WorldWideScience

Sample records for cell recognition molecule

  1. Cell recognition molecule L1 promotes embryonic stem cell differentiation through the regulation of cell surface glycosylation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ying [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Department of Clinical Laboratory, Second Affiliated Hospital of Dalian Medical University, Dalian 116023 (China); Huang, Xiaohua [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Department of Clinical Biochemistry, College of Laboratory Medicine, Dalian Medical University, Dalian 116044 (China); An, Yue [Department of Clinical Laboratory, Second Affiliated Hospital of Dalian Medical University, Dalian 116023 (China); Ren, Feng [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Yang, Zara Zhuyun; Zhu, Hongmei; Zhou, Lei [The Key Laboratory of Stem Cell and Regenerative Medicine, Institute of Molecular and Clinical Medicine, Kunming Medical University, Kunming 650228 (China); Department of Anatomy and Developmental Biology, Monash University, Clayton 3800 (Australia); He, Xiaowen; Schachner, Melitta [Keck Center for Collaborative Neuroscience and Department of Cell Biology and Neuroscience, Rutgers University, New Brunswick, NJ (United States); Xiao, Zhicheng, E-mail: zhicheng.xiao@monash.edu [The Key Laboratory of Stem Cell and Regenerative Medicine, Institute of Molecular and Clinical Medicine, Kunming Medical University, Kunming 650228 (China); Department of Anatomy and Developmental Biology, Monash University, Clayton 3800 (Australia); Ma, Keli, E-mail: makeli666@aliyun.com [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Li, Yali, E-mail: yalilipaper@gmail.com [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Department of Anatomy, National University of Singapore, Singapore 119078 (Singapore)

    2013-10-25

    Highlights: •Down-regulating FUT9 and ST3Gal4 expression blocks L1-induced neuronal differentiation of ESCs. •Up-regulating FUT9 and ST3Gal4 expression in L1-ESCs depends on the activation of PLCγ. •L1 promotes ESCs to differentiate into neuron through regulating cell surface glycosylation. -- Abstract: Cell recognition molecule L1 (CD171) plays an important role in neuronal survival, migration, differentiation, neurite outgrowth, myelination, synaptic plasticity and regeneration after injury. Our previous study has demonstrated that overexpressing L1 enhances cell survival and proliferation of mouse embryonic stem cells (ESCs) through promoting the expression of FUT9 and ST3Gal4, which upregulates cell surface sialylation and fucosylation. In the present study, we examined whether sialylation and fucosylation are involved in ESC differentiation through L1 signaling. RNA interference analysis showed that L1 enhanced differentiation of ESCs into neurons through the upregulation of FUT9 and ST3Gal4. Furthermore, blocking the phospholipase Cγ (PLCγ) signaling pathway with either a specific PLCγ inhibitor or knockdown PLCγ reduced the expression levels of both FUT9 and ST3Gal4 mRNAs and inhibited L1-mediated neuronal differentiation. These results demonstrate that L1 promotes neuronal differentiation from ESCs through the L1-mediated enhancement of FUT9 and ST3Gal4 expression.

  2. Cell recognition molecule L1 promotes embryonic stem cell differentiation through the regulation of cell surface glycosylation

    International Nuclear Information System (INIS)

    Li, Ying; Huang, Xiaohua; An, Yue; Ren, Feng; Yang, Zara Zhuyun; Zhu, Hongmei; Zhou, Lei; He, Xiaowen; Schachner, Melitta; Xiao, Zhicheng; Ma, Keli; Li, Yali

    2013-01-01

    Highlights: •Down-regulating FUT9 and ST3Gal4 expression blocks L1-induced neuronal differentiation of ESCs. •Up-regulating FUT9 and ST3Gal4 expression in L1-ESCs depends on the activation of PLCγ. •L1 promotes ESCs to differentiate into neuron through regulating cell surface glycosylation. -- Abstract: Cell recognition molecule L1 (CD171) plays an important role in neuronal survival, migration, differentiation, neurite outgrowth, myelination, synaptic plasticity and regeneration after injury. Our previous study has demonstrated that overexpressing L1 enhances cell survival and proliferation of mouse embryonic stem cells (ESCs) through promoting the expression of FUT9 and ST3Gal4, which upregulates cell surface sialylation and fucosylation. In the present study, we examined whether sialylation and fucosylation are involved in ESC differentiation through L1 signaling. RNA interference analysis showed that L1 enhanced differentiation of ESCs into neurons through the upregulation of FUT9 and ST3Gal4. Furthermore, blocking the phospholipase Cγ (PLCγ) signaling pathway with either a specific PLCγ inhibitor or knockdown PLCγ reduced the expression levels of both FUT9 and ST3Gal4 mRNAs and inhibited L1-mediated neuronal differentiation. These results demonstrate that L1 promotes neuronal differentiation from ESCs through the L1-mediated enhancement of FUT9 and ST3Gal4 expression

  3. Molecular Regulation of Immune Recognition Molecule Expression by Breast Cancer Cells

    National Research Council Canada - National Science Library

    Burns, Linda

    2000-01-01

    Novel anti-tumor strategies are required for breast cancer. We hypothesize that immunotherapy used in a minimal residual disease setting, such as can be obtained following stem cell transplantation, may prevent relapse...

  4. Designer molecule for molecular recognition and photoinduced ...

    Indian Academy of Sciences (India)

    amitava

    Designer molecule for molecular recognition and photoinduced energy/electron transfer processes p. A it. D. Central Salt and Marine Chemicals Research Institute (CSIR). Bhavnagar: 364002 Gujarat. Amitava Das. Bhavnagar: 364002, Gujarat. E-Mail: amitava@csmcri.org. IAS-2011 ...

  5. Fluid phase recognition molecules in neutrophil-dependent immune responses.

    Science.gov (United States)

    Jaillon, Sébastien; Ponzetta, Andrea; Magrini, Elena; Barajon, Isabella; Barbagallo, Marialuisa; Garlanda, Cecilia; Mantovani, Alberto

    2016-04-01

    The innate immune system comprises both a cellular and a humoral arm. Neutrophils are key effector cells of the immune and inflammatory responses and have emerged as a major source of humoral pattern recognition molecules (PRMs). These molecules, which include collectins, ficolins, and pentraxins, are specialised in the discrimination of self versus non-self and modified-self and share basic multifunctional properties including recognition and opsonisation of pathogens and apoptotic cells, activation and regulation of the complement cascade and tuning of inflammation. Neutrophils act as a reservoir of ready-made soluble PRMs, such as the long pentraxin PTX3, the peptidoglycan recognition protein PGRP-S, properdin and M-ficolin, which are stored in neutrophil granules and are involved in neutrophil effector functions. In addition, other soluble PRMs, such as members of the collectin family, are not expressed in neutrophils but can modulate neutrophil-dependent immune responses. Therefore, soluble PRMs are an essential part of the innate immune response and retain antibody-like effector functions. Here, we will review the expression and general function of soluble PRMs, focusing our attention on molecules involved in neutrophil effector functions. Copyright © 2016. Published by Elsevier Ltd.

  6. Ficolins and FIBCD1: Soluble and membrane bound pattern recognition molecules with acetyl group selectivity

    DEFF Research Database (Denmark)

    Thomsen, Theresa; Schlosser, Anders; Holmskov, Uffe

    2011-01-01

    as pattern recognition molecules. Ficolins are soluble oligomeric proteins composed of trimeric collagen-like regions linked to fibrinogen-related domains (FReDs) that have the ability to sense molecular patterns on both pathogens and apoptotic cell surfaces and activate the complement system. The ficolins......D-containing molecules, and discusses structural resemblance but also diversity in recognition of acetylated ligands....

  7. Recognition of the Major Histocompatibility Complex (MHC) Class Ib Molecule H2-Q10 by the Natural Killer Cell Receptor Ly49C.

    Science.gov (United States)

    Sullivan, Lucy C; Berry, Richard; Sosnin, Natasha; Widjaja, Jacqueline M L; Deuss, Felix A; Balaji, Gautham R; LaGruta, Nicole L; Mirams, Michiko; Trapani, Joseph A; Rossjohn, Jamie; Brooks, Andrew G; Andrews, Daniel M

    2016-09-02

    Murine natural killer (NK) cells are regulated by the interaction of Ly49 receptors with major histocompatibility complex class I molecules (MHC-I). Although the ligands for inhibitory Ly49 were considered to be restricted to classical MHC (MHC-Ia), we have shown that the non-classical MHC molecule (MHC-Ib) H2-M3 was a ligand for the inhibitory Ly49A. Here we establish that another MHC-Ib, H2-Q10, is a bona fide ligand for the inhibitory Ly49C receptor. H2-Q10 bound to Ly49C with a marginally lower affinity (∼5 μm) than that observed between Ly49C and MHC-Ia (H-2K(b)/H-2D(d), both ∼1 μm), and this recognition could be prevented by cis interactions with H-2K in situ To understand the molecular details underpinning Ly49·MHC-Ib recognition, we determined the crystal structures of H2-Q10 and Ly49C bound H2-Q10. Unliganded H2-Q10 adopted a classical MHC-I fold and possessed a peptide-binding groove that exhibited features similar to those found in MHC-Ia, explaining the diverse peptide binding repertoire of H2-Q10. Ly49C bound to H2-Q10 underneath the peptide binding platform to a region that encompassed residues from the α1, α2, and α3 domains, as well as the associated β2-microglobulin subunit. This docking mode was conserved with that previously observed for Ly49C·H-2K(b) Indeed, structure-guided mutation of Ly49C indicated that Ly49C·H2-Q10 and Ly49C·H-2K(b) possess similar energetic footprints focused around residues located within the Ly49C β4-stand and L5 loop, which contact the underside of the peptide-binding platform floor. Our data provide a structural basis for Ly49·MHC-Ib recognition and demonstrate that MHC-Ib represent an extended family of ligands for Ly49 molecules. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Bergmann glia and the recognition molecule CHL1 organize GABAergic axons and direct innervation of Purkinje cell dendrites.

    Directory of Open Access Journals (Sweden)

    Fabrice Ango

    2008-04-01

    Full Text Available The geometric and subcellular organization of axon arbors distributes and regulates electrical signaling in neurons and networks, but the underlying mechanisms have remained elusive. In rodent cerebellar cortex, stellate interneurons elaborate characteristic axon arbors that selectively innervate Purkinje cell dendrites and likely regulate dendritic integration. We used GFP BAC transgenic reporter mice to examine the cellular processes and molecular mechanisms underlying the development of stellate cell axons and their innervation pattern. We show that stellate axons are organized and guided towards Purkinje cell dendrites by an intermediate scaffold of Bergmann glial (BG fibers. The L1 family immunoglobulin protein Close Homologue of L1 (CHL1 is localized to apical BG fibers and stellate cells during the development of stellate axon arbors. In the absence of CHL1, stellate axons deviate from BG fibers and show aberrant branching and orientation. Furthermore, synapse formation between aberrant stellate axons and Purkinje dendrites is reduced and cannot be maintained, leading to progressive atrophy of axon terminals. These results establish BG fibers as a guiding scaffold and CHL1 a molecular signal in the organization of stellate axon arbors and in directing their dendritic innervation.

  9. The Regions on the Light Chain of Botulinum Neurotoxin Type A Recognized by T Cells from Toxin-Treated Cervical Dystonia Patients. The Complete Human T-Cell Recognition Map of the Toxin Molecule.

    Science.gov (United States)

    Oshima, Minako; Deitiker, Philip; Jankovic, Joseph; Atassi, M Zouhair

    2018-01-01

    We have recently mapped the in vitro proliferative responses of T cells from botulinum neurotoxin type A (BoNT/A)-treated cervical dystonia (CD) patients with overlapping peptides encompassing BoNT/A heavy chain (residues 449-1296). In the present study, we determined the recognition profiles, by peripheral blood lymphocytes (PBL) from the same set of patients, of BoNT/A light (L) chain (residues 1-453) by using 32 synthetic overlapping peptides that encompassed the entire L chain. Profiles of the T-cell responses (expressed in stimulation index, SI; Z score based on transformed SI) to the peptides varied among the patients. Samples from 14 patients treated solely with BoNT/A recognized 3-13 (average 7.2) peptides/sample at Z > 3.0 level. Two peptide regions representing residues 113-131 and 225-243 were recognized by around 40% of these patients. Regarding treatment parameters, treatment history with current BOTOX ® only group produced significantly lower average T-cell responses to the 32 L-chain peptides compared to treatments with mix of type A including original and current BOTOX ® . Influence of other treatment parameters on T-cell recognition of the L-chain peptides was also observed. Results of the submolecular T-cell recognition of the L chain are compared to those of the H chain and the T-cell recognition profile of the entire BoNT/A molecule is discussed. Abbreviations used: BoNT/A, botulinum neurotoxin type A; BoNT/A i , inactivated BoNT/A; BoNT/B, botulinum neurotoxin type B; CD, cervical dystonia; L chain, the light chain (residues 1-448) of BoNT/A; LNC, lymph node cells; H chain, the heavy chain (residues 449-1296) of BoNT/A; H C , C-terminal domain (residues 855-1296) of H chain; H N , N-terminal domain (residues 449-859) of H chain; MPA, mouse protection assay; SI, stimulation index (SI = cpm of 3 H-thymidine incorporated by antigen-stimulated T cells/cpm incorporated by unstimulated cells); TeNT, tetanus neurotoxin; TeNT i , inactivated TeNT.

  10. Subtle Changes in Peptide Conformation Profoundly Affect Recognition of the Non-Classical MHC Class I Molecule HLA-E by the CD94-NKG2 Natural Killer Cell Receptors

    Energy Technology Data Exchange (ETDEWEB)

    Hoare, Hilary L; Sullivan, Lucy C; Clements, Craig S; Ely, Lauren K; Beddoe, Travis; Henderson, Kate N; Lin, Jie; Reid, Hugh H; Brooks, Andrew G; Rossjohn, Jamie [Monash; (Melbourne)

    2008-03-31

    Human leukocyte antigen (HLA)-E is a non-classical major histocompatibility complex class I molecule that binds peptides derived from the leader sequences of other HLA class I molecules. Natural killer cell recognition of these HLA-E molecules, via the CD94-NKG2 natural killer family, represents a central innate mechanism for monitoring major histocompatibility complex expression levels within a cell. The leader sequence-derived peptides bound to HLA-E exhibit very limited polymorphism, yet subtle differences affect the recognition of HLA-E by the CD94-NKG2 receptors. To better understand the basis for this peptide-specific recognition, we determined the structure of HLA-E in complex with two leader peptides, namely, HLA-Cw*07 (VMAPRALLL), which is poorly recognised by CD94-NKG2 receptors, and HLA-G*01 (VMAPRTLFL), a high-affinity ligand of CD94-NKG2 receptors. A comparison of these structures, both of which were determined to 2.5-Å resolution, revealed that allotypic variations in the bound leader sequences do not result in conformational changes in the HLA-E heavy chain, although subtle changes in the conformation of the peptide within the binding groove of HLA-E were evident. Accordingly, our data indicate that the CD94-NKG2 receptors interact with HLA-E in a manner that maximises the ability of the receptors to discriminate between subtle changes in both the sequence and conformation of peptides bound to HLA-E.

  11. Application of Recognition Tunneling in Single Molecule Identification

    Science.gov (United States)

    Zhao, Yanan

    Single molecule identification is one essential application area of nanotechnology. The application areas including DNA sequencing, peptide sequencing, early disease detection and other industrial applications such as quantitative and quantitative analysis of impurities, etc. The recognition tunneling technique we have developed shows that after functionalization of the probe and substrate of a conventional Scanning Tunneling Microscope with recognition molecules ("tethered molecule-pair" configuration), analyte molecules trapped in the gap that is formed by probe and substrate will bond with the reagent molecules. The stochastic bond formation/breakage fluctuations give insight into the nature of the intermolecular bonding at a single molecule-pair level. The distinct time domain and frequency domain features of tunneling signals were extracted from raw signals of analytes such as amino acids and their enantiomers. The Support Vector Machine (a machine-learning method) was used to do classification and predication based on the signal features generated by analytes, giving over 90% accuracy of separation of up to seven analytes. This opens up a new interface between chemistry and electronics with immediate implications for rapid Peptide/DNA sequencing and molecule identification at single molecule level.

  12. Simple test system for single molecule recognition force microscopy

    International Nuclear Information System (INIS)

    Riener, Christian K.; Stroh, Cordula M.; Ebner, Andreas; Klampfl, Christian; Gall, Alex A.; Romanin, Christoph; Lyubchenko, Yuri L.; Hinterdorfer, Peter; Gruber, Hermann J.

    2003-01-01

    We have established an easy-to-use test system for detecting receptor-ligand interactions on the single molecule level using atomic force microscopy (AFM). For this, avidin-biotin, probably the best characterized receptor-ligand pair, was chosen. AFM sensors were prepared containing tethered biotin molecules at sufficiently low surface concentrations appropriate for single molecule studies. A biotin tether, consisting of a 6 nm poly(ethylene glycol) (PEG) chain and a functional succinimide group at the other end, was newly synthesized and covalently coupled to amine-functionalized AFM tips. In particular, PEG 800 diamine was glutarylated, the mono-adduct NH 2 -PEG-COOH was isolated by ion exchange chromatography and reacted with biotin succinimidylester to give biotin-PEG-COOH which was then activated as N-hydroxysuccinimide (NHS) ester to give the biotin-PEG-NHS conjugate which was coupled to the aminofunctionalized AFM tip. The motional freedom provided by PEG allows for free rotation of the biotin molecule on the AFM sensor and for specific binding to avidin which had been adsorbed to mica surfaces via electrostatic interactions. Specific avidin-biotin recognition events were discriminated from nonspecific tip-mica adhesion by their typical unbinding force (∼40 pN at 1.4 nN/s loading rate), unbinding length (<13 nm), the characteristic nonlinear force-distance relation of the PEG linker, and by specific block with excess of free d-biotin. The convenience of the test system allowed to evaluate, and compare, different methods and conditions of tip aminofunctionalization with respect to specific binding and nonspecific adhesion. It is concluded that this system is well suited as calibration or start-up kit for single molecule recognition force microscopy

  13. The innate pattern recognition molecule Ficolin-1 is secreted by monocytes/macrophages and is circulating in human plasma

    DEFF Research Database (Denmark)

    Honoré, Christian; Rørvig, Sara; Munthe-Fog, Lea

    2008-01-01

    Ficolin-1 (M-Ficolin) is a pattern recognition molecule of the complement system that is expressed by myeloid cells and type II alveolar epithelial cells. Ficolin-1 has been shown to localize in the secretory granules of these cells and attached to cell surfaces, but whether Ficolin-1 exists...

  14. CD molecules 2005: human cell differentiation molecules

    Czech Academy of Sciences Publication Activity Database

    Zola, H.; Swart, B.; Nicholson, I.; Aasted, B.; Bensussan, A.; Boumsell, L.; Buckley, C.; Clark, G.; Drbal, Karel; Engel, P.; Hart, D.; Hořejší, Václav; Isacke, C.; Macardle, P.; Malavasi, F.; Mason, D.; Olive, D.; Saalmüller, A.; Schlossman, S.F.; Schwartz-Albiez, R.; Simmons, P.; Tedder, T.F.; Uguccioni, M.; Warren, H.

    2005-01-01

    Roč. 106, č. 9 (2005), s. 3123-3126 ISSN 0006-4971 Institutional research plan: CEZ:AV0Z5052915 Keywords : CD molecules * leukocyte antigen Subject RIV: EC - Immunology Impact factor: 10.131, year: 2005

  15. The neural cell adhesion molecule

    DEFF Research Database (Denmark)

    Berezin, V; Bock, E; Poulsen, F M

    2000-01-01

    During the past year, the understanding of the structure and function of neural cell adhesion has advanced considerably. The three-dimensional structures of several of the individual modules of the neural cell adhesion molecule (NCAM) have been determined, as well as the structure of the complex...

  16. The pattern-recognition molecule mannan-binding lectin (MBL) in the pathophysiology of diabetic nephropathy

    DEFF Research Database (Denmark)

    Axelgaard, Esben; Thiel, Steffen; Hansen, Troels Krarup

    The pattern-recognition molecule mannan-binding lectin (MBL) in the pathophysiology of diabetic nephropathy Esben Axelgaard*; Steffen Thiel*; Jakob Appel Østergaard† and Troels Krarup Hansen† *Department of Biomedicine, Aarhus University, Wilhelm Meyer´s Allé 4, 8000 Aarhus C, Denmark. †Department...... of Clinical Medicine, Aarhus University and The Danish Diabetes Academy, Nørrebrogade 44, build. 3, 8000 Aarhus C, Denmark The complement system is part of the innate immune system and is an important part of the first line of defence against pathogens. Mannan-binding lectin (MBL) is one of the pattern-recognition...... mechanisms are proposed, 1) the formation of neoepitopes for MBL pattern recognition on host cells would enable lectin pathway activation and 2) inactivation of complement regulatory proteins by glycation that may exaggerate complement attack on host cells. MBL initiates the lectin pathway through binding...

  17. The neural cell adhesion molecule

    DEFF Research Database (Denmark)

    Berezin, V; Bock, E; Poulsen, F M

    2000-01-01

    During the past year, the understanding of the structure and function of neural cell adhesion has advanced considerably. The three-dimensional structures of several of the individual modules of the neural cell adhesion molecule (NCAM) have been determined, as well as the structure of the complex...... between two identical fragments of the NCAM. Also during the past year, a link between homophilic cell adhesion and several signal transduction pathways has been proposed, connecting the event of cell surface adhesion to cellular responses such as neurite outgrowth. Finally, the stimulation of neurite...

  18. The pattern recognition molecule ficolin-1 exhibits differential binding to lymphocyte subsets, providing a novel link between innate and adaptive immunity

    DEFF Research Database (Denmark)

    Genster, Ninette; Ma, Ying Jie; Munthe-Fog, Lea

    2014-01-01

    and demonstrated that CD56(dim) NK-cells and both CD4(+) and CD8(+) subsets of activated T-cells were recognized by ficolin-1. In contrast we did not detect binding of ficolin-1 to CD56(bright) NK-cells, NKT-cells, resting T-cells or B-cells. Furthermore, we showed that the protein-lymphocyte interaction occurred......Ficolin-1 is a soluble pattern recognition molecule synthesized by myeloid cells and capable of activating the lectin pathway of complement on the surface of pathogens. It is tethered to the membranes of monocytes and granulocytes; however, the biological significance of cell-associated ficolin-1...... is unknown. Recognition of healthy host cells by a pattern recognition molecule constitutes a potential hazard to self cells and tissues, emphasizing the importance of further elucidating the reported self-recognition. In the current study we investigated the potential recognition of lymphocytes by ficolin-1...

  19. The pattern recognition molecule deleted in malignant brain tumors 1 (DMBT1) and synthetic mimics inhibit liposomal nucleic acid delivery

    DEFF Research Database (Denmark)

    Lund Hansen, Pernille; Blaich, Stephanie; End, Caroline

    2011-01-01

    Liposomal nucleic acid delivery is a preferred option for therapeutic settings. The cellular pattern recognition molecule DMBT1, secreted at high levels in various diseases, and synthetic mimics efficiently inhibit liposomal nucleic acid delivery to human cells. These findings may have relevance ...

  20. Efficient unfolding pattern recognition in single molecule force spectroscopy data

    Directory of Open Access Journals (Sweden)

    Labudde Dirk

    2011-06-01

    Full Text Available Abstract Background Single-molecule force spectroscopy (SMFS is a technique that measures the force necessary to unfold a protein. SMFS experiments generate Force-Distance (F-D curves. A statistical analysis of a set of F-D curves reveals different unfolding pathways. Information on protein structure, conformation, functional states, and inter- and intra-molecular interactions can be derived. Results In the present work, we propose a pattern recognition algorithm and apply our algorithm to datasets from SMFS experiments on the membrane protein bacterioRhodopsin (bR. We discuss the unfolding pathways found in bR, which are characterised by main peaks and side peaks. A main peak is the result of the pairwise unfolding of the transmembrane helices. In contrast, a side peak is an unfolding event in the alpha-helix or other secondary structural element. The algorithm is capable of detecting side peaks along with main peaks. Therefore, we can detect the individual unfolding pathway as the sequence of events labeled with their occurrences and co-occurrences special to bR's unfolding pathway. We find that side peaks do not co-occur with one another in curves as frequently as main peaks do, which may imply a synergistic effect occurring between helices. While main peaks co-occur as pairs in at least 50% of curves, the side peaks co-occur with one another in less than 10% of curves. Moreover, the algorithm runtime scales well as the dataset size increases. Conclusions Our algorithm satisfies the requirements of an automated methodology that combines high accuracy with efficiency in analyzing SMFS datasets. The algorithm tackles the force spectroscopy analysis bottleneck leading to more consistent and reproducible results.

  1. T cell avidity and tumor recognition: implications and therapeutic strategies

    Directory of Open Access Journals (Sweden)

    Roszkowski Jeffrey J

    2005-09-01

    Full Text Available Abstract In the last two decades, great advances have been made studying the immune response to human tumors. The identification of protein antigens from cancer cells and better techniques for eliciting antigen specific T cell responses in vitro and in vivo have led to improved understanding of tumor recognition by T cells. Yet, much remains to be learned about the intricate details of T cell – tumor cell interactions. Though the strength of interaction between T cell and target is thought to be a key factor influencing the T cell response, investigations of T cell avidity, T cell receptor (TCR affinity for peptide-MHC complex, and the recognition of peptide on antigen presenting targets or tumor cells reveal complex relationships. Coincident with these investigations, therapeutic strategies have been developed to enhance tumor recognition using antigens with altered peptide structures and T cells modified by the introduction of new antigen binding receptor molecules. The profound effects of these strategies on T cell – tumor interactions and the clinical implications of these effects are of interest to both scientists and clinicians. In recent years, the focus of much of our work has been the avidity and effector characteristics of tumor reactive T cells. Here we review concepts and current results in the field, and the implications of therapeutic strategies using altered antigens and altered effector T cells.

  2. Carbohydrate Recognition by Boronolectins, Small Molecules, and Lectins

    Science.gov (United States)

    Jin, Shan; Cheng, Yunfeng; Reid, Suazette; Li, Minyong; Wang, Binghe

    2009-01-01

    Carbohydrates are known to mediate a large number of biological and pathological events. Small and macromolecules capable of carbohydrate recognition have great potentials as research tools, diagnostics, vectors for targeted delivery of therapeutic and imaging agents, and therapeutic agents. However, this potential is far from being realized. One key issue is the difficulty in the development of “binders” capable of specific recognition of carbohydrates of biological relevance. This review discusses systematically the general approaches that are available in developing carbohydrate sensors and “binders/receptors,” and their applications. The focus is on discoveries during the last five years. PMID:19291708

  3. Fast recognition of single molecules based on single-event photon statistics

    International Nuclear Information System (INIS)

    Dong Shuangli; Huang Tao; Liu Yuan; Wang Jun; Zhang Guofeng; Xiao Liantuan; Jia Suotang

    2007-01-01

    Mandel's Q parameter, which is determined from single-event photon statistics, provides an alternative way to recognize single molecules with fluorescence detection, other than the second-order correlation function. It is shown that the Q parameter of an assumed ideal double-molecule fluorescence with the same average photon number as that of the sample fluorescence can act as the criterion for single-molecule recognition. The influence of signal-to-background ratio and the error estimates for photon statistics are also presented. We have applied this method to ascertain single Cy5 dye molecules within hundreds of milliseconds

  4. Pattern recognition monitoring of PEM fuel cell

    Science.gov (United States)

    Meltser, Mark Alexander

    1999-01-01

    The CO-concentration in the H.sub.2 feed stream to a PEM fuel cell stack is monitored by measuring current and voltage behavior patterns from an auxiliary cell attached to the end of the stack. The auxiliary cell is connected to the same oxygen and hydrogen feed manifolds that supply the stack, and discharges through a constant load. Pattern recognition software compares the current and voltage patterns from the auxiliary cell to current and voltage signature determined from a reference cell similar to the auxiliary cell and operated under controlled conditions over a wide range of CO-concentrations in the H.sub.2 fuel stream.

  5. Interactions of the humoral pattern recognition molecule PTX3 with the complement system

    DEFF Research Database (Denmark)

    Doni, Andrea; Garlanda, Cecilia; Bottazzi, Barbara

    2012-01-01

    The innate immune system comprises a cellular and a humoral arm. The long pentraxin PTX3 is a fluid phase pattern recognition molecule, which acts as an essential component of the humoral arm of innate immunity. PTX3 has antibody-like properties including interactions with complement components...

  6. Colour measurement and white blood cell recognition

    CERN Document Server

    Gelsema, E S

    1972-01-01

    As a part of a collaboration with NEMCH aimed at the automation of the differential white blood cell count, studies have been made of the different possibilities for using colour to help in the recognition process. Results are presented comparing data obtained with a microspectrophotometer and with a simulated three-colour scanner.

  7. The long pentraxin PTX3: a paradigm for humoral pattern recognition molecules.

    Science.gov (United States)

    Mantovani, Alberto; Valentino, Sonia; Gentile, Stefania; Inforzato, Antonio; Bottazzi, Barbara; Garlanda, Cecilia

    2013-05-01

    Pattern recognition molecules (PRMs) are components of the humoral arm of innate immunity; they recognize pathogen-associated molecular patterns (PAMP) and are functional ancestors of antibodies, promoting complement activation, opsonization, and agglutination. In addition, several PRMs have a regulatory function on inflammation. Pentraxins are a family of evolutionarily conserved PRMs characterized by a cyclic multimeric structure. On the basis of structure, pentraxins have been operationally divided into short and long families. C-reactive protein (CRP) and serum amyloid P component are prototypes of the short pentraxin family, while pentraxin 3 (PTX3) is a prototype of the long pentraxins. PTX3 is produced by somatic and immune cells in response to proinflammatory stimuli and Toll-like receptor engagement, and it interacts with several ligands and exerts multifunctional properties. Unlike CRP, PTX3 gene organization and regulation have been conserved in evolution, thus allowing its pathophysiological roles to be evaluated in genetically modified animals. Here we will briefly review the general properties of CRP and PTX3 as prototypes of short and long pentraxins, respectively, emphasizing in particular the functional role of PTX3 as a prototypic PRM with antibody-like properties. © 2013 New York Academy of Sciences.

  8. MHC class I molecules with superenhanced CD8 binding properties bypass the requirement for cognate TCR recognition and nonspecifically activate CTLs

    NARCIS (Netherlands)

    L. Wooldridge (Linda); M. Clement (Mathew); A. Lissina (Anna); E.S.J. Edwards (Emily); K. Ladell (Kristin); J. Ekeruche (Julia); R.E. Hewitt (Rachel); B. Laugel (Bruno); E. Gostick (Emma); D.K. Cole (David); J.E.M.A. Debets (Reno); C.A. Berrevoets (Cor); J.J. Miles (John); S.R. Burrows (Scott); D.A. Price (David); A.K. Sewell (Andrew)

    2010-01-01

    textabstractCD8+CTLs are essential for effective immune defense against intracellular microbes and neoplasia. CTLs recognize short peptide fragments presented in association with MHC class I (MHCI) molecules on the surface of infected or dysregulated cells. Ag recognition involves the binding of

  9. Assay for the pattern recognition molecule collectin liver 1 (CL-L1)

    DEFF Research Database (Denmark)

    Axelgaard, Esben; Jensenius, Jens Christian; Jensen, Lisbeth

    Collectin liver 1 (also termed collectin 10 and CL-L1) is a C-type lectin that functions as a pattern recognition molecule (PRM) in the innate immune system1. We have produced antibodies against CL-L1 and have developed a sandwich-type time-resolved immuno-fluorometric assay (TRIFMA) for the meas......Collectin liver 1 (also termed collectin 10 and CL-L1) is a C-type lectin that functions as a pattern recognition molecule (PRM) in the innate immune system1. We have produced antibodies against CL-L1 and have developed a sandwich-type time-resolved immuno-fluorometric assay (TRIFMA...

  10. Heterogeneity of cell adhesion molecules in the developing nervous system

    International Nuclear Information System (INIS)

    Williams, R.K.

    1985-01-01

    Cell-surface molecules, especially glycoproteins, are believed to mediate interactions between developing neurons and their environment. These interactions include pathfinding by growing processes, recognition of appropriate targets, and formation of synaptic structures. In order to identify neuronal cell-surface molecules, monoclonal antibodies (Mab's) were prepared against synaptic fractions from adult rat brain. From this group three monoclonal antibodies, designated 3C5.59, 3G5.34, and 3G6.41, that react with cell-surface antigens of embryonic neurons were selected for further study. In immunofluoresence experiments each of these antibodies strongly reacted with the processes of cultured granule cell neurons, the major class of small cerebellar neurons, cultured from developing rat cerebellum. Mab's 3C5.59 and 3G5.34 reacted only with neurons in the cerebellar cultures. Mab 3G6.41, however, also reacted with cultured brain astrocytes. On frozen sections Mab's 3G5.34 and 3G6.41 also strongly stained the molecular layer, the site of active granule cell axon growth, in the developing cerebellum. Monoclonal and polyclonal antibodies specific for the neural cell adhesion molecule (N-CAM) were used to compare the two glycoproteins recognized by Mab 3G6.41 with N-CAM. Band 1, another large neuronal cell-surface glycoprotein was originally identified in mouse N18 neuroblastoma cells. In this study 125 I-labeled N18-derived band 1 was tested for binding to 9 plant lectins and Limulus polyphemus agglutinin coupled to agarose beads. Band 1 solubilized from brain also specifically bound to LCA-agarose, indicating that mannose containing sugar moieties are present on band 1 from brain

  11. T cell recognition of breast cancer antigens

    DEFF Research Database (Denmark)

    Petersen, Nadia Viborg; Andersen, Sofie Ramskov; Andersen, Rikke Sick

    Recent studies are encouraging research of breast cancer immunogenicity to evaluate the applicability ofimmunotherapy as a treatment strategy. The epitope landscape in breast cancer is minimally described, thus it is necessary to identify T cell targets to develop immune mediated therapies.......This project investigates four proteins commonly upregulated in breast cancer and thus probable tumor associated antigens (TAAs). Aromatase, prolactin, NEK3, and PIAS3 contribute to increase growth, survival, and motility of malignant cells. Aspiring to uncover novel epitopes for cytotoxic T cells, a reverse...... recognition utilizing DNA barcode labeled MHC multimers to screen peripheral blood lymphocytes from breast cancer patients and healthy donor samples. Signif-icantly more TAA specific T cell responses were detected in breast cancer patients than healthy donors for both HLA-A*0201 (P

  12. Single-molecule spectroscopy of amino acids and peptides by recognition tunnelling

    Science.gov (United States)

    Zhao, Yanan; Ashcroft, Brian; Zhang, Peiming; Liu, Hao; Sen, Suman; Song, Weisi; Im, Jongone; Gyarfas, Brett; Manna, Saikat; Biswas, Sovan; Borges, Chad; Lindsay, Stuart

    2014-06-01

    The human proteome has millions of protein variants due to alternative RNA splicing and post-translational modifications, and variants that are related to diseases are frequently present in minute concentrations. For DNA and RNA, low concentrations can be amplified using the polymerase chain reaction, but there is no such reaction for proteins. Therefore, the development of single-molecule protein sequencing is a critical step in the search for protein biomarkers. Here, we show that single amino acids can be identified by trapping the molecules between two electrodes that are coated with a layer of recognition molecules, then measuring the electron tunnelling current across the junction. A given molecule can bind in more than one way in the junction, and we therefore use a machine-learning algorithm to distinguish between the sets of electronic `fingerprints' associated with each binding motif. With this recognition tunnelling technique, we are able to identify D and L enantiomers, a methylated amino acid, isobaric isomers and short peptides. The results suggest that direct electronic sequencing of single proteins could be possible by sequentially measuring the products of processive exopeptidase digestion, or by using a molecular motor to pull proteins through a tunnel junction integrated with a nanopore.

  13. Recognition of microbial glycolipids by Natural Killer T cells

    Directory of Open Access Journals (Sweden)

    Dirk Michael Zajonc

    2015-08-01

    Full Text Available T cells can recognize microbial antigens when presented by dedicated antigen-presenting molecules. While peptides are presented by classical members of the Major Histocompatibility (MHC family (MHC I and II, lipids, glycolipids and lipopeptides can be presented by the non-classical MHC member CD1. The best studied subset of lipid-reactive T cells are Type I Natural killer T (iNKT cells that recognize a variety of different antigens when presented by the non-classical MHCI homolog CD1d. iNKT cells have been shown to be important for the protection against various microbial pathogens, including B. burgdorferi the causative agents of Lyme disease and S. pneumoniae, which causes pneumococcal meningitis and community-acquired pneumonia. Both pathogens carry microbial glycolipids that can trigger the T cell antigen receptor (TCR, leading to iNKT cell activation. iNKT cells have an evolutionary conserved TCR alpha chain, yet retain the ability to recognize structurally diverse glycolipids. They do so using a conserved recognition mode, in which the TCR enforces a conserved binding orientation on CD1d. TCR binding is accompanied by structural changes within the TCR binding site of CD1d, as well as the glycolipid antigen itself. In addition to direct recognition of microbial antigens, iNKT cells can also be activated by a combination of cytokines (IL-12/IL-18 and TCR stimulation. Many microbes carry TLR antigens and microbial infections can lead to TLR activation. The subsequent cytokine response in turn lower the threshold of TCR mediated iNKT cell activation, especially when weak microbial or even self-antigens are presented during the cause of the infection. In summary, iNKT cells can be directly activated through TCR triggering of strong antigens, while cytokines produced by the innate immune response may be necessary for TCR triggering and iNKT cell activation in the presence of weak antigens. Here we will review the molecular basis of iNKT cell

  14. Assay for the pattern recognition molecule collectin liver 1 (CL-L1)

    DEFF Research Database (Denmark)

    Axelgaard, Esben; Jensenius, Jens Christian; Jensen, Lisbeth

    Collectin liver 1 (also termed collectin 10 and CL-L1) is a C-type lectin that functions as a pattern recognition molecule (PRM) in the innate immune system1. We have produced antibodies against CL-L1 and have developed a sandwich-type time-resolved immuno-fluorometric assay (TRIFMA...... to co-purify with MASPs, possibly rendering it a role in complement. CL-L1 showed binding activity towards mannose-TSK beads in a Ca2+-dependent manner. This binding could be inhibited by mannose and glucose, but not by galactose, indicating that CL-L1 binds via its carbohydrate-recognition domain (CRD)....

  15. T Cell Costimulatory Molecules in Anti-Viral Immunity: Potential Role in Immunotherapeutic Vaccines

    OpenAIRE

    Watts, Tania H; Bertram, Edward M; Bukczynski, Jacob; Wen, Tao

    2003-01-01

    T lymphocyte activation is required to eliminate or control intracellular viruses. The activation of T cells requires both an antigen specific signal, involving the recognition of a peptide/major histocompatibility protein complex by the T cell receptor, as well as additional costimulatory signals. In chronic viral diseases, T cell responses, although present, are unable to eliminate the infection. By providing antigens and costimulatory molecules together, investigators may be able to incr...

  16. Remote control of therapeutic T cells through a small molecule-gated chimeric receptor

    Science.gov (United States)

    Wu, Chia-Yung; Roybal, Kole T.; Puchner, Elias M.; Onuffer, James; Lim, Wendell A.

    2016-01-01

    There is growing promise in using engineered cells as therapeutic agents. For example, synthetic Chimeric Antigen Receptors (CARs) can redirect T cells to recognize and eliminate tumor cells expressing specific antigens. Despite promising clinical results, excessive activity and poor control over such engineered T cells can cause severe toxicities. We present the design of “ON-switch” CARs that enable small molecule-control over T cell therapeutic functions, while still retaining antigen specificity. In these split receptors, antigen binding and intracellular signaling components only assemble in the presence of a heterodimerizing small molecule. This titratable pharmacologic regulation could allow physicians to precisely control the timing, location, and dosage of T cell activity, thereby mitigating toxicity. This work illustrates the potential of combining cellular engineering with orthogonal chemical tools to yield safer therapeutic cells that tightly integrate both cell autonomous recognition and user control. PMID:26405231

  17. Remote control of therapeutic T cells through a small molecule-gated chimeric receptor.

    Science.gov (United States)

    Wu, Chia-Yung; Roybal, Kole T; Puchner, Elias M; Onuffer, James; Lim, Wendell A

    2015-10-16

    There is growing interest in using engineered cells as therapeutic agents. For example, synthetic chimeric antigen receptors (CARs) can redirect T cells to recognize and eliminate tumor cells expressing specific antigens. Despite promising clinical results, these engineered T cells can exhibit excessive activity that is difficult to control and can cause severe toxicity. We designed "ON-switch" CARs that enable small-molecule control over T cell therapeutic functions while still retaining antigen specificity. In these split receptors, antigen-binding and intracellular signaling components assemble only in the presence of a heterodimerizing small molecule. This titratable pharmacologic regulation could allow physicians to precisely control the timing, location, and dosage of T cell activity, thereby mitigating toxicity. This work illustrates the potential of combining cellular engineering with orthogonal chemical tools to yield safer therapeutic cells that tightly integrate cell-autonomous recognition and user control. Copyright © 2015, American Association for the Advancement of Science.

  18. NATO Advanced Research Workshop on Chemosensors of Ion and Molecule Recognition

    CERN Document Server

    Czarnik, A

    1997-01-01

    In the broad field of supramolecular chemistry, the design and hence the use of chemosensors for ion and molecule recognition have developed at an extroardinary rate. This imaginative and creative area which involves the interface of different disciplines, e.g. organic and inorganic chemistry, physical chemistry, biology, medicine, environmental science, is not only fundamental in nature. It is also clear that progress is most rewarding for several new sensor applications deriving from the specific signal delivered by the analyte-probe interaction. Indeed, if calcium sensing in real time for biological purposes is actually possible, owing to the emergence of efficient fluorescent receptors, other elements can also be specifically detected, identified and finally titrated using tailored chemosensors. Pollutants such as heavy metals or radionuclides are among the main targets since their detection and removal could be envisioned at very low concentrations with, in addition, sensors displaying specific and stron...

  19. Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins

    DEFF Research Database (Denmark)

    Thiel, Steffen

    2007-01-01

    Mannan-binding lectin (MBL), L-ficolin, M-ficolin and H-ficolin are all complement activating soluble pattern recognition molecules with recognition domains linked to collagen-like regions. All four may form complexes with four structurally related proteins, the three MBL-associated serine...... proteases (MASPs), MASP-1, MASP-2 and MASP-3, and a smaller MBL-associated protein (MAp19). The four recognition molecules recognize patterns of carbohydrate or acetyl-group containing ligands. After binding to the relevant targets all four are able to activate the complement system. We thus have a system...... where four different and/or overlapping patterns of microbial origin or patterns of altered-self may be recognized, but in all cases the signalling molecules, the MASPs, are shared. MASP-1 and MASP-3 are formed from one gene, MASP1/3, by alternative splicing generating two different mRNAs from a single...

  20. Natural Killer cell recognition of melanoma: new clues for a more effective immunotherapy

    Directory of Open Access Journals (Sweden)

    Raquel eTarazona

    2016-01-01

    Full Text Available Natural killer cells participate in the early immune response against melanoma and also contribute to the development of an adequate adaptive immune response by their crosstalk with dendritic cells and cytokine secretion. Melanoma resistance to conventional therapies together with its high immunogenicity justifies the development of novel therapies aimed to stimulate effective immune responses against melanoma. However, melanoma cells frequently escape to CD8 T cell recognition by the down-regulation of major histocompatibility complex class I molecules. In this scenario, Natural killer cells emerge as potential candidates for melanoma immunotherapy due to their capacity to recognize and destroy melanoma cells expressing low levels of major histocompatibility complex class I molecules. In addition, the possibility to combine immune checkpoint blockade with other NK cell potentiating strategies (e.g. cytokine induction of activating receptors has opened new perspectives in the potential use of adoptive NK cell-based immunotherapy in melanoma.

  1. Bacterial Vaginosis Bacterial and Epithelial Cell Adhesion Molecules

    Directory of Open Access Journals (Sweden)

    Şayeste Demirezen

    2016-05-01

    molecules. The most important adhesion molecules of epithelium are cadherins, fibronectins, Toll like receptors and carbohydrates. In bacteria, pilis, lypopolysaccaharide and biofilm have primary importance. In this review, the adhesion molecules are discussed in detail and their roles in formation of clue cell are clarified.

  2. Mucosal-Associated Invariant T Cells: New Insights into Antigen Recognition and Activation

    Directory of Open Access Journals (Sweden)

    Xingxing Xiao

    2017-11-01

    Full Text Available Mucosal-associated invariant T (MAIT cells, a novel subpopulation of innate-like T cells that express an invariant T cell receptor (TCRα chain and a diverse TCRβ chain, can recognize a distinct set of small molecules, vitamin B metabolites, derived from some bacteria, fungi but not viruses, in the context of an evolutionarily conserved major histocompatibility complex-related molecule 1 (MR1. This implies that MAIT cells may play unique and important roles in host immunity. Although viral antigens are not recognized by this limited TCR repertoire, MAIT cells are known to be activated in a TCR-independent mechanism during some viral infections, such as hepatitis C virus and influenza virus. In this article, we will review recent works in MAIT cell antigen recognition, activation and the role MAIT cells may play in the process of bacterial and viral infections and pathogenesis of non-infectious diseases.

  3. Single Molecule Spectroscopy: Single Live Cell

    Indian Academy of Sciences (India)

    kbhattacharjee

    Live Cell Imaging: Seeing inside a cell. • Cell: ~20,000 nm ~ 100 times bigger than focus. • Label different parts of a cell with fluorescent dye. • Cancer Cell: How different from a normal cell? cell. Space & time resolution ...

  4. Interaction of an immunodominant epitope with Ia molecules in T-cell activation

    DEFF Research Database (Denmark)

    Adorini, L; Sette, A; Buus, S

    1988-01-01

    The amino acid sequence corresponding to residues 107-116 of hen egg-white lysozyme (HEL) has been identified as containing an immunodominant T-cell epitope recognized in association with the I-Ed molecule. The immunodominance of this epitope in HEL-primed H-2d mice was demonstrated by analysis...... of the T-cell proliferative response induced by synthetic peptides covering almost the entire HEL sequence. All the T-cell hybridomas from H-2d mice analyzed recognize the HEL sequence 107-116 in association with the I-Ed molecule. Correlating with the restriction of T-cell recognition, HEL-(105......-120)-peptide binds to I-Ed but not to I-Ad molecules. Conservative or semiconservative substitutions at positions 113 (Asn----Lys), 114 (Arg----His), or 115 (Cys----Ala) abrogate the ability of HEL-(105-120) to activate T cells. Substitutions at residues 113 and 115 affect T-cell recognition...

  5. MHC class II molecules regulate growth in human T cells

    DEFF Research Database (Denmark)

    Nielsen, M; Odum, Niels; Bendtzen, K

    1994-01-01

    MHC-class-II-positive T cells are found in tissues involved in autoimmune disorders. Stimulation of class II molecules by monoclonal antibodies (mAbs) or bacterial superantigens induces protein tyrosine phosphorylation through activation of protein tyrosine kinases in T cells, and class II signals...... lines tested. Only one of three CD4+, CD45RAhigh, ROhigh T cells responded to class II costimulation. There was no correlation between T cell responsiveness to class II and the cytokine production profile of the T cell in question. Thus, T cell lines producing interferon (IFN)-gamma but not IL-4 (TH1...... modulate several T cell responses. Here, we studied further the role of class II molecules in the regulation of T cell growth. Costimulation of class II molecules by immobilized HLA-DR mAb significantly enhanced interleukin (IL)-2-supported T cell growth of the majority of CD4+, CD45RAlow, ROhigh T cell...

  6. Interaction of an immunodominant epitope with Ia molecules in T-cell activation

    DEFF Research Database (Denmark)

    Adorini, L; Sette, A; Buus, S

    1988-01-01

    but not the binding to I-Ed molecules, whereas, as shown by binding data and competition experiments, an Arg----His substitution at position 114 profoundly impairs the capacity of the peptide to interact with I-Ed molecules. In agreement with these results, [Lys113]HEL-(105-120)-peptide but not [His114]HEL-(105......-120)-peptide binds to I-Ed but not to I-Ad molecules. Conservative or semiconservative substitutions at positions 113 (Asn----Lys), 114 (Arg----His), or 115 (Cys----Ala) abrogate the ability of HEL-(105-120) to activate T cells. Substitutions at residues 113 and 115 affect T-cell recognition...

  7. Bioinspired assembly of small molecules in cell milieu.

    Science.gov (United States)

    Wang, Huaimin; Feng, Zhaoqianqi; Xu, Bing

    2017-05-09

    Self-assembly, the autonomous organization of components to form patterns or structures, is a prevalent process in nature at all scales. Particularly, biological systems offer remarkable examples of diverse structures (as well as building blocks) and processes resulting from self-assembly. The exploration of bioinspired assemblies not only allows for mimicking the structures of living systems, but it also leads to functions for applications in different fields that benefit humans. In the last several decades, efforts on understanding and controlling self-assembly of small molecules have produced a large library of candidates for developing the biomedical applications of assemblies of small molecules. Moreover, recent findings in biology have provided new insights on the assemblies of small molecules to modulate essential cellular processes (such as apoptosis). These observations indicate that the self-assembly of small molecules, as multifaceted entities and processes to interact with multiple proteins, can have profound biological impacts on cells. In this review, we illustrate that the generation of assemblies of small molecules in cell milieu with their interactions with multiple cellular proteins for regulating cellular processes can result in primary phenotypes, thus providing a fundamentally new molecular approach for controlling cell behavior. By discussing the correlation between molecular assemblies in nature and the assemblies of small molecules in cell milieu, illustrating the functions of the assemblies of small molecules, and summarizing some guiding principles, we hope this review will stimulate more molecular scientists to explore the bioinspired self-assembly of small molecules in cell milieu.

  8. Human thymic epithelial cells express functional HLA-DP molecules

    DEFF Research Database (Denmark)

    Jørgensen, A; Röpke, C; Nielsen, M

    1996-01-01

    T lymphocytes, we examined whether human thymic epithelial cells (TEC) expressed HLA-DP molecules. We present evidence that TEC obtained from short time culture express low but significant levels of HLA-DP molecules. The expression of HLA-DP molecules was comparable to or higher than the expression...... of HLA-DP allospecific primed lymphocyte typing (PLT) CD4 T cell lines. IFN-gamma treatment strongly upregulated the HLA-DP allospecific PLT responses whereas other PLT responses remained largely unchanged. In conclusion, these data indicate that human thymus epithelial cells express significant levels...

  9. The humoral pattern recognition molecule PTX3 is a key component of innate immunity against urinary tract infection.

    Science.gov (United States)

    Jaillon, Sébastien; Moalli, Federica; Ragnarsdottir, Bryndis; Bonavita, Eduardo; Puthia, Manoj; Riva, Federica; Barbati, Elisa; Nebuloni, Manuela; Cvetko Krajinovic, Lidija; Markotic, Alemka; Valentino, Sonia; Doni, Andrea; Tartari, Silvia; Graziani, Giorgio; Montanelli, Alessandro; Delneste, Yves; Svanborg, Catharina; Garlanda, Cecilia; Mantovani, Alberto

    2014-04-17

    Immunity in the urinary tract has distinct and poorly understood pathophysiological characteristics and urinary tract infections (UTIs) are important causes of morbidity and mortality. We investigated the role of the soluble pattern recognition molecule pentraxin 3 (PTX3), a key component of the humoral arm of innate immunity, in UTIs. PTX3-deficient mice showed defective control of UTIs and exacerbated inflammation. Expression of PTX3 was induced in uroepithelial cells by uropathogenic Escherichia coli (UPEC) in a Toll-like receptor 4 (TLR4)- and MyD88-dependent manner. PTX3 enhanced UPEC phagocytosis and phagosome maturation by neutrophils. PTX3 was detected in urine of UTI patients and amounts correlated with disease severity. In cohorts of UTI-prone patients, PTX3 gene polymorphisms correlated with susceptibility to acute pyelonephritis and cystitis. These results suggest that PTX3 is an essential component of innate resistance against UTIs. Thus, the cellular and humoral arms of innate immunity exert complementary functions in mediating resistance against UTIs. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Growth hormone increases vascular cell adhesion molecule 1 expression

    DEFF Research Database (Denmark)

    Hansen, Troels Krarup; Fisker, Sanne; Dall, Rolf

    2004-01-01

    We investigated the impact of GH administration on endothelial adhesion molecules, vascular cell adhesion molecule-1 (VCAM-1) and E-selectin, in vivo and in vitro. Soluble VCAM-1, E-selectin, and C-reactive protein concentrations were measured before and after treatment in 25 healthy subjects...

  11. Neurite outgrowth induced by a synthetic peptide ligand of neural cell adhesion molecule requires fibroblast growth factor receptor activation

    DEFF Research Database (Denmark)

    Rønn, L C; Doherty, P; Holm, A

    2000-01-01

    The neural cell adhesion molecule NCAM is involved in axonal outgrowth and target recognition in the developing nervous system. In vitro, NCAM-NCAM binding has been shown to induce neurite outgrowth, presumably through an activation of fibroblast growth factor receptors (FGFRs). We have recently...

  12. The Molecules of the Cell Matrix.

    Science.gov (United States)

    Weber, Klaus; Osborn, Mary

    1985-01-01

    Cytoplasmic proteins form a highly structured yet changeable matrix that affects cell shape, division, motion, and transport of vesicles and organelles. Types of microfilaments, research techniques, actin and myosin, tumor cells, and other topics are addressed. Evidence indicates that the cell matrix might have a bearing on metabolism. (DH)

  13. Theoretical Investigation of Optical Detection and Recognition of Single Biological Molecules Using Coherent Dynamics of Exciton-Plasmon Coupling.

    Science.gov (United States)

    Sadeghi, S M; Hood, B; Patty, K D; Mao, C-B

    2013-08-20

    We use quantum coherence in a system consisting of one metallic nanorod and one semi-conductor quantum dot to investigate a plasmonic nanosensor capable of digital optical detection and recognition of single biological molecules. In such a sensor the adsorption of a specific molecule to the nanorod turns off the emission of the system when it interacts with an optical pulse having a certain intensity and temporal width. The proposed quantum sensors can count the number of molecules of the same type or differentiate between molecule types with digital optical signals that can be measured with high certainty. We show that these sensors are based on the ultrafast upheaval of coherent dynamics of the system and the removal of coherent blockage of energy transfer from the quantum dot to the nanorod once the adsorption process has occurred.

  14. Simultaneous AFM topography and recognition imaging at the plasma membrane of mammalian cells.

    Science.gov (United States)

    Chtcheglova, Lilia A; Hinterdorfer, Peter

    2018-01-01

    Elucidation the nano-organization of membrane proteins at/within the plasma membrane is probably the most demanding and still challenging task in cell biology since requires experimental approaches with nanoscale resolution. During last decade, atomic force microscopy (AFM)-based simultaneous topography and recognition imaging (TREC) has become a powerful tool to quickly obtain local receptor nano-maps on complex heterogeneous biosurfaces such as cells and membranes. Here we emphasize the TREC technique and explain how to unravel the nano-landscape of mammalian cells. We describe the procedures for all steps of the experiment including tip functionalization with ligand molecules, sample preparation, and localization of key molecules on the cell surface. We also discuss the current limitations and future perspectives of this technique. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Folding and ligand recognition of the TPP riboswitch aptamer at single-molecule resolution.

    Science.gov (United States)

    Haller, Andrea; Altman, Roger B; Soulière, Marie F; Blanchard, Scott C; Micura, Ronald

    2013-03-12

    Thiamine pyrophosphate (TPP)-sensitive mRNA domains are the most prevalent riboswitches known. Despite intensive investigation, the complex ligand recognition and concomitant folding processes in the TPP riboswitch that culminate in the regulation of gene expression remain elusive. Here, we used single-molecule fluorescence resonance energy transfer imaging to probe the folding landscape of the TPP aptamer domain in the absence and presence of magnesium and TPP. To do so, distinct labeling patterns were used to sense the dynamics of the switch helix (P1) and the two sensor arms (P2/P3 and P4/P5) of the aptamer domain. The latter structural elements make interdomain tertiary contacts (L5/P3) that span a region immediately adjacent to the ligand-binding site. In each instance, conformational dynamics of the TPP riboswitch were influenced by ligand binding. The P1 switch helix, formed by the 5' and 3' ends of the aptamer domain, adopts a predominantly folded structure in the presence of Mg(2+) alone. However, even at saturating concentrations of Mg(2+) and TPP, the P1 helix, as well as distal regions surrounding the TPP-binding site, exhibit an unexpected degree of residual dynamics and disperse kinetic behaviors. Such plasticity results in a persistent exchange of the P3/P5 forearms between open and closed configurations that is likely to facilitate entry and exit of the TPP ligand. Correspondingly, we posit that such features of the TPP aptamer domain contribute directly to the mechanism of riboswitch-mediated translational regulation.

  16. Cell Adhesion Molecules and Ubiquitination—Functions and Significance

    Science.gov (United States)

    Homrich, Mirka; Gotthard, Ingo; Wobst, Hilke; Diestel, Simone

    2015-01-01

    Cell adhesion molecules of the immunoglobulin (Ig) superfamily represent the biggest group of cell adhesion molecules. They have been analyzed since approximately 40 years ago and most of them have been shown to play a role in tumor progression and in the nervous system. All members of the Ig superfamily are intensively posttranslationally modified. However, many aspects of their cellular functions are not yet known. Since a few years ago it is known that some of the Ig superfamily members are modified by ubiquitin. Ubiquitination has classically been described as a proteasomal degradation signal but during the last years it became obvious that it can regulate many other processes including internalization of cell surface molecules and lysosomal sorting. The purpose of this review is to summarize the current knowledge about the ubiquitination of cell adhesion molecules of the Ig superfamily and to discuss its potential physiological roles in tumorigenesis and in the nervous system. PMID:26703751

  17. Adhesion molecule expression in basal cell carcinoma

    NARCIS (Netherlands)

    Verhaegh, M.; Beljaards, R.; Veraart, J.; Hoekzema, R.; Neumann, M.

    1998-01-01

    Basal cell carcinomas (BCCs) are frequently associated with a peritumoral mononuclear infiltrate. Until now, the function of this inflammatory infiltrate and its possible role in the control of tumor growth is unclear. Mechanisms controlling endothelial and target cell adhesiveness for leukocytes

  18. Modulation of MHC class-I molecules on melanoma cells after photodynamic treatment

    International Nuclear Information System (INIS)

    Gassner, F.; Moder, A.; Krammer, B.; Thalhamer, J.; Hammerl, P.

    2003-01-01

    Full text: Endogenous antigenic peptides are presented in the context of MHC class-I molecules on the cell surface for recognition by CD8+ T lymphocytes. Down-regulation of MHC molecules is a frequently observed strategy of tumor cells to escape immune attack. E.g., B16 melanoma is characterized by extremely low MHC-I surface expression and high tumorigenicity in syngeneic mice. Generally, the efficiency of photodynamic therapy is low for melanotic tumors. On the other hand, PDT has been shown capable of inducing anti-tumoral immunity. Therefore, we investigated the effect of PDT treatment in vitro on the MHC class-I surface expression of surviving B16 cells. When sensitized with 50 ng/mL hypericin and then irradiated the viability of the cells gradually decreased with increasing light dose. However, with 4 J/cm 2 50 % of cells were still viable after 24 hours. Analysis by flow cytometry revealed that a subpopulation of these cells had significantly elevated the surface density of MHC class-I molecules (fluorescence intensity approx. 5-fold over that of untreated cells). These findings suggest that repetitive PDT might facilitate CTL-mediated cytolysis of tumor cells and might, therefore, synergize with immunotherapeutic approaches for at least some tumors. (author)

  19. Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

    Science.gov (United States)

    2016-10-01

    mouse hematopoietic stem cells ex vivo by reprogramming cellular metabolism. Blood. 2015;125(10):1562-1565. 54. Nath N, Khan M, Paintlia MK, Singh I...Award Number: W81XWH-14-1-0297 TITLE: Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells PRINCIPAL INVESTIGATOR: Raymond J...Molecule Protection of Bone Marrow Hematopoietic Stem Cells Stem Cells ’ 5a. CONTRACT NUMBER W81XWH-14-1-0297 W81XWH-14-1-0297 W81XWH-14-1-0297 5b

  20. Cells, targets, and molecules in radiation biology

    International Nuclear Information System (INIS)

    Elkind, M.M.

    1979-01-01

    Cellular damage and repair are discussed with regard to inactivation models, dose-effect curves and cancer research, repair relative to damage accumulation, potentially lethal damage, repair of potentially lethal vs. sublethal damage, cell killing and DNA damage due to nonionizing radiation, and anisotonicity vs. lethality due to nonionizing radiation. Other topics discussed are DNA damage and repair in cells exposed to ionizing radiation, kinetics of repair of single-strand DNA breaks, effects of actinomycin D on x-ray survival curve of hamster cells, misrepair and lethality, and perspective and prospects

  1. A new class of pluripotent stem cell cytotoxic small molecules.

    Directory of Open Access Journals (Sweden)

    Mark Richards

    Full Text Available A major concern in Pluripotent Stem Cell (PSC-derived cell replacement therapy is the risk of teratoma formation from contaminating undifferentiated cells. Removal of undifferentiated cells from differentiated cultures is an essential step before PSC-based cell therapies can be safely deployed in a clinical setting. We report a group of novel small molecules that are cytotoxic to PSCs. Our data indicates that these molecules are specific and potent in their activity allowing rapid eradication of undifferentiated cells. Experiments utilizing mixed PSC and primary human neuronal and cardiomyocyte cultures demonstrate that up to a 6-fold enrichment for specialized cells can be obtained without adversely affecting cell viability and function. Several structural variants were synthesized to identify key functional groups and to improve specificity and efficacy. Comparative microarray analysis and ensuing RNA knockdown studies revealed involvement of the PERK/ATF4/DDIT3 ER stress pathway. Surprisingly, cell death following ER stress induction was associated with a concomitant decrease in endogenous ROS levels in PSCs. Undifferentiated cells treated with these molecules preceding transplantation fail to form teratomas in SCID mice. Furthermore, these molecules remain non-toxic and non-teratogenic to zebrafish embryos suggesting that they may be safely used in vivo.

  2. Pharmacologic suppression of target cell recognition by engineered T cells expressing chimeric T-cell receptors.

    Science.gov (United States)

    Alvarez-Vallina, L; Yañez, R; Blanco, B; Gil, M; Russell, S J

    2000-04-01

    Adoptive therapy with autologous T cells expressing chimeric T-cell receptors (chTCRs) is of potential interest for the treatment of malignancy. To limit possible T-cell-mediated damage to normal tissues that weakly express the targeted tumor antigen (Ag), we have tested a strategy for the suppression of target cell recognition by engineered T cells. Jurkat T cells were transduced with an anti-hapten chTCR tinder the control of a tetracycline-suppressible promoter and were shown to respond to Ag-positive (hapten-coated) but not to Ag-negative target cells. The engineered T cells were then reacted with hapten-coated target cells at different effector to target cell ratios before and after exposure to tetracycline. When the engineered T cells were treated with tetracycline, expression of the chTCR was greatly decreased and recognition of the hapten-coated target cells was completely suppressed. Tetracycline-mediated suppression of target cell recognition by engineered T cells may be a useful strategy to limit the toxicity of the approach to cancer gene therapy.

  3. Small Molecule Agonists of Cell Adhesion Molecule L1 Mimic L1 Functions In Vivo.

    Science.gov (United States)

    Kataria, Hardeep; Lutz, David; Chaudhary, Harshita; Schachner, Melitta; Loers, Gabriele

    2016-09-01

    Lack of permissive mechanisms and abundance of inhibitory molecules in the lesioned central nervous system of adult mammals contribute to the failure of functional recovery after injury, leading to severe disabilities in motor functions and pain. Peripheral nerve injury impairs motor, sensory, and autonomic functions, particularly in cases where nerve gaps are large and chronic nerve injury ensues. Previous studies have indicated that the neural cell adhesion molecule L1 constitutes a viable target to promote regeneration after acute injury. We screened libraries of known drugs for small molecule agonists of L1 and evaluated the effect of hit compounds in cell-based assays in vitro and in mice after femoral nerve and spinal cord injuries in vivo. We identified eight small molecule L1 agonists and showed in cell-based assays that they stimulate neuronal survival, neuronal migration, and neurite outgrowth and enhance Schwann cell proliferation and migration and myelination of neurons in an L1-dependent manner. In a femoral nerve injury mouse model, enhanced functional regeneration and remyelination after application of the L1 agonists were observed. In a spinal cord injury mouse model, L1 agonists improved recovery of motor functions, being paralleled by enhanced remyelination, neuronal survival, and monoaminergic innervation, reduced astrogliosis, and activation of microglia. Together, these findings suggest that application of small organic compounds that bind to L1 and stimulate the beneficial homophilic L1 functions may prove to be a valuable addition to treatments of nervous system injuries.

  4. Epithelial cell adhesion molecule - More than a carcinoma marker and adhesion molecule

    NARCIS (Netherlands)

    Trzpis, Monika; McLaughlin, Pamela M. J.; de Leij, Lou M. F. H.; Harmsen, Martin C.

    The epithetial cell adhesion molecule (EpCAM, CD326) is a glycoprotein of similar to 40 kd that was originally identified as a marker for carcinoma, attributable to its high expression on rapidly proliferating tumors of epithelial origin. Normal epithelia express EpCAM at a variable but generally

  5. The Tumor Antigen NY-ESO-1 Mediates Direct Recognition of Melanoma Cells by CD4+ T Cells after Intercellular Antigen Transfer.

    Science.gov (United States)

    Fonteneau, Jean Francois; Brilot, Fabienne; Münz, Christian; Gannagé, Monique

    2016-01-01

    NY-ESO-1-specific CD4(+) T cells are of interest for immune therapy against tumors, because it has been shown that their transfer into a patient with melanoma resulted in tumor regression. Therefore, we investigated how NY-ESO-1 is processed onto MHC class II molecules for direct CD4(+) T cell recognition of melanoma cells. We could rule out proteasome and autophagy-dependent endogenous Ag processing for MHC class II presentation. In contrast, intercellular Ag transfer, followed by classical MHC class II Ag processing via endocytosis, sensitized neighboring melanoma cells for CD4(+) T cell recognition. However, macroautophagy targeting of NY-ESO-1 enhanced MHC class II presentation. Therefore, both elevated NY-ESO-1 release and macroautophagy targeting could improve melanoma cell recognition by CD4(+) T cells and should be explored during immunotherapy of melanoma. Copyright © 2015 by The American Association of Immunologists, Inc.

  6. Small molecule probes for plant cell wall polysaccharide imaging

    Directory of Open Access Journals (Sweden)

    Ian eWallace

    2012-05-01

    Full Text Available Plant cell walls are composed of interlinked polymer networks consisting of cellulose, hemicelluloses, pectins, proteins, and lignin. The ordered deposition of these components is a dynamic process that critically affects the development and differentiation of plant cells. However, our understanding of cell wall synthesis and remodeling, as well as the diverse cell wall architectures that result from these processes, has been limited by a lack of suitable chemical probes that are compatible with live-cell imaging. In this review, we summarize the currently available molecular toolbox of probes for cell wall polysaccharide imaging in plants, with particular emphasis on recent advances in small molecule-based fluorescent probes. We also discuss the potential for further development of small molecule probes for the analysis of cell wall architecture and dynamics.

  7. Lack of the pattern recognition molecule mannose-binding lectin increases susceptibility to influenza A virus infection

    Directory of Open Access Journals (Sweden)

    Hartshorn Kevan L

    2010-12-01

    Full Text Available Abstract Background Mannose-binding lectin (MBL, a pattern recognition innate immune molecule, inhibits influenza A virus infection in vitro. MBL deficiency due to gene polymorphism in humans has been associated with infection susceptibility. These clinical observations were confirmed by animal model studies, in which mice genetically lacking MBL were susceptible to certain pathogens, including herpes simplex virus 2. Results We demonstrate that MBL is present in the lung of naïve healthy wild type (WT mice and that MBL null mice are more susceptible to IAV infection. Administration of recombinant human MBL (rhMBL reverses the infection phenotype, confirming that the infection susceptibility is MBL-mediated. The anti-viral mechanisms of MBL include activation of the lectin complement pathway and coagulation, requiring serum factors. White blood cells (WBCs in the lung increase in WT mice compared with MBL null mice on day 1 post-infection. In contrast, apoptotic macrophages (MΦs are two-fold higher in the lung of MBL null mice compared with WT mice. Furthermore, MBL deficient macrophages appear to be susceptible to apoptosis in vitro. Lastly, soluble factors, which are associated with lung injury, are increased in the lungs of MBL null mice during IAV infection. These results suggest that MBL plays a key role against IAV infection. Conclusion MBL plays a key role in clearing IAV and maintaining lung homeostasis. In addition, our findings also suggest that MBL deficiency maybe a risk factor in IAV infection and MBL may be a useful adjunctive therapy for IAV infection.

  8. Transmembrane neural cell-adhesion molecule (NCAM), but not glycosyl-phosphatidylinositol-anchored NCAM, down-regulates secretion of matrix metalloproteinases

    DEFF Research Database (Denmark)

    Edvardsen, K; Chen, W; Rucklidge, G

    1993-01-01

    proteinases, and proteinase inhibitors all participate in the construction, maintenance, and remodeling of extracellular matrix by cells. The neural cell-adhesion molecule (NCAM)-negative rat glioma cell line BT4Cn secretes substantial amounts of metalloproteinases, as compared with its NCAM-positive mother......) and interstitial collagenase (matrix metalloproteinase 1), indicating that cellular expression of the recognition molecule NCAM regulates the metabolism of the surrounding matrix....

  9. TCRα-TCRβ pairing controls recognition of CD1d and directs the development of adipose NKT cells.

    Science.gov (United States)

    Vieth, Joshua A; Das, Joy; Ranaivoson, Fanomezana M; Comoletti, Davide; Denzin, Lisa K; Sant'Angelo, Derek B

    2017-01-01

    The interaction between the T cell antigen receptor (TCR) expressed by natural killer T cells (NKT cells) and the antigen-presenting molecule CD1d is distinct from interactions between the TCR and major histocompatibility complex (MHC). Our molecular modeling suggested that a hydrophobic patch created after TCRα-TCRβ pairing has a role in maintaining the conformation of the NKT cell TCR. Disruption of this patch ablated recognition of CD1d by the NKT cell TCR but not interactions of the TCR with MHC. Partial disruption of the patch, while permissive to the recognition of CD1d, significantly altered NKT cell development, which resulted in the selective accumulation of adipose-tissue-resident NKT cells. These results indicate that a key component of the TCR is essential for the development of a distinct population of NKT cells.

  10. Dscam-Mediated Cell Recognition Regulates Neural Circuit Formation

    OpenAIRE

    Hattori, Daisuke; Millard, S. Sean; Wojtowicz, Woj M.; Zipursky, S. Lawrence

    2008-01-01

    The Dscam family of immunoglobulin cell surface proteins mediates recognition events between neurons that play an essential role in the establishment of neural circuits. The Drosophila Dscam1 locus encodes tens of thousands of cell surface proteins via alternative splicing. These isoforms exhibit exquisite isoform-specific binding in vitro that mediates homophilic repulsion in vivo. These properties provide the molecular basis for self-avoidance, an essential developmental mechanism that allo...

  11. Recognition

    DEFF Research Database (Denmark)

    Gimmler, Antje

    2017-01-01

    In this article, I shall examine the cognitive, heuristic and theoretical functions of the concept of recognition. To evaluate both the explanatory power and the limitations of a sociological concept, the theory construction must be analysed and its actual productivity for sociological theory must...... be evaluated. In the first section, I will introduce the concept of recognition as a travelling concept playing a role both on the intellectual stage and in real life. In the second section, I will concentrate on the presentation of Honneth’s theory of recognition, emphasizing the construction of the concept...... and its explanatory power. Finally, I will discuss Honneth’s concept in relation to the critique that has been raised, addressing the debate between Honneth and Fraser. In a short conclusion, I will return to the question of the explanatory power of the concept of recognition....

  12. Cathepsin G-mediated proteolytic degradation of MHC class I molecules to facilitate immune detection of human glioblastoma cells.

    Science.gov (United States)

    Palesch, David; Wagner, Johanna; Meid, Annika; Molenda, Nicole; Sienczyk, Marcin; Burkhardt, Jutta; Münch, Jan; Prokop, Lea; Stevanovic, Stefan; Westhoff, Mike-Andrew; Halatsch, Marc-Eric; Wirtz, Christian Rainer; Zimecki, Michal; Burster, Timo

    2016-03-01

    To mount an adaptive immune response, MHC I molecules present antigenic peptides to CTLs. Transcriptional reduction of MHC I molecules is a strategy of immune evasion, which impairs the detection of infected or tumorous cells by CTLs. Natural killer (NK) cells, on the other hand, eliminate target cells specifically in the absence of MHC I. Consequently, infected or tumorous cells partly retain their MHC I at the cell surface to avoid NK recognition. However, it remains unclear which protease degrades MHC I molecules and how these cells maintain a limited set of MHC I at the cell surface. Here, we demonstrate that cathepsin G (CatG), a serine protease, found in the endocytic compartment of APCs and, to a lesser extent, CatD and CatS proteolytically degrade MHC I molecules. Inhibition of CatG boosted MHC I expression at the cell surface of primary human immune cells. In contrast, human glioblastoma cells do not harbor active CatG and might have lost the ability to proteolytically degrade MHC I during tumorigenesis to avoid NK-mediated killing. Overexpression of CatG in glioblastoma cells resulted in a rapid and efficient MHC I degradation. In conclusion, CatG is an essential protease for regulating MHC I molecules and thus modulation of CatG activity might present a new avenue for therapeutic intervention.

  13. Speech recognition systems on the Cell Broadband Engine

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Y; Jones, H; Vaidya, S; Perrone, M; Tydlitat, B; Nanda, A

    2007-04-20

    In this paper we describe our design, implementation, and first results of a prototype connected-phoneme-based speech recognition system on the Cell Broadband Engine{trademark} (Cell/B.E.). Automatic speech recognition decodes speech samples into plain text (other representations are possible) and must process samples at real-time rates. Fortunately, the computational tasks involved in this pipeline are highly data-parallel and can receive significant hardware acceleration from vector-streaming architectures such as the Cell/B.E. Identifying and exploiting these parallelism opportunities is challenging, but also critical to improving system performance. We observed, from our initial performance timings, that a single Cell/B.E. processor can recognize speech from thousands of simultaneous voice channels in real time--a channel density that is orders-of-magnitude greater than the capacity of existing software speech recognizers based on CPUs (central processing units). This result emphasizes the potential for Cell/B.E.-based speech recognition and will likely lead to the future development of production speech systems using Cell/B.E. clusters.

  14. Improved and targeted delivery of bioactive molecules to cells with magnetic layer-by-layer assembled microcapsules.

    Science.gov (United States)

    Pavlov, Anton M; Gabriel, Samantha A; Sukhorukov, Gleb B; Gould, David J

    2015-06-07

    Despite our increasing knowledge of cell biology and the recognition of an increasing repertoire of druggable intracellular therapeutic targets, there remain a limited number of approaches to deliver bioactive molecules to cells and even fewer that enable targeted delivery. Layer-by-layer (LbL) microcapsules are assembled using alternate layers of oppositely charged molecules and are potential cell delivery vehicles for applications in nanomedicine. There are a wide variety of charged molecules that can be included in the microcapsule structure including metal nanoparticles that introduce physical attributes. Delivery of bioactive molecules to cells with LbL microcapsules has recently been demonstrated, so in this study we explore the delivery of bioactive molecules (luciferase enzyme and plasmid DNA) to cells using biodegradable microcapsules containing a layer of magnetite nanoparticles. Interestingly, significantly improved intracellular luciferase enzyme activity (25 fold) and increased transfection efficiency with plasmid DNA (3.4 fold) was observed with magnetic microcapsules. The use of a neodymium magnet enabled efficient targeting of magnetic microcapsules which further improved the delivery efficiency of the cargoes as a consequence of increased microcapsule concentration at the magnetic site. Microcapsules were well tolerated by cells in these experiments and only displayed signs of toxicity at a capsule : cell ratio of 100 : 1 and with extended exposure. These studies illustrate how multi-functionalization of LbL microcapsules can improve and target delivery of bioactive molecules to cells.

  15. Improved and targeted delivery of bioactive molecules to cells with magnetic layer-by-layer assembled microcapsules

    Science.gov (United States)

    Pavlov, Anton M.; Gabriel, Samantha A.; Sukhorukov, Gleb B.; Gould, David J.

    2015-05-01

    Despite our increasing knowledge of cell biology and the recognition of an increasing repertoire of druggable intracellular therapeutic targets, there remain a limited number of approaches to deliver bioactive molecules to cells and even fewer that enable targeted delivery. Layer-by-layer (LbL) microcapsules are assembled using alternate layers of oppositely charged molecules and are potential cell delivery vehicles for applications in nanomedicine. There are a wide variety of charged molecules that can be included in the microcapsule structure including metal nanoparticles that introduce physical attributes. Delivery of bioactive molecules to cells with LbL microcapsules has recently been demonstrated, so in this study we explore the delivery of bioactive molecules (luciferase enzyme and plasmid DNA) to cells using biodegradable microcapsules containing a layer of magnetite nanoparticles. Interestingly, significantly improved intracellular luciferase enzyme activity (25 fold) and increased transfection efficiency with plasmid DNA (3.4 fold) was observed with magnetic microcapsules. The use of a neodymium magnet enabled efficient targeting of magnetic microcapsules which further improved the delivery efficiency of the cargoes as a consequence of increased microcapsule concentration at the magnetic site. Microcapsules were well tolerated by cells in these experiments and only displayed signs of toxicity at a capsule : cell ratio of 100 : 1 and with extended exposure. These studies illustrate how multi-functionalization of LbL microcapsules can improve and target delivery of bioactive molecules to cells.

  16. Single molecule microscopy in 3D cell cultures and tissues.

    Science.gov (United States)

    Lauer, Florian M; Kaemmerer, Elke; Meckel, Tobias

    2014-12-15

    From the onset of the first microscopic visualization of single fluorescent molecules in living cells at the beginning of this century, to the present, almost routine application of single molecule microscopy, the method has well-proven its ability to contribute unmatched detailed insight into the heterogeneous and dynamic molecular world life is composed of. Except for investigations on bacteria and yeast, almost the entire story of success is based on studies on adherent mammalian 2D cell cultures. However, despite this continuous progress, the technique was not able to keep pace with the move of the cell biology community to adapt 3D cell culture models for basic research, regenerative medicine, or drug development and screening. In this review, we will summarize the progress, which only recently allowed for the application of single molecule microscopy to 3D cell systems and give an overview of the technical advances that led to it. While initially posing a challenge, we finally conclude that relevant 3D cell models will become an integral part of the on-going success of single molecule microscopy. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. New protein involved in the replacement of cell molecules

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave

    2011-01-01

    In collaboration with colleagues from La Trobe University, Australia, scientists at Aarhus University have discovered and defined a novel enzyme involved in the replacement and renewal of cell molecules. The enzyme exerts its function within the so-called mitochondria - small “enclosed” compartme......In collaboration with colleagues from La Trobe University, Australia, scientists at Aarhus University have discovered and defined a novel enzyme involved in the replacement and renewal of cell molecules. The enzyme exerts its function within the so-called mitochondria - small “enclosed...

  18. Measurement of diffusion of fluorescent molecules in living cells

    International Nuclear Information System (INIS)

    Tatarkova, S A; Lloyd, C; Khaira, S K; Berk, D

    2003-01-01

    The possibilities of the method of fluorescence correlation spectroscopy for studying the molecular dynamics in living cells are demonstrated. The method provides point measurements of extremely low concentrations of fluorescent molecules and their diffusion coefficients with a high time resolution in a microscopic volume, which is especially important in pharmacological investigations. A biological model of the interaction of liposomes with a cellular membrane is considered. The diffusion coefficients of fluorescent molecules are measured directly in the living cell cytoplasm. (laser applications and other topics in quantum electronics)

  19. Exploring both sequence detection and restriction endonuclease cleavage kinetics by recognition site via single-molecule microfluidic trapping.

    Science.gov (United States)

    Xu, Weilin; Muller, Susan J

    2011-02-07

    We demonstrate the feasibility of a single-molecule microfluidic approach to both sequence detection and obtaining kinetic information for restriction endonucleases on dsDNA. In this method, a microfluidic stagnation point flow is designed to trap, hold, and linearize double-stranded (ds) genomic DNA to which a restriction endonuclease has been pre-bound sequence-specifically. By introducing the cofactor magnesium, we determine the binding location of the enzyme by the cleavage process of dsDNA as in optical restriction mapping, however here the DNA need not be immobilized on a surface. We note that no special labeling of the enzyme is required, which makes it simpler than our previous scheme using stagnation point flows for sequence detection. Our accuracy in determining the location of the recognition site is comparable to or better than other single molecule techniques due to the fidelity with which we can control the linearization of the DNA molecules. In addition, since the cleavage process can be followed in real time, information about the cleavage kinetics, and subtle differences in binding and cleavage frequencies among the recognition sites, may also be obtained. Data for the five recognition sites for the type II restriction endonuclease EcoRI on λ-DNA are presented as a model system. While the roles of the varying fluid velocity and tension along the chain backbone on the measured kinetics remain to be determined, we believe this new method holds promise for a broad range of studies of DNA-protein interactions, including the kinetics of other DNA cleavage processes, the dissociation of a restriction enzyme from the cleaved substrate, and other macromolecular cleavage processes.

  20. Changes in cell adhesion molecule expression on T cells associated with systemic virus infection

    DEFF Research Database (Denmark)

    Andersson, E C; Christensen, Jan Pravsgaard; Marker, O

    1994-01-01

    analyses showed that T cells with a changed adhesion molecule profile tended to present other cell surface markers indicating a state of cellular activation, e.g., IL-2R, and included all virus-specific CTL effectors. Regarding the physiologic significance of these changes in adhesion molecule expression......Virus-induced changes in adhesion molecule expression on T cells were investigated to understand how antiviral effector cells migrate into infectious foci. FACS analysis revealed that after systemic infection with lymphocytic choriomeningitis virus a number of cell adhesion molecules, including VLA...

  1. Changes in cell adhesion molecule expression on T cells associated with systemic virus infection

    DEFF Research Database (Denmark)

    Andersson, E C; Christensen, Jan Pravsgaard; Marker, O

    1994-01-01

    Virus-induced changes in adhesion molecule expression on T cells were investigated to understand how antiviral effector cells migrate into infectious foci. FACS analysis revealed that after systemic infection with lymphocytic choriomeningitis virus a number of cell adhesion molecules, including VLA...... analyses showed that T cells with a changed adhesion molecule profile tended to present other cell surface markers indicating a state of cellular activation, e.g., IL-2R, and included all virus-specific CTL effectors. Regarding the physiologic significance of these changes in adhesion molecule expression...

  2. A Single Amino Acid Difference within the α-2 Domain of Two Naturally Occurring Equine MHC Class I Molecules Alters the Recognition of Gag and Rev Epitopes by Equine Infectious Anemia Virus-Specific CTL1

    Science.gov (United States)

    Mealey, Robert H.; Lee, Jae-Hyung; Leib, Steven R.; Littke, Matt H.; McGuire, Travis C.

    2012-01-01

    Although CTL are critical for control of lentiviruses, including equine infectious anemia virus, relatively little is known regarding the MHC class I molecules that present important epitopes to equine infectious anemia virus-specific CTL. The equine class I molecule 7-6 is associated with the equine leukocyte Ag (ELA)-A1 haplotype and presents the Env-RW12 and Gag-GW12 CTL epitopes. Some ELA-A1 target cells present both epitopes, whereas others are not recognized by Gag-GW12-specific CTL, suggesting that the ELA-A1 haplotype comprises functionally distinct alleles. The Rev-QW11 CTL epitope is also ELA-A1-restricted, but the molecule that presents Rev-QW11 is unknown. To determine whether functionally distinct class I molecules present ELA-A1-restricted CTL epitopes, we sequenced and expressed MHC class I genes from three ELA-A1 horses. Two horses had the 7-6 allele, which when expressed, presented Env-RW12, Gag-GW12, and Rev-QW11 to CTL. The other horse had a distinct allele, designated 141, encoding a molecule that differed from 7-6 by a single amino acid within the α-2 domain. This substitution did not affect recognition of Env-RW12, but resulted in more efficient recognition of Rev-QW11. Significantly, CTL recognition of Gag-GW12 was abrogated, despite Gag-GW12 binding to 141. Molecular modeling suggested that conformational changes in the 141/Gag-GW12 complex led to a loss of TCR recognition. These results confirmed that the ELA-A1 haplotype is comprised of functionally distinct alleles, and demonstrated for the first time that naturally occurring MHC class I molecules that vary by only a single amino acid can result in significantly different patterns of epitope recognition by lentivirus-specific CTL. PMID:17082657

  3. DMBT1 functions as pattern-recognition molecule for poly-sulfated and poly-phosphorylated ligands

    DEFF Research Database (Denmark)

    End, Caroline; Bikker, Floris; Renner, Marcus

    2009-01-01

    Deleted in malignant brain tumors 1 (DMBT1) is a secreted glycoprotein displaying a broad bacterial-binding spectrum. Recent functional and genetic studies linked DMBT1 to the suppression of LPS-induced TLR4-mediated NF-kappaB activation and to the pathogenesis of Crohn's disease. Here, we aimed ...... that DMBT1 functions as pattern-recognition molecule for poly-sulfated and poly-phosphorylated ligands providing a molecular basis for its broad bacterial-binding specificity and its inhibitory effects on LPS-induced TLR4-mediated NF-kappaB activation....

  4. T cell receptor reversed polarity recognition of a self-antigen major histocompatibility complex.

    Science.gov (United States)

    Beringer, Dennis X; Kleijwegt, Fleur S; Wiede, Florian; van der Slik, Arno R; Loh, Khai Lee; Petersen, Jan; Dudek, Nadine L; Duinkerken, Gaby; Laban, Sandra; Joosten, Antoinette; Vivian, Julian P; Chen, Zhenjun; Uldrich, Adam P; Godfrey, Dale I; McCluskey, James; Price, David A; Radford, Kristen J; Purcell, Anthony W; Nikolic, Tatjana; Reid, Hugh H; Tiganis, Tony; Roep, Bart O; Rossjohn, Jamie

    2015-11-01

    Central to adaptive immunity is the interaction between the αβ T cell receptor (TCR) and peptide presented by the major histocompatibility complex (MHC) molecule. Presumably reflecting TCR-MHC bias and T cell signaling constraints, the TCR universally adopts a canonical polarity atop the MHC. We report the structures of two TCRs, derived from human induced T regulatory (iT(reg)) cells, complexed to an MHC class II molecule presenting a proinsulin-derived peptide. The ternary complexes revealed a 180° polarity reversal compared to all other TCR-peptide-MHC complex structures. Namely, the iT(reg) TCR α-chain and β-chain are overlaid with the α-chain and β-chain of MHC class II, respectively. Nevertheless, this TCR interaction elicited a peptide-reactive, MHC-restricted T cell signal. Thus TCRs are not 'hardwired' to interact with MHC molecules in a stereotypic manner to elicit a T cell signal, a finding that fundamentally challenges our understanding of TCR recognition.

  5. Recognition of lysophosphatidylcholine by type II NKT cells and protection from an inflammatory liver disease.

    Science.gov (United States)

    Maricic, Igor; Girardi, Enrico; Zajonc, Dirk M; Kumar, Vipin

    2014-11-01

    Lipids presented by the MHC class I-like molecule, CD1d, are recognized by NK T (NKT) cells, which can be broadly categorized into two subsets. The well-characterized type I NKT cells express a semi-invariant TCR and can recognize both α- and β-linked glycolipids, whereas type II NKT cells are less well studied, express a relatively diverse TCR repertoire, and recognize β-linked lipids. Recent structural studies have shown a distinct mode of recognition of a self-glycolipid sulfatide bound to CD1d by a type II NKT TCR. To further characterize Ag recognition by these cells, we have used the structural data and screened other small molecules able to bind to CD1d and activate type II NKT cells. Using plate-bound CD1d and APC-based Ag presentation assay, we found that phospholipids such as lysophosphatidylcholine (LPC) can stimulate the sulfatide-reactive type II NKT hybridoma Hy19.3 in a CD1d-dependent manner. Using plasmon resonance studies, we found that this type II NKT TCR binds with CD1d-bound LPC with micromolar affinities similar to that for sulfatide. Furthermore, LPC-mediated activation of type II NKT cells leads to anergy induction in type I NKT cells and affords protection from Con A-induced hepatitis. These data indicate that, in addition to self-glycolipids, self-lysophospholipids are also recognized by type II NKT cells. Because lysophospholipids are involved during inflammation, our findings have implications for not only understanding activation of type II NKT cells in physiological settings, but also for the development of immune intervention in inflammatory diseases. Copyright © 2014 by The American Association of Immunologists, Inc.

  6. Neural Stem Cells Derived by Small Molecules Preserve Vision.

    Science.gov (United States)

    Lu, Bin; Morgans, Catherine W; Girman, Sergey; Luo, Jing; Zhao, Jiagang; Du, Hongjun; Lim, Sioklam; Ding, Sheng; Svendsen, Clive; Zhang, Kang; Wang, Shaomei

    2013-01-01

    The advances in stem cell biology hold a great potential to treat retinal degeneration. Importantly, specific cell types can be generated efficiently with small molecules and maintained stably over numerous passages. Here, we investigated whether neural stem cell (NSC) derived from human embryonic stem cells (hESC) by small molecules can preserve vision following grafting into the Royal College Surgeon (RCS) rats; a model for retinal degeneration. A cell suspension containing 3 × 10 4 NSCs or NSCs labeled with green fluorescent protein (GFP) was injected into the subretinal space or the vitreous cavity of RCS rats at postnatal day (P) 22; animals injected with cell-carry medium and those left untreated were used as controls. The efficacy of treatment was evaluated by testing optokinetic response, recording luminance threshold, and examining retinal histology. NSCs offered significant preservation of both photoreceptors and visual function. The grafted NSCs survived for long term without evidence of tumor formation. Functionally, NSC treated eyes had significantly better visual acuity and lower luminance threshold than controls. Morphologically, photoreceptors and retinal connections were well preserved. There was an increase in expression of cillary neurotrophic factor (CNTF) in Müller cells in the graft-protected retina. This study reveals that NSCs derived from hESC by small molecules can survive and preserve vision for long term following subretinal transplantation in the RCS rats. These cells migrate extensively in the subretinal space and inner retina; there is no evidence of tumor formation or unwanted changes after grafting into the eyes. The NSCs derived from hESC by small molecules can be generated efficiently and provide an unlimited supply of cells for the treatment of some forms of human outer retinal degenerative diseases. The capacity of NSCs migrating into inner retina offers a potential as a vehicle to delivery drugs/factors to treat inner retinal

  7. Small molecule alteration of RNA sequence in cells and animals.

    Science.gov (United States)

    Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D

    2017-10-18

    RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Nitric oxide modulates the expression of endothelial cell adhesion molecules involved in angiogenesis and leukocyte recruitment.

    Science.gov (United States)

    Carreau, Aude; Kieda, Claudine; Grillon, Catherine

    2011-01-01

    Tumor angiogenesis and immune response have in common to be cell recognition mechanisms, which are based on specific adhesion molecules and dependent on nitric oxide (NO(•)). The aim of the present study is to deepen the mechanisms of angiogenesis and inflammation regulation by NO(•) to find out the molecular regulation processes that govern endothelial cell permeability and leukocyte transmigration. Effects of NO(•), either exogenous or produced in hypoxic conditions, were studied on microvascular endothelial cells from skin and lymph node because of their strong involvement in melanoma progression. We found that NO(•) down-regulation of pseudo-vessel formation was linked to a decrease in endothelial cell ability to adhere to each other which can be explain, in part, by the inhibition of PECAM-1/CD31 expression. On the other hand, NO(•) was shown to be able to decrease leukocyte adhesion on an endothelial monolayer, performed either in static or in rolling conditions, and to modulate differentially CD34, ICAM-1/CD54, ICAM-2/CD102 and VCAM-1/CD106 expression. In conclusion, during angiogenesis and leukocyte recruitment, NO(•) regulates cell interactions by controlling adhesion molecule expression and subsequently cell adhesion. Moreover, each endothelial cell type presents its own organospecific response to NO(•), reflecting the functions of the tissue they originate from. Copyright © 2010 Elsevier Inc. All rights reserved.

  9. Organic Zeolite Analogues Based on Multi-Component Liquid Crystals: Recognition and Transformation of Molecules within Constrained Environments

    Directory of Open Access Journals (Sweden)

    Yasuhiro Ishida

    2011-01-01

    Full Text Available In liquid crystals (LCs, molecules are confined in peculiar environments, where ordered alignment and certain mobility are realized at the same time. Considering these characteristics, the idea of “controlling molecular events within LC media” seems reasonable. As a suitable system for investigating this challenge, we have recently developed a new class of ionic LCs; the salts of amphiphilic carboxylic acids with 2-amino alcohols, or those of carboxylic acids with amphiphilic 2-amino alcohols, have a strong tendency to exhibit thermotropic LC phases. Because of the noncovalent nature of the interaction between molecules, one of the two components can easily be exchanged with, or transformed into, another molecule, without distorting the original LC architecture. In addition, both components are common organic molecules, and a variety of compounds are easily available. Taking advantage of these characteristics, we have succeeded in applying two‑component LCs as chiral media for molecular recognition and reactions. This review presents an overview of our recent studies, together with notable reports related to this field.

  10. Organic Zeolite Analogues Based on Multi-Component Liquid Crystals: Recognition and Transformation of Molecules within Constrained Environments.

    Science.gov (United States)

    Ishida, Yasuhiro

    2011-01-11

    In liquid crystals (LCs), molecules are confined in peculiar environments, where ordered alignment and certain mobility are realized at the same time. Considering these characteristics, the idea of "controlling molecular events within LC media" seems reasonable. As a suitable system for investigating this challenge, we have recently developed a new class of ionic LCs; the salts of amphiphilic carboxylic acids with 2-amino alcohols, or those of carboxylic acids with amphiphilic 2-amino alcohols, have a strong tendency to exhibit thermotropic LC phases. Because of the noncovalent nature of the interaction between molecules, one of the two components can easily be exchanged with, or transformed into, another molecule, without distorting the original LC architecture. In addition, both components are common organic molecules, and a variety of compounds are easily available. Taking advantage of these characteristics, we have succeeded in applying two‑component LCs as chiral media for molecular recognition and reactions. This review presents an overview of our recent studies, together with notable reports related to this field.

  11. Collectin liver 1 and collectin kidney 1 and other complement-associated pattern recognition molecules in systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Troldborg, A; Thiel, S; Jensen, L

    2015-01-01

    The objective of this study was to explore the involvement of collectin liver 1 (CL-L1) and collectin kidney 1 (CL-K1) and other pattern recognition molecules (PRMs) of the lectin pathway of the complement system in a cross-sectional cohort of systemic lupus erythematosus (SLE) patients. Concentr......The objective of this study was to explore the involvement of collectin liver 1 (CL-L1) and collectin kidney 1 (CL-K1) and other pattern recognition molecules (PRMs) of the lectin pathway of the complement system in a cross-sectional cohort of systemic lupus erythematosus (SLE) patients...... patients negative for anti-dsDNA antibodies (P = 0·02). In a cross-sectional cohort of SLE patients, we found differences in the plasma concentrations of CL-L1, CL-K1, M-ficolin and H-ficolin compared to a group of healthy controls. Alterations in plasma concentrations of the PRMs of the lectin pathway...

  12. Molecule mechanism of stem cells in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Wenjin; Yu, Rongming

    2014-07-01

    Plants possess the ability to continually produce new tissues and organs throughout their life. Unlike animals, plants are exposed to extreme variations in environmental conditions over the course of their lives. The vitality of plants is so powerful that they can survive several hundreds of years or even more making it an amazing miracle that comes from plant stem cells. The stem cells continue to divide to renew themselves and provide cells for the formation of leaves, stems, and flowers. Stem cells are not only quiescent but also immortal, pluripotent and homeostatic. Stem cells are the magic cells that repair tissues and regenerate organs. During the past decade, scholars around the world have paid more and more attention toward plant stem cells. At present, the major challenge is in relating molecule action mechanism to root apical meristem, shoot apical meristem and vascular system. The coordination between stem cells maintenance and differentiation is critical for normal plant growth and development. Elements such as phytohormones, transcription factors and some other known or unknown genes cooperate to balance this process. In this review, Arabidopsis thaliana as a pioneer system, we highlight recent developments in molecule modulating, illustrating how plant stem cells generate new mechanistic insights into the regulation of plants growth and development.

  13. Cell shape recognition by colloidal cell imprints: energy of the cell-imprint interaction.

    Science.gov (United States)

    Borovička, Josef; Stoyanov, Simeon D; Paunov, Vesselin N

    2015-09-01

    The results presented in this study are aimed at the theoretical estimate of the interactions between a spherical microbial cell and the colloidal cell imprints in terms of the Derjaguin, Landau, Vervey, and Overbeek (DLVO) surface forces. We adapted the Derjaguin approximation to take into account the geometry factor in the colloidal interaction between a spherical target particle and a hemispherical shell at two different orientations with respect to each other. We took into account only classical DLVO surface forces, i.e., the van der Waals and the electric double layer forces, in the interaction of a spherical target cell and a hemispherical shell as a function of their size ratio, mutual orientation, distance between their surfaces, their respective surface potentials, and the ionic strength of the aqueous solution. We found that the calculated interaction energies are several orders higher when match and recognition between the target cell and the target cell imprint is achieved. Our analysis revealed that the recognition effect of the hemispherical shell towards the target microsphere comes from the greatly increased surface contact area when a full match of their size and shape is produced. When the interaction between the surfaces of the hemishell and the target cell is attractive, the recognition greatly amplifies the attraction and this increases the likelihood of them to bind strongly. However, if the surface interaction between the cell and the imprint is repulsive, the shape and size match makes this interaction even more repulsive and thus decreases the likelihood of binding. These results show that the surface chemistry of the target cells and their colloidal imprints is very important in controlling the outcome of the interaction, while the shape recognition only amplifies the interaction. In the case of nonmonotonous surface-to-surface interaction we discovered some interesting interplay between the effects of shape match and surface chemistry

  14. Recent developments in small molecule therapies for renal cell carcinoma.

    Science.gov (United States)

    Song, Minsoo

    2017-12-15

    Renal cell carcinoma (RCC) is the most common type of kidney cancer in adults and is known to be the 10th most common type of cancer in the world. Most of the currently available RCC drugs are tyrosine kinase inhibitors (TKIs). However, combination therapies of TKIs and immune checkpoint inhibitors such as programmed cell death protein 1 (PD-1) and programmed cell death protein 1 ligand 1 (PD-L1) inhibitors are the focus of most of the final stage clinical trials. Meanwhile, other small molecule therapies for RCC that target indoleamine-2,3-dioxygenase (IDO1), glutaminase, C-X-C chemokine receptor 4 (CXCR4), and transglutaminase 2 (TG2) are emerging as the next generation of therapeutics. In this review, these three major streams for the development of small molecule drugs for RCC are described. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  15. Generation of murine tumor cell lines deficient in MHC molecule surface expression using the CRISPR/Cas9 system.

    Science.gov (United States)

    Das, Krishna; Eisel, David; Lenkl, Clarissa; Goyal, Ashish; Diederichs, Sven; Dickes, Elke; Osen, Wolfram; Eichmüller, Stefan B

    2017-01-01

    In this study, the CRISPR/Cas9 technology was used to establish murine tumor cell lines, devoid of MHC I or MHC II surface expression, respectively. The melanoma cell line B16F10 and the murine breast cancer cell line EO-771, the latter stably expressing the tumor antigen NY-BR-1 (EO-NY), were transfected with an expression plasmid encoding a β2m-specific single guide (sg)RNA and Cas9. The resulting MHC I negative cells were sorted by flow cytometry to obtain single cell clones, and loss of susceptibility of peptide pulsed MHC I negative clones to peptide-specific CTL recognition was determined by IFNγ ELISpot assay. The β2m knockout (KO) clones did not give rise to tumors in syngeneic mice (C57BL/6N), unless NK cells were depleted, suggesting that outgrowth of the β2m KO cell lines was controlled by NK cells. Using sgRNAs targeting the β-chain encoding locus of the IAb molecule we also generated several B16F10 MHC II KO clones. Peptide loaded B16F10 MHC II KO cells were insusceptible to recognition by OT-II cells and tumor growth was unaltered compared to parental B16F10 cells. Thus, in our hands the CRISPR/Cas9 system has proven to be an efficient straight forward strategy for the generation of MHC knockout cell lines. Such cell lines could serve as parental cells for co-transfection of compatible HLA alleles together with human tumor antigens of interest, thereby facilitating the generation of HLA matched transplantable tumor models, e.g. in HLAtg mouse strains of the newer generation, lacking cell surface expression of endogenous H2 molecules. In addition, our tumor cell lines established might offer a useful tool to investigate tumor reactive T cell responses that function independently from MHC molecule surface expression by the tumor.

  16. Generation of murine tumor cell lines deficient in MHC molecule surface expression using the CRISPR/Cas9 system.

    Directory of Open Access Journals (Sweden)

    Krishna Das

    Full Text Available In this study, the CRISPR/Cas9 technology was used to establish murine tumor cell lines, devoid of MHC I or MHC II surface expression, respectively. The melanoma cell line B16F10 and the murine breast cancer cell line EO-771, the latter stably expressing the tumor antigen NY-BR-1 (EO-NY, were transfected with an expression plasmid encoding a β2m-specific single guide (sgRNA and Cas9. The resulting MHC I negative cells were sorted by flow cytometry to obtain single cell clones, and loss of susceptibility of peptide pulsed MHC I negative clones to peptide-specific CTL recognition was determined by IFNγ ELISpot assay. The β2m knockout (KO clones did not give rise to tumors in syngeneic mice (C57BL/6N, unless NK cells were depleted, suggesting that outgrowth of the β2m KO cell lines was controlled by NK cells. Using sgRNAs targeting the β-chain encoding locus of the IAb molecule we also generated several B16F10 MHC II KO clones. Peptide loaded B16F10 MHC II KO cells were insusceptible to recognition by OT-II cells and tumor growth was unaltered compared to parental B16F10 cells. Thus, in our hands the CRISPR/Cas9 system has proven to be an efficient straight forward strategy for the generation of MHC knockout cell lines. Such cell lines could serve as parental cells for co-transfection of compatible HLA alleles together with human tumor antigens of interest, thereby facilitating the generation of HLA matched transplantable tumor models, e.g. in HLAtg mouse strains of the newer generation, lacking cell surface expression of endogenous H2 molecules. In addition, our tumor cell lines established might offer a useful tool to investigate tumor reactive T cell responses that function independently from MHC molecule surface expression by the tumor.

  17. Recognition of HLA class II molecules by antipeptide antibodies elicited by synthetic peptides selected from regions of HLA-DP antigens.

    Science.gov (United States)

    Chersi, A; Houghten, R A; Morganti, M C; Muratti, E

    1987-01-01

    Repeated immunizations of rabbits with chemically synthesized peptides from selected regions of HLA-DP histocompatibility antigens resulted in the production of specific antibodies that were then isolated from the immune sera by chromatography on Sepharose-peptide immunoadsorbents. The purified antibodies, when tested with an enzyme-linked immunosorbent assay, specifically bound to the inciting fragments; moreover, two of them recognized glycoproteins extracted by nonionic detergents from human chronic lymphocytic leukemia cells, as revealed by binding assays. The results suggest that amino acid stretches 51-61 of the alpha chain and 80-90 of the beta chain of HLA-DP histocompatibility antigens are likely exposed on the surface of the protein molecule. The specific recognition of DP regions is strongly suggested by the difference in the binding of those antibodies to soluble membrane proteins, as compared to the binding of monomorphic anti-Class II monoclonal antibodies to the same antigens.

  18. New method for recognition of sterol signalling molecules: Methinium salts as receptors for sulphated steroids

    Czech Academy of Sciences Publication Activity Database

    Kejík, Z.; Bříza, T.; Králová, Jarmila; Mikula, I.; Poučková, P.; Martásek, P.; Král, V.

    2015-01-01

    Roč. 94, February 2015 (2015), s. 15-20 ISSN 1878-5867 R&D Projects: GA TA ČR(CZ) TE01020028; GA ČR(CZ) GAP303/11/1291; GA MŠk(CZ) LH14008; GA MŠk(CZ) CZ.1.07/2.300/30.0060; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : Polymethinium salts * Sulphated sterols * Molecular recognition * Synthetic receptors Subject RIV: EB - Genetics ; Molecular Biology

  19. Computer approach to recognition of Fuhrman grade of cells in clear-cell renal cell carcinoma.

    Science.gov (United States)

    Kruk, Michal; Osowski, Stanislaw; Markiewicz, Tomasz; Slodkowska, Janina; Koktysz, Robert; Kozlowski, Wojciech; Swiderski, Bartosz

    2014-06-01

    To present a computerized system for recognition of Fuhrman grade of cells in clear-cell renal cell carcinoma on the basis of microscopic images of the neoplasm cells in application of hematoxylin and eosin staining. The applied methods use combined gradient and mathematical morphology to obtain nuclei and classifiers in the form of support vector machine to estimate their Fuhrman grade. The starting point is a microscopic kidney image, which is subject to the advanced methods of preprocessing, leading finally to estimation of Fuhrman grade of cells and the whole analyzed image. The results of the numerical experiments have shown that the proposed nuclei descriptors based on different principles of generation are well connected with the Fuhrman grade. These descriptors have been used as the diagnostic features forming the inputs to the classifier, which performs the final recognition of the cells. The average discrepancy rate between the score of our system and the human expert results, estimated on the basis of over 3,000 nuclei, is below 10%. The obtained results have shown that the system is able to recognize 4 Fuhrman grades of the cells with high statistical accuracy and agreement with different expert scores. This result gives a good perspective to apply the system for supporting and accelerating the research of kidney cancer.

  20. MHC molecules protect T cell epitopes against proteolytic destruction

    DEFF Research Database (Denmark)

    Mouritsen, S; Meldal, M; Werdelin, O

    1992-01-01

    There is a subtle duality in the role of proteolytic enzymes in Ag processing. They are required to fragment protein Ag ingested by APC. However, prolonged exposure to proteolytic enzymes may lead to a complete degradation of the Ag, leaving nothing for the T cell system to recognize. What ensures...... that some of the Ag is salvaged? Using a cell-free system we demonstrate that an Ag fragment, once bound to a MHC class II molecule, is effectively protected against proteolytic destruction by cathepsin B and pronase E. The bound fragment, however, can be modified by aminopeptidase N. We suggest that MHC...

  1. Slp-76 is a critical determinant of NK cell-mediated recognition of missing-self targets

    Science.gov (United States)

    Lampe, Kristin; Endale, Mehari; Cashman, Siobhan; Fang, Hao; Mattner, Jochen; Hildeman, David; Hoebe, Kasper

    2015-01-01

    Absence of MHC class I expression is an important mechanism by which NK cells recognize a variety of target cells, yet the pathways underlying “missing-self” recognition, including the involvement of activating receptors, remain poorly understood. Using ENU mutagenesis in mice, we identified a germline mutant, designated Ace, with a marked defect in NK cell-mediated recognition and elimination of “missing-self” targets. The causative mutation was linked to chromosome 11 and identified as a missense mutation [Thr428Ile] in the SH2 domain of Slp-76—a critical adapter molecule downstream of ITAM-containing surface receptors. The Slp-76 Ace mutation behaved as a hypomorphic allele—while no major defects were observed in conventional T cell development/function, a marked defect in NK cell-mediated elimination of β2-Microglobulin (β2M)-deficient target cells was observed. Further studies revealed Slp-76 to control NK cell receptor expression and maturation, however, activation of Slp-76ace/ace NK cells through ITAM-containing NK cell receptors or allogeneic/tumor target cells appeared largely unaffected. Imagestream analysis of the NK-β2M−/− target cell synapse, revealed a specific defect in actin recruitment to the conjugate synapse in Slp-76ace/ace NK cells. Overall these studies establish Slp-76 as a critical determinant of NK cell development and NK cell-mediated elimination of missing-self target cells. PMID:25929249

  2. Transfection of glioma cells with the neural-cell adhesion molecule NCAM

    DEFF Research Database (Denmark)

    Edvardsen, K; Pedersen, P H; Bjerkvig, R

    1994-01-01

    The tumor growth and the invasive capacity of a rat glioma cell line (BT4Cn) were studied after transfection with the human transmembrane 140-kDa isoform of the neural-cell adhesion molecule, NCAM. After s.c. injection, the NCAM-transfected cells showed a slower growth rate than the parent cell...

  3. Laser Controlled Synthesis of Noble Metal Nanoparticle Arrays for Low Concentration Molecule Recognition

    Directory of Open Access Journals (Sweden)

    Enza Fazio

    2014-12-01

    Full Text Available Nanostructured gold and silver thin films were grown by pulsed laser deposition.Performing the process in an ambient gas (Ar leads to the nucleation and growth ofnanoparticles in the ablation plasma and their self-organization on the substrate. Thedependence of surface nanostructuring of the films on the deposition parameters is discussedconsidering in particular the number of laser pulses and the ambient gas nature and pressure.The performance of the deposited thin films as substrates for surface-enhanced Ramanspectroscopy (SERS was tested against the detection of molecules at a low concentration.Taking Raman maps on micrometer-sized areas, the spatial homogeneity of the substrateswith respect to the SERS signal was tested.

  4. An electrochemical impedance sensor based on a small molecule modified Au electrode for the recognition of a trinucleotide repeat.

    Science.gov (United States)

    He, Hanping; Peng, Xiaoqian; Huang, Min; Chang, Gang; Zhang, Xiuhua; Wang, Shengfu

    2014-11-07

    A small molecule modified sensor was developed for the detection of XGG trinucleotide repeats (X = C, T) by electrochemical impedance spectroscopy. The sensor (NCD/MPA/Au) was fabricated by immobilizing the nucleic acid recognition molecule (NCD) on the surface of a gold electrode through a condensation reaction between the amino-terminal end of the NCD linker and carboxylic groups in 3-mercaptopropionic acid that were self-assembled on the electrode surface. After the sensor was incubated with trinucleotide repeats, electrochemical impedance spectroscopy was performed using [Fe(CN)6](3-/4-) as redox marker ions. XGG repeats (X = C, T) could be selectively detected based on the differences in charge transfer resistance (ΔRct) even in the presence of other trinucleotide repeats. The relationship between ΔRct and lg [concentration of CGG repeats] for the sensor was linear from 1 nM to 1 μM, enabling the quantification of the number of repeats. The electrochemical impedance sensor provides a simple and rapid method to detect trinucleotide repeats without requiring labelling and immobilizations of DNA, making it promising for the early diagnosis of neurodegenerative diseases; the sensor may be further extended to the detection of other special sequences of DNA.

  5. Autophagonizer, a novel synthetic small molecule, induces autophagic cell death

    Energy Technology Data Exchange (ETDEWEB)

    Choi, In-Kwon; Cho, Yoon Sun; Jung, Hye Jin [Chemical Genomics Laboratory, Department of Biotechnology, Translational Research Center for Protein Function Control, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Kwon, Ho Jeong, E-mail: kwonhj@yonsei.ac.kr [Chemical Genomics Laboratory, Department of Biotechnology, Translational Research Center for Protein Function Control, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of)

    2010-03-19

    Autophagy is an apoptosis-independent mechanism of cell death that protects the cell from environmental imbalances and infection by pathogens. We identified a novel small molecule, 2-(3-Benzyl-4-oxo-3,4,5,6,7,8-hexahydro-benzo[4,5]thieno[2,3-d] pyrimidin-2-ylsulfanylmethyl)-oxazole-4-carboxylic acid (2-pyrrolidin-1-yl-ethyl)-amide (referred as autophagonizer), using high-content cell-based screening and the autophagosome marker EGFP-LC3. Autophagonizer inhibited growth and induced cell death in the human tumor cell lines MCF7, HeLa, HCT116, A549, AGS, and HT1080 via a caspase-independent pathway. Conversion of cytosolic LC3-I to autophagosome-associated LC3-II was greatly enhanced by autophagonizer treatment. Transmission electron microscopy and acridine orange staining revealed increased autophagy in the cytoplasm of autophagonizer-treated cells. In conclusion, autophagonizer is a novel autophagy inducer with unique structure, which induces autophagic cell death in the human tumor cell lines.

  6. Neural cell adhesion molecule differentially interacts with isoforms of the fibroblast growth factor receptor

    DEFF Research Database (Denmark)

    Christensen, Claus; Berezin, Vladimir; Bock, Elisabeth

    2011-01-01

    The fibroblast growth factor receptor (FGFR) can be activated through direct interactions with various fibroblast growth factors or through a number of cell adhesion molecules, including the neural cell adhesion molecule (NCAM). We produced recombinant proteins comprising the ligand...

  7. Syntenin-1 and ezrin proteins link activated leukocyte cell adhesion molecule to the actin cytoskeleton

    NARCIS (Netherlands)

    Tudor, Cicerone; te Riet, J.; Eich, C.; Harkes, R.; Smisdom, N.; Bouhuijzen Wenger, J.; Ameloot, M.; Holt, M.; Kanger, Johannes S.; Figdor, Carl; Cambi, A.; Subramaniam, Vinod

    2014-01-01

    Activated leukocyte cell adhesion molecule (ALCAM) is a type I transmembrane protein member of the immunoglobulin superfamily of cell adhesion molecules. Involved in important pathophysiological processes such as the immune response, cancer metastasis, and neuronal development, ALCAM undergoes both

  8. Function of adhesion molecules lymphocyte function-associated antigen-3 and intercellular adhesion molecule-1 on human epidermal Langerhans cells in antigen-specific T cell activation

    NARCIS (Netherlands)

    Teunissen, M. B.; Rongen, H. A.; Bos, J. D.

    1994-01-01

    In addition to the interaction between the TCR and the MHC/Ag complex on the APC, optimal T cell activation also requires interaction between adhesion molecules on the APC and their ligands on T cells. We determined the presence of adhesion molecules on human epidermal Langerhans cells (LC) and

  9. A positive correlation between expression of beta 1-integrin cell adhesion molecules and fertilizing ability of human spermatozoa in vitro.

    Science.gov (United States)

    Klentzeris, L D; Fishel, S; McDermott, H; Dowell, K; Hall, J; Green, S

    1995-03-01

    The purpose of this study was to investigate firstly whether beta 1-integrin cell adhesion molecules are expressed by human spermatozoa, and secondly whether there is any relationship between the expression of beta 1-integrin cell adhesion molecules and the fertilizing ability of human spermatozoa in vitro. A total of 50 semen samples were examined. The samples were obtained from the male partners of couples undergoing in-vitro fertilization (IVF) for either unexplained, tubal or male factor infertility. A panel of six monoclonal antibodies against beta 1-integrin cell adhesion molecules and immunohistochemical techniques were used to identify the presence of these molecules on the spermatozoa. The percentage of spermatozoa showing strong immunolabelling with each monoclonal antibody was assessed in each sample. The relationship between these results and the aetiology of infertility and incidence of fertilization was examined. beta 1-Integrins, and primarily the ones with alpha 4-, alpha 5- and alpha 6-chains, were expressed by human spermatozoa. Compared with semen samples from unexplained or male factor infertility patients, samples from tubal infertility patients had a significantly higher (P fertilizing ability of spermatozoa. The positive correlation between the presence of certain beta 1-integrin cell adhesion molecules and the fertilizing ability of human spermatozoa suggests that integrins may be putative determinants in egg-sperm recognition and interaction.

  10. Colorimetric sensor arrays based on pattern recognition for the detection of nitroaromatic molecules

    International Nuclear Information System (INIS)

    Lu, Wei; Dong, Xiao; Qiu, Lili; Yan, Zequn; Meng, Zihui; Xue, Min; He, Xuan; Liu, Xueyong

    2017-01-01

    , the sensor array can illustrate the influence of the nitryl quantity and generate a separate response region of nitroaromatics for pattern recognition with 95.25% of variance explained in the measurements by the first three principal components (PCs). The statistical analysis endowed the cross-reactive array with better classification and identification ability and this novel detection platform provided a wider applied range among other harmful chemicals in a simple sensor array with customized functionality.

  11. Colorimetric sensor arrays based on pattern recognition for the detection of nitroaromatic molecules

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Wei; Dong, Xiao [School of Chemical Engineering and the Environment, Beijing Institute of Technology, Beijing, 100081 (China); Qiu, Lili, E-mail: qiulili@bit.edu.cn [School of Chemical Engineering and the Environment, Beijing Institute of Technology, Beijing, 100081 (China); Yan, Zequn [School of Chemical Engineering and the Environment, Beijing Institute of Technology, Beijing, 100081 (China); Meng, Zihui, E-mail: m_zihui@yahoo.com [School of Chemical Engineering and the Environment, Beijing Institute of Technology, Beijing, 100081 (China); Xue, Min [School of Chemical Engineering and the Environment, Beijing Institute of Technology, Beijing, 100081 (China); He, Xuan; Liu, Xueyong [Institute of Chemical Materials, China Academy of Engineering Physics, Mianyang, Sichuan, 621900 (China)

    2017-03-15

    , the sensor array can illustrate the influence of the nitryl quantity and generate a separate response region of nitroaromatics for pattern recognition with 95.25% of variance explained in the measurements by the first three principal components (PCs). The statistical analysis endowed the cross-reactive array with better classification and identification ability and this novel detection platform provided a wider applied range among other harmful chemicals in a simple sensor array with customized functionality.

  12. Modulation of lens cell adhesion molecules by particle beams

    Science.gov (United States)

    McNamara, M. P.; Bjornstad, K. A.; Chang, P. Y.; Chou, W.; Lockett, S. J.; Blakely, E. A.

    2001-01-01

    Cell adhesion molecules (CAMs) are proteins which anchor cells to each other and to the extracellular matrix (ECM), but whose functions also include signal transduction, differentiation, and apoptosis. We are testing a hypothesis that particle radiations modulate CAM expression and this contributes to radiation-induced lens opacification. We observed dose-dependent changes in the expression of beta 1-integrin and ICAM-1 in exponentially-growing and confluent cells of a differentiating human lens epithelial cell model after exposure to particle beams. Human lens epithelial (HLE) cells, less than 10 passages after their initial culture from fetal tissue, were grown on bovine corneal endothelial cell-derived ECM in medium containing 15% fetal bovine serum and supplemented with 5 ng/ml basic fibroblast growth factor (FGF-2). Multiple cell populations at three different stages of differentiation were prepared for experiment: cells in exponential growth, and cells at 5 and 10 days post-confluence. The differentiation status of cells was characterized morphologically by digital image analysis, and biochemically by Western blotting using lens epithelial and fiber cell-specific markers. Cultures were irradiated with single doses (4, 8 or 12 Gy) of 55 MeV protons and, along with unirradiated control samples, were fixed using -20 degrees C methanol at 6 hours after exposure. Replicate experiments and similar experiments with helium ions are in progress. The intracellular localization of beta 1-integrin and ICAM-1 was detected by immunofluorescence using monoclonal antibodies specific for each CAM. Cells known to express each CAM were also processed as positive controls. Both exponentially-growing and confluent, differentiating cells demonstrated a dramatic proton-dose-dependent modulation (upregulation for exponential cells, downregulation for confluent cells) and a change in the intracellular distribution of the beta 1-integrin, compared to unirradiated controls. In contrast

  13. Exogenous cathepsin G upregulates cell surface MHC class I molecules on immune and glioblastoma cells.

    Science.gov (United States)

    Giese, Madleen; Turiello, Nadine; Molenda, Nicole; Palesch, David; Meid, Annika; Schroeder, Roman; Basilico, Paola; Benarafa, Charaf; Halatsch, Marc-Eric; Zimecki, Michal; Westhoff, Mike-Andrew; Wirtz, Christian Rainer; Burster, Timo

    2016-11-15

    Major histocompatibility complex (MHC) class I molecules present antigenic peptides to cytotoxic T cells. During an adaptive immune response, MHC molecules are regulated by several mechanisms including lipopolysaccharide (LPS) and interferon gamma (IFN-g). However, it is unclear whether the serine protease cathepsin G (CatG), which is generally secreted by neutrophils at the site of inflammation, might regulate MHC I molecules. We identified CatG, and to a higher extend CatG and lactoferrin (LF), as an exogenous regulator of cell surface MHC I expression of immune cells and glioblastoma stem cells. In addition, levels of MHC I molecules are reduced on dendritic cells from CatG deficient mice compared to their wild type counterparts. Furthermore, cell surface CatG on immune cells, including T cells, B cells, and NK cells triggers MHC I on THP-1 monocytes suggesting a novel mechanism for CatG to facilitate intercellular communication between infiltrating cells and the respective target cell. Subsequently, our findings highlight the pivotal role of CatG as a checkpoint protease which might force target cells to display their intracellular MHC I:antigen repertoire.

  14. Algorithms for pattern recognition in images of cell cultures

    Science.gov (United States)

    Mendes, Joyce M.; Peixoto, Nathalia L.; Ramirez-Fernandez, Francisco J.

    2001-06-01

    Several applications of silicon microstructures in areas such as neurobiology and electrophysiology have been stimulating the development of microsystems with the objective of mechanical support to monitor and control several parameters in cell cultures. In this work a multi-microelectrode arrays was fabricated over a glass plate to obtain the growth of neuronal cell monitoring their behavior during cell development. To identify the neuron core and axon an approach for implementation of edge detectors algorithms associated to images is described. The necessity of efficient and reliable algorithms for image processing and interpretation is justified by its large field of applications in several areas as well as medicine, robotics, cellular biology, computational vision and pattern recognition. In this work, it is investigated the adequacy of some edge detectors algorithms such as Canny, Marr-Hildreth. Some alterations in those methods are propose to improve the identification of both cell core and axonal growth measure. We compare the operator to edge detector proposed by Canny, Marr-Hildreth operator and application of Hough Transform. For evaluation of algorithms adaptations, we developed a method for automatic cell segmentation and measurement. Our goal is to find a set of parameters defining the location of the objects to compare the original and processed images.

  15. Molecular Recognition of Azelaic Acid and Related Molecules with DNA Polymerase I Investigated by Molecular Modeling Calculations.

    Science.gov (United States)

    Shawon, Jakaria; Khan, Akib Mahmud; Rahman, Adhip; Hoque, Mohammad Mazharol; Khan, Mohammad Abdul Kader; Sarwar, Mohammed G; Halim, Mohammad A

    2016-10-01

    Molecular recognition has central role on the development of rational drug design. Binding affinity and interactions are two key components which aid to understand the molecular recognition in drug-receptor complex and crucial for structure-based drug design in medicinal chemistry. Herein, we report the binding affinity and the nonbonding interactions of azelaic acid and related compounds with the receptor DNA polymerase I (2KFN). Quantum mechanical calculation was employed to optimize the modified drugs using B3LYP/6-31G(d,p) level of theory. Charge distribution, dipole moment and thermodynamic properties such as electronic energy, enthalpy and free energy of these optimized drugs are also explored to evaluate how modifications impact the drug properties. Molecular docking calculation was performed to evaluate the binding affinity and nonbonding interactions between designed molecules and the receptor protein. We notice that all modified drugs are thermodynamically more stable and some of them are more chemically reactive than the unmodified drug. Promise in enhancing hydrogen bonds is found in case of fluorine-directed modifications as well as in the addition of trifluoroacetyl group. Fluorine participates in forming fluorine bonds and also stimulates alkyl, pi-alkyl interactions in some drugs. Designed drugs revealed increased binding affinity toward 2KFN. A1, A2 and A3 showed binding affinities of -8.7, -8.6 and -7.9 kcal/mol, respectively against 2KFN compared to the binding affinity -6.7 kcal/mol of the parent drug. Significant interactions observed between the drugs and Thr358 and Asp355 residues of 2KFN. Moreover, designed drugs demonstrated improved pharmacokinetic properties. This study disclosed that 9-octadecenoic acid and drugs containing trifluoroacetyl and trifluoromethyl groups are the best 2KFN inhibitors. Overall, these results can be useful for the design of new potential candidates against DNA polymerase I.

  16. Upregulation of adhesion molecules on leukemia targets improves the efficacy of cytotoxic T cells transduced with chimeric anti-CD19 receptor.

    Science.gov (United States)

    Laurin, David; Marin, Virna; Biagi, Ettore; Pizzitola, Irene; Agostoni, Valentina; Gallot, Géraldine; Vié, Henri; Jacob, Marie Christine; Chaperot, Laurence; Aspord, Caroline; Plumas, Joël

    2013-04-01

    T lymphocytes engineered to express chimeric antigen receptors (CARs) interact directly with cell surface molecules, bypassing MHC antigen presentation dependence. We generated human anti-CD19ζ CAR cytotoxic T lymphocytes and cytokine-induced killer cells and studied their sensitivity to the expression of adhesion molecules for the killing of primary B-lineage acute lymphoblastic leukemia (B-ALL) targets. Despite a very low basal expression of surface adhesion molecules, B-ALL blasts were lysed by the anti-CD19ζ-CAR transduced effectors as expected. We next investigated the regulatory role of adhesion molecules during CAR-mediated cytolysis. The blocking of these accessory molecules strongly limited the chimeric effector's cytotoxicity. Thereafter, B-ALL cells surface adhesion molecule level expression was induced by IFN-γ or by the combined use of CD40L and IL-4 and the cells were submitted to anti-CD19ζ-CAR transduced effectors lysis. Upregulation of adhesion molecules expression by blasts potentiated their killing. The improved cytotoxicity observed was dependent on target surface expression of adhesion molecules, particularly CD54. Taken together, these results indicate that adhesion molecules, and principally CD54, are involved in the efficiency of recognition by effector chimeric ζ. These observations have potential implications for the design of immunotherapy treatment approaches for hematological malignancies and tumors based on the adoption of CAR effector cells.

  17. Cell-contact-dependent activation of CD4+T cells by adhesion molecules on synovial fibroblasts.

    Science.gov (United States)

    Mori, Masato; Hashimoto, Motomu; Matsuo, Takashi; Fujii, Takao; Furu, Moritoshi; Ito, Hiromu; Yoshitomi, Hiroyuki; Hirose, Jun; Ito, Yoshinaga; Akizuki, Shuji; Nakashima, Ran; Imura, Yoshitaka; Yukawa, Naoichiro; Yoshifuji, Hajime; Ohmura, Koichiro; Mimori, Tsuneyo

    2017-05-01

    To determine how cell-cell contact with synovial fibroblasts (SF) influence on the proliferation and cytokine production of CD4 +  T cells. Naïve CD4 +  T cells were cultured with SF from rheumatoid arthritis patients, stimulated by anti-CD3/28 antibody, and CD4 +  T cell proliferation and IFN-γ/IL-17 production were analyzed. To study the role of adhesion molecules, cell contact was blocked by transwell plate or anti-intracellular adhesion molecule-1 (ICAM-1)/vascular cell adhesion molecule-1(VCAM-1) antibody. To study the direct role of adhesion molecules for CD4 +  T cells, CD161 +  or CD161 - naïve CD4 +  T cells were stimulated on plastic plates coated by recombinant ICAM-1 or VCAM-1, and the source of IFN-γ/IL-17 were analyzed. SF enhanced naïve CD4 +  T cell proliferation and IFN-γ/IL-17 production in cell-contact and in part ICAM-1-/VCAM-1-dependent manner. Plate-coated ICAM-1 and VCAM-1 enhanced naïve CD4 +  T cell proliferation and IFN-γ production, while VCAM-1 efficiently promoting IL-17 production. CD161 +  naïve T cells upregulating LFA-1 and VLA-4 were the major source of IFN-γ/IL-17 upon interaction with ICAM-1/VCAM-1. CD4 +  T cells rapidly expand and secrete IFN-γ/IL-17 upon cell-contact with SF via adhesion molecules. Interfering with ICAM-1-/VCAM-1 may be beneficial for inhibiting RA synovitis.

  18. Graphene and Graphene-like Molecules: Prospects in Solar Cells.

    Science.gov (United States)

    Loh, Kian Ping; Tong, Shi Wun; Wu, Jishan

    2016-02-03

    Graphene is constantly hyped as a game-changer for flexible transparent displays. However, to date, no solar cell fabricated on graphene electrodes has out-performed indium tin oxide in power conversion efficiency (PCE). This Perspective covers the enabling roles that graphene can play in solar cells because of its unique properties. Compared to transparent and conducting metal oxides, graphene may not have competitive advantages in terms of its electrical conductivity. The unique strength of graphene lies in its ability to perform various enabling roles in solar cell architectures, leading to overall improvement in PCE. Graphene can serve as an ultrathin and transparent diffusion barrier in solar cell contacts, as an intermediate layer in tandem solar cells, as an electron acceptor, etc. Inspired by the properties of graphene, chemists are also designing graphene-like molecules in which the topology of π-electron array, donor-acceptor structures, and conformation can be tuned to offer a new class of light-harvesting materials.

  19. Enhanced resolution of molecular recognition to distinguish structurally similar molecules by different conformational responses of a protein upon ligand binding.

    Science.gov (United States)

    Higuchi, Mariko; Fujii, Jumpei; Yonetani, Yoshiteru; Kitao, Akio; Go, Nobuhiro

    2011-01-01

    MutT distinguishes substrate 8-oxo-dGTP from dGTP and also 8-oxo-dGMP from dGMP despite small differences of chemical structures between them. In this paper we show by the method of molecular dynamics simulation that the transition between conformational substates of MutT is a key mechanism for a high-resolution molecular recognition of the differences between the very similar chemical compounds. (1) The native state MutT has two conformational substates with similar free energies, each characterized by either open or closed of two loops surrounding the substrate binding active site. Between the two substates, the open substate is more stable in free MutT and in dGMP-MutT complex, and the closed substate is more stable in 8-oxo-dGMP-MutT complex. (2) Conformational fluctuation of the open substate is much larger than that of the closed substate. An estimate of associated entropy difference was found to be consistent with the experimentally found difference of entropy contribution to the binding free energies of the two molecules. (3) A hydrogen bond between H7 atom of 8-oxo-dGMP and the sidechain of Asn119 plays a crucial role for maintaining the closed substate in 8-oxo-dGMP-MutT complex. When this hydrogen bond is absent in the H7-deficient dGMP-MutT complex, the closed substate is no more maintained and transition to the more entropically-favored open substate is induced. (4) Thus, this mechanism of the hydrogen bond controlling the relative stabilities of the drastically different two conformational substates enhances the resolution to recognize the small difference of the chemical structures between the two molecules, dGMP and 8-oxo-dGMP. Copyright © 2010 Elsevier Inc. All rights reserved.

  20. Epigenetic mechanisms regulate MHC and antigen processing molecules in human embryonic and induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Beatriz Suárez-Alvarez

    2010-04-01

    Full Text Available Human embryonic stem cells (hESCs are an attractive resource for new therapeutic approaches that involve tissue regeneration. hESCs have exhibited low immunogenicity due to low levels of Mayor Histocompatibility Complex (MHC class-I and absence of MHC class-II expression. Nevertheless, the mechanisms regulating MHC expression in hESCs had not been explored.We analyzed the expression levels of classical and non-classical MHC class-I, MHC class-II molecules, antigen-processing machinery (APM components and NKG2D ligands (NKG2D-L in hESCs, induced pluripotent stem cells (iPSCs and NTera2 (NT2 teratocarcinoma cell line. Epigenetic mechanisms involved in the regulation of these genes were investigated by bisulfite sequencing and chromatin immunoprecipitation (ChIP assays. We showed that low levels of MHC class-I molecules were associated with absent or reduced expression of the transporter associated with antigen processing 1 (TAP-1 and tapasin (TPN components in hESCs and iPSCs, which are involved in the transport and load of peptides. Furthermore, lack of beta2-microglobulin (beta2m light chain in these cells limited the expression of MHC class I trimeric molecule on the cell surface. NKG2D ligands (MICA, MICB were observed in all pluripotent stem cells lines. Epigenetic analysis showed that H3K9me3 repressed the TPN gene in undifferentiated cells whilst HLA-B and beta2m acquired the H3K4me3 modification during the differentiation to embryoid bodies (EBs. Absence of HLA-DR and HLA-G expression was regulated by DNA methylation.Our data provide fundamental evidence for the epigenetic control of MHC in hESCs and iPSCs. Reduced MHC class I and class II expression in hESCs and iPSCs can limit their recognition by the immune response against these cells. The knowledge of these mechanisms will further allow the development of strategies to induce tolerance and improve stem cell allograft acceptance.

  1. Human NK cells selective targeting of colon cancer-initiating cells: A role for natural cytotoxicity receptors and MHC class i molecules

    KAUST Repository

    Tallerico, Rossana

    2013-01-23

    Tumor cell populations have been recently proposed to be composed of two compartments: tumor-initiating cells characterized by a slow and asymmetrical growth, and the "differentiated" cancer cells with a fast and symmetrical growth. Cancer stem cells or cancer-initiating cells (CICs) play a crucial role in tumor recurrence. The resistance of CICs to drugs and irradiation often allows them to survive traditional therapy. NK cells are potent cytotoxic lymphocytes that can recognize tumor cells. In this study, we have analyzed the NK cell recognition of tumor target cells derived from the two cancer cell compartments of colon adenocarcinoma lesions. Our data demonstrate that freshly purified allogeneic NK cells can recognize and kill colorectal carcinoma- derived CICs whereas the non-CIC counterpart of the tumors (differentiated tumor cells), either autologous or allogeneic, is less susceptible to NK cells. This difference in the NK cell susceptibility correlates with higher expression on CICs of ligands for NKp30 and NKp44 in the natural cytotoxicity receptor (NCR) group of activating NK receptors. In contrast, CICs express lower levels of MHC class I, known to inhibit NK recognition, on their surface than do the "differentiated" tumor cells. These data have been validated by confocal microscopy where NCR ligands and MHC class I molecule membrane distribution have been analyzed. Moreover, NK cell receptor blockade in cytotoxicity assays demonstrates that NCRs play a major role in the recognition of CIC targets. This study strengthens the idea that biology-based therapy harnessing NK cells could be an attractive opportunity in solid tumors. Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved.

  2. Atomic force microscopy imaging and single molecule recognition force spectroscopy of coat proteins on the surface of Bacillus subtilis spore.

    Science.gov (United States)

    Tang, Jilin; Krajcikova, Daniela; Zhu, Rong; Ebner, Andreas; Cutting, Simon; Gruber, Hermann J; Barak, Imrich; Hinterdorfer, Peter

    2007-01-01

    Coat assembly in Bacillus subtilis serves as a tractable model for the study of the self-assembly process of biological structures and has a significant potential for use in nano-biotechnological applications. In the present study, the morphology of B. subtilis spores was investigated by magnetically driven dynamic force microscopy (MAC mode atomic force microscopy) under physiological conditions. B. subtilis spores appeared as prolate structures, with a length of 0.6-3 microm and a width of about 0.5-2 microm. The spore surface was mainly covered with bump-like structures with diameters ranging from 8 to 70 nm. Besides topographical explorations, single molecule recognition force spectroscopy (SMRFS) was used to characterize the spore coat protein CotA. This protein was specifically recognized by a polyclonal antibody directed against CotA (anti-CotA), the antibody being covalently tethered to the AFM tip via a polyethylene glycol linker. The unbinding force between CotA and anti-CotA was determined as 55 +/- 2 pN. From the high-binding probability of more than 20% in force-distance cycles it is concluded that CotA locates in the outer surface of B. subtilis spores. Copyright (c) 2007 John Wiley & Sons, Ltd.

  3. Collectin liver 1 and collectin kidney 1 and other complement-associated pattern recognition molecules in systemic lupus erythematosus.

    Science.gov (United States)

    Troldborg, A; Thiel, S; Jensen, L; Hansen, S; Laska, M J; Deleuran, B; Jensenius, J C; Stengaard-Pedersen, K

    2015-11-01

    The objective of this study was to explore the involvement of collectin liver 1 (CL-L1) and collectin kidney 1 (CL-K1) and other pattern recognition molecules (PRMs) of the lectin pathway of the complement system in a cross-sectional cohort of systemic lupus erythematosus (SLE) patients. Concentrations in plasma of CL-L1, CL-K1, mannan-binding lectin (MBL), M-ficolin, H-ficolin and L-ficolin were determined in 58 patients with SLE and 65 healthy controls using time-resolved immunoflourometric assays. The SLE patients' demographic, diagnostic, clinical and biochemical data and collection of plasma samples were performed prospectively during 4 months. CL-L1, CL-K1 and M-ficolin plasma concentrations were lower in SLE patients than healthy controls (P-values PRMs of the lectin pathway in SLE patients and associations to key elements of the disease support the hypothesis that the lectin pathway plays a role in the pathogenesis of SLE. © 2015 British Society for Immunology.

  4. Cell Adhesion Molecules of the Immunoglobulin Superfamily in the Nervous System

    DEFF Research Database (Denmark)

    Walmod, Peter Schledermann; Pedersen, Martin Volmer; Berezin, Vladimir

    2007-01-01

    CAMs belonging to IgSF, that exclusively or in part, are expressed in the nervous system. The chapter includes descriptions of myelin protein zero (P0), integrin-associated protein (CD47), neuroplastin, activated leukocyte-cell adhesion molecule (ALCAM), melanoma cell adhesion molecule (MCAM......Cell adhesion molecules (CAMs) are proteins mediating cell-cell or cell-extracellular matrix (ECM) interactions. CAMs are traditionally divided into four groups, the cadherins, the selectins, the integrins and CAMs belonging to the immunoglobulin superfamily (IgSF). The present chapter describes......), myelinassociated glycoprotein (MAG), the neural cell adhesion molecules 1 and 2 (NCAM, NCAM2), Down Syndrome cell adhesion molecule (DSCAM) and Down Syndrome cell adhesion molecule-like-1 (DSCAML1), sidekick 1 and 2 (SDK1, SDK2), signal-regulatory proteins (SIRPs), nectins, nectin-like proteins (necls...

  5. Adhesion Molecule Expression in Human Endothelial Cells under Simulated Microgravity

    Science.gov (United States)

    Rudimov, E. G.; Andreeva, E. R.; Buravkova, L. B.

    2013-02-01

    High gravisensitivity of endothelium is now well recognized. Therefore, the microgravity can be one of the main factors affecting the endothelium in space flight. In this work we studied the effects of gravity vector randomization (3D-clinorotation in RPM) on the viability of endothelial cells from human umbilical vein (HUVEC) and the expression of adhesion molecules on its surface. After RPM exposure, HUVEC conditioning medium was collected for cytokines evaluation, a part of vials was used for immunocytochemistry and other one - for cytofluorimetric analysis of ICAM-I, VCAM-I, PECAM-I, E-selectin, Endoglin, VE-cadherin expression. The viability of HUVEC and constitutive expression of EC marker molecules PECAM-I and Endoglin were similar in all experimental groups both after 6 and 24 hrs of exposure. There were no differences in ICAM-I and E-selectin expression on HUVEC in 3 groups after 6 hrs of exposure. 24 hrs incubation has provoked decrease in ICAM-I and E-selectin expression. Thus, gravity vector randomization can lead to the disruption of ECs monolayer.

  6. Tetrahydroquinoxaline Based Small Molecule: PCBM Bulk Heterojunction Solar Cell

    International Nuclear Information System (INIS)

    Sharma, S. S.; Sharma, G. D.; Subodh,; Sharma, Sarla; Vijay, Y. K.

    2011-01-01

    We have fabricated solution processed bulk heterojuction (BHJ) solar cell from small molecule (SM) as donor blended with PCBM as an acceptor. The BHJ showed power conversion efficiency (PCE) up to 2.80%. The PCE has been further improved up to 3.80 % after thermal annealing of the SM: PCBM layer. The higher PCE of the photovoltaic devices based on the thermal annealed SM: PCBM blend as compared to SM: PCBM blend is attributed to the increase in the crystalline nature of the blend and hole mobility. The thermal annealing allows not only a broad absorption but also tuning of the inter energy level leading to a higher short circuit current (Jsc) and open circuit voltage (Voc).

  7. Experimental techniques for single cell and single molecule biomechanics

    International Nuclear Information System (INIS)

    Lim, C.T.; Zhou, E.H.; Li, A.; Vedula, S.R.K.; Fu, H.X.

    2006-01-01

    Stresses and strains that act on the human body can arise either from external physical forces or internal physiological environmental conditions. These biophysical interactions can occur not only at the musculoskeletal but also cellular and molecular levels and can determine the health and function of the human body. Here, we seek to investigate the structure-property-function relationship of cells and biomolecules so as to understand their important physiological functions as well as establish possible connections to human diseases. With the recent advancements in cell and molecular biology, biophysics and nanotechnology, several innovative and state-of-the-art experimental techniques and equipment have been developed to probe the structural and mechanical properties of biostructures from the micro- down to picoscale. Some of these experimental techniques include the optical or laser trap method, micropipette aspiration, step-pressure technique, atomic force microscopy and molecular force spectroscopy. In this article, we will review the basic principles and usage of these techniques to conduct single cell and single molecule biomechanics research

  8. Hypertonic saline impedes tumor cell-endothelial cell interaction by reducing adhesion molecule and laminin expression.

    LENUS (Irish Health Repository)

    Shields, Conor J

    2012-02-03

    BACKGROUND: Hypertonic saline infusion dampens inflammatory responses and suppresses neutrophil-endothelial interaction by reducing adhesion molecule expression. This study tested the hypothesis that hypertonic saline attenuates tumor cell adhesion to the endothelium through a similar mechanism. METHODS: Human colon cancer cells (LS174T) were transfected with green fluorescent protein and exposed to lipopolysaccharide, tumor necrosis factor-alpha, and interleukin-6 under hypertonic and isotonic conditions for 1 and 4 hours. Confluent human umbilical vein endothelial cells were similarly exposed. Cellular apoptosis and expression of adhesion molecules and laminin were measured by flow cytometry. Tumor cell adhesion to endothelium and laminin was assessed with fluorescence microscopy. Data are represented as mean +\\/- standard error of mean, and an ANOVA test was performed to gauge statistical significance, with P <.05 considered significant. RESULTS: Hypertonic exposure significantly reduced tumor cell adhesion despite the presence of the perioperative cell stressors (42 +\\/- 2.9 vs 172.5 +\\/- 12.4, P <.05), attenuated tumor cell beta-1 integrin (14.43 vs 23.84, P <.05), and endothelial cell laminin expression (22.78 +\\/- 2.2 vs 33.74 +\\/- 2.4, P <.05), but did not significantly alter cell viability. CONCLUSION: Hypertonic saline significantly attenuates tumor cell adhesion to endothelium by inhibiting adhesion molecule and laminin expression. This may halt the metastatic behavior of tumor cells shed at surgery.

  9. The Drosophila cell adhesion molecule Neuroglian regulates Lissencephaly-1 localisation in circulating immunosurveillance cells

    Directory of Open Access Journals (Sweden)

    Williams Michael J

    2009-03-01

    Full Text Available Abstract Background When the parasitoid wasp Leptopilina boulardi lays its eggs in Drosophila larvae phagocytic cells called plasmatocytes and specialized cells known as lamellocytes encapsulate the egg. This requires these circulating immunosurveillance cells (haemocytes to change from a non-adhesive to an adhesive state enabling them to bind to the invader. Interestingly, attachment of leukocytes, platelets, and insect haemocytes requires the same adhesion complexes as epithelial and neuronal cells. Results Here evidence is presented showing that the Drosophila L1-type cell adhesion molecule Neuroglian (Nrg is required for haemocytes to encapsulate L. boulardi wasp eggs. The amino acid sequence FIGQY containing a conserved phosphorylated tyrosine is found in the intracellular domain of all L1-type cell adhesion molecules. This conserved tyrosine is phosphorylated at the cell periphery of plasmatocytes and lamellocytes prior to parasitisation, but dephosphorylated after immune activation. Intriguingly, another pool of Nrg located near the nucleus of plasmatocytes remains phosphorylated after parasitisation. In mammalian neuronal cells phosphorylated neurofascin, another L1-type cell adhesion molecule interacts with a nucleokinesis complex containing the microtubule binding protein lissencephaly-1 (Lis1 1. Interestingly in plasmatocytes from Nrg mutants the nucleokinesis regulating protein Lissencephaly-1 (Lis1 fails to localise properly around the nucleus and is instead found diffuse throughout the cytoplasm and at unidentified perinuclear structures. After attaching to the wasp egg control plasmatocytes extend filopodia laterally from their cell periphery; as well as extending lateral filopodia plasmatocytes from Nrg mutants also extend many filopodia from their apical surface. Conclusion The Drosophila cellular adhesion molecule Neuroglian is expressed in haemocytes and its activity is required for the encapsulation of L. boularli eggs. At

  10. The Neural Cell Adhesion Molecule NCAM2/OCAM/RNCAM, a Close Relative to NCAM

    DEFF Research Database (Denmark)

    Kulahin, Nikolaj; Walmod, Peter

    2008-01-01

    molecule (NCAM) is a well characterized, ubiquitously expressed CAM that is highly expressed in the nervous system. In addition to mediating cell adhesion, NCAM participates in a multitude of cellular events, including survival, migration, and differentiation of cells, outgrowth of neurites, and formation......Cell adhesion molecules (CAMs) constitute a large class of plasma membrane-anchored proteins that mediate attachment between neighboring cells and between cells and the surrounding extracellular matrix (ECM). However, CAMs are more than simple mediators of cell adhesion. The neural cell adhesion...... and plasticity of synapses. NCAM shares an overall sequence identity of approximately 44% with the neural cell adhesion molecule 2 (NCAM2), a protein also known as olfactory cell adhesion molecule (OCAM) and Rb-8 neural cell adhesion molecule (RNCAM), and the region-for-region sequence homology between the two...

  11. Allergen recognition by innate immune cells: critical role of dendritic and epithelial cells

    Directory of Open Access Journals (Sweden)

    Fabian eSalazar

    2013-11-01

    Full Text Available Allergy is an exacerbated response of the immune system against non-self-proteins called allergens and is typically characterized by biased type-2 T helper cell and deleterious IgE mediated immune responses. The allergic cascade starts with the recognition of allergens by antigen presenting cells, mainly dendritic cells, culminating in mast cell sensitization and triggering. Dendritic cells have been demonstrated to play a crucial role in orchestrating allergic diseases. Using different C-type lectin receptors dendritic cells are able to recognize and internalize a number of allergens from diverse sources leading to sensitization. Furthermore, there is increasing evidence highlighting the role of epithelial cells in triggering and modulating immune responses to allergens. As well as providing a physical barrier, epithelial cells can interact with allergens and influence dendritic cells behaviour through the release of a number of Th2 promoting cytokines. In this review we will summarise current understanding of how allergens are recognised by dendritic cells and epithelial cells and what are the consequences of such interaction in the context of allergic sensitisation and downstream events leading to allergic inflammation. Better understanding of the molecular mechanisms of allergen recognition and associated signalling pathways could enable developing more effective therapeutic strategies that target the initial steps of allergic sensitisation hence hindering development or progression of allergic diseases.

  12. Fluorescence molecule counting for single-molecule studies in crowded environment of living cells without and with broken ergodicity.

    Science.gov (United States)

    Földes-Papp, Zeno; Baumann, Gerd

    2011-05-01

    We present a new approach to distinguish between non-ergodic and ergodic behavior. Performing ensemble averaging in a subpopulation of individual molecules leads to a mean value that can be similar to the mean value obtained in an ergodic system. The averaging is carried out by minimizing the variation between the sum of the temporal averaged mean square deviation of the simulated data with respect to the logarithmic scaling behavior of the subpopulation. For this reason, we first introduce a kind of Continuous Time Random Walks (CTRW), which we call Limited Continuous Time Random Walks (LCTRW) on fractal support. The random waiting time distributions are sampled at points which fulfill the condition N <1, where N is the Poisson probability of finding a single molecule in the femtoliter-sized observation volume ΔV at the single-molecule level. Given a subpopulation of different single molecules of the same kind, the ratio T/ T(m) between the measurement time T and the meaningful time T(m), which is the time for observing just one and the same single molecule, is the experimentally accessible quantity that allows to compare different molecule numbers in the subpopulation. In addition, the mean square displacement traveled by the molecule during the time t is determined by an upper limit of the geometric dimension of the living cell or its nucleus.

  13. A small-molecule/cytokine combination enhances hematopoietic stem cell proliferation via inhibition of cell differentiation.

    Science.gov (United States)

    Wang, Lan; Guan, Xin; Wang, Huihui; Shen, Bin; Zhang, Yu; Ren, Zhihua; Ma, Yupo; Ding, Xinxin; Jiang, Yongping

    2017-07-18

    Accumulated evidence supports the potent stimulating effects of multiple small molecules on the expansion of hematopoietic stem cells (HSCs) which are important for the therapy of various hematological disorders. Here, we report a novel, optimized formula, named the SC cocktail, which contains a combination of three such small molecules and four cytokines. Small-molecule candidates were individually screened and then combined at their optimal concentration with the presence of cytokines to achieve maximum capacity for stimulating the human CD34 + cell expansion ex vivo. The extent of cell expansion and the immunophenotype of expanded cells were assessed through flow cytometry. The functional preservation of HSC stemness was confirmed by additional cell and molecular assays in vitro. Subsequently, the expanded cells were transplanted into sublethally irradiated NOD/SCID mice for the assessment of human cell viability and engraftment potential in vivo. Furthermore, the expression of several genes in the cell proliferation and differentiation pathways was analyzed through quantitative polymerase chain reaction (qPCR) during the process of CD34 + cell expansion. The SC cocktail supported the retention of the immunophenotype of hematopoietic stem/progenitor cells remarkably well, by yielding purities of 86.6 ± 11.2% for CD34 + cells and 76.2 ± 10.5% for CD34 + CD38 - cells, respectively, for a 7-day culture. On day 7, the enhancement of expansion of CD34 + cells and CD34 + CD38 - cells reached a maxima of 28.0 ± 5.5-fold and 27.9 ± 4.3-fold, respectively. The SC cocktail-expanded CD34 + cells preserved the characteristics of HSCs by effectively inhibiting their differentiation in vitro and retained the multilineage differentiation potential in primary and secondary in vivo murine xenotransplantation trials. Further gene expression analysis suggested that the small-molecule combination strengthened the ability of the cytokines to enhance the Notch

  14. Slp-76 is a critical determinant of NK-cell mediated recognition of missing-self targets.

    Science.gov (United States)

    Lampe, Kristin; Endale, Mehari; Cashman, Siobhan; Fang, Hao; Mattner, Jochen; Hildeman, David; Hoebe, Kasper

    2015-07-01

    Absence of MHC class I expression is an important mechanism by which NK cells recognize a variety of target cells, yet the pathways underlying "missing-self" recognition, including the involvement of activating receptors, remain poorly understood. Using ethyl-N-nitrosourea mutagenesis in mice, we identified a germline mutant, designated Ace, with a marked defect in NK cell mediated recognition and elimination of "missing-self" targets. The causative mutation was linked to chromosome 11 and identified as a missense mutation (Thr428Ile) in the SH2 domain of Slp-76-a critical adapter molecule downstream of ITAM-containing surface receptors. The Slp-76 Ace mutation behaved as a hypomorphic allele-while no major defects were observed in conventional T-cell development/function, a marked defect in NK cell mediated elimination of β2-microglobulin (β2M) deficient target cells was observed. Further studies revealed Slp-76 to control NK-cell receptor expression and maturation; however, activation of Slp-76(ace/ace) NK cells through ITAM-containing NK-cell receptors or allogeneic/tumor target cells appeared largely unaffected. Imagestream analysis of the NK-β2M(-/-) target cell synapse revealed a specific defect in actin recruitment to the conjugate synapse in Slp-76(ace/ace) NK cells. Overall these studies establish Slp-76 as a critical determinant of NK-cell development and NK cell mediated elimination of missing-self target cells in mice. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Endothelial juxtaposition of distinct adult stem cells activates angiogenesis signaling molecules in endothelial cells.

    Science.gov (United States)

    Mohammadi, Elham; Nassiri, Seyed Mahdi; Rahbarghazi, Reza; Siavashi, Vahid; Araghi, Atefeh

    2015-12-01

    Efficacy of therapeutic angiogenesis needs a comprehensive understanding of endothelial cell (EC) function and biological factors and cells that interplay with ECs. Stem cells are considered the key components of pro- and anti-angiogenic milieu in a wide variety of physiopathological states, and interactions of EC-stem cells have been the subject of controversy in recent years. In this study, the potential effects of three tissue-specific adult stem cells, namely rat marrow-derived mesenchymal stem cells (rBMSCs), rat adipose-derived stem cells (rADSCs) and rat muscle-derived satellite cells (rSCs), on the endothelial activation of key angiogenic signaling molecules, including VEGF, Ang-2, VEGFR-2, Tie-2, and Tie2-pho, were investigated. Human umbilical vein endothelial cells (HUVECs) and rat lung microvascular endothelial cells (RLMECs) were cocultured with the stem cells or incubated with the stem cell-derived conditioned media on Matrigel. Following HUVEC-stem cell coculture, CD31-positive ECs were flow sorted and subjected to western blotting to analyze potential changes in the expression of the pro-angiogenic signaling molecules. Elongation and co-alignment of the stem cells were seen along the EC tubes in the EC-stem cell cocultures on Matrigel, with cell-to-cell dye communication in the EC-rBMSC cocultures. Moreover, rBMSCs and rADSCs significantly improved endothelial tubulogenesis in both juxtacrine and paracrine manners. These two latter stem cells dynamically up-regulated VEGF, Ang-2, VREGR-2, and Tie-2 but down-regulated Tie2-pho and the Tie2-pho/Tie-2 ratio in HUVECs. Induction of pro-angiogenic signaling in ECs by marrow- and adipose-derived MSCs further indicates the significance of stem cell milieu in angiogenesis dynamics.

  16. Regulation of body weight and energy homeostasis by neuronal cell adhesion molecule 1

    NARCIS (Netherlands)

    Rathjen, Thomas; Yan, Xin; Kononenko, Natalia L.; Ku, Min-Chi; Song, Kun; Ferrarese, Leiron; Tarallo, Valentina; Puchkov, Dmytro; Kochlamazashvili, Gaga; Brachs, Sebastian; Varela, Luis; Szigeti-Buck, Klara; Yi, Chun-Xia; Schriever, Sonja C.; Tattikota, Sudhir Gopal; Carlo, Anne Sophie; Moroni, Mirko; Siemens, Jan; Heuser, Arnd; van der Weyden, Louise; Birkenfeld, Andreas L.; Niendorf, Thoralf; Poulet, James F. A.; Horvath, Tamas L.; Tschöp, Matthias H.; Heinig, Matthias; Trajkovski, Mirko; Haucke, Volker; Poy, Matthew N.

    2017-01-01

    Susceptibility to obesity is linked to genes regulating neurotransmission, pancreatic beta-cell function and energy homeostasis. Genome-wide association studies have identified associations between body mass index and two loci near cell adhesion molecule 1 (CADM1) and cell adhesion molecule 2

  17. Central dogma at the single-molecule level in living cells.

    Science.gov (United States)

    Li, Gene-Wei; Xie, X Sunney

    2011-07-20

    Gene expression originates from individual DNA molecules within living cells. Like many single-molecule processes, gene expression and regulation are stochastic, that is, sporadic in time. This leads to heterogeneity in the messenger-RNA and protein copy numbers in a population of cells with identical genomes. With advanced single-cell fluorescence microscopy, it is now possible to quantify transcriptomes and proteomes with single-molecule sensitivity. Dynamic processes such as transcription-factor binding, transcription and translation can be monitored in real time, providing quantitative descriptions of the central dogma of molecular biology and the demonstration that a stochastic single-molecule event can determine the phenotype of a cell.

  18. New domains of neural cell-adhesion molecule L1 implicated in X-linked hydrocephalus and MASA syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Jouet, M.; Kenwick, S. [Univ. of Cambridge (United Kingdom); Moncla, A. [Hopital d`Enfants de la Timone, Marseillas (United Kingdom)] [and others

    1995-06-01

    The neural cell-adhesion molecule L1 is involved in intercellular recognition and neuronal migration in the CNS. Recently, we have shown that mutations in the gene encoding L1 are responsible for three related disorders; X-linked hydrocephalus, MASA (mental retardation, aphasia, shuffling gait, and adducted thumbs) syndrome, and spastic paraplegia type I (SPG1). These three disorders represent a clinical spectrum that varies not only between families but sometimes also within families. To date, 14 independent L1 mutations have been reported and shown to be disease causing. Here we report nine novel L1 mutations in X-linked hydrocephalus and MASA-syndrome families, including the first examples of mutations affecting the fibronectin type III domains of the molecule. They are discussed in relation both to phenotypes and to the insights that they provide into L1 function. 39 refs., 5 figs., 3 tabs.

  19. Crystal structure of Vδ1 T cell receptor in complex with CD1d-sulfatide shows MHC-like recognition of a self-lipid by human γδ T cells.

    Science.gov (United States)

    Luoma, Adrienne M; Castro, Caitlin D; Mayassi, Toufic; Bembinster, Leslie A; Bai, Li; Picard, Damien; Anderson, Brian; Scharf, Louise; Kung, Jennifer E; Sibener, Leah V; Savage, Paul B; Jabri, Bana; Bendelac, Albert; Adams, Erin J

    2013-12-12

    The nature of the antigens recognized by γδ T cells and their potential recognition of major histocompatibility complex (MHC)-like molecules has remained unclear. Members of the CD1 family of lipid-presenting molecules are suggested ligands for Vδ1 TCR-expressing γδ T cells, the major γδ lymphocyte population in epithelial tissues. We crystallized a Vδ1 TCR in complex with CD1d and the self-lipid sulfatide, revealing the unusual recognition of CD1d by germline Vδ1 residues spanning all complementarity-determining region (CDR) loops, as well as sulfatide recognition separately encoded by nongermline CDR3δ residues. Binding and functional analysis showed that CD1d presenting self-lipids, including sulfatide, was widely recognized by gut Vδ1+ γδ T cells. These findings provide structural demonstration of MHC-like recognition of a self-lipid by γδ T cells and reveal the prevalence of lipid recognition by innate-like T cell populations. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Characterization of the recognition of tumor cells by the natural cytotoxicity receptor, NKp44.

    NARCIS (Netherlands)

    Hershkovitz, O.; Jivov, S.; Bloushtain, N.; Zilka, A.; Landau, G.; Bar-Ilan, A.; Lichtenstein, R.G.; Campbell, K.S.; Kuppevelt, A.H.M.S.M. van; Porgador, A.

    2007-01-01

    NKp44 is a natural cytotoxicity receptor expressed by human NK cells upon activation. In this study, we demonstrate that cell surface heparan sulfate proteoglycans (HSPGs), expressed by target cells, are involved in the recognition of tumor cells by NKp44. NKp44 showed heparan sulfate-dependent

  1. Pluripotent stem cells derived from mouse primordial germ cells by small molecule compounds.

    Science.gov (United States)

    Kimura, Tohru; Kaga, Yoshiaki; Sekita, Yoichi; Fujikawa, Keita; Nakatani, Tsunetoshi; Odamoto, Mika; Funaki, Soichiro; Ikawa, Masahito; Abe, Kuniya; Nakano, Toru

    2015-01-01

    Primordial germ cells (PGCs) can give rise to pluripotent stem cells known as embryonic germ cells (EGCs) when cultured with basic fibroblast growth factor (bFGF), stem cell factor (SCF), and leukemia inhibitory factor. Somatic cells can give rise to induced pluripotent stem cells (iPSCs) by introduction of the reprogramming transcription factors Oct4, Sox2, and Klf4. The effects of Sox2 and Klf4 on somatic cell reprogramming can be reproduced using the small molecule compounds, transforming growth factor-β receptor (TGFβR) inhibitor and Kempaullone, respectively. Here we examined the effects of TGFβR inhibitor and Kempaullone on EGC derivation from PGCs. Treatment of PGCs with TGFβR inhibitor and/or Kempaullone generated pluripotent stem cells under standard embryonic stem cell (ESC) culture conditions without bFGF and SCF, which we termed induced EGCs (iEGCs). The derivation efficiency of iEGCs was dependent on the differentiation stage and sex. DNA methylation levels of imprinted genes in iEGCs were reduced, with the exception of the H19 gene. The promoters of genes involved in germline development were generally hypomethylated in PGCs, but three germline genes showed comparable DNA methylation levels among iEGs, ESCs, and iPSCs. These results show that PGCs can be reprogrammed into pluripotent state using small molecule compounds, and that DNA methylation of these germline genes is not maintained in iEGCs. © 2014 AlphaMed Press.

  2. Regulation of endothelial cell adhesion molecule expression by mast cells, macrophages, and neutrophils.

    Directory of Open Access Journals (Sweden)

    Jie Zhang

    2011-01-01

    Full Text Available Leukocyte adhesion to the vascular endothelium and subsequent transendothelial migration play essential roles in the pathogenesis of cardiovascular diseases such as atherosclerosis. The leukocyte adhesion is mediated by localized activation of the endothelium through the action of inflammatory cytokines. The exact proinflammatory factors, however, that activate the endothelium and their cellular sources remain incompletely defined.Using bone marrow-derived mast cells from wild-type, Tnf(-/-, Ifng(-/-, Il6(-/- mice, we demonstrated that all three of these pro-inflammatory cytokines from mast cells induced the expression of vascular cell adhesion molecule-1 (VCAM-1, intercellular adhesion molecule-1 (ICAM-1, P-selectin, and E-selectin in murine heart endothelial cells (MHEC at both mRNA and protein levels. Compared with TNF-α and IL6, IFN-γ appeared weaker in the induction of the mRNA levels, but at protein levels, both IL6 and IFN-γ were weaker inducers than TNF-α. Under physiological shear flow conditions, mast cell-derived TNF-α and IL6 were more potent than IFN-γ in activating MHEC and in promoting neutrophil adhesion. Similar observations were made when neutrophils or macrophages were used. Neutrophils and macrophages produced the same sets of pro-inflammatory cytokines as did mast cells to induce MHEC adhesion molecule expression, with the exception that macrophage-derived IFN-γ showed negligible effect in inducing VCAM-1 expression in MHEC.Mast cells, neutrophils, and macrophages release pro-inflammatory cytokines such as TNF-α, IFN-γ, and IL6 that induce expression of adhesion molecules in endothelium and recruit of leukocytes, which is essential to the pathogenesis of vascular inflammatory diseases.

  3. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner.

    Science.gov (United States)

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins.

  4. CD1 and major histocompatibility complex II molecules follow a different course during dendritic cell maturation

    NARCIS (Netherlands)

    van der Wel, Nicole N.; Sugita, Masahiko; Fluitsma, Donna M.; Cao, Xaiochun; Schreibelt, Gerty; Brenner, Michael B.; Peters, Peter J.

    2003-01-01

    The maturation of dendritic cells is accompanied by the redistribution of major histocompatibility complex (MHC) class II molecules from the lysosomal MHC class IT compartment to the plasma membrane to mediate presentation of peptide antigens. Besides MHC molecules, dendritic cells also express CD1

  5. Biosynthesis of the neural cell adhesion molecule: characterization of polypeptide C

    DEFF Research Database (Denmark)

    Nybroe, O; Albrechtsen, M; Dahlin, J

    1985-01-01

    The biosynthesis of the neural cell adhesion molecule (N-CAM) was studied in primary cultures of rat cerebral glial cells, cerebellar granule neurons, and skeletal muscle cells. The three cell types produced different N-CAM polypeptide patterns. Glial cells synthesized a 135,000 Mr polypeptide B...

  6. Association of the pattern recognition molecule H-ficolin with incident microalbuminuria in an inception cohort of newly diagnosed type 1 diabetic patients

    DEFF Research Database (Denmark)

    Østergaard, Jakob A; Thiel, Steffen; Hovind, Peter

    2014-01-01

    AIMS/HYPOTHESIS: Increasing evidence links complement activation through the lectin pathway to diabetic nephropathy. Adverse complement recognition of proteins modified by glycation has been suggested to trigger complement auto-attack in diabetes. H-ficolin (also known as ficolin-3) is a pattern...... recognition molecule that activates the complement cascade on binding to glycated surfaces, but the role of H-ficolin in diabetic nephropathy is unknown. We aimed to investigate the association between circulating H-ficolin levels and the incidence of microalbuminuria in type 1 diabetes. METHODS: We measured...... baseline H-ficolin levels and tracked the development of persistent micro- and macroalbuminuria in a prospective 18 year observational follow-up study of an inception cohort of 270 patients with newly diagnosed type 1 diabetes. RESULTS: Patients were followed for a median of 18 years (range 1-22 years...

  7. Single-molecule motions and interactions in live cells reveal target search dynamics in mismatch repair.

    Science.gov (United States)

    Liao, Yi; Schroeder, Jeremy W; Gao, Burke; Simmons, Lyle A; Biteen, Julie S

    2015-12-15

    MutS is responsible for initiating the correction of DNA replication errors. To understand how MutS searches for and identifies rare base-pair mismatches, we characterized the dynamic movement of MutS and the replisome in real time using superresolution microscopy and single-molecule tracking in living cells. We report that MutS dynamics are heterogeneous in cells, with one MutS population exploring the nucleoid rapidly, while another MutS population moves to and transiently dwells at the replisome region, even in the absence of appreciable mismatch formation. Analysis of MutS motion shows that the speed of MutS is correlated with its separation distance from the replisome and that MutS motion slows when it enters the replisome region. We also show that mismatch detection increases MutS speed, supporting the model for MutS sliding clamp formation after mismatch recognition. Using variants of MutS and the replication processivity clamp to impair mismatch repair, we find that MutS dynamically moves to and from the replisome before mismatch binding to scan for errors. Furthermore, a block to DNA synthesis shows that MutS is only capable of binding mismatches near the replisome. It is well-established that MutS engages in an ATPase cycle, which is necessary for signaling downstream events. We show that a variant of MutS with a nucleotide binding defect is no longer capable of dynamic movement to and from the replisome, showing that proper nucleotide binding is critical for MutS to localize to the replisome in vivo. Our results provide mechanistic insight into the trafficking and movement of MutS in live cells as it searches for mismatches.

  8. The small molecule inhibitor QLT0267 Radiosensitizes squamous cell carcinoma cells of the head and neck.

    Directory of Open Access Journals (Sweden)

    Iris Eke

    Full Text Available BACKGROUND: The constant increase of cancer cell resistance to radio- and chemotherapy hampers improvement of patient survival and requires novel targeting approaches. Integrin-Linked Kinase (ILK has been postulated as potent druggable cancer target. On the basis of our previous findings clearly showing that ILK transduces antisurvival signals in cells exposed to ionizing radiation, this study evaluated the impact of the small molecule inhibitor QLT0267, reported as putative ILK inhibitor, on the cellular radiation survival response of human head and neck squamous cell carcinoma cells (hHNSCC. METHODOLOGY/PRINCIPAL FINDINGS: Parental FaDu cells and FaDu cells stably transfected with a constitutively active ILK mutant (FaDu-IH or empty vectors, UTSCC45 cells, ILK(floxed/floxed(fl/fl and ILK(-/- mouse fibroblasts were used. Cells grew either two-dimensionally (2D on or three-dimensionally (3D in laminin-rich extracellular matrix. Cells were treated with QLT0267 alone or in combination with irradiation (X-rays, 0-6 Gy single dose. ILK knockdown was achieved by small interfering RNA transfection. ILK kinase activity, clonogenic survival, number of residual DNA double strand breaks (rDSB; gammaH2AX/53BP1 foci assay, cell cycle distribution, protein expression and phosphorylation (e.g. Akt, p44/42 mitogen-activated protein kinase (MAPK were measured. Data on ILK kinase activity and phosphorylation of Akt and p44/42 MAPK revealed a broad inhibitory spectrum of QLT0267 without specificity for ILK. QLT0267 significantly reduced basal cell survival and enhanced the radiosensitivity of FaDu and UTSCC45 cells in a time- and concentration-dependent manner. QLT0267 exerted differential, cell culture model-dependent effects with regard to radiogenic rDSB and accumulation of cells in the G2 cell cycle phase. Relative to corresponding controls, FaDu-IH and ILK(fl/fl fibroblasts showed enhanced radiosensitivity, which failed to be antagonized by QLT0267. A

  9. Modulation of Human Leukocyte Antigen-C by Human Cytomegalovirus Stimulates KIR2DS1 Recognition by Natural Killer Cells.

    Science.gov (United States)

    van der Ploeg, Kattria; Chang, Chiwen; Ivarsson, Martin A; Moffett, Ashley; Wills, Mark R; Trowsdale, John

    2017-01-01

    The interaction of inhibitory killer cell Ig-like receptors (KIRs) with human leukocyte antigen (HLA) class I molecules has been characterized in detail. By contrast, activating members of the KIR family, although closely related to inhibitory KIRs, appear to interact weakly, if at all, with HLA class I. KIR2DS1 is the best studied activating KIR and it interacts with C2 group HLA-C (C2-HLA-C) in some assays, but not as strongly as KIR2DL1. We used a mouse 2B4 cell reporter system, which carries NFAT-green fluorescent protein with KIR2DS1 and a modified DAP12 adaptor protein. KIR2DS1 reporter cells were not activated upon coculture with 721.221 cells transfected with different HLA-C molecules, or with interferon-γ stimulated primary dermal fibroblasts. However, KIR2DS1 reporter cells and KIR2DS1 + primary natural killer (NK) cells were activated by C2-HLA-C homozygous human fetal foreskin fibroblasts (HFFFs) but only after infection with specific clones of a clinical strain of human cytomegalovirus (HCMV). Active viral gene expression was required for activation of both cell types. Primary NKG2A - KIR2DS1 + NK cell subsets degranulated after coculture with HCMV-infected HFFFs. The W6/32 antibody to HLA class I blocked the KIR2DS1 reporter cell interaction with its ligand on HCMV-infected HFFFs but did not block interaction with KIR2DL1. This implies a differential recognition of HLA-C by KIR2DL1 and KIR2DS1. The data suggest that modulation of HLA-C by HCMV is required for a potent KIR2DS1-mediated NK cell activation.

  10. Expression of cell adhesion molecules in normal nerves, chronic axonal neuropathies and Schwann cell tumors.

    Science.gov (United States)

    Roche, P H; Figarella-Branger, D; Daniel, L; Bianco, N; Pellet, W; Pellissier, J F

    1997-10-22

    Cell adhesion molecules (CAMs) play a role in the normal development and regeneration of tissues as well as in the biological behaviour of tumors. We studied the immunohistochemical expression of various CAMs, such as neural cell adhesion molecule (NCAM), its polysialylated isoform (PSA-NCAM), epithelial (E-) cadherin, and beta1 integrins (alpha2beta1, alpha5beta1, alpha6beta1) in a series of frozen specimens of 10 normal nerves, 5 axonal neuropathies, 26 benign Schwannomas and 2 malignant peripheral nerve sheath tumors (MNST). NCAM was expressed by non-myelinating Schwann cells from normal nerves and overexpressed by Schwann cells from patients with chronic axonal neuropathies and Schwannomas. The expression was lower in MNST. Expression of PSA-NCAM was heterogeneously displayed by Schwann cells from the various tissues studied. Anti E-cadherin immunoreactivity was present in myelin sheath in normal nerves and axonopathies. It was expressed in some Schwannomas especially in vestibular Schwannomas. Integrins VLA alpha2 and VLA alpha6 were widely expressed by Schwann cells from normal nerves, axonal neuropathies and Schwannomas but their expression was low in MNST. VLA alpha5 was not expressed by Schwann cells from normal nerve and Schwannomas but present in chronic axonal neuropathies and MNST. In addition VLA alpha6 was strongly expressed by perineurial cells. These data show that CAMs have a characteristic pattern of expression in normal nerve. Also, some CAMs are always expressed by Schwann cells but the expression of others differs in normal nerves versus axonopathies or tumors, suggesting a role of the microcellular environment in the regulation of CAM expression. Schwannomas have different pattern of expression than MNST.

  11. Cell Adhesion Molecules of the Immunoglobulin Superfamily in the Nervous System

    DEFF Research Database (Denmark)

    Walmod, Peter Schledermann; Pedersen, Martin Volmer; Berezin, Vladimir

    2007-01-01

    Cell adhesion molecules (CAMs) are proteins mediating cell-cell or cell-extracellular matrix (ECM) interactions. CAMs are traditionally divided into four groups, the cadherins, the selectins, the integrins and CAMs belonging to the immunoglobulin superfamily (IgSF). The present chapter describes...

  12. Recognition of nonpeptide antigens by human V gamma 9V delta 2 T cells requires contact with cells of human origin.

    Science.gov (United States)

    Green, A E; Lissina, A; Hutchinson, S L; Hewitt, R E; Temple, B; James, D; Boulter, J M; Price, D A; Sewell, A K

    2004-06-01

    SUMMARY It is becoming apparent that gamma delta T cells form an important part of the adaptive immune response. However, the ligands recognized by gamma delta T cell receptors (TCRs) and the exact biological function of the cells that express this receptor remain unclear. Numerous studies have shown that the dominant human peripheral blood subset of gamma delta T cells, which express a V gamma 9V delta 2 TCR, can activate in response to low molecular weight nonpeptidic molecules. Some of these components have been purified from bacteria or parasites. We examined the activation of polyclonal gamma delta T cell lines, clones with V gamma 9V delta 2 and V gamma 9V delta 1 TCRs, and gamma delta T cells directly ex vivo in response to multiple phosphate, alkylamine and aminobisphosphonate (nBP) antigens and purified protein derivative from Mycobacterium tuberculosis (PPD). V gamma 9V delta 2 T cells were able to respond to multiple small organic molecules of highly variable structure whereas cells expressing a similar V gamma 9 chain paired with a V delta 1 chain failed to recognize these antigens. Thus, the TCR delta chain appears to make an important contribution to the recognition of these antigens. The kinetics of responses to alkylphosphate and alkylamine antigens differ from those of responses to the nBP pamidronate. These different classes of antigen are believed to have differed mechanisms of action. Such differences explain why nBPs can be pulsed onto antigen presenting cells (APCs) and still retain their ability to activate gamma delta T cells while alkylphosphate and alkylamine antigens cannot. We also demonstrate that a substantial proportion of the cells that produce IFN gamma directly ex vivo in response to PPD are gamma delta T cells and that gamma delta T cell activation requires contact with cells of human origin.

  13. Monofunctional stealth nanoparticle for unbiased single molecule tracking inside living cells.

    Science.gov (United States)

    Lisse, Domenik; Richter, Christian P; Drees, Christoph; Birkholz, Oliver; You, Changjiang; Rampazzo, Enrico; Piehler, Jacob

    2014-01-01

    On the basis of a protein cage scaffold, we have systematically explored intracellular application of nanoparticles for single molecule studies and discovered that recognition by the autophagy machinery plays a key role for rapid metabolism in the cytosol. Intracellular stealth nanoparticles were achieved by heavy surface PEGylation. By combination with a generic approach for nanoparticle monofunctionalization, efficient labeling of intracellular proteins with high fidelity was accomplished, allowing unbiased long-term tracking of proteins in the outer mitochondrial membrane.

  14. The coffee diterpene kahweol inhibits tumor necrosis factor-α-induced expression of cell adhesion molecules in human endothelial cells

    International Nuclear Information System (INIS)

    Kim, Hyung Gyun; Kim, Ji Young; Hwang, Yong Pil; Lee, Kyung Jin; Lee, Kwang Youl; Kim, Dong Hee; Kim, Dong Hyun; Jeong, Hye Gwang

    2006-01-01

    Endothelial cells produce adhesion molecules after being stimulated with various inflammatory cytokines. These adhesion molecules play an important role in the development of atherogenesis. Recent studies have highlighted the chemoprotective and anti-inflammatory effects of kahweol, a coffee-specific diterpene. This study examined the effects of kahweol on the cytokine-induced monocyte/human endothelial cell interaction, which is a crucial early event in atherogenesis. Kahweol inhibited the adhesion of TNFα-induced monocytes to endothelial cells and suppressed the TNFα-induced protein and mRNA expression of the cell adhesion molecules, VCAM-1 and ICAM-1. Furthermore, kahweol inhibited the TNFα-induced JAK2-PI3K/Akt-NF-κB activation pathway in these cells. Overall, kahweol has anti-inflammatory and anti-atherosclerotic activities, which occurs partly by down-regulating the pathway that affects the expression and interaction of the cell adhesion molecules on endothelial cells

  15. Evidence for Nuclear Tensor Polarization of Deuterium Molecules in Storage Cells

    International Nuclear Information System (INIS)

    van den Brand, J.; Bulten, H.; Zhou, Z.; Unal, O.; van den Brand, J.; Ferro-Luzzi, M.; Botto, T.; Bouwhuis, M.; Heimberg, P.; de Jager, C.; de Lange, D.; Nooren, G.; Papadakis, N.; Passchier, I.; Poolman, H.; Steijger, J.; Vodinas, N.; de Vries, H.; van den Brand, J.; Ferro-Luzzi, M.; Lang, J.; Alarcon, R.; Dolfini, S.; Ent, R.; Higinbotham, D.

    1997-01-01

    Deuterium molecules were obtained by recombination, on a copper surface, of deuterium atoms prepared in specific hyperfine states. The molecules were stored for about 5ms in an open-ended cylindrical cell, placed in a 23mT magnetic field, and their tensor polarization was measured by elastic scattering of 704MeV electrons. The results of the measurements are consistent with the deuterium molecules retaining the tensor polarization of the initial atoms. copyright 1997 The American Physical Society

  16. The T-cell accessory molecule CD4 recognizes a monomorphic determinant on isolated Ia

    DEFF Research Database (Denmark)

    Gay, D; Buus, S; Pasternak, J

    1988-01-01

    The membrane protein CD4 is commonly found on mature T cells specific for antigen in association with class II major histocompatibility complex (MHC; Ia) proteins. This correlation has led to the suggestion that CD4 binds to a monomorphic region of the Ia molecule on the antigen-presenting cell...... proteins into a planar membrane system, we show that different Ia molecules can greatly enhance the ability of a CD4+ but not a CD4- variant of this class I-restricted T hybrid to respond to isolated class I molecules. T-cell responses can be strongly augmented by the concurrent expression of CD4 on the T...... cell and any of four different Ia proteins on planar membranes, thus supporting the idea that CD4 binds to a monomorphic region of the Ia molecule and increases the avidity with which the T cell can interact with its target....

  17. INFLUENCE OF SOLUBLE PLACENTAL TISSUE-DERIVED MOLECULES UPON EXPRESSION OF ADHESION MOLECULES BY EA.HY926 ENDOTHELIAL CELLS

    Directory of Open Access Journals (Sweden)

    O. I. Stepanova

    2011-01-01

    Full Text Available Abstract.  Leukocyte  recruitment  to  placental  tissue  is  an  important  factor  of  its  development.  In  this respect, adhesion molecules at the endothelial cell surface represent a key determining factor of leukocyte adhesion and their trans-endothelial migration. The goal of investigation was to evaluate changed expression of adhesion molecules on the endothelial cells induced by supernates of placental tissue cultures. Placental tissue supernatants produced by the first- and third-trimester placental tissue from normal pregnancy, as well as from women with gestosis, induced higher expression of CD31, CD9, CD62E, CD62P, CD34, CD54, CD51/61, CD49d  and  integrin  β7  expression  by  endothelial  cells,  as  compared  with  their  baseline  levels.  However, the  supernates  from  pre-eclamptic  placental  tissue (3rd  trimester  caused  an  increased  CD9  expression by  endothelial  cells,  as  compared  with  effects  of placental  supernates  from  eclampsia-free  cases.  Our data  contribute  to  understanding  a  possible  role  of endothelial cell adhesion molecules in recruitment of leukocytes to placental tissue and possible participation of adhesion molecules in pathogenesis of pre-eclampsia. The work was supported by a grant from Russian Ministry of Education and Science ГК №02.740.11.0711 and Presidential grant № НШ-3594.2010.7 and МД-150.2011.7. (Med. Immunol., 2011, vol. 13, N 6, pp 589-596

  18. Point-of-Care Determination of Acetaminophen Levels with Multi-Hydrogen Bond Manipulated Single-Molecule Recognition (eMuHSiR).

    Science.gov (United States)

    Zhang, Yan; Huang, Zhongyuan; Wang, Letao; Wang, Chunming; Zhang, Changde; Wiese, Tomas; Wang, Guangdi; Riley, Kevin; Wang, Zhe

    2018-04-03

    This work aims to face the challenge of monitoring small molecule drugs accurately and rapidly for point-of-care (POC) diagnosis in current clinical settings. Overdose of acetaminophen (AP), a commonly used over the counter (OTC) analgesic drug, has been determined to be a major cause of acute liver failure in the US and the UK. However, there is no rapid and accurate detection method available for this drug in the emergency room. The present study examined an AP sensing strategy that relies on a previously unexplored strong interaction between AP and the arginine (Arg) molecule. It was found that as many as 4 hydrogen bonds can be formed between one Arg molecule and one AP molecule. By taking advantages of this structural selectivity and high tenability of hydrogen bonds, Arg, immobilized on a graphene surface via electrostatic interactions, was utilized to structurally capture AP. Interestingly, bonded AP still remained the perfect electrochemical activities. The extent of Arg-AP bonds was quantified using a newly designed electrochemical (EC) sensor. To verify the feasibility of this novel assay, based on multihydrogen bond manipulated single-molecule recognition (eMuHSiR), both pharmaceutical and serum sample were examined. In commercial tablet measurement, no significant difference was seen between the results of eMuHSiR and other standard methods. For measuring AP concentration in the mice blood, the substances in serum, such as sugars and fats, would not bring any interference to the eMuHSiR in a wide concentration range. This eMuHSiR method opens the way for future development of small molecule detection for the POC testing.

  19. Fully synthetic phage-like system for screening mixtures of small molecules in live cells.

    Science.gov (United States)

    Byk, Gerardo; Partouche, Shirly; Weiss, Aryeh; Margel, Shlomo; Khandadash, Raz

    2010-05-10

    A synthetic "phage-like" system was designed for screening mixtures of small molecules in live cells. The core of the system consists of 2 mum diameter cross-linked monodispersed microspheres bearing a panel of fluorescent tags and peptides or small molecules either directly synthesized or covalently conjugated to the microspheres. The microsphere mixtures were screened for affinity to cell line PC-3 (prostate cancer model) by incubation with live cells, and as was with phage-display peptide methods, unbound microspheres were removed by repeated washings followed by total lysis of cells and analysis of the bound microspheres by flow-cytometry. Similar to phage-display peptide screening, this method can be applied even in the absence of prior information about the cellular targets of the candidate ligands, which makes the system especially interesting for selection of molecules with high affinity for desired cells, tissues, or tumors. The advantage of the proposed system is the possibility of screening synthetic non-natural peptides or small molecules that cannot be expressed and screened using phage display libraries. A library composed of small molecules synthesized by the Ugi reaction was screened, and a small molecule, Rak-2, which strongly binds to PC-3 cells was found. Rak-2 was then individually synthesized and validated in a complementary whole cell-based binding assay, as well as by live cell microscopy. This new system demonstrates that a mixture of molecules bound to subcellular sized microspheres can be screened on plated cells. Together with other methods using subcellular sized particles for cellular multiplexing, this method represents an important milestone toward high throughput screening of mixtures of small molecules in live cells and in vivo with potential applications in the fields of drug delivery and diagnostic imaging.

  20. Role for Adhesion Molecules in the Spermatogonial Stem Cell Niche

    NARCIS (Netherlands)

    de Rooij, Dirk G.; Repping, S.; van Pelt, Ans M. M.

    2008-01-01

    In this issue of Cell Stem Cell, Kanatsu-Shinohara et al. (2008) show that beta 1-integrin participates in normal spermatogenesis and is required for spermatogonial stem cell (SSC) homing to the basal membrane niche. The methodology used provides a powerful tool to study the role of other factors in

  1. Differential Signaling and Sugar Exchanges in Response to Avirulent Pathogen- and Symbiont-Derived Molecules in Tobacco Cells

    Directory of Open Access Journals (Sweden)

    Carole Pfister

    2017-11-01

    Full Text Available Plants interact with microbes whose ultimate aim is to exploit plant carbohydrates for their reproduction. Plant–microbe interactions (PMIs are classified according to the nature of their trophic exchanges: while mutualistic microbes trade nutrients with plants, pathogens unilaterally divert carbohydrates. The early responses following microbe recognition and the subsequent control of plant sugar distribution are still poorly understood. To further decipher PMI functionality, we used tobacco cells treated with microbial molecules mimicking pathogenic or mutualistic PMIs, namely cryptogein, a defense elicitor, and chitotetrasaccharide (CO4, which is secreted by mycorrhizal fungi. CO4 was perceived by tobacco cells and triggered widespread transient signaling components such as a sharp cytosolic Ca2+ elevation, NtrbohD-dependent H2O2 production, and MAP kinase activation. These CO4-induced events differed from those induced by cryptogein, i.e., sustained events leading to cell death. Furthermore, cryptogein treatment inhibited glucose and sucrose uptake but not fructose uptake, and promoted the expression of NtSUT and NtSWEET sugar transporters, whereas CO4 had no effect on sugar uptake and only a slight effect on NtSWEET2B expression. Our results suggest that microbial molecules induce different signaling responses that reflect microbial lifestyle and the subsequent outcome of the interaction.

  2. Facts on the fragmentation of antigens in presenting cells, on the association of antigen fragments with MHC molecules in cell-free systems, and speculation on the cell biology of antigen processing

    DEFF Research Database (Denmark)

    Werdelin, O; Mouritsen, S; Petersen, B L

    1988-01-01

    The processing of a protein antigen is a multi-step event taking place in antigen-presenting cells. Processing is a prerequisite for the recognition of most antigens by T lymphocytes. The antigen is ingested by endocytosis, transported to an acid cellular compartment and subjected to proteolytic...... fragmentation. Some of the antigen fragments bind to MHC class II molecules and are transported to the surface of the antigen-presenting cell where the actual presentation to T lymphocytes occurs. The nature of the processed antigen, how and where it is derived and subsequently becomes associated with MHC...

  3. Single-molecule tracking in living cells using single quantum dot applications.

    Science.gov (United States)

    Baba, Koichi; Nishida, Kohji

    2012-01-01

    Revealing the behavior of single molecules in living cells is very useful for understanding cellular events. Quantum dot probes are particularly promising tools for revealing how biological events occur at the single molecule level both in vitro and in vivo. In this review, we will introduce how single quantum dot applications are used for single molecule tracking. We will discuss how single quantum dot tracking has been used in several examples of complex biological processes, including membrane dynamics, neuronal function, selective transport mechanisms of the nuclear pore complex, and in vivo real-time observation. We also briefly discuss the prospects for single molecule tracking using advanced probes.

  4. Ia-restricted B-B cell interaction. I. The MHC haplotype of bone marrow cells present during B cell ontogeny dictates the self-recognition specificity of B cells in the polyclonal B cell activation by a B cell differentiation factor, B151-TRF2

    International Nuclear Information System (INIS)

    Ono, S.; Takahama, Y.; Hamaoka, T.

    1987-01-01

    We have demonstrated that B cell recognition of Ia molecules is involved in polyclonal B cell differentiation by B151-TRF2. The present study was undertaken to examine the Ia recognition specificity of B151-TRF2-responsive B cells in fully major histocompatibility complex (MHC)-allogeneic P1----P2, semiallogeneic P1----(P1 x P2)F1, and double donor (P1 + P2)----(P1 x P2)F1 and (P1 + P2)----P1 radiation bone marrow chimeras. The B cells from both P1----P2 and P1----(P1 x P2)F1 chimeras could give rise to in vitro immunoglobulin M-producing cells upon stimulation with B151-TRF2 comparable in magnitude to that of normal P1 B cells, and their responses were inhibited by anti-I-AP1 but not by anti-I-AP2 monoclonal antibody even in the presence of mitomycin C-treated T cell-depleted P2 spleen cells as auxiliary cells. In contrast, the B151-TRF2 responses of P1 B cells isolated from both (P1 + P2)----(P1 x P2)F1 and (P1 + P2)----P1 double bone marrow chimeras became sensitive to the inhibition of not only anti-I-AP1 but also anti-I-AP2 monoclonal antibody only when the culture was conducted in the presence of P2 auxiliary cells, demonstrating that they adaptively differentiate to recognize as self-structures allogeneic as well as syngeneic Ia molecules. Moreover, the experiments utilizing B cells from H-2-congenic mice and B cell hybridoma clones as auxiliary cells revealed that B151-TRF2-responsive B cells recognize Ia molecules expressed on B cells. Taken together, these results demonstrate that B151-TRF2-responsive B cells recognize Ia molecules expressed by B cells as self-structures and that their self-recognition specificity is dictated by the MHC haplotype of bone marrow cells present during the B cell ontogeny but not by the MHC haplotype of a radiation-resistant host environment

  5. Cleavage and Cell Adhesion Properties of Human Epithelial Cell Adhesion Molecule (HEPCAM)*

    Science.gov (United States)

    Tsaktanis, Thanos; Kremling, Heidi; Pavšič, Miha; von Stackelberg, Ricarda; Mack, Brigitte; Fukumori, Akio; Steiner, Harald; Vielmuth, Franziska; Spindler, Volker; Huang, Zhe; Jakubowski, Jasmine; Stoecklein, Nikolas H.; Luxenburger, Elke; Lauber, Kirsten; Lenarčič, Brigita; Gires, Olivier

    2015-01-01

    Human epithelial cell adhesion molecule (HEPCAM) is a tumor-associated antigen frequently expressed in carcinomas, which promotes proliferation after regulated intramembrane proteolysis. Here, we describe extracellular shedding of HEPCAM at two α-sites through a disintegrin and metalloprotease (ADAM) and at one β-site through BACE1. Transmembrane cleavage by γ-secretase occurs at three γ-sites to generate extracellular Aβ-like fragments and at two ϵ-sites to release human EPCAM intracellular domain HEPICD, which is efficiently degraded by the proteasome. Mapping of cleavage sites onto three-dimensional structures of HEPEX cis-dimer predicted conditional availability of α- and β-sites. Endocytosis of HEPCAM warrants acidification in cytoplasmic vesicles to dissociate protein cis-dimers required for cleavage by BACE1 at low pH values. Intramembrane cleavage sites are accessible and not part of the structurally important transmembrane helix dimer crossing region. Surprisingly, neither chemical inhibition of cleavage nor cellular knock-out of HEPCAM using CRISPR-Cas9 technology impacted the adhesion of carcinoma cell lines. Hence, a direct function of HEPCAM as an adhesion molecule in carcinoma cells is not supported and appears to be questionable. PMID:26292218

  6. Molecule mechanism of stem cells in Arabidopsis thaliana

    OpenAIRE

    Wenjin Zhang; Rongming Yu

    2014-01-01

    Plants possess the ability to continually produce new tissues and organs throughout their life. Unlike animals, plants are exposed to extreme variations in environmental conditions over the course of their lives. The vitality of plants is so powerful that they can survive several hundreds of years or even more making it an amazing miracle that comes from plant stem cells. The stem cells continue to divide to renew themselves and provide cells for the formation of leaves, stems, and flowers. S...

  7. A-D-A small molecules for solution-processed organic photovoltaic cells.

    Science.gov (United States)

    Ni, Wang; Wan, Xiangjian; Li, Miaomiao; Wang, Yunchuang; Chen, Yongsheng

    2015-03-25

    A-D-A small molecules have drawn more and more attention in solution-processed organic solar cells due to the advantages of a diversity of structures, easy control of energy levels, etc. Recently, a power conversion efficiency of nearly 10% has been achieved through careful material design and device optimization. This feature article reviews recent representative progress in the design and application of A-D-A small molecules in organic photovoltaic cells.

  8. Direct binding of autoimmune disease related T cell epitopes to purified Lewis rat MHC class II molecules

    DEFF Research Database (Denmark)

    Joosten, I; Wauben, M H; Holewijn, M C

    1994-01-01

    characteristics of the Lewis rat MHC class II RT1.B1 molecule. We have now developed a biochemical binding assay which enables competition studies in which the relative MHC binding affinity of a set of non-labelled peptides can be assessed while employing detection of biotinylated marker peptides......New strategies applied in the treatment of experimental autoimmune disease models involve blocking or modulation of MHC-peptide-TCR interactions either at the level of peptide-MHC interaction or, alternatively, at the level of T cell recognition. In order to identify useful competitor peptides one...... must be able to assess peptide-MHC interactions. Several well described autoimmune disease models exist in the Lewis rat and thus this particular rat strain provides a good model system to study the effect of competitor peptides. So far no information has been available on the peptide binding...

  9. A neural cell adhesion molecule-derived peptide reduces neuropathological signs and cognitive impairment induced by Abeta25-35

    DEFF Research Database (Denmark)

    Klementiev, B; Novikova, T; Novitskaya, V

    2007-01-01

    death and brain atrophy in response to Abeta25-35. Finally, the Abeta25-35-administration led to a reduced short-term memory as determined by the social recognition test. A synthetic peptide termed FGL derived from the neural cell adhesion molecule (NCAM) was able to prevent or, if already manifest......, strongly reduce all investigated signs of Abeta25-35-induced neuropathology and cognitive impairment. The FGL peptide was recently demonstrated to be able to cross the blood-brain-barrier. Accordingly, we found that the beneficial effects of FGL were achieved not only by intracisternal, but also...... and cognitive impairment involves the modulation of intracellular signal-transduction mediated through GSK3beta....

  10. The novel carbohydrate epitope L3 is shared by some neural cell adhesion molecules.

    Science.gov (United States)

    Kücherer, A; Faissner, A; Schachner, M

    1987-06-01

    The monoclonal L3 antibody reacts with an N-glycosidically linked carbohydrate structure on at least nine glycoproteins of adult mouse brain. Three out of the L3 epitope-carrying glycoproteins could be identified as the neural cell adhesion molecules L1 and myelin-associated glycoprotein, and the novel adhesion molecule on glia. Expression of the L3 carbohydrate epitope is regulated independently of the protein backbone of these three glycoproteins. Based on the observation that out of three functionally characterized L3 epitope-carrying glycoproteins three fulfill the operational definition of an adhesion molecule, we would like to suggest that they form a new family of adhesion molecules that is distinct from the L2/HNK-1 carbohydrate epitope family of neural cell adhesion molecules. Interestingly, some members in each family appear to be unique to one family while other members belong to the two families.

  11. Matter in strong fields: from molecules to living cells

    International Nuclear Information System (INIS)

    Mathur, D

    2007-01-01

    Strong optical fields induce multiple ionization in irradiated molecules. The ionization dynamics are governed by optical-field-induced distortions of molecular potential energy surfaces and molecular dissociation is the expected by-product. Recent experiments have even shown, quite counter-intuitively, that strong optical fields may even induce bond formation processes in molecules. All such processes are all manifestations of how intense light affects matter. In turn, matter also affects intense light. A visually dramatic manifestation of matter affecting light is obtained when ultrashort pulses of intense light propagate though condensed matter. The temporal and spatial properties of the incident light pulse are modified, and such modifications manifest themselves in an enlarged optical frequency sweep, resulting in the generation of broadband radiation (white light) known as supercontinuum production. Although the physics that governs supercontinuum generation is not properly understood, some recent progress is summarized. Novel applications of strong field phenomena are reported that are of relevance in the biomedical and life sciences

  12. Modulation of adhesion molecules by cholesterol-lowering therapy in mononuclear cells from hypercholesterolemic patients.

    Science.gov (United States)

    Cerda, Alvaro; Rodrigues, Alice Cristina; Alves, Camila; Genvigir, Fabiana Dalla Vecchia; Fajardo, Cristina Moreno; Dorea, Egidio Lima; Gusukuma, Maria Cecilia; Pinto, Gelba Almeida; Hirata, Mario Hiroyuki; Hirata, Rosario Dominguez Crespo

    2015-08-01

    Cholesterol-lowering therapy has been related with several pleiotropic effects including anti-inflammatory action in vascular endothelium; however, their influence on monocyte adhesion molecules is poorly described. To investigate the effect of inhibitors of synthesis (statins) and absorption (ezetimibe) of cholesterol on expression of adhesion molecules L-selectin, PSGL-1, VLA-4, LFA-1, and Mac-1 in mononuclear cells in vivo and in vitro using THP-1 cells. The influence of simvastatin (10 mg/day), ezetimibe (10 mg/day), and their combination (10 mg each/day) on mRNA expression of adhesion molecules was analyzed in peripheral blood mononuclear cells (PBMC) from hypercholesterolemics. The effects of atorvastatin, simvastatin, and ezetimibe on mRNA and protein expression of adhesion molecules were also evaluated in THP-1 cells. Simvastatin/ezetimibe combination, but not the monotherapies, reduced the mRNA expression of the PSGL-1, LFA-1, and Mac-1 genes in PBMC from hypercholesterolemics. Total and LDL cholesterol in serum correlated with PSGL-1 mRNA expression, whereas HDL cholesterol negatively correlated with mRNA levels of L-selectin and VLA-4 genes (P molecules in PBMC from hypercholesterolemics and THP-1 cells. Simvastatin/ezetimibe combination gives more benefits by reducing to a larger extent the expression of adhesion molecules in mononuclear cells. © 2015 John Wiley & Sons Ltd.

  13. Small Molecules Affect Human Dental Pulp Stem Cell Properties Via Multiple Signaling Pathways

    Science.gov (United States)

    Al-Habib, Mey; Yu, Zongdong

    2013-01-01

    One fundamental issue regarding stem cells for regenerative medicine is the maintenance of stem cell stemness. The purpose of the study was to test whether small molecules can enhance stem cell properties of mesenchymal stem cells (MSCs) derived from human dental pulp (hDPSCs), which have potential for multiple clinical applications. We identified the effects of small molecules (Pluripotin (SC1), 6-bromoindirubin-3-oxime and rapamycin) on the maintenance of hDPSC properties in vitro and the mechanisms involved in exerting the effects. Primary cultures of hDPSCs were exposed to optimal concentrations of these small molecules. Treated hDPSCs were analyzed for their proliferation, the expression levels of pluripotent and MSC markers, differentiation capacities, and intracellular signaling activations. We found that small molecule treatments decreased cell proliferation and increased the expression of STRO-1, NANOG, OCT4, and SOX2, while diminishing cell differentiation into odonto/osteogenic, adipogenic, and neurogenic lineages in vitro. These effects involved Ras-GAP-, ERK1/2-, and mTOR-signaling pathways, which may preserve the cell self-renewal capacity, while suppressing differentiation. We conclude that small molecules appear to enhance the immature state of hDPSCs in culture, which may be used as a strategy for adult stem cell maintenance and extend their capacity for regenerative applications. PMID:23573877

  14. Curcumin attenuates TNF-α-induced expression of intercellular adhesion molecule-1, vascular cell adhesion molecule-1 and proinflammatory cytokines in human endometriotic stromal cells.

    Science.gov (United States)

    Kim, Ki-Hyung; Lee, Eun Na; Park, Jin Kyeong; Lee, Ja-Rang; Kim, Ji-Hyun; Choi, Hak-Jong; Kim, Bong-Seon; Lee, Hee-Woo; Lee, Kyu-Sup; Yoon, Sik

    2012-07-01

    Curcumin, a naturally occurring polyphenolic compound from Curcuma longa, has long been used in folk medicine as an antiinflammatory remedy in Asian countries. Endometriosis is a chronic gynecological inflammatory disorder in which immune system deregulation may play a role in its initiation and progression. A number of mediators, including cell adhesion molecules such as intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1); proinflammatory cytokines such as tumour necrosis factor-α (TNF-α), interleukin-1 (IL-1), IL-6 and IL-8; and chemokines such as monocyte chemotactic protein-1 (MCP-1), play key roles in the pathogenesis of endometriosis. The aim of our study was to explore the effect of curcumin on the expression of these critical molecules in human ectopic endometriotic stromal cells isolated from women with endometriosis. Endometriotic stromal cells treated with curcumin showed marked suppression of TNF-α-induced mRNA expression of ICAM-1 and VCAM-1. Curcumin treatment also significantly decreased the TNF-α-induced cell surface and total protein expression of ICAM-1 and VCAM-1 in a dose-dependent manner. In addition, treatment of endometriotic stromal cells with curcumin markedly inhibited TNF-α-induced secretion of IL-6, IL-8 and MCP-1. Furthermore, curcumin inhibited the activation of transcription factor NF-κB, a key regulator of inflammation, in human endometriotic stromal cells. These findings suggest that curcumin may have potential therapeutic uses in the prevention and treatment of endometriosis. Copyright © 2011 John Wiley & Sons, Ltd.

  15. Neural cell adhesion molecules in rodent brains isolated by monoclonal antibodies with cross-species reactivity.

    OpenAIRE

    Chuong, C M; McClain, D A; Streit, P; Edelman, G M

    1982-01-01

    Previous studies in this laboratory have led to the identification and purification of a chicken cell surface protein named "neural cell adhesion molecule" (N-CAM) that is involved in neural cell-cell and neurite-neurite interactions. In the present investigation, we have found that a similar molecule exists in the mouse and have confirmed that it is also present in rat neural tissue. A monoclonal antibody to chicken N-CAM that crossreacted with mouse and rat brains and an independently deriv...

  16. Photodynamic therapy application of PAMAM-porphyrin molecule on stomach cancer cells

    Science.gov (United States)

    Kiris, Tugba; Burgucu, Mehmet Necmi; Sagir, Tugba; Senel, Mehmet; Isik, Sevim; Bölük-basi Ates, Gamze; Tabakoglu, Hasim Ozgur

    2015-03-01

    In this study, effect of a novel LED-based light source developed for 96-well-plates cell culture applications, was tried on AGS stomach cancer cell line, in combination with Poly(amido amine) (PAMAM) modified - porhyrin molecule. For each 4 generation of modified PpIX molecule 5 different concentrations tried. According to results PAMAM molecule doesnt have any photosensitizer property also didn't show any toxic effect even if higher concentrations. Morphology and real time monitoring analysis results hold up each other and confirmed that, PpIX molecules with and without modificated high concentrations (>100μM) caused cell death via toxicicity this reason optimal concentration for PAMAM modified PpIX should be between 25 - 50 μm concentration .

  17. Research on effects of ionizing radiation of human peripheral blood white cell adhesive molecules

    International Nuclear Information System (INIS)

    Li Haijun; Cheng Ying; Le Chen; Min Rui

    2008-01-01

    Objective: To investigate the links between expression and function of adhesive molecule on the surface of irradiated peripheral blood white cells. Methods: Heparinized human peripheral blood was exposed to γ rays with different dose. At the different post-radiation time adhesive molecule expression on cellular surface was determined by double fluorescence labeling antibodies which were against adhesive molecule and special mark of granulocyte or mononuclear cell respectively with flow cytometry, and cellular adhesive ability to different matrixes mediated by adhesive molecule was estimated by commercializing enzyme-linked immunosorbent assay kit and crystalviolet dying. Results: A decline pattern of CD11b on surface of mononuclear cells and CD29 on surface of granulocyte with irradiation dose increase was found. The changes of adhesive ability of mononuclear cells to substance of β1-integrin and collagen-I was well related with irradiation dose. Conclusion: Good relationship shown by the changes of adhesive molecule expression and adhesive ability mediated by the molecules on the surface of peripheral blood white cells with radiation dose was primary base of further research on indicting exposure dose by biomarker. (authors)

  18. Differential expression of neural cell adhesion molecule and cadherins in pancreatic islets, glucagonomas, and insulinomas

    DEFF Research Database (Denmark)

    Møller, C J; Christgau, S; Williamson, M R

    1992-01-01

    (delta-cells), and pancreatic polypeptide (PP-cells) in a sequential order. The endocrine cells are believed to arise from a stem cell with neuronal traits. The developmental lineage from a common neuron-like progenitor is evidenced by: transient coexpression of more than one cell type-specific hormone......-cadherin in brain. Insulinoma cells express E-cadherin but differ from primary islet cells by expressing a second cadherin molecule, which is similar to N-cadherin. The expression of NCAM and cadherin isoforms in the glucagonoma suggest that this transformed alpha-cell type has converted to an immature phenotype......The endocrine cells of the pancreas develop from the endoderm and yet display several characteristics of a neuronal phenotype. During embryonic life, ductal epithelial cells give rise to first the glugagon-producing cells (alpha-cells) and then cells that express insulin (beta-cells), somatostatin...

  19. Programmed cell death in Acanthamoeba castellanii Neff induced by several molecules present in olive leaf extracts.

    Directory of Open Access Journals (Sweden)

    Ines Sifaoui

    Full Text Available Therapy against Acanthamoeba infections such as Granulomatous Amoebic Encephalitis (GAE and Acanthamoeba Keratitis (AK, remains as an issue to be solved due to the existence of a cyst stage which is highly resistant to most chemical and physical agents. Recently, the activity of Olive Leaf Extracts (OLE was demonstrated against Acanthamoeba species. However, the molecules involved in this activity were not identified and/or evaluated. Therefore, the aim of this study was to evaluate the activity of the main molecules which are present in OLE and secondly to study their mechanism of action in Acanthamoeba. Among the tested molecules, the observed activities ranged from an IC50 of 6.59 in the case of apigenine to an IC50 > 100 μg/ml for other molecules. After that, elucidation of the mechanism of action of these molecules was evaluated by the detection of changes in the phosphatidylserine (PS exposure, the permeability of the plasma membrane, the mitochondrial membrane potential and the ATP levels in the treated cells. Vanillic, syringic and ursolic acids induced the higher permeabilization of the plasma membrane. Nevertheless, the mitochondrial membrane was altered by all tested molecules which were also able to decrease the ATP levels to less than 50% in IC90 treated cells after 24 h. Therefore, all the molecules tested in this study could be considered as a future therapeutic alternative against Acanthamoeba spp. Further studies are needed in order to establish the true potential of these molecules against these emerging opportunistic pathogenic protozoa.

  20. Programmed cell death in Acanthamoeba castellanii Neff induced by several molecules present in olive leaf extracts.

    Science.gov (United States)

    Sifaoui, Ines; López-Arencibia, Atteneri; Martín-Navarro, Carmen Mª; Reyes-Batlle, María; Wagner, Carolina; Chiboub, Olfa; Mejri, Mondher; Valladares, Basilio; Abderrabba, Manef; Piñero, José E; Lorenzo-Morales, Jacob

    2017-01-01

    Therapy against Acanthamoeba infections such as Granulomatous Amoebic Encephalitis (GAE) and Acanthamoeba Keratitis (AK), remains as an issue to be solved due to the existence of a cyst stage which is highly resistant to most chemical and physical agents. Recently, the activity of Olive Leaf Extracts (OLE) was demonstrated against Acanthamoeba species. However, the molecules involved in this activity were not identified and/or evaluated. Therefore, the aim of this study was to evaluate the activity of the main molecules which are present in OLE and secondly to study their mechanism of action in Acanthamoeba. Among the tested molecules, the observed activities ranged from an IC50 of 6.59 in the case of apigenine to an IC50 > 100 μg/ml for other molecules. After that, elucidation of the mechanism of action of these molecules was evaluated by the detection of changes in the phosphatidylserine (PS) exposure, the permeability of the plasma membrane, the mitochondrial membrane potential and the ATP levels in the treated cells. Vanillic, syringic and ursolic acids induced the higher permeabilization of the plasma membrane. Nevertheless, the mitochondrial membrane was altered by all tested molecules which were also able to decrease the ATP levels to less than 50% in IC90 treated cells after 24 h. Therefore, all the molecules tested in this study could be considered as a future therapeutic alternative against Acanthamoeba spp. Further studies are needed in order to establish the true potential of these molecules against these emerging opportunistic pathogenic protozoa.

  1. T cell recognition of rat myelin basic protein as a TCR antagonist inhibits reciprocal activation of antigen-presenting cells and engenders resistance to experimental autoimmune encephalomyelitis.

    Science.gov (United States)

    Walker, M R; Mannie, M D

    2001-06-01

    The aim of this study was to assess whether T cell recognition of myelin basic protein (MBP) as a partially antagonistic self antigen regulates the reciprocal activation of professional antigen-presenting cells (APC). This study focused on the rat 3H3 T cell clone that recognized guinea pig (GP) MBP as a full agonist and self rat (R) MBP as a partial agonist. In cultures of 3H3 T cells and splenic APC, the agonist GPMBP elicited several responses by splenic APC, including production of nitric oxide, down-regulation of I-A, induction of B7.1 and B7.2, and prolongation of APC survival. RMBP stimulated a partial increase in production of nitric oxide, partially promoted survival of splenic APC, but did not alter expression of I-A, B7.1, or B7.2 on splenic APC. In the presence ofGPMBP, RMBP antagonized agonist-stimulated induction of B7 molecules, reversed the loss of I-A, and promoted the generation of I-A(+), costimulus-deficient APC. Furthermore, 3H3 T cells cultured with RMBP and irradiated splenocytes reduced the severity of EAE upon adoptive transfer into naive rat recipients subsequently challenged with an encephalitogenic dose of GPMBP/CFA. Overall, this study indicates that T cell receptor antagonism blocks T cell activation, inhibits feedback activation of splenic APC, and promotes T cell-dependent regulatory activities in EAE.

  2. In situ single molecule imaging of cell membranes: linking basic nanotechniques to cell biology, immunology and medicine

    Science.gov (United States)

    Pi, Jiang; Jin, Hua; Yang, Fen; Chen, Zheng W.; Cai, Jiye

    2014-10-01

    The cell membrane, which consists of a viscous phospholipid bilayer, different kinds of proteins and various nano/micrometer-sized domains, plays a very important role in ensuring the stability of the intracellular environment and the order of cellular signal transductions. Exploring the precise cell membrane structure and detailed functions of the biomolecules in a cell membrane would be helpful to understand the underlying mechanisms involved in cell membrane signal transductions, which could further benefit research into cell biology, immunology and medicine. The detection of membrane biomolecules at the single molecule level can provide some subtle information about the molecular structure and the functions of the cell membrane. In particular, information obtained about the molecular mechanisms and other information at the single molecule level are significantly different from that detected from a large amount of biomolecules at the large-scale through traditional techniques, and can thus provide a novel perspective for the study of cell membrane structures and functions. However, the precise investigations of membrane biomolecules prompts researchers to explore cell membranes at the single molecule level by the use of in situ imaging methods, as the exact conformation and functions of biomolecules are highly controlled by the native cellular environment. Recently, the in situ single molecule imaging of cell membranes has attracted increasing attention from cell biologists and immunologists. The size of biomolecules and their clusters on the cell surface are set at the nanoscale, which makes it mandatory to use high- and super-resolution imaging techniques to realize the in situ single molecule imaging of cell membranes. In the past few decades, some amazing imaging techniques and instruments with super resolution have been widely developed for molecule imaging, which can also be further employed for the in situ single molecule imaging of cell membranes. In

  3. Activation of toll-like receptors and dendritic cells by a broad range of bacterial molecules

    NARCIS (Netherlands)

    Boele, L.C.L.; Bajramovic, J.J.; Vries, A.M.M.B.C. de; Voskamp-Visser, I.A.I.; Kaman, W.E.; Kleij, D. van der

    2009-01-01

    Activation of pattern recognition receptors such as Toll-like receptors (TLRs) by pathogens leads to activation and maturation of dendritic cells (DC), which orchestrate the development of the adaptive immune response. To create an overview of the effects of a broad range of pathogenic bacteria,

  4. Placement of molecules in (not out of) the cell

    International Nuclear Information System (INIS)

    Dauter, Zbigniew

    2013-01-01

    The importance of presenting macromolecular structures in unified, standard ways is discussed. To uniquely describe a crystal structure, it is sufficient to specify the crystal unit cell and symmetry, and describe the unique structural motif which is repeated by the space-group symmetry throughout the whole crystal. It is somewhat arbitrary how such a unique motif can be defined and positioned with respect to the unit-cell origin. As a result of such freedom, some isomorphous structures are presented in the Protein Data Bank in different locations and appear as if they have different atomic coordinates, despite being completely equivalent structurally. This may easily confuse those users of the PDB who are less familiar with crystallographic symmetry transformations. It would therefore be beneficial for the community of PDB users to introduce standard rules for locating crystal structures of macromolecules in the unit cells of various space groups

  5. Microassay for measurement of binding of radiolabelled ligands to cell surface molecules

    International Nuclear Information System (INIS)

    Woof, J.M.; Burton, D.R.

    1988-01-01

    An improved technique for measuring the binding of radiolabelled ligands to cell surface molecules has been developed by modification of a procedure using centrifugation through a water-immiscible oil to separate free and cell-bound ligand. It maximises the percentage of ligand bound since cell-bound and free ligand can be separated easily and reproducibly even when very small reaction volumes are used. This permits low levels of ligand radiolabelling and relatively low numbers of cells to be used

  6. Peptide modification in T cell immunology - from molecule to animal

    NARCIS (Netherlands)

    Haan, Ellen Christine de

    2003-01-01

    Chemical knowledge can be applied in the field of immunology. It provides a better understanding of how a peptide interacts with proteins and cells of the immune system. However, it is not possible to predict the outcome of peptide administration in an animal. Peptides are used in experimental

  7. [Impact of stromal interaction molecule 1 silencing on cell cycle of endothelial progenitor cells].

    Science.gov (United States)

    Kuang, Chun-Yan; Huang, Lan; Yu, Yang; Deng, Meng-Yang; Wang, Kui; Qian, De-Hui

    2011-07-01

    To investigate the effect of stromal interaction molecule 1 (STIM1) silencing on EPCs cell cycle. Rat bone marrow derived endothelial progenitor cells (EPCs) were isolated and cultured in L-DMEM with 20% FBS. Ad-si/rSTIM1 and Ad-hSTIM1 were then transfected into EPCs and the expression of STIM1 mRNA was detected by RT-PCR. The cell cycle was determined using flow cytometry analysis and intracellular free Ca2+ was measured using LSCM. Co-immunoprecipitation was performed to examine the interaction between STIM1 and TRPC1. Protein levels of inositol 1, 4, 5-trisphosphate were analyzed with ELISA assay. Forty-eight hours after transfection, the expression of STIM1 mRNA was significantly downregulated (0.37 +/- 0.02 vs. 1.00 +/- 0.02, P si/rSTIM1 group compared with control group. The cell cycle was arrested at G1 phase [(90.91 +/- 1.10)% vs. (77.10 +/- 0.56)%, P si/rSTIM1. However, cotransfection of Ad-hSTIM1 with Ad-si/rSTIM1 significantly reversed these responses. Interestingly, co-immunoprecipitation study showed that STIM1 co-precipitated with TRPC1, and IP3 levels measured by ELISA were similar among three groups (P > 0.05). siRNA-mediated knockdown of STIM1 inhibited EPCs proliferation by reducing intracellular free Ca2+ through TRPC1-SOC signaling pathway.

  8. Cell protection from Ca2+-overloading by bioactive molecules extracted from olive pomace.

    Science.gov (United States)

    Averna, Monica; Casazza, Alessandro A; Martines, Antonino; Pedrazzi, Marco; Franchi, Alice; De Tullio, Roberta; Perego, Patrizia; Melloni, Edon

    2018-01-04

    We are reporting in the present study that molecules extracted from olive pomace prevent cell death induced by Ca 2+ -overloading in different cell types. Exposure of cells to these molecules counteracts the Ca 2+ -induced cell damages by reducing the activation of the Ca 2+ -dependent protease calpain, acting possibly through the modification of the permeability to Ca 2+ of the plasma membrane. The purification step by RP-HPLC suggests that effective compound(s), differing from the main biophenols known to be present in the olive pomace extract, could be responsible for this effect. Our observations suggest that bioactive molecules present in the olive pomace could be potential candidates for therapeutic applications in pathologies characterised by alterations of intracellular Ca 2+ homeostasis.

  9. APLP2 regulates the expression of MHC class I molecules on irradiated Ewing's sarcoma cells.

    Science.gov (United States)

    Peters, Haley L; Yan, Ying; Solheim, Joyce C

    2013-10-01

    Ewing's sarcoma (EWS) is a pediatric cancer that is conventionally treated by surgery, chemotherapy, and radiation therapy. Innovative immunotherapies to treat EWS are currently under development. Unfortunately for EWS patients, when the disease is found to be resistant to current therapeutic approaches, the prognosis is predictably grim. Radiation therapy and immunotherapy could potentially synergize in the eradication of EWS, as some studies have previously shown that irradiation increases the presence of immune receptors, including MHC class I molecules, on the surface of tumor cells. However, EWS cells have been reported to express low levels of MHC class I molecules, a phenotype that would inhibit T-cell mediated lysis. We have previously demonstrated that the transgene-driven overexpression of amyloid β (A4) precursor-like protein 2 (APLP2) reduces the expression of MHC class I molecules on the surface of human cervical carcinoma HeLa cells. We thus examined whether endogenously expressed APLP2 downregulates MHC class I expression on EWS cells, particularly upon irradiation. We found that irradiation induces the relocalization of APLP2 and MHC class I molecules on the surface of EWS cells, redistributing cells from subpopulations with relatively low APLP2 and high MHC class I into subpopulations with relatively high APLP2 and low MHC class I surface expression. Consistent with these findings, the transfection of an APLP2-targeting siRNA into EWS cells increased MHC class I expression on the cell surface. Furthermore, APLP2 was found by co-immunoprecipitation to bind to MHC class I molecules. Taken together, these findings suggest that APLP2 inhibits MHC class I expression on the surface of irradiated EWS cells by a mechanism that involves APLP2/MHC class I interactions. Thus, therapeutic strategies that limit APLP2 expression may boost the ability of T cells to recognize and eradicate EWS in patients.

  10. Development and testing of shingle-type solar cell molecules

    Science.gov (United States)

    Shepard, N. F.

    1978-01-01

    The details of a shingle module design which produces in excess of 97 watts/sq m of module area at 1 kW/sq m insolation and at 60 C are reported. This selected design employs a tempered glass coverplate to provide the primary solar cell structural support. The fabrication and testing of a preproduction module of this design has demonstrated that this selected approach will meet the environmental testing requirements imposed by the contract.

  11. Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

    Science.gov (United States)

    2015-10-01

    NM_004629 CTCATTGAGGTAGAATTACTA 964-984(ORF) Hs_FANCG_4 FANCG_R1 NM_004629 (GA)GTCTGGAGCTGCTAGTTGA 903-923(ORF) Rosetta design 1 FANCG_R2 NM_004629 ( CA ...Derived CD34+ and iPS Cells The goal of this project is to use genome-editing TALEN and CRISPR /Cas9 nucleases to correct the two most common disease

  12. Fungal pattern-recognition receptors and tetraspanins: partners on antigen-presenting cells.

    NARCIS (Netherlands)

    Figdor, C.G.; Spriel, A.B. van

    2010-01-01

    Fungal pattern-recognition receptors (F-PRRs), including C-type lectins, Toll-like receptors, scavenger receptors and Fc/complement receptors, are crucial for inducing anti-fungal immune responses by antigen-presenting cells. The recent identification of specific F-PRR interactions with tetraspanins

  13. Force probing of individual molecules inside the living cell is now a reality.

    Science.gov (United States)

    Oddershede, Lene B

    2012-11-01

    Biological systems can be quantitatively explored using single-molecule manipulation techniques such as optical or magnetic tweezers or atomic force microscopy. Though a plethora of discoveries have been accomplished using single-molecule manipulation techniques in vitro, such investigations constantly face the criticism that conditions are too far from being physiologically relevant. Technical achievements now allow scientists to take the next step: to use single-molecule manipulation techniques quantitatively in vivo. Considerable progress has been accomplished in this realm; for example, the interaction between a protein and the membrane of a living cell has been probed, the mechanical properties of individual proteins central for cellular adhesion have been measured and even the action of molecular motors in living cells has been quantified. Here, we review the progress of in vivo single-molecule manipulation with a focus on the special challenges posed by in vivo conditions and how these can be overcome.

  14. Molecular recognition by a polymorphic cell surface receptor governs cooperative behaviors in bacteria.

    Directory of Open Access Journals (Sweden)

    Darshankumar T Pathak

    2013-11-01

    Full Text Available Cell-cell recognition is a fundamental process that allows cells to coordinate multicellular behaviors. Some microbes, such as myxobacteria, build multicellular fruiting bodies from free-living cells. However, how bacterial cells recognize each other by contact is poorly understood. Here we show that myxobacteria engage in recognition through interactions between TraA cell surface receptors, which leads to the fusion and exchange of outer membrane (OM components. OM exchange is shown to be selective among 17 environmental isolates, as exchange partners parsed into five major recognition groups. TraA is the determinant of molecular specificity because: (i exchange partners correlated with sequence conservation within its polymorphic PA14-like domain and (ii traA allele replacements predictably changed partner specificity. Swapping traA alleles also reprogrammed social interactions among strains, including the regulation of motility and conferred immunity from inter-strain killing. We suggest that TraA helps guide the transition of single cells into a coherent bacterial community, by a proposed mechanism that is analogous to mitochondrial fusion and fission cycling that mixes contents to establish a homogenous population. In evolutionary terms, traA functions as a rare greenbeard gene that recognizes others that bear the same allele to confer beneficial treatment.

  15. Profiling of glycan receptors for minute virus of mice in permissive cell lines towards understanding the mechanism of cell recognition.

    Directory of Open Access Journals (Sweden)

    Sujata Halder

    Full Text Available The recognition of sialic acids by two strains of minute virus of mice (MVM, MVMp (prototype and MVMi (immunosuppressive, is an essential requirement for successful infection. To understand the potential for recognition of different modifications of sialic acid by MVM, three types of capsids, virus-like particles, wild type empty (no DNA capsids, and DNA packaged virions, were screened on a sialylated glycan microarray (SGM. Both viruses demonstrated a preference for binding to 9-O-methylated sialic acid derivatives, while MVMp showed additional binding to 9-O-acetylated and 9-O-lactoylated sialic acid derivatives, indicating recognition differences. The glycans recognized contained a type-2 Galβ1-4GlcNAc motif (Neu5Acα2-3Galβ1-4GlcNAc or 3'SIA-LN and were biantennary complex-type N-glycans with the exception of one. To correlate the recognition of the 3'SIA-LN glycan motif as well as the biantennary structures to their natural expression in cell lines permissive for MVMp, MVMi, or both strains, the N- and O-glycans, and polar glycolipids present in three cell lines used for in vitro studies, A9 fibroblasts, EL4 T lymphocytes, and the SV40 transformed NB324K cells, were analyzed by MALDI-TOF/TOF mass spectrometry. The cells showed an abundance of the sialylated glycan motifs recognized by the viruses in the SGM and previous glycan microarrays supporting their role in cellular recognition by MVM. Significantly, the NB324K showed fucosylation at the non-reducing end of their biantennary glycans, suggesting that recognition of these cells is possibly mediated by the Lewis X motif as in 3'SIA-Le(X identified in a previous glycan microarray screen.

  16. Cellular mechanisms of exogenous peptide binding to HLA class II molecules in B cells.

    Science.gov (United States)

    Frumento, G; de Totero, D; Ferrara, G B; Chersi, A; Pernis, B

    1994-04-15

    We have investigated the ability of APC Class II molecules to bind and release exogenous peptides, two phenomena that are still poorly understood. In order to investigate the half-life of the complex of an exogenous peptide with DR molecules we have evaluated the uptake and release of the radiolabeled peptide 17-29-Tyr of influenza virus matrix protein (MA 17-29-Y) by a B-EBV cell line at different times and under different conditions. We have found that the kinetics of both binding and release of the peptide are very fast in living cells; using glutaraldehyde-fixed cells, the kinetics of the two phenomena are slow, closely resembling those observed with the same peptide and purified, immobilized DR molecules. As confirmed by the study of a specific T-cell clone activation, the Class II-MA 17-29-Y complexes are short-living ones, with an average half-life of 55 min, and the DR molecules that bind exogenous peptides continuously undergo peptidic exchange. These data, taken together, suggest that the APC are endowed with cellular mechanisms that increase the efficiency of both the loading and the unloading of Class II HLA with exogenous peptides. These mechanisms do not appear to require ATP or to involve newly synthesized Class II molecules, intracellular acidic compartments, or the microtubule-microfilament system. On the other hand, an undamaged cell membrane appears to be crucial for an efficient binding.

  17. Drug and bioactive molecule screening based on a bioelectrical impedance cell culture platform.

    Science.gov (United States)

    Ramasamy, Sakthivel; Bennet, Devasier; Kim, Sanghyo

    2014-01-01

    This review will present a brief discussion on the recent advancements of bioelectrical impedance cell-based biosensors, especially the electric cell-substrate impedance sensing (ECIS) system for screening of various bioactive molecules. The different technical integrations of various chip types, working principles, measurement systems, and applications for drug targeting of molecules in cells are highlighted in this paper. Screening of bioactive molecules based on electric cell-substrate impedance sensing is a trial-and-error process toward the development of therapeutically active agents for drug discovery and therapeutics. In general, bioactive molecule screening can be used to identify active molecular targets for various diseases and toxicity at the cellular level with nanoscale resolution. In the innovation and screening of new drugs or bioactive molecules, the activeness, the efficacy of the compound, and safety in biological systems are the main concerns on which determination of drug candidates is based. Further, drug discovery and screening of compounds are often performed in cell-based test systems in order to reduce costs and save time. Moreover, this system can provide more relevant results in in vivo studies, as well as high-throughput drug screening for various diseases during the early stages of drug discovery. Recently, MEMS technologies and integration with image detection techniques have been employed successfully. These new technologies and their possible ongoing transformations are addressed. Select reports are outlined, and not all the work that has been performed in the field of drug screening and development is covered.

  18. Expression and Function of the Homeostatic Molecule Del-1 in Endothelial Cells and the Periodontal Tissue

    Directory of Open Access Journals (Sweden)

    Jieun Shin

    2013-01-01

    Full Text Available Developmental endothelial locus-1 (Del-1 is an endothelial cell-secreted protein that limits the recruitment of neutrophils by antagonizing the interaction between the LFA-1 integrin on neutrophils and the intercellular adhesion molecule (ICAM-1 on endothelial cells. Mice with genetic or age-associated Del-1 deficiency exhibit increased neutrophil infiltration in the periodontium resulting in inflammatory bone loss. Here we investigated additional novel mechanisms whereby Del-1 could interfere with neutrophil recruitment and inflammation. Treatment of human endothelial cells with Del-1 did not affect the expression of endothelial molecules involved in the leukocyte adhesion cascade (ICAM-1, VCAM-1, and E-selectin. Moreover, genetic or age-associated Del-1 deficiency did not significantly alter the expression of these adhesion molecules in the murine periodontium, further ruling out altered adhesion molecule expression as a mechanism whereby Del-1 regulates leukocyte recruitment. Strikingly, Del-1 inhibited ICAM-1-dependent chemokine release (CXCL2, CCL3 by neutrophils. Therefore, Del-1 could potentially suppress the amplification of inflammatory cell recruitment mediated through chemokine release by infiltrating neutrophils. Interestingly, Del-1 was itself regulated by inflammatory stimuli, which generally exerted opposite effects on adhesion molecule expression. The reciprocal regulation between Del-1 and inflammation may contribute to optimally balance the protective and the potentially harmful effects of inflammatory cell recruitment.

  19. The adaptor molecule SAP plays essential roles during invariant NKT cell cytotoxicity and lytic synapse formation.

    Science.gov (United States)

    Das, Rupali; Bassiri, Hamid; Guan, Peng; Wiener, Susan; Banerjee, Pinaki P; Zhong, Ming-Chao; Veillette, André; Orange, Jordan S; Nichols, Kim E

    2013-04-25

    The adaptor molecule signaling lymphocytic activation molecule-associated protein (SAP) plays critical roles during invariant natural killer T (iNKT) cell ontogeny. As a result, SAP-deficient humans and mice lack iNKT cells. The strict developmental requirement for SAP has made it difficult to discern its possible involvement in mature iNKT cell functions. By using temporal Cre recombinase-mediated gene deletion to ablate SAP expression after completion of iNKT cell development, we demonstrate that SAP is essential for T-cell receptor (TCR)-induced iNKT cell cytotoxicity against T-cell and B-cell leukemia targets in vitro and iNKT-cell-mediated control of T-cell leukemia growth in vivo. These findings are not restricted to the murine system: silencing RNA-mediated suppression of SAP expression in human iNKT cells also significantly impairs TCR-induced cytolysis. Mechanistic studies reveal that iNKT cell killing requires the tyrosine kinase Fyn, a known SAP-binding protein. Furthermore, SAP expression is required within iNKT cells to facilitate their interaction with T-cell targets and induce reorientation of the microtubule-organizing center to the immunologic synapse (IS). Collectively, these studies highlight a novel and essential role for SAP during iNKT cell cytotoxicity and formation of a functional IS.

  20. Solution processable organic polymers and small molecules for bulk-heterojunction solar cells: A review

    International Nuclear Information System (INIS)

    Sharma, G. D.

    2011-01-01

    Solution processed bulk heterojunction (BHJ) organic solar cells (OSCs) have gained wide interest in past few years and are established as one of the leading next generation photovoltaic technologies for low cost power production. Power conversion efficiencies up to 6% and 6.5% have been reported in the literature for single layer and tandem solar cells, respectively using conjugated polymers. A recent record efficiency about 8.13% with active area of 1.13 cm 2 has been reported. However Solution processable small molecules have been widely applied for photovoltaic (PV) devices in recent years because they show strong absorption properties, and they can be easily purified and deposited onto flexible substrates at low cost. Introducing different donor and acceptor groups to construct donor--acceptor (D--A) structure small molecules has proved to be an efficient way to improve the properties of organic solar cells (OSCs). The power conversion efficiency about 4.4 % has been reported for OSCs based on the small molecules. This review deals with the recent progress of solution processable D--A structure small molecules and discusses the key factors affecting the properties of OSCs based on D--A structure small molecules: sunlight absorption, charge transport and the energy level of the molecules.

  1. The Role of Immunoglobulin Superfamily Cell Adhesion Molecules in Cancer Metastasis

    Directory of Open Access Journals (Sweden)

    Chee Wai Wong

    2012-01-01

    Full Text Available Metastasis is a major clinical problem and results in a poor prognosis for most cancers. The metastatic pathway describes the process by which cancer cells give rise to a metastatic lesion in a new tissue or organ. It consists of interconnecting steps all of which must be successfully completed to result in a metastasis. Cell-cell adhesion is a key aspect of many of these steps. Adhesion molecules belonging to the immunoglobulin superfamily (Ig-SF commonly play a central role in cell-cell adhesion, and a number of these molecules have been associated with cancer progression and a metastatic phenotype. Surprisingly, the contribution of Ig-SF members to metastasis has not received the attention afforded other cell adhesion molecules (CAMs such as the integrins. Here we examine the steps in the metastatic pathway focusing on how the Ig-SF members, melanoma cell adhesion molecule (MCAM, L1CAM, neural CAM (NCAM, leukocyte CAM (ALCAM, intercellular CAM-1 (ICAM-1 and platelet endothelial CAM-1 (PECAM-1 could play a role. Although much remains to be understood, this review aims to raise the profile of Ig-SF members in metastasis formation and prompt further research that could lead to useful clinical outcomes.

  2. Nucleotide-binding oligomerization domain 1 regulates Porphyromonas gingivalis-induced vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 expression in endothelial cells through NF-κB pathway.

    Science.gov (United States)

    Wan, M; Liu, J; Ouyang, X

    2015-04-01

    Porphyromonas gingivalis has been shown to actively invade endothelial cells and induce vascular cell adhesion molecule 1 (VCAM-1) and intercellular adhesion molecule 1 (ICAM-1) overexpression. Nucleotide-binding oligomerization domain 1 (NOD1) is an intracellular pattern recognition reporter, and its involvement in this process was unknown. This study focused on endothelial cells infected with P. gingivalis, the detection of NOD1 expression and the role that NOD1 plays in the upregulation of VCAM-1 and ICAM-1. The human umbilical vein endothelial cell line (ECV-304) was intruded by P. gingivalis W83, and cells without any treatment were the control group. Expression levels of NOD1, VCAM-1, ICAM-1, phosphorylated P65 between cells with and without treatment on both mRNA and protein levels were compared. Then we examined whether mesodiaminopimelic acid (NOD1 agonist) could increase VCAM-1 and ICAM-1 expression, meanwhile, NOD1 gene silence by RNA interference could reduce VCAM-1, ICAM-1 and phosphorylated P65 release. At last, we examined whether inhibition of NF-κB by Bay117082 could reduce VCAM-1 and ICAM- 1 expression. The mRNA levels were measured by real-time polymerase chain reaction, and protein levels by western blot or electrophoretic mobility shift assays (for phosphorylated P65). P. gingivalis invasion showed significant upregulation of NOD1, VCAM-1 and ICAM-1. NOD1 activation by meso-diaminopimelic acid increased VCAM-1 and ICAM-1 expression, and NOD1 gene silence reduced VCAM-1 and ICAM-1 release markedly. The NF-κB signaling pathway was activated by P. gingivalis, while NOD1 gene silence decreased the activation of NF-κB. Moreover, inhibition of NF-κB reduced VCAM-1 and ICAM-1 expression induced by P. gingivalis in endothelial cells. The results revealed that P. gingivalis induced NOD1 overexpression in endothelial cells and that NOD1 played an important role in the process of VCAM-1 and ICAM-1 expression in endothelial cells infected with P

  3. Single molecule analysis of B cell receptor motion during signaling activation

    Science.gov (United States)

    Rey Suarez, Ivan; Koo, Peter; Zhou, Shu; Wheatley, Brittany; Song, Wenxia; Mochrie, Simon; Upadhyaya, Arpita

    B cells are an essential part of the adaptive immune system. They patrol the body for signs of infection in the form of antigen on the surface of antigen presenting cells. B cell receptor (BCR) binding to antigen induces a signaling cascade that leads to B cell activation and spreading. During activation, BCR form signaling microclusters that later coalesce as the cell contracts. We have studied the dynamics of BCRs on activated murine primary B cells using single particle tracking. The tracks are analyzed using perturbation expectation-maximization (pEM), a systems-level analysis, which allows identification of different short-time diffusive states from single molecule tracks. We identified four dominant diffusive states, two of which correspond to BCRs interacting with signaling molecules. For wild-type cells, the number of BCR in signaling states increases as the cell spreads and then decreases during cell contraction. In contrast, cells lacking the actin regulatory protein, N-WASP, are unable to contract and BCRs remain in the signaling states for longer times. These observations indicate that actin cytoskeleton dynamics modulate BCR diffusion and clustering. Our results provide novel information regarding the timescale of interaction between BCR and signaling molecules.

  4. Neutrophil Attack Triggers Extracellular Trap-Dependent Candida Cell Wall Remodeling and Altered Immune Recognition.

    Directory of Open Access Journals (Sweden)

    Alex Hopke

    2016-05-01

    Full Text Available Pathogens hide immunogenic epitopes from the host to evade immunity, persist and cause infection. The opportunistic human fungal pathogen Candida albicans, which can cause fatal disease in immunocompromised patient populations, offers a good example as it masks the inflammatory epitope β-glucan in its cell wall from host recognition. It has been demonstrated previously that β-glucan becomes exposed during infection in vivo but the mechanism behind this exposure was unknown. Here, we show that this unmasking involves neutrophil extracellular trap (NET mediated attack, which triggers changes in fungal cell wall architecture that enhance immune recognition by the Dectin-1 β-glucan receptor in vitro. Furthermore, using a mouse model of disseminated candidiasis, we demonstrate the requirement for neutrophils in triggering these fungal cell wall changes in vivo. Importantly, we found that fungal epitope unmasking requires an active fungal response in addition to the stimulus provided by neutrophil attack. NET-mediated damage initiates fungal MAP kinase-driven responses, particularly by Hog1, that dynamically relocalize cell wall remodeling machinery including Chs3, Phr1 and Sur7. Neutrophil-initiated cell wall disruptions augment some macrophage cytokine responses to attacked fungi. This work provides insight into host-pathogen interactions during disseminated candidiasis, including valuable information about how the C. albicans cell wall responds to the biotic stress of immune attack. Our results highlight the important but underappreciated concept that pattern recognition during infection is dynamic and depends on the host-pathogen dialog.

  5. CD56 Is a Pathogen Recognition Receptor on Human Natural Killer Cells.

    Science.gov (United States)

    Ziegler, Sabrina; Weiss, Esther; Schmitt, Anna-Lena; Schlegel, Jan; Burgert, Anne; Terpitz, Ulrich; Sauer, Markus; Moretta, Lorenzo; Sivori, Simona; Leonhardt, Ines; Kurzai, Oliver; Einsele, Hermann; Loeffler, Juergen

    2017-07-21

    Aspergillus (A.) fumigatus is an opportunistic fungal mold inducing invasive aspergillosis (IA) in immunocompromised patients. Although antifungal activity of human natural killer (NK) cells was shown in previous studies, the underlying cellular mechanisms and pathogen recognition receptors (PRRs) are still unknown. Using flow cytometry we were able to show that the fluorescence positivity of the surface receptor CD56 significantly decreased upon fungal contact. To visualize the interaction site of NK cells and A. fumigatus we used SEM, CLSM and dSTORM techniques, which clearly demonstrated that NK cells directly interact with A. fumigatus via CD56 and that CD56 is re-organized and accumulated at this interaction site time-dependently. The inhibition of the cytoskeleton showed that the receptor re-organization was an active process dependent on actin re-arrangements. Furthermore, we could show that CD56 plays a role in the fungus mediated NK cell activation, since blocking of CD56 surface receptor reduced fungal mediated NK cell activation and reduced cytokine secretion. These results confirmed the direct interaction of NK cells and A. fumigatus, leading to the conclusion that CD56 is a pathogen recognition receptor. These findings give new insights into the functional role of CD56 in the pathogen recognition during the innate immune response.

  6. Pharmacology of cell adhesion molecules of the nervous system

    DEFF Research Database (Denmark)

    Kiryushko, Darya; Bock, Elisabeth; Berezin, Vladimir

    2007-01-01

    development. The majority of CAMs are signal transducing receptors. CAM-induced intracellular signalling is triggered via homophilic (CAM-CAM) and heterophilic (CAM - other counter-receptors) interactions, which both can be targeted pharmacologically. We here describe the progress in the CAM pharmacology...... focusing on cadherins and CAMs of the immunoglobulin (Ig) superfamily, such as NCAM and L1. Structural basis of CAM-mediated cell adhesion and CAM-induced signalling are outlined. Different pharmacological approaches to study functions of CAMs are presented including the use of specific antibodies......, recombinant proteins, and synthetic peptides. We also discuss how unravelling of the 3D structure of CAMs provides novel pharmacological tools for dissection of CAM-induced signalling pathways and offers therapeutic opportunities for a range of neurological disorders....

  7. Influence of drug molecules on regulatory B cells.

    Science.gov (United States)

    Amrouche, Kahina; Jamin, Christophe

    2017-11-01

    By their suppressive functions, regulatory B (Breg) cells are considered as key elements in the control and development of various disease states. Many signals can induce Bregs in vivo and in vitro and often from heterogeneous populations. Several specific signals delivered in a timely immunological context contribute to the establishment of Bregs. These are endogenous and physiological signals or stimuli, widely discussed in the literature participating in the establishment of an effective immune response. However, exogenous signals, much less clearly identified can also be considered as Bregs inducers. These extrinsic signals are capable of directly or indirectly influencing the suppressive capacity of Bregs, but also their expansion and functional restoration in its absence. Faced with the excitement generated by the development of processes favoring the expansion of Bregs in mice for therapeutic purposes, the challenge today is to extrapolate such approaches in humans. This perspective may already be in effect. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Nanodevices and a new approach to the problem of recognition and destruction of cancer cells in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Namiot, V.A., E-mail: vnamiot@gmail.com

    2013-11-22

    We suggest for recognition and destruction of cancer cells in vivo to introduce into an organism simultaneously two different interacting nanodevices. Only one of the nanodevices has to be able to recognize cancer cell and mark it. The second nanodevice has to be able to destroy the marked cancer cell. Such process allows increasing the reliability of the cancer cell recognition process and making the process of their destruction rather safe for an organism.

  9. Endothelial vascular cell adhesion molecule 1 expression is suppressed by melanoma and carcinoma

    OpenAIRE

    1995-01-01

    Vascular cell adhesion molecule 1 (VCAM-1) mediates extravasation of circulating leukocytes into inflamed tissues, and presumably, plays a role in the immigration of cytotoxic effector lymphocytes into tumor metastases. Since metastases are rarely cleared by blood-borne cells from the immune system, we asked whether the tumor may escape host defense by interfering with the mechanism of effector cell extravasation. Here we show that in mice and humans, VCAM-1 expression is repressed on tumor-i...

  10. Polysialic Acid/Neural Cell Adhesion Molecule Modulates the Formation of Ductular Reactions in Liver Injury

    OpenAIRE

    Tsuchiya, Atsunori; Lu, Wei-Yu; Weinhold, Birgit; Boulter, Luke; Stutchfield, Benjamin M.; Williams, Michael J.; Guest, Rachel V.; Minnis-Lyons, Sarah E.; MacKinnon, Alison C.; Schwarzer, David; Ichida, Takafumi; Nomoto, Minoru; Aoyagi, Yutaka; Gerardy-Schahn, Rita; Forbes, Stuart J.

    2014-01-01

    In severe liver injury, ductular reactions (DRs) containing bipotential hepatic progenitor cells (HPCs) branch from the portal tract. Neural cell adhesion molecule (NCAM) marks bile ducts and DRs, but not mature hepatocytes. NCAM mediates interactions between cells and surrounding matrix; however, its role in liver development and regeneration is undefined. Polysialic acid (polySia), a unique posttranslational modifier of NCAM, is produced by the enzymes, ST8SiaII and ST8SiaIV, and weakens NC...

  11. The Physics of Small Molecule Acceptors for Efficient and Stable Bulk Heterojunction Solar Cells

    KAUST Repository

    Gasparini, Nicola

    2018-01-29

    Organic bulk heterojunction solar cells based on small molecule acceptors have recently seen a rapid rise in the power conversion efficiency with values exceeding 13%. This impressive achievement has been obtained by simultaneous reduction of voltage and charge recombination losses within this class of materials as compared to fullerene-based solar cells. In this contribution, the authors review the current understanding of the relevant photophysical processes in highly efficient nonfullerene acceptor (NFA) small molecules. Charge generation, recombination, and charge transport is discussed in comparison to fullerene-based composites. Finally, the authors review the superior light and thermal stability of nonfullerene small molecule acceptor based solar cells, and highlight the importance of NFA-based composites that enable devices without early performance loss, thus resembling so-called burn-in free devices.

  12. Signaling mechanisms of neurite outgrowth induced by the cell adhesion molecules NCAM and N-cadherin

    DEFF Research Database (Denmark)

    Hansen, S M; Berezin, V; Bock, E

    2008-01-01

    Formation of appropriate neural circuits depends on a complex interplay between extracellular guiding cues and intracellular signaling events that result in alterations of cytoskeletal dynamics and a neurite growth response. Surface-expressed cell adhesion molecules (CAMs) interact with the surro......Formation of appropriate neural circuits depends on a complex interplay between extracellular guiding cues and intracellular signaling events that result in alterations of cytoskeletal dynamics and a neurite growth response. Surface-expressed cell adhesion molecules (CAMs) interact...... extracellular guidance cues to intracellular events and thereby regulating neurite outgrowth. In this review, we focus on two CAMs, the neural cell adhesion molecule (NCAM) and N-cadherin, and their ability to mediate signaling associated with a neurite outgrowth response. In particular, we will focus on direct...

  13. Small Molecule Supplements Improve Cultured Megakaryocyte Polyploidization by Modulating Multiple Cell Cycle Regulators

    Directory of Open Access Journals (Sweden)

    Xiaojing Zou

    2017-01-01

    Full Text Available Platelets (PLTs are produced by megakaryocytes (MKs that completed differentiation and endomitosis. Endomitosis is an important process in which the cell replicates its DNA without cytokinesis and develops highly polyploid MK. In this study, to gain a better PLTs production, four small molecules (Rho-Rock inhibitor (RRI, nicotinamide (NIC, Src inhibitor (SI, and Aurora B inhibitor (ABI and their combinations were surveyed as MK culture supplements for promoting polyploidization. Three leukemia cell lines as well as primary mononuclear cells were chosen in the function and mechanism studies of the small molecules. In an optimal culture method, cells were treated with different small molecules and their combinations. The impact of the small molecules on megakaryocytic surface marker expression, polyploidy, proliferation, and apoptosis was examined for the best MK polyploidization supplement. The elaborate analysis confirmed that the combination of SI and RRI together with our MK induction system might result in efficient ploidy promotion. Our experiments demonstrated that, besides direct downregulation on the expression of cytoskeleton protein actin, SI and RRI could significantly enhance the level of cyclins through the suppression of p53 and p21. The verified small molecule combination might be further used in the in vitro PLT manufacture and clinical applications.

  14. Recognition and Blocking of Innate Immunity Cells by Candida albicans Chitin ▿ †

    Science.gov (United States)

    Mora-Montes, Héctor M.; Netea, Mihai G.; Ferwerda, Gerben; Lenardon, Megan D.; Brown, Gordon D.; Mistry, Anita R.; Kullberg, Bart Jan; O'Callaghan, Chris A.; Sheth, Chirag C.; Odds, Frank C.; Brown, Alistair J. P.; Munro, Carol A.; Gow, Neil A. R.

    2011-01-01

    Chitin is a skeletal cell wall polysaccharide of the inner cell wall of fungal pathogens. As yet, little about its role during fungus-host immune cell interactions is known. We show here that ultrapurified chitin from Candida albicans cell walls did not stimulate cytokine production directly but blocked the recognition of C. albicans by human peripheral blood mononuclear cells (PBMCs) and murine macrophages, leading to significant reductions in cytokine production. Chitin did not affect the induction of cytokines stimulated by bacterial cells or lipopolysaccharide (LPS), indicating that blocking was not due to steric masking of specific receptors. Toll-like receptor 2 (TLR2), TLR4, and Mincle (the macrophage-inducible C-type lectin) were not required for interactions with chitin. Dectin-1 was required for immune blocking but did not bind chitin directly. Cytokine stimulation was significantly reduced upon stimulation of PBMCs with heat-killed chitin-deficient C. albicans cells but not with live cells. Therefore, chitin is normally not exposed to cells of the innate immune system but is capable of influencing immune recognition by blocking dectin-1-mediated engagement with fungal cell walls. PMID:21357722

  15. Soluble Collectin-12 (CL-12) Is a Pattern Recognition Molecule Initiating Complement Activation via the Alternative Pathway

    DEFF Research Database (Denmark)

    Ma, Ying Jie; Hein, Estrid; Munthe-Fog, Lea

    2015-01-01

    Soluble defense collagens including the collectins play important roles in innate immunity. Recently, a new member of the collectin family named collectin-12 (CL-12 or CL-P1) has been identified. CL-12 is highly expressed in umbilical cord vascular endothelial cells as a transmembrane receptor...... and may recognize certain bacteria and fungi, leading to opsonophagocytosis. However, based on its structural and functional similarities with soluble collectins, we hypothesized the existence of a fluid-phase analog of CL-12 released from cells, which may function as a soluble pattern...

  16. A modified single-cell electroporation method for molecule delivery into a motile protist, Euglena gracilis.

    Science.gov (United States)

    Ohmachi, Masashi; Fujiwara, Yoshie; Muramatsu, Shuki; Yamada, Koji; Iwata, Osamu; Suzuki, Kengo; Wang, Dan Ohtan

    2016-11-01

    Single-cell transfection is a powerful technique for delivering chemicals, drugs, or probes into arbitrary, specific single cells. This technique is especially important when the analysis of molecular function and cellular behavior in individual microscopic organisms such as protists requires the precise identification of the target cell, as fluorescence labeling of bulk populations makes tracking of individual motile protists virtually impossible. Herein, we have modified current single-cell electroporation techniques for delivering fluorescent markers into single Euglena gracilis, a motile photosynthetic microalga. Single-cell electroporation introduced molecules into individual living E. gracilis cells after a negative pressure was applied through a syringe connected to the micropipette to the target cell. The new method achieves high transfection efficiency and viability after electroporation. With the new technique, we successfully introduced a variety of molecules such as GFP, Alexa Fluor 488, and exciton-controlled hybridization-sensitive fluorescent oligonucleotide (ECHO) RNA probes into individual motile E. gracilis cells. We demonstrate imaging of endogenous mRNA in living E. gracilis without interfering with their physiological functions, such as swimming or division, over an extended period of time. Thus the modified single-cell electroporation technique is suitable for delivering versatile functional molecules into individual motile protists. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Power losses in bilayer inverted small molecule organic solar cells

    KAUST Repository

    Trinh, Cong

    2012-01-01

    Inverted bilayer organic solar cells using copper phthalocyanine (CuPc) as a donor and C60 as an acceptor with the structure: glass/indium tin oxide (ITO)/ZnO/C60/CuPc/MoO3/Al, in which the zinc oxide (ZnO) was deposited by atomic layer deposition, are compared with a conventional device: glass/ITO/CuPc/C60/bathocuproine/Al. These inverted and conventional devices give short circuit currents of 3.7 and 4.8 mA/cm 2, respectively. However, the inverted device gives a reduced photoresponse from the CuPc donor compared to that of the conventional device. Optical field models show that the arrangement of organic layers in the inverted devices leads to lower absorption of long wavelengths by the CuPc donor; the low energy portion of the spectrum is concentrated near the metal oxide electrode in both devices. © 2012 American Institute of Physics.

  18. Biosynthesis of the D2 cell adhesion molecule: pulse-chase studies in cultured fetal rat neuronal cells

    DEFF Research Database (Denmark)

    Lyles, J M; Norrild, B; Bock, E

    1984-01-01

    D2 is a membrane glycoprotein that is believed to function as a cell adhesion molecule (CAM) in neural cells. We have examined its biosynthesis in cultured fetal rat brain neurones. We found D2-CAM to be synthesized initially as two polypeptides: Mr 186,000 (A) and Mr 136,000 (B). With increasing...

  19. Sialyllactose in viral membrane gangliosides is a novel molecular recognition pattern for mature dendritic cell capture of HIV-1.

    Directory of Open Access Journals (Sweden)

    Nuria Izquierdo-Useros

    Full Text Available HIV-1 is internalized into mature dendritic cells (mDCs via an as yet undefined mechanism with subsequent transfer of stored, infectious virus to CD4+ T lymphocytes. Thus, HIV-1 subverts a DC antigen capture mechanism to promote viral spread. Here, we show that gangliosides in the HIV-1 membrane are the key molecules for mDC uptake. HIV-1 virus-like particles and liposomes mimicking the HIV-1 lipid composition were shown to use a common internalization pathway and the same trafficking route within mDCs. Hence, these results demonstrate that gangliosides can act as viral attachment factors, in addition to their well known function as cellular receptors for certain viruses. Furthermore, the sialyllactose molecule present in specific gangliosides was identified as the determinant moiety for mDC HIV-1 uptake. Thus, sialyllactose represents a novel molecular recognition pattern for mDC capture, and may be crucial both for antigen presentation leading to immunity against pathogens and for succumbing to subversion by HIV-1.

  20. UP-scaling of inverted small molecule based organic solar cells

    DEFF Research Database (Denmark)

    Patil, Bhushan Ramesh; Madsen, Morten

    Organic solar cells (OSC), in spite of being a promising technology, still face challenges regarding large-scale fabrication. Although efficiencies of up to 12 % has been reached for small molecule OSC, their performance, both in terms of device efficiency and stability, is significantly reduced...... during up-scaling processes. The work presented here is focused on an approach towards up-scaling of small molecule based OSC with inverted device configuration. Bilayer OSC from Tetraphenyldibenzoperiflanthene (DBP) and Fullerenes (C70), as electron donor and acceptor respectively, with cell area...

  1. Manipulation and Motion of Organelles and Single Molecules in Living Cells

    DEFF Research Database (Denmark)

    Norregaard, Kamilla; Metzler, Ralf; Ritter, Christine M.

    2017-01-01

    driving many cellular processes. The forces on a molecular scale are exactly in the range that can be manipulated and probed with single molecule force spectroscopy. The natural environment of a biomolecule is inside a living cell, hence, this is the most relevant environment for probing their function....... In vivo studies are, however, challenged by the complexity of the cell. In this review, we start with presenting relevant theoretical tools for analyzing single molecule data obtained in intracellular environments followed by a description of state-of-the art visualization techniques. The most commonly...

  2. The L1-type cell adhesion molecule Neuroglian is necessary for maintenance of sensory axon advance in the Drosophila embryo

    Directory of Open Access Journals (Sweden)

    Martin Veronica

    2008-04-01

    Full Text Available Abstract Background Cell adhesion molecules have long been implicated in the regulation of axon growth, but the precise cellular roles played by individual cell adhesion molecules and the molecular basis for their action are still not well understood. We have used the sensory system of the Drosophila embryo to shed light on the mechanism by which the L1-type cell adhesion molecule Neuroglian regulates axon growth. Results We have found a highly penetrant sensory axon stalling phenotype in neuroglian mutant embryos. Axons stalled at a variety of positions along their normal trajectory, but most commonly in the periphery some distance along the peripheral nerve. All lateral and dorsal cluster sensory neurons examined, except for the dorsal cluster neuron dbd, showed stalling. Sensory axons were never seen to project along inappropriate pathways in neuroglian mutants and stalled axons showed normal patterns of fasciculation within nerves. The growth cones of stalled axons possessed a simple morphology, similar to their appearance in wild-type embryos when advancing along nerves. Driving expression of the wild-type form of Neuroglian in sensory neurons alone rescued the neuroglian mutant phenotype of both pioneering and follower neurons. A partial rescue was achieved by expressing the Neuroglian extracellular domain. Over/mis-expression of Neuroglian in all neurons, oenocytes or trachea had no apparent effect on sensory axon growth. Conclusion We conclude that Neuroglian is necessary to maintain axon advance along axonal substrates, but is not required for initiation of axon outgrowth, axon fasciculation or recognition of correct growth substrates. Expression of Neuroglian in sensory neurons alone is sufficient to promote axon advance and the intracellular region of the molecule is largely dispensable for this function. It is unlikely, therefore, that Nrg acts as a molecular 'clutch' to couple adhesion of F-actin within the growth cone to the

  3. A Stochastic Single-Molecule Event Triggers Phenotype Switching of a Bacterial Cell

    Science.gov (United States)

    Xie, Sunney; Choi, Paul; Cai, Long

    2009-03-01

    By monitoring fluorescently labeled lactose permease with single-molecule sensitivity, we investigated the molecular mechanism of how an Escherichia coli cell with the lac operon switches from one phenotype to another. At intermediate inducer concentrations, a population of genetically identical cells exhibits two phenotypes: induced cells with highly fluorescent membranes and uninduced cells with a small number of membrane-bound permeases. We found that this basal-level expression results from partial dissociation of the tetrameric lactose repressor from one of its operators on looped DNA. In contrast, infrequent events of complete dissociation of the repressor from DNA result in large bursts of permease expression that trigger induction of the lac operon. Hence, a stochastic single-molecule event determines a cell's phenotype.

  4. Small Molecule-Photoactive Yellow Protein Labeling Technology in Live Cell Imaging

    Directory of Open Access Journals (Sweden)

    Feng Gao

    2016-08-01

    Full Text Available Characterization of the chemical environment, movement, trafficking and interactions of proteins in live cells is essential to understanding their functions. Labeling protein with functional molecules is a widely used approach in protein research to elucidate the protein location and functions both in vitro and in live cells or in vivo. A peptide or a protein tag fused to the protein of interest and provides the opportunities for an attachment of small molecule probes or other fluorophore to image the dynamics of protein localization. Here we reviewed the recent development of no-wash small molecular probes for photoactive yellow protein (PYP-tag, by the means of utilizing a quenching mechanism based on the intramolecular interactions, or an environmental-sensitive fluorophore. Several fluorogenic probes have been developed, with fast labeling kinetics and cell permeability. This technology allows quick live-cell imaging of cell-surface and intracellular proteins without a wash-out procedure.

  5. Solution-processed small-molecule solar cells: breaking the 10% power conversion efficiency.

    Science.gov (United States)

    Liu, Yongsheng; Chen, Chun-Chao; Hong, Ziruo; Gao, Jing; Yang, Yang Michael; Zhou, Huanping; Dou, Letian; Li, Gang; Yang, Yang

    2013-11-28

    A two-dimensional conjugated small molecule (SMPV1) was designed and synthesized for high performance solution-processed organic solar cells. This study explores the photovoltaic properties of this molecule as a donor, with a fullerene derivative as an acceptor, using solution processing in single junction and double junction tandem solar cells. The single junction solar cells based on SMPV1 exhibited a certified power conversion efficiency of 8.02% under AM 1.5 G irradiation (100 mW cm(-2)). A homo-tandem solar cell based on SMPV1 was constructed with a novel interlayer (or tunnel junction) consisting of bilayer conjugated polyelectrolyte, demonstrating an unprecedented PCE of 10.1%. These results strongly suggest solution-processed small molecular materials are excellent candidates for organic solar cells.

  6. Connecting synthetic chemistry decisions to cell and genome biology using small-molecule phenotypic profiling.

    Science.gov (United States)

    Wagner, Bridget K; Clemons, Paul A

    2009-12-01

    Discovering small-molecule modulators for thousands of gene products requires multiple stages of biological testing, specificity evaluation, and chemical optimization. Many cellular profiling methods, including cellular sensitivity, gene expression, and cellular imaging, have emerged as methods to assess the functional consequences of biological perturbations. Cellular profiling methods applied to small-molecule science provide opportunities to use complex phenotypic information to prioritize and optimize small-molecule structures simultaneously against multiple biological endpoints. As throughput increases and cost decreases for such technologies, we see an emerging paradigm of using more information earlier in probe-discovery and drug-discovery efforts. Moreover, increasing access to public datasets makes possible the construction of 'virtual' profiles of small-molecule performance, even when multiplexed measurements were not performed or when multidimensional profiling was not the original intent. We review some key conceptual advances in small-molecule phenotypic profiling, emphasizing connections to other information, such as protein-binding measurements, genetic perturbations, and cell states. We argue that to maximally leverage these measurements in probe-discovery and drug-discovery requires a fundamental connection to synthetic chemistry, allowing the consequences of synthetic decisions to be described in terms of changes in small-molecule profiles. Mining such data in the context of chemical structure and synthesis strategies can inform decisions about chemistry procurement and library development, leading to optimal small-molecule screening collections.

  7. Extracellular recognition of oomycetes during biotrophic infection of plants

    NARCIS (Netherlands)

    Raaymakers, Tom M.; Van Den Ackerveken, Guido

    2016-01-01

    Extracellular recognition of pathogens by plants constitutes an important early detection system in plant immunity. Microbe-derived molecules, also named patterns, can be recognized by pattern recognition receptors (PRRs) on the host cell membrane that trigger plant immune responses. Most knowledge

  8. Antigen-B Cell Receptor Complexes Associate with Intracellular major histocompatibility complex (MHC) Class II Molecules*

    Science.gov (United States)

    Barroso, Margarida; Tucker, Heidi; Drake, Lisa; Nichol, Kathleen; Drake, James R.

    2015-01-01

    Antigen processing and MHC class II-restricted antigen presentation by antigen-presenting cells such as dendritic cells and B cells allows the activation of naïve CD4+ T cells and cognate interactions between B cells and effector CD4+ T cells, respectively. B cells are unique among class II-restricted antigen-presenting cells in that they have a clonally restricted antigen-specific receptor, the B cell receptor (BCR), which allows the cell to recognize and respond to trace amounts of foreign antigen present in a sea of self-antigens. Moreover, engagement of peptide-class II complexes formed via BCR-mediated processing of cognate antigen has been shown to result in a unique pattern of B cell activation. Using a combined biochemical and imaging/FRET approach, we establish that internalized antigen-BCR complexes associate with intracellular class II molecules. We demonstrate that the M1-paired MHC class II conformer, shown previously to be critical for CD4 T cell activation, is incorporated selectively into these complexes and loaded selectively with peptide derived from BCR-internalized cognate antigen. These results demonstrate that, in B cells, internalized antigen-BCR complexes associate with intracellular MHC class II molecules, potentially defining a site of class II peptide acquisition, and reveal a selective role for the M1-paired class II conformer in the presentation of cognate antigen. These findings provide key insights into the molecular mechanisms used by B cells to control the source of peptides charged onto class II molecules, allowing the immune system to mount an antibody response focused on BCR-reactive cognate antigen. PMID:26400081

  9. Targeting Jurkat T Lymphocyte Leukemia Cells by an Engineered Interferon-Alpha Hybrid Molecule.

    Science.gov (United States)

    Yu, Dehai; Du, Zhonghua; Li, Wei; Chen, Huaqiu; Ye, Songgen; Hoffman, Andrew R; Cui, Jiuwei; Hu, Ji-Fan

    2017-01-01

    Adult T-cell leukemia/lymphoma (ATL) is a very aggressive T cell malignancy that carries a poor prognosis, primarily due to its resistance to chemotherapy and to life-threatening infectious complications. Interferon-alpha (IFNα) has been used in combination with the anti-retroviral drug zidovudine to treat patients with ATL. However, the efficacy of long-term therapy is significantly limited due to the systemic toxicity of IFNα. We utilized phage display library screening to identify short peptides that specifically bind to Jurkat T lymphocyte leukemia cells. By fusing the Jurkat-binding peptide to the C-terminus of IFNα, we constructed an engineered chimeric IFNα molecule (IFNP) for the treatment of ATL. We found that IFNP exhibited significantly higher activity than wild type IFNα in inhibiting the growth of leukemia cells and inducing cell blockage at the G0/G1 phase. The synthetic IFNP molecule exerted its antitumor activity by upregulating the downstream genes involved in the STAT1 pathway and in apoptosis. Using a cell receptor binding assay, we showed that this Jurkat-binding peptide facilitated the binding affinity of IFNα to the cell surface type I IFN receptor. The isolated Jurkat-binding peptide significantly potentiates the therapeutic activity of IFNα in T lymphocyte leukemia cells. The engineered IFNP molecule may prove to a novel antitumor approach in the treatment of patients with ATL. © 2017 The Author(s). Published by S. Karger AG, Basel.

  10. Neural Cell Adhesion Molecules of the Immunoglobulin Superfamily Regulate Synapse Formation, Maintenance, and Function.

    Science.gov (United States)

    Sytnyk, Vladimir; Leshchyns'ka, Iryna; Schachner, Melitta

    2017-05-01

    Immunoglobulin superfamily adhesion molecules are among the most abundant proteins in vertebrate and invertebrate nervous systems. Prominent family members are the neural cell adhesion molecules NCAM and L1, which were the first to be shown to be essential not only in development but also in synaptic function and as key regulators of synapse formation, synaptic activity, plasticity, and synaptic vesicle recycling at distinct developmental and activity stages. In addition to interacting with each other, adhesion molecules interact with ion channels and cytokine and neurotransmitter receptors. Mutations in their genes are linked to neurological disorders associated with abnormal development and synaptic functioning. This review presents an overview of recent studies on these molecules and their crucial impact on neurological disorders. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Chitin recognition via chitotriosidase promotes pathologic type-2 helper T cell responses to cryptococcal infection.

    Directory of Open Access Journals (Sweden)

    Darin L Wiesner

    2015-03-01

    Full Text Available Pulmonary mycoses are often associated with type-2 helper T (Th2 cell responses. However, mechanisms of Th2 cell accumulation are multifactorial and incompletely known. To investigate Th2 cell responses to pulmonary fungal infection, we developed a peptide-MHCII tetramer to track antigen-specific CD4+ T cells produced in response to infection with the fungal pathogen Cryptococcus neoformans. We noted massive accruement of pathologic cryptococcal antigen-specific Th2 cells in the lungs following infection that was coordinated by lung-resident CD11b+ IRF4-dependent conventional dendritic cells. Other researchers have demonstrated that this dendritic cell subset is also capable of priming protective Th17 cell responses to another pulmonary fungal infection, Aspergillus fumigatus. Thus, higher order detection of specific features of fungal infection by these dendritic cells must direct Th2 cell lineage commitment. Since chitin-containing parasites commonly elicit Th2 responses, we hypothesized that recognition of fungal chitin is an important determinant of Th2 cell-mediated mycosis. Using C. neoformans mutants or purified chitin, we found that chitin abundance impacted Th2 cell accumulation and disease. Importantly, we determined Th2 cell induction depended on cleavage of chitin via the mammalian chitinase, chitotriosidase, an enzyme that was also prevalent in humans experiencing overt cryptococcosis. The data presented herein offers a new perspective on fungal disease susceptibility, whereby chitin recognition via chitotriosidase leads to the initiation of harmful Th2 cell differentiation by CD11b+ conventional dendritic cells in response to pulmonary fungal infection.

  12. Chitin Recognition via Chitotriosidase Promotes Pathologic Type-2 Helper T Cell Responses to Cryptococcal Infection

    Science.gov (United States)

    Wiesner, Darin L.; Specht, Charles A.; Lee, Chrono K.; Smith, Kyle D.; Mukaremera, Liliane; Lee, S. Thera; Lee, Chun G.; Elias, Jack A.; Nielsen, Judith N.; Boulware, David R.; Bohjanen, Paul R.; Jenkins, Marc K.; Levitz, Stuart M.; Nielsen, Kirsten

    2015-01-01

    Pulmonary mycoses are often associated with type-2 helper T (Th2) cell responses. However, mechanisms of Th2 cell accumulation are multifactorial and incompletely known. To investigate Th2 cell responses to pulmonary fungal infection, we developed a peptide-MHCII tetramer to track antigen-specific CD4+ T cells produced in response to infection with the fungal pathogen Cryptococcus neoformans. We noted massive accruement of pathologic cryptococcal antigen-specific Th2 cells in the lungs following infection that was coordinated by lung-resident CD11b+ IRF4-dependent conventional dendritic cells. Other researchers have demonstrated that this dendritic cell subset is also capable of priming protective Th17 cell responses to another pulmonary fungal infection, Aspergillus fumigatus. Thus, higher order detection of specific features of fungal infection by these dendritic cells must direct Th2 cell lineage commitment. Since chitin-containing parasites commonly elicit Th2 responses, we hypothesized that recognition of fungal chitin is an important determinant of Th2 cell-mediated mycosis. Using C. neoformans mutants or purified chitin, we found that chitin abundance impacted Th2 cell accumulation and disease. Importantly, we determined Th2 cell induction depended on cleavage of chitin via the mammalian chitinase, chitotriosidase, an enzyme that was also prevalent in humans experiencing overt cryptococcosis. The data presented herein offers a new perspective on fungal disease susceptibility, whereby chitin recognition via chitotriosidase leads to the initiation of harmful Th2 cell differentiation by CD11b+ conventional dendritic cells in response to pulmonary fungal infection. PMID:25764512

  13. Slit molecules prevent entrance of trunk neural crest cells in developing gut.

    Science.gov (United States)

    Zuhdi, Nora; Ortega, Blanca; Giovannone, Dion; Ra, Hannah; Reyes, Michelle; Asención, Viviana; McNicoll, Ian; Ma, Le; de Bellard, Maria Elena

    2015-04-01

    Neural crest cells emerge from the dorsal neural tube early in development and give rise to sensory and sympathetic ganglia, adrenal cells, teeth, melanocytes and especially enteric nervous system. Several inhibitory molecules have been shown to play important roles in neural crest migration, among them are the chemorepulsive Slit1-3. It was known that Slits chemorepellants are expressed at the entry to the gut, and thus could play a role in the differential ability of vagal but not trunk neural crest cells to invade the gut and form enteric ganglia. Especially since trunk neural crest cells express Robo receptor while vagal do not. Thus, although we know that Robo mediates migration along the dorsal pathway in neural crest cells, we do not know if it is responsible in preventing their entry into the gut. The goal of this study was to further corroborate a role for Slit molecules in keeping trunk neural crest cells away from the gut. We observed that when we silenced Robo receptor in trunk neural crest, the sympathoadrenal (somites 18-24) were capable of invading gut mesenchyme in larger proportion than more rostral counterparts. The more rostral trunk neural crest tended not to migrate beyond the ventral aorta, suggesting that there are other repulsive molecules keeping them away from the gut. Interestingly, we also found that when we silenced Robo in sacral neural crest they did not wait for the arrival of vagal crest but entered the gut and migrated rostrally, suggesting that Slit molecules are the ones responsible for keeping them waiting at the hindgut mesenchyme. These combined results confirm that Slit molecules are responsible for keeping the timeliness of colonization of the gut by neural crest cells. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Entamoeba Clone-Recognition Experiments: Morphometrics, Aggregative Behavior, and Cell-Signaling Characterization.

    Science.gov (United States)

    Espinosa, Avelina; Paz-Y-Miño-C, Guillermo; Hackey, Meagan; Rutherford, Scott

    2016-05-01

    Studies on clone- and kin-discrimination in protists have proliferated during the past decade. We report clone-recognition experiments in seven Entamoeba lineages (E. invadens IP-1, E. invadens VK-1:NS, E. terrapinae, E. moshkovskii Laredo, E. moshkovskii Snake, E. histolytica HM-1:IMSS and E. dispar). First, we characterized morphometrically each clone (length, width, and cell-surface area) and documented how they differed statistically from one another (as per single-variable or canonical-discriminant analyses). Second, we demonstrated that amebas themselves could discriminate self (clone) from different (themselves vs. other clones). In mix-cell-line cultures between closely-related (E. invadens IP-1 vs. E. invadens VK-1:NS) or distant-phylogenetic clones (E. terrapinae vs. E. moshkovskii Laredo), amebas consistently aggregated with same-clone members. Third, we identified six putative cell-signals secreted by the amebas (RasGap/Ankyrin, coronin-WD40, actin, protein kinases, heat shock 70, and ubiquitin) and which known functions in Entamoeba spp. included: cell proliferation, cell adhesion, cell movement, and stress-induced encystation. To our knowledge, this is the first multi-clone characterization of Entamoeba spp. morphometrics, aggregative behavior, and cell-signaling secretion in the context of clone-recognition. Protists allow us to study cell-cell recognition from ecological and evolutionary perspectives. Modern protistan lineages can be central to studies about the origins and evolution of multicellularity. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  15. Sequence recognition of alpha-LFA-1-derived peptides by ICAM-1 cell receptors: inhibitors of T-cell adhesion.

    Science.gov (United States)

    Yusuf-Makagiansar, Helena; Yakovleva, Tatyana V; Tejo, Bimo A; Jones, Karen; Hu, Yongbo; Verkhivker, Gennady M; Audus, Kenneth L; Siahaan, Teruna J

    2007-09-01

    Blocking the T-cell adhesion signal from intercellular adhesion molecule-1/leukocyte function-associated antigen-1 interactions (Signal-2) can suppress the progression of autoimmune diseases (i.e. type-1 diabetes, psoriasis) and prevent allograph rejection. In this study, we determined the active region(s) of cLAB.L peptide [cyclo(1,12)Pen-ITDGEATDSGC] by synthesizing and evaluating the biologic activity of hexapeptides in inhibiting T-cell adhesion. A new heterotypic T-cell adhesion assay was also developed to provide a model for the T-cell adhesion process during lung inflammation. Two hexapeptides, ITDGEA and DGEATD, were found to be more active than the other linear hexapeptides. The cyclic derivative of ITDGEA [i.e. cyclo(1,6)ITDGEA] has similar activity than the parent linear peptide and has lower activity than cLAB.L peptide. Computational-binding experiments were carried out to explain the possible mechanism of binding of these peptides to intercellular adhesion molecule-1. Both ITDGEA and DGEATD bind the same site on intercellular adhesion molecule-1 and they interact with the Gln34 and Gln73 residues on D1 of intercellular adhesion molecule-1. In the future, more potent derivatives of cyclo(1,6)ITDGEA will be designed by utilizing structural and binding studies of the peptide to intercellular adhesion molecule-1. The heterotypic T-cell adhesion to Calu-3 will also be used as another assay to evaluate the selectivity of the designed peptides.

  16. Slp-76 is a critical determinant of NK cell-mediated recognition of missing-self targets

    OpenAIRE

    Lampe, Kristin; Endale, Mehari; Cashman, Siobhan; Fang, Hao; Mattner, Jochen; Hildeman, David; Hoebe, Kasper

    2015-01-01

    Absence of MHC class I expression is an important mechanism by which NK cells recognize a variety of target cells, yet the pathways underlying “missing-self” recognition, including the involvement of activating receptors, remain poorly understood. Using ENU mutagenesis in mice, we identified a germline mutant, designated Ace, with a marked defect in NK cell-mediated recognition and elimination of “missing-self” targets. The causative mutation was linked to chromosome 11 and identified as a mi...

  17. Oncolytic viruses sensitize human tumor cells for NY-ESO-1 tumor antigen recognition by CD4+ effector T cells.

    Science.gov (United States)

    Delaunay, Tiphaine; Violland, Mathilde; Boisgerault, Nicolas; Dutoit, Soizic; Vignard, Virginie; Münz, Christian; Gannage, Monique; Dréno, Brigitte; Vaivode, Kristine; Pjanova, Dace; Labarrière, Nathalie; Wang, Yaohe; Chiocca, E Antonio; Boeuf, Fabrice Le; Bell, John C; Erbs, Philippe; Tangy, Frédéric; Grégoire, Marc; Fonteneau, Jean-François

    2018-01-01

    Oncolytic immunotherapy using oncolytic viruses (OV) has been shown to stimulate the antitumor immune response by inducing the release of tumor-associated antigens (TAA) and danger signals from the dying infected tumor cells. In this study, we sought to determine if the lysis of tumor cells induced by different OV: measles virus, vaccinia virus, vesicular stomatitis virus, herpes simplex type I virus, adenovirus or enterovirus, has consequences on the capacity of tumor cells to present TAA, such as NY-ESO-1. We show that the co-culture of NY-ESO-1 neg /HLA-DP4 pos melanoma cells with NY-ESO-1 pos /HLA-DP4 neg melanoma cells infected and killed by different OV induces an intercellular transfer of NY-ESO-1 that allows the recognition of NY-ESO-1 neg /HLA-DP4 pos tumor cells by an HLA-DP4/NY-ESO-1 (157-170) -specific CD4+ cytotoxic T cell clone, NY67. We then confirmed this result in a second model with an HLA-DP4+ melanoma cell line that expresses a low amount of NY-ESO-1. Recognition of this cell line by the NY67 clone is largely increased in the presence of OV productive infection. Altogether, our results show for the first time another mechanism of stimulation of the anti-tumor immune response by OV, via the loading of tumor cells with TAA that sensitizes them for direct recognition by specific effector CD4+ T cells, supporting the use of OV for cancer immunotherapy.

  18. Superantigen presentation by human retinal pigment epithelial cells to T cells is dependent on CD2-CD58 and CD18-CD54 molecule interactions

    DEFF Research Database (Denmark)

    Jørgensen, A; Junker, N; Kaestel, C G

    2001-01-01

    Human retinal pigment epithelial (RPE) cells are capable of presenting bacterial superantigens (SAg) to T cells in vitro by ligation of MHC class II molecules on RPE cells with the T cell receptor. The purpose of this study was to evaluate the involvement of adhesion molecules in presentation....... Proliferation was measured by (3)H-thymidine incorporation assay. In selected experiments, either RPE or T cells were pre-treated with blocking antibodies specific for cell surface molecules. For comparison, dendritic cells were used as superantigen presenting cells for T cells. This study showed...... that presentation of SEA by RPE cells to resting T cells was dependent on the presence of the molecules CD2, CD58 and CD18, CD54. The cycling status of T cells was decisive, thus resting T cells but not activated T cells were capable to proliferate in response to SEA presentation. Proliferation of T cells induced...

  19. The cell adhesion molecule Fasciclin2 regulates brush border length and organization in Drosophila renal tubules.

    Science.gov (United States)

    Halberg, Kenneth A; Rainey, Stephanie M; Veland, Iben R; Neuert, Helen; Dornan, Anthony J; Klämbt, Christian; Davies, Shireen-Anne; Dow, Julian A T

    2016-04-13

    Multicellular organisms rely on cell adhesion molecules to coordinate cell-cell interactions, and to provide navigational cues during tissue formation. In Drosophila, Fasciclin 2 (Fas2) has been intensively studied due to its role in nervous system development and maintenance; yet, Fas2 is most abundantly expressed in the adult renal (Malpighian) tubule rather than in neuronal tissues. The role Fas2 serves in this epithelium is unknown. Here we show that Fas2 is essential to brush border maintenance in renal tubules of Drosophila. Fas2 is dynamically expressed during tubule morphogenesis, localizing to the brush border whenever the tissue is transport competent. Genetic manipulations of Fas2 expression levels impact on both microvilli length and organization, which in turn dramatically affect stimulated rates of fluid secretion by the tissue. Consequently, we demonstrate a radically different role for this well-known cell adhesion molecule, and propose that Fas2-mediated intermicrovillar homophilic adhesion complexes help stabilize the brush border.

  20. Neuregulin-1 is a chemoattractant and chemokinetic molecule for trunk neural crest cells.

    Science.gov (United States)

    de Bellard, Maria Elena; Ortega, Blanca; Sao, Sothy; Kim, Lino; Herman, Joshua; Zuhdi, Nora

    2018-03-08

    Trunk neural crest cells migrate rapidly along characteristic pathways within the developing vertebrate embryo. Proper trunk neural crest cell migration is necessary for the morphogenesis of much of the peripheral nervous system, melanocytes, and the adrenal medulla. Numerous molecules help guide trunk neural crest cell migration throughout the early embryo. Here, we show that the trophic factor NRG1 is a chemoattractant through in vitro chemotaxis assays and in vivo silencing via a DN-erbB receptor. Interestingly, we also observed changes in migratory responses consistent with a chemokinetic effect of NRG1 in trunk neural crest velocity. NRG1 is a trunk neural crest cell chemoattractant and chemokinetic molecule. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

  1. Reversible cryo-arrest for imaging molecules in living cells at high spatial resolution

    Science.gov (United States)

    Sabet, Ola; Wehner, Frank; Konitsiotis, Antonios; Fuhr, Günther R.; Bastiaens, Philippe I. H.

    2016-01-01

    The dynamics of molecules in living cells hamper precise imaging of molecular patterns by functional and super resolution microscopy. Circumventing lethal chemical fixation, an on-stage cryo-arrest was developed for consecutive imaging of molecular patterns within the same living, but arrested cells. The reversibility of consecutive cryo-arrests was demonstrated by the high survival rate of different cell lines and intact growth factor signaling that was not perturbed by stress response. Reversible cryo-arrest was applied to study the evolution of ligand-induced receptor tyrosine kinase activation at different scales. The nanoscale clustering of epidermal growth factor receptor (EGFR) in the plasma membrane was assessed by single molecule localization microscopy and endosomal microscale activity patterns of ephrin receptor type-A (EphA2) by fluorescence lifetime imaging microscopy. We thereby demonstrate that reversible cryo-arrest allows the precise determination of molecular patterns while conserving the dynamic capabilities of living cells. PMID:27400419

  2. Water and oxygen induced degradation of small molecule organic solar cells

    DEFF Research Database (Denmark)

    Hermenau, Martin; Riede, Moritz; Leo, Karl

    2011-01-01

    Small molecule organic solar cells were studied with respect to water and oxygen induced degradation by mapping the spatial distribution of reaction products in order to elucidate the degradation patterns and failure mechanisms. The active layers consist of a 30 nm bulk heterojunction formed...

  3. Age-related changes in expression of neural cell adhesion molecule (NCAM) in heart

    DEFF Research Database (Denmark)

    Gaardsvoll, H; Krog, L; Zhernosekov, D

    1993-01-01

    The neural cell adhesion molecule (NCAM) has been implicated in cellular interactions involved in cardiac morphogenesis and innervation. In this study, expression of NCAM mRNA and protein was characterized in rat heart during postnatal development and aging (postnatal days 1, 10, 40, 270, and 730...

  4. The neural cell adhesion molecule binds to fibroblast growth factor receptor 2

    DEFF Research Database (Denmark)

    Christensen, Claus; Lauridsen, Jes B; Berezin, Vladimir

    2006-01-01

    The neural cell adhesion molecule (NCAM) can bind to and activate fibroblast growth factor receptor 1 (FGFR1). However, there are four major FGFR isoforms (FGFR1-FGFR4), and it is not known whether NCAM also interacts directly with the other three FGFR isoforms. In this study, we show by surface...

  5. Age-related changes in expression of the neural cell adhesion molecule in skeletal muscle

    DEFF Research Database (Denmark)

    Andersson, A M; Olsen, M; Zhernosekov, D

    1993-01-01

    Neural cell adhesion molecule (NCAM) is expressed by muscle and involved in muscle-neuron and muscle-muscle cell interactions. The expression in muscle is regulated during myogenesis and by the state of innervation. In aged muscle, both neurogenic and myogenic degenerative processes occur. We here...... been demonstrated in muscle cell lines and in primary cultures of muscle cells during formation of myotubes in vitro, and this switch in NCAM mRNA classes has been suggested to correlate with myogenesis.(ABSTRACT TRUNCATED AT 250 WORDS)...

  6. Differential expression of the neural cell adhesion molecule NCAM 140 in human pituitary tumors

    OpenAIRE

    Aletsee-Ufrecht, M. C.; Langley, O. K.; Gratzl, O.; Gratzl, Manfred

    1990-01-01

    We have analyzed the expression of the intracellular marker protein neuron specific enolase (NSE), synaptophysin (SYN) and of the cell surface marker NCAM (neural cell adhesion molecule) in both normal human hypophysis and in pituitary adenomas in order to explore their potential use as diagnostic tools. All adenomas (4 prolactinomas, 3 growth hormone (GH) producing adenomas and 4 inactive adenomas) showed SYN and NSE immunoreactivity on tissue sections and this was confirmed by immunoblots. ...

  7. Structure and Mutagenesis of Neural Cell Adhesion Molecule Domains Evidence for Flexibility in the Placement of Polysialic Acid Attachment Sites

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Deirdre A.; Swartzentruber, Kristin G.; Lavie, Arnon; Colley, Karen J. (UICM)

    2010-11-09

    The addition of {alpha}2,8-polysialic acid to the N-glycans of the neural cell adhesion molecule, NCAM, is critical for brain development and plays roles in synaptic plasticity, learning and memory, neuronal regeneration, and the growth and invasiveness of cancer cells. Our previous work indicates that the polysialylation of two N-glycans located on the fifth immunoglobulin domain (Ig5) of NCAM requires the presence of specific sequences in the adjacent fibronectin type III repeat (FN1). To understand the relationship of these two domains, we have solved the crystal structure of the NCAM Ig5-FN1 tandem. Unexpectedly, the structure reveals that the sites of Ig5 polysialylation are on the opposite face from the FN1 residues previously found to be critical for N-glycan polysialylation, suggesting that the Ig5-FN1 domain relationship may be flexible and/or that there is flexibility in the placement of Ig5 glycosylation sites for polysialylation. To test the latter possibility, new Ig5 glycosylation sites were engineered and their polysialylation tested. We observed some flexibility in glycosylation site location for polysialylation and demonstrate that the lack of polysialylation of a glycan attached to Asn-423 may be in part related to a lack of terminal processing. The data also suggest that, although the polysialyltransferases do not require the Ig5 domain for NCAM recognition, their ability to engage with this domain is necessary for polysialylation to occur on Ig5 N-glycans.

  8. Direct Reprogramming of Mouse Fibroblasts to Neural Stem Cells by Small Molecules

    Directory of Open Access Journals (Sweden)

    Yan-Chuang Han

    2016-01-01

    Full Text Available Although it is possible to generate neural stem cells (NSC from somatic cells by reprogramming technologies with transcription factors, clinical utilization of patient-specific NSC for the treatment of human diseases remains elusive. The risk hurdles are associated with viral transduction vectors induced mutagenesis, tumor formation from undifferentiated stem cells, and transcription factors-induced genomic instability. Here we describe a viral vector-free and more efficient method to induce mouse fibroblasts into NSC using small molecules. The small molecule-induced neural stem (SMINS cells closely resemble NSC in morphology, gene expression patterns, self-renewal, excitability, and multipotency. Furthermore, the SMINS cells are able to differentiate into astrocytes, functional neurons, and oligodendrocytes in vitro and in vivo. Thus, we have established a novel way to efficiently induce neural stem cells (iNSC from fibroblasts using only small molecules without altering the genome. Such chemical induction removes the risks associated with current techniques such as the use of viral vectors or the induction of oncogenic factors. This technique may, therefore, enable NSC to be utilized in various applications within clinical medicine.

  9. Oncogene Expression Modulation in Cancer Cell Lines by DNA G-Quadruplex-Interactive Small Molecules.

    Science.gov (United States)

    Francisco, Ana Paula; Paulo, Alexandra

    2017-01-01

    Nucleic acids are prone to structural polymorphism and a number of structures may be formed in addition to the well-known DNA double helix. Among these is a family of nucleic acid four-stranded structures known as G-quadruplexes (G4). These quadruplex structures can be formed by sequences containing repetitive guanine-rich tracks and the analysis of Non-B-DNA database indicated an enrichment of these sequences in genomic regions controlling cellular proliferation, such as for example in the promoter regions of c- MYC, k-RAS, c-KIT, HSP90 and VEGF among others. The broad concept of G4 targeting with small molecules is now generally accepted as a promising novel approach to anticancer therapy and several small molecules with antiproliferative activity in cancer cell lines have also been shown to stabilize these DNA structures, thus suggesting a potential application of G4-interactive small molecules as new anticancer drugs. Herein we review, by targeted oncogene and main chemical scaffold, those G4-interactive small molecules with reported gene expression modulatory activity in cancer cell lines. The data obtained so far are encouraging but further efforts are needed to validate G4 as drug targets and optimize the structure of G4- interactive small molecules into new anticancer drugs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  10. Decreased soluble cell adhesion molecules after tirofiban infusion in patients with unstable angina pectoris

    Directory of Open Access Journals (Sweden)

    Aliyev Emil

    2004-04-01

    Full Text Available Abstract Aim The inflammatory response, initiated by neutrophil and monocyte adhesion to endothelial cells, is important in the pathogenesis of acute coronary syndromes. Platelets play an important role in inflammatory process by interacting with monocytes and neutrophils. In this study, we investigated the effect of tirofiban on the levels of cell adhesion molecules (soluble intercellular adhesion molecule-1, sICAM-1, and vascular cell adhesion molecule-1, sVCAM-1 in patients with unstable angina pectoris (AP. Methods Thirty-five patients with unstable AP (Group I, ten patients with stable AP (Group II and ten subjects who had angiographycally normal coronary arteries (Group III were included the study. Group I was divided into two subgroups for the specific treatment regimens: Group IA (n = 15 received tirofiban and Group IB (n = 20 did not. Blood samples for investigating the cell adhesion molecules were drawn at zero time (baseline; 0 h in all patients and at 72 h in Group I. Results The baseline levels of sICAM-1 and sVCAM-1 were higher in Group I than in Groups II and III. They were higher in Group IA than in Group IB. However, the sICAM-1 and sVCAM-1 levels decreased significantly in Group IA after tirofiban infusion. In contrast, these levels remained unchanged or were increased above the baseline value in Group IB at 72 h. Conclusion The levels of cell adhesion molecules in patients with unstable AP decreased significantly after tirofiban infusion. Inhibition of platelet function by specific glycoprotein IIb/IIIa antagonists may decrease platelet-mediated inflammation and the ischemic end-point.

  11. [Influence of hepatocyte cell adhesion molecule on gene expression profile of human bladder transitional cell carcinoma cell line].

    Science.gov (United States)

    Wang, Qiu-ju; Lv, Chang-kun; Tao, Jia; Du, Hong-fei; Fan, Yan-ru; Song, Xue-dong; Luo, Chun-li

    2013-04-01

    To investigate the changes of gene expression file in transitional cell carcinoma of bladder after hepatocyte cell adhesion molecule(hepaCAM) overexpression. Affymetrix Human Genome U133 Plus 2.0 Array was used to investigate the changes of gene expression profile between adenovirus-green fluorescent protein(GFP) -hepaCAM group and GFP group in transitional cell carcinoma of bladder EJ cells.Significant Analysis of Microarray(SAM) was used to screen the differentially expressed genes, DAVID software was used to conduct gene ontology analysis and wikiPathway analysis based on the differentially expressed genes. Reverse transcription-polymerase chain reaction and Western blot were applied to verify microarray data. Compared with the GFP group, a total of 2469 genes were up-regulated or down-regulated by more than 2 times in the GFP-hepaCAM group. Among these genes, 1602 genes were up-regulated and 867 were down-regulated.Most of the differentially expressed genes were involved in the function of cell proliferation and cell cycle regulation. The mRNA expressions of nibrin, liver kinase B1, and cyclin D1 detected by reverse transcription-polymerase chain reaction in three different bladder cancer cell lines were consistent with the microarray data.The protein expressions of nibrin and liver kinase B1 in these three cell lines measured by Western blot were consistent with the mRNA expression. HepaCAM can alter the gene expression profile of bladder cancer EJ cells. The well-known anti-tumor effect of hepaCAM may be mediated by regulating the gene expression via multiple pathways.

  12. Multicolour single molecule imaging in cells with near infra-red dyes.

    Directory of Open Access Journals (Sweden)

    Christopher J Tynan

    Full Text Available The autofluorescence background of biological samples impedes the detection of single molecules when imaging. The most common method of reducing the background is to use evanescent field excitation, which is incompatible with imaging beyond the surface of biological samples. An alternative would be to use probes that can be excited in the near infra-red region of the spectrum, where autofluorescence is low. Such probes could also increase the number of labels that can be imaged in multicolour single molecule microscopes. Despite being widely used in ensemble imaging, there is a currently a shortage of information available for selecting appropriate commercial near infra-red dyes for single molecule work. It is therefore important to characterise available near infra-red dyes relevant to multicolour single molecule imaging.A range of commercially available near infra-red dyes compatible with multi-colour imaging was screened to find the brightest and most photostable candidates. Image series of immobilised samples of the brightest dyes (Alexa 700, IRDye 700DX, Alexa 790 and IRDye 800CW were analysed to obtain the mean intensity of single dye molecules, their photobleaching rates and long period blinking kinetics. Using the optimum dye pair, we have demonstrated for the first time widefield, multi-colour, near infra-red single molecule imaging using a supercontinuum light source in MCF-7 cells.We have demonstrated that near infra-red dyes can be used to avoid autofluorescence background in samples where restricting the illumination volume of visible light fails or is inappropriate. We have also shown that supercontinuum sources are suited to single molecule multicolour imaging throughout the 470-1000 nm range. Our measurements of near infra-red dye properties will enable others to select optimal dyes for single molecule imaging.

  13. Multicolour Single Molecule Imaging in Cells with Near Infra-Red Dyes

    Science.gov (United States)

    Tynan, Christopher J.; Clarke, David T.; Coles, Benjamin C.; Rolfe, Daniel J.; Martin-Fernandez, Marisa L.; Webb, Stephen E. D.

    2012-01-01

    Background The autofluorescence background of biological samples impedes the detection of single molecules when imaging. The most common method of reducing the background is to use evanescent field excitation, which is incompatible with imaging beyond the surface of biological samples. An alternative would be to use probes that can be excited in the near infra-red region of the spectrum, where autofluorescence is low. Such probes could also increase the number of labels that can be imaged in multicolour single molecule microscopes. Despite being widely used in ensemble imaging, there is a currently a shortage of information available for selecting appropriate commercial near infra-red dyes for single molecule work. It is therefore important to characterise available near infra-red dyes relevant to multicolour single molecule imaging. Methodology/Principal Findings A range of commercially available near infra-red dyes compatible with multi-colour imaging was screened to find the brightest and most photostable candidates. Image series of immobilised samples of the brightest dyes (Alexa 700, IRDye 700DX, Alexa 790 and IRDye 800CW) were analysed to obtain the mean intensity of single dye molecules, their photobleaching rates and long period blinking kinetics. Using the optimum dye pair, we have demonstrated for the first time widefield, multi-colour, near infra-red single molecule imaging using a supercontinuum light source in MCF-7 cells. Conclusions/Significance We have demonstrated that near infra-red dyes can be used to avoid autofluorescence background in samples where restricting the illumination volume of visible light fails or is inappropriate. We have also shown that supercontinuum sources are suited to single molecule multicolour imaging throughout the 470–1000 nm range. Our measurements of near infra-red dye properties will enable others to select optimal dyes for single molecule imaging. PMID:22558412

  14. Junctional adhesion molecule C (JAM-C) dimerization aids cancer cell migration and metastasis.

    Science.gov (United States)

    Garrido-Urbani, Sarah; Vonlaufen, Alain; Stalin, Jimmy; De Grandis, Maria; Ropraz, Patricia; Jemelin, Stéphane; Bardin, Florence; Scheib, Holger; Aurrand-Lions, Michel; Imhof, Beat A

    2018-04-01

    Most cancer deaths result from metastasis, which is the dissemination of cells from a primary tumor to distant organs. Metastasis involves changes to molecules that are essential for tumor cell adhesion to the extracellular matrix and to endothelial cells. Junctional Adhesion Molecule C (JAM-C) localizes at intercellular junctions as homodimers or more affine heterodimers with JAM-B. We previously showed that the homodimerization site (E66) in JAM-C is also involved in JAM-B binding. Here we show that neoexpression of JAM-C in a JAM-C-negative carcinoma cell line induced loss of adhesive property and pro-metastatic capacities. We also identify two critical structural sites (E66 and K68) for JAM-C/JAM-B interaction by directed mutagenesis of JAM-C and studied their implication on tumor cell behavior. JAM-C mutants did not bind to JAM-B or localize correctly to junctions. Moreover, mutated JAM-C proteins increased adhesion and reduced proliferation and migration of lung carcinoma cell lines. Carcinoma cells expressing mutant JAM-C grew slower than with JAM-C WT and were not able to establish metastatic lung nodules in mice. Overall these data demonstrate that the dimerization sites E66-K68 of JAM-C affected cell adhesion, polarization and migration and are essential for tumor cell metastasis. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Heat shock protein-90 inhibitors enhance antigen expression on melanomas and increase T cell recognition of tumor cells.

    Directory of Open Access Journals (Sweden)

    Timothy J Haggerty

    Full Text Available In an effort to enhance antigen-specific T cell recognition of cancer cells, we have examined numerous modulators of antigen-expression. In this report we demonstrate that twelve different Hsp90 inhibitors (iHsp90 share the ability to increase the expression of differentiation antigens and MHC Class I antigens. These iHsp90 are active in several molecular and cellular assays on a series of tumor cell lines, including eleven human melanomas, a murine B16 melanoma, and two human glioma-derived cell lines. Intra-cytoplasmic antibody staining showed that all of the tested iHsp90 increased expression of the melanocyte differentiation antigens Melan-A/MART-1, gp100, and TRP-2, as well as MHC Class I. The gliomas showed enhanced gp100 and MHC staining. Quantitative analysis of mRNA levels showed a parallel increase in message transcription, and a reporter assay shows induction of promoter activity for Melan-A/MART-1 gene. In addition, iHsp90 increased recognition of tumor cells by T cells specific for Melan-A/MART-1. In contrast to direct Hsp90 client proteins, the increased levels of full-length differentiation antigens that result from iHsp90 treatment are most likely the result of transcriptional activation of their encoding genes. In combination, these results suggest that iHsp90 improve recognition of tumor cells by T cells specific for a melanoma-associated antigen as a result of increasing the expressed intracellular antigen pool available for processing and presentation by MHC Class I, along with increased levels of MHC Class I itself. As these Hsp90 inhibitors do not interfere with T cell function, they could have potential for use in immunotherapy of cancer.

  16. An Evolutionary-Conserved Function of Mammalian Notch Family Members as Cell Adhesion Molecules

    Science.gov (United States)

    Murata, Akihiko; Yoshino, Miya; Hikosaka, Mari; Okuyama, Kazuki; Zhou, Lan; Sakano, Seiji; Yagita, Hideo; Hayashi, Shin-Ichi

    2014-01-01

    Notch family members were first identified as cell adhesion molecules by cell aggregation assays in Drosophila studies. However, they are generally recognized as signaling molecules, and it was unclear if their adhesion function was restricted to Drosophila. We previously demonstrated that a mouse Notch ligand, Delta-like 1 (Dll1) functioned as a cell adhesion molecule. We here investigated whether this adhesion function was conserved in the diversified mammalian Notch ligands consisted of two families, Delta-like (Dll1, Dll3 and Dll4) and Jagged (Jag1 and Jag2). The forced expression of mouse Dll1, Dll4, Jag1, and Jag2, but not Dll3, on stromal cells induced the rapid and enhanced adhesion of cultured mast cells (MCs). This was attributed to the binding of Notch1 and Notch2 on MCs to each Notch ligand on the stromal cells themselves, and not the activation of Notch signaling. Notch receptor-ligand binding strongly supported the tethering of MCs to stromal cells, the first step of cell adhesion. However, the Jag2-mediated adhesion of MCs was weaker and unlike other ligands appeared to require additional factor(s) in addition to the receptor-ligand binding. Taken together, these results demonstrated that the function of cell adhesion was conserved in mammalian as well as Drosophila Notch family members. Since Notch receptor-ligand interaction plays important roles in a broad spectrum of biological processes ranging from embryogenesis to disorders, our finding will provide a new perspective on these issues from the aspect of cell adhesion. PMID:25255288

  17. Three dimensional extrusion printing induces polymer molecule alignment and cell organization within engineered cartilage.

    Science.gov (United States)

    Guo, Ting; Ringel, Julia P; Lim, Casey G; Bracaglia, Laura G; Noshin, Maeesha; Baker, Hannah B; Powell, Douglas A; Fisher, John P

    2018-04-16

    Proper cell-material interactions are critical to remain cell function and thus successful tissue regeneration. Many fabrication processes have been developed to create microenvironments to control cell attachment and organization on a three-dimensional (3D) scaffold. However, these approaches often involve heavy engineering and only the surface layer can be patterned. We found that 3D extrusion based printing at high temperature and pressure will result an aligned effect on the polymer molecules, and this molecular arrangement will further induce the cell alignment and different differentiation capacities. In particular, articular cartilage tissue is known to have zonal collagen fiber and cell orientation to support different functions, where collagen fibers and chondrocytes align parallel, randomly, and perpendicular, respectively, to the surface of the joint. Therefore, cell alignment was evaluated in a cartilage model in this study. We used small angle X-ray scattering analysis to substantiate the polymer molecule alignment phenomenon. The cellular response was evaluated both in vitro and in vivo. Seeded mesenchymal stem cells (MSCs) showed different morphology and orientation on scaffolds, as a combined result of polymer molecule alignment and printed scaffold patterns. Gene expression results showed improved superficial zonal chondrogenic marker expression in parallel-aligned group. The cell alignment was successfully maintained in the animal model after 7 days with distinct MSC morphology between the casted and parallel printed scaffolds. This 3D printing induced polymer and cell alignment will have a significant impact on developing scaffold with controlled cell-material interactions for complex tissue engineering while avoiding complicated surface treatment, and therefore provides new concept for effective tissue repairing in future clinical applications. © 2018 Wiley Periodicals, Inc. J Biomed Mater Res Part A, 2018. © 2018 Wiley Periodicals, Inc.

  18. Biosynthesis of the neural cell adhesion molecule: characterization of polypeptide C

    DEFF Research Database (Denmark)

    Nybroe, O; Albrechtsen, M; Dahlin, J

    1985-01-01

    The biosynthesis of the neural cell adhesion molecule (N-CAM) was studied in primary cultures of rat cerebral glial cells, cerebellar granule neurons, and skeletal muscle cells. The three cell types produced different N-CAM polypeptide patterns. Glial cells synthesized a 135,000 Mr polypeptide B...... and a 115,000 Mr polypeptide C, whereas neurons expressed a 200,000 Mr polypeptide A as well as polypeptide B. Skeletal muscle cells produced polypeptide B. The polypeptides synthesized by the three cell types were immunochemically identical. The membrane association of polypeptide C was investigated...... with methods that distinguish peripheral and integral membrane proteins. Polypeptide C was found to be a peripheral membrane protein, whereas polypeptides A and B were integral membrane proteins with cytoplasmic domains of approximately 50,000 and approximately 25,000 Mr, respectively. The affinity...

  19. Studies on T-cell receptors involved in experimental autoimmune encephalomyelitis using the complementary peptide recognition approach.

    Science.gov (United States)

    Xian, C J; Simmons, R D; Willenborg, D O; Vandenbark, A A; Hashim, G A; Carnegie, P R

    1995-08-01

    Based upon Blalock's complementary recognition approach, a complementary or antisense peptide (CP) was designed to the experimental autoimmune encephalomyelitis (EAE) epitope peptide, rat myelin basic protein (MBP) peptide 72-82. This peptide (EAE CP) was shown to have some sequence similarities to T-cell receptors (TCR) and MHC II molecules in a sequence homology search. Solid-phase binding assays demonstrated specific and high affinity binding (3 and 4 microM) between the EAE CP and the rat and guinea pig EAE epitope peptides (Rt72-82 and Gp69-82), respectively. This EAE CP was also found to be immunogenic in rats in an ear swelling test for delayed type hypersensitivity (DTH) reactions and an ELISA for antibody responses. However, a rabbit antibody generated to EAE CP was shown to be unable to stain the V beta 8+ EAE susceptible T-cells in immunofluorescence analyses. This EAE CP was also used in attempts to down-regulate EAE and the results showed that prior immunization with EAE CP in complete Freund's adjuvant could not prevent the Lewis rats from developing EAE. Although the data on sense-antisense peptide interaction were positive and the EAE CP was immunogenic, the inability of EAE CP to regulate EAE indicates that the CP approach may not be generally applicable.

  20. Recognition tunneling

    International Nuclear Information System (INIS)

    Lindsay, Stuart; He Jin; Zhang Peiming; Chang Shuai; Huang Shuo; Sankey, Otto; Hapala, Prokop; Jelinek, Pavel

    2010-01-01

    Single molecules in a tunnel junction can now be interrogated reliably using chemically functionalized electrodes. Monitoring stochastic bonding fluctuations between a ligand bound to one electrode and its target bound to a second electrode ('tethered molecule-pair' configuration) gives insight into the nature of the intermolecular bonding at a single molecule-pair level, and defines the requirements for reproducible tunneling data. Simulations show that there is an instability in the tunnel gap at large currents, and this results in a multiplicity of contacts with a corresponding spread in the measured currents. At small currents (i.e. large gaps) the gap is stable, and functionalizing a pair of electrodes with recognition reagents (the 'free-analyte' configuration) can generate a distinct tunneling signal when an analyte molecule is trapped in the gap. This opens up a new interface between chemistry and electronics with immediate implications for rapid sequencing of single DNA molecules. (topical review)

  1. Recognition tunneling

    Energy Technology Data Exchange (ETDEWEB)

    Lindsay, Stuart; He Jin; Zhang Peiming; Chang Shuai; Huang Shuo [Biodesign Institute, Arizona State University, Tempe, AZ 85287 (United States); Sankey, Otto [Department of Physics, Arizona State University, Tempe, AZ 85287 (United States); Hapala, Prokop; Jelinek, Pavel [Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 1862 53, Prague (Czech Republic)

    2010-07-02

    Single molecules in a tunnel junction can now be interrogated reliably using chemically functionalized electrodes. Monitoring stochastic bonding fluctuations between a ligand bound to one electrode and its target bound to a second electrode ('tethered molecule-pair' configuration) gives insight into the nature of the intermolecular bonding at a single molecule-pair level, and defines the requirements for reproducible tunneling data. Simulations show that there is an instability in the tunnel gap at large currents, and this results in a multiplicity of contacts with a corresponding spread in the measured currents. At small currents (i.e. large gaps) the gap is stable, and functionalizing a pair of electrodes with recognition reagents (the 'free-analyte' configuration) can generate a distinct tunneling signal when an analyte molecule is trapped in the gap. This opens up a new interface between chemistry and electronics with immediate implications for rapid sequencing of single DNA molecules. (topical review)

  2. Recognition of microbial viability via TLR8 drives TFH cell differentiation and vaccine responses

    DEFF Research Database (Denmark)

    Ugolini, Matteo; Gerhard, Jenny; Burkert, Sanne

    2018-01-01

    Live attenuated vaccines are generally highly efficacious and often superior to inactivated vaccines, yet the underlying mechanisms of this remain largely unclear. Here we identify recognition of microbial viability as a potent stimulus for follicular helper T cell (TFH cell) differentiation...... and vaccine responses. Antigen-presenting cells (APCs) distinguished viable bacteria from dead bacteria through Toll-like receptor 8 (TLR8)-dependent detection of bacterial RNA. In contrast to dead bacteria and other TLR ligands, live bacteria, bacterial RNA and synthetic TLR8 agonists induced a specific...... cytokine profile in human and porcine APCs, thereby promoting TFH cell differentiation. In domestic pigs, immunization with a live bacterial vaccine induced robust TFH cell and antibody responses, but immunization with its heat-killed counterpart did not. Finally, a hypermorphic TLR8 polymorphism...

  3. Carcinoembryonic antigen-related cell adhesion molecules (CEACAMs) in cancer progression and metastasis.

    Science.gov (United States)

    Beauchemin, Nicole; Arabzadeh, Azadeh

    2013-12-01

    The discovery of the carcinoembryonic antigen (CEA) as a tumor marker for colorectal cancer some 50 years ago became the first step in the identification of a much larger family of 12 carcinoembryonic antigen-related cell adhesion molecules (CEACAMs) with surprisingly diverse functions in cell adhesion, in intracellular and intercellular signaling, and during complex biological processes such as cancer progression, inflammation, angiogenesis, and metastasis. The development of proper molecular and biochemical tools and mouse models has enabled bidirectional translation of the CEACAM network biology. Indeed, CEACAM1, CEACAM5, and CEACAM6 are now considered valid clinical biomarkers and promising therapeutic targets in melanoma, lung, colorectal, and pancreatic cancers. These fascinating proteins illustrate how a better understanding of the CEACAM family of cell adhesion molecules reveals their functional link to the underlying disease and lead to new monitoring and targeting opportunities.

  4. Biased small-molecule ligands for selective inhibition of HIV-1 cell entry via CCR5

    DEFF Research Database (Denmark)

    Berg, Christian; Spiess, Katja; von Lüttichau, Hans Rudolf

    2016-01-01

    Since the discovery of HIV's use of CCR5 as the primary coreceptor in fusion, the focus on developing small-molecule receptor antagonists for inhibition hereof has only resulted in one single drug, Maraviroc. We therefore investigated the possibility of using small-molecule CCR5 agonists as HIV-1...... fusion inhibitors. A virus-free cell-based fusion reporter assay, based on mixing "effector cells" (expressing HIV Env and luciferase activator) with "target cells" (expressing CD4, CCR5 wild type or a selection of well-described mutations, and luciferase reporter), was used as fusion readout. Receptor...... expression was evaluated by ELISA and fluorescence microscopy. On CCR5 WT, Maraviroc and Aplaviroc inhibited fusion with high potencies (EC 50 values of 91 and 501 nM, respectively), whereas removal of key residues for both antagonists (Glu283Ala) or Maraviroc alone (Tyr251Ala) prevented fusion inhibition...

  5. Small molecule AT7867 proliferates PDX1-expressing pancreatic progenitor cells derived from human pluripotent stem cells

    Directory of Open Access Journals (Sweden)

    Azuma Kimura

    2017-10-01

    Full Text Available While pancreatic islet transplantation achieves insulin independence in type 1 diabetes (T1D patients, its widespread application is limited by donor tissue scarcity. Pancreatic progenitor cells (PPCs give rise to all cell types in the pancreas during development. PPCs derived from human pluripotent stem cells have been shown to differentiate into functional β cells both in vitro and in vivo, and to reverse hyperglycemia, at least in mice. Therefore, PPCs have great potential to serve as an alternative cell source for cell therapy, and the identification of compounds that facilitate PPC proliferation could provide stable and large-scale pancreatic cell preparation systems in clinical settings. Here, we developed and performed cell-based screens to identify small molecules that induce the proliferation of hiPSC-derived PDX1-expressing PPCs. The screening identified AT7867, which promoted PPC proliferation approximately five-fold within six days through the maintenance of a high Ki67+ cell ratio. The induced proliferation by AT7867 does not result in DNA damage, as revealed by pHH2AX staining, and is observed specifically in PPCs but not other cell types. The established platform utilizing small molecules for PPC proliferation may contribute to the development of cell therapy for T1D using a regenerative medicine approach.

  6. Cloning of B cell-specific membrane tetraspanning molecule BTS possessing B cell proliferation-inhibitory function.

    Science.gov (United States)

    Suenaga, Tadahiro; Arase, Hisashi; Yamasaki, Sho; Kohno, Masayuki; Yokosuka, Tadashi; Takeuchi, Arata; Hattori, Takamichi; Saito, Takashi

    2007-11-01

    Lymphocyte proliferation is regulated by signals through antigen receptors, co-stimulatory receptors, and other positive and negative modulators. Several membrane tetraspanning molecules are also involved in the regulation of lymphocyte growth and death. We cloned a new B cell-specific tetraspanning (BTS) membrane molecule, which is similar to CD20 in terms of expression, structure and function. BTS is specifically expressed in the B cell line and its expression is increased after the pre-B cell stage. BTS is expressed in intracellular granules and on the cell surface. Overexpression of BTS in immature B cell lines induces growth retardation through inhibition of cell cycle progression and cell size increase without inducing apoptosis. This inhibitory function is mediated predominantly by the N terminus of BTS. The development of mature B cells is inhibited in transgenic mice expressing BTS, suggesting that BTS is involved in the in vivo regulation of B cells. These results indicate that BTS plays a role in the regulation of cell division and B cell growth.

  7. Primed T cell responses to chemokines are regulated by the immunoglobulin-like molecule CD31.

    Directory of Open Access Journals (Sweden)

    Madhav Kishore

    Full Text Available CD31, an immunoglobulin-like molecule expressed by leukocytes and endothelial cells, is thought to contribute to the physiological regulation T cell homeostasis due to the presence of two immunotyrosine-based inhibitory motifs in its cytoplasmic tail. Indeed, loss of CD31 expression leads to uncontrolled T cell-mediated inflammation in a variety of experimental models of disease and certain CD31 polymorphisms correlate with increased disease severity in human graft-versus-host disease and atherosclerosis. The molecular mechanisms underlying CD31-mediated regulation of T cell responses have not yet been clarified. We here show that CD31-mediated signals attenuate T cell chemokinesis both in vitro and in vivo. This effect selectively affects activated/memory T lymphocytes, in which CD31 is clustered on the cell membrane where it segregates to the leading edge. We provide evidence that this molecular segregation, which does not occur in naïve T lymphocytes, might lead to cis-CD31 engagement on the same membrane and subsequent interference with the chemokine-induced PI3K/Akt signalling pathway. We propose that CD31-mediated modulation of memory T cell chemokinesis is a key mechanism by which this molecule contributes to the homeostatic regulation of effector T cell immunity.

  8. Inhibition of SIRT1 by a small molecule induces apoptosis in breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Kalle, Arunasree M., E-mail: arunasreemk@ilsresearch.org [Institute of Life Sciences, University of Hyderabad Campus, Hyderabad, AP 500 046 (India); Mallika, A. [Institute of Life Sciences, University of Hyderabad Campus, Hyderabad, AP 500 046 (India); Badiger, Jayasree [HKE' s Smt. V.G. College for Women, Aiwan-E-Shahi Area, Gulbarga, KA 585 102 (India); Alinakhi [Institute of Life Sciences, University of Hyderabad Campus, Hyderabad, AP 500 046 (India); Talukdar, Pinaki [Department of Chemistry, Indian Institute of Science Education and Research, First Floor, Central Tower, Sai Trinity Building Garware Circle, Sutarwadi, PashanPune, Maharashtra 411 021 (India); Sachchidanand [Lupin Research Park, 46/47, A, Village Nande, Taluka Mulshi, Dist. Pune 411 042 (India)

    2010-10-08

    Research highlights: {yields} Novel small molecule SIRT1 inhibitor better than sirtinol. {yields} IC{sub 50} 500 nM. {yields} Specific tumor cytotoxicity towards breast cancer cells. {yields} Restoration of H3K9 acetylation levels to baseline when co-treated with SIRT1 activator (Activator X) and inhibitor (ILS-JGB-1741). -- Abstract: Overexpression of SIRT1, a NAD{sup +}-dependent class III histone deacetylases (HDACs), is implicated in many cancers and therefore could become a promising antitumor target. Here we demonstrate a small molecule SIRT1 inhibitor, ILS-JGB-1741(JGB1741) with potent inhibitory effects on the proliferation of human metastatic breast cancer cells, MDA-MB 231. The molecule has been designed using medicinal chemistry approach based on known SIRT1 inhibitor, sirtinol. The molecule showed a significant inhibition of SIRT1 activity compared to sirtinol. Studies on the antitumor effects of JGB on three different cancer cell lines, K562, HepG2 and MDA-MB 231 showed an IC{sub 50} of 1, 10 and 0.5 {mu}M, respectively. Further studies on MDA-MB 231 cells showed a dose-dependent increase in K9 and K382 acetylation of H3 and p53, respectively. Results also demonstrated that JGB1741-induced apoptosis is associated with increase in cytochrome c release, modulation in Bax/Bcl2 ratio and cleavage of PARP. Flowcytometric analysis showed increased percentage of apoptotic cells, decrease in mitochondrial membrane potential and increase in multicaspase activation. In conclusion, the present study indicates the potent apoptotic effects of JGB1741 in MDA-MB 231 cells.

  9. Natural-killer cell ligands at the maternal-fetal interface: UL-16 binding proteins, MHC class-I chain related molecules, HLA-F and CD48.

    Science.gov (United States)

    Apps, Richard; Gardner, Lucy; Traherne, James; Male, Victoria; Moffett, Ashley

    2008-11-01

    In the early stages of human placentation, the decidua is invaded by fetal extravillous trophoblast (EVT) cells. Interactions between EVT cells and local decidual leukocytes are likely to contribute to immunological accommodation of the semi-allogeneic fetus. Natural-killer group 2 member D (NKG2D) and 2B4 (CD244) are receptors ubiquitously expressed by the distinctive population of CD56 bright, uterine natural-killer cells, which dominate the decidua at the time of implantation. Here, we investigate the UL-16 binding protein (ULBP) and MHC class-I chain related molecule (MIC) ligands of NKG2D, the CD48 ligand of 2B4 and the non-classical HLA class-I molecule, HLA-F, at the maternal-fetal interface of normal pregnancies. For many of these molecules, significant mRNA expression was detected by RT-PCR in decidual and placental tissue throughout gestation. Flow cytometry of isolated cells or immunohistological staining of implantation site sections was then performed. No protein expression of NKG2D ligands or HLA-F could be detected in decidual leukocytes or fetal trophoblast cells from the first trimester. An NKG2D-Fc fusion protein identified no novel ligands for this promiscuous receptor at the maternal-fetal interface. Strong surface protein expression of CD48 by decidual leukocytes but not by trophoblast cells was detected by flow cytometry. Histological staining showed a clear aggregation of CD48(+) cells around transformed spiral arteries of the implantation site. We conclude that the role of NKG2D and 2B4 is not focussed on trophoblast recognition in normal pregnancy, but is more likely involved in cross-talk among maternal cells of the placental bed.

  10. Imbalanced expression of functional surface molecules in regulatory and effector T cells in systemic lupus erythematosus

    International Nuclear Information System (INIS)

    Mesquita Júnior, D.; Cruvinel, W.M.; Araujo, J.A.P.; Salmazi, K.C.; Kallas, E.G.; Andrade, L.E.C.

    2014-01-01

    Regulatory T (TREG) cells play an important role in maintaining immune tolerance and avoiding autoimmunity. We analyzed the expression of membrane molecules in TREG and effector T cells in systemic lupus erythematosus (SLE). TREG and effector T cells were analyzed for the expression of CTLA-4, PD1, CD28, CD95, GITR, HLA-DR, OX40, CD40L, and CD45RO in 26 patients with active disease, 31 with inactive disease, and 26 healthy controls. TREG cells were defined as CD25 +/high CD127 Ø/low FoxP3 + , and effector T cells were defined as CD25 + CD127 + FoxP3 Ø . The ratio of TREG to effector T cells expressing GITR, PD1, HLA-DR, OX40, CD40L, and CD45RO was determined in the three groups. The frequency of TREG cells was similar in patients with SLE and controls. However, SLE patients had a decreased frequency of CTLA-4 + TREG and CD28 + TREG cells and an increased frequency of CD40L + TREG cells. There was a decrease in the TREG/effector-T ratio for GITR + , HLA-DR + , OX40 + , and CD45RO + cells, and an increased ratio of TREG/effector-T CD40L + cells in patients with SLE. In addition, CD40L + TREG cell frequency correlated with the SLE disease activity index (P=0.0163). In conclusion, our findings showed several abnormalities in the expression of functionally critical surface molecules in TREG and effector T cells in SLE that may be relevant to the pathogenesis of this disease

  11. Imbalanced expression of functional surface molecules in regulatory and effector T cells in systemic lupus erythematosus

    Energy Technology Data Exchange (ETDEWEB)

    Mesquita Júnior, D. [Disciplina de Reumatologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil); Cruvinel, W.M. [Disciplina de Reumatologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil); Departamento de Biomedicina, Universidade Católica de Goiás, Goiânia, GO (Brazil); Araujo, J.A.P. [Disciplina de Reumatologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil); Salmazi, K.C.; Kallas, E.G. [Disciplina de Imunologia Clínica e Alergia, Departamento de Clínica Médica, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil); Andrade, L.E.C. [Disciplina de Reumatologia, Departamento de Medicina, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil)

    2014-08-22

    Regulatory T (TREG) cells play an important role in maintaining immune tolerance and avoiding autoimmunity. We analyzed the expression of membrane molecules in TREG and effector T cells in systemic lupus erythematosus (SLE). TREG and effector T cells were analyzed for the expression of CTLA-4, PD1, CD28, CD95, GITR, HLA-DR, OX40, CD40L, and CD45RO in 26 patients with active disease, 31 with inactive disease, and 26 healthy controls. TREG cells were defined as CD25{sup +/high}CD127{sup Ø/low}FoxP3{sup +}, and effector T cells were defined as CD25{sup +}CD127{sup +}FoxP3{sup Ø}. The ratio of TREG to effector T cells expressing GITR, PD1, HLA-DR, OX40, CD40L, and CD45RO was determined in the three groups. The frequency of TREG cells was similar in patients with SLE and controls. However, SLE patients had a decreased frequency of CTLA-4{sup +}TREG and CD28{sup +}TREG cells and an increased frequency of CD40L{sup +}TREG cells. There was a decrease in the TREG/effector-T ratio for GITR{sup +}, HLA-DR{sup +}, OX40{sup +}, and CD45RO{sup +} cells, and an increased ratio of TREG/effector-T CD40L{sup +} cells in patients with SLE. In addition, CD40L{sup +}TREG cell frequency correlated with the SLE disease activity index (P=0.0163). In conclusion, our findings showed several abnormalities in the expression of functionally critical surface molecules in TREG and effector T cells in SLE that may be relevant to the pathogenesis of this disease.

  12. A Small-Molecule Screen for Enhanced Homing of Systemically Infused Cells

    OpenAIRE

    Levy, Oren; Mortensen, Luke J.; Boquet, Gerald; Tong, Zhixiang; Perrault, Christelle; Benhamou, Brigitte; Zhang, Jidong; Stratton, Tara; Han, Edward; Safaee, Helia; Musabeyezu, Juliet; Yang, Zijiang; Multon, Marie-Christine; Rothblatt, Jonathan; Deleuze, Jean-Francois

    2014-01-01

    Poor homing of systemically infused cells to disease sites may limit the success of exogenous cell-based therapy. In this study, we screened 9,000 signal-transduction modulators to identify hits that increase mesenchymal stromal cell (MSC) surface expression of homing ligands that bind to intercellular adhesion molecule 1 (ICAM-1), such as CD11a. Pretreatment of MSCs with Ro-31-8425, an identified hit from this screen, increased MSC firm adhesion to an ICAM-1-coated substrate in vitro and ena...

  13. Using Thermogenic Beige Cells to Identify Biologically Active Small Molecules and Peptides.

    Science.gov (United States)

    Wu, Ling; Xu, Bin

    2017-01-01

    Incorporating molecular libraries in chemical biology screenings in cultured cells has been successfully used for gene discovery in many cellular processes. It has the unique potential to uncover novel mechanisms of complex cellular biology through the screening of small molecules and protein biologics in relevant cell-based assays. Recent development in the understanding and generation of thermogenic adipocytes provides opportunities for potential anti-obesity therapeutics discovery. In this chapter, we describe screening methods using thermogenic beige cells to identify novel compounds and peptides that activate adipocyte thermogenesis.

  14. Combination of Small Molecule Microarray and Confocal Microscopy Techniques for Live Cell Staining Fluorescent Dye Discovery

    Directory of Open Access Journals (Sweden)

    Attila Bokros

    2013-08-01

    Full Text Available Discovering new fluorochromes is significantly advanced by high-throughput screening (HTS methods. In the present study a combination of small molecule microarray (SMM prescreening and confocal laser scanning microscopy (CLSM was developed in order to discover novel cell staining fluorescent dyes. Compounds with high native fluorescence were selected from a 14,585-member library and further tested on living cells under the microscope. Eleven compartment-specific, cell-permeable (or plasma membrane-targeted fluorochromes were identified. Their cytotoxicity was tested and found that between 1–10 micromolar range, they were non-toxic even during long-term incubations.

  15. An Ursolic Acid Derived Small Molecule Triggers Cancer Cell Death through Hyperstimulation of Macropinocytosis.

    Science.gov (United States)

    Sun, Lin; Li, Bin; Su, Xiaohui; Chen, Ge; Li, Yaqin; Yu, Linqian; Li, Li; Wei, Wanguo

    2017-08-10

    Macropinocytosis is a transient endocytosis that internalizes extracellular fluid and particles into vacuoles. Recent studies suggest that hyperstimulation of macropinocytosis can induce a novel nonapoptotic cell death, methuosis. In this report, we describe the identification of an ursolic acid derived small molecule (compound 17), which induces cancer cell death through hyperstimulation of macropinocytosis. 17 causes the accumulation of vacuoles derived from macropinosomes based on transmission electron microscopy, time-lapse microscopy, and labeling with extracellular fluid phase tracers. The vacuoles induced by 17 separate from other cytoplasmic compartments but acquire some characteristics of late endosomes and lysosomes. Inhibiting hyperstimulation of macropinocytosis with the specific inhibitor amiloride blocks cell death, implicating that 17 leads to cell death via macropinocytosis, which is coincident with methuosis. Our results uncovered a novel cell death pathway involved in the activity of 17, which may provide a basis for further development of natural-product-derived scaffolds for drugs that trigger cancer cell death by methuosis.

  16. How do CD4+ T cells detect and eliminate tumor cells that either lack or express MHC class II molecules?

    Directory of Open Access Journals (Sweden)

    Ole Audun Werner Haabeth

    2014-04-01

    Full Text Available CD4+ T cells contribute to tumor eradication, even in the absence of CD8+ T cells. Cytotoxic CD4+ T cells can directly kill MHC class II positive tumor cells. More surprisingly, CD4+ T cells can indirectly eliminate tumor cells that lack MHC class II expression. Here, we review the mechanisms of direct and indirect CD4+ T cell-mediated elimination of tumor cells. An emphasis is put on T cell receptor (TCR transgenic models, where anti-tumor responses of naïve CD4+ T cells of defined specificity can be tracked. Some generalizations can tentatively be made. For both MHCIIPOS and MHCIINEG tumors, presentation of tumor specific antigen by host antigen presenting cells (APCs appears to be required for CD4+ T cell priming. This has been extensively studied in a myeloma model (MOPC315, where host APCs in tumor-draining lymph nodes are primed with secreted tumor antigen. Upon antigen recognition, naïve CD4+ T cells differentiate into Th1 cells and migrate to the tumor. At the tumor site, the mechanisms for elimination of MHCIIPOS and MHCIINEG tumor cells differ. In a TCR transgenic B16 melanoma model, MHCIIPOS melanoma cells are directly killed by cytotoxic CD4+ T cells in a perforin/granzyme B-dependent manner. By contrast, MHCIINEG myeloma cells are killed by IFN-g stimulated M1-like macrophages. In summary, while the priming phase of CD4+ T cells appears similar for MHCIIPOS and MHCIINEG tumors, the killing mechanisms are different. Unresolved issues and directions for future research are addressed.

  17. Mesenchymal Stem Cells in Perichondrium Express Activated Leukocyte Cell Adhesion Molecule and Participate in Bone Marrow Formation

    Science.gov (United States)

    Arai, Fumio; Ohneda, Osamu; Miyamoto, Takeshi; Zhang, Xiu Qin; Suda, Toshio

    2002-01-01

    Perichondrium in fetal limb is composed of undifferentiated mesenchymal cells. However, the multipotency of cells in this region and the role of perichondrium in bone marrow formation are not well understood. In this report, we purified and characterized perichondrial cells using a monoclonal antibody against activated leukocyte cell adhesion molecule (ALCAM) and investigated the role of perichondrial cells in hematopoietic bone marrow formation. ALCAM is expressed on hematopoietic cells, endothelial cells, bone marrow stromal cells, and mesenchymal stem cells and mediates homophilic (ALCAM–ALCAM)/heterophilic (ALCAM-CD6) cell adhesion. Here we show by immunohistochemical staining that ALCAM is expressed in perichondrium. ALCAM+ perichondrial cells isolated by FACS® exhibit the characteristics of mesenchymal stem cells. ALCAM+ cells can differentiate into osteoblasts, adipocytes, chondrocytes, and stromal cells, which can support osteoclastogenesis, hematopoiesis, and angiogenesis. Furthermore, the addition of ALCAM-Fc or CD6-Fc to the metatarsal culture, the invasion of the blood vessels to a cartilage was inhibited. Our findings indicate that ALCAM+ perichondrial cells participate in vascular invasion by recruiting osteoclasts and vessels. These findings suggest that perichondrium might serve as a stem cell reservoir and play an important role in the early development of a bone and bone marrow. PMID:12070283

  18. Crystal structure of the Ig1 domain of the neural cell adhesion molecule NCAM2 displays domain swapping

    DEFF Research Database (Denmark)

    Rasmussen, Kim Krighaar; Kulahin, Nikolaj; Kristensen, Ole

    2008-01-01

    The crystal structure of the first immunoglobulin (Ig1) domain of neural cell adhesion molecule 2 (NCAM2/OCAM/RNCAM) is presented at a resolution of 2.7 A. NCAM2 is a member of the immunoglobulin superfamily of cell adhesion molecules (IgCAMs). In the structure, two Ig domains interact by domain...

  19. Latent Membrane Protein LMP2A Impairs Recognition of EBV-Infected Cells by CD8+ T Cells.

    Directory of Open Access Journals (Sweden)

    Chiara Rancan

    2015-06-01

    Full Text Available The common pathogen Epstein-Barr virus (EBV transforms normal human B cells and can cause cancer. Latent membrane protein 2A (LMP2A of EBV supports activation and proliferation of infected B cells and is expressed in many types of EBV-associated cancer. It is not clear how latent EBV infection and cancer escape elimination by host immunity, and it is unknown whether LMP2A can influence the interaction of EBV-infected cells with the immune system. We infected primary B cells with EBV deleted for LMP2A, and established lymphoblastoid cell lines (LCLs. We found that CD8+ T cell clones showed higher reactivity against LMP2A-deficient LCLs compared to LCLs infected with complete EBV. We identified several potential mediators of this immunomodulatory effect. In the absence of LMP2A, expression of some EBV latent antigens was elevated, and cell surface expression of MHC class I was marginally increased. LMP2A-deficient LCLs produced lower amounts of IL-10, although this did not directly affect CD8+ T cell recognition. Deletion of LMP2A led to several changes in the cell surface immunophenotype of LCLs. Specifically, the agonistic NKG2D ligands MICA and ULBP4 were increased. Blocking experiments showed that NKG2D activation contributed to LCL recognition by CD8+ T cell clones. Our results demonstrate that LMP2A reduces the reactivity of CD8+ T cells against EBV-infected cells, and we identify several relevant mechanisms.

  20. Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.

    Science.gov (United States)

    Ghodke, Harshad; Ho, Han; van Oijen, Antoine M

    2018-02-19

    Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  1. The molecule HLA-G: radiosensitivity indicator of a human melanoma cell line

    International Nuclear Information System (INIS)

    Michelin, S.C.; Gallegos, C.E.; Dubner, D.L.; Baffa Trasci, S.; Favier, B.; Carosella, E.D.

    2010-01-01

    The physiological and pathological relevance of the HLA-G molecule (non-classical Human Leukocyte Antigen) has been motif of important research studies. Its distribution is restricted to only few tissues. HLA-G takes part in the implantation after in vitro fecundation, in graft tolerance, in auto-immune diseases, and in tumoral immune escape. Its expression has been demonstrated in more than 30% of tumors of 15 different histological types. Gamma radiation modulates HLA-G expression at the cell surface. However, its involvement in tumoral radiosensitivity has not been demonstrated yet. The objective of this work was to demonstrate if the HLA-G molecule intervenes in the radiosensibility of human melanoma cells cultured in vitro. For this purpose we used the human melanoma cell line M8, which was transfected with the plasmid containing the HLA-G gene (M8 HLA-G+) or with the plasmid alone, without the HLA-G gene (M8 pc DNA). Both cell lines were irradiated with 0, 2, 5 y 10 Gy and in all cases survival frequency was determined with the clonogenic assay. We observed a significant reduction in M8 HLA-G+ survival with respect to M8 pc DNA for all irradiation doses and was independent of doses. These results, if confirmed in other histological types, could postulate the HLA-G molecule as a tumoral radiosensitivity marker. The specific mechanism involved in the radiosensibility modification exerted by HLA-G has not been elucidated yet. (authors) [es

  2. A novel anti-CD146 antibody specifically targets cancer cells by internalizing the molecule.

    Science.gov (United States)

    Nollet, Marie; Stalin, Jimmy; Moyon, Anaïs; Traboulsi, Waël; Essaadi, Amel; Robert, Stéphane; Malissen, Nausicaa; Bachelier, Richard; Daniel, Laurent; Foucault-Bertaud, Alexandrine; Gaudy-Marqueste, Caroline; Lacroix, Romaric; Leroyer, Aurélie S; Guillet, Benjamin; Bardin, Nathalie; Dignat-George, Françoise; Blot-Chabaud, Marcel

    2017-12-22

    CD146 is an adhesion molecule present on many tumors (melanoma, kidney, pancreas, breast, ...). In addition, it has been shown to be expressed on vascular endothelial and smooth muscle cells. Generating an antibody able to specifically recognize CD146 in cancer cells (designated as tumor CD146), but not in normal cells, would thus be of major interest for targeting tumor CD146 without affecting the vascular system. We thus generated antibodies against the extracellular domain of the molecule produced in cancer cells and selected an antibody that specifically recognizes tumor CD146. This antibody (TsCD146 mAb) was able to detect CD146-positive tumors in human biopsies and in vivo , by PET imaging, in a murine xenograft model. In addition, TsCD146 mAb antibody was able to specifically detect CD146-positive cancer microparticles in the plasma of patients. TsCD146 mAb displayed also therapeutic effects since it was able to reduce the growth of human CD146-positive cancer cells xenografted in nude mice. This effect was due to a decrease in the proliferation and an increase in the apoptosis of CD146-positive cancer cells after TsCD146-mediated internalization of the cell surface CD146. Thus, TsCD146 mAb could be of major interest for diagnostic and therapeutic strategies against CD146-positive tumors in a context of personalized medicine.

  3. Label-free recognition of drug resistance via impedimetric screening of breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Bilge Eker

    Full Text Available We present a novel study on label-free recognition and distinction of drug resistant breast cancer cells (MCF-7 DOX from their parental cells (MCF-7 WT via impedimetric measurements. Drug resistant cells exhibited significant differences in their dielectric properties compared to wild-type cells, exerting much higher extracellular resistance (Rextra . Immunostaining revealed that MCF-7 DOX cells gained a much denser F-actin network upon acquiring drug resistance indicating that remodeling of actin cytoskeleton is probably the reason behind higher Rextra , providing stronger cell architecture. Moreover, having exposed both cell types to doxorubicin, we were able to distinguish these two phenotypes based on their substantially different drug response. Interestingly, impedimetric measurements identified a concentration-dependent and reversible increase in cell stiffness in the presence of low non-lethal drug doses. Combined with a profound frequency analysis, these findings enabled distinguishing distinct cellular responses during drug exposure within four concentration ranges without using any labeling. Overall, this study highlights the possibility to differentiate drug resistant phenotypes from their parental cells and to assess their drug response by using microelectrodes, offering direct, real-time and noninvasive measurements of cell dependent parameters under drug exposure, hence providing a promising step for personalized medicine applications such as evaluation of the disease progress and optimization of the drug treatment of a patient during chemotherapy.

  4. On the hunt for helminths: innate immune cells in the recognition and response to helminth parasites.

    Science.gov (United States)

    Perrigoue, Jacqueline G; Marshall, Fraser A; Artis, David

    2008-09-01

    The generation of protective immunity to helminth parasites is critically dependent upon the development of a CD4(+) T helper type 2 cytokine response. However, the host-parasite interactions responsible for initiating this response are poorly understood. This review will discuss recent advances in our understanding of how helminth-derived products are recognized by innate immune cells. Specifically, interactions between helminth excretory/secretory products and host Toll-like receptors and lectins will be discussed as well as the putative functions of helminth proteases and chitin in activating and recruiting innate immune cells. In addition, the functional significance of pattern recognition by epithelial cells, granulocytes, dendritic cells and macrophages including expression of alarmins, thymic stromal lymphopoetin, interleukin (IL)-25, IL-33 and Notch ligands in the development of adaptive anti-parasite Th2 cytokine responses will be examined.

  5. Marinobufagin, a molecule from poisonous frogs, causes biochemical, morphological and cell cycle changes in human neoplasms and vegetal cells.

    Science.gov (United States)

    Machado, Kátia da Conceição; Sousa, Lívia Queiroz de; Lima, Daisy Jereissati Barbosa; Soares, Bruno Marques; Cavalcanti, Bruno Coêlho; Maranhão, Sarah Sant'Anna; Noronha, Janaina da Costa de; Rodrigues, Domingos de Jesus; Militão, Gardenia Carmen Gadelha; Chaves, Mariana Helena; Vieira-Júnior, Gerardo Magela; Pessoa, Cláudia; Moraes, Manoel Odorico de; Sousa, João Marcelo de Castro E; Melo-Cavalcante, Ana Amélia de Carvalho; Ferreira, Paulo Michel Pinheiro

    2018-03-15

    Skin toad secretion present physiologically active molecules to protect them against microorganisms, predators and infections. This work detailed the antiproliferative action of marinobufagin on tumor and normal lines, investigate its mechanism on HL-60 leukemia cells and its toxic effects on Allium cepa meristematic cells. Initially, cytotoxic action was assessed by colorimetric assays. Next, HL-60 cells were analyzed by morphological and flow cytometry techniques and growing A. cepa roots were examined after 72 h exposure. Marinobufagin presented high antiproliferative action against all human tumor lines [IC 50 values ranging from 0.15 (leukemia) to 7.35 (larynx) μM] and it failed against human erythrocytes and murine lines. Human normal peripheral blood mononuclear cells (PBMC) were up to 72.5-fold less sensitive [IC 50: 10.88 μM] to marinobufagin than HL-60 line, but DNA strand breaks were no detected. Leukemia treaded cells exhibited cell viability reduction, DNA fragmentation, phosphatidylserine externalization, binucleation, nuclear condensation and cytoplasmic vacuoles. Marinobufagin also reduced the growth of A. cepa roots (EC 50 : 7.5 μM) and mitotic index, caused cell cycle arrest and chromosomal alterations (micronuclei, delays and C-metaphases) in meristematic cells. So, to find out partially targeted natural molecules on human leukemia cells, like marinobufagin, is an amazing and stimulating way to continue the battle against cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Abolishing Cell Wall Glycosylphosphatidylinositol-Anchored Proteins in Candida albicans Enhances Recognition by Host Dectin-1.

    Science.gov (United States)

    Shen, Hui; Chen, Si Min; Liu, Wei; Zhu, Fang; He, Li Juan; Zhang, Jun Dong; Zhang, Shi Qun; Yan, Lan; Xu, Zheng; Xu, Guo Tong; An, Mao Mao; Jiang, Yuan Ying

    2015-07-01

    Fungi can shield surface pathogen-associated molecular patterns (PAMPs) for evading host immune attack. The most common and opportunistic human pathogen, Candida albicans, can shield β-(1 3)-glucan on the cell wall, one of the major PAMPs, to avoid host phagocyte Dectin-1 recognition. The way to interfere in the shielding process for more effective antifungal defense is not well established. In this study, we found that deletion of the C. albicans GPI7 gene, which was responsible for adding ethanolaminephosphate to the second mannose in glycosylphosphatidylinositol (GPI) biosynthesis, could block the attachment of most GPI-anchored cell wall proteins (GPI-CWPs) to the cell wall and subsequently unmask the concealed β-(1,3)-glucan. Neutrophils could kill the uncloaked gpi7 mutant more efficiently with an augmented respiratory burst. The gpi7 mutant also stimulated Dectin-1-dependent immune responses of macrophages, including activation of nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) pathways and secretion of specific cytokines, such as tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6), and IL-12p40. Furthermore, the gpi7 null mutant could induce an enhanced inflammatory response through promoting significant recruitment of neutrophils and monocytes and could stimulate stronger Th1 and Th17 cell responses to fungal infections in vivo. These in vivo phenotypes also were Dectin-1 dependent. Thus, we assume that GPI-CWPs are involved in the immune mechanism of C. albicans escaping from host recognition by Dectin-1. Our studies also indicate that the blockage of GPI anchor synthesis is a strategy to inhibit C. albicans evading host recognition. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Cell adhesion molecules in the development of inflammatory infiltrates in giant cell arteritis: inflammation-induced angiogenesis as the preferential site of leukocyte-endothelial cell interactions.

    Science.gov (United States)

    Cid, M C; Cebrián, M; Font, C; Coll-Vinent, B; Hernández-Rodríguez, J; Esparza, J; Urbano-Márquez, A; Grau, J M

    2000-01-01

    To investigate the expression pattern of adhesion molecules involved in leukocyte-endothelial cell interactions in giant cell arteritis (GCA). Immunohistochemical analysis was performed on frozen temporal artery sections from 32 patients with biopsy-proven GCA and from 12 control patients with other diseases. Adhesion molecules identified were intercellular adhesion molecule 1 (ICAM-1), ICAM-2, ICAM-3, vascular cell adhesion molecule 1 (VCAM-1), platelet endothelial cell adhesion molecule 1 (PECAM-1), E-selectin, P-selectin, L-selectin, lymphocyte function-associated antigen 1 (LFA-1), very late activation antigen 4 (VLA-4), Mac-1 (CD18/CD11b), and gp 150,95 (CD18/CD11c). Clinical and biochemical parameters of inflammation in the patients, as well as the duration of previous corticosteroid treatment, were prospectively recorded. Constitutive (PECAM-1, ICAM-1, ICAM-2, and P-selectin) and inducible (E-selectin and VCAM-1) endothelial adhesion molecules for leukocytes were mainly expressed by adventitial microvessels and neovessels within inflammatory infiltrates. Concurrent analysis of leukocyte receptors indicated a preferential use of VLA-4/VCAM-1 and LFA-1/ICAM-1 at the adventitia and Mac-1/ICAM-1 at the intima-media junction. The intensity of inducible endothelial adhesion molecule expression (E-selectin and VCAM-1) correlated with the intensity of the systemic inflammatory response. Previous corticosteroid treatment reduced, but did not completely abrogate, the expression of the inducible endothelial adhesion molecules E-selectin and VCAM-1. Inflammation-induced angiogenesis is the main site of leukocyte-endothelial cell interactions leading to the development of inflammatory infiltrates in GCA. The distribution of leukocyte-endothelial cell ligand pairs suggests a heterogeneity in leukocyte-endothelial cell interactions used by different functional cell subsets at distinct areas of the temporal artery.

  8. Signaling through intercellular adhesion molecule 1 (ICAM-1) in a B cell lymphoma line

    DEFF Research Database (Denmark)

    Holland, J; Owens, T

    1997-01-01

    Intercellular adhesion molecule 1 (ICAM-1) (CD54) is an adhesion molecule of the immunoglobulin superfamily. The interaction between ICAM-1 on B lymphocytes and leukocyte function-associated antigen 1 on T cells plays a major role in several aspects of the immune response, including T-dependent B...... cell activation. While it was originally believed that ICAM-1 played a purely adhesive role, recent evidence suggests that it can itself transduce biochemical signals. We demonstrate that cross-linking of ICAM-1 results in the up-regulation of class II major histocompatibility complex, and we...... investigate the biochemical mechanism for the signaling role of ICAM-1. We show that cross-linking of ICAM-1 on the B lymphoma line A20 induces an increase in tyrosine phosphorylation of several cellular proteins, including the Src family kinase p53/p56(lyn). In vitro kinase assays showed that Lyn kinase...

  9. Discovery of Novel Small Molecules that Activate Satellite Cell Proliferation and Enhance Repair of Damaged Muscle.

    Science.gov (United States)

    Billin, Andrew N; Bantscheff, Marcus; Drewes, Gerard; Ghidelli-Disse, Sonja; Holt, Jason A; Kramer, Henning F; McDougal, Alan J; Smalley, Terry L; Wells, Carrow I; Zuercher, William J; Henke, Brad R

    2016-02-19

    Skeletal muscle progenitor stem cells (referred to as satellite cells) represent the primary pool of stem cells in adult skeletal muscle responsible for the generation of new skeletal muscle in response to injury. Satellite cells derived from aged muscle display a significant reduction in regenerative capacity to form functional muscle. This decrease in functional recovery has been attributed to a decrease in proliferative capacity of satellite cells. Hence, agents that enhance the proliferative abilities of satellite cells may hold promise as therapies for a variety of pathological settings, including repair of injured muscle and age- or disease-associated muscle wasting. Through phenotypic screening of isolated murine satellite cells, we identified a series of 2,4-diaminopyrimidines (e.g., 2) that increased satellite cell proliferation. Importantly, compound 2 was effective in accelerating repair of damaged skeletal muscle in an in vivo mouse model of skeletal muscle injury. While these compounds were originally prepared as c-Jun N-terminal kinase 1 (JNK-1) inhibitors, structure-activity analyses indicated JNK-1 inhibition does not correlate with satellite cell activity. Screening against a broad panel of kinases did not result in identification of an obvious molecular target, so we conducted cell-based proteomics experiments in an attempt to identify the molecular target(s) responsible for the potentiation of the satellite cell proliferation. These data provide the foundation for future efforts to design improved small molecules as potential therapeutics for muscle repair and regeneration.

  10. HLA Class II Defects in Burkitt Lymphoma: Bryostatin-1-Induced 17 kDa Protein Restores CD4+ T-Cell Recognition

    Directory of Open Access Journals (Sweden)

    Azim Hossain

    2011-01-01

    Full Text Available While the defects in HLA class I-mediated Ag presentation by Burkitt lymphoma (BL have been well documented, CD4+ T-cells are also poorly stimulated by HLA class II Ag presentation, and the reasons underlying this defect(s have not yet been fully resolved. Here, we show that BL cells are deficient in their ability to optimally stimulate CD4+ T cells via the HLA class II pathway. The observed defect was not associated with low levels of BL-expressed costimulatory molecules, as addition of external co-stimulation failed to result in BL-mediated CD4+ T-cell activation. We further demonstrate that BL cells express the components of the class II pathway, and the defect was not caused by faulty Ag/class II interaction, because antigenic peptides bound with measurable affinity to BL-associated class II molecules. Treatment of BL with broystatin-1, a potent modulator of protein kinase C, led to significant improvement of functional class II Ag presentation in BL. The restoration of immune recognition appeared to be linked with an increased expression of a 17 kDa peptidylprolyl-like protein. These results demonstrate the presence of a specific defect in HLA class II-mediated Ag presentation in BL and reveal that treatment with bryostatin-1 could lead to enhanced immunogenicity.

  11. Soluble endothelial cell-selective adhesion molecule and incident cardiovascular events in a multiethnic population.

    Science.gov (United States)

    Ren, Hao-Yu; Khera, Amit; de Lemos, James A; Ayers, Colby R; Rohatgi, Anand

    2017-09-01

    Cell adhesion molecules are key regulators of atherosclerotic plaque development, but circulating levels of soluble fragments, such as intercellular adhesion molecule (sICAM-1) and vascular cell adhesion molecule (sVCAM-1), have yielded conflicting associations with atherosclerotic cardiovascular disease (ASCVD). Endothelial cell-selective adhesion molecule (ESAM) is expressed exclusively in platelets and endothelial cells, and soluble ESAM (sESAM) levels have been associated with prevalent subclinical atherosclerosis. We therefore hypothesized that sESAM would be associated with incident ASCVD. sESAM, sICAM-1, and sVCAM-1 were measured in 2,442 participants without CVD in the Dallas Heart Study, a probability-based population sample aged 30-65 years enrolled between 2000 and 2002. ASCVD was defined as first myocardial infarction, stroke, coronary revascularization, or CV death. A total of 162 ASCVD events were analyzed over 10.4 years. Increasing sESAM was associated with ASCVD, independent of risk factors (HR Q4 vs Q1: 2.7, 95% CI 1.6-4.6). Serial adjustment for renal function, sICAM-1, VCAM-1, and prevalent coronary calcium did not attenuate these associations. Continuous ESAM demonstrated similar findings (HR 1.31, 95% CI 1.2-1.4). Addition of sESAM to traditional risk factors improved discrimination and reclassification (delta c-index: P = .009; integrated-discrimination-improvement index P = .001; net reclassification index = 0.42, 95% CI 0.15-0.68). Neither sICAM-1 nor sVCAM-1 was independently associated with ASCVD. sESAM but not sICAM-1 or sVCAM-1 levels are associated with incident ASCVD. Further studies are warranted to investigate the role of sESAM in ASCVD. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Neural cell adhesion molecule induces intracellular signaling via multiple mechanisms of Ca2+ homeostasis

    DEFF Research Database (Denmark)

    Kiryushko, Darya; Korshunova, Irina; Berezin, Vladimir

    2006-01-01

    The neural cell adhesion molecule (NCAM) plays a pivotal role in the development of the nervous system, promoting neuronal differentiation via homophilic (NCAM-NCAM) as well as heterophilic (NCAM-fibroblast growth factor receptor [FGFR]) interactions. NCAM-induced intracellular signaling has been...... with the Src-family kinases, were also involved in neuritogenesis induced by physiological, homophilic NCAM interactions. Thus, unanticipated mechanisms of Ca2+ homeostasis are shown to be activated by NCAM and to contribute to neuronal differentiation....

  13. Biased small-molecule ligands for selective inhibition of HIV-1 cell entry via CCR5.

    Science.gov (United States)

    Berg, Christian; Spiess, Katja; Lüttichau, Hans R; Rosenkilde, Mette M

    2016-12-01

    Since the discovery of HIV's use of CCR5 as the primary coreceptor in fusion, the focus on developing small-molecule receptor antagonists for inhibition hereof has only resulted in one single drug, Maraviroc. We therefore investigated the possibility of using small-molecule CCR5 agonists as HIV-1 fusion inhibitors. A virus-free cell-based fusion reporter assay, based on mixing "effector cells" (expressing HIV Env and luciferase activator) with "target cells" (expressing CD4, CCR5 wild type or a selection of well-described mutations, and luciferase reporter), was used as fusion readout. Receptor expression was evaluated by ELISA and fluorescence microscopy. On CCR5 WT, Maraviroc and Aplaviroc inhibited fusion with high potencies (EC 50 values of 91 and 501 nM, respectively), whereas removal of key residues for both antagonists (Glu283Ala) or Maraviroc alone (Tyr251Ala) prevented fusion inhibition, establishing this assay as suitable for screening of HIV entry inhibitors. Both ligands inhibited HIV fusion on signaling-deficient CCR5 mutations (Tyr244Ala and Trp248Ala). Moreover, the steric hindrance CCR5 mutation (Gly286Phe) impaired fusion, presumably by a direct hindrance of gp120 interaction. Finally, the efficacy switch mutation (Leu203Phe) - converting small-molecule antagonists/inverse agonists to full agonists biased toward G-protein activation - uncovered that also small-molecule agonists can function as direct HIV-1 cell entry inhibitors. Importantly, no agonist-induced receptor internalization was observed for this mutation. Our studies of the pharmacodynamic requirements for HIV-1 fusion inhibitors highlight the possibility of future development of biased ligands with selective targeting of the HIV-CCR5 interaction without interfering with the normal functionality of CCR5.

  14. Stability assessments on luminescent down-shifting molecules for UV-protection of perovskite solar cells

    Science.gov (United States)

    Gheno, Alexandre; Trigaud, Thierry; Bouclé, Johann; Audebert, Pierre; Ratier, Bernard; Vedraine, Sylvain

    2018-01-01

    In this work the use of a S-tetrazine (NITZ) molecule with down-shifting capability to improve the stability of perovskite solar cells is reported. Indeed perovskite solar cells are known to present a high sensitivity to UV light and one strategy to overcome this issue is to actually supress the UV from the illumination light. The NITZ down-shifting molecule is well suited for this application since it has the particularity to be excited in the near-UV region and to emit into the visible light spectrum, giving the possibility to recycle UV photons for additional current generation. Through current-voltage curves, incident-photon-to-electron conversion efficiency, and photoluminescence spectroscopy characterization we show that NITZ presents an emission quantum yield of 30% which allows to reduce the loss of JSC induced by the use of a conventional UV filter, even if a net gain in photocurrent is not achieved in our case. We also present a simple prediction of the ability of a down-shifting molecule to efficiently perform for a specific active material. Moreover, we finally discuss the possibility to improve using such down-shifting strategy, the performance of some perovskite solar cells based on alternatives electron-transporting layers such as WO3, which are known to alter the active layer performance following UV light absorption.

  15. c-Met and Other Cell Surface Molecules: Interaction, Activation and Functional Consequences

    Directory of Open Access Journals (Sweden)

    Giuditta Viticchiè

    2015-01-01

    Full Text Available The c-Met receptor, also known as the HGF receptor, is one of the most studied tyrosine kinase receptors, yet its biological functions and activation mechanisms are still not fully understood. c-Met has been implicated in embryonic development and organogenesis, in tissue remodelling homeostasis and repair and in cancer metastasis. These functions are indicative of the many cellular processes in which the receptor plays a role, including cell motility, scattering, survival and proliferation. In the context of malignancy, sustained activation of c-Met leads to a signalling cascade involving a multitude of kinases that initiate an invasive and metastatic program. Many proteins can affect the activation of c-Met, including a variety of other cell surface and membrane-spanning molecules or receptors. Some cell surface molecules share structural homology with the c-Met extracellular domain and can activate c-Met via clustering through this domain (e.g., plexins, whereas other receptor tyrosine kinases can enhance c-Met activation and signalling through intracellular signalling cascades (e.g., EGFR. In this review, we provide an overview of c-Met interactions and crosstalk with partner molecules and the functional consequences of these interactions on c-Met activation and downstream signalling, c-Met intracellular localization/recycling and c-Met degradation.

  16. Expression analysis of multiple myeloma CD138 negative progenitor cells using single molecule microarray readout

    Science.gov (United States)

    Jacak, Jaroslaw; Schnidar, Harald; Muresan, Leila; Regl, Gerhard; Frischauf, Annemarie; Aberger, Fritz; Schütz, Gerhard J.; Hesse, Jan

    2013-01-01

    We present a highly sensitive bioanalytical microarray assay that enables the analysis of small genomic sample material. By combining an optimized cDNA purification step with single molecule cDNA detection on the microarray, the platform has improved sensitivity compared to conventional systems, allowing amplification-free determination of expression profiles with as little as 600 ng total RNA. Total RNA from cells was reverse transcribed into fluorescently labeled cDNA and purified employing a precipitation method that minimizes loss of cDNA material. The microarray was scanned on a fluorescence chip-reader with single molecule sensitivity. Using the newly developed platform we were able to analyze the RNA expression profile of a subpopulation of rare multiple myeloma CD138 negative progenitor (MM CD138neg) cells. The high-sensitivity microarray approach led to the identification of a set of 20 genes differentially expressed in MM CD138neg cells. Our work demonstrates the applicability of a straight-forward single-molecule DNA array technology to current topics of molecular and cellular cancer research, which are otherwise difficult to address due to the limited amount of sample material. PMID:23416329

  17. Antioxidant effect of thiazolidine molecules in cell culture media improves stability and performance.

    Science.gov (United States)

    Kuschelewski, Jennifer; Schnellbaecher, Alisa; Pering, Sascha; Wehsling, Maria; Zimmer, Aline

    2017-05-01

    The ability of cell culture media components to generate reactive species as well as their sensitivity to oxidative degradation, affects the overall stability of media and the behavior of cells cultured in vitro. This study investigates the influence of thiazolidine molecules, formed from the condensation between cysteine and alpha-ketoacids, on the stability of these complex mixtures and on the performance of cell culture processes aiming to produce therapeutically relevant monoclonal antibodies. Results presented in this study indicate that 2-methyl-1,3-thiazolidine-2,4-dicarboxylic acid and 2-(2-carboxyethyl)-1,3-thiazolidine-2,4-dicarboxylic acid, obtained by condensation of cysteine with pyruvate or alpha-ketoglutarate, respectively, are able to stabilize cell culture media formulations, in particular redox sensitive molecules like folic acid, thiamine, l-methionine (met) and l-tryptophan (trp). The use of thiazolidine containing feeds in Chinese hamster ovary fed-batch processes showed prolonged culture duration and increased productivity. This enhanced performance was correlated with lower reactive species generation, extracellularly and intracellularly. Moreover, an anti-oxidative response was triggered via the induction of superoxide dismutase and an increase in the total glutathione pool, the major intracellular antioxidant. In total, the results confirm that cells in vitro are not cultured in an oxidant-free environment, a concept that has to be considered when studying the influence of reactive species in human diseases. Furthermore, this study indicates that thiazolidines are an interesting class of antioxidant molecules, capable of increasing cell culture media stability and process performance. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:759-770, 2017. © 2017 American Institute of Chemical Engineers.

  18. Modulation of pathogen recognition by autophagy

    Directory of Open Access Journals (Sweden)

    Ji Eun eOh

    2012-03-01

    Full Text Available Autophagy is an ancient biological process for maintaining cellular homeostasis by degradation of long-lived cytosolic proteins and organelles. Recent studies demonstrated that autophagy is availed by immune cells to regulate innate immunity. On the one hand, cells exert direct effector function by degrading intracellular pathogens; on the other hand, autophagy modulates pathogen recognition and downstream signaling for innate immune responses. Pathogen recognition via pattern recognition receptors induces autophagy. The function of phagocytic cells is enhanced by recruitment of autophagy-related proteins. Moreover, autophagy acts as a delivery system for viral replication complexes to migrate to the endosomal compartments where virus sensing occurs. In another case, key molecules of the autophagic pathway have been found to negatively regulate immune signaling, thus preventing aberrant activation of cytokine production and consequent immune responses. In this review, we focus on the recent advances in the role of autophagy in pathogen recognition and modulation of innate immune responses.

  19. T-cell recognition is shaped by epitope sequence conservation in the host proteome and microbiome

    DEFF Research Database (Denmark)

    Bresciani, Anne Gøther; Paul, Sinu; Schommer, Nina

    2016-01-01

    Several mechanisms exist to avoid or suppress inflammatory T-cell immune responses that could prove harmful to the host due to targeting self-antigens or commensal microbes. We hypothesized that these mechanisms could become evident when comparing the immunogenicity of a peptide from a pathogen...... as a result of negative selection of T cells capable of recognizing such peptides. Moreover, we also found a reduced level of immune recognition for epitopes conserved in the commensal microbiome, presumably as a result of peripheral tolerance. These findings indicate that the existence (and potentially...... the polarization) of T-cell responses to a given epitope is influenced and to some extent predictable based on its similarity to self-antigens and commensal antigens....

  20. The BAR domain protein PICK1 regulates cell recognition and morphogenesis by interacting with Neph proteins.

    Science.gov (United States)

    Höhne, Martin; Lorscheider, Johannes; von Bardeleben, Anna; Dufner, Matthias; Scharf, M Antonia; Gödel, Markus; Helmstädter, Martin; Schurek, Eva-Maria; Zank, Sibylle; Gerke, Peter; Kurschat, Christine; Sivritas, Sema Hayriye; Neumann-Haefelin, Elke; Huber, Tobias B; Reinhardt, H Christian; Schauss, Astrid C; Schermer, Bernhard; Fischbach, Karl-Friedrich; Benzing, Thomas

    2011-08-01

    Neph proteins are evolutionarily conserved membrane proteins of the immunoglobulin superfamily that control the formation of specific intercellular contacts. Cell recognition through these proteins is essential in diverse cellular contexts such as patterning of the compound eye in Drosophila melanogaster, neuronal connectivity in Caenorhabditis elegans, and the formation of the kidney filtration barrier in mammals. Here we identify the PDZ and BAR domain protein PICK1 (protein interacting with C-kinase 1) as a Neph-interacting protein. Binding required dimerization of PICK1, was dependent on PDZ domain protein interactions, and mediated stabilization of Neph1 at the plasma membrane. Moreover, protein kinase C (PKCα) activity facilitated the interaction through releasing Neph proteins from their binding to the multidomain scaffolding protein zonula occludens 1 (ZO-1), another PDZ domain protein. In Drosophila, the Neph homologue Roughest is essential for sorting of interommatidial precursor cells and patterning of the compound eye. RNA interference-mediated knockdown of PICK1 in the Drosophila eye imaginal disc caused a Roughest destabilization at the plasma membrane and a phenotype that resembled rst mutation. These data indicate that Neph proteins and PICK1 synergistically regulate cell recognition and contact formation.

  1. Cell penetrating peptides: efficient vectors for delivery of nanoparticles, nanocarriers, therapeutic and diagnostic molecules.

    Science.gov (United States)

    Farkhani, Samad Mussa; Valizadeh, Alireza; Karami, Hadi; Mohammadi, Samane; Sohrabi, Nasrin; Badrzadeh, Fariba

    2014-07-01

    Efficient delivery of therapeutic and diagnostic molecules to the cells and tissues is a difficult challenge. The cellular membrane is very effective in its role as a selectively permeable barrier. While it is essential for cell survival and function, also presents a major barrier for intracellular delivery of cargo such as therapeutic and diagnostic agents. In recent years, cell-penetrating peptides (CPPs), that are relatively short cationic and/or amphipathic peptides, received great attention as efficient cellular delivery vectors due to their intrinsic ability to enter cells and mediate uptake of a wide range of macromolecular cargo such as plasmid DNA (pDNA), small interfering RNA (siRNAs), drugs, and nanoparticulate pharmaceutical carriers. This review discusses the various uptake mechanisms of these peptides. Furthermore, we discuss recent advances in the use of CPP for the efficient delivery of nanoparticles, nanocarriers, DNA, siRNA, and anticancer drugs to the cells. In addition, we have been highlighting new results for improving endosomal escape of CPP-cargo molecules. Finally, pH-responsive and activable CPPs for tumor-targeting therapy have been described. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Small molecule inhibition of Axl receptor tyrosine kinase potently suppresses multiple malignant properties of glioma cells

    Science.gov (United States)

    Vouri, Mikaella; An, Qian; Birt, Matthew; Pilkington, Geoffrey J.; Hafizi, Sassan

    2015-01-01

    Glioblastoma multiforme (GBM) often features a combination of tumour suppressor gene inactivation and multiple oncogene overactivation. The Axl receptor tyrosine kinase is found overexpressed in GBM and thought to contribute to invasiveness, chemoresistance and poor survival. Here, we have evaluated the effect of BGB324, a clinical candidate Axl-specific small molecule inhibitor, on the invasive behaviour of human GBM cells in vitro, as an indicator of its potential in GBM therapy and also to elucidate the role of Axl in GBM pathogenesis. Two cultured adult GBM cell lines, SNB-19 and UP007, were treated with Gas6 and/or BGB324, and analysed in assays for survival, 3D colony growth, motility, migration and invasion. Western blot was used to detect protein expression and signal protein phosphorylation. In both cell lines, BGB324 inhibited specifically phosphorylation of Axl as well as Akt kinase further downstream. BGB324 also inhibited survival and proliferation of both cell lines in a concentration-dependent manner, as well as completely suppressing migration and invasion. Furthermore, our results indicate co-operative activation between the Axl and Tyro3 receptors, as well as ligand-independent Axl signalling, to take place in GBM cells. In conclusion, small molecule inhibitor-led targeting of Axl may be a promising therapy for GBM progression. PMID:25980499

  3. Trafficking of MHC molecules to the cell surface creates dynamic protein patches.

    Science.gov (United States)

    Blumenthal, Daniel; Edidin, Michael; Gheber, Levi A

    2016-09-01

    Major histocompatibility complex class I (MHC-I) molecules signal infection or transformation by engaging receptors on T lymphocytes. The spatial organization of MHC-I on the plasma membranes is important for this engagement. We and others have shown that MHC-I molecules, like other membrane proteins, are not uniformly distributed, but occur in patches in the plasma membrane. Here, we describe the temporal details of MHC-I patch formation and combine them with the spatial details, which we have described earlier, to yield a comprehensive quantitative description of patch formation. MHC-I is delivered to the plasma membrane in clathrin-coated vesicles, arriving at a rate of ∼2.5×10(-3) μm(-1) min(-1) (or about two arrivals per minute over the whole cell). The vesicles dock and fuse at non-random, apparently targeted, locations on the membrane and the newly delivered MHC-I molecules form patches that are a few hundred nanometers in diameter. The patches are maintained at steady state by a dynamic equilibrium between the rate of delivery and the rate of hindered diffusion of MHC-I molecules out of the patches (caused by components of the actin cytoskeleton). © 2016. Published by The Company of Biologists Ltd.

  4. The CD39 molecule defines distinct cytotoxic subsets within alloactivated human CD8-positive cells.

    Science.gov (United States)

    Gouttefangeas, C; Mansur, I; Schmid, M; Dastot, H; Gélin, C; Mahouy, G; Boumsell, L; Bensussan, A

    1992-10-01

    Lymphocyte activation induces or increases the expression of several surface structures, none of which is characteristic of an activated cell subset. In particular, structures such as CD45RO, CD25, CD26, CD49b, CD54, CD71 are expressed by the vast majority of lymphocytes at various times following in vitro activation. CD39 molecules were originally identified on activated B lymphocytes and have recently been described on activated T cell clones. In the present report, we have characterized phenotypically and functionally defined cell subsets generated during an in vitro allostimulation. Results indicated that the percentage of CD39+ cells reached a maximum at day 6 and remained stable thereafter. We demonstrate that CD39 expression allows the identification within the allosensitized CD8+ cytotoxic cells of distinct subsets of cells mediating allo cytotoxic T lymphocyte or natural killer (NK)-like reactivity. More precisely, CD8+CD39+ alloactivated cells mainly mediate specific killer activity, whereas CD8+CD39- alloactivated cells predominantly exhibit NK-like reactivity. Further, we show a high functional correlation associated with the lack of CD39 expression on NK-like alloactivated CD8+ cells, while there is no association with CD56 or CD57 NK-associated structures.

  5. The study of the structures of the white blood cells using pattern recognition technique

    International Nuclear Information System (INIS)

    Arquisa, M.

    1976-03-01

    It is aimed that through machine recognition, a significant quantitative description of the white blood cells be obtained. This technique will give the characterization of the normal and abnormal white blood cells which may eventually lead to exact and efficient blood examinations and to the possibility of using white blood cells as an effective biological monitor in the assessment of radiation damage and other pathological disorders. Described are the preparation of blood stains and staining procedure with Giemsa and Wright stains, photomicrography of white blood cells with the use of Kodak Dektol Developer and Kodak Acid-Bath Fixer. The film rolls were then scanned. The scanner is used to scan photographic transparencies of white blood cells. This instrument gathers information and converts cell features such as size, shape, ash and granulation into a series of parameters whose values are descriptive of the minute but essential structural characteristics of the cells. From July 1 -December 31, 1975, a total of 51 blood smears were collected and stained. From these blood samples, a total of 103 neutrophils, 30 lymphocytes and 12 monocytes were added to the film library

  6. Transfection of glioma cells with the neural-cell adhesion molecule NCAM

    DEFF Research Database (Denmark)

    Edvardsen, K; Pedersen, P H; Bjerkvig, R

    1994-01-01

    of the injection site, with a sharply demarcated border between the tumor and brain tissue. In contrast, the parental cell line showed single-cell infiltration and more pronounced destruction of normal brain tissue. Using a 51Cr-release assay, spleen cells from rats transplanted with BT4Cn tumor cells generally...

  7. Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Shanlin [Univ. of Alabama, Tuscaloosa, AL (United States)

    2014-11-16

    Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest that the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an

  8. Interplay between efficiency and device architecture for small molecule organic solar cells.

    Science.gov (United States)

    Williams, Graeme; Sutty, Sibi; Aziz, Hany

    2014-06-21

    Small molecule organic solar cells (OSCs) have experienced a resurgence of interest over their polymer solar cell counterparts, owing to their improved batch-to-batch (thus, cell-to-cell) reliability. In this systematic study on OSC device architecture, we investigate five different small molecule OSC structures, including the simple planar heterojunction (PHJ) and bulk heterojunction (BHJ), as well as several planar-mixed structures. The different OSC structures are studied over a wide range of donor:acceptor mixing concentrations to gain a comprehensive understanding of their charge transport behavior. Transient photocurrent decay measurements provide crucial information regarding the interplay between charge sweep-out and charge recombination, and ultimately hint toward space charge effects in planar-mixed structures. Results show that the BHJ/acceptor architecture, comprising a BHJ layer with high C60 acceptor content, generates OSCs with the highest performance by balancing charge generation with charge collection. The performance of other device architectures is largely limited by hole transport, with associated hole accumulation and space charge effects.

  9. Effect of a small molecule Lipid II binder on bacterial cell wall stress

    Directory of Open Access Journals (Sweden)

    Malin J

    2017-02-01

    Full Text Available Jakob Malin,1,2 Amol C Shetty,3 Sean Daugherty,3 Erik PH de Leeuw,1,2 1Institute of Human Virology, 2Department of Biochemistry and Molecular Biology, 3Institute for Genome Sciences, University of Maryland Baltimore School of Medicine, Baltimore, MD, USA Abstract: We have recently identified small molecule compounds that act as binders of Lipid II, an essential precursor of bacterial cell wall biosynthesis. Lipid II comprised a hydrophilic head group that includes a peptidoglycan subunit composed of N-acetylglucosamine (GlcNAc and N-acetylmuramic acid (MurNAc coupled to a short pentapeptide moiety. This headgroup is coupled to a long bactoprenol chain via a pyrophosphate group. Here, we report on the cell wall activity relationship of dimethyl-3-methyl(phenylamino-ethenylcyclohexylidene-propenyl-3-ethyl-1,3-benzothiazolium iodide (compound 5107930 obtained by functional and genetic analyses. Our results indicate that compounds bind to Lipid II and cause specific upregulation of the vancomycin-resistance associated gene vraX. vraX is implicated in the cell wall stress stimulon that confers glycopeptide resistance. Our small molecule Lipid II inhibitor retained activity against strains of Staphylococcus aureus mutated in genes encoding the cell wall stress stimulon. This suggests the feasibility of developing this new scaffold as a therapeutic agent in view of increasing glycopeptide resistance. Keywords: defensin, Lipid II, antibiotics, bacterial membrane, vancomycin

  10. Solution-Processed Organic Solar Cells from Dye Molecules: An Investigation of Diketopyrrolopyrrole:Vinazene Heterojunctions

    KAUST Repository

    Walker, Bright

    2012-01-25

    Although one of the most attractive aspects of organic solar cells is their low cost and ease of fabrication, the active materials incorporated into the vast majority of reported bulk heterojunction (BHJ) solar cells include a semiconducting polymer and a fullerene derivative, classes of materials which are both typically difficult and expensive to prepare. In this study, we demonstrate that effective BHJs can be fabricated from two easily synthesized dye molecules. Solar cells incorporating a diketopyrrolopyrrole (DPP)-based molecule as a donor and a dicyanoimidazole (Vinazene) acceptor function as an active layer in BHJ solar cells, producing relatively high open circuit voltages and power conversion efficiencies (PCEs) up to 1.1%. Atomic force microscope images of the films show that active layers are rough and apparently have large donor and acceptor domains on the surface, whereas photoluminescence of the blends is incompletely quenched, suggesting that higher PCEs might be obtained if the morphology could be improved to yield smaller domain sizes and a larger interfacial area between donor and acceptor phases. © 2011 American Chemical Society.

  11. Cryptococcus neoformans Cells in Biofilms Are Less Susceptible than Planktonic Cells to Antimicrobial Molecules Produced by the Innate Immune System

    OpenAIRE

    Martinez, Luis R.; Casadevall, Arturo

    2006-01-01

    The human pathogenic fungus Cryptococcus neoformans can form biofilms on polystyrene plates and medical devices in a process that requires capsular polysaccharide release. Although biofilms are known to be less susceptible to antimicrobial drugs, little is known about their susceptibility to antimicrobial molecules produced by the innate immune system. In this study, we investigated the susceptibility of C. neoformans cells in biofilm and planktonic states to oxidative and nonoxidative antimi...

  12. Knudsen cell mass spectrometric study of the Cs2IOH(g) molecule thermodynamics

    International Nuclear Information System (INIS)

    Roki, F-Z.; Ohnet, M-N.; Fillet, S.; Chatillon, C.; Nuta, I.

    2013-01-01

    Highlights: • The pronounced ionic character leads to only dissociative ionization processes. • Ions formed are same as those coming from pure dimmers. • De-convolution of the ions origin needs accurate thermodynamic values for the pure gas phase. • Mass spectrometric interpretation has to be performed gradually and as a function of suitable condensed compositions. • Thermal functions have to be fully estimated. -- Abstract: The gas phase of the CsI + CsOH system is analyzed by high temperature Knudsen cell mass spectrometry in order to confirm the existence of the Cs 2 IOH(g) complex molecule. The mass spectrometric analysis is quite complex since such molecules undergo dissociative ionization into fragment ions that mix with the same ions from dimers of the pure compounds in the same vapor phase. Varying the chemical conditions for vaporization by using different CsI + CsOH mixture contents showed that the ionization of the Cs 2 IOH(g) molecule led to five different fragment ions, Cs 2 OH + , Cs 2 I + , Cs + , CsOH + and CsI + . This complex ionization pattern was studied in relation with previous assessed values for the vaporization of CsOH and CsI pure compounds in which monomer and dimer molecules are predominant. The equilibrium constant for the reaction CsI(g) + CsOH(g) = Cs 2 IOH(g) was determined and, after modeling the structure of the Cs 2 IOH molecule, the enthalpy of formation was determined using the third law of thermodynamics, as follows: Δ f H°(Cs 2 IOH, g, 298.15 K) = −578 ± 14.7 kJ · mole −1

  13. Small Molecule-BIO Accelerates and Enhances Marrow-Derived Mesenchymal Stem Cell in Vitro Chondrogenesis

    Directory of Open Access Journals (Sweden)

    Mohamadreza Baghaban Eslaminejad

    2014-03-01

    Full Text Available Background: Hyaline cartilage defects exhibit a major challenge in the field of orthopedic surgery owing to its limited repair capacity. On the other hand, mesenchymal stem cells (MSCs are regarded as potent cells with a property of cartilage regeneration. We aimed to optimize marrow-derived MSC chondrogenic culture using a small bioactive molecule referred to as BIO. Methods: MSCs from the marrow of NMRI mice were extracted, culture-expanded, and characterized. Micro-mass culture was then established for chondrogenic differentiation (control group. The cultures of MSC in chondrogenic medium supplemented with 0.01, 0.05, 0.1, and 1 µM BIO were taken as the experimental groups. Cartilage differentiation was examined by both histological sections and real-time PCR for Sox9, aggrecan, and collagen II at different time points. Moreover, the involvement of the Wnt pathway was investigated. Results: Based on histological sections, there was seemingly more intense metachromatic matrix produced in the cultures with 0.01 µM BIO. In this experimental group, cartilage-specific genes tended to be upregulated at day 14 compared to day 21 of the control group, indicating the accelerating effect of BIO on cartilage differentiation. Overall, there was statistically a significant increase (P=0.01 in the expression level of cartilage-specific genes in cultures with 0.01 µM BIO (enhancing effects. These upregulations appeared to be mediated through the Wnt pathway evident from the significant upregulation of T-cell factor and beta-catenin molecules (P=0.01. Conclusion: Taken together, BIO at 0.01 µM could accelerate and enhance in vitro chondrogenesis of mouse marrow-derived MSCs. Please cite this article as: Baghaban Eslaminejad MR, Fallah N. Small Molecule-BIO Accelerates and Enhances Marrow-Derived Mesenchymal Stem Cell in Vitro Chondrogenesis. Iran J Med Sci. 2014;39(2:107-116.

  14. Phenotypic modulation of auto-reactive cells by insertion of tolerogenic molecules via MSC-derived exosomes.

    Science.gov (United States)

    Mokarizadeh, Aram; Delirezh, Nowruz; Morshedi, Ahhmad; Mosayebi, Ghasem; Farshid, Amir-Abbas; Dalir-Naghadeh, Bahram

    2012-01-01

    Auto-reactive cells-mediated immune responses are responsible for the current tissue damages during autoimmunity. Accordingly, functional modulation of auto-reactive cells has been a pivotal aim in many of recent studies. In the current study, we investigated the possibility for insertion of regulatory molecules onto auto-reactive cells through exosomal nano-shuttles as a novel approach for phenotype modification of auto-reactive cells. The exosomes were isolated from supernatant of mesenchymal stem cells culture. Resultant exosomes co-cultured with lymphocytes were harvested from established EAE mice in the presence of antigenic MOG35-55 peptide. After 24 hr, insertion of exosomal tolerogenic molecules (PD-L1, TGF-β, galectin-1) onto auto-reactive cells were explored through flow cytometry. The potency of exosomal inserted membrane molecules to modulate phenotype of auto-reactive lymphocytes was assessed upon ELISA test for their-derived cytokines IFN-γ and IL-17. Incorporation of exosomal molecules into lymohocytes' membrane was confirmed by flow cytometric analyses for surface levels of mentioned molecules. Additionally, the decreased secretion of IFN-γ and IL-17 were detected in exosome pre-treated lymphocytes upon stimulation with MOG peptide. Mesenchymal stem cells -derived exosomes showed to be efficient organelles for insertion of bioactive tolerogenic molecules onto auto-reactive cells and modulation of their phenotypes.

  15. Repression ofSalmonellahost cell invasion by aromatic small molecules from the human fecal metabolome.

    Science.gov (United States)

    Peixoto, Rafael J M; Alves, Eduardo S; Wang, Melody; Ferreira, Rosana B R; Granato, Alessandra; Han, Jun; Gill, Hira; Jacobson, Kevan; Lobo, Leandro A; Domingues, Regina M C P; Borchers, Christoph H; Davies, Julian E; Finlay, B Brett; Antunes, L Caetano M

    2017-07-28

    The human microbiome is a collection of microorganisms that inhabit every surface of the body that is exposed to the environment, generally coexisting peacefully with their host. These microbes have important functions such as the production of vitamins, maturation of the immune system and protection against pathogens. We have previously shown that a small-molecule extract from the human fecal microbiome has a strong repressive effect on Salmonella enterica serovar Typhimurium host cell invasion by modulating the expression of genes involved in this process. Here, we describe the characterization of this biological activity. Using a series of purification methods, we obtained fractions with biological activity and characterized them by mass spectrometry. These experiments revealed an abundance of aromatic compounds in the bioactive fraction. Selected compounds were obtained from commercial sources and tested with respect to their ability to repress the expression of hilA , the gene encoding the master regulator of invasion genes in Salmonella We found that the aromatic compound 3,4-dimethylbenzoic acid acts as a strong inhibitor of hilA expression as well as invasion of cultured host cells by Salmonella Future studies should reveal the molecular details of this phenomenon, such as the signaling cascades involved in sensing this bioactive molecule. Importance Microbes constantly sense and adapt to their environment. Often, this is achieved through the production and sensing of small extracellular molecules. The human body is colonized by complex communities of microbes, and, given their biological and chemical diversity, these ecosystems represent a platform where the production and sensing of molecules occurs. In previous work, we showed that small molecules produced by microbes from the human gut can significantly impair the virulence of the enteric pathogen Salmonella enterica Here, we describe a specific compound from the human gut that produces this same effect

  16. The Acinar Cage: Basement Membranes Determine Molecule Exchange and Mechanical Stability of Human Breast Cell Acini.

    Directory of Open Access Journals (Sweden)

    Aljona Gaiko-Shcherbak

    Full Text Available The biophysical properties of the basement membrane that surrounds human breast glands are poorly understood, but are thought to be decisive for normal organ function and malignancy. Here, we characterize the breast gland basement membrane with a focus on molecule permeation and mechanical stability, both crucial for organ function. We used well-established and nature-mimicking MCF10A acini as 3D cell model for human breast glands, with ether low- or highly-developed basement membrane scaffolds. Semi-quantitative dextran tracer (3 to 40 kDa experiments allowed us to investigate the basement membrane scaffold as a molecule diffusion barrier in human breast acini in vitro. We demonstrated that molecule permeation correlated positively with macromolecule size and intriguingly also with basement membrane development state, revealing a pore size of at least 9 nm. Notably, an intact collagen IV mesh proved to be essential for this permeation function. Furthermore, we performed ultra-sensitive atomic force microscopy to quantify the response of native breast acini and of decellularized basement membrane shells against mechanical indentation. We found a clear correlation between increasing acinar force resistance and basement membrane formation stage. Most important native acini with highly-developed basement membranes as well as cell-free basement membrane shells could both withstand physiologically relevant loads (≤ 20 nN without loss of structural integrity. In contrast, low-developed basement membranes were significantly softer and more fragile. In conclusion, our study emphasizes the key role of the basement membrane as conductor of acinar molecule influx and mechanical stability of human breast glands, which are fundamental for normal organ function.

  17. Vascular Cell Adhesion Molecule 1, Intercellular Adhesion Molecule 1, and Cluster of Differentiation 146 Levels in Patients with Type 2 Diabetes with Complications.

    Science.gov (United States)

    Hocaoglu-Emre, F Sinem; Saribal, Devrim; Yenmis, Guven; Guvenen, Guvenc

    2017-03-01

    Type 2 diabetes mellitus (T2DM) is a multisystemic, chronic disease accompanied by microvascular complications involving various complicated mechanisms. Intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and cluster of differentiation-146 (CD146) are mainly expressed by endothelial cells, and facilitate the adhesion and transmigration of immune cells, leading to inflammation. In the present study, we evaluated the levels of soluble adhesion molecules in patients with microvascular complications of T2DM. Serum and whole blood samples were collected from 58 T2DM patients with microvascular complications and 20 age-matched healthy subjects. Levels of soluble ICAM-1 (sICAM-1) and soluble VCAM-1 (sVCAM-1) were assessed using enzyme-linked immunosorbent assay, while flow cytometry was used to determine CD146 levels. Serum sICAM-1 levels were lower in T2DM patients with microvascular complications than in healthy controls (Pmolecule levels were not correlated with the complication type. In the study group, most of the patients were on insulin therapy (76%), and 95% of them were receiving angiotensin-converting enzyme (ACE)-inhibitor agents. Insulin and ACE-inhibitors have been shown to decrease soluble adhesion molecule levels via various mechanisms, so we suggest that the decreased or unchanged levels of soluble forms of cellular adhesion molecules in our study group may have resulted from insulin and ACE-inhibitor therapy, as well as tissue-localized inflammation in patients with T2DM. Copyright © 2017 Korean Endocrine Society

  18. Effects of ionizing radiation on cell-matrix interactions at the single molecule level

    Energy Technology Data Exchange (ETDEWEB)

    Lauer, Florian

    2015-04-20

    Single molecule microscopy is a technology that allows for accurate assessment of the location and motion of single fluorescent molecules, even in the context of observations on living biological samples. In the present thesis, a flexible analysis tool for single molecule data as obtained in biological experiments was established. The development of a tool to faithfully detect and localize diffraction-limited images of individual fluorescent probes was necessary since data acquired under cell cultivation conditions that account for a three-dimensional microenvironment as experienced physiologically by cells in native tissue poses a challenge not faced ordinarily. After design, implementation, quantitative tests using simulations for comparisons and verification, and evaluation of the different steps of the analysis procedure including local background estimation, local noise estimation, de-noising approaches, detection, localization, and post-processing, analysis capabilities were utilized to evaluate the impact of x-ray irradiation on the plasma membrane architecture of U2OS human osteosarcoma cells as assessed by tracking individual fluorescent lipid-mimetic dye molecules diffusing in the outer membrane leaflet. It was shown that lateral diffusion in the plasma membrane is well described as two-phase anomalous subdiffusion and presence of 3D extracellular matrix leads to lower anomalous exponents of the fast fraction in comparison to monolayer cell culture. Interestingly, even high single-dose (25 Gy) treatments known to induce membrane-mediated apoptosis in tumor microvessel endothelium via membrane viscosity enhancing ceramide generation were not observed to alter membrane architecture in U2OS cells which can be related to amplifying, feedback-driven redox-signaling in the endothelium absent in U2OS. In summary, the sensitive and accurate framework developed in this thesis to assess minute changes of plasma membrane located dynamic processes did not uncover a

  19. Triple Effect of Mimetic Peptides Interfering with Neural Cell Adhesion Molecule Homophilic Cis Interactions

    DEFF Research Database (Denmark)

    Li, S. Z.; Kolkova, Kateryna; Rudenko, Olga

    2005-01-01

    on neurite extension and adhesion. To evaluate how interference of these mimetic peptides with NCAM homophilic interactions in cis influences NCAM binding in trans, we employed a coculture system in which PC12-E2 cells were grown on monolayers of fibroblasts with or without NCAM expression and the rate...... of neurite outgrowth subsequently was analyzed. P2, but not P1-B, induced neurite outgrowth in the absence of NCAM binding in trans. When PC12-E2 cells were grown on monolayers of NCAM-expressing fibroblasts, the effect of both P1-B and P2 on neurite outgrowth was dependent on peptide concentrations. P1-B......The neural cell adhesion molecule (NCAM) is pivotal in neural development, regeneration, and learning. Here we characterize two peptides, termed P1-B and P2, derived from the homophilic binding sites in the first two N-terminal immunoglobulin (Ig) modules of NCAM, with regard to their effects...

  20. Inhibition of human copper trafficking by a small molecule significantly attenuates cancer cell proliferation

    Science.gov (United States)

    Wang, Jing; Luo, Cheng; Shan, Changliang; You, Qiancheng; Lu, Junyan; Elf, Shannon; Zhou, Yu; Wen, Yi; Vinkenborg, Jan L.; Fan, Jun; Kang, Heebum; Lin, Ruiting; Han, Dali; Xie, Yuxin; Karpus, Jason; Chen, Shijie; Ouyang, Shisheng; Luan, Chihao; Zhang, Naixia; Ding, Hong; Merkx, Maarten; Liu, Hong; Chen, Jing; Jiang, Hualiang; He, Chuan

    2015-12-01

    Copper is a transition metal that plays critical roles in many life processes. Controlling the cellular concentration and trafficking of copper offers a route to disrupt these processes. Here we report small molecules that inhibit the human copper-trafficking proteins Atox1 and CCS, and so provide a selective approach to disrupt cellular copper transport. The knockdown of Atox1 and CCS or their inhibition leads to a significantly reduced proliferation of cancer cells, but not of normal cells, as well as to attenuated tumour growth in mouse models. We show that blocking copper trafficking induces cellular oxidative stress and reduces levels of cellular ATP. The reduced level of ATP results in activation of the AMP-activated protein kinase that leads to reduced lipogenesis. Both effects contribute to the inhibition of cancer cell proliferation. Our results establish copper chaperones as new targets for future developments in anticancer therapies.

  1. Expression of functional recombinant antibody molecules in insect cell expression systems.

    Science.gov (United States)

    Reavy, B; Ziegler, A; Diplexcito, J; Macintosh, S M; Torrance, L; Mayo, M

    2000-03-01

    Recombinant single-chain variable-fragment molecules (scFv) were constructed from a cell line expressing a monoclonal antibody against African cassava mosaic virus (ACMV) and expressed in Escherichia coli. DNA sequences that encoded the scFv were manipulated to allow scFv expression in insect cell lines. A recombinant baculovirus containing the scFv cDNA was constructed and large amounts of scFv were produced in each of three insect cell lines infected with the baculovirus. However, the scFv were not secreted into the medium by any of the cell lines despite the scFv having been linked to a honeybee melittin leader sequence. The same scFv cDNA construct was introduced into Drosophila DS2 cells and a stable recombinant cell line was obtained that produced scFv that was secreted into the medium. Culture medium containing the scFv was used directly in enzyme-linked immunosorbent assay (ELISA) tests to detect ACMV in plant tissues. Another construct that encoded the Ckappa domain of human IgG was fused to the C-terminus of the scFv that was produced and expressed in Drosophila cells. This scFv derivative also accumulated in the medium and was more active in ELISA than scFv lacking the Ckappa domain. Copyright 2000 Academic Press.

  2. Distribution of apoptotic cells and apoptosis-related molecules in the developing murine palatine rugae.

    Science.gov (United States)

    Amasaki, Hajime; Ogawa, Miyuki; Nagasao, Jun; Mutoh, Ken-ichiro; Ichihara, Nobutsune; Asari, Masao

    2002-12-01

    Distribution of apoptotic cells and expression of the apoptosis-related factors p53, bcl-2 and bad during morphogenesis of the murine palatine rugae (PR) were examined histochemically using the terminal deoxynucleotidyl transferase-mediated UTP nick end-labeling (TUNEL) technique and specific antibodies against apoptosis and cell cycle-related molecules. Formation of the PR rudiment was controlled by cell proliferation and apoptosis in the palatal epithelium. TUNEL-positive cells were detected only at the epithelial placode area at 12.5-13.5 days post coitus (dpc), but only a few cells were positive at the protruding PR area at 14.5-16.5 dpc. Bcl-2 protein was expressed mainly in the areas outside of those containing TUNEL-positive cells at 15.5 -6.5 dpc. P53 protein was not detected throughout gestation. Bad was detected in the epithelial layer at 13.5 and 15.5 dpc and overlapping the apoptotic area at 13.5-15.5 dpc. Apoptosis of palatal epithelial cells might therefore involve spatiotemporally regulated expression of bad during murine PR development.

  3. The intercellular cell adhesion molecule-1 (icam-1) in lung cancer: implications for disease progression and prognosis.

    Science.gov (United States)

    Kotteas, Elias A; Boulas, Panagiotis; Gkiozos, Ioannis; Tsagkouli, Sofia; Tsoukalas, George; Syrigos, Konstantinos N

    2014-09-01

    The intercellular cell-adhesion molecule-1 (ICAM-1) is a transmembrane molecule and a distinguished member of the Immunoglobulin superfamily of proteins that participates in many important processes, including leukocyte endothelial transmigration, cell signaling, cell-cell interaction, cell polarity and tissue stability. ICAM-1and its soluble part are highly expressed in inflammatory conditions, chronic diseases and a number of malignancies. In the present article we present the implications of ICAM-1 in the progression and prognosis of one of the major global killers of our era: lung cancer. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  4. EXPRESSION OF CELLULAR ADHESION MOLECULES IN LANGERHANS CELL HISTIOCYTOSIS AND NORMAL LANGERHANS CELLS

    NARCIS (Netherlands)

    DEGRAAF, JH; TAMMINGA, RYJ; KAMPS, WA; TIMENS, W

    1995-01-01

    Langerhans cell histiocytosis (LCH) is characterized by lesions with an accumulation and/or proliferation of Langerhans cells (LCs). Little is known of the etiology and pathogenesis of LCH. Although the relation between the LCH cell and normal LCs is currently uncertain, the localizations of the LCH

  5. Small molecule ice recrystallization inhibitors enable freezing of human red blood cells with reduced glycerol concentrations.

    Science.gov (United States)

    Capicciotti, Chantelle J; Kurach, Jayme D R; Turner, Tracey R; Mancini, Ross S; Acker, Jason P; Ben, Robert N

    2015-04-08

    In North America, red blood cells (RBCs) are cryopreserved in a clinical setting using high glycerol concentrations (40% w/v) with slow cooling rates (~1°C/min) prior to storage at -80°C, while European protocols use reduced glycerol concentrations with rapid freezing rates. After thawing and prior to transfusion, glycerol must be removed to avoid intravascular hemolysis. This is a time consuming process requiring specialized equipment. Small molecule ice recrystallization inhibitors (IRIs) such as β-PMP-Glc and β-pBrPh-Glc have the ability to prevent ice recrystallization, a process that contributes to cellular injury and decreased cell viability after cryopreservation. Herein, we report that addition of 110 mM β-PMP-Glc or 30 mM β-pBrPh-Glc to a 15% glycerol solution increases post-thaw RBC integrity by 30-50% using slow cooling rates and emphasize the potential of small molecule IRIs for the preservation of cells.

  6. Biological response of HeLa cells to gold nanoparticles coated with organic molecules.

    Science.gov (United States)

    Cardoso Avila, P E; Rangel Mendoza, A; Pichardo Molina, J L; Flores Villavicencio, L L; Castruita Dominguez, J P; Chilakapati, M K; Sabanero Lopez, M

    2017-08-01

    In this work, gold nanospheres functionalized with low weight organic molecules (4-aminothiphenol and cysteamine) were synthesized in a one-step method for their in vitro cytotoxic evaluation on HeLa cells. To enhance the biocompatibility of the cysteamine-capped GNPs, BSA was used due to its broad PH stability and high binding affinity to gold nanoparticles. Besides, the widely reported silica coated gold nanorods were tested here to contrast their toxic response against our nanoparticles coated with organic molecules. Our results shown, the viability measured at 1.9×10 -5 M did not show significant differences against negative controls for all the samples; however, the metabolic activity of HeLa cells dropped when they were exposed to silica gold nanorods in the range of concentrations from 2.9×10 -7 M to 3.0×10 -4 M, while in the cases of gold nanospheres, we found that only at concentrations below 1.9×10 -5 M metabolic activity was normal. Our preliminary results did not indicate any perceivable harmful toxicity to cell membrane, cytoskeleton or nucleus due to our nanospheres at 1.9×10 -5 M. Additional test should be conducted in order to ensure a safe use of them for biological applications, and to determine the extent of possible damage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Live-cell microscopy reveals small molecule inhibitor effects on MAPK pathway dynamics.

    Directory of Open Access Journals (Sweden)

    Daniel J Anderson

    Full Text Available Oncogenic mutations in the mitogen activated protein kinase (MAPK pathway are prevalent in human tumors, making this pathway a target of drug development efforts. Recently, ATP-competitive Raf inhibitors were shown to cause MAPK pathway activation via Raf kinase priming in wild-type BRaf cells and tumors, highlighting the need for a thorough understanding of signaling in the context of small molecule kinase inhibitors. Here, we present critical improvements in cell-line engineering and image analysis coupled with automated image acquisition that allow for the simultaneous identification of cellular localization of multiple MAPK pathway components (KRas, CRaf, Mek1 and Erk2. We use these assays in a systematic study of the effect of small molecule inhibitors across the MAPK cascade either as single agents or in combination. Both Raf inhibitor priming as well as the release from negative feedback induced by Mek and Erk inhibitors cause translocation of CRaf to the plasma membrane via mechanisms that are additive in pathway activation. Analysis of Erk activation and sub-cellular localization upon inhibitor treatments reveals differential inhibition and activation with the Raf inhibitors AZD628 and GDC0879 respectively. Since both single agent and combination studies of Raf and Mek inhibitors are currently in the clinic, our assays provide valuable insight into their effects on MAPK signaling in live cells.

  8. A-π-D-π-A Electron-Donating Small Molecules for Solution-Processed Organic Solar Cells: A Review.

    Science.gov (United States)

    Wang, Zhen; Zhu, Lingyun; Shuai, Zhigang; Wei, Zhixiang

    2017-11-01

    Organic solar cells based on semiconducting polymers and small molecules have attracted considerable attention in the last two decades. Moreover, the power conversion efficiencies for solution-processed solar cells containing A-π-D-π-A-type small molecules and fullerenes have reached 11%. However, the method for designing high-performance, photovoltaic small molecules still remains unclear. In this review, recent studies on A-π-D-π-A electron-donating small molecules for organic solar cells are introduced. Moreover, the relationships between molecular properties and device performances are summarized, from which inspiration for the future design of high performance organic solar cells may be obtained. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. The clinical spectrum of mutations in L1, a neuronal cell adhesion molecule

    Energy Technology Data Exchange (ETDEWEB)

    Fransen, E.; Vits, L.; Van Camp, G.; Willems, P.J. [Univ. of Antwerp (Belgium)

    1996-07-12

    Mutations in the gene encoding the neuronal cell adhesion molecule L1 are responsible for several syndromes with clinical overlap, including X-linked hydrocephalus (XLH, HSAS), MASA (mental retardation, aphasia, shuffling gait, adducted thumbs) syndrome, complicated X-linked spastic paraplegia (SP 1), X-linked mental retardation-clasped thumb (MR-CT) syndrome, and some forms of X-linked agenesis of the corpus callosum (ACC). We review 34 L1 mutations in patients with these phenotypes. 22 refs., 3 figs., 4 tabs.

  10. The role of cell adhesion molecules in brain wiring and neuropsychiatric disorders.

    Science.gov (United States)

    Sakurai, Takeshi

    2017-06-01

    Cell adhesion molecules (CAMs) in the nervous system have long been a research focus, but many mice lacking CAMs show very subtle phenotypes, giving an impression that CAMs may not be major players in constructing the nervous system. However, recent human genetic studies suggest CAM involvement in many neuropsychiatric disorders, implicating that they must have significant functions in nervous system development, namely in circuitry formation. As CAMs can provide specificity through their molecular interactions, this review summarizes possible mechanisms on how alterations of CAMs can result in neuropsychiatric disorders through circuitry modification. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Neural cell adhesion molecule (NCAM) and prealbumin in cerebrospinal fluid from depressed patients

    DEFF Research Database (Denmark)

    Jørgensen, Ole Steen

    1988-01-01

    The size of the soluble form of the human cerebrospinal fluid (CSF) neural cell adhesion molecule, NCAM-sol, was by gel permeation chromatography estimated to 160-250 kDa. Within the CSF the concentration of NCAM-sol was found about 15-25% increased in lumbar fluid and 25% increased in ventricular...... fluid, both compared to cisternal fluid. Whereas prealbumin was found evenly distributed in CSF, albumin was relatively enriched in lumbar fluid. The concentrations of NCAM-sol and prealbumin were measured in lumbar CSF from psychiatric patients. Prealbumin was increased 7.2% and NCAM-sol was decreased...

  12. Solvent additive effects on small molecule crystallization in bulk heterojunction solar cells probed during spin casting

    KAUST Repository

    Pérez, Louis A.

    2013-09-04

    Solvent additive processing can lead to drastic improvements in the power conversion efficiency (PCE) in solution processable small molecule (SPSM) bulk heterojunction solar cells. In situ grazing incidence wide-angle X-ray scattering is used to investigate the kinetics of crystallite formation during and shortly after spin casting. The additive is shown to have a complex effect on structural evolution invoking polymorphism and enhanced crystalline quality of the donor SPSM. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Predicting mitochondrial targeting by small molecule xenobiotics within living cells using QSAR models.

    Science.gov (United States)

    Horobin, Richard W

    2015-01-01

    Whether small molecule xenobiotics (biocides, drugs, probes, toxins) will target mitochondria in living cells can be predicted using an algorithm derived from QSAR modeling. Application of the algorithm requires the chemical structures of all ionic species of the xenobiotic compound in question to be defined, and for certain numerical structure parameters (AI, CBN, log P, pKa, and Z) to be obtained for all such species. How the chemical structures are specified, how the structure parameters are obtained or estimated, and how the algorithm is used are described in an explicit protocol.

  14. Neural cell adhesion molecule (NCAM) and prealbumin in cerebrospinal fluid from depressed patients

    DEFF Research Database (Denmark)

    Jørgensen, Ole Steen

    1988-01-01

    The size of the soluble form of the human cerebrospinal fluid (CSF) neural cell adhesion molecule, NCAM-sol, was by gel permeation chromatography estimated to 160-250 kDa. Within the CSF the concentration of NCAM-sol was found about 15-25% increased in lumbar fluid and 25% increased in ventricula...... 15.1% in depressed patients. The changes were partially normalized during recovery from the depression. The findings can be explained by hypothesizing that endogenous depression is associated with an increased choroid plexus activity and CSF production....

  15. Dual Function Additives: A Small Molecule Crosslinker for Enhanced Efficiency and Stability in Organic Solar Cells

    KAUST Repository

    Rumer, Joseph W.

    2015-02-01

    A bis-azide-based small molecule crosslinker is synthesized and evaluated as both a stabilizing and efficiency-boosting additive in bulk heterojunction organic photovoltaic cells. Activated by a noninvasive and scalable solution processing technique, polymer:fullerene blends exhibit improved thermal stability with suppressed polymer skin formation at the cathode and frustrated fullerene aggregation on ageing, with initial efficiency increased from 6% to 7%. © 2015 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. High expression of carcinoembryonic antigen-related cell adhesion molecule (CEACAM) 6 and 8 in primary myelofibrosis

    DEFF Research Database (Denmark)

    Riley, Caroline Hasselbalch; Skov, Vibe; Larsen, Thomas Stauffer

    2011-01-01

    for the egress of CD34+ cells from the bone marrow. Carcinoembryonic antigen-related cell adhesion molecule (CEACAM) 6 has been implicated in cell adhesion, cellular invasiveness, angiogenesis, and inflammation, which are all key processes in the pathophysiology of PMF. Accordingly, CEACAMs may play an important...

  17. Zika Virus Escapes NK Cell Detection by Upregulating Major Histocompatibility Complex Class I Molecules.

    Science.gov (United States)

    Glasner, Ariella; Oiknine-Djian, Esther; Weisblum, Yiska; Diab, Mohammad; Panet, Amos; Wolf, Dana G; Mandelboim, Ofer

    2017-11-15

    infection is largely unknown. Here we demonstrate that Zika virus infection is almost undetected by NK cells, as evidenced by the fact that the expression of activating ligands for NK cells is not induced following Zika infection. We identified a mechanism whereby Zika virus sensing via the RIGI-IRF3 pathway resulted in IFN-β-mediated upregulation of MHC-I molecules and inhibition of NK cell activity. Countering MHC class I upregulation and boosting NK cell activity may be employed as prophylactic measures to combat Zika virus infection. Copyright © 2017 American Society for Microbiology.

  18. Expression of polysialylated neural cell adhesion molecules on adult stem cells after neuronal differentiation of inner ear spiral ganglion neurons

    Energy Technology Data Exchange (ETDEWEB)

    Park, Kyoung Ho [Department of Otolaryngology Head and Neck Surgery, College of Medicine, Catholic University, Seoul (Korea, Republic of); Yeo, Sang Won, E-mail: swyeo@catholic.ac.kr [Department of Otolaryngology Head and Neck Surgery, College of Medicine, Catholic University, Seoul (Korea, Republic of); Troy, Frederic A., E-mail: fatroy@ucdavis.edu [Department of Biochemistry and Molecular Medicine, University of California, School of Medicine, Davis, CA 95616 (United States); Xiamen University, School of Medicine, Xiamen City (China)

    2014-10-17

    Highlights: • PolySia expressed on neurons primarily during early stages of neuronal development. • PolySia–NCAM is expressed on neural stem cells from adult guinea pig spiral ganglion. • PolySia is a biomarker that modulates neuronal differentiation in inner ear stem cells. - Abstract: During brain development, polysialylated (polySia) neural cell adhesion molecules (polySia–NCAMs) modulate cell–cell adhesive interactions involved in synaptogenesis, neural plasticity, myelination, and neural stem cell (NSC) proliferation and differentiation. Our findings show that polySia–NCAM is expressed on NSC isolated from adult guinea pig spiral ganglion (GPSG), and in neurons and Schwann cells after differentiation of the NSC with epidermal, glia, fibroblast growth factors (GFs) and neurotrophins. These differentiated cells were immunoreactive with mAb’s to polySia, NCAM, β-III tubulin, nestin, S-100 and stained with BrdU. NSC could regenerate and be differentiated into neurons and Schwann cells. We conclude: (1) polySia is expressed on NSC isolated from adult GPSG and on neurons and Schwann cells differentiated from these NSC; (2) polySia is expressed on neurons primarily during the early stage of neuronal development and is expressed on Schwann cells at points of cell–cell contact; (3) polySia is a functional biomarker that modulates neuronal differentiation in inner ear stem cells. These new findings suggest that replacement of defective cells in the inner ear of hearing impaired patients using adult spiral ganglion neurons may offer potential hope to improve the quality of life for patients with auditory dysfunction and impaired hearing disorders.

  19. Involvement of dying beta cell originated messenger molecules in differentiation of pancreatic mesenchymal stem cells under glucotoxic and glucolipotoxic conditions.

    Science.gov (United States)

    Gezginci-Oktayoglu, Selda; Onay-Ucar, Evren; Sancar-Bas, Serap; Karatug-Kacar, Ayse; Arda, Emine S N; Bolkent, Sehnaz

    2018-05-01

    Beta cell mass regulation represents a critical issue for understanding and treatment of diabetes. The most important process in the development of diabetes is beta cell death, generally induced by glucotoxicity or glucolipotoxicity, and the regeneration mechanism of new beta cells that will replace dead beta cells is still not fully understood. The aim of this study was to investigate the generation mechanism of new beta cells by considering the compensation phase of type 2 diabetes mellitus. In this study, pancreatic islet derived mesenchymal stem cells (PI-MSCs) were isolated from adult rats and characterized. Then, beta cells isolated from rats were co-cultured with PI-MSCs and they were exposed to glucotoxicity, lipotoxicity and glucolipotoxicity conditions for 72 hr. As the results apoptotic and necrotic cell death were increased in both PI-MSCs and beta cells especially by the exposure of glucotoxic and glucolipotoxic conditions to the co-culture systems. Glucotoxicity induced-differentiated beta cells were functional due to their capability of insulin secretion in response to rising glucose concentrations. Moreover, beta cell proliferation was induced in the glucotoxicity-treated co-culture system whereas suppressed in lipotoxicity or glucolipotoxicity-treated co-culture systems. In addition, 11 novel proteins, that may release from dead beta cells and have the ability to stimulate PI-MSCs in the direction of differentiation, were determined in media of glucotoxicity or glucolipotoxicity-treated co-culture systems. In conclusion, these molecules were considered as important for understanding cellular mechanism of beta cell differentiation and diabetes. Thus, they may be potential targets for diagnosis and cellular or therapeutic treatment of diabetes. © 2017 Wiley Periodicals, Inc.

  20. Small-molecule-based inhibition of histone demethylation in cells assessed by quantitative mass spectrometry.

    Science.gov (United States)

    Mackeen, Mukram M; Kramer, Holger B; Chang, Kai-Hsuan; Coleman, Matthew L; Hopkinson, Richard J; Schofield, Christopher J; Kessler, Benedikt M

    2010-08-06

    Post-translational modifications on histones are an important mechanism for the regulation of gene expression and are involved in all aspects of cell growth and differentiation, as well as pathological processes including neurodegeneration, autoimmunity, and cancer. A major challenge within the chromatin field is to develop methods for the quantitative analysis of histone modifications. Here we report a mass spectrometry (MS) approach based on ultraperformance liquid chromatography high/low collision switching (UPLC-MS(E)) to monitor histone modifications in cells. This approach is exemplified by the analysis of trimethylated lysine-9 levels in histone H3, following a simple chemical derivatization procedure with d(6)-acetic anhydride. This method was used to study the inhibition of histone demethylases with pyridine-2,4-dicarboxylic acid (PDCA) derivatives in cells. Our results show that the PDCA-dimethyl ester inhibits JMJD2A catalyzed demethylation of lysine-9 on histone H3 in human HEK 293T cells. Demethylase inhibition, as observed by MS analyses, was supported by immunoblotting with modification-specific antibodies. The results demonstrate that PDCA derived small molecules are cell permeable demethylase inhibitors and reveal that quantitative MS is a useful tool for measuring post-translational histone modifications in cells.

  1. The Prion Protein Controls Polysialylation of Neural Cell Adhesion Molecule 1 during Cellular Morphogenesis.

    Directory of Open Access Journals (Sweden)

    Mohadeseh Mehrabian

    Full Text Available Despite its multi-faceted role in neurodegenerative diseases, the physiological function of the prion protein (PrP has remained elusive. On the basis of its evolutionary relationship to ZIP metal ion transporters, we considered that PrP may contribute to the morphogenetic reprogramming of cells underlying epithelial-to-mesenchymal transitions (EMT. Consistent with this hypothesis, PrP transcription increased more than tenfold during EMT, and stable PrP-deficient cells failed to complete EMT in a mammalian cell model. A global comparative proteomics analysis identified the neural cell adhesion molecule 1 (NCAM1 as a candidate mediator of this impairment, which led to the observation that PrP-deficient cells fail to undergo NCAM1 polysialylation during EMT. Surprisingly, this defect was caused by a perturbed transcription of the polysialyltransferase ST8SIA2 gene. Proteomics data pointed toward β-catenin as a transcriptional regulator affected in PrP-deficient cells. Indeed, pharmacological blockade or siRNA-based knockdown of β-catenin mimicked PrP-deficiency in regards to NCAM1 polysialylation. Our data established the existence of a PrP-ST8SIA2-NCAM signaling loop, merged two mature fields of investigation and offer a simple model for explaining phenotypes linked to PrP.

  2. Single-molecule analysis of the major glycopolymers of pathogenic and non-pathogenic yeast cells

    Science.gov (United States)

    El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Alsteens, David; Sarazin, Aurore; Jouault, Thierry; Dufrêne, Yves F.

    2013-05-01

    Most microbes are coated with carbohydrates that show remarkable structural variability and play a crucial role in mediating microbial-host interactions. Understanding the functions of cell wall glycoconjugates requires detailed knowledge of their molecular organization, diversity and heterogeneity. Here we use atomic force microscopy (AFM) with tips bearing specific probes (lectins, antibodies) to analyze the major glycopolymers of pathogenic and non-pathogenic yeast cells at molecular resolution. We show that non-ubiquitous β-1,2-mannans are largely exposed on the surface of native cells from pathogenic Candida albicans and C. glabrata, the former species displaying the highest glycopolymer density and extensions. We also find that chitin, a major component of the inner layer of the yeast cell wall, is much more abundant in C. albicans. These differences in molecular properties, further supported by flow cytometry measurements, may play an important role in strengthening cell wall mechanics and immune interactions. This study demonstrates that single-molecule AFM, combined with immunological and fluorescence methods, is a powerful platform in fungal glycobiology for probing the density, distribution and extension of specific cell wall glycoconjugates. In nanomedicine, we anticipate that this new form of AFM-based nanoglycobiology will contribute to the development of sugar-based drugs, immunotherapeutics, vaccines and diagnostics.

  3. Fluorenone-based molecules for bulk-heterojunction solar cells: synthesis, characterization, and photovoltaic properties

    Energy Technology Data Exchange (ETDEWEB)

    Lincker, Frederic; Delbosc, Nicolas; Billon, Martial; Pron, Adam [Laboratoire d' Electronique Moleculaire Organique et Hybride (LEMOH), UMR5819-SPrAM (CEA-CNRS-University Grenoble I) INAC CEA-Grenoble (France); Bailly, Severine; Bettignies, Remi de [Laboratoire Cellules Solaires, DRT-LITEN-GENEC-LCS, INES Savoie-Technolac Chambery (France); Demadrille, Renaud [Laboratoire d' Electronique Moleculaire Organique et Hybride (LEMOH), UMR5819-SPrAM (CEA-CNRS-University Grenoble I) INAC CEA-Grenoble (France); Laboratoire Cellules Solaires, DRT-LITEN-GENEC-LCS, INES Savoie-Technolac Chambery (France)

    2008-11-10

    A series of four conjugated molecules consisting of a fluorenone central unit symmetrically coupled to different oligothiophene segments are conceptually designed and synthesized to provide new electroactive materials for application in photovoltaic devices. The combination of electron-donating oligothiophene building blocks with an electron-accepting fluorenone unit results in the emergence of a new band assigned to an intramolecular charge transfer transition that gives rise to the extension of the absorption spectral range of the resulting molecules. Detailed spectroscopic and voltammetric investigations show that all studied molecules have highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) level positions, which make them good candidates for the application as electron-donors in bulk-heterojunction photovoltaic cells, with (6,6)-phenyl-C61-butyric acid methyl ester (PCBM)-C{sub 60} as electron acceptor component. Moderate device performances, with power conversion efficiencies (PCEs) comprised between 0.3 and 0.6%, were obtained with rigid molecules, containing either the bridging units between the thiophene rings, i.e., (2,7-bis(4,4'-dioctyl)-cyclopenta[2,1-b:3,4-b']dithiophen-2-yl)-fluoren-9-one (SCPTF) and 2,7-bis(4-(dioctylmethylene)-cyclopenta[2,1-b:3,4-b']dithiophen-5-yl)-fluoren-9-one (MCPTF) or a vinylene unit 2,7-bis(5-[(E)-1,2-bis(3-octylthien-2-yl)ethylene])-fluoren-9-one (TVF), whereas with (2,7-bis-(3,3'''-dioctyl-[2,2';5',2'';5'',2'''])quaterthiophen-5-yl)-fluoren-9-one (QTF) PCE up to 1.2% (under AM 1.5 illumination, 100 mW cm{sup -2}, active area 0.28 cm{sup 2}) was obtained. The strong {pi}-stacking interactions in the solid state for this oligomer leading to improved morphology could explain the good performances of QTF-based devices, which rank among the highest recorded for non-polymeric materials. Consequently, fluorenone

  4. Simian T Lymphotropic Virus 1 Infection of Papio anubis: tax Sequence Heterogeneity and T Cell Recognition.

    Science.gov (United States)

    Termini, James M; Magnani, Diogo M; Maxwell, Helen S; Lauer, William; Castro, Iris; Pecotte, Jerilyn; Barber, Glen N; Watkins, David I; Desrosiers, Ronald C

    2017-10-15

    Baboons naturally infected with simian T lymphotropic virus (STLV) are a potentially useful model system for the study of vaccination against human T lymphotropic virus (HTLV). Here we expanded the number of available full-length baboon STLV-1 sequences from one to three and related the T cell responses that recognize the immunodominant Tax protein to the tax sequences present in two individual baboons. Continuously growing T cell lines were established from two baboons, animals 12141 and 12752. Next-generation sequencing (NGS) of complete STLV genome sequences from these T cell lines revealed them to be closely related but distinct from each other and from the baboon STLV-1 sequence in the NCBI sequence database. Overlapping peptides corresponding to each unique Tax sequence and to the reference baboon Tax sequence were used to analyze recognition by T cells from each baboon using intracellular cytokine staining (ICS). Individual baboons expressed more gamma interferon and tumor necrosis factor alpha in response to Tax peptides corresponding to their own STLV-1 sequence than in response to Tax peptides corresponding to the reference baboon STLV-1 sequence. Thus, our analyses revealed distinct but closely related STLV-1 genome sequences in two baboons, extremely low heterogeneity of STLV sequences within each baboon, no evidence for superinfection within each baboon, and a ready ability of T cells in each baboon to recognize circulating Tax sequences. While amino acid substitutions that result in escape from CD8 + T cell recognition were not observed, premature stop codons were observed in 7% and 56% of tax sequences from peripheral blood mononuclear cells from animals 12141 and 12752, respectively. IMPORTANCE It has been estimated that approximately 100,000 people suffer serious morbidity and 10,000 people die each year from the consequences associated with human T lymphotropic virus (HTLV) infection. There are no antiviral drugs and no preventive vaccine. A

  5. Identification of amino acids involved in recognition by dengue virus NS3-specific, HLA-DR15-restricted cytotoxic CD4+ T-cell clones.

    Science.gov (United States)

    Zeng, L; Kurane, I; Okamoto, Y; Ennis, F A; Brinton, M A

    1996-05-01

    The majority of T-cell clones derived from a donor who experienced dengue illness following receipt of a live experimental dengue virus type 3 (DEN3) vaccine cross-reacted with all four serotypes of dengue virus, but some were serotype specific or only partially cross-reactive. The nonstructural protein, NS3, was immuno-dominant in the CD4+ T-cell response of this donor. The epitopes of four NS3-specific T-cell clones were analyzed. JK15 and JK13 recognized only DEN3 NS3, while JK44 recognized DEN1, DEN2, and DEN3 NS3 and JK5 recognized DEN1, DEN3, and West Nile virus NS3. The epitopes recognized by these clones on the DEN3 NS3 protein were localized with recombinant vaccinia viruses expressing truncated regions of the NS3 gene, and then the minimal recognition sequence was mapped with synthetic peptides. Amino acids critical for T-cell recognition were assessed by using peptides with amino acid substitutions. One of the serotype-specific clones (JK13) and the subcomplex- and flavivirus-cross-reactive clone (JK5) recognized the same core epitope, WITDFVGKTVW. The amino acid at the sixth position of this epitope is critical for recognition by both clones. Sequence analysis of the T-cell receptors of these two clones showed that they utilize different VP chains. The core epitopes for the four HLA-DR15-restricted CD4+ CTL clones studied do not contain motifs similar to those proposed by previous studies on endogenous peptides eluted from HLA-DR15 molecules. However, the majority of these dengue virus NS3 core epitopes have a positive amino acid (K or R) at position 8 or 9. Our results indicate that a single epitope can induce T cells with different virus specificities despite the restriction of these T cells by the same HLA-DR15 allele. This finding suggests a previously unappreciated level of complexity for interactions between human T-cell receptors and viral epitopes with very similar sequences on infected cells.

  6. The SALM/Lrfn family of leucine-rich repeat-containing cell adhesion molecules.

    Science.gov (United States)

    Nam, Jungyong; Mah, Won; Kim, Eunjoon

    2011-07-01

    Synaptic adhesion molecules play important roles in various stages of neuronal development, including neurite outgrowth and synapse formation. The SALM (synaptic adhesion-like molecule) family of adhesion molecules, also known as Lrfn, belongs to the superfamily of leucine-rich repeat (LRR)-containing adhesion molecules. Proteins of the SALM family, which includes five known members (SALMs 1-5), have been implicated in the regulation of neurite outgrowth and branching, and synapse formation and maturation. Despite sharing a similar domain structure, individual SALM family proteins appear to have distinct functions. SALMs 1-3 contain a C-terminal PDZ-binding motif, which interacts with PSD-95, an abundant postsynaptic scaffolding protein, whereas SALM4 and SALM5 lack PDZ binding. SALM1 directly interacts with NMDA receptors but not with AMPA receptors, whereas SALM2 associates with both NMDA and AMPA receptors. SALMs 1-3 form homo- and heteromeric complexes with each other in a cis manner, whereas SALM4 and SALM5 do not, but instead participate in homophilic, trans-cellular adhesion. SALM3 and SALM5, but not other SALMs, possess synaptogenic activity, inducing presynaptic differentiation in contacting axons. All SALMs promote neurite outgrowth, while SALM4 uniquely increases the number of primary processes extending from the cell body. In addition to these functional diversities, the fifth member of the SALM family, SALM5/Lrfn5, has recently been implicated in severe progressive autism and familial schizophrenia, pointing to the clinical importance of SALMs. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Efficient Capture of Cancer Cells by Their Replicated Surfaces Reveals Multiscale Topographic Interactions Coupled with Molecular Recognition.

    Science.gov (United States)

    Wang, Wenshuo; Cui, Haijun; Zhang, Pengchao; Meng, Jingxin; Zhang, Feilong; Wang, Shutao

    2017-03-29

    Cell-surface topographic interactions can direct the design of biointerfaces, which have been widely used in isolation of circulating tumor cells or fundamental cell biological research. By using three kinds of cancer cell-replicated surfaces with differentiated structures, we uncover that multiscale-cooperative topographic interactions (at both nanoscale and microscale) coupled with molecular recognition enable efficient and specific isolation of cancer cells. The cell replicas precisely inherit the structural features from the original cancer cells, providing not only preferable structures for matching with cancer cells but also a unique platform to interrogate whether certain cancer cells can optimally match with their own replicated surfaces. The results reveal that cancer cells do not show preferential recognitions to their respective replicas, while the capture agent-modified surfaces with hierarchical structures exhibit improved cancer cell capture efficiencies. Two levels of topographic interactions between cancer cells and cell replica surfaces exist. Nanoscale filopodia on cancer cells can topographically interact with different nanostructures on replica surfaces. In addition, microscale concave/convex on surfaces provide suitable sites for trapping cancer cells. This study may promote smart design of multiscale biofunctional materials that can specifically recognize cancer cells.

  8. Bacteria-induced neo-biosynthesis, stabilization, and surface expression of functional class I molecules in mouse dendritic cells

    OpenAIRE

    Rescigno, Maria; Citterio, Stefania; Thèry, Clotilde; Rittig, Michael; Medaglini, Donata; Pozzi, Gianni; Amigorena, Sebastian; Ricciardi-Castagnoli, Paola

    1998-01-01

    Here, we show that bacteria induce de novo synthesis of both major histocompatability complex (MHC) class I and II molecules in a mouse dendritic cell culture system. The neo-biosynthesis of MHC class I molecules is delayed as compared with that of MHC class II. Furthermore, bacteria stabilize MHC class I molecules by a 3-fold increase of their half-life. This has important consequences for the capacity of dendritic cells to present bacterial antigens in the draining lymph nodes. In addition,...

  9. Mechanisms of transcriptional regulation and prognostic significance of activated leukocyte cell adhesion molecule in cancer

    Directory of Open Access Journals (Sweden)

    Chen Hairu

    2010-10-01

    Full Text Available Abstract Background Activated leukocyte cell adhesion molecule (ALCAM is implicated in the prognosis of multiple cancers with low level expression associated with metastasis and early death in breast cancer. Despite this significance, mechanisms that regulate ALCAM gene expression and ALCAM's role in adhesion of pre-metastatic circulating tumor cells have not been defined. We studied ALCAM expression in 20 tumor cell lines by real-time PCR, western blot and immunochemistry. Epigenetic alterations of the ALCAM promoter were assessed using methylation-specific PCR and bisulfite sequencing. ALCAM's role in adhesion of tumor cells to the vascular wall was studied in isolated perfused lungs. Results A common site for transcription initiation of the ALCAM gene was identified and the ALCAM promoter sequenced. The promoter contains multiple cis-active elements including a functional p65 NF-κB motif, and it harbors an extensive array of CpG residues highly methylated exclusively in ALCAM-negative tumor cells. These CpG residues were modestly demethylated after 5-aza-2-deoxycytidine treatment. Restoration of high-level ALCAM expression using an ALCAM cDNA increased clustering of MDA-MB-435 tumor cells perfused through the pulmonary vasculature of ventilated rat lungs. Anti-ALCAM antibodies reduced the number of intravascular tumor cell clusters. Conclusion Our data suggests that loss of ALCAM expression, due in part to DNA methylation of extensive segments of the promoter, significantly impairs the ability of circulating tumor cells to adhere to each other, and may therefore promote metastasis. These findings offer insight into the mechanisms for down-regulation of ALCAM gene expression in tumor cells, and for the positive prognostic value of high-level ALCAM in breast cancer.

  10. Can the Outputs of LGN Y-Cells Support Emotion Recognition? A Computational Study

    Directory of Open Access Journals (Sweden)

    Andrea De Cesarei

    2015-01-01

    Full Text Available It has been suggested that emotional visual input is processed along both a slower cortical pathway and a faster subcortical pathway which comprises the lateral geniculate nucleus (LGN, the superior colliculus, the pulvinar, and finally the amygdala. However, anatomical as well as functional evidence concerning the subcortical route is lacking. Here, we adopt a computational approach in order to investigate whether the visual representation that is achieved in the LGN may support emotion recognition and emotional response along the subcortical route. In four experiments, we show that the outputs of LGN Y-cells support neither facial expression categorization nor the same/different expression matching by an artificial classificator. However, the same classificator is able to perform at an above chance level in a statistics-based categorization of scenes containing animals and scenes containing people and of light and dark patterns. It is concluded that the visual representation achieved in the LGN is insufficient to allow for the recognition of emotional facial expression.

  11. Blue Laser Imaging-Bright Improves Endoscopic Recognition of Superficial Esophageal Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Akira Tomie

    2016-01-01

    Full Text Available Background/Aims. The aim of this study was to evaluate the endoscopic recognition of esophageal squamous cell carcinoma (ESCC using four different methods (Olympus white light imaging (O-WLI, Fujifilm white light imaging (F-WLI, narrow band imaging (NBI, and blue laser imaging- (BLI- bright. Methods. We retrospectively analyzed 25 superficial ESCCs that had been examined using the four different methods. Subjective evaluation was provided by three endoscopists as a ranking score (RS of each image based on the ease of detection of the cancerous area. For the objective evaluation we calculated the color difference scores (CDS between the cancerous and noncancerous areas with each of the four methods. Results. There was no difference between the mean RS of O-WLI and F-WLI. The mean RS of NBI was significantly higher than that of O-WLI and that of BLI-bright was significantly higher than that of F-WLI. Moreover, the mean RS of BLI-bright was significantly higher than that of NBI. Furthermore, in the objective evaluation, the mean CDS of BLI-bright was significantly higher than that of O-WLI, F-WLI, and NBI. Conclusion. The recognition of superficial ESCC using BLI-bright was more efficacious than the other methods tested both subjectively and objectively.

  12. Opium induces apoptosis in Jurkat cells via promotion of pro-apoptotic and inhibition of anti-apoptotic molecules.

    Science.gov (United States)

    Arababadi, Mohammad Kazemi; Asadikaram, Gholamreza

    2016-02-01

    The aim of this study was to determine the important molecules involved in apoptosis induction by opium in Jurkat cell line. Jurkat cells were incubated 48 hrs with 2.86×10(-5) g/ml concentration of opium and apoptosis as well as expression levels of related molecules were measured. Our results demonstrated that 50.3±0.2 percent of opium treated Jurkat cells were revealed apoptotic features. The levels of mRNA of several pro-apoptotic and anti-apoptotic molecules were increased and decreased, respectively, in the opium treated cells. The results also demonstrated that expression levels of BCL2, DFFA and NOL3 as anti-apoptotic molecules were increased in the opium treated cells. It seems that opium induces apoptosis in Jurkat cells via both intrinsic and extrinsic pathways. Although opium induces apoptosis in the cells but increased expression of some anti-apoptotic molecules may be a normal resistance of the cell for death.

  13. Biologic role of activated leukocyte cell adhesion molecule overexpression in breast cancer cell lines and clinical tumor tissue.

    Science.gov (United States)

    Hein, Sibyll; Müller, Volkmar; Köhler, Nadine; Wikman, Harriet; Krenkel, Sylke; Streichert, Thomas; Schweizer, Michaela; Riethdorf, Sabine; Assmann, Volker; Ihnen, Maike; Beck, Katrin; Issa, Rana; Jänicke, Fritz; Pantel, Klaus; Milde-Langosch, Karin

    2011-09-01

    The activated leukocyte cell adhesion molecule (ALCAM) is overexpressed in many mammary tumors, but controversial results about its role and prognostic impact in breast cancer have been reported. Therefore, we evaluated the biologic effects of ALCAM expression in two breast cancer cell lines and a larger cohort of mammary carcinomas. By stable transfections, MCF7 cells with ALCAM overexpression and MDA-MB231 cells with reduced ALCAM levels were generated and analyzed in functional assays and cDNA microarrays. In addition, an immunohistochemical study on 347 patients with breast cancer with long-term follow-up and analysis of disseminated tumor cells (DTCs) was performed. In both cell lines, high ALCAM expression was associated with reduced cell motility. In addition, ALCAM silencing in MDA-MB231 cells resulted in lower invasive potential, whereas high ALCAM expression was associated with increased apoptosis in both cell lines. Among genes which were differentially expressed in clones with altered ALCAM expression, there was an overlap of 15 genes between both cell lines, among them cathepsin D, keratin 7, gelsolin, and ets2 whose deregulation was validated by western blot analysis. In MDA-MB231 cells, we observed a correlation with VEGF expression which was validated by enzyme-linked immuno sorbent assay (ELISA). Our IHC results on primary breast carcinomas showed that ALCAM expression was associated with an estrogen receptor-positive phenotype. In addition, strong ALCAM immunostaining correlated with nodal involvement and the presence of tumor cells in bone marrow. By Kaplan-Meier analysis, strong ALCAM expression in ductal carcinomas correlated with shorter recurrence-free intervals (P=0.048) and overall survival (OAS, P=0.003). Our results indicate that the biologic role of ALCAM in breast cancer is complex, but overexpression might be relevant for outcome in ductal carcinomas.

  14. Dendritic cells and parasites: from recognition and activation to immune response instruction.

    Science.gov (United States)

    Motran, Claudia Cristina; Ambrosio, Laura Fernanda; Volpini, Ximena; Celias, Daiana Pamela; Cervi, Laura

    2017-02-01

    The effective defense against parasite infections requires the ability to mount an appropriate and controlled specific immune response able to eradicate the invading pathogen while limiting the collateral damage to self-tissues. Dendritic cells are key elements for the development of immunity against parasites; they control the responses required to eliminate these pathogens while maintaining host homeostasis. Ligation of dendritic cell pattern recognition receptors by pathogen-associated molecular pattern present in the parasites initiates signaling pathways that lead to the production of surface and secreted proteins that are required, together with the antigen, to induce an appropriate and timely regulated immune response. There is evidence showing that parasites can influence and regulate dendritic cell functions in order to promote a more permissive environment for their survival. In this review, we will focus on new insights about the ability of protozoan and helminth parasites or their products to modify dendritic cell function and discuss how this interaction is crucial in shaping the host response.

  15. Contribution of Candida albicans cell wall components to recognition by and escape from murine macrophages.

    Science.gov (United States)

    McKenzie, C G J; Koser, U; Lewis, L E; Bain, J M; Mora-Montes, H M; Barker, R N; Gow, N A R; Erwig, L P

    2010-04-01

    The pathogenicity of the opportunistic human fungal pathogen Candida albicans depends on its ability to escape destruction by the host immune system. Using mutant strains that are defective in cell surface glycosylation, cell wall protein synthesis, and yeast-hypha morphogenesis, we have investigated three important aspects of C. albicans innate immune interactions: phagocytosis by primary macrophages and macrophage cell lines, hyphal formation within macrophage phagosomes, and the ability to escape from and kill macrophages. We show that cell wall glycosylation is critically important for the recognition and ingestion of C. albicans by macrophages. Phagocytosis was significantly reduced for mutants deficient in phosphomannan biosynthesis (mmn4Delta, pmr1Delta, and mnt3 mnt5Delta), whereas O- and N-linked mannan defects (mnt1Delta mnt2Delta and mns1Delta) were associated with increased ingestion, compared to the parent wild-type strains and genetically complemented controls. In contrast, macrophage uptake of mutants deficient in cell wall proteins such as adhesins (ece1Delta, hwp1Delta, and als3Delta) and yeast-locked mutants (clb2Delta, hgc1Delta, cph1Delta, efg1Delta, and efg1Delta cph1Delta), was similar to that observed for wild-type C. albicans. Killing of macrophages was abrogated in hypha-deficient strains, significantly reduced in all glycosylation mutants, and comparable to wild type in cell wall protein mutants. The diminished ability of glycosylation mutants to kill macrophages was not a consequence of impaired hyphal formation within macrophage phagosomes. Therefore, cell wall composition and the ability to undergo yeast-hypha morphogenesis are critical determinants of the macrophage's ability to ingest and process C. albicans.

  16. Autoimmune diabetes: the role of T cells, MHC molecules and autoantigens.

    Science.gov (United States)

    Durinovic-Belló, I

    1998-01-01

    Type 1 diabetes (IDDM) is a T cell mediated autoimmune disease which in part is determined genetically by its association with major histocompatibility complex (MHC) class II alleles. The major role of MHC molecules is the regulation of immune responses through the presentation of peptide epitopes of processed protein antigens to the immune system. Recently it has been demonstrated that MHC molecules associated with autoimmune diseases preferentially present peptides of other endogenous MHC proteins, that often mimic autoantigen-derived peptides. Hence, these MHC-derived peptides might represent potential targets for autoreactive T cells. It has consistently been shown that humoral autoimmunity to insulin predominantly occurs in early childhood. The cellular immune response to insulin is relatively low in the peripheral blood of patients with IDDM. Studies in NOD mice however have shown, that lymphocytes isolated from pancreatic islet infiltrates display a high reactivity to insulin and in particular to an insulin peptide B 9-23. Furthermore we have evidence that cellular autoimmunity to insulin is higher in young pre-diabetic individuals, whereas cellular reactivity to other autoantigens is equally distributed in younger and older subjects. This implicates that insulin, in human childhood IDDM and animal autoimmune diabetes, acts as an important early antigen which may target the autoimmune response to pancreatic beta cells. Moreover, we observed that in the vast majority of newly diagnosed diabetic patients or individuals at risk for IDDM, T cell reactivity to various autoantigens occurs simultaneously. In contrast, cellular reactivity to a single autoantigen is found with equal frequency in (pre)-type 1 diabetic individuals as well as in control subjects. Therefore the autoimmune response in the inductive phase of IDDM may be targeted to pancreatic islets by the cellular and humoral reactivity to one beta-cell specific autoantigen, but spreading to a set of

  17. Crossing borders to bind proteins--a new concept in protein recognition based on the conjugation of small organic molecules or short peptides to polypeptides from a designed set.

    Science.gov (United States)

    Baltzer, Lars

    2011-06-01

    A new concept for protein recognition and binding is highlighted. The conjugation of small organic molecules or short peptides to polypeptides from a designed set provides binder molecules that bind proteins with high affinities, and with selectivities that are equal to those of antibodies. The small organic molecules or peptides need to bind the protein targets but only with modest affinities and selectivities, because conjugation to the polypeptides results in molecules with dramatically improved binder performance. The polypeptides are selected from a set of only sixteen sequences designed to bind, in principle, any protein. The small number of polypeptides used to prepare high-affinity binders contrasts sharply with the huge libraries used in binder technologies based on selection or immunization. Also, unlike antibodies and engineered proteins, the polypeptides have unordered three-dimensional structures and adapt to the proteins to which they bind. Binder molecules for the C-reactive protein, human carbonic anhydrase II, acetylcholine esterase, thymidine kinase 1, phosphorylated proteins, the D-dimer, and a number of antibodies are used as examples to demonstrate that affinities are achieved that are higher than those of the small molecules or peptides by as much as four orders of magnitude. Evaluation by pull-down experiments and ELISA-based tests in human serum show selectivities to be equal to those of antibodies. Small organic molecules and peptides are readily available from pools of endogenous ligands, enzyme substrates, inhibitors or products, from screened small molecule libraries, from phage display, and from mRNA display. The technology is an alternative to established binder concepts for applications in drug development, diagnostics, medical imaging, and protein separation.

  18. Mapping out the structural changes of natural and pretreated plant cell wall surfaces by atomic force microscopy single molecular recognition imaging

    Science.gov (United States)

    2013-01-01

    Background Enzymatic hydrolysis of lignocellulosic biomass (mainly plant cell walls) is a critical process for biofuel production. This process is greatly hindered by the natural complexity of plant cell walls and limited accessibility of surface cellulose by enzymes. Little is known about the plant cell wall structural and molecular level component changes after pretreatments, especially on the outer surface. Therefore, a more profound understanding of surface cellulose distributions before and after pretreatments at single-molecule level is in great need. In this study, we determined the structural changes, specifically on crystalline cellulose, of natural, dilute sulfuric acid pretreated and delignified cell wall surfaces of poplar, switchgrass, and corn stover using single molecular atomic force microscopy (AFM) recognition imaging. Results The AFM tip was first functionalized by a family 3 carbohydrate-binding module (CBM3a) (Clostridium thermocellum Scaffoldin) which specifically recognizes crystalline cellulose by selectively binding to it. The surface structural changes were studied at single molecule level based on the recognition area percentage (RAP) of exposed crystalline cellulose over the imaged cell wall surface. Our results show that the cell wall surface crystalline cellulose coverage increased from 17-20% to 18-40% after dilute acid pretreatment at 135°C under different acid concentrations and reached to 40-70% after delignification. Pretreated with 0.5% sulfuric acid, the crystalline cellulose surface distributions of 23% on poplar, 28% on switchgrass and, 38% on corn stover were determined as an optimized result. Corn stover cell walls also show less recalcitrance due to more effective pretreatments and delignification compared to poplar and switchgrass. Conclusions The dilute acid pretreatment can effectively increase the cellulose accessibility on plant cell wall surfaces. The optimal acid concentration was determined to be 0.5% acid at 135

  19. Detection of molecules and cells using nuclear magnetic resonance with magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Rümenapp, Christine, E-mail: ruemenapp@tum.de [Zentralinstitut für Medizintechnik (IMETUM), Technische Universität München, Garching (Germany); Gleich, Bernhard [Zentralinstitut für Medizintechnik (IMETUM), Technische Universität München, Garching (Germany); Mannherz, Hans Georg [Abteilung für Anatomie und Molekulare Embryologie, Ruhr Universität Bochum, Bochum (Germany); Haase, Axel [Zentralinstitut für Medizintechnik (IMETUM), Technische Universität München, Garching (Germany)

    2015-04-15

    For the detection of small molecules, proteins or even cells in vitro, functionalised magnetic nanoparticles and nuclear magnetic resonance measurements can be applied. In this work, magnetic nanoparticles with the size of 5–7 nm were functionalised with antibodies to detect two model systems of different sizes, the protein avidin and Saccharomyces cerevisiae as the model organism. The synthesised magnetic nanoparticles showed a narrow size distribution, which was determined using transmission electron microscopy and dynamic light scattering. The magnetic nanoparticles were functionalised with the according antibodies via EDC/NHS chemistry. The binding of the antigen to magnetic nanoparticles was detected through the change in the NMR T{sub 2} relaxation time at 0.5 T (≈21.7 MHz). In case of a specific binding the particles cluster and the T{sub 2} relaxation time of the sample changes. The detection limit in buffer for FITC-avidin was determined to be 1.35 nM and 10{sup 7} cells/ml for S. cerevisiae. For fluorescent microscopy the avidin molecules were labelled with FITC and for the detection of S. cerevisiae the magnetic nanoparticles were additionally functionalised with rhodamine. The binding of the particles to S. cerevisiae and the resulting clustering was also seen by transmission electron microscopy.

  20. HLA Class Ib Molecules and Immune Cells in Pregnancy and Preeclampsia

    Science.gov (United States)

    Djurisic, Snezana; Hviid, Thomas Vauvert F.

    2014-01-01

    Despite decades of research, the highly prevalent pregnancy complication preeclampsia, “the disease of theories,” has remained an enigma. Indeed, the etiology of preeclampsia is largely unknown. A compiling amount of studies indicates that the pathological basis involves a complex array of genetic predisposition and immunological maladaptation, and that a contribution from the mother, the father, and the fetus is likely to be important. The Human Leukocyte Antigen (HLA)-G is an increasing focus of research in relation to preeclampsia. The HLA-G molecule is primarily expressed by the extravillous trophoblast cells lining the placenta together with the two other HLA class Ib molecules, HLA-E and HLA-F. Soluble isoforms of HLA-G have been detected in the early endometrium, the matured cumulus–oocyte complex, maternal blood of pregnant women, in umbilical cord blood, and lately, in seminal plasma. HLA-G is believed to be involved in modulating immune responses in the context of vascular remodeling during pregnancy as well as in dampening potential harmful immune attacks raised against the semi-allogeneic fetus. In addition, HLA-G genetic variants are associated with both membrane-bound and soluble forms of HLA-G, and, in some studies, with preeclampsia. In this review, a genetic contribution from the mother, the father, and the fetus, together with the presence and function of various immune cells of relevance in pregnancy are reviewed in relation to HLA-G and preeclampsia. PMID:25566263

  1. The Role of Cell Adhesion Molecule Genes Regulating Neuroplasticity in Addiction

    Directory of Open Access Journals (Sweden)

    Dawn E. Muskiewicz

    2018-01-01

    Full Text Available A variety of genetic approaches, including twin studies, linkage studies, and candidate gene studies, has established a firm genetic basis for addiction. However, there has been difficulty identifying the precise genes that underlie addiction liability using these approaches. This situation became especially clear in genome-wide association studies (GWAS of addiction. Moreover, the results of GWAS brought into clarity many of the shortcomings of those early genetic approaches. GWAS studies stripped away those preconceived notions, examining genes that would not previously have been considered in the study of addiction, consequently creating a shift in our understanding. Most importantly, those studies implicated a class of genes that had not previously been considered in the study of addiction genetics: cell adhesion molecules (CAMs. Considering the well-documented evidence supporting a role for various CAMs in synaptic plasticity, axonal growth, and regeneration, it is not surprising that allelic variation in CAM genes might also play a role in addiction liability. This review focuses on the role of various cell adhesion molecules in neuroplasticity that might contribute to addictive processes and emphasizes the importance of ongoing research on CAM genes that have been implicated in addiction by GWAS.

  2. Small molecule inhibitor regorafenib inhibits RET signaling in neuroblastoma cells and effectively suppresses tumor growthin vivo.

    Science.gov (United States)

    Chen, Zhenghu; Zhao, Yanling; Yu, Yang; Pang, Jonathan C; Woodfield, Sarah E; Tao, Ling; Guan, Shan; Zhang, Huiyuan; Bieerkehazhi, Shayahati; Shi, Yan; Patel, Roma; Vasudevan, Sanjeev A; Yi, Joanna S; Muscal, Jodi A; Xu, Guo-Tong; Yang, Jianhua

    2017-11-28

    Neuroblastoma (NB), the most common extracranial pediatric solid tumor, continues to cause significant cancer-related morbidity and mortality in children. Dysregulation of oncogenic receptor tyrosine kinases (RTKs) has been shown to contribute to tumorigenesis in various human cancers and targeting these RTKs has had therapeutic benefit. RET is an RTK which is commonly expressed in NB, and high expression of RET correlates with poor outcomes in patients with NB. Herein we report that RET is required for NB cell proliferation and that the small molecule inhibitor regorafenib (BAY 73-4506) blocks glial cell derived neurotrophic factor (GDNF)-induced RET signaling in NB cells and inhibits NB growth both in vitro and in vivo . We found that regorafenib significantly inhibited cell proliferation and colony formation ability of NB cells. Moreover, regorafenib suppressed tumor growth in both an orthotopic xenograft NB mouse model and a TH-MYCN transgenic NB mouse model. Finally, regorafenib markedly improved the overall survival of TH-MYCN transgenic tumor-bearing mice. In summary, our study suggests that RET is a potential therapeutic target in NB, and that using a novel RET inhibitor, like regorafenib, should be investigated as a therapeutic treatment option for children with NB.

  3. A Small-Molecule Screen for Enhanced Homing of Systemically Infused Cells

    Directory of Open Access Journals (Sweden)

    Oren Levy

    2015-03-01

    Full Text Available Poor homing of systemically infused cells to disease sites may limit the success of exogenous cell-based therapy. In this study, we screened 9,000 signal-transduction modulators to identify hits that increase mesenchymal stromal cell (MSC surface expression of homing ligands that bind to intercellular adhesion molecule 1 (ICAM-1, such as CD11a. Pretreatment of MSCs with Ro-31-8425, an identified hit from this screen, increased MSC firm adhesion to an ICAM-1-coated substrate in vitro and enabled targeted delivery of systemically administered MSCs to inflamed sites in vivo in a CD11a- (and other ICAM-1-binding domains-dependent manner. This resulted in a heightened anti-inflammatory response. This represents a new strategy for engineering cell homing to enhance therapeutic efficacy and validates CD11a and ICAM-1 as potential targets. Altogether, this multi-step screening process may significantly improve clinical outcomes of cell-based therapies.

  4. Improved Reliability of Small Molecule Organic Solar Cells by Double Anode Buffer Layers

    Directory of Open Access Journals (Sweden)

    Pao-Hsun Huang

    2014-01-01

    Full Text Available An optimized hybrid planar heterojunction (PHJ of small molecule organic solar cells (SM-OSCs based on copper phthalocyanine (CuPc as donor and fullerene (C60 as acceptor was fabricated, which obviously enhanced the performance of device by sequentially using both MoO3 and pentacene as double anode buffer layers (ABL, also known as hole extraction layer (HEL. A series of the vacuum-deposited ABL, acting as an electron and exciton blocking layer, were examined for their characteristics in SM-OSCs. The performance and reliability were compared between conventional ITO/ABL/CuPc/C60/BCP/Ag cells and the new ITO/double ABL/CuPc/C60/BCP/Ag cells. The effect on the electrical properties of these materials was also investigated to obtain the optimal thickness of ABL. The comparison shows that the modified cell has an enhanced reliability compared to traditional cells. The improvement of lifetime was attributed to the idea of double layers to prevent humidity and oxygen from diffusing into the active layer. We demonstrated that the interfacial extraction layers are necessary to avoid degradation of device. That is to say, in normal temperature and pressure, a new avenue for the device within double buffer layers has exhibited the highest values of open circuit voltage (Voc, fill factor (FF, and lifetime in this work compared to monolayer of ABL.

  5. The Immunomodulatory Small Molecule Imiquimod Induces Apoptosis in Devil Facial Tumour Cell Lines.

    Directory of Open Access Journals (Sweden)

    Amanda L Patchett

    Full Text Available The survival of the Tasmanian devil (Sarcophilus harrisii is threatened by devil facial tumour disease (DFTD. This transmissible cancer is usually fatal, and no successful treatments have been developed. In human studies, the small immunomodulatory molecule imiquimod is a successful immunotherapy, activating anti-tumour immunity via stimulation of toll-like receptor-7 (TLR7 signaling pathways. In addition, imiquimod is a potent inducer of apoptosis in human tumour cell lines via TLR7 independent mechanisms. Here we investigate the potential of imiquimod as a DFTD therapy through analysis of treated DFTD cell lines and Tasmanian devil fibroblasts. WST-8 proliferation assays and annexin V apoptosis assays were performed to monitor apoptosis, and changes to the expression of pro- and anti-apoptotic genes were analysed using qRT-PCR. Our results show that DFTD cell lines, but not Tasmanian devil fibroblasts, are sensitive to imiquimod-induced apoptosis in a time and concentration dependent manner. Induction of apoptosis was accompanied by down-regulation of the anti-apoptotic BCL2 and BCLXL genes, and up-regulation of the pro-apoptotic BIM gene. Continuous imiquimod treatment was required for these effects to occur. These results demonstrate that imiquimod can deregulate DFTD cell growth and survival in direct and targeted manner. In vivo, this may increase DFTD vulnerability to imiquimod-induced TLR7-mediated immune responses. Our findings have improved the current knowledge of imiquimod action in tumour cells for application to both DFTD and human cancer therapy.

  6. Light scattering sensing detection of pathogens based on the molecular recognition of immunoglobulin with cell wall-associated protein A

    International Nuclear Information System (INIS)

    Liu Zhongde; Chen Shaofen; Cheng Zhihuang; Zhen Shujun; Liao Qiegen

    2007-01-01

    In this contribution, we report a rapid optical detection method of pathogens using Staphylococcus aureus (S. aureus) as the model analyte based on the molecular recognition of immunoglobulin with cell wall-associated Protein A (SpA). It was found that the molecular recognition of human immunoglobulin (IgG) with protein A on the cell wall of S. aureus on glass slide sensing area could result in strong surface enhanced light scattering (SELS) signals, and the SELS intensity (ΔI) increases proportionally with the concentration of S. aureus over the range of 2.5 x 10 5 -1.0 x 10 8 CFU mL -1 with right angle light scattering (RALS) signals detection mode. In order to identify the solid support based molecular recognition between IgG with SpA, we also employed water-soluble CdS quantum dots (CdS-QDs) as a fluorescent marker for IgG by immobilizing the IgG onto the surfaces of CdS-QDs through covalent binding in order to generate recognition probes for SpA on the cell wall of S. aureus. Consequently, the fluorescent method also showed that the detection for pathogens with solid supports is reliable based on the molecular recognition of IgG with SpA

  7. The fungal quorum-sensing molecule farnesol activates innate immune cells but suppresses cellular adaptive immunity.

    Science.gov (United States)

    Leonhardt, Ines; Spielberg, Steffi; Weber, Michael; Albrecht-Eckardt, Daniela; Bläss, Markus; Claus, Ralf; Barz, Dagmar; Scherlach, Kirstin; Hertweck, Christian; Löffler, Jürgen; Hünniger, Kerstin; Kurzai, Oliver

    2015-03-17

    Farnesol, produced by the polymorphic fungus Candida albicans, is the first quorum-sensing molecule discovered in eukaryotes. Its main function is control of C. albicans filamentation, a process closely linked to pathogenesis. In this study, we analyzed the effects of farnesol on innate immune cells known to be important for fungal clearance and protective immunity. Farnesol enhanced the expression of activation markers on monocytes (CD86 and HLA-DR) and neutrophils (CD66b and CD11b) and promoted oxidative burst and the release of proinflammatory cytokines (tumor necrosis factor alpha [TNF-α] and macrophage inflammatory protein 1 alpha [MIP-1α]). However, this activation did not result in enhanced fungal uptake or killing. Furthermore, the differentiation of monocytes to immature dendritic cells (iDC) was significantly affected by farnesol. Several markers important for maturation and antigen presentation like CD1a, CD83, CD86, and CD80 were significantly reduced in the presence of farnesol. Furthermore, farnesol modulated migrational behavior and cytokine release and impaired the ability of DC to induce T cell proliferation. Of major importance was the absence of interleukin 12 (IL-12) induction in iDC generated in the presence of farnesol. Transcriptome analyses revealed a farnesol-induced shift in effector molecule expression and a down-regulation of the granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor during monocytes to iDC differentiation. Taken together, our data unveil the ability of farnesol to act as a virulence factor of C. albicans by influencing innate immune cells to promote inflammation and mitigating the Th1 response, which is essential for fungal clearance. Farnesol is a quorum-sensing molecule which controls morphological plasticity of the pathogenic yeast Candida albicans. As such, it is a major mediator of intraspecies communication. Here, we investigated the impact of farnesol on human innate immune cells known to be

  8. MHC class II molecules deliver costimulatory signals in human T cells through a functional linkage with IL-2-receptors

    DEFF Research Database (Denmark)

    Odum, Niels; Kanner, S B; Ledbetter, J A

    1993-01-01

    MHC class II-positive T cells are found in tissues involved in autoimmune and infectious disorders. Because stimulation of class II molecules by mAb or bacterial superantigens induces protein tyrosine phosphorylation through activation of PTK3 in T cells, we hypothesized that class II signals play...... tyrosine phosphorylation of specific substrates including PLC-gamma 1. Combined stimulation of IL-2R and class II molecules had an additive effect on tyrosine phosphorylation. Pretreatment of T cells with a protein tyrosine kinase inhibitor, herbimycin A, inhibited IL-2 and class II-induced proliferation...... a regulatory function in T cell activation. Here, we show that cross-linking HLA-DR and -DP but not -DQ molecules by immobilized mAb enhanced proliferative T cell responses to IL-2. In contrast, class II stimulation had no effect on IL-4-induced proliferation. The costimulatory effect was most pronounced...

  9. Variability in the recognition of distinctive immunofluorescence patterns in different brands of HEp-2 cell slides

    Directory of Open Access Journals (Sweden)

    Alessandra Dellavance

    2013-06-01

    Full Text Available INTRODUCTION: Indirect immunofluorescence on HEp-2 cells is considered the gold standard for the detection of autoantibodies against cellular antigens. However, the culture conditions, cell fixation and permeabilization processes interfere directly in the preservation and spatial distribution of antigens. Therefore, one can assume that certain peculiarities in the processing of cellular substrate may affect the recognition of indirect immunofluorescence patterns associated with several autoantibodies. OBJECTIVE: To evaluate a panel of serum samples representing nuclear, nucleolar, cytoplasmic, mitotic apparatus, and chromosome plate patterns on HEp-2 cell substrates from different suppliers. MATERIALS AND METHODS: Seven blinded observers, independent from the three selected reference centers, evaluated 17 samples yielding different nuclear, nucleolar, cytoplasmic and mitotic apparatus patterns on HEp-2 cell slides from eight different brands. The slides were coded to maintain confidentiality of both brands and participating centers. RESULTS: The 17 HEp-2 cell patterns were identified on most substrates. Nonetheless, some slides showed deficit in the expression of several patterns: nuclear coarse speckled/U1-ribonucleoprotein associated with antibodies against RNP (U1RNP, centromeric protein F (CENP-F, proliferating cell nuclear antigen (PCNA, cytoplasmic fine speckled associated with anti-Jo-1 antibodies (histidyl synthetase, nuclear mitotic apparatus protein 1 (NuMA-1 and nuclear mitotic apparatus protein 2 (NuMA-2. CONCLUSION: Despite the overall good quality of the assessed HEp-2 substrates, there was considerable inconsistency in results among different commercial substrates. The variations may be due to the evaluated batches, hence generalizations cannot be made as to the respective brands. It is recommended that each new batch or new brand be tested with a panel of reference sera representing the various patterns.

  10. Serum of patients with antiphospholipid syndrome induces adhesion molecules in endothelial cells.

    Science.gov (United States)

    Engel, Bettina; Müller, Gregor; Roch, Beate; Schröder, Hans-Egbert; Aringer, Martin; Bornstein, Stefan R; Morawietz, Henning

    2017-11-01

    The antiphospholipid syndrome (APS) is a systemic auto-immune disease with an unclear pathophysiology. The aim of our study was to understand the development of APS on a cellular level. Therefore, we analyzed the influence of human serum of APS patients on endothelial expression of specific genes and proteins in comparison to a control group. In this study, we analyzed the expression of ICAM-1, VCAM-1, E-selectin and annexin V in primary cultures of human umbilical vein endothelial cells (HUVEC) in response to 10% (v/v) serum of control patients (n = 6), patients with systemic lupus erythematosus (SLE) and no APS (n = 4) or APS patients (n = 9) for 24 h. Total RNA was prepared from confluent endothelial cell layers and mRNA expression of ICAM-1, VCAM-1 and E-selectin was analyzed by reverse transcription polymerase-chain reaction (RT-PCR). The protein expression was determined by Western blot. Serum protein concentrations of soluble forms of adhesion molecules sICAM-1 and sVCAM-1 were quantified by ELISA. Gene expression data were correlated with clinical parameters. The mRNA expression of ICAM-1 was increased in cells incubated with serum from APS patients (166 ± 22% of control; P = 0.023). Serum of patients with (SLE)/no APS caused a 1.4-fold higher ICAM-1 mRNA level. Western blot analysis showed an increase in protein expression of adhesion molecules ICAM-1 (260 ± 49%; P = 0.011) and VCAM-1 (357 ± 97%; P = 0.023) in cells that were incubated with serum from APS patients. Plasma analysis showed elevated levels of sVCAM-1 in APS patients (189 ± 34%; P = 0.045) compared to the levels measured in the control group. The sVCAM-1 plasma level was correlating with the frequency of abortions. An augmented expression of endothelial adhesion molecules is involved in the pathophysiology of patients with antiphospholipid syndrome. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Novel Design Strategies for Platinum-Containing Conjugated Polymers and Small Molecules for Organic Solar Cells

    Science.gov (United States)

    He, Wenhan

    Current state-of-the-art organic solar cells (OSCs) adopt the strategy of using conjugated polymers or small molecules as donors and fullerene derivatives as acceptors in their active layers. Regarding to the donors of interest, the conjugated polymers and small molecules coupled with heavy metals have been less explored compared to their counterparts. Among various transition metal complexes applied, Pt(II) complexes are unique because of their intrinsic square planar geometries and ability to serve as building blocks for conjugated systems. Furthermore, the heavy metal Pt facilitates the formation of triplet excitons with longer life times through spin-orbital coupling which are of benefit for the OSCs application. However, in order to obtain low bandgap polymers, people are intended to use chromophores with long conjugated length, nevertheless such design will inevitably dilute the spin-orbital coupling effect and finally influence the formation of triplet excitons. Furthermore, the majority of Pt-containing conjugated systems reported so far shared a common feature-- they all possessed "dumbbell" shaped structures and were amorphous, leading to poor device performance. In addition, there were few examples reporting the capture of the triplet excitons by the fullerene acceptors in the OSCs since there is a mismatch between the triplet energy state (T1) of the Pt-containing compounds and the LUMO level of fullerene acceptors. As a result, these three intrinsic problems will impede the further development of such a field. In order to solve these problems, I originally designed and synthesized three novel compounds with unique proprieties named as Bodipy-Pt, Pt-SM and C60+SDS-. Specifically, Bodipy has the advantages of compact size, easy to synthesis and high fluorescence quantum yield which can effectively solve the problem of long conjugated length. While in terms of second problem, the new Pt-SM possessed a "roller-wheel" structural design with increased

  12. Decreased Expression of T-Cell Costimulatory Molecule CD28 on CD4 and CD8 T Cells of Mexican Patients with Pulmonary Tuberculosis

    Directory of Open Access Journals (Sweden)

    German Bernal-Fernandez

    2010-01-01

    Full Text Available Patients with tuberculosis frequently develop anergy, a state of T-cell hyporesponsiveness in which defective T-cell costimulation could be a factor. To know if the expression of T-cell costimulatory molecules was altered in tuberculosis, we analyzed the peripheral blood T-cell phenotype of 23 Mexican patients with pulmonary tuberculosis. There was severe CD4 (P<.001 and CD8 (P<.01 lymphopenia and upregulation of costimulatory molecule CD30 on CD4 and CD8 T cells (P<.05; this increase was higher in relapsing tuberculosis. The main finding was severe downregulation of the major costimulatory molecule CD28 on both CD8 and CD4 T cells (P<.001. Depletion of the CD4/CD28 subset, a hitherto undescribed finding, is relevant because CD4 T cells constitute the main arm of the cell-mediated antimycobacterial immune response.

  13. Intercellular adhesion molecule-1 expression by skeletal muscle cells augments myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Goh, Qingnian; Dearth, Christopher L.; Corbett, Jacob T. [Department of Kinesiology, The University of Toledo, Toledo, OH (United States); Pierre, Philippe [Centre d’Immunologie de Marseille-Luminy U2M, Aix-Marseille Université, Marseille (France); INSERM U631, Institut National de la Santé et Recherche Médicale, Marseille (France); CNRS UMR6102, Centre National de la Recherche Scientifique, Marseille (France); Chadee, Deborah N. [Department of Biological Sciences, The University of Toledo, Toledo, OH (United States); Pizza, Francis X., E-mail: Francis.Pizza@utoledo.edu [Department of Kinesiology, The University of Toledo, Toledo, OH (United States)

    2015-02-15

    We previously demonstrated that the expression of intercellular adhesion molecule-1 (ICAM-1) by skeletal muscle cells after muscle overload contributes to ensuing regenerative and hypertrophic processes in skeletal muscle. The objective of the present study is to reveal mechanisms through which skeletal muscle cell expression of ICAM-1 augments regenerative and hypertrophic processes of myogenesis. This was accomplished by genetically engineering C2C12 myoblasts to stably express ICAM-1, and by inhibiting the adhesive and signaling functions of ICAM-1 through the use of a neutralizing antibody or cell penetrating peptide, respectively. Expression of ICAM-1 by cultured skeletal muscle cells augmented myoblast–myoblast adhesion, myotube formation, myonuclear number, myotube alignment, myotube–myotube fusion, and myotube size without influencing the ability of myoblasts to proliferate or differentiate. ICAM-1 augmented myotube formation, myonuclear accretion, and myotube alignment through a mechanism involving adhesion-induced activation of ICAM-1 signaling, as these dependent measures were reduced via antibody and peptide inhibition of ICAM-1. The adhesive and signaling functions of ICAM-1 also facilitated myotube hypertrophy through a mechanism involving myotube–myotube fusion, protein synthesis, and Akt/p70s6k signaling. Our findings demonstrate that ICAM-1 expression by skeletal muscle cells augments myogenesis, and establish a novel mechanism through which the inflammatory response facilitates growth processes in skeletal muscle. - Highlights: • We examined mechanisms through which skeletal muscle cell expression of ICAM-1 facilitates events of in vitro myogenesis. • Expression of ICAM-1 by cultured myoblasts did not influence their ability to proliferate or differentiate. • Skeletal muscle cell expression of ICAM-1 augmented myoblast fusion, myotube alignment, myotube–myotube fusion, and myotube size. • ICAM-1 augmented myogenic processes through

  14. Hydrodynamic guiding for addressing subsets of immobilized cells and molecules in microfluidic systems

    Directory of Open Access Journals (Sweden)

    Beyer Michael

    2003-07-01

    Full Text Available Abstract Background The interest in microfluidics and surface patterning is increasing as the use of these technologies in diverse biomedical applications is substantiated. Controlled molecular and cellular surface patterning is a costly and time-consuming process. Methods for keeping multiple separate experimental conditions on a patterned area are, therefore, needed to amplify the amount of biological information that can be retrieved from a patterned surface area. We describe, in three examples of biomedical applications, how this can be achieved in an open microfluidic system, by hydrodynamically guiding sample fluid over biological molecules and living cells immobilized on a surface. Results A microfluidic format of a standard assay for cell-membrane integrity showed a fast and dose-dependent toxicity of saponin on mammalian cells. A model of the interactions of human mononuclear leukocytes and endothelial cells was established. By contrast to static adhesion assays, cell-cell adhesion in this dynamic model depended on cytokine-mediated activation of both endothelial and blood cells. The microfluidic system allowed the use of unprocessed blood as sample material, and a specific and fast immunoassay for measuring the concentration of C-reactive protein in whole blood was demonstrated. Conclusion The use of hydrodynamic guiding made multiple and dynamic experimental conditions on a small surface area possible. The ability to change the direction of flow and produce two-dimensional grids can increase the number of reactions per surface area even further. The described microfluidic system is widely applicable, and can take advantage of surfaces produced by current and future techniques for patterning in the micro- and nanometer scale.

  15. Cerebrospinal fluid and plasma concentration of soluble intercellular adhesion molecule1, vascular cell adhesion molecule1 and endothelial leukocyte adhesion molecule in patients with acute ischemic b

    Directory of Open Access Journals (Sweden)

    Selaković Vesna M.

    2003-01-01

    Full Text Available Background. Leukocyte migration into the ischemic area is a complex process controlled by adhesion molecules (AM in leukocytes and endothelium, by migratory capacity of leukocytes and the presence of hemotaxic agents in the tissue. In this research it was supposed that in the blood and cerebrospinal fluid (CSF of patients in the acute phase of ischemic brain disease (IBD there were relevant changes in the concentration of soluble AM (sICAM-1 sVCAM-1 and sE-selectin, that could have been the indicators of the intensity of damaging processes in central nervous system (CNS. Methods. The study included 45 IBD patients, 15 with transient ischemic attack (TIA 15 with reversible ischemic attack (RIA, and 15 with brain infarction (BI of both sexes, mean age 66±7. Control group consisted of 15 patients with radicular lesions of discal origin, subjected to diagnostic radiculography without the signs of interruption in the passage of CSF. Changes of selected biochemical parameters were determined in all patients in frame 72 hours since the occurence of an ischemic episode. Concentrations of soluble AM were determined in plasma and CSF by ELISA. Total number of leukocytes (TNL in peripheral blood was determined by hematological analyzer. Results. The results showed that during the first 72 hrs of IBD significant increases occured in TNL and that the increase was progressive compared to the severeness of the disease. Significant increase of soluble AM concentration was shown in plasma of IBD patients. The increase was highest in BI somewhat lower in RIA and the lowest in TIA patients compared to the control. In CSF concentrations of sICAM-1, sVCAM-1 and sE-selectin demonstrated similar increasing trend as in plasma. Conclusion. TNL, as well as the soluble AM concentrations in plasma and CSF, were increased during the acute IBD phase and progressive in relation to the severeness of the disease, so that they might have been the indicators of CNS inflammatory

  16. The role of pattern-recognition receptors in graft-versus-host disease and graft-versus-leukemia after allogeneic stem cell transplantation.

    Science.gov (United States)

    Heidegger, Simon; van den Brink, Marcel R M; Haas, Tobias; Poeck, Hendrik

    2014-01-01

    Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is the only treatment with curative potential for certain aggressive hematopoietic malignancies. Its success is limited by acute graft-versus-host disease (GVHD), a life-threatening complication that occurs when allo-reactive donor T cells attack recipient organs. There is growing evidence that microbes and innate pattern-recognition receptors (PRRs) such as toll-like receptors (TLR) and nod-like receptors (NLR) are critically involved in the pathogenesis of acute GVHD. Currently, a widely accepted model postulates that intensive chemotherapy and/or total-body irradiation during pre-transplant conditioning results in tissue damage and a loss of epithelial barrier function. Subsequent translocation of bacterial components as well as release of endogenous danger molecules stimulate PRRs of host antigen-presenting cells to trigger the production of pro-inflammatory cytokines (cytokine storm) that modulate T cell allo-reactivity against host tissues, but eventually also the beneficial graft-versus-leukemia (GVL) effect. Given the limitations of existing immunosuppressive therapies, a better understanding of the molecular mechanisms that govern GVHD versus GVL is urgently needed. This may ultimately allow to design modulators, which protect from GvHD but preserve donor T-cell attack on hematologic malignancies. Here, we will briefly summarize current knowledge about the role of innate immunity in the pathogenesis of GVHD and GVL following allo-HSCT.

  17. Coaggregation of the T-cell receptor with CD4 and other T-cell surface molecules enhances T-cell activation

    DEFF Research Database (Denmark)

    Owens, T; Fazekas de St Groth, B; Miller, J F

    1987-01-01

    and the TCR to stabilize TCR complexes and so to enhance T-cell activation. A related but less specific accessory role for other T-cell surface molecules is also suggested. We propose that the cellular interaction that leads to physiological T-cell activation not only achieves TCR ligation but also promotes......The CD4 molecule, expressed by T cells restricted by class II major histocompatibility complex (MHC) molecules, is believed to play a role in T-cell activation. We have previously suggested that CD4 interacts with the T-cell receptor for antigen (TCR) and with class II MHC and that this dual...... interaction stabilizes the bond between the TCR and antigen in association with MHC. To investigate the contribution of CD4-TCR interaction, we have used the murine monoclonal anti-TCR V beta 8 antibody F23.1 to activate cloned T cells. Weak activation by soluble biotinylated F23.1 was markedly enhanced...

  18. Targeted methylation of the epithelial cell adhesion molecule (EpCAM promoter to silence its expression in ovarian cancer cells.

    Directory of Open Access Journals (Sweden)

    Suneetha Nunna

    Full Text Available The Epithelial Cell Adhesion Molecule (EpCAM is overexpressed in many cancers including ovarian cancer and EpCAM overexpression correlates with decreased survival of patients. It was the aim of this study to achieve a targeted methylation of the EpCAM promoter and silence EpCAM gene expression using an engineered zinc finger protein that specifically binds the EpCAM promoter fused to the catalytic domain of the Dnmt3a DNA methyltransferase. We show that transient transfection of this construct increased the methylation of the EpCAM promoter in SKOV3 cells from 4-8% in untreated cells to 30%. Up to 48% methylation was observed in stable cell lines which express the chimeric methyltransferase. Control experiments confirmed that the methylation was dependent on the fusion of the Zinc finger and the methyltransferase domains and specific for the target region. The stable cell lines with methylated EpCAM promoter showed a 60-80% reduction of EpCAM expression as determined at mRNA and protein level and exhibited a significantly reduced cell proliferation. Our data indicate that targeted methylation of the EpCAM promoter could be an approach in the therapy of EpCAM overexpressing cancers.

  19. Rim Pathway-Mediated Alterations in the Fungal Cell Wall Influence Immune Recognition and Inflammation

    Directory of Open Access Journals (Sweden)

    Kyla S. Ost

    2017-01-01

    Full Text Available Compared to other fungal pathogens, Cryptococcus neoformans is particularly adept at avoiding detection by innate immune cells. To explore fungal cellular features involved in immune avoidance, we characterized cell surface changes of the C. neoformans rim101Δ mutant, a strain that fails to organize and shield immunogenic epitopes from host detection. These cell surface changes are associated with an exaggerated, detrimental inflammatory response in mouse models of infection. We determined that the disorganized strain rim101Δ cell wall increases macrophage detection in a contact-dependent manner. Using biochemical and microscopy methods, we demonstrated that the rim101Δ strain shows a modest increase in the levels of both cell wall chitin and chitosan but that it shows a more dramatic increase in chito-oligomer exposure, as measured by wheat germ agglutinin staining. We also created a series of mutants with various levels of cell wall wheat germ agglutinin staining, and we demonstrated that the staining intensity correlates with the degree of macrophage activation in response to each strain. To explore the host receptors responsible for recognizing the rim101Δ mutant, we determined that both the MyD88 and CARD9 innate immune signaling proteins are involved. Finally, we characterized the immune response to the rim101Δ mutant in vivo, documenting a dramatic and sustained increase in Th1 and Th17 cytokine responses. These results suggest that the Rim101 transcription factor actively regulates the C. neoformans cell wall to prevent the exposure of immune stimulatory molecules within the host. These studies further explored the ways in which immune cells detect C. neoformans and other fungal pathogens by mechanisms that include sensing N-acetylglucosamine-containing structures, such as chitin and chitosan.

  20. Kinetics of T cell-activation molecules in response to Mycobacterium tuberculosis antigens

    Directory of Open Access Journals (Sweden)

    Antas Paulo RZ

    2002-01-01

    Full Text Available The phenotypic features acquired subsequent to antigen-specific stimulation in vitro were evaluated by means of the kinetic expressions of CD69 and CD25 activation molecules on T lymphocytes and assayed by flow cytometry in response to PPD, Ag85B, and ferritin in PPD-positive healthy control individuals. In response to PHA, CD69 staining on both CD4+ and CD8+ T cells became initially marked after 4 h, peaked at 24 h, and quickly decreased after 120 h. For CD25, a latter expression was detected around 8 h, having increased after 96 h. As expected, the response rate to the mycobacterial antigens was much lower than that to the mitogen. Positive staining was high after 96 h for CD25 and after 24 h for CD69. CD69 expression was significantly enhanced (p < 0.05 on CD8+ as compared to CD4+ T cells. High levels were also found between 96-120 h. Regarding Ag85B, CD25+ cells were mostly CD4+ instead of CD8+ T cells. Moreover, in response to ferritin, a lower CD25 expression was noted. The present data will allow further characterization of the immune response to new mycobacterial-specific antigens and their evaluation for possible inclusion in developing new diagnostic techniques for tuberculosis as well in a new vaccine to prevent the disease.

  1. Cell Death-Associated Molecular-Pattern Molecules: Inflammatory Signaling and Control

    Directory of Open Access Journals (Sweden)

    Beatriz Sangiuliano

    2014-01-01

    Full Text Available Apoptosis, necroptosis, and pyroptosis are different cellular death programs characterized in organs and tissues as consequence of microbes infection, cell stress, injury, and chemotherapeutics exposure. Dying and death cells release a variety of self-proteins and bioactive chemicals originated from cytosol, nucleus, endoplasmic reticulum, and mitochondria. These endogenous factors are named cell death-associated molecular-pattern (CDAMP, damage-associated molecular-pattern (DAMP molecules, and alarmins. Some of them cooperate or act as important initial or delayed inflammatory mediators upon binding to diverse membrane and cytosolic receptors coupled to signaling pathways for the activation of the inflammasome platforms and NF-κB multiprotein complexes. Current studies show that the nonprotein thiols and thiol-regulating enzymes as well as highly diffusible prooxidant reactive oxygen and nitrogen species released together in extracellular inflammatory milieu play essential role in controlling pro- and anti-inflammatory activities of CDAMP/DAMP and alarmins. Here, we provide an overview of these emerging concepts and mechanisms of triggering and maintenance of tissue inflammation under massive death of cells.

  2. Effect of human colorectal carcinogenesis on the neural cell adhesion molecule expression and polysialylation.

    Science.gov (United States)

    Fernández-Briera, A; García-Parceiro, I; Cuevas, E; Gil-Martín, E

    2010-01-01

    Although downregulation of neural cell adhesion molecule (NCAM) has been correlated with poor prognosis in colorectal cancer (CRC), it is also possible that colon cancer spreading comes from reducing tumor cell adhesion through NCAM polysialylation, as occurs in lung carcinoma or Wilms' tumor. To prove this hypothesis, we have performed a prospective study on tumor and control specimens from 39 CRC patients, which were immunostained for NCAM and PSA (polysialic acid) expression. Tumor versus control expression of NCAM and PSA epitopes in tissue specimens, as well as correlation between tumor expression and clinicopathological features, were statistically analyzed. Results showed a low constitutive expression of NCAM and PSA (PSA-NCAM) in control tissue, which reached a statistically significant increase in the tumor tissue. Likewise, the presence and number of lymph node metastases at surgery were correlated with NCAM expression and PSA/NCAM coexpression. These data highlight the importance of taking into account PSA-associated epitopes when dealing with NCAM cell expression studies in tumor development and progression. The analysis of PSA and NCAM expression in CRC suggests a new way, other than downregulation of NCAM, in order to escape contact inhibition and promote cell tumor spreading in colorectal cancer. Copyright 2010 S. Karger AG, Basel.

  3. Intercellular Adhesion Molecule-1 and Vascular Cell Adhesion Molecule Are Induced by Ionizing Radiation on Lymphatic Endothelium

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez-Ruiz, María E., E-mail: mrruiz@unav.es [Division of Immunology and Immunotherapy, Center for Applied Medical Research, University of Navarra, Pamplona (Spain); Radiation Oncology, University Clinic, University of Navarra, Pamplona (Spain); Garasa, Saray; Rodriguez, Inmaculada [Division of Immunology and Immunotherapy, Center for Applied Medical Research, University of Navarra, Pamplona (Spain); Solorzano, Jose Luis; Barbes, Benigno [Radiation Oncology, University Clinic, University of Navarra, Pamplona (Spain); Yanguas, Alba [Division of Immunology and Immunotherapy, Center for Applied Medical Research, University of Navarra, Pamplona (Spain); Department of Biochemistry and Genetics, University of Navarra, Pamplona (Spain); Teijeira, Alvaro; Etxeberria, Iñaki [Division of Immunology and Immunotherapy, Center for Applied Medical Research, University of Navarra, Pamplona (Spain); Aristu, José Javier [Radiation Oncology, University Clinic, University of Navarra, Pamplona (Spain); Halin, Cornelia [Pharmaceutical Immunology, Institute of Pharmaceutical Sciences, ETH Zurich, Zurich (Switzerland); Melero, Ignacio [Division of Immunology and Immunotherapy, Center for Applied Medical Research, University of Navarra, Pamplona (Spain); Radiation Oncology, University Clinic, University of Navarra, Pamplona (Spain); Rouzaut, Ana [Division of Immunology and Immunotherapy, Center for Applied Medical Research, University of Navarra, Pamplona (Spain); Department of Biochemistry and Genetics, University of Navarra, Pamplona (Spain)

    2017-02-01

    Purpose/Objectives: The goal of this study was to assess the effects of ionizing radiation on the expression of the integrin ligands ICAM-1 and VCAM that control leucocyte transit by lymphatic endothelial cells. Materials/Methods: Confluent monolayers of primary human lymphatic endothelial cells (LEC) were irradiated with single dose of 2, 5, 10 or 20 Gy, with 6 MeV-x-rays using a Linear-Accelerator. ICAM-1 and VCAM expression was determined by flow cytometry. Human tissue specimens received a single dose of 20 Gy with 15 MeV-x-rays. MC38, B16-OVA or B16-VEGF-C tumors grown in C57BL/6 mice were irradiated with single dose of 20Gy using a Linear-Accelerator fitted with a 10mm Radiosurgery collimator. Clinical samples were obtained from patients previous and 4 weeks after complete standard radiotherapy. ICAM-1 and VCAM expression was detected in all tissue specimens by confocal microscopy. To understand the role of TGFβ in this process anti-TGFβ blocking mAb were injected i.p. 30min before radiotherapy. Cell adhesion to irradiated LEC was analyzed in adhesion experiments performed in the presence or in the absence of anti- TGFβ and /or anti-ICAM1 blocking mAb. Results: We demonstrate that lymphatic endothelial cells in tumor samples experience induction of surface ICAM-1 and VCAM when exposed to ionizing radiation in a dose- and time-dependent manner. These effects can be recapitulated in cultured LEC, and are in part mediated by TGFβ. These data are consistent with increases in ICAM-1 and VCAM expression on LYVE-1+ endothelial cells in freshly explanted human tumor tissue and in mouse transplanted tumors after radiotherapy. Finally, ICAM-1 and VCAM expression accounts for enhanced adherence of human T lymphocytes to irradiated LEC. Conclusion: Our results show induction of ICAM-1 and VCAM on LVs in irradiated lesions and offer a starting point for elucidating the biological and therapeutic implications of targeting leukocyte traffic in combination to

  4. Biomimetic Receptors for Bioanalyte Detection by Quartz Crystal Microbalances — From Molecules to Cells

    Directory of Open Access Journals (Sweden)

    Usman Latif

    2014-12-01

    Full Text Available A universal label-free detection of bioanalytes can be performed with biomimetic quartz crystal microbalance (QCM coatings prepared by imprinting strategies. Bulk imprinting was used to detect the endocrine disrupting chemicals (EDCs known as estradiols. The estrogen 17β-estradiol is one of the most potent EDCs, even at very low concentrations. A highly sensitive, selective and robust QCM sensor was fabricated for real time monitoring of 17β-estradiol in water samples by using molecular imprinted polyurethane. Optimization of porogen (pyrene and cross-linker (phloroglucinol levels leads to improved sensitivity, selectivity and response time of the estradiol sensor. Surface imprinting of polyurethane as sensor coating also allowed us to generate interaction sites for the selective recognition of bacteria, even in a very complex mixture of interfering compounds, while they were growing from their spores in nutrient solution. A double molecular imprinting approach was followed to transfer the geometrical features of natural bacteria onto the synthetic polymer to generate biomimetic bacteria. The use of biomimetic bacteria as template makes it possible to prepare multiple sensor coatings with similar sensitivity and selectivity. Thus, cell typing, e.g., differentiation of bacteria strains, bacteria growth profile and extent of their nutrition, can be monitored by biomimetic mass sensors. Obviously, this leads to controlled cell growth in bioreactors.

  5. Molecular Recognition of Human Liver Cancer Cells Using DNA Aptamers Generated via Cell-SELEX.

    Directory of Open Access Journals (Sweden)

    Jiehua Xu

    Full Text Available Most clinical cases of liver cancer cannot be diagnosed until they have evolved to an advanced stage, thus resulting in high mortality. It is well recognized that the implementation of early detection methods and the development of targeted therapies for liver cancer are essential to reducing the high mortality rates associated with this disease. To achieve these goals, molecular probes capable of recognizing liver cancer cell-specific targets are needed. Here we describe a panel of aptamers able to distinguish hepatocarcinoma from normal liver cells. The aptamers, which were selected by cell-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment, have Kd values in the range of 64-349 nM toward the target human hepatoma cell HepG2, and also recognize ovarian cancer cells and lung adenocarcinoma. The proteinase treatment experiment indicated that all aptamers could recognize target HepG2 cells through surface proteins. This outcome suggested that these aptamers could be used as potential probes for further research in cancer studies, such as developing early detection assays, targeted therapies, and imaging agents, as well as for the investigation of common membrane proteins in these distinguishable cancers.

  6. Antibody recognition of Plasmodium falciparum infected red blood cells by symptomatic and asymptomatic individuals in the Brazilian Amazon

    Science.gov (United States)

    Fratus, Alessandra Sampaio Bassi; Cabral, Fernanda Janku; Fotoran, Wesley Luzetti; Medeiros, Márcia Melo; Carlos, Bianca Cechetto; Martha, Rosimeire dalla; da Silva, Luiz Hildebrando Pereira; Lopes, Stefanie Costa Pinto; Costa, Fabio Trindade Maranhão; Wunderlich, Gerhard

    2014-01-01

    In the Amazon Region, there is a virtual absence of severe malaria and few fatal cases of naturally occurring Plasmodium falciparum infections; this presents an intriguing and underexplored area of research. In addition to the rapid access of infected persons to effective treatment, one cause of this phenomenon might be the recognition of cytoadherent variant proteins on the infected red blood cell (IRBC) surface, including the var gene encoded P. falciparum erythrocyte membrane protein 1. In order to establish a link between cytoadherence, IRBC surface antibody recognition and the presence or absence of malaria symptoms, we phenotype-selected four Amazonian P. falciparum isolates and the laboratory strain 3D7 for their cytoadherence to CD36 and ICAM1 expressed on CHO cells. We then mapped the dominantly expressed var transcripts and tested whether antibodies from symptomatic or asymptomatic infections showed a differential recognition of the IRBC surface. As controls, the 3D7 lineages expressing severe disease-associated phenotypes were used. We showed that there was no profound difference between the frequency and intensity of antibody recognition of the IRBC-exposed P. falciparum proteins in symptomatic vs. asymptomatic infections. The 3D7 lineages, which expressed severe malaria-associated phenotypes, were strongly recognised by most, but not all plasmas, meaning that the recognition of these phenotypes is frequent in asymptomatic carriers, but is not necessarily a prerequisite to staying free of symptoms. PMID:25099336

  7. Apoptosis following interleukin-2 withdrawal from T cells: evidence for a regulatory role of CD18 (beta 2-integrin) molecules

    DEFF Research Database (Denmark)

    Röpke, C; Gladstone, P; Nielsen, M

    1996-01-01

    molecules (CD28, CD29, CD49d, CD80, CD86) did not. Secondly, IL-2 withdrawal resulted in a retarded apoptotic response in LFA-1 (CD11a/CD18) negative T cells obtained from a leukocyte adhesion deficiency (LAD) patient, as compared to LFA-1 positive T cell lines. Thirdly, co-culture of LFA-1 positive...

  8. Allelic imbalance modulates surface expression of the tolerance-inducing HLA-G molecule on primary trophoblast cells

    DEFF Research Database (Denmark)

    Djurisic, S; Teiblum, S; Tolstrup, C K

    2015-01-01

    The HLA-G molecule is expressed on trophoblast cells at the feto-maternal interface, where it interacts with local immune cells, and upholds tolerance against the semi-allogeneic fetus. Aberrant HLA-G expression in the placenta and reduced soluble HLA-G levels are observed in pregnancy complicati...

  9. Pharmacological approach for targeting dysfunctional brain plasticity: Focus on neural cell adhesion molecule (NCAM).

    Science.gov (United States)

    Aonurm-Helm, Anu; Jaako, Külli; Jürgenson, Monika; Zharkovsky, Alexander

    2016-11-01

    Brain plasticity refers to the ability of the brain to undergo functionally relevant adaptations in response to external and internal stimuli. Alterations in brain plasticity have been associated with several neuropsychiatric disorders, and current theories suggest that dysfunctions in neuronal circuits and synaptogenesis have a major impact in the development of these diseases. Among the molecules that regulate brain plasticity, neural cell adhesion molecule (NCAM) and its polysialylated form PSA-NCAM have been of particular interest for years because alterations in NCAM and PSA-NCAM levels have been associated with memory impairment, depression, autistic spectrum disorders and schizophrenia. In this review, we discuss the roles of NCAM and PSA-NCAM in the regulation of brain plasticity and, in particular, their roles in the mechanisms of depression. We also demonstrate that the NCAM-mimetic peptides FGL and Enreptin are able to restore disrupted neuronal plasticity. FGL peptide has also been demonstrated to ameliorate the symptoms of depressive-like behavior in NCAM-deficient mice and therefore, may be considered a new drug candidate for the treatment of depression as well as other neuropsychiatric disorders with disrupted neuroplasticity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Transplatin enhances effect of cisplatin on both single DNA molecules and live tumor cells.

    Science.gov (United States)

    Liu, Yu-Ru; Ji, Chao; Zhang, Hong-Yan; Dou, Shuo-Xing; Xie, Ping; Wang, Wei-Chi; Wang, Peng-Ye

    2013-08-01

    Cisplatin is the main platinum antitumor drug applied in clinical settings. However, its trans isomer, transplatin, is known to have an ineffective antitumor activity. Despite intensive studies in this field, the structural and biophysical properties of DNA molecules reacting with these two platinum complexes have not been fully elucidated. In the present study, we observed that transplatin made efficient cross-linking of DNA in the vicinity of cisplatin adducts. High-resolution atomic force microscopy studies revealed that the transplatin-induced cross-linkings of nucleotides flanking cisplatin adducts were characterized by kinked-loop structures with rod-like shapes of nanometer scales (∼10-60nm). The results were further confirmed by denaturing gel electrophoresis and single-molecule experiment using magnetic tweezers. In vivo studies revealed that transplatin and cisplatin co-treatment could induce a considerable amount of kinked loops with smaller sizes (∼15nm) in cellular DNA. Furthermore, compared with cisplatin treatment alone, the co-treatment resulted in enhanced cytotoxicity, increased amount of interstrand cross-links, and cell lesions more reluctant to cellular repair system. The results of the present study provide a new clue for understanding the stepwise reactions of DNA with platinum drugs and might serve as a basis for the development of a new antitumor strategy. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Cell adhesion molecules and hyaluronic acid as markers of inflammation, fibrosis and response to antiviral therapy in chronic hepatitis C patients

    Directory of Open Access Journals (Sweden)

    Esther Granot

    2001-01-01

    Full Text Available Objective: Cell adhesion molecules (intracellular adhesion molecule-1 (ICAM-1, vascular cell adhesion molecule-1 (VCAM-1 and hyaluronic acid, markers of inflammation and fibrosis were monitored in hepatitis C patients to determine whether changes in plasma levels, during antiviral treatment, can predict long-term response to therapy.

  12. Pseudomonas aeruginosa quorum-sensing signal molecules interfere with dendritic cell-induced T-cell proliferation

    DEFF Research Database (Denmark)

    Skindersø, Mette Elena; Zeuthen, Louise; Pedersen, Susanne Brix

    2009-01-01

    Pseudomonas aeruginosa releases a wide array of toxins and tissue-degrading enzymes. Production of these malicious virulence factors is controlled by interbacterial communication in a process known as quorum sensing. An increasing body of evidence reveals that the bacterial signal molecule N-(3...... article we demonstrate that both OdDHL and PQS decrease the production of interleukin-12 (IL-12) by Escherichia coli lipopolysaccharide-stimulated bone marrow-derived dendritic cells (BM-DCs) without altering their IL-10 release. Moreover, BM-DCs exposed to PQS and OdDHL during antigen stimulation exhibit...... a decreased ability to induce T-cell proliferation in vitro. Collectively, this suggests that OdDHL and PQS change the maturation pattern of stimulated DCs away from a proinflammatory T-helper type I directing response, thereby decreasing the antibacterial activity of the adaptive immune defence. Od...

  13. Self-assembly of 5,11,17,23-Tetranitro-25,26,27,28-tetramethoxythiacalix[4]arene with Neutral Molecules and its Use for Anion Recognition

    Czech Academy of Sciences Publication Activity Database

    Macková, M.; Himl, M.; Budka, J.; Pojarová, M.; Císařová, I.; Eigner, V.; Cuřínová, Petra; Dvořáková, H.; Lhoták, P.

    2013-01-01

    Roč. 69, č. 4 (2013), s. 1397-1402 ISSN 0040-4020 R&D Projects: GA ČR GA203/09/0691; GA AV ČR IAAX08240901 Institutional support: RVO:67985858 Keywords : thiacalixarenes * self assembly * anion recognition Subject RIV: CC - Organic Chemistry Impact factor: 2.817, year: 2013

  14. Diabetic impairment of C-kit bone marrow stem cells involves the disorders of inflammatory factors, cell adhesion and extracellular matrix molecules.

    Directory of Open Access Journals (Sweden)

    Tao-Sheng Li

    Full Text Available Bone marrow stem cells from diabetes mellitus patients exhibit functional impairment, but the relative molecular mechanisms responsible for this impairment are poorly understood. We investigated the mechanisms responsible for diabetes-related functional impairment of bone marrow stem cells by extensively screening the expression levels of inflammatory factors, cell cycle regulating molecules, extracellular matrix molecules and adhesion molecules. Bone marrow cells were collected from type 2 diabetic (db/db and healthy control (db/m+ mice, and c-kit+ stem cells were purified (purity>85% for experiments. Compared with the healthy control mice, diabetic mice had significantly fewer c-kit+ stem cells, and these cells had a lower potency of endothelial differentiation; however, the production of the angiogenic growth factor VEGF did not differ between groups. A pathway-focused array showed that the c-kit+ stem cells from diabetic mice had up-regulated expression levels of many inflammatory factors, including Tlr4, Cxcl9, Il9, Tgfb1, Il4, and Tnfsf5, but no obvious change in the expression levels of cell cycle molecules. Interestingly, diabetes-related alterations of the extracellular matrix and adhesion molecules were varied; Pecam, Mmp10, Lamc1, Itgb7, Mmp9, and Timp4 were up-regulated, but Col11a1, Fn1, Admts2, and Itgav were down-regulated. Some of these changes were also confirmed at the protein level by flow cytometry analysis. In conclusion, c-kit+ bone marrow stem cells from diabetic mice exhibited an extensive enhancement of inflammatory factors and disorders of the extracellular matrix and adhesion molecules. Further intervention studies are required to determine the precise role of each molecule in the diabetes-related functional impairment of c-kit+ bone marrow stem cells.

  15. HLA Class Ib Molecules and Immune Cells in Pregnancy and Preeclampsia

    DEFF Research Database (Denmark)

    Djurisic, Snezana; Hviid, Thomas Vauvert F

    2014-01-01

    Despite decades of research, the highly prevalent pregnancy complication preeclampsia, "the disease of theories," has remained an enigma. Indeed, the etiology of preeclampsia is largely unknown. A compiling amount of studies indicates that the pathological basis involves a complex array of genetic...... predisposition and immunological maladaptation, and that a contribution from the mother, the father, and the fetus is likely to be important. The Human Leukocyte Antigen (HLA)-G is an increasing focus of research in relation to preeclampsia. The HLA-G molecule is primarily expressed by the extravillous...... of HLA-G, and, in some studies, with preeclampsia. In this review, a genetic contribution from the mother, the father, and the fetus, together with the presence and function of various immune cells of relevance in pregnancy are reviewed in relation to HLA-G and preeclampsia....

  16. Blend ratio dependence of photovoltaic properties in octahexylphthalocyanine-based small molecule solar cell

    Science.gov (United States)

    Dao, Quang-Duy; Kumada, Taishi; Fukui, Hitoshi; Ohmori, Masashi; Fujii, Akihiko; Shimizu, Yo; Ozaki, Masanori

    2014-01-01

    A study on the blend ratio dependence of the photovoltaic properties in bulk heterojunction organic solar cells (OSCs) consisting of [6,6]-phenyl-C71 butyric acid methyl ester ([70]PCBM) and 1,4,8,11,15,18,22,25-octahexylphthalocyanine (C6PcH2) has been reported. With increasing the [70]PCBM volume fraction, the short-circuit current density was enhanced to be 10.6 mA·cm-2 owing to the enlargement of the donor and acceptor interfacial areas. However, when the [70]PCBM volume fraction was higher than 33%, the fill factor was reduced owing to the deterioration of crystallization of discotic C6PcH2 molecules with hexagonal structures. The OSCs with the optimum blend ratio demonstrated a high power conversion efficiency of 3.9%.

  17. Bioactive phytochemical proanthocyanidins inhibit growth of head and neck squamous cell carcinoma cells by targeting multiple signaling molecules.

    Directory of Open Access Journals (Sweden)

    Ram Prasad

    Full Text Available Despite advances in surgical and medical therapies, approximate 50% survival rate of head and neck squamous cell carcinoma (HNSCC has had marginal improvement in the last 30 years. Therefore, alternative strategies are required for the management of HNSCC. Here, we report the chemotherapeutic effect of proanthocyanidins on HNSCC cells using in vitro and in vivo models. Treatment of human HNSCC cell lines from different sub-sites, such as oral cavity (SCC1, larynx (SCC5, tongue (OSC19 and pharynx (FaDu, with grape seed proanthocyanidins (GSPs reduced their cell viability and induced cell death in a dose- and time-dependent manner. GSPs induced inhibition of cell viability was associated with: (i G1-phase arrest, (ii inhibition of expressions of cyclins (cyclin D1 and Cyclin D2 and cyclin-dependent kinases (Cdk, (iii increased expression of the Cdk inhibitory proteins (Cip1/p21, Kip1/p27, enhanced binding of Cdk inhibitors to Cdks, and downregulation of E2F transcription factor. GSPs significantly (P<0.05-0.001 increased apoptosis of SCC1 and OSC19 cells with induction of Bax, reduced expression of Bcl-2, and activation of caspase-3. GSPs also reduced the expression of epidermal growth factor receptor (EGFR, and treatment of SCC1 cells with erlotinib, an EGFR-targeting small molecule tyrosine kinase inhibitor, significantly (P<0.05-0.001 reduced cell viability and increased cell death. Dietary administration of GSPs (0.5%, w/w in supplementation with AIN76A control diet inhibited the growth of SCC1 tumor xenografts in athymic nude mice, which was associated with: (i inhibition of cell proliferation, (ii induction of apoptosis of tumor xenograft cells, (iii decreased expression of cyclins and Cdks, (iv decreased expression of EGFR, and (v increased expression of Cip1/p21 and Kip1/p27 proteins and their increased binding to Cdks in tumor xenograft samples. Together, these results suggest that GSPs may be a promising candidate for head and neck

  18. Compact halo-ligand-conjugated quantum dots for multicolored single-molecule imaging of overcrowding GPCR proteins on cell membranes.

    Science.gov (United States)

    Komatsuzaki, Akihito; Ohyanagi, Tatsuya; Tsukasaki, Yoshikazu; Miyanaga, Yukihiro; Ueda, Masahiro; Jin, Takashi

    2015-03-25

    To detect single molecules within the optical diffraction limit (< ca. 200 nm), a multicolored imaging technique is developed using Halo-ligand conjugated quantum dots (Halo-QDs; <6 nm in diameter). Using three types of Halo-QDs, multicolored single-molecule fluorescence imaging of GPCR proteins in Dictyostelium cells is achieved. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. History of Maternal Recognition of Pregnancy.

    Science.gov (United States)

    Bazer, Fuller W

    2015-01-01

    The mechanism for signaling pregnancy recognition is highly variable among species, and the signaling molecule itself varies between estrogens in pigs to chorionic gonadotrophin in primates. This chapter provides insight into the menstrual cycle of women and estrous cycles of rodents, dog, cat, pigs, sheep, rabbits, and marsupials, as well as the hormones required for pregnancy recognition. Pregnancy recognition involves specific hormones such as prolactin in rodents or interferons in ruminants and estrogens in pigs that in their own way ensure the maintenance of the corpus luteum and its secretion of progesterone which is the hormone of pregnancy. However, these pregnancy recognition signals may also modify gene expression in a cell-specific and temporal manner to ensure the growth and development of the conceptus. This chapter provides some historical aspects of the development of understanding of mechanisms for the establishment and maintenance of pregnancy in several species of mammals.

  20. Resistin-like molecule alpha1 (Fizz1 recruits lung dendritic cells without causing pulmonary fibrosis

    Directory of Open Access Journals (Sweden)

    Madala Satish K

    2012-06-01

    Full Text Available Abstract Background Resistin-like molecule alpha or found in inflammatory zone protein (Fizz1 is increased in pulmonary epithelial cells and also in limited amounts by other lung cells during various lung injuries and fibrosis. However, the direct role of Fizz1 produced in the pulmonary epithelium has not been determined. Methods Fizz1 Transgenic mice (CCSP/Fizz1 were generated that overexpress Fizz1 in the lung epithelium under the control of a doxycycline (Dox inducible lung epithelial cell specific promoter Scgb1a1 (Clara cell secretory protein, CCSP. Histology and FACS analysis of lung cells were used to identify the direct effects of Fizz1 in the transgenic mice (Dox treated when compared with control (CCSP/- mice. Intratracheal bleomycin sulfate or silica in saline and saline alone were used to study the role of Fizz1 during bleomycin- and silica-induced pulmonary fibrosis in CCSP/Fizz1 and CCSP/- mice. Weight change, pulmonary inflammation, and fibrosis were assessed 10 days post bleomycin or 28 days post silica challenge. Results When CCSP/Fizz1 mice were fed Dox food, elevated Fizz1 protein was detected in lung homogenates by western blot. Lungs of mice in which Fizz1 was induced in the epithelium contained increased lung cells staining for CD11c and F4/80 by FACS analysis consistent with increased dendritic cells however, no changes were observed in the percentage of interstitial macrophages compared to CCSP/- controls. No significant changes were found in the lung histology of CCSP/Fizz1 mice after up to 8 weeks of overexpression compared to CCSP/- controls. Overexpression of Fizz1 prior to challenge or following challenge with bleomycin or silica did not significantly alter airway inflammation or fibrosis compared to control mice. Conclusions The current study demonstrates that epithelial cell derived Fizz1 is sufficient to increase the bone-marrow derived dendritic cells in the lungs, but it is not sufficient to cause lung

  1. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    Directory of Open Access Journals (Sweden)

    Hui-Ching Chuang

    Full Text Available TP53 is the most commonly mutated gene in head and neck cancer (HNSCC, with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis, a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1 inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  2. Differentiation of MCF-7 tumor cells from leukocytes and fibroblast cells using epithelial cell adhesion molecule targeted multicore surface-enhanced Raman spectroscopy labels

    Science.gov (United States)

    Freitag, Isabel; Matthäus, Christian; Csaki, Andrea; Clement, Joachim H.; Cialla-May, Dana; Weber, Karina; Krafft, Christoph; Popp, Jürgen

    2015-05-01

    Identification of tumor and normal cells is a promising application of Raman spectroscopy. The throughput of Raman-assisted cell sorting is limited by low sensitivity. Surface-enhanced Raman spectroscopy (SERS) is a well-recognized candidate to increase the intensity of Raman signals of cells. First, different strategies are summarized to detect tumor cells using targeted SERS probes. Then, a protocol is described to prepare multicore-SERS-labels (MSLs) by aggregating gold nanoparticles, coating with a reporter molecule and a thin silver shell to further boost enhancement, encapsulating with a stable silica layer, and functionalizing by epithelial cell adhesion molecule (EpCAM) antibodies. Raman, dark field and fluorescence microscopy proved the specific and nonspecific binding of functionalized and nonfunctionalized MSLs to MCF-7 tumor cells, leukocytes from blood, and nontransformed human foreskin fibroblasts. Raman imaging and dark field microscopy indicated no uptake of MSLs, yet binding to the cellular membrane. Viability tests were performed with living tumor cells to demonstrate the low toxicity of MSL-EpCAM. The SERS signatures were detected from cells with exposure times down to 25 ms at 785-nm laser excitation. The prospects of these MSLs in multiplex assays, for enumeration and sorting of circulating tumor cells in microfluidic chips, are discussed.

  3. A SMYD3 Small-Molecule Inhibitor Impairing Cancer Cell Growth

    Science.gov (United States)

    Barbosa, Armenio Jorge; Di Virgilio, Valeria; Fittipaldi, Raffaella; Fabini, Edoardo; Bertucci, Carlo; Varchi, Greta; Moyer, Mary Pat; Caretti, Giuseppina; Del Rio, Alberto; Simone, Cristiano

    2016-01-01

    SMYD3 is a histone lysine methyltransferase that plays an important role in transcriptional activation as a member of an RNA polymerase complex, and its oncogenic role has been described in different cancer types. We studied the expression and activity of SMYD3 in a preclinical model of colorectal cancer (CRC) and found that it is strongly upregulated throughout tumorigenesis both at the mRNA and protein level. Our results also showed that RNAi-mediated SMYD3 ablation impairs CRC cell proliferation indicating that SMYD3 is required for proper cancer cell growth. These data, together with the importance of lysine methyltransferases as a target for drug discovery, prompted us to carry out a virtual screening to identify new SMYD3 inhibitors by testing several candidate small molecules. Here we report that one of these compounds (BCI-121) induces a significant reduction in SMYD3 activity both in vitro and in CRC cells, as suggested by the analysis of global H3K4me2/3 and H4K5me levels. Of note, the extent of cell growth inhibition by BCI-121 was similar to that observed upon SMYD3 genetic ablation. Most of the results described above were obtained in CRC; however, when we extended our observations to tumor cell lines of different origin, we found that SMYD3 inhibitors are also effective in other cancer types, such as lung, pancreatic, prostate, and ovarian. These results represent the proof of principle that SMYD3 is a druggable target and suggest that new compounds capable of inhibiting its activity may prove useful as novel therapeutic agents in cancer treatment. PMID:25728514

  4. Influence of cartilage extracellular matrix molecules on cell phenotype and neocartilage formation.

    Science.gov (United States)

    Grogan, Shawn P; Chen, Xian; Sovani, Sujata; Taniguchi, Noboru; Colwell, Clifford W; Lotz, Martin K; D'Lima, Darryl D

    2014-01-01

    Interaction between chondrocytes and the cartilage extracellular matrix (ECM) is essential for maintaining the cartilage's role as a low-friction and load-bearing tissue. In this study, we examined the influence of cartilage zone-specific ECM on human articular chondrocytes (HAC) in two-dimensional and three-dimensional (3D) environments. Two culture systems were used. SYSTEM 1: HAC were cultured on cell-culture plates that had been precoated with the following ECM molecules for 7 days: decorin, biglycan, tenascin C (superficial zone), collagen type II, hyaluronan (HA) (middle and deep zones), and osteopontin (deep zone). Uncoated standard culture plates were used as controls. Expanded cells were examined for phenotypic changes using real-time polymerase chain reaction. In addition, expanded cells were placed into high-density pellet cultures for 14 days. Neocartilage formation was assessed via gene expression and histology evaluations. SYSTEM 2: HAC that were cultured on untreated plates and encapsulated in a 3D alginate scaffold were mixed with one of the zone-specific ECM molecules. Cell viability, gene expression, and histology assessments were conducted on 14-day-old tissues. In HAC monolayer culture, exposure to decorin, HA, and osteopontin increased COL2A1 and aggrecan messenger RNA (mRNA) levels compared with controls. Biglycan up-regulated aggrecan without a significant impact on COL2A1 expression; Tenascin C reduced COL2A1 expression. Neocartilage formed after preculture on tenascin C and collagen type II expressed higher COL2A1 mRNA compared with control pellets. Preculture of HAC on HA decreased both COL2A1 and aggrecan expression levels compared with controls, which was consistent with histology. Reduced proteoglycan 4 (PRG4) mRNA levels were observed in HAC pellets that had been precultured with biglycan and collagen type II. Exposing HAC to HA directly in 3D-alginate culture most effectively induced neocartilage formation, showing increased COL2A1

  5. Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    commensurability is displayed in phenomena in different branches of science. All material objects (micro- and macro systems) that are described by standing waves know all about each other. Each object is the scaled one of the other and it is not possible to say which is more 'fundamental'. In this work we have demonstrated that the structure of DNA and cell molecules can be calculated with some structure of a hydrogen atom. The inter-atomic distances in cell molecules are quantized according to the quantization rule of the fractional Hall effect. Therefore, we can conclude that the structure of DNA and cell molecules can be established from the analysis of hydrogen spectra using the quantization rule of the Hall effect and vice versa. The bridge between the structure of a hydrogen atom, cell molecules and the Hall effect exists. It is very surprising that there are phenomena in Nature that are really described by simple rational relations. Only the fundamental conservation law of energy-momentum is responsible for this harmonic movement. We are now able to calculate and predict the structure of a cell molecule, and we invite people for cooperation. The Huygens principle of synchronization became a fruitful inter disciplinary science of general laws of self-organized processes in different branches of physics. It is intriguing to speculate that many questions can be now formulated as a result of universality of the Huygens synchronization principle independent of substance, fields, matter, and interactions for micro- and macro systems. Information concerning important details of an ecosystem's evolution is contained in frequency spectra. Therefore matter turns out to be a form of organized information. The Universe was arranged according to number, harmony and perfect forms. A new concept in evolution is robustness. One suggests simulating evolution of complex organisms constrained by the sole requirement of robustness in their expression patterns. Robustness in biophysics is

  6. NK cell killer Ig-like receptor repertoire acquisition and maturation are strongly modulated by HLA class I molecules.

    Science.gov (United States)

    Sleiman, Marwan; Brons, Nicolaas H C; Kaoma, Tony; Dogu, Figen; Villa-Forte, Alexandra; Lenoble, Patrick; Hentges, François; Kotsch, Katja; Gadola, Stephan D; Vilches, Carlos; Zimmer, Jacques

    2014-03-15

    The interaction between clonally distributed inhibitory receptors and their activating counterparts on NK cells and HLA class I molecules defines NK cell functions, but the role of HLA class I ligands in the acquisition of their receptors during NK development is still unclear. Although some studies demonstrated that HLA-C affects the expression of killer Ig-like receptors (KIR), other studies showed that NK cells acquire their KIR repertoire in a stochastic manner. Only when infected with human CMV is an expansion of self-specific KIR(+) NKG2C(+) NK cells detected. To gain more insight into this question, we compared the coexpression of different KIR molecules, NKG2A, CD8, and CD57, on NK cells in healthy donors and seven patients with deficient HLA class I expression due to mutations in one of the TAP genes. Our results show a correlation between the presence/absence of HLA class I molecules and the coexpression of their receptors. In an HLA class I low-expression context, an increase in KIR molecules' coexpression is detected on the NKG2A(+) CD8(+) subset. In functional assays, hyporesponsiveness was observed for TAP-deficient NK cells derived from four patients. In contrast, NK cells from patient five were functional, whereas CD107a(+) and IFN-γ(+) CD56(dim) NK cells presented a different pattern of HLA class I receptors compared with healthy donors. Taken together, our results provide strong evidence for the role of HLA class I molecules in NK cell maturation and KIR repertoire acquisition.

  7. A novel attribute of enoxaparin: inhibition of monocyte adhesion to endothelial cells by a mechanism involving cell adhesion molecules.

    Science.gov (United States)

    Manduteanu, I; Voinea, M; Capraru, M; Dragomir, E; Simionescu, M

    2002-05-01

    Enoxaparin is a low molecular weight heparin, widely accepted as anticoagulant or antithrombotic drug, and is likely to have a role in acute inflammation. To evaluate the anti-inflammatory potential of enoxaparin, we investigated the direct effect of the drug on the activation of endothelial cells. For this purpose we set up an in vitro system in which cultured valvular endothelial cells (VEC) activated by tumor necrosis factor alpha or lipopolysaccharide were exposed to a monocytic cell line; these conditions induced a significant adhesion of monocytes to VEC. Adhesion assays, ELISA, and flow cytometric analysis revealed that pretreatment with enoxaparin, at a relevant plasma concentration (16 microg/ml), acts upon activation of VEC by inhibition of lipopolysaccharide-induced E-selectin expression and tumor necrosis factor stimulated ICAM-1 expression, thus reducing monocyte adhesion to VEC. These results suggest a novel function of enoxaparin, namely to protect VEC from activation and inhibiting the expression of cell adhesion molecules. Copyright 2002 S. Karger AG, Basel

  8. Soluble melanoma cell adhesion molecule (sMCAM/sCD146) promotes angiogenic effects on endothelial progenitor cells through angiomotin.

    Science.gov (United States)

    Stalin, Jimmy; Harhouri, Karim; Hubert, Lucas; Subrini, Caroline; Lafitte, Daniel; Lissitzky, Jean-Claude; Elganfoud, Nadia; Robert, Stéphane; Foucault-Bertaud, Alexandrine; Kaspi, Elise; Sabatier, Florence; Aurrand-Lions, Michel; Bardin, Nathalie; Holmgren, Lars; Dignat-George, Françoise; Blot-Chabaud, Marcel

    2013-03-29

    The melanoma cell adhesion molecule (CD146) contains a circulating proteolytic variant (sCD146), which is involved in inflammation and angiogenesis. Its circulating level is modulated in different pathologies, but its intracellular transduction pathways are still largely unknown. Using peptide pulldown and mass spectrometry, we identified angiomotin as a sCD146-associated protein in endothelial progenitor cells (EPC). Interaction between angiomotin and sCD146 was confirmed by enzyme-linked immunosorbent assay (ELISA), homogeneous time-resolved fluorescence, and binding of sCD146 on both immobilized recombinant angiomotin and angiomotin-transfected cells. Silencing angiomotin in EPC inhibited sCD146 angiogenic effects, i.e. EPC migration, proliferation, and capacity to form capillary-like structures in Matrigel. In addition, sCD146 effects were inhibited by the angiomotin inhibitor angiostatin and competition with recombinant angiomotin. Finally, binding of sCD146 on angiomotin triggered the activation of several transduction pathways that were identified by antibody array. These results delineate a novel signaling pathway where sCD146 binds to angiomotin to stimulate a proangiogenic response. This result is important to find novel target cells of sCD146 and for the development of therapeutic strategies based on EPC in the treatment of ischemic diseases.

  9. Soluble Melanoma Cell Adhesion Molecule (sMCAM/sCD146) Promotes Angiogenic Effects on Endothelial Progenitor Cells through Angiomotin*

    Science.gov (United States)

    Stalin, Jimmy; Harhouri, Karim; Hubert, Lucas; Subrini, Caroline; Lafitte, Daniel; Lissitzky, Jean-Claude; Elganfoud, Nadia; Robert, Stéphane; Foucault-Bertaud, Alexandrine; Kaspi, Elise; Sabatier, Florence; Aurrand-Lions, Michel; Bardin, Nathalie; Holmgren, Lars; Dignat-George, Françoise; Blot-Chabaud, Marcel

    2013-01-01

    The melanoma cell adhesion molecule (CD146) contains a circulating proteolytic variant (sCD146), which is involved in inflammation and angiogenesis. Its circulating level is modulated in different pathologies, but its intracellular transduction pathways are still largely unknown. Using peptide pulldown and mass spectrometry, we identified angiomotin as a sCD146-associated protein in endothelial progenitor cells (EPC). Interaction between angiomotin and sCD146 was confirmed by enzyme-linked immunosorbent assay (ELISA), homogeneous time-resolved fluorescence, and binding of sCD146 on both immobilized recombinant angiomotin and angiomotin-transfected cells. Silencing angiomotin in EPC inhibited sCD146 angiogenic effects, i.e. EPC migration, proliferation, and capacity to form capillary-like structures in Matrigel. In addition, sCD146 effects were inhibited by the angiomotin inhibitor angiostatin and competition with recombinant angiomotin. Finally, binding of sCD146 on angiomotin triggered the activation of several transduction pathways that were identified by antibody array. These results delineate a novel signaling pathway where sCD146 binds to angiomotin to stimulate a proangiogenic response. This result is important to find novel target cells of sCD146 and for the development of therapeutic strategies based on EPC in the treatment of ischemic diseases. PMID:23389031

  10. The Broad Institute: Screening for Dependencies in Cancer Cell Lines Using Small Molecules | Office of Cancer Genomics

    Science.gov (United States)

    Using cancer cell-line profiling, we established an ongoing resource to identify, as comprehensively as possible, the drug-targetable dependencies that specific genomic alterations impart on human cancers. We measured the sensitivity of hundreds of genetically characterized cancer cell lines to hundreds of small-molecule probes and drugs that have highly selective interactions with their targets, and that collectively modulate many distinct nodes in cancer cell circuitry.

  11. Role of Extrachromosomal Histone H2B on Recognition of DNA Viruses and Cell Damage.

    Science.gov (United States)

    Kobiyama, Kouji; Kawashima, Akira; Jounai, Nao; Takeshita, Fumihiko; Ishii, Ken J; Ito, Tetsuhide; Suzuki, Koichi

    2013-01-01

    Histones are essential components of chromatin structure, and histone modification plays an important role in various cellular functions including transcription, gene silencing, and immunity. Histones also play distinct roles in extrachromosomal settings. Extrachromosomal histone H2B acts as a cytosolic sensor to detect double-stranded DNA (dsDNA) fragments derived from infectious agents or damaged cells to activate innate and acquired immune responses in various cell types. It also physically interacts with interferon (IFN)-β promoter stimulator 1 (IPS-1), an essential adaptor molecule that activates innate immunity, through COOH-terminal importin 9-related adaptor organizing histone H2B and IPS-1 (CIAO), resulting in a distinct signaling complex that induces dsDNA-induced type I IFN production. Such a molecular platform acts as a cellular sensor to recognize aberrant dsDNA in cases of viral infection and cell damage. This mechanism may also play roles in autoimmunity, transplantation rejection, gene-mediated vaccines, and other therapeutic applications.

  12. A systematic investigation of differential effects of cell culture substrates on the extent of artifacts in single-molecule tracking.

    Directory of Open Access Journals (Sweden)

    Laura C Zanetti-Domingues

    Full Text Available Single-molecule techniques are being increasingly applied to biomedical investigation, notwithstanding the numerous challenges they pose in terms of signal-to-noise ratio issues. Non-specific binding of probes to glass substrates, in particular, can produce experimental artifacts due to spurious molecules on glass, which can be particularly deleterious in live-cell tracking experiments. In order to resolve the issue of non-specific probe binding to substrates, we performed systematic testing of a range of available surface coatings, using three different proteins, and then extended our assessment to the ability of these coatings to foster cell growth and retain non-adhesive properties. Linear PEG, a passivating agent commonly used both in immobilized-molecule single-molecule techniques and in tissue engineering, is able to both successfully repel non-specific adhesion of fluorescent probes and to foster cell growth when functionalized with appropriate adhesive peptides. Linear PEG treatment results in a significant reduction of tracking artifacts in EGFR tracking with Affibody ligands on a cell line expressing EGFR-eGFP. The findings reported herein could be beneficial to a large number of experimental situations where single-molecule or single-particle precision is required.

  13. The Cytolytically Inactive Terminal Complement Complex Activates Endothelial Cells to Express Adhesion Molecules and Tissue Factor Procoagulant Activity

    Science.gov (United States)

    Tedesco, Francesco; Pausa, Mario; Nardon, Ermanno; Introna, Martino; Mantovani, Alberto; Dobrina, Aldo

    1997-01-01

    The membrane attack complex of complement (C) in sublytic concentrations stimulates endothelial cells (EC) to express adhesion molecules and to release biologically active products. We have examined the ability of a cytolytically inactive form of this complex, which is incapable of inserting into the cell membrane, to upregulate the expression of adhesion molecules and of tissue factor (TF) procoagulant activity. The inactive terminal C complex (iTCC) was prepared by mixing C5b6, C7, C8, and C9 and was purified by fast protein liquid chromatography on a Superose 12 column. Binding of this complex to EC was found to be dose dependent and was inhibited by anti-C9 antibodies, as assessed both by ELISA using an mAb anti-C9 neoantigen and by measuring cell-bound 125I-labeled iTCC. Exposure of EC to iTCC resulted in a dose- and time-dependent expression of endothelial leukocyte adhesion molecule 1, intercellular adhesion molecule 1, and vascular cell adhesion molecule 1 accompanied by increased levels of the corresponding mRNA, but not in the rapid expression of P-selectin. Inactive TCC also induced increased TF activity evaluated by a chromogenic assay that measures the formation of factor Xa. These effects were inhibited by anti-C9 antibodies. The data support the conclusion that iTCC may induce proinflammatory and procoagulant activities on EC. PMID:9151899

  14. Efficient small-molecule organic solar cells incorporating a doped buffer layer

    Energy Technology Data Exchange (ETDEWEB)

    Chou, Dei-Wei [Department of aviation and Communication Electronics, Air Force Institute of Technology, Kaohsiung 820, Taiwan (China); Chen, Kan-Lin [Department of Electronic Engineering, Fortune Institute of Technology, Kaohsiung 831, Taiwan (China); Huang, Chien-Jung, E-mail: chien@nuk.edu.tw [Department of Applied Physics, National University of Kaohsiung, Nanzih, Kaohsiung 811, Taiwan (China); Tsao, Yao-Jen [Department of Applied Physics, National University of Kaohsiung, Nanzih, Kaohsiung 811, Taiwan (China); Chen, Wen-Ray; Meen, Teen-Hang [Department of Electronic Engineering, National Formosa University, Hu-Wei, Yunlin 632, Taiwan (China)

    2013-06-01

    Small-molecule organic solar cells (OSCs) with an optimized structure of indium tin oxide/poly (3,4-ethylenedioxythioxythiophene):poly(styrenesulfonate)/copper phthalocyanine (CuPc) (10 nm)/CuPc: fullerene (C{sub 60}) mixed (20 nm)/C{sub 60} (20 nm)/4,7-diphenyl-1,10-phenanthroline (BPhen) (5 nm)/Ag were fabricated. In this study, the cesium carbonate-doped BPhen (Cs{sub 2}CO{sub 3}:BPhen) was adopted as the buffer layer to enhance the efficiency of the OSCs. The photovoltaic parameters of the OSCs, such as the short-circuit current density and fill factor, depend on the doping concentration of Cs{sub 2}CO{sub 3} in the BPhen layer. The cell with a Cs{sub 2}CO{sub 3}:BPhen (1:4) cathode buffer layer exhibits a power conversion efficiency (PCE) of 3.51%, compared to 3.37% for the device with the pristine BPhen layer. The enhancement of PCE was attributed to the energy-level alignment between the C{sub 60} layer and the Cs{sub 2}CO{sub 3}:BPhen layer. In addition, the characterization measured using atomic force microscopy shows that the Cs{sub 2}CO{sub 3}:BPhen layers have smoother surfaces. - Highlight: • Cs2CO3-doped 4,7-diphenyl-1,10-phenanthroline (BPhen) cathode buffer layer. • Cs2CO3:BPhen layer with different ratios affects organic solar cells performance. • Cell with 1:4 (Cs2CO3:BPhen) ratio shows 3.51% power conversion efficiency.

  15. Synaptic Cell Adhesion

    OpenAIRE

    Missler, Markus; Südhof, Thomas C.; Biederer, Thomas

    2012-01-01

    Chemical synapses are asymmetric intercellular junctions that mediate synaptic transmission. Synaptic junctions are organized by trans-synaptic cell adhesion molecules bridging the synaptic cleft. Synaptic cell adhesion molecules not only connect pre- and postsynaptic compartments, but also mediate trans-synaptic recognition and signaling processes that are essential for the establishment, specification, and plasticity of synapses. A growing number of synaptic cell adhesion molecules that inc...

  16. T cell receptor-like recognition of tumor in vivo by synthetic antibody fragment.

    Directory of Open Access Journals (Sweden)

    Keith R Miller

    Full Text Available A major difficulty in treating cancer is the inability to differentiate between normal and tumor cells. The immune system differentiates tumor from normal cells by T cell receptor (TCR binding of tumor-associated peptides bound to Major Histocompatibility Complex (pMHC molecules. The peptides, derived from the tumor-specific proteins, are presented by MHC proteins, which then serve as cancer markers. The TCR is a difficult protein to use as a recombinant protein because of production issues and has poor affinity for pMHC; therefore, it is not a good choice for use as a tumor identifier outside of the immune system. We constructed a synthetic antibody-fragment (Fab library in the phage-display format and isolated antibody-fragments that bind pMHC with high affinity and specificity. One Fab, fE75, recognizes our model cancer marker, the Human Epidermal growth factor Receptor 2 (HER2/neu peptide, E75, bound to the MHC called Human Leukocyte Antigen-A2 (HLA-A2, with nanomolar affinity. The fE75 bound selectively to E75/HLA-A2 positive cancer cell lines in vitro. The fE75 Fab conjugated with (64Cu selectively accumulated in E75/HLA-A2 positive tumors and not in E75/HLA-A2 negative tumors in an HLA-A2 transgenic mouse as probed using positron emission tomography/computed tomography (PET/CT imaging. Considering that hundreds to thousands of different peptides bound to HLA-A2 are present on the surface of each cell, the fact that fE75 arrives at the tumor at all shows extraordinary specificity. These antibody fragments have great potential for diagnosis and targeted drug delivery in cancer.

  17. Imaging Live Cells at the Nanometer-Scale with Single-Molecule Microscopy: Obstacles and Achievements in Experiment Optimization for Microbiology

    Science.gov (United States)

    Haas, Beth L.; Matson, Jyl S.; DiRita, Victor J.; Biteen, Julie S.

    2015-01-01

    Single-molecule fluorescence microscopy enables biological investigations inside living cells to achieve millisecond- and nanometer-scale resolution. Although single-molecule-based methods are becoming increasingly accessible to non-experts, optimizing new single-molecule experiments can be challenging, in particular when super-resolution imaging and tracking are applied to live cells. In this review, we summarize common obstacles to live-cell single-molecule microscopy and describe the methods we have developed and applied to overcome these challenges in live bacteria. We examine the choice of fluorophore and labeling scheme, approaches to achieving single-molecule levels of fluorescence, considerations for maintaining cell viability, and strategies for detecting single-molecule signals in the presence of noise and sample drift. We also discuss methods for analyzing single-molecule trajectories and the challenges presented by the finite size of a bacterial cell and the curvature of the bacterial membrane. PMID:25123183

  18. Desmosomal Molecules In and Out of Adhering Junctions: Normal and Diseased States of Epidermal, Cardiac and Mesenchymally Derived Cells

    Directory of Open Access Journals (Sweden)

    Sebastian Pieperhoff

    2010-01-01

    Full Text Available Current cell biology textbooks mention only two kinds of cell-to-cell adhering junctions coated with the cytoplasmic plaques: the desmosomes (maculae adhaerentes, anchoring intermediate-sized filaments (IFs, and the actin microfilament-anchoring adherens junctions (AJs, including both punctate (puncta adhaerentia and elongate (fasciae adhaerentes structures. In addition, however, a series of other junction types has been identified and characterized which contain desmosomal molecules but do not fit the definition of desmosomes. Of these special cell-cell junctions containing desmosomal glycoproteins or proteins we review the composite junctions (areae compositae connecting the cardiomyocytes of mature mammalian hearts and their importance in relation to human arrhythmogenic cardiomyopathies. We also emphasize the various plakophilin-2-positive plaques in AJs (coniunctiones adhaerentes connecting proliferatively active mesenchymally-derived cells, including interstitial cells of the heart and several soft tissue tumor cell types. Moreover, desmoplakin has also been recognized as a constituent of the plaques of the complexus adhaerentes connecting certain lymphatic endothelial cells. Finally, we emphasize the occurrence of the desmosomal transmembrane glycoprotein, desmoglein Dsg2, out of the context of any junction as dispersed cell surface molecules in certain types of melanoma cells and melanocytes. This broadening of our knowledge on the diversity of AJ structures indicates that it may still be too premature to close the textbook chapters on cell-cell junctions.

  19. A Novel Small-molecule WNT Inhibitor, IC-2, Has the Potential to Suppress Liver Cancer Stem Cells.

    Science.gov (United States)

    Seto, Kenzo; Sakabe, Tomohiko; Itaba, Noriko; Azumi, Junya; Oka, Hiroyuki; Morimoto, Minoru; Umekita, Yoshihisa; Shiota, Goshi

    2017-07-01

    The presence of cancer stem cells (CSCs) contributes to metastasis, recurrence, and resistance to chemo/radiotherapy in hepatocellular carcinoma (HCC). The WNT signaling pathway is reportedly linked to the maintenance of stemness of CSCs. In the present study, in order to eliminate liver CSCs and improve the prognosis of patients with HCC, we explored whether small-molecule compounds targeting WNT signaling pathway suppress liver CSCs. The screening was performed using cell proliferation assay and reporter assay. We next investigated whether these compounds suppress liver CSC properties by using flow cytometric analysis and sphere-formation assays. A mouse xenograft model transplanted with CD44-positive HuH7 cells was used to examine the in vivo antitumor effect of IC-2. In HuH7 human HCC cells, 10 small-molecule compounds including novel derivatives, IC-2 and PN-3-13, suppressed cell viability and WNT signaling activity. Among them, IC-2 significantly reduced the CD44-positive population, also known as liver CSCs, and dramatically reduced the sphere-forming ability of both CD44-positive and CD44-negative HuH7 cells. Moreover, CSC marker-positive populations, namely CD90-positive HLF cells, CD133-positive HepG2 cells, and epithelial cell adhesion molecule-positive cells, were also reduced by IC-2 treatment. Finally, suppressive effects of IC-2 on liver CSCs were also observed in a xenograft model using CD44-positive HuH7 cells. The novel derivative of small-molecule WNT inhibitor, IC-2, has the potential to suppress liver CSCs and can serve as a promising therapeutic agent to improve the prognosis of patients with HCC. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  20. Live-Cell Visualization of Pre-mRNA Splicing with Single-Molecule Sensitivity

    Directory of Open Access Journals (Sweden)

    Robert M. Martin

    2013-09-01

    Full Text Available Removal of introns from pre-messenger RNAs (pre-mRNAs via splicing provides a versatile means of genetic regulation that is often disrupted in human diseases. To decipher how splicing occurs in real time, we directly examined with single-molecule sensitivity the kinetics of intron excision from pre-mRNA in the nucleus of living human cells. By using two different RNA labeling methods, MS2 and λN, we show that β-globin introns are transcribed and excised in 20–30 s. Furthermore, we show that replacing the weak polypyrimidine (Py tract in mouse immunoglobulin μ (IgM pre-mRNA by a U-rich Py decreases the intron lifetime, thus providing direct evidence that splice-site strength influences splicing kinetics. We also found that RNA polymerase II transcribes at elongation rates ranging between 3 and 6 kb min−1 and that transcription can be rate limiting for splicing. These results have important implications for a mechanistic understanding of cotranscriptional splicing regulation in the live-cell context.

  1. In situ synthesis of graphene molecules on TiO2: application in sensitized solar cells.

    Science.gov (United States)

    Ji, Zhiqiang; Wu, Ruilian; Adamska, Lyudmyla; Velizhanin, Kirill A; Doorn, Stephen K; Sykora, Milan

    2014-11-26

    We present a method for preparation of graphene molecules (GMs), whereby a polyphenylene precursor functionalized with surface anchoring groups, preadsorbed on surface of TiO2, is oxidatively dehydrogenated in situ via a Scholl reaction. The reaction, performed at ambient conditions, yields surface adsorbed GMs structurally and electronically equivalent to those synthesized in solution. The new synthetic approach reduces the challenges associated with the tendency of GMs to aggregate and provides a convenient path for integration of GMs into optoelectronic applications. The surface synthesized GMs can be effectively reduced or oxidized via an interfacial charge transfer and can also function as sensitizers for metal oxides in light harvesting applications. Sensitized solar cells (SSCs) prepared from mesoscopic TiO2/GM films and an iodide-based liquid electrolyte show photocurrents of ∼2.5 mA/cm2, an open circuit voltage of ∼0.55 V and fill factor of ∼0.65 under AM 1.5 illumination. The observed power conversion efficiency of η=0.87% is the highest reported efficiency for the GM sensitized solar cell. The performance of the devices was reproducible and stable for a period of at least 3 weeks. We also report first external and internal quantum efficiency measurements for GM SSCs, which point to possible paths for further performance improvements.

  2. Can neurodegenerative disease be defined by four 'primary determinants': anatomy, cells, molecules, and morphology?

    Science.gov (United States)

    Armstrong, R A

    2016-01-01

    Traditional methods of describing and classifying neurodegenerative disease are based on the clinico-pathological concept supported by molecular pathological studies and defined by 'consensus criteria'. Disease heterogeneity, overlap between disorders, and the presence of multiple co-pathologies, however, have questioned the validity and status of many traditional disorders. If cases of neurodegenerative disease are not easily classifiable into distinct entities, but more continuously distributed, then a new descriptive framework may be required. This review proposes that there are four key neuropathological features of neurodegenerative disease (the 'primary determinants') that could be used to provide such a framework, viz., the anatomical pathways affected by the disease ('anatomy'), the cell populations affected ('cells'), the molecular pathology of 'signature' pathological lesions ('molecules'), and the morphological types of neurodegeneration ('morphology'). This review first discusses the limitations of existing classificatory systems and second provides evidence that the four primary determinants could be used as axes to define all cases of neurodegenerative disease. To illustrate the methodology, the primary determinants were applied to the study of a group of closely related tauopathy cases and to heterogeneity within frontotemporal lobar degeneration with TDP-43 proteinopathy (FTLD-TDP).

  3. HER2/HER3 signaling regulates NK cell-mediated cytotoxicity via MHC class I chain-related molecule A and B expression in human breast cancer cell lines.

    Science.gov (United States)

    Okita, Riki; Mougiakakos, Dimitrios; Ando, Takashi; Mao, Yumeng; Sarhan, Dhifaf; Wennerberg, Erik; Seliger, Barbara; Lundqvist, Andreas; Mimura, Kousaku; Kiessling, Rolf

    2012-03-01

    Overexpression of the receptor tyrosine kinases HER2 and HER3 is associated with a poor prognosis in several types of cancer. Presently, HER2- as well as HER3-targeted therapies are in clinical practice or evaluated within clinical trials, including treatment with mAbs mediating growth inhibition and/or activation of Ab-induced innate or adaptive cellular immunity. A better understanding of how HER2/HER3 signaling in tumors influences cellular immune mechanisms is therefore warranted. In this study, we demonstrate that HER2/HER3 signaling regulates the expression of MHC class I-related chain A and B (MICA and MICB) in breast cancer cell lines. The MICA and MICB (MICA/B) molecules act as key ligands for the activating receptor NK group 2, member D (NKG2D) and promote NK cell-mediated recognition and cytolysis. Genetic silencing of HER3 but not HER2 downregulated the expression of MICA/B, and HER3 overexpression significantly enhanced MICA expression. Among the major pathways activated by HER2/HER3 signaling, the PI3K/AKT pathway was shown to predominantly regulate MICA/B expression. Treatment with the HER3-specific ligand neuregulin 1β promoted the expression in a process that was antagonized by pharmacological and genetic interference with HER3 but not by the ataxia-telangiectasia-mutated (ATM) and ATM and Rad3-related protein kinases inhibitor caffeine. These observations further emphasize that HER2/HER3 signaling directly, and not via genotoxic stress, regulates MICA/B expression. As anticipated, stimulating HER2/HER3 enhanced the NKG2D-MICA/B-dependent NK cell-mediated cytotoxicity. Taken together, we conclude that signaling via the HER2/HER3 pathway in breast carcinoma cell lines may lead to enhanced NKG2D-MICA/B recognition by NK cells and T cells.

  4. Porcine blood mononuclear cell cytokine responses to PAMP molecules: comparison of mRNA and protein production

    DEFF Research Database (Denmark)

    Sørensen, Nanna Skall; Skovgaard, Kerstin; Heegaard, Peter M. H.

    2011-01-01

    Pathogen-associated molecular patterns (PAMPs) are conserved molecules of microorganisms inducing innate immune cells to secrete distinct patterns of cytokines. In veterinary species, due to a lack of specific antibodies, cytokines are often monitored as expressed mRNA only. This study investigated...... the induction of IFN-α, IL-12 p40, IL-1β, TNF-α, IL-6 and IL-10 by PAMP-molecules [CpG oligonucleotide D19 (CpG), peptidoglycan (PGN), lipopolysaccharide (LPS), Pam3Cys and poly-U] in porcine blood mononuclear cells (BMC) within a 24h period. As expected, cytokine responses were PAMP-specific, CpG inducing IFN...

  5. Clinical significance of circulating vascular cell adhesion molecule-1 to white matter disintegrity in Alzheimer's dementia.

    Science.gov (United States)

    Huang, Chi-Wei; Tsai, Meng-Han; Chen, Nai-Ching; Chen, Wei-Hsi; Lu, Yan-Ting; Lui, Chun-Chung; Chang, Ya-Ting; Chang, Wen-Neng; Chang, Alice Y W; Chang, Chiung-Chih

    2015-11-25

    Endothelial dysfunction leads to worse cognitive performance in Alzheimer's dementia (AD). While both cerebrovascular risk factors and endothelial dysfunction lead to activation of vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1) and E-selectin, it is not known whether these biomarkers extend the diagnostic repertoire in reflecting intracerebral structural damage or cognitive performance. A total of 110 AD patients and 50 age-matched controls were enrolled. Plasma levels of VCAM-1, ICAM-1 and E-selectin were measured and correlated with the cognitive performance, white matter macro-structural changes, and major tract-specific fractional anisotropy quantification. The AD patients were further stratified by clinical dementia rating score (mild dementia, n=60; moderate-to-severe dementia, n=50). Compared with the controls, plasma levels of VCAM-1 (p< 0.001), ICAM-1 (p=0.028) and E-selectin (p=0.016) were significantly higher in the patients, but only VCAM-1 levels significantly reflected the severity of dementia (p< 0.001). In addition, only VCAM-1 levels showed an association with macro- and micro- white matter changes especially in the superior longitudinal fasciculus (p< 0.001), posterior thalamic radiation (p=0.002), stria terminalis (p=0.002) and corpus callosum (p=0.009), and were independent of, age and cortical volume. These tracts show significant association with MMSE, short term memory and visuospatial function. Meanwhile, while VCAM-1 level correlated significantly with short-term memory (p=0.026) and drawing (p=0.025) scores in the AD patients after adjusting for age and education, the significance disappeared after adjusting for global FA. Endothelial activation, especially VCAM-1, was of clinical significance in AD that reflects macro- and micro-structural changes and poor short term memory and visuospatial function.

  6. Differential expression pattern of co-inhibitory molecules on CD4+T cells in uncomplicated versus complicated malaria.

    Science.gov (United States)

    Abel, Annemieke; Steeg, Christiane; Aminkiah, Francis; Addai-Mensah, Otchere; Addo, Marylyn; Gagliani, Nicola; Casar, Christian; Yar, Denis Dekugmen; Owusu-Dabo, Ellis; Jacobs, Thomas; Mackroth, Maria Sophia

    2018-03-19

    The immune response of malaria patients is a main factor influencing the clinical severity of malaria. A tight regulation of the CD4 + T cell response or the induction of tolerance have been proposed to contribute to protection from severe or clinical disease. We therefore compared the CD4 + T cell phenotypes of Ghanaian children with complicated malaria, uncomplicated malaria, asymptomatic Plasmodium falciparum (Pf) infection or no infection. Using flow cytometric analysis and automated multivariate clustering, we characterized the expression of the co-inhibitory molecules CTLA-4, PD-1, Tim-3, and LAG-3 and other molecules implicated in regulatory function on CD4 + T cells. Children with complicated malaria had higher frequencies of CTLA-4 + or PD-1 + CD4 + T cells than children with uncomplicated malaria. Conversely, children with uncomplicated malaria showed a higher proportion of CD4 + T cells expressing CD39 and Granzyme B, compared to children with complicated malaria. In contrast, asymptomatically infected children expressed only low levels of co-inhibitory molecules. Thus, different CD4 + T cell phenotypes are associated with complicated versus uncomplicated malaria, suggesting a two-sided role of CD4 + T cells in malaria pathogenesis and protection. Deciphering the signals that shape the CD4 + T cell phenotype in malaria will be important for new treatment and immunization strategies.

  7. Taking one for the team: self-recognition and cell suicide in pollen.

    Science.gov (United States)

    Wilkins, Katie A; Poulter, Natalie S; Franklin-Tong, Vernonica E

    2014-03-01

    Self-incompatibility (SI) is an important genetically controlled mechanism used by many angiosperms to prevent self-fertilization and inbreeding. A multiallelic S-locus allows discrimination between 'self' (incompatible) pollen from 'nonself' pollen at the pistil. Interaction of matching pollen and pistil S-determinants allows 'self' recognition and triggers rejection of incompatible pollen. The S-determinants for Papaver rhoeas (poppy) are PrsS and PrpS. PrsS is a small secreted protein that acts as a signalling ligand to interact with its cognate pollen S-determinant PrpS, a small novel transmembrane protein. Interaction of PrsS with incompatible pollen stimulates increases in cytosolic free Ca(2+) and involves influx of Ca(2+) and K(+). Data implicate involvement of reactive oxygen species and nitric oxide signalling in the SI response. Downstream targets include the cytoskeleton, a soluble inorganic pyrophosphatase, Pr-p26.1, and a MAP kinase, PrMPK9-1. A major focus for SI-induced signalling is to initiate programmed cell death (PCD). In this review we provide an overview of our understanding of SI, with focus on how the signals and components are integrated, in particular, how reactive oxygen species, nitric oxide, and the actin cytoskeleton feed into a PCD network. We also discuss our recent functional expression of PrpS in Arabidopsis thaliana pollen in the context of understanding how PCD signalling systems may have evolved.

  8. Overexpression of Polysialylated Neural Cell Adhesion Molecule Improves the Migration Capacity of Induced Pluripotent Stem Cell-Derived Oligodendrocyte Precursors

    Science.gov (United States)

    Czepiel, Marcin; Leicher, Lasse; Becker, Katja; Boddeke, Erik

    2014-01-01

    Cell replacement therapy aiming at the compensation of lost oligodendrocytes and restoration of myelination in acquired or congenital demyelination disorders has gained considerable interest since the discovery of induced pluripotent stem cells (iPSCs). Patient-derived iPSCs provide an inexhaustible source for transplantable autologous oligodendrocyte precursors (OPCs). The first transplantation studies in animal models for demyelination with iPSC-derived OPCs demonstrated their survival and remyelinating capacity, but also revealed their limited migration capacity. In the present study, we induced overexpression of the polysialylating enzyme sialyltransferase X (STX) in iPSC-derived OPCs to stimulate the production of polysialic acid-neuronal cell adhesion molecules (PSA-NCAMs), known to promote and facilitate the migration of OPCs. The STX-overexpressing iPSC-derived OPCs showed a normal differentiation and maturation pattern and were able to downregulate PSA-NCAMs when they became myelin-forming oligodendrocytes. After implantation in the demyelinated corpus callosum of cuprizone-fed mice, STX-expressing iPSC-derived OPCs demonstrated a significant increase in migration along the axons. Our findings suggest that the reach and efficacy of iPSC-derived OPC transplantation can be improved by stimulating the OPC migration potential via specific gene modulation. PMID:25069776

  9. Cell factory-derived bioactive molecules with polymeric cryogel scaffold enhance the repair of subchondral cartilage defect in rabbits.

    Science.gov (United States)

    Gupta, Ankur; Bhat, Sumrita; Chaudhari, Bhushan P; Gupta, Kailash C; Tägil, Magnus; Zheng, Ming Hao; Kumar, Ashok; Lidgren, Lars

    2017-06-01

    We have explored the potential of cell factory-derived bioactive molecules, isolated from conditioned media of primary goat chondrocytes, for the repair of subchondral cartilage defects. Enzyme-linked immunosorbent assay (ELISA) confirms the presence of transforming growth factor-β1 in an isolated protein fraction (12.56 ± 1.15 ng/mg protein fraction). These bioactive molecules were used alone or with chitosan-agarose-gelatin cryogel scaffolds, with and without chondrocytes, to check whether combined approaches further enhance cartilage repair. To evaluate this, an in vivo study was conducted on New Zealand rabbits in which a subchondral defect (4.5 mm wide × 4.5 mm deep) was surgically created. Starting after the operation, bioactive molecules were injected at the defect site at regular intervals of 14 days. Histopathological analysis showed that rabbits treated with bioactive molecules alone had cartilage regeneration after 4 weeks. However, rabbits treated with bioactive molecules along with scaffolds, with or without cells, showed cartilage formation after 3 weeks; 6 weeks after surgery, the cartilage regenerated in rabbits treated with either bioactive molecules alone or in combinations showed morphological similarities to native cartilage. No systemic cytotoxicity or inflammatory response was induced by any of the treatments. Further, ELISA was done to determine systemic toxicity, which showed no difference in concentration of tumour necrosis factor-α in blood serum, before or after surgery. In conclusion, intra-articular injection with bioactive molecules alone may be used for the repair of subchondral cartilage defects, and bioactive molecules along with chondrocyte-seeded scaffolds further enhance the repair. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  10. Low-Dose Formaldehyde Delays DNA Damage Recognition and DNA Excision Repair in Human Cells

    Science.gov (United States)

    Luch, Andreas; Frey, Flurina C. Clement; Meier, Regula; Fei, Jia; Naegeli, Hanspeter

    2014-01-01

    Objective Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. Methodology/Principal Findings The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding) and XPC (xeroderma pigmentosum group C) was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. Conclusions/Significance A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks. PMID:24722772

  11. Ligand binding and signaling of dendritic cell immunoreceptor (DCIR is modulated by the glycosylation of the carbohydrate recognition domain.

    Directory of Open Access Journals (Sweden)

    Karien Bloem

    Full Text Available C-type lectins are innate receptors expressed on antigen-presenting cells that are involved in the recognition of glycosylated pathogens and self-glycoproteins. Upon ligand binding, internalization and/or signaling often occur. Little is known on the glycan specificity and ligands of the Dendritic Cell Immunoreceptor (DCIR, the only classical C-type lectin that contains an intracellular immunoreceptor tyrosine-based inhibitory motif (ITIM. Here we show that purified DCIR binds the glycan structures Lewis(b and Man3. Interestingly, binding could not be detected when DCIR was expressed on cells. Since DCIR has an N-glycosylation site inside its carbohydrate recognition domain (CRD, we investigated the effect of this glycan in ligand recognition. Removing or truncating the glycans present on purified DCIR increased the affinity for DCIR-binding glycans. Nevertheless, altering the glycosylation status of the DCIR expressing cell or mutating the N-glycosylation site of DCIR itself did not increase glycan binding. In contrast, cis and trans interactions with glycans induced DCIR mediated signaling, resulting in a decreased phosphorylation of the ITIM sequence. These results show that glycan binding to DCIR is influenced by the glycosylation of the CRD region in DCIR and that interaction with its ligands result in signaling via its ITIM motif.

  12. [Adhesion molecules and mononuclear cell subpopulations in the coronary and pulmonary arteries of patients with coronary heart disease].

    Science.gov (United States)

    Chumachenko, P V; Ivanova, A G; Belokon, E V; Akchurin, R S

    2015-01-01

    Atherosclerosis is a multifactor disease, in which dysfunction of the endothelium leads to the emergence of its adhesion molecules. to investigate the expression of the endothelial adhesion molecules PECAM (CD31), ICAM, and VCAM, as well as adherent endothelial T cells and monocytes. The material examined was en face pulmonary and coronary artery samples taken during autopsies (10 men), and en face specimens obtained from the coronary artery fragments taken from coronary heart disease patients during endarterectomy (37 men). This investigation used antibodies to the adhesion molecules ICAM-1, VCAM-1, and PECAM and those to CD3, CD4, CD8 T-cells and CD68 monocytes. The endothelial cells in the atherosclerotically intact coronary arteries had an elongated shape and were aligned along the blood flow. Those located above atheromas and fibroatheromas changed their shape from elongated to polygonal. Above the fatty streaks and atheromas, the reaction with antibodies to CD31 antigens became weaker at the edge of endothelial cells and disappeared in places. While the atherosclerotic process progressed, the reaction with the CD31 antigen at the edge of endothelial cells was similar in intensity to that on the surface of the endothelium. Adhesion of T cells and monocytes to the endothelium of coronary arteries increased as the atherosclerotic vascular process progressed. T cells and monocytes more often adhered to the endothelium at the sites where the endothelial cells contacted each other. Heterogeneity was found in the endothelial cells: their shape, the expression of adhesion molecules, and the adhesion of lymphocytes and monocytes to them changed during the progression of the atherosclerotic process.

  13. In vitro and in situ intercellular adhesion molecule-1 (ICAM-1) expression by endothelial cells lining a polyester fabric.

    Science.gov (United States)

    Rémy, M; Valli, N; Brethes, D; Labrugère, C; Porté-Durrieu, M C; Dobrova, N B; Novikova, S P; Gorodkov, A J; Bordenave, L

    1999-02-01

    In order to improve long-term patency of vascular grafts, the promising concept of endothelial cell seeding is actually under investigation. Our laboratory tested a polyester coated with albumin and chitosan which permits a rapid colonization by human umbilical vein endothelial cells (HUVEC) and it seems relevant to test in vitro the expression of adhesive molecules expressed by cells with regard to the inflammatory process. We studied intercellular adhesion molecule-1 (ICAM-1) expression and focused our work on the determination of ICAM-1 sites expressed per adherent cell lining the biomaterial, thus in situ, in comparison to control HUVEC on plastic wells: the results obtained by binding experiments were correlated to flow cytometry analyses and showed that the polyester does not induce a proinflammatory state and that HUVEC covering the structure are able to respond to a stimulus.

  14. The Neural Cell Adhesion Molecule-Derived Peptide FGL Facilitates Long-Term Plasticity in the Dentate Gyrus in Vivo

    Science.gov (United States)

    Dallerac, Glenn; Zerwas, Meike; Novikova, Tatiana; Callu, Delphine; Leblanc-Veyrac, Pascale; Bock, Elisabeth; Berezin, Vladimir; Rampon, Claire; Doyere, Valerie

    2011-01-01

    The neural cell adhesion molecule (NCAM) is known to play a role in developmental and structural processes but also in synaptic plasticity and memory of the adult animal. Recently, FGL, a NCAM mimetic peptide that binds to the Fibroblast Growth Factor Receptor 1 (FGFR-1), has been shown to have a beneficial impact on normal memory functioning, as…

  15. Improved Efficiency in Inverted Perovskite Solar Cells Employing a Novel Diarylamino-Substituted Molecule as PEDOT:PSS Replacement

    KAUST Repository

    El Labban, Abdulrahman

    2016-03-15

    An approach to fabricate high-efficiency inverted planar perovskites solar cells using solution-processed organic small molecules hole transporting layer is reported. Devices using CH3NH3PbI3 as photoactive layer and PC60BM as electron transport layer show power conversion efficiencies exceeding 12% and open-circuit voltages (VOC) higher than 1 V.

  16. New tools to study biophysical properties of single molecules and single cells

    Directory of Open Access Journals (Sweden)

    Márcio S. Rocha

    2007-03-01

    Full Text Available We present a review on two new tools to study biophysical properties of single molecules and single cells. A laser incident through a high numerical aperture microscope objective can trap small dielectric particles near the focus. This arrangement is named optical tweezers. This technique has the advantage to permit manipulation of a single individual object. We use optical tweezers to measure the entropic elasticity of a single DNA molecule and its interaction with the drug Psoralen. Optical tweezers are also used to hold a kidney cell MDCK away from the substrate to allow precise volume measurements of this single cell during an osmotic shock. This procedure allows us to obtain information about membrane water permeability and regulatory volume increase. Defocusing microscopy is a recent technique invented in our laboratory, which allows the observation of transparent objects, by simply defocusing the microscope in a controlled way. Our physical model of a defocused microscope shows that the image contrast observed in this case is proportional to the defocus distance and to the curvature of the transparent object. Defocusing microscopy is very useful to study motility and mechanical properties of cells. We show here the application of defocusing microscopy to measurements of macrophage surface fluctuations and their influence on phagocytosis.Apresentamos uma revisão de duas novas técnicas para estudar propriedades biofísicas de moléculas únicas e células únicas. Um laser incidindo em uma objetiva de microscópio de grande abertura numérica é capaz de aprisionar pequenas partículas dielétricas na região próxima ao foco. Este aparato é chamado de pinça óptica. Esta técnica tem a grande vantagem de permitir a manipulação de um objeto individual. Usamos a pinça óptica para medir a elasticidade entrópica de uma molécula única de DNA em sua interação com o fármaco Psoralen. A pinça óptica também é usada para segurar

  17. The neural cell adhesion molecule L1 is distinct from the N-CAM related group of surface antigens BSP-2 and D2

    DEFF Research Database (Denmark)

    Faissner, A; Kruse, J; Goridis, C

    1984-01-01

    The neural cell adhesion molecule L1 and the group of N-CAM related molecules, BSP-2 and D2 antigen, are immunochemically distinct molecular species. The two groups of surface molecules are also functionally distinct entities, since inhibition of Ca2+-independent adhesion among early post-natal m...

  18. Functionalized organic semiconductor molecules to enhance charge carrier injection in electroluminescent cell

    Science.gov (United States)

    Yalcin, Eyyup; Kara, Duygu Akin; Karakaya, Caner; Yigit, Mesude Zeliha; Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Demic, Serafettin; Kus, Mahmut; Aboulouard, Abdelkhalk

    2017-07-01

    Organic semiconductor (OSC) materials as a charge carrier interface play an important role to improve the device performance of organic electroluminescent cells. In this study, 4,4″-bis(diphenyl amino)-1,1':3‧,1″-terphenyl-5'-carboxylic acid (TPA) and 4,4″-di-9H-carbazol-9-yl-1,1':3‧,1″-terphenyl-5'-carboxylic acid (CAR) has been designed and synthesized to modify indium tin oxide (ITO) layer as interface. Bare ITO and PEDOT:PSS coated on ITO was used as reference anode electrodes for comparison. Furthermore, PEDOT:PSS coated over CAR/ITO and TPA/ITO to observe stability of OSC molecules and to completely cover the ITO surface. Electrical, optical and surface characterizations were performed for each device. Almost all modified devices showed around 36% decrease at the turn on voltage with respect to bare ITO. The current density of bare ITO, ITO/CAR and ITO/TPA were measured as 288, 1525 and 1869 A/m2, respectively. By increasing current density, luminance of modified devices showed much better performance with respect to unmodified devices.

  19. Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

    International Nuclear Information System (INIS)

    Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil

    2007-01-01

    Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent

  20. Down syndrome cell adhesion molecule 1: testing for a role in insect immunity, behaviour and reproduction.

    Science.gov (United States)

    Peuß, Robert; Wensing, Kristina U; Woestmann, Luisa; Eggert, Hendrik; Milutinović, Barbara; Sroka, Marlene G U; Scharsack, Jörn P; Kurtz, Joachim; Armitage, Sophie A O

    2016-04-01

    Down syndrome cell adhesion molecule 1 (Dscam1) has wide-reaching and vital neuronal functions although the role it plays in insect and crustacean immunity is less well understood. In this study, we combine different approaches to understand the roles that Dscam1 plays in fitness-related contexts in two model insect species. Contrary to our expectations, we found no short-term modulation of Dscam1 gene expression after haemocoelic or oral bacterial exposure in Tribolium castaneum, or after haemocoelic bacterial exposure in Drosophila melanogaster. Furthermore, RNAi-mediated Dscam1 knockdown and subsequent bacterial exposure did not reduce T. castaneum survival. However, Dscam1 knockdown in larvae resulted in adult locomotion defects, as well as dramatically reduced fecundity in males and females. We suggest that Dscam1 does not always play a straightforward role in immunity, but strongly influences behaviour and fecundity. This study takes a step towards understanding more about the role of this intriguing gene from different phenotypic perspectives.

  1. CHLORHEXIDINE INHIBITS L1 CELL ADHESION MOLECULE MEDIATED NEURITE OUTGROWTH IN VITRO

    Science.gov (United States)

    Milstone, Aaron M.; Bamford, Penny; Aucott, Susan W.; Tang, Ningfeng; White, Kimberly R.; Bearer, Cynthia F.

    2013-01-01

    Background Chlorhexidine is a skin disinfectant that reduces skin and mucous membrane bacterial colonization and inhibits organism growth. Despite numerous studies assessing chlorhexidine safety in term infants, residual concerns have limited its use in hospitalized neonates, especially low birth weight preterm infants. The aim of this study was to assess the potential neurotoxicity of chlorhexidine on the developing central nervous system using a well-established in vitro model of neurite outgrowth that includes laminin and L1 cell adhesion molecule (L1) as neurite outgrowth promoting substrates. Methods Cerebellar granule neurons are plated on either poly L-lysine, L1 or laminin. Chlorhexidine, hexachlorophene or their excipients are added to the media. Neurons are grown for 24 h, then fixed and neurite length measured. Results Chlorhexidine significantly reduced the length of neurites grown on L1 but not laminin. Chlorhexidine concentrations as low as 125 ng/ml statistically significantly reduced neurite length on L1. Hexachlorophene did not affect neurite length. Conclusion Chlorhexidine at concentrations detected in the blood following topical applications in preterm infants specifically inhibited L1 mediated neurite outgrowth of cerebellar granule neurons. It is now vital to determine whether the blood brain barrier is permeable to chlorhexidine in preterm infants. PMID:24126818

  2. Evaluation of Activated Leukocyte Cell Adhesion Molecule as a Biomarker for Breast Cancer in Egyptian Patients

    International Nuclear Information System (INIS)

    El-Shepiny, M.S.E.M.

    2013-01-01

    In this study, serum activated leukocyte cell adhesion molecule (ALCAM) levels were evaluated in 41 primary breast cancer patients and 20 healthy females, and its diagnostic value was quantified, and compared with those of carbohydrate antigen 15-3 (CA15-3) and carcinoembryonic antigen (CEA). Also, its prognostic value was examined. Serum ALCAM levels were also evaluated before and after surgical treatment. Serum levels of ALCAM and CA 15-3 were significantly higher in breast cancer patients than healthy controls (P=0.002, P=0.043 respectively), but the difference in serum CEA levels did not reach statistical significance. Serum ALCAM levels had significant area under the curve (AUC) (P=0.002), but serum levels of CA 15-3 and CEA had nonsignificant AUCs, and various combinations between them did not result in any improvement. A significant association was found between serum levels of ALCAM and CEA with age and menopausal status in breast cancer patients. Non-significant difference was shown in serum levels of ALCAM, CA 15-3 and CEA before and after surgical treatment. In conclusion, this study suggests that serum ALCAM may represent a novel diagnostic bio marker for breast cancer

  3. Planar microdevices enhance transport of large molecular weight molecules across retinal pigment epithelial cells.

    Science.gov (United States)

    Wade, Jennifer S; Desai, Tejal A

    2014-08-01

    Large molecular weight drug delivery to the posterior eye is challenging due to cellular barriers that hinder drug transport. Understanding how to enhance transport across the retinal barrier is important for the design of new drug delivery systems. A novel mechanism to enhance drug transport is the use of geometric properties, which has not been extensively explored in the retina. Planar SU-8/Poly(ethyleneglycol)dimethacrylate microdevices were constructed using photolithography to deliver FITC dextran across an in vitro retinal model. The model consists of retinal pigment epithelial (RPE) cells grown to confluence on transwell inserts, which provides an environment to investigate the influence of geometry on paracellular and transcellular delivery of encapsulated large molecules. Planar microdevices enhanced transport of large molecular weight dextrans across different models of RPE in a size dependent fashion. Increased drug permeation across the RPE was observed with the addition of microdevices as compared to a traditional bolus of FITC dextran. This phenomena was initiated by a non-toxic interaction between the microdevices and the retinal tight junction proteins. Suggesting that increased drug transport occurs via a paracellular pathway. These experiments provide evidence to support the future use of planar unidirectional microdevices for delivery of biologics in ocular applications.

  4. A High-Throughput Flow Cytometry Screen Identifies Molecules That Inhibit Hantavirus Cell Entry.

    Science.gov (United States)

    Buranda, Tione; Gineste, Catherine; Wu, Yang; Bondu, Virginie; Perez, Dominique; Lake, Kaylin R; Edwards, Bruce S; Sklar, Larry A

    2018-04-01

    Hantaviruses cause hemorrhagic fever with renal syndrome (HFRS) and hantavirus cardiopulmonary syndrome (HCPS), which infects more than 200,000 people worldwide. Sin Nombre virus (SNV) and Andes virus (ANDV) cause the most severe form of HCPS, with case fatality ratios of 30%-40%. There are no specific therapies or vaccines for SNV. Using high-throughput flow cytometry, we screened the Prestwick Chemical Library for small-molecule inhibitors of the binding interaction between UV-inactivated and fluorescently labeled SNV R18 particles, and decay-accelerating factor (DAF) expressed on Tanoue B cells. Eight confirmed hit compounds from the primary screen were investigated further in secondary screens that included infection inhibition, cytotoxicity, and probe interference. Antimycin emerged as a bona fide hit compound that inhibited cellular infection of the major HCPS (SNV)- and HCPS (Hantaan)-causing viruses. Confirming our assay's ability to detect active compounds, orthogonal testing of the hit compound showed that antimycin binds directly to the virus particle and blocks recapitulation of physiologic integrin activation caused by SNV binding to the integrin PSI domain.

  5. The BAR Domain Protein PICK1 Regulates Cell Recognition and Morphogenesis by Interacting with Neph Proteins ▿

    OpenAIRE

    Höhne, Martin; Lorscheider, Johannes; von Bardeleben, Anna; Dufner, Matthias; Scharf, M. Antonia; Gödel, Markus; Helmstädter, Martin; Schurek, Eva-Maria; Zank, Sibylle; Gerke, Peter; Kurschat, Christine; Sivritas, Sema Hayriye; Neumann-Haefelin, Elke; Huber, Tobias B.; Reinhardt, H. Christian

    2011-01-01

    Neph proteins are evolutionarily conserved membrane proteins of the immunoglobulin superfamily that control the formation of specific intercellular contacts. Cell recognition through these proteins is essential in diverse cellular contexts such as patterning of the compound eye in Drosophila melanogaster, neuronal connectivity in Caenorhabditis elegans, and the formation of the kidney filtration barrier in mammals. Here we identify the PDZ and BAR domain protein PICK1 (protein interacting wit...

  6. Differential Expression of Osteo-Modulatory Molecules in Periodontal Ligament Stem Cells in Response to Modified Titanium Surfaces

    Directory of Open Access Journals (Sweden)

    So Yeon Kim

    2014-01-01

    Full Text Available This study assessed differential gene expression of signaling molecules involved in osteogenic differentiation of periodontal ligament stem cells (PDLSCs subjected to different titanium (Ti surface types. PDLSCs were cultured on tissue culture polystyrene (TCPS, and four types of Ti discs (PT, SLA, hydrophilic PT (pmodPT, and hydrophilic SLA (modSLA with no osteoinductive factor and then osteogenic activity, including alkaline phosphatase (ALP activity, mRNA expression of runt-related gene 2, osterix, FOSB, FRA1, and protein levels of osteopontin and collagen type IA, were examined. The highest osteogenic activity appeared in PDLSCs cultured on SLA, compared with the TCPS and other Ti surfaces. The role of surface properties in affecting signaling molecules to modulate PDLSC behavior was determined by examining the regulation of Wnt pathways. mRNA expression of the canonical Wnt signaling molecules, Wnt3a and β-catenin, was higher on SLA and modSLA than on smooth surfaces, but gene expression of the calcium-dependent Wnt signaling molecules Wnt5a, calmodulin, and NFATc1 was increased significantly on PT and pmodPT. Moreover, integrin α2/β1, sonic hedgehog, and Notch signaling molecules were affected differently by each surface modification. In conclusion, surface roughness and hydrophilicity can affect differential Wnt pathways and signaling molecules, targeting the osteogenic differentiation of PDLSCs.

  7. Glutamine Supplementation Attenuates Expressions of Adhesion Molecules and Chemokine Receptors on T Cells in a Murine Model of Acute Colitis

    Directory of Open Access Journals (Sweden)

    Yu-Chen Hou

    2014-01-01

    Full Text Available Background. Migration of T cells into the colon plays a major role in the pathogenesis in inflammatory bowel disease. This study investigated the effects of glutamine (Gln supplementation on chemokine receptors and adhesion molecules expressed by T cells in mice with dextran sulfate sodium- (DSS- induced colitis. Methods. C57BL/6 mice were fed either a standard diet or a Gln diet replacing 25% of the total nitrogen. After being fed the diets for 5 days, half of the mice from both groups were given 1.5% DSS in drinking water to induce colitis. Mice were killed after 5 days of DSS exposure. Results. DSS colitis resulted in higher expression levels of P-selectin glycoprotein ligand- (PSGL- 1, leukocyte function-associated antigen- (LFA- 1, and C-C chemokine receptor type 9 (CCR9 by T helper (Th and cytotoxic T (Tc cells, and mRNA levels of endothelial adhesion molecules in colons were upregulated. Gln supplementation decreased expressions of PSGL-1, LFA-1, and CCR9 by Th cells. Colonic gene expressions of endothelial adhesion molecules were also lower in Gln-colitis mice. Histological finding showed that colon infiltrating Th cells were less in the DSS group with Gln administration. Conclusions. Gln supplementation may ameliorate the inflammation of colitis possibly via suppression of T cell migration.

  8. Various domains of the B-cell regulatory molecule CD72 has diverged at different rates in mammals

    DEFF Research Database (Denmark)

    Petersen, Cathrine Bie; Hillig, Ann-Britt Nygaard; Fredholm, Merete

    2007-01-01

    We report the cloning of the porcine B-cell co-receptor CD72, as well as genomic mapping and examination of transcription. The B-cell receptor (BCR) complex mediates signalling upon antigen recognition by the membrane bound BCR. Several co-receptors modulate this signal positively or negatively. CD......72 has been shown to be a negatively regulating BCR co-receptor. We isolated and sequenced three porcine CD72 transcript variants. Using a pig radiation hybrid panel we found the porcien CD72 gene to be located on chromosome 1q21-28 in a region syntenic to human chromosome 9. The porcine CD72 gene...

  9. Effect of irradiation-induced intercellular adhesion molecule-1 expression on natural killer cell-mediated cytotoxicity toward human cancer cells.

    Science.gov (United States)

    Jeong, Jae-Uk; Uong, Tung Nguyen Thanh; Chung, Woong-Ki; Nam, Taek-Keun; Ahn, Sung-Ja; Song, Ju-Young; Kim, Sang-Ki; Shin, Dong-Jun; Cho, Eugene; Kim, Kyoung Won; Cho, Duck; Yoon, Mee Sun

    2018-03-20

    Irradiation enhances the adhesion between natural killer (NK) cells and target cells by up-regulating intercellular adhesion molecule-1 (ICAM-1) on target cells. Therefore, we investigated the effect of irradiation-induced ICAM-1 expression on human cancer cells on NK cell-mediated cytotoxicity. Expression levels of ICAM-1 on the target cell surface before and after irradiation of six human cancer cell lines (HL60, SKBR-3, T47D, HCT-116, U937 and U251) were analyzed by flow cytometry. Ex vivo expansion of NK cells from human peripheral blood mononuclear cells was performed by co-culture with irradiated K562 cells. The related adhesion molecule lymphocyte function-associated antigen 1 (LFA-1) on NK cells was analyzed by flow cytometry. An enzyme-linked immunosorbent assay was used to detect interferon-γ (IFN-γ), and WST-8 assays were performed to check NK cell cytotoxicity. Finally, blocking assays were performed using monoclonal antibodies against ICAM-1 or LFA-1. LFA-1 expression increased on NK cells after expansion (P cytotoxicity increased after irradiation of HL60 (P cytotoxicity against irradiated SKBR-3 (P cytotoxicity against irradiated HL60 (P cytotoxicity. Therefore, irradiation combined with NK cell therapy may improve the antitumor effects of NK cells. Copyright © 2018. Published by Elsevier Inc.

  10. Developing new optical imaging techniques for single particle and molecule tracking in live cells

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Wei [Iowa State Univ., Ames, IA (United States)

    2010-01-01

    Differential interference contrast (DIC) microscopy is a far-field as well as wide-field optical imaging technique. Since it is non-invasive and requires no sample staining, DIC microscopy is suitable for tracking the motion of target molecules in live cells without interfering their functions. In addition, high numerical aperture objectives and condensers can be used in DIC microscopy. The depth of focus of DIC is shallow, which gives DIC much better optical sectioning ability than those of phase contrast and dark field microscopies. In this work, DIC was utilized to study dynamic biological processes including endocytosis and intracellular transport in live cells. The suitability of DIC microscopy for single particle tracking in live cells was first demonstrated by using DIC to monitor the entire endocytosis process of one mesoporous silica nanoparticle (MSN) into a live mammalian cell. By taking advantage of the optical sectioning ability of DIC, we recorded the depth profile of the MSN during the endocytosis process. The shape change around the nanoparticle due to the formation of a vesicle was also captured. DIC microscopy was further modified that the sample can be illuminated and imaged at two wavelengths simultaneously. By using the new technique, noble metal nanoparticles with different shapes and sizes were selectively imaged. Among all the examined metal nanoparticles, gold nanoparticles in rod shapes were found to be especially useful. Due to their anisotropic optical properties, gold nanorods showed as diffraction-limited spots with disproportionate bright and dark parts that are strongly dependent on their orientation in the 3D space. Gold nanorods were developed as orientation nanoprobes and were successfully used to report the self-rotation of gliding microtubules on kinesin coated substrates. Gold nanorods were further used to study the rotational motions of cargoes during the endocytosis and intracellular transport processes in live mammalian

  11. High-risk human papillomavirus E7 expression reduces cell-surface MHC class I molecules and increases susceptibility to natural killer cells

    DEFF Research Database (Denmark)

    Bottley, G; Watherston, O G; Hiew, Y-L

    2007-01-01

    a role for E7 in tumour immune evasion. We show that knockdown of E7 expression in HPV16- and HPV18-transformed cervical carcinoma cells by RNA interference increased expression of major histocompatibility complex (MHC) class I at the cell surface and reduced susceptibility of these cells to natural...... killer (NK) cells. Tetracycline-regulated induction of HPV16 E7 resulted in reduced expression of cell surface MHC class I molecules and increased NK cell killing. Our results suggest that, for HPV-associated malignancies, reduced MHC class I expression is the result of an active immune evasion strategy...

  12. Terminal moiety-driven electrical performance of asymmetric small-molecule-based organic solar cells

    DEFF Research Database (Denmark)

    Huang, Jianhua; Zhang, Shanlin; jiang, Bo

    2016-01-01

    With respect to the successes from symmetric small molecules, asymmetric ones have recently emerged as an alternative choice. In this paper, we present the synthesis and photovoltaic properties of four asymmetric small molecule donors. The benzo[1,2-b:4,5-b']dithiophene (BDT) end in the asymmetri...

  13. Type I interferon production during herpes simplex virus infection is controlled by cell-type-specific viral recognition through Toll-like receptor 9, the mitochondrial antiviral signaling protein pathway, and novel recognition systems

    DEFF Research Database (Denmark)

    Rasmussen, Simon Brandtoft; Sørensen, Louise Nørgaard; Malmgaard, Lene

    2007-01-01

    Recognition of viruses by germ line-encoded pattern recognition receptors of the innate immune system is essential for rapid production of type I interferon (IFN) and early antiviral defense. We investigated the mechanisms of viral recognition governing production of type I IFN during herpes...... simplex virus (HSV) infection. We show that early production of IFN in vivo is mediated through Toll-like receptor 9 (TLR9) and plasmacytoid dendritic cells, whereas the subsequent alpha/beta IFN (IFN-alpha/beta) response is derived from several cell types and induced independently of TLR9...... and fibroblasts, where the virus was able to replicate, HSV-induced IFN-alpha/beta production was dependent on both viral entry and replication, and ablated in cells unable to signal through the mitochondrial antiviral signaling protein pathway. Thus, during an HSV infection in vivo, multiple mechanisms...

  14. Gene expression profiles of cell adhesion molecules, matrix metalloproteinases and their tissue inhibitors in canine oral tumors.

    Science.gov (United States)

    Pisamai, Sirinun; Rungsipipat, Anudep; Kalpravidh, Chanin; Suriyaphol, Gunnaporn

    2017-08-01

    Perturbation of cell adhesion can be essential for tumor cell invasion and metastasis, but the current knowledge on the gene expression of molecules that mediate cell adhesion in canine oral tumors is limited. The present study aimed to investigate changes in the gene expression of cell adhesion molecules (E-cadherin or CDH1, syndecan 1 or SDC1, NECTIN2 and NECTIN4), matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMPs), in canine oral tumors, including benign tumors, oral melanoma (OM) and non-tonsillar oral squamous cell carcinoma (OSCC), by quantitative real-time reverse transcription PCR. When compared with the normal gingival controls, decreased CDH1, SDC1 and NECTIN4 expression levels were observed in OSCC and OM, reflecting a possible role as cell adhesion molecules and tumor suppressors in canine oral cancers in contrast to the upregulation of MMP2 expression. Downregulated MMP7 was specifically revealed in the OM group. In the late-stage OM, the positive correlation of MMP7 and CDH1 expression was noticed as well as that of SDC1 and NECTIN4. Enhanced TIMP1 expression was shown in all tumor groups with prominent expression in the benign tumors and the early-stage OM. MMP14 expression was notable in the early-stage OM. Higher MMP9 and TIMP1 expression was observed in the acanthomatous ameloblastoma. In conclusion, this study revealed that the altered expression of cell adhesion molecules, MMP7 and MMP2 was correlated with clinicopathologic features in canine oral cancers whereas TIMP1 and MMP14 expression was probably associated with early-stage tumors; therefore, these genes might serve as molecular markers for canine oral tumors. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Bone marrow-derived thymic antigen-presenting cells determine self-recognition of Ia-restricted T lymphocytes

    International Nuclear Information System (INIS)

    Longo, D.L.; Kruisbeek, A.M.; Davis, M.L.; Matis, L.A.

    1985-01-01

    The authors previously have demonstrated that in radiation-induced bone marrow chimeras, T-cell self-Ia restriction specificity appeared to correlate with the phenotype of the bone marrow-derived antigen-presenting (or dendritic) cell in the thymus during T-cell development. However, these correlations were necessarily indirect because of the difficulty in assaying thymic function directly by adult thymus transplant, which has in the past been uniformly unsuccessful. They now report success in obtaining functional T cells from nude mice grafted with adult thymuses reduced in size by treatment of the thymus donor with anti-thymocyte globulin and cortisone. When (B10 Scn X B10.D2)F1 nude mice (I-Ab,d) are given parental B10.D2 (I-Ad) thymus grafts subcutaneously, their T cells are restricted to antigen recognition in association with I-Ad gene products but not I-Ab gene products. Furthermore, thymuses from (B10 X B10.D2)F1 (I-Ab,d)----B10 (I-Ab) chimeras transplanted 6 months or longer after radiation (a time at which antigen-presenting cell function is of donor bone marrow phenotype) into (B10 X B10.D2)F1 nude mice generate T cells restricted to antigen recognition in association with both I-Ad and I-Ab gene products. Thymuses from totally allogeneic bone marrow chimeras appear to generate T cells of bone marrow donor and thymic host restriction specificity. Thus, when thymus donors are radiation-induced bone marrow chimeras, the T-cell I-region restriction of the nude mice recipients is determined at least in part by the phenotype of the bone marrow-derived thymic antigen presenting cells or dendritic cells in the chimeric thymus

  16. Exosomes from iPSCs Delivering siRNA Attenuate Intracellular Adhesion Molecule-1 Expression and Neutrophils Adhesion in Pulmonary Microvascular Endothelial Cells.

    Science.gov (United States)

    Ju, Zhihai; Ma, Jinhui; Wang, Chen; Yu, Jie; Qiao, Yeru; Hei, Feilong

    2017-04-01

    The pro-inflammatory activation of pulmonary microvascular endothelial cells resulting in continuous expression of cellular adhesion molecules, and subsequently recruiting primed neutrophils to form a firm neutrophils-endothelium (PMN-EC) adhesion, has been examined and found to play a vital role in acute lung injury (ALI). RNA interference (RNAi) is a cellular process through harnessing a natural pathway silencing target gene based on recognition and subsequent degradation of specific mRNA sequences. It opens a promising approach for precision medicine. However, this application was hampered by many obstacles, such as immunogenicity, instability, toxicity problems, and difficulty in across the biological membrane. In this study, we reprogrammed urine exfoliated renal epithelial cells into human induced pluripotent stem cells (huiPSCs) and purified the exosomes (Exo) from huiPSCs as RNAi delivery system. Through choosing the episomal system to deliver transcription factors, we obtained a non-integrating huiPSCs. Experiments in both vitro and vivo demonstrated that these huiPSCs possess the pluripotent properties. The exosomes of huiPSCs isolated by differential centrifugation were visualized by transmission electron microscopy (TEM) showing a typical exosomal appearance with an average diameter of 122 nm. Immunoblotting confirmed the presence of the typical exosomal markers, including CD63, TSG 101, and Alix. Co-cultured PKH26-labeled exosomes with human primary pulmonary microvascular endothelial cells (HMVECs) confirmed that they could be internalized by recipient cells at a time-dependent manner. Then, electroporation was used to introduce siRNA against intercellular adhesion molecule-1 (ICAM-1) into exosomes to form an Exo/siRNA compound. The Exo/siRNA compound efficiently delivered the target siRNA into HMVECs causing selective gene silencing, inhibiting the ICAM-1 protein expression, and PMN-EC adhesion induced by lipopolysaccharide (LPS). These data suggest

  17. Identification of the homing molecules that escort pluripotent stem cells-derived hematopoietic stem cells to their niches and human activated T-cells to inflammatory sites.

    KAUST Repository

    Ali, Amal

    2017-12-01

    Hematopoietic cells exploit the multistep paradigm of cell migration to ultimately enable them to perform their function. This process is dictated by the ability of adhesion molecules on the circulating hematopoietic cells to find their counter-receptors on endothelial cells. Of those molecules, the selectin family and their respective ligands induce the initial transient interactions between circulating cells and the opposing endothelium. In this thesis, I focused on studying E-selectin mediated cellular migration in two hematopoietic cell types, namely human hematopoietic stem and progenitor cells (HSPCs) and human T-lymphocytes. HSPCs derived from pluripotent sources theoretically offers a novel, unlimited source for hematopoietic stem cell transplantation therapy. In vitro pluripotent stem cell derived- hematopoietic stem/progenitor cells (ES/iPS-HSPCs) behave much like somatic HSPCs in that they exhibit clonal expansion and multilineage hematopoietic capacity. However, unlike somatic sources, ES/iPS-HSPCs do not give rise to effective hematopoietic repopulation, which may be due to insufficient HSPCs homing to the bone marrow. HSPCs exploit E- and P-selectin to home and engraft into bone marrow niches. Thus, one of my objectives in this thesis was to study the expression of E-selectin ligands associated with ES/iPS-HSPCs. I showed that ES/iPS-HSPCs lack functional E-selectin ligand(s). In an effort to enhance the interaction between Eselectin and ES/iPS-HSPCs, we decorated the cell surface with sialyl-Lewis x (sLex) using the ex-vivo glycan engineering technology. However, this decoration did not improve the engraftment capacity of ES/iPS-HSPCs, in vivo. Induction of E-selectin expression during inflammation is key to recruitment of immune cells and therefore I also focused on analyzing the expression of E-selectin ligands on activated human T-cells. I identified several novel glycoproteins that may function as E-selectin ligands. Specifically, I compared the

  18. Arsenite enhances tumor necrosis factor-α-induced expression of vascular cell adhesion molecule-1

    International Nuclear Information System (INIS)

    Tsou, T.-C.; Yeh, Szu Ching; Tsai, E.-M.; Tsai, F.-Y.; Chao, H.-R.; Chang, Louis W.

    2005-01-01

    Epidemiological studies demonstrated a high association of vascular diseases with arsenite exposure. We hypothesize that arsenite potentiates the effect of proinflammatory cytokines on vascular endothelial cells, and hence contributes to atherosclerosis. In this study, we investigated the effect of arsenite and its induction of glutathione (GSH) on vascular cell adhesion molecule-1 (VCAM-1) protein expression in human umbilical vein endothelial cells (HUVECs) in response to tumor necrosis factor-α (TNF-α), a typical proinflammatory cytokine. Our study demonstrated that arsenite pretreatment potentiated the TNF-α-induced VCAM-1 expression with up-regulations of both activator protein-1 (AP-1) and nuclear factor-κB (NF-κB). To elucidate the role of GSH in regulation of AP-1, NF-κB, and VCAM-1 expression, we employed L-buthionine (S,R)-sulfoximine (BSO), a specific γ-glutamylcysteine synthetase (γ-GCS) inhibitor, to block intracellular GSH synthesis. Our investigation revealed that, by depleting GSH, arsenite attenuated the TNF-α-induced VCAM-1 expression as well as a potentiation of AP-1 and an attenuation of NF-κB activations by TNF-α. Moreover, we found that depletion of GSH would also attenuate the TNF-α-induced VCAM-1 expression with a down-regulation of the TNF-α-induced NF-κB activation and without significant effect on AP-1. On the other hand, the TNF-α-induced VCAM-1 expression could be completely abolished by inhibition of AP-1 or NF-κB activity, suggesting that activation of both AP-1 and NF-κB was necessary for VCAM-1 expression. In summary, we demonstrate that arsenite enhances the TNF-α-induced VCAM-1 expression in HUVECs via regulation of AP-1 and NF-κB activities in a GSH-sensitive manner. Our present study suggested a potential mechanism for arsenite in the induction of vascular inflammation and vascular diseases via modulating the actions of proinflammatory cytokines

  19. Toward Additive-Free Small-Molecule Organic Solar Cells: Roles of the Donor Crystallization Pathway and Dynamics

    KAUST Repository

    Abdelsamie, Maged

    2015-09-29

    The ease with which small-molecule donors crystallize during solution processing is directly linked to the need for solvent additives. Donor molecules that get trapped in disordered (H1) or liquid crystalline (T1) mesophases require additive processing to promote crystallization, phase separation, and efficient light harvesting. A donor material (X2) that crystallizes directly from solution yields additive-free solar cells with an efficiency of 7.6%. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. ShcA regulates neurite outgrowth stimulated by neural cell adhesion molecule but not by fibroblast growth factor 2: evidence for a distinct fibroblast growth factor receptor response to neural cell adhesion molecule activation

    DEFF Research Database (Denmark)

    Hinsby, Anders M; Lundfald, Line; Ditlevsen, Dorte K

    2004-01-01

    Homophilic binding in trans of the neural cell adhesion molecule (NCAM) mediates adhesion between cells and leads, via activation of intracellular signaling cascades, to neurite outgrowth in primary neurons as well as in the neuronal cell line PC12. NCAM mediates neurite extension in PC12 cells....... Here, we investigated the involvement of adaptor proteins in NCAM and fibroblast growth factor 2 (FGF2)-mediated neurite outgrowth in the PC12-E2 cell line. We found that both FGFR substrate-2 and Grb2 play important roles in NCAM as well as in FGF2-stimulated events. In contrast, the docking protein...... ShcA was pivotal to neurite outgrowth induced by NCAM, but not by FGF2, in PC12 cells. Moreover, in rat cerebellar granule neurons, phosphorylation of ShcA was stimulated by an NCAM mimicking peptide, but not by FGF2. This activation was blocked by inhibitors of both FGFR and Fyn, indicating that NCAM...

  1. Carbamylated low-density lipoprotein induces proliferation and increases adhesion molecule expression of human coronary artery smooth muscle cells.

    Science.gov (United States)

    Asci, Gulay; Basci, Ali; Shah, Sudhir V; Basnakian, Alexei; Toz, Huseyin; Ozkahya, Mehmet; Duman, Soner; Ok, Ercan

    2008-12-01

    Presence of accelerated atherosclerosis in dialysis patients cannot be entirely explained by conventional risk factors. Exposure to urea, which is elevated in patients with kidney disease, leads to the carbamylation of proteins. We investigated the effects of carbamylated low-density lipoprotein (cLDL) on human coronary artery vascular smooth muscle cells (VSMC). Native LDL (nLDL) was carbamylated with potassium cyanate. Cells were incubated with different concentrations of cLDL carbamylated at different time points. Cytotoxicity, apoptosis, proliferation (bromodeoxyuridine incorporation), expression of adhesion molecules and extracellular matrix protein synthesis were studied. Carbamylated low-density lipoprotein exposure leads to morphological alterations and presence of cellular debris. Neither nLDL nor cLDL caused apoptosis. Lactate dehydrogenase (LDH) release was not different between groups. Carbamylated low-density lipoprotein led to a striking proliferation in VSMC compared to nLDL. Carbamylated low-density lipoprotein significantly increased intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 expression compared to the control. The effects of cLDL on proliferation and adhesion molecule expression were dose-dependent and correlated with the degree of low-density lipoprotein carbamylation. cLDL had no effect on extracellular matrix protein synthesis. The results support the hypothesis that cLDL may contribute to the pathogenesis of atherosclerosis in uraemic patients.

  2. Structures of MART-126/27-35Peptide/HLA-A2 Complexes Reveal a Remarkable Disconnect between Antigen Structural Homology and T Cell Recognition

    Energy Technology Data Exchange (ETDEWEB)

    Borbulevych, Oleg Y; Insaidoo, Francis K; Baxter, Tiffany K; Powell, Jr., Daniel J.; Johnson, Laura A; Restifo, Nicholas P; Baker, Brian M [NIH; (Notre)

    2008-09-17

    Small structural changes in peptides presented by major histocompatibility complex (MHC) molecules often result in large changes in immunogenicity, supporting the notion that T cell receptors are exquisitely sensitive to antigen structure. Yet there are striking examples of TCR recognition of structurally dissimilar ligands. The resulting unpredictability of how T cells will respond to different or modified antigens impacts both our understanding of the physical bases for TCR specificity as well as efforts to engineer peptides for immunomodulation. In cancer immunotherapy, epitopes and variants derived from the MART-1/Melan-A protein are widely used as clinical vaccines. Two overlapping epitopes spanning amino acid residues 26 through 35 are of particular interest: numerous clinical studies have been performed using variants of the MART-1 26-35 decamer, although only the 27-35 nonamer has been found on the surface of targeted melanoma cells. Here, we show that the 26-35 and 27-35 peptides adopt strikingly different conformations when bound to HLA-A2. Nevertheless, clonally distinct MART-1{sub 26/27-35}-reactive T cells show broad cross-reactivity towards these ligands. Simultaneously, however, many of the cross-reactive T cells remain unable to recognize anchor-modified variants with very subtle structural differences. These dichotomous observations challenge our thinking about how structural information on unligated peptide/MHC complexes should be best used when addressing questions of TCR specificity. Our findings also indicate that caution is warranted in the design of immunotherapeutics based on the MART-1 26/27-35 epitopes, as neither cross-reactivity nor selectivity is predictable based on the analysis of the structures alone.

  3. Staphylococcus-mediated T-cell activation and spontaneous natural killer cell activity in the absence of major histocompatibility complex class II molecules

    Science.gov (United States)

    Chapes, S. K.; Hoynowski, S. M.; Woods, K. M.; Armstrong, J. W.; Beharka, A. A.; Iandolo, J. J.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    We used major histocompatibility complex class II antigen-deficient transgenic mice to show that in vitro natural killer cell cytotoxicity and T-cell activation by staphylococcal exotoxins (superantigens) are not dependent upon the presence of major histocompatibility complex class II molecules. T cells can be activated by exotoxins in the presence of exogenously added interleukin 1 or 2 or in the presence of specific antibody without exogenously added cytokines.

  4. Toward performance-diverse small-molecule libraries for cell-based phenotypic screening using multiplexed high-dimensional profiling

    Science.gov (United States)

    Wawer, Mathias J.; Li, Kejie; Gustafsdottir, Sigrun M.; Ljosa, Vebjorn; Bodycombe, Nicole E.; Marton, Melissa A.; Sokolnicki, Katherine L.; Bray, Mark-Anthony; Kemp, Melissa M.; Winchester, Ellen; Taylor, Bradley; Grant, George B.; Hon, C. Suk-Yee; Duvall, Jeremy R.; Wilson, J. Anthony; Bittker, Joshua A.; Dančík, Vlado; Narayan, Rajiv; Subramanian, Aravind; Winckler, Wendy; Golub, Todd R.; Carpenter, Anne E.; Shamji, Alykhan F.; Schreiber, Stuart L.; Clemons, Paul A.

    2014-01-01

    High-throughput screening has become a mainstay of small-molecule probe and early drug discovery. The question of how to build and evolve efficient screening collections systematically for cell-based and biochemical screening is still unresolved. It is often assumed that chemical structure diversity leads to diverse biological performance of a library. Here, we confirm earlier results showing that this inference is not always valid and suggest instead using biological measurement diversity derived from multiplexed profiling in the construction of libraries with diverse assay performance patterns for cell-based screens. Rather than using results from tens or hundreds of completed assays, which is resource intensive and not easily extensible, we use high-dimensional image-based cell morphology and gene expression profiles. We piloted this approach using over 30,000 compounds. We show that small-molecule profiling can be used to select compound sets with high rates of activity and diverse biological performance. PMID:25024206

  5. Microfluidic electroporation for delivery of small molecules and genes into cells using a common DC power supply.

    Science.gov (United States)

    Wang, Hsiang-Yu; Lu, Chang

    2008-06-15

    Electroporation is an efficient method of introducing foreign impermeant molecules such as drugs and genes into cells. Conventional electroporation has been based on the application of short electrical pulses (electropulsation). Electropulsation requires specialized equipment and cannot be integrated easily with techniques such as electrophoresis which is based on constant voltage. Here we demonstrate the delivery of small molecules and genes into cells, using a microfluidic electroporation technique based on constant direct current (DC) voltage that we developed earlier. We demonstrate the delivery of two molecules into Chinese hamster ovary (CHO-K1) cells: a membrane impermeable nucleic acid dye (SYTOX Green) and a plasmid vector carrying the gene for green fluorescent protein (pEGFP-C1). Our devices can exert field variations to flowing cells that are analogous to the application of single or multiple pulses by having different geometries. We investigate the effects of the electrical parameters and different geometries of the device on the transfection efficiency and cell viability. Our technique provides a simple solution to electroporation-based drug and gene delivery by eliminating the need for a pulse generator. We envision that these simple microscale electroporation devices will have the potential to work in parallel on a microchip platform and such technology will allow high-throughput functional screening of drugs and genes. (c) 2008 Wiley Periodicals, Inc.

  6. 25th anniversary article: isoindigo-based polymers and small molecules for bulk heterojunction solar cells and field effect transistors.

    Science.gov (United States)

    Wang, Ergang; Mammo, Wendimagegn; Andersson, Mats R

    2014-03-26

    Driven by the potential advantages and promising applications of organic solar cells, donor-acceptor (D-A) polymers have been intensively investigated in the past years. One of the strong electron-withdrawing groups that were widely used as acceptors for the construction of D-A polymers for applications in polymer solar cells and FETs is isoindigo. The isoindigo-based polymer solar cells have reached efficiencies up to ∼7% and hole mobilities as high as 3.62 cm(2) V(-1) s(-1) have been realized by FETs based on isoindigo polymers. Over one hundred isoindigo-based small molecules and polymers have been developed in only three years. This review is an attempt to summarize the structures and properties of the isoindigo-based polymers and small molecules that have been reported in the literature since their inception in 2010. Focus has been given only to the syntheses and device performances of those polymers and small molecules that were designed for use in solar cells and FETs. Attempt has been made to deduce structure-property relationships that would guide the design of isoindigo-based materials. It is expected that this review will present useful guidelines for the design of efficient isoindigo-based materials for applications in solar cells and FETs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Activation of Apoptotic Signal in Endothelial Cells through Intracellular Signaling Molecules Blockade in Tumor-Induced Angiogenesis

    Directory of Open Access Journals (Sweden)

    Hossein Bazmara

    2015-01-01

    Full Text Available Tumor-induced angiogenesis is the bridge between avascular and vascular tumor growth phases. In tumor-induced angiogenesis, endothelial cells start to migrate and proliferate toward the tumor and build new capillaries toward the tumor. There are two stages for sprout extension during angiogenesis. The first stage is prior to anastomosis, when single sprouts extend. The second stage is after anastomosis when closed flow pathways or loops are formed and blood flows in the closed loops. Prior to anastomosis, biochemical and biomechanical signals from extracellular matrix regulate endothelial cell phenotype; however, after anastomosis, blood flow is the main regulator of endothelial cell phenotype. In this study, the critical signaling pathways of each stage are introduced. A Boolean network model is used to map environmental and flow induced signals to endothelial cell phenotype (proliferation, migration, apoptosis, and lumen formation. Using the Boolean network model, blockade of intracellular signaling molecules of endothelial cell is investigated prior to and after anastomosis and the cell fate is obtained in each case. Activation of apoptotic signal in endothelial cell can prevent the extension of new vessels and may inhibit angiogenesis. It is shown that blockade of a few signaling molecules in endothelial cell activates apoptotic signal that are proposed as antiangiogenic strategies.

  8. Endosomal recognition of Lactococcus lactis G121 and its RNA by dendritic cells is key to its allergy-protective effects.

    Science.gov (United States)

    Stein, Karina; Brand, Stephanie; Jenckel, André; Sigmund, Anna; Chen, Zhijian James; Kirschning, Carsten J; Kauth, Marion; Heine, Holger

    2017-02-01

    Bacterial cowshed isolates are allergy protective in mice; however, the underlying mechanisms are largely unknown. We examined the ability of Lactococcus lactis G121 to prevent allergic inflammatory reactions. We sought to identify the ligands and pattern recognition receptors through which L lactis G121 confers allergy protection. L lactis G121-induced cytokine release and surface expression of costimulatory molecules by untreated or inhibitor-treated (bafilomycin and cytochalasin D) human monocyte-derived dendritic cells (moDCs), bone marrow-derived mouse dendritic cells (BMDCs), and moDC/naive CD4 + T-cell cocultures were analyzed by using ELISA and flow cytometry. The pathology of ovalbumin-induced acute allergic airway inflammation after adoptive transfer of BMDCs was examined by means of microscopy. L lactis G121-treated murine BMDCs and human moDCs released T H 1-polarizing cytokines and induced T H 1 T cells. Inhibiting phagocytosis and endosomal acidification in BMDCs or moDCs impaired the release of T H 1-polarizing cytokines, costimulatory molecule expression, and T-cell activation on L lactis G121 challenge. In vivo allergy protection mediated by L lactis G121 was dependent on endosomal acidification in dendritic cells (DCs). Toll-like receptor (Tlr) 13 -/- BMDCs showed a weak response to L lactis G121 and were unresponsive to its RNA. The T H 1-polarizing activity of L lactis G121-treated human DCs was blocked by TLR8-specific inhibitors, mediated by L lactis G121 RNA, and synergistically enhanced by activation of nucleotide-binding oligomerization domain-containing protein (NOD) 2. Bacterial RNA is the main driver of L lactis G121-mediated protection against experimentally induced allergy and requires both bacterial uptake by DCs and endosomal acidification. In mice L lactis G121 RNA signals through TLR13; however, the most likely intracellular receptor in human subjects is TLR8. Copyright © 2016 American Academy of Allergy, Asthma & Immunology

  9. Serum activated leukocyte cell adhesion molecule and intercellular adhesion molecule-1 in patients with gastric cancer: Can they be used as biomarkers?

    Science.gov (United States)

    Erturk, Kayhan; Tastekin, Didem; Bilgin, Elif; Serilmez, Murat; Bozbey, Hamza Ugur; Sakar, Burak

    2016-02-01

    Cellular adhesion molecules might be used as markers in diagnosis and prognosis in some types of malignant tumors. The purpose of this study was to determine the clinical significance of the serum levels of activated leukocyte cell adhesion molecule-1 (ALCAM) and intercellular adhesion molecule-1 (ICAM-1) in gastric cancer (GC) patients. Fifty-eight GC patients and 20 age- and sex-matched healthy controls were enrolled into this study. Pretreatment serum markers were determined by the solid-phase sandwich enzyme-linked immunosorbent assay (ELISA). The median age at diagnosis was 59.5 years (range 32-82 years). Tumor localizations of the majority of the patients were antrum (n=42, 72.4%) and tumor histopathologies of the majority of the patients were diffuse (n=43, 74.1%). The majority of the patients had stage IV disease (n=41, 70.7%). Thirty six (62.1%) patients had lymph node involvement. The median follow-up time was 66 months (range 1-97.2 months). At the end of the observation period, 26 patients (44.8%) were dead. The median survival for all patients was 21.4±5 months (%95 CI, 11.5-31.3). The 1-year survival rates were 66.2%. The baseline serum ALCAM levels of the patients were significantly higher than those of the controls (p=0.001). There was no significant difference in the serum levels of ICAM-1 between the patients and controls (p=0.232). No significant correlation was detected between the levels of the serum markers and other clinical parameters (p>0.05). Tumor localization (p=0.03), histopathology (p=0.05), and response to chemotherapy (p=0.003) had prognostic factors on survival. Neither serum ALCAM levels nor serum ICAM-1 levels were identified to have a prognostic role on overall survival (ICAM-1 p=0.6, ALCAM p=0.25). In conclusion, serum levels of ALCAM were found to have diagnostic value in GC patients. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. Exogenous, but not Endogenous Nitric Oxide Inhibits Adhesion Molecule Expression in Human Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Jin eQian

    2012-01-01

    Full Text Available Nitric oxide (NO has many beneficial actions on the vascular wall including suppression of inflammation. The mechanism(s by which NO antagonizes cytokine signaling are poorly understood, but are thought to involve inhibition of the pro-inflammatory transcription factor, NF-κB. NO represses nuclear translocation of NF-κB via the S-nitrosylation of its subunits which decreases the expression of target genes including adhesion molecules. In previous studies, we have shown that the intracellular location of endothelial nitric oxide synthase (eNOS can influence the amount of NO produced and that NO levels are paramount in regulating the S-nitrosylation of target proteins. The purpose of the current study was to investigate the significance of subcellular eNOS to NF-κB signaling induced by proinflammatory cytokines in human aortic endothelial cells (HAECs. We found that in HAECs stimulated with TNFα, L-NAME did not influence the expression of ICAM-1 or VCAM-1. In eNOS knock down HAECs reconstituted with either plasma membrane or Golgi restricted forms of eNOS, there was no significant effect on the activation of the NF-κB pathway over different times and concentrations of TNFα. Similarly, the endogenous production of NO did not influence the phosphorylation of IkBα. In contrast, higher concentrations of NO derived from the use of the exogenous NO donor, DETA NONOate, effectively suppressed the expression of ICAM-1/VCAM-1 in response to TNFα. Collectively these results suggest that neither endogenous eNOS nor eNOS location is an important influence on inflammatory signaling via the NF-κB pathway and that higher NO concentrations are required to suppress NF-κB in HAECs.

  11. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-05-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

  12. The role of phosphatidylinositol 3-kinase in neural cell adhesion molecule-mediated neuronal differentiation and survival

    DEFF Research Database (Denmark)

    Ditlevsen, Dorte K; Køhler, Lene B; Pedersen, Martin V

    2003-01-01

    The neural cell adhesion molecule, NCAM, is known to stimulate neurite outgrowth from primary neurones and PC12 cells presumably through signalling pathways involving the fibroblast growth factor receptor (FGFR), protein kinase A (PKA), protein kinase C (PKC), the Ras-mitogen activated protein...... that phosphatidylinositol 3-kinase (PI3K) is required for NCAM-mediated neurite outgrowth from PC12-E2 cells and from cerebellar and dopaminergic neurones in primary culture, and that the thr/ser kinase Akt/protein kinase B (PKB) is phosphorylated downstream of PI3K after stimulation with C3. Moreover, we present data...

  13. Crossreactive T Cells Spotlight the Germline Rules for [alpha beta] T Cell-Receptor Interactions with MHC Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Shaodong; Huseby, Eric S.; Rubtsova, Kira; Scott-Browne, James; Crawford, Frances; Macdonald, Whitney A.; Marrack, Philippa; Kappler, John W. (HHMI)