulolytic B. fibrisolvens (50.0%, Clostridium sp. (2.4% and unknowns (38.1%, while CMC hydrolysing strains (n=11 isolated from animals fed lichen and strains (n=4 isolated from animals fed silage where all characterised as B. fibrisolvens. None of the bacterial strains isolated from the rumen solids of reindeer fed lichen or silage were found to be cellulolytic. This study suggests that both lichen and timothy silage have a negative influence, compared to hay, on the numbers of cellulolytic bacteria adherent to the plant particles in the rumen of reindeer.

  9. Biohydrogen Production by the Thermophilic Bacterium Caldicellulosiruptor saccharolyticus: Current Status and Perspectives

    OpenAIRE

    Kengen, Servé W. M.; Verhaart, Marcel R. A.; John van der Oost; Abraham A. M. Bielen

    2013-01-01

    Caldicellulosiruptor saccharolyticus is one of the most thermophilic cellulolytic organisms known to date. This Gram-positive anaerobic bacterium ferments a broad spectrum of mono-, di- and polysaccharides to mainly acetate, CO2 and hydrogen. With hydrogen yields approaching the theoretical limit for dark fermentation of 4 mol hydrogen per mol hexose, this organism has proven itself to be an excellent candidate for biological hydrogen production. This review provides an overview of the resear...

  10. Thermochemical pre- and biological co-treatments to improve hydrolysis and methane production from poultry wastes

    OpenAIRE

    Costa, J.C.; Barbosa, S. G.; Alves, M. M.; Sousa, D.Z.

    2011-01-01

    Poultry industry wastes, namely feathers and poultry litter, are an interesting source of substrate for biogas production. The aim of this work was to assess the biomethane potential of raw poultry wastes, as well as the possibility of enhancing this potential by favouring the hydrolysis of cellulolytic and proteinaceous material in the wastes by using bioaugmentation and thermochemical pre-treatments. Biomethane production from poultry litter and chicken feathers was assessed in batch ass...

  11. Innovative enzymes for bioethanol production from lignocellulosic materials

    OpenAIRE

    Marcolongo, Loredana

    2015-01-01

    The general aim of this work was to add new knowledge on novel hemicellulolytic enzymes involved in the hydrolysis of lignocellulosic materials, considered as a key process for the bioethanol production. Therefore, it is not only focused on (hemi)cellulolytic enzymes from mesophilic fungi and bacteria but also on newly isolated and characterized xylanase and β-xylosidase from the thermophilic bacteria Geobacillus thermodenitrificans A333 and Anoxybacillus sp. 3M, respectively. The cove...

  12. Exo-endo cellulase fusion protein

    Science.gov (United States)

    Bower, Benjamin S.; Larenas, Edmund A.; Mitchinson, Colin

    2012-01-17

    The present invention relates to a heterologous exo-endo cellulase fusion construct, which encodes a fusion protein having cellulolytic activity comprising a catalytic domain derived from a fungal exo-cellobiohydrolase and a catalytic domain derived from an endoglucanase. The invention also relates to vectors and fungal host cells comprising the heterologous exo-endo cellulase fusion construct as well as methods for producing a cellulase fusion protein and enzymatic cellulase compositions.

  13. Kinetic transcriptome analysis reveals an essentially intact induction system in a cellulase hyper-producer Trichoderma reesei strain

    OpenAIRE

    Poggi-Parodi, Dante; Bidard, Frédérique; Pirayre, Aurélie; Portnoy, Thomas; Blugeon, Corinne; Seiboth, Bernhard; Kubicek, Christian P.; Le Crom, Stéphane; Margeot, Antoine

    2014-01-01

    Background The filamentous fungus Trichoderma reesei is the main industrial cellulolytic enzyme producer. Several strains have been developed in the past using random mutagenesis, and despite impressive performance enhancements, the pressure for low-cost cellulases has stimulated continuous research in the field. In this context, comparative study of the lower and higher producer strains obtained through random mutagenesis using systems biology tools (genome and transcriptome sequencing) can ...

  14. Production of Alkaline Cellulase by Fungi Isolated from an Undisturbed Rain Forest of Peru

    OpenAIRE

    Karin Vega; Gretty K. Villena; Sarmiento, Victor H.; Yvette Ludeña; Nadia Vera; Marcel Gutiérrez-Correa

    2012-01-01

    Alkaline cellulase producing fungi were isolated from soils of an undisturbed rain forest of Peru. The soil dilution plate method was used for the enumeration and isolation of fast growing cellulolytic fungi on an enriched selective medium. Eleven out of 50 different morphological colonies were finally selected by using the plate clearing assay with CMC as substrate at different pH values. All 11 strains produced cellulases in liquid culture with activities at alkaline pH values without an ap...

  15. Degradation of cellulosic biomass and its subsequent utilization for the production of chemical feedstocks. Progress report, March 1-August 31, 1980

    Energy Technology Data Exchange (ETDEWEB)

    Wang, D. I.C.

    1980-09-01

    Progress is reported in this coordinated research program to effect the microbiological degradation of cellulosic biomass by anaerobic microorganisms possessing cellulolytic enzymes. Three main areas of research are discussed: increasing enzyme levels through genetics, mutations, and genetic manipulation; the direct conversion of cellulosic biomass to liquid fuel (ethanol); and the production of chemical feedstocks from biomass (acrylic acid, acetone/butanol, and acetic acid). (DMC)

  16. Effect of phytochemical and coconut oil supplementation on rumen ecology and methane production in ruminants

    International Nuclear Information System (INIS)

    Four, native beef cattle were used to determine the effect of phytochemical and coconut oil on rumen ecology and ruminal methane gas. The animals were housed in individual pens and fed with rice straw and concentrate containing 7% coconut oil (CCO) or supplemented with 100g mangosteen peel powder (MSP, Garcinia Mangostana), 100g soap berry tree fruit (SBF, Sapindus rarak) or with no supplement (NS). Feeding regimes lasted for 3 weeks and sampling of feeds, rumen fluid and gas measurements were done during the last 3 days. Animals received SBF had lowest (P 0.75), however, CCO supplemented group had highest (P 0.75. The OM and NDF digestibility were found lowest (P 4 : BW, L/kg) was significantly highest (P 4:BW): %NDF digestibility), it was found that MSP supplemented group had lowest value but were not significantly different when compared with control and SBF supplemented groups. These results were similar with methane gas production per % NDF digestibility. Quantification of the three predominant cellulolytic bacteria by using real time PCR technique are shown. It was found that CCO supplementation influenced on three species (P < 0.05) and resulted in lower (P < 0.05) total cellulolytic bacterial population. These results reflected on lower OM and NDF digestibility. However, MSP supplemented group had greatest in cellulolytic bacteria population. Supplementation had resulted in variable population of cellulolytic bacteria (P < 0.05), which corresponded with Ngamsaeng et al., who reported that MSP supplementation increased (P < 0.05) bacterial population and total count of bacteria and was highest at 150 g/hd/d. Quantification of Methanogenes population was found that SBF and CCO supplementation could decrease the population, particularly, SBF supplementation had resulted in lowest value (P < 0.05). Based on this study, use of phytochemicals showed potential effect on rumen manipulation especially supplementation with 100 g of mangosteen peel powder

  17. Elucidation of the recognition mechanisms for hemicellulose and pectin in Clostridium cellulovorans using intracellular quantitative proteome analysis

    OpenAIRE

    Aburaya, Shunsuke; Esaka, Kohei; Morisaka, Hironobu; Kuroda, Kouichi; Ueda, Mitsuyoshi

    2015-01-01

    Clostridium cellulovorans is an anaerobic, cellulolytic bacterium, capable of effectively degrading and metabolizing various types of substrates, including cellulose, hemicellulose (xylan and galactomannan), and pectin. Among Clostridia, this ability to degrade and metabolize a wide range of hemicellulose and pectin substrates is a unique feature; however, the mechanisms are currently unknown. To clarify the mechanisms of hemicelluloses and pectin recognition and metabolism, we carried out a ...

  18. Utilization of Enzymatically Hydrolyzed Wood Hemicelluloses by Microorganisms for Production of Liquid Fuels

    OpenAIRE

    Saddler, John N.; Yu, Ernest K. C.; Mes-Hartree, Mary; Levitin, Norm; Brownell, Harold H.

    1983-01-01

    Hemicellulose-derived sugars were obtained from a variety of pretreated wood substrates such as water-soluble fractions from steam-exploded aspen, solvent-extracted aspen, and commercial xylan. These fractions were enzymatically hydrolyzed by commercial enzyme preparations and by the culture filtrates of eight highly cellulolytic fungi. The sugars released were assayed by high-pressure liquid chromatography. Over 30% of the hemicellulose fractions, at a 10% substrate concentration, could be h...

  19. Synergism in Degradation and Utilization of Intact Forage Cellulose, Hemicellulose, and Pectin by Three Pure Cultures of Ruminal Bacteria †

    OpenAIRE

    Osborne, J. M.; Dehority, B. A.

    1989-01-01

    Pure cultures of ruminal bacteria characterized as using only a single forage polysaccharide (Fibrobacter succinogenes A3c, cellulolytic; Bacteroides ruminicola H2b, hemicellulolytic; Lachnospira multiparus D15d, pectinolytic) were inoculated separately and in all possible combinations into fermentation tubes containing orchard grass as the sole substrate. Fermentations were run to completion, and then cultures were analyzed for digestion of cellulose plus degradation and utilization of hemic...

  20. Aspects of the life history strategies of the Teredinidae

    OpenAIRE

    Shipway, John Reuben

    2013-01-01

    The Teredinidae are a major economic pest of wooden coastal structures, causing billions of Dollars worth of damage per annum. To fully understand the threat posed by teredinids it is necessary to examine their biology at a number of different levels. These include: the anatomical adaptations which facilitate their wood-boring and wood- feeding life-style; the mechanism of cellulose digestion, which is aided by cellulolytic symbionts retained in bacteriocytes on the teredinid gill; the early ...

  1. Bacteriocin-resistant mutants of Erwinia chrysanthemi: possible involvement of iron acquisition in phytopathogenicity.

    Science.gov (United States)

    Expert, D; Toussaint, A

    1985-07-01

    A series of bacteriocin-resistant mutants of Erwinia chrysanthemi 3937JRH were unable to elicit soft-rot symptoms on saintpaulia plants. The loss of pathogenicity was correlated with the disappearance of one to three outer membrane polypeptides (molecular weights, about 80,000 to 90,000) whose production in wild-type strains was greatly enhanced under iron-limited growth conditions. The mutants did not exhibit altered extracellular pectinolytic or cellulolytic activities. PMID:4008442

  2. Enzymatic Hydrolysis of Lignocelluloses

    DEFF Research Database (Denmark)

    Kolasa, Marta; Ahring, Birgitte Kiær; Lübeck, Peter Stephensen;

    2010-01-01

    bonds. Cellulose can be degraded to simple sugar components by means of enzymatic hydrolysis. However, due to its complex, crystalline structure it is difficult to break it down and the cooperative action of a variety of cellulolytic enzymes is necessary. Fungi are known to have potential in production...... genes which subsequently will be cloned and expressed in a relevant fungal host for further characterization of the expressed enzymes. The goal is to introduce new enzymes to industrial processes....

  3. Enzymatic hydrolysis of lignocelluloses: Identification of novel cellulase genes from filamentous fungi

    DEFF Research Database (Denmark)

    Kolasa, Marta; Ahring, Birgitte Kiær; Lübeck, Peter Stephensen;

    2010-01-01

    bonds. Cellulose can be degraded to simple sugar components by means of enzymatic hydrolysis. However, due to its complex, crystalline structure it is difficult to break it down and the cooperative action of a variety of cellulolytic enzymes is necessary. Fungi are known to have potential in production...... genes which subsequently will be cloned and expressed in a relevant fungal host for further characterization of the expressed enzymes. The goal is to introduce new enzymes to industrial processes....

  4. fSpatial and temporal dynamics of cellulose degradation and biofilm formation by Caldicellulosiruptor obsidiansis and Clostridium thermocellum

    OpenAIRE

    Wang, Zhi-Wu; Lee, Seung-Hwan; Elkins, James G; Morrell-Falvey, Jennifer L.

    2011-01-01

    Cellulose degradation is one of the major bottlenecks of a consolidated bioprocess that employs cellulolytic bacterial cells as catalysts to produce biofuels from cellulosic biomass. In this study, we investigated the spatial and temporal dynamics of cellulose degradation by Caldicellulosiruptfor obsidiansis, which does not produce cellulosomes, and Clostridium thermocellum, which does produce cellulosomes. Results showed that the degradation of either regenerated or natural cellulose was syn...

  5. Complete Genome Sequence of Herbinix luporum SD1D, a New Cellulose-Degrading Bacterium Isolated from a Thermophilic Biogas Reactor.

    Science.gov (United States)

    Koeck, Daniela E; Maus, Irena; Wibberg, Daniel; Winkler, Anika; Zverlov, Vladimir V; Liebl, Wolfgang; Pühler, Alfred; Schwarz, Wolfgang H; Schlüter, Andreas

    2016-01-01

    A novel cellulolytic bacterial strain was isolated from an industrial-scale biogas plant. The 16S rRNA gene sequence of the strain SD1D showed 96.4% similarity to Herbinix hemicellulosilytica T3/55(T), indicating a novel species within the genus Herbinix (family Lachnospiraceae). Here, the complete genome sequence of Herbinix luporum SD1D is reported. PMID:27445379

  6. Synergistic and Dose-Controlled Regulation of Cellulase Gene Expression in Penicillium oxalicum.

    Science.gov (United States)

    Li, Zhonghai; Yao, Guangshan; Wu, Ruimei; Gao, Liwei; Kan, Qinbiao; Liu, Meng; Yang, Piao; Liu, Guodong; Qin, Yuqi; Song, Xin; Zhong, Yaohua; Fang, Xu; Qu, Yinbo

    2015-09-01

    Filamentous fungus Penicillium oxalicum produces diverse lignocellulolytic enzymes, which are regulated by the combinations of many transcription factors. Here, a single-gene disruptant library for 470 transcription factors was constructed and systematically screened for cellulase production. Twenty transcription factors (including ClrB, CreA, XlnR, Ace1, AmyR, and 15 unknown proteins) were identified to play putative roles in the activation or repression of cellulase synthesis. Most of these regulators have not been characterized in any fungi before. We identified the ClrB, CreA, XlnR, and AmyR transcription factors as critical dose-dependent regulators of cellulase expression, the core regulons of which were identified by analyzing several transcriptomes and/or secretomes. Synergistic and additive modes of combinatorial control of each cellulase gene by these regulatory factors were achieved, and cellulase expression was fine-tuned in a proper and controlled manner. With one of these targets, the expression of the major intracellular β-glucosidase Bgl2 was found to be dependent on ClrB. The Bgl2-deficient background resulted in a substantial gene activation by ClrB and proved to be closely correlated with the relief of repression mediated by CreA and AmyR during cellulase induction. Our results also signify that probing the synergistic and dose-controlled regulation mechanisms of cellulolytic regulators and using it for reconstruction of expression regulation network (RERN) may be a promising strategy for cellulolytic fungi to develop enzyme hyper-producers. Based on our data, ClrB was identified as focal point for the synergistic activation regulation of cellulase expression by integrating cellulolytic regulators and their target genes, which refined our understanding of transcriptional-regulatory network as a "seesaw model" in which the coordinated regulation of cellulolytic genes is established by counteracting activators and repressors. PMID:26360497

  7. Production and characterization of an enzyme complex from a new strain of Clostridium thermocellum with emphasis on its xylanase activity Produção e caracterização de um complexo enzimático de uma nova linhagem de Clostridium thermocellum com enfase em sua atividade de xilanase

    OpenAIRE

    Werner Bessa Vieira; Leonora Rios de Souza Moreira; Amadeu Monteiro Neto; Edivaldo Ximenes Ferreira Filho

    2007-01-01

    A new bacterial strain (ISO II) was isolated from manure cow and identified as phylogenetically close to the thermophilic cellulolytic bacterium Clostridium thermocellum. The new strain produced extracellular xylanase, pectinase, mannanase and cellulase activities when grown in liquid culture medium containing banana stem as carbon source. The enzyme production profile after growth on banana stem showed that xylanase and cellulase activities were detected in different incubation periods. An e...

  8. A study of over-production and enhanced secretion of enzymes. Quarterly report 2

    Energy Technology Data Exchange (ETDEWEB)

    Dashek, W.V.

    1993-04-08

    This project is concerned with the over-production of ligno-cellulolytic enzymes which are relevant to the paper-pulp industry and agricultural community. Since ligno-cellulosics are components of wood, the project involves the forest, a renewable energy resource. Attention is focused on the following: over-production of polyphenol oxidase; establishment of the route of polyphenol oxidase secretion; regulation of polyphenol oxidase secretion; purification of extracellular oxidase.

  9. Lignocellulose-based bioproducts

    CERN Document Server

    Karimi, Keikhosro

    2015-01-01

    This volume provides the technical information required for the production of biofuels and chemicals from lignocellulosic biomass. It starts with a brief overview of the importance, applications, and production processes of different lignocellulosic products. Further chapters review the perspectives of waste-based biofuels and biochemicals; the pretreatment of lignocellulosic biomass for biofuel production; cellulolytic enzyme systems for the hydrolysis of lignocelluloses; and basic and applied aspects of the production of bioethanol, biogas, biohydrogen, and biobutanol from lignocelluloses.

  10. Cellulose fermentation by nitrogen-fixing anaerobic bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Canale-Parola, E.

    1992-12-13

    In anaerobic natural environments cellulose is degraded to methane, carbon dioxide and other products by the combined activities of many diverse microorganisms. We are simulating processes occurring in natural environments by constructing biologically-defined, stable, heterogeneous bacterial communities (consortia) that we use as in vitro systems for quantitative studies of cellulose degradation under conditions of combined nitrogen deprivation. These studies include the investigation of (i) metabolic interactions among members of cellulose-degrading microbial populations, and (ii) processes that regulate the activity or biosynthesis of cellulolytic enzymes. In addition, we are studying the sensory mechanisms that, in natural environments, may enable motile cellulolytic bacteria to migrate toward cellulose. This part of our work includes biochemical characterization of the cellobiose chemoreceptor of cellulolytic bacteria. Finally, an important aspect of our research is the investigation of the mechanisms by which multienzyme complexes of anaerobic bacteria catalyze the depolymerization of crystalline cellulose and of other plant cell wall polysacchaddes. The research will provide fundamental information on the physiology and ecology of cellulose-fermenting, N{sub 2}-fixing bacteria, and on the intricate processes involved in C and N cycling in anaerobic environments. Furthermore, the information will be valuable for the development of practical applications, such as the conversion of plant biomass (e.g., agricultural, forestry and municipal wastes) to automotive fuels such as ethanol.

  11. Degradation of cellulose by basidiomycetous fungi.

    Science.gov (United States)

    Baldrian, Petr; Valásková, Vendula

    2008-05-01

    Cellulose is the main polymeric component of the plant cell wall, the most abundant polysaccharide on Earth, and an important renewable resource. Basidiomycetous fungi belong to its most potent degraders because many species grow on dead wood or litter, in environment rich in cellulose. Fungal cellulolytic systems differ from the complex cellulolytic systems of bacteria. For the degradation of cellulose, basidiomycetes utilize a set of hydrolytic enzymes typically composed of endoglucanase, cellobiohydrolase and beta-glucosidase. In some species, the absence of cellobiohydrolase is substituted by the production of processive endoglucanases combining the properties of both of these enzymes. In addition, systems producing hydroxyl radicals based on cellobiose dehydrogenase, quinone redox cycling or glycopeptide-based Fenton reaction are involved in the degradation of several plant cell wall components, including cellulose. The complete cellulolytic complex used by a single fungal species is typically composed of more than one of the above mechanisms that contribute to the utilization of cellulose as a source of carbon or energy or degrade it to ensure fast substrate colonization. The efficiency and regulation of cellulose degradation differs among wood-rotting, litter-decomposing, mycorrhizal or plant pathogenic fungi and yeasts due to the different roles of cellulose degradation in the physiology and ecology of the individual groups. PMID:18371173

  12. Maximising high solid loading enzymatic saccharification yield from acid-catalysed hydrothermally-pretreated brewers spent grain

    Directory of Open Access Journals (Sweden)

    Stuart Wilkinson

    2016-06-01

    Full Text Available Enzyme saccharification of pretreated brewers spent grains (BSG was investigated, aiming at maximising glucose production. Factors investigated were; variation of the solids loadings at different cellulolytic enzyme doses, reaction time, higher energy mixing methods, supplementation of the cellulolytic enzymes with additional enzymes (and cofactors and use of fed-batch methods. Improved slurry agitation through aerated high-torque mixing offered small but significant enhancements in glucose yields (to 53 ± 2.9 g/L and 45% of theoretical yield compared to only 41 ± 4.0 g/L and 39% of theoretical yield for standard shaking methods (at 15% w/v solids loading. Supplementation of the cellulolytic enzymes with additional enzymes (acetyl xylan esterases, ferulic acid esterases and α-L- arabinofuranosidases also boosted achieved glucose yields to 58 – 69 ± 0.8 - 6.2 g/L which equated to 52 - 58% of theoretical yield. Fed-batch methods also enhanced glucose yields (to 58 ± 2.2 g/L and 35% of theoretical yield at 25% w/v solids loading compared to non-fed-batch methods. From these investigations a novel enzymatic saccharification method was developed (using enhanced mixing, a fed-batch approach and additional carbohydrate degrading enzymes which further increased glucose yields to 78 ± 4.1 g/L and 43% of theoretical yield when operating at high solids loading (25% w/v.

  13. Cellulose and hemicellulose decomposition by forest soil bacteria proceeds by the action of structurally variable enzymatic systems

    Science.gov (United States)

    López-Mondéjar, Rubén; Zühlke, Daniela; Becher, Dörte; Riedel, Katharina; Baldrian, Petr

    2016-04-01

    Evidence shows that bacteria contribute actively to the decomposition of cellulose and hemicellulose in forest soil; however, their role in this process is still unclear. Here we performed the screening and identification of bacteria showing potential cellulolytic activity from litter and organic soil of a temperate oak forest. The genomes of three cellulolytic isolates previously described as abundant in this ecosystem were sequenced and their proteomes were characterized during the growth on plant biomass and on microcrystalline cellulose. Pedobacter and Mucilaginibacter showed complex enzymatic systems containing highly diverse carbohydrate-active enzymes for the degradation of cellulose and hemicellulose, which were functionally redundant for endoglucanases, β-glucosidases, endoxylanases, β-xylosidases, mannosidases and carbohydrate-binding modules. Luteibacter did not express any glycosyl hydrolases traditionally recognized as cellulases. Instead, cellulose decomposition was likely performed by an expressed GH23 family protein containing a cellulose-binding domain. Interestingly, the presence of plant lignocellulose as well as crystalline cellulose both trigger the production of a wide set of hydrolytic proteins including cellulases, hemicellulases and other glycosyl hydrolases. Our findings highlight the extensive and unexplored structural diversity of enzymatic systems in cellulolytic soil bacteria and indicate the roles of multiple abundant bacterial taxa in the decomposition of cellulose and other plant polysaccharides.

  14. Effect of leachate recycle and inoculation on microbial characteristics of municipal refuse in landfill bioreactors

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Population development of key groups of anaerobic and aerobic bacteria involved in municipal refuse decomposition under laboratory landfill bioreactors with and without leachate recycle adinoculation was measured since modeling municipal refuse was landfilled in bioreactors for about 210 days. Hydrolytic fermentative bacteria (HFB), hydrogen-producing acetogenic bacteria (HPAB), methane-producing bacteria (MPB), sulfate-reducing bacteria (SRB), anaerobic and aerobic cellulolytic bacteria and denitrabacteria were enumerated by the most probable number technique. The results showed that the dominant microorganismgroups were the methanogenic bacteria including hydrolytic fermentative, hydrogen-producing acetogenic and methane-producing bacteria. They were present in fresh refuse but at low values and positively affected by leachate recycle and refuse inoculation. The amounts of HFB or HPAB in digesters D4 and D5 operated with noculation and leachate recycle reached their maximum values of1010-1012 cells/g dry refuse for HFB or 105-106 cells/g dry refuse for HPAB on day 60, in digester D3 operated with leachate recycle on day 120 for HFB (109 cells/g dry refuse) or on day 90 for HPAB (105 cells/g dry refuse), and in digesters D1 and D2 on day 210 for HFB (109 cells/g dry refuse) or on day 90 for HPAB (104-106 cells/g dry refuse). The population of methane-producing bacteria in digesters D4 and D5 sharply increased on days 60 and 90 respectively, however in igesters D1, D2 and D3 on day 120. Leachate recycle and inoculation changed the cellulolytic microorganisms composition of refuse ecosystem, the higher amounts of anaerobic cellulolytic bacteria were measured in digesters D4 and D5 (107 cells/g dry refuse), followed by digesters D3 (106 cells/g dry refuse), D2 or D1(104 cells/g dry refuse). However, the amounts of aerobic cellulolytic bacteria were much lower than that of anaerobic cellulolytic bacteria. And it was higher in digester D3 than those in digesters D1, D2

  15. Taxonomic revision of Coniceromyia Borgmeier (Diptera: Phoridae), with the description of three new species from Brazil.

    Science.gov (United States)

    Ament, Danilo César; Amorim, Dalton De Souza

    2016-01-01

    The 55 known species of Coniceromyia are herein revised. Three new species from the Atlantic Forest in Brazil are described-C. apioneura, sp.nov., C. neofusca, sp.nov. and C. tanycrossa, sp.nov.-and fourteen species are redescribed. Most of the species have foreleg, wing, hind femur, and male terminalia illustrated. Characters previously unnoticed are described for the first time. Coniceromyia cubensis Brues, previously accepted as a synonym of C. latimana (Malloch), has its status reinstated. Taxonomic problems in the genus are addressed, including the condition of the damaged holotypes of C. boliviana Borgmeier and C. vespertilio Schmitz, and our inability to associate males with the female holotypes of C. arizonensis Borgmeier, C. fusca Borgmeier and C. grenadensis (Brues). The holotypes of Coniceromyia angularis Borgmeier & Prado and Coniceromyia laticosta Prado are considered to be lost. PMID:27394322

  16. AcEST: BP917174 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000097_B12 537 Adiantum capillus-veneris mRNA. clone: YMU001_000097_B12. BP917174 - Show BP91717...is mRNA. clone: YMU001_000097_B12. Accession BP917174 Tissue type prothallium Developmental stage - Contig I...cids Res. 25:3389-3402. Query= BP917174|Adiantum capillus-veneris mRNA, clone: YMU001_000097_B12. (537 lette...THEFY Ribosome maturation factor rimM OS=Thermobifida fusca (strain YX) GN=rimM PE=3 SV=1 Length = 170 Score...re = 30.8 bits (68), Expect = 4.3 Identities = 17/62 (27%), Positives = 32/62 (51%), Gaps = 1/62 (1%) Frame

  17. A species pair of Bivesicula Yamaguti, 1934 (Trematoda: Bivesiculidae) in unrelated Great Barrier Reef fishes: implications for the basis of speciation in coral reef fish trematodes.

    Science.gov (United States)

    Trieu, Nancy; Cutmore, Scott C; Miller, Terrence L; Cribb, Thomas H

    2015-07-01

    Combined morphological and molecular analysis shows that a species of Bivesicula Yamaguti, 1934 from four species of Apogonidae Günther [Nectamia fusca (Quoy & Gaimard), Ostorhinchus angustatus (Smith & Radcliffe), O. cookii (Macleay) and Taeniamia fucata (Cantor)] on the Great Barrier Reef is morphologically similar to, but clearly distinct from B. unexpecta Cribb, Bray & Barker, 1994 which infects a sympatric pomacentrid, Acanthochromis polyacanthus (Bleeker). Bivesicula neglecta n. sp. is proposed for the form from apogonids. Novel ITS2 rDNA sequences generated for the two species differ at just one consistent base position, implying that the two species are closely related. The combination of their close relationship, high but distinct specificity and co-occurrence suggests that speciation was driven by a recent host switching event enabled by similar dietary ecomorphology.

  18. Diversity of plasmodial slime molds (myxomycetes in coastal, mountain, and community forests of Puerto Galera, Oriental Mindoro, the Philippines

    Directory of Open Access Journals (Sweden)

    Nikki Heherson A. Dagamac

    2015-12-01

    Full Text Available No profiling of diversity of myxomycetes has ever been conducted in one of the biodiversity hotspot areas in the Philippine archipelago, and this necessitates a swift survey of myxomycetes in Puerto Galera, Oriental Mindoro. An assessment of diversity of myxomycetes collected from seven collecting points of three different forest types in the study area showed a total of 926 records of myxomycetes. Of which, 42 morphospecies belonging to 16 genera are reported in this study. Species richness of myxomycetes was higher in collecting points that were found in inland lowland mountain forests, but the most taxonomically diverse species was found in coastal forests. Myxomycete species, namely, Arcyria cinerea, Diderma hemisphaericum, Physarum echinosporum, Lamproderma scintillans, and Stemonitis fusca, were found in all the collecting points. Manmade disturbances and forest structure may affect the occurrence of myxomycetes.

  19. Phylogeny of genus Glossina (Diptera: Glossinidae) according to ITS2 sequences

    Institute of Scientific and Technical Information of China (English)

    陈小爱; 李嵩; 李昌本; 赵寿元; Aksoy; Serap

    1999-01-01

    The flies of genus Glossina (Diptera: Glossinidae) are an important vector of African trypanosomiases which cause diseases in humans and animals. The ribosomal DNA Internal Transcribed Spacer-2 (ITS-2) region sequences from different Glossina species were PCR-amplified and analyzed in order to construct a molecular phylogeny for genus Glossina. Trees generated by parsimony confirmed the monophyletic taxonomic placement of genus Glossina where fusca group species formed the deepest branch followed by morsitans and palpalis groups, respectively. The placement of Glossina austeni by both the traditional morphological and biochemical criteria has been controversial. Results presented here, based on ITS-2 locus sequence analysis, suggest that Glossina austeni can be placed into a separate subgenerus which forms a sister-group relationship with the morsitans group species.

  20. Monitoring oil spill bioremediation using marsh foraminifera as indicators.

    Science.gov (United States)

    Sabean, J A R; Scott, D B; Lee, K; Venosa, A D

    2009-01-01

    A controlled experiment was conducted in June 2000 to identify the environmental impacts of weathered crude oil on an Atlantic coastal salt marsh to help evaluate in situ biological remediation techniques for restoring the environment. Foraminifera, marsh microfossils known to be sensitive to a range of environmental stress factors, were used to monitor the effects of the residual oil and the experimental treatments. Results show that the foraminifera responded quickly to the oil and that the oil had a statistically significant, negative impact, as demonstrated by a dramatic increase in deformities in the tests of Miliammina fusca, compared to specimens from the non-oiled control plots. The results clearly show that foraminifera can be excellent indicators of oil pollution using only the percent of deformed tests. The advantages that foraminifera provide are the ease of sampling, processing and examination, with the added benefit that these organisms leave a fossil record.

  1. Kızılırmak Vadisinde Kuşları Etkileyen Olumsuz Faktörler

    Directory of Open Access Journals (Sweden)

    Ayşegül İLİKER

    2015-03-01

    Full Text Available Totally, 263 bird species were observed in the Kızılırmak valley between 2010-2012 years. Among them were 93 residents, 82 summer migrants, 51 winter migrants and 37 transit migrants. When evaluated in IUCN criteria, Egyptian vulture (Neophron percnopterus, saker falcon (Falco cherrug and velvet scoter (Melanitta fusca are endengared (EN, marbled teal (Marmaronette angustirostris, great bustard (Otis tarda and aquatic warbler (Acrocephalus paludicola are vulnareble (VU and ferruginous duck (Aythya nyroca, red kite (Milvus milvus, pallid harrier (Circus macrourus, red footed falcon (Falco vespertinus, great snipe (Gallinago media, rock partridge (Alectoris graeca, black tailed godwit (Limosa limosa, European roller (Coracias garrulus and semi collared flycatcher (Ficedula semitorquata are near threatened (NT. Among negatively affecting factors the birds, in Kızılırmak Valley; reed cutting, water regime changing, recreational activities in riverside, stubble burning, agricultural land expansion, chemical and noise pollution can be considered

  2. Dicty_cDB: Contig-U01509-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 4.5 CU207211_1706( CU207211 |pid:none) Herminiimonas arsenicoxydans ch... 35 4.5 CP000677_289( CP000677 |pid...ubique ... 36 2.6 CP000088_160( CP000088 |pid:none) Thermobifida fusca YX, complete ... 35 3.4 (Q8FCT4) RecName: Full=Carboxyles...450 |pid:none) Mycoplasma gallisepticum strain ... 34 7.6 CP000449_1137( CP000449 |pid:none) Maricaulis mari...gth = 1063 Score = 1279 bits (645), Expect = 0.0 Identities = 645/645 (100%) Strand = Plus / Plus Query: 339 ccca... 56.0 bits (28), Expect = 1e-07 Identities = 28/28 (100%) Strand = Plus / Plus Query: 1 gttgttgctcactctcataatca

  3. Dicty_cDB: Contig-U05819-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 4_1( A93824 |pid:none) Sequence 3 from Patent WO9729194. 58 3e-07 AB183698_1( AB183698 |pid:none) Cannabis s...... 56 1e-06 AB292684_1( AB292684 |pid:none) Cannabis sativa CBDAS3 mRNA for ca... 56 1e-06 FB863225_1( FB86... AY610511_1( AY610511 |pid:none) Thalictrum flavum subsp. glaucum b... 55 3e-06 AB292683_1( AB292683 |pid:none) Cannabis...0 genomic... 53 1e-05 AB212833_1( AB212833 |pid:none) Cannabis sativa gene for tetrahydr... 53 1e-05 AF36486...58( CP000088 |pid:none) Thermobifida fusca YX, complete g... 53 1e-05 AB212830_1( AB212830 |pid:none) Cannabis

  4. A species pair of Bivesicula Yamaguti, 1934 (Trematoda: Bivesiculidae) in unrelated Great Barrier Reef fishes: implications for the basis of speciation in coral reef fish trematodes.

    Science.gov (United States)

    Trieu, Nancy; Cutmore, Scott C; Miller, Terrence L; Cribb, Thomas H

    2015-07-01

    Combined morphological and molecular analysis shows that a species of Bivesicula Yamaguti, 1934 from four species of Apogonidae Günther [Nectamia fusca (Quoy & Gaimard), Ostorhinchus angustatus (Smith & Radcliffe), O. cookii (Macleay) and Taeniamia fucata (Cantor)] on the Great Barrier Reef is morphologically similar to, but clearly distinct from B. unexpecta Cribb, Bray & Barker, 1994 which infects a sympatric pomacentrid, Acanthochromis polyacanthus (Bleeker). Bivesicula neglecta n. sp. is proposed for the form from apogonids. Novel ITS2 rDNA sequences generated for the two species differ at just one consistent base position, implying that the two species are closely related. The combination of their close relationship, high but distinct specificity and co-occurrence suggests that speciation was driven by a recent host switching event enabled by similar dietary ecomorphology. PMID:26063300

  5. Arsenic and lead contamination in soil and in feathers of three resident passerine species in a semi-arid mining region of the Mexican plateau.

    Science.gov (United States)

    Monzalvo-Santos, Karina; Alfaro-De la Torre, Ma Catalina; Chapa-Vargas, Leonardo; Castro-Larragoitia, Javier; Rodríguez-Estrella, Ricardo

    2016-08-23

    The current study aimed at quantifying arsenic and lead in feathers from three passerine species that are residents from areas exposed to mining activities (Toxostoma curvirostre, Campylorhynchus brunneicapillus, and Melozone fusca). Lead and As contents in bird feathers and in superficial soil samples were measured with AAS. Levels of these metals were compared between sites exposed and unexposed to mining. Possible correlations of As and Pb between superficial soil and bird feathers were also investigated. Soil metal concentrations were significantly higher near mining sites, and metal concentrations in bird feathers showed a behavior similar to those recorded for soil samples. Individual birds from polluted sites had higher mean feather metal concentrations in comparison with non-polluted sites; no differences in metal concentrations were recorded among bird species. This work constitutes a basis for monitoring contaminants, and for future toxicological studies attempting to understand the impact that some mining activities may have on bird populations. PMID:27220419

  6. Annual and seasonal distribution of intertidal foraminifera and stable carbon isotope geochemistry, Bandon Marsh, Oregon, USA

    Science.gov (United States)

    Milker, Yvonne; Horton, Benjamin; Vane, Christopher; Engelhart, Simon; Nelson, Alan R.; Witter, Robert C.; Khan, Nicole S.; Bridgeland, William

    2014-01-01

    We investigated the influence of inter-annual and seasonal differences on the distribution of live and dead foraminifera, and the inter-annual variability of stable carbon isotopes (d13C), total organic carbon (TOC) values and carbon to nitrogen (C/N) ratios in bulk sediments from intertidal environments of Bandon Marsh (Oregon, USA). Living and dead foraminiferal species from 10 stations were analyzed over two successive years in the summer (dry) and fall (wet) seasons. There were insignificant inter-annual and seasonal variations in the distribution of live and dead species. But there was a noticeable decrease in calcareous assemblages (Haynesina sp.) between live populations and dead assemblages, indicating that most of the calcareous tests were dissolved after burial; the agglutinated assemblages were comparable between constituents. The live populations and dead assemblages were dominated by Miliammina fusca in the tidal flat and low marsh, Jadammina macrescens, Trochammina inflata and M. fusca in the high marsh, and Trochamminita irregularis and Balticammina pseudomacrescens in the highest marsh to upland. Geochemical analyses (d13C, TOC and C/N of bulk sedimentary organic matter) show no significant influence of inter-annual variations but a significant correlation of d13C values (R = 20.820, p , 0.001), TOC values (R = 0.849, p , 0.001) and C/N ratios (R = 0.885, p , 0.001) to elevation with respect to the tidal frame. Our results suggest that foraminiferal assemblages and d13C and TOC values, as well as C/N ratios, in Bandon Marsh are useful in reconstructing paleosea-levels on the North American Pacific coast.

  7. Fossil cladoceran record from Lake Piramide Inferiore (5067 m asl in the Nepalese Himalayas: biogeographical and paleoecological implications

    Directory of Open Access Journals (Sweden)

    Liisa Nevalainen

    2014-04-01

    Full Text Available We investigated 2500 years of community succession in Cladocera from the sediments of a mountain lake (Lake Piramide Inferiore located in the Khumbu Valley close to Mt. Everest in the Nepalese Himalayas. Our objective was to determine late Holocene changes in cladoceran species composition and abundance in a biogeographical context and with respect to previous proxy-based paleolimnological data (algal pigments and organic content. The results suggested that cladoceran fauna of Lake Piramide Inferiore was species-poor and dominated by Chydorus cf. sphaericus throughout the sequence. The sediment profile recorded the occurrence of Alona guttata type individuals, which were attributed to Alona werestschagini Sinev 1999 based on their morphology and the species' current distributional range, and this was the first record of its presence in the Himalayas. In addition, a periodic long-term succession of melanic Daphnia (Ctenodaphnia fusca Gurney, 1907 and non-melanic D. (Daphnia dentifera Forbes 1893 was observed in the sediments. The millennia-long cladoceran community changes, although subtle due to the C. cf. sphaericus dominance, were in general agreement with the previous proxy-data of lake productivity following the regional paleoclimatic development and apparently partly driven by bottom-up mechanisms. The periodic occurrence and success of D. fusca and D. dentifera throughout the late Holocene in Lake Piramide Inferiore, combined with the knowledge of their phenotypic properties (i.e. carapace melanization and previous investigations on their contemporary and past distribution in Khumbu Valley, suggested that they may have responded to altered underwater UV radiation regimes. Furthermore, they may have even periodically excluded each other subsequent to changes in the underwater UV environment. The results indicated the usefulness of fossil cladoceran analysis as a tool in biogeographical research, since the occurrence of species in space and

  8. New xenophytes from Gran Canaria (Canary Islands, Spain, with emphasis on naturalized and (potentially invasive species

    Directory of Open Access Journals (Sweden)

    Verloove, F.

    2013-12-01

    Full Text Available Trabajos recientes de campo en Gran Canaria han facilitado el descubrimiento de nuevas localidades para plantas vasculares no nativas. Agave attenuata, Antigonon leptopus, Atriplex nummularia, Cascabela thevetia, Cenchrus echinatus, Cuscuta campestris, Diplachne fusca subsp. uninervia, Diplotaxis tenuifolia, Dysphania anthelmintica (hasta ahora confundida con D. ambrosioides, Eclipta prostrata, Euphorbia pulcherrima, Fagopyrum esculentum, Gossypium barbadense, Lablab purpureus, Lemna minuta, Opuntia leucotricha, Passiflora edulis, Pennisetum glaucum, Phaseolus acutifolius, Pluchea carolinensis, Prosopis juliflora, Salvia microphylla, Schinus terebinthifolius, Senna spectabilis, Solanum chrysotrichum, Tecoma stans, Tipuana tipu, Urochloa mutica, U. plantaginea y Washingtonia se citan por primera vez para las Islas Canarias, mientras que Alopecurus myosuroides, Amaranthus blitoides, Bothriochloa ischaemum var. songarica, Cardamine flexuosa subsp. debilis, Heliotropium curassavicum, Leonotis nepetifolia, Medicago lupulina, Parkinsonia aculeata, Physalis peruviana, Phytolacca americana y Turnera ulmifolia son nuevas para la flora de la isla de Gran Canaria. Finalmente, se confirma la presencia de Paspalum vaginatum, P. distichum y Cortaderia selloana en Gran Canaria.Trabajos recientes de campo en Gran Canaria han facilitado el descubrimiento de nuevas localidades para plantas vasculares no nativas. Agave attenuata, Antigonon leptopus, Atriplex nummularia, Cascabela thevetia, Cenchrus echinatus, Cuscuta campestris, Diplachne fusca subsp. uninervia, Diplotaxis tenuifolia, Dysphania anthelmintica (hasta ahora confundida con D. ambrosioides, Eclipta prostrata, Euphorbia pulcherrima, Fagopyrum esculentum, Gossypium barbadense, Lablab purpureus, Lemna minuta, Opuntia leucotricha, Passiflora edulis, Pennisetum glaucum, Phaseolus acutifolius, Pluchea carolinensis, Prosopis juliflora, Salvia microphylla, Schinus terebinthifolius, Senna spectabilis, Solanum

  9. Acid epimerization of 20-keto pregnane glycosides is determined by 2D-NMR spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Victor P., E-mail: vpergarw@gobiernodecanarias.org [Instituto de Productos Naturales de Canarias, Departamento de Quimica de Productos Naturales y Biotecnologia (Spain)

    2011-05-15

    Carbohydrates influence many essential biological events such as apoptosis, differentiation, tumor metastasis, cancer, neurobiology, immunology, development, host-pathogen interactions, diabetes, signal transduction, protein folding, and many other contexts. We now report on the structure determination of pregnane glycosides isolated from the aerial parts of Ceropegia fusca Bolle (Asclepiadaceae). The observation of cicatrizant, vulnerary and cytostatic activities in some humans and animals of Ceropegia fusca Bolle, a species endemic to the Canary Islands, encouraged us to begin a pharmacological study to determine their exact therapeutic properties. High resolution {sup 1}H-NMR spectra of pregnane glycosides very often display well-resolved signals that can be used as starting points in several selective NMR experiments to study scalar (J coupling), and dipolar (NOE) interactions. ROESY is especially suited for molecules such that {omega}{tau}{sub c} {approx} 1, where {tau}{sub c} are the motional correlation times and {omega} is the angular frequency. In these cases the NOE is nearly zero, while the rotating-frame Overhauser effect spectroscopy (ROESY) is always positive and increases monotonically for increasing values of {tau}{sub c}. The ROESY shows dipolar interactions cross peaks even in medium-sized molecules which are helpful in unambiguous assignment of all the interglycosidic linkages. Selective excitation was carried out using a double pulsed-field gradient spin-echo sequence (DPFGSE) in which 180 Degree-Sign Gaussian pulses are sandwiched between sine shaped z-gradients. Scalar interactions were studied by homonuclear DPFGSE-COSY and DPFGSE-TOCSY experiments, while DPFGSE-ROESY was used to monitor the spatial environment of the selectively excited proton. Dipolar interactions between nuclei close in space can be detected by the 1D GROESY experiment, which is a one-dimensional counterpart of the 2D ROESY method. The C-12 and C-17 configurations were

  10. Molecular typing of Giardia duodenalis isolates from nonhuman primates housed IN a Brazilian zoo.

    Science.gov (United States)

    David, Érica Boarato; Patti, Mariella; Coradi, Silvana Torossian; Oliveira-Sequeira, Teresa Cristina Goulart; Ribolla, Paulo Eduardo Martins; Guimarães, Semíramis

    2014-01-01

    Giardia infections in captive nonhuman primates (NHP) housed at a Brazilian zoo were investigated in order to address their zoonotic potential. Fresh fecal samples were collected from the floors of 22 enclosures where 47 primates of 18 different species were housed. The diagnosis of intestinal parasites after concentration by sedimentation and flotation methods revealed the following parasites and their frequencies: Giardia (18%); Entamoeba spp. (18%); Endolimax nana (4.5%); Iodamoeba spp. (4.5%); Oxyurid (4.5%) and Strongylid (4.5%). Genomic DNA extracted from all samples was processed by PCR methods in order to amplify fragments of gdh and tpi genes of Giardia. Amplicons were obtained from samples of Ateles belzebuth, Alouatta caraya, Alouatta fusca and Alouatta seniculus. Clear sequences were only obtained for the isolates from Ateles belzebuth (BA1), Alouatta fusca (BA2) and Alouatta caraya (BA3). According to the phenetic analyses of these sequences, all were classified as assemblage A. For the tpi gene, all three isolates were grouped into sub-assemblage AII (BA1, BA2 and BA3) whereas for the gdh gene, only BA3 was sub-assemblage AII, and the BA1 and BA2 were sub-assemblage AI. Considering the zoonotic potential of the assemblage A, and that the animals of the present study show no clinical signs of infection, the data obtained here stresses that regular coproparasitological surveys are necessary to implement preventive measures and safeguard the health of the captive animals, of their caretakers and of people visiting the zoological gardens. PMID:24553608

  11. MOLECULAR TYPING OF Giardia duodenalis ISOLATES FROM NONHUMAN PRIMATES HOUSED IN A BRAZILIAN ZOO

    Directory of Open Access Journals (Sweden)

    Erica Boarato David

    2014-01-01

    Full Text Available Giardia infections in captive nonhuman primates (NHP housed at a Brazilian zoo were investigated in order to address their zoonotic potential. Fresh fecal samples were collected from the floors of 22 enclosures where 47 primates of 18 different species were housed. The diagnosis of intestinal parasites after concentration by sedimentation and flotation methods revealed the following parasites and their frequencies: Giardia (18%; Entamoeba spp. (18%; Endolimax nana (4.5%; Iodamoeba spp. (4.5%; Oxyurid (4.5% and Strongylid (4.5%. Genomic DNA extracted from all samples was processed by PCR methods in order to amplify fragments of gdh and tpi genes of Giardia. Amplicons were obtained from samples of Ateles belzebuth, Alouatta caraya, Alouatta fusca and Alouatta seniculus. Clear sequences were only obtained for the isolates from Ateles belzebuth (BA1, Alouatta fusca (BA2 and Alouatta caraya (BA3. According to the phenetic analyses of these sequences, all were classified as assemblage A. For the tpi gene, all three isolates were grouped into sub-assemblage AII (BA1, BA2 and BA3 whereas for the gdh gene, only BA3 was sub-assemblage AII, and the BA1 and BA2 were sub-assemblage AI. Considering the zoonotic potential of the assemblage A, and that the animals of the present study show no clinical signs of infection, the data obtained here stresses that regular coproparasitological surveys are necessary to implement preventive measures and safeguard the health of the captive animals, of their caretakers and of people visiting the zoological gardens.

  12. Estado poblacional y distribución de los primates no humanos en Argentina

    Directory of Open Access Journals (Sweden)

    Novo, Nelson M.

    2005-01-01

    Full Text Available Los monos del Nuevo Mundo ofrecen modelos para estudiar paralelismos que ayudan a elucidar principios generales aplicables a todos los primates, y modelar el comportamiento de homínidos tempranos. En la Argentina encontramos cuatro especies de primates, Cebus apella, Alouatta caraya, Alouatta fusca y Aotus azarai. El último estudio sobre su situación poblacional fue publicado en 1994. En este trabajo presentamos una actualización del estado poblacional en Argentina y nuestras evaluaciones poblacionales de A.caraya en las Provincias del Chaco y Corrientes. Solo existen datos para 4 poblaciones de A. caraya en zonas no protegidas, 1 población de A. azarai en zonas no protegidas, 1 población de C. apella en el PN Iguazú y no existen datos para A. fusca una especie incluida en cites II. Las poblaciones de A. caraya bajo estudio (n=4 aumentaron probablemente como consecuencia de un incremento de los bosques secundarios, como resultado de la deforestación. Existen 7 Parques Nacionales que representan menos del 4 % de la superficie de selvas que contienen primates y no hay relevamientos poblacionales en los mismos. Nuestros resultados indican una situación incierta para las restantes tres especies en Argentina. Ante la falta de control y protección de sus habitats, recomendamos realizar estudios comparativos a largo plazo en zonas protegidas y zonas no protegidas. Estos estudios nos permiten develar patrones y principios validos que no pueden ser identificados solamente con el estudio de la especie humana.

  13. Evaluación del estado de conservación de las microcuencas pertenecientes a los Cerros Orientales de Chía, Cundinamarca, Colombia

    Directory of Open Access Journals (Sweden)

    Arévalo Santos Carolina

    2006-06-01

    Full Text Available El trabajo se realizó en colaboración con la Alcaldía Municipal de Chía, Cundinamarca, Colombia, con el fin de
    aproximarnos al estado de conservación de las microcuencas localizadas sobre la cota de altitud 2.600-3.200 msnm, en las veredas de Yerbabuena y Fusca, donde se identificaron cuatro microcuencas de interés: Mana- Yerbabuena, Coseteja, Fusca y Honda-Pan de Azúcar. El documento final se presenta como un instrumento para el conocimiento de los cerros Orientales de Chía a una escala municipal, cuyo enfoque establece los diferentes tipos de cobertura de vegetación existentes como indicador del estado actual de las microcuencas y evidencia situaciones críticas que pueden propiciar su total degradación. Los resultados permiten concluir que los procesos de transformación son bastante intensos, debido básicamente a la acción antrópica que ha hecho de los procesos urbanísticos el factor de amenaza más significativo, que ha conducido a la pérdida acelerada de la vegetación, apertura de vías de acceso, uso inadecuado de las fuentes hídricas etc. El producto principal de este  análisis es la generación de un mapa de áreas de interés ambiental que proponemos deben ser proyectadas ya sea
    para fines de conservación, restauración, recuperación y áreas cuyo manejo de conflictos debe ser prioridad. La
    importancia de establecer el estado de conservación deriva de la necesidad de proporcionar bases para el desarrollo de planes de manejo ambiental.

  14. Lignocellulosic ethanol: Technology design and its impact on process efficiency.

    Science.gov (United States)

    Paulova, Leona; Patakova, Petra; Branska, Barbora; Rychtera, Mojmir; Melzoch, Karel

    2015-11-01

    This review provides current information on the production of ethanol from lignocellulosic biomass, with the main focus on relationships between process design and efficiency, expressed as ethanol concentration, yield and productivity. In spite of unquestionable advantages of lignocellulosic biomass as a feedstock for ethanol production (availability, price, non-competitiveness with food, waste material), many technological bottlenecks hinder its wide industrial application and competitiveness with 1st generation ethanol production. Among the main technological challenges are the recalcitrant structure of the material, and thus the need for extensive pretreatment (usually physico-chemical followed by enzymatic hydrolysis) to yield fermentable sugars, and a relatively low concentration of monosaccharides in the medium that hinder the achievement of ethanol concentrations comparable with those obtained using 1st generation feedstocks (e.g. corn or molasses). The presence of both pentose and hexose sugars in the fermentation broth, the price of cellulolytic enzymes, and the presence of toxic compounds that can inhibit cellulolytic enzymes and microbial producers of ethanol are major issues. In this review, different process configurations of the main technological steps (enzymatic hydrolysis, fermentation of hexose/and or pentose sugars) are discussed and their efficiencies are compared. The main features, benefits and drawbacks of simultaneous saccharification and fermentation (SSF), simultaneous saccharification and fermentation with delayed inoculation (dSSF), consolidated bioprocesses (CBP) combining production of cellulolytic enzymes, hydrolysis of biomass and fermentation into one step, together with an approach combining utilization of both pentose and hexose sugars are discussed and compared with separate hydrolysis and fermentation (SHF) processes. The impact of individual technological steps on final process efficiency is emphasized and the potential for use

  15. Recycle of enzymes and substrate following enzymatic hydrolysis of steam-pretreated aspenwood

    Energy Technology Data Exchange (ETDEWEB)

    Mes-Hartree, M.; Hogan, C.M.; Saddler, J.N.

    1987-09-01

    The commercial production of chemicals and fuels from lignocellulosic residues by enzymatic means still requires considerable research on both the technical and economic aspects. Two technical problems that have been identified as requiring further research are the recycle of the enzymes used in hydrolysis and the reuse of the recalcitrant cellulose remaining after incomplete hydrolysis. Enzyme recycle is required to lower the cost of the enzymes, while the reuse of the spent cellulose will lower the feedstock cost. The conversion process studied was a combined enzymatic hydrolysis and fermentation (CHF) procedure that utilized the cellulolytic enzymes derived from the fungus Trichoderma harzianum E58 and the yeast Saccharomyces cerevisiae. The rate and extent of hydrolysis and ethanol production was monitored as was the activity and hydrolytic potential of the enzymes remaining in the filtrate after the hydrolysis period. When a commercial cellulose was used as the substrate for a routine 2-day CHF process, 60% of the original filter paper activity could be recovered. When steam-treated, water-extracted aspenwood was used as the substrate, only 13% of the original filter paper activity was detected after a similar procedure. The combination of 60% spent enzymes with 40% fresh enzymes resulted in the production of 30% less reducing sugars than the original enzyme mixture. Since 100% hydrolysis of the cellulose portion is seldom accomplished in an enzymatic hydrolysis process, the residual cellulose was used as a substrate for the growth of T. harzianum E58 and production of cellulolytic enzymes. The residue remaining after the CHF process was used as a substrate for the production of the cellulolytic enzymes. The production of enzymes from the residue of the Solka Floc hydrolysis was greater than the production of enzymes from the original Solka Floc. (Refs. 14).

  16. Molecular organization in the native state of woody tissue: Studies of tertiary structure using the Raman microprobe solid state 13C NMR and biomimetic tertiary aggregates. Progress report, July 1, 1989--June 30, 1993

    Energy Technology Data Exchange (ETDEWEB)

    Atalla, R.H.

    1993-12-31

    We have previously shown that all relatively pure plant and bacterial celluloses are, in their native states, composites of two lattice forms, I{sub {alpha}} and I{sub {beta}}, and that the two forms possess molecular chains in the same conformations but with different hydrogen bonding patterns. In the current period we have demonstrated that in higher plant cell wall matrices, the hemicelluloses are likely to have a regulatory function during the aggregation of cellulose. Different hemicelluloses appear to influence the aggregation in different ways. We have also developed preliminary evidence indicating the hemicelluloses may have a protective function against the action of some cellulolytic enzymes. The specific accomplishments during the current period are detailed. Demonstration that hemicelluloses present during biogenesis can transform bacterial cellulose into a cellulose typical of higher plant celluloses, and that each hemicellulose has a different effect on the pattern of aggregation. Evidence is presented that the hemicelluloses may limit the action of certain cellulolytic enzymes, suggesting that their function may go beyond regulation to include passive resistance to cellulolytic pathogens. Enhancing the potential of the Raman microprobe technique for mapping variability of lignin in the cell wall by identifying the contribution of the different substructures of lignin to the intensity of the key band in the Raman spectrum of lignin. Mapping of the variability of lignin across two cell wall sections. The mappings have convoluted within them both composition and concentration, but they demonstrate the potential of the method and point to the improvements we are now making so as to distinguish between variability of concentration and variability of composition.

  17. Saccharification of Sugarcane Bagasse by Enzymatic Treatment for bioethanol production

    Directory of Open Access Journals (Sweden)

    Ahmed, F. M.

    2012-06-01

    Full Text Available Aims: The escalating demands for traditional fossil fuels with unsecured deliverance and issues of climate change compel the researchers to develop alternative fuels like bioethanol. This study examines the prospect of biofuel production from high carbohydrate containing lignocellulosic material, e.g. sugarcane bagasse through biological means. Methodology and Results: Cellulolytic enzymes were collected from the culture filtrate of thermotolerant Trichodermaviride grown on variously pre-treated sugarcane bagasse. CMCase and FPase enzyme activities were determined as a measure of suitable substrate pre-treatment and optimum condition for cellulolytic enzyme production. The highest CMCase and FPase activity was found to be 1.217 U/ml and 0.109 U/ml respectively under the production conditions of 200 rpm, pH 4.0 and 50 °C using steamed NaOH treated bagasse as substrate. SEM was carried out to compare and confirm the activity of cellulolytic enzymes on sugarcane bagasse. Saccharification of pre-treated bagasse was carried out with crude enzymes together using a two-factor experimental design. Under optimized conditions the pre-treated bagasse was saccharified up to 42.7 % in 24 h. The hydrolysate was concentrated by heating to suitable concentration and then used for fermentation by an indigenous isolate of Saccharomyces cerevisiae. With 50 and 80 % brix containing liquor the concentration of alcohol was 0.579 % and 1.15 % respectively. Conclusion, significance and impact of study: This is the first report in Bangladesh for the production of cellulosicethanol using local isolates. Though the rate of alcohol production was very low, a great impetus in this field can maximize the production thereby meet the demand for fuel in future.

  18. In Situ Production of Branched Glycerol Dialkyl Glycerol Tetraethers in a Great Basin Hot Spring (USA

    Directory of Open Access Journals (Sweden)

    Chuanlun eZhang

    2013-07-01

    Full Text Available Branched glycerol dialkyl glycerol tetraethers (bGDGTs are predominantly found in soils and peat bogs. In this study, we analyzed core-bGDGTs and polar (P- bGDGTs after hydrolysis of polar fractions using liquid chromatography-atmospheric pressure chemical ionization-mass spectrometry and analyzed intact P-bGDGTs using total lipid extract (TLE without hydrolysis by liquid chromatography-electrospray ionization-multiple stage mass spectrometry. Our results show multiple lines of evidence for the production of bGDGTs in sediments and cellulolytic enrichments in a hot spring (62-86°C in the Great Basin (USA. First, in situ cellulolytic enrichment led to an increase in the relative abundance of hydrolysis-derived P-bGDGTs over their Core (C-bGDGT counterparts. Second, the hydrolysis-derived P- and C-bGDGT profiles in the hot spring were different from those of the surrounding soil samples; in particular, a monoglycosidic bGDGT Ib containing 13,16-dimethyloctacosane and one cyclopentane moiety was detected in the TLE but it was undetectable in surrounding soil samples even after sample enrichments. Third, previously published 16S rRNA gene pyrotag analysis from the same lignocellulose samples demonstrated the enrichment of thermophiles, rather than mesophiles, and total bGDGT abundance in cellulolytic enrichments correlated with the relative abundance of 16S rRNA gene pyrotags from thermophilic bacteria in the phyla Bacteroidetes, Dictyoglomi, EM3, and OP9 (Atribacteria. These observations conclusively demonstrate the production of bGDGTs in this hot spring; however, the identity of organisms that produce bGDGTs in the geothermal environment remains unclear.

  19. Complete genome of the cellyloytic thermophile Acidothermus cellulolyticus 11B provides insights into its ecophysiological and evloutionary adaptations

    Energy Technology Data Exchange (ETDEWEB)

    Barabote, Ravi D.; Xie, Gary; Leu, David H.; Normand, Philippe; Necsulea, Anamaria; Daubin, Vincent; Medigue, Claudine; Adney, William S.; Xu,Xin Clare; Lapidus, Alla; Detter, Chris; Pujic, Petar; Bruce, David; Lavire, Celine; Challacombe, Jean F.; Brettin, Thomas S.; Berry, Alison M.

    2009-01-01

    We present here the complete 2.4 Mb genome of the cellulolytic actinobacterial thermophile, Acidothermus cellulolyticus 11B. New secreted glycoside hydrolases and carbohydrate esterases were identified in the genome, revealing a diverse biomass-degrading enzyme repertoire far greater than previously characterized, and significantly elevating the industrial value of this organism. A sizable fraction of these hydrolytic enzymes break down plant cell walls and the remaining either degrade components in fungal cell walls or metabolize storage carbohydrates such as glycogen and trehalose, implicating the relative importance of these different carbon sources. A novel feature of the A. cellulolyticus secreted cellulolytic and xylanolytic enzymes is that they are fused to multiple tandemly arranged carbohydrate binding modules (CBM), from families 2 and 3. Interestingly, CBM3 was found to be always N-terminal to CBM2, suggesting a functional constraint driving this organization. While the catalytic domains of these modular enzymes are either diverse or unrelated, the CBMs were found to be highly conserved in sequence and may suggest selective substrate-binding interactions. For the most part, thermophilic patterns in the genome and proteome of A. cellulolyticus were weak, which may be reflective of the recent evolutionary history of A. cellulolyticus since its divergence from its closest phylogenetic neighbor Frankia, a mesophilic plant endosymbiont and soil dweller. However, ribosomal proteins and non-coding RNAs (rRNA and tRNAs) in A. cellulolyticus showed thermophilic traits suggesting the importance of adaptation of cellular translational machinery to environmental temperature. Elevated occurrence of IVYWREL amino acids in A. cellulolyticus orthologs compared to mesophiles, and inverse preferences for G and A at the first and third codon positions also point to its ongoing thermoadaptation. Additional interesting features in the genome of this cellulolytic, hot

  20. Implications of Industrial Processing Strategy on Cellulosic Ethanol Production at High Solids Concentrations

    DEFF Research Database (Denmark)

    Cannella, David

    solids strategy resulted critical for its cost effectiveness: high concentration of initial biomass it will lead to high concentration of the final product (ethanol), thus more convenient to isolate. This thesis investigate the implementation of a high solids loading concept into cellulosic ethanol...... technology using new enzymatic cellulolytic cocktails, and how a high solids setup may affect the overall process design. The thesis focuses on two main biomasses: an agricultural feedstock such as wheat straw and a woody feedstock such as Norwegian spruce. The best performing strategy for cellulosic ethanol...

  1. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński

    2014-08-01

    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  2. Cell-wall properties contributing to improved deconstruction by alkaline pre-treatment and enzymatic hydrolysis in diverse maize (Zea mays L.) lines

    OpenAIRE

    Li, Muyang; Heckwolf, Marlies; Crowe, Jacob D.; Williams, Daniel L.; Magee, Timothy D.; Shawn M Kaeppler; Leon, Natalia de; Hodge, David B

    2015-01-01

    A maize (Zea mays L. subsp. mays) diversity panel consisting of 26 maize lines exhibiting a wide range of cell-wall properties and responses to hydrolysis by cellulolytic enzymes was employed to investigate the relationship between cell-wall properties, cell-wall responses to mild NaOH pre-treatment, and enzymatic hydrolysis yields. Enzymatic hydrolysis of the cellulose in the untreated maize was found to be positively correlated with the water retention value, which is a measure of cell-wall...

  3. Flux Analysis of the Metabolism of Clostridium cellulolyticum Grown in Cellulose-Fed Continuous Culture on a Chemically Defined Medium under Ammonium-Limited Conditions

    OpenAIRE

    Desvaux, Mickaël; Petitdemange, Henri

    2001-01-01

    An investigation of cellulose degradation by the nonruminal, cellulolytic, mesophilic bacterium Clostridium cellulolyticum was performed in cellulose-fed chemostat cultures with ammonium as the growth-limiting nutrient. At any dilution rate (D), acetate was always the main product of the catabolism, with a yield of product from substrate ranging between 37.7 and 51.5 g per mol of hexose equivalent fermented and an acetate/ethanol ratio always higher than 1. As D rose, the acetyl coenzyme A wa...

  4. Effects of Essential Oils on Methane Production and Fermentation by, and Abundance and Diversity of, Rumen Microbial Populations

    OpenAIRE

    Patra, Amlan K.; Yu, Zhongtang

    2012-01-01

    Five essential oils (EOs), namely, clove oil (CLO), eucalyptus oil (EUO), garlic oil (GAO), origanum oil (ORO), and peppermint oil (PEO), were tested in vitro at 3 different doses (0.25, 0.50, and 1.0 g/liter) for their effect on methane production, fermentation, and select groups of ruminal microbes, including total bacteria, cellulolytic bacteria, archaea, and protozoa. All the EOs significantly reduced methane production with increasing doses, with reductions by 34.4%, 17.6%, 42.3%, 87%, a...

  5. Bifunctional xylanases and their potential use in biotechnology

    Digital Repository Service at National Institute of Oceanography (India)

    Khandeparker, R.; Numan, M.Th.

    showed signiWcant similarity (33– 40% identical residues) to a diVerent group of bacterial xylanases and exoglucanases exempliWed by the Caldocel- lum saccharolyticum xynA and celB products. The xynA product is, therefore, a bifunctional enzyme having two... biochemistry of fungal and bacterial cellulolytic enzyme system. In: Aubert JP, Be- guin P, Millet J (eds) Biochemistry and genetics of cellulose deg- radation. Academic Press, London, pp 11–30 19. Cui W, Wood PJ, Blackwell B, Nikiforuk J (2000) Physicochemi...

  6. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them

    Energy Technology Data Exchange (ETDEWEB)

    Gray, Kevin A; Zhao, Lishan; Cayouette, Michelle H

    2015-11-04

    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  7. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them

    Science.gov (United States)

    Gray, Kevin A.; Zhao, Lishan; Cayouette, Michelle H.

    2015-09-08

    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  8. Heat and microbial treatments for nutritional upgrading of wheat straw

    Energy Technology Data Exchange (ETDEWEB)

    Milstein, O.; Vered, Y.; Sharma, A.; Gressel, J.; Flowers, H.M.

    1986-03-01

    The ligninolytic activities of four cellulolytic organisms were compared using straw. Only Aspergillus japonicus and Polyporous versicolor appreciably degraded lignin with A. japonicus yielding the most protein. In solid culture, most protein was produced by P. versicolor, closely followed by A. japonicus. Pertreatment of the straw by hot water facilitated biodegradation and protein production. The nutritional value of the residual straw was also increased by some fungal cultures. The greatest amount of degradable polysaccharide in the straw was made available by A. japonicus in liquid media and Pleurotus ostreatus in solid media. 29 references.

  9. Biotechnological valorisation of agro-industrial wastes for the production of cellulases

    OpenAIRE

    DAMATO, GIUSEPPE

    2012-01-01

    This experimental work is embedded in a wider European-funded project named Etoile (FP7/2007-2013, Project n° 222331). The aim of Etoile project was to develop a new integrated process where the two main wastes coming from olive oil traditional three-phase production process, the solid lignocellulosic olive pomace (OP) and the liquid olive oil mill waste water (OOMW), are exploited for the production of cellulolytic enzymes and bioethanol.More specifically, this experimental work was focus...

  10. Cellulosic ethanol production using a yeast consortium displaying a minicellulosome and β-glucosidase

    Directory of Open Access Journals (Sweden)

    Kim Sujin

    2013-02-01

    Full Text Available Abstract Background Cellulosic biomass is considered as a promising alternative to fossil fuels, but its recalcitrant nature and high cost of cellulase are the major obstacles to utilize this material. Consolidated bioprocessing (CBP, combining cellulase production, saccharification, and fermentation into one step, has been proposed as the most efficient way to reduce the production cost of cellulosic bioethanol. In this study, we developed a cellulolytic yeast consortium for CBP, based on the surface display of cellulosome structure, mimicking the cellulolytic bacterium, Clostridium thermocellum. Results We designed a cellulolytic yeast consortium composed of four different yeast strains capable of either displaying a scaffoldin (mini CipA containing three cohesin domains derived from C. thermocellum, or secreting one of the three types of cellulases, C. thermocellum CelA (endoglucanase containing its own dockerin, Trichoderma reesei CBHII (exoglucanase fused with an exogenous dockerin from C. thermocellum, or Aspergillus aculeatus BGLI (β-glucosidase. The secreted dockerin-containing enzymes, CelA and CBHI, were randomly assembled to the surface-displayed mini CipA via cohesin-dockerin interactions. On the other hand, BGLI was independently assembled to the cell surface since we newly found that it already has a cell adhesion characteristic. We optimized the cellulosome activity and ethanol production by controlling the combination ratio among the four yeast strains. A mixture of cells with the optimized mini CipA:CelA:CBHII:BGLI ratio of 2:3:3:0.53 produced 1.80 g/l ethanol after 94 h, indicating about 20% increase compared with a consortium composed of an equal amount of each cell type (1.48 g/l. Conclusions We produced cellulosic ethanol using a cellulolytic yeast consortium, which is composed of cells displaying mini cellulosomes generated via random assembly of CelA and CBHII to a mini CipA, and cells displaying BGLI independently. One

  11. Laboratory decomposition of Dalbergia nigra all. ex. benth and Eucalyptus grandis w.hill ex. maiden leaves in forest and eucalypt plantation soils

    OpenAIRE

    Rezende Juliana L. P.; Garcia Queila S.; Scotti Maria Rita M. M. L.

    2001-01-01

    The objective was to evaluate the decomposition of D. nigra and E. grandis leaves under laboratory conditions when incubated in soils from Atlantic Forest and from a 40-year-old eucalypt plantation for a year. The obtained values of pH in forest and eucalypt plantation soils were 5.61 and 4.47 and for aluminum 0.32 and 1.89mEqx100, respectively. A great number of microorganisms (total fungi, phosphate solubilising and cellulolytic organisms) were found in forest soil. Litterbag study revealed...

  12. Mageeibacillus indolicus gen. nov., sp. nov: A novel bacterium isolated from the female genital tract

    OpenAIRE

    Austin, Michele N.; Rabe, Lorna K.; Srinivasan, Sujatha; Fredricks, David N.; Wiesenfeld, Harold C.; Hillier, Sharon L.

    2014-01-01

    Three isolates of a bacterium recovered from human endometrium using conventional culture methods were characterized biochemically and subjected to 16S rRNA gene sequencing and phylogenetic analysis. Isolates were non-motile, obligately anaerobic, non-spore forming, asaccharolytic, non-cellulolytic, indole positive, Gram positive rods. Cell wall fatty acid profiling revealed C14:0, C16:0, C18:2 ω6, 9c, C18:1 ω9c and C18:0 to be the major fatty acid composition. The DNA mol % G+C was determine...

  13. EndB, a Multidomain Family 44 Cellulase from Ruminococcus flavefaciens 17, Binds to Cellulose via a Novel Cellulose-Binding Module and to Another R. flavefaciens Protein via a Dockerin Domain

    OpenAIRE

    Rincón, Marco T.; McCrae, Sheila I.; Kirby, James; Scott, Karen P.; Flint, Harry J.

    2001-01-01

    The mechanisms by which cellulolytic enzymes and enzyme complexes in Ruminococcus spp. bind to cellulose are not fully understood. The product of the newly isolated cellulase gene endB from Ruminococcus flavefaciens 17 was purified as a His-tagged product after expression in Escherichia coli and found to be able to bind directly to crystalline cellulose. The ability to bind cellulose is shown to be associated with a novel cellulose-binding module (CBM) located within a region of 200 amino aci...

  14. Hydrolysis of Cellulose Using Mono-Component Enzymes Shows Synergy during Hydrolysis of Phosphoric Acid Swollen Cellulose (PASC), but Competition on Avicel

    DEFF Research Database (Denmark)

    Andersen, Natalija; Johansen, Katja S.; Michelsen, Michael Locht;

    2008-01-01

    To study the synergy between the three groups of cellulolytic enzymes, 20 mixtures of different mole percentage of Humicola insolens Cel45A (EG V) and Cel6A (CBH II), and Penicillium brasilianuin Cel3A (O-glucosidase) were used to hydrolyze Avicel and phosphoric acid swollen cellulose/Avicel (PASC...... the enzymes), increasing as the hydrolysis proceeded. DS of binary exo-/endo-glucanase mixtures, decreased as the mol% of Cel45A increased. In contrast to hydrolysis of PASC, DS values during degradation of Avicel were less then 1, indicating inhibition of the involved enzymes. Thus, our data point...

  15. Studying the ability of Fusarium oxysporum and recombinant Saccharomyces cerevisiae to efficiently cooperate in decomposition and ethanolic fermentation of wheat straw

    DEFF Research Database (Denmark)

    Panagiotou, Gianni; Topakas, Evangelos; Moukouli, Maria;

    2011-01-01

    Fusarium oxysporum F3 alone or in mixed culture with Saccharomyces cerevisiae F12 were used to ferment carbohydrates of wet exploded pre-treated wheat straw (PWS) directly to ethanol. Both microorganisms were first grown aerobically to produce cell mass and thereafter fermented PWS to ethanol under...... anaerobic conditions. During fermentation, soluble and insoluble carbohydrates were hydrolysed by the lignocellulolytic system of F. oxysporum. Mixed substrate fermentation using PWS and corn cobs (CC) in the ratio 1:2 was used to obtain an enzyme mixture with high cellulolytic and hemicellulolytic...

  16. DECENTRALIZED THERMOPHILIC BIOHYDROGEN: A MORE EFFICIENT AND COST EFFECTIVE PROCESS

    Directory of Open Access Journals (Sweden)

    Rajesh K. Sani

    2011-11-01

    Full Text Available Nonfood lignocellulosic biomass is an ideal substrate for biohydrogen production. By avoiding pretreatment steps (acid, alkali, or enzymatic, there is potential to make the process economical. Utilization of regional untreated lignocellulosic biomass by cellulolytic and fermentative thermophiles in a consolidated mode using a single reactor is one of the ways to achieve economical and sustainable biohydrogen production. Employing these potential microorganisms along with decentralized biohydrogen energy production will lead us towards regional and national independence having a positive influence on the bioenergy sector.

  17. Nutritional Interdependence Among Rumen Bacteria During Cellulose Digestion In Vitro

    OpenAIRE

    Miura, Hideki; HORIGUCHI, Masaaki; Ogimoto, Keiji; MATSUMOTO, Tatsuro

    1983-01-01

    A study has been made of the promoting effect of starch on cellulose digestion by mixed rumen bacteria in a cellulose-urea medium. Starch supplementation of the medium promoted the growth of bacteria that required neither amino acids (AA) nor branched-chain fatty acids (BrFA). The growth of these bacteria was followed by the growth of AA-dependent bacteria, AA- or BrFA-dependent bacteria, BrFA-producing bacteria, and finally, BrFA-dependent cellulolytic bacteria. Population changes of these b...

  18. Hydrogen and volatile fatty acid production during fermentation of cellulosic substrates by a thermophilic consortium at 50 and 60 °C.

    Science.gov (United States)

    Carver, Sarah M; Nelson, Michael C; Lepistö, Raghida; Yu, Zhongtang; Tuovinen, Olli H

    2012-01-01

    The purpose of this study was to characterize the effect of temperature and cellulosic substrates on fermentative metabolites, H(2) production, and community successions in an anaerobic, cellulolytic consortium, TC60. Pyrosequencing analysis indicated that the consortium was predominated by Thermoanaerobacter and Clostridium spp. Metabolite production was analyzed with four cellulosic substrates at 4 kg/m(3). Triplicate cultures of each substrate were incubated at 50 or 60 °C. The main fermentation products (H(2), CO(2), ethanol, and acetate) were monitored over time. The ANOVA model for production rates showed a significant temperature effect (Phydrogen-producing microorganisms.

  19. Penicillium oxalicum PoFlbC regulates fungal asexual development and is important for cellulase gene expression.

    Science.gov (United States)

    Yao, Guangshan; Li, Zhonghai; Wu, Ruimei; Qin, Yuqi; Liu, Guodong; Qu, Yinbo

    2016-01-01

    Filamentous fungi can initiate vegetative growth on complex plant polysaccharides in nature through secreting a large amount of lignocellulose-degrading enzymes. These fungi develop a large amount of asexual spores to disperse and survive under harsh conditions, such as carbon and nitrogen depletion. Numerous studies report the presence of a cross-talk between asexual development and extracellular enzyme production, especially at the regulation level. This study identified and characterized a C2H2-type transcription factor called PoFlbC, which is an Aspergillus FlbC ortholog, in cellulolytic fungus Penicillium oxalicum. Results showed that the native level of PoFlbC was crucial for the normal growth and asexual development of P. oxalicum. Importantly, deletion of the PoflbC gene substantially reduced cellulase and hemicellulase productions. Comparative transcriptome analysis by RNA sequencing revealed a global downregulation of genes encoding cellulases, hemicellulases, and other proteins with functions in lignocellulose degradation. A similar defect was also observed in the OEPoflbC strain, suggesting that the production of cellulolytic enzymes was maintained by native expression of the PoflbC. In this study, an essential activator for both fungal asexual development and cellulase production was established in P. oxalicum.

  20. Gas hold-up and oxygen mass transfer in three pneumatic bioreactors operating with sugarcane bagasse suspensions.

    Science.gov (United States)

    Esperança, M N; Cunha, F M; Cerri, M O; Zangirolami, T C; Farinas, C S; Badino, A C

    2014-05-01

    Sugarcane bagasse is a low-cost and abundant by-product generated by the bioethanol industry, and is a potential substrate for cellulolytic enzyme production. The aim of this work was to evaluate the effects of air flow rate (QAIR), solids loading (%S), sugarcane bagasse type, and particle size on the gas hold-up (εG) and volumetric oxygen transfer coefficient (kLa) in three different pneumatic bioreactors, using response surface methodology. Concentric tube airlift (CTA), split-cylinder airlift (SCA), and bubble column (BC) bioreactor types were tested. QAIR and %S affected oxygen mass transfer positively and negatively, respectively, while sugarcane bagasse type and particle size (within the range studied) did not influence kLa. Using large particles of untreated sugarcane bagasse, the loop-type bioreactors (CTA and SCA) exhibited higher mass transfer, compared to the BC reactor. At higher %S, SCA presented a higher kLa value (0.0448 s−1) than CTA, and the best operational conditions in terms of oxygen mass transfer were achieved for %S 27.0 L min−1. These results demonstrated that pneumatic bioreactors can provide elevated oxygen transfer in the presence of vegetal biomass, making them an excellent option for use in three-phase systems for cellulolytic enzyme production by filamentous fungi. PMID:24078146

  1. Effect of steroidal saponin from Yucca schidigera extract on ruminal microbes.

    Science.gov (United States)

    Wang, Y; McAllister, T A; Yanke, L J; Cheeke, P R

    2000-05-01

    The effects of steroidal saponins (SAP) isolated from Yucca schidigera extract on ruminal bacteria and fungi were investigated in pure culture studies. Prevotella bryantii, Ruminobacter amylophilus, Selenomonas ruminantium and Streptococcus bovis were cultured through ten 24-h transfers in ruminal fluid medium containing 0 or 25 microg SAP ml-1 (measured as smilagenin equivalents). The four strains, each non-exposed or pre-exposed to SAP, were then inoculated into medium containing 0 or 250 microgram smilagenin equivalents ml-1 and 24-h growth curves were determined. The cellulolytic ruminal bacteria Ruminococcus flavefaciens, Fibrobacter succinogenes and Rc. albus were cultured for 72 h on Whatman no. 1 filter paper in medium containing 0, 9, 90 or 180 microgram SAP ml-1 for the determination of filter paper digestion and endoglucanase activity. The ruminal bacteria differed in their responses to SAP. Steroidal saponins in the medium reduced the growth of Strep. bovis (P 0.05) between pre-exposed and non-exposed cultures and the concentrations of total SAP and soluble (deglycosylated) SAP in the liquid fraction were unchanged (P > 0.05) over time. Steroidal saponins inhibited the digestion of filter paper by all three cellulolytic bacteria, but F. succinogenes was less (P starch-digesting ruminal micro-organisms. PMID:10792550

  2. Comparative analysis of carbohydrate active enzymes in Clostridium termitidis CT1112 reveals complex carbohydrate degradation ability.

    Directory of Open Access Journals (Sweden)

    Riffat I Munir

    Full Text Available Clostridium termitidis strain CT1112 is an anaerobic, gram positive, mesophilic, cellulolytic bacillus isolated from the gut of the wood-feeding termite, Nasutitermes lujae. It produces biofuels such as hydrogen and ethanol from cellulose, cellobiose, xylan, xylose, glucose, and other sugars, and therefore could be used for biofuel production from biomass through consolidated bioprocessing. The first step in the production of biofuel from biomass by microorganisms is the hydrolysis of complex carbohydrates present in biomass. This is achieved through the presence of a repertoire of secreted or complexed carbohydrate active enzymes (CAZymes, sometimes organized in an extracellular organelle called cellulosome. To assess the ability and understand the mechanism of polysaccharide hydrolysis in C. termitidis, the recently sequenced strain CT1112 of C. termitidis was analyzed for both CAZymes and cellulosomal components, and compared to other cellulolytic bacteria. A total of 355 CAZyme sequences were identified in C. termitidis, significantly higher than other Clostridial species. Of these, high numbers of glycoside hydrolases (199 and carbohydrate binding modules (95 were identified. The presence of a variety of CAZymes involved with polysaccharide utilization/degradation ability suggests hydrolysis potential for a wide range of polysaccharides. In addition, dockerin-bearing enzymes, cohesion domains and a cellulosomal gene cluster were identified, indicating the presence of potential cellulosome assembly.

  3. Yeasts from sub-Antarctic region: biodiversity, enzymatic activities and their potential as oleaginous microorganisms.

    Science.gov (United States)

    Martinez, A; Cavello, I; Garmendia, G; Rufo, C; Cavalitto, S; Vero, S

    2016-09-01

    Various microbial groups are well known to produce a range of extracellular enzymes and other secondary metabolites. However, the occurrence and importance of investment in such activities have received relatively limited attention in studies of Antarctic soil microbiota. Sixty-one yeasts strains were isolated from King George Island, Antarctica which were characterized physiologically and identified at the molecular level using the D1/D2 region of rDNA. Fifty-eight yeasts (belonging to the genera Cryptococcus, Leucosporidiella, Rhodotorula, Guehomyces, Candida, Metschnikowia and Debaryomyces) were screened for extracellular amylolytic, proteolytic, esterasic, pectinolytic, inulolytic xylanolytic and cellulolytic activities at low and moderate temperatures. Esterase activity was the most common enzymatic activity expressed by the yeast isolates regardless the assay temperature and inulinase was the second most common enzymatic activity. No cellulolytic activity was detected. One yeast identified as Guehomyces pullulans (8E) showed significant activity across six of seven enzymes types tested. Twenty-eight yeast isolates were classified as oleaginous, being the isolate 8E the strain that accumulated the highest levels of saponifiable lipids (42 %). PMID:27469174

  4. Comparative genomics provide insights into evolution of trichoderma nutrition style.

    Science.gov (United States)

    Xie, Bin-Bin; Qin, Qi-Long; Shi, Mei; Chen, Lei-Lei; Shu, Yan-Li; Luo, Yan; Wang, Xiao-Wei; Rong, Jin-Cheng; Gong, Zhi-Ting; Li, Dan; Sun, Cai-Yun; Liu, Gui-Ming; Dong, Xiao-Wei; Pang, Xiu-Hua; Huang, Feng; Liu, Weifeng; Chen, Xiu-Lan; Zhou, Bai-Cheng; Zhang, Yu-Zhong; Song, Xiao-Yan

    2014-02-01

    Saprotrophy on plant biomass is a recently developed nutrition strategy for Trichoderma. However, the physiology and evolution of this new nutrition strategy is still elusive. We report the deep sequencing and analysis of the genome of Trichoderma longibrachiatum, an efficient cellulase producer. The 31.7-Mb genome, smallest among the sequenced Trichoderma species, encodes fewer nutrition-related genes than saprotrophic T. reesei (Tr), including glycoside hydrolases and nonribosomal peptide synthetase-polyketide synthase. Homology and phylogenetic analyses suggest that a large number of nutrition-related genes, including GH18 chitinases, β-1,3/1,6-glucanases, cellulolytic enzymes, and hemicellulolytic enzymes, were lost in the common ancestor of T. longibrachiatum (Tl) and Tr. dN/dS (ω) calculation indicates that all the nutrition-related genes analyzed are under purifying selection. Cellulolytic enzymes, the key enzymes for saprotrophy on plant biomass, are under stronger purifying selection pressure in Tl and Tr than in mycoparasitic species, suggesting that development of the nutrition strategy of saprotrophy on plant biomass has increased the selection pressure. In addition, aspartic proteases, serine proteases, and metalloproteases are subject to stronger purifying selection pressure in Tl and Tr, suggesting that these enzymes may also play important roles in the nutrition. This study provides insights into the physiology and evolution of the nutrition strategy of Trichoderma.

  5. Heterologous expression of Pycnoporus cinnabarinus cellobiose dehydrogenase in Pichia pastoris and involvement in saccharification processes

    Directory of Open Access Journals (Sweden)

    Bey Mathieu

    2011-12-01

    Full Text Available Abstract Background Cellobiose dehydrogenase (CDH is an extracellular hemoflavoenzyme produced by lignocellulose-degrading fungi including Pycnoporus cinnabarinus. We investigated the cellulolytic system of P. cinnabarinus, focusing on the involvement of CDH in the deconstruction of lignocellulosic biomass. Results First, P. cinnabarinus growth conditions were optimized for CDH production. Following growth under cellulolytic conditions, the main components secreted were cellulases, xylanases and CDH. To investigate the contribution of P. cinnabarinus secretome in saccharification processes, the Trichoderma reesei enzymatic cocktail was supplemented with the P. cinnabarinus secretome. A significant enhancement of the degradation of wheat straw was observed with (i the production of a large amount of gluconic acid, (ii increased hemicellulose degradation, and (iii increased overall degradation of the lignocellulosic material. P. cinnabarinus CDH was heterologously expressed in Pichia pastoris to obtain large amounts of pure enzyme. In a bioreactor, the recombinant CDH (rCDH expression level reached 7800 U/L. rCDH exhibited values of biochemical parameters similar to those of the natural enzyme, and was able to bind cellulose despite the absence of a carbohydrate-binding module (CBM. Following supplementation of purified rCDH to T. reesei enzymatic cocktail, formation of gluconic acid and increased hemicellulose degradation were observed, thus confirming the previous results observed with P. cinnabarinus secretome. Conclusions We demonstrate that CDH offers an attractive tool for saccharification process enhancement due to gluconic acid production from raw lignocellulosic material.

  6. Cost-effective production of biotechnologically important hydrolytic enzymes by Sporotrichum thermophile.

    Science.gov (United States)

    Bala, Anju; Singh, Bijender

    2016-01-01

    Economical production of xylanase and three cellulases, endo-β-1,4-glucanase (CMCase), exo-β-1,4-glucanase (FPase), β-glucosidase (BGL) was studied in submerged fermentation using cane molasses medium. A statistical optimization approach involving Plackett-Burman design and response surface methodology (RSM) resulted in the production of 72,410, 36,420, 32,420 and 5180 U/l of xylanase, CMCase, FPase and β-glucosidase, respectively. Optimization resulted in more than fourfold improvements in production of xylanolytic and cellulolytic enzymes. Scale up of enzymes production in shake flasks of varied volumes was sustainable, suggesting a good scope for large scale enzyme production. Addition of microparticles engineered fungal morphology and enhanced enzymes production. Xylanase of S. thermophile is a neutral xylanase displaying its optimal activity at 60 °C while all the cellulases are optimally active at pH 5.0 and 60 °C. The efficacy of enzyme cocktail in waste tea cup paper and rice straw hydrolysis showed that maximum sugar yield of 578.12 and 421.79 mg/g substrate for waste tea cup and rice straw, respectively, were achieved after 24 h. Therefore, concomitant production of cellulolytic and xylanolytic enzymes will be beneficial for the saccharification of lignocellulosics in generating both monomeric and oligomeric sugars for biofuels and other biotechnological applications.

  7. Cost-effective production of biotechnologically important hydrolytic enzymes by Sporotrichum thermophile.

    Science.gov (United States)

    Bala, Anju; Singh, Bijender

    2016-01-01

    Economical production of xylanase and three cellulases, endo-β-1,4-glucanase (CMCase), exo-β-1,4-glucanase (FPase), β-glucosidase (BGL) was studied in submerged fermentation using cane molasses medium. A statistical optimization approach involving Plackett-Burman design and response surface methodology (RSM) resulted in the production of 72,410, 36,420, 32,420 and 5180 U/l of xylanase, CMCase, FPase and β-glucosidase, respectively. Optimization resulted in more than fourfold improvements in production of xylanolytic and cellulolytic enzymes. Scale up of enzymes production in shake flasks of varied volumes was sustainable, suggesting a good scope for large scale enzyme production. Addition of microparticles engineered fungal morphology and enhanced enzymes production. Xylanase of S. thermophile is a neutral xylanase displaying its optimal activity at 60 °C while all the cellulases are optimally active at pH 5.0 and 60 °C. The efficacy of enzyme cocktail in waste tea cup paper and rice straw hydrolysis showed that maximum sugar yield of 578.12 and 421.79 mg/g substrate for waste tea cup and rice straw, respectively, were achieved after 24 h. Therefore, concomitant production of cellulolytic and xylanolytic enzymes will be beneficial for the saccharification of lignocellulosics in generating both monomeric and oligomeric sugars for biofuels and other biotechnological applications. PMID:26581490

  8. Cellulose degrading bacteria isolated from industrial samples and the gut of native insects from Northwest of Argentina.

    Science.gov (United States)

    Manfredi, Adriana P; Perotti, Nora I; Martínez, María A

    2015-12-01

    The raw materials used to produce bioethanol mostly are food crops, which has led to conflicts on food security. It is, therefore, recommended the gradual replacement for second generation substrates such as lignocellulosic materials. Herein, cellulolytic bacteria were isolated from the gut content of native larvae from Lepidoptera, Coleoptera, and adults of Isoptera. Few environmental samples from the pulp and paper feedstock were also assessed. A total of 233 isolates were obtained using enrichment cultures and classic criteria. Interestingly, several halo-forming colonies were found to be bacterial consortia that presented difficulties to take apart the microbial members. Those pure isolates which hydrolyzed cellulose in larger extend (45 strains) were selected and identified by means of 16S rRNA sequence analysis. Firmicutes was the prevalent phylum (62.2%) being Bacillus spp. the most frequent genus, while Paenibacillus, Brevibacillus, Cohnella, and Staphylococcus species were less frequent. The phylum Actinobacteria (6.7%) was represented by isolates related to Agromyces spp. and Microbacterium spp. Regarding Gram-negative bacteria (31.1%), the more depicted genus was Pseudomonas spp., and members of Achromobacter spp., Enterobacter spp., and Bacteroidetes phylum were also selected. These native bacterial strains are expected to enlarge the cellulolytic toolbox for efficient biomass deconstruction. PMID:26370071

  9. Bioconversion of sugar cane crop residues with white-rot fungiPleurotus sp.

    Science.gov (United States)

    Ortega, G M; Martínez, E O; Betancourt, D; González, A E; Otero, M A

    1992-07-01

    Four mushroom strains ofPleurotus spp. were cultivated on sugar cane crop residues for 30 days at 26°C. Biochemical changes affected the substrate as a result of fungal growth, in terms of nitrogen, lignin, cellulose and hemicellulose contents. All strains showed a strong ligninolytic activity together with variable cellulolytic and xylanolytic action.Pleurotus sajor-caju attacked lignin and cellulose at the same rate, showing a degradation of 47% and 55%, respectively. A better balance was shown by theP. ostreatus-P. pulmonarius hybrid, which exhibited the poorest cellulolytic action (39%) and the highest ligninolytic activity (67%). The average composition of mushroom fruit bodies, in terms of nitrogen, carbohydrates, fats and amino acid profiles, was determined. Crude protein and total carbohydrate varied from 23% to 33% and 36% to 68% of dry matter, respectively. Fat ranged from 3.3% to 4.7% and amino acid content from 12.2% to 22.2%. Slight evidence for a nitrogen fixing capability was encountered in the substrate to fruit body balance.

  10. Cellulose degrading bacteria isolated from industrial samples and the gut of native insects from Northwest of Argentina.

    Science.gov (United States)

    Manfredi, Adriana P; Perotti, Nora I; Martínez, María A

    2015-12-01

    The raw materials used to produce bioethanol mostly are food crops, which has led to conflicts on food security. It is, therefore, recommended the gradual replacement for second generation substrates such as lignocellulosic materials. Herein, cellulolytic bacteria were isolated from the gut content of native larvae from Lepidoptera, Coleoptera, and adults of Isoptera. Few environmental samples from the pulp and paper feedstock were also assessed. A total of 233 isolates were obtained using enrichment cultures and classic criteria. Interestingly, several halo-forming colonies were found to be bacterial consortia that presented difficulties to take apart the microbial members. Those pure isolates which hydrolyzed cellulose in larger extend (45 strains) were selected and identified by means of 16S rRNA sequence analysis. Firmicutes was the prevalent phylum (62.2%) being Bacillus spp. the most frequent genus, while Paenibacillus, Brevibacillus, Cohnella, and Staphylococcus species were less frequent. The phylum Actinobacteria (6.7%) was represented by isolates related to Agromyces spp. and Microbacterium spp. Regarding Gram-negative bacteria (31.1%), the more depicted genus was Pseudomonas spp., and members of Achromobacter spp., Enterobacter spp., and Bacteroidetes phylum were also selected. These native bacterial strains are expected to enlarge the cellulolytic toolbox for efficient biomass deconstruction.

  11. Tillage practices and straw-returning methods affect topsoil bacterial community and organic C under a rice-wheat cropping system in central China

    Science.gov (United States)

    Guo, Lijin; Zheng, Shixue; Cao, Cougui; Li, Chengfang

    2016-09-01

    The objective of this study was to investigate how the relationships between bacterial communities and organic C (SOC) in topsoil (0-5 cm) are affected by tillage practices [conventional intensive tillage (CT) or no-tillage (NT)] and straw-returning methods [crop straw returning (S) or removal (NS)] under a rice-wheat rotation in central China. Soil bacterial communities were determined by high-throughput sequencing technology. After two cycles of annual rice-wheat rotation, compared with CT treatments, NT treatments generally had significantly more bacterial genera and monounsaturated fatty acids/saturated fatty acids (MUFA/STFA), but a decreased gram-positive bacteria/gram-negative bacteria ratio (G+/G-). S treatments had significantly more bacterial genera and MUFA/STFA, but had decreased G+/G- compared with NS treatments. Multivariate analysis revealed that Gemmatimonas, Rudaea, Spingomonas, Pseudomonas, Dyella, Burkholderia, Clostridium, Pseudolabrys, Arcicella and Bacillus were correlated with SOC, and cellulolytic bacteria (Burkholderia, Pseudomonas, Clostridium, Rudaea and Bacillus) and Gemmationas explained 55.3% and 12.4% of the variance in SOC, respectively. Structural equation modeling further indicated that tillage and residue managements affected SOC directly and indirectly through these cellulolytic bacteria and Gemmationas. Our results suggest that Burkholderia, Pseudomonas, Clostridium, Rudaea, Bacillus and Gemmationas help to regulate SOC sequestration in topsoil under tillage and residue systems.

  12. Screening and identification of newly isolated cellulose-degrading bacteria from the gut of xylophagous termite Microcerotermes diversus (Silvestri).

    Science.gov (United States)

    Pourramezan, Z; Ghezelbash, G R; Romani, B; Ziaei, S; Hedayatkhah, A

    2012-01-01

    The aim of the present study was to isolate and characterize the cellulose-degrading bacteria from the gut of the local termite, Microcerotermes diversus (Silvestri), inhabiting the Khuzestan province of Iran. The microorganisms capable of growing in the liquid medium containing cellulose as the only source of carbon were isolated and their cellulolytic activity on CMC-containing media was confirmed by the congo red clearing zone assay. The isolates were identified based on biochemical characteristics and the phylogenetic analysis of 16S rRNA gene fragments. The results of the present study show that three cellulose-degrading bacteria isolated from local termite guts belonged to the genera Acinetobacter, Pseudomonas and Staphylococcus and four cellulose-degrading bacteria belonged to Enterobacteriaceae and Bacillaceae families. Several isolates recovered from separate termite Microcerotermes diversus samples closely clustered in phylogenetic trees indicating high similarity and the abundance of particular cellulolytic strains. Bacillus B5B and Acinetobacter L9B hydrolyzed cellulose faster than the other isolates (with CMCase activity of 1.47 U/mL and 1.22 U/mL, respectively). The stability of CMCase produced by Bacillus B5B over a broad range of pH and high temperature indicated that the enzyme may be of great commercial value.

  13. Integrated ‘omics analysis for studying the microbial community response to a pH perturbation of a cellulose-degrading bioreactor culture

    Energy Technology Data Exchange (ETDEWEB)

    Boaro, Amy A.; Kim, Young-Mo; Konopka, Allan; Callister, Stephen J.; Ahring, Birgitte K.

    2014-12-01

    Integrated ‘omics have been used on pure cultures and co-cultures, yet they have not been applied to complex microbial communities to examine questions of perturbation response. In this study, we used integrated ‘omics to measure the perturbation response of a cellulose-degrading bioreactor community fed with microcrystalline cellulose (Avicel). We predicted that a pH decrease by addition of a pulse of acid would reduce microbial community diversity and temporarily reduce reactor function such as cellulose degradation. However, 16S rDNA pyrosequencing results revealed increased alpha diversity in the microbial community after the perturbation, and a persistence of the dominant community members over the duration of the experiment. Proteomics results showed a decrease in activity of proteins associated with Fibrobacter succinogenes two days after the perturbation followed by increased protein abundances six days after the perturbation. The decrease in cellulolytic activity suggested by the proteomics was confirmed by the accumulation of Avicel in the reactor. Metabolomics showed a pattern similar to that of the proteome, with amino acid production decreasing two days after the perturbation and increasing after six days. This study demonstrated that community ‘omics data provides valuable information about the interactions and function of anaerobic cellulolytic community members after a perturbation.

  14. AISLAMIENTO Y SELECCIÓN DE BACTERIAS AUTÓCTONAS DE MANABÍ-ECUADOR CON ACTIVIDAD CELULOLÍTICA

    Directory of Open Access Journals (Sweden)

    Ángel M. Guzmán Cedeño

    2015-01-01

    Full Text Available The present study aimed to isolate and select bacteria with cellulolytic capacity, having future application as inoculum in the fibrous organic waste composting. Five sampling environments were considered: organic agriculture (AO, conventional agriculture (AQ, forest (BM; sugarcane area (RC and compost piles (AC. For bacterial isolation the nutrient agar medium was used changing the carbon source by cellulose. The main selection criterion of the bacterial isolates was the growth on above medium and its positive reaction to congo red test, showing clear zones around the colonies. The 93 bacterial isolates obtained were subjected to Gram staining, catalase test, presence of endospores and aerobically growth; having 70 bacteria Bacillus spp. like characteristics. Their cellulolytic activities were determined and 30 bacteria produced hydrolysis halo. Eight of these bacterial isolates were selected according to the largest halo production (AO-19, AO-28, AO-29, AQ-2, BM-7, RC-2, RC-6, CR-18 and their growth at different pH (3, 5, 7, 9 and temperatures (50 and 70 °C were evaluated. The bacteria AO-19 showed higher hydrolysis halo with 12,33 mm and growth stability at different pH and temperature levels, for which its growth dynamic and amylolytic and pectinolytic capacity was determined. According to results the bacteria AO-19 has potential to be used as inoculum in composting.

  15. Functional and structural analyses of a 1,4-β-endoglucanase from Ganoderma lucidum.

    Science.gov (United States)

    Liu, Guizhi; Li, Qian; Shang, Na; Huang, Jian-Wen; Ko, Tzu-Ping; Liu, Weidong; Zheng, Yingying; Han, Xu; Chen, Yun; Chen, Chun-Chi; Jin, Jian; Guo, Rey-Ting

    2016-05-01

    Ganoderma lucidum is a saprotrophic white-rot fungus which contains a rich set of cellulolytic enzymes. Here, we screened an array of potential 1,4-β-endoglucanases from G. lucidum based on the gene annotation library and found that one candidate gene, GlCel5A, exhibits CMC-hydrolyzing activity. The recombinant GlCel5A protein expressed in Pichia pastoris is able to hydrolyze CMC and β-glucan but not xylan and mannan. The enzyme exhibits optimal activity at 60°C and pH 3-4, and retained 50% activity at 80 and 90°C for at least 15 and 10min. The crystal structure of GlCel5A and its complex with cellobiose, solved at 2.7 and 2.86Å resolution, shows a classical (β/α)8 TIM-barrel fold as seen in other members of glycoside hydrolase family 5. The complex structure contains a cellobiose molecule in the +1 and +2 subsites, and reveals the interactions with the positive sites of the enzyme. Collectively, the present work provides the first comprehensive characterization of an endoglucanase from G. lucidum that possesses properties for industrial applications, and strongly encourages further studying in the cellulolytic enzyme system of G. lucidum.

  16. Tillage practices and straw-returning methods affect topsoil bacterial community and organic C under a rice-wheat cropping system in central China.

    Science.gov (United States)

    Guo, Lijin; Zheng, Shixue; Cao, Cougui; Li, Chengfang

    2016-01-01

    The objective of this study was to investigate how the relationships between bacterial communities and organic C (SOC) in topsoil (0-5 cm) are affected by tillage practices [conventional intensive tillage (CT) or no-tillage (NT)] and straw-returning methods [crop straw returning (S) or removal (NS)] under a rice-wheat rotation in central China. Soil bacterial communities were determined by high-throughput sequencing technology. After two cycles of annual rice-wheat rotation, compared with CT treatments, NT treatments generally had significantly more bacterial genera and monounsaturated fatty acids/saturated fatty acids (MUFA/STFA), but a decreased gram-positive bacteria/gram-negative bacteria ratio (G(+)/G(-)). S treatments had significantly more bacterial genera and MUFA/STFA, but had decreased G(+)/G(-) compared with NS treatments. Multivariate analysis revealed that Gemmatimonas, Rudaea, Spingomonas, Pseudomonas, Dyella, Burkholderia, Clostridium, Pseudolabrys, Arcicella and Bacillus were correlated with SOC, and cellulolytic bacteria (Burkholderia, Pseudomonas, Clostridium, Rudaea and Bacillus) and Gemmationas explained 55.3% and 12.4% of the variance in SOC, respectively. Structural equation modeling further indicated that tillage and residue managements affected SOC directly and indirectly through these cellulolytic bacteria and Gemmationas. Our results suggest that Burkholderia, Pseudomonas, Clostridium, Rudaea, Bacillus and Gemmationas help to regulate SOC sequestration in topsoil under tillage and residue systems. PMID:27611023

  17. Biochemical passive reactors for treatment of acid mine drainage: Effect of hydraulic retention time on changes in efficiency, composition of reactive mixture, and microbial activity.

    Science.gov (United States)

    Vasquez, Yaneth; Escobar, Maria C; Neculita, Carmen M; Arbeli, Ziv; Roldan, Fabio

    2016-06-01

    Biochemical passive treatment represents a promising option for the remediation of acid mine drainage. This study determined the effect of three hydraulic retention times (1, 2, and 4 days) on changes in system efficiency, reactive mixture, and microbial activity in bioreactors under upward flow conditions. Bioreactors were sacrificed in the weeks 8, 17 and 36, and the reactive mixture was sampled at the bottom, middle, and top layers. Physicochemical analyses were performed on reactive mixture post-treatment and correlated with sulfate-reducing bacteria and cellulolytic and dehydrogenase activity. All hydraulic retention times were efficient at increasing pH and alkalinity and removing sulfate (>60%) and metals (85-99% for Fe(2+) and 70-100% for Zn(2+)), except for Mn(2+). The longest hydraulic retention time (4 days) increased residual sulfides, deteriorated the quality of treated effluent and negatively impacted sulfate-reducing bacteria. Shortest hydraulic retention time (1 day) washed out biomass and increased input of dissolved oxygen in the reactors, leading to higher redox potential and decreasing metal removal efficiency. Concentrations of iron, zinc and metal sulfides were high in the bottom layer, especially with 2 day of hydraulic retention time. Sulfate-reducing bacteria, cellulolytic and dehydrogenase activity were higher in the middle layer at 4 days of hydraulic retention time. Hydraulic retention time had a strong influence on overall performance of passive reactors.

  18. Fundamental study of the mechanism and kinetics of cellulose hydrolysis by acids and enzymes. Final report, June 1, 1978-January 31, 1981

    Energy Technology Data Exchange (ETDEWEB)

    Gong, C.S.; Chang, M.

    1981-02-01

    There are three basic enzymes (e.g., endoglucanase (C/sub x/), exoglucanase (C/sub 1/) and cellobiase) comprising the majority of extracellular cellulase enzymes produced by the cellulolytic mycelial fungi, Trichoderma reesei, and other cellulolytic microorganisms. The enzymes exhibited different mode of actions in respect to the hydrolysis of cellulose and cellulose derived oligosaccharides. In combination, these enzymes complimented each other to hydrolyze cellulose to its basic constituent, glucose. The kinetics of cellobiase were developed on the basis of applying the pseudo-steady state assumption to hydrolyze cellobiose to glucose. The results indicated that cellobiase was subjected to end-product inhibition by glucose. The kinetic modeling of exoglucanase (C/sub 1/) with respect to cellodextrins was studied. Both glucose and cellobiose were found to be inhibitors of this enzyme with cellobiose being a stronger inhibitor than glucose. Similarly, endoglucanase (C/sub x/) is subject to end-product inhibition by glucose. Crystallinity of the cellulose affects the rate of hydrolysis by cellulases. Hence, the changes in crystallinity of cellulose in relation to chemical pretreatment and enzyme hydrolysis was compared. The study of cellulase biosynthesis resulted in the conclusion that exo- and endo-glucanases are co-induced while cellobiase is synthesized independent of the other two enzymes. The multiplicity of cellulase enzymes are the end results of post-translational modification during and/or after the secretion of enzymes into growth environment.

  19. Butanediol production from cellulose and hemicellulose by Klebsiella pneumoniae grown in sequential coculture with Trichoderma harzianum

    Energy Technology Data Exchange (ETDEWEB)

    Yu, E.K.C.; Deschatelets, L.; Louis-Seize, G.; Saddler, J.N.

    1985-10-01

    The bioconverison of cellulose and hemicellulose substrates to 2,3-butanediol by a sequential coculture approach was investigated with the cellulolytic fungus Trichoderma harzianum E58 and the fermentative bacterium Klebsiella pneumoniae. Vogel medium optimal for the production of the cellulolytic and xylanolytic enzymes of the fungus was found to be inhibitory to butanediol fermentation. This inhibition appeared to be due to a synergistic effect of various ingredients, particularly the salts, present in the fungal medium. The removal or replacement of such ingredients from Vogel medium led to the relief of fermentation inhibition, but the treatments also resulted in a significant decrease in fungal enzyme production. Resting cells of K. pneumoniae could be used for butanediol production in the fungal medium, indicating that the inhibitory effect on solvent production under such conditions was due to the indirect result of growing inhibition of the bacterial cells. The resting-cell approach could be combined with a fed-batch system for the direct conversion of 8 to 10% (wt/vol) of Solka-Floc or aspenwood xylan to butanediol at over 30% of the theoretical conversion efficiencies.

  20. Trichoderma species occurring on wood with decay symptoms in mountain forests in Central Europe: genetic and enzymatic characterization.

    Science.gov (United States)

    Błaszczyk, Lidia; Strakowska, Judyta; Chełkowski, Jerzy; Gąbka-Buszek, Agnieszka; Kaczmarek, Joanna

    2016-08-01

    The aim of this study was to explore the species diversity of Trichoderma obtained from samples of wood collected in the forests of the Gorce Mountains (location A), Karkonosze Mountains (location B) and Tatra Mountains (location C) in Central Europe and to examine the cellulolytic and xylanolytic activity of these species as an expression of their probable role in wood decay processes. The present study has led to the identification of the following species and species complex: Trichoderma atroviride P. Karst., Trichoderma citrinoviride Bissett, Trichoderma cremeum P. Chaverri & Samuels, Trichoderma gamsii Samuels & Druzhin., Trichoderma harzianum complex, Trichoderma koningii Oudem., Trichoderma koningiopsis Samuels, C. Suárez & H.C. Evans, Trichoderma longibrachiatum Rifai, Trichoderma longipile Bissett, Trichoderma sp. (Hypocrea parapilulifera B.S. Lu, Druzhin. & Samuels), Trichoderma viride Schumach. and Trichoderma viridescens complex. Among them, T. viride was observed as the most abundant species (53 % of all isolates) in all the investigated locations. The Shannon's biodiversity index (H), evenness (E), and the Simpson's biodiversity index (D) calculations for each location showed that the highest species diversity and evenness were recorded for location A-Gorce Mountains (H' = 1.71, E = 0.82, D = 0.79). The preliminary screening of 119 Trichoderma strains for cellulolytic and xylanolytic activity showed the real potential of all Trichoderma species originating from wood with decay symptoms to produce cellulases and xylanases-the key enzymes in plant cell wall degradation. PMID:26586561

  1. Analysis of genomic regions of Trichoderma harzianum IOC-3844 related to biomass degradation.

    Science.gov (United States)

    Crucello, Aline; Sforça, Danilo Augusto; Horta, Maria Augusta Crivelente; dos Santos, Clelton Aparecido; Viana, Américo José Carvalho; Beloti, Lilian Luzia; de Toledo, Marcelo Augusto Szymanski; Vincentz, Michel; Kuroshu, Reginaldo Massanobu; de Souza, Anete Pereira

    2015-01-01

    Trichoderma harzianum IOC-3844 secretes high levels of cellulolytic-active enzymes and is therefore a promising strain for use in biotechnological applications in second-generation bioethanol production. However, the T. harzianum biomass degradation mechanism has not been well explored at the genetic level. The present work investigates six genomic regions (~150 kbp each) in this fungus that are enriched with genes related to biomass conversion. A BAC library consisting of 5,760 clones was constructed, with an average insert length of 90 kbp. The assembled BAC sequences revealed 232 predicted genes, 31.5% of which were related to catabolic pathways, including those involved in biomass degradation. An expression profile analysis based on RNA-Seq data demonstrated that putative regulatory elements, such as membrane transport proteins and transcription factors, are located in the same genomic regions as genes related to carbohydrate metabolism and exhibit similar expression profiles. Thus, we demonstrate a rapid and efficient tool that focuses on specific genomic regions by combining a BAC library with transcriptomic data. This is the first BAC-based structural genomic study of the cellulolytic fungus T. harzianum, and its findings provide new perspectives regarding the use of this species in biomass degradation processes. PMID:25836973

  2. MICROFLORA CULTIVABLE Y ENDOMICORRIZAS OBTENIDAS EN HOJARASCA DE BOSQUE (PÁRAMO GUERRERO FINCA PUENTE DE TIERRA ZIPAQUIRÁ, COLOMBIA Cultivable Microflora and Endomycorrhizas Obtained in Litter Forest (Paramo Guerrero Finca Puente de Tierra Zipaquirá, Colombia

    Directory of Open Access Journals (Sweden)

    ELEONORA BERNAL

    2006-06-01

    Full Text Available Se realizó el recuento de microorganismos cultivables (bacterias y hongos, microorganismos celulolíticos y endomicorrizas presentes en la hojarasca de bosque (finca Puente de Tierra en el páramo Guerrero, Colombia. Los microorganismos aislados con mayor frecuencia pertenecían a los géneros Staphylococcus, Bacillus, Pseudomonas, Micrococcus, Penicillium, Rhodotorula y se aisló una cepa de Cladosporium sp. en un medio selectivo con carboximetil celulosa. Así mismo, se encontraron ocho morfotipos de endomicorrizas, entre los cuales predominaron especies de Glomus y Acaulospora. Este estudio contribuye con el conocimiento de la microbiota cultivable de hojarasca, que ha sido poco explorada en ecosistemas de páramo.The count of cultivable microorganisms (bacteria and fungi, cellulolytic microorganisms and endomycorrhizas present in litter forest (property Puente de Tierra in the Guerrero’s moor, Colombia was made. The most frequently isolated microorganisms belonged to the Staphylococcus, Bacillus, Pseudomonas, Micrococcus, Penicillium and Rhodotorula genus and Cladosporium sp., which is a cellulolytic microorganism, was isolated in carboxymethyl cellulose agar. In addition eight morphotypes of endomycorrhizas were found, species of Glomus and Acaulospora predominated among them. This study contributes with the knowledge of the cultivable microorganisms of litter that have been little explored in moor ecosystems.

  3. Two major facilitator superfamily sugar transporters from Trichoderma reesei and their roles in induction of cellulase biosynthesis.

    Science.gov (United States)

    Zhang, Weixin; Kou, Yanbo; Xu, Jintao; Cao, Yanli; Zhao, Guolei; Shao, Jing; Wang, Hai; Wang, Zhixing; Bao, Xiaoming; Chen, Guanjun; Liu, Weifeng

    2013-11-15

    Proper perception of the extracellular insoluble cellulose is key to initiating the rapid synthesis of cellulases by cellulolytic Trichoderma reesei. Uptake of soluble oligosaccharides derived from cellulose hydrolysis represents a potential point of control in the induced cascade. In this study, we identified a major facilitator superfamily sugar transporter Stp1 capable of transporting cellobiose by reconstructing a cellobiose assimilation system in Saccharomyces cerevisiae. The absence of Stp1 in T. reesei resulted in differential cellulolytic response to Avicel versus cellobiose. Transcriptional profiling revealed a different expression profile in the Δstp1 strain from that of wild-type strain in response to Avicel and demonstrated that Stp1 somehow repressed induction of the bulk of major cellulase and hemicellulose genes. Two other putative major facilitator superfamily sugar transporters were, however, up-regulated in the profiling. Deletion of one of them identified Crt1 that was required for growth and enzymatic activity on cellulose or lactose, but was not required for growth or hemicellulase activity on xylan. The essential role of Crt1 in cellulase induction did not seem to rely on its transporting activity because the overall uptake of cellobiose or sophorose by T. reesei was not compromised in the absence of Crt1. Phylogenetic analysis revealed that orthologs of Crt1 exist in the genomes of many filamentous ascomycete fungi capable of degrading cellulose. These data thus shed new light on the mechanism by which T. reesei senses and transmits the cellulose signal and offers potential strategies for strain improvement.

  4. Functional and structural analyses of a 1,4-β-endoglucanase from Ganoderma lucidum.

    Science.gov (United States)

    Liu, Guizhi; Li, Qian; Shang, Na; Huang, Jian-Wen; Ko, Tzu-Ping; Liu, Weidong; Zheng, Yingying; Han, Xu; Chen, Yun; Chen, Chun-Chi; Jin, Jian; Guo, Rey-Ting

    2016-05-01

    Ganoderma lucidum is a saprotrophic white-rot fungus which contains a rich set of cellulolytic enzymes. Here, we screened an array of potential 1,4-β-endoglucanases from G. lucidum based on the gene annotation library and found that one candidate gene, GlCel5A, exhibits CMC-hydrolyzing activity. The recombinant GlCel5A protein expressed in Pichia pastoris is able to hydrolyze CMC and β-glucan but not xylan and mannan. The enzyme exhibits optimal activity at 60°C and pH 3-4, and retained 50% activity at 80 and 90°C for at least 15 and 10min. The crystal structure of GlCel5A and its complex with cellobiose, solved at 2.7 and 2.86Å resolution, shows a classical (β/α)8 TIM-barrel fold as seen in other members of glycoside hydrolase family 5. The complex structure contains a cellobiose molecule in the +1 and +2 subsites, and reveals the interactions with the positive sites of the enzyme. Collectively, the present work provides the first comprehensive characterization of an endoglucanase from G. lucidum that possesses properties for industrial applications, and strongly encourages further studying in the cellulolytic enzyme system of G. lucidum. PMID:26992795

  5. Tillage practices and straw-returning methods affect topsoil bacterial community and organic C under a rice-wheat cropping system in central China

    Science.gov (United States)

    Guo, Lijin; Zheng, Shixue; Cao, Cougui; Li, Chengfang

    2016-01-01

    The objective of this study was to investigate how the relationships between bacterial communities and organic C (SOC) in topsoil (0–5 cm) are affected by tillage practices [conventional intensive tillage (CT) or no-tillage (NT)] and straw-returning methods [crop straw returning (S) or removal (NS)] under a rice-wheat rotation in central China. Soil bacterial communities were determined by high-throughput sequencing technology. After two cycles of annual rice-wheat rotation, compared with CT treatments, NT treatments generally had significantly more bacterial genera and monounsaturated fatty acids/saturated fatty acids (MUFA/STFA), but a decreased gram-positive bacteria/gram-negative bacteria ratio (G+/G−). S treatments had significantly more bacterial genera and MUFA/STFA, but had decreased G+/G− compared with NS treatments. Multivariate analysis revealed that Gemmatimonas, Rudaea, Spingomonas, Pseudomonas, Dyella, Burkholderia, Clostridium, Pseudolabrys, Arcicella and Bacillus were correlated with SOC, and cellulolytic bacteria (Burkholderia, Pseudomonas, Clostridium, Rudaea and Bacillus) and Gemmationas explained 55.3% and 12.4% of the variance in SOC, respectively. Structural equation modeling further indicated that tillage and residue managements affected SOC directly and indirectly through these cellulolytic bacteria and Gemmationas. Our results suggest that Burkholderia, Pseudomonas, Clostridium, Rudaea, Bacillus and Gemmationas help to regulate SOC sequestration in topsoil under tillage and residue systems. PMID:27611023

  6. Endo- and exoglucanase activities in bacteria from mangrove sediment.

    Science.gov (United States)

    Soares Júnior, Fábio Lino; Dias, Armando Cavalcante Franco; Fasanella, Cristiane Cipola; Taketani, Rodrigo Gouvêa; de Souza Lima, André Oliveira; Melo, Itamar Soares; Andreote, Fernando Dini

    2013-01-01

    The mangrove ecosystem is an unexplored source for biotechnological applications. In this unique environment, endemic bacteria have the ability to thrive in the harsh environmental conditions (salinity and anaerobiosis), and act in the degradation of organic matter, promoting nutrient cycles. Thus, this study aimed to assess the cellulolytic activities of bacterial groups present in the sediment from a mangrove located in Ilha do Cardoso (SP, Brazil). To optimize the isolation of cellulolytic bacteria, enrichments in two types of culture media (tryptone broth and minimum salt medium), both supplemented with 5% NaCl and 1% of cellulose, were performed. Tests conducted with the obtained colonies showed a higher occurrence of endoglycolytic activity (33 isolates) than exoglycolytic (19 isolates), and the degradation activity was shown to be modulated by the presence of NaCl. The isolated bacteria were clustered by BOX-PCR and further classified on the basis of partial 16S rRNA sequences as Alphaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes or Bacteroidetes. Therefore, this study highlights the importance of studies focusing on the endemic species found in mangroves to exploit them as novel biotechnological tools for the degradation of cellulose. PMID:24516466

  7. Endo-and exoglucanase activities in bacteria from mangrove sediment

    Directory of Open Access Journals (Sweden)

    Fábio Lino Soares Júnior

    2013-09-01

    Full Text Available The mangrove ecosystem is an unexplored source for biotechnological applications. In this unique environment, endemic bacteria have the ability to thrive in the harsh environmental conditions (salinity and anaerobiosis, and act in the degradation of organic matter, promoting nutrient cycles. Thus, this study aimed to assess the cellulolytic activities of bacterial groups present in the sediment from a mangrove located in Ilha do Cardoso (SP, Brazil. To optimize the isolation of cellulolytic bacteria, enrichments in two types of culture media (tryptone broth and minimum salt medium, both supplemented with 5% NaCl and 1% of cellulose, were performed. Tests conducted with the obtained colonies showed a higher occurrence of endoglycolytic activity (33 isolates than exoglycolytic (19 isolates, and the degradation activity was shown to be modulated by the presence of NaCl. The isolated bacteria were clustered by BOX-PCR and further classified on the basis of partial 16S rRNA sequences as Alphaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes or Bacteroidetes. Therefore, this study highlights the importance of studies focusing on the endemic species found in mangroves to exploit them as novel biotechnological tools for the degradation of cellulose.

  8. Gas hold-up and oxygen mass transfer in three pneumatic bioreactors operating with sugarcane bagasse suspensions.

    Science.gov (United States)

    Esperança, M N; Cunha, F M; Cerri, M O; Zangirolami, T C; Farinas, C S; Badino, A C

    2014-05-01

    Sugarcane bagasse is a low-cost and abundant by-product generated by the bioethanol industry, and is a potential substrate for cellulolytic enzyme production. The aim of this work was to evaluate the effects of air flow rate (QAIR), solids loading (%S), sugarcane bagasse type, and particle size on the gas hold-up (εG) and volumetric oxygen transfer coefficient (kLa) in three different pneumatic bioreactors, using response surface methodology. Concentric tube airlift (CTA), split-cylinder airlift (SCA), and bubble column (BC) bioreactor types were tested. QAIR and %S affected oxygen mass transfer positively and negatively, respectively, while sugarcane bagasse type and particle size (within the range studied) did not influence kLa. Using large particles of untreated sugarcane bagasse, the loop-type bioreactors (CTA and SCA) exhibited higher mass transfer, compared to the BC reactor. At higher %S, SCA presented a higher kLa value (0.0448 s−1) than CTA, and the best operational conditions in terms of oxygen mass transfer were achieved for %S 27.0 L min−1. These results demonstrated that pneumatic bioreactors can provide elevated oxygen transfer in the presence of vegetal biomass, making them an excellent option for use in three-phase systems for cellulolytic enzyme production by filamentous fungi.

  9. Analysis of genomic regions of Trichoderma harzianum IOC-3844 related to biomass degradation.

    Directory of Open Access Journals (Sweden)

    Aline Crucello

    Full Text Available Trichoderma harzianum IOC-3844 secretes high levels of cellulolytic-active enzymes and is therefore a promising strain for use in biotechnological applications in second-generation bioethanol production. However, the T. harzianum biomass degradation mechanism has not been well explored at the genetic level. The present work investigates six genomic regions (~150 kbp each in this fungus that are enriched with genes related to biomass conversion. A BAC library consisting of 5,760 clones was constructed, with an average insert length of 90 kbp. The assembled BAC sequences revealed 232 predicted genes, 31.5% of which were related to catabolic pathways, including those involved in biomass degradation. An expression profile analysis based on RNA-Seq data demonstrated that putative regulatory elements, such as membrane transport proteins and transcription factors, are located in the same genomic regions as genes related to carbohydrate metabolism and exhibit similar expression profiles. Thus, we demonstrate a rapid and efficient tool that focuses on specific genomic regions by combining a BAC library with transcriptomic data. This is the first BAC-based structural genomic study of the cellulolytic fungus T. harzianum, and its findings provide new perspectives regarding the use of this species in biomass degradation processes.

  10. A Metagenomic Advance for the Cloning and Characterization of a Cellulase from Red Rice Crop Residues.

    Science.gov (United States)

    Meneses, Carlos; Silva, Bruna; Medeiros, Betsy; Serrato, Rodrigo; Johnston-Monje, David

    2016-01-01

    Many naturally-occurring cellulolytic microorganisms are not readily cultivable, demanding a culture-independent approach in order to study their cellulolytic genes. Metagenomics involves the isolation of DNA from environmental sources and can be used to identify enzymes with biotechnological potential from uncultured microbes. In this study, a gene encoding an endoglucanase was cloned from red rice crop residues using a metagenomic strategy. The amino acid identity between this gene and its closest published counterparts is lower than 70%. The endoglucanase was named EglaRR01 and was biochemically characterized. This recombinant protein showed activity on carboxymethylcellulose, indicating that EglaRR01 is an endoactive lytic enzyme. The enzymatic activity was optimal at a pH of 6.8 and at a temperature of 30 °C. Ethanol production from this recombinant enzyme was also analyzed on EglaRR01 crop residues, and resulted in conversion of cellulose from red rice into simple sugars which were further fermented by Saccharomyces cerevisiae to produce ethanol after seven days. Ethanol yield in this study was approximately 8 g/L. The gene found herein shows strong potential for use in ethanol production from cellulosic biomass (second generation ethanol). PMID:27347917

  11. Metagenomics of the Svalbard reindeer rumen microbiome reveals abundance of polysaccharide utilization loci.

    Directory of Open Access Journals (Sweden)

    Phillip B Pope

    Full Text Available Lignocellulosic biomass remains a largely untapped source of renewable energy predominantly due to its recalcitrance and an incomplete understanding of how this is overcome in nature. We present here a compositional and comparative analysis of metagenomic data pertaining to a natural biomass-converting ecosystem adapted to austere arctic nutritional conditions, namely the rumen microbiome of Svalbard reindeer (Rangifer tarandus platyrhynchus. Community analysis showed that deeply-branched cellulolytic lineages affiliated to the Bacteroidetes and Firmicutes are dominant, whilst sequence binning methods facilitated the assemblage of metagenomic sequence for a dominant and novel Bacteroidales clade (SRM-1. Analysis of unassembled metagenomic sequence as well as metabolic reconstruction of SRM-1 revealed the presence of multiple polysaccharide utilization loci-like systems (PULs as well as members of more than 20 glycoside hydrolase and other carbohydrate-active enzyme families targeting various polysaccharides including cellulose, xylan and pectin. Functional screening of cloned metagenome fragments revealed high cellulolytic activity and an abundance of PULs that are rich in endoglucanases (GH5 but devoid of other common enzymes thought to be involved in cellulose degradation. Combining these results with known and partly re-evaluated metagenomic data strongly indicates that much like the human distal gut, the digestive system of herbivores harbours high numbers of deeply branched and as-yet uncultured members of the Bacteroidetes that depend on PUL-like systems for plant biomass degradation.

  12. Ruminococcus flavefaciens 007C cellulosomes and cellulase consortium

    Directory of Open Access Journals (Sweden)

    Maša VODOVNIK

    2015-11-01

    Full Text Available Ruminococcus flavefaciens is among the most important cellulolytic bacterial species in rumen and gastrointestinal tract of monogastric herbivorous animals. Its efficiency in degradation of (hemicellulosic substrates is associated with the production of remarkably intricate extracellular multienzyme complexes, named cellulosomes. In the present work we investigated the cellulolytic system of 007C. The bioinformatic analysis of the draft genome sequence revealed identical organization of sca gene cluster as has previously been found in four other strains of R. flavefaciens. The cluster consists of five genes in the following order: scaC-scaA-scaB-cttA-scaE. The cellulases of R. flavefaciens 007C belong to four families of glycoside hydrolases, namely GH48, GH44, GH9 in GH5. Majority of these enzymes are putative endoglucanases, belonging to families GH5 and GH9, whereas only one gene encoding GH44 and GH48 was found. Apart from catalytic domains, most of these proteins also contain dockerins – signature sequences, which indicate their attachement to cellulosomes. On the other hand, carbohydrate-binding modules were only found coupled to GH9 catalytic domains. Zymogram analysis showed that larger endoglucanases were mostly constitutively expressed, wheras smaller enzymes were only detected in later phases of Avicel-grown cultures.

  13. Cellulose-Enriched Microbial Communities from Leaf-Cutter Ant (Atta colombica Refuse Dumps Vary in Taxonomic Composition and Degradation Ability.

    Directory of Open Access Journals (Sweden)

    Gina R Lewin

    Full Text Available Deconstruction of the cellulose in plant cell walls is critical for carbon flow through ecosystems and for the production of sustainable cellulosic biofuels. Our understanding of cellulose deconstruction is largely limited to the study of microbes in isolation, but in nature, this process is driven by microbes within complex communities. In Neotropical forests, microbes in leaf-cutter ant refuse dumps are important for carbon turnover. These dumps consist of decaying plant material and a diverse bacterial community, as shown here by electron microscopy. To study the portion of the community capable of cellulose degradation, we performed enrichments on cellulose using material from five Atta colombica refuse dumps. The ability of enriched communities to degrade cellulose varied significantly across refuse dumps. 16S rRNA gene amplicon sequencing of enriched samples identified that the community structure correlated with refuse dump and with degradation ability. Overall, samples were dominated by Bacteroidetes, Gammaproteobacteria, and Betaproteobacteria. Half of abundant operational taxonomic units (OTUs across samples were classified within genera containing known cellulose degraders, including Acidovorax, the most abundant OTU detected across samples, which was positively correlated with cellulolytic ability. A representative Acidovorax strain was isolated, but did not grow on cellulose alone. Phenotypic and compositional analyses of enrichment cultures, such as those presented here, help link community composition with cellulolytic ability and provide insight into the complexity of community-based cellulose degradation.

  14. Comparative analysis of carbohydrate active enzymes in Clostridium termitidis CT1112 reveals complex carbohydrate degradation ability.

    Science.gov (United States)

    Munir, Riffat I; Schellenberg, John; Henrissat, Bernard; Verbeke, Tobin J; Sparling, Richard; Levin, David B

    2014-01-01

    Clostridium termitidis strain CT1112 is an anaerobic, gram positive, mesophilic, cellulolytic bacillus isolated from the gut of the wood-feeding termite, Nasutitermes lujae. It produces biofuels such as hydrogen and ethanol from cellulose, cellobiose, xylan, xylose, glucose, and other sugars, and therefore could be used for biofuel production from biomass through consolidated bioprocessing. The first step in the production of biofuel from biomass by microorganisms is the hydrolysis of complex carbohydrates present in biomass. This is achieved through the presence of a repertoire of secreted or complexed carbohydrate active enzymes (CAZymes), sometimes organized in an extracellular organelle called cellulosome. To assess the ability and understand the mechanism of polysaccharide hydrolysis in C. termitidis, the recently sequenced strain CT1112 of C. termitidis was analyzed for both CAZymes and cellulosomal components, and compared to other cellulolytic bacteria. A total of 355 CAZyme sequences were identified in C. termitidis, significantly higher than other Clostridial species. Of these, high numbers of glycoside hydrolases (199) and carbohydrate binding modules (95) were identified. The presence of a variety of CAZymes involved with polysaccharide utilization/degradation ability suggests hydrolysis potential for a wide range of polysaccharides. In addition, dockerin-bearing enzymes, cohesion domains and a cellulosomal gene cluster were identified, indicating the presence of potential cellulosome assembly.

  15. Dynamics of bacterial community in the gut of Cornu aspersum

    Directory of Open Access Journals (Sweden)

    ZDRAVKA KOLEVA

    2015-12-01

    Full Text Available The dynamics of the bacterial community in the intestinal tract of Cornu aspersum was investigated during different states of its life cycle. Two approaches were applied – culture and non-culture. The non-culture approach was performed by ARDRA of 16S rDNA using two of the six tested endonucleases. Data were analyzed by hierarchical cluster analysis. The restriction of 16S rDNA samples from the snail of different physiological states with endonucleases HinfI and Csp6I resulted in generation of different profiles depending on the snail states. By the culture approach we found that the total number of cultivable bacteria, representatives of Enterobacteriaceae, lactic acid bacteria, amylolitic and cellulolytic bacteria were the most abundant in active state of the snails. Cellulolytic bacteria were not detected in juveniles of C. aspersum. Escherichia coli, Clostridium perfringens as well as bacteria from the genus Salmonella, Shigella and Pseudomonas were not detected. Bacteria of the genus Aeromonas were found in juveniles of C. aspersum, after that their number decrease and were not found in hibernating snails. On the base of the two applied approaches this study shows that the bacterial flora in the intestinal tract of C. aspersum is affected by the seasonal and environmental variations and undergoes quantitative and qualitative changes during the different states of the life cycle. The snails harbor in their gut intestinal bacteria, which possess biochemical potentiality to degrade the plant components.

  16. Determinación de la actividad lignocelulolítica en sustrato natural de aislamientos fúngicos obtenidos de sabana de pastoreo y de bosque secundario de sabana inundable tropical Determination of lignocellulolytic activity in a natural substrate of native fungi strains obtained from savanna and of secondary forest from a tropical flooded savanna

    Directory of Open Access Journals (Sweden)

    Martha Lucía Ortiz Moreno

    2010-12-01

    Full Text Available El objetivo de este trabajo fue identificar aislamientos de hongos ligninolíticos y celulolíticos que pudieran degradar desechos de cosecha y mejorar las características del suelo en los Llanos Orientales, se realizó un muestreo siguiendo la metodología de transepto y muestras integradas. Se obtuvo una cepa ligninolítica (005L Verticillium spp. y 72 cepas celulolíticas. La comparación de los usos del suelo (sabana de pastoreo y bosque secundario mostró que no existía una relación entre el número de géneros obtenidos y las características del suelo. Posteriormente, se realizó la cuantificación de la actividad celulolítica y ligninolítica de los aislamientos para identificar las cepas que posteriormente serían evaluadas en el sustrato natural pasto seco (Brachiaria spp.. Se encontraron dos cepas con alta actividad exoglucanasa (055C y 061C Penicillium spp. y una cepa con alta actividad endoglucanasa (019C Trichoderma spp. respecto al control Trichoderma viride. En el sustrato natural se evaluaron los consorcios de las cepas seleccionadas formados por pares: una ligninolítica y una celulolítica. Las pruebas mostraron que los aislamientos promisorios aumentaron su actividad enzimática en el sustrato pasto superando a los controles positivos (Pleurotus ostreatus para lignina y T. viride para celulosa y que los consorcios no afectaron la capacidad enzimática de las cepas que los formaban. Por lo tanto, se recomienda utilizar estos consorcios para el desarrollo de biofertilizantes acondicionadores del suelo, empleando especialmente el consorcio formado por las cepas 005L (Verticillium spp. y 055C (Penicillium spp., que mostró alta actividad ligninolítica y celulolítica.The aim of this work was to identify lignolytic and cellulolytic fungal strains capable of degrading harvest waste and thereby improving the soil characteristics of the eastern Llanos of Colombia. Sampling was carried out using the transept methodology and

  17. Contribution to the knowledge of Turkish stoneflies with annotated catalogue (Insecta: Plecoptera).

    Science.gov (United States)

    Darilmaz, Mustafa Cemal; Salur, Ali; Murányi, Dávid; Vinçon, Gilles

    2016-01-01

    The stoneflies of Turkey are reviewed providing all known distributions and including new records. Additionally, ecological and biogeographical notes are given. The genus Taeniopteryx Pictet 1841 is reported from Turkey for the first time and 12 species new for the Turkish fauna: Leuctra joosti Braasch 1970, L. kopetdaghi Zhiltzova 1972, Protonemura rauschi Theischinger 1975, P. strandschaensis Braasch & Joost 1972, Nemoura asceta Murányi 2007, N. cambrica Stephens 1836, N. uncinata Despax 1934, Taeniopteryx caucasica Zhiltzova 1981, Brachyptera risi (Morton 1896), Pontoperla katherinae (Balinsky 1950), Siphonoperla neglecta (Rostock 1881), and Bulgaroperla mirabilis nigrita Zwick 1978.          Protonemura bithynica Aubert 1964 and Nemoura turcica Zwick 1972 are recognized as full species. The previously unknown female of Leuctra marilouae Vinçon & Sivec 2001 is described. The type locality is also given for each species located in Turkey.          The distributions of several rare endemic species are augmented by additional new records (Leuctra aculeata Zwick 1982, L. brachyptera Kazancı 1985, L. karcali Vinçon & Sivec 2001, L. kurui Kazancı 1983, L. marilouae Vinçon & Sivec 2001, L. sipahilerae Vinçon & Sivec 2001, L. theischingeri Vinçon & Sivec 2001, Protonemura bacurianica bacurianica Zhiltzova 1957, P. oreas Martynov 1928, P. spinulata Martynov 1928 (first confirmed records from Anatolia), P. triangulata Martynov 1928, Nemoura dromokeryx Theischinger 1976, N. martynovia Claassen 1936, and Brachyptera berkii Kazancı 2001.          Several species previously reported only from females are excluded from the Turkish fauna: Leuctra minuta minuta Zhiltzova 1960, L. svanetica Zhiltzova 1960, P. dilatata Martynov 1928. Other species are also excluded from the Turkish fauna: L. fusca fusca (Linnaeus 1758), N. carpathica Illies 1963, Siphonoperla burmeisteri (Pictet 1841), and S. libanica Alouf, 1992.          According to

  18. Revisão de Pseudoparlatoria (Hemiptera, Diaspididae Review of Pseudoparlatoria (Hemiptera, Diaspididae

    Directory of Open Access Journals (Sweden)

    Vera Regina dos S. Wolff

    2008-09-01

    Full Text Available Revisou-se a taxonomia das espécies incluídas em Pseudoparlatoria Cockerell, 1892, através do exame das séries tipo, exemplares obtidos nas localidades-tipo e material disponível em coleções científicas. Foram redescritas: P. argentata Hempel, 1912; P. browni McKenzie, 1963; P. campinensis Lepage & Giannotti, 1946; P. carolilehmanni Balachowsky, 1959; P. caucae Balachowsky, 1959; P. circularis Lepage, 1942; P. constricta Fonseca, 1975; P. elongata Ferris, 1941; P. fuscaFerris, 1941; P. fusiformisFonseca, 1969; P. lentigo Ferris, 1942; P. maculata Ferris, 1942; P. noacki Cockerell, 1898; P. occultata (Hempel, 1937; P. ostreataCockerell, 1892; P. parlatorioides(Comstock, 1883; P. perparvula Ferris, 1942; P. pisai (Hempel, 1904; P. punctata Ferris, 1942; P. rossetae Fonseca, 1969; P. serrulata Townsend & Cockerell, 1898; P. subcircularis Balachowsky, 1959; P. tillandsiae Tippins, 1970; P. trimaculata Lepage & Giannotti, 1946; P. turgida Ferris, 1941. Duas novas combinações são estabelecidas, P. mammata(Ferris, 1941; P. sculpta (Ferris, 1941. Uma chave para identificação das espécies é apresentada.The armored scale insects of genus Pseudoparlatoria Cockerell, 1892 were revised through the exam of the type series, species obtained in the type-localities and available material in scientific collections. Pseudoparlatoria argentata Hempel, 1912; P. browni McKenzie, 1963; P. campinensis Lepage & Giannotti, 1946; P. carolilehmanni Balachowsky, 1959; P. caucae Balachowsky, 1959; P. circularis Lepage, 1942; P. constricta Fonseca, 1975; P. elongata Ferris, 1941; P. fuscaFerris, 1941; P. fusiformisFonseca, 1969; P. lentigo Ferris, 1942; P. maculata Ferris, 1942; P. noacki Cockerell, 1898; P. occultata (Hempel, 1937; P. ostreata Cockerell, 1892; P. parlatorioides(Comstock, 1883; P. perparvula Ferris, 1942; P. pisai (Hempel, 1904; P. punctata Ferris, 1942; P. rossetae Fonseca, 1969; P. serrulata Townsend & Cockerell, 1898; P. subcircularis

  19. Egg Brochosomes of Proconiini (Hemiptera: Cicadellidae, Cicadellinae species associated with cultivation of grapevines Brocossomos de ovos de espécies de Proconiini (Hemiptera: Cicadellidae, Cicadellinae associadas à cultura da videira

    Directory of Open Access Journals (Sweden)

    Wilson Sampaio de Azevedo Filho

    2008-04-01

    Full Text Available Brochosomes production is considered a feature of Cicadellidae, and may represent an outstanding innovation which has played an important role in the development and diversification of this insect group. The objective of this study was to identify the species of Proconiini that produced egg brochosomes associated with grapevines in the Serra Gaúcha region of Brazil. Egg brochosome characteristics and an identification key are also discussed. The specimens were collected using yellow sticky cards in four vineyards (Vitis vinifera L. from October 2004 to May 2006. Eight species capable of producing egg brochosomes were identified:Acrogonia citrina Marucci & Cavichioli; Homalodisca ignorata Melichar; Molomea consolida Schröder; Molomea lineiceps Young; Molomea personata (Signoret; Oncometopia facialis (Signoret; Oncometopia fusca Melichar; and Tapajosa rubromarginata (Signoret. Egg brochosomes are useful structures to identify Proconiini species in vine.A produção de brocossomos é considerada uma característica dos Cicadellidae e pode representar uma inovação importante no desenvolvimento e diversificação deste grupo. O objetivo do estudo foi identificar as espécies de Proconiini formadoras de brocossomos de ovos associadas à cultura da videira na região da Serra Gaúcha. As características dos brocossomos de ovos e uma chave para identificação também são discutidas. Os espécimes foram coletados com cartões adesivos amarelos em quatro vinhedos (Vitis vinifera L. no período de outubro de 2004 a maio de 2006. Foram identificadas oito espécies com capacidade de produzir brocossomos de ovos: Acrogonia citrina Marucci & Cavichioli; Homalodisca ignorata Melichar; Molomea consolida Schröder; Molomea lineiceps Young; Molomea personata (Signoret; Oncometopia facialis (Signoret; Oncometopia fusca Melichar e Tapajosa rubromarginata (Signoret. Os brocossomos de ovos são estruturas que podem ser utilizadas na identificação de esp

  20. White grubs (Coleoptera, Melolonthidae in the "Planalto Region", Rio Grande do Sul state, Brazil: Key for identification, species richness and distribution

    Directory of Open Access Journals (Sweden)

    Mariana A. Cherman

    2013-09-01

    Full Text Available White grubs (Coleoptera, Melolonthidae in the "Planalto Region", Rio Grande do Sul state, Brazil: Key for identification, species richness and distribution. The objective of this study was to survey the occurrence and geographic distribution of white grub species (Coleoptera, Melolonthidae in cultivated and non-cultivated fields of the "Planalto Region", Rio Grande do Sul state, Brazil and develop a key at genus-level. Twenty-eight species from 15 genera and three subfamilies were recorded: Dynastinae, Melolonthinae and Rutelinae. The species or genera recorded for the first time in the state are: Cyclocephala metrica, C. tucumana, Isonychus albicinctus, Liogenys bidenticeps, L. fusca, L. obesa and L. sinuaticeps, Paranomala violacea, as well as unidentified species of Amononyx, Dicrania, Leucothyreus, Macrodactylus, Plectris and Rhizogeniates. Among the species recorded, 23 were associated with winter crops. Only Cyclocephala metrica, Dyscinetus rugifrons, two species of Leucothyreus and one species of the tribe Sericini were not present in cultivated crop fields. Cyclocephala flavipennis and Diloboderus abderus occurred in most of the municipalities sampled, often associated with Plectris sp., C. modesta and C. putrida. The highest richness of melolonthids was concentrated in the northeast of the Planalto region.

  1. Diversity and abundance of water birds in a subarctic lake during three decades

    Directory of Open Access Journals (Sweden)

    Anders Klemetsen

    2013-12-01

    Full Text Available The numbers of divers, ducks, gulls, terns and waders in the 15 km2 oligotrophic lake Takvatn, North Norway were estimated six times during 1983-2012. Systematic mapping surveys were done by boat within the first week after ice-break in June. Twenty-one species were observed over the years and 12 were regarded as breeding on the lake. Red-breasted merganser Mergus serrator was the dominant diving bird, with estimated minimum number of pairs varying from 15 to 39 among years. Black-throated diver Gavia arctica (1-3 pairs, tufted duck Aythya fuligula (2-15 pairs and common scoter Melanitta nigra (1-5 pairs bred regularly, while velvet scoter Melanitta fusca (1-2 and goldeneye Bucephala clangula (2-4 were found in some years and mallard Anas platyrhynchos (1 pair and wigeon Anas penelope (1 pair in one year. Common gull Larus canus (6-30 pairs and arctic tern Sterna paradisaea (2-35 pairs bred in all years. Common sandpiper Tringa hypoleucos (3-9 pairs and redshank Tringa totanus (1-4 pairs were regular waders. Density variations of mergansers, gulls and terns are possibly related to density variations of three-spined sticklebacks Gasterosteus aculeatus, their dominant fish prey. The water birds are important links in the food web of the lake.

  2. Biofilm inhibition activity of compounds isolated from two Eunicea species collected at the Caribbean Sea

    Directory of Open Access Journals (Sweden)

    Yenny Martínez Díaz

    2015-12-01

    Full Text Available Abstract Biofilm has a primary role in the pathogenesis of diseases and in the attachment of multicellular organisms to a fouled surface. Because of that, the control of bacterial biofilms has been identified as an important target. In the present study, five lipid compounds isolated from soft coral Eunicea sp. and three terpenoids together with a mixture of sterols from Eunicea fusca collected at the Colombian Caribbean Sea showed different effectiveness against biofilm formation by three marine bacteria associated with immersed fouled surfaces, Ochrobactrum pseudogringnonense,Alteromona macleodii and Vibrio harveyi, and against two known biofilm forming bacteria, Pseudomonas aeruginosa ATCC 27853 and Staphylococcus aureus ATCC 25923. The pure compounds were characterized by NMR, HRESI-MS, HRGC-MS and optical rotation. The most effective compounds were batyl alcohol (1 and fuscoside E peracetate (6, acting against four strains without affecting their microbial growth. Compound 1 showed biofilm inhibition greater than 30% against A. macleodii, and up to 60% against O. pseudogringnonense,V. harveyi and S. aureus. Compound 6 inhibited O. pseudogringnonense and V. harveyi between 25 and 50%, and P. aeruginosa or S. aureus up to 60% at 0.5 mg/ml. The results suggest that these compounds exhibit specific biofilm inhibition with lower antimicrobial effect against the bacterial species assayed.

  3. Microfaunal indicators, Ciliophora phylogeny and protozoan population shifts in an intermittently aerated and fed bioreactor

    Energy Technology Data Exchange (ETDEWEB)

    Ntougias, Spyridon, E-mail: sntougia@env.duth.gr [Democritus University of Thrace, Department of Environmental Engineering, Laboratory of Wastewater Management and Treatment Technologies, Vas. Sofias 12, 67100 Xanthi (Greece); Tanasidis, Spartakos; Melidis, Paraschos [Democritus University of Thrace, Department of Environmental Engineering, Laboratory of Wastewater Management and Treatment Technologies, Vas. Sofias 12, 67100 Xanthi (Greece)

    2011-02-28

    Microfauna community structure was examined in the mixed liquor of a bench-scale bioreactor equipped with an intermittent aeration and feeding system. The reactor was operated under an intermittent aeration of 25 min in every 1 h and varying feeding conditions (0.264, 0.403 and 0.773 kg BOD{sub 5}/m{sup 3} d). A total of 14 protozoan and metazoan taxa were identified by microscopic examination. Sessile ciliates, followed by crawling ciliates, were the major protozoan groups under 0.403 kg BOD{sub 5}/m{sup 3} d organic loading conditions, while sessile ciliate population was remarkably increased under an organic loading of 0.773 kg BOD{sub 5}/m{sup 3} d. Principal Component Analysis and Pearson correlation coefficient tests were performed in order to reveal relationships between microfauna community and operational parameters. Ciliophora specific-18S rRNA gene clone library was constructed to identify ciliate diversity under 0.773 kg BOD{sub 5}/m{sup 3} d organic loading conditions. Ciliophora diversity consisted of members of Aspidiscidae, Epistylidae, Opisthonectidae and Vorticellidae, with the majority of the clones being associated with the species Vorticella fusca. At least one novel phylogenetic linkage among Ciliophora was identified. Comparisons made after molecular characterization and microscopic examination of Ciliophora community showed that the estimation of broad ciliate groups is useful for ecological considerations and evaluation of the operational conditions in wastewater treatment plants.

  4. Screening for estrogenic and antiestrogenic activities of plants growing in Egypt and Thailand

    Directory of Open Access Journals (Sweden)

    Ali M El-Halawany

    2011-01-01

    Full Text Available Background: There is a growing demand for the discovery of new phytoestrogens to be used as a safe and effective hormonal replacement therapy. Materials and Methods: The methanol extracts of 40 plants from the Egyptian and Thailand folk medicines were screened for their estrogen agonist and antagonist activities. The estrogenic and antiestrogenic effects of the tested extracts were carried out using the yeast two-hybrid assay system expressing ERα and ERβ. In addition, all the extracts were subjected to a naringinase treatment and retested for their estrogenic activity. Results: The methanol extracts of Derris reticulata and Dracaena lourieri showed the most potent estrogenic activity on both estrogen-receptor subtypes, while, the methanol extracts of Butea monosperma, Erythrina fusca, and Dalbergia candenatensis revealed significant estrogenic activity on ERβ only. Nigella sativa, Sophora japonica, Artabotrys harmandii, and Clitorea hanceana showed estrogenic effect only after naringinase treatment. The most potent antiestrogenic effect was revealed by Aframomum melegueta, Dalbergia candenatensis, Dracena loureiri, and Mansonia gagei.

  5. Changruicaoia Z. Y. Zhu——A new genus of Labiatae from Mount Emei, Sichuan, China%长蕊草属——四川峨眉山唇形科植物一新属

    Institute of Scientific and Technical Information of China (English)

    祝正银

    2001-01-01

    @@长蕊草属新属 Changruicaoia Z. Y. Zhu, gen. nov. Herba perennis; rhizoma robustum procumbens. Caulis rectus quadrangularis quadrisulcatus supra ramosus. Folia triangularia vel triangulari_cordata usque cordata, margine crasse dentata, subtus plerumque purpurea, longius petiolata. Inflorescentia paniculata e cymis 3~16-floris composita; bracteae longe ovatae vel oblongae; bracteolae acerosae, interdum absentes. Calyx tubulatus 15_nervus, intus ad medium piloso-annulatus apice 3/2_bilabiatus, labio supero trilobo, lobo medio maximo ovato_rotundato, margine integro vel repando, lobis lateralibus oblique oblongis apice cuspidatis, labio infero bilobo lobis lanceolatis apice cuspidatis. Corolla flava vel flavida, sursum sensim ampliata, limbo bilabiato, labio supero bilobo recto, labio infero trilobo, lobo medio maximo oblongo, lobis lateralibus oblique ovatis. Stamina 4, ex labio supero exserta, anteriora 2 longiora, 2-plo longiora quam corollae tubus, filamentis filiformibus, antheris ovoideis, loculis semidivergentibus. Discus patelliformis. Ovarium 4_lobum; stylus staminibus longior; stigma subaequaliter bilobum. Nuculae obtuso-triangulo-oblongae, fuscae, reticulato_lacunosae, umbilicis oblongis parvis.

  6. Biochemical composition of seven species of cyanobacteria isolated from different aquatic habitats of Western Ghats, Southern India

    Directory of Open Access Journals (Sweden)

    Karanth Rama Rajeshwari

    2011-10-01

    Full Text Available The aim of this work was to study the biochemical constituents of seven species of cyanobacteria namely, Calothrix fusca, Gloeocapsa livida, Lyngbya limnetica and Scytonema bohneri isolated from Panekal sulfur spring. The species namely, Oscillatoria acuminata from petrochemical refinery, O. calcuttensis from dairy effluent and O. foreaui from a sewage drain located in the Western Ghats of Southern India under laboratory culture conditions. The biochemical constituents were analyzed in terms of total carbohydrates, total protein, total free amino acid, total lipid, fatty acid and mineral contents. The analysis showed that maximum amount of total carbohydrate in S. bohneri (28.4% dry weight and minimum in O. foreaui (8.0% of dry weight. Maximum amount of total protein and total free amino acid were in O. foreaui (7% of dry weight. O. calcuttensis showed higher amount of total lipid (20% dry weight. A total of 12 types of fatty acids were detected among which lauric acid was in highest quantity in all the seven species. Among the polyunsaturated fatty acids, oleic acid was present in all the species ranging from 1.68 to 3.89%. O. foreaui showed highest quantities of copper, manganese, ferrous and zinc. Nickel was maximum in S. bohneri (11.05 µgmL-1. O. acuminata showed highest quantity of magnesium (21.050 mg g-1 and it was least in O. foreaui (12.812 mg g-1.

  7. Influence of Dietary Experience on the Induction of Preference of Adult Moths and Larvae for a New Olfactory Cue.

    Directory of Open Access Journals (Sweden)

    Christophe Petit

    Full Text Available In Lepidoptera, host plant selection is first conditioned by oviposition site preference of adult females followed by feeding site preference of larvae. Dietary experience to plant volatile cues can induce larval and adult host plant preference. We investigated how the parent's and self-experience induce host preference in adult females and larvae of three lepidopteran stem borer species with different host plant ranges, namely the polyphagous Sesamia nonagrioides, the oligophagous Busseola fusca and the monophagous Busseola nairobica, and whether this induction can be linked to a neurophysiological phenotypic plasticity. The three species were conditioned to artificial diet enriched with vanillin from the neonate larvae to the adult stage during two generations. Thereafter, two-choice tests on both larvae and adults using a Y-tube olfactometer and electrophysiological (electroantennography [EAG] recordings experiments on adults were carried out. In the polyphagous species, the induction of preference for a new olfactory cue (vanillin by females and 3rd instar larvae was determined by parents' and self-experiences, without any modification of the sensitivity of the females antennae. No preference induction was found in the oligophagous and monophagous species. Our results suggest that lepidopteran stem borers may acquire preferences for new olfactory cues from the larval to the adult stage as described by Hopkins' host selection principle (HHSP, neo-Hopkins' principle, and the concept of 'chemical legacy.'

  8. Prey-induced changes in the accumulation of amino acids and phenolic metabolites in the leaves of Drosera capensis L.

    Science.gov (United States)

    Kováčik, Jozef; Klejdus, Bořivoj; Stork, František; Hedbavny, Josef

    2012-04-01

    Effect of prey feeding (ants Formica fusca) on the quantitative changes in the accumulation of free amino acids, soluble proteins, phenolic metabolites and mineral nutrients in the leaves of carnivorous plant Drosera capensis was studied. Arginine was the most abundant compound in Drosera leaves, while proline was abundant in ants. The amount of the majority of amino acids and their sum were elevated in the fed leaves after 3 and 21 days, and the same, but with further enhancement after 21 days, was observed in ants. Accumulation of amino acids also increased in young non-fed leaves of fed plants. Soluble proteins decreased in ants, but were not enhanced in fed leaves. This confirms the effectiveness of sundew's enzymatic machinery in digestion of prey and suggests that amino acids are not in situ deposited, but rather are allocated within the plant. The content of total soluble phenols, flavonoids and two selected flavonols (quercetin and kaempferol) was not affected by feeding in Drosera leaves, indicating that their high basal level was sufficient for the plant's metabolism and prey-induced changes were mainly N based. The prey also showed to be an important source of other nutrients besides N, and a stimulation of root uptake of some mineral nutrients is assumed (Mg, Cu, Zn). Accumulation of Ca and Na was not affected by feeding. PMID:21140278

  9. Bioaccumulation of polonium {sup 210}Po in marine birds

    Energy Technology Data Exchange (ETDEWEB)

    Skwarzec, B. [University of Gdansk, Faculty of Chemistry, Chair of Analytical Chemistry, ul. Sobieskiego 18/19, 80-952 Gdansk (Poland)]. E-mail: bosk@chemik.chem.univ.gda.pl; Fabisiak, J. [Naval Academy, Smidowicza 61, 81-103 Gdynia (Poland)

    2007-07-01

    The aim of this work was to determine the {sup 210}Po content in marine birds which permanently or temporally live in the Polish part of the Baltic Sea. We chose 11 species of sea birds: three species permanently residing at southern Baltic Sea, four species of wintering birds and three species of migrating birds. The results show that the polonium is non-uniformly distributed in the marine birds. The highest activities of {sup 210}Po were observed in feathers, muscles and liver and the lowest in skin and skeleton. Species of birds that eat crustaceans, molluscs, fish and plants (long-tailed duck Clangula hyemalis, white-winged scoter Melanitta fusca) accumulated more polonium than species that eat mainly fish (great cormorant Phalacrocorax carbo, common guillemot Uria aalge) or plants (tufted duck Aythya fuligula). Moreover, about 63% of the {sup 210}Po that was located in feathers of razorbil (Alca torda) and long-tailed duck (C. hyemalis) was apparently adsorbed, suggesting an external source such as the air. It means that the adsorption of {sup 210}Po on the feather surface may be an important transfer from air to water.

  10. Regulatory network analysis reveals novel regulators of seed desiccation tolerance in Arabidopsis thaliana.

    Science.gov (United States)

    González-Morales, Sandra Isabel; Chávez-Montes, Ricardo A; Hayano-Kanashiro, Corina; Alejo-Jacuinde, Gerardo; Rico-Cambron, Thelma Y; de Folter, Stefan; Herrera-Estrella, Luis

    2016-08-30

    Desiccation tolerance (DT) is a remarkable process that allows seeds in the dry state to remain viable for long periods of time that in some instances exceed 1,000 y. It has been postulated that seed DT evolved by rewiring the regulatory and signaling networks that controlled vegetative DT, which itself emerged as a crucial adaptive trait of early land plants. Understanding the networks that regulate seed desiccation tolerance in model plant systems would provide the tools to understand an evolutionary process that played a crucial role in the diversification of flowering plants. In this work, we used an integrated approach that included genomics, bioinformatics, metabolomics, and molecular genetics to identify and validate molecular networks that control the acquisition of DT in Arabidopsis seeds. Two DT-specific transcriptional subnetworks were identified related to storage of reserve compounds and cellular protection mechanisms that act downstream of the embryo development master regulators LEAFY COTYLEDON 1 and 2, FUSCA 3, and ABSCICIC ACID INSENSITIVE 3. Among the transcription factors identified as major nodes in the DT regulatory subnetworks, PLATZ1, PLATZ2, and AGL67 were confirmed by knockout mutants and overexpression in a desiccation-intolerant mutant background to play an important role in seed DT. Additionally, we found that constitutive expression of PLATZ1 in WT plants confers partial DT in vegetative tissues. PMID:27551092

  11. Crystal structure and biochemical characterization of Chlamydomonas FDX2 reveal two residues that, when mutated, partially confer FDX2 the redox potential and catalytic properties of FDX1.

    Science.gov (United States)

    Boehm, Marko; Alahuhta, Markus; Mulder, David W; Peden, Erin A; Long, Hai; Brunecky, Roman; Lunin, Vladimir V; King, Paul W; Ghirardi, Maria L; Dubini, Alexandra

    2016-04-01

    The green alga Chlamydomonas reinhardtii contains six plastidic [2Fe2S]-cluster ferredoxins (FDXs), with FDX1 as the predominant isoform under photoautotrophic growth. FDX2 is highly similar to FDX1 and has been shown to interact with specific enzymes (such as nitrite reductase), as well as to share interactors with FDX1, such as the hydrogenases (HYDA), ferredoxin:NAD(P) reductase I (FNR1), and pyruvate:ferredoxin oxidoreductase (PFR1), albeit performing at low catalytic rates. Here we report the FDX2 crystal structure solved at 1.18 Å resolution. Based on differences between the Chlorella fusca FDX1 and C. reinhardtii FDX2 structures, we generated and purified point-mutated versions of the FDX2 protein and assayed them in vitro for their ability to catalyze hydrogen and NADPH photo-production. The data show that structural differences at two amino acid positions contribute to functional differences between FDX1 and FDX2, suggesting that FDX2 might have evolved from FDX1 toward a different physiological role in the cell. Moreover, we demonstrate that the mutations affect both the midpoint potentials of the FDX and kinetics of the FNR reaction, possibly due to altered binding between FDX and FNR. An effect on H2 photo-production rates was also observed, although the kinetics of the reaction were not further characterized. PMID:26526668

  12. Solar energy conversion by green microalgae: a photosystem for hydrogen peroxide production.

    Science.gov (United States)

    de la Rosa, F F; Montes, O; Galván, F

    2001-09-20

    A photosystem for solar energy conversion, comprised of a culture of green microalgae supplemented with methyl viologen, is proposed. The capture of solar energy is based on the Mehler reaction. The reduction of methyl viologen by the photosynthetic apparatus and its subsequent reoxidation by oxygen produces hydrogen peroxide. This is a rich-energy compound that can be used as a nonpollutant and efficient fuel. Four different species of green microalgae, Chlamydomonas reinhardtii (21gr) C. reinhardtii (CW15), Chlorella fusca, and Monoraphidium braunii, were tested as a possible biocatalyst. Each species presented a different efficiency level in the transformation of energy. Azide was an efficient inhibitor of the hydrogen peroxide scavenging system while maintaining photosynthetic activity of the microalgae, and thus significantly increasing the production of the photosystem. The strain C. reinhardtii (21gr), among the species studied, was the most efficient with an initial production rate of 185 micromol H(2)O(2)/h x mg Chl and reaching a maximum of 42.5 micromol H(2)O(2)/mg Chl when assayed in the presence of azide inhibitor. PMID:11494222

  13. Lichen communities as bioindicators of the Aburra Valley air quality

    International Nuclear Information System (INIS)

    Lichens have been used as bioindicators of air quality. They are sensitive to changes in air composition at any given site affecting their abundance, biomass and vitality.This study evaluated lichen affectation as a consequence of air pollution. Two study areas within the Aburra Valley and the RedAire network were selected: Miguel Aguinaga (high pollution station) and the Medellin University (low pollution station). Four phorophytic tree species were chosen at each site Terminalia catappa Linneaus, Eritrina fusca Loureiro, Mangifera indica Linneaus y Fraxinus chinensis Roxb. The lichen cover by species, the vitality and the fructification were used to analyze the effect of air pollution. Finally, the lichen cover information was used to calculate the index of atmospheric purity (IAP) and the Q factor determination. Total qualitative and quantitative information obtained made evident that Canoparmelia sp. and Parmotrema austrosinensis (Zahlbr) Hale. lichen species are the most sensitive, and therefore appropriate to assess air quality. Additionally, the statistical analysis carried out using the relative abundances by phorophytic trees, showed that Fraxinus chinensis Roxb is the most appropriate tree species for bioindicator lichens studies into the Aburra valley.

  14. Experiences in management of area-wide control of Glossina palpalis palpalis (Diptera: Glossinidae) in Ghana using bait technology and releases of sterile males

    International Nuclear Information System (INIS)

    Ghana is infested with ten species of morsitans, palpalis and fusca groups of tsetse fly in approximately 37% of the country including areas where mixed farming is practiced, hence making animal trypanosomiasis a major constraint to rural agricultural production and other socioeconomic development. There have been many tsetse and trypanosomiasis control schemes implemented since the 1920s using a variety of methods. In the control of animal trypanosomiasis, the country has relied mainly on chemotherapy and chemoprophylaxis regimes using homidium chloride (Novidium), diaminazene aceturate (Berenil) and isometamidium chloride (Samorin) in cattle, goats and sheep, keeping of trypanotolerant cattle and game elimination. Methods for tsetse control include discriminate bush clearance, settlements and land use, insecticidal dips, ground spraying of tsetse habitats with insecticides, use of traps of various designs, insecticide-impregnated biconical traps, screens and targets and pour-ons. Despite successes in the various control programmes, the magnitude of the tsetse and trypanosomiasis problem is increasing due to the advance of tsetse flies into previously uninfested areas and development of drug resistance by trypanosome parasites to different types of trypanocidal drugs in use in Ghana. Sustainable tsetse and trypanosomiasis control require the use of appropriate strategies which take into account the environmental and socioeconomic considerations to facilitate adequate community participation. In the 1983 Ghana entered into a Technical Assistance Cooperation Programme with IAEA to provide technical support for the control of riverine tsetse flies in critical cattle-rearing areas in the northern sector of the country

  15. Heterogeneity of Soil and Vegetation in the Urban Habitats of New Industrial Cities in the Desert Landscape of Egypt

    Directory of Open Access Journals (Sweden)

    Monier Abd EL-GHANI

    2015-03-01

    Full Text Available The relationship between vegetation and soil supporting the habitats in 4 new industrial cities were assessed. Five main habitats were distinguished from inner city toward outskirts: lawns, home gardens, public gardens, waste lands and desert outskirts. After application of Twinspan, 26 vegetation groups were identified in the 5 recognized habitats, demonstrating that some groups are chatracteristic of a certain city, e.g. Asphodelus aestivus - Deverra tortuosa - Thymelaea hirsuta group was confined to the desert habitat of Burg El-Arab city; Thymelaea hirsuta - Linaria albifrons and Atriplex halimus - Atriplex lindleyi subsp. inflata - Suaeda vermiculata - Typha domingensis groups were found in the waste lands of Burg El-Arab city; Conyza bonariensis - Cynodon dactylon - Sonchus oleraceus group in the home garden habitat of 10th Ranadan city; Cynodon dactylon group in the lawns of Burg El-Arab city; Bassia indica - Plantago major group in the public gardens of Burg El-Arab city; Oxalis corniculata - Plantago lagopus group in the public gardens of 10th Ramadan city; Sonchus oleraceus - Cynodon dactylon and Dactyloctenium aegyptium - Leptochloa fusca - Phragmites australis groups in the public gardens of 6th October city. Silt, clay, organic matter, carbonates and carbon contents showed significant diffrences among the 5 habitats.

  16. Ecological Factors Acting on the Microfauna in Mangrove Swamps. The Case of Foraminiferal Assemblages in French Guiana

    Science.gov (United States)

    Debenay, J.-P.; Guiral, D.; Parra, M.

    2002-10-01

    Thirty-seven surface sediment samples were collected in January 1999 and July 2000 in the mangrove swamps and mud flats of French Guiana where strong seasonal contrasts occur. Sampling stations were selected to provide information on the foraminiferal assemblages associated with different environmental conditions, on the mud banks and in the mangrove forest. A total of 44 species have been identified. The main parameter acting on the distribution of foraminiferal assemblages is the hydrodynamics of the estuary, characterized by the double influence of coastal water and low-Ca fresh water, with drastic seasonal changes. The coastal end member is dominated by the calcareous species Ammonia tepida, A. parkinsoniana and Cribroelphidium spp., the continental (freshwater) end member is characterized by Miliammina fusca and Trochamminita irregularis . The calcareous species penetrate into the estuary, even into the mangrove forest during the dry season, but totally disappear from the estuary during the rainy season. The second parameter acting on the distribution of foraminiferal assemblages is the vertical elevation that acts indirectly by influencing the time of aerial exposure and the colonization by mangrove trees. Both canopy and litter of the mangrove forest protect the sediment from heating, drying and increases in salinity due to sun and wind. Foraminifera are very rare or absent on the open mud banks affected by mud cracks, but begin to grow as soon as young Avicennia are present. In the mangrove swamps, local conditions influence the composition of the assemblages and the taphonomic processes.

  17. Fine structure and meiotic behaviour of the male multiple sex chromosomes in the genus Alouatta.

    Science.gov (United States)

    Solari, A J; Rahn, M I

    2005-01-01

    The meiotic cytology and fine structure of the sex multiples in males from two species of the genus Alouatta are presented and compared with descriptions from other species of this genus. As shown in pachytene by synaptonemal complex analysis and in metaphase I by spreading, there is a quadrivalent in male meiosis in A. caraya, which is formed by an X(1)X(2)Y(1)Y(2) complex, while in A. palliata there is a trivalent formed by an X(1)X(2)Y(1) complex. Chromosome painting with human probes shows that A. caraya sex multiples share the same components as those of A. seniculus sara and A. seniculus arctoidea. However, as shown here for A. palliata and by others in A. fusca, there are differences among the multiples of some species. It is shown that in this genus there are several varieties of sex multiples that share some features, and that the origin of these multiples is most probably a primitive development in the genus Alouatta. PMID:15545739

  18. Molecular phylogenetics of howler monkeys (Alouatta, Platyrrhini). A comparison with karyotypic data.

    Science.gov (United States)

    Bonvicino, C R; Lemos, B; Seuánez, H N

    2001-07-01

    Molecular phylogenetic analyses of seven Brazilian Alouatta species, based on cytochrome b DNA sequence data were carried out. Parsimony and neighbor joining topologies grouped Alouatta belzebul and A. fusca as sister groups in one clade while another, well-supported clade contained A. seniculus as the most basal offshoot, followed by A. nigerrima as a sister lineage of A. macconnelli/A. stramineus. Estimates of inter-specific sequence divergence were generally low, and estimates of the time of divergence indicated that the main Alouatta lineages emerged during a short evolutionary interval. A comparison with karyotypic data confirmed the molecular topology showing a closer relationship between A. macconnelli and A. stramineus in respect to A. nigerrima. It also showed that the XX/XY sex chromosome system was maintained in several lineages while the X1X2Y/X1X1X2X2 system appeared independently at least three times during the radiation of howler monkeys. Moreover, the X1X2Y1Y2/X1X1X2X2 system might have appeared once or, alternatively, twice and independently. PMID:11513299

  19. A New Esterase from Thermobifida halotolerans Hydrolyses Polyethylene Terephthalate (PET and Polylactic Acid (PLA

    Directory of Open Access Journals (Sweden)

    Georg Steinkellner

    2012-02-01

    Full Text Available A new esterase from Thermobifida halotolerans (Thh_Est was cloned and expressed in E. coli and investigated for surface hydrolysis of polylactic acid (PLA and polyethylene terephthalate (PET. Thh_Est is a member of the serine hydrolases superfamily containing the -GxSxG- motif with 85–87% homology to an esterase from T. alba, to an acetylxylan esterase from T. fusca and to various Thermobifida cutinases. Thh_Est hydrolyzed the PET model substrate bis(benzoyloxyethylterephthalate and PET releasing terephthalic acid and mono-(2-hydroxyethyl terephthalate in comparable amounts (19.8 and 21.5 mmol/mol of enzyme while no higher oligomers like bis-(2-hydroxyethyl terephthalate were detected. Similarly, PLA was hydrolyzed as indicated by the release of lactic acid. Enzymatic surface hydrolysis of PET and PLA led to a strong hydrophilicity increase, as quantified with a WCA decrease from 90.8° and 75.5° to 50.4° and to a complete spread of the water drop on the surface, respectively.

  20. Prey-induced changes in the accumulation of amino acids and phenolic metabolites in the leaves of Drosera capensis L.

    Science.gov (United States)

    Kováčik, Jozef; Klejdus, Bořivoj; Stork, František; Hedbavny, Josef

    2012-04-01

    Effect of prey feeding (ants Formica fusca) on the quantitative changes in the accumulation of free amino acids, soluble proteins, phenolic metabolites and mineral nutrients in the leaves of carnivorous plant Drosera capensis was studied. Arginine was the most abundant compound in Drosera leaves, while proline was abundant in ants. The amount of the majority of amino acids and their sum were elevated in the fed leaves after 3 and 21 days, and the same, but with further enhancement after 21 days, was observed in ants. Accumulation of amino acids also increased in young non-fed leaves of fed plants. Soluble proteins decreased in ants, but were not enhanced in fed leaves. This confirms the effectiveness of sundew's enzymatic machinery in digestion of prey and suggests that amino acids are not in situ deposited, but rather are allocated within the plant. The content of total soluble phenols, flavonoids and two selected flavonols (quercetin and kaempferol) was not affected by feeding in Drosera leaves, indicating that their high basal level was sufficient for the plant's metabolism and prey-induced changes were mainly N based. The prey also showed to be an important source of other nutrients besides N, and a stimulation of root uptake of some mineral nutrients is assumed (Mg, Cu, Zn). Accumulation of Ca and Na was not affected by feeding.

  1. Selection of a Thermophilic Alkalitolerant Actinomycete and Conditions for CMCase Production

    Institute of Scientific and Technical Information of China (English)

    QI Yun; ZHAO Lin; LIAO Yinzhang; TAN Xin

    2005-01-01

    Five thermophilic strains that can degrade cellulose were isolated from the compost of a waste management in Guangzhou, China. Since one of them degraded cellulose effectively, it was chosen as the study strain. Based on its morphology, spores′ susceptibility to heat, cell wall composition and other characteristics, the organism was classified as Thermomonospora fusca. Conditions for production of carboxy methyl cellulase (CMCase) were examined. The optimal temperature and pH value for enzyme production were 50 ℃ and 10.5, respectively. Cellulosic materials and easily metabolisable carbohydrates served as carbon sources for the growth of the strain. Only cotton, avicel,carboxy methyl cellulose (CMC) acted as potent inducers for the production of cellulases by this strain. Despite excellent growth on easily metabolisable carbohydrates, only constitutive levels of cellulases were produced. The optimal carbon and nitrogen sources for CMCase production were cotton and soybean respectively. The high thermostability, wide pH stability, and cheap nitrogen source show well potential use for composting treatment and commercial detergents.

  2. Structural and Functional Characterizations of SsgB, a Conserved Activator of Developmental Cell Division in Morphologically Complex Actinomycetes

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Qingping; Traag, Bjørn A.; Willemse, Joost; McMullan, Daniel; Miller, Mitchell D.; Elsliger, Marc-André; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Bakolitsa, Constantina; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chruszcz, Maksymilian; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L.; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Grzechnik, Slawomir K.; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; Minor, Wladek; Mommaas, A. Mieke; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; van den Bedem, Henry; Wang, Shuren; Weekes, Dana; Hodgson, Keith O.; Wooley, John; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.; van Wezel, Gilles P.; (Leiden-MC); (SLAC); (Scripps); (UV); (UCSD); (Burnham)

    2010-01-20

    SsgA-like proteins (SALPs) are a family of homologous cell division-related proteins that occur exclusively in morphologically complex actinomycetes. We show that SsgB, a subfamily of SALPs, is the archetypal SALP that is functionally conserved in all sporulating actinomycetes. Sporulation-specific cell division of Streptomyces coelicolor ssgB mutants is restored by introduction of distant ssgB orthologues from other actinomycetes. Interestingly, the number of septa (and spores) of the complemented null mutants is dictated by the specific ssgB orthologue that is expressed. The crystal structure of the SsgB from Thermobifida fusca was determined at 2.6 {angstrom} resolution and represents the first structure for this family. The structure revealed similarities to a class of eukaryotic 'whirly' single-stranded DNA/RNA-binding proteins. However, the electro-negative surface of the SALPs suggests that neither SsgB nor any of the other SALPs are likely to interact with nucleotide substrates. Instead, we show that a conserved hydrophobic surface is likely to be important for SALP function and suggest that proteins are the likely binding partners.

  3. Ethanol production from rape straw: Part of an oilseed rape biorefinery

    DEFF Research Database (Denmark)

    Arvaniti, Efthalia

    The aim of this study was 1) present an oilseed rape whole crop biorefinery; 2) to investigate the best available experimental conditions for production of cellulosic ethanol from rape straw, and included the processes of thermo-chemical pretreatment, enzymatic hydrolysis, and C6 fermentation......, and 3) to couple cellulosic ethanol production to production of cellulolytic enzymes that are needed for cellulosic ethanol production, inside a rape straw biorefinery. For the first is based less on available experiments, and more on literature review. The second and third study conclusions were drawn...... based more on experimental findings, and less to literature review. In Chapter 1, the problem context and background theory for biorefineries is presented. Finally, latest developments of upscaled biorefineries in Europe are summarized. In Chapter 2, a scenario about upgrading and expanding a typical...

  4. A NOVEL STRAIN OF Aspergillus niger PRODUCING A COCKTAIL OF HYDROLYTIC DEPOLYMERISING ENZYMES FOR THE PRODUCTION OF SECOND GENERATION BIOFUELS

    Directory of Open Access Journals (Sweden)

    Namita Bansal

    2011-02-01

    Full Text Available The screening and isolation of fungi producing a cocktail of hydrolytic enzymes was studied. Among the various isolates obtained from different soil samples, a strain NS-2 was selected. The phylogenetic analysis of this strain showed highest homology (99% with Aspergillus niger. It was capable of producing cellulolytic, hemicellulolytic, amylolytic, and pectinolytic enzymes in appreciable titers on wheat bran based liquid and solid state media. The mixture of enzymes produced by this organism could effectively hydrolyze various domestic waste residues, revealing conversion efficiencies of 89 to 92% and produced high reducing sugar yields of 0.48 to 0.66 g/g of dry residue. This enzyme cocktail could potentially find a significant application in the conversion of agricultural and other waste residues having cellulose, hemicellulose, starch, and pectin as carbohydrates to produce simpler sugars which can be fermented for the production of second generation biofuels.

  5. Synergistic effects of cellobiose dehydrogenase and manganese-dependent peroxidases during lignin degradation

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The synergistic effects of cellobiose dehydrogenase (CDH) and manganese-dependent peroxidases (MnP) on the degradation of kraft pulp cellulolytic enzyme lignin (CEL) were investigated. Addition of CDH significantly increased the amount of water-soluble products reduced from CEL by MnP. CDH facilitated the reduction of the contents of methoxyl, carboxyl, phenolic hydroxyl and total hydroxyl groups of CEL by MnP. 1H-NMR analysis showed that addition of CDH also decreased further the amount of protons of CEL degraded by MnP. The results proved for the first time that CDH could promote degradation of lignin by MnP and suggest that CDH could not only promote degradation of cellulose but also is an important part of the lignin biodegradation system.

  6. Production of Citric Acid from Apple Pomace Enzymolyzed by Cellulase

    Institute of Scientific and Technical Information of China (English)

    宋纪蓉; 黄洁; 徐抗震; 赵巧云

    2003-01-01

    Cellulase can evidently increase the content of glucose and has a significant effect on the production of citric acid from apple pomace by Aspergillus niger. Based on experiments, a cellulolytic enzyme named cellulase A6 was found able to produce about 170 g glucose from 1 kg dried apple pomace after 12 h reaction, with cellulase concentration of 20 U/g in the medium at 50℃, natural pH without pretreatment of alkali. Using the treated apple pomace as a liquid state substrate, Aspergillus niger-C selected out was able to produce about 256 g citric acid from 1 kg dried apple pomace at 35℃ in 3 d or 30℃ in 5 d with flask rotation speed of 210 r/min, and the conversion of citric acid could reach 80% based on the amount of sugar consumed.

  7. Production of cellulases and hemicellulases by an anaerobic mixed culture from lignocellulosic biomass.

    Science.gov (United States)

    Tabassum, R; Rajoka, M I; Malik, K A

    1990-03-01

    A comparison of different habitats, biogas plant, rumen fluid and sewage sludge, for cellulolytic organisms indicated sewage studge was the best source. Enrichment cultura gave a mixed culture which exhibited CMCase activity as well as extracellular Avicelase, xylanase, β-glucosidase, β-xylosidase activities and cell-bound β-glucosidase, and β-xylosidase production in a synthetic medium with eleven different cellulosic and lignocellulosic substrates. The activity of extracellular β-glucosidase and β-xylosidase production was significantly higher than endogenous activities. Hemicellulases were induced better than cellulases. The anzyme system was stable under aerobic conditions. Of the different lignocellulosic substrates, kallar grass was the best inducer of extracellular enzymes.

  8. Symbiont-derived beta-1,3-glucanases in a social insect: mutualism beyond nutrition

    Directory of Open Access Journals (Sweden)

    Rebeca B Rosengaus

    2014-11-01

    Full Text Available Termites have had a long co-evolutionary history with prokaryotic and eukaryotic gut microbes. Historically, the role of these anaerobic obligate symbionts has been attributed to the nutritional welfare of the host. We provide evidence that protozoa (and/or their associated bacteria colonizing the hindgut of the dampwood termite Zootermopsis angusticollis, synthesize multiple functional beta-1,3-glucanases, enzymes known for breaking down beta-1,3-glucans, the main component of fungal cell walls. These enzymes, we propose, may help in both digestion of ingested fungal hyphae and protection against invasion by fungal pathogens. This research points to an additional novel role for the mutualistic hindgut microbial consortia of termites, an association that may extend beyond ligno-cellulolytic activity and nitrogen fixation to include a reduction in the risks of mycosis at both the individual- and colony-levels while nesting in and feeding on microbial-rich decayed wood.

  9. Growth and enzyme production of Cellulomonas sp. ATCC 21399 on microcrystalline cellulose. Effects of increasing concentration of a mineral medium

    Energy Technology Data Exchange (ETDEWEB)

    Poulsen, O.M.; Petersen, L.W.

    1989-05-01

    The kinetics and production of different extracellular enzyme activities were studied during growth of Cellulomonas sp. ATCC 21399 on 2% Avicel with different concentrations of M9 mineral medium. The lag phase and the doubling time increased with increasing ionic strength of the medium. The highest cell density was obtained during growth at 5xM9 mineral medium and Cellulomonas grew well at this high salinity. The enzyme activities against carboxymethylcellulose and xylan increased with increasing concentration of M9 medium up to 5xM9. By contrast, activities against microcrystalline cellulose (Avicel), galactomannan and amylose decreased with increasing concentration of M9 medium. The extracellular proteinase activity increased with increasing concentration of M9 medium, and it is possible that the lability of the cellulolytic and amylolytic enzymes may be due to their susceptibility to proteolytic inactivation by the extracellular proteinases.

  10. Total fractionation of green tea residue by microwave-assisted alkaline pretreatment and enzymatic hydrolysis.

    Science.gov (United States)

    Tsubaki, Shuntaro; Azuma, Jun-ichi

    2013-03-01

    Total refinery of constituents of green tea residue was achieved by combination of microwave-assisted alkaline pretreatment and enzymatic hydrolysis. Alkaline pretreatment was effective at separating pectic polysaccharides, protein, phenolic compounds and aliphatic compounds (probably originating from cuticular components), and the solubilization rate was attained 64–74% by heating at 120–200 °C. The higher heating value (HHV) of alkali-soluble fraction attained 20.1 MJ/kg, indicating its usability as black-liquor-like biofuel. Successive cellulolytic enzymatic hydrolysis mainly converted cellulose into glucose and attained the maximum solubilization rate of 89%. Final residue was predominantly composed of aliphatic cuticular components with high proportion in 9,10,18-trihydroxyoctadecanoic acid (30.1–48.6%). These cuticular components are potential alternative feedstock for aliphatic compounds commonly found in oil plants. PMID:23384782

  11. Structure investigation of Cellobiohydrolase I from Trichoderma pseudokoningii S38 with a scanning tunneling microscope

    Science.gov (United States)

    Zhang, Y. Z.; Liu, J.; Gao, P. J.; Ma, L. P.; Shi, D. X.; Pang, S. J.

    Cellobiohydrolase I (CBH I) was isolated from a cellulolytic fungal strain Trichoderma pseudokoningii S38, and its ultrastructure was investigated with a scanning tunneling microscope (STM). The STM images showed that the shape of intact CBH I was tadpole-like, consisting of a big head and a long tail. It could be deduced that the head domain was the core protein for the catalytic function, and the long tail was the cellulose binding domain for substrate binding. Thus, for this enzyme molecule, functional differentiation is reflected in the structure peculiarities. This is the first direct observation of the three-dimensional structure of intact CBH I from real space at nanometer scale. The functional mechanism is also discussed.

  12. Development of a commercial enzymes system for lignocellulosic biomass saccharification

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Manoj

    2012-12-20

    DSM Innovation Inc., in its four year effort was able to evaluate and develop its in-house DSM fungal cellulolytic enzymes system to reach enzyme efficiency mandates set by DoE Biomass program MYPP goals. DSM enzyme cocktail is uniquely active at high temperature and acidic pH, offering many benefits and product differentiation in 2G bioethanol production. Under this project, strain and process development, ratio optimization of enzymes, protein and genetic engineering has led to multitudes of improvement in productivity and efficiency making development of a commercial enzyme system for lignocellulosic biomass saccharification viable. DSM is continuing further improvement by additional biodiversity screening, protein engineering and overexpression of enzymes to continue to further lower the cost of enzymes for saccharification of biomass.

  13. A study of overproduction and enhanced secretion of enzymes. Quarterly report

    Energy Technology Data Exchange (ETDEWEB)

    Dashek, W.V.

    1993-09-01

    Wood decay within forests, a significant renewable photosynthetic energy resource, is caused primarily by Basidiomycetous fungi, e.g., white rot fungi. These organisms possess the ability to degrade lignin, cellulose and hemicellulose, the main organic polymers of wood. In the case of the white rot fungi, e.g., Coriolus versicolor, the capacity results from the fungus` ability to elaborate extracellular cellulolytic and ligninolytic enzymes. With regard to the latter, at least one of the enzymes, polyphenol oxidase (PPO) appears within a defined growth medium. This proposal focuses on the over-production and enhanced secretion of PPO, cellulase and lignin peroxidase. There are two major sections to the proposal: (1) overproduction of lignocellulolytic enzymes by genetic engineering methodologies and hyper-production and enhanced secretion of these enzymes by biochemical/electro microscopical techniques and (2) the biochemical/electron microscopical method involves substrate induction and the time-dependent addition of respiration and PPO enzymes.

  14. Isolation of extremely AT-rich genomic DNA and analysis of genes encoding carbohydrate-degrading enzymes from Orpinomyces sp. strain PC-2.

    Science.gov (United States)

    Chen, Huizhong; Hopper, Sherryll L; Li, Xin-Liang; Ljungdahl, Lars G; Cerniglia, Carl E

    2006-11-01

    An effective method for extraction of intact genomic DNA from the extremely AT-rich polycentric anaerobic fungus Orpinomyces sp. strain PC-2 has been developed. This procedure involves removal of glycogen-like storage polysaccharides using hexadecyltrimethylammonium bromide (CTAB) and high salt washes. The DNA was digested with various restriction enzymes and was suitable for use as a PCR template, for Southern blotting, and for genomic library construction. Genomic DNA analysis of three representative genes (celE, bgl1, and xynA) encoding (hemi-) cellulolytic enzymes of the fungus revealed multiplicity of family 5 endocellulase genes (celE-like), and family 1 beta-glucosidase genes (bgl1-like), but only a single copy of family 11 xylanase gene (xynA). PMID:17019643

  15. Enzymatic hydrolysis of sugarcane bagasse pretreated with acid or alkali

    Directory of Open Access Journals (Sweden)

    Vivian Cristina Pietrobon

    2011-04-01

    Full Text Available The aim of this study was to evaluate the performance of enzymatic hydrolysis of acid or alkali pretreated sugarcane bagasse for the production of fermentable sugars. The first step consisted of selection of commercial enzymes presenting the highest cellulolytic activities. After selection of four enzymes: HPL, CL, P1 and P4, their performances were tested in the bagasse pretreated with acid and alkali. The sugar content of the hydrolysates was analyzed by anion exchange liquid chromatography. Data showed that the joint action of 0.5% acid pretreatment, 121ºC, 30 minutes and enzyme CL provides the best results, 67.25 g of hexose and 148.13g of pentose per kg of dry bagasse.

  16. Taxonomic and functional diversity of Streptomyces in a forest soil.

    Science.gov (United States)

    Bontemps, Cyril; Toussaint, Maxime; Revol, Pierre-Vincent; Hotel, Laurence; Jeanbille, Mathilde; Uroz, Stéphane; Turpault, Marie-Pierre; Blaudez, Damien; Leblond, Pierre

    2013-05-01

    In this work we report the isolation and the characterization of 79 Streptomyces isolates from a French forest soil. The 16S rRNA gene phylogeny indicated that a great diversity of Streptomyces was present in this soil, with at least nine different and potentially new species. Growth plate assays showed that most Streptomyces lineages exhibit cellulolytic and hemicellulolytic capacities and potentially participate in wood decomposition. Molecular screening for a specific hydrogenase also indicated a widespread potential for atmospheric H2 uptake. Co-culture experiments with representative strains showed antagonistic effects between Streptomyces of the same population and between Streptomyces and various fungi. Interestingly, in certain conditions, growth promotion of some fungi also occurred. We conclude that in forest soil, Streptomyces populations exhibit many important functions involved in different biogeochemical cycles and also influence the structure of soil microbial communities. PMID:23489323

  17. The Activity of Cellulase from Thermophilic Fungi Isolated from CaneBagasses

    International Nuclear Information System (INIS)

    The activity of cellulase from thermophilic fungi isolated from canebagasses has been measured. This wild strain, named fungal strain PJ-2,secreted a large amount of cellulolytic enzyme components consisting of 0.46units of avicelase, 0.8 units of carboxymethyl cellulose hydrolizing enzyme(CMCase) and 0.5 units of β-glucosidase per ml of culture broth oncultivation in Mandels Reese medium for 7 days at 500 oC. These cellulasesproduction was lower than that of Trichoderma reesei NRRL 3653 producing 0.5units/ml avicelase, 1.6 units/ml CMCase and 0.4 units/ml ofβ-glucosidase cultivated in the same medium at 30 oC. However,thermophilic fungi may be potential to be exploited in lignocellulosedegradation at the tropical areas as the process usually needs temperature ofabove 50 oC. (author)

  18. Evolution and Ecology of Actinobacteria and Their Bioenergy Applications.

    Science.gov (United States)

    Lewin, Gina R; Carlos, Camila; Chevrette, Marc G; Horn, Heidi A; McDonald, Bradon R; Stankey, Robert J; Fox, Brian G; Currie, Cameron R

    2016-09-01

    The ancient phylum Actinobacteria is composed of phylogenetically and physiologically diverse bacteria that help Earth's ecosystems function. As free-living organisms and symbionts of herbivorous animals, Actinobacteria contribute to the global carbon cycle through the breakdown of plant biomass. In addition, they mediate community dynamics as producers of small molecules with diverse biological activities. Together, the evolution of high cellulolytic ability and diverse chemistry, shaped by their ecological roles in nature, make Actinobacteria a promising group for the bioenergy industry. Specifically, their enzymes can contribute to industrial-scale breakdown of cellulosic plant biomass into simple sugars that can then be converted into biofuels. Furthermore, harnessing their ability to biosynthesize a range of small molecules has potential for the production of specialty biofuels.

  19. Enhanced cellulase and β-glucosidase production by a mutant of Alternaria alternata

    International Nuclear Information System (INIS)

    The cellulolytic activity of the wild type and a mutant strain of A. alternata was investigated. Mutants were induced by gamma radiation. A suspension of about 105 condidia/mL in 0.05M phosphate buffer pH 5 were irradiated in a gamma-cell-type (Cammacell 220, Atomic Energy of Canada Limited, Ottawa, Canada) 60Co source with a dose rate of 2.5 krad/min. The amount of radiation given was 70 krad which resulted in about 10% survival level. The stock culture was maintained on a sterile growth medium supplemented with 1% cellulose 123 and 0.3% agar. Following the incubation period, the fungal biomass was harvested by centrifugation (5000g for 10 min) and the clarified supernatant was used as the source of cellulase and β-glucosidase

  20. Cell surface engineering of industrial microorganisms for biorefining applications.

    Science.gov (United States)

    Tanaka, Tsutomu; Kondo, Akihiko

    2015-11-15

    In order to decrease carbon emissions and negative environmental impacts of various pollutants, biofuel/biochemical production should be promoted for replacing fossil-based industrial processes. Utilization of abundant lignocellulosic biomass as a feedstock has recently become an attractive option. In this review, we focus on recent efforts of cell surface display using industrial microorganisms such as Escherichia coli and yeast. Cell surface display is used primarily for endowing cellulolytic activity on the host cells, and enables direct fermentation to generate useful fuels and chemicals from lignocellulosic biomass. Cell surface display systems are systematically summarized, and the drawbacks/perspectives as well as successful application of surface display for industrial biotechnology are discussed.

  1. Expanding xylose metabolism in yeast for plant cell wall conversion to biofuels.

    Science.gov (United States)

    Li, Xin; Yu, Vivian Yaci; Lin, Yuping; Chomvong, Kulika; Estrela, Raíssa; Park, Annsea; Liang, Julie M; Znameroski, Elizabeth A; Feehan, Joanna; Kim, Soo Rin; Jin, Yong-Su; Glass, N Louise; Cate, Jamie H D

    2015-01-01

    Sustainable biofuel production from renewable biomass will require the efficient and complete use of all abundant sugars in the plant cell wall. Using the cellulolytic fungus Neurospora crassa as a model, we identified a xylodextrin transport and consumption pathway required for its growth on hemicellulose. Reconstitution of this xylodextrin utilization pathway in Saccharomyces cerevisiae revealed that fungal xylose reductases act as xylodextrin reductases, producing xylosyl-xylitol oligomers as metabolic intermediates. These xylosyl-xylitol intermediates are generated by diverse fungi and bacteria, indicating that xylodextrin reduction is widespread in nature. Xylodextrins and xylosyl-xylitol oligomers are then hydrolyzed by two hydrolases to generate intracellular xylose and xylitol. Xylodextrin consumption using a xylodextrin transporter, xylodextrin reductases and tandem intracellular hydrolases in cofermentations with sucrose and glucose greatly expands the capacity of yeast to use plant cell wall-derived sugars and has the potential to increase the efficiency of both first-generation and next-generation biofuel production. PMID:25647728

  2. Endophytic fungi found in association with Bacopa monnieri as potential producers of industrial enzymes and antimicrobial bioactive compounds

    Directory of Open Access Journals (Sweden)

    Meenu Katoch

    2014-10-01

    Full Text Available This study aimed to screen the endophytic fungal species of ethano-medicinal plant Bacopa monnieri (L. Pennell for their ability to produce antimicrobial substances against Bacillus subtilis, Pseudomonas aeroginosa, Salmonella typhimurium, Escherichia coli, Klebsiella pneumonia, Staphylococcus aureus, and Candida albicans. Endophytes were also screened for their ability to produce amylase, cellulase, protease and lipase to evaluate their ecological role within the host plant. Twenty-six endophytes were isolated and seventeen were identified. All the isolated endophytes exhibited amylolytic activity. Lipolytic, cellulolytic, proteolytic activity was shown by 98, 28 and 31% isolates, respectively. Similarly, all the endophytes (100% exhibited significant antimicrobial activity against K. pneumonia, while seventeen endophytes (89.5% were active against S. aureus. Fourteen endophytes (78.9% showed significant antimicrobial activity against B. subtilis and C. albicans. Eleven (57.8%, nine (50%, four (21% endophytes were active against S. typhimurium, E. coli and P. aeruginosa, respectively.

  3. Cell surface engineering of industrial microorganisms for biorefining applications.

    Science.gov (United States)

    Tanaka, Tsutomu; Kondo, Akihiko

    2015-11-15

    In order to decrease carbon emissions and negative environmental impacts of various pollutants, biofuel/biochemical production should be promoted for replacing fossil-based industrial processes. Utilization of abundant lignocellulosic biomass as a feedstock has recently become an attractive option. In this review, we focus on recent efforts of cell surface display using industrial microorganisms such as Escherichia coli and yeast. Cell surface display is used primarily for endowing cellulolytic activity on the host cells, and enables direct fermentation to generate useful fuels and chemicals from lignocellulosic biomass. Cell surface display systems are systematically summarized, and the drawbacks/perspectives as well as successful application of surface display for industrial biotechnology are discussed. PMID:26070720

  4. Electron beam irradiation pretreatment and enzymatic saccharification of used newsprint and paper mill wastes

    Science.gov (United States)

    Waheed Khan, A.; Labrie, Jean-Pierre; McKeown, Joseph

    Electron beam pretreatment of used newsprint, pulp, as well as pulp recovered from clarifier sludge and paper mill sludge, caused the dissociation of cellulose from lignin, and rendered them suitable for enzymatic hydrolysis. A maximum dose of 1 MGy for newsprint and 1.5—2.0 MGy for pulp and paper mill sludge was required to render cellulose present in them in a form which, could be enzymatically saccharified to 90% of completion. Saccharification approaching the theoretical yield was obtained in 2 days with a cellulolytic enzyme system obtained from Trichoderma reesei. As a result of irradiation, water soluble lignin breakdown products, NaOH- soluble lignin, free cellobiose, glucose, mannose, xylose and their polymers, and acetic acid were produced from these materials.

  5. Optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production

    International Nuclear Information System (INIS)

    The purpose of this project is optimization of upstream and development of cellulose hydrolysis process for cellulosic bio-ethanol production. The 2nd year Research scope includes: 1) Optimization of pre-treatment conditions for enzymatic hydrolysis of lignocellulosic biomass and 2) Demonstration of enzymatic hydrolysis by recombinant enzymes. To optimize the pretreatment, we applied two processes: a wet process (wet milling + popping), and dry process (popping + dry milling). Out of these, the wet process presented the best glucose yield with a 93.1% conversion, while the dry process yielded 69.6%, and the unpretreated process yielded <20%. The recombinant cellulolytic enzymes showed very high specific activity, about 80-1000 times on CMC and 13-70 times on filter paper at pH 3.5 and 55 .deg. C

  6. Selection of micro-organisms and fermentation conditions of oil palm empty fruit bunch (EFB) and palm press fibre (PPF)

    International Nuclear Information System (INIS)

    The selection of useful microorganisms was made by trial cultivation of various cellulolytic fungi on EFB and PPF. Several fermentation conditions were performed involving adjusting alkali treatment conditions, pH, changing media composition and preparation technique of solid culture media. Basic the preparation of the solid culture media was made by dissolving inorganic salts together with micro-nutrients and then added to the alkali treated EFB and PPF. In the cultivation of mushrooms, the preparation of solid culture media was adopted from mushroom growers technique. The criteria of a good degradation ability of fungi were evaluated based on the percentage of crude fibre degradation of EFB and PPF by fungi. The nutritional values of the products such as protein was also characterised

  7. Synergistic collaboration of gut symbionts in Odontotermes formosanus for lignocellulosic degradation and bio-hydrogen production.

    Science.gov (United States)

    Mathew, Gincy Marina; Mathew, Dony Chacko; Lo, Shou-Chen; Alexios, Georgy Mathew; Yang, Jia-Cih; Sashikumar, Jagathala Mahalingam; Shaikh, Tanveer Mahamadali; Huang, Chieh-Chen

    2013-10-01

    In this work, gut microbes from the macrotermitine termite Odontotermes formosanus the cellulolytic Bacillus and fermentative Clostridium were studied in batch experiments using different carbon substrates to bio-mimic the termite gut for hydrogen production. Their fungus comb aging and the in vitro lignocellulosic degradation of the mango tree substrates by the synergistic interaction of Bacillus, Clostridium and Termitomyces were detected by Solid-state NMR. From the results, Bacillus species acted as a mutualist, by initiating an anaerobic environment for the growth of Clostridium, for bio-hydrogen production and the presence of Termitomyces enhanced the lignocellulosic degradation of substrates in vitro and in vivo. Thus, the synergistic collaboration of these three microbes can be used for termite-derived bio-fuel processing technology.

  8. BIO-DIAGNOSTICS OF RESISTANCE OF GREY FOREST SOILS OF ADYGEA TO POLLUTION WITH Zn, Cd, Mo, Se

    Directory of Open Access Journals (Sweden)

    Tatlok D. R.

    2015-04-01

    Full Text Available The essential part of a soil cover of the Republic of Adygea is occupied by gray forest soils. Thus they still remain a little studied, including concerning their resistance to chemical pollution. Contamination of gray forest soils of Adygea with Zn, Cd, Mo, Se causes deterioration of their biological properties. In most cases, the degree of reduction of the values of biological indicators is directly dependent on the concentration of pollutant in the soil. According to the degree of toxicity to the biological properties of the investigated elements form the following sequence: Se > Zn > = Cd > Mo. Biological parameters investigated in research (activity of catalase and dehydrogenase, cellulolytic ability, abundance of bacteria of the genus Azotobacter, radish root length may be used for purposes of monitoring, diagnosis and regulation of chemical pollution of gray forest soils Zn, Cd, Mo, Se

  9. Radiation application for upgrading of bio resources

    International Nuclear Information System (INIS)

    To degrade lignin which is the most difficult fraction to be degraded in cellulosic bio resources and reuse as valuable formats, the improved strains of edible mushroom with more highly ligno cellulolytic activity were induced by γ-ray radiation and analysed their physiological and genetical characteristics. Mnp, Lac gene related to be the above were cloned. From the base sequence analysis, it seemed that there could be specific radiation-sensitive spots on the gene of mutants. anti mutagenicity, glyceollin elicitation activity and synergistic effects with indole acetic acid were found promisingly from the extracts of their cultural byproducts. And also were the byproducts expected to be useful for the candidate of subsidiary animal feed. By the radiation mutation, it seemed to be possible to induce the improved strains of antifungal activity, too. (author)

  10. Fungal Communities in Soils: Soil Organic Matter Degradation.

    Science.gov (United States)

    Větrovský, Tomáš; Štursová, Martina; Baldrian, Petr

    2016-01-01

    Stable isotope probing (SIP) provides the opportunity to label decomposer microorganisms that build their biomass on a specific substrate. In combination with high-throughput sequencing, SIP allows for the identification of fungal community members involved in a particular decomposition process. Further information can be gained through gene-targeted metagenomics and metatranscriptomics, opening the possibility to describe the pool of genes catalyzing specific decomposition reactions in situ and to identify the diversity of genes that are expressed. When combined with gene descriptions of fungal isolates from the same environment, specific biochemical reactions involved in decomposition can be linked to individual fungal taxa. Here we describe the use of these methods to explore the cellulolytic fungal community in forest litter and soil. PMID:26791498

  11. Evolution and Ecology of Actinobacteria and Their Bioenergy Applications.

    Science.gov (United States)

    Lewin, Gina R; Carlos, Camila; Chevrette, Marc G; Horn, Heidi A; McDonald, Bradon R; Stankey, Robert J; Fox, Brian G; Currie, Cameron R

    2016-09-01

    The ancient phylum Actinobacteria is composed of phylogenetically and physiologically diverse bacteria that help Earth's ecosystems function. As free-living organisms and symbionts of herbivorous animals, Actinobacteria contribute to the global carbon cycle through the breakdown of plant biomass. In addition, they mediate community dynamics as producers of small molecules with diverse biological activities. Together, the evolution of high cellulolytic ability and diverse chemistry, shaped by their ecological roles in nature, make Actinobacteria a promising group for the bioenergy industry. Specifically, their enzymes can contribute to industrial-scale breakdown of cellulosic plant biomass into simple sugars that can then be converted into biofuels. Furthermore, harnessing their ability to biosynthesize a range of small molecules has potential for the production of specialty biofuels. PMID:27607553

  12. Radiation application for upgrading of bio resources

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Young Keun; Lee, Young Il; Kim, Jae Sung; Kim, Jin Kyu; Chun, Ki Jung; Lee, Sang Jae; Kim, Yeon Ku; Chang, Hwa Hyoung; Song, In Geun; Lee, Ki Sung; Ko, Dong Kyu; Lee, Sung Ho; Han, Gab Jin

    2000-04-01

    To degrade lignin which is the most difficult fraction to be degraded in cellulosic bio resources and reuse as valuable formats, the improved strains of edible mushroom with more highly ligno cellulolytic activity were induced by {gamma}-ray radiation and analysed their physiological and genetical characteristics. Mnp, Lac gene related to be the above were cloned. From the base sequence analysis, it seemed that there could be specific radiation-sensitive spots on the gene of mutants. anti mutagenicity, glyceollin elicitation activity and synergistic effects with indole acetic acid were found promisingly from the extracts of their cultural byproducts. And also were the byproducts expected to be useful for the candidate of subsidiary animal feed. By the radiation mutation, it seemed to be possible to induce the improved strains of antifungal activity, too. (author)

  13. Malbranchea cinnamomea: A thermophilic fungal source of catalytically efficient lignocellulolytic glycosyl hydrolases and metal dependent enzymes.

    Science.gov (United States)

    Mahajan, Chhavi; Basotra, Neha; Singh, Surender; Di Falco, Marcos; Tsang, Adrian; Chadha, B S

    2016-01-01

    This study reports thermophilic fungus Malbranchea cinnamomea as an important source of lignocellulolytic enzymes. The secretome analysis using LC-MS/MS orbitrap showed that fungus produced a spectrum of glycosyl hydrolases (cellulase/hemicellulase), polysaccharide lyases (PL) and carbohydrate esterases (CE) in addition to cellobiose dehydrogenase (CDH) indicating the presence of functional classical and oxidative cellulolytic mechanisms. The protein fractions in the secretome resolved by ion exchange chromatography were analyzed for ability to hydrolyze alkali treated carrot grass (ATCG) in the presence of Mn(2+)/Cu(2+). This strategy in tandem with peptide mass fingerprinting led to identification of metal dependent protein hydrolases with no apparent hydrolytic activity, however, showed 5.7 folds higher saccharification in presence of Mn(2+). Furthermore, adding different protein fractions to commercial cellulase (Novozymes: Cellic CTec2) resulted in enhanced hydrolysis of ATCG ranging between 1.57 and 3.43 folds indicating the enzymes from M. cinnamomea as catalytically efficient. PMID:26476165

  14. [Biodegradation of Cellulose-Containing Substrates by Micromycetes Followed by Bioconversion into Biogas].

    Science.gov (United States)

    Prokudina, L I; Osmolovskii, A A; Egorova, M A; Malakhova, D V; Netrusov, A I; Tsavkelova, E A

    2016-01-01

    The ability of micromycetes Trichoderma viride and Aspergillus terreus to decompose the cellulose-containing substrates was studied. Office paper and cardboard, as well as a paper mixture, were found to be the most hydrolyzable. The cellulolytic activity of T. viride was 2-3 times higher than that of A. terreus; the highest values of 0.80 and 0.73 U/mLwere obtained from office paper and the paper mixture, respectively. The micromycete cultivation conditions (composition of culture medium, sucrose cosubstrate addition, seeding method) and the conditions of the fungus biomass treatment for its subsequent bioconversion into biogas by anaerobic microbial communities were optimized. It was shown that pretreatment improves the efficiency of biogas production from lignocellulosic materials under seeding with microbial community of bovine animal manure. After pretreatment of the Jerusalem artichoke phytomass (stems and leaves) and its subsequent bioconversion into biogas by methanogenic community, the biogas yield was increased by 1.5 times.

  15. Dicty_cDB: Contig-U06888-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 58 9e-08 CP000614_2675( CP000614 |pid:none) Burkholderia vietnamiensis G4 c... 58 1e-07 CP000677_200( CP000...e-06 CP000614_1743( CP000614 |pid:none) Burkholderia vietnamiensis G4 c... 52 6e-06 CP000728_3399( CP000728 ..... 51 1e-05 CP000614_2268( CP000614 |pid:none) Burkholderia vietnamiensis G4 c... 51 1e-05 CP000568_926( CP0...obium phaeobacteroides DSM... 52 5e-06 AM286415_1968( AM286415 |pid:none) Yersinia enterocolitica subsp. ......421( BA000030 |pid:none) Streptomyces avermitilis MA-468... 57 2e-07 CP001348_2558( CP001348 |pid:none) Clostridium cellulolytic

  16. Product inhibition of five Hypocrea jecorina cellulases

    DEFF Research Database (Denmark)

    Murphy, Leigh; Westh, Peter; Bohlin, Christina;

    2013-01-01

    Product inhibition of cellulolytic enzymes has been deemed a critical factor in the industrial saccharification of cellulosic biomass. Several investigations have addressed this problem using crude enzyme preparations or commercial (mixed) cellulase products, but quantitative information...... cellulose may be monitored by calorimetry. The key advantage of this approach is that it directly measures the rate of hydrolysis while being essentially blind to the background of added product. We investigated the five major cellulases from Hypocrea jecorina (anamorph: Tricoderma reesei), Cel7A (formerly...... by cellobiose, but showed the highest sensitivity to glucose among all investigated enzymes. The endoglucanases Cel12A and Cel7B were moderately inhibited by cellobiose (IC50 = 60–80 mM), and weakly inhibited by glucose (IC50 = 350–380 mM). The highest resistance to both products was found for Cel5A, which...

  17. Microorganisms applying for artificial soil regeneration technology in space greenhouses

    Science.gov (United States)

    Krivobok, A. S.

    2012-04-01

    The space greenhouse and technology for growing plants are being designed in frame of bio-technical life support systems development. During long-term space missions such greenhouse could provide the crew with vitamins and rough plant fiber. One of the important elements of the plant cultivation technology in the absence of earth gravity is organization and support the optimum root area. The capillary-porous substrate composed of anionites (FIBAN -1) and cationites (FIBAN -22-1) synthetic salt-saturated fibers is developed for plant cultivation in space and named "BIONA-V3". The BIONA main features are high productivity and usability. But the pointed features are not constant: the substrate productivity will be decreasing gradually from vegetation to vegetation course of plant residues and root secretions accumulation. Also, the basic hydro-physical characteristic of root zone will be shifted. Furthermore, saprotrophic microflora will develop and lead to increasing the level of microbial contamination of whole inhabit isolated module. Due to these changes the substrate useful life is limited and store mass is increased in long-term missions. For overhaul-period renewal it' necessary to remove the roots residues and other organic accumulation providing safety of the substrate capillary-porous structure. The basic components of 24-days old plant roots (Brassica chinensis, L) are cellulose (35 %) hemicellulose (11 %) and lignin (10 %). We see that one of the possible ways for roots residues removal from fibrous BIONA is microorganisms applying with strong cellulolytic and ligninolytic activities. The fungi Trichoderma sp., cellulolytic bacteria associations, and some genus of anaerobic thermophilic cellulolitic bacteria have been used for roots residues biodegradation. In case of applying cellulolytic fungi Trichoderma sp. considerable decrease of microcrystalline cellulose has been noted in both liquid and solid state fermentation. Cellulolytic fungi weight has been

  18. A Review of the Role of Amphiphiles in Biomass to Ethanol Conversion

    Directory of Open Access Journals (Sweden)

    William Gibbons

    2013-04-01

    Full Text Available One of the concerns for economical production of ethanol from biomass is the large volume and high cost of the cellulolytic enzymes used to convert biomass into fermentable sugars. The presence of acetyl groups in hemicellulose and lignin in plant cell walls reduces accessibility of biomass to the enzymes and makes conversion a slow process. In addition to low enzyme accessibility, a rapid deactivation of cellulases during biomass hydrolysis can be another factor contributing to the low sugar recovery. As of now, the economical reduction in lignin content of the biomass is considered a bottleneck, and raises issues for several reasons. The presence of lignin in biomass reduces the swelling of cellulose fibrils and accessibility of enzyme to carbohydrate polymers. It also causes an irreversible adsorption of the cellulolytic enzymes that prevents effective enzyme activity and recycling. Amphiphiles, such as surfactants and proteins have been found to improve enzyme activity by several mechanisms of action that are not yet fully understood. Reduction in irreversible adsorption of enzyme to non-specific sites, reduction in viscosity of liquid and surface tension and consequently reduced contact of enzyme with air-liquid interface, and modifications in biomass chemical structure are some of the benefits derived from surface active molecules. Application of some of these amphiphiles could potentially reduce the capital and operating costs of bioethanol production by reducing fermentation time and the amount of enzyme used for saccharification of biomass. In this review article, the benefit of applying amphiphiles at various stages of ethanol production (i.e., pretreatment, hydrolysis and hydrolysis-fermentation is reviewed and the proposed mechanisms of actions are described.

  19. POTENCY OF LIGNOCELLULOSE DEGRADING BACTERIA ISOLATED FROM BUFFALO AND HORSE GASTROINTESTINAL TRACT AND ELEPHANT DUNG FOR FEED FIBER DEGRADATION

    Directory of Open Access Journals (Sweden)

    A. Wahyudi

    2014-10-01

    Full Text Available Lignin is limiting factor for cellulose and hemicellulose degradation in rumen. Isolation andselection bacteria from buffalo and horse gastrointestinal tract and elephant dung could be foundbacteria that have superiority to degrade lignin, xylan, and cellulose. Those animals were chosenbecause they were herbivores that consume low quality crude fiber as their main energy sources.Lignocellulose degrading bacteria were isolated by Hungate selective media, by using lignin (tannicacid, xylan, and cellulose as selective substrates. The morphological identification used an enrichmentmedia by measuring color, colony size, diffusion zone, clear zone, and biochemical identification usingproduction of ligninase, xylanase, and cellulase enzymes. The best lignocellulose degrading bacteriathen was determined by the morphological and biochemical character. This study showed thatlignocellulose degrading bacteria could be found in gastrointestinal tract of buffalo and horse, andelephant dung. Highest number colony was found in samples from buffalo's colon (376, followed byhorse's cecum (203, elephant’s dung (46, buffalo’s cecum (23, buffalo's rumen (9 and horse’s colon(7. The highest isolates activity of lignolytic, xylanolytic, and cellulolytic were reached by buffalo’scecum (7.64, horse's cecum (6.27, and buffalo’s colon (2.48. Meanwhile the highest enzymesproductivities were: buffalo’s cecum (0.0400 µmol, horse’s cecum (1.3912 µmol and buffalo’s colon(0.1971 µmol. Based on morphologycal character and biochemical test, it could be concluded thatlignolytic from buffalo’s cecum, xylanolytic from horse’s cecum, and cellulolytic from buffalo’s colonwere the superior isolates and they were 99% analyzed as Enterococcus casseliflavus/gallinarumspecies.

  20. Comparison of different liquid anaerobic digestion effluents as inocula and nitrogen sources for solid-state batch anaerobic digestion of corn stover

    Energy Technology Data Exchange (ETDEWEB)

    Xu Fuqing; Shi Jian [Department of Food, Agricultural and Biological Engineering, Ohio State University, Ohio Agricultural Research and Development Center, 1680 Madison Ave., Wooster, OH 44691 (United States); Lv Wen; Yu Zhongtang [Department of Animal Sciences, Ohio State University, Columbus, OH 43210 (United States); Li Yebo, E-mail: li.851@osu.edu [Department of Food, Agricultural and Biological Engineering, Ohio State University, Ohio Agricultural Research and Development Center, 1680 Madison Ave., Wooster, OH 44691 (United States)

    2013-01-15

    Highlights: Black-Right-Pointing-Pointer Compared methane production of solid AD inoculated with different effluents. Black-Right-Pointing-Pointer Food waste effluent (FWE) had the largest population of acetoclastic methanogens. Black-Right-Pointing-Pointer Solid AD inoculated with FWE produced the highest methane yield at F/E ratio of 4. Black-Right-Pointing-Pointer Dairy waste effluent (DWE) was rich of cellulolytic and xylanolytic bacteria. Black-Right-Pointing-Pointer Solid AD inoculated with DWE produced the highest methane yield at F/E ratio of 2. - Abstract: Effluents from three liquid anaerobic digesters, fed with municipal sewage sludge, food waste, or dairy waste, were evaluated as inocula and nitrogen sources for solid-state batch anaerobic digestion of corn stover in mesophilic reactors. Three feedstock-to-effluent (F/E) ratios (i.e., 2, 4, and 6) were tested for each effluent. At an F/E ratio of 2, the reactor inoculated by dairy waste effluent achieved the highest methane yield of 238.5 L/kgVS{sub feed}, while at an F/E ratio of 4, the reactor inoculated by food waste effluent achieved the highest methane yield of 199.6 L/kgVS{sub feed}. The microbial population and chemical composition of the three effluents were substantially different. Food waste effluent had the largest population of acetoclastic methanogens, while dairy waste effluent had the largest populations of cellulolytic and xylanolytic bacteria. Dairy waste also had the highest C/N ratio of 8.5 and the highest alkalinity of 19.3 g CaCO{sub 3}/kg. The performance of solid-state batch anaerobic digestion reactors was closely related to the microbial status in the liquid anaerobic digestion effluents.

  1. Use of Pleurotus sajor-caju in upgrading green jute plants and jute sticks as ruminant feed

    Directory of Open Access Journals (Sweden)

    Zinat Mahal

    2013-01-01

    Full Text Available In this study, superfluous jute plants and jute stick were converted into upgraded animal feed by solid state fermentation (SSF using a cellulolytic fungus, Pleurotus sajor-caju. Prior to fermentation, substrates were subjected to several pretreatments such as soaking with water overnight and alkali or lime pretreatment. SSF was carried out with 20 g of substrate in 100 ml conical flask and was incubated at 30C for 8 weeks. In all treatments, the highest amount of reducing sugar, soluble protein as well as the cellulolytic activities of three enzymes viz. cellobiase, carboxymethyl cellulase and avicelase were obtained at 6th week of fermentation. Compared to raw, unsoaked substrates, soaking treatment alone could produce 10% more soluble protein in both substrates whereas reducing sugar increment was 5% and 6% in jute sticks and jute plants, respectively. From all treatments, combination of soaking and lime treatment in green jute plants yielded higher value than jute sticks in terms of reducing sugar, soluble protein and enzymatic activity. The radiation doses at 20, 30 and 40 kGy appeared to have no effect on sugar and protein accretion. During eight weeks of fermentation, relatively higher cellobiase activity was found compared to that of carboxymethyl cellulase and avicelase. The present investigation indicates that fungal conversion with pretreatment can turn these lignocellulosic agro-wastes to a nutritionally enriched animal feed by increasing the crude protein and reducing sugar content. However, further research is necessary to develop strategies for industrial scale production to overcome the crisis of nutritionally improved animal feed.

  2. Effects of essential oils on methane production and fermentation by, and abundance and diversity of, rumen microbial populations.

    Science.gov (United States)

    Patra, Amlan K; Yu, Zhongtang

    2012-06-01

    Five essential oils (EOs), namely, clove oil (CLO), eucalyptus oil (EUO), garlic oil (GAO), origanum oil (ORO), and peppermint oil (PEO), were tested in vitro at 3 different doses (0.25, 0.50, and 1.0 g/liter) for their effect on methane production, fermentation, and select groups of ruminal microbes, including total bacteria, cellulolytic bacteria, archaea, and protozoa. All the EOs significantly reduced methane production with increasing doses, with reductions by 34.4%, 17.6%, 42.3%, 87%, and 25.7% for CLO, EUO, GAO, ORO, and PEO, respectively, at 1.0 g/liter compared with the control. However, apparent degradability of dry matter and neutral detergent fiber also decreased linearly with increasing doses by all EOs except GAO. The concentrations of total volatile fatty acids were not affected by GAO, EUO, or PEO but altered linearly and quadratically by CLO and ORO, respectively. All the EOs also differed in altering the molar proportions of acetate, propionate, and butyrate. As determined by quantitative real-time PCR, all the EOs decreased the abundance of archaea, protozoa, and major cellulolytic bacteria (i.e., Fibrobacter succinogenes, Ruminococcus flavefaciens, and R. albus) linearly with increasing EO doses. On the basis of denaturing gradient gel electrophoresis analysis, different EOs changed the composition of both archaeal and bacterial communities to different extents. The Shannon-Wiener diversity index (H') was reduced for archaea by all EOs in a dose-dependent manner but increased for bacteria at low and medium doses (0.25 and 0.50 g/liter) for all EOs except ORO. Due to the adverse effects on feed digestion and fermentation at high doses, a single EO may not effectively and practically mitigate methane emission from ruminants unless used at low doses in combinations with other antimethanogenic compounds. PMID:22492451

  3. Direct xylan conversion into glycolipid biosurfactants, mannosylerythritol lipids, by Pseudozyma antarctica PYCC 5048(T).

    Science.gov (United States)

    Faria, Nuno Torres; Marques, Susana; Fonseca, César; Ferreira, Frederico Castelo

    2015-04-01

    Mannosylerythritol lipids (MEL) are glycolipid biosurfactants, produced by Pseudozyma spp., with increasing commercial interest. While MEL can be produced from d-glucose and d-xylose, the direct conversion of the respective lignocellulosic polysaccharides, cellulose and xylan, was not reported yet. The ability of Pseudozyma antarctica PYCC 5048(T) and Pseudozyma aphidis PYCC 5535(T) to use cellulose (Avicel(®)) and xylan (beechwood) as carbon and energy source has been assessed along with their capacity of producing cellulolytic and hemicellulolytic enzymes, toward a consolidated bioprocess (CBP) for MEL production. The yeasts assessed were neither able to grow in medium containing Avicel(®) nor produce cellulolytic enzymes under the conditions tested. On contrary, both yeasts were able to efficiently grow in xylan, but MEL production was only detected in P. antarctica PYCC 5048(T) cultures. MEL titers reached 1.3g/l after 10 days in batch cultures with 40g/l xylan, and 2.0g/l in fed-batch cultures with xylan feeding (additional 40g/l) at day 4. High levels of xylanase activities were detected in xylan cultures, reaching 47-62U/ml (31-32U/mg) at 50°C, and still exhibiting more than 10U/ml under physiological temperature (28°C). Total β-xylosidase activities, displayed mainly as wall-bounded and extracellular activity, accounted for 0.154 and 0.176U/ml in P. antarctica PYCC 5048(T) and P. aphidis PYCC 5535(T) cultures, respectively. The present results demonstrate the potential of Pseudozyma spp. for using directly a fraction of lignocellulosic biomass, xylan, and combining in the same bioprocess the production of xylanolytic enzymes with MEL production. PMID:25765311

  4. Genome-wide analysis of acetivibrio cellulolyticus provides a blueprint of an elaborate cellulosome system

    Directory of Open Access Journals (Sweden)

    Dassa Bareket

    2012-05-01

    Full Text Available Abstract Background Microbial degradation of plant cell walls and its conversion to sugars and other byproducts is a key step in the carbon cycle on Earth. In order to process heterogeneous plant-derived biomass, specialized anaerobic bacteria use an elaborate multi-enzyme cellulosome complex to synergistically deconstruct cellulosic substrates. The cellulosome was first discovered in the cellulolytic thermophile, Clostridium thermocellum, and much of our knowledge of this intriguing type of protein composite is based on the cellulosome of this environmentally and biotechnologically important bacterium. The recently sequenced genome of the cellulolytic mesophile, Acetivibrio cellulolyticus, allows detailed comparison of the cellulosomes of these two select cellulosome-producing bacteria. Results Comprehensive analysis of the A. cellulolyticus draft genome sequence revealed a very sophisticated cellulosome system. Compared to C. thermocellum, the cellulosomal architecture of A. cellulolyticus is much more extensive, whereby the genome encodes for twice the number of cohesin- and dockerin-containing proteins. The A. cellulolyticus genome has thus evolved an inflated number of 143 dockerin-containing genes, coding for multimodular proteins with distinctive catalytic and carbohydrate-binding modules that play critical roles in biomass degradation. Additionally, 41 putative cohesin modules distributed in 16 different scaffoldin proteins were identified in the genome, representing a broader diversity and modularity than those of Clostridium thermocellum. Although many of the A. cellulolyticus scaffoldins appear in unconventional modular combinations, elements of the basic structural scaffoldins are maintained in both species. In addition, both species exhibit similarly elaborate cell-anchoring and cellulosome-related gene- regulatory elements. Conclusions This work portrays a particularly intricate, cell-surface cellulosome system in A. cellulolyticus

  5. Glycosylation variants of a β-glucosidase secreted by a Taiwanese fungus, Chaetomella raphigera, exhibit variant-specific catalytic and biochemical properties.

    Directory of Open Access Journals (Sweden)

    Aki Yoneda

    Full Text Available Cellulosic biomass is an abundant and promising energy source. To make cellulosic biofuels competitive against conventional fuels, conversion of rigid plant materials into sugars must become efficient and cost-effective. During cellulose degradation, cellulolytic enzymes generate cellobiose (β-(1→4-glucose dimer molecules, which in turn inhibit such enzymes by negative feedback. β-Glucosidases (BGLs cleave cellobiose into glucose monomers, assisting overall cellulolytic activities. Therefore, BGLs are essential for efficient conversion of cellulosic biomass into biofuels, and it is important to characterize newly isolated BGLs for useful traits. Here, we report our discovery that the indigenous Taiwanese fungus Chaetomella raphigera strain D2 produces two molecular weight variants of a single BGL, D2-BGL (shortened to "D2", which differ in O-glycosylation. The more extensively O-glycosylated form of native D2 (nD2L has increased activity toward the natural substrate, cellobiose, compared to the less O-glycosylated form (nD2S. nD2L is more stable at 60°C, in acidic pH, and in the presence of the ionic detergent sodium dodecyl sulfate than nD2S. Furthermore, unlike nD2S, nD2L does not display substrate inhibition by an artificial substrate p-nitrophenyl glucopyranoside (pNPG, and the glucose feedback inhibition kinetics of nD2L is competitive (while it is non-competitive for nD2S, suggesting that these two glycovariants of D2 bind substrates differently. Interestingly, D2 produced in a heterologous system, Pichia pastoris, closely mimics properties of nD2S. Our studies suggest that O-glycosylation of D2 is important in determining its catalytic and biochemical properties.

  6. Enzymatic hydrolysis of potato pulp

    Directory of Open Access Journals (Sweden)

    Mariusz Lesiecki

    2012-03-01

    Full Text Available Background. Potato pulp constitutes a complicated system of four types of polysaccharides: cellulose, hemicellulose, pectin and starch. Its composition makes it a potential and attractive raw material for the production of the second generation bioethanol. The aim of this research project was to assess the usefulness of commercial enzymatic preparations for the hydrolysis of potato pulp and to evaluate the effectiveness of hydrolysates obtained in this way as raw materials for ethanol fermentation. Material  and methods. Sterilised potato pulp was subjected to hydrolysis with commercial enzymatic preparations. The effectiveness of the preparations declared as active towards only one fraction of potato pulp (separate amylase, pectinase and cellulase activity and mixtures of these preparations was analysed. The monomers content in hydrolysates was determined using HPLC method. Results.  The application of amylolytic enzymes for potato pulp hydrolysis resulted in the release of only 18% of raw material with glucose as the dominant (77% constituent of the formed product. In addition, 16% galactose was also determined in it. The hydrolysis of the cellulose fraction yielded up to 35% raw material and the main constituents of the obtained hydrolysate were glucose (46% and arabinose (40%. Simultaneous application of amylolytic, cellulolytic and pectinolytic enzymes turned out to be the most effective way of carrying out the process as its efficiency in this case reached 90%. The obtained hydrolysate contained 63% glucose, 25% arabinose and 12% other simple substances. Conclusion. The application of commercial enzymatic preparations made it possible to perform potato pulp hydrolysis with 90% effectiveness. This was achieved by the application of a complex of amylolytic, cellulolytic and pectinolytic enzymes and the hydrolysate obtained in this way contained, primarily, glucose making it a viable substrate for ethanol fermentation.

  7. Microbial diversity in the midguts of field and lab-reared populations of the European corn borer Ostrinia nubilalis.

    Directory of Open Access Journals (Sweden)

    Eugeni Belda

    Full Text Available BACKGROUND: Insects are associated with microorganisms that contribute to the digestion and processing of nutrients. The European Corn Borer (ECB is a moth present world-wide, causing severe economical damage as a pest on corn and other crops. In the present work, we give a detailed view of the complexity of the microorganisms forming the ECB midgut microbiota with the objective of comparing the biodiversity of the midgut-associated microbiota and explore their potential as a source of genes and enzymes with biotechnological applications. METHODOLOGICAL/PRINCIPAL FINDINGS: A high-throughput sequencing approach has been used to identify bacterial species, genes and metabolic pathways, particularly those involved in plant-matter degradation, in two different ECB populations (field-collected vs. lab-reared population with artificial diet. Analysis of the resulting sequences revealed the massive presence of Staphylococcus warneri and Weissella paramesenteroides in the lab-reared sample. This enabled us to reconstruct both genomes almost completely. Despite the apparently low diversity, 208 different genera were detected in the sample, although most of them at very low frequency. By contrast, the natural population exhibited an even higher taxonomic diversity along with a wider array of cellulolytic enzyme families. However, in spite of the differences in relative abundance of major taxonomic groups, not only did both metagenomes share a similar functional profile but also a similar distribution of non-redundant genes in different functional categories. CONCLUSIONS/SIGNIFICANCE: Our results reveal a highly diverse pool of bacterial species in both O. nubilalis populations, with major differences: The lab-reared sample is rich in gram-positive species (two of which have almost fully sequenced genomes while the field sample harbors mainly gram-negative species and has a larger set of cellulolytic enzymes. We have found a clear relationship between the

  8. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Fueyo, Elena; Ruiz-Duenas, Francisco J.; Ferreira, Patrica; Floudas, Dimitrios; HIbbett, David S.; Canessa, Paulo; Larrondo, Luis F.; James, Tim Y.; Seelenfreund, Daniela; Lobos, Sergio; Polanco, Ruben; Tello, Mario; Honda, Yoichi; Watanabe, Takahito; Watanabe, Takashi; Ryu, Jae San; Kubicek, Christian P.; Schmoll, Monika; Gaskell, Jill; Hammel, Kenneth E.; John, Franz J.; Vanden Wymelenberg, Amber; Sabat, Grzegorz; Splinter BonDurant, Sandra; Syed, Khajamohiddin; Yadav, Jagjit S.; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Lavin, Jose L.; Oguiza, Jose A.; Perez, Gumer; Pisabarro, Antonio G.; Ramirez, Lucia; Santoyo, Francisco; Master, Emma; Coutinho, Pedro M.; Henrissat, Bernard; Lombard, Vincent; Magnuson, Jon Karl; Kues, Ursula; Hori, Chiaki; Igarashi, Kiyohiko; Samejima, Masahiro; Held, Benjamin W.; Barry, Kerrie W.; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Riley, Robert; Salamov, Asaf A.; Hoffmeister, Dirk; Schwenk, Daniel; Hadar, Yitzhak; Yarden, Oded; de Vries, Ronald P.; Wiebenga, Ad; Stenlid, Jan; Eastwood, Daniel; Grigoriev, Igor V.; Berka, Randy M.; Blanchette, Robert A.; Kersten, Phil; Martinez, Angel T.; Vicuna, Rafael; Cullen, Dan

    2011-12-06

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little cellulose degradation. To investigate the basis for selective ligninolysis, we conducted comparative genome analysis of C. subvermispora and P. chrysosporium. Genes encoding manganese peroxidase numbered 13 and five in C. subvermispora and P. chrysosporium, respectively. In addition, the C. subvermispora genome contains at least seven genes predicted to encode laccases, whereas the P. chrysosporium genome contains none. We also observed expansion of the number of C. subvermispora desaturase-encoding genes putatively involved in lipid metabolism. Microarray-based transcriptome analysis showed substantial up-regulation of several desaturase and MnP genes in wood-containing medium. MS identified MnP proteins in C. subvermispora culture filtrates, but none in P. chrysosporium cultures. These results support the importance of MnP and a lignin degradation mechanism whereby cleavage of the dominant nonphenolic structures is mediated by lipid peroxidation products. Two C. subvermispora genes were predicted to encode peroxidases structurally similar to P. chrysosporium lignin peroxidase and, following heterologous expression in Escherichia coli, the enzymes were shown to oxidize high redox potential substrates, but not Mn2. Apart from oxidative lignin degradation, we also examined cellulolytic and hemicellulolytic systems in both fungi. In summary, the C. subvermispora genetic inventory and expression patterns exhibit increased oxidoreductase potential and diminished cellulolytic capability relative to P. chrysosporium.

  9. Effect of Dietary Starch Source and Concentration on Equine Fecal Microbiota.

    Directory of Open Access Journals (Sweden)

    Brittany E Harlow

    Full Text Available Starch from corn is less susceptible to equine small intestinal digestion than starch from oats, and starch that reaches the hindgut can be utilized by the microbiota. The objective of the current study was to examine the effects of starch source on equine fecal microbiota. Thirty horses were assigned to treatments: control (hay only, HC (high corn, HO (high oats, LC (low corn, LO (low oats, and LW (low pelleted wheat middlings. Horses received an all-forage diet (2 wk; d -14 to d -1 before the treatment diets (2 wk; d 1 to 14. Starch was introduced gradually so that horses received 50% of the assigned starch amount (high = 2 g starch/kg BW; low = 1 g starch/kg BW by d 4 and 100% by d 11. Fecal samples were obtained at the end of the forage-only period (S0; d -2, and on d 6 (S1 and d 13 (S2 of the treatment period. Cellulolytics, lactobacilli, Group D Gram-positive cocci (GPC, lactate-utilizers and amylolytics were enumerated. Enumeration data were log transformed and analyzed by repeated measures ANOVA. There were sample day × treatment interactions (P 0.05. All treatments except LO resulted in increased amylolytics and decreased cellulolytics, but the changes were larger in horses fed corn and wheat middlings (P < 0.05. Feeding oats resulted in increased lactobacilli and decreased GPC (P < 0.05, while corn had the opposite effects. LW had increased lactobacilli and GPC (P < 0.05. The predominant amylolytic isolates from HC, LC and LW on S2 were identified by 16S RNA gene sequencing as Enterococcus faecalis, but other species were found in oat fed horses. These results demonstrate that starch source can have a differential effect on the equine fecal microbiota.

  10. Effect of Dietary Starch Source and Concentration on Equine Fecal Microbiota.

    Science.gov (United States)

    Harlow, Brittany E; Lawrence, Laurie M; Hayes, Susan H; Crum, Andrea; Flythe, Michael D

    2016-01-01

    Starch from corn is less susceptible to equine small intestinal digestion than starch from oats, and starch that reaches the hindgut can be utilized by the microbiota. The objective of the current study was to examine the effects of starch source on equine fecal microbiota. Thirty horses were assigned to treatments: control (hay only), HC (high corn), HO (high oats), LC (low corn), LO (low oats), and LW (low pelleted wheat middlings). Horses received an all-forage diet (2 wk; d -14 to d -1) before the treatment diets (2 wk; d 1 to 14). Starch was introduced gradually so that horses received 50% of the assigned starch amount (high = 2 g starch/kg BW; low = 1 g starch/kg BW) by d 4 and 100% by d 11. Fecal samples were obtained at the end of the forage-only period (S0; d -2), and on d 6 (S1) and d 13 (S2) of the treatment period. Cellulolytics, lactobacilli, Group D Gram-positive cocci (GPC), lactate-utilizers and amylolytics were enumerated. Enumeration data were log transformed and analyzed by repeated measures ANOVA. There were sample day × treatment interactions (P 0.05). All treatments except LO resulted in increased amylolytics and decreased cellulolytics, but the changes were larger in horses fed corn and wheat middlings (P < 0.05). Feeding oats resulted in increased lactobacilli and decreased GPC (P < 0.05), while corn had the opposite effects. LW had increased lactobacilli and GPC (P < 0.05). The predominant amylolytic isolates from HC, LC and LW on S2 were identified by 16S RNA gene sequencing as Enterococcus faecalis, but other species were found in oat fed horses. These results demonstrate that starch source can have a differential effect on the equine fecal microbiota.

  11. Cloning and functional characterization of endo-β-1,4-glucanase gene from metagenomic library of vermicompost.

    Science.gov (United States)

    Yasir, Muhammad; Khan, Haji; Azam, Syed Sikander; Telke, Amar; Kim, Seon Won; Chung, Young Ryun

    2013-06-01

    In the vermicomposting of paper mill sludge, the activity of earthworms is very dependent on dietetic polysaccharides including cellulose as energy sources. Most of these polymers are degraded by the host microbiota and considered potentially important source for cellulolytic enzymes. In the present study, a metagenomic library was constructed from vermicompost (VC) prepared with paper mill sludge and dairy sludge (fresh sludge, FS) and functionally screened for cellulolytic activities. Eighteen cellulase expressing clones were isolated from about 89,000 fosmid clones libraries. A short fragment library was constructed from the most active positive clone (cMGL504) and one open reading frame (ORF) of 1,092 bp encoding an endo-β-1,4-glucanase was indentified which showed 88% similarity with Cellvibrio mixtus cellulase A gene. The endo-β-1,4-glucanase cmgl504 gene was overexpressed in Escherichia coli. The purified recombinant cmgl504 cellulase displayed activities at a broad range of temperature (25-55°C) and pH (5.5-8.5). The enzyme degraded carboxymethyl cellulose (CMC) with 15.4 U, while having low activity against avicel. No detectable activity was found for xylan and laminarin. The enzyme activity was stimulated by potassium chloride. The deduced protein and three-dimensional structure of metagenome-derived cellulase cmgl504 possessed all features, including general architecture, signature motifs, and N-terminal signal peptide, followed by the catalytic domain of cellulase belonging to glycosyl hydrolase family 5 (GHF5). The cellulases cloned in this work may play important roles in the degradation of celluloses in vermicomposting process and could be exploited for industrial application in future. PMID:23812813

  12. Expression of an endoglucanase from Tribolium castaneum (TcEG1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Shirley, Derek; Oppert, Cris; Reynolds, Todd B; Miracle, Bethany; Oppert, Brenda; Klingeman, William E; Jurat-Fuentes, Juan Luis

    2014-10-01

    Insects are a largely unexploited resource in prospecting for novel cellulolytic enzymes to improve the production of ethanol fuel from lignocellulosic biomass. The cost of lignocellulosic ethanol production is expected to decrease by the combination of cellulose degradation (saccharification) and fermentation of the resulting glucose to ethanol in a single process, catalyzed by the yeast Saccharomyces cerevisiae transformed to express efficient cellulases. While S. cerevisiae is an established heterologous expression system, there are no available data on the functional expression of insect cellulolytic enzymes for this species. To address this knowledge gap, S. cerevisiae was transformed to express the full-length cDNA encoding an endoglucanase from the red flour beetle, Tribolium castaneum (TcEG1), and evaluated the activity of the transgenic product (rTcEG1). Expression of the TcEG1 cDNA in S. cerevisiae was under control of the strong glyceraldehyde-3 phosphate dehydrogenase promoter. Cultured transformed yeast secreted rTcEG1 protein as a functional β-1,4-endoglucanase, which allowed transformants to survive on selective media containing cellulose as the only available carbon source. Evaluation of substrate specificity for secreted rTcEG1 demonstrated endoglucanase activity, although some activity was also detected against complex cellulose substrates. Potentially relevant to uses in biofuel production rTcEG1 activity increased with pH conditions, with the highest activity detected at pH 12. Our results demonstrate the potential for functional production of an insect cellulase in S. cerevisiae and confirm the stability of rTcEG1 activity in strong alkaline environments.

  13. Comparison of different liquid anaerobic digestion effluents as inocula and nitrogen sources for solid-state batch anaerobic digestion of corn stover

    International Nuclear Information System (INIS)

    Highlights: ► Compared methane production of solid AD inoculated with different effluents. ► Food waste effluent (FWE) had the largest population of acetoclastic methanogens. ► Solid AD inoculated with FWE produced the highest methane yield at F/E ratio of 4. ► Dairy waste effluent (DWE) was rich of cellulolytic and xylanolytic bacteria. ► Solid AD inoculated with DWE produced the highest methane yield at F/E ratio of 2. - Abstract: Effluents from three liquid anaerobic digesters, fed with municipal sewage sludge, food waste, or dairy waste, were evaluated as inocula and nitrogen sources for solid-state batch anaerobic digestion of corn stover in mesophilic reactors. Three feedstock-to-effluent (F/E) ratios (i.e., 2, 4, and 6) were tested for each effluent. At an F/E ratio of 2, the reactor inoculated by dairy waste effluent achieved the highest methane yield of 238.5 L/kgVSfeed, while at an F/E ratio of 4, the reactor inoculated by food waste effluent achieved the highest methane yield of 199.6 L/kgVSfeed. The microbial population and chemical composition of the three effluents were substantially different. Food waste effluent had the largest population of acetoclastic methanogens, while dairy waste effluent had the largest populations of cellulolytic and xylanolytic bacteria. Dairy waste also had the highest C/N ratio of 8.5 and the highest alkalinity of 19.3 g CaCO3/kg. The performance of solid-state batch anaerobic digestion reactors was closely related to the microbial status in the liquid anaerobic digestion effluents.

  14. Genome, transcriptome, and secretome analysis of wood decay fungus Postia placenta supports unique mechanisms of lignocellulose conversion

    Energy Technology Data Exchange (ETDEWEB)

    Martinez, Diego; Challacombe, Jean; Morgenstern, Ingo; Hibbett, David; Schmoll, Monika; Kubicek, Christian P.; Ferreira, Patricia; Ruiz-Duenas, Francisco; Martinez, Angel T.; Kersten, Phil; Hammel, Ken; Vanden Wymelenberg, Amber; Gaskell, Jill; Lindquist, Erika; Sabat, Gregorz; Splinter Bondurant, Sandra; Larrondo, Luis F.; Canessa, Paulo; Vicuna, Rafael; Yadev, Jagjit; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Pisabarro, Antonio; Lavin, Jose L.; Oguiza, Jose A.; Master, Emma; Henrissat, Bernard; Coutinho, Pedro M.; Harris, Paul; Magnuson, Jon K.; Baker, Scott E.; Bruno, Kenneth S.; Kenealy, William; Hoegger, Patrik; Kues, Ursula; Ramaiya, Preethi; Lucas, Susan; Salamov, Asaf; Shapiro, Harris; Tu, Hank; Chee, Christine L.; Misra, Monica; Xie, Gary; Teter, Sarah; Yaver, Debbie; James, Tim; Mokrejs, Martin; Pospisek, Martin; Grigoriev, Igor V.; Brettin, T.; Rokhsar, Daniel S.; Berka, Randy; Cullen, Dan

    2009-02-10

    Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome, and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in media containing cellulose as sole carbon source, transcripts corresponding to many hemicellulases and to a single putative β-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Also upregulated under cellulolytic culture conditions were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H2O2. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H2O2 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. In particular, comparisons between P. placenta and the closely related white-rot fungus, Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which efficient depolymerization of lignin was lost.

  15. Impact of the lignin structure of three lignocellulosic feedstocks on their organosolv delignification. Effect of carbonium ion scavengers

    International Nuclear Information System (INIS)

    Effect of autohydrolysis and aromatic scavengers on delignification patterns were evaluated using miscanthus (MxG), empty palm fruit bunch (EFB) and typha grass residue as feedstocks. Autohydrolysis was carried out without naphthol and in the presence of naphthol followed by delignification by ethanol organosolv process. Despite their close chemical composition, the three feedstocks demonstrated quite different patterns of delignification under the same condition of pretreatment. Nuclear magnetic resonance (NMR) spectroscopic characterization of ethanol organosolv lignins (EOLs) extracted from the three feedstocks revealed information concerning syringyl, guaiacyl and hydroxyphenyl content (S/G/H ratios) which underpinned the differences among the feedstock behavior. The (S + H)/G ratios for MxG, EFB and typha were determined as 1.27, 2.33 and 2.70 respectively. The major cause of difference in behavior of feedstock during the pretreatment process was attributed to the variation in lignin composition. A good relationship was observed between S/G ratio and the scavenging effect of 2-naphthol. The effect of four additional aromatic scavengers viz. p-cresol, o-cresol, hydroquinone and dihydroxyanthraquinone (DHAQ) tested in miscanthus demonstrated a significant enhancement on delignification; the effect of p-cresol and DHAQ was tantamount to that of naphthol. Cellulolytic enzyme lignin (CEL) extracted from typha grass was also subjected to 13C NMR characterization in order to obtain a more complete picture of typha lignin. Comparison of NMR spectra of CEL and EOL from TC was performed for determining the processing effect in lignin structure. -- Highlights: ► Effect of autohydrolysis and aromatic scavengers on delignification patterns were evaluated. ► Ethanol organosolv lignins and Cellulolytic Enzyme Lignin extracted from typha were characterized. ► A correlation was observed between S + H/G ratio and the effect of aromatic scavengers

  16. Identification of a haloalkaliphilic and thermostable cellulase with improved ionic liquid tolerance

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Tao; Datta, Supratim; Eichler, Jerry; Ivanova, Natalia; Axen, Seth D.; Kerfeld, Cheryl A.; Chen, Feng; Kyrpides, Nikos; Hugenholtz, Philip; Cheng, Jan-Fang; Sale, Kenneth L.; Simmons, Blake; Rubin, Eddy

    2011-02-17

    Some ionic liquids (ILs) have been shown to be very effective solvents for biomass pretreatment. It is known that some ILs can have a strong inhibitory effect on fungal cellulases, making the digestion of cellulose inefficient in the presence of ILs. The identification of IL-tolerant enzymes that could be produced as a cellulase cocktail would reduce the costs and water use requirements of the IL pretreatment process. Due to their adaptation to high salinity environments, halophilic enzymes are hypothesized to be good candidates for screening and identifying IL-resistant cellulases. Using a genome-based approach, we have identified and characterized a halophilic cellulase (Hu-CBH1) from the halophilic archaeon, Halorhabdus utahensis. Hu-CBH1 is present in a gene cluster containing multiple putative cellulolytic enzymes. Sequence and theoretical structure analysis indicate that Hu-CBH1 is highly enriched with negatively charged acidic amino acids on the surface, which may form a solvation shell that may stabilize the enzyme, through interaction with salt ions and/or water molecules. Hu-CBH1 is a heat tolerant haloalkaliphilic cellulase and is active in salt concentrations up to 5 M NaCl. In high salt buffer, Hu-CBH1 can tolerate alkali (pH 11.5) conditions and, more importantly, is tolerant to high levels (20percent w/w) of ILs, including 1-allyl-3-methylimidazolium chloride ([Amim]Cl). Interestingly, the tolerances to heat, alkali and ILs are found to be salt-dependent, suggesting that the enzyme is stabilized by the presence of salt. Our results indicate that halophilic enzymes are good candidates for the screening of IL-tolerant cellulolytic enzymes.

  17. Halophilic bacteria are colonizing the exhibition areas of the Capuchin Catacombs in Palermo, Italy.

    Science.gov (United States)

    Piñar, G; Kraková, L; Pangallo, D; Piombino-Mascali, D; Maixner, F; Zink, A; Sterflinger, K

    2014-07-01

    The Capuchin Catacombs of Palermo, Italy, contain over 1800 mummies dating from the 16th to 20th centuries AD. Their environment is not conducive to the conservation of the remains due to, among other factors, water infiltration, which is producing salt efflorescences on the walls. A multiphasic approach was applied to investigate the halophilic microbiota present in the Catacombs. Enrichment cultures were conducted on media containing different NaCl concentrations, ranging from 3 to 20 %. For screening of the strains, the following two PCR-based methods were used and compared: fluorescence internal transcribed spacer PCR (f-ITS) and random amplification of polymorphic DNA (RAPD) analyses. Results derived from RAPD profiles were shown to be slightly more discriminative than those derived from f-ITS. In addition, the proteolytic and cellulolytic abilities were screened through the use of plate assays, gelatin agar and Ostazin Brilliant Red H-3B (OBR-HEC), respectively. Many of the strains isolated from the wall samples displayed proteolytic activities, such as all strains belonging to the genera Bacillus, Virgibacillus and Arthrobacter, as well as some strains related to the genera Oceanobacillus, Halobacillus and Idiomarina. In addition, many of the strains isolated from materials employed to stuff the mummies showed cellulolytic activities, such as those related to species of the genera Chromohalobacter and Nesterenkonia, as well as those identified as Staphylococcus equorum and Halomonas sp. Furthermore, many of the strains were pigmented ranging from yellow to a strong pink color, being directly related to the discoloration displayed by the materials. PMID:24863363

  18. Contributing factors in the improvement of cellulosic H2 production in Clostridium thermocellum/Thermoanaerobacterium co-cultures.

    Science.gov (United States)

    Wang, Mingyu; Zhao, Qi; Li, Ling; Niu, Kangle; Li, Yi; Wang, Fangzhong; Jiang, Baojie; Liu, Kuimei; Jiang, Yi; Fang, Xu

    2016-10-01

    Lignocellulosic biohydrogen is a promising renewable energy source that could be a potential alternative to the unsustainable fossil fuel-based energy. Biohydrogen production could be performed by Clostridium thermocellum that is the fastest known cellulose-degrading bacterium. Previous investigations have shown that the co-culture of C. thermocellum JN4 and a non-cellulolytic bacterium Thermoanaerobacterium thermosaccharolyticum GD17 produces more hydrogen than the C. thermocellum JN4 mono-culture, but the mechanism of this improvement is unknown. In this work, we carried out genomic and evolutionary analysis of hydrogenase-coding genes in C. thermocellum and T. thermosaccharolyticum, identifying one Ech-type [NiFe] hydrogenase complex in each species, and, respectively, five and four monomeric or multimeric [FeFe] hydrogenases in the two species. Further transcriptional analysis showed hydrogenase-coding genes in C. thermocellum are regulated by carbon sources, while hydrogenase-coding genes in T. thermosaccharolyticum are not. However, comparison between transcriptional abundance of hydrogenase-coding genes in mono- and co-cultures showed the co-culturing condition leads to transcriptional changes of hydrogenase-coding genes in T. thermosaccharolyticum but not C. thermocellum. Further metabolic analysis showed T. thermosaccharolyticum produces H2 at a rate 4-12-fold higher than C. thermocellum. These findings lead to the suggestion that the improvement of H2 production in the co-culture over mono-culture should be attributed to changes in T. thermosaccharolyticum but not C. thermocellum. Further suggestions can be made that C. thermocellum and T. thermosaccharolyticum perform highly specialized tasks in the co-culture, and optimization of the co-culture for more lignocellulosic biohydrogen production should be focused on the improvement of the non-cellulolytic bacterium.

  19. Influence of different periods of exposure to hot environment on rumen function and diet digestibility in sheep

    Science.gov (United States)

    Bernabucci, U.; Lacetera, N.; Danieli, P. P.; Bani, P.; Nardone, A.; Ronchi, B.

    2009-09-01

    Effects of different periods of exposure to hot environments on rumen function, diet digestibility and digesta passage rate were studied in four adult not-pregnant Sardinian ewes housed in a climatic chamber. The ewes were kept in individual metabolic cages. The trial lasted 83 days; 17 days were spent under thermal comfort conditions (TC) [temperature-humidity index (THI) = 65.0 ± 2.0], followed by 49 days under elevated THI (ETHI: THI = 82.0 ± 2.5) and 17 days under thermal comfort (TC; THI = 65.0 ± 1.0). Five digestibility and passage rate trials were carried out during the 83 days. Trials 1 and 5 were carried out under TC; trials 2, 3 and 4 were carried out under ETHI. Values of rectal temperatures (39.7 ± 0.3°C) and respiratory rate (118.4 ± 31.8 breaths/min) indicated that sheep under ETHI were heat-stressed. Heat stress caused an increase ( P < 0.01) in water intake, and reductions ( P < 0.05) in dry matter intake, rumen pH, rumen cellulolytic and amylolytic bacteria count, rumen osmolarity, organic matter, dry matter, neutral detergent fibre, acid detergent fibre and non-structural carbohydrates digestibility coefficients, and a reduction of digesta passage rates. Under ETHI, diet digestibility and passage rate of digesta were reduced in a time-dependent fashion. Variation of diet digestibility under ETHI was not related to passage rate of digesta and feed intake. Reduction of cellulolytic and amylolytic bacteria and the adaptive response to hot environment seem to be related to alteration of digestibility observed in ewes chronically exposed to hot environment.

  20. Homologous expression of the Caldicellulosiruptor bescii CelA reveals that the extracellular protein is glycosylated.

    Directory of Open Access Journals (Sweden)

    Daehwan Chung

    Full Text Available Members of the bacterial genus Caldicellulosiruptor are the most thermophilic cellulolytic microbes described with ability to digest lignocellulosic biomass without conventional pretreatment. The cellulolytic ability of different species varies dramatically and correlates with the presence of the multimodular cellulase CelA, which contains both a glycoside hydrolase family 9 endoglucanase and a glycoside hydrolase family 48 exoglucanase known to be synergistic in their activity, connected by three cellulose-binding domains via linker peptides. This architecture exploits the cellulose surface ablation driven by its general cellulase processivity as well as excavates cavities into the surface of the substrate, revealing a novel paradigm for cellulase activity. We recently reported that a deletion of celA in C. bescii had a significant effect on its ability to utilize complex biomass. To analyze the structure and function of CelA and its role in biomass deconstruction, we constructed a new expression vector for C. bescii and were able, for the first time, to express significant quantities of full-length protein in vivo in the native host. The protein, which contains a Histidine tag, was active and excreted from the cell. Expression of CelA protein with and without its signal sequence allowed comparison of protein retained intracellularly to protein transported extracellularly. Analysis of protein in culture supernatants revealed that the extracellular CelA protein is glycosylated whereas the intracellular CelA is not, suggesting that either protein transport is required for this post-translational modification or that glycosylation is required for protein export. The mechanism and role of protein glycosylation in bacteria is poorly understood and the ability to express CelA in vivo in C. bescii will allow the study of the mechanism of protein glycosylation in this thermophile. It will also allow the study of glycosylation of CelA itself and its