WorldWideScience

Sample records for cell line nci-h460

  1. Phenethyl Isothiocyanate Induces Apoptotic Cell Death Through the Mitochondria-dependent Pathway in Gefitinib-resistant NCI-H460 Human Lung Cancer Cells In Vitro.

    Science.gov (United States)

    Hsia, Te-Chun; Huang, Yi-Ping; Jiang, Yi-Wen; Chen, Hsin-Yu; Cheng, Zheng-Yu; Hsiao, Yung-Ting; Chen, Cheng-Yen; Peng, Shu-Fen; Chueh, Fu-Shin; Chou, Yu-Cheng; Chung, Jing-Gung

    2018-04-01

    Some lung cancer patients treated with gefitinib develop resistance to this drug resulting in unsatisfactory treatment outcomes. Phenethyl isothiocyanate (PEITC), present in our common cruciferous vegetables, exhibits anticancer activities in many human cancer cell lines. Currently, there is no available information on the possible modification of gefitinib resistance of lung cancer in vitro by PEITC. Thus, the effects of PEITC on gefitinib resistant lung cancer NCI-H460 cells were investigated in vitro. The total cell viability, apoptotic cell death, production of reactive oxygen species (ROS) and Ca 2+ , levels of mitochondria membrane potential (ΔΨ m ) and caspase-3, -8 and -9 activities were measured by flow cytometry assay. PEITC induced chromatin condensation was examined by DAPI staining. PEITC-induced cell morphological changes, decreased total viable cell number and induced apoptotic cell death in NCI-H460 and NCI-H460/G cells. PEITC decreased ROS production in NCI-H460 cells, but increased production in NCI-H460/G cells. PEITC increased Ca 2+ production, decreased the levels of ΔΨ m and increased caspase-3, -8 and -9 activities in both NCI-H460 and NCI-H460/G cells. Western blotting was used to examine the effect of apoptotic cell death associated protein expression in NCI-H460 NCI-H460/G cells after exposure to PEITC. Results showed that PEITC increased expression of cleaved caspase-3, PARP, GADD153, Endo G and pro-apoptotic protein Bax in NCI-H460/G cells. Based on these results, we suggest that PEITC induces apoptotic cell death via the caspase- and mitochondria-dependent pathway in NCI-H460/G cells. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  2. Metformin synergistically enhances antiproliferative effects of cisplatin and etoposide in NCI-H460 human lung cancer cells

    Directory of Open Access Journals (Sweden)

    Sarah Fernandes Teixeira

    2013-12-01

    Full Text Available OBJECTIVE: To test the effectiveness of combining conventional antineoplastic drugs (cisplatin and etoposide with metformin in the treatment of non-small cell lung cancer in the NCI-H460 cell line, in order to develop new therapeutic options with high efficacy and low toxicity.METHODS: We used the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay and calculated the combination index for the drugs studied.RESULTS: We found that the use of metformin as monotherapy reduced the metabolic viability of the cell line studied. Combining metformin with cisplatin or etoposide produced a synergistic effect and was more effective than was the use of cisplatin or etoposide as monotherapy.CONCLUSIONS: Metformin, due to its independent effects on liver kinase B1, had antiproliferative effects on the NCI-H460 cell line. When metformin was combined with cisplatin or etoposide, the cell death rate was even higher.

  3. Regulation of voltage-gated potassium channels attenuates resistance of side-population cells to gefitinib in the human lung cancer cell line NCI-H460.

    Science.gov (United States)

    Choi, Seon Young; Kim, Hang-Rae; Ryu, Pan Dong; Lee, So Yeong

    2017-02-21

    Side-population (SP) cells that exclude anti-cancer drugs have been found in various tumor cell lines. Moreover, SP cells have a higher proliferative potential and drug resistance than main population cells (Non-SP cells). Also, several ion channels are responsible for the drug resistance and proliferation of SP cells in cancer. To confirm the expression and function of voltage-gated potassium (Kv) channels of SP cells, these cells, as well as highly expressed ATP-binding cassette (ABC) transporters and stemness genes, were isolated from a gefitinib-resistant human lung adenocarcinoma cell line (NCI-H460), using Hoechst 33342 efflux. In the present study, we found that mRNA expression of Kv channels in SP cells was different compared to Non-SP cells, and the resistance of SP cells to gefitinib was weakened with a combination treatment of gefitinib and Kv channel blockers or a Kv7 opener, compared to single-treatment gefitinib, through inhibition of the Ras-Raf signaling pathway. The findings indicate that Kv channels in SP cells could be new targets for reducing the resistance to gefitinib.

  4. Investigation of internalization and cytotoxicity of 125I-[Tyr3]-octreotide in NCI-H446 cell line

    International Nuclear Information System (INIS)

    Sun Junjie; Fan Wo; Xu Yujie; Zhang Youjiu; Zhu Ran; Hu Mingjiang

    2004-01-01

    Objective: To investigate the [Tyr 3 ]-octreotide (TOC) internalizing capacity of NCI-H446 cell line, and the cytotoxicity of 125 I-TOC in NCI-H446 cell line. To assess the therapeutic radiopharmaceutical potentiality of 125 I-TOC for the somatostatin receptor (SSTR) positive tumor. Methods: NCI-H446 cells were incubated together with 125 I-TOC for different periods of time, the amount of internalized 125 I-TOC and the 125 I-TOC bound on the cellular nucleus were detected with γ counter, respectively. The viability of the cells was analyzed by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay at different time points with various doses of 125 I-TOC, free 125 I and TOC. Results: 125 I-TOC was internalized into the nucleus and bound on the nucleus in a time-dependent manner. 125 I-TOC bound on the nucleus increased to the highest level at 24 h, the amount of nucleus bound 125 I-TOC at 24 h was 7 times higher than that at 0.5 h. Cytotoxicity of 125 I-TOC in SSTR positive NCI-H446 cells was also dose- and time-dependent. The supreme effect of cytotoxicity was found at 96 h with 74 kBq 125 I-TOC, the survival ratio of cells was reduced to (44.8 ± 7.2)%. Conclusions: 125 I-TOC can be internalized into SSTR positive cells mediated by SSTR. The NCI-H446 cells can be killed by Auger electron emitting from 125 I-TOC. Effect of cytotoxicity showed dose- and time-dependent

  5. Analysis of 125I-[Tyr3] octreotide receptors of NCI-H466 cell line

    International Nuclear Information System (INIS)

    Sun Junjie; Fan Wo; Xu Yujie; Zhang Youjiu; Zhu Ran

    2002-01-01

    Objective: To study the affinity of small cell lung carcinoma to [Tyr 3 ] octreotide (TOC). Methods: Taking 125 I-[Tyr 3 ] octreotide (labeled by chloramine-T method), as the ligand, small cell lung carcinoma NCI-H466 cell line was inspected for the receptor-binding points and affinity constant. Results: The radio-chemical purity of 125 I-TOC purified through sephadex G-10 was higher than 95%. Receptor analysis study showed that the expression of somatostatin receptors on NCI-H446 cells was numerous (Bmax = 1.17 x 10 5 /cell) with strong affinity to 125 I-TOC (Kd = 0.56 nM). Conclusion: Labeled TOC could be used for small cell lung carcinoma receptor imaging and radio-pharmaceutical therapy

  6. Achillea millefolium L. hydroethanolic extract inhibits growth of human tumor cell lines by interfering with cell cycle and inducing apoptosis.

    Science.gov (United States)

    Pereira, Joana M; Peixoto, Vanessa; Teixeira, Alexandra; Sousa, Diana; Barros, Lillian; Ferreira, Isabel C F R; Vasconcelos, M Helena

    2018-06-05

    The cell growth inhibitory activity of the hydroethanolic extract of Achillea millefolium was studied in human tumor cell lines (NCI-H460 and HCT-15) and its mechanism of action was investigated. The GI 50 concentration was determined with the sulforhodamine B assay and cell cycle and apoptosis were analyzed by flow cytometry following incubation with PI or Annexin V FITC/PI, respectively. The expression levels of proteins involved in cell cycle and apoptosis were analyzed by Western blot. The extracts were characterized regarding their phenolic composition by LC-DAD-ESI/MS. 3,5-O-Dicaffeoylquinic acid, followed by 5-O-caffeoylquinic acid, were the main phenolic acids, while, luteolin-O-acetylhexoside and apigenin-O-acetylhexoside were the main flavonoids. This extract decreased the growth of the tested cell lines, being more potent in HCT-15 and then in NCI-H460cells. Two different concentrations of the extract (75 and 100 μg/mL) caused alterations in cell cycle profile and increased apoptosis levels in HCT-15 and NCI-H460cells. Moreover, the extract caused an increase in p53 and p21 expression in NCI-H460cells (which have wt p53), and reduced XIAP levels in HCT-15 cells (with mutant p53). This work enhances the importance of A. millefolium as source of bioactive phenolic compounds, particularly of XIAP inhibitors. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. DNA fingerprinting of the NCI-60 cell line panel.

    Science.gov (United States)

    Lorenzi, Philip L; Reinhold, William C; Varma, Sudhir; Hutchinson, Amy A; Pommier, Yves; Chanock, Stephen J; Weinstein, John N

    2009-04-01

    The National Cancer Institute's NCI-60 cell line panel, the most extensively characterized set of cells in existence and a public resource, is frequently used as a screening tool for drug discovery. Because many laboratories around the world rely on data from the NCI-60 cells, confirmation of their genetic identities represents an essential step in validating results from them. Given the consequences of cell line contamination or misidentification, quality control measures should routinely include DNA fingerprinting. We have, therefore, used standard DNA microsatellite short tandem repeats to profile the NCI-60, and the resulting DNA fingerprints are provided here as a reference. Consistent with previous reports, the fingerprints suggest that several NCI-60 lines have common origins: the melanoma lines MDA-MB-435, MDA-N, and M14; the central nervous system lines U251 and SNB-19; the ovarian lines OVCAR-8 and OVCAR-8/ADR (also called NCI/ADR); and the prostate lines DU-145, DU-145 (ATCC), and RC0.1. Those lines also show that the ability to connect two fingerprints to the same origin is not affected by stable transfection or by the development of multidrug resistance. As expected, DNA fingerprints were not able to distinguish different tissues-of-origin. The fingerprints serve principally as a barcodes.

  8. Effect of bcl-2 antisense oligodexynucleotides on chemotherapy efficacy of Vp-16 on human small cell lung cancer cell line NCI-H69

    International Nuclear Information System (INIS)

    He Wenqian; Liu Zhonghua

    2007-01-01

    Objective: To study the effect of bcl-2 antisense oligodexynucleotides on chemotherapy efficacy of Vp-16 on human small cell lung cancer cell line NCI-H69. Methods: Cultured NCI-H69 cells were derided into 4 groups: bcl-2 antisense oligodexynucleotides (ASODN) added, sense oligodexynucleotides (SODN) added, nonsense oligodexynucleotides (NSODN) added and control (no nucleotides added), the oligodexynucleotides were transfected into the cultured cells with oligofectamine. The cellular expression of Bcl-2 protein 72h later was examined with Western-Blot. The four different groups of cultured tumor cells were treated with etopside(Vp-16) at different concentrations (0, 0.25, 0.5, 1.0, 2.0 and 4.0 μg/ml) for 48hr then the cell survival fraction was assessed with MTY test. Results: The apoptotic rate of cells in the ASODN group was significantly higher than that of the control group, also, the survival fraction of cells in ASODN group was significantly lower than that of the control group. The Bcl-2 protein expression in ASODN group was significantly lower than that in the control group, but no inhibition was observed in SODN and NSODN groups. Conclusion: The bcl-2 ASODN could enhance the sensitivity to chemotherapy with Vp-16 in small cell lung cancer cell line NCI-H69 by effectively blocking bcl-2 gene expression. (authors)

  9. Cypripedin, a phenanthrenequinone from Dendrobium densiflorum, sensitizes non-small cell lung cancer H460 cells to cisplatin-mediated apoptosis.

    Science.gov (United States)

    Wattanathamsan, Onsurang; Treesuwan, Surassawadee; Sritularak, Boonchoo; Pongrakhananon, Varisa

    2018-03-01

    The life-threatening potential of lung cancer has increased over the years due to its acquisition of chemotherapeutic resistance, especially to cisplatin, a first-line therapy. In response to this development, researchers have turned their attention to several compounds derived from natural origins, including cypripedin (CYP), a phenanthrenequinone substance extracted from Dendrobium densiflorum. The aim of the present study was to investigate the ability of CYP to induce apoptosis and enhance cisplatin-mediated death of human lung cancer NCI-H460 cells using cell viability and apoptosis assays. The induction of apoptosis by CYP was observed at a concentration of > 50 μM with the appearance of morphological changes, including DNA condensation and chromatin fragmentation. Together with, CYP was able to activate caspase-3 and downregulate the anti-apoptotic proteins Bcl-2 and Bcl-xL. Also, a non-cytotoxic dose of CYP synergistically potentiated the effect of cisplatin in non-small cell lung cancer line H460 cells, which clearly exhibited the apoptotic phenotype. Western blot analysis revealed that the underlying mechanism involved the downregulation of anti-apoptotic Bcl-xL, whereas the levels of other apoptotic regulatory proteins were not altered. This study provides interesting information on the potent effect of CYP as a chemotherapeutic sensitizer that could be further developed to improve the clinical outcomes of lung cancer patients.

  10. Suppression of cancer stem-like phenotypes in NCI-H460 lung cancer cells by vanillin through an Akt-dependent pathway.

    Science.gov (United States)

    Srinual, Songpol; Chanvorachote, Pithi; Pongrakhananon, Varisa

    2017-04-01

    Cancer stem cells (CSCs) have been reported as a major cause of cancer metastasis and the failure of cancer treatment. Cumulative studies have indicated that protein kinase B (Akt) and its downstream signaling pathway, including CSC markers, play a critical role in the aggressive behavior of this cancer. In this study, we investigated whether vanillin, a major component in Vanilla planifolia seed, could suppress cancer stemness phenotypes and related proteins in the human non-small cell lung cancer NCI‑H460 cell line. A non-toxic concentration of vanillin suppressed spheroid and colony formation, two hallmarks of the cancer stemness phenotype, in vitro in NCI‑H460 cells. Western blot analysis revealed that the CSC markers CD133 and ALDH1A1 and the associated transcription factors, Oct4 and Nanog, were extensively downregulated by vanillin. Vanillin also attenuated the expression and activity of Akt, a transcription regulator upstream of CSCs, an action that was confirmed by treatment with the Akt inhibitor perifosine. Furthermore, the ubiquitination of Akt was elevated in response to vanillin treatment prior to proteasomal degradation. This finding indicates that vanillin can inhibit cancer stem cell-like behavior in NCI‑H460 cells through the induction of Akt-proteasomal degradation and reduction of downstream CSC transcription factors. This inhibitory effect of vanillin may be an alternative approach in the treatment against lung cancer metastasis and its resistance to chemotherapy.

  11. Permissivity of the NCI-60 cancer cell lines to oncolytic Vaccinia Virus GLV-1h68

    International Nuclear Information System (INIS)

    Ascierto, Maria Libera; Bedognetti, Davide; Uccellini, Lorenzo; Rossano, Fabio; Ascierto, Paolo A; Stroncek, David F; Restifo, Nicholas P; Wang, Ena; Szalay, Aladar A; Marincola, Francesco M; Worschech, Andrea; Yu, Zhiya; Adams, Sharon; Reinboth, Jennifer; Chen, Nanhai G; Pos, Zoltan; Roychoudhuri, Rahul; Di Pasquale, Giovanni

    2011-01-01

    Oncolytic viral therapy represents an alternative therapeutic strategy for the treatment of cancer. We previously described GLV-1h68, a modified Vaccinia Virus with exclusive tropism for tumor cells, and we observed a cell line-specific relationship between the ability of GLV-1h68 to replicate in vitro and its ability to colonize and eliminate tumor in vivo. In the current study we surveyed the in vitro permissivity to GLV-1h68 replication of the NCI-60 panel of cell lines. Selected cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV) strain. In order to identify correlates of permissity to viral infection, we measured transcriptional profiles of the cell lines prior infection. We observed highly heterogeneous permissivity to VACV infection amongst the cell lines. The heterogeneity of permissivity was independent of tissue with the exception of B cell derivation. Cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV) strain and a significant correlation was found suggesting a common permissive phenotype. While no clear transcriptional pattern could be identified as predictor of permissivity to infection, some associations were observed suggesting multifactorial basis permissivity to viral infection. Our findings have implications for the design of oncolytic therapies for cancer and offer insights into the nature of permissivity of tumor cells to viral infection

  12. Synergistic Effect of Subtoxic-dose Cisplatin and TRAIL to Mediate Apoptosis by Down-regulating Decoy Receptor 2 and Up-regulating Caspase-8, Caspase-9 and Bax Expression on NCI-H460 and A549 Cells

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhang

    2013-05-01

    Full Text Available Objective(s: Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL can selectively induce apoptosis in tumor cells, more than half of tumors including non-small cell lung cancer (NSCLC exhibit TRAIL-resistance. The purpose of this study was to determine whether subtoxic-dose cisplatin and TRAIL could synergistically enhance apoptosis on NSCLC cells and investigate its underlying mechanisms. Materials and Methods:NCI-H460 and A549 cells were treated with TRAIL alone, cisplatin alone or combination treatment in this study. The cytotoxicity was evaluated according to Sulforhodamine B assay, and apoptosis was examined using Hoechst 33342 staining and flow cytometry. The mRNA and protein levels of TRAIL receptors and apoptotic proteins including caspase-8, caspase-9, Bcl-2 and Bax were determined by RT-PCR and Western blotting, respectively. Results:Our results showed that NCI-H460 cells were sensitive to TRAIL, whereas A549 cells were resistant. However, subtoxic-dose cisplatin could enhance the both cells to TRAIL-mediated cell proliferation inhibition and apoptosis. The underlying mechanisms might be associated with the down-regulation of DcR2 and up-regulation of Caspase-8, Caspase-9 and Bax. Conclusion:Subtoxic-dose cisplatin could enhance both TRAIL- sensitive and TRAIL- resistant NSCLC cells to TRAIL-mediated apoptosis. These findings motivated further studies to evaluate such a combinatory therapeutic strategy against NSCLC in the animal models.

  13. Time, Concentration, and pH-Dependent Transport and Uptake of Anthocyanins in a Human Gastric Epithelial (NCI-N87 Cell Line

    Directory of Open Access Journals (Sweden)

    Allison A. Atnip

    2017-02-01

    Full Text Available Anthocyanins are the largest class of water soluble plant pigments and a common part of the human diet. They may have many potential health benefits, including antioxidant, anti-inflammatory, anti-cancer, and cardioprotective activities. However, anthocyanin metabolism is not well understood. Studies suggest that anthocyanins absorption may occur in the stomach, in which the acidic pH favors anthocyanin stability. A gastric epithelial cell line (NCI-N87 has been used to study the behavior of anthocyanins at a pH range of 3.0–7.4. This work examines the effects of time (0–3 h, concentration (50–1500 µM, and pH (3.0, 5.0, 7.4 on the transport and uptake of anthocyanins using NCI-N87 cells. Anthocyanins were transported from the apical to basolateral side of NCI-N87 cells in time and dose dependent manners. Over the treatment time of 3 h the rate of transport increased, especially with higher anthocyanin concentrations. The non-linear rate of transport may suggest an active mechanism for the transport of anthocyanins across the NCI-N87 monolayer. At apical pH 3.0, higher anthocyanin transport was observed compared to pH 5.0 and 7.4. Reduced transport of anthocyanins was found to occur at apical pH 5.0.

  14. Curcumin Inhibits Growth of Human NCI-H292 Lung Squamous Cell Carcinoma Cells by Increasing FOXA2 Expression

    Directory of Open Access Journals (Sweden)

    Lingling Tang

    2018-02-01

    Full Text Available Lung squamous cell carcinoma (LSCC is a common histological lung cancer subtype, but unlike lung adenocarcinoma, limited therapeutic options are available for treatment. Curcumin, a natural compound, may have anticancer effects in various cancer cells, but how it may be used to treat LSCC has not been well studied. Here, we applied curcumin to a human NCI-H292 LSCC cell line to test anticancer effects and explored underlying potential mechanisms of action. Curcumin treatment inhibited NCI-H292 cell growth and increased FOXA2 expression in a time-dependent manner. FOXA2 expression was decreased in LSCC tissues compared with adjacent normal tissues and knockdown of FOXA2 increased NCI-H292 cells proliferation. Inhibition of cell proliferation by curcumin was attenuated by FOXA2 knockdown. Moreover inhibition of STAT3 pathways by curcumin increased FOXA2 expression in NCI-H292 cells whereas a STAT3 activator (IL-6 significantly inhibited curcumin-induced FOXA2 expression. Also, SOCS1 and SOCS3, negative regulators of STAT3 activity, were upregulated by curcumin treatment. Thus, curcumin inhibited human NCI-H292 cells growth by increasing FOXA2 expression via regulation of STAT3 signaling pathways.

  15. Chlorella vulgaris Induces Apoptosis of Human Non-Small Cell Lung Carcinoma (NSCLC) Cells.

    Science.gov (United States)

    Zhang, Zhi-Dong; Liang, Kai; Li, Kun; Wang, Guo-Quan; Zhang, Ke-Wei; Cai, Lei; Zhai, Shui-Ting; Chou, Kuo-Chen

    2017-01-01

    Chlorella vulgaris (C. vulgaris), a unicellular green microalga, has been widely used as a food supplement and reported to have antioxidant and anticancer properties. The current study was designed to assess the cytotoxic, apoptotic, and DNA-damaging effects of C. vulgaris growth factor (CGF), hot water C. vulgaris extracts, inlung tumor A549 and NCI-H460 cell lines. A549 cells, NCI-H460 cells, and normal human fibroblasts were treated with CGF at various concentrations (0-300 μg/ml) for 24 hr. The comet assay and γH2AX assay showed DNA damage in A549 and NCI-H460 cells upon CGF exposure. Evaluation of apoptosis by the TUNEL assay and DNA fragmentation analysis by agarose gel electrophoresis showed that CGF induced apoptosis in A549 and NCI-H460 cells. Chlorella vulgaris hot water extract induced apoptosis and DNA damage in human lung carcinoma cells. CGF can thus be considered a potential cytotoxic or genotoxic drug for treatment of lung carcinoma. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  16. In vitro growth inhibition and cytotoxicity of Euphorbia caducifolia against four human cancer cell lines and its phytochemical characterisation.

    Science.gov (United States)

    Bano, Shaista; Siddiqui, Bina Shaheen; Farooq, Ahsana Dar; Begum, Sabira; Siddiqui, Faheema; Kashif, Muhammad; Azhar, Mudassar

    2017-12-01

    Several Euphorbia species have been used in folklore as cancer remedies, however, scientific studies on the cytotoxicity (in vitro studies) of Euphorbia caducifolia are lacking. In present study, anticancer potential of E. caducifolia aerial parts ethanol extract and its fractions were evaluated against human lung (NCI-H460), breast (MCF-7), prostate (PC-3) and cervical (HeLa) cancer cell lines, using sulphorhodamine-B in vitro cytotoxicity (in vitro studies) assay. The ethanol extract demonstrated growth inhibitory effect against all aforementioned cancer cell lines with IC 50 , 19-135 μg/mL and LC 50 , ~220 μg/mL, and its petroleum ether fraction obtained on bioactivity guided fraction showed highest activity with IC 50 , 28-70 μg/mL and LC 50 , 71 μg/mL against NCI-H460 and MCF-7 cell lines. Its phytochemicals were analysed by gas chromatography-mass spectrometry (GC-MS). The present study provides scientific justification for its traditional use against cancer.

  17. Hexamethoxylated Monocarbonyl Analogues of Curcumin Cause G2/M Cell Cycle Arrest in NCI-H460 Cells via Michael Acceptor-Dependent Redox Intervention.

    Science.gov (United States)

    Li, Yan; Zhang, Li-Ping; Dai, Fang; Yan, Wen-Jing; Wang, Hai-Bo; Tu, Zhi-Shan; Zhou, Bo

    2015-09-09

    Curcumin, derived from the dietary spice turmeric, holds promise for cancer prevention. This prompts much interest in investigating the action mechanisms of curcumin and its analogues. Two symmetrical hexamethoxy-diarylpentadienones (1 and 2) as cucumin analogues were reported to possess significantly enhanced cytotoxicity compared with the parent molecule. However, the detailed mechanisms remain unclear. In this study, compounds 1 and 2 were identified as the G2/M cell cycle arrest agents to mediate the cytotoxicity toward NCI-H460 cells via Michael acceptor-dependent redox intervention. Compared with curcumin, they could more easily induce a burst of reactive oxygen species (ROS) and collapse of the redox buffering system. One possible reason is that they could more effectively target intracellular TrxR to convert this antioxidant enzyme into a ROS promoter. Additionally, they caused up-regulation of p53 and p21 and down-regulation of redox-sensitive Cdc25C along with cyclin B1/Cdk1 in a Michael acceptor- and ROS-dependent fashion. Interestingly, in comparison with compound 2, compound 1 displayed a relatively weak ability to generate ROS but increased cell cycle arrest activity and cytotoxicity probably due to its Michael acceptor-dependent microtubule-destabilizing effect and greater GST-inhibitory activity, as well as its enhanced cellular uptake. This work provides useful information for understanding Michael acceptor-dependent and redox-mediated cytotoxic mechanisms of curcumin and its active analogues.

  18. The primary study of the radiosensitive effect on the H460 cell line by human lactotransferrin high expression in vitro

    International Nuclear Information System (INIS)

    Wang Yong; Wang Yan; Du Liqing; Yang Qingshan; Wang Yueying; Fan Feiyue

    2009-01-01

    Objective: To investigate the possible radiosensitive effect of human Lactotransferrin (hLF) high expression in lung cancer cell, we hereby constructed and transfected a recombinant vector pBC1 containing exogenous hLF gene. Methods: Firstly the recombinant plasmid pBC1-hLF was transferred into H460 and the hLF expression was evaluated by western blotting. Then we test the cell viability, apoptosis and clone formation after radiation along with the standard hLF treatment control. Results: The results showed that the hLF gene had been successfully transfect into H460 cells and hLF high expression can reduce the clone formation after radiation (P<0.01), and inhibit the cell proliferation with induced apoptosis (P<0.01). And the sensitization ratio of hLF treated and pBC1-hLF transfected were 1.29, 1.59. Conclusion: Our primary data shows that hLF high expression can radio sensitize the H460 cell in vitro. (authors)

  19. Global Proteome Analysis of the NCI-60 Cell Line Panel

    Directory of Open Access Journals (Sweden)

    Amin Moghaddas Gholami

    2013-08-01

    Full Text Available The NCI-60 cell line collection is a very widely used panel for the study of cellular mechanisms of cancer in general and in vitro drug action in particular. It is a model system for the tissue types and genetic diversity of human cancers and has been extensively molecularly characterized. Here, we present a quantitative proteome and kinome profile of the NCI-60 panel covering, in total, 10,350 proteins (including 375 protein kinases and including a core cancer proteome of 5,578 proteins that were consistently quantified across all tissue types. Bioinformatic analysis revealed strong cell line clusters according to tissue type and disclosed hundreds of differentially regulated proteins representing potential biomarkers for numerous tumor properties. Integration with public transcriptome data showed considerable similarity between mRNA and protein expression. Modeling of proteome and drug-response profiles for 108 FDA-approved drugs identified known and potential protein markers for drug sensitivity and resistance. To enable community access to this unique resource, we incorporated it into a public database for comparative and integrative analysis (http://wzw.tum.de/proteomics/nci60.

  20. Radiosensitizing effect of PSMC5, a 19S proteasome ATPase, in H460 lung cancer cells

    International Nuclear Information System (INIS)

    Yim, Ji-Hye; Yun, Hong Shik; Lee, Su-Jae; Baek, Jeong-Hwa; Lee, Chang-Woo; Song, Ji-Young; Um, Hong-Duck; Park, Jong Kuk; Kim, Jae-Sung; Park, In-Chul; Hwang, Sang-Gu

    2016-01-01

    The function of PSMC5 (proteasome 26S subunit, ATPase 5) in tumors, particularly with respect to cancer radioresistance, is not known. Here, we identified PSMC5 as a novel radiosensitivity biomarker, demonstrating that radiosensitive H460 cells were converted to a radioresistance phenotype by PSMC5 depletion. Exposure of H460 cells to radiation induced a marked accumulation of cell death-promoting reactive oxygen species, but this effect was blocked in radiation-treated H460 PSMC5-knockdown cells through downregulation of the p53-p21 pathway. Interestingly, PSMC5 depletion in H460 cells enhanced both AKT activation and MDM2 transcription, thereby promoting the degradation of p53 and p21 proteins. Furthermore, specific inhibition of AKT with triciribine or knockdown of MDM2 with small interfering RNA largely restored p21 expression in PSMC5-knockdown H460 cells. Our data suggest that PSMC5 facilitates the damaging effects of radiation in radiation-responsive H460 cancer cells and therefore may serve as a prognostic indicator for radiotherapy and molecular targeted therapy in lung cancer patients. - Highlights: • PSMC5 is a radiation-sensitive biomarker in H460 cells. • PSMC5 depletion inhibits radiation-induced apoptosis in H460 cells. • PSMC5 knockdown blocks ROS generation through inhibition of the p53-p21 pathway. • PSMC5 knockdown enhances p21 degradation via AKT-dependent MDM2 stabilization.

  1. Inactivated Tianjin strain, a novel genotype of Sendai virus, induces apoptosis in HeLa, NCI-H446 and Hep3B cells.

    Science.gov (United States)

    Chen, Jun; Han, Han; Wang, Bin; Shi, Liying

    2016-07-01

    The Sendai virus strain Tianjin is a novel genotype of the Sendai virus. In previous studies, ultraviolet-inactivated Sendai virus strain Tianjin (UV-Tianjin) demonstrated antitumor effects on human breast cancer cells. The aim of the present study was to investigate the in vitro antitumor effects of UV-Tianjin on the human cervical carcinoma HeLa, human small cell lung cancer NCI-H446 and human hepatocellular carcinoma Hep 3B cell lines, and the possible underlying mechanisms of these antitumor effects. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay revealed that UV-Tianjin treatment inhibited the proliferation of HeLa, NCI-H446 and Hep 3B cells in a dose- and time-dependent manner. Hoechst and Annexin V-fluorescein isothiocyanate/propidium iodide double staining indicated that UV-Tianjin induced dose-dependent apoptosis in all three cell lines with the most significant effect observed in the HeLa cell line. In the HeLa cell line, UV-Tianjin-induced apoptosis was further confirmed by the disruption of the mitochondria membrane potential and the activation of caspases, as demonstrated by fluorescent cationic dye and colorimetric assays, respectively. In addition, western blot analysis revealed that UV-Tianjin treatment resulted in significant upregulation of cytochrome c , apoptosis protease activating factor-1, Fas, Fas ligand and Fas-associated protein with death domain, and activated caspase-9, -8 and -3 in HeLa cells. Based on these results, it is hypothesized that UV-Tianjin exhibits anticancer activity in HeLa, NCI-H446 and Hep 3B cell lines via the induction of apoptosis. In conclusion, the results of the present study indicate that in the HeLa cell line, intrinsic and extrinsic apoptotic pathways may be involved in UV-Tianjin-induced apoptosis.

  2. Inhibition of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus.

    Science.gov (United States)

    Chang, Hong-Bin; Chen, Bing-Huei

    2015-01-01

    The objectives of this study were to explore the inhibition mechanism of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus. In addition, human bronchus epithelial cell line BEAS-2B (normal cell) was selected for comparison. A high-performance liquid chromatography (HPLC) method was developed to separate and quantify the various curcuminoids in C. longa extract, including curcumin (1,714.5 μg/mL), demethoxycurcumin (1,147.4 μg/mL), and bisdemethoxycurcumin (190.2 μg/mL). A high-stability nanoemulsion composed of Tween 80, water, and curcuminoid extract was prepared, with mean particle size being 12.6 nm. The cell cycle was retarded at G2/M for both the curcuminoid extract and nanoemulsion treatments; however, the inhibition pathway may be different. H460 cells were more susceptible to apoptosis than A549 cells for both curcuminoid extract and nanoemulsion treatments. Growth of BEAS-2B remained unaffected for both the curcuminoid extract and nanoemulsion treatments, with a concentration range from 1 to 4 μg/mL. Also, the activities of caspase-3, caspase-8, and caspase-9 followed a dose-dependent increase for both A549 and H460 cells for both the treatments, accompanied by a dose-dependent increase in cytochrome C expression and a dose-dependent decrease in CDK1 expression. Interestingly, a dose-dependent increase in cyclin B expression was shown for A549 cells for both the treatments, while a reversed trend was found for H460 cells. Both mitochondria and death receptor pathways may be responsible for apoptosis of both A549 and H460 cells.

  3. Paracytosis of Haemophilus influenzae through cell layers of NCI-H292 lung epithelial cells

    NARCIS (Netherlands)

    van Schilfgaarde, M.; van Alphen, L.; Eijk, P.; Everts, V.; Dankert, J.

    1995-01-01

    Haemophilus influenzae penetrates the respiratory epithelium during carriage and invasive disease, including respiratory tract infections. We developed an in vitro model system consisting of lung epithelial NCI-H292 cells on permeable supports to study the passage of H. influenzae through lung

  4. CellMiner: a relational database and query tool for the NCI-60 cancer cell lines

    Directory of Open Access Journals (Sweden)

    Reinhold William C

    2009-06-01

    Full Text Available Abstract Background Advances in the high-throughput omic technologies have made it possible to profile cells in a large number of ways at the DNA, RNA, protein, chromosomal, functional, and pharmacological levels. A persistent problem is that some classes of molecular data are labeled with gene identifiers, others with transcript or protein identifiers, and still others with chromosomal locations. What has lagged behind is the ability to integrate the resulting data to uncover complex relationships and patterns. Those issues are reflected in full form by molecular profile data on the panel of 60 diverse human cancer cell lines (the NCI-60 used since 1990 by the U.S. National Cancer Institute to screen compounds for anticancer activity. To our knowledge, CellMiner is the first online database resource for integration of the diverse molecular types of NCI-60 and related meta data. Description CellMiner enables scientists to perform advanced querying of molecular information on NCI-60 (and additional types through a single web interface. CellMiner is a freely available tool that organizes and stores raw and normalized data that represent multiple types of molecular characterizations at the DNA, RNA, protein, and pharmacological levels. Annotations for each project, along with associated metadata on the samples and datasets, are stored in a MySQL database and linked to the molecular profile data. Data can be queried and downloaded along with comprehensive information on experimental and analytic methods for each data set. A Data Intersection tool allows selection of a list of genes (proteins in common between two or more data sets and outputs the data for those genes (proteins in the respective sets. In addition to its role as an integrative resource for the NCI-60, the CellMiner package also serves as a shell for incorporation of molecular profile data on other cell or tissue sample types. Conclusion CellMiner is a relational database tool for

  5. Inhibition of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus

    Directory of Open Access Journals (Sweden)

    Chang HB

    2015-08-01

    Full Text Available Hong-Bin Chang,1 Bing-Huei Chen1,21Department of Food Science, 2Graduate Institute of Medicine, Fu Jen Catholic University, Taipei, TaiwanAbstract: The objectives of this study were to explore the inhibition mechanism of lung cancer cells A549 and H460 by curcuminoid extracts and nanoemulsions prepared from Curcuma longa Linnaeus. In addition, human bronchus epithelial cell line BEAS-2B (normal cell was selected for comparison. A high-performance liquid chromatography (HPLC method was developed to separate and quantify the various curcuminoids in C. longa extract, including curcumin (1,714.5 µg/mL, demethoxycurcumin (1,147.4 µg/mL, and bisdemethoxycurcumin (190.2 µg/mL. A high-stability nanoemulsion composed of Tween 80, water, and curcuminoid extract was prepared, with mean particle size being 12.6 nm. The cell cycle was retarded at G2/M for both the curcuminoid extract and nanoemulsion treatments; however, the inhibition pathway may be different. H460 cells were more susceptible to apoptosis than A549 cells for both curcuminoid extract and nanoemulsion treatments. Growth of BEAS-2B remained unaffected for both the curcuminoid extract and nanoemulsion treatments, with a concentration range from 1 to 4 µg/mL. Also, the activities of caspase-3, caspase-8, and caspase-9 followed a dose-dependent increase for both A549 and H460 cells for both the treatments, accompanied by a dose-dependent increase in cytochrome C expression and a dose-dependent decrease in CDK1 expression. Interestingly, a dose-dependent increase in cyclin B expression was shown for A549 cells for both the treatments, while a reversed trend was found for H460 cells. Both mitochondria and death receptor pathways may be responsible for apoptosis of both A549 and H460 cells.Keywords: curcuminoid extract, curcuminoid nanoemulsion, Curcuma longa Linnaeus, lung cancer cell, cell cycle, apoptosis mechanism

  6. Anti-tumor effect of bisphosphonate (YM529 on non-small cell lung cancer cell lines

    Directory of Open Access Journals (Sweden)

    Date Hiroshi

    2007-01-01

    Full Text Available Abstract Background YM529 is a newly developed nitrogen-containing bisphosphonate (BP classified as a third-generation BP that shows a 100-fold greater potency against bone resorption than pamidronate, a second-generation BP. This agent is, therefore expected to be extremely useful clinically for the treatment of osteoporosis and hypercalcemia. Recently, YM529 as well as other third-generation BPs have also been shown to exert anti-tumor effects against various types of cancer cells both in vitro or/and in vivo. In this study, we investigate the anti-tumor effect of YM529 on non-small cell lung cancer (NSCLC. Methods Direct anti-tumor effect of YM529 against 8 NSCLC cell lines (adenocarcinoma: H23, H1299, NCI-H1819, NCI-H2009, H44, A549, adenosquamous cell carcinoma: NCI-H125, squamous cell carcinoma: NCI-H157 were measured by MTS assay and calculated inhibition concentration 50 % (IC50 values. YM529 induced apoptosis of NCI-H1819 was examined by DNA fragmentation of 2 % agarose gel electrophoresis and flowcytometric analysis (sub-G1 method. We examined where YM529 given effect to apoptosis of NSCLC cells in signaling pathway of the mevalonate pathway by western blotting analysis. Results We found that there was direct anti-tumor effect of YM529 on 8 NSCLC cell lines in a dose-dependent manner and their IC50 values were 2.1 to 7.9 μM and YM529 induced apoptosis and G1 arrest cell cycle with dose-dependent manner and YM529 caused down regulation of phospholyration of ERK1/2 in signaling pathways of NSCLC cell line (NCI-H1819. Conclusion Our study demonstrate that YM529 showed direct anti-tumor effect on NSCLC cell lines in vitro, which supports the possibility that third-generation BPs including YM529 can be one of therapeutic options for NSCLC.

  7. Fisetin induces apoptosis and endoplasmic reticulum stress in human non-small cell lung cancer through inhibition of the MAPK signaling pathway.

    Science.gov (United States)

    Kang, Kyoung Ah; Piao, Mei Jing; Madduma Hewage, Susara Ruwan Kumara; Ryu, Yea Seong; Oh, Min Chang; Kwon, Taeg Kyu; Chae, Sungwook; Hyun, Jin Won

    2016-07-01

    Fisetin (3,3',4',7-tetrahydroxyflavone), a dietary flavonoid compound, is currently being investigated for its anticancer effect in various cancer models, including lung cancer. Recent studies show that fisetin induces cell growth inhibition and apoptosis in the human non-small cell lung cancer line NCI-H460. In this study, we investigated whether fisetin can induce endoplasmic reticulum (ER) stress-mediated apoptosis in NCI-H460 cells. Fisetin induced mitochondrial reactive oxygen species (ROS) and characteristic signs of ER stress: ER staining; mitochondrial Ca(2+) overload; expression of ER stress-related proteins; glucose-regulated protein (GRP)-78, phosphorylation of protein kinase RNA (PKR)-like endoplasmic reticulum kinase (PERK) and phosphorylation of eukaryotic initiation factor-2 α subunit; cleavage of activating transcription factor-6; phosphorylation of inositol-requiring kinase-1 and splicing of X-box transcription factor-1; induction of C/EBP homologous protein and cleaved caspase-12. siRNA-mediated knockdown of CHOP and ATF-6 attenuated fisetin-induced apoptotic cell death. In addition, fisetin induced phosphorylation of ERK, JNK, and p38 MAPK. Moreover, silencing of the MAPK signaling pathway prevented apoptotic cell death. In summary, our results indicate that, in NCI-H460 cells, fisetin induces apoptosis and ER stress that is mediated by induction of the MAPK signaling pathway.

  8. Preparation of Rhodium(III) complexes with 2(1H)-quinolinone derivatives and evaluation of their in vitro and in vivo antitumor activity.

    Science.gov (United States)

    Lu, Xing; Wu, Yi-Ming; Yang, Jing-Mei; Ma, Feng-E; Li, Liang-Ping; Chen, Sheng; Zhang, Ye; Ni, Qing-Ling; Pan, Ying-Ming; Hong, Xue; Peng, Yan

    2018-05-10

    A series of 2(1H)-quinolinone derivatives and their rhodium (III) complexes were designed and synthesized. All the rhodium (III) complexes exhibited higher in vitro cytotoxicity for Hep G2, HeLa 229, MGC80-3, and NCI-H460 human tumor cell lines than their ligands and cisplatin, and among them complex 9 was found to be selectively cytotoxic to tumor cells. Further investigation revealed that complex 9 caused cell cycle arrest at the G2/M phase and induced apoptosis, and inhibited the proliferation of Hep G2 cells by impeding the phosphorylation of epidermal growth factor receptor (EGFR) and its downstream enzymes. Complex 9 also up-regulated the proapoptotic proteins Bak, Bax, and Bim, which altogether activated caspase-3/9 to initiate cell apoptosis. Notably, complex 9 effectively inhibited tumor growth in the NCI-H460 xenograft mouse model with less adverse effect than cisplatin. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  9. Arctigenin enhances chemosensitivity to cisplatin in human nonsmall lung cancer H460 cells through downregulation of survivin expression.

    Science.gov (United States)

    Wang, Huan-qin; Jin, Jian-jun; Wang, Jing

    2014-01-01

    Arctigenin, a dibenzylbutyrolactone lignan, enhances cisplatin-mediated cell apoptosis in cancer cells. Here, we sought to investigate the effects of arctigenin on cisplatin-treated non-small-cell lung cancer (NSCLC) H460 cells. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and annexin-V/propidium iodide staining were performed to analyze the proliferation and apoptosis of H460 cells. Arctigenin dose-dependently suppressed cell proliferation and potentiated cell apoptosis, coupled with increased cleavage of caspase-3 and poly(ADP-ribose) polymerase. Moreover, arctigenin sensitized H460 cells to cisplatin-induced proliferation inhibition and apoptosis. Arctigenin alone or in combination with cisplatin had a significantly lower amount of survivin. Ectopic expression of survivin decreased cell apoptosis induced by arctigenin (P arctigenin (P arctigenin has a therapeutic potential in combina-tion with chemotherapeutic agents for NSLC. © 2013 Wiley Periodicals, Inc.

  10. Furano diterpenes from Pterodon pubescens Benth with selective in vitro anticancer activity for prostate cell line

    International Nuclear Information System (INIS)

    Spindola, Humberto M.; Carvalho, Joao E. de; Ruiz, Ana Lucia T.G.; Rodrigues, Rodney A. F.; Denny, Carina; Sousa, Ilza M. de Oliveira; Foglio, Mary Ann; Tamashiro, Jorge Y.

    2009-01-01

    Activity guided fractionation of Pterodon pubescens Benth. methylene chloride-soluble fraction afforded novel 6α-acetoxi 7β-hydroxy-vouacapan 1 and four known diterpene furans 2, 3, 4, 5. The compounds were evaluated for in vitro cytotoxic activities against human normal cells and tumour cell lines UACC-62 (melanoma), MCF-7 (breast), NCI-H460 (lung, non-small cells), OVCAR-03 (ovarian), PC-3 (prostate), HT-29 (colon), 786-0 (renal), K562 (leukemia) and NCI-ADR/RES (ovarian expressing phenotype multiple drugs resistance). Results were expressed by three concentration dependent parameters GI 50 (concentration that produces 50% growth inhibition), TGI (concentration that produces total growth inhibition or cytostatic effect) and LC 50 (concentration that produces .50% growth, a cytotoxicity parameter). Also, in vitro cytotoxicity was evaluated against 3T3 cell line (mouse embryonic fibroblasts). Antiproliferative properties of compounds 1, 4 and 5 are herein reported for the first time. These compounds showed selectivity in a concentration-dependent way against human PC-3. Compound 1 demonstrated selectivity 26 fold more potent than the positive control, doxorubicin, for PC-3 (prostrate) cell line based on GI 50 values, causing cytostatic effect (TGI value) at a concentration fifteen times less than positive control. Moreover comparison of 50% lethal concentration (LC 50 value) with positive control (doxorubicin) suggested that compound 1 was less toxic. (author)

  11. Enhanced Missing Proteins Detection in NCI60 Cell Lines Using an Integrative Search Engine Approach.

    Science.gov (United States)

    Guruceaga, Elizabeth; Garin-Muga, Alba; Prieto, Gorka; Bejarano, Bartolomé; Marcilla, Miguel; Marín-Vicente, Consuelo; Perez-Riverol, Yasset; Casal, J Ignacio; Vizcaíno, Juan Antonio; Corrales, Fernando J; Segura, Victor

    2017-12-01

    The Human Proteome Project (HPP) aims deciphering the complete map of the human proteome. In the past few years, significant efforts of the HPP teams have been dedicated to the experimental detection of the missing proteins, which lack reliable mass spectrometry evidence of their existence. In this endeavor, an in depth analysis of shotgun experiments might represent a valuable resource to select a biological matrix in design validation experiments. In this work, we used all the proteomic experiments from the NCI60 cell lines and applied an integrative approach based on the results obtained from Comet, Mascot, OMSSA, and X!Tandem. This workflow benefits from the complementarity of these search engines to increase the proteome coverage. Five missing proteins C-HPP guidelines compliant were identified, although further validation is needed. Moreover, 165 missing proteins were detected with only one unique peptide, and their functional analysis supported their participation in cellular pathways as was also proposed in other studies. Finally, we performed a combined analysis of the gene expression levels and the proteomic identifications from the common cell lines between the NCI60 and the CCLE project to suggest alternatives for further validation of missing protein observations.

  12. Resveratrol enhances radiosensitivity of human non-small cell lung cancer NCI-H838 cells accompanied by inhibition of nuclear factor-kappa B activation

    International Nuclear Information System (INIS)

    Liao, Hui-Fen; Kuo Cheng-Deng; Yang, Yuh-Cheng; Lin, Chin-Ping; Tai, Hung-Chi; Chen, Yu-Jen; Chen, Yu-Yawn

    2005-01-01

    Resveratrol, a polyphenol in red wine, possesses many pharmacological activities including cardio-protection, chemoprevention, anti-tumor effects, and nuclear factor-kappa B (NF-κB) inactivation. The present study was designed to evaluate the effects and possible mechanism of resveratrol in enhancing radiosensitivity of lung cancer cells. Human non-small cell lung cancer NCI-H838 cells were irradiated with or without resveratrol pretreatment. The surviving fraction and sensitizer enhancement ratio (SER) were estimated by using a colony formation assay and linear-quadratic model. The cell-cycle distribution was evaluated by using prospidium iodide staining and flow cytometry. An enzyme-linked immunosorbent assay (ELISA)-based assay with immobilized oligonucleotide was performed to assess the DNA binding activity of NF-κB. Resveratrol had no direct growth-inhibitory effect on NCI-H838 cells treated for 24 hours with doses up to 25 μM. Pretreatment with resveratrol significantly enhanced cell killing by radiation, with an SER up to 2.2. Radiation activated NF-κB, an effect reversed by resveratrol pretreatment. Resveratrol resulted in a decrease of cells in the G 0 /G 1 phase and an increase in the S phase. Our results demonstrate that resveratrol enhances the radiosensitivity of NCI-H838 cells accompanied by NF-κB inhibition and S-phase arrest. (author)

  13. Cytotoxicity of Portuguese Propolis: The Proximity of the In Vitro Doses for Tumor and Normal Cell Lines

    Directory of Open Access Journals (Sweden)

    Ricardo C. Calhelha

    2014-01-01

    Full Text Available With a complex chemical composition rich in phenolic compounds, propolis (resinous substance collected by Apis mellifera from various tree buds exhibits a broad spectrum of biological activities. Recently, in vitro and in vivo data suggest that propolis has anticancer properties, but is the cytoxicity of propolis specific for tumor cells? To answer this question, the cytotoxicity of phenolic extracts from Portuguese propolis of different origins was evaluated using human tumor cell lines (MCF7—breast adenocarcinoma, NCI-H460—non-small cell lung carcinoma, HCT15—colon carcinoma, HeLa—cervical carcinoma, and HepG2—hepatocellular carcinoma, and non-tumor primary cells (PLP2. The studied propolis presented high cytotoxic potential for human tumor cell lines, mostly for HCT15. Nevertheless, excluding HCT15 cell line, the extracts at the GI50 obtained for tumor cell lines showed, in general, cytotoxicity for normal cells (PLP2. Propolis phenolic extracts comprise phytochemicals that should be further studied for their bioactive properties against human colon carcinoma. In the other cases, the proximity of the in vitro cytotoxic doses for tumor and normal cell lines should be confirmed by in vivo tests and may highlight the need for selection of specific compounds within the propolis extract.

  14. Variations in Mre11/Rad50/Nbs1 status and DNA damage-induced S-phase arrest in the cell lines of the NCI60 panel

    Directory of Open Access Journals (Sweden)

    Eastman Alan

    2011-05-01

    Full Text Available Abstract Background The Mre11/Rad50/Nbs1 (MRN complex is a regulator of cell cycle checkpoints and DNA repair. Defects in MRN can lead to defective S-phase arrest when cells are damaged. Such defects may elicit sensitivity to selected drugs providing a chemical synthetic lethal interaction that could be used to target therapy to tumors with these defects. The goal of this study was to identify these defects in the NCI60 panel of cell lines and identify compounds that might elicit selective cytotoxicity. Methods We screened the NCI60 panel in search of cell lines that express low levels of MRN proteins, or that fail to arrest in S-phase in response to the topisomerase I inhibitor SN38. The NCI COMPARE program was used to discover compounds that preferentially target cells with these phenotypes. Results HCT116 cells were initially identified as defective in MRN and S phase arrest. Transfection with Mre11 also elevated Rad50 and Nbs1, and rescued the defective S-phase arrest. Cells of the NCI60 panel exhibited a large range of protein expression but a strong correlation existed between Mre11, Rad50 and Nbs1 consistent with complex formation determining protein stability. Mre11 mRNA correlated best with protein level suggesting it was the primary determinant of the overall level of the complex. Three other cell lines failed to arrest in response to SN38, two of which also had low MRN. However, other cell lines with low MRN still arrested suggesting low MRN does not predict an inability to arrest. Many compounds, including a family of benzothiazoles, correlated with the failure to arrest in S phase. The activity of benzothiazoles has been attributed to metabolic activation and DNA alkylation, but we note several cell lines in which sensitivity does not correlate with metabolism. We propose that the checkpoint defect imposes an additional mechanism of sensitivity on cells. Conclusions We have identified cells with possible defects in the MRN complex

  15. Variations in Mre11/Rad50/Nbs1 status and DNA damage-induced S-phase arrest in the cell lines of the NCI60 panel

    International Nuclear Information System (INIS)

    Garner, Kristen M; Eastman, Alan

    2011-01-01

    The Mre11/Rad50/Nbs1 (MRN) complex is a regulator of cell cycle checkpoints and DNA repair. Defects in MRN can lead to defective S-phase arrest when cells are damaged. Such defects may elicit sensitivity to selected drugs providing a chemical synthetic lethal interaction that could be used to target therapy to tumors with these defects. The goal of this study was to identify these defects in the NCI60 panel of cell lines and identify compounds that might elicit selective cytotoxicity. We screened the NCI60 panel in search of cell lines that express low levels of MRN proteins, or that fail to arrest in S-phase in response to the topisomerase I inhibitor SN38. The NCI COMPARE program was used to discover compounds that preferentially target cells with these phenotypes. HCT116 cells were initially identified as defective in MRN and S phase arrest. Transfection with Mre11 also elevated Rad50 and Nbs1, and rescued the defective S-phase arrest. Cells of the NCI60 panel exhibited a large range of protein expression but a strong correlation existed between Mre11, Rad50 and Nbs1 consistent with complex formation determining protein stability. Mre11 mRNA correlated best with protein level suggesting it was the primary determinant of the overall level of the complex. Three other cell lines failed to arrest in response to SN38, two of which also had low MRN. However, other cell lines with low MRN still arrested suggesting low MRN does not predict an inability to arrest. Many compounds, including a family of benzothiazoles, correlated with the failure to arrest in S phase. The activity of benzothiazoles has been attributed to metabolic activation and DNA alkylation, but we note several cell lines in which sensitivity does not correlate with metabolism. We propose that the checkpoint defect imposes an additional mechanism of sensitivity on cells. We have identified cells with possible defects in the MRN complex and S phase arrest, and a series of compounds that may

  16. Expression of G-protein inwardly rectifying potassium channels (GIRKs in lung cancer cell lines

    Directory of Open Access Journals (Sweden)

    Schuller Hildegard M

    2005-08-01

    Full Text Available Abstract Background Previous data from our laboratory has indicated that there is a functional link between the β-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in human breast cancer cell lines. We wanted to determine if GIRK channels were expressed in lung cancers and if a similar link exists in lung cancer. Methods GIRK1-4 expression and levels were determined by reverse transcription polymerase chain reaction (RT-PCR and real-time PCR. GIRK protein levels were determined by western blots and cell proliferation was determined by a 5-bromo-2'-deoxyuridine (BrdU assay. Results GIRK1 mRNA was expressed in three of six small cell lung cancer (SCLC cell lines, and either GIRK2, 3 or 4 mRNA expression was detected in all six SCLC cell lines. Treatment of NCI-H69 with β2-adrenergic antagonist ICI 118,551 (100 μM daily for seven days led to slight decreases of GIRK1 mRNA expression levels. Treatment of NCI-H69 with the β-adrenergic agonist isoproterenol (10 μM decreased growth rates in these cells. The GIRK inhibitor U50488H (2 μM also inhibited proliferation, and this decrease was potentiated by isoproterenol. In the SCLC cell lines that demonstrated GIRK1 mRNA expression, we also saw GIRK1 protein expression. We feel these may be important regulatory pathways since no expression of mRNA of the GIRK channels (1 & 2 was found in hamster pulmonary neuroendocrine cells, a suggested cell of origin for SCLC, nor was GIRK1 or 2 expression found in human small airway epithelial cells. GIRK (1,2,3,4 mRNA expression was also seen in A549 adenocarcinoma and NCI-H727 carcinoid cell lines. GIRK1 mRNA expression was not found in tissue samples from adenocarcinoma or squamous cancer patients, nor was it found in NCI-H322 or NCI-H441 adenocarcinoma cell lines. GIRK (1,3,4 mRNA expression was seen in three squamous cell lines, GIRK2 was only expressed in one squamous cell line. However, GIRK1 protein

  17. Expression of P-gp, MRP, LRP, GST-π and TopoIIα and intrinsic resistance in human lung cancer cell lines.

    Science.gov (United States)

    Wang, Jiarui; Zhang, Jinhui; Zhang, Lichuan; Zhao, Long; Fan, Sufang; Yang, Zhonghai; Gao, Fei; Kong, Ying; Xiao, Gary Guishan; Wang, Qi

    2011-11-01

    This study aimed to determine the relationship between the endogenous levels of P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP), lung resistance-related protein (LRP), glutathione-s-transferase-π (GST‑π) and topoisomerase IIα (TopoIIα) and intrinsic drug resistance in four human lung cancer cell lines, SK-MES-1, SPCA-1, NCI-H-460 and NCI-H-446, of different histological types. The expression of P-gp, MRP, LRP, GST-π and TopoIIα was measured by immunofluorescence, Western blotting and RT-PCR. Drug resistance to cisplatin, doxorubicin and VP-16 was determined using MTT assays. The correlation between expression of the resistance-related proteins and their roles in the resistance to drugs in these cancer cell lines was analyzed. We found that the endogenous levels of P-gp, MRP, LRP, GST-π and TopoIIα in the four cell lines varied. The level of GST-π in the SK-MES-1 cells was the highest, whereas the level of P-gp in the SPCA-1 cells was the lowest. The chemoresistance to cisplatin, doxorubicin and VP-16 in the four cell lines was different. The SPCA-1 cell line was most resistance to cisplatin; SK-MES-1 was most resistance to VP-16; whereas SK-MES-1 was most sensitive to doxorubicin. There was a positive correlation between GST-π expression and resistance to cisplatin, between TopoIIα expression and resistance to VP-16; and a negative correlation was noted between TopoIIα expression and resistance to doxorubicin. In summary, the endogenous expression of P-gp, MRP, LRP, GST-π and TopoIIα was different in the four human lung cancer cell lines of different histological types, and this variance may be associated with the variation in chemosensitivity to cisplatin, doxorubicin and VP-16. Among the related proteins, GST-π may be useful for the prediction of the intrinsic resistance to cisplatin, whereas TopoIIα may be useful to predict resistance to doxorubicin and VP-16 in human lung cancer cell lines.

  18. Data Sets from Major NCI Initiaves

    Science.gov (United States)

    The NCI Data Catalog includes links to data collections produced by major NCI initiatives and other widely used data sets, including animal models, human tumor cell lines, epidemiology data sets, genomics data sets from TCGA, TARGET, COSMIC, GSK, NCI60.

  19. In vitro incorporation studies of 99mTc-alendronate sodium at different bone cell lines

    International Nuclear Information System (INIS)

    Evren Gundogdu; Derya Ilem-Ozdemir; Makbule Asikoglu

    2014-01-01

    Bisphosphonates can be labeled with Technetium-99m ( 99m Tc) and are used for bone imaging because of their good localization in the skeleton and rapid clearance from soft tissues. Over the last decades bone scintigraphy has been used extensively in the evaluation of oncological patients to provide information about the sites of bone lesions, their prognosis and the effectiveness of therapy by showing the sequential changes in tracer uptake. Since the lesion visualization and lesion/bone ratio are important utilities for a bone scanning radiopharmaceutic; in this study incorporation of 99m Tc labeled alendronate sodium ( 99m Tc-ALD) was evaluated in U 2 OS (human bone osteosarcoma) and NCI-H209 (human bone carcinoma) cell lines. ALD was directly labeled by 99m Tc, radiochemical purity and stability of the complex were analyzed by radioactive thin layer chromatography and radioactive high performance liquid chromatography studies. For cell incorporation study, NCI-H209 and U 2 OS cell lines were used with standard cell culture methods. The six well plates were used for all experiments and the integrity of each cell monolayer was checked by measuring its transepithelial electrical resistance (TEER) with an epithelial voltammeter. Results confirmed that ALD was successfully radiolabeled with 99m Tc. 99m Tc-ALD incorporated with NCI-H209 and U 2 OS cells. The uptake percentages of 99m Tc-ALD in NCI-H209 and U 2 OS cell lines were found significantly different. Since 99m Tc-ALD highly uptake in cancer cell line, the results demonstrated that radiolabeled ALD may be a promising agent for bone cancer diagnosis. (author)

  20. The In Vitro Anti-Tumor Activity of Phycocyanin against Non-Small Cell Lung Cancer Cells

    Directory of Open Access Journals (Sweden)

    Shuai Hao

    2018-05-01

    Full Text Available Phycocyanin, a type of functional food colorant, is shown to have a potent anti-cancer property. Non-small cell lung cancer (NSCLC is one of the most aggressive form of cancers with few effective therapeutic options. Previous studies have demonstrated that phycocyanin exerts a growth inhibitory effect on NSCLC A549 cells. However, its biological function and underlying regulatory mechanism on other cells still remain unknown. Here, we investigated the in vitro function of phycocyanin on three typical NSCLC cell lines, NCI-H1299, NCI-H460, and LTEP-A2, for the first time. The results showed that phycocyanin could significantly induce apoptosis, cell cycle arrest, as well as suppress cell migration, proliferation, and the colony formation ability of NSCLC cells through regulating multiple key genes. Strikingly, phycocyanin was discovered to affect the cell phenotype through regulating the NF-κB signaling of NSCLC cells. Our findings demonstrated the anti-neoplastic function of phycocyanin and provided valuable information for the regulation of phycocyanin in NSCLC cells.

  1. Electromechanical transducer for rapid detection, discrimination and quantification of lung cancer cells

    International Nuclear Information System (INIS)

    Ali, Waqas; Raza, Muhammad Usman; Iqbal, Samir M; Moghaddam, Fatemeh Jalvhei; Bui, Loan; Sayles, Bailey; Kim, Young-Tae

    2016-01-01

    Tumor cells are malignant derivatives of normal cells. There are characteristic differences in the mechanophysical properties of normal and tumor cells, and these differences stem from the changes that occur in the cell cytoskeleton during cancer progression. There is a need for viable whole blood processing techniques for rapid and reliable tumor cell detection that do not require tagging. Micropore biosensors have previously been used to differentiate tumor cells from normal cells and we have used a micropore-based electromechanical transducer to differentiate one type of tumor cells from the other types. This device generated electrical signals that were characteristic of the cell properties. Three non-small cell lung cancer (NSCLC) cell lines, NCl-H1155, A549 and NCI-H460, were successfully differentiated. NCI-H1155, due to their comparatively smaller size, were found to be the quickest in translocating through the micropore. Their translocation through a 15 μm micropore caused electrical pulses with an average translocation time of 101 ± 9.4 μs and an average peak amplitude of 3.71 ± 0.42 μA, whereas translocation of A549 and NCI-H460 caused pulses with average translocation times of 126 ± 17.9 μs and 148 ± 13.7 μs and average peak amplitudes of 4.58 ± 0.61 μA and 5.27 ± 0.66 μA, respectively. This transformation of the differences in cell properties into differences in the electrical profiles (i.e. the differences in peak amplitudes and translocation times) with this electromechanical transducer is a quantitative way to differentiate these lung cancer cells. The solid-state micropore device processed whole biological samples without any pre-processing requirements and is thus ideal for point-of-care applications. (paper)

  2. Characterization of the effects of cyclooxygenase-2 inhibition in the regulation of apoptosis in human small and non-small cell lung cancer cell lines.

    LENUS (Irish Health Repository)

    Alam, Mahmood

    2012-02-03

    BACKGROUND: Cyclooxygenase-2 enzyme (COX-2) is overexpressed in human non-small cell lung cancer (NSCLC) but is not expressed in small cell lung cancer. Selective COX-2 inhibitors have been shown to induce apoptosis in NSCLC cells, an effect which is associated with the regulation of intracellular MAP kinase (MAPK) signal pathways. Our aims were to characterize the effects of COX-2 inhibition by rofecoxib on apoptosis in human NSCLC and small cell lung cancer cell lines. METHODS: The human NSCLC cell line NCI-H2126 and small cell lung cancer cell line DMS-79 were used. Constitutive COX-2 protein levels were first determined by Western blot test. Levels of apoptosis were evaluated by using propidium iodide staining on FACScan analysis after incubation of NCI-H2126 and DMS-79 with p38 MAPK inhibitor SB202190 (25 ?microM), NF-kappaB inhibitor SN50 (75 microg\\/mL), and rofecoxib at 100 and 250 microM. All statistical analysis was performed by analysis of variance. RESULTS: Western blot test confirmed the presence of COX-2 enzyme in NCI-H2126 and absence in DMS-79. Interestingly, rofecoxib treatment demonstrated a dose-dependent increase in apoptosis in both cell lines. Given this finding, the effect of rofecoxib on NF-kappaB and p38 MAPK pathways was also examined. Apoptosis in both cell lines was unaltered by SN50, either alone or in combination with rofecoxib. A similar phenomenon was observed in NCI-H2126 cells treated with SB202190, either alone or in combination with rofecoxib. In contrast, p38 MAPK inhibition greatly upregulated DMS-79 apoptosis in a manner that was unaltered by the addition of rofecoxib. CONCLUSIONS: Rofecoxib led to a dose-dependent increase in apoptosis in both tumor cell lines. This effect occurred independently of COX-2, NF-kappaB, and p38 MAPK pathways in DMS-79 cells. As such, rofecoxib must act on alternative pathways to regulate apoptosis in human small cell lung cancer cells.

  3. Down-regulation of GRP78 is associated with the sensitivity of chemotherapy to VP-16 in small cell lung cancer NCI-H446 cells

    International Nuclear Information System (INIS)

    Wang, Yingyan; Wang, Wei; Wang, Siyan; Wang, Jiarui; Shao, Shujuan; Wang, Qi

    2008-01-01

    Chemotherapy resistance remains a major obstacle for the treatment of small cell lung cancer (SCLC). Glucose-regulated protein 78 (GRP78), an endoplasmic reticulum chaperone, plays a critical role in chemotherapy resistance in some cancers. However, whether the suppression of the chaperone can enhance the sensitivity of chemotherapy in SCLC is still unclear. The SCLC NCI-H446 cells were divided into three groups: BAPTA-AM→A23187-treated group, A23187-treated group and control-group. Immunofluorescence, western blot and RT-PCR were used to assess the expression of GRP78 at both protein and mRNA levels. Cell apoptosis and the cell cycle distributions of the cells were analyzed by flow cytometry in order to evaluate the therapeutic sensitivity to VP-16. The expression of GRP78 at both protein and mRNA levels in the BAPTA-AM→A23187-treated cells dramatically decreased as compared to that in both A23187-treated and control groups. After treatment by VP-16, the percentage of apoptotic cells in BAPTA-AM→A23187-treated cells were: 33.4 ± 1.01%, 48.2 ± 1.77%, 53.0 ± 1.43%, 56.5 ± 2.13%, respectively, corresponding to the concentrations of BAPTA-AM 10, 15, 25, 40 μM, which was statistically significant high in comparison with the A23187-treated group and untreated-group (7.18 ± 1.03% and 27.8 ± 1.45%, respectively, p < 0.05). The results from analysis of cell cycle distribution showed that there was a significantly decreased in G 1 phase and a dramatically increased in S phase for the BAPTA-AM→A23187-treated cells as compared with the untreated cells. BAPTA-AM is a strong inhibitor of GRP78 in the NCI-H446 cell line, the down-regulation of GRP78 can significantly increase the sensitivity to VP-16. The suppression of GRP78 may offer a new surrogated therapeutic approach to the clinical management of lung cancer

  4. Esters of Quinoxaline 1ˏ4-Di-N-oxide with Cytotoxic Activity on Tumor Cell Lines Based on NCI-60 Panel

    Science.gov (United States)

    Rivera, Gildardo; Ahmad Shah, Syed Shoaib; Arrieta-Baez, Daniel; Palos, Isidro; Mongue, Antonio; Sánchez-Torres, Luvia Enid

    2017-01-01

    Quinoxalines display diverse and interesting pharmacological activities as antibacterial, antiviral, antiparasitic and anticancer agents. Particularly, their 1ˏ4-di-N-oxide derivatives have proved to be cytotoxic agents that are active under hypoxic conditions as that of solid tumours. A new series of quinoxaline 1ˏ4-di-N-oxide substitutes at 7-position with esters group were synthetized and characterized by infrared (IR), proton nuclear magnetic resonance (1H-NMR), spectroscopy, and elemental analysis. Seventeen derivatives (M1-M3, E1-E8, P1-P3 and DR1-DR3) were selected and evaluated for antitumor activities using the NCI-60 human tumor cell lines screen. Results showed that E7, P3 and E6 were the most active compounds against the cell lines tested. Substitutions at 7-position with esters group not necessarily affect the biological activity, but the nature of the esters group could exert an influence on the selectivity. Additionally, substitutions at 2-position influenced the cytotoxic activity of the compounds. PMID:29201086

  5. Preparation of oligonucleotide microarray for radiation-associated gene expression detection and its application in lung cancer cell lines

    International Nuclear Information System (INIS)

    Guo Wanfeng; Lin Ruxian; Huang Jian; Guo Guozhen; Wang Shengqi

    2005-01-01

    Objective: The response of tumor cell to radiation is accompanied by complex change in patterns of gene expression. It is highly probable that a better understanding of molecular and genetic changes can help to sensitize the radioresistant tumor cells. Methods: Oligonucleotide microarray provides a powerful tool for high-throughput identifying a wider range of genes involved in the radioresistance. Therefore, the authors designed one oligonucleotide microarray according to the biological effect of IR. By using different radiosensitive lung cancer cell lines, the authors identified genes showing altered expression in lung cancer cell lines. To provide independent confirmation of microarray data, semi-quantitative RT-PCR was performed on a selection of genes. Results: In radioresistant A549 cell lines, a total of 18 genes were selected as having significant fold-changes compared to NCI-H446, 8 genes were up-regulated and 10 genes were down-regulated. Subsequently, A549 and NCI-H446 cells were delivered by ionizing radiation. In A549 cell line, we found 22 (19 up-regulated and 3 down-regulated) and 26 (8 up-regulated and 18 down-regulated) differentially expressed genes at 6h and 24h after ionizing radiation. In NCI-H446 cell line, we identified 17 (9 up-regulated and 8 down-regulated) and 18 (6 up-regulated and 12 down-regulated) differentially expressed genes at 6 h and 24 h after ionizing radiation. The authors tested seven genes (MDM2, p53, XRCC5, Bcl-2, PIM2, NFKBIA and Cyclin B1) for RT-PCR, and found that the results were in good agreement with those from the microarray data except for NFKBIA gene, even though the value for each mRNA level might be different between the two measurements. In present study, the authors identified some genes with cell proliferation and anti-apoptosis, such as MdM2, BCL-2, PKCz and PIM2 expression levels increased in A549 cells and decreased in NCI-H446 cells after radiation, and other genes with DNA repair, such as XRCC5, ERCC5

  6. Zinc finger nuclease mediated knockout of ADP-dependent glucokinase in cancer cell lines: effects on cell survival and mitochondrial oxidative metabolism.

    Directory of Open Access Journals (Sweden)

    Susan Richter

    Full Text Available Zinc finger nucleases (ZFN are powerful tools for editing genes in cells. Here we use ZFNs to interrogate the biological function of ADPGK, which encodes an ADP-dependent glucokinase (ADPGK, in human tumour cell lines. The hypothesis we tested is that ADPGK utilises ADP to phosphorylate glucose under conditions where ATP becomes limiting, such as hypoxia. We characterised two ZFN knockout clones in each of two lines (H460 and HCT116. All four clones had frameshift mutations in all alleles at the target site in exon 1 of ADPGK, and were ADPGK-null by immunoblotting. ADPGK knockout had little or no effect on cell proliferation, but compromised the ability of H460 cells to survive siRNA silencing of hexokinase-2 under oxic conditions, with clonogenic survival falling from 21±3% for the parental line to 6.4±0.8% (p = 0.002 and 4.3±0.8% (p = 0.001 for the two knockouts. A similar increased sensitivity to clonogenic cell killing was observed under anoxia. No such changes were found when ADPGK was knocked out in HCT116 cells, for which the parental line was less sensitive than H460 to anoxia and to hexokinase-2 silencing. While knockout of ADPGK in HCT116 cells caused few changes in global gene expression, knockout of ADPGK in H460 cells caused notable up-regulation of mRNAs encoding cell adhesion proteins. Surprisingly, we could discern no consistent effect on glycolysis as measured by glucose consumption or lactate formation under anoxia, or extracellular acidification rate (Seahorse XF analyser under oxic conditions in a variety of media. However, oxygen consumption rates were generally lower in the ADPGK knockouts, in some cases markedly so. Collectively, the results demonstrate that ADPGK can contribute to tumour cell survival under conditions of high glycolytic dependence, but the phenotype resulting from knockout of ADPGK is cell line dependent and appears to be unrelated to priming of glycolysis in these lines.

  7. Zinc finger nuclease mediated knockout of ADP-dependent glucokinase in cancer cell lines: effects on cell survival and mitochondrial oxidative metabolism.

    Science.gov (United States)

    Richter, Susan; Morrison, Shona; Connor, Tim; Su, Jiechuang; Print, Cristin G; Ronimus, Ron S; McGee, Sean L; Wilson, William R

    2013-01-01

    Zinc finger nucleases (ZFN) are powerful tools for editing genes in cells. Here we use ZFNs to interrogate the biological function of ADPGK, which encodes an ADP-dependent glucokinase (ADPGK), in human tumour cell lines. The hypothesis we tested is that ADPGK utilises ADP to phosphorylate glucose under conditions where ATP becomes limiting, such as hypoxia. We characterised two ZFN knockout clones in each of two lines (H460 and HCT116). All four clones had frameshift mutations in all alleles at the target site in exon 1 of ADPGK, and were ADPGK-null by immunoblotting. ADPGK knockout had little or no effect on cell proliferation, but compromised the ability of H460 cells to survive siRNA silencing of hexokinase-2 under oxic conditions, with clonogenic survival falling from 21±3% for the parental line to 6.4±0.8% (p = 0.002) and 4.3±0.8% (p = 0.001) for the two knockouts. A similar increased sensitivity to clonogenic cell killing was observed under anoxia. No such changes were found when ADPGK was knocked out in HCT116 cells, for which the parental line was less sensitive than H460 to anoxia and to hexokinase-2 silencing. While knockout of ADPGK in HCT116 cells caused few changes in global gene expression, knockout of ADPGK in H460 cells caused notable up-regulation of mRNAs encoding cell adhesion proteins. Surprisingly, we could discern no consistent effect on glycolysis as measured by glucose consumption or lactate formation under anoxia, or extracellular acidification rate (Seahorse XF analyser) under oxic conditions in a variety of media. However, oxygen consumption rates were generally lower in the ADPGK knockouts, in some cases markedly so. Collectively, the results demonstrate that ADPGK can contribute to tumour cell survival under conditions of high glycolytic dependence, but the phenotype resulting from knockout of ADPGK is cell line dependent and appears to be unrelated to priming of glycolysis in these lines.

  8. Metabolic Response to NAD Depletion across Cell Lines Is Highly Variable.

    Science.gov (United States)

    Xiao, Yang; Kwong, Mandy; Daemen, Anneleen; Belvin, Marcia; Liang, Xiaorong; Hatzivassiliou, Georgia; O'Brien, Thomas

    2016-01-01

    Nicotinamide adenine dinucleotide (NAD) is a cofactor involved in a wide range of cellular metabolic processes and is a key metabolite required for tumor growth. NAMPT, nicotinamide phosphoribosyltransferase, which converts nicotinamide (NAM) to nicotinamide mononucleotide (NMN), the immediate precursor of NAD, is an attractive therapeutic target as inhibition of NAMPT reduces cellular NAD levels and inhibits tumor growth in vivo. However, there is limited understanding of the metabolic response to NAD depletion across cancer cell lines and whether all cell lines respond in a uniform manner. To explore this we selected two non-small cell lung carcinoma cell lines that are sensitive to the NAMPT inhibitor GNE-617 (A549, NCI-H1334), one that shows intermediate sensitivity (NCI-H441), and one that is insensitive (LC-KJ). Even though NAD was reduced in all cell lines there was surprising heterogeneity in their metabolic response. Both sensitive cell lines reduced glycolysis and levels of di- and tri-nucleotides and modestly increased oxidative phosphorylation, but they differed in their ability to combat oxidative stress. H1334 cells activated the stress kinase AMPK, whereas A549 cells were unable to activate AMPK as they contain a mutation in LKB1, which prevents activation of AMPK. However, A549 cells increased utilization of the Pentose Phosphate pathway (PPP) and had lower reactive oxygen species (ROS) levels than H1334 cells, indicating that A549 cells are better able to modulate an increase in oxidative stress. Inherent resistance of LC-KJ cells is associated with higher baseline levels of NADPH and a delayed reduction of NAD upon NAMPT inhibition. Our data reveals that cell lines show heterogeneous response to NAD depletion and that the underlying molecular and genetic framework in cells can influence the metabolic response to NAMPT inhibition.

  9. Metabolic Response to NAD Depletion across Cell Lines Is Highly Variable.

    Directory of Open Access Journals (Sweden)

    Yang Xiao

    Full Text Available Nicotinamide adenine dinucleotide (NAD is a cofactor involved in a wide range of cellular metabolic processes and is a key metabolite required for tumor growth. NAMPT, nicotinamide phosphoribosyltransferase, which converts nicotinamide (NAM to nicotinamide mononucleotide (NMN, the immediate precursor of NAD, is an attractive therapeutic target as inhibition of NAMPT reduces cellular NAD levels and inhibits tumor growth in vivo. However, there is limited understanding of the metabolic response to NAD depletion across cancer cell lines and whether all cell lines respond in a uniform manner. To explore this we selected two non-small cell lung carcinoma cell lines that are sensitive to the NAMPT inhibitor GNE-617 (A549, NCI-H1334, one that shows intermediate sensitivity (NCI-H441, and one that is insensitive (LC-KJ. Even though NAD was reduced in all cell lines there was surprising heterogeneity in their metabolic response. Both sensitive cell lines reduced glycolysis and levels of di- and tri-nucleotides and modestly increased oxidative phosphorylation, but they differed in their ability to combat oxidative stress. H1334 cells activated the stress kinase AMPK, whereas A549 cells were unable to activate AMPK as they contain a mutation in LKB1, which prevents activation of AMPK. However, A549 cells increased utilization of the Pentose Phosphate pathway (PPP and had lower reactive oxygen species (ROS levels than H1334 cells, indicating that A549 cells are better able to modulate an increase in oxidative stress. Inherent resistance of LC-KJ cells is associated with higher baseline levels of NADPH and a delayed reduction of NAD upon NAMPT inhibition. Our data reveals that cell lines show heterogeneous response to NAD depletion and that the underlying molecular and genetic framework in cells can influence the metabolic response to NAMPT inhibition.

  10. Cancer Cell Growth Inhibitory Effect of Bee Venom via Increase of Death Receptor 3 Expression and Inactivation of NF-kappa B in NSCLC Cells

    Directory of Open Access Journals (Sweden)

    Kyung Eun Choi

    2014-07-01

    Full Text Available Our previous findings have demonstrated that bee venom (BV has anti-cancer activity in several cancer cells. However, the effects of BV on lung cancer cell growth have not been reported. Cell viability was determined with trypan blue uptake, soft agar formation as well as DAPI and TUNEL assay. Cell death related protein expression was determined with Western blotting. An EMSA was used for nuclear factor kappaB (NF-κB activity assay. BV (1–5 μg/mL inhibited growth of lung cancer cells by induction of apoptosis in a dose dependent manner in lung cancer cell lines A549 and NCI-H460. Consistent with apoptotic cell death, expression of DR3 and DR6 was significantly increased. However, deletion of DRs by small interfering RNA significantly reversed BV induced cell growth inhibitory effects. Expression of pro-apoptotic proteins (caspase-3 and Bax was concomitantly increased, but the NF-κB activity and expression of Bcl-2 were inhibited. A combination treatment of tumor necrosis factor (TNF-like weak inducer of apoptosis, TNF-related apoptosis-inducing ligand, docetaxel and cisplatin, with BV synergistically inhibited both A549 and NCI-H460 lung cancer cell growth with further down regulation of NF-κB activity. These results show that BV induces apoptotic cell death in lung cancer cells through the enhancement of DR3 expression and inhibition of NF-κB pathway.

  11. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Tzu-Chin [Chest Clinic, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Lin, Yi-Chin [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Chen, Hsiao-Ling [Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan (China); Huang, Pei-Ru; Liu, Shang-Yu [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Yeh, Shu-Lan, E-mail: suzyyeh@csmu.edu.tw [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Department of Nutrition, Chung Shan Medical University Hospital, Taichung, Taiwan (China)

    2016-02-01

    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.

  12. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase

    International Nuclear Information System (INIS)

    Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling; Huang, Pei-Ru; Liu, Shang-Yu; Yeh, Shu-Lan

    2016-01-01

    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.

  13. Adrenomedullin stimulates cyclic AMP production in the airway epithelial cells of guinea-pigs and in the human epithelial cell line

    Directory of Open Access Journals (Sweden)

    Takashi Kawaguchi

    1999-01-01

    Full Text Available This study was designed to examine the effects of adrenomedullin (AM on airway epithelial cells. Primary cultures of guinea-pig tracheal epithelial cells and the human bronchiolar epithelial cell line NCI-H441 were used. Intracellular cyclic adenosine monophosphate (cAMP, cyclic guanosine monophosphate (cGMP, prostaglandin E2 (PGE2, and stable end-products of nitric oxide were assayed. Adrenomedullin (10−6 mol/L stimulated cAMP production in guinea-pig epithelial cells. Indomethacin (10−5 mol/L significantly decreased the basal level of intracellular cAMP in guinea-pig epithelial cells, but not in NCI-H441 cells. However, AM did not stimulate production of PGE2, a major product that can increase cAMP formation. In the case of NCI-H441 cells, AM (10−8 – 10−6 mol/L did not significantly affect intracellular cGMP levels or nitrite content in conditioned medium. Adrenomedullin and calcitonin gene-related peptide (CGRP each stimulated cAMP production in NCI-H441 cells, but AM-stimulated cAMP production was antagonized by the CGRP fragment CGRP8–37. These findings suggest that AM stimulates cAMP production and functionally competes with CGRP for binding sites in airway epithelial cells, at least in human epithelial cells, but that it does not stimulate the release of PGE2 and nitric oxide. Though cyclooxygenase products contribute to some extent to cAMP formation in guinea-pigs, AM independently stimulates intracellular cAMP formation in airway epithelial cells.

  14. Irradiation specifically sensitises solid tumour cell lines to TRAIL mediated apoptosis

    International Nuclear Information System (INIS)

    Marini, Patrizia; Schmid, Angelika; Jendrossek, Verena; Faltin, Heidrun; Daniel, Peter T; Budach, Wilfried; Belka, Claus

    2005-01-01

    TRAIL (tumor necrosis factor related apoptosis inducing ligand) is an apoptosis inducing ligand with high specificity for malignant cell systems. Combined treatment modalities using TRAIL and cytotoxic drugs revealed highly additive effects in different tumour cell lines. Little is known about the efficacy and underlying mechanistic effects of a combined therapy using TRAIL and ionising radiation in solid tumour cell systems. Additionally, little is known about the effect of TRAIL combined with radiation on normal tissues. Tumour cell systems derived from breast- (MDA MB231), lung- (NCI H460) colorectal- (Colo 205, HCT-15) and head and neck cancer (FaDu, SCC-4) were treated with a combination of TRAIL and irradiation using two different time schedules. Normal tissue cultures from breast, prostate, renal and bronchial epithelia, small muscle cells, endothelial cells, hepatocytes and fibroblasts were tested accordingly. Apoptosis was determined by fluorescence microscopy and western blot determination of PARP processing. Upregulation of death receptors was quantified by flow cytometry. The combined treatment of TRAIL with irradiation strongly increased apoptosis induction in all treated tumour cell lines compared to treatment with TRAIL or irradiation alone. The synergistic effect was most prominent after sequential application of TRAIL after irradiation. Upregulation of TRAIL receptor DR5 after irradiation was observed in four of six tumour cell lines but did not correlate to tumour cell sensitisation to TRAIL. TRAIL did not show toxicity in normal tissue cell systems. In addition, pre-irradiation did not sensitise all nine tested human normal tissue cell cultures to TRAIL. Based on the in vitro data, TRAIL represents a very promising candidate for combination with radiotherapy. Sequential application of ionising radiation followed by TRAIL is associated with an synergistic induction of cell death in a large panel of solid tumour cell lines. However, TRAIL receptor

  15. Effects of Monoclonal Antibody Cetuximab on Proliferation of Non-small Cell Lung Cancer Cell lines

    Directory of Open Access Journals (Sweden)

    Zhen CHEN

    2010-08-01

    Full Text Available Background and objective The epidermal growth factor receptor (EGFR monoclonal antibody cetuximab has been used widely in non-small cell lung cancer patients. The aim of this study is to explore the effect of lung cancer cells (A549, H460, H1299, SPC-A-1 which were treated by cetuximab in vitro. Methods We studied the effects of increasing concentrations of cetuximab (1 nmol/L-625 nmol/L in four human lung cancer cell lines (A549, SPC-A-1, H460, H1229. CCK8 measured the inhibition of cell proliferation in each group. A549, SPC-A-1 were marked by PI and the statuses of apoptosis were observed. Western blot were used to detect the proliferation-related signaling protein and apoptosis-related protein in A549. Results The treatment with cetuximab resulted in the effect on cell proliferation and apoptosis in a time- and dosedependent manner. The expression of activated key enzymes (p-AKT, p-EGFR, p-MAPK in EGFR signaling transduction pathway were down-regulated more obviously. Conclusion Cetuximab is an effective targeted drug in the treatment of lung cancer cell lines, tissues, most likely to contribute to the inhibition of key enzymes in EGFR signaling transduction pathway.

  16. Icotinib antagonizes ABCG2-mediated multidrug resistance, but not the pemetrexed resistance mediated by thymidylate synthase and ABCG2.

    Science.gov (United States)

    Wang, De-Shen; Patel, Atish; Shukla, Suneet; Zhang, Yun-Kai; Wang, Yi-Jun; Kathawala, Rishil J; Robey, Robert W; Zhang, Li; Yang, Dong-Hua; Talele, Tanaji T; Bates, Susan E; Ambudkar, Suresh V; Xu, Rui-Hua; Chen, Zhe-Sheng

    2014-06-30

    ABCG2 is a potential biomarker causing multidrug resistance (MDR) in Non-Small Cell Lung Cancer (NSCLC). We conducted this study to investigate whether Icotinib, a small-molecule inhibitor of EGFR tyrosine kinase, could interact with ABCG2 transporter in NSCLC. Our results showed that Icotinib reversed ABCG2-mediated MDR by antagonizing the drug efflux function of ABCG2. Icotinib stimulated the ATPase activity in a concentration-dependent manner and inhibited the photolabeling of ABCG2 with [125I]-Iodoarylazidoprazosin, demonstrating that it interacts at the drug-binding pocket. Homology modeling predicted the binding conformation of Icotinib at Asn629 centroid-based grid of ABCG2. However, Icotinib at reversal concentration did not affect the expression levels of AKT and ABCG2. Furthermore, a combination of Icotinib and topotecan exhibited significant synergistic anticancer activity against NCI-H460/MX20 tumor xenografts. However, the inhibition of transport activity of ABCG2 was insufficient to overcome pemetrexed resistance in NCI-H460/MX20 cells, which was due to the co-upregulated thymidylate synthase (TS) and ABCG2 expression. This is the first report to show that the up-regulation of TS in ABCG2-overexpressing cell line NCI-H460/MX20 may play a role of resistance to pemetrexate. Our findings suggested different possible strategies of overcoming the resistance of topotecan and pemetrexed in the NSCLC patients.

  17. Antiproliferative Activity and Chemical Constituents of Hypericum dyeri. Rehder

    International Nuclear Information System (INIS)

    Ali, M.; Arfan, M.; Zaman, K.

    2013-01-01

    The antiproliferative activity of hexane (F1), ethyl acetate (F2), butanol (F3) and water (F4) extracts of Hypericum dyeri were tested in vitro for their anti- proliferative (anticancer) activity on the cell lines: HT-29 human colon adenocarcinoma, NCI-H460 human non-small cell lung carcinoma, MCF-7 human breast cancer, OVCAR-3 human ovarian adenocarcinoma and RXF-393 human renal cell carcinoma with etoposide as positive control. Among the various extracts the F1 showed relatively potent anti-proliferative activity (IC50, 17.20 +- 4.80 micro g/mL) on NCI-H460 human non-small cell lung carcinoma cell growth. Six compounds were also isolated for the first time from this source. These phytochemicals were identified as 1-Octatriacontanol (1), Hexacosyl tetracosanoate (2), Geddic acid (3), Octacosanoic acid (4), Ceric acid (5) and Sitosterol (6) on the basis of spectroscopic studies such as 1H NMR ,13C NMR, 2D NMR and Mass spectroscopy as well as established with help of reported literature. (author)

  18. Butyrate Inhibits Cancerous HCT116 Colon Cell Proliferation but to a Lesser Extent in Noncancerous NCM460 Colon Cells.

    Science.gov (United States)

    Zeng, Huawei; Taussig, David P; Cheng, Wen-Hsing; Johnson, LuAnn K; Hakkak, Reza

    2017-01-01

    Butyrate, an intestinal microbiota metabolite of dietary fiber, exhibits chemoprevention effects on colon cancer development. However, the mechanistic action of butyrate remains to be determined. We hypothesize that butyrate inhibits cancerous cell proliferation but to a lesser extent in noncancerous cells through regulating apoptosis and cellular-signaling pathways. We tested this hypothesis by exposing cancerous HCT116 or non-cancerous NCM460 colon cells to physiologically relevant doses of butyrate. Cellular responses to butyrate were characterized by Western analysis, fluorescent microscopy, acetylation, and DNA fragmentation analyses. Butyrate inhibited cell proliferation, and led to an induction of apoptosis, genomic DNA fragmentation in HCT116 cells, but to a lesser extent in NCM460 cells. Although butyrate increased H3 histone deacetylation and p21 tumor suppressor expression in both cell types, p21 protein level was greater with intense expression around the nuclei in HCT116 cells when compared with that in NCM460 cells. Furthermore, butyrate treatment increased the phosphorylation of extracellular-regulated kinase 1/2 (p-ERK1/2), a survival signal, in NCM460 cells while it decreased p-ERK1/2 in HCT116 cells. Taken together, the activation of survival signaling in NCM460 cells and apoptotic potential in HCT116 cells may confer the increased sensitivity of cancerous colon cells to butyrate in comparison with noncancerous colon cells.

  19. β-Sitosterol targets Trx/Trx1 reductase to induce apoptosis in A549 cells via ROS mediated mitochondrial dysregulation and p53 activation.

    Science.gov (United States)

    Rajavel, Tamilselvam; Packiyaraj, Pandian; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar; Ruckmani, Kandasamy; Pandima Devi, Kasi

    2018-02-01

    β-Sitosterol (BS), a major bioactive constituent present in plants and vegetables has shown potent anticancer effect against many human cancer cells, but the underlying mechanism remain elusive on NSCLC cancers. We found that BS significantly inhibited the growth of A549 cells without harming normal human lung and PBMC cells. Further, BS treatment triggered apoptosis via ROS mediated mitochondrial dysregulation as evidenced by caspase-3 & 9 activation, Annexin-V/PI positive cells, PARP inactivation, loss of MMP, Bcl-2-Bax ratio alteration and cytochrome c release. Moreover, generation of ROS species and subsequent DNA stand break were found upon BS treatment which was reversed by addition of ROS scavenger (NAC). Indeed BS treatment increased p53 expression and its phosphorylation at Ser15, while silencing the p53 expression by pifithrin-α, BS induced apoptosis was reduced in A549 cells. Furthermore, BS induced apoptosis was also observed in NCI-H460 cells (p53 wild) but not in the NCI-H23 cells (p53 mutant). Down-regulation of Trx/Trx1 reductase contributed to the BS induced ROS accumulation and mitochondrial mediated apoptotic cell death in A549 and NCI-H460 cells. Taken together, our findings provide evidence for the novel anti-cancer mechanism of BS which could be developed as a promising chemotherapeutic drug against NSCLC cancers.

  20. Bio-guided fractionation of methanol extract of Ziziphus mauritiana Lam. (bark and effect of the most active fraction on cancer cell lines

    Directory of Open Access Journals (Sweden)

    Richard Simo Tagne

    2015-04-01

    Full Text Available Objective: To investigate the anticancer and antioxidant potential of methanol bark extract of Ziziphus mauritiana (Z. mauritiana, which is used by traditional healers to cure some cases of cancer in Cameroon. Methods: The methanol crude extract of Z. mauritiana has the antiproliferative activity on four cancer cell lines and its antioxidant activity. The extract was partitioned in five different solvents, and each fraction was tested. The effect of the most antiproliferative fraction on cell cycle was determined. Bio-guided fractionation was performed on the fraction with the highest antiproliferative and the highest antioxidant activities. Results: Z. mauritiana methanol extract was active on all tested cells, and showed promising antioxidant activity. All fractions except hexane fraction were active with the dichloromethane fraction being the most active and showed S and G2-M phase arrest (P<0.01 on cell cycle progression of NCI-H460 and MCF-7, respectively. Bio-guided fractionation of the dichloromethane fraction led to lupeol and betulinic acid. The greatest antioxidant activity was recorded with ethyl acetate fraction and its fractionation led to catechin and epigallocatechin. Conclusions: Overall, this study showed that Z. mauritiana barks has benefits as a chemoprevention agent cancer.

  1. [Overexpression of liver kinase B1 inhibits the proliferation of lung cancer cells].

    Science.gov (United States)

    Li, Yang; Zhang, Libin; Wang, Ping

    2017-01-01

    Objective To explore the effect of overexpressed liver kinase B1(LKB1) on the proliferation of lung cancer cell lines. Methods The expression levels of LKB1 and PTEN in A549, NCI-H23, NCI-H157, XWLC-05, NCI-H446 lung cancer cells were detected by immunocytochemistry (ICC) and Western blotting. Plasmid pcDNA3.1 + -LKB1 and empty vector pcDNA3.1 + -null were separately transfected into the above five cell lines, and then the expression of LKB1 mRNA and protein were determined by quantitative real-time PCR and Western blotting, respectively. Finally, CCK-8 assay was used to analyze the proliferation ability of the transfected cells. Results LKB1 and PTEN were positive in NCI-H23 cells; LKB1 was negative while PTEN was positive in A549 and NCI-H446 cells; both LKB1 and PTEN were negative in NCI-H157 and XWLC-05 cells. Quantitative real-time PCR and Western blotting showed that the expression level of LKB1 significantly increased in the above cell lines transfected with plasmid pcDNA3.1 + -LKB1 compared with the ones with empty vector pcDNA3.1 + -null. Besides, CCK-8 assay showed that the overexpression of LKB1 in the lung cancer cells transfected with pcDNA3.1 + -LKB1 had an obvious inhibitory effect on cell proliferation. Conclusion The expression of LKB1 is down-regulated in most of the lung cell lines to different extent and the over-expression of LKB1 can remarkably inhibit the proliferation ability of lung cancer cell lines.

  2. Guignardones P–S, New Meroterpenoids from the Endophytic Fungus Guignardia mangiferae A348 Derived from the Medicinal Plant Smilax glabra

    Directory of Open Access Journals (Sweden)

    Zhang-Hua Sun

    2015-12-01

    Full Text Available Four new meroterpenoids, guignardones P–S (1–4, and three known analogues (5–7 were isolated from the endophytic fungal strain Guignardia mangiferae A348. Their structures were elucidated on the basis of spectroscopic analysis and single crystal X-ray diffraction. All the isolated compounds were evaluated for their inhibitory effects on SF-268, MCF-7, and NCI-H460 human cancer cell lines. Compounds 2 and 4 exhibited weak inhibitions of cell proliferation against MCF-7 cell line.

  3. Absence of death receptor translocation into lipid rafts in acquired TRAIL-resistant NSCLC cells.

    Science.gov (United States)

    Ouyang, Wen; Yang, Chunxu; Zhang, Simin; Liu, Yu; Yang, Bo; Zhang, Junhong; Zhou, Fuxiang; Zhou, Yunfeng; Xie, Conghua

    2013-02-01

    Resistance to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a major limitation for its clinical use. The mechanisms of TRAIL resistance have been mostly studied in the context of cell lines that are intrinsically resistant to TRAIL. However, little is known about the molecular alterations that contribute to the development of acquired resistance during treatment with TRAIL. In this study, we established H460R, an isogenic cell line with acquired TRAIL resistance, from the TRAIL‑sensitive human lung cancer cell line H460 to investigate the mechanisms of acquired resistance. The acquired TRAIL‑resistant H460R cells remained sensitive to cisplatin. The mRNA and protein expression levels of death receptor 4 (DR4) and death receptor 5 (DR5) were not altered in either of the TRAIL-treated cell lines. Nevertheless, tests in which the DR4 or DR5 gene was overexpressed or silenced suggest that death receptor expression is necessary but not sufficient for TRAIL‑induced apoptosis. Compared with parental TRAIL-sensitive H460 cells, H460R cells showed a decreased TRAIL-induced translocation of DR4/DR5 into lipid rafts. Further studies showed that nystatin partially prevented lipid raft aggregation and DR4 and DR5 clustering and reduced apoptosis in H460 cells again. Analysis of apoptotic molecules showed that more pro-caspase-8, FADD, caspase-3 and Bid, but less cFLIP in H460 cells than in H460R cells. Our findings suggest that the lack of death receptor redistribution negatively impacts DISC assembly in lipid rafts, which at least partially leads to the development of acquired resistance to TRAIL in H460R cells.

  4. Prolonged sulforaphane treatment activates survival signaling in nontumorigenic NCM460 colon cells but apoptotic signaling in tumorigenic HCT116 colon cells.

    Science.gov (United States)

    Zeng, Huawei; Trujillo, Olivia N; Moyer, Mary P; Botnen, James H

    2011-01-01

    Sulforaphane (SFN) is a naturally occurring chemopreventive agent; the induction of cell cycle arrest and apoptosis is a key mechanism by which SFN exerts its colon cancer prevention. However, little is known about the differential effects of SFN on colon cancer and normal cells. In this study, we demonstrated that SFN (15 μmol/L) exposure (72 h) inhibited cell proliferation by up to 95% in colon cancer cells (HCT116) and by 52% in normal colon mucosa-derived (NCM460) cells. Our data also showed that SFN exposure (5 and 10 μmol/L) led to the reduction of G1 phase cell distribution and an induction of apoptosis in HCT116 cells, but to a much lesser extent in NCM460 cells. Furthermore, the examination of mitogen-activated protein kinase (MAPK) signaling status revealed that SFN upregulated the phosphorylation of extracellular-regulated kinase 1/2 (ERK1/2) in NCM460 cells but not in HCT116 cells. In contrast, SFN enhanced the phosphorylation of stress-activated protein kinase (SAPK) and decreased cellular myelocytomatosis oncogene (c-Myc) expression in HCT116 cells but not NCM460 cells. Taken together, the activation of survival signaling in NCM460 cells and apoptotic signaling in HCT116 cells may play a critical role in SFN's stronger potential of inhibiting cell proliferation in colon cancer cells than in normal colon cells. Copyright © 2011, Taylor & Francis Group, LLC

  5. GLP-1 Amidation Efficiency Along the Length of the Intestine in Mice, Rats and Pigs and in GLP-1 Secreting Cell Lines

    DEFF Research Database (Denmark)

    Kuhre, Rune Ehrenreich; Albrechtsen, Nicolai Jacob Wewer; Windeløv, Johanne Agerlin

    2014-01-01

    and whether this varied with the six different locations. We also analyzed the amidation in 3 GLP-1 secreting cell lines (GLUTag, NCI-H716 and STC-1). To our surprise there were marked differences between the 3 species with respect to the concentration of GLP-1 in gut. In the mouse, concentrations increased...... sites, whereas rats and pigs on average had around 2.5 and 4 times higher levels of amidated compared to non-amidated GLP-1, although the ratio varied depending upon the location. GLUTag, NCI-H716 and STC-1 cells all exhibited partial amidation with 2-4 times higher levels of amidated compared to non...

  6. Diarachidonoylphosphoethanolamine induces necrosis/necroptosis of malignant pleural mesothelioma cells.

    Science.gov (United States)

    Kaku, Yoshiko; Tsuchiya, Ayako; Kanno, Takeshi; Nakano, Takashi; Nishizaki, Tomoyuki

    2015-09-01

    The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI) and annexin V (AV), DAPE significantly increased the population of PI-positive and AV-negative cells, corresponding to primary necrosis, and that of PI-positive and AV-positive cells, corresponding to late apoptosis/secondary necrosis, in NCI-H28 cells. DAPE-induced reduction of NCI-H28 cell viability was partially inhibited by necrostatin-1, an inhibitor of RIP1 kinase to induce necroptosis, or knocking-down RIP1. DAPE generated reactive oxygen species (ROS) followed by disruption of mitochondrial membrane potentials in NCI-H28 cells. DAPE-induced mitochondrial damage was attenuated by cyclosporin A, an inhibitor of cyclophilin D (CypD). DAPE did not affect expression and mitochondrial localization of p53 protein in NCI-H28 cells. DAPE significantly decreased intracellular ATP concentrations in NCI-H28 cells. Overall, the results of the present study indicate that DAPE induces necroptosis and necrosis of MPM cells; the former is mediated by RIP1 kinase and the latter is caused by generating ROS and opening CypD-dependent mitochondrial permeability transition pore, to reduce intracellular ATP concentrations. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Relative Apoptosis-inducing Potential of Homeopa-thic Condurango 6C and 30C in H460 Lung Cancer Cells In vitro

    Directory of Open Access Journals (Sweden)

    Sikdar Sourav

    2014-03-01

    Full Text Available Objectives: In homeopathy, it is claimed that more homeopathically-diluted potencies render more protective/curative effects against any disease condition. Potentized forms of Condurango are used successfully to treat digestive problems, as well as esophageal and stomach cancers. However, the comparative efficacies of Condurango 6C and 30C, one diluted below and one above Avogadro’s limit (lacking original drug molecule, respectively, have not been critically analyzed for their cell-killing (apoptosis efficacy against lung cancer cells in vitro, and signalling cascades have not been studied. Hence, the present study was undertaken. Methods: 3-(4,5-dimethylthiazol-2-yl-2,5-diphenylte- trazolium bromide (MTT assays were conducted on H460-non-small-cell lung cancer (NSCLC cells by using a succussed ethyl alcohol vehicle (placebo as a control. Studies on cellular morphology, cell cycle regulation, generation of reactive oxygen species (ROS, changes in mitochondrial membrane potential (MMP, and DNA-damage were made, and expressions of related signaling markers were studied. The observations were done in a “blinded” manner. Results: Both Condurango 6C and 30C induced apoptosis via cell cycle arrest at subG0/G1 and altered expressions of certain apoptotic markers significantly in H460 cells. The drugs induced oxidative stress through ROS elevation and MMP depolarization at 18-24 hours. These events presumably activated a caspase-3-mediated signalling cascade, as evidenced by reverse transcriptase- polymerase chain reaction (RT-PCR, western blot and immunofluorescence studies at a late phase (48 hours in which cells were pushed towards apoptosis. Conclusion: Condurango 30C had greater apoptotic effect than Condurango 6C as claimed in the homeopathic doctrine.

  8. Effects of the single and combined treatment with dopamine agonist, somatostatin analog and mTOR inhibitors in a human lung carcinoid cell line: an in vitro study.

    Science.gov (United States)

    Pivonello, Claudia; Rousaki, Panagoula; Negri, Mariarosaria; Sarnataro, Maddalena; Napolitano, Maria; Marino, Federica Zito; Patalano, Roberta; De Martino, Maria Cristina; Sciammarella, Concetta; Faggiano, Antongiulio; Rocco, Gaetano; Franco, Renato; Kaltsas, Gregory A; Colao, Annamaria; Pivonello, Rosario

    2017-06-01

    Somatostatin analogues and mTOR inhibitors have been used as medical therapy in lung carcinoids with variable results. No data are available on dopamine agonists as treatment for lung carcinoids. The main aim of the current study was to evaluate the effect of the combined treatment of somatostatin analogue octreotide and the dopamine agonist cabergoline with mTOR inhibitors in an in vitro model of typical lung carcinoids: the NCI-H727 cell line. In NCI-H727 cell line, reverse transcriptase-quantitative polymerase chain reaction and immunofluorescence were assessed to characterize the expression of the somatostatin receptor 2 and 5, dopamine receptor 2 and mTOR pathway components. Fifteen typical lung carcinoids tissue samples have been used for somatostatin receptor 2, dopamine receptor 2, and the main mTOR pathway component p70S6K expression and localization by immunohistochemistry. Cell viability, fluorescence-activated cell sorting analysis and western blot have been assessed to test the pharmacological effects of octreotide, cabergoline and mTOR inhibitors, and to evaluate the activation of specific cell signaling pathways in NCI-H727 cell line. NCI-H727 cell line expressed somatostatin receptor 2, somatostatin receptor 5 and dopamine receptor 2 and all mTOR pathway components at messenger and protein levels. Somatostatin receptor 2, dopamine receptor 2, and p70S6K (non phosphorylated and phosphorylated) proteins were expressed in most typical lung carcinoids tissue samples. Octreotide and cabergoline did not reduce cell viability as single agents but, when combined with mTOR inhibitors, they potentiate mTOR inhibitors effect after long-term exposure, reducing Akt and ERK phosphorylation, mTOR escape mechanisms, and increasing the expression DNA-damage-inducible transcript 4, an mTOR suppressor. In conclusion, the single use of octreotide and cabergoline is not sufficient to block cell viability but the combined approach of these agents with mTOR inhibitors

  9. Cytotoxic Effects of Fascaplysin against Small Cell Lung Cancer Cell Lines

    Science.gov (United States)

    Hamilton, Gerhard

    2014-01-01

    Fascaplysin, the natural product of a marine sponge, exhibits anticancer activity against a broad range of tumor cells, presumably through interaction with DNA, and/or as a highly selective cyclin-dependent kinase 4 (CDK4) inhibitor. In this study, cytotoxic activity of fascaplysin against a panel of small cell lung cancer (SCLC) cell lines and putative synergism with chemotherapeutics was investigated. SCLC responds to first-line chemotherapy with platinum-based drugs/etoposide, but relapses early with topotecan remaining as the single approved therapeutic agent. Fascaplysin was found to show high cytotoxicity against SCLC cells and to induce cell cycle arrest in G1/0 at lower and S-phase at higher concentrations, respectively. The compound generated reactive oxygen species (ROS) and induced apoptotic cell death in the chemoresistant NCI-H417 SCLC cell line. Furthermore, fascaplysin revealed marked synergism with the topoisomerase I-directed camptothecin and 10-hydroxy-camptothecin. The Poly(ADP-ribose)-Polymerase 1 (PARP1) inhibitor BYK 204165 antagonized the cytotoxic activity of fascaplysin, pointing to the involvement of DNA repair in response to the anticancer activity of the drug. In conclusion, fascaplysin seems to be suitable for treatment of SCLC, based on high cytotoxic activity through multiple routes of action, affecting topoisomerase I, integrity of DNA and generation of ROS. PMID:24608973

  10. Synthesis of Novel Heterocyclic Compounds Incorporate 4,5,6,7-Tetrahydrobenzo[b]thiophene Together with Their Cytotoxic Evaluations.

    Science.gov (United States)

    Abdallah, Amira Elsayed Mahmoud; Mohareb, Rafat Milad; Khalil, Eid Metwally; Elshamy, Menna Alla Mohamed Abd Elaleem

    2017-01-01

    The 2-amino-3-cyano-4,5,6,7-tetrahydrobenzo[b]thiophene was the key starting compound used to synthesize new thiazole, pyrimidine, pyran, pyridine and thiazine derivatives. The cytotoxicity of the synthesized compounds was studied towards the three cancer cell lines namely MCF-7 (breast adenocarcinoma), NCI-H460 (non-small cell lung cancer) and SF-268 (central nervous system (CNS) cancer) in addition to the normal cell line (WI-38) using doxorubicin as the reference drug. The study showed that compounds 5, 9a, 15b, 17c, 18 and 21b were the most potent compounds.

  11. Cytotoxic Effects of Fascaplysin against Small Cell Lung Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Gerhard Hamilton

    2014-03-01

    Full Text Available Fascaplysin, the natural product of a marine sponge, exhibits anticancer activity against a broad range of tumor cells, presumably through interaction with DNA, and/or as a highly selective cyclin-dependent kinase 4 (CDK4 inhibitor. In this study, cytotoxic activity of fascaplysin against a panel of small cell lung cancer (SCLC cell lines and putative synergism with chemotherapeutics was investigated. SCLC responds to first-line chemotherapy with platinum-based drugs/etoposide, but relapses early with topotecan remaining as the single approved therapeutic agent. Fascaplysin was found to show high cytotoxicity against SCLC cells and to induce cell cycle arrest in G1/0 at lower and S-phase at higher concentrations, respectively. The compound generated reactive oxygen species (ROS and induced apoptotic cell death in the chemoresistant NCI-H417 SCLC cell line. Furthermore, fascaplysin revealed marked synergism with the topoisomerase I-directed camptothecin and 10-hydroxy-camptothecin. The Poly(ADP-ribose-Polymerase 1 (PARP1 inhibitor BYK 204165 antagonized the cytotoxic activity of fascaplysin, pointing to the involvement of DNA repair in response to the anticancer activity of the drug. In conclusion, fascaplysin seems to be suitable for treatment of SCLC, based on high cytotoxic activity through multiple routes of action, affecting topoisomerase I, integrity of DNA and generation of ROS.

  12. Mangosenone F, A Furanoxanthone from Garciana mangostana, Induces Reactive Oxygen Species-Mediated Apoptosis in Lung Cancer Cells and Decreases Xenograft Tumor Growth.

    Science.gov (United States)

    Seo, Kyung Hye; Ryu, Hyung Won; Park, Mi Jin; Park, Ki Hun; Kim, Jin Hyo; Lee, Mi-Ja; Kang, Hyeon Jung; Kim, Sun Lim; Lee, Jin Hwan; Seo, Woo Duck

    2015-11-01

    Mangosenone F (MSF), a natural xanthone, was isolated form Carcinia mangotana, and a few studies have reported its glycosidase inhibitor effect. In this study we investigated the anti lung cancer effect of MSF both in vitro and in vivo. MSF inhibited cancer cell cytotoxicity and induced and induced apoptosis via reactive oxygen species (ROS) generation in NCI-H460. MSF treatment also showed in pronounced release of apoptogenic cytochrome c from the mitochondria to the cytosol, downregulation of Bcl-2 and Bcl-xL, and upregulation of Bax, suggesting that caspase-mediated pathways were involved in MSF-induced apoptosis. ROS activation of the mitogen-activated protein kinase signaling pathway was shown to play a predominant role in the apoptosis mechanism of MSF. Compared with cisplatin treatment, MSF treatment showed significantly increased inhibition of the growth of NCI-H460 cells xenografted in nude mice. Together, these results indicate the potential of MSF as a candidate natural anticancer drug by promoting ROS production. Copyright © 2015 John Wiley & Sons, Ltd.

  13. Notch1/3 and p53/p21 are a potential therapeutic target for APS-induced apoptosis in non-small cell lung carcinoma cell lines.

    Science.gov (United States)

    Zhang, Jing-Xi; Han, Yi-Ping; Bai, Chong; Li, Qiang

    2015-01-01

    Previous studies have shown that Astragalus polysaccharide (APS) can be applied to anti-cancer. However, the mechanism by which APS mediate this effect is unclear. In the present study, APS-mediated NSCLC cell apoptosis was investigated through the regulation of the notch signaling pathway. The cell viability was detected by the CCK8 assay. The mRNA and protein expression of notch1/3 and tumor suppressors were analyzed by RT-PCR and western blotting, respectively. The mRNA and protein of notch1 and notch3 were significantly up-regulated in tumor tissues as compared to non-tumor adjacent tissues. Treatment of human NSCLC cells with APS induced cell death in a dose-and time-dependent manner by using CCK8 assay. The mRNA and protein expression of notch1 and notch3 were significantly lower in NSCLC cells with APS treatment than that in control group. Moreover, western blotting analysis showed that treatment of H460 cells with APS significantly increased the pro-apoptotic Bax and caspase 8 levels, decreased the anti-apoptotic Bcl-2 level. Furthermore, p53, p21 and p16 were obviously up-regulated by APS treatment in H460 cell. This study demonstrated that APS-treated could inhibit proliferation and promote cell apoptosis, at least partially, through suppressing the expression of notch1 and notch3 and up-regulating the expression of tumor suppressors in H460 NSCLC cell lines.

  14. Determination of gamma radiation lethal dose (LD50) and resveratrol cytotoxicity level in tumor cells line

    International Nuclear Information System (INIS)

    Magalhaes, Vanessa D.; Rogero, Sizue O.; Rogero, Jose R.; Cruz, Aurea S.

    2011-01-01

    Cancer is a disease with high incidence and it is considered a worldwide public health problem. Resveratrol is a polyphenol occurring naturally in a wide variety of plants according to response of ultraviolet radiation (UV) exposition or according to mechanical stress resulting of pathogens or chemical and physical agents. This polyphenol possesses a pharmacological activity of carcinogenesis inhibition in multiple levels. It also protects cells by scavenging the free radicals which are considered toxic products. These free radicals are formed of natural process of cell aging and also by incidence of ionizing radiation in the organism. Thus, resveratrol is considered as a cell radioprotector. On the other hand, in some elevated concentrations resveratrol may be considered as a radiosensitizing. The aim of this work was the determination of radiation lethal dose (LD 50 ) and also verifies the cytotoxicity level of resveratrol in tumor cells line: muco epidermoid pulmonary carcinoma cells (NCI-H292) and rhabdomyosarcoma cells (RD). The cytotoxicity test was performed by neutral red uptake assay. The results of resveratrol IC 50% in NCI-H292 cells was 192μM and in RD cells was 128μM; and RD cells gamma radiation LD 50 was 435Gy. (author)

  15. Development of an in vitro skin sensitization test using human cell lines; human Cell Line Activation Test (h-CLAT). II. An inter-laboratory study of the h-CLAT.

    Science.gov (United States)

    Sakaguchi, H; Ashikaga, T; Miyazawa, M; Yoshida, Y; Ito, Y; Yoneyama, K; Hirota, M; Itagaki, H; Toyoda, H; Suzuki, H

    2006-08-01

    Recent regulatory changes have placed a major emphasis on in vitro safety testing and alternative models. In regard to skin sensitization tests, dendritic cells (DCs) derived from human peripheral blood have been considered in the development of new in vitro alternatives. Human cell lines have been also reported recently. In our previous study, we suggested that measuring CD86 and/or CD54 expression on THP-1 cells (human monocytic leukemia cell line) could be used as an in vitro skin sensitization method. An inter-laboratory study among two laboratories was undertaken in Japan in order to further develop an in vitro skin sensitization model. In the present study, we used two human cell lines: THP-1 and U-937 (human histiocytic lymphoma cell line). First we optimized our test protocol (refer to the related paper entitled "optimization of the h-CLAT protocol" within this journal) and then we did an inter-laboratory validation with nine chemicals using the optimized protocol. We measured the expression of CD86 and CD54 on the above cells using flow cytometry after a 24h and 48h exposure to six known allergens (e.g., DNCB, pPD, NiSO(4)) and three non-allergens (e.g., SLS, tween 80). For the sample test concentration, four doses (0.1x, 0.5x, 1x, and 2x of the 50% inhibitory concentration (IC(50))) were evaluated. IC(50) was calculated using MTT assay. We found that allergens/non-allergens were better predicted using THP-1 cells compared to U-937 cells following a 24 h and a 48 h exposure. We also found that the 24h treatment time tended to have a better accuracy than the 48 h treatment time for THP-1 cells. Expression of CD86 and CD54 were good predictive markers for THP-1 cells, but for U-937 cells, expression of CD86 was a better predictor than CD54, at the 24h and the 48 h treatment time. The accuracy also improved when both markers (CD86 and CD54) were used as compared with a single marker for THP-1 cells. Both laboratories gave a good prediction of allergen

  16. Synthesis of 2,3-diyne-1,4-naphthoquinone derivatives and evaluation of cytotoxic activity against tumor cell lines

    International Nuclear Information System (INIS)

    Silva, Mauro G.; Camara, Celso A.; Silva, Tania M.S.; Feitosa, Anderson C.S.; Meira, Assuero S.; Pessoa, Claudia

    2013-01-01

    A series of 2,3-diyne-1,4-naphthoquinone derivatives was synthesized from 2,3-dibromo- 1,4-naphthoquinone and various functionalized terminal alkynes using palladium-catalyzed Sonogashira cross-coupling reaction. The diynes were evaluated as potential cytotoxic agents against three tumor cell lines: human ovarian adenocarcinoma (OVCAR-8), human metastatic prostate cancer (PC-3M) and human bronchoalveolar lung carcinoma (NCI-H358M), presenting, in general, satisfactory results for inhibition of cell growth. (author)

  17. Synthesis of 2,3-diyne-1,4-naphthoquinone derivatives and evaluation of cytotoxic activity against tumor cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Mauro G.; Camara, Celso A.; Silva, Tania M.S., E-mail: ccelso@dcm.ufrpe.br [Universidade Federal Rural de Pernambuco (LSCB/UFRPE), Recife, PE (Brazil). Dept. de Ciencias Moleculares. Lab. de Sintese de Compostos Bioativos; Feitosa, Anderson C.S.; Meira, Assuero S.; Pessoa, Claudia [Universidade Federal do Ceara (LOE/UFC), Fortaleza, CE (Brazil). Dept. de Fisiologia e Farmacologia. Lab. de Oncologia Experimental

    2013-09-15

    A series of 2,3-diyne-1,4-naphthoquinone derivatives was synthesized from 2,3-dibromo- 1,4-naphthoquinone and various functionalized terminal alkynes using palladium-catalyzed Sonogashira cross-coupling reaction. The diynes were evaluated as potential cytotoxic agents against three tumor cell lines: human ovarian adenocarcinoma (OVCAR-8), human metastatic prostate cancer (PC-3M) and human bronchoalveolar lung carcinoma (NCI-H358M), presenting, in general, satisfactory results for inhibition of cell growth. (author)

  18. Determination of gamma radiation lethal dose (LD{sub 50}) and resveratrol cytotoxicity level in tumor cells line

    Energy Technology Data Exchange (ETDEWEB)

    Magalhaes, Vanessa D.; Rogero, Sizue O.; Rogero, Jose R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Cruz, Aurea S. [Instituto Adolfo Lutz (IAL-SP) Secao de Culturas Celulares, SP (Brazil)

    2011-07-01

    Cancer is a disease with high incidence and it is considered a worldwide public health problem. Resveratrol is a polyphenol occurring naturally in a wide variety of plants according to response of ultraviolet radiation (UV) exposition or according to mechanical stress resulting of pathogens or chemical and physical agents. This polyphenol possesses a pharmacological activity of carcinogenesis inhibition in multiple levels. It also protects cells by scavenging the free radicals which are considered toxic products. These free radicals are formed of natural process of cell aging and also by incidence of ionizing radiation in the organism. Thus, resveratrol is considered as a cell radioprotector. On the other hand, in some elevated concentrations resveratrol may be considered as a radiosensitizing. The aim of this work was the determination of radiation lethal dose (LD{sub 50}) and also verifies the cytotoxicity level of resveratrol in tumor cells line: muco epidermoid pulmonary carcinoma cells (NCI-H292) and rhabdomyosarcoma cells (RD). The cytotoxicity test was performed by neutral red uptake assay. The results of resveratrol IC{sub 50%} in NCI-H292 cells was 192{mu}M and in RD cells was 128{mu}M; and RD cells gamma radiation LD{sub 50} was 435Gy. (author)

  19. Synthesis, characterization, and in vivo efficacy evaluation of PGG–docetaxel conjugate for potential cancer chemotherapy

    Directory of Open Access Journals (Sweden)

    Jiang X

    2012-02-01

    Full Text Available Danbo Yang1, Sang Van2, Yingyi Shu1, Xiaoqing Liu1, Yangfeng Ge1, Xinguo Jiang3, Yi Jin2, Lei Yu1,21Biomedical Engineering and Technology Institute, Institutes for Advanced Interdisciplinary Research, East China Normal University, Shanghai, People’s Republic of China; 2Biomedical Group, Nitto Denko Technical Corporation, CA, USA; 3School of Pharmacy, Fudan University, Shanghai, People’s Republic of ChinaAim: This work is intended to develop and evaluate a biopolymeric poly(L-γ-glutamyl-glutamine (PGG–docetaxel (DTX conjugate that can spontaneously self-assemble in aqueous solutions to become nanoparticles.Methods: DTX was covalently attached to hydrophilic PGG by direct esterification, and the conjugate was characterized by proton nuclear magnetic resonance spectroscopy, molecular weight gel permeation chromatography, solubility, size distribution and morphology, and hemolysis. Conjugated DTX was found to have 2000 times improved water solubility compared with free DTX. Dynamic light scattering, transmission electron microscopy, and atomic force microscopy revealed the particle size, distribution and morphology of the PGG–DTX conjugate. In addition, the conjugate was further tested for in vitro cytotoxicity and in vivo antitumor efficacy on the human non-small cell lung cancer cell line NCI-H460.Results: Conjugated DTX was found to have 2000 times improved water solubility compared with free DTX. The conjugate formed nanoparticles with an average diameter of 30 nm in spherical shape and unimodal particle size distribution. The conjugate exhibited about 2% hemolysis at 10 mg/mL, compared with 56% for Tween 80® at 0.4 mg/mL, and 33% for Cremophor EL® at 10 mg/mL. In addition, the conjugate was further tested for in vitro cytotoxicity and in vivo antitumor efficacy on the human non-small cell lung cancer cell line NCI-H460. As expected, conjugated DTX exhibited lower cytotoxicity compared to that of free DTX, in concentration

  20. Cisplatin-mediated radiosensitization of non-small cell lung cancer cells is stimulated by ATM inhibition

    International Nuclear Information System (INIS)

    Toulany, Mahmoud; Mihatsch, Julia; Holler, Marina; Chaachouay, Hassan; Rodemann, H. Peter

    2014-01-01

    Background and purpose: Cisplatin activates ataxia-telangiectasia-mutated (ATM), a protein with roles in DNA repair, cell cycle progression and autophagy. We investigated the radiosensitizing effect of cisplatin with respect to its effect on ATM pathway activation. Material and methods: Non-small cell lung cancer cells (NSCLC) cell lines (A549, H460) and human fibroblast (ATM-deficient AT5, ATM-proficient 1BR3) cells were used. The effects of cisplatin combined with irradiation on ATM pathway activity, clonogenicity, DNA double-strand break (DNA-DSB) repair and cell cycle progression were analyzed with Western blotting, colony formation and γ-H2AX foci assays as well as FACS analysis, respectively. Results: Cisplatin radiosensitized H460 cells, but not A549 cells. Radiosensitization of H460 cells was not due to impaired DNA-DSB repair, increased apoptosis or cell cycle dysregulation. The lack of radiosensitization demonstrated for A549 cells was associated with cisplatin-mediated stimulation of ATM (S1981) and AMPKα (T172) phosphorylation and autophagy. However, in both cell lines inhibition of ATM and autophagy by KU-55933 and chloroquine diphosphate (CQ) respectively resulted in a significant radiosensitization. Combined treatment with the AMPK inhibitor compound-C led to radiosensitization of A549 but not of H460 cells. As compared to the treatment with KU-55933 alone, radiosensitivity of A549 cells was markedly stimulated by the combination of KU-55933 and cisplatin. However, the combination of CQ and cisplatin did not modulate the pattern of radiation sensitivity of A549 or H460 cells. In accordance with the results that cisplatin via stimulation of ATM activity can abrogate its radiosensitizing effect, ATM deficient cells were significantly sensitized to ionizing radiation by cisplatin. Conclusion: The results obtained indicate that ATM targeting can potentiate cisplatin-induced radiosensitization

  1. Dithiolethione modified valproate and diclofenac increase E-cadherin expression and decrease proliferation of non-small cell lung cancer cells

    OpenAIRE

    Moody, Terry W.; Switzer, Christopher; Santana-Flores, Wilmarie; Ridnour, Lisa A.; Berna, Marc; Thill, Michelle; Jensen, Robert T.; Sparatore, Anna; Del Soldato, Piero; Yeh, Grace C; Roberts, David D.; Giaccone, Giuseppe; Wink, David A.

    2009-01-01

    The effects of dithiolethione-modified valproate, diclofenac and sulindac on non-small cell lung cancer (NSCLC) cells were investigated. Sulfur(S)-valproate and S-diclofenac at 1 μg/ml concentrations significantly reduced prostaglandin (PG)E2 levels in NSCLC cell lines A549 and NCI-H1299 as did the COX-2 inhibitor DuP-697. In vitro, S-valproate, S-diclofenac and S-sulindac half-maximally inhibited the clonal growth of NCI-H1299 cells at 6, 6 and 15 μg/ml, respectively. Using the MTT assay, 10...

  2. Decreased glucose uptake by hyperglycemia is regulated by different mechanisms in human cancer cells and monocytes

    International Nuclear Information System (INIS)

    Kim, Chae Kyun; Chung, June Key; Lee, Yong Jin; Hong, Mee Kyoung; Jeong, Jae Min; Lee, Dong Soo; Lee, Myung Chul

    2002-01-01

    To clarify the difference in glucose uptake between human cancer cells and monocytes, we studied ( 18 F) fluorodeoxyglucose (FDG) uptake in three human colon cancer cell lines (SNU-C2A, SNU-C4, SNU-C5), one human lung cancer cell line (NCI-H522), and human peripheral blood monocytes. The FDG uptake of both cancer cells and monocytes was increased in glucose-free medium, but decreased in the medium containing 16.7 mM glucose (hyperglycemic). The level of Glut1 mRNA decreased in human colon cancer cells and NCI-H522 under hyperglycemic condition. Glut1 protein expression was also decreased in the four human cancer cell lines under hyperglycemic condition, whereas it was consistently undetectable in monocytes. SNU-C2A, SNU-C4 and NCI-H522 showed a similar level of hexokinase activity (7.5-10.8 mU/mg), while SNU-C5 and moncytes showed lower range of hexokinase activity (4.3-6.5 mU/mg). These data suggest that glucose uptake is regulated by different mechanisms in human cancer cells and monocytes

  3. Anti-cancer activity of tectona hamiltoniana-an endemic plant of Myanmar

    International Nuclear Information System (INIS)

    Mya, K.M.; Shyaula, S.L.

    2012-01-01

    Summary: The ethanolic extracts of barks and leaves of Tectona hamiltoniana (Verbenaceae) were tested for anti-cancer activity against MCF-7 (Human breast cancer) and NCI-H460 (Lung cancer) cell lines employing sulpho rhodamine B (SRB) bioassay. These extracts demonstrated cytotoxicity with GI/sub 50/ values ranging between 24-33 macro g/mL against both cell lines. Upon further fractionation, dichloromethane fraction appeared to be most active against the MCF-7 cell line (GI/sub 50/ value of 3.4+-0.9 macro g/mL) leading to the isolation of lupane type triterpenoids, betulinic acid (1), betulin aldehyde ( 2 ) and betulin (3). Compound 2 and 3, both showed significant cytotoxic effect against both cancerous cell lines (GI/sub 50/ value range 6-11 macro M). (author)

  4. Bystander effects of exposure to low-dose-rate 125I seeds on human lung cancers cells in vitro

    International Nuclear Information System (INIS)

    Jia Rongfei; Chen Honghong; Yu Lei; Zhao Meijia; Shao Chunlin; Cheng Wenying

    2007-01-01

    The bystander effects induced by continuous low-dose-rate (LDR) 125 I seeds radiation on damage of human lung cancer cells were investigated. Human adenocarcinoma cell line A549 and human small cell lung cancer cell line NCI-H446, which have different sensitivities to high-dose rate (HDR) external irradiation, were exposed directly to 125 I seeds in vitro and co-cultured with unirradiated cells for 24 h. Using cytokinesis-blocking micronucleus method and γ H2AX fluorescence immunoassay, bystander effects induced by 2Gy and 4Gy 125 I seed irradiation on micronucleus formation and DNA double-strand breaks (DSBs) of human lung cancer cells were detected and evaluated. The results showed that irradiation with 125 I seeds can induce medium-mediated bystander effects in A549 cells and NCI-H446 cells, exhibiting that both micronuclei formation and γ H2AX focus formation in bystander cells were increased significantly compared with non-irradiated cells. The extent of DNA damage induced by bystander effects was correlated with accumulated radiation dose and radiosensitive of tumor cells. NCI-H446 cells that were sensitive to HDR γ irradiation were more sensitive to continuous LDR irradiation and bystander effects than A549. However, a comparison between the bystander effects and direct effects elicits the intensity of bystander responses of A549 cells was higher than that of NCI-H446 cells. A dose-related reduction in bystander responses was observed both in A549 cells and NCI-H446 cells, suggesting that the signaling factors involved in the bystander signaling pathways may decrease with the increase of cell damages. (authors)

  5. Anticancer effects of saponin and saponin–phospholipid complex of Panax notoginseng grown in Vietnam

    OpenAIRE

    Thu Dang Kim; Hai Nguyen Thanh; Duong Nguyen Thuy; Loi Vu Duc; Thu Vu Thi; Hung Vu Manh; Patcharee Boonsiri; Tung Bui Thanh

    2016-01-01

    Objective: To evaluate the antitumor activity both in vitro and in vivo of saponin–phospholipid complex of Panax notoginseng. Methods: The in vitro cytotoxic effect of saponins extract and saponin–phospholipid complex against human lung cancer NCI-H460 and breast cancer cell lines BT474 was examined using MTS assay. For in vivo evaluation of antitumor potential, saponin and saponin–phospholipid complex were administered orally in rats induced mammary carcinogenesis by 7,12-dimethylbenz(a)a...

  6. Co-culture with NK-92MI cells enhanced the anti-cancer effect of bee venom on NSCLC cells by inactivation of NF-κB.

    Science.gov (United States)

    Kollipara, Pushpa Saranya; Kim, Jung Hyun; Won, Dohee; Lee, Sang Min; Sung, Ha Chang; Chang, Hyun Sok; Lee, Kang Tae; Lee, Kang Sik; Park, Mi Hee; Song, Min Jong; Song, Ho Sueb; Hong, Jin Tae

    2014-03-01

    In the present study we experimented on a multimodal therapeutic approach, such as combining chemotherapy agent (Bee venom) with cellular (NK-92MI) immunotherapy. Previously bee venom has been found to show anti-cancer effect in various cancer cell lines. In lung cancer cells bee venom showed an IC(50) value of 3 μg/ml in both cell lines. The co-culture of NK-92MI cell lines with lung cancer cells also show a decrease in viability upto 50 % at 48 h time point. Hence we used bee venom treated NK-92MI cells to co-culture with NSCLC cells and found that there is a further decrease in cell viability upto 70 and 75 % in A549 and NCI-H460 cell lines respectively. We further investigated the expression of various apoptotic and anti-apoptotic proteins and found that Bax, cleaved caspase-3 and -8 were increasing where as Bcl-2 and cIAP-2 was decreasing. The expression of various death receptor proteins like DR3, DR6 and Fas was also increasing. Concomitantly the expression of various death receptor ligands (TNFalpha, Apo3L and FasL) was also increasing of NK-92MI cells after co-culture. Further the DNA binding activity and luciferase activity of NF-κB was also inhibited after co-culture with bee venom treated NK-92MI cell lines. The knock down of death receptors with si-RNA has reversed the decrease in cell viability and NF-κB activity after co-culture with bee venom treated NK-92MI cells. Thus this new approach can enhance the anti-cancer effect of bee venom at a much lower concentration.

  7. Decreased glucose uptake by hyperglycemia is regulated by different mechanisms in human cancer cells and monocytes

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chae Kyun; Chung, June Key; Lee, Yong Jin; Hong, Mee Kyoung; Jeong, Jae Min; Lee, Dong Soo; Lee, Myung Chul [College of Medicine, Seoul National Univ., Seoul (Korea, Republic of)

    2002-04-01

    To clarify the difference in glucose uptake between human cancer cells and monocytes, we studied ({sup 18}F) fluorodeoxyglucose (FDG) uptake in three human colon cancer cell lines (SNU-C2A, SNU-C4, SNU-C5), one human lung cancer cell line (NCI-H522), and human peripheral blood monocytes. The FDG uptake of both cancer cells and monocytes was increased in glucose-free medium, but decreased in the medium containing 16.7 mM glucose (hyperglycemic). The level of Glut1 mRNA decreased in human colon cancer cells and NCI-H522 under hyperglycemic condition. Glut1 protein expression was also decreased in the four human cancer cell lines under hyperglycemic condition, whereas it was consistently undetectable in monocytes. SNU-C2A, SNU-C4 and NCI-H522 showed a similar level of hexokinase activity (7.5-10.8 mU/mg), while SNU-C5 and moncytes showed lower range of hexokinase activity (4.3-6.5 mU/mg). These data suggest that glucose uptake is regulated by different mechanisms in human cancer cells and monocytes.

  8. Role of novel anticancer drug Roscovitine on enhancing radiosensitivity in carcinoma cell lines

    International Nuclear Information System (INIS)

    Mohamed, H.M.S.

    2009-01-01

    The present study was conducted to evaluate the radiosensitization effect of Roscovitine (cyclin dependent kinase inhibitor) in carcinoma cell lines. Three cell lines are used (HepG2 liver carcinoma cell line, U251 brain carcinoma cell line, H460 Lung carcinoma cell line) in this study .cells were treated with Roscovitine in different concentrations ranging from 0.1μM to 100 μM before exposure to radiation doses ranging from 0.5 Gy to 20 Gy according to each experiment. The cell viability by MTT assay, The cell cycle analysis by flow cytometry and DNA fragmentation repair mechanism by diphenylamine were measured after Roscovitine treatment with or without radiation to explore the sensitization effect of Roscovitine. The present study conclude that Roscovitine a good candidate as radiosensitizer for modifying the ionizing radiation (IR) response in cancer cells, beside its cyclin dependent kinase inhibitor function, roscovitine can generate DNA Double strand Breaks and cooperate to enhance IR induce DNA damages . Roscovitine is currently in clinical trials, although our findings suggest that the combination of Roscovitine with IR appears to be a very promising especially for liver, brain and lung cancer treatment, further investigation is needed to evaluate the therapeutic index before tested in clinical trial

  9. Role of novel anticancer drug Roscovitine on enhancing radiosensitivity in carcinoma cell lines

    International Nuclear Information System (INIS)

    Noaman, E.; Sayed, H.M.; Medhat, A.M.; Morcos, N.Y.S.

    2010-01-01

    The present study was conducted to evaluate the radiosensitization effect of Roscovitine (cyclin dependent kinase inhibitor) in carcinoma cell lines. Three cell lines are used liver carcinoma cell line (HepG2), brain carcinoma cell line (U251), Lung carcinoma cell line (H460) in this study cells were treated with Roscovitine in different concentrations ranging from 0.1 ?M to 100 ?M before exposure to radiation doses ranging from 0.5 Gy to 20 Gy according to each experiment. The cell viability by MTT assay, the cell cycle analysis by flow cytometry and DNA fragmentation repair mechanism by diphenylamine were measured after Roscovitine treatment with or without radiation exposure to explore the sensitization effect of Roscovitine. The present study conclude that Roscovitine a good candidate as radiosensitizer for modifying the ionizing radiation (IR) response in cancer cells, beside its cyclin dependent kinase inhibitor function, Roscovitine can generate DNA Double strand Breaks and cooperate to enhance IR induce DNA damages. Roscovitine is currently in clinical trials, although our findings suggest that the combination of Roscovitine with IR appears to be a very promising especially for liver, brain and lung cancer treatment, further investigation is needed to evaluate the therapeutic index before tested in clinical trials

  10. Highly functionalized piperidines: Free radical scavenging, anticancer activity, DNA interaction and correlation with biological activity

    Directory of Open Access Journals (Sweden)

    Suvankar Das

    2018-01-01

    Full Text Available Twenty-five piperidines were studied as potential radical scavengers and antitumor agents. Quantitative interaction of compounds with ctDNA using spectroscopic techniques was also evaluated. Our results demonstrate that the evaluated piperidines possesses different abilities to scavenge the radical 2,2-diphenyl-1-picrylhydrazyl (DPPH and the anion radical superoxide (·O2−. The piperidine 19 was the most potent radical DPPH scavenger, while the most effective to ·O2− scavenger was piperidine 10. In general, U251, MCF7, NCI/ADR-RES, NCI-H460 and HT29 cells were least sensitive to the tested compounds and all compounds were considerably more toxic to the studied cancer cell lines than to the normal cell line HaCaT. The binding mode of the compounds and ctDNA was preferably via intercalation. In addition, these results were confirmed based on theoretical studies. Finally, a linear and exponential correlation between interaction constant (Kb and GI50 for several human cancer cell was observed.

  11. Radiation response of human lung cancer cells with inherent and acquired resistance to cisplatin

    International Nuclear Information System (INIS)

    Twentyman, P.R.; Wright, K.A.; Rhodes, T.

    1991-01-01

    We have derived sublines of three human lung cancer cell lines with acquired resistance to cisplatin. The cisplatin resistant sublines of NCI-H69 (small cell), COR-L23 (large cell), and MOR (adenocarcinoma) show 5.3 fold, 3.1 fold, and 3.8 fold resistance, respectively, determined in a 6-day MTT assay. Although the parent lines show a wide range of glutathione content per cell, the sublines each show similar values to their corresponding parent line. Radiation response curves have been obtained using a soft agar clonogenic assay. Values obtained for the parent lines (95% CL in parentheses) were: NCI-H69: Do = 0.99 Gy (0.87-1.16), n = 2.9 (1.6-5.2), GSH = 14 ng/10(4) cells; COR-L23: Do = 1.23 Gy (1.05-1.49), n = 1.3 (0.7-2.2), GSH = 47 ng/10(4) cells; MOR: Do = 1.66 Gy (1.48-1.88), n = 3.0 (1.9-4.8), GSH = 86 ng/10(4) cells. The cisplatin resistant variants of NCI-H69 and COR-L23 showed 31% and 63% increases, respectively, in Do compared to their parent lines, whereas no change in radiation response was seen in MOR. In this panel of lines, therefore, although there is a correlation between glutathione content and radiosensitivity of the parent cell lines, acquired resistance to cisplatin is not accompanied by increased glutathione content. However, two of the three cisplatin resistant lines do show a significantly reduced radiosensitivity

  12. Selective and sensitive fluorescent sensor for Pd2+ using coumarin 460 for real-time and biological applications.

    Science.gov (United States)

    Ashwin, Bosco Christin Maria Arputham; Sivaraman, Gandhi; Stalin, Thambusamy; Yuvakkumar, Rathinam; Muthu Mareeswaran, Paulpandian

    2018-05-03

    The efficient fluorescent property of coumarin 460 (C460) is utilized to sense the Pd 2+ selectively and sensitively. Fabrication of a sensor strip using commercial adhesive tape is achieved and the detection of Pd 2+ is attempted using a handy UV torch. The naked eye detection in solution state using UV chamber is also attempted. The calculated high binding constant values support the strong stable complex formation of Pd 2+ with C460. The detection limit up to 2.5 × 10 -7  M is achieved using fluorescence spectrometer, which is considerably low from the WHO's recommendation. The response of coumarin 460 with various cations also studied. The quenching is further studied by the lifetime measurements. The binding mechanism is clearly explained by the 1 H NMR titration. The sensing mechanism is established as ICT. C460 strip's Pd 2+ quenching detection is further confirmed by solid-state PL study. The in-vitro response of Pd 2+ in a living cell is also studied using fluorescent imaging studies by means of HeLa cell lines and this probe is very compatible with biological environments. It could be applicable to sense trace amounts of a Pd 2+ ion from various industries. Compared with previous reports, this one is very cheap, sensitive, selective and suitable for biological systems. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Susceptibility of Human Oral Squamous Cell Carcinoma (OSCC H103 and H376 cell lines to Retroviral OSKM mediated reprogramming

    Directory of Open Access Journals (Sweden)

    Nalini Devi Verusingam

    2017-04-01

    Full Text Available Although numbers of cancer cell lines have been shown to be successfully reprogrammed into induced pluripotent stem cells (iPSCs, reprogramming Oral Squamous Cell Carcinoma (OSCC to pluripotency in relation to its cancer cell type and the expression pattern of pluripotent genes under later passage remain unexplored. In our study, we reprogrammed and characterised H103 and H376 oral squamous carcinoma cells using retroviral OSKM mediated method. Reprogrammed cells were characterized for their embryonic stem cells (ESCs like morphology, pluripotent gene expression via quantitative real-time polymerase chain reaction (RT-qPCR, immunofluorescence staining, embryoid bodies (EB formation and directed differentiation capacity. Reprogrammed H103 (Rep-H103 exhibited similar ESCs morphologies with flatten cells and clear borders on feeder layer. Reprogrammed H376 (Rep-H376 did not show ESCs morphologies but grow with a disorganized morphology. Critical pluripotency genes Oct4, Sox2 and Nanog were expressed higher in Rep-H103 against the parental counterpart from passage 5 to passage 10. As for Rep-H376, Nanog expression against its parental counterpart showed a significant decrease at passage 5 and although increased in passage 10, the level of expression was similar to the parental cells. Rep-H103 exhibited pluripotent signals (Oct4, Sox2, Nanog and Tra-1-60 and could form EB with the presence of three germ layers markers. Rep-H103 displayed differentiation capacity into adipocytes and osteocytes. The OSCC cell line H103 which was able to be reprogrammed into an iPSC like state showed high expression of Oct4, Sox2 and Nanog at late passage and may provide a potential iPSC model to study multi-stage oncogenesis in OSCC.

  14. NCI-60 whole exome sequencing and pharmacological CellMiner analyses.

    Directory of Open Access Journals (Sweden)

    William C Reinhold

    Full Text Available Exome sequencing provides unprecedented insights into cancer biology and pharmacological response. Here we assess these two parameters for the NCI-60, which is among the richest genomic and pharmacological publicly available cancer cell line databases. Homozygous genetic variants that putatively affect protein function were identified in 1,199 genes (approximately 6% of all genes. Variants that are either enriched or depleted compared to non-cancerous genomes, and thus may be influential in cancer progression and differential drug response were identified for 2,546 genes. Potential gene knockouts are made available. Assessment of cell line response to 19,940 compounds, including 110 FDA-approved drugs, reveals ≈80-fold range in resistance versus sensitivity response across cell lines. 103,422 gene variants were significantly correlated with at least one compound (at p<0.0002. These include genes of known pharmacological importance such as IGF1R, BRAF, RAD52, MTOR, STAT2 and TSC2 as well as a large number of candidate genes such as NOM1, TLL2, and XDH. We introduce two new web-based CellMiner applications that enable exploration of variant-to-compound relationships for a broad range of researchers, especially those without bioinformatics support. The first tool, "Genetic variant versus drug visualization", provides a visualization of significant correlations between drug activity-gene variant combinations. Examples are given for the known vemurafenib-BRAF, and novel ifosfamide-RAD52 pairings. The second, "Genetic variant summation" allows an assessment of cumulative genetic variations for up to 150 combined genes together; and is designed to identify the variant burden for molecular pathways or functional grouping of genes. An example of its use is provided for the EGFR-ERBB2 pathway gene variant data and the identification of correlated EGFR, ERBB2, MTOR, BRAF, MEK and ERK inhibitors. The new tools are implemented as an updated web-based Cell

  15. Antiproliferative Activity of Flavonoids from Croton sphaerogynus Baill. (Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    Kátia Pereira dos Santos

    2015-01-01

    Full Text Available Croton sphaerogynus is a shrub from the Atlantic Rain Forest in southeastern Brazil. A lyophilized crude EtOH extract from leaves of C. sphaerogynus, obtained by maceration at room temperature (seven days, was suspended in methanol and partitioned with hexane. The purified MeOH phase was fractionated over Sephadex LH-20 yielding five fractions (F1–F5 containing flavonoids, as characterized by HPLC-DAD and HPLC-MS analyses. The antiproliferative activity of the crude EtOH extract, MeOH and hexane phases, and fractions F1–F5 was evaluated on in vitro cell lines NCI-H460 (nonsmall cell lung, MCF-7 (breast cancer, and U251 (glioma. The MeOH phase showed activity (mean log GI50 0.54 higher than the hexane phase and EtOH extract (mean log GI50 1.13 and 1.19, resp.. F1 exhibited activity against NCI-H460 (nonsmall cell lung (GI50 1.2 μg/mL, which could be accounted for the presence of flavonoids and/or diterpenes. F4 showed moderate activity (mean log GI50 1.05, while F5 showed weak activity (mean log GI50 1.36. It is suggested that the antiproliferative activity of the crude EtOH extract and MeOH phase is accounted for a synergistic combination of flavonoids and diterpenes.

  16. Colon cancer proliferating desulfosinigrin in wasabi (Wasabia japonica).

    Science.gov (United States)

    Weil, Marvin J; Zhang, Yanjun; Nair, Muraleedharan G

    2004-01-01

    A reduced incidence of different types of cancer has been linked to consumption of Brassica vegetables, and there is evidence that glucosinolates (GSLs) and their hydrolysis products play a role in reducing cancer risk. Wasabi (Wasabia japonica) and horseradish (Armoracia rusticana), both Brassica vegetables, are widely used condiments both in Japanese cuisine and in the United States. Desulfosinigrin (DSS) (1) was isolated from a commercially available wasabi powder and from fresh wasabi roots. Sinigrin (2) was isolated from horseradish roots. DSS and sinigrin were evaluated for their inhibitory effects on cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2) enzymes, on lipid peroxidation, and on the proliferation of human colon (HCT-116), breast (MCF-7), lung (NCIH460), and central nervous system (CNS, SF-268) cancer cell lines. DSS did not inhibit COX enzymes or lipid peroxidation at 250 microg/ml. Sinigrin inhibited lipid peroxidation by 71% at 250 microg/ml. However, DSS promoted the growth of HCT-116 (colon) and NCI H460 (lung) human cancer cells as determined by the MTT assay in a concentration-dependent manner. At 3.72 microg/ml, a 27% increase in the number of viable human HCT-116 colon cancer cells was observed; the corresponding increases at 7.50 and 15 microg/ml were 42 and 69%, respectively. At 60 microg/ml, DSS doubled the number of HCT-16 colon cancer cells. For NCI H460 human lung cancer cells, DSS at 60 microg/ml increased the cell number by 20%. Sinigrin showed no proliferating effect on the tumor cells tested. This is the first report of the tumor cell-proliferating activity by a desulfoglucosinolate, the biosynthetic precursor of GSLs found in Brassica spp.

  17. Human metastatic melanoma cell lines express high levels of growth hormone receptor and respond to GH treatment

    Energy Technology Data Exchange (ETDEWEB)

    Sustarsic, Elahu G. [Edison Biotechnology Institute, 1 Watertower Drive, Athens, OH (United States); Department of Biological Sciences, Ohio University, Athens, OH (United States); Junnila, Riia K. [Edison Biotechnology Institute, 1 Watertower Drive, Athens, OH (United States); Kopchick, John J., E-mail: kopchick@ohio.edu [Edison Biotechnology Institute, 1 Watertower Drive, Athens, OH (United States); Department of Biological Sciences, Ohio University, Athens, OH (United States); Department of Biomedical Sciences, Heritage College of Osteopathic Medicine, Ohio University, Athens, OH (United States)

    2013-11-08

    Highlights: •Most cancer types of the NCI60 have sub-sets of cell lines with high GHR expression. •GHR is highly expressed in melanoma cell lines. •GHR is elevated in advanced stage IV metastatic tumors vs. stage III. •GH treatment of metastatic melanoma cell lines alters growth and cell signaling. -- Abstract: Accumulating evidence implicates the growth hormone receptor (GHR) in carcinogenesis. While multiple studies show evidence for expression of growth hormone (GH) and GHR mRNA in human cancer tissue, there is a lack of quantification and only a few cancer types have been investigated. The National Cancer Institute’s NCI60 panel includes 60 cancer cell lines from nine types of human cancer: breast, CNS, colon, leukemia, melanoma, non-small cell lung, ovarian, prostate and renal. We utilized this panel to quantify expression of GHR, GH, prolactin receptor (PRLR) and prolactin (PRL) mRNA with real-time RT qPCR. Both GHR and PRLR show a broad range of expression within and among most cancer types. Strikingly, GHR expression is nearly 50-fold higher in melanoma than in the panel as a whole. Analysis of human metastatic melanoma biopsies confirmed GHR gene expression in melanoma tissue. In these human biopsies, the level of GHR mRNA is elevated in advanced stage IV tumor samples compared to stage III. Due to the novel finding of high GHR in melanoma, we examined the effect of GH treatment on three NCI60 melanoma lines (MDA-MB-435, UACC-62 and SK-MEL-5). GH increased proliferation in two out of three cell lines tested. Further analysis revealed GH-induced activation of STAT5 and mTOR in a cell line dependent manner. In conclusion, we have identified cell lines and cancer types that are ideal to study the role of GH and PRL in cancer, yet have been largely overlooked. Furthermore, we found that human metastatic melanoma tumors express GHR and cell lines possess active GHRs that can modulate multiple signaling pathways and alter cell proliferation. Based on

  18. Nicotine transport in lung and non-lung epithelial cells.

    Science.gov (United States)

    Takano, Mikihisa; Kamei, Hidetaka; Nagahiro, Machi; Kawami, Masashi; Yumoto, Ryoko

    2017-11-01

    Nicotine is rapidly absorbed from the lung alveoli into systemic circulation during cigarette smoking. However, mechanism underlying nicotine transport in alveolar epithelial cells is not well understood to date. In the present study, we characterized nicotine uptake in lung epithelial cell lines A549 and NCI-H441 and in non-lung epithelial cell lines HepG2 and MCF-7. Characteristics of [ 3 H]nicotine uptake was studied using these cell lines. Nicotine uptake in A549 cells occurred in a time- and temperature-dependent manner and showed saturation kinetics, with a Km value of 0.31mM. Treatment with some organic cations such as diphenhydramine and pyrilamine inhibited nicotine uptake, whereas treatment with organic cations such as carnitine and tetraethylammonium did not affect nicotine uptake. Extracellular pH markedly affected nicotine uptake, with high nicotine uptake being observed at high pH up to 11.0. Modulation of intracellular pH with ammonium chloride also affected nicotine uptake. Treatment with valinomycin, a potassium ionophore, did not significantly affect nicotine uptake, indicating that nicotine uptake is an electroneutral process. For comparison, we assessed the characteristics of nicotine uptake in another lung epithelial cell line NCI-H441 and in non-lung epithelial cell lines HepG2 and MCF-7. Interestingly, these cell lines showed similar characteristics of nicotine uptake with respect to pH dependency and inhibition by various organic cations. The present findings suggest that a similar or the same pH-dependent transport system is involved in nicotine uptake in these cell lines. A novel molecular mechanism of nicotine transport is proposed. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. ImmunoPET for assessing the differential uptake of a CD146-specific monoclonal antibody in lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

    2016-11-15

    Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146

  20. Attenuation of the DNA Damage Response by Transforming Growth Factor-Beta Inhibitors Enhances Radiation Sensitivity of Non–Small-Cell Lung Cancer Cells In Vitro and In Vivo

    Energy Technology Data Exchange (ETDEWEB)

    Du, Shisuo; Bouquet, Sophie; Lo, Chen-Hao; Pellicciotta, Ilenia; Bolourchi, Shiva [Department of Radiation Oncology, New York University School of Medicine, New York, New York (United States); Parry, Renate [Varian Medical Systems, Palo Alto, California (United States); Barcellos-Hoff, Mary Helen, E-mail: mhbarcellos-hoff@nyumc.org [Department of Radiation Oncology, New York University School of Medicine, New York, New York (United States)

    2015-01-01

    Purpose: To determine whether transforming growth factor (TGF)-β inhibition increases the response to radiation therapy in human and mouse non–small-cell lung carcinoma (NSCLC) cells in vitro and in vivo. Methods and Materials: TGF-β–mediated growth response and pathway activation were examined in human NSCLC NCI-H1299, NCI-H292, and A549 cell lines and murine Lewis lung cancer (LLC) cells. Cells were treated in vitro with LY364947, a small-molecule inhibitor of the TGF-β type 1 receptor kinase, or with the pan-isoform TGF-β neutralizing monoclonal antibody 1D11 before radiation exposure. The DNA damage response was assessed by ataxia telangiectasia mutated (ATM) or Trp53 protein phosphorylation, γH2AX foci formation, or comet assay in irradiated cells. Radiation sensitivity was determined by clonogenic assay. Mice bearing syngeneic subcutaneous LLC tumors were treated with 5 fractions of 6 Gy and/or neutralizing or control antibody. Results: The NCI-H1299, A549, and LLC NSCLC cell lines pretreated with LY364947 before radiation exposure exhibited compromised DNA damage response, indicated by decreased ATM and p53 phosphorylation, reduced γH2AX foci, and increased radiosensitivity. The NCI-H292 cells were unresponsive. Transforming growth factor-β signaling inhibition in irradiated LLC cells resulted in unresolved DNA damage. Subcutaneous LLC tumors in mice treated with TGF-β neutralizing antibody exhibited fewer γH2AX foci after irradiation and significantly greater tumor growth delay in combination with fractionated radiation. Conclusions: Inhibition of TGF-β before radiation attenuated DNA damage recognition and increased radiosensitivity in most NSCLC cells in vitro and promoted radiation-induced tumor control in vivo. These data support the rationale for concurrent TGF-β inhibition and RT to provide therapeutic benefit in NSCLC.

  1. Imaging and biodistribution of Her2/neu expression in non-small cell lung cancer xenografts with 64Cu-labeled trastuzumab PET

    International Nuclear Information System (INIS)

    Paudyal, P.; Paudyal, B.; Hanaoka, Hirofumi

    2010-01-01

    Non-small cell lung carcinomas (NSCLC) overexpress the Her2/neu gene in approximately 59% of cases. Trastuzumab, a humanized monoclonal antibody, interferes with Her2 signaling and is approved for the treatment of Her2/neu overexpressing breast cancer. However, its therapeutic use in Her2/neu overexpressing NSCLC remains obscure. The present study aimed to determine the role of 64 Cu-labeled trastuzumab positron emission tomography (PET) for non-invasive imaging of Her2/neu expression in NSCLC. Trastuzumab was conjugated with the bifunctional chelator 1, 4, 7, 10-tetraazacyclododecane-1, 4, 7, 10-tetraacetic acid (DOTA) and radiolabeled with 64 Cu. The molecular specificity of DOTA-trastuzumab was determined in NSCLC cell lines with Her2/neu overexpression (NCI-H2170) and negative expression (NCI-H520). Imaging of Her2/neu expression was performed in NCI-H2170 tumor-bearing mice with 64 Cu-DOTA-trastuzumab PET and 64 Cu-DOTA-immunoglobulin G (IgG). In vitro studies revealed specific binding of DOTA-trastuzumab in the Her2/neu positive NCI-H2170 cells, while no binding was seen in the Her2/neu negative NCI-H520 cell line. Biodistribution and PET studies revealed a significantly high accumulation of 64 Cu-DOTA-trastuzumab in the Her2/neu overexpressing NCI-H2170 tumor at 24 and 48 h post-injection (21.4±1.4% and 23.2±5.1% injection dose/gram (% ID/g), respectively). PET imaging of Her2/neu negative NCI-H520 tumors showed much less uptake of 64 Cu-DOTA-trastuzumab (4.0% ID/g). The NCI-H2170 tumor uptake of 64 Cu-DOTA-trastuzumab was significantly higher than that of 64 Cu-DOTA-IgG (P 64 Cu-DOTA-trastuzumab showed a very clear image of a Her2/neu positive tumor and appeared to be effective as a PET tracer for imaging of Her2/neu gene expression in NSCLC, suggesting its potential clinical use for identifying patients that might benefit from trastuzumab-based therapy. (author)

  2. NCI Holds on to Defelice Cup | Poster

    Science.gov (United States)

    NCI kept the Defelice Cup trophy this year after beating Leidos Biomedical Research, 15 to 9, at the 10th annual Ronald H. Defelice Golf Tournament held on Columbus Day. Sixteen players on each team battled it out at the yearly contractor vs. government tournament held at Rattlewood Golf Course in Mount Airy, Md. NCI leads the series 6–4. “The score was the highest NCI margin

  3. Methylselenol, a selenium metabolite, plays common and different roles in cancerous colon HCT116 cell and noncancerous NCM460 colon cell proliferation.

    Science.gov (United States)

    Zeng, Huawei; Briske-Anderson, Mary; Wu, Min; Moyer, Mary P

    2012-01-01

    Methylselenol is hypothesized to be a critical selenium metabolite for anticancer action, and differential chemopreventive effects of methylselenol on cancerous and noncancerous cells may play an important role. In this study, the submicromolar concentrations of methylselenol were generated by incubating methionase with seleno-L methionine, and colon-cancer-derived HCT-116 cells and noncancerous colon NCM460 cells were exposed to methylselenol. Methylselenol exposure inhibited cell growth and led to an increase in G1 and G2 fractions with a concomitant drop in S-phase and an induction of apoptosis in HCT116, but to a much lesser extent in NCM460 colon cells. Similarly, the examination of mitogen-activated protein kinase (MAPK) and cellular myelocytomatosis oncogene (c-Myc) signaling status revealed that methylselenol inhibited the phosphorylation of extracellular-regulated kinase1/2 and p38 mitogen-activated protein kinase and the expression of c-Myc in HCT116 cells, but also to a lesser extent in NCM460 cells. The other finding is that methylselenol inhibits sarcoma kinase phosphorylation in HCT116 cells. In contrast, methylselenol upregulated the phosphorylation of sarcoma and focal adhesion kinase survival signals in the noncancerous NCM460 cells. Collectively, methylselenol's stronger potential of inhibiting cell proliferation/survival signals in the cancerous HCT116 cells when compared with that in noncancerous NCM460 cells may partly explain the potential of methylselenol's anticancer action.

  4. Prostate Cancer Cell Growth: Stimulatory Role of Neurotensin and Mechanism of Inhibition by Flavonoids as Related to Protein Kinase C

    Science.gov (United States)

    2010-01-01

    cell lines (NCI-N417, NCI-H345, NCI-N592) were found to convert exogenous NT into the fragments NT1 –8 and NT9–13, reflecting the presence of...secrete NT. However, exogenous NT was degraded primarily to NT1 –11, consistent with the presence of neutral endopeptidase 3.4.24.11 in these cells . This...TITLE: Prostate Cancer Cell Growth: Stimulatory Role of Neurotensin and Mechanism of Inhibition by Flavonoids as Related to Protein Kinase C

  5. Secondary Analysis of the NCI-60 Whole Exome Sequencing Data Indicates Significant Presence of Propionibacterium acnes Genomic Material in Leukemia (RPMI-8226 and Central Nervous System (SF-295, SF-539, and SNB-19 Cell Lines.

    Directory of Open Access Journals (Sweden)

    Mark Rojas

    Full Text Available The NCI-60 human tumor cell line panel has been used in a broad range of cancer research over the last two decades. A landmark 2013 whole exome sequencing study of this panel added an exceptional new resource for cancer biologists. The complementary analysis of the sequencing data produced by this study suggests the presence of Propionibacterium acnes genomic sequences in almost half of the datasets, with the highest abundance in the leukemia (RPMI-8226 and central nervous system (SF-295, SF-539, and SNB-19 cell lines. While the origin of these contaminating bacterial sequences remains to be determined, observed results suggest that computational control for the presence of microbial genomic material is a necessary step in the analysis of the high throughput sequencing (HTS data.

  6. An Inducible, Isogenic Cancer Cell Line System for Targeting the State of Mismatch Repair Deficiency

    Science.gov (United States)

    Bailis, Julie M.; Gordon, Marcia L.; Gurgel, Jesse L.; Komor, Alexis C.; Barton, Jacqueline K.; Kirsch, Ilan R.

    2013-01-01

    The DNA mismatch repair system (MMR) maintains genome stability through recognition and repair of single-base mismatches and small insertion-deletion loops. Inactivation of the MMR pathway causes microsatellite instability and the accumulation of genomic mutations that can cause or contribute to cancer. In fact, 10-20% of certain solid and hematologic cancers are MMR-deficient. MMR-deficient cancers do not respond to some standard of care chemotherapeutics because of presumed increased tolerance of DNA damage, highlighting the need for novel therapeutic drugs. Toward this goal, we generated isogenic cancer cell lines for direct comparison of MMR-proficient and MMR-deficient cells. We engineered NCI-H23 lung adenocarcinoma cells to contain a doxycycline-inducible shRNA designed to suppress the expression of the mismatch repair gene MLH1, and compared single cell subclones that were uninduced (MLH1-proficient) versus induced for the MLH1 shRNA (MLH1-deficient). Here we present the characterization of these MMR-inducible cell lines and validate a novel class of rhodium metalloinsertor compounds that differentially inhibit the proliferation of MMR-deficient cancer cells. PMID:24205301

  7. 77 FR 2734 - Proposed Collection; Comment Request: Solar Cell: A Mobile UV Manager for Smart Phones (NCI)

    Science.gov (United States)

    2012-01-19

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Proposed Collection; Comment Request: Solar Cell: A Mobile UV Manager for Smart Phones (NCI) SUMMARY: In compliance with the... Manager for Smart Phones (NCI). Type of Information Collection Request: New. Need and Use of Information...

  8. Bystander Effects Induced by Continuous Low-Dose-Rate 125I Seeds Potentiate the Killing Action of Irradiation on Human Lung Cancer Cells In Vitro

    International Nuclear Information System (INIS)

    Chen, H.H.; Jia, R.F.; Yu, L.; Zhao, M.J.; Shao, C.L.; Cheng, W.Y.

    2008-01-01

    Purpose: To investigate bystander effects of low-dose-rate (LDR) 125 I seed irradiation on human lung cancer cells in vitro. Methods and Materials: A549 and NCI-H446 cell lines of differing radiosensitivity were directly exposed to LDR 125 I seeds irradiation for 2 or 4 Gy and then cocultured with nonirradiated cells for 24 hours. Induction of micronucleus (MN), γH2AX foci, and apoptosis were assayed. Results: After 2 and 4 Gy irradiation, micronucleus formation rate (MFR) and apoptotic rate of A549 and NCI-H446 cells were increased, and the MFR and apoptotic rate of NCI-H446 cells was 2.1-2.8 times higher than that of A549 cells. After coculturing nonirradiated bystander cells with 125 I seed irradiated cells for 24 hours, MFR and the mean number of γH2AX foci/cells of bystander A549 and NCI-H446 cells were similar and significantly higher than those of control (p 125 I seeds could induce bystander effects, which potentiate the killing action on tumor cells and compensate for the influence of nonuniform distribution of radiation dosage on therapeutic outcomes

  9. A study of radiation sensitivity and drug-resistance by DNA methylation in human tumor cell lines

    International Nuclear Information System (INIS)

    Jung, Il Lae; Kim, In Gyu; Kim, Kug Chan

    2009-12-01

    It has recently been known that functional loss of tumor suppressive genes may com from DNA methylation on the chromosome. This kind of tumorigenesis has became one of the major field related to the epigenetics, whose study would be an important fundamental approach in cancer therapy market. In this study, we firstly selected two radiation-resistant mutant H460 cells, which doesn't show any significant cytotoxic effect compared to their parental wild type H460. We found that the two mutants has decreased level of PTEN, whose expression has known to be related to the cell differentiation and growth. We also found that the level of PTEN was greatly different in two lung adenocarcinoma, H460 and A549, in which more radiation-resistant A549 cells showed the decreased PTEN expression. This difference in PTEN expression between two cells was resulted from their different methylation on 5 CpG islands. We expect to know more profoundly through investigating the PTEN-related downstream genes

  10. Characterization of stimulus-secretion coupling in the human pancreatic EndoC-βH1 beta cell line.

    Directory of Open Access Journals (Sweden)

    Lotta E Andersson

    Full Text Available Studies on beta cell metabolism are often conducted in rodent beta cell lines due to the lack of stable human beta cell lines. Recently, a human cell line, EndoC-βH1, was generated. Here we investigate stimulus-secretion coupling in this cell line, and compare it with that in the rat beta cell line, INS-1 832/13, and human islets.Cells were exposed to glucose and pyruvate. Insulin secretion and content (radioimmunoassay, gene expression (Gene Chip array, metabolite levels (GC/MS, respiration (Seahorse XF24 Extracellular Flux Analyzer, glucose utilization (radiometric, lactate release (enzymatic colorimetric, ATP levels (enzymatic bioluminescence and plasma membrane potential and cytoplasmic Ca2+ responses (microfluorometry were measured. Metabolite levels, respiration and insulin secretion were examined in human islets.Glucose increased insulin release, glucose utilization, raised ATP production and respiratory rates in both lines, and pyruvate increased insulin secretion and respiration. EndoC-βH1 cells exhibited higher insulin secretion, while plasma membrane depolarization was attenuated, and neither glucose nor pyruvate induced oscillations in intracellular calcium concentration or plasma membrane potential. Metabolite profiling revealed that glycolytic and TCA-cycle intermediate levels increased in response to glucose in both cell lines, but responses were weaker in EndoC-βH1 cells, similar to those observed in human islets. Respiration in EndoC-βH1 cells was more similar to that in human islets than in INS-1 832/13 cells.Functions associated with early stimulus-secretion coupling, with the exception of plasma membrane potential and Ca2+ oscillations, were similar in the two cell lines; insulin secretion, respiration and metabolite responses were similar in EndoC-βH1 cells and human islets. While both cell lines are suitable in vitro models, with the caveat of replicating key findings in isolated islets, EndoC-βH1 cells have the

  11. Hypoxia-Induced Cisplatin Resistance in Non-Small Cell Lung Cancer Cells Is Mediated by HIF-1α and Mutant p53 and Can Be Overcome by Induction of Oxidative Stress.

    Science.gov (United States)

    Deben, Christophe; Deschoolmeester, Vanessa; De Waele, Jorrit; Jacobs, Julie; Van den Bossche, Jolien; Wouters, An; Peeters, Marc; Rolfo, Christian; Smits, Evelien; Lardon, Filip; Pauwels, Patrick

    2018-04-21

    The compound APR-246 (PRIMA-1 MET ) is a known reactivator of (mutant) p53 and inducer of oxidative stress which can sensitize cancer cells to platinum-based chemotherapeutics. However, the effect of a hypoxic tumor environment has been largely overlooked in this interaction. This study focusses on the role of hypoxia-inducible factor-1α (HIF-1α) and the p53 tumor suppressor protein in hypoxia-induced cisplatin resistance in non-small cell lung cancer (NSCLC) cells and the potential of APR-246 to overcome this resistance. We observed that hypoxia-induced cisplatin resistance only occurred in the p53 mutant NCI-H2228 Q331 * cell line, and not in the wild type A549 and mutant NCI-H1975 R273H cell lines. Cisplatin reduced HIF-1α protein levels in NCI-H2228 Q331 * cells, leading to a shift in expression from HIF-1α-dependent to p53-dependent transcription targets under hypoxia. APR-246 was able to overcome hypoxia-induced cisplatin resistance in NCI-H2228 Q331 * cells in a synergistic manner without affecting mutant p53 Q331 * transcriptional activity, but significantly depleting total glutathione levels more efficiently under hypoxic conditions. Synergism was dependent on the presence of mutant p53 Q331 * and the induction of reactive oxygen species, with depletion of one or the other leading to loss of synergism. Our data further support the rationale of combining APR-246 with cisplatin in NSCLC, since their synergistic interaction is retained or enforced under hypoxic conditions in the presence of mutant p53.

  12. Hypoxia-Induced Cisplatin Resistance in Non-Small Cell Lung Cancer Cells Is Mediated by HIF-1α and Mutant p53 and Can Be Overcome by Induction of Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Christophe Deben

    2018-04-01

    Full Text Available The compound APR-246 (PRIMA-1MET is a known reactivator of (mutant p53 and inducer of oxidative stress which can sensitize cancer cells to platinum-based chemotherapeutics. However, the effect of a hypoxic tumor environment has been largely overlooked in this interaction. This study focusses on the role of hypoxia-inducible factor-1α (HIF-1α and the p53 tumor suppressor protein in hypoxia-induced cisplatin resistance in non-small cell lung cancer (NSCLC cells and the potential of APR-246 to overcome this resistance. We observed that hypoxia-induced cisplatin resistance only occurred in the p53 mutant NCI-H2228Q331* cell line, and not in the wild type A549 and mutant NCI-H1975R273H cell lines. Cisplatin reduced HIF-1α protein levels in NCI-H2228Q331* cells, leading to a shift in expression from HIF-1α-dependent to p53-dependent transcription targets under hypoxia. APR-246 was able to overcome hypoxia-induced cisplatin resistance in NCI-H2228Q331* cells in a synergistic manner without affecting mutant p53Q331* transcriptional activity, but significantly depleting total glutathione levels more efficiently under hypoxic conditions. Synergism was dependent on the presence of mutant p53Q331* and the induction of reactive oxygen species, with depletion of one or the other leading to loss of synergism. Our data further support the rationale of combining APR-246 with cisplatin in NSCLC, since their synergistic interaction is retained or enforced under hypoxic conditions in the presence of mutant p53.

  13. Growth inhibitory effects of miR-221 and miR-222 in non-small cell lung cancer cells

    International Nuclear Information System (INIS)

    Yamashita, Ryo; Sato, Mitsuo; Kakumu, Tomohiko; Hase, Tetsunari; Yogo, Naoyuki; Maruyama, Eiichi; Sekido, Yoshitaka; Kondo, Masashi; Hasegawa, Yoshinori

    2015-01-01

    Both pro- and anti-oncogenic roles of miR-221 and miR-222 microRNAs are reported in several types of human cancers. A previous study suggested their oncogenic role in invasiveness in lung cancer, albeit only one cell line (H460) was used. To further evaluate involvement of miR-221 and miR-222 in lung cancer, we investigated the effects of miR-221 and miR-222 overexpression on six lung cancer cell lines, including H460, as well as one immortalized normal human bronchial epithelial cell line, HBEC4. miR-221 and miR-222 induced epithelial-to-mesenchymal transition (EMT)-like changes in a minority of HBEC4 cells but, unexpectedly, both the microRNAs rather suppressed their invasiveness. Consistent with the prior report, miR-221 and miR-222 promoted growth in H460; however, miR-221 suppressed growth in four other cell lines with no effects in one, and miR-222 suppressed growth in three cell lines but promoted growth in two. These are the first results to show tumor-suppressive effects of miR-221 and miR-222 in lung cancer cells, and we focused on clarifying the mechanisms. Cell cycle and apoptosis analyses revealed that growth suppression by miR-221 and miR-222 occurred through intra-S-phase arrest and/or apoptosis. Finally, lung cancer cell lines transfected with miR-221 or miR-222 became more sensitive to the S-phase targeting drugs, possibly due to an increased S-phase population. In conclusion, our data are the first to show tumor-suppressive effects of miR-221 and miR-222 on lung cancer, warranting testing their potential as therapeutics for the disease

  14. Association of a single nucleotide polymorphic variation in the human chromosome 19q13.3 with drug responses in the NCI60 cell lines

    DEFF Research Database (Denmark)

    Nissen, K.K.; Vogel, Ulla Birgitte; Nexo, B.A.

    2009-01-01

    the correlations between the responses of the NCI60 cells to different anticancer drugs and their respective alleles of five DNA polymorphisms located in a cancer-related chromosomal area. One polymorphism, located in the 5' noncoding region of the gene ASE-1, alias CD3EAP, proved to be associated with drug...

  15. Potentiation of in vitro and in vivo antitumor efficacy of doxorubicin by cyclin-dependent kinase inhibitor P276-00 in human non-small cell lung cancer cells

    International Nuclear Information System (INIS)

    Rathos, Maggie J; Khanwalkar, Harshal; Joshi, Kavita; Manohar, Sonal M; Joshi, Kalpana S

    2013-01-01

    In the present study, we show that the combination of doxorubicin with the cyclin-dependent kinase inhibitor P276-00 was synergistic at suboptimal doses in the non-small cell lung carcinoma (NSCLC) cell lines and induces extensive apoptosis than either drug alone in H-460 human NSCLC cells. Synergistic effects of P276-00 and doxorubicin on growth inhibition was studied using the Propidium Iodide (PI) assay. The doses showing the best synergistic effect was determined and these doses were used for further mechanistic studies such as western blotting, cell cycle analysis and RT-PCR. The in vivo efficacy of the combination was evaluated using the H-460 xenograft model. The combination of 100 nM doxorubicin followed by 1200 nM P276-00 showed synergistic effect in the p53-positive and p53-mutated cell lines H-460 and H23 respectively as compared to the p53-null cell line H1299. Abrogation of doxorubicin-induced G2/M arrest and induction of apoptosis was observed in the combination treatment. This was associated with induction of tumor suppressor protein p53 and reduction of anti-apoptotic protein Bcl-2. Furthermore, doxorubicin alone greatly induced COX-2, a NF-κB target and Cdk-1, a target of P276-00, which was downregulated by P276-00 in the combination. Doxorubicin when combined with P276-00 in a sequence-specific manner significantly inhibited tumor growth, compared with either doxorubicin or P276-00 alone in H-460 xenograft model. These findings suggest that this combination may increase the therapeutic index over doxorubicin alone and reduce systemic toxicity of doxorubicin most likely via an inhibition of doxorubicin-induced chemoresistance involving NF-κB signaling and inhibition of Cdk-1 which is involved in cell cycle progression

  16. Cell Penetrating Capacity and Internalization Mechanisms Used by the Synthetic Peptide CIGB-552 and Its Relationship with Tumor Cell Line Sensitivity.

    Science.gov (United States)

    Astrada, Soledad; Fernández Massó, Julio Raúl; Vallespí, Maribel G; Bollati-Fogolín, Mariela

    2018-03-30

    CIGB-552 is a twenty-amino-acid novel synthetic peptide that has proven to be effective in reducing tumor size and increasing lifespan in tumor-bearing mice. Such capability is conferred by its cell-penetrating peptide character, which allows it to enter cells and elicit a pro-apoptotic effect through its major mediator, COMMD1 protein. Cell-penetrating peptides are able to use different internalization mechanisms, such as endocytosis or direct transduction through the plasma membrane. Although CIGB-552 cytotoxicity has been evaluated in several non-tumor- and tumor-derived cell lines, no data regarding the relationship between cell line sensitivity, cell penetrating capacity, the internalization mechanisms involved, COMMD1 expression levels, or its subcellular localization has yet been produced. Here, we present the results obtained from a comparative analysis of CIGB-552 sensitivity, internalization capacity and the mechanisms involved in three human tumor-derived cell lines from different origins: mammary gland, colon and lung (MCF-7, HT-29 and H460, respectively). Furthermore, cell surface markers relevant for internalization processes such as phosphatidylserine, as well as CIGB-552 target COMMD1 expression/localization, were also evaluated. We found that both endocytosis and transduction are involved in CIGB-552 internalization in the three cell lines evaluated. However, CIGB-552 incorporation efficiency and contribution of each mechanism is cell-line dependent. Finally, sensitivity was directly correlated with high internalization capacity in those cell lines where endocytosis had a major contribution on CIGB-552 internalization.

  17. Flavonoid Composition and Antitumor Activity of Bee Bread Collected in Northeast Portugal

    Directory of Open Access Journals (Sweden)

    Filipa Sobral

    2017-02-01

    Full Text Available Bee bread (BB is a fermented mixture of plant pollen, honey, and bee saliva that worker bees use as food for larvae, and for young bees to produce royal jelly. In the present study, five BB samples, collected from Apis mellifera iberiensis hives located in different apiaries near Bragança, in the northeast region of Portugal, and one BB commercial sample were characterized by high-performance liquid chromatography coupled to a diode array detector and electrospray mass spectrometry (HPLC-DAD-ESI/MS in terms of phenolic compounds, such as flavonoid glycoside derivatives. Furthermore, the samples were screened, using in vitro assays, against different human tumor cell lines, MCF-7 (breast adenocarcinoma, NCI-H460 (non-small cell lung cancer, HeLa (cervical carcinoma and HepG2 (hepatocellular carcinoma, and also against non-tumor liver cells (porcine liver cells, PLP2. The main phenolic compounds found were flavonol derivatives, mainly quercetin, kaempferol, myricetin, isorhamnetin and herbacetrin glycoside derivatives. Thirty-two compounds were identified in the six BB samples, presenting BB1 and BB3 with the highest contents (6802 and 6480 µg/g extract, respectively and the highest number of identified compounds. Two isorhamnetin glycoside derivatives, isrohamnetin-O-hexosyl-O-rutinoside and isorhamnetin-O-pentosyl-hexoside, were the most abundant compounds present in BB1; on the other hand, quercetin-3-O-rhamnoside was the most abundant flavonol in BB3. However, it was not possible to establish a correlation between the flavonoids and the observed low to moderate cytotoxicity (ranging from >400 to 68 µg/mL, in which HeLa and NCI-H460 cell lines were the most susceptible to the inhibition. To the authors’ knowledge, this is the first report characterizing glycosidic flavonoids in BB samples, contributing to the chemical knowledge of this less explored bee product.

  18. Characterization of antiproliferative activity constituents from Artocarpus heterophyllus.

    Science.gov (United States)

    Zheng, Zong-Ping; Xu, Yang; Qin, Chuan; Zhang, Shuang; Gu, Xiaohong; Lin, Yingying; Xie, Guobin; Wang, Mingfu; Chen, Jie

    2014-06-18

    Artocarpus heterophyllus is an evergreen fruit tree cultivated in many tropical regions. Previous studies have shown that some of its compositions exhibited potential tyrosinase inhibition activities. This study indentified 8 new phenolic compounds, artoheterophyllins E-J (1-6), 4-geranyl-2',3,4',5-tetrahydroxy-cis-stilbene (7), and 5-methoxymorican M (8) and 2 new natural compounds (9 and 10), 2,3-dihydro-5,7-dihydroxy-2-(2-hydroxy-4-methoxyphenyl)-4H-benzopyran-4-one and 6-[(1S,2S)-1,2-dihydroxy-3-methylbutyl]-2-(2,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-3-(3-methyl-2-buten-1-yl)-4H-1-benzopyran-4-one, together with 23 known compounds (11-33), from the ethanol extract of the wood of A. heterophyllus. The structures of the eight new compounds (1-8) and two new natural compounds were established by extensive 1D- and 2D-NMR experiments. The anticancer effects of the isolated compounds were examined in MCF-7, H460, and SMMC-7721 human cancer cell lines by MTT assay. Compounds 5, 11, 12, and 30 significantly reduced the cell viabilities of these cell lines. Especially, compounds 11 and 30 resulted in more potent cytotoxicity than the positive control, 5-fluorouracil (5-Fu), in SMMC-7721 cell line, with IC50 values of 15.85 and 12.06 μM, whereas compound 30 exhibited more potent cytotoxicity than 5-Fu in NCI-H460 cell line, with an IC50 value of 5.19 μM. In addition, this study suggests that compounds 11 and 30 from the wood of A. heterophyllus have anticancer potential via MAPK pathways.

  19. Investigation of hTERT gene expression levels in two cell lines infected by high-risk human papilloma virus

    Directory of Open Access Journals (Sweden)

    Maryam Akhtari

    2016-07-01

    Full Text Available Background: Human papilloma virus (HPV is one of the most important factors in cervical cancer. Viral sequences are integrated into the host cell genome. In mild cases the virus causes skin damages, in severe cases it leads to cancer. Like many other cancers, telomerase gene expression was increased in cervical cancer. This enzyme is a reverse transcriptase that contains two common subunits: i catalytic protein called human telomerase reverse transcriptase (hTERT and, ii RNA sequence called hTR. hTERT expression is hardly found in any somatic tissues. Detection of high telomerase activity in human cells, lead to tumor genesis. So hTERT can be used as a diagnostic tool in cancer detection. Methods: This experimental study was carried out from May 2013 to April 2014 in Nanobiotechnology Research Center, Baqiyatallah University of Medical Sciences in Tehran, Iran. Caski and Hela cancer cell lines were used which contain HPV16 and HPV18 respectively. Cell lines were cultured and total RNA was extracted. Following normalization agent glyceraldehyde-3-phosphate dehydrogenase (GADPH, hTERT expression level was determining by real-time PCR method. For each sample, the expression level of hTERT and GAPDH were quantified as copy numbers (per reaction using the standard curve. Finally, hTERT levels in Hela and Caski cell lines were compared quantitatively by t-test using GraphPad statistic software version 5 (San Diego, CA, USA. Results: According to the charts real-time PCR, hTERT gene expression in Hela and Caski cancer cell lines is significantly different (t=0.0319. Conclusion: All results confirm that hTERT expression levels in Hela and Caski cell lines are significantly different and the level of hTERT expression in the Caski cell line was slightly higher than that of Hela cell line. The significant difference between hTERT mRNA expression levels reported here could be used as a tumor marker for HPV16 and HPV18 in cervical cancer.

  20. Generation and Characterisation of Cisplatin-Resistant Non-Small Cell Lung Cancer Cell Lines Displaying a Stem-Like Signature

    Science.gov (United States)

    Barr, Martin P.; Gray, Steven G.; Hoffmann, Andreas C.; Hilger, Ralf A.; Thomale, Juergen; O’Flaherty, John D.; Fennell, Dean A.; Richard, Derek; O’Leary, John J.; O’Byrne, Kenneth J.

    2013-01-01

    Introduction Inherent and acquired cisplatin resistance reduces the effectiveness of this agent in the management of non-small cell lung cancer (NSCLC). Understanding the molecular mechanisms underlying this process may result in the development of novel agents to enhance the sensitivity of cisplatin. Methods An isogenic model of cisplatin resistance was generated in a panel of NSCLC cell lines (A549, SKMES-1, MOR, H460). Over a period of twelve months, cisplatin resistant (CisR) cell lines were derived from original, age-matched parent cells (PT) and subsequently characterized. Proliferation (MTT) and clonogenic survival assays (crystal violet) were carried out between PT and CisR cells. Cellular response to cisplatin-induced apoptosis and cell cycle distribution were examined by FACS analysis. A panel of cancer stem cell and pluripotent markers was examined in addition to the EMT proteins, c-Met and β-catenin. Cisplatin-DNA adduct formation, DNA damage (γH2AX) and cellular platinum uptake (ICP-MS) was also assessed. Results Characterisation studies demonstrated a decreased proliferative capacity of lung tumour cells in response to cisplatin, increased resistance to cisplatin-induced cell death, accumulation of resistant cells in the G0/G1 phase of the cell cycle and enhanced clonogenic survival ability. Moreover, resistant cells displayed a putative stem-like signature with increased expression of CD133+/CD44+cells and increased ALDH activity relative to their corresponding parental cells. The stem cell markers, Nanog, Oct-4 and SOX-2, were significantly upregulated as were the EMT markers, c-Met and β-catenin. While resistant sublines demonstrated decreased uptake of cisplatin in response to treatment, reduced cisplatin-GpG DNA adduct formation and significantly decreased γH2AX foci were observed compared to parental cell lines. Conclusion Our results identified cisplatin resistant subpopulations of NSCLC cells with a putative stem-like signature, providing

  1. Generation and characterisation of cisplatin-resistant non-small cell lung cancer cell lines displaying a stem-like signature.

    Directory of Open Access Journals (Sweden)

    Martin P Barr

    Full Text Available Inherent and acquired cisplatin resistance reduces the effectiveness of this agent in the management of non-small cell lung cancer (NSCLC. Understanding the molecular mechanisms underlying this process may result in the development of novel agents to enhance the sensitivity of cisplatin.An isogenic model of cisplatin resistance was generated in a panel of NSCLC cell lines (A549, SKMES-1, MOR, H460. Over a period of twelve months, cisplatin resistant (CisR cell lines were derived from original, age-matched parent cells (PT and subsequently characterized. Proliferation (MTT and clonogenic survival assays (crystal violet were carried out between PT and CisR cells. Cellular response to cisplatin-induced apoptosis and cell cycle distribution were examined by FACS analysis. A panel of cancer stem cell and pluripotent markers was examined in addition to the EMT proteins, c-Met and β-catenin. Cisplatin-DNA adduct formation, DNA damage (γH2AX and cellular platinum uptake (ICP-MS was also assessed.Characterisation studies demonstrated a decreased proliferative capacity of lung tumour cells in response to cisplatin, increased resistance to cisplatin-induced cell death, accumulation of resistant cells in the G0/G1 phase of the cell cycle and enhanced clonogenic survival ability. Moreover, resistant cells displayed a putative stem-like signature with increased expression of CD133+/CD44+cells and increased ALDH activity relative to their corresponding parental cells. The stem cell markers, Nanog, Oct-4 and SOX-2, were significantly upregulated as were the EMT markers, c-Met and β-catenin. While resistant sublines demonstrated decreased uptake of cisplatin in response to treatment, reduced cisplatin-GpG DNA adduct formation and significantly decreased γH2AX foci were observed compared to parental cell lines.Our results identified cisplatin resistant subpopulations of NSCLC cells with a putative stem-like signature, providing a further understanding of the

  2. Pancreatic Transdifferentiation and Glucose-Regulated Production of Human Insulin in the H4IIE Rat Liver Cell Line

    Directory of Open Access Journals (Sweden)

    Binhai Ren

    2016-04-01

    Full Text Available Due to the limitations of current treatment regimes, gene therapy is a promising strategy being explored to correct blood glucose concentrations in diabetic patients. In the current study, we used a retroviral vector to deliver either the human insulin gene alone, the rat NeuroD1 gene alone, or the human insulin gene and rat NeuroD1 genes together, to the rat liver cell line, H4IIE, to determine if storage of insulin and pancreatic transdifferentiation occurred. Stable clones were selected and expanded into cell lines: H4IIEins (insulin gene alone, H4IIE/ND (NeuroD1 gene alone, and H4IIEins/ND (insulin and NeuroD1 genes. The H4IIEins cells did not store insulin; however, H4IIE/ND and H4IIEins/ND cells stored 65.5 ± 5.6 and 1475.4 ± 171.8 pmol/insulin/5 × 106 cells, respectively. Additionally, several β cell transcription factors and pancreatic hormones were expressed in both H4IIE/ND and H4IIEins/ND cells. Electron microscopy revealed insulin storage vesicles in the H4IIE/ND and H4IIEins/ND cell lines. Regulated secretion of insulin to glucose (0–20 mmol/L was seen in the H4IIEins/ND cell line. The H4IIEins/ND cells were transplanted into diabetic immunoincompetent mice, resulting in normalization of blood glucose. This data shows that the expression of NeuroD1 and insulin in liver cells may be a useful strategy for inducing islet neogenesis and reversing diabetes.

  3. SAHA-induced TRAIL-sensitisation of Multiple Myeloma cells is enhanced in 3D cell culture.

    Science.gov (United States)

    Arhoma, A; Chantry, A D; Haywood-Small, S L; Cross, N A

    2017-11-15

    Multiple Myeloma (MM) is currently incurable despite many novel therapies. Tumour Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL) is a potential anti-tumour agent although effects as a single agent are limited. In this study, we investigated whether the Histone Deacetylase (HDAC) inhibitor SAHA can enhance TRAIL-induced apoptosis and target TRAIL resistance in both suspension culture, and 3D cell culture as a model of disseminated MM lesions that form in bone. The effects of SAHA and/or TRAIL in 6 Multiple Myeloma cell lines were assessed in both suspension cultures and in an Alginate-based 3D cell culture model. The effect of SAHA and/or TRAIL was assessed on apoptosis by assessment of nuclear morphology using Hoechst 33342/Propidium Iodide staining. Viable cell number was assessed by CellTiter-Glo luminescence assay, Caspase-8 and -9 activities were measured by Caspase-Glo™ assay kit. TRAIL-resistant cells were generated by culture of RPMI 8226 and NCI-H929 by acute exposure to TRAIL followed by selection of TRAIL-resistant cells. TRAIL significantly induced apoptosis in a dose-dependent manner in OPM-2, RPMI 8226, NCI-H929, U266, JJN-3 MM cell lines and ADC-1 plasma cell leukaemia cells. SAHA amplified TRAIL responses in all lines except OPM-2, and enhanced TRAIL responses were both via Caspase-8 and -9. SAHA treatment induced growth inhibition that further increased in the combination treatment with TRAIL in MM cells. The co-treatment of TRAIL and SAHA reduced viable cell numbers all cell lines. TRAIL responses were further potentiated by SAHA in 3D cell culture in NCI-H929, RPMI 8226 and U266 at lower TRAIL + SAHA doses than in suspension culture. However TRAIL responses in cells that had been selected for TRAIL resistance were not further enhanced by SAHA treatment. SAHA is a potent sensitizer of TRAIL responses in both TRAIL sensitive and resistant cell lines, in both suspension and 3D culture, however SAHA did not sensitise TRAIL-sensitive cell

  4. Evaluation of a curcumin analog as an anti-cancer agent inducing ER stress-mediated apoptosis in non-small cell lung cancer cells

    International Nuclear Information System (INIS)

    Liu, Zhiguo; Wang, Yi; Sun, Yusheng; Ren, Luqing; Huang, Yi; Cai, Yuepiao; Weng, Qiaoyou; Shen, Xueqian; Li, Xiaokun; Liang, Guang

    2013-01-01

    Recent advances have highlighted the importance of the endoplasmic reticulum (ER) in cell death processes. Pharmacological interventions that effectively enhance tumor cell death through activating ER stress have attracted a great deal of attention for anti-cancer therapy. A bio-evaluation on 113 curcumin analogs against four cancer cell lines was performed through MTT assay. Furthermore, real time cell assay and flow cytometer were used to evaluate the apoptotic induction of (1E,4E)-1,5-bis(5-bromo-2-ethoxyphenyl)penta-1,4-dien-3-one (B82). Western blot, RT-qPCR, and siRNA were then utilized to confirm whether B82-induced apoptosis is mediated through activating ER stress pathway. Finally, the in vivo anti-tumor effect of B82 was evaluated. B82 exhibited strong anti-tumor activity in non-small cell lung cancer (NSCLC) H460 cells. Treatment with B82 significantly induced apoptosis in H460 cells in vitro and inhibited H460 tumor growth in vivo. Further studies demonstrated that the B82-induced apoptosis is mediated by activating ER stress both in vitro and in vivo. A new monocarbonyl analog of curcumin, B82, exhibited anti-tumor effects on H460 cells via an ER stress-mediated mechanism. B82 could be further explored as a potential anticancer agent for the treatment of NSCLC

  5. Danusertib, a potent pan-Aurora kinase and ABL kinase inhibitor, induces cell cycle arrest and programmed cell death and inhibits epithelial to mesenchymal transition involving the PI3K/Akt/mTOR-mediated signaling pathway in human gastric cancer AGS and NCI-N78 cells

    Directory of Open Access Journals (Sweden)

    Yuan CX

    2015-03-01

    autophagy-inducing effects on AGS and NCI-N78 cells. Danusertib arrested AGS and NCI-N78 cells in G2/M phase, with downregulation of expression of cyclin B1 and cyclin-dependent kinase 1 and upregulation of expression of p21 Waf1/Cip1, p27 Kip1, and p53. Danusertib induced mitochondria-mediated apoptosis, with an increase in expression of proapoptotic protein and a decrease in antiapoptotic proteins in both cell lines. Danusertib induced release of cytochrome c from the mitochondria to the cytosol and triggered activation of caspase 9 and caspase 3 in AGS and NCI-N78 cells. Further, danusertib induced autophagy, with an increase in expression of beclin 1 and conversion of microtubule-associated protein 1A/1B-light chain 3 (LC3-I to LC3-II in both cell lines. Inhibition of phosphatidylinositol 3-kinase (PI3K/protein kinase B (Akt/mammalian target of rapamycin (mTOR and p38 mitogen-activated protein kinase pathways as well as activation of 5' AMP-activated protein kinase contributed to the proautophagic effect of danusertib in AGS and NCI-N78 cells. SB202191 and wortmannin enhanced the autophagy-inducing effect of danusertib in AGS and NCI-N78 cells. In addition, danusertib inhibited epithelial to mesenchymal transition with an increase in expression of E-cadherin and a decrease in expression of N-cadherin in both cell lines. Taken together, danusertib has potent inducing effects on cell cycle arrest, apoptosis, and autophagy, but has an inhibitory effect on epithelial to mesenchymal transition, with involvement of signaling pathways mediated by PI3K/Akt/mTOR, p38 mitogen-activated protein kinase, and 5' AMP-activated protein kinase in AGS and NCI-N78 cells. Keywords: danusertib, gastric cancer, Aurora kinase, apoptosis, autophagy, epithelial to mesenchymal transition

  6. Effect of Flavopiridol on Radiation-induced Apoptosis of Human Laryngeal and Lung Cancer Cells

    International Nuclear Information System (INIS)

    Kim, Suzy; Kwon, Eun Kyung; Lee, B. S.; Lee, Seung Hee; Park, B. S.; Wu, Hong Gyun

    2007-01-01

    Purpose: To investigate the flavopiridol effect on radiation-induced apoptosis and expression of apoptosisrelated genes of human laryngeal and lung cancer cells. Materials and Methods: A human laryngeal cancer cell line, AMC-HN3 and a human lung cancer cell line, NCI-H460, were used in the study. The cells were divided into four groups according to the type of treatment: 1) control groups; 2) cells that were only irradiated; 3) cells treated only with flavopiridol; 4) cells treated with flavopiridol and radiation simultaneously. The cells were irradiated with 10 Gy of X-rays using a 4 MV linear accelerator. Flavopiridol was administered to the media at a concentration of 100 nM for 24 hours. We compared the fraction of apoptotic cells of each group 24 hours after the initiation of treatment. The fraction of apoptotic cells was detected by measurement of the sub-G1 fractions from a flow cytometric analysis. The expression of apoptosis-regulating genes, including cleaved caspase-3, cleaved PARP (poly (ADP-ribose) polymerase), p53, p21, cyclin D1, and phosphorylated Akt (protein kinase B) were analyzed by Western blotting. Results: The sub-G1 fraction of cells was significantly increased in the combination treatment group, as compared to cells exposed to radiation alone or flavopiridol alone. Western blotting also showed an increased expression of cleaved caspase-3 and cleaved PARP expression in cells of the combination treatment group, as compared with cells exposed to radiation alone or flavopiridol alone. Treatment with flavopiridol down regulated cyclin D1 expression of both cell lines but its effect on p53 and p21 expression was different according to each individual cell line. Flavopiridol did not affect the expression of phophorylated Akt in both cell lines. Conclusion: Treatment with flavopiridol increased radiation-induced apoptosis of both the human laryngeal and lung cancer cell lines. Flavopiridol effects on p53 and p21 expression were different according

  7. Expression and Activity of Breast Cancer Resistance Protein (BCRP/ABCG2) in Human Distal Lung Epithelial Cells In Vitro.

    Science.gov (United States)

    Nickel, Sabrina; Selo, Mohammed Ali; Fallack, Juliane; Clerkin, Caoimhe G; Huwer, Hanno; Schneider-Daum, Nicole; Lehr, Claus-Michael; Ehrhardt, Carsten

    2017-12-01

    Breast cancer resistance protein (BCRP/ABCG2) has previously been identified with high expression levels in human lung. The subcellular localisation and functional activity of the transporter in lung epithelia, however, remains poorly investigated. The aim of this project was to study BCRP expression and activity in freshly isolated human alveolar epithelial type 2 (AT2) and type 1-like (AT1-like) cells in primary culture, and to compare these findings with data obtained from the NCI-H441 cell line. BCRP expression levels in AT2 and AT1-like cells and in different passages of NCI-H441 cells were determined using q-PCR and immunoblot. Transporter localisation was confirmed by confocal laser scanning microscopy. Efflux and transport studies using the BCRP substrate BODIPY FL prazosin and the inhibitor Ko143 were carried out to assess BCRP activity in the different cell models. BCRP expression decreased during transdifferentiation from AT2 to AT1-like phenotype. Culturing NCI-H441 cells at an air-liquid interface or submersed did not change BCRP abundance, however, BCRP levels increased with passage number. BCRP was localised to the apical membrane and cytosol in NCI-H441 cells. In primary cells, the protein was found predominantly in the nucleus. Functional studies were consistent with expression data. BCRP is differently expressed in AT2 and AT1-like cells with lower abundance and activity in the latter ones. Nuclear BCRP might play a transcriptional role in distal lung epithelium. In NCI-H441 cells, BCRP is expressed in apical cell membranes and its activity is consistent with the localisation pattern.

  8. Small interfering RNA against transcription factor STAT6 leads to increased cholesterol synthesis in lung cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Richa Dubey

    Full Text Available STAT6 transcription factor has become a potential molecule for therapeutic intervention because it regulates broad range of cellular processes in a large variety of cell types. Although some target genes and interacting partners of STAT6 have been identified, its exact mechanism of action needs to be elucidated. In this study, we sought to further characterize the molecular interactions, networks, and functions of STAT6 by profiling the mRNA expression of STAT6 silenced human lung cells (NCI-H460 using microarrays. Our analysis revealed 273 differentially expressed genes after STAT6 silencing. Analysis of the gene expression data with Ingenuity Pathway Analysis (IPA software revealed Gene expression, Cell death, Lipid metabolism as the functions associated with highest rated network. Cholesterol biosynthesis was among the most enriched pathways in IPA as well as in PANTHER analysis. These results have been validated by real-time PCR and cholesterol assay using scrambled siRNA as a negative control. Similar findings were also observed with human type II pulmonary alveolar epithelial cells, A549. In the present study we have, for the first time, shown the inverse relationship of STAT6 with the cholesterol biosynthesis in lung cancer cells. The present findings are potentially significant to advance the understanding and design of therapeutics for the pathological conditions where both STAT6 and cholesterol biosynthesis are implicated viz. asthma, atherosclerosis etc.

  9. Biologic characteristics of the side population of human small cell lung cancer cell line H446.

    Science.gov (United States)

    Wang, Bo; Yang, Huan; Huang, Yu-Zheng; Yan, Ru-Hong; Liu, Fen-Ju; Zhang, Jun-Ning

    2010-03-01

    Recently, the theory of cancer stem cells (CSCs) has presented new targets and orientations for tumor therapy. The major difficulties in researching CSCs include their isolation and purification. The aim of this study is to identify and characterize the side population (SP) cells in small cell lung cancer (SCLC) cell line H446, which lays the foundation for the isolation and purification of CSCs. Fluorescence-activated cell sorting (FACS) was used to sort SP and non-SP (NSP) cells from H446. Both subgroups were cultivated to survey the capacity to form into suspended tumor cell spheres. Reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR were used to evaluate the expression levels of the mRNA of CD133, ABCG2, and nucleostemin in both subgroups. The capacity of proliferation and the differences in drug resistance of both subgroups and unsorted cells were tested by the MTT method. The differentiation ability of both subgroups was determined by FACS. Proliferation was determined by subcutaneous tumor formation in nude mice. The percent of Hoechst 33342 negative cells was about (5.1 +/- 0.2)% in H446 by fluorescence microscopy. The percent of SP cells was (6.3 +/- 0.1)% by flow cytometry. SP cells had a stronger capability of forming into tumor spheres than NSP cells. The mRNA expression levels of ABCG2, CD133, and nucleostemin in SP cells were 21.60 +/- 0.26, 7.10 +/- 0.14, and 1.02 +/- 0.08 folds higher than that in NSP cells (P 0.05, respectively). In vivo, SP cells showed better proliferative ability and tougher viability when treated with drugs. SP cells can differentiate into NSP cells, but NSP cells cannot differentiate into SP cells. SP cells had a greater ability to form tumors. The H446 cell line contained some SP cells with stem cell properties. CD133 and ABCG2 may be cancer stem cell markers of SCLC.

  10. Design, Synthesis and Evaluation of N13-Substituted Evodiamine Derivatives against Human Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Senchuan Song

    2013-12-01

    Full Text Available Attempting to improve the anticancer activity and solubility of evodiamine in simulated gastric fluid (SGF and simulated intestinal fluid (SIF solutions, thirty-eight N13-substituted evodiamine derivatives were designed, synthesized and tested for antitumor activities against six kinds of human cancer cell lines, namely prostate cancer (DU-145 and PC-3, lung cancer (H460, breast cancer (MCF-7, colon cancer (HCT-5 and glioblastoma (SF-268. The solubility of these compounds in SGF and SIF solutions was evaluated, and apoptosis induced by 2-2, 2-3, 2-16 and 3-2 was determined. The results showed: (1 among all compounds examined, 2-16 showed the highest antitumor activity and a broader spectrum of activity, with IC50 values ranging from 1–2 µM; (2 their solubility was obviously improved; (3 2-3, 2-16 and 3-2 had a significant impact inducing apoptosis in some cancer cell lines. The preliminary structure-activity relationships of these derivatives were discussed.

  11. Oxytetracycline Inhibits Mucus Secretion and Inflammation in Human Airway Epithelial Cells.

    Science.gov (United States)

    Shah, Said Ahmad; Ishinaga, Hajime; Takeuchi, Kazuhiko

    2017-01-01

    Oxytetracycline is a broad-spectrum antibiotic, but its nonantibacterial effects in the human respiratory tract are unknown. In this study, the effects of oxytetracycline on mucus secretion and inflammation were examined by PCR and ELISA in the human airway epithelial cell line NCI-H292. Oxytetracycline (10 μg/mL) significantly inhibited TNF-α-induced MUC5AC gene expression and MUC5AC protein levels in NCI-H292 cells. It also downregulated IL-8 and IL-1β gene expression and IL-1β protein levels. Our findings demonstrated that oxytetracycline suppressed mucus production and inflammation in human respiratory epithelial cells, providing further evidence for the usefulness of oxytetracycline for human airway inflammatory diseases. © 2017 S. Karger AG, Basel.

  12. Low-Dose Radiation Induces Cell Proliferation in Human Embryonic Lung Fibroblasts but not in Lung Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xinyue Liang

    2016-01-01

    Full Text Available Hormesis and adaptive responses are 2 important biological effects of low-dose ionizing radiation (LDR. In normal tissue, LDR induces hormesis as evinced by increased cell proliferation; however, whether LDR also increases tumor cell proliferation needs to be investigated. In this study, cell proliferation was assayed by total cell numbers and the Cell Counting Kit 8 assay. Mitogen-activated protein kinases (MAPK/extracellular signal-regulated kinase (ERK and phosphatidylinositol 3′ -kinase(PI3K-Akt (PI3K/AKT phosphorylation were determined by Western blot analysis. Human embryonic lung fibroblast 2BS and lung cancer NCI-H446 cell lines were irradiated with LDR at different doses (20-100 mGy. In response to 20 to 75 mGy X-rays, cell proliferation was significantly increased in 2BS but not in NCI-H446 cells. In 2BS cells, LDR at 20 to 75 mGy also stimulated phosphorylation of MAPK/ERK pathway proteins including ERK, MEK, and Raf and of the PI3K/AKT pathway protein AKT. To test whether ERK1/2 and AKT pathway activation was involved in the stimulation of cell proliferation in 2BS cells, the MAPK/ERK and PI3K/AKT pathways were inhibited using their specific inhibitors, U0126 and LY294002. U0126 decreased the phosphorylation of ERK1/2, and LY294002 decreased the phosphorylation of AKT; each could significantly inhibit LDR-induced 2BS cell proliferation. However, LDR did not stimulate these kinases, and kinase inhibitors also did not affect cell proliferation in the NCI-H446 cells. These results suggest that LDR stimulates cell proliferation via the activation of both MAPK/ERK and PI3K/AKT signaling pathways in 2BS but not in NCI-H446 cells. This finding implies the potential for applying LDR to protect normal tissues from radiotherapy without diminishing the efficacy of tumor therapy.

  13. Chrysin enhances doxorubicin-induced cytotoxicity in human lung epithelial cancer cell lines: The role of glutathione

    Energy Technology Data Exchange (ETDEWEB)

    Brechbuhl, Heather M. [Pediatrics, National Jewish Health, Denver, Colorado (United States); Kachadourian, Remy; Min, Elysia [Department of Medicine, National Jewish Health, Denver, Colorado (United States); Chan, Daniel [Medical Oncology, University of Colorado Denver Health Sciences Center (United States); Day, Brian J., E-mail: dayb@njhealth.org [Department of Medicine, University of Colorado Denver Health Sciences Center (United States); Immunology, University of Colorado Denver Health Sciences Center (United States); Pharmaceutical Sciences, University of Colorado Denver Health Sciences Center (United States); Department of Medicine, National Jewish Health, Denver, Colorado (United States)

    2012-01-01

    We hypothesized that flavonoid-induced glutathione (GSH) efflux through multi-drug resistance proteins (MRPs) and subsequent intracellular GSH depletion is a viable mechanism to sensitize cancer cells to chemotherapies. This concept was demonstrated using chrysin (5–25 μM) induced GSH efflux in human non-small cell lung cancer lines exposed to the chemotherapeutic agent, doxorubicin (DOX). Treatment with chrysin resulted in significant and sustained intracellular GSH depletion and the GSH enzyme network in the four cancer cell types was predictive of the severity of chrysin induced intracellular GSH depletion. Gene expression data indicated a positive correlation between basal MRP1, MRP3 and MRP5 expression and total GSH efflux before and after chrysin exposure. Co-treating the cells for 72 h with chrysin (5–30 μM) and DOX (0.025–3.0 μM) significantly enhanced the sensitivity of the cells to DOX as compared to 72-hour DOX alone treatment in all four cell lines. The maximum decrease in the IC{sub 50} values of cells treated with DOX alone compared to co-treatment with chrysin and DOX was 43% in A549 cells, 47% in H157 and H1975 cells and 78% in H460 cells. Chrysin worked synergistically with DOX to induce cancer cell death. This approach could allow for use of lower concentrations and/or sensitize cancer cells to drugs that are typically resistant to therapy. -- Graphical abstract: Possible mechanisms by which chrysin enhances doxorubicin-induced toxicity in cancer cells. Highlights: ► Chyrsin sustains a significant depletion of GSH levels in lung cancer cells. ► Chyrsin synergistically potentiates doxorubicin-induced cancer cell cytotoxicity. ► Cancer cell sensitivity correlated with GSH and MRP gene network expression. ► This approach could allow for lower side effects and targeting resistant tumors.

  14. Ternary copper(II) complex: NCI60 screening, toxicity studies, and evaluation of efficacy in xenograft models of nasopharyngeal carcinoma

    Science.gov (United States)

    Chu, Tai-Lin; Abdul Aziz, Norazlin; Mohd Kornain, Noor-Kaslina; Samiulla, D. S.; Lo, Kwok-Wai; Ng, Chew-Hee

    2018-01-01

    Copper(II) ternary complex, [Cu(phen)(C-dmg)(H2O)]NO3 was evaluated against a panel of cell lines, tested for in vivo efficacy in nasopharyngeal carcinoma xenograft models as well as for toxicity in NOD scid gamma mice. The Cu(II) complex displayed broad spectrum cytotoxicity against multiple cancer types, including lung, colon, central nervous system, melanoma, ovarian, and prostate cancer cell lines in the NCI-60 panel. The Cu(II) complex did not cause significant induction of cytochrome P450 (CYP) 3A and 1A enzymes but moderately inhibited CYP isoforms 1A2, 2C9, 2C19, 2D6, 2B6, 2C8 and 3A4. The complex significantly inhibited tumor growth in nasopharyngeal carcinoma xenograft bearing mice models at doses which were well tolerated without causing significant or permanent toxic side effects. However, higher doses which resulted in better inhibition of tumor growth also resulted in toxicity. PMID:29329342

  15. Comparison of heat and/or radiation sensitivity and membrane composition of seven X-ray-transformed C3H 10T1/2 cell lines and normal C3H 10T1/2 cells

    International Nuclear Information System (INIS)

    Raaphorst, G.P.; Vadasz, J.A.; Azzam, E.I.; Sargent, M.D.; Borsa, J.; Einspenner, M.

    1985-01-01

    C3H 10T1/2 mouse embryo cells were transformed by X-irradiation, and seven transformed clones were isolated and propagated as cell lines. Some of these cell lines produced tumors in syngeneic mice and grew in agarose while the normal C3H 10T1/2 cell line did not possess these characteristics. Exponentially growing cell cultures with comparable cell-cycle distributions as measured by flow cytometry were tested for heat and X-ray sensitivity. The heat and X-ray sensitivity varied randomly compared to the normal cell line. One cell line was more heat resistant and one more heat sensitive than the normal cell line, and the others had sensitivities comparable to the normal cell line. Measurements on some of the biochemical parameters of the particulate fraction of cells after sonication and 24,000 X g centrifugation showed that altered thermal sensitivity was not correlated with protein, cholesterol, or phospholipid content of this fraction

  16. Cathepsin H indirectly regulates morphogenetic protein-4 (BMP-4) in various human cell lines

    Science.gov (United States)

    Rojnik, Matija; Jevnikar, Zala; Mirkovic, Bojana; Janes, Damjan; Zidar, Nace; Kikelj, Danijel; Kos, Janko

    2011-01-01

    Background Cathepsin H is a cysteine protease considered to play a major role in tumor progression, however, its precise function in tumorigenesis is unclear. Cathepsin H was recently proposed to be involved in processing of bone morphogenetic protein 4 (BMP-4) in mice. In order to clarify whether cathepsin H also regulates BMP-4 in humans, its impact on BMP-4 expression, processing and degradation was investigated in prostate cancer (PC-3), osteosarcoma (HOS) and pro-monocytic (U937) human cell lines. Materials and methods BMP-4 expression was founded to be regulated by cathepsin H using PCR array technology and confirmed by real time PCR. Immunoassays including Western blot and confocal microscopy were used to evaluate the influence of cathepsin H on BMP-4 processing. Results In contrast to HOS, the expression of BMP-4 mRNA in U937 and PC3 cells was significantly decreased by cathepsin H. The different regulation of BMP-4 synthesis could be associated with the absence of the mature 28 kDa cathepsin H form in HOS cells, where only the intermediate 30 kDa form was observed. No co-localization of BMP-4 and cathepsin H was observed in human cell lines and the multistep processing of BMP-4 was not altered in the presence of specific cathepsin H inhibitor. Isolated cathepsin H does not cleave mature recombinant BMP-4, neither with its amino- nor its endopeptidase activity. Conclusions Our results exclude direct proteolytic processing of BMP-4 by cathepsin H, however, they provide support for its involvement in the regulation of BMP-4 expression. PMID:22933963

  17. Molecular analysis of the effects of Piroxicam and Cisplatin on mesothelioma cells growth and viability

    Science.gov (United States)

    Verdina, Alessandra; Cardillo, Irene; Nebbioso, Angela; Galati, Rossella; Menegozzo, Simona; Altucci, Lucia; Sacchi, Ada; Baldi, Alfonso

    2008-01-01

    Nonsteroidal anti-inflammatory drugs (NSAIDs) have been proposed for prevention and treatment of a variety of human cancers. Piroxicam, in particular, has been recently shown to exert significant anti-tumoral activity in combination with cisplatin (CDDP) on mesothelioma cells. However, the mechanisms through which NSAIDs regulate the cell cycle as well as the signal pathways involved in the growth inhibition, remain unclear. In the present study, using two mesothelioma cell lines, MSTO-211H and NCI-H2452, we have investigated the influence of piroxicam alone and in association with CDDP on proliferation, cell cycle regulation and apoptosis. In both cell lines a significant effect on cell growth inhibition, respect to the control, was observed with all the drugs tested. Moreover, treatment with piroxicam or CDDP alone altered the cell cycle phase distribution as well as the expression of some cell cycle regulatory proteins in both cell lines. These effects were increased, even if in a not completely overlapping manner, after treatment with the association of piroxicam and CDDP. In particular, the two drugs in NCI cell line had a synergistic effect on apoptosis, probably through activation of caspase 8 and caspase 9, while the most evident targets among the cell cycle regulators were cyclin D1 and p21waf1. These results suggest that the association of piroxicam and CDDP specifically triggers cell cycle regulation and apoptosis in different mesothelioma cell lines and may hold promise in the treatment of mesothelioma. PMID:18498639

  18. High hRFI expression correlates with resistance to Fluoro pyrimidines in human colon cancer cell lines and in xenografts

    International Nuclear Information System (INIS)

    Sasaki, S.; Tokyo Univ., Tokyo; Watanabe, T.; Konishi, T.; Kitayama, J.; Nagawa, H.; Kobunai, T.

    2005-01-01

    We previously reported that the over-expression of hRFI, a protein preferentially expressed in the digestive tract regions of several cancers, exhibited a tendency to inhibit TNF-α induced apoptosis. In this study, we sought to determine the potential effect of hRFI expression on the sensitivity to 5-fluorouracil (5-FU) and/or other fluoro pyrimidines. For the whole lysates of 8 colon cancer cell lines, we performed Western blotting with anti-hRFI antibody and analyzed the correlations between the expression level of hRFI and the cell lines' sensitivity to 5-FU induced apoptosis. Furthermore, for a tissue micro array consisting of 32 xenograft derived human cancer cell lines, we examined the expression levels of hRFI and survivin by immunohistochemical staining, and analyzed the correlations between the expression of each protein and the sensitivity to several chemotherapeutic agents in the xenografts examined. Both in colon cancer cell lines and in xenografts, the expression level of hRFI was correlated with resistance to 5-FU and its derivatives. This evidence suggests that hRFI may be a marker predicting the response to fluorouracil derived chemotherapeutic agents and that the reduction of the expression level of hRFI might improve the outcome of chemotherapy

  19. The fibronectin III-1 domain activates a PI3-Kinase/Akt signaling pathway leading to αvβ5 integrin activation and TRAIL resistance in human lung cancer cells

    International Nuclear Information System (INIS)

    Cho, Christina; Horzempa, Carol; Jones, David; McKeown-Longo, Paula J.

    2016-01-01

    Fibronectin is a mechanically sensitive protein which is organized in the extracellular matrix as a network of interacting fibrils. The lung tumor stroma is enriched for fibronectin which is thought to contribute to metastasis and drug resistance. Fibronectin is an elastic, multi-modular protein made up of individually folded domains, some of which can stretch in response to increased mechanical tension. Very little is known about the relationship of fibronectin’s unfolded domains to lung cancer resistance to chemotherapy. In the present study, we evaluated the impact of unfolding the first Type III domain of fibronectin (FnIII-1c) on TNF-related apoptosis inducing ligand (TRAIL) resistance. NCI-H460 non-small cell lung cancer cells were treated with FnIII-1c then assessed for TRAIL-induced apoptosis. Subsequent analysis of FnIII-1c-mediated signaling pathways was also completed. Human non-small cell lung cancer tissue sections were assessed for the expression of vitronectin by immunohistochemistry. FnIII-1c inhibited TRAIL-induced activation of caspase 8 and subsequent apoptosis in NCI-H460 lung cancer cells. FnIII-1c treatment was associated with the activation of the phosphatidylinositol-3-kinase/alpha serine/threonine kinase (PI3K/Akt) pathway and the αvβ5 integrin receptor for vitronectin, both of which were required for TRAIL resistance. Immunohistochemical staining of sections from non-small cell lung cancers showed that vitronectin was localized around blood vessels and in the tumor-stroma interface. Unfolding of Type III domains within the fibronectin matrix may promote TRAIL resistance through the activation of a PI3K/Akt/αvβ5 signaling axis and point to a novel mechanism by which changes in secondary structure of fibronectin contribute to cancer cell resistance to apoptosis

  20. Radiosensitization of C225 on human non-small cell lung cancer cell line H-520

    International Nuclear Information System (INIS)

    Zhang Yingdong; Wang Junjie; Liu Feng; Zhao Yong

    2008-01-01

    Objective: To investigate the efficacy of C225 (cetuximab), a chimeric human-mouse anti-epithelial growth factor receptor monoclonal antibody, combined with 60 Co gamma irradiation against human non-small cell lung cancer cell line H-520. Methods: H-520 cells were treated either with different dose of 60 Co irradiation (1,2,4,6,8 and 10 Gy)alone or together with C225 (100 nmol/L). Colony forming capacity was determined to create the survival curve 10 days after the treatment. Cells in different groups were harvested 72 hours after irradiation for apoptosis analysis or 48 hours after irradiation for cell cycle analysis by flow cytometry assay. Results: The clone number in combinational treatment group was less than that in irradiation only group, which suggested that the cell survival rate in the combinational treatment group was significantly decreased comparing with irradiation only group (F=6.36, P O + G 1 phases for C225 treatment, in G 2 + M phases for 60 Co irradiation, and in both G 0 + G 1 and G 2 + M phases for C225 in combination with 60 Co irradiation. Conclusions: C225 has radiosensitizing effects on H-520 cells, which may through the enhancement of 60 Co irradiation-induced cell death and cell cycle arrest. This study provides a supportive evidence for clinical treatment in non-small cell lung cancer. (authors)

  1. New Approaches for the Synthesis, Cytotoxicity and Toxicity of Heterocyclic Compounds Derived from 2-Cyanomethylbenzo[c]imidazole.

    Science.gov (United States)

    Mohareb, Rafat M; Mohamed, Abeer A; Abdallah, Amira E M

    2016-01-01

    The reaction of ethyl cyanoacetate with o-phenylenediamine gave the 2-cyanomethylbenzo[c]imidazole (1). The latter compound was used as the key starting material to synthesise biologically active heterocyclic derivatives. Thus, the reaction of 1 with cyclohexanone and either of benzaldehyde, 4-methoxybenzaldehyde or 4-chlorobenzaldehyde gave the annulated derivatives 2a-c, respectively. The antitumor evaluations of the newly synthesized products against the three cancer cell lines MCF-7 (breast adeno-carcinoma), NCI-H460 (non-small cell lung cancer) and SF-268 (CNS cancer) showed that compounds 2b, 6, 11b, 11c, 12b, 16a, 16b and 18a exhibited optimal cytotoxic effect against cancer cell lines, with IC50 values in the nM range. Bioactive compounds are often toxic to shrimp larvae. Thus, in order to monitor these chemicals in vivo lethality to shrimp larvae (Artemia salina), Brine-Shrimp Lethality Assay was used. Compounds 11b, 12b and 16b showed no toxicity against the tested organisms.

  2. NCI Takes Back the Defelice Cup at Ninth Annual Golf Tournament | Poster

    Science.gov (United States)

    By Ashley DeVine, Staff Writer After being down by a point in the morning, NCI reclaimed the Defelice Cup trophy from Leidos Biomedical Research, with a final score of 12 ½ to 11 ½, at the ninth annual Ronald H. Defelice Golf Tournament, held Oct. 13. “The tightest matches in the nine-year history of this cup competition resulted in a narrow victory for NCI and allowed NCI to

  3. Induction of reactive oxygen species-stimulated distinctive autophagy by chelerythrine in non-small cell lung cancer cells.

    Science.gov (United States)

    Tang, Zheng-Hai; Cao, Wen-Xiang; Wang, Zhao-Yu; Lu, Jia-Hong; Liu, Bo; Chen, Xiuping; Lu, Jin-Jian

    2017-08-01

    Chelerythrine (CHE), a natural benzo[c]phenanthridine alkaloid, shows anti-cancer effect through a number of mechanisms. Herein, the effect and mechanism of the CHE-induced autophagy, a type II programmed cell death, in non-small cell lung cancer (NSCLC) cells were studied for the first time. CHE induced cell viability decrease, colony formation inhibition, and apoptosis in a concentration-dependent manner in NSCLC A549 and NCI-H1299 cells. In addition, CHE triggered the expression of phosphatidylethanolamine-modified microtubule-associated protein light-chain 3 (LC3-II). The CHE-induced expression of LC3-II was further increased in the combination treatment with chloroquine (CQ), an autophagy inhibitor, and large amounts of red-puncta were observed in the CHE-treated A549 cells with stable expression of mRFP-EGFP-LC3, indicating that CHE induces autophagy flux. Silence of beclin 1 reversed the CHE-induced expression of LC3-II. Inhibition of autophagy remarkably reversed the CHE-induced cell viability decrease and apoptosis in NCI-H1299 cells but not in A549 cells. Furthermore, CHE triggered reactive oxygen species (ROS) generation in both cell lines. A decreased level of ROS through pretreatment with N-acetyl-L-cysteine reversed the CHE-induced cell viability decrease, apoptosis, and autophagy. Taken together, CHE induced distinctive autophagy in A549 (accompanied autophagy) and NCI-H1299 (pro-death autophagy) cells and a decreased level of ROS reversed the effect of CHE in NSCLC cells in terms of cell viability, apoptosis, and autophagy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Glucocorticoid effect on melphalan cytotoxicity, cell-cycle position, cell size, and [3H]uridine incorporation in one of three human melanoma cell lines

    International Nuclear Information System (INIS)

    Benckhuijsen, C.; Osman, A.M.; Hillebrand, M.J.; Smets, L.A.

    1987-01-01

    Three human melanoma cell lines of known content of specific glucocorticoid-binding sites were studied for colony formation after a microM dose of glucocorticoid combined with melphalan. In one of the three cell lines, M-5A, subcloned from M-5 (formerly designated RPMI 8322), the effect of combined treatment was markedly increased compared to that of melphalan even if the glucocorticoid was applied for 1 h only, 10 h before the melphalan. Semilogarithmic dose-effect plots for a reduction of final plating efficiency by glucocorticoid were curvilinear, according to a receptor-mediated process. The effects of glucocorticoid, melphalan, and their combination were linearized by bilogarithmic median-effect plotting which allowed the quantitation of a synergism which was more marked in case of glucocorticoid pretreatment, for 1 or 24 h, than on simultaneous exposure. According to sequential DNA per cell cytophotometry, melphalan abolished in M-5A a glucocorticoid-induced arrest in the G1 phase of the cell cycle. The cytotoxic synergism correlated with an apparent stimulation by glucocorticoid of the rate of acid-insoluble incorporation of [ 3 H]uridine and [ 14 C]leucine and an increase in cell size and protein content in M-5A cells but not in the other two cell lines. The way in which glucocorticoids induce an enhanced susceptibility to melphalan is not clear. Our results appear compatible with a hypothesis that chromatin in a transcriptionally activated state is more vulnerable to cytotoxic attack by an alkylating agent than under average conditions

  5. Dose-rate effects between 0.3 and 30 Gy/h in a normal and a malignant human cell line

    International Nuclear Information System (INIS)

    Amdur, R.J.; Bedford, J.S.

    1994-01-01

    This study used continuous open-quotes intermediateclose quotes dose rate irradiation (0.3-30 Gy/h) to compare the capacity for and repair of sublethal radiation damage in different cell lines growing in tissue culture. Two human cell lines were studied; one was derived from normal human fibroblasts (AG1522) and the other from a squamous cell carcinoma of the uterine cervix (HTB-35). Dose-response curves for clonogenic survival were determined following irradiation of plateau-phase cultures at five different dose rates: 22.6, 6.12, 3.65, 1.04, and 0.38 Gy/h. Subculture following irradiation was delayed for 8-24 h to allow for the full repair of open-quotes potentially lethal damage.close quotes A significant dose-rate effect was seen in both cell lines. For irradiation at the highest dose rate, survival at 2 Gy (SF2) and the α/β ratio were similar for the two cell lines (approximately 0.7 and 8.0 Gy, respectively) but the half-time of repair of sublethal damage was estimated to be approximately five times longer in the normal human fibroblast line (154 min) than in the carcinoma (31 min) cell line. These results indicate that measuring the dose-rate effect between 0.3 and 30 Gy/h is a useful way to identify and quantify differences in sublethal damage repair between cell lines. To the extent that in vitro and in vivo repair parameters are similar, and that representative tumor biopsy specimens can be examined in this way, this approach may provide a prospective way of determining the dose rate (brachytherapy) or fractionation schedule that will optimize the therapeutic ratio. 32 refs., 1 fig

  6. Comparison of egg and high yielding MDCK cell-derived live attenuated influenza virus for commercial production of trivalent influenza vaccine: in vitro cell susceptibility and influenza virus replication kinetics in permissive and semi-permissive cells.

    Science.gov (United States)

    Hussain, Althaf I; Cordeiro, Melissa; Sevilla, Elizabeth; Liu, Jonathan

    2010-05-14

    Currently MedImmune manufactures cold-adapted (ca) live, attenuated influenza vaccine (LAIV) from specific-pathogen free (SPF) chicken eggs. Difficulties in production scale-up and potential exposure of chicken flocks to avian influenza viruses especially in the event of a pandemic influenza outbreak have prompted evaluation and development of alternative non-egg based influenza vaccine manufacturing technologies. As part of MedImmune's effort to develop the live attenuated influenza vaccine (LAIV) using cell culture production technologies we have investigated the use of high yielding, cloned MDCK cells as a substrate for vaccine production by assessing host range and virus replication of influenza virus produced from both SPF egg and MDCK cell production technologies. In addition to cloned MDCK cells the indicator cell lines used to evaluate the impact of producing LAIV in cells on host range and replication included two human cell lines: human lung carcinoma (A549) cells and human muco-epidermoid bronchiolar carcinoma (NCI H292) cells. The influenza viruses used to infect the indicators cell lines represented both the egg and cell culture manufacturing processes and included virus strains that composed the 2006-2007 influenza seasonal trivalent vaccine (A/New Caledonia/20/99 (H1N1), A/Wisconsin/67/05 (H3N2) and B/Malaysia/2506/04). Results from this study demonstrate remarkable similarity between influenza viruses representing the current commercial egg produced and developmental MDCK cell produced vaccine production platforms. MedImmune's high yielding cloned MDCK cells used for the cell culture based vaccine production were highly permissive to both egg and cell produced ca attenuated influenza viruses. Both the A549 and NCI H292 cells regardless of production system were less permissive to influenza A and B viruses than the MDCK cells. Irrespective of the indicator cell line used the replication properties were similar between egg and the cell produced

  7. Inactivation and changes in metabolic profile of selected foodborne bacteria by 460 nm LED illumination.

    Science.gov (United States)

    Kumar, Amit; Ghate, Vinayak; Kim, Min-Jeong; Zhou, Weibiao; Khoo, Gek Hoon; Yuk, Hyun-Gyun

    2017-05-01

    The objective of this study was to investigate the effect of 460 nm light-emitting diode (LED) on the inactivation of foodborne bacteria. Additionally, the change in the endogenous metabolic profile of LED illuminated cells was analyzed to understand the bacterial response to the LED illumination. Six different species of bacteria (Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus, Escherichia coli O157:H7, Pseudomonas aeruginosa and Salmonella Typhimurium) were illuminated with 460 nm LED to a maximum dose of 4080 J/cm 2 at 4, 10 and 25 °C. Inactivation curves were modeled using Hom model. Metabolic profiling of the non-illuminated and illuminated cells was performed using a Liquid chromatography-mass spectrometry system. Results indicate that the 460 nm LED significantly (p illuminated cells indicated that several metabolites e.g. 11-deoxycortisol, actinonin, coformycin, tyramine, chitobiose etc. were regulated during LED illumination. These results elucidate the effectiveness of 460 nm LED against foodborne bacteria and hence, its suitability as a novel antimicrobial control method to ensure food safety. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. TRAIL and proteasome inhibitors combination induces a robust apoptosis in human malignant pleural mesothelioma cells through Mcl-1 and Akt protein cleavages

    International Nuclear Information System (INIS)

    Yuan, Bao-Zhu; Chapman, Joshua; Ding, Min; Wang, Junzhi; Jiang, Binghua; Rojanasakul, Yon; Reynolds, Steven H

    2013-01-01

    Malignant pleural mesothelioma (MPM) is an aggressive malignancy closely associated with asbestos exposure and extremely resistant to current treatments. It exhibits a steady increase in incidence, thus necessitating an urgent development of effective new treatments. Proteasome inhibitors (PIs) and TNFα-Related Apoptosis Inducing Ligand (TRAIL), have emerged as promising new anti-MPM agents. To develop effective new treatments, the proapoptotic effects of PIs, MG132 or Bortezomib, and TRAIL were investigated in MPM cell lines NCI-H2052, NCI-H2452 and NCI-H28, which represent three major histological types of human MPM. Treatment with 0.5-1 μM MG132 alone or 30 ng/mL Bortezomib alone induced a limited apoptosis in MPM cells associated with the elevated Mcl-1 protein level and hyperactive PI3K/Akt signaling. However, whereas 10–20 ng/ml TRAIL alone induced a limited apoptosis as well, TRAIL and PI combination triggered a robust apoptosis in all three MPM cell lines. The robust proapoptotic activity was found to be the consequence of a positive feedback mechanism-governed amplification of caspase activation and cleavage of both Mcl-1 and Akt proteins, and exhibited a relative selectivity in MPM cells than in non-tumorigenic Met-5A mesothelial cells. The combinatorial treatment using TRAIL and PI may represent an effective new treatment for MPMs

  9. Dithiolethione modified valproate and diclofenac increase E-cadherin expression and decrease proliferation of non-small cell lung cancer cells.

    Science.gov (United States)

    Moody, Terry W; Switzer, Christopher; Santana-Flores, Wilmarie; Ridnour, Lisa A; Berna, Marc; Thill, Michelle; Jensen, Robert T; Sparatore, Anna; Del Soldato, Piero; Yeh, Grace C; Roberts, David D; Giaccone, Giuseppe; Wink, David A

    2010-05-01

    The effects of dithiolethione modified valproate, diclofenac and sulindac on non-small cell lung cancer (NSCLC) cells were investigated. Sulfur(S)-valproate and S-diclofenac at 1 microg/ml concentrations significantly reduced prostaglandin (PG)E(2) levels in NSCLC cell lines A549 and NCI-H1299 as did the COX-2 inhibitor DuP-697. In vitro, S-valproate, S-diclofenac and S-sulindac half-maximally inhibited the clonal growth of NCI-H1299 cells at 6, 6 and 15 microg/ml, respectively. Using the MTT assay, 10 microg/ml S-valproate, NO-aspirin and Cay10404, a selective COX-2 inhibitor, but not SC-560, a selective COX-1 inhibitor, inhibited the growth of A549 cells. In vivo, 18mg/kg i.p. of S-valproate and S-diclofenac, but not S-sulindac, significantly inhibited A549 or NCI-H1299 xenograft proliferation in nude mice, but had no effect on the nude mouse body weight. The mechanism by which S-valproate and S-diclofenac inhibited the growth of NSCLC cells was investigated. Nitric oxide-aspirin but not S-valproate caused apoptosis of NSCLC cells. By Western blot, S-valproate and S-diclofenac increased E-cadherin but reduced vimentin and ZEB1 (a transcriptional suppressor of E-cadherin) protein expression in NSCLC cells. Because S-valproate and S-diclofenac inhibit the growth of NSCLC cells and reduce PGE(2) levels, they may prove beneficial in the chemoprevention and/or therapy of NSCLC. Published by Elsevier Ireland Ltd.

  10. Enhanced anticancer effects of Scutellaria barbata D. Don in combination with traditional Chinese medicine components on non-small cell lung cancer cells.

    Science.gov (United States)

    Wang, Qian; Acharya, Narayan; Liu, Zhongwei; Zhou, Xianmei; Cromie, Meghan; Zhu, Jia; Gao, Weimin

    2018-05-10

    Experience-based herbal medicine as a complementary to modern western medicine has triggered an array of studies in quest of novel anticancer drugs. Scutellaria barbata D. Don (SB) is commonly used to treat different types of cancers, but its molecular mechanism of action is not clearly understood. In this study, we attempted to elucidate the mode of action of a traditional Chinese medicine prescription with a total of 14 components, named Lian-Jia-San-Jie-Fang (LJSJF, in Chinese), where SB works as the "principle" against non-small cell lung cancer (NSCLC) cells. Four different NSCLC cell lines (A549, H460, H1650, and H1975) were used. Cytotoxicity, in vitro tumorigenicity, gene expression, and protein expression were analyzed by MTT assay, soft agar assay, real-time PCR, and Western blots, respectively. Among the 14 components in LJSJF, SB was the only one to possess cytotoxic effects at its pharmacologically relevant doses. Additionally, we observed synergistically dose-dependent cytotoxic effects of SB in combination with other LJSJF components. After SB or LJSJF treatment, significant reductions in colony number and/or size were observed in A549 and H460; a notable dose-dependent decrease in EGFR was observed in A549, H460, and H1650; significant downregulation in EGFR and its downstream signaling targets mTOR and p38MAPK were also observed in A549 and H460; and p53 and p21 were significantly increased while survivin, cyclin D1, and MDM2 were significantly decreased in A549. Additionally, p53, p21, and Mettl7b were decreased, but p73 was increased in H460. Neither EGFR nor p53 was changed in H1975. Therefore, SB or LJSJF may induce cytotoxic effects by regulating multiple and/or distinct apoptotic pathways in different NSCLC cells. LJSJF exerts more pronounced cytotoxic effects against NSCLC cells than SB does by synergistically regulating the underlining molecular mechanisms including EGFR and/or p53 signaling pathways. Copyright © 2018 Elsevier B.V. All

  11. Transcription of a novel mouse semaphorin gene, M-semaH, correlates with the metastatic ability of mouse tumor cell lines

    DEFF Research Database (Denmark)

    Christensen, C R; Klingelhöfer, Jörg; Tarabykina, S

    1998-01-01

    identified a novel member of the semaphorin/collapsin family in the two metastatic cell lines. We have named it M-semaH. Northern hybridization to a panel of tumor cell lines revealed transcripts in 12 of 12 metastatic cell lines but in only 2 of 6 nonmetastatic cells and none in immortalized mouse...

  12. 77 FR 4334 - Proposed Collection; Comment Request; Solar Cell: A Mobile UV Manager for Smart Phones (NCI)

    Science.gov (United States)

    2012-01-27

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Proposed Collection; Comment Request; Solar Cell: A Mobile UV Manager for Smart Phones (NCI) SUMMARY: In compliance with the... Manager for Smart Phones [[Page 4335

  13. Feasibility of dual reporter gene in rat myoblast cell line using human sodium iodide symporter (hNIS) and enhanced green fluorescent protein (EGFP) gene

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yong Jin; Lee, You La; Ahn, Sohn Joo; Choi, Chang Ik; Lee, Sang Woo; Ahn, Byeong Cheol; Lee, Jae Tae [School of Medicine, Kyungpook National University, Daegu (Korea, Republic of)

    2007-07-01

    To develop a non-invasive combined imaging method of gamma camera and optical imaging to assess rat myoblast cell line, H9c2, we constructed retrovirus containing hNIS and EGFP gene, and transfected to rat myoblast cell and monitored hNIS and EGFP expression. Rat myoblast cell line, H9C2, was transfected with hNIS and EGFP gene using retrovirus (H9C2-NG). The expression of hNIS and EGFP gene was determined by RT-PCR and fluorescence microscopy, respectively. The uptake and efflux of I-125 were measured in the transfected and wild type cell lines. Each cell line was injected to 4 flank sites (H9c2: 1X107 or 2X107, H9C2-NG: 1X107 or 2X107) in nude mouse. Scintigraphic image was performed at 3h, 1 day after H9C2 and H9C2-NG cell inoculation. We performed gamma camera and animal PET imaging to evaluate NIS expression. Also, GFP image obtained using optical imaging system. The expression of hNIS and EGFP gene was confirmed by RT-PCR. In iodide uptake, H9C2-NG cells accumulated 274.52.2 pmol/ mg protein at 30 min. But wild type cell line did not uptake iodide. In fluorescent microscopy, H9C2-NG cells were highly fluorescent than that of H9C2 cells. In iodide efflux study, 50% of radioactivity flowed out during the first 10min. Scintigraphy showed increased uptake of Tc-99m in H9c2-NG than in H9C2 for 1 day. Also, H9C2-NG cells showed high signal-to-background fluorescent spots in animal body. In this study, NIS and EGFP reporter gene were successfully transfected by a retrovirus in myoblast cell line, and the transfected cell can be easily visualized in vivo. These results suggest that NIS and EGFP gene has an excellent feasibility as a reporter gene, and it can be used to monitor cell trafficking for monitoring.

  14. An ensemble based top performing approach for NCI-DREAM drug sensitivity prediction challenge.

    Directory of Open Access Journals (Sweden)

    Qian Wan

    Full Text Available We consider the problem of predicting sensitivity of cancer cell lines to new drugs based on supervised learning on genomic profiles. The genetic and epigenetic characterization of a cell line provides observations on various aspects of regulation including DNA copy number variations, gene expression, DNA methylation and protein abundance. To extract relevant information from the various data types, we applied a random forest based approach to generate sensitivity predictions from each type of data and combined the predictions in a linear regression model to generate the final drug sensitivity prediction. Our approach when applied to the NCI-DREAM drug sensitivity prediction challenge was a top performer among 47 teams and produced high accuracy predictions. Our results show that the incorporation of multiple genomic characterizations lowered the mean and variance of the estimated bootstrap prediction error. We also applied our approach to the Cancer Cell Line Encyclopedia database for sensitivity prediction and the ability to extract the top targets of an anti-cancer drug. The results illustrate the effectiveness of our approach in predicting drug sensitivity from heterogeneous genomic datasets.

  15. Evaluation of the anti-adhesive effect of milk fat globule membrane glycoproteins on Helicobacter pylori in the human NCI-N87 cell line and C57BL/6 mouse model.

    Science.gov (United States)

    Horemans, Tessa; Kerstens, Monique; Clais, Sofie; Struijs, Karin; van den Abbeele, Pieter; Van Assche, Tim; Maes, Louis; Cos, Paul

    2012-08-01

     The interest in non-antibiotic therapies for Helicobacter pylori infections in man has considerably grown because increasing numbers of antibiotic-resistant strains are being reported. Intervention at the stage of bacterial attachment to the gastric mucosa could be an approach to improve the control/eradication rate of this infection.  Fractions of purified milk fat globule membrane glycoproteins were tested in vitro for their cytotoxic and direct antibacterial effect. The anti-adhesive effect on H. pylori was determined first in a cell model using the mucus-producing gastric epithelial cell line NCI-N87 and next in the C57BL/6 mouse model after dosing at 400 mg/kg protein once or twice daily from day -2 to day 4 post-infection. Bacterial loads were determined by using quantitative real-time PCR and the standard plate count method.  The milk fat globule membrane fractions did not show in vitro cytotoxicity, and a marginal antibacterial effect was demonstrated for defatted milk fat globule membrane at 256 μg/mL. In the anti-adhesion assay, the results varied from 56.0 ± 5.3% inhibition for 0.3% crude milk fat globule membrane to 79.3 ± 3.5% for defatted milk fat globule membrane. Quite surprisingly, in vivo administration of the same milk fat globule membrane fractions did not confirm the anti-adhesive effects and even caused an increase in bacterial load in the stomach.  The promising anti-adhesion in vitro results could not be confirmed in the mouse model, even after the highest attainable exposure. It is concluded that raw or defatted milk fat globule membrane fractions do not have any prophylactic or therapeutic potential against Helicobacter infection. © 2012 Blackwell Publishing Ltd.

  16. Iso-suillin from Suillus flavus Induces Apoptosis in Human Small Cell Lung Cancer H446 Cell Line.

    Science.gov (United States)

    Zhao, Jun-Xia; Zhang, Qing-Shuang; Chen, Ying; Yao, Sheng-Jie; Yan, Yong-Xin; Wang, Ying; Zhang, Jin-Xiu; Wang, Li-An

    2016-05-20

    The suillin isoform iso-suillin is a natural substance isolated from a petroleum ether extract of the fruiting bodies of the mushroom Suillus flavus. Previous studies have found its inhibition effect on some cancer cells, and we aimed to study its effects on human small cell lung cancer H446 cell line. Cell viability was measured by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide assay. Cellular morphological changes (apoptosis and necrosis) were evaluated using an electron microscope and Hoechst 33258 staining detected by the inverted microscope. Flow cytometry was used to detect cell apoptosis, cell cycle distribution, and mitochondrial membrane potential. Protein expression was determined by Western blotting analysis. Here, we describe the ability of iso-suillin to inhibit the growth of H446 cells in time- and dose-dependent way. Iso-suillin had no obvious impact on normal human lymphocyte proliferation at low concentrations (9.09, 18.17, or 36.35 μmol/L) but promoted lymphocyte proliferation at a high concentration (72.70 μmol/L). After treatment of different concentrations of iso-suillin (6.82, 13.63, or 20.45 μmol/L), the apoptosis rate of H446 cells increased with increasing concentrations of iso-suillin (16.70%, 35.54%, and 49.20%, respectively, all P iso-suillin could induce H446 cell apoptosis through the mitochondrial pathway and the death-receptor pathway. Therefore, iso-suillin might have a potential application as a novel drug for lung cancer treatment.

  17. [Adenovirus-mediated delivery of nm23-H1 gene inhibits growth of colorectal carcinoma cell line Lovo].

    Science.gov (United States)

    Wang, Qi; He, Xueling; Liu, Yan; Yin, Hailin

    2010-12-01

    This experimental study sought to find out the inhibitory effects of Ad-GFP-nm23-H1 on proliferation and metastasis of human colorectal carcinoma cell line Lovo, and, further, to gain an insight into some theoretical and methodical basis for instituting nm23-H1 gene therapy of cancers. MTT assay and Transwell chamber were used to detect the rates of proliferation and invasion as well as the adhesion of Lovo cells in vitro. The results demonstrated that the proliferation inhibition rates of Lovo cells treated with Ad-GFP-nm23-H1 of 10(10) PFU/ml, 10(9) PFU/ml and 10(8) PFU/ml were 84.9% +/- 1.51%, 48.5% +/- 7.23% and 22.5% +/- 5.47%, that the adherence inhibition rates of Lovo cells treated with Ad-GFP-nm23-H1 of 10(10) PFU/ml, 10(9) PFU/ml and 10(8) PFU/ml were 70.3% +/- 2.40%, 60.1% +/- 5.68% and 18.5% +/- 3.61%, and that the invasiveness inhibition rates of Lovo cells treated with Ad-GFP-nm23-H1 of 10(10) PFU/ml, 10(9) PFU/ml and 10(8) PFU/ml were 83.2% +/- 5.71%, 52.2% +/- 6.94% and 28.1% +/- 8.21%. These data suggested that Ad-GFP-nm23-H1 exerted significant inhibitory effects on the proliferation and metastasis of human colorectal carcinoma cell line Lovo in a dose-dependent way.

  18. [Different effects of anticancer drugs on two human thyroid cell lines with different stages of differentiation].

    Science.gov (United States)

    Yamanaka, T; Hishinuma, A

    1995-01-20

    We established two human thyroid tumor cell lines. One cell line (hPTC) was established from the tissue of a papillary thyroid carcinoma surgically excised from a 27-year-old female patient. The other cell line (hAG) was established from the tissue of an adenomatous goiter excised from a 59-year old female patient. Synthesis of cAMP by hPTC and hAG increased when they were stimulated by TSH. hPTC and hAG continued to divide as a monolayer in a tissue culture for three years and two years, respectively. We assessed the efficacy of anticancer drugs (doxorubicin:ADR, cisplatin:CDDP, nimustine:ACNU, bleomycin:BLM, cyclophosphamide:CPA, aclarubicin:ACR) with resard to hPTC. The hPTC cells were cultured in 24-well plates in the presence of the anticancer drugs for 48 hours, and the cellular DNA of the live cells was measured with diaminobenzoic acid. ADR had the lowest ED50 (0.029 mu g/ml) and the clinical blood concentration was 13.8 times that of the ED50. The clinical blood concentration divided by ED50 for the other anticancer drugs are, in order of higher values, 2.3 for CPA, 1.7 for BLM, 1.2 for CDDP, 0.5 for ACR, and less than 0.1 for ACNU. ADR showed time-independent effects since a 2-hour exposure of ADR to the hPTC cells resulted in the significant reduction of the cellular DNA content of the live cells even after 48 hours. The effects of the other anticancer drugs were time-dependent. We then studied the difference of the effects of ADR on hPTC and hAG. ED50 for hPTC was significantly low (0.035 mu g/ml) compared to that for hAG (0.460 mu g/ml). Since free radical formation is one of the major anticancer mechanisms of ADR the effects of free radicals on ED50's for hPTC and hAG were measured by adding glutathione (GSH), N-acetylcystein (NAC), buthionine sulfoximine (BSO), and alpha-tocopherol (alpha-toco) into the culture media. GSH catches up with free radicals in the extracellular fluid. NAC promotes production of GSH in the cytoplasm, but BSO interferes with

  19. A novel radiation-induced p53 mutation is not implicated in radiation resistance via a dominant-negative effect.

    Directory of Open Access Journals (Sweden)

    Yunguang Sun

    Full Text Available Understanding the mutations that confer radiation resistance is crucial to developing mechanisms to subvert this resistance. Here we describe the creation of a radiation resistant cell line and characterization of a novel p53 mutation. Treatment with 20 Gy radiation was used to induce mutations in the H460 lung cancer cell line; radiation resistance was confirmed by clonogenic assay. Limited sequencing was performed on the resistant cells created and compared to the parent cell line, leading to the identification of a novel mutation (del at the end of the DNA binding domain of p53. Levels of p53, phospho-p53, p21, total caspase 3 and cleaved caspase 3 in radiation resistant cells and the radiation susceptible (parent line were compared, all of which were found to be similar. These patterns held true after analysis of p53 overexpression in H460 cells; however, H1299 cells transfected with mutant p53 did not express p21, whereas those given WT p53 produced a significant amount, as expected. A luciferase assay demonstrated the inability of mutant p53 to bind its consensus elements. An MTS assay using H460 and H1299 cells transfected with WT or mutant p53 showed that the novel mutation did not improve cell survival. In summary, functional characterization of a radiation-induced p53 mutation in the H460 lung cancer cell line does not implicate it in the development of radiation resistance.

  20. Mechanism of gene transfection by polyamidoamine (PAMAM) dendrimers modified with ornithine residues.

    Science.gov (United States)

    Kumar, Ajay; Yellepeddi, Venkata K; Vangara, Kiran K; Strychar, Kevin B; Palakurthi, Srinath

    2011-11-01

    The aim of this study was to prepare and investigate the mechanism of uptake of the dendriplexes prepared with ornithine-conjugated polyamidoamine (PAMAM) G4 dendrimers. Ornithine-conjugated PAMAMG4 dendrimers were prepared by Fmoc synthesis. A comparative transfection study in NCI H157G cells and polyamine transport-deficient cell line NCI H157R was performed to confirm the role of the polyamine transporter system (PAT) in the dendriplex uptake. Transfection efficiency significantly increased with increase in generation number and extent of ornithine conjugation. Transfection efficiency of the PAMAMG4-ORN60 dendrimers significantly decreased in presence of excess of ornithine (P dendrimers. Transfection efficiency of PAMAMG4-ORN60 was significantly low in NCI H157R (31.66 ± 3.95%, RFU: 17.87 ± 1.34) as compared to NCI H157G cell line (63.07 ± 6.8%, relative fluorescence units (RFU): 23.28 ± 0.66). Results indicate the role of PAT in addition to charge-mediated endocytosis in the internalization of ornithine-conjugated PAMAMG4 dendrimers. Cytotoxicity analysis (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) assay) in human embryonic kidney cell line (HEK) 293T cells showed that the dendriplexes were non-toxic at N/P 10.

  1. miR-375 is highly expressed and possibly transactivated by achaete-scute complex homolog 1 in small-cell lung cancer cells

    Institute of Scientific and Technical Information of China (English)

    Huijie Zhao; Lei Zhu; Yujuan Jin; Hongbin Ji; Xiumin Yan; Xueliang Zhu

    2012-01-01

    In this study,we identified five miRNAs highly expressed in the small-cell lung cancer (SCLC) cell line NCI-H209.Among them,the expression levels of miR-375 were dramatically elevated in all SCLC cell lines examined,coincident with the expression of the transcription factor achaete-scute complex homolog 1 (ASCL1).Moreover,miR-375 was upregulated and correlated with ASCL1 in the cell lines generated from mouse SCLC-like tumors as well.Dual-luciferase assays further showed that ASCL1 activated the expression of miR-375 by binding to the three E-box elements in the miR-375 promoter.These results imply a role of ASCL1 in SCLC via the upregulation of miR-375.

  2. Anti-proliferative activity of 2,6-dichloro-9- or 7-(ethoxycarbonylmethyl)-9H- or 7H-purines against several human solid tumour cell lines.

    Science.gov (United States)

    Morales, Fátima; Ramírez, Alberto; Conejo-García, Ana; Morata, Cynthia; Marchal, Juan A; Campos, Joaquín M

    2014-04-09

    As leads we took several benzo-fused seven- and six-membered scaffolds linked to the pyrimidine or purine moieties with notable anti-proliferative activity against human breast, colon and melanoma cancerous cell lines. We then decided to maintain the double-ringed nitrogenous bases and change the other components to the ethyl acetate moiety. This way six purine and two 5-fluorouracil derivatives were obtained and evaluated against the MCF-7, HCT-116, A-375 and G-361 cancer cell lines. Two QSARs are obtained between the anti-proliferative IC₅₀ values for compounds 26-33 and the clog P against the melanoma cell lines A-375 and G-361. Our results show that two of the analogues [ethyl 2-(2,6-dichloro-9H- or 7H-purine-9- or 7-yl)acetates (30 and 33, respectively)] are potent cytotoxic agents against all the tumour cell lines assayed, showing single-digit micromolar IC₅₀ values. This exemplifies the potential of our previously reported purine compounds to qualify as lead structures for medicinal chemistry campaigns, affording simplified analogues easy to synthesize and with a noteworthy bioactivity. The selective activity of 30 and 33 against the melanoma cell line A-375, via apoptosis, supposes a great advantage for a future therapeutic use. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  3. Heterogeneity in radiosensitivity within esophageal cell line CaEs-17 and amplification of H-ras gene

    International Nuclear Information System (INIS)

    Wang Shunbao; Guo Lei; Niu Wenzhe

    1997-01-01

    Ten clones were picked from cultured colonies of CaEs-17 cell line and developed to a subcell line. The values of SF 2 were measured for each subcell line. Two radioresistant subcell lines, clone 7 and clone 10 were established. According to survival curve assay, for wild type, the value of D 0 was 1.57 Gy, D Q was 1.07 Gy, N was 1.96, SF 2 was 0.41. For clone 7, the value of D 0 was 1.64 Gy, D Q was 1.85 Gy, N was 3.07, SF 2 was 0.53. For clone 10, the value of D 0 was 1.58 Gy, D Q was 2.04 Gy, N was 3.63, SF 2 was 0.61. Clone 7 and clone 10 have much higher values of D Q and N than those of wild type. There was amplification of H-ras gene in clone 10 after 2 Gy irradiation. The amplification of H-ras gene in clone 10 after 2 Gy irradiation might be involved in hetero geneity of CaEs-17 cell line

  4. Vectors to Increase Production Efficiency of Inducible Pluripotent Stem Cell (iPSC) | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    This invention describes the discovery that specific p53 isoform increase the number of inducible pluripotent stem cells (iPS). It is known that the activity of p53 regulates the self-renewal and pluripotency of normal and cancer stem cells, and also affects re-programming efficiency of iPS cells. This p53 isoform-based technology provides a more natural process of increasing iPS cell production than previous methods of decreasing p53. NCI seeks licensees for this technology.

  5. Pleiotropic effects of cancer cells' secreted factors on human stromal (mesenchymal) stem cells

    DEFF Research Database (Denmark)

    Al-toub, Mashael; Almusa, Abdulaziz; Almajed, Mohammed

    2013-01-01

    cells' secreted factors as represented by a panel of human cancer cell lines (breast (MCF7 and MDA-MB-231); prostate (PC-3); lung (NCI-H522); colon (HT-29) and head & neck (FaDu)) on the biological characteristics of MSCs. METHODS: Morphological changes were assessed using fluorescence microscopy......, but not from MCF7 and HT-29, developed an elongated, spindle-shaped morphology with bipolar processes. In association with phenotypic changes, genome-wide gene expression and bioinformatics analysis revealed an enhanced pro-inflammatory response of those MSCs. Pharmacological inhibitions of FAK and MAPKK...

  6. Rumex L. species induce apoptosis in 1301, EOL-1 and H-9 cell lines.

    Science.gov (United States)

    Wegiera, Magdalena; Smolarz, Helena D; Bogucka-Kocka, Anna

    2012-01-01

    The Rumex L. (dock) species for many centuries have been used in medical treatment, through their adstringent, spasmolitic or cholagogic action. In the present study, the in vitro screening of cytotoxic activities of ethanol extract from roots, leaves and fruits of six Rumex species: R. acetosa L., R. acetosella L., R. confertus Willd., R. crispus L., R. hydrolapathum Huds. and R. obtusifolius L. were performed. We found remarkable cytotoxic activities on leukemic 1301 and EOL-1 cell lines and T cell line at concentration dependent manners. Cytotoxic activity was determined in two ways: trypan blue test and annexin-V FITC and propidium iodide assay. Received IC50 values of investigated extracts on 1301, EOL-1 and H-9 cell lines ranged from 0.22, 0.17 and 0.04 to 2.56, 1.91 and 1.83 mg/mL, respectively. Analysis of morphological changes demonstrated that the extract exerted cell-death via apoptosis. The overall activities of Rumex species support the traditional use of the extract from the fruits of R. confertus, R. crispus, R. hydrolapathum and R. obtusifolius in the treatment of cancer.

  7. P120-catenin isoforms 1A and 3A differently affect invasion and proliferation of lung cancer cells

    International Nuclear Information System (INIS)

    Liu Yang; Dong Qianze; Zhao Yue; Dong Xinjun; Miao Yuan; Dai Shundong; Yang Zhiqiang; Zhang Di; Wang Yan; Li Qingchang; Zhao Chen; Wang Enhua

    2009-01-01

    Different isoforms of p120-catenin (p120ctn), a member of the Armadillo gene family, are variably expressed in different tissues as a result of alternative splicing and the use of multiple translation initiation codons. When expressed in cancer cells, these isoforms may confer different properties with respect to cell adhesion and invasion. We have previously reported that the p120ctn isoforms 1 and 3 were the most highly expressed isoforms in normal lung tissues, and their expression level was reduced in lung tumor cells. To precisely define their biological roles, we transfected p120ctn isoforms 1A and 3A into the lung cancer cell lines A549 and NCI-H460. Enhanced expression of p120ctn isoform 1A not only upregulated E-cadherin and β-catenin, but also downregulated the Rac1 activity, and as a result, inhibited the ability of cells to invade. In contrast, overexpression of p120ctn isoform 3A led to the inactivation of Cdc42 and the activation of RhoA, and had a smaller influence on invasion. However, we found that isoform 3A had a greater ability than isoform 1A in both inhibiting the cell cycle and reducing tumor cell proliferation. The present study revealed that p120ctn isoforms 1A and 3A differently regulated the adhesive, proliferative, and invasive properties of lung cancer cells through distinct mechanisms

  8. Diarachidonoylphosphoethanolamine induces apoptosis of malignant pleural mesothelioma cells through a Trx/ASK1/p38 MAPK pathway

    OpenAIRE

    Ayako Tsuchiya; Yoshiko Kaku; Takashi Nakano; Tomoyuki Nishizaki

    2015-01-01

    1,2-Diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE) induces both necrosis/necroptosis and apoptosis of NCI-H28 malignant pleural mesothelioma (MPM) cells. The present study was conducted to understand the mechanism for DAPE-induced apoptosis of NCI-H28 cells. DAPE induced caspase-independent apoptosis of NCI-H28 malignant pleural mesothelioma (MPM) cells, and the effect of DAPE was prevented by antioxidants or an inhibitor of NADPH oxidase (NOX). DAPE generated reactive oxygen species ...

  9. Radiosensitivity of mesothelioma cell lines

    International Nuclear Information System (INIS)

    Haekkinen, A.M.; Laasonen, A.; Linnainmaa, K.; Mattson, K.; Pyrhoenen, S.

    1996-01-01

    The present study was carried out in order to examine the radiosensitivity of malignant pleural mesothelioma cell lines. Cell kinetics, radiation-induced delay of the cell cycle and DNA ploidy of the cell lines were also determined. For comparison an HeLa and a human foetal fibroblast cell line were simultaneously explored. Six previously cytogenetically and histologically characterized mesothelioma tumor cell lines were applied. A rapid tiazolyl blue microtiter (MTT) assay was used to analyze radiosensitivity and cell kinetics and DNA ploidy of the cultured cells were determined by flow cytometry. The survival fraction after a dose of 2 Gy (SF2), parameters α and β of the linear quadratic model (LQ-model) and mean inactivation dose (D MID ) were also estimated. The DNA index of four cell lines equaled 1.0 and two cell lines equaled 1.5 and 1.6. Different mesothelioma cell lines showed a great variation in radiosensitivity. Mean survival fraction after a radiation dose of 2 Gy (SF2) was 0.60 and ranged from 0.36 to 0.81 and mean α value was 0.26 (range 0.48-0.083). The SF2 of the most sensitive diploid mesothelioma cell line was 0.36: Less than that of the foetal fibroblast cell line (0.49). The survival fractions (0.81 and 0.74) of the two most resistant cell lines, which also were aneuploid, were equal to that of the HeLa cell line (0.78). The α/β ratios of the most sensitive cell lines were almost an order of magnitude greater than those of the two most resistant cell lines. Radiation-induced delay of the most resistant aneuploid cell line was similar to that of HeLa cells but in the most sensitive (diploid cells) there was practically no entry into the G1 phase following the 2 Gy radiation dose during 36 h. (orig.)

  10. Radiosensitivity of mesothelioma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Haekkinen, A.M. [Dept. of Oncology, Univ. Central Hospital, Helsinki (Finland); Laasonen, A. [Dept. of Pathology, Central Hospital of Etelae-Pohjanmaa, Seinaejoki (Finland); Linnainmaa, K. [Dept. of Industrial Hygiene and Toxicology, Inst. of Occupational Health, Helsinki (Finland); Mattson, K. [Dept. Pulmonary Medicine, Univ. Central Hospital, Helsinki (Finland); Pyrhoenen, S. [Dept. of Oncology, Univ. Central Hospital, Helsinki (Finland)

    1996-10-01

    The present study was carried out in order to examine the radiosensitivity of malignant pleural mesothelioma cell lines. Cell kinetics, radiation-induced delay of the cell cycle and DNA ploidy of the cell lines were also determined. For comparison an HeLa and a human foetal fibroblast cell line were simultaneously explored. Six previously cytogenetically and histologically characterized mesothelioma tumor cell lines were applied. A rapid tiazolyl blue microtiter (MTT) assay was used to analyze radiosensitivity and cell kinetics and DNA ploidy of the cultured cells were determined by flow cytometry. The survival fraction after a dose of 2 Gy (SF2), parameters {alpha} and {beta} of the linear quadratic model (LQ-model) and mean inactivation dose (D{sub MID}) were also estimated. The DNA index of four cell lines equaled 1.0 and two cell lines equaled 1.5 and 1.6. Different mesothelioma cell lines showed a great variation in radiosensitivity. Mean survival fraction after a radiation dose of 2 Gy (SF2) was 0.60 and ranged from 0.36 to 0.81 and mean {alpha} value was 0.26 (range 0.48-0.083). The SF2 of the most sensitive diploid mesothelioma cell line was 0.36: Less than that of the foetal fibroblast cell line (0.49). The survival fractions (0.81 and 0.74) of the two most resistant cell lines, which also were aneuploid, were equal to that of the HeLa cell line (0.78). The {alpha}/{beta} ratios of the most sensitive cell lines were almost an order of magnitude greater than those of the two most resistant cell lines. Radiation-induced delay of the most resistant aneuploid cell line was similar to that of HeLa cells but in the most sensitive (diploid cells) there was practically no entry into the G1 phase following the 2 Gy radiation dose during 36 h. (orig.).

  11. Identification and characterization of luekotriene C4 and D4 receptors on a cultured smooth muscle cell line, BC3H-1

    International Nuclear Information System (INIS)

    Tamura, N.; Agrawal, D.K.; Townley, R.G.

    1987-01-01

    The authors studied the characteristics of the leukotriene (LT) C 4 and D 4 receptors on a cultured smooth muscle cell line, BC3H-1. Specific [ 3 H]LTC 4 binding to the cell membrane was greater than 80% of total binding and saturable at a density of 3.96 +/- 0.39 pmol/mg protein, with an apparent dissociation constant(Kd) of 14.3 +/- 2.0 nM (n=9). The association and dissociation of [ 3 H]LTC 4 binding were rapid and apparent equilibrium conditions were established within 5 min. Calculated Kd value of [ 3 H]LTC binding from the kinetic analysis was 9.9 nM. From the competition analysis, calculated Ki value of unlabeled LTC 4 to compete for the specific binding of [ 3 H]LTC 4 was 9.2 nM and was in good agreement with the Kd value obtained from the Scatchard plots or kinetic analysis. The maximum number of binding sites (Bmax) of [ 3 H]LTD 4 in the membrane of BC3H-1 cell line was about 11 times lower than that of the [ 3 H]LTC 4 . The calculated values of Kd and Bmax of [ 3 H]LTD 4 binding were 9.3 +/- 0.8 nM and 0.37 +/- 0.04 pmol/mg proteins, respectively (n=3). These findings demonstrate that BC3H-1 cell line possess both LTC 4 and LTD 4 receptors with a predominance of LTC 4 receptors. Thus, BC3H-1 cell line is a good model to study the regulation of LTC 4 and LTD 4 receptors. 34 references, 5 figures, 1 table

  12. Combination of Bifunctional Alkylating Agent and Arsenic Trioxide Synergistically Suppresses the Growth of Drug-Resistant Tumor Cells

    Directory of Open Access Journals (Sweden)

    Pei-Chih Lee

    2010-05-01

    Full Text Available Drug resistance is a crucial factor in the failure of cancer chemotherapy. In this study, we explored the effect of combining alkylating agents and arsenic trioxide (ATO on the suppression of tumor cells with inherited or acquired resistance to therapeutic agents. Our results showed that combining ATO and a synthetic derivative of 3a-aza-cyclopenta[a]indenes (BO-1012, a bifunctional alkylating agent causing DNA interstrand cross-links, was more effective in killing human cancer cell lines (H460, H1299, and PC3 than combining ATO and melphalan or thiotepa. We further demonstrated that the combination treatment of H460 cells with BO-1012 and ATO resulted in severe G2/M arrest and apoptosis. In a xenograft mouse model, the combination treatment with BO-1012 and ATO synergistically reduced tumor volumes in nude mice inoculated with H460 cells. Similarly, the combination of BO-1012 and ATO effectively reduced the growth of cisplatin-resistant NTUB1/P human bladder carcinoma cells. Furthermore, the repair of BO-1012-induced DNA interstrand cross-links was significantly inhibited by ATO, and consequently, γH2AX was remarkably increased and formed nuclear foci in H460 cells treated with this drug combination. In addition, Rad51 was activated by translocating and forming foci in nuclei on treatment with BO-1012, whereas its activation was significantly suppressed by ATO. We further revealed that ATO might mediate through the suppression of AKT activity to inactivate Rad51. Taken together, the present study reveals that a combination of bifunctional alkylating agents and ATO may be a rational strategy for treating cancers with inherited or acquired drug resistance.

  13. Cytotoxic effect of achatinin(H) (lectin) from Achatina fulica against a human mammary carcinoma cell line (MCF7).

    Science.gov (United States)

    Dharmu, Indra; Ramamurty, N; Kannan, Ramalingam; Babu, Mary

    2007-01-01

    The hemolymph-derived achatinin(H) (lectin) from Achatina fulica showed a marked cytotoxic effect on MCF7, a human mammary carcinoma cell line. IC(50) values as measured by the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide assay for achatinin(H) ranged from 6 to 10 microg/ml in the MCF7 cells. MCF7 cells showed significant morphological changes leading to cell death. The above cell death was observed after 48 h of treatment with 8 microg/ml when compared to untreated cells. Alterations in the tumor marker enzymes, as well as in antioxidant enzymes, were observed after achatinin(H) treatment. The specificity and purity of the achatinin(H) was confirmed by the Western blot assay. Achatinin(H) binding to MCF7 cells was detected by anti-achatinin(H), and visualization of the achatinin(H) binding sites on confluent MCF7 cells was confirmed by flourescein isothiocyanate conjugated secondary antibody. MCF7-treated cells fluoresced, indicating the presence of achatinin(H) binding sites. Fluorescence-activated cell sorting analysis of the cell cycle showed a significant increase in S-phase in MCF7 cells after 48 h of achatinin(H) treatment. The cells were arrested in G(2)/M phase of the cell cycle after 48 h with significant changes in cell viability. Cellular damage was confirmed by agarose gel electrophoresis with the characteristic appearance of a DNA streak in treated MCF7 cells indicating the ongoing apoptosis.

  14. Regulation of hemopoiesis: inhibitors and stimulators produced by a murine bone marrow stromal cell line (H-1)

    International Nuclear Information System (INIS)

    Cronkite, E.P.; Miller, M.E.; Garnett, H.; Harigaya, K.

    1982-01-01

    A murine cell line (H-1) probably derived from the adventitial reticular cell has been isolated and preserved. This line produces: (1) CSF; (2) a labile inhibitor of CFU-c proliferation with preferential action on granulopoiesis; (3) PGE; (4) proliferation inhibitors of BFU-E and GEMM; and (5) suppression of entry of CFU-S into DNA synthesis in vitro. It is postulated that the adventitial reticular cell (ARC) may play a major regulatory role in hemopoiesis through intramedullary production of the factors described. The nature of the signals that activate the genes in the ARC which are coded for the factors described is not known

  15. ERK phosphorylation is predictive of resistance to IGF-1R inhibition in small cell lung cancer.

    Science.gov (United States)

    Zinn, Rebekah L; Gardner, Eric E; Marchionni, Luigi; Murphy, Sara C; Dobromilskaya, Irina; Hann, Christine L; Rudin, Charles M

    2013-06-01

    New therapies are critically needed to improve the outcome for patients with small cell lung cancer (SCLC). Insulin-like growth factor 1 receptor (IGF-1R) inhibition is a potential treatment strategy for SCLC: the IGF-1R pathway is commonly upregulated in SCLC and has been associated with inhibition of apoptosis and stimulation of proliferation through downstream signaling pathways, including phosphatidylinositol-3-kinase-Akt and mitogen-activated protein kinase. To evaluate potential determinants of response to IGF-1R inhibition, we assessed the relative sensitivity of 19 SCLC cell lines to OSI-906, a small molecule inhibitor of IGF-1R, and the closely related insulin receptor. Approximately one third of these cell lines were sensitive to OSI-906, with an IC50 OSI-906. Interestingly, OSI-906 sensitive lines expressed significantly lower levels of baseline phospho-ERK relative to resistant lines (P = 0.006). OSI-906 treatment resulted in dose-dependent inhibition of phospho-IGF-1R and phospho-Akt in both sensitive and resistant cell lines, but induced apoptosis and cell-cycle arrest only in sensitive lines. We tested the in vivo efficacy of OSI-906 using an NCI-H187 xenograft model and two SCLC patient xenografts in mice. OSI-906 treatment resulted in 50% tumor growth inhibition in NCI-H187 and 30% inhibition in the primary patient xenograft models compared with mock-treated animals. Taken together our data support IGF-1R inhibition as a viable treatment strategy for a defined subset of SCLC and suggest that low pretreatment levels of phospho-ERK may be indicative of sensitivity to this therapeutic approach. ©2013 AACR

  16. Suberoylanilide hydroxamic acid affects γH2AX expression in osteosarcoma, atypical teratoid rhabdoid tumor and normal tissue cell lines after irradiation

    International Nuclear Information System (INIS)

    Blattmann, C.; Oertel, S.; Thiemann, M.; Weber, K.J.; Schmezer, P.; Zelezny, O.; Lopez Perez, R.; Kulozik, A.E.; Debus, J.; Ehemann, V.

    2012-01-01

    Osteosarcoma and atypical teratoid rhabdoid tumors are tumor entities with varying response to common standard therapy protocols. Histone acetylation affects chromatin structure and gene expression which are considered to influence radiation sensitivity. The aim of this study was to investigate the effect of the combination therapy with the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) and irradiation on atypical teratoid rhabdoid tumors and osteosarcoma compared to normal tissue cell lines. Clonogenic assay was used to determine cell survival. DNA double-strand breaks (DSB) were examined by pulsed-field electrophoresis (PFGE) as well as by γH2AX immunostaining involving flow cytometry, fluorescence microscopy, and immunoblot analysis. SAHA lead to an increased radiosensitivity in tumor but not in normal tissue cell lines. γH2AX expression as an indicator for DSB was significantly increased when SAHA was applied 24 h before irradiation to the sarcoma cell cultures. In contrast, γH2AX expression in the normal tissue cell lines was significantly reduced when irradiation was combined with SAHA. Analysis of initial DNA fragmentation and fragment rejoining by PFGE, however, did not reveal differences in response to the SAHA pretreatment for either cell type. SAHA increases radiosensitivity in tumor but not normal tissue cell lines. The increased H2AX phosphorylation status of the SAHA-treated tumor cells post irradiation likely reflects its delayed dephosphorylation within the DNA damage signal decay rather than chromatin acetylation-dependent differences in the overall efficacy of DSB induction and rejoining. The results support the hypothesis that combining SAHA with irradiation may provide a promising strategy in the treatment of solid tumors. (orig.)

  17. Gastrointestinal cell lines form polarized epithelia with an adherent mucus layer when cultured in semi-wet interfaces with mechanical stimulation.

    Science.gov (United States)

    Navabi, Nazanin; McGuckin, Michael A; Lindén, Sara K

    2013-01-01

    Mucin glycoproteins are secreted in large quantities by mucosal epithelia and cell surface mucins are a prominent feature of the glycocalyx of all mucosal epithelia. Currently, studies investigating the gastrointestinal mucosal barrier use either animal experiments or non-in vivo like cell cultures. Many pathogens cause different pathology in mice compared to humans and the in vitro cell cultures used are suboptimal because they are very different from an in vivo mucosal surface, are often not polarized, lack important components of the glycocalyx, and often lack the mucus layer. Although gastrointestinal cell lines exist that produce mucins or polarize, human cell line models that reproducibly create the combination of a polarized epithelial cell layer, functional tight junctions and an adherent mucus layer have been missing until now. We trialed a range of treatments to induce polarization, 3D-organization, tight junctions, mucin production, mucus secretion, and formation of an adherent mucus layer that can be carried out using standard equipment. These treatments were tested on cell lines of intestinal (Caco-2, LS513, HT29, T84, LS174T, HT29 MTX-P8 and HT29 MTX-E12) and gastric (MKN7, MKN45, AGS, NCI-N87 and its hTERT Clone5 and Clone6) origins using Ussing chamber methodology and (immuno)histology. Semi-wet interface culture in combination with mechanical stimulation and DAPT caused HT29 MTX-P8, HT29 MTX-E12 and LS513 cells to polarize, form functional tight junctions, a three-dimensional architecture resembling colonic crypts, and produce an adherent mucus layer. Caco-2 and T84 cells also polarized, formed functional tight junctions and produced a thin adherent mucus layer after this treatment, but with less consistency. In conclusion, culture methods affect cell lines differently, and testing a matrix of methods vs. cell lines may be important to develop better in vitro models. The methods developed herein create in vitro mucosal surfaces suitable for studies

  18. Gastrointestinal cell lines form polarized epithelia with an adherent mucus layer when cultured in semi-wet interfaces with mechanical stimulation.

    Directory of Open Access Journals (Sweden)

    Nazanin Navabi

    Full Text Available Mucin glycoproteins are secreted in large quantities by mucosal epithelia and cell surface mucins are a prominent feature of the glycocalyx of all mucosal epithelia. Currently, studies investigating the gastrointestinal mucosal barrier use either animal experiments or non-in vivo like cell cultures. Many pathogens cause different pathology in mice compared to humans and the in vitro cell cultures used are suboptimal because they are very different from an in vivo mucosal surface, are often not polarized, lack important components of the glycocalyx, and often lack the mucus layer. Although gastrointestinal cell lines exist that produce mucins or polarize, human cell line models that reproducibly create the combination of a polarized epithelial cell layer, functional tight junctions and an adherent mucus layer have been missing until now. We trialed a range of treatments to induce polarization, 3D-organization, tight junctions, mucin production, mucus secretion, and formation of an adherent mucus layer that can be carried out using standard equipment. These treatments were tested on cell lines of intestinal (Caco-2, LS513, HT29, T84, LS174T, HT29 MTX-P8 and HT29 MTX-E12 and gastric (MKN7, MKN45, AGS, NCI-N87 and its hTERT Clone5 and Clone6 origins using Ussing chamber methodology and (immunohistology. Semi-wet interface culture in combination with mechanical stimulation and DAPT caused HT29 MTX-P8, HT29 MTX-E12 and LS513 cells to polarize, form functional tight junctions, a three-dimensional architecture resembling colonic crypts, and produce an adherent mucus layer. Caco-2 and T84 cells also polarized, formed functional tight junctions and produced a thin adherent mucus layer after this treatment, but with less consistency. In conclusion, culture methods affect cell lines differently, and testing a matrix of methods vs. cell lines may be important to develop better in vitro models. The methods developed herein create in vitro mucosal surfaces

  19. [Study on secondary metabolites of marine fungus Penicillium sp. FS60 from the South China Sea].

    Science.gov (United States)

    Zhang, Ling; Li, Dong-Li; Chen, Yu-Chan; Tao, Mei-Hua; Zhang, Wei-Min

    2012-07-01

    To study the secondary metabolites of the marine fungus Penicillium sp. FS60 from the South China Sea and their cytotoxicities. The compounds were isolated from the culture of strain FS60 by various chromatographic methods (silica gel, reverse silica gel, Sephadex-LH20, preparative TLC, HPLC and PTLC) and recrystallization. Their structures were identified by extensive analysis of their spectroscopic data. Compounds were tested for their cytotoxicities against SF-268, MCF-7, and NCI-H460 cell lines by SRB method. While, Compounds were tested for their antibacterial activities against S. aureus, E. coli and P. aeruginosa. Seven compounds were isolated from the culture and identified as methyl 2,4-dihydroxy-3,5,6-trimethylbenzoate (1), 4-hydroxyacetophenone (2), 5-hydroxymethyl-furoic acid (3), isochromophilones VIII (4), ergosterol (5), ergosterol peroxide (6), and cerevisterol (7). Compound 1 is isolated from the genus Penicillium for the first time. Compound 3 is demonstrated to have significant inhibition against S. aureus and P. aeruginosa. Compound 4 is demonstrated to have significant inhibition against the three cell lines.

  20. Esculetin exerts anti-proliferative effects against non-small-cell lung carcinoma by suppressing specificity protein 1 in vitro.

    Science.gov (United States)

    Lee, Ra H; Jeon, Young-Joo; Cho, Jin H; Jang, Jeong-Yun; Kong, Il-Keun; Kim, Seok-Ho; Kim, MinSeok S; Chung, Hak-Jae; Oh, Keon B; Park, Seon-Min; Shin, Jae-Cheon; Seo, Jae-Min; Ko, Sungho; Shim, Jung-Hyun; Chae, Jung-Il

    2017-01-01

    Esculetin, a coumarin derivative, is a phenolic compound isolated from Artemisia capillaris, Citrus limonia, and Euphorbia lathyris. Although it has been reported to have anti-inflammatory, anti-oxidant, and anti-proliferative activities in several human cancers, its anti-proliferative activity against non-small-cell lung carcinoma (NSCLC) and the molecular mechanisms involved have not been adequately elucidated. In this study, we used two NSCLC cell lines (NCI-H358 and NCI-H1299) to investigate the anti-proliferative activity and apoptotic effect of esculetin. Our data showed that esculetin-treated cells exhibited reduced proliferation and apoptotic cell morphologies. Intriguingly, the transcription factor specificity protein 1 (Sp1) was significantly suppressed by esculetin in a dose- and time-dependent manner. Furthermore, the levels of p27 and p21, two key regulators of the cell cycle, were up-regulated by the esculetin-mediated down-regulation of Sp1; the level of a third cell-cycle regulator, survivin, was decreased, resulting in caspase-dependent apoptosis. Therefore, we conclude that esculetin could be a potent anti-proliferative agent in patients with NSCLC.

  1. Steroids from the leaves of Chinese Melia azedarach and their cytotoxic effects on human cancer cell lines.

    Science.gov (United States)

    Wu, Shi-Biao; Ji, Yan-Ping; Zhu, Jing-Jing; Zhao, Yun; Xia, Gang; Hu, Ying-He; Hu, Jin-Feng

    2009-09-01

    Three new (1-3) and several known (4-6) steroids were isolated from the leaves of Chinese Melia azedarach. The structures of the new compounds were elucidated by means of spectroscopic methods including 2D NMR techniques and mass spectrometry to be (20S)-5,24(28)-ergostadiene-3beta,7alpha,16beta,20-tetrol (1), (20S)-5-ergostene-3beta,7alpha,16beta,20-tetrol (2), and 2alpha,3beta-dihydro-5-pregnen-16-one (3). The cytotoxicities of the isolated compounds against three human cancer cell lines (A549, H460, U251) were evaluated; only compounds 1, 2, and (20S)-5-stigmastene-3beta,7alpha,20-triol (4) were found to show significant cyctotoxic effects with IC(50)s from 12.0 to 30.1 microg/mL.

  2. Identification of chrysoplenetin from Vitex negundo as a potential cytotoxic agent against PANC-1 and a panel of 39 human cancer cell lines (JFCR-39).

    Science.gov (United States)

    Awale, Suresh; Linn, Thein Zaw; Li, Feng; Tezuka, Yasuhiro; Myint, Aung; Tomida, Akihiro; Yamori, Takao; Esumi, Hiroyasu; Kadota, Shigetoshi

    2011-12-01

    Human pancreatic cancer is known to be the most deadly disease with the lowest 5-year survival rate and is resistant to well known conventional chemotherapeutic drugs in clinical use. Screening of medicinal plants from Myanmar utilizing antiausterity strategy led to the identification of Vitex negundo as one of the medicinal plants having potent preferential cytotoxic activity against PANC-1 human pancreatic cancer cells. Bioactivity-guided phytochemical investigation led to the isolation of chrysoplenetin (1) and chrysosplenol D (2) as the active constituents with a PC(50) value of 3.4 μg/mL and 4.6 μg/mL, respectively, against PANC-1 cells. Both these compounds induced apoptosis-like morphological changes in PANC-1 cells. Chrysoplenetin was further tested against a panel of 39 human cancer cell lines (JFCR-39) at the Japanese Foundation for Cancer Research, and 25 cell lines belonging to lung, breast, CNS, colon, melanoma, ovarian, prostate cancer and stomach cancer cell lines were found to be highly sensitive to chrysoplenetin at a submicromolar range. In the JFCR-39 panel, lung NCI-H522, ovarian OVCAR-3 and prostate PC-3 cells were found to be most sensitive with GI(50) of 0.12, 0.18 and 0.17 μm, respectively. The COMPARE analysis suggested that the molecular mode of action of chrysoplenetin was unique compared with the existing anticancer drugs. Copyright © 2011 John Wiley & Sons, Ltd.

  3. Establishment of optimized MDCK cell lines for reliable efflux transport studies.

    Science.gov (United States)

    Gartzke, Dominik; Fricker, Gert

    2014-04-01

    Madin-Darby canine kidney (MDCK) cells transfected with human MDR1 gene (MDCK-MDR1) encoding for P-glycoprotein (hPgp, ABCB1) are widely used for transport studies to identify drug candidates as substrates of this efflux protein. Therefore, it is necessary to rely on constant and comparable expression levels of Pgp to avoid false negative or positive results. We generated a cell line with homogenously high and stable expression of hPgp through sorting single clones from a MDCK-MDR1 cell pool using fluorescence-activated cell sorting (FACS). To obtain control cell lines for evaluation of cross-interactions with endogenous canine Pgp (cPgp) wild-type cells were sorted with a low expression pattern of cPgp in comparison with the MDCK-MDR1. Expression of other transporters was also characterized in both cell lines by quantitative real-time PCR and Western blot. Pgp function was investigated applying the Calcein-AM assay as well as bidirectional transport assays using (3) H-Digoxin, (3) H-Vinblastine, and (3) H-Quinidine as substrates. Generated MDCK-MDR1 cell lines showed high expression of hPgp. Control MDCK-WT cells were optimized in showing a comparable expression level of cPgp in comparison with MDCK-MDR1 cell lines. Generated cell lines showed higher and more selective Pgp transport compared with parental cells. Therefore, they provide a significant improvement in the performance of efflux studies yielding more reliable results. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

  4. Determination of anti-cancer constituents in oplopanax horridus and oplopanax elatus

    International Nuclear Information System (INIS)

    Liu, P.; Gu, Y.; Dou, D.; Kang, T.; Smith, D.

    2012-01-01

    A rapid and reliable RP-HPLC method for the analysis of 3a-hydroxylup -20(29)-ene-23,28-dioic acid and 3 alpha -hydroxylup-20(29) -ene-23, 28-dioic acid-3-O-beta-D-glucoside in leaves of Oplopanax horridus and O. elatus was established, and their contents changes between species and different cultivated places were compared. The established analysis method presented good results and could be used as a method for the quality control of leaves of O. horridus and O. elatus. Meanwhile, the inhibitory effect of 1 and 2 on human hepatoma carcinoma cell (HepG-2) were examined and their IC/sub 50/ were determined to be 41.15 mu M and 120.06 mu M indicating that the anti-cancer activity of 1 was stronger than that of its glycoside. Moreover, the inhibitions of 1 on human colon cancer cell line (HCT116), human lung carcinoma cell line (NCI-H460) and human gastric cancer cell line (MGC803) were further tested, and the IC/sub 50/ were determined to be 21.40 mu M, 22.80 mu M and 21.26 mu M, respectively. While the inhibition of 1 on human pancreatic cancer cell line (PANC-1) was insignificant, indicating 1 possessed selectivity for the anti-cancer activity. (author)

  5. Comparative study of four immortalized human brain capillary endothelial cell lines, hCMEC/D3, hBMEC, TY10, and BB19, and optimization of culture conditions, for an in vitro blood-brain barrier model for drug permeability studies.

    Science.gov (United States)

    Eigenmann, Daniela E; Xue, Gongda; Kim, Kwang S; Moses, Ashlee V; Hamburger, Matthias; Oufir, Mouhssin

    2013-11-22

    Reliable human in vitro blood-brain barrier (BBB) models suitable for high-throughput screening are urgently needed in early drug discovery and development for assessing the ability of promising bioactive compounds to overcome the BBB. To establish an improved human in vitro BBB model, we compared four currently available and well characterized immortalized human brain capillary endothelial cell lines, hCMEC/D3, hBMEC, TY10, and BB19, with respect to barrier tightness and paracellular permeability. Co-culture systems using immortalized human astrocytes (SVG-A cell line) and immortalized human pericytes (HBPCT cell line) were designed with the aim of positively influencing barrier tightness. Tight junction (TJ) formation was assessed by transendothelial electrical resistance (TEER) measurements using a conventional epithelial voltohmmeter (EVOM) and an automated CellZscope system which records TEER and cell layer capacitance (CCL) in real-time.Paracellular permeability was assessed using two fluorescent marker compounds with low BBB penetration (sodium fluorescein (Na-F) and lucifer yellow (LY)). Conditions were optimized for each endothelial cell line by screening a series of 24-well tissue culture inserts from different providers. For hBMEC cells, further optimization was carried out by varying coating material, coating procedure, cell seeding density, and growth media composition. Biochemical characterization of cell type-specific transmembrane adherens junction protein VE-cadherin and of TJ proteins ZO-1 and claudin-5 were carried out for each endothelial cell line. In addition, immunostaining for ZO-1 in hBMEC cell line was performed. The four cell lines all expressed the endothelial cell type-specific adherens junction protein VE-cadherin. The TJ protein ZO-1 was expressed in hCMEC/D3 and in hBMEC cells. ZO-1 expression could be confirmed in hBMEC cells by immunocytochemical staining. Claudin-5 expression was detected in hCMEC/D3, TY10, and at a very low level

  6. Diarachidonoylphosphoethanolamine induces apoptosis of malignant pleural mesothelioma cells through a Trx/ASK1/p38 MAPK pathway

    Directory of Open Access Journals (Sweden)

    Ayako Tsuchiya

    2015-11-01

    Full Text Available 1,2-Diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE induces both necrosis/necroptosis and apoptosis of NCI-H28 malignant pleural mesothelioma (MPM cells. The present study was conducted to understand the mechanism for DAPE-induced apoptosis of NCI-H28 cells. DAPE induced caspase-independent apoptosis of NCI-H28 malignant pleural mesothelioma (MPM cells, and the effect of DAPE was prevented by antioxidants or an inhibitor of NADPH oxidase (NOX. DAPE generated reactive oxygen species (ROS and inhibited activity of thioredoxin (Trx reductase (TrxR. DAPE decreased an association of apoptosis signal-regulating kinase 1 (ASK1 with thioredoxin (Trx, thereby releasing ASK1. DAPE activated p38 mitogen-activated protein kinase (MAPK, which was inhibited by an antioxidant or knocking-down ASK1. In addition, DAPE-induced NCI-H28 cell death was also prevented by knocking-down ASK1. Taken together, the results of the present study indicate that DAPE stimulates NOX-mediated ROS production and suppresses TrxR activity, resulting in the decrease of reduced Trx and the dissociation of ASK1 from a complex with Trx, allowing sequential activation of ASK1 and p38 MAPK, to induce apoptosis of NCI-H28 MPM cells.

  7. Diarachidonoylphosphoethanolamine induces apoptosis of malignant pleural mesothelioma cells through a Trx/ASK1/p38 MAPK pathway.

    Science.gov (United States)

    Tsuchiya, Ayako; Kaku, Yoshiko; Nakano, Takashi; Nishizaki, Tomoyuki

    2015-11-01

    1,2-Diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE) induces both necrosis/necroptosis and apoptosis of NCI-H28 malignant pleural mesothelioma (MPM) cells. The present study was conducted to understand the mechanism for DAPE-induced apoptosis of NCI-H28 cells. DAPE induced caspase-independent apoptosis of NCI-H28 malignant pleural mesothelioma (MPM) cells, and the effect of DAPE was prevented by antioxidants or an inhibitor of NADPH oxidase (NOX). DAPE generated reactive oxygen species (ROS) and inhibited activity of thioredoxin (Trx) reductase (TrxR). DAPE decreased an association of apoptosis signal-regulating kinase 1 (ASK1) with thioredoxin (Trx), thereby releasing ASK1. DAPE activated p38 mitogen-activated protein kinase (MAPK), which was inhibited by an antioxidant or knocking-down ASK1. In addition, DAPE-induced NCI-H28 cell death was also prevented by knocking-down ASK1. Taken together, the results of the present study indicate that DAPE stimulates NOX-mediated ROS production and suppresses TrxR activity, resulting in the decrease of reduced Trx and the dissociation of ASK1 from a complex with Trx, allowing sequential activation of ASK1 and p38 MAPK, to induce apoptosis of NCI-H28 MPM cells. Copyright © 2015 The Authors. Production and hosting by Elsevier B.V. All rights reserved.

  8. Sci—Fri AM: Mountain — 04: Label-free Raman spectroscopy of single tumour cells detects early radiation-induced glycogen synthesis associated with increased radiation resistance

    International Nuclear Information System (INIS)

    Matthews, Q; Lum, JJ; Isabelle, M; Harder, S; Jirasek, A; Brolo, AG

    2014-01-01

    Purpose: To use label-free Raman spectroscopy (RS) for early treatment monitoring of tumour cell radioresistance. Methods: Three human tumour cell lines, two radioresistant (H460, SF 2 = 0.57 and MCF7, SF 2 = 0.70) and one radiosensitive (LNCaP, SF 2 = 0.36), were irradiated with single fractions of 2, 4, 6, 8 or 10 Gy. In additional experiments, H460 and MCF7 cells were irradiated under co-treatment with the anti-diabetic drug metformin, a known radiosensitizing agent. Treated and control cultures were analyzed with RS daily for 3 days post-treatment. Single-cell Raman spectra were acquired from 20 live cells per sample, and experiments were repeated in triplicate. The combined data sets were analyzed with principal component analysis using standard algorithms. Cells from each culture were also subjected to standard assays for viability, proliferation, cell cycle, and radiation clonogenic survival. Results: The radioresistant cells (H460, MCF7) exhibited a RS molecular radiation response signature, detectable as early as 1 day post-treatment, of which radiation-induced glycogen synthesis is a significant contributor. The radiosensitive cells (LNCaP) exhibited negligible glycogen synthesis. Co-treatment with metformin in MCF7 cells blocked glycogen synthesis, reduced viability and proliferation, and increased radiosensitivity. Conversely, metformin co-treatment in H460 cells did not produce these same effects; importantly, both radiation-induced synthesis of glycogen and radiosensitivity were unaffected. Conclusions: Label-free RS can detect early glycogen synthesis post-irradiation, a previously undocumented metabolic mechanism associated with tumour cell radioresistance that can be targeted to increase radiosensitivity. RS monitoring of intratumoral glycogen may provide new opportunities for personalized combined modality radiotherapy treatments

  9. Sci—Fri AM: Mountain — 04: Label-free Raman spectroscopy of single tumour cells detects early radiation-induced glycogen synthesis associated with increased radiation resistance

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, Q; Lum, JJ [BC Cancer Agency — Vancouver Island Centre (Canada); Isabelle, M; Harder, S; Jirasek, A [Physics and Astronomy, University of Victoria (Australia); Brolo, AG [Chemistry, University of Victoria (Australia)

    2014-08-15

    Purpose: To use label-free Raman spectroscopy (RS) for early treatment monitoring of tumour cell radioresistance. Methods: Three human tumour cell lines, two radioresistant (H460, SF{sub 2} = 0.57 and MCF7, SF{sub 2} = 0.70) and one radiosensitive (LNCaP, SF{sub 2} = 0.36), were irradiated with single fractions of 2, 4, 6, 8 or 10 Gy. In additional experiments, H460 and MCF7 cells were irradiated under co-treatment with the anti-diabetic drug metformin, a known radiosensitizing agent. Treated and control cultures were analyzed with RS daily for 3 days post-treatment. Single-cell Raman spectra were acquired from 20 live cells per sample, and experiments were repeated in triplicate. The combined data sets were analyzed with principal component analysis using standard algorithms. Cells from each culture were also subjected to standard assays for viability, proliferation, cell cycle, and radiation clonogenic survival. Results: The radioresistant cells (H460, MCF7) exhibited a RS molecular radiation response signature, detectable as early as 1 day post-treatment, of which radiation-induced glycogen synthesis is a significant contributor. The radiosensitive cells (LNCaP) exhibited negligible glycogen synthesis. Co-treatment with metformin in MCF7 cells blocked glycogen synthesis, reduced viability and proliferation, and increased radiosensitivity. Conversely, metformin co-treatment in H460 cells did not produce these same effects; importantly, both radiation-induced synthesis of glycogen and radiosensitivity were unaffected. Conclusions: Label-free RS can detect early glycogen synthesis post-irradiation, a previously undocumented metabolic mechanism associated with tumour cell radioresistance that can be targeted to increase radiosensitivity. RS monitoring of intratumoral glycogen may provide new opportunities for personalized combined modality radiotherapy treatments.

  10. Bufalin inhibits the differentiation and proliferation of human osteosarcoma cell line hMG63-derived cancer stem cells.

    Science.gov (United States)

    Chang, Yuewen; Zhao, Yongfang; Zhan, Hongsheng; Wei, Xiaoen; Liu, Tianjin; Zheng, Bo

    2014-02-01

    Cancer stem cells (CSCs) play an important role in drug resistance of tumor and are responsible for high recurrence rates. Agents that can suppress the proliferation and differentiation of CSCs would provide new opportunity to fight against tumor recurrence. In this study, we developed a new strategy to enrich CSCs in human osteosarcoma cell line hMG63. Using these CSCs as model, we tested the effect of bufalin, a traditional Chinese medicine, on the proliferation and differentiation of CSCs. hMG63 cells were cultured in poly-HEMA-treated dish and cancer stem cell-specific medium. In this nonadhesive culture system, hMG63 formed spheres, which were then collected and injected into the immunodeficient mice. Cisplatin was administered every 3 days for five times. The enriched xenograft tumors were cultured in cancer stem cell-specific medium again to form tumor spheres. Expression of cancer stem cell markers of these cells was measured by flow cytometry. These cells were then treated with bufalin, and the proliferation and differentiation ability were indicated by the expression level of molecular markers and the formation of sphere again in vitro. We obtained a low CD133+/CD44 cell population with high-level stem cell marker. When treated with bufalin, the sphere could not get attached to the flask and failed to differentiate, which was indicated by the stable expression of stem cell marker CD133 and OCT-4 in the condition permissive to differentiation. Treatment of bufalin also suppressed the single cells isolated from the sphere to form sphere again in the nonadhesive culture system, and a decreased expression of proliferation marker Ki67 was also detected in these cells. Sphere-formed and chemoresistant colon xenograft tumors in immunodeficient mice could enrich cancer stem cell population. Bufalin could inhibit proliferation and differentiation of CSCs.

  11. Quantitative Secretomic Analysis Identifies Extracellular Protein Factors That Modulate the Metastatic Phenotype of Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Hu, Rongkuan; Huffman, Kenneth E; Chu, Michael; Zhang, Yajie; Minna, John D; Yu, Yonghao

    2016-02-05

    Lung cancer is the leading cause of cancer-related deaths for men and women in the United States, with non-small cell lung cancer (NSCLC) representing 85% of all diagnoses. Late stage detection, metastatic disease and lack of actionable biomarkers contribute to the high mortality rate. Proteins in the extracellular space are known to be critically involved in regulating every stage of the pathogenesis of lung cancer. To investigate the mechanism by which secreted proteins contribute to the pathogenesis of NSCLC, we performed quantitative secretomic analysis of two isogenic NSCLC cell lines (NCI-H1993 and NCI-H2073) and an immortalized human bronchial epithelial cell line (HBEC3-KT) as control. H1993 was derived from a chemo-naïve metastatic tumor, while H2073 was derived from the primary tumor after etoposide/cisplatin therapy. From the conditioned media of these three cell lines, we identified and quantified 2713 proteins, including a series of proteins involved in regulating inflammatory response, programmed cell death and cell motion. Gene Ontology (GO) analysis indicates that a number of proteins overexpressed in H1993 media are involved in biological processes related to cancer metastasis, including cell motion, cell-cell adhesion and cell migration. RNA interference (RNAi)-mediated knock down of a number of these proteins, including SULT2B1, CEACAM5, SPRR3, AGR2, S100P, and S100A14, leads to dramatically reduced migration of these cells. In addition, meta-analysis of survival data indicates NSCLC patients whose tumors express higher levels of several of these secreted proteins, including SULT2B1, CEACAM5, SPRR3, S100P, and S100A14, have a worse prognosis. Collectively, our results provide a potential molecular link between deregulated secretome and NSCLC cell migration/metastasis. In addition, the identification of these aberrantly secreted proteins might facilitate the development of biomarkers for early detection of this devastating disease.

  12. Pseudonocardians A–C, New Diazaanthraquinone Derivatives from a Deap-Sea Actinomycete Pseudonocardia sp. SCSIO 01299

    Directory of Open Access Journals (Sweden)

    Xianwen Yang

    2011-08-01

    Full Text Available Pseudonocardians A–C (2–4, three new diazaanthraquinone derivatives, along with a previously synthesized compound deoxynyboquinone (1, were produced by the strain SCSIO 01299, a marine actinomycete member of the genus Pseudonocardia, isolated from deep-sea sediment of the South China Sea. The structures of compounds 1–4 were determined by mass spectrometry and NMR experiments (1H, 13C, HSQC, and HMBC. The structure of compound 1, which was obtained for the first time from a natural source, was confirmed by X-ray analysis. Compounds 1–3 exhibited potent cytotoxic activities against three tumor cell lines of SF-268, MCF-7 and NCI-H460 with IC50 values between 0.01 and 0.21 μm, and also showed antibacterial activities on Staphylococcus aureus ATCC 29213, Enterococcus faecalis ATCC 29212 and Bacillus thuringensis SCSIO BT01, with MIC values of 1–4 μg mL−1.

  13. 42 CFR 460.82 - Marketing.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Marketing. 460.82 Section 460.82 Public Health... Administrative Requirements § 460.82 Marketing. (a) Information that a PACE organization must include in its marketing materials. (1) A PACE organization must inform the public about its program and give prospective...

  14. Derivation from an alloreactive T-cell line of a clone which cross-reacts with a self H2-E-restricted minor alloantigen

    DEFF Research Database (Denmark)

    Owens, T; Liddell, M E; Crispe, I N

    1984-01-01

    An alloreactive T-helper-cell line [(A.TH X Balb/c) anti-A.TL] was shown to recognize both H2-Ek and H2-Ed. Both proliferation and polyclonal B-cell activation (protein A plaques) were used in the analyses of specificity. On cloning, the H2-Ek/Ed cross-reaction was shown by one clonotype...

  15. Dicty_cDB: SLC460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

  16. 21 CFR 558.460 - Penicillin.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin. 558.460 Section 558.460 Food and Drugs... Animal Feeds § 558.460 Penicillin. (a) Specifications. As penicillin procaine G or feed grade penicillin.... (1) It is used as follows: Penicillin in grams per ton Combination in grams per ton Indications for...

  17. NCI Alliance for Nanotechnology in Cancer

    Science.gov (United States)

    The NCI Alliance for Nanotechnology in Cancer funds the Cancer Nanotechnology Training Centers collectively with the NCI Cancer Training Center. Find out about the funded Centers, to date, that train our next generation of scientists in the field of Canc

  18. The influence of differential processing of procathepsin H on its aminopeptidase activity, secretion and subcellular localization in human cell lines.

    Science.gov (United States)

    Rojnik, Matija; Jevnikar, Zala R; Doljak, Bojan; Turk, Samo; Zidar, Nace; Kos, Janko

    2012-10-01

    Cathepsin H is a unique member of the cysteine cathepsins that acts primarily as an aminopeptidase. Like other cysteine cathepsins, it is synthesized as an inactive precursor and activated by proteolytic removal of its propeptide. Here we demonstrate that, in human cells, the processing of the propeptide is an autocatalytic, multistep process proceeding from an inactive 41kDa pro-form, through a 30kDa intermediate form, to the 28kDa mature form. Tyr87P and Gly90P were identified as the two major endopeptidase cleavage sites, converting the 30kDa form into the mature 28kDa form. The level of processing differs significantly in different human cell lines. In monocyte-derived macrophages U937 and prostate cancer cells PC-3, the 28kDa form is predominant, whereas in osteoblasts HOS the processing from the 30kDa form to the 28kDa form is significantly lower. The aminopeptidase activity of the enzyme and its subcellular localization are independent of the product, however the 30kDa form was not secreted in HOS cells. The activity of the resulting cathepsin H in U937 cells was significantly lower than that in HOS cells, presumably due to the high levels of endogenous cysteine protease inhibitor cystatin F present specifically in this cell line. These results provide an insight into the dependence of human cathepsin H processing and regulation on cell type. Copyright © 2012 Elsevier GmbH. All rights reserved.

  19. The relationship between CD86/CD54 expression and THP-1 cell viability in an in vitro skin sensitization test--human cell line activation test (h-CLAT).

    Science.gov (United States)

    Sakaguchi, Hitoshi; Ashikaga, Takao; Miyazawa, Masaaki; Kosaka, Nanae; Ito, Yuichi; Yoneyama, Katsurako; Sono, Sakiko; Itagaki, Hiroshi; Toyoda, Hidekazu; Suzuki, Hiroyuki

    2009-04-01

    Recent regulations for cosmetics in Europe prohibit animal testing for evaluating the sensitization potential of chemicals to improve animal welfare. Yet, there is not an acceptable Organization for Economic Co-operation and Development non-animal skin sensitization test method. Several in vitro skin sensitization methods that focus on the activation of Langerhans cells, including human cell lines, are being evaluated as possible alternatives. In our previous study, we optimized our human cell line activation test (h-CLAT) using THP-1 cells (monocytic leukemia cell line) and conducted an inter-laboratory study. We found that measuring CD86/CD54 expression may be useful for predicting skin sensitization. The aim of this study was to confirm the relationship between CD86/CD54 expression and THP-1 cell viability in the h-CLAT. In this study, 21 allergens (e.g., dinitrochlorobenzene, p-phenylenediamine, Ni) and 8 non-allergens (e.g., SLS, lactic acid) were evaluated. For each chemical, more than 10 concentrations that gave a predicted cell viability range of 20-95% were used. The data showed that expression patterns of CD86/CD54 differed depending on chemical. For most allergens, cytotoxicity (65-90% cell viability) was needed for enhancement of CD86/CD54 expression. The criteria of "CD86 > or = 150 or CD54 > or = 200" resulted in an accuracy of 93%, which confirms appropriate cut-off criteria for h-CLAT. Furthermore, a good correlation was observed between EC3 of local lymph node assay and EC150(CD86) or EC200(CD54) of h-CLAT (12 or 16 chemicals, respectively), which would provide a useful estimate of allergic potency. These findings suggest that h-CLAT would be a good robust in vitro skin sensitization test.

  20. Small Molecular TRAIL Inducer ONC201 Induces Death in Lung Cancer Cells: A Preclinical Study

    OpenAIRE

    Feng, Yuan; Zhou, Jihong; Li, Zhanhua; Jiang, Ying; Zhou, Ying

    2016-01-01

    Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) selectively targets cancer cells. The present preclinical study investigated the anti-cancer efficiency of ONC201, a first-in-class small molecule TRAIL inducer, in lung cancer cells. We showed that ONC201 was cytotoxic and anti-proliferative in both established (A549 and H460 lines) and primary human lung cancer cells. It was yet non-cytotoxic to normal lung epithelial cells. Further, ONC201 induced exogenous apoptosis act...

  1. JTC801 Induces pH-dependent Death Specifically in Cancer Cells and Slows Growth of Tumors in Mice.

    Science.gov (United States)

    Song, Xinxin; Zhu, Shan; Xie, Yangchun; Liu, Jiao; Sun, Lingyi; Zeng, Dexing; Wang, Pengcheng; Ma, Xiaochao; Kroemer, Guido; Bartlett, David L; Billiar, Timothy R; Lotze, Michael T; Zeh, Herbert J; Kang, Rui; Tang, Daolin

    2018-04-01

    Maintenance of acid-base homeostasis is required for normal physiology, metabolism, and development. It is not clear how cell death is activated in response to changes in pH. We performed a screen to identify agents that induce cell death in a pH-dependent manner (we call this alkaliptosis) in pancreatic ductal adenocarcinoma cancer (PDAC) cells and tested their effects in mice. We screened a library of 254 compounds that interact with G-protein-coupled receptors (GPCRs) to identify those with cytotoxic activity against a human PDAC cell line (PANC1). We evaluated the ability of JTC801, which binds the opiod receptor and has analgesic effects, to stimulate cell death in human PDAC cell lines (PANC1, MiaPaCa2, CFPAC1, PANC2.03, BxPc3, and CAPAN2), mouse pancreatic cancer-associated stellate cell lines, primary human pancreatic ductal epithelial cells, and 60 cancer cell lines (the NCI-60 panel). Genes encoding proteins in cell death and GPCR signaling pathways, as well as those that regulate nuclear factor-κB (NF-κB) activity, were knocked out, knocked down, or expressed from transgenes in cancer cell lines. JTC801 was administered by gavage to mice with xenograft tumors, C57BL/6 mice with orthographic pancreatic tumors grown from Pdx1-Cre;KRas G12D/+ ;Tp53 R172H/+ (KPC) cells, mice with metastases following tail-vein injection of KPC cells, and Pdx-1-Cre;Kras G12D/+ mice crossed with Hmgb1 flox/flox mice (KCH mice). Pancreata were collected from mice and analyzed for tumor growth and by histology and immunohistochemistry. We compared gene and protein expression levels between human pancreatic cancer tissues and patient survival times using online R2 genomic or immunohistochemistry analyses. Exposure of human PDAC cell lines (PANC1 and MiaPaCa2) to JTC801 did not induce molecular markers of apoptosis (cleavage of caspase 3 or poly [ADP ribose] polymerase [PARP]), necroptosis (interaction between receptor-interacting serine-threonine kinase 3 [RIPK3] and mixed

  2. Patient-Derived Antibody Targets Tumor Cells

    Science.gov (United States)

    An NCI Cancer Currents blog on an antibody derived from patients that killed tumor cells in cell lines of several cancer types and slowed tumor growth in mouse models of brain and lung cancer without evidence of side effects.

  3. Dicty_cDB: SSF460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSF460 (Link to dictyBase) - - - Contig-U03803-1 SSF460Z (Link... to Original site) - - SSF460Z 453 - - - - Show SSF460 Library SS (Link to library) Clone ID SSF460 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSF4-C/SSF460Q.Seq.d/ Representative seq. ID SSF46...0Z (Link to Original site) Representative DNA sequence >SSF460 (SSF460Q) /CSM/SS/SSF4-C/SSF460Q.Seq.d/ XXXXX...s) Value SSM309 (SSM309Q) /CSM/SS/SSM3-A/SSM309Q.Seq.d/ 424 e-118 SSH196 (SSH196Q) /CSM/SS/SSH1-D/SSH196Q.Seq.d/ 424 e-118 SSF4

  4. Downregulation of telomerase activity in human promyelocytic cell line using RNA interference.

    Science.gov (United States)

    Miri-Moghaddam, E; Deezagi, A; Soheili, Z S

    2009-12-01

    Telomerase is a ribonucleoprotein complex. It consists of two main components, human telomerase reverse transcriptase (hTERT) and human telomerase RNA. High telomerase activity is present in most malignant cells, but it is barely detectable in majority of somatic cells. The direct correlation between telomerase reactivation and carcinogens has made hTERT a key target for anticancer therapeutic studies. In this study, for the first time, we evaluated the ability of the new generation of short interfering RNA (siRNA) to regulate telomerase activity in the human promyelocytic leukemia cell line (HL-60). Transient transfection cell line by hTERT siRNAs resulted in statistically significant suppression of hTERT messenger RNAs which were detected by quantitative real-time polymerase chain reaction, while the expressed hTERT protein levels were measured by flow cytometry. The results of telomeric repeat amplification protocol showed that telomerase activity was significantly reduced upon transfection of the HL-60 cell line with hTERT siRNAs. The results of this study showed that telomerase activity and cell proliferation were efficiently inhibited in the hTERT siRNA-treated leukemic cell line.

  5. Caffeine markedly sensitizes human mesothelioma cell lines to pemetrexed

    Science.gov (United States)

    Min, Sang Hee; Goldman, I. David; Zhao, Rongbao

    2013-01-01

    Pemetrexed is a new generation antifolate approved for the treatment of mesothelioma and non-small cell lung cancer. Caffeine is known to augment radiation or chemotherapeutic drug-induced cell killing. The current study addresses the impact of caffeine on the activity of pemetrexed in mesothelioma cell lines. Caffeine enhanced pemetrexed activity in all four mesothelioma cell lines tested (H2052, H2373, H28 and MSTO-211H). Caffeine sensitized H2052 cells in a dose- and schedule-dependent manner, and was associated with a markedly decreased clonogenic survival. Caffeine sensitization occurred only in cells subjected to pulse, but not continuous, exposure to pemetrexed. Similar pemetrexed sensitization was also observed with the clinically better tolerated caffeine analog, theobromine. Pemetrexed sensitization by caffeine was associated with an increase in pemetrexed-induced phosphorylation of ataxia-telangiectasia-mutated (ATM) and Chk1. These data indicate that caffeine and its analog, theobromine, may be a useful approach to enhance pemetrexed-based chemotherapy. PMID:17594092

  6. Inhibition of H3K9me2 Reduces Hair Cell Regeneration after Hair Cell Loss in the Zebrafish Lateral Line by Down-Regulating the Wnt and Fgf Signaling Pathways

    Science.gov (United States)

    Tang, Dongmei; Lin, Qin; He, Yingzi; Chai, Renjie; Li, Huawei

    2016-01-01

    The activation of neuromast (NM) supporting cell (SC) proliferation leads to hair cell (HC) regeneration in the zebrafish lateral line. Epigenetic mechanisms have been reported that regulate HC regeneration in the zebrafish lateral line, but the role of H3K9me2 in HC regeneration after HC loss remains poorly understood. In this study, we focused on the role of H3K9me2 in HC regeneration following neomycin-induced HC loss. To investigate the effects of H3K9me2 in HC regeneration, we took advantage of the G9a/GLP-specific inhibitor BIX01294 that significantly reduces the dimethylation of H3K9. We found that BIX01294 significantly reduced HC regeneration after neomycin-induced HC loss in the zebrafish lateral line. BIX01294 also significantly reduced the proliferation of NM cells and led to fewer SCs in the lateral line. In situ hybridization showed that BIX01294 significantly down-regulated the Wnt and Fgf signaling pathways, which resulted in reduced SC proliferation and HC regeneration in the NMs of the lateral line. Altogether, our results suggest that down-regulation of H3K9me2 significantly decreases HC regeneration after neomycin-induced HC loss through inactivation of the Wnt/β-catenin and Fgf signaling pathways. Thus H3K9me2 plays a critical role in HC regeneration. PMID:27303264

  7. Inhibition of H3K9me2 Reduces Hair Cell Regeneration after Hair Cell Loss in the Zebrafish Lateral Line by Down-Regulating the Wnt and Fgf Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Dongmei eTang

    2016-05-01

    Full Text Available The activation of neuromast supporting cell (SC proliferation leads to hair cell (HC regeneration in the zebrafish lateral line. Epigenetic mechanisms have been reported that regulate HC regeneration in the zebrafish lateral line, but the role of H3K9me2 in HC regeneration after HC loss remains poorly understood. In this study, we focused on the role of H3K9me2 in HC regeneration following neomycin-induced HC loss. To investigate the effects of H3K9me2 in HC regeneration, we took advantage of the G9a/GLP-specific inhibitor BIX01294 that significantly reduces the dimethylation of H3K9. We found that BIX01294 significantly reduced HC regeneration after neomycin-induced HC loss in the zebrafish lateral line. BIX01294 also significantly reduced the proliferation of neuromast cells and led to fewer SCs in the lateral line. In situ hybridization showed that BIX01294 significantly down-regulated the Wnt and Fgf signaling pathways, which resulted in reduced SC proliferation and HC regeneration in the neuromasts of the lateral line. Altogether, our results suggest that down-regulation of H3K9me2 significantly decreases HC regeneration after neomycin-induced HC loss through inactivation of the Wnt/β-catenin and Fgf signaling pathways. Thus H3K9me2 plays a critical role in HC regeneration.

  8. Caveolin-1 sensitizes cisplatin-induced lung cancer cell apoptosis via superoxide anion-dependent mechanism.

    Science.gov (United States)

    Pongjit, Kanittha; Chanvorachote, Pithi

    2011-12-01

    Caveolin-1 (Cav-1) expression frequently found in lung cancer was linked with disease prognosis and progression. This study reveals for the first time that Cav-1 sensitizes cisplatin-induced lung carcinoma cell death by the mechanism involving oxidative stress modulation. We established stable Cav-1 overexpressed (H460/Cav-1) cells and investigated their cisplatin susceptibility in comparison with control-transfected cells and found that Cav-1 expression significantly enhanced cisplatin-mediated cell death. Results indicated that the different response to cisplatin between these cells was resulted from different level of superoxide anion induced by cisplatin. Inhibitory study revealed that superoxide anion inhibitor MnTBAP could inhibit cisplatin-mediated toxicity only in H460/Cav-1 cells while had no effect on H460 cells. Further, superoxide anion detected by DHE probe indicated that H460/Cav-1 cells generated significantly higher superoxide anion level in response to cisplatin than that of control cells. The role of Cav-1 in regulating cisplatin sensitivity was confirmed in shRNA-mediated Cav-1 down-regulated (H460/shCav-1) cells and the cells exhibited decreased cisplatin susceptibility and superoxide generation. In summary, these findings reveal novel aspects regarding role of Cav-1 in modulating oxidative stress induced by cisplatin, possibly providing new insights for cancer biology and cisplatin-based chemotherapy.

  9. License Agreements | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    NCI Technology Transfer Center (TTC) licenses the discoveries of NCI and nine other NIH Institutes so new technologies can be developed and commercialized, to convert them into public health benefits.

  10. Effects of currently used pesticides in the AhR-CALUX assay: comparison between the human TV101L and the rat H4IIE cell line

    DEFF Research Database (Denmark)

    Long, M.; Laier, Peter; Vinggaard, Anne

    2003-01-01

    TV101L hepatoma cell lines. In comparison the results indicated that the rat H4IIE cell line is more sensitive than the human TV101L for detection of TCDD inducing AhR-CALUX activity. The pesticides iprodione, chlorpyrifos and prochloraz showed dose-dependent AhR agonistic effects in both cell lines...

  11. Anticancer effect of luteolin is mediated by downregulation of TAM receptor tyrosine kinases, but not interleukin-8, in non-small cell lung cancer cells.

    Science.gov (United States)

    Lee, Youn Ju; Lim, Taeho; Han, Min Su; Lee, Sun-Hwa; Baek, Suk-Hwan; Nan, Hong-Yan; Lee, Chuhee

    2017-02-01

    TAM receptor tyrosine kinases (RTKs), Tyro3, Axl and MerTK, transduce diverse signals responsible for cell survival, growth, proliferation and anti-apoptosis. In the present study, we demonstrated the effect of luteolin, a flavonoid with antioxidant, anti-inflammatory and anticancer activities, on the expression and activation of TAM RTKs and the association with its cytotoxicity in non-small cell lung cancer (NSCLC) cells. We observed the cytotoxic effect of luteolin in parental A549 and H460 cells as well as in cisplatin-resistant A549/CisR and H460/CisR cells. Exposure of these cells to luteolin also resulted in a dose‑dependent decrease in clonogenic ability. Next, luteolin was found to decrease the protein levels of all three TAM RTKs in the A549 and A549/CisR cells in a dose‑dependent manner. In a similar manner, in H460 and H460/CisR cells, the protein levels of Axl and Tyro3 were decreased following luteolin treatment. In addition, Axl promoter activity was decreased by luteolin, indicating that luteolin suppresses Axl expression at the transcriptional level. We next found that luteolin abrogated Axl phosphorylation in response to growth arrest-specific 6 (Gas6), its ligand, implying the inhibitory effect of luteolin on Gas6-induced Axl activation. Ectopic expression of Axl was observed to attenuate the antiproliferative effect of luteolin, while knockdown of the Axl protein level using a gold nanoparticle-assisted gene delivery system increased its cytotoxicity. In contrast to the inhibitory effect of luteolin on the expression of TAM RTKs, interleukin-8 (IL-8) production was not decreased by luteolin in H460 and H460/CisR cells, while IL-8 production/cell was increased. Collectively, our data suggest that TAM RTKs, but not IL-8, are promising therapeutic targets of luteolin to abrogate cell proliferation and to overcome chemoresistance in NSCLC cells.

  12. NCI & Division Obligations

    Science.gov (United States)

    Displays obligations for grants, contracts, training fellowships, intramural research, and management and support, including the number of grant awards, funding amounts, and percent of the total NCI budget.

  13. The EndoC-βH1 cell line is a valid model of human beta cells and applicable for screenings to identify novel drug target candidates.

    Science.gov (United States)

    Tsonkova, Violeta Georgieva; Sand, Fredrik Wolfhagen; Wolf, Xenia Asbæk; Grunnet, Lars Groth; Kirstine Ringgaard, Anna; Ingvorsen, Camilla; Winkel, Louise; Kalisz, Mark; Dalgaard, Kevin; Bruun, Christine; Fels, Johannes Josef; Helgstrand, Charlotte; Hastrup, Sven; Öberg, Fredrik Kryh; Vernet, Erik; Sandrini, Michael Paolo Bastner; Shaw, Allan Christian; Jessen, Carsten; Grønborg, Mads; Hald, Jacob; Willenbrock, Hanni; Madsen, Dennis; Wernersson, Rasmus; Hansson, Lena; Jensen, Jan Nygaard; Plesner, Annette; Alanentalo, Tomas; Petersen, Maja Borup Kjær; Grapin-Botton, Anne; Honoré, Christian; Ahnfelt-Rønne, Jonas; Hecksher-Sørensen, Jacob; Ravassard, Philippe; Madsen, Ole D; Rescan, Claude; Frogne, Thomas

    2018-02-01

    To characterize the EndoC-βH1 cell line as a model for human beta cells and evaluate its beta cell functionality, focusing on insulin secretion, proliferation, apoptosis and ER stress, with the objective to assess its potential as a screening platform for identification of novel anti-diabetic drug candidates. EndoC-βH1 was transplanted into mice for validation of in vivo functionality. Insulin secretion was evaluated in cells cultured as monolayer and as pseudoislets, as well as in diabetic mice. Cytokine induced apoptosis, glucolipotoxicity, and ER stress responses were assessed. Beta cell relevant mRNA and protein expression were investigated by qPCR and antibody staining. Hundreds of proteins or peptides were tested for their effect on insulin secretion and proliferation. Transplantation of EndoC-βH1 cells restored normoglycemia in streptozotocin induced diabetic mice. Both in vitro and in vivo, we observed a clear insulin response to glucose, and, in vitro, we found a significant increase in insulin secretion from EndoC-βH1 pseudoislets compared to monolayer cultures for both glucose and incretins. Apoptosis and ER stress were inducible in the cells and caspase 3/7 activity was elevated in response to cytokines, but not affected by the saturated fatty acid palmitate. By screening of various proteins and peptides, we found Bombesin (BB) receptor agonists and Pituitary Adenylate Cyclase-Activating Polypeptides (PACAP) to significantly induce insulin secretion and the proteins SerpinA6, STC1, and APOH to significantly stimulate proliferation. ER stress was readily induced by Tunicamycin and resulted in a reduction of insulin mRNA. Somatostatin (SST) was found to be expressed by 1% of the cells and manipulation of the SST receptors was found to significantly affect insulin secretion. Overall, the EndoC-βH1 cells strongly resemble human islet beta cells in terms of glucose and incretin stimulated insulin secretion capabilities. The cell line has an active

  14. The EndoC-βH1 cell line is a valid model of human beta cells and applicable for screenings to identify novel drug target candidates

    Directory of Open Access Journals (Sweden)

    Violeta Georgieva Tsonkova

    2018-02-01

    Full Text Available Objective: To characterize the EndoC-βH1 cell line as a model for human beta cells and evaluate its beta cell functionality, focusing on insulin secretion, proliferation, apoptosis and ER stress, with the objective to assess its potential as a screening platform for identification of novel anti-diabetic drug candidates. Methods: EndoC-βH1 was transplanted into mice for validation of in vivo functionality. Insulin secretion was evaluated in cells cultured as monolayer and as pseudoislets, as well as in diabetic mice. Cytokine induced apoptosis, glucolipotoxicity, and ER stress responses were assessed. Beta cell relevant mRNA and protein expression were investigated by qPCR and antibody staining. Hundreds of proteins or peptides were tested for their effect on insulin secretion and proliferation. Results: Transplantation of EndoC-βH1 cells restored normoglycemia in streptozotocin induced diabetic mice. Both in vitro and in vivo, we observed a clear insulin response to glucose, and, in vitro, we found a significant increase in insulin secretion from EndoC-βH1 pseudoislets compared to monolayer cultures for both glucose and incretins.Apoptosis and ER stress were inducible in the cells and caspase 3/7 activity was elevated in response to cytokines, but not affected by the saturated fatty acid palmitate.By screening of various proteins and peptides, we found Bombesin (BB receptor agonists and Pituitary Adenylate Cyclase-Activating Polypeptides (PACAP to significantly induce insulin secretion and the proteins SerpinA6, STC1, and APOH to significantly stimulate proliferation.ER stress was readily induced by Tunicamycin and resulted in a reduction of insulin mRNA. Somatostatin (SST was found to be expressed by 1% of the cells and manipulation of the SST receptors was found to significantly affect insulin secretion. Conclusions: Overall, the EndoC-βH1 cells strongly resemble human islet beta cells in terms of glucose and incretin stimulated

  15. TGF-β of lung cancer microenvironment upregulates B7H1 and GITRL expression in dendritic cells and is associated with regulatory T cell generation.

    Science.gov (United States)

    Ni, Xiao Yan; Sui, Hua Xiu; Liu, Yao; Ke, Shi Zhong; Wang, Yi Nan; Gao, Feng Guang

    2012-08-01

    The effects of TGF-β on dendritic cells (DCs) on the tumor microenvironment are not well understood. We report, here, the establishment of an in vitro lung cancer microenvironment by co-incubation of seminaphtharhodafluor (SNARF) labeled Lewis lung cancer (LLC) cells, carboxyfluorescein succinimidyl ester (CFSE) labeled fibroblasts and 4-chloromethyl-7-hydroxycoumarin (CMHC) labeled DCs. Raw 264.7, EL4 and NCI-H446 cells were able to synthesize TGF-β which was determined by flow cyto-metry and western blotting, respectively. Furthermore, TGF-β efficiently increased regulatory T-cell (Treg) expansion and upregulated DC B7H1 and GITRL expression. TGF-β and the co-incubation of LLC cells, fibroblasts with DCs could augment the expression of B7H1 and GITRL molecules of DCs. The data presented here indicate that the B7H1 and GITRL molecules may play an important role in TGF-β-induced Treg expansion of lung cancer microenvironment.

  16. 42 CFR 460.76 - Transportation services.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Transportation services. 460.76 Section 460.76... ELDERLY (PACE) PACE Administrative Requirements § 460.76 Transportation services. (a) Safety, accessibility, and equipment. A PACE organization's transportation services must be safe, accessible, and...

  17. Biochemical signatures of in vitro radiation response in human lung, breast and prostate tumour cells observed with Raman spectroscopy

    International Nuclear Information System (INIS)

    Matthews, Q; Jirasek, A; Lum, J J; Brolo, A G

    2011-01-01

    This work applies noninvasive single-cell Raman spectroscopy (RS) and principal component analysis (PCA) to analyze and correlate radiation-induced biochemical changes in a panel of human tumour cell lines that vary by tissue of origin, p53 status and intrinsic radiosensitivity. Six human tumour cell lines, derived from prostate (DU145, PC3 and LNCaP), breast (MDA-MB-231 and MCF7) and lung (H460), were irradiated in vitro with single fractions (15, 30 or 50 Gy) of 6 MV photons. Remaining live cells were harvested for RS analysis at 0, 24, 48 and 72 h post-irradiation, along with unirradiated controls. Single-cell Raman spectra were acquired from 20 cells per sample utilizing a 785 nm excitation laser. All spectra (200 per cell line) were individually post-processed using established methods and the total data set for each cell line was analyzed with PCA using standard algorithms. One radiation-induced PCA component was detected for each cell line by identification of statistically significant changes in the PCA score distributions for irradiated samples, as compared to unirradiated samples, in the first 24-72 h post-irradiation. These RS response signatures arise from radiation-induced changes in cellular concentrations of aromatic amino acids, conformational protein structures and certain nucleic acid and lipid functional groups. Correlation analysis between the radiation-induced PCA components separates the cell lines into three distinct RS response categories: R1 (H460 and MCF7), R2 (MDA-MB-231 and PC3) and R3 (DU145 and LNCaP). These RS categories partially segregate according to radiosensitivity, as the R1 and R2 cell lines are radioresistant (SF 2 > 0.6) and the R3 cell lines are radiosensitive (SF 2 < 0.5). The R1 and R2 cell lines further segregate according to p53 gene status, corroborated by cell cycle analysis post-irradiation. Potential radiation-induced biochemical response mechanisms underlying our RS observations are proposed, such as (1) the

  18. 42 CFR 460.208 - Financial statements.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Financial statements. 460.208 Section 460.208... ELDERLY (PACE) Data Collection, Record Maintenance, and Reporting § 460.208 Financial statements. (a... must submit a certified financial statement that includes appropriate footnotes. (2) The financial...

  19. Dosage and cell line dependent inhibitory effect of bFGF supplement in human pluripotent stem cell culture on inactivated human mesenchymal stem cells.

    Science.gov (United States)

    Quang, Tara; Marquez, Maribel; Blanco, Giselle; Zhao, Yuanxiang

    2014-01-01

    Many different culture systems have been developed for expanding human pluripotent stem cells (hESCs and hiPSCs). In general, 4-10 ng/ml of bFGF is supplemented in culture media in feeder-dependent systems regardless of feeder cell types, whereas in feeder-free systems, up to 100 ng/ml of bFGF is required for maintaining long-term culture on various substrates. The amount of bFGF required in native hESCs growth niche is unclear. Here we report using inactivated adipose-derived human mesenchymal stem cells as feeder cells to examine long-term parallel cultures of two hESCs lines (H1 and H9) and one hiPSCs line (DF19-9-7T) in media supplemented with 0, 0.4 or 4 ng/ml of bFGF for up to 23 passages, as well as parallel cultures of H9 and DF19 in media supplemented with 4, 20 or 100 ng/ml bFGF for up to 13 passages for comparison. Across all cell lines tested, bFGF supplement demonstrated inhibitory effect over growth expansion, single cell colonization and recovery from freezing in a dosage dependent manner. In addition, bFGF exerted differential effects on different cell lines, inducing H1 and DF19 differentiation at 4 ng/ml or higher, while permitting long-term culture of H9 at the same concentrations with no apparent dosage effect. Pluripotency was confirmed for all cell lines cultured in 0, 0.4 or 4 ng/ml bFGF excluding H1-4 ng, as well as H9 cultured in 4, 20 and 100 ng/ml bFGF. However, DF19 demonstrated similar karyotypic abnormality in both 0 and 4 ng/ml bFGF media while H1 and H9 were karyotypically normal in 0 ng/ml bFGF after long-term culture. Our results indicate that exogenous bFGF exerts dosage and cell line dependent effect on human pluripotent stem cells cultured on mesenchymal stem cells, and implies optimal use of bFGF in hESCs/hiPSCs culture should be based on specific cell line and its culture system.

  20. A new in vitro screening system for anticancer drugs for the treatment of non-small cell lung cancer

    International Nuclear Information System (INIS)

    Hanauske, U.; Hanauske, A.R.; Clark, G.M.; Tsen, D.; Buchok, J.; Hoff, D.D. von

    1989-01-01

    We have evaluated a semiautomated radiometric assay (BACTEC 460 system) for screening of activity of anticancer drugs against human non-small cell lung cancer cell lines. Cells from seven cell lines were exposed to standard antineoplastic agents at four different concentrations using a 1-h incubation. Alpha 2-interferon was tested using a continuous incubation. In vitro drug activity was analyzed as a function of the clinically achievable serum concentration. Our results indicate that two cell lines (CALU-3, SK-MES-1) exhibit in vitro drug sensitivity patterns closest to those observed in clinical studies. These two cell lines might therefore be most useful for screening new anticancer compounds for activity against non-small cell lung cancer. The radiometric assay is a semiautomated system which has advantages over other, more time-consuming screening systems

  1. NCI calculations for understanding a physical phase transition in (C6H14N2)[Mn(H2O)6](SeO4)2

    Science.gov (United States)

    Naïli, Houcine; François, Michel; Norquist, Alexander J.; Rekik, Walid

    2017-12-01

    An organically templated manganese selenate, (C6H14N2)[Mn(H2O)6](SeO4)2, has been synthesized by slow evaporation and crystallographically characterized. The title compound crystallizes at room temperature in the monoclinic centrosymmetric space group P21/n, with the following unit cell parameters: a = 7.2373(4) Å; b = 12.5600(7) Å; c = 10.1945(7) Å; β = 91.155(4)°, V = 926.50(10) Å3and Z = 2. Its crystal structure is built of manganese(II) cations coordinated by six water molecules in octahedral geometry, disordered dabcodiium cations and selenate anions, resulting in an extensive hydrogen-bonding network. Differential scanning calorimetry (DSC) measurement indicated that the precursor undergoes a reversible phase transition at about 216 and 218 K during the cooling and heating processes respectively. Below this temperature the title compound is noncentrosymmetric with space group P21 and lattice parameters a = 7.2033(8) Å; b = 12.4981(13) Å; c = 10.0888(11) Å; β = 91.281(2)°, V = 908.04(17) Å3 and Z = 2. The disorder-order transformation of the C atoms of (C6H14N2)2+ cation may drive the structural phase transition. The low temperature phase obtained by breaking symmetry presents a fully ordered structure. The noncovalent interaction (NCI) method was used not only to locate, quantify, and visualize intermolecular interactions in the high and low temperature phases but also to confirm the phase transition detected by DSC measurement. The thermal decomposition of this new compound proceeds through four stages giving rise to the manganese oxide as final product at 850 °C.

  2. Characterization of novel non-clonal intrachromosomal rearrangements between the H4 and PTEN genes (H4/PTEN) in human thyroid cell lines and papillary thyroid cancer specimens

    International Nuclear Information System (INIS)

    Puxeddu, Efisio; Zhao Guisheng; Stringer, James R.; Medvedovic, Mario; Moretti, Sonia; Fagin, James A.

    2005-01-01

    The two main forms of RET rearrangement in papillary thyroid carcinomas (PTC) arise from intrachromosomal inversions fusing the tyrosine kinase domain of RET with either the H4 (RET/PTC1) or the ELE1/RFG genes (RET/PTC3). PTEN codes for a dual-specificity phosphatase and maps to chromosome 10q22-23. Germline mutations confer susceptibility to Cowden syndrome whereas somatic mutations or deletions are common in several sporadic human tumors. Decreased PTEN expression has been implicated in thyroid cancer development. We report the characterization of a new chromosome 10 rearrangement involving H4 and PTEN. The initial H4/PTEN rearrangement was discovered as a non-specific product of RT-PCR for RET/PTC1 in irradiated thyroid cell lines. Sequencing revealed a transcript consisting of exon 1 and 2 of H4 fused with exons 3-6 of PTEN. Nested RT-PCR with specific primers bracketing the breakpoints confirmed the H4/PTEN rearrangements in irradiated KAT-1 and KAT-50 cells. Additional H4/PTEN variants, generated by recombination of either exon 1 or exon 2 of H4 with exon 6 of PTEN, were found in non-irradiated KAK-1, KAT-50, ARO and NPA cells. Their origin through chromosomal recombination was confirmed by detection of the reciprocal PTEN/H4 product. H4/PTEN recombination was not a clonal event in any of the cell lines, as Southern blots with appropriate probes failed to demonstrate aberrant bands, and multicolor FISH of KAK1 cells with BAC probes for H4 and PTEN did not show a signal overlap in all cells. Based on PCR of serially diluted samples, the minimal frequency of spontaneous recombination between these loci was estimated to be approximately 1/10 6 cells. H4/PTEN products were found by nested RT-PCR in 4/14 normal thyroid tissues (28%) and 14/18 PTC (78%) (P < 0.01). H4/PTEN is another example of recombination involving the H4 locus, and points to the high susceptibility of thyroid cells to intrachromosomal gene rearrangements. As this also represents a plausible

  3. Characterization of novel non-clonal intrachromosomal rearrangements between the H4 and PTEN genes (H4/PTEN) in human thyroid cell lines and papillary thyroid cancer specimens

    Energy Technology Data Exchange (ETDEWEB)

    Puxeddu, Efisio [Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, PO Box 670547, Cincinnati, OH 45267-0547 (United States); Zhao Guisheng [Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, PO Box 670547, Cincinnati, OH 45267-0547 (United States); Stringer, James R. [Department of Molecular Genetics, University of Cincinnati College of Medicine, PO Box 670547, Cincinnati, OH 45267-0547 (United States); Medvedovic, Mario [Center for Biostatistic Service, University of Cincinnati College of Medicine, PO Box 670547, Cincinnati, OH 45267-0547 (United States); Moretti, Sonia [Dipartimento di Medicina Interna, Universita degli Studi di Perugia, Via E. dal Pozzo, Perugia 06126, (Italy); Fagin, James A. [Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, PO Box 670547, Cincinnati, OH 45267-0547 (United States)]. E-mail: james.fagin@uc.edu

    2005-02-15

    The two main forms of RET rearrangement in papillary thyroid carcinomas (PTC) arise from intrachromosomal inversions fusing the tyrosine kinase domain of RET with either the H4 (RET/PTC1) or the ELE1/RFG genes (RET/PTC3). PTEN codes for a dual-specificity phosphatase and maps to chromosome 10q22-23. Germline mutations confer susceptibility to Cowden syndrome whereas somatic mutations or deletions are common in several sporadic human tumors. Decreased PTEN expression has been implicated in thyroid cancer development. We report the characterization of a new chromosome 10 rearrangement involving H4 and PTEN. The initial H4/PTEN rearrangement was discovered as a non-specific product of RT-PCR for RET/PTC1 in irradiated thyroid cell lines. Sequencing revealed a transcript consisting of exon 1 and 2 of H4 fused with exons 3-6 of PTEN. Nested RT-PCR with specific primers bracketing the breakpoints confirmed the H4/PTEN rearrangements in irradiated KAT-1 and KAT-50 cells. Additional H4/PTEN variants, generated by recombination of either exon 1 or exon 2 of H4 with exon 6 of PTEN, were found in non-irradiated KAK-1, KAT-50, ARO and NPA cells. Their origin through chromosomal recombination was confirmed by detection of the reciprocal PTEN/H4 product. H4/PTEN recombination was not a clonal event in any of the cell lines, as Southern blots with appropriate probes failed to demonstrate aberrant bands, and multicolor FISH of KAK1 cells with BAC probes for H4 and PTEN did not show a signal overlap in all cells. Based on PCR of serially diluted samples, the minimal frequency of spontaneous recombination between these loci was estimated to be approximately 1/10{sup 6} cells. H4/PTEN products were found by nested RT-PCR in 4/14 normal thyroid tissues (28%) and 14/18 PTC (78%) (P < 0.01). H4/PTEN is another example of recombination involving the H4 locus, and points to the high susceptibility of thyroid cells to intrachromosomal gene rearrangements. As this also represents a

  4. 38 CFR 3.460 - Death pension.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Death pension. 3.460 Section 3.460 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation Apportionments § 3.460 Death pension. Death pension...

  5. 42 CFR 460.72 - Physical environment.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Physical environment. 460.72 Section 460.72 Public...) PACE Administrative Requirements § 460.72 Physical environment. (a) Space and equipment—(1) Safe design..., sanitary, functional, accessible, and comfortable environment for the delivery of services that protects...

  6. 42 CFR 460.74 - Infection control.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Infection control. 460.74 Section 460.74 Public...) PACE Administrative Requirements § 460.74 Infection control. (a) Standard procedures. The PACE organization must follow accepted policies and standard procedures with respect to infection control, including...

  7. HIV-1 replication in cell lines harboring INI1/hSNF5 mutations

    Directory of Open Access Journals (Sweden)

    Wu Xuhong

    2006-08-01

    Full Text Available Abstract Background INI1/hSNF5 is a cellular protein that directly interacts with HIV-1 integrase (IN. It is specifically incorporated into HIV-1 virions. A dominant negative mutant derived from INI1 inhibits HIV-1 replication. Recent studies indicate that INI1 is associated with pre-integration and reverse transcription complexes that are formed upon viral entry into the target cells. INI1 also is a tumor suppressor, biallelically deleted/mutated in malignant rhabdoid tumors. We have utilized cell lines derived from the rhabdoid tumors, MON and STA-WT1, that harbor either null or truncating mutations of INI1 respectively, to assess the effect of INI1 on HIV-1 replication. Results We found that while HIV-1 virions produced in 293T cells efficiently transduced MON and STA-WT1 cells, HIV-1 particle production was severely reduced in both of these cells. Reintroduction of INI1 into MON and STA-WT1 significantly enhanced the particle production in both cell lines. HIV-1 particles produced in MON cells were reduced for infectivity, while those produced in STA-WT1 were not. Further analysis indicated the presence of INI1 in those virions produced from STA-WT1 but not from those produced from MON cells. HIV-1 produced in MON cells were defective for synthesis of early and late reverse transcription products in the target cells. Furthermore, virions produced in MON cells were defective for exogenous reverse transcriptase activity carried out using exogenous template, primer and substrate. Conclusion Our results suggest that INI1-deficient cells exhibit reduced particle production that can be partly enhanced by re-introduction of INI1. Infectivity of HIV-1 produced in some but not all INI1 defective cells, is affected and this defect may correlate to the lack of INI1 and/or some other proteins in these virions. The block in early events of virion produced from MON cells appears to be at the stage of reverse transcription. These studies suggest that

  8. HIV-1 replication in cell lines harboring INI1/hSNF5 mutations.

    Science.gov (United States)

    Sorin, Masha; Yung, Eric; Wu, Xuhong; Kalpana, Ganjam V

    2006-08-31

    INI1/hSNF5 is a cellular protein that directly interacts with HIV-1 integrase (IN). It is specifically incorporated into HIV-1 virions. A dominant negative mutant derived from INI1 inhibits HIV-1 replication. Recent studies indicate that INI1 is associated with pre-integration and reverse transcription complexes that are formed upon viral entry into the target cells. INI1 also is a tumor suppressor, biallelically deleted/mutated in malignant rhabdoid tumors. We have utilized cell lines derived from the rhabdoid tumors, MON and STA-WT1, that harbor either null or truncating mutations of INI1 respectively, to assess the effect of INI1 on HIV-1 replication. We found that while HIV-1 virions produced in 293T cells efficiently transduced MON and STA-WT1 cells, HIV-1 particle production was severely reduced in both of these cells. Reintroduction of INI1 into MON and STA-WT1 significantly enhanced the particle production in both cell lines. HIV-1 particles produced in MON cells were reduced for infectivity, while those produced in STA-WT1 were not. Further analysis indicated the presence of INI1 in those virions produced from STA-WT1 but not from those produced from MON cells. HIV-1 produced in MON cells were defective for synthesis of early and late reverse transcription products in the target cells. Furthermore, virions produced in MON cells were defective for exogenous reverse transcriptase activity carried out using exogenous template, primer and substrate. Our results suggest that INI1-deficient cells exhibit reduced particle production that can be partly enhanced by re-introduction of INI1. Infectivity of HIV-1 produced in some but not all INI1 defective cells, is affected and this defect may correlate to the lack of INI1 and/or some other proteins in these virions. The block in early events of virion produced from MON cells appears to be at the stage of reverse transcription. These studies suggest that presence of INI1 or some other host factor in virions and

  9. 42 CFR 460.182 - Medicaid payment.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Medicaid payment. 460.182 Section 460.182 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...) Payment § 460.182 Medicaid payment. (a) Under a PACE program agreement, the State administering agency...

  10. Cell cycle dependent RRM2 may serve as proliferation marker and pharmaceutical target in adrenocortical cancer.

    Science.gov (United States)

    Grolmusz, Vince Kornél; Karászi, Katalin; Micsik, Tamás; Tóth, Eszter Angéla; Mészáros, Katalin; Karvaly, Gellért; Barna, Gábor; Szabó, Péter Márton; Baghy, Kornélia; Matkó, János; Kovalszky, Ilona; Tóth, Miklós; Rácz, Károly; Igaz, Péter; Patócs, Attila

    2016-01-01

    Adrenocortical cancer (ACC) is a rare, but agressive malignancy with poor prognosis. Histopathological diagnosis is challenging and pharmacological options for treatment are limited. By the comparative reanalysis of the transcriptional malignancy signature with the cell cycle dependent transcriptional program of ACC, we aimed to identify novel biomarkers which may be used in the histopathological diagnosis and for the prediction of therapeutical response of ACC. Comparative reanalysis of publicly available microarray datasets included three earlier studies comparing transcriptional differences between ACC and benign adrenocortical adenoma (ACA) and one study presenting the cell cycle dependent gene expressional program of human ACC cell line NCI-H295R. Immunohistochemical analysis was performed on ACC samples. In vitro effects of antineoplastic drugs including gemcitabine, mitotane and 9-cis-retinoic acid alone and in combination were tested in the NCI-H295R adrenocortical cell line. Upon the comparative reanalysis, ribonucleotide reductase subunit 2 (RRM2), responsible for the ribonucleotide dezoxyribonucleotide conversion during the S phase of the cell cycle has been validated as cell cycle dependently expressed. Moreover, its expression was associated with the malignancy signature, as well. Immunohistochemical analysis of RRM2 revealed a strong correlation with Ki67 index in ACC. Among the antiproliferative effects of the investigated compounds, gemcitabine showed a strong inhibition of proliferation and an increase of apoptotic events. Additionally, RRM2 has been upregulated upon gemcitabine treatment. Upon our results, RRM2 might be used as a proliferation marker in ACC. RRM2 upregulation upon gemcitabine treatment might contribute to an emerging chemoresistance against gemcitabine, which is in line with its limited therapeutical efficacy in ACC, and which should be overcome for successful clinical applications.

  11. 42 CFR 460.152 - Enrollment process.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Enrollment process. 460.152 Section 460.152 Public...) Participant Enrollment and Disenrollment § 460.152 Enrollment process. (a) Intake process. Intake is an intensive process during which PACE staff members make one or more visits to a potential participant's place...

  12. In vitro synergistic antitumor efficacy of sequentially combined chemotherapy/icotinib in non‑small cell lung cancer cell lines.

    Science.gov (United States)

    Wang, Min-Cong; Liang, Xuan; Liu, Zhi-Yan; Cui, Jie; Liu, Ying; Jing, Li; Jiang, Li-Li; Ma, Jie-Qun; Han, Li-Li; Guo, Qian-Qian; Yang, Cheng-Cheng; Wang, Jing; Wu, Tao; Nan, Ke-Jun; Yao, Yu

    2015-01-01

    The concurrent administration of chemotherapy and epidermal growth factor receptor‑tyrosine kinase inhibitors (EGFR‑TKIs) has previously produced a negative interaction and failed to confer a survival benefit to non‑small cell lung cancer (NSCLC) patients compared with first‑line cytotoxic chemotherapy. The present study aimed to investigate the optimal schedule of the combined treatment of cisplatin/paclitaxel and icotinib in NSCLC cell lines and clarify the underlying mechanisms. HCC827, H1975, H1299 and A549 human NSCLC cell lines with wild‑type and mutant EGFR genes were used as in vitro models to define the differential effects of various schedules of cisplatin/paclitaxel with icotinib treatments on cell growth, proliferation, cell cycle distribution, apoptosis, and EGFR signaling pathway. Sequence‑dependent antiproliferative effects differed among the four NSCLC cell lines, and were not associated with EGFR mutation, constitutive expression levels of EGFR or downstream signaling molecules. The antiproliferative effect of cisplatin plus paclitaxel followed by icotinib was superior to that of cisplatin or paclitaxel followed by icotinib in the HCC827, H1975, H1299 and A549 cell lines, and induced more cell apoptosis and G0/G1 phase arrest. Cisplatin and paclitaxel significantly increased the expression of EGFR phosphorylation in the HCC827 cell line. However, only paclitaxel increased the expression of EGFR phosphorylation in the H1975 cell line. Cisplatin/paclitaxel followed by icotinib influenced the expression of p‑EGFR and p‑AKT, although the expression of p‑ERK1/2 remained unchanged. The results suggest that the optimal schedule of the combined treatment of cisplatin/paclitaxel and icotinib differed among the NSCLC cell lines. The results also provide molecular evidence to support clinical treatment strategies for NSCLC patients.

  13. Hypoxic cell turnover in different solid tumor lines

    International Nuclear Information System (INIS)

    Ljungkvist, Anna S.E.; Bussink, Johan; Kaanders, Johannes H.A.M.; Rijken, Paulus F.J.W.; Begg, Adrian C.; Raleigh, James A.; Kogel, Albert J. van der

    2005-01-01

    Purpose: Most solid tumors contain hypoxic cells, and the amount of tumor hypoxia has been shown to have a negative impact on the outcome of radiotherapy. The efficacy of combined modality treatments depends both on the sequence and timing of the treatments. Hypoxic cell turnover in tumors may be important for optimal scheduling of combined modality treatments, especially when hypoxic cell targeting is involved. Methods and Materials: Previously we have shown that a double bioreductive hypoxic marker assay could be used to detect changes of tumor hypoxia in relation to the tumor vasculature after carbogen and hydralazine treatments. This assay was used in the current study to establish the turnover rate of hypoxic cells in three different tumor models. The first hypoxic marker, pimonidazole, was administered at variable times before tumor harvest, and the second hypoxic marker, CCI-103F, was injected at a fixed time before harvest. Hypoxic cell turnover was defined as loss of pimonidazole (first marker) relative to CCI-103F (second marker). Results: The half-life of hypoxic cell turnover was 17 h in the murine C38 colon carcinoma line, 23 h and 49 h in the human xenograft lines MEC82 and SCCNij3, respectively. Within 24 h, loss of pimonidazole-stained areas in C38 and MEC82 occurred concurrent with the appearance of pimonidazole positive cell debris in necrotic regions. In C38 and MEC82, most of the hypoxic cells had disappeared after 48 h, whereas in SCCNij3, viable cells that had been labeled with pimonidazole were still observed after 5 days. Conclusions: The present study demonstrates that the double hypoxia marker assay can be used to study changes in both the proportion of hypoxic tumor cells and their lifespan at the same time. The present study shows that large differences in hypoxic cell turnover rates may exist among tumor lines, with half-lives ranging from 17-49 h

  14. NCI collaborates with Multiple Myeloma Research Foundation

    Science.gov (United States)

    The National Cancer Institute (NCI) announced a collaboration with the Multiple Myeloma Research Foundation (MMRF) to incorporate MMRF's wealth of genomic and clinical data on the disease into the NCI Genomic Data Commons (GDC), a publicly available datab

  15. Jizanpeptins, Cyanobacterial Protease Inhibitors from a Symploca sp. Cyanobacterium Collected in the Red Sea.

    Science.gov (United States)

    Gallegos, David A; Saurí, Josep; Cohen, Ryan D; Wan, Xuemei; Videau, Patrick; Vallota-Eastman, Alec O; Shaala, Lamiaa A; Youssef, Diaa T A; Williamson, R Thomas; Martin, Gary E; Philmus, Benjamin; Sikora, Aleksandra E; Ishmael, Jane E; McPhail, Kerry L

    2018-05-29

    Jizanpeptins A-E (1-5) are micropeptin depsipeptides isolated from a Red Sea specimen of a Symploca sp. cyanobacterium. The planar structures of the jizanpeptins were established using NMR spectroscopy and mass spectrometry and contain 3-amino-6-hydroxy-2-piperidone (Ahp) as one of eight residues in a typical micropeptin motif, as well as a side chain terminal glyceric acid sulfate moiety. The absolute configurations of the jizanpeptins were assigned using a combination of Marfey's methodology and chiral-phase HPLC analysis of hydrolysis products compared to commercial and synthesized standards. Jizanpeptins A-E showed specific inhibition of the serine protease trypsin (IC 50 = 72 nM to 1 μM) compared to chymotrypsin (IC 50 = 1.4 to >10 μM) in vitro and were not overtly cytotoxic to HeLa cervical or NCI-H460 lung cancer cell lines at micromolar concentrations.

  16. Polyoxygenated Cyclohexenoids with Promising α-Glycosidase Inhibitory Activity Produced by Phomopsis sp. YE3250, an Endophytic Fungus Derived from Paeonia delavayi.

    Science.gov (United States)

    Huang, Rong; Jiang, Bo-Guang; Li, Xiao-Nian; Wang, Ya-Ting; Liu, Si-Si; Zheng, Kai-Xuan; He, Jian; Wu, Shao-Hua

    2018-02-07

    Seven new polyoxygenated cyclohexenoids, namely, phomopoxides A-G (1-7), were isolated from the fermentation broth extract of an endophytic fungal strain Phomopsis sp. YE3250 from the medicinal plant Paeonia delavayi Franch. The structures of these compounds were established by spectroscopic interpretation. The absolute configurations of compounds 1 and 4 were confirmed by X-ray crystallographic analysis and chemical derivative approach. All isolated compounds showed weak cytotoxic activities toward three human tumor cell lines (Hela, MCF-7, and NCI-H460) and weak antifungal activities against five pathogenic fungi (Candida albicans, Aspergillus niger, Pyricularia oryzae, Fusarium avenaceum, and Hormodendrum compactum). In addition, compounds 1-7 showed a promising α-glycosidase inhibitory activity with IC 50 values of 1.47, 1.55, 1.83, 2.76, 2.88, 3.16, and 2.94 mM, respectively, as compared with a positive control of acarbose (IC 50 = 1.22 mM).

  17. 42 CFR 460.100 - Emergency care.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Emergency care. 460.100 Section 460.100 Public...) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PACE Services § 460.100 Emergency care. (a) Written plan. A PACE organization must establish and...

  18. 42 CFR 460.62 - Governing body.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Governing body. 460.62 Section 460.62 Public Health... Administrative Requirements § 460.62 Governing body. (a) Governing body. A PACE organization must be operating under the control of an identifiable governing body (for example, a board of directors) or a designated...

  19. Chemical composition of the essential oil from the leaves of Anaxagorea brevipes (Annonaceae) and evaluation of its bioactivity.

    Science.gov (United States)

    de Alencar, Danielle Cardoso; Pinheiro, Maria Lúcia Belém; Pereira, José Lamak da Silva; de Carvalho, João Ernesto; Campos, Francinete Ramos; Serain, Alessandra Freitas; Tirico, Ricardo Brunelli; Hernández-Tasco, Alvaro José; Costa, Emmanoel Vilaça; Salvador, Marcos José

    2016-01-01

    The essential oil obtained by hydrodistillation from leaves of Anaxagorea brevipes was analysed by gas chromatography fitted with a flame ionisation detector (GC-FID) and coupled to mass spectrometry (GC-MS). Thirty one components were identified, representing around 75.7% of total oil. The major components were β-eudesmol (13.16%), α-eudesmol (13.05%), γ-eudesmol (7.54%), guaiol (5.12%), caryophyllene oxide (4.18%) and β-bisabolene (4.10%). The essential oil showed antimicrobial activity against Gram-positive bacteria and yeast with the MIC values between 25.0 and 100 μg/mL. The highest antiproliferative activity was observed for the oil against MCF-7 (breast, TGI = 12.8 μg/mL), NCI-H460 (lung, TGI = 13.0 μg/mL) and PC-3 (prostate, TGI = 9.6 μg/mL) cell lines, while against no cancer cell line HaCat (keratinocyte) the TGI was 38.8 μg/mL. The oil exhibited a small antioxidant activity assessed through ORAC-FL assay (517 μmol TE/g). This is the first report regarding the chemical composition and bioactivity of A. brevipes essential oil.

  20. 16 CFR 460.22 - Tax claims.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Tax claims. 460.22 Section 460.22 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.22 Tax claims. Do not say or imply that your product qualifies for a tax benefit unless it is true. ...

  1. Evaluation of low-dose proton beam radiation efficiency in MIA PaCa-2 pancreatic cancer cell line vitality and H2AX formation

    Directory of Open Access Journals (Sweden)

    Aušra Liubavičiūtė

    2015-11-01

    Conclusions: Our data demonstrate that low-doses proton beam irradiation had an effect on MIA PaCa-2 pancreatic carcinoma cell line. Full extent of irradiation had an impact only 24 h postirradiation, triggering DNA arrested cell cycle in G1/0 phase. Formed DNA DSBs were found to be repaired via the NHEJ pathway mechanism within 72 h. Unsuccessful repaired DSBs induced apoptotic cell death. After 72 h reparation processes were completed, and cell cycle was released from arrest in G1/0 phase.

  2. Acetyl-CoA Carboxylase-α Inhibitor TOFA Induces Human Cancer Cell Apoptosis

    Science.gov (United States)

    Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-fang; Cao, Deliang

    2009-01-01

    Acetyl-CoA carboxylase-α (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC50 at approximately 5.0, 5.0, and 4.5 μg/ml, respectively. TOFA at 1.0–20.0 μg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 μM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis. PMID:19450551

  3. Acetyl-CoA carboxylase-alpha inhibitor TOFA induces human cancer cell apoptosis.

    Science.gov (United States)

    Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-Fang; Cao, Deliang

    2009-07-31

    Acetyl-CoA carboxylase-alpha (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC(50) at approximately 5.0, 5.0, and 4.5 microg/ml, respectively. TOFA at 1.0-20.0 microg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 microM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis.

  4. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    International Nuclear Information System (INIS)

    Huang, Shang-Lang; Chao, Chuck C.-K.

    2015-01-01

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug

  5. Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)

    2015-06-16

    A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.

  6. In vitro culture and characterization of human lung cancer circulating tumor cells isolated by size exclusion from an orthotopic nude-mouse model expressing fluorescent protein.

    Science.gov (United States)

    Kolostova, Katarina; Zhang, Yong; Hoffman, Robert M; Bobek, Vladimir

    2014-09-01

    In the present study, we demonstrate an animal model and recently introduced size-based exclusion method for circulating tumor cells (CTCs) isolation. The methodology enables subsequent in vitro CTC-culture and characterization. Human lung cancer cell line H460, expressing red fluorescent protein (H460-RFP), was orthotopically implanted in nude mice. CTCs were isolated by a size-based filtration method and successfully cultured in vitro on the separating membrane (MetaCell®), analyzed by means of time-lapse imaging. The cultured CTCs were heterogeneous in size and morphology even though they originated from a single tumor. The outer CTC-membranes were blebbing in general. Abnormal mitosis resulting in three daughter cells was frequently observed. The expression of RFP ensured that the CTCs originated from lung tumor. These readily isolatable, identifiable and cultivable CTCs can be used to characterize individual patient cancers and for screening of more effective treatment.

  7. No Relationship between Embryo Morphology and Successful Derivation of Human Embryonic Stem Cell Lines

    Science.gov (United States)

    Ström, Susanne; Rodriguez-Wallberg, Kenny; Holm, Frida; Bergström, Rosita; Eklund, Linda; Strömberg, Anne-Marie; Hovatta, Outi

    2010-01-01

    Background The large number (30) of permanent human embryonic stem cell (hESC) lines and additional 29 which did not continue growing, in our laboratory at Karolinska Institutet have given us a possibility to analyse the relationship between embryo morphology and the success of derivation of hESC lines. The derivation method has been improved during the period 2002–2009, towards fewer xeno-components. Embryo quality is important as regards the likelihood of pregnancy, but there is little information regarding likelihood of stem cell derivation. Methods We evaluated the relationship of pronuclear zygote stage, the score based on embryo morphology and developmental rate at cleavage state, and the morphology of the blastocyst at the time of donation to stem cell research, to see how they correlated to successful establishment of new hESC lines. Results Derivation of hESC lines succeeded from poor quality and good quality embryos in the same extent. In several blastocysts, no real inner cell mass (ICM) was seen, but permanent well growing hESC lines could be established. One tripronuclear (3PN) zygote, which developed to blastocyst stage, gave origin to a karyotypically normal hESC line. Conclusion Even very poor quality embryos with few cells in the ICM can give origin to hESC lines. PMID:21217828

  8. Assessment of cytotoxicity of Portulaca oleracea Linn. against human colon adenocarcinoma and vero cell line

    Science.gov (United States)

    Mali, Prashant Y.

    2015-01-01

    Background: Portulaca oleracea Linn. (Portulacaceae) is commonly known as purslane in English. In traditional system it is used to cure diarrhea, dysentery, leprosy, ulcers, asthma, and piles, reduce small tumors and inflammations. Aim: To assess cytotoxic potential of chloroform extract of P. oleracea whole plant against human colon adenocarcinoma (HCT-15) and normal (Vero) cell line. Materials and Methods: Characterization of chloroform extract of P. oleracea by Fourier transform infrared (FTIR) spectroscopy was performed. Cytotoxicity (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) assay was used for assessment of cytotoxic potential of chloroform extract of P. oleracea. The concentrations of 1000–0.05 μg/ml were used in the experiment. Doxorubicin was considered as standard reference drug. Results: FTIR spectrum showed the peak at 1019.52 and 1396.21 center. The 50% cell growth inhibition (IC50) of chloroform extract of P. oleracea and doxorubicin was 1132.02 μg/ml and 460.13 μg/ml against human colon adenocarcinoma and 767.60 μg/ml and 2392.71 μg/ml against Vero cell line, respectively. Conclusion: Chloroform extract of P. oleracea whole plant was less efficient or does not have cytotoxic activity against human colon adenocarcinoma cell line. It was not safe to normal Vero cell line. But, there is a need to isolate, identify, and confirm the phytoconstituents present in extract by sophisticated analytical techniques. PMID:27833374

  9. Widespread molecular patterns associated with drug sensitivity in breast cancer cell lines, with implications for human tumors.

    Directory of Open Access Journals (Sweden)

    Chad J Creighton

    Full Text Available BACKGROUND: Recent landmark studies have profiled cancer cell lines for molecular features, along with measuring the corresponding growth inhibitory effects for specific drug compounds. These data present a tool for determining which subsets of human cancer might be more responsive to particular drugs. To this end, the NCI-DREAM-sponsored DREAM7: Drug Sensitivity Prediction Challenge (sub-challenge 1 set out to predict the sensitivities of 18 breast cancer cell lines to 31 previously untested compounds, on the basis of molecular profiling data and a training subset of cell lines. METHODS AND RESULTS: With 47 teams submitting blinded predictions, team Creighton scored third in terms of overall accuracy. Team Creighton's method was simple and straightforward, incorporated multiple expression data types (RNA-seq, gene array, RPPA, and incorporated all profiled features (not only the "best" predictive ones. As an extension of the approach, cell line data, from public datasets of expression profiling coupled with drug sensitivities (Barretina, Garnett, Heiser were used to "predict" the drug sensitivities in human breast tumors (using data from The Cancer Genome Atlas. Drug sensitivity correlations within human breast tumors showed differences by expression-based subtype, with many associations in line with the expected (e.g. Lapatinib sensitivity in HER2-enriched cancers and others inviting further study (e.g. relative resistance to PI3K inhibitors in basal-like cancers. CONCLUSIONS: Molecular patterns associated with drug sensitivity are widespread, with potentially hundreds of genes that could be incorporated into making predictions, as well as offering biological clues as to the mechanisms involved. Applying the cell line patterns to human tumor data may help generate hypotheses on what tumor subsets might be more responsive to therapies, where multiple cell line datasets representing various drugs may be used, in order to assess consistency of

  10. Spatial patterns of FUS-immunoreactive neuronal cytoplasmic inclusions (NCI) in neuronal intermediate filament inclusion disease (NIFID).

    Science.gov (United States)

    Armstrong, Richard A; Gearing, Marla; Bigio, Eileen H; Cruz-Sanchez, Felix F; Duyckaerts, Charles; Mackenzie, Ian R A; Perry, Robert H; Skullerud, Kari; Yokoo, Hideaki; Cairns, Nigel J

    2011-11-01

    Neuronal intermediate filament inclusion disease (NIFID), a rare form of frontotemporal lobar degeneration (FTLD), is characterized neuropathologically by focal atrophy of the frontal and temporal lobes, neuronal loss, gliosis, and neuronal cytoplasmic inclusions (NCI) containing epitopes of ubiquitin and neuronal intermediate filament (IF) proteins. Recently, the 'fused in sarcoma' (FUS) protein (encoded by the FUS gene) has been shown to be a component of the inclusions of NIFID. To further characterize FUS proteinopathy in NIFID, we studied the spatial patterns of the FUS-immunoreactive NCI in frontal and temporal cortex of 10 cases. In the cerebral cortex, sectors CA1/2 of the hippocampus, and the dentate gyrus (DG), the FUS-immunoreactive NCI were frequently clustered and the clusters were regularly distributed parallel to the tissue boundary. In a proportion of cortical gyri, cluster size of the NCI approximated to those of the columns of cells was associated with the cortico-cortical projections. There were no significant differences in the frequency of different types of spatial patterns with disease duration or disease stage. Clusters of NCI in the upper and lower cortex were significantly larger using FUS compared with phosphorylated, neurofilament heavy polypeptide (NEFH) or α-internexin (INA) immunohistochemistry (IHC). We concluded: (1) FUS-immunoreactive NCI exhibit similar spatial patterns to analogous inclusions in the tauopathies and synucleinopathies, (2) clusters of FUS-immunoreactive NCI are larger than those revealed by NEFH or ΙΝΑ, and (3) the spatial patterns of the FUS-immunoreactive NCI suggest the degeneration of the cortico-cortical projections in NIFID.

  11. A human beta cell line with drug inducible excision of immortalizing transgenes

    Science.gov (United States)

    Benazra, Marion; Lecomte, Marie-José; Colace, Claire; Müller, Andreas; Machado, Cécile; Pechberty, Severine; Bricout-Neveu, Emilie; Grenier-Godard, Maud; Solimena, Michele; Scharfmann, Raphaël; Czernichow, Paul; Ravassard, Philippe

    2015-01-01

    Objectives Access to immortalized human pancreatic beta cell lines that are phenotypically close to genuine adult beta cells, represent a major tool to better understand human beta cell physiology and develop new therapeutics for Diabetes. Here we derived a new conditionally immortalized human beta cell line, EndoC-βH3 in which immortalizing transgene can be efficiently removed by simple addition of tamoxifen. Methods We used lentiviral mediated gene transfer to stably integrate a tamoxifen inducible form of CRE (CRE-ERT2) into the recently developed conditionally immortalized EndoC βH2 line. The resulting EndoC-βH3 line was characterized before and after tamoxifen treatment for cell proliferation, insulin content and insulin secretion. Results We showed that EndoC-βH3 expressing CRE-ERT2 can be massively amplified in culture. We established an optimized tamoxifen treatment to efficiently excise the immortalizing transgenes resulting in proliferation arrest. In addition, insulin expression raised by 12 fold and insulin content increased by 23 fold reaching 2 μg of insulin per million cells. Such massive increase was accompanied by enhanced insulin secretion upon glucose stimulation. We further observed that tamoxifen treated cells maintained a stable function for 5 weeks in culture. Conclusions EndoC βH3 cell line represents a powerful tool that allows, using a simple and efficient procedure, the massive production of functional non-proliferative human beta cells. Such cells are close to genuine human beta cells and maintain a stable phenotype for 5 weeks in culture. PMID:26909308

  12. Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.

    Science.gov (United States)

    Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C

    2010-05-01

    Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.

  13. Lung cancer radiosensitization by CMNa in vitro and in vivo

    International Nuclear Information System (INIS)

    Zhang Xia; Ouyang Xienong; Ji Hongbing; Chen Zhonghua; Yang Rujun

    2005-01-01

    Objective: To probe into the radiosensitization effect of CMNa on lung tumor cell lines after γ-irradiation combined with γ-knife to treat patients suffering from lung cancer. Methods: 1. Cells of small cell lung cancer cell line NCI-H446 and non-small cell lung cancer cell line NCI-H596 irradiated with 60 Co γ-rays combined with or without CMNa were counted using trypan blue exclusion methods, and cell survival rate curves were depicted. 2. Patients suffering from lung cancer at different clinical stages were treated using γ-knife combined with or without CMNa, and the curative effect was evaluated 6 weeks after one cycle of treatment. Results: CMNa could significantly increase the sensitivity of lung cancer cell lines to γ-irradiation. Curative effect increased significantly by γ-knife treatment combined with CMNa i. e., the CR+PR rates for these two groups were 47.22% and 37.67% separately (P 0.05). Conclusion: CMNa could significantly increase the radiation sensitivity of lung cancer cell line cells in vitro and tumors in vivo, therefore, it could be used as a radiosensitization agent in clinical treatment of lung cancer. (authors)

  14. Change of cell cycle arrest of tumor cell lines after 60Co γ-irradiation

    International Nuclear Information System (INIS)

    Tang Yi; Liu Wenli; Zhou Jianfeng; Gao Qinglei; Wu Jianhong

    2003-01-01

    Objective: To observe the cell cycle arrest changes in peripheral blood mononuclear cells (PBMNCs) of normal persons and several kinds of tumor cell lines after 60 Co γ-irradiation. Methods: PBMNCs of normal persons, HL-60, K562, SiHA and 113 tumor cell lines were irradiated with 60 Co γ-rays at the absorbed doses of 6, 10,15 Gy. Cell cycles changes were checked 6, 12, 24, 48 and 60 h after the irradiation. Results: A stasis state was observed in normal person PBMNCs, 95 percents of which were in G 1 phase, and they still remained stasis after the irradiation. Except the 113 cell line manifesting G 1 phase arrest, all other tumor cell lines showed G 2 /M phase arrest after irradiation. The radiation sensitivity of HL-60 was higher than that of SiHA cell line. Conclusion: Different cell lines have different cell cycle arrest reaction to radiation and their radiation sensitivity are also different

  15. Investigating the influence of respiratory motion on the radiation induced bystander effect in modulated radiotherapy

    Science.gov (United States)

    Cole, Aidan J.; McGarry, Conor K.; Butterworth, Karl T.; McMahon, Stephen J.; Hounsell, Alan R.; Prise, Kevin M.; O'Sullivan, Joe M.

    2013-12-01

    Respiratory motion introduces complex spatio-temporal variations in the dosimetry of radiotherapy and may contribute towards uncertainties in radiotherapy planning. This study investigates the potential radiobiological implications occurring due to tumour motion in areas of geometric miss in lung cancer radiotherapy. A bespoke phantom and motor-driven platform to replicate respiratory motion and study the consequences on tumour cell survival in vitro was constructed. Human non-small-cell lung cancer cell lines H460 and H1299 were irradiated in modulated radiotherapy configurations in the presence and absence of respiratory motion. Clonogenic survival was calculated for irradiated and shielded regions. Direction of motion, replication of dosimetry by multi-leaf collimator (MLC) manipulation and oscillating lead shielding were investigated to confirm differences in cell survival. Respiratory motion was shown to significantly increase survival for out-of-field regions for H460/H1299 cell lines when compared with static irradiation (p < 0.001). Significantly higher survival was found in the in-field region for the H460 cell line (p < 0.030). Oscillating lead shielding also produced these significant differences. Respiratory motion and oscillatory delivery of radiation dose to human tumour cells has a significant impact on in- and out-of-field survival in the presence of non-uniform irradiation in this in vitro set-up. This may have important radiobiological consequences for modulated radiotherapy in lung cancer.

  16. BAD overexpression inhibits cell growth and induces apoptosis via mitochondrial-dependent pathway in non-small cell lung cancer.

    Science.gov (United States)

    Jiang, Li; Luo, Man; Liu, Dan; Chen, Bojiang; Zhang, Wen; Mai, Lin; Zeng, Jing; Huang, Na; Huang, Yi; Mo, Xianming; Li, Weimin

    2013-06-01

    The pro-apoptotic Bcl-2 protein BAD initiated apoptosis in human cells and has been identified as a prognostic marker in non-small cell lung cancer (NSCLC). In this study, we aimed to explore the functions of BAD in NSCLC. Overexpression of BAD was performed by transfecting different NSCLC cell lines with wild-type BAD. Cell proliferation, cell cycle, apoptosis, and invasion were characterized in vitro. Tumorigenicity was analyzed in vivo. Western blot was performed to determine the effects of BAD overexpression on the Bcl-2 family proteins and apoptosis-related proteins. Overexpression of BAD significantly inhibited cell proliferation in H1299, H292, and SPC-A1 but not in SK-MES-1 and H460 cell lines in vitro. BAD overexpression also reduced the tumorigenicity of H1299/SPC-A1 cell in vivo. However, no appreciable effects on cell cycle distribution and invasion were observed in all these cell lines. BAD overexpression also induced apoptosis in all cell types, in which process expression of mitochondrial cytochrom c (cyto-c) and caspase 3 were increased, whereas Bcl-xl, Bcl-2, Bax and caspase 8 expressions did not changed. These findings indicated that a mitochondrial pathway, in which process cyto-c was released from mitochondrial to activate caspase 3, was involved in BAD overexpression-mediated apoptosis. Our data suggested that increased expression of BAD enhance apoptosis and has negative influence on cell proliferation and tumor growth in NSCLC. Bad is a new potential target for tumor interventions.

  17. A molecular targeting against nuclear factor-κB, as a chemotherapeutic approach for human malignant mesothelioma

    International Nuclear Information System (INIS)

    Nishikawa, Sho; Tanaka, Akane; Matsuda, Akira; Oida, Kumiko; Jang, Hyosun; Jung, Kyungsook; Amagai, Yosuke; Ahn, Ginae; Okamoto, Noriko; Ishizaka, Saori; Matsuda, Hiroshi

    2014-01-01

    Chronic inflammation due to the absorption of asbestos is an important cause of mesothelioma. Although the increased prevalence of mesothelioma is a serious problem, the development of effective chemotherapeutic agents remains incomplete. As the nuclear factor-κB (NF-κB) pathway contributes to malignant transformation of various types of cells, we explored NF-κB activity in three different pathological types of malignant mesothelioma cells, and evaluated the therapeutic potential of a recently reported NF-κB inhibitor, IMD-0354. NF-κB was constantly activated in MSTO-211H, NCI-H28, and NCI-H2052 cells, and the proliferation of these cell lines was inhibited by IMD-0354. D-type cyclins were effectively suppressed in mixed tissue type MSTO-211H, leading to cell cycle arrest at sub G 1 /G 1 phase. IMD-0354 reduced cyclin D3 in both epithelial tissue type NCI-H28 and sarcomatoid tissue type NCI-H2052. In a sphere formation assay, IMD-0354 effectively decreased the number and diameter of MSTO-211H spheres. Preincubation of MSTO-211H cells with IMD-0354 delayed tumor formation in transplanted immunodeficient mice. Furthermore, administration of IMD-0354 markedly rescued the survival rate of mice that received intrathoracic injections of MSTO-211H cells. These results indicate that a targeted drug against NF-κB might have therapeutic efficacy in the treatment of human malignant mesothelioma

  18. Cytotoxic effects of local anesthesia through lidocaine/ropivacaine on human melanoma cell lines

    Directory of Open Access Journals (Sweden)

    Ding-Kun Kang

    Full Text Available Abstract Background: Local anesthetics (LAs are generally considered as safe, but cytotoxicity has been reported for several local anesthetics used in humans, which is not well investigated. In the present study, the cytotoxicity of lidocaine, ropivacaine and the combination of lidocaine and ropivacaine were evaluated on human melanoma cell lines. Melphalan, a nitrogen mustard alkylating agent, was used as a control agent for comparison of cytotoxic activity. Methods: Melanoma cell lines, A375 and Hs294T, were exposed to 1 h to different concentrations of above agents. Cell-viability after exposure was determined by flow cytometry. Results: Investigated LAs showed detrimental cytotoxicity on studied melanoma cell lines in time- (p < 0.001, concentration- (p < 0.001, and agent dependant. In both A375 and Hs294T cell lines, minimum cell viability rates were found after 72 h of exposure to these agents. Lidocaine 2% caused a reduction of vital cells to 10% ± 2% and 14% ± 2% in A375 and Hs294T, respectively after 72 h of exposure. Ropivacaine 0.75% after 72 h reduced viable cells to 15% ± 3% and 25% ± 3% in A375 and Hs294T, respectively. Minimum cell viability after 72 h exposure to the combination was 10% ± 2% and 18% ± 2% in A375 and Hs294T, respectively. Minimum cell viability after 72 h exposure to melphalan was 8% ± 1% and 12% ± 2%, in A375 and Hs294T, respectively. Conclusion: LAs have cytotoxic activity on human melanoma cell lines in a time-, concentration- and agent-dependant manner. Apoptosis in the cell lines was mediated through activity of caspases-3 and caspases-8.

  19. 14 CFR 460.53 - Security.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Security. 460.53 Section 460.53 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF....53 Security. An operator must implement security requirements to prevent any space flight participant...

  20. Predicting skin sensitization potential and inter-laboratory reproducibility of a human Cell Line Activation Test (h-CLAT) in the European Cosmetics Association (COLIPA) ring trials.

    Science.gov (United States)

    Sakaguchi, Hitoshi; Ryan, Cindy; Ovigne, Jean-Marc; Schroeder, Klaus R; Ashikaga, Takao

    2010-09-01

    Regulatory policies in Europe prohibited the testing of cosmetic ingredients in animals for a number of toxicological endpoints. Currently no validated non-animal test methods exist for skin sensitization. Evaluation of changes in cell surface marker expression in dendritic cell (DC)-surrogate cell lines represents one non-animal approach. The human Cell Line Activation Test (h-CLAT) examines the level of CD86 and CD54 expression on the surface of THP-1 cells, a human monocytic leukemia cell line, following 24h of chemical exposure. To examine protocol transferability, between-lab reproducibility, and predictive capacity, the h-CLAT has been evaluated by five independent laboratories in several ring trials (RTs) coordinated by the European Cosmetics Association (COLIPA). The results of the first and second RTs demonstrated that the protocol was transferable and basically had good between-lab reproducibility and predictivity, but there were some false negative data. To improve performance, protocol and prediction model were modified. Using the modified prediction model in the first and second RT, accuracy was improved. However, about 15% of the outcomes were not correctly identified, which exposes some of the limitations of the assay. For the chemicals evaluated, the limitation may due to chemical being a weak allergen or having low solubility (ex. alpha-hexylcinnamaldehyde). The third RT evaluated the modified prediction model and satisfactory results were obtained. From the RT data, the feasibility of utilizing cell lines as surrogate DC in development of in vitro skin sensitization methods shows promise. The data also support initiating formal pre-validation of the h-CLAT in order to fully understand the capabilities and limitations of the assay. Copyright 2010 Elsevier Ltd. All rights reserved.

  1. Dependence of Relative Expression of NTR1 and EGFR on Cell Density and Extracellular pH in Human Pancreatic Cancer Cell Lines

    International Nuclear Information System (INIS)

    Olszewski-Hamilton, Ulrike; Hamilton, Gerhard

    2011-01-01

    Pancreatic adenocarcinoma is a devastating disease characterized by early dissemination and poor prognosis. These solid tumors express receptors for neuropeptides like neurotensin (NT) or epidermal growth factor (EGF) and exhibit acidic regions when grown beyond a certain size. We previously demonstrated increases in intracellular Ca 2+ levels, intracellular pH and interleukin-8 (IL-8) secretion in BxPC-3 and PANC-1 pancreatic cancer cells in response to a stable NT analog. The present study aimed at investigation of the dependence of the relative expression of NT receptor 1 (NTR1) and EGFR in BxPC-3 and MIA PaCa-2 cells on cell density and extracellular pH (pH e ). MTT assays revealed the NTR1 inhibitor SR 142948-sensitive Lys 8 -ψ-Lys 9 NT (8–13)-induced proliferation in BxPC-3 and PANC-1 cells. Confluent cultures of BxPC3 and HT-29 lines exhibited highest expression of NTR1 and lowest of EGFR and expression of NTR1 was maximal at slightly acidic pH e . IL-8 production was stimulated by Lys 8 -ψ-Lys 9 NT (8–13) and even enhanced at both acidic and alkaline pH e in BxPC-3 and PANC-1 cells. In conclusion, our in vitro study suggests that one contributing factor to the minor responses obtained with EGFR-directed therapy may be downregulation of this receptor in tumor cell aggregates, possibly resulting in acquisition of a more aggressive phenotype via other growth factor receptors like NTR1

  2. [Effects of icotinib hydrochloride on the proliferation and apoptosis of human lung cancer cell lines].

    Science.gov (United States)

    Ma, Li; Han, Xiao-hong; Wang, Shuai; Wang, Jian-fei; Shi, Yuan-kai

    2012-09-25

    To explore the effects of icotinib on the proliferation and apoptosis of various lung cancer cell lines. Human lung cancer cell lines HCC827, H1650, H1975, A549 and human epidermal cancer cell line A431 were treated in vitro with icotinib or gefitinib at a concentration gradient of 0 - 40 µmol/L. Their proliferation effects were analyzed by the thiazolyl blue (MTT) assay and the apoptotic effects detected by flow cytometer. The downstream signaling proteins were detected by Western blot. The median inhibitory concentrations (IC(50)) of icotinib for A431 and HCC827 cell lines were (0.04 ± 0.02) and (0.15 ± 0.06) µmol/L respectively. No significant differences existed between the inhibitions of gefitinib and icotinib on A431, HCC827, H1650, H1975 and A549 cell lines (all P > 0.05). Compared with H1650, H1975 and A549 cell lines, icotinib significantly inhibited A431 (P = 0.009, 0.005 and 0.000) and HCC827 (P = 0.001, 0.001 and 0.000) cell lines. And it lowered the expressions of p-AKT, p-ERK and survivin protein expression through the inhibited activity of p-EGFR protein. Icotinib can arrest the proliferation of lung adenocarcinoma cells with EGFR mutation or over-expression by inhibiting the signal pathways of AKT-ERK and survivin.

  3. Silencing of B7-H4 suppresses the tumorigenicity of the MGC-803 human gastric cancer cell line and promotes cell apoptosis via the mitochondrial signaling pathway.

    Science.gov (United States)

    Zhou, Donghui; Zhou, Yong; Li, Chao; Yang, Lina

    2018-04-01

    B7-H4 is a transmembrane protein which is a member of the B7 superfamily. It is overexpressed in various types of cancer, including gastric cancer. However, the effects of B7-H4 on the tumorigenicity of gastric cancer and the underlying mechanisms have not yet been fully explored. Thus, the aim of this study was to examine the effects of B7-H4 on the tumorigenicity of gastric cancer cells and to elucidate the underlying mechanisms. For this purpose, B7-H4 expression in gastric cancer tissues was detected by immunohistochemical staining. The effects of B7-H4 on the biological behavior of the MGC-803 human gastric cancer cell line were examined by Cell Counting kit-8 (CCK-8) assay, cell cycle analysis, wound healing assay, Annexin V/propidium iodide staining and terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay. Moreover, the expression levels of apoptotic markers, such as cleaved caspase‑3, cleaved caspase‑9, Bcl-2 and Bax were examined by western blot analysis. Immunohistochemical staining revealed that a high expression of B7-H4 was found in about 41.8% of tissues obtained from patients with gastric cancer. Comparative analysis revealed that B7-H4 expression significantly correlated with lymph node metastasis and the TNM stage. The results of CCK-8 assay, cell cycle analysis, wound healing assay, Annexin V/propidium iodide staining assay and TUNEL assay all demonstrated that the silencing of B7-H4 by small interfering RNA decreased cell proliferation, suppressed cell motility, and induced cell cycle arrest and the apoptosis of MGC-803 human gastric cancer cells. Furthermore, the results of western blot analysis indicated that the downregulation of B7-H4 induced the apoptosis of the MGC-803 cells via the mitochondrial signaling pathway through the activation of caspase‑3 and caspase‑9, and by altering the Bax/Bcl-2 ratio in a manner that favored apoptosis. Based on the findings on human gastric cancer cell line MGC-803, the

  4. CRADA Payment Options | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    NCI TTC CRADA PAYMENT OPTIONS: Electronic Payments by Wire Transfer via Fedwire, Mail a check to the Institute or Center, or Automated Clearing House (ACH)/Electronic Funds Transfer (ETF) payments via Pay.gov (NCI ONLY).

  5. Dicty_cDB: AFA460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFA460 (Link to dictyBase) - - - Contig-U15574-1 AFA460Z (Link... to Original site) - - AFA460Z 170 - - - - Show AFA460 Library AF (Link to library) Clone ID AFA460 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U15574-1 Original site URL http://dict...date 2001. 6. 2 Translated Amino Acid sequence ---QIHQTIQVVKITLSSASSSSSSSSSSILNKTRICTYINSNSTHSLXXNIYKYKLPK T...it* Frame B: ---QIHQTIQVVKITLSSASSSSSSSSSSILNKTRICTYINSNSTHSLXXNIYKYKLPK Frame C:

  6. Investigation of the selenium metabolism in cancer cell lines

    DEFF Research Database (Denmark)

    Lunøe, Kristoffer; Gabel-Jensen, Charlotte; Stürup, Stefan

    2011-01-01

    The aim of this work was to compare different selenium species for their ability to induce cell death in different cancer cell lines, while investigating the underlying chemistry by speciation analysis. A prostate cancer cell line (PC-3), a colon cancer cell line (HT-29) and a leukaemia cell line...... (Jurkat E6-1) were incubated with five selenium compounds representing inorganic as well as organic Se compounds in different oxidation states. Selenomethionine (SeMet), Se-methylselenocysteine (MeSeCys), methylseleninic acid (MeSeA), selenite and selenate in the concentration range 5-100 mu M were...... incubated with cells for 24 h and the induction of cell death was measured using flow cytometry. The amounts of total selenium in cell medium, cell lysate and the insoluble fractions was determined by ICP-MS. Speciation analysis of cellular fractions was performed by reversed phase, anion exchange and size...

  7. Hedgehog Pathway Inhibitor HhAntag691 Is a Potent Inhibitor of ABCG2/BCRP and ABCB1/Pgp

    Directory of Open Access Journals (Sweden)

    Yimao Zhang

    2009-01-01

    Full Text Available HhAntag691 (GDC-0449, a low-molecular weight inhibitor of the tumor-promoting hedgehog (Hh signaling pathway, has been used to treat medulloblastoma in animal models and has recently entered clinical trials for a variety of solid tumors. Here, we show that HhAntag691 inhibits multiple ATP-binding cassette (ABC transporters. ATP-binding cassette transporters are within a family of membrane proteins, the overexpression of which is associated with multidrug resistance, a major impediment to successful cancer treatment. HhAntag691 is a potent inhibitor of two ABC transporters, ABCG2/BCRP and ABCB1/Pgp, and is a mild inhibitor of ABCC1/MRP1. In ABCG2-overexpressing HEK293 cells, HhAntag691 increased retention of the fluorescent ABCG2 substrate BODIPY-prazosin and resensitized these cells to mitoxantrone, an antineoplastic ABCG2 substrate. In Madin-Darby canine kidney II cells engineered to overexpress Pgp or MRP1, HhAntag691 increased the retention of calcein-AM and resensitized them to colchicine. HhAntag691 also resensitized human non-small cell lung carcinoma cells NCI-H460/par and NCI-H460/MX20, which overexpress ABCG2 in response to mitoxantrone, to mitoxantrone, and to topotecan or SN-38. The IC50 values of HhAntag691 for inhibition of ABCG2 and Pgp were ∼1.4 and ∼3.0 µM, respectively. Because ABC transporters are highly expressed at the blood-brain barrier and on many tumor cells, they contribute significantly to treatment failure of many types of cancer, particularly of those within the neuraxis. In addition to its effect on Hh signaling, the ability of HhAntag691 and related compounds to inhibit two key ABC transporters could contribute to their effectiveness in treating malignancies.

  8. Bifenthrin activates homotypic aggregation in human T-cell lines.

    Science.gov (United States)

    Hoffman, Nataly; Tran, Van; Daniyan, Anthony; Ojugbele, Olutosin; Pryor, Stephen C; Bonventre, Josephine A; Flynn, Katherine; Weeks, Benjamin S

    2006-03-01

    Here, we addressed the concern that, despite the lack of overt toxicity, exposure to low levels of the common household pyrethroid pesticide, bifenthrin, could cause harm to the immune system. To do this, we measure the effect of bifenthrin on phytohemagglutinin (PHA) activation of homotypic aggregation in human T-cell lines. The human CD4+ H9, and Jurkat cell lines and the human promonocyte U937 cell line, were exposed to varying concentrations of bifenthrin. Cell viability was determined using the AlmarBlue Toxicity Assay. Concentrations of bifenthrin which did not reduce cell viability were determined and these concentrations were tested for the effect of bifenthrin on PHA-mediated homotypic aggregation. Blocking antibodies to ICAM and LFA-1 were used to disrupt aggregation and a nonspecific IgG was used as a control. Bifenthrin was found to be nontoxic at concentrations ranging from 10(-4) to 10(-13) M. Bifenthrin did not inhibit PHA induced cell aggregation in all cell lines tested. However, at 10(-4) M, bifenthrin to form aggregates stimulated homotypic aggregation in the H9 and Jurkat T-cell lines. The bifenthrin-induced aggregate formation, like that seen with PHA, was blocked by treating the cells with antibodies to either LFA-1 or ICAM. The results here show that bifenthrin activates T-cell function by stimulating ICAM/LFA-1 mediated homotypic aggregation. This data suggests that exposure to bifenthrin, even at "acceptable" limits, can increase the risk for and frequency of inflammatory responses and diseases such as asthma.

  9. Transcriptome variations among human embryonic stem cell lines are associated with their differentiation propensity.

    Directory of Open Access Journals (Sweden)

    Changbin Sun

    Full Text Available Human embryonic stem cells (hESCs have the potential to form any cell type in the body, making them attractive cell sources in drug screening, regenerative medicine, disease and developmental processes modeling. However, not all hESC lines have the equal potency to generate desired cell types in vitro. Significant variations have been observed for the differentiation efficiency of various human ESC lines. The precise underpinning molecular mechanisms are still unclear. In this work, we compared transcriptome variations of four hESC lines H7, HUES1, HUES8 and HUES9. We found that hESC lines have different gene expression profiles, and these differentially expressed genes (DEGs are significantly enriched in developmental processes, such as ectodermal, mesodermal and endodermal development. The enrichment difference between hESC lines was consistent with its lineage bias. Among these DEGs, some pluripotency factors and genes involved in signaling transduction showed great variations as well. The pleiotropic functions of these genes in controlling hESC identity and early lineage specification, implicated that different hESC lines may utilize distinct balance mechanisms to maintain pluripotent state. When the balance is broken in a certain environment, gene expression variation between them could impact on their different lineage specification behavior.

  10. Histone H2A subfractions and their phosphorylation in cultured Peromyscus cells

    International Nuclear Information System (INIS)

    Halleck, M.S.; Gurley, L.R.

    1980-01-01

    Patterns of histone phosphorylation and histone H2A subfractionation have been compared in cultured cell lines from two species of deer mice, Peromyscus eremicus and Peromyscus boylii, which differ considerably in their content of heterochromatin but which contain essentially the same euchromatin content. DNA measurements by flow microfluorometry indicated that P. eremicus cells contained 34.2% more DNA than P. boylii cells, and C-band chromosome analysis indicated that the extra DNA in P. eremicus was present as constitutive heterochromatin. Subfraction of histone H2A by acid-urea polyacrylamide preparative gel electrophoresis in the presence of non-ionic detergent showed that each cell line contained two H2A subfractions. Incorporation of 32 PO 4 into these histones indicated that the steady state phosphorylation of the two H2A subfractions was not the same, the more hydrophobic H2A being greater than two times more phosphorylated than the less hydrophobic H2A in both cell lines. A comparison of the two cell lines indicated that the cell line with 34.2% greater constitutive heterochromatin contained a similar excess (29%) in its ratio of the more highly phosphorylated, more hydrophobic H2A subfraction to the less hydrophobic H2A subfraction. It is suggested that this enrichment of the more highly phosphorylated, more hydrophobic H2A subfraction may be related to the amount of constitutive heterochromatin present in the genome

  11. Cordycepin Induces Apoptosis and Inhibits Proliferation of Human Lung Cancer Cell Line H1975 via Inhibiting the Phosphorylation of EGFR

    Directory of Open Access Journals (Sweden)

    Zheng Wang

    2016-09-01

    Full Text Available Cordycepin is an active component of the traditional Chinese medicine Cordyceps sinensis and Cordyceps militaris with notable anticancer activity. Though the prominent inhibitory activity was reported in different kinds of cancer cell lines, the concrete mechanisms remain elusive. It was reported that cordycepin could be converted into tri-phosphates in vivo to confuse a number of enzymes and interfere the normal cell function. For the inhibitory mechanism of EGFR inhibitors and the structure similarity of ATP and tri-phosphated cordycepin, human lung cancer cell line H1975 was employed to investigate the inhibitory effect of cordycepin. The results showed that cordycepin could inhibit cell proliferation and induce apoptosis in a dose-dependent manner. Cell cycle analysis revealed that H1975 cells could be arrested at the G0/G1 phase after cordycepin treatment. The expression levels of apoptosis-related protein Caspase-3 and Bcl-2 and phosphorylated expression levels of EGFR, AKT and ERK1/2 were all decreased compared with the control group stimulated with EGF. However, the protein expression levels of proapoptotic protein Bax and cleaved caspase-3 were increased. These results implied that cordycepin could inhibit cell proliferation and induce apoptosis via the EGFR signaling pathway. Our results indicated that there was potential to seek a novel EGFR inhibitor from cordycepin and its chemical derivatives.

  12. NCI Visuals Online

    Science.gov (United States)

    NCI Visuals Online contains images from the collections of the National Cancer Institute's Office of Communications and Public Liaison, including general biomedical and science-related images, cancer-specific scientific and patient care-related images, and portraits of directors and staff of the National Cancer Institute.

  13. 42 CFR 460.46 - Civil money penalties.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Civil money penalties. 460.46 Section 460.46 Public...) Sanctions, Enforcement Actions, and Termination § 460.46 Civil money penalties. (a) CMS may impose civil money penalties up to the following maximum amounts: (1) For each violation regarding enrollment or...

  14. 42 CFR 460.60 - PACE organizational structure.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false PACE organizational structure. 460.60 Section 460... ELDERLY (PACE) PACE Administrative Requirements § 460.60 PACE organizational structure. (a) A PACE organization must be, or be a distinct part of, one of the following: (1) An entity of city, county, State, or...

  15. 46 CFR 153.460 - Fire protection systems.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Fire protection systems. 153.460 Section 153.460... Requirements for Flammable Or Combustible Cargoes § 153.460 Fire protection systems. Each self-propelled ship... protection system listed beside the cargo in Table 1 and described in the footnotes to Table 1. (b) The...

  16. Data on the construction of a recombinant HEK293 cell line overexpressing hERG potassium channel and examining the presence of hERG mRNA and protein expression

    Directory of Open Access Journals (Sweden)

    Yi Fan Teah

    2017-10-01

    Full Text Available The data presented in this article are related to the research article entitled “The effects of deoxyelephantopin on the cardiac delayed rectifier potassium channel current (IKr and human ether-a-go-go-related gene (hERG expression” (Y.F. Teah, M.A. Abduraman, A. Amanah, M.I. Adenan, S.F. Sulaiman, M.L. Tan [1], which the possible hERG blocking properties of deoxyelephantopin were investigated. This article describes the construction of human embryonic kidney 293 (HEK293 cells overexpressing HERG potassium channel and verification of the presence of hERG mRNA and protein expression in this recombinant cell line.

  17. Prenylated Chalcone 2 Acts as an Antimitotic Agent and Enhances the Chemosensitivity of Tumor Cells to Paclitaxel

    Directory of Open Access Journals (Sweden)

    Joana Fonseca

    2016-07-01

    Full Text Available We previously reported that prenylated chalcone 2 (PC2, the O-prenyl derivative (2 of 2′-hydroxy-3,4,4′,5,6′-pentamethoxychalcone (1, induced cytotoxicity of tumor cells via disruption of p53-MDM2 interaction. However, the cellular changes through which PC2 exerts its cytotoxic activity and its antitumor potential, remain to be addressed. In the present work, we aimed to (i characterize the effect of PC2 on mitotic progression and the underlying mechanism; and to (ii explore this information to evaluate its ability to sensitize tumor cells to paclitaxel in a combination regimen. PC2 was able to arrest breast adenocarcinoma MCF-7 and non-small cell lung cancer NCI-H460 cells in mitosis. All mitosis-arrested cells showed collapsed mitotic spindles with randomly distributed chromosomes, and activated spindle assembly checkpoint. Live-cell imaging revealed that the compound induced a prolonged delay (up to 14 h in mitosis, culminating in massive cell death by blebbing. Importantly, PC2 in combination with paclitaxel enhanced the effect on cell growth inhibition as determined by cell viability and proliferation assays. Our findings demonstrate that the cytotoxicity induced by PC2 is mediated through antimitotic activity as a result of mitotic spindle damage. The enhancement effects of PC2 on chemosensitivity of cancer cells to paclitaxel encourage further validation of the clinical potential of this combination.

  18. Synthesis and Cytotoxic Evaluation of a Series of 2-Amino-Naphthoquinones against Human Cancer Cells

    Directory of Open Access Journals (Sweden)

    Thiago A. P. de Moraes

    2014-08-01

    Full Text Available The cytotoxicity of a series of aminonaphthoquinones resulting from the reaction of suitable aminoacids with 1,4-naphthoquinone was assayed against SF-295 (glioblastoma, MDAMB-435 (breast, HCT-8 (colon, HCT-116 (colon, HL-60 (leukemia, OVCAR-8 (ovarian, NCI-H358M (bronchoalveolar lung carcinoma and PC3-M (prostate cancer cells and also against PBMC (peripheral blood mononuclear cells. The results demonstrated that all the synthetic aminonaphthoquinones had relevant cytotoxic activity against all human cancer lines used in this experiment. Five of the compounds showed high cytotoxicity and selectivity against all cancer cell lines tested (IC50 = 0.49 to 3.89 µg·mL−1. The title compounds were less toxic to PBMC, since IC50 was 1.5 to eighteen times higher (IC50 = 5.51 to 17.61 µg·mL−1 than values shown by tumour cell lines. The mechanism of cell growth inhibition and structure–activity relationships remains as a target for future investigations.

  19. 42 CFR 460.106 - Plan of care.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Plan of care. 460.106 Section 460.106 Public Health... ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PROGRAMS OF ALL-INCLUSIVE CARE FOR THE ELDERLY (PACE) PACE Services § 460.106 Plan of care. (a) Basic requirement. The interdisciplinary team must promptly develop a...

  20. Genetic inactivation of the Fanconi anemia gene FANCC identified in the hepatocellular carcinoma cell line HuH-7 confers sensitivity towards DNA-interstrand crosslinking agents

    Directory of Open Access Journals (Sweden)

    Bassermann Florian

    2010-05-01

    Full Text Available Abstract Background Inactivation of the Fanconi anemia (FA pathway through defects in one of 13 FA genes occurs at low frequency in various solid cancer entities among the general population. As FA pathway inactivation confers a distinct hypersensitivity towards DNA interstrand-crosslinking (ICL-agents, FA defects represent rational targets for individualized therapeutic strategies. Except for pancreatic cancer, however, the prevalence of FA defects in gastrointestinal (GI tumors has not yet been systematically explored. Results A panel of GI cancer cell lines was screened for FA pathway inactivation applying FANCD2 monoubiquitination and FANCD2/RAD51 nuclear focus formation and a newly identified FA pathway-deficient cell line was functionally characterized. The hepatocellular carcinoma (HCC line HuH-7 was defective in FANCD2 monoubiquitination and FANCD2 nuclear focus formation but proficient in RAD51 focus formation. Gene complementation studies revealed that this proximal FA pathway inactivation was attributable to defective FANCC function in HuH-7 cells. Accordingly, a homozygous inactivating FANCC nonsense mutation (c.553C > T, p.R185X was identified in HuH-7, resulting in partial transcriptional skipping of exon 6 and leading to the classic cellular FA hypersensitivity phenotype; HuH-7 cells exhibited a strongly reduced proliferation rate and a pronounced G2 cell cycle arrest at distinctly lower concentrations of ICL-agents than a panel of non-isogenic, FA pathway-proficient HCC cell lines. Upon retroviral transduction of HuH-7 cells with FANCC cDNA, FA pathway functions were restored and ICL-hypersensitivity abrogated. Analyses of 18 surgical HCC specimens yielded no further examples for genetic or epigenetic inactivation of FANCC, FANCF, or FANCG in HCC, suggesting a low prevalence of proximal FA pathway inactivation in this tumor type. Conclusions As the majority of HCC are chemoresistant, assessment of FA pathway function in HCC could

  1. Uniform TiO2 nanoparticles induce apoptosis in epithelial cell lines in a size-dependent manner.

    Science.gov (United States)

    Sun, Qingqing; Ishii, Takayuki; Kanehira, Koki; Sato, Takeshi; Taniguchi, Akiyoshi

    2017-05-02

    The size of titanium dioxide (TiO 2 ) nanoparticles is a vital parameter that determines their cytotoxicity. However, most reported studies have employed irregular shapes and sizes of TiO 2 nanoparticles, as it is difficult to produce nanoparticles of suitable sizes for research. We produced good model TiO 2 nanoparticles of uniform shape and size for use in studying their cytotoxicity. In this work, spherical, uniform polyethylene glycol-modified TiO 2 (TiO 2 -PEG) nanoparticles of differing sizes (100, 200, and 300 nm) were prepared using the sol-gel method. A size-dependent decrease in cell viability was observed with increasing nanoparticle size. Furthermore, apoptosis was found to be positively associated with nanoparticle size, as evidenced by an increase in caspase-3 activity with increasing nanoparticle size. Larger nanoparticles exhibited higher cellular uptake, suggesting that larger nanoparticles more strongly induce apoptosis. In addition, the cellular uptake of different sizes of nanoparticles was energy dependent, suggesting that there are size-dependent uptake pathways. We found that 100 and 200 nm (but not 300 nm) nanoparticles were taken up via clathrin-mediated endocytosis. These results utilizing uniform nanoparticles suggest that the size-dependent cytotoxicity of nanoparticles involves active cellular uptake, caspase-3 activation, and apoptosis in the epithelial cell line (NCI-H292). These findings will hopefully aid in the future design and safe use of nanoparticles.

  2. 16 CFR 460.8 - R-value tolerances.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false R-value tolerances. 460.8 Section 460.8... INSULATION § 460.8 R-value tolerances. If you are a manufacturer of home insulation, no individual specimen of the insulation you sell can have an R-value more than 10% below the R-value shown in a label, fact...

  3. 16 CFR 460.12 - Labels.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Labels. 460.12 Section 460.12 Commercial....12 Labels. If you are a manufacturer, you must label all packages of your insulation. The labels must... chart. Labels for these products must state the minimum net weight of the insulation in the package. You...

  4. Fluorescent pH-Sensing Probe Based on Biorefinery Wood Lignosulfonate and Its Application in Human Cancer Cell Bioimaging.

    Science.gov (United States)

    Xue, Yuyuan; Liang, Wanshan; Li, Yuan; Wu, Ying; Peng, Xinwen; Qiu, Xueqing; Liu, Jinbin; Sun, Runcang

    2016-12-28

    A water-soluble, ratiometric fluorescent pH probe, L-SRhB, was synthesized via grafting spirolactam Rhodamine B (SRhB) to lignosulfonate (LS). As the ring-opening product of L-SRhB, FL-SRhB was also prepared. The pH-response experiment indicated that L-SRhB showed a rapid response to pH changes from 4.60 to 6.20 with a pK a of 5.35, which indicated that L-SRhB has the potential for pH detection of acidic organelle. In addition, the two probes were internalized successfully by living cells through the endocytosis pathway and could distinguish normal cells from cancer cells by different cell staining rates. In addition, L-SRhB showed obvious cytotoxicity to cancer cells, whereas it was nontoxic to normal cells in the same condition. L-SRhB might have potential in cancer therapy. L-SRhB might be a promising ratiometric fluorescent pH sensor and bioimaging dye for the recognition of cancer cells. The results also provided a new perspective to the high-value utilization of lignin.

  5. Discrepancy of biologic behavior influenced by bone marrow derived cells in lung cancer.

    Science.gov (United States)

    Zhang, Jie; Niu, Xiao-Min; Liao, Mei-Lin; Liu, Yun; Sha, Hui-Fang; Zhao, Yi; Yu, Yong-Feng; Tan, Qiang; Xiang, Jia-Qing; Fang, Jing; Lv, Dan-Dan; Li, Xue-Bing; Lu, Shun; Chen, Hai-Quan

    2010-11-01

    Disseminated cancer cells may initially require local nutrients and growth factors to thrive and survive in bone marrow. However, data on the influence of bone marrow derived cells (BMDC, also called bone stromal cells in some publications) on lung cancer cells is largely unexplored. This study explored the mechanism of how bone stromal factors contribute to the bone tropism in lung cancer. The difference among lung cancer cell lines in their abilities to metastasize to bone was found using the SCID animal model. Supernatant of bone marrow aspiration (BM) and condition medium from human bone stromal cells (BSC) were used to study the activity of bone stromal factors. We found bone stromal factors significantly increased the proliferation, invasion, adhesion and expression of angiogenosis-related factors, and inhibited the apoptosis for high bone metastasis H460 lung cancer cells. These biologic effects were not seen in SPC-A1 or A549 cells, which are low bone metastasis lung cancer cells. Adhesion of H460 cells to surface coated with bone stromal cells can activate some signal transduction pathways, and alter the expression of adhesion associated factors, including integrin β 3 and ADAMTS-1, two potential targets related with bone metastasis. We concluded that bone marrow derived cells had a profound effect on biological behavior of lung cancers, therefore favoring the growth of lung cancer cells in bone.

  6. International Fellows of NCI at Frederick | Poster

    Science.gov (United States)

    Each year, the Employee Diversity Team (EDT) acknowledges members of the NCI at Frederick Community for their achievements and contributions towards the mission of facility.  Historically, the team has profiled the “Women of NCI at Frederick,” but this year, the team decided to instead shed light on the diverse and successful individuals who make up the international fellows community.

  7. Difference in membrane repair capacity between cancer cell lines and a normal cell line

    DEFF Research Database (Denmark)

    Frandsen, Stine Krog; McNeil, Anna K.; Novak, Ivana

    2016-01-01

    repair was investigated by disrupting the plasma membrane using laser followed by monitoring fluorescent dye entry over time in seven cancer cell lines, an immortalized cell line, and a normal primary cell line. The kinetics of repair in living cells can be directly recorded using this technique...... cancer cell lines (p immortalized cell line (p

  8. Tumor therapy with 125I-octreotide and 125I-UdR

    International Nuclear Information System (INIS)

    Fan, W.; Zhu, R.; Yang, C.; Sun, J.J.; Xu, Y.J.; Zhang, Y.J.; Wu, M.J.; Wang, D.J.

    2005-01-01

    Purpose: To determine the tumor cell damage effect with Auger-electron emitter 125 I in different chemical states. Methods: (1) [Tyr 3 ] octreotide (TOC) and UdR are labeled with 125 I,respectively. (2) Receptor analysis of 125 I-TOC on small cell lung cancer (SCLC) NCI-H446 cell lines is performed comparing with normal lymph cells. NCI-H446 cells added various dose of 125 I-TOC are incubated for different time with 125 I-Nal and non-labeled TOC as control. The capacity of NCI-H446 cell lines bound and internalization of 125 I TOC are determined. The radiation damage of tumor cells is measured by MTF methods. (3) The killing effects of 125 I-UdR in human pancreatic cancer cell line Bax-Pc and Sca-BER bladder carcinoma cells are evaluated with the similar methods. I-UdR penetrating into the Sca-BER cell nucleus is observed with confocal microscope. The grow suppression and clonogenic formation of Sca-BER cells after incubation with 125 I-UdR are analyzed. Proliferation fraction and S phase cell fraction of Sca-BER cell added 125 I-UdR is measured with flow cytometric analysis. Results: (1) Kd=(0.56∼2.0) x 10 -11 mol/L and B max =(1.17∼2.0) x 10 5 cell site are obtained by receptor analysis of 125 I-TOC on NCI-H446 cells. Comparatively, the difference between total binding and non-specific binding is low and there is no saturation of specific binding for normal lymphocyte. About 50% of 125 I-TOC is internalized into the NCI-H446 cell nucleus at 24h after incubation. The damige of NCI-H446 cells by 125 I-TOC is clearly observed. (2) The penetration amount of 125 I-UdR into cell nucleus increases with the incubate time when the concentration of 125 I-UdR is in the range of 10∼500 kBq/mL and reaches the peak fraction of 94% at 36 h after incubation. The radioactivity of 125 I-UdR is then achieved equelibration and no more increased with time. The linear correlation with γ=0.867∼0.978 between the concentration of 125 I-UdR in cell nucleus and the incubation time

  9. Gene expression analysis of cell death induction by Taurolidine in different malignant cell lines

    International Nuclear Information System (INIS)

    Chromik, Ansgar M; Weyhe, Dirk; Mittelkötter, Ulrich; Uhl, Waldemar; Hahn, Stephan A; Daigeler, Adrien; Flier, Annegret; Bulut, Daniel; May, Christina; Harati, Kamran; Roschinsky, Jan; Sülberg, Dominique

    2010-01-01

    The anti-infective agent Taurolidine (TRD) has been shown to have cell death inducing properties, but the mechanism of its action is largely unknown. The aim of this study was to identify potential common target genes modulated at the transcriptional level following TRD treatment in tumour cell lines originating from different cancer types. Five different malignant cell lines (HT29, Chang Liver, HT1080, AsPC-1 and BxPC-3) were incubated with TRD (100 μM, 250 μM and 1000 μM). Proliferation after 8 h and cell viability after 24 h were analyzed by BrdU assay and FACS analysis, respectively. Gene expression analyses were carried out using the Agilent -microarray platform to indentify genes which displayed conjoint regulation following the addition of TRD in all cell lines. Candidate genes were subjected to Ingenuity Pathways Analysis and selected genes were validated by qRT-PCR and Western Blot. TRD 250 μM caused a significant inhibition of proliferation as well as apoptotic cell death in all cell lines. Among cell death associated genes with the strongest regulation in gene expression, we identified pro-apoptotic transcription factors (EGR1, ATF3) as well as genes involved in the ER stress response (PPP1R15A), in ubiquitination (TRAF6) and mitochondrial apoptotic pathways (PMAIP1). This is the first conjoint analysis of potential target genes of TRD which was performed simultaneously in different malignant cell lines. The results indicate that TRD might be involved in different signal transduction pathways leading to apoptosis

  10. Radiation-induced alterations of histone post-translational modification levels in lymphoblastoid cell lines

    International Nuclear Information System (INIS)

    Maroschik, Belinda; Gürtler, Anne; Krämer, Anne; Rößler, Ute; Gomolka, Maria; Hornhardt, Sabine; Mörtl, Simone; Friedl, Anna A

    2014-01-01

    Radiation-induced alterations in posttranslational histone modifications (PTMs) may affect the cellular response to radiation damage in the DNA. If not reverted appropriately, altered PTM patterns may cause long-term alterations in gene expression regulation and thus lead to cancer. It is therefore important to characterize radiation-induced alterations in PTM patterns and the factors affecting them. A lymphoblastoid cell line established from a normal donor was used to screen for alterations in methylation levels at H3K4, H3K9, H3K27, and H4K20, as well as acetylation at H3K9, H3K56, H4K5, and H4K16, by quantitative Western Blot analysis at 15 min, 1 h and 24 h after irradiation with 2 Gy and 10 Gy. The variability of alterations in acetylation marks was in addition investigated in a panel of lymphoblastoid cell lines with differing radiosensitivity established from lung cancer patients. The screening procedure demonstrated consistent hypomethylation at H3K4me3 and hypoacetylation at all acetylation marks tested. In the panel of lymphoblastoid cell lines, however, a high degree of inter-individual variability became apparent. Radiosensitive cell lines showed more pronounced and longer lasting H4K16 hypoacetylation than radioresistant lines, which correlates with higher levels of residual γ-H2AX foci after 24 h. So far, the factors affecting extent and duration of radiation-induced histone alterations are poorly defined. The present work hints at a high degree of inter-individual variability and a potential correlation of DNA damage repair capacity and alterations in PTM levels

  11. Pharmacologically directed strategies in academic anticancer drug discovery based on the European NCI compounds initiative.

    Science.gov (United States)

    Hendriks, Hans R; Govaerts, Anne-Sophie; Fichtner, Iduna; Burtles, Sally; Westwell, Andrew D; Peters, Godefridus J

    2017-07-11

    The European NCI compounds programme, a joint initiative of the EORTC Research Branch, Cancer Research Campaign and the US National Cancer Institute, was initiated in 1993. The objective was to help the NCI in reducing the backlog of in vivo testing of potential anticancer compounds, synthesised in Europe that emerged from the NCI in vitro 60-cell screen. Over a period of more than twenty years the EORTC-Cancer Research Campaign panel reviewed ∼2000 compounds of which 95 were selected for further evaluation. Selected compounds were stepwise developed with clear go/no go decision points using a pharmacologically directed programme. This approach eliminated quickly compounds with unsuitable pharmacological properties. A few compounds went into Phase I clinical evaluation. The lessons learned and many of the principles outlined in the paper can easily be applied to current and future drug discovery and development programmes. Changes in the review panel, restrictions regarding numbers and types of compounds tested in the NCI in vitro screen and the appearance of targeted agents led to the discontinuation of the European NCI programme in 2017 and its transformation into an academic platform of excellence for anticancer drug discovery and development within the EORTC-PAMM group. This group remains open for advice and collaboration with interested parties in the field of cancer pharmacology.

  12. NCI at Frederick Ebola Response Team | Poster

    Science.gov (United States)

    Editor’s note: This article was adapted from the Employee Diversity Team’s display case exhibit “Recognizing the NCI at Frederick Ebola Response Team,” in the lobby of Building 549. The Poster staff recognizes that this article does not include everyone who was involved in the response to the Ebola crisis, both at NCI at Frederick and in Africa. When the Ebola crisis broke out

  13. IJUE. Tema 3. Les competències de la Unió Europea

    OpenAIRE

    Torres Pérez, María

    2018-01-01

    PowerPoint del Tema 3 de la asignatura "Institucions Jurídiques de la Unió Europea". Curso académico 2017-2018. Tema 3. Les competències de la Unió Europea. 1. L’atribució de competències a la Unió Europea. 2. La delimitació de les competències a la Unió Europea. 3. Els principis que regeixen l’exercici de les competències. 4. L’exercici de les competències de la Unió per “alguns Estats membres”.

  14. Derivation of novel genetically diverse human embryonic stem cell lines.

    Science.gov (United States)

    Stefanova, Valentina T; Grifo, James A; Hansis, Christoph

    2012-06-10

    Human embryonic stem cells (hESCs) have the potential to revolutionize many biomedical fields ranging from basic research to disease modeling, regenerative medicine, drug discovery, and toxicity testing. A multitude of hESC lines have been derived worldwide since the first 5 lines by Thomson et al. 13 years ago, but many of these are poorly characterized, unavailable, or do not represent desired traits, thus making them unsuitable for application purposes. In order to provide the scientific community with better options, we have derived 12 new hESC lines at New York University from discarded genetically normal and abnormal embryos using the latest techniques. We examined the genetic status of the NYUES lines in detail as well as their molecular and cellular features and DNA fingerprinting profile. Furthermore, we differentiated our hESCs into the tissues most affected by a specific condition or into clinically desired cell types. To our knowledge, a number of characteristics of our hESCs have not been previously reported, for example, mutation for alpha thalassemia X-linked mental retardation syndrome, linkage to conditions with a genetic component such as asthma or poor sperm morphology, and novel combinations of ethnic backgrounds. Importantly, all of our undifferentiated euploid female lines tested to date did not show X chromosome inactivation, believed to result in superior potency. We continue to derive new hESC lines and add them to the NIH registry and other registries. This should facilitate the use of our hESCs and lead to advancements for patient-benefitting applications.

  15. Generation of iPSC lines from primary human chorionic villi cells

    Directory of Open Access Journals (Sweden)

    Björn Lichtner

    2015-11-01

    Full Text Available Primary human chorionic villi (CV cells were used to generate the iPSC line by retroviral transduction of the four Yamanaka-factors OCT4, SOX2, KLF4 and c-MYC. Pluripotency was confirmed both in vivo and in vitro. The transcriptomes of the CV-derived iPSC lines and the human embryonic stem cell lines—H1 and H9 have a Pearson correlation of 0.929 and 0.943 respectively.

  16. Derivation and characterization of human embryonic stem cell lines from the Chinese population

    Institute of Scientific and Technical Information of China (English)

    Zhao Wu; Huimin Dai; Lei Qian; Qing Tian; Lei Xiao; Xiaojun Tan; Hui Li; Lingjun Rao; Lixiazi He; Lei Bao; Jing Liao; Chun Cui; Zhenyu Zuo; Qiao Li

    2011-01-01

    Human embryonic stem cells (hESCs) can self-renew indefinitely and differentiate into all cell types in the human body. Therefore, they are valuable in regenerative medicine, human developmental biology and drug discovery. A number of hESC lines have been derived from the Chinese population,but limited of them are available for research purposes. Here we report the derivation and characterization of two hESC lines derived from human blastocysts of Chinese origin. These hESCs express alkaline phosphatase and hESC-specific markers, including Oct4, Nanog, SSEA-3, SSEA-4,TRA-1-60 and TRA-1-81. They also have high levels of telomerase activity and normal karyotypes. These cells can form embryoid body in vitro and can be differentiated into all three germ layers in vivo by teratoma formation. The newly established hESCs will be distributed for research purposes.The availability of hESC lines from the Chinese population will facilitate studies on the differences in hESCs from different ethnic groups.

  17. Cytotoxicity of the indole alkaloid reserpine from Rauwolfia serpentina against drug-resistant tumor cells.

    Science.gov (United States)

    Abdelfatah, Sara A A; Efferth, Thomas

    2015-02-15

    The antihypertensive reserpine is an indole alkaloid from Rauwolfia serpentina and exerts also profound activity against cancer cells in vitro and in vivo. The present investigation was undertaken to investigate possible modes of action to explain its activity toward drug-resistant tumor cells. Sensitive and drug-resistant tumor cell lines overexpressing P-glycoprotein (ABCB1/MDR1), breast cancer resistance protein (ABCG2/BCRP), mutation-activated epidermal growth factor receptor (EGFR), wild-type and p53-knockout cells as well as the NCI panel of cell lines from different tumor origin were analyzed. Reserpine's cytotoxicity was investigated by resazurin and sulforhodamine assays, flow cytometry, and COMPARE and hierarchical cluster analyses of transcriptome-wide microarray-based RNA expressions. P-glycoprotein- or BCRP overexpressing tumor cells did not reveal cross-resistance to reserpine. EGFR-overexpressing cells were collateral sensitive and p53- Knockout cells cross-resistant to this drug compared to their wild-type parental cell lines. Reserpine increased the uptake of doxorubicin in P-glycoprotein-overexpressing cells, indicating that reserpine inhibited the efflux function of P-glycoprotein. Using molecular docking, we found that reserpine bound with even higher binding energy to P-glycoprotein and EGFR than the control drugs verapamil (P-glycoprotein inhibitor) and erlotinib (EGFR inhibitor). COMPARE and cluster analyses of microarray data showed that the mRNA expression of a panel of genes predicted the sensitivity or resistance of the NCI tumor cell line panel with statistical significance. The genes belonged to diverse pathways and biological functions, e.g. cell survival and apoptosis, EGFR activation, regulation of angiogenesis, cell mobility, cell adhesion, immunological functions, mTOR signaling, and Wnt signaling. The lack of cross-resistance to most resistance mechanisms and the collateral sensitivity in EGFR-transfectants compared to wild

  18. Evaluation of Preclinical Assays to Investigate an Anthroposophic Pharmaceutical Process Applied to Mistletoe (Viscum album L. Extracts

    Directory of Open Access Journals (Sweden)

    Stephan Baumgartner

    2014-01-01

    Full Text Available Extracts from European mistletoe (Viscum album L. developed in anthroposophic medicine are based on specific pharmaceutical procedures to enhance remedy efficacy. One such anthroposophic pharmaceutical process was evaluated regarding effects on cancer cell toxicity in vitro and on colchicine tumor formation in Lepidium sativum. Anthroposophically processed Viscum album extract (APVAE was produced by mixing winter and summer mistletoe extracts in the edge of a high-speed rotating disk and was compared with manually mixed Viscum album extract (VAE. The antiproliferative effect of VAE/APVAE was determined in five cell lines (NCI-H460, DU-145, HCC1143, MV3, and PA-TU-8902 by WST-1 assay in vitro; no difference was found between VAE and APVAE in any cell line tested (P>0.14. Incidence of colchicine tumor formation was assessed by measurement of the root/shoot-ratio of seedlings of Lepidium sativum treated with colchicine as well as VAE, APVAE, or water. Colchicine tumor formation decreased after application of VAE (−5.4% compared to water, P<0.001 and was even stronger by APVAE (−8.8% compared to water, P<0.001. The high-speed mistletoe extract mixing process investigated thus did not influence toxicity against cancer cells but seemed to sustain morphostasis and to enhance resistance against external noxious influences leading to phenomenological malformations.

  19. Synthesis of 3-(4, 5-dihydro-1-phenyl-5-substituted phenyl-1H-pyrazol-3-yl-2H-chromen-2-one derivatives and evaluation of their anticancer activity

    Directory of Open Access Journals (Sweden)

    Nitin Kumar

    2017-05-01

    Full Text Available A novel series of 3-(4, 5-dihydro-1-phenyl-5-substituted phenyl-1H-pyrazol-3-yl-2H-chromen-2-one derivatives were synthesized. In the first step salicylaldehyde was reacted with ethylacetoacetate at room temperature by stirring which gives compound (I. Compound (I when refluxed with substituted benzaldehyde and diethylamine in the presence of n-butanol for 4–5 h gives substituted derivatives (IIa–d. Compounds synthesized in step 2 when refluxed with phenyl hydrazine in the presence of pyridine for 6–7 h gives the title compounds (IIIa–d. All the synthesized compounds were sent to NCI for anticancer activity. Synthesized compounds were tested for anticancer activity against 60 different cell lines. From the data thus obtained it was observed that simple coumarin ring derivatives were more effective in inhibiting the growth of cancerous cell lines, than coumarin-pyrazoline derivatives. Among all the synthesized compounds, irrespective of compounds having simple coumarin ring and coumarin-pyrazoline combination, compounds IIa–c, IIIb and IIId were potent anticancer agents. Compounds were active for the single dose therapeutic program at the dose of 1.00E-5 molar concentration. The main anti cancer activity is assumed to be due to the presence of the lactone structure in coumarin moiety.

  20. An NCI perspective on creating sustainable biospecimen resources.

    Science.gov (United States)

    Vaught, Jimmie; Rogers, Joyce; Myers, Kimberly; Lim, Mark David; Lockhart, Nicole; Moore, Helen; Sawyer, Sherilyn; Furman, Jeffrey L; Compton, Carolyn

    2011-01-01

    High-quality biospecimens with appropriate clinical annotation are critical in the era of personalized medicine. It is now widely recognized that biospecimen resources need to be developed and operated under established scientific, technical, business, and ethical/legal standards. To date, such standards have not been widely practiced, resulting in variable biospecimen quality that may compromise research efforts. The National Cancer Institute (NCI) Office of Biorepositories and Biospecimen Research (OBBR) was established in 2005 to coordinate NCI's biospecimen resource activities and address those issues that affect access to the high-quality specimens and data necessary for its research enterprises as well as the broader translational research field. OBBR and the NCI Biorepository Coordinating Committee developed NCI's "Best Practices for Biospecimen Resources" after consultation with a broad array of experts. A Biospecimen Research Network was established to fund research to develop additional evidence-based practices. Although these initiatives will improve the overall availability of high-quality specimens and data for cancer research, OBBR has been authorized to implement a national biobanking effort, cancer HUman Biobank (caHUB). caHUB will address systematically the gaps in knowledge needed to improve the state-of-the-science and strengthen the standards for human biobanking. This commentary outlines the progressive efforts by NCI in technical, governance, and economic considerations that will be important as the new caHUB enterprise is undertaken.

  1. Hydrophilic CeO2 nanocubes protect pancreatic β-cell line INS-1 from H2O2-induced oxidative stress

    Science.gov (United States)

    Lyu, Guang-Ming; Wang, Yan-Jie; Huang, Xue; Zhang, Huai-Yuan; Sun, Ling-Dong; Liu, Yan-Jun; Yan, Chun-Hua

    2016-04-01

    Oxidative stress plays a key role in the occurrence and development of diabetes. With their unique redox properties, CeO2 nanoparticles (nanoceria) exhibit promising potential for the treatment of diabetes resulting from oxidative stress. Here, we develop a novel preparation of hydrophilic CeO2 nanocubes (NCs) with two different sizes (5 nm and 25 nm) via an acetate assisted hydrothermal method. Dynamic light scattering, zeta potential measurements and thermogravimetric analyses were utilized to investigate the changes in the physico-chemical characteristics of CeO2 NCs when exposed to in vitro cell culture conditions. CCK-8 assays revealed that the CeO2 NCs did not impair cell proliferation in the pancreatic β-cell line INS-1 at the highest dose of 200 μg mL-1 over the time scale of 72 h, while being able to protect INS-1 cells from H2O2-induced cytotoxicity even after protein adsorption. It is also noteworthy that nanoceria with a smaller hydrodynamic radius exhibit stronger antioxidant and anti-apoptotic effects, which is consistent with their H2O2 quenching capability in biological systems. These findings suggest that nanoceria can be used as an excellent antioxidant for controlling oxidative stress-induced pancreatic β-cell damage.Oxidative stress plays a key role in the occurrence and development of diabetes. With their unique redox properties, CeO2 nanoparticles (nanoceria) exhibit promising potential for the treatment of diabetes resulting from oxidative stress. Here, we develop a novel preparation of hydrophilic CeO2 nanocubes (NCs) with two different sizes (5 nm and 25 nm) via an acetate assisted hydrothermal method. Dynamic light scattering, zeta potential measurements and thermogravimetric analyses were utilized to investigate the changes in the physico-chemical characteristics of CeO2 NCs when exposed to in vitro cell culture conditions. CCK-8 assays revealed that the CeO2 NCs did not impair cell proliferation in the pancreatic β-cell line INS-1 at

  2. 13 CFR 130.460 - Budget justification.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Budget justification. 130.460 Section 130.460 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION SMALL BUSINESS DEVELOPMENT...) Cost principles. Principles for determining allowable costs are contained in OMB Circulars A-21 (cost...

  3. Bactericidal impact of Ag, ZnO and mixed AgZnO colloidal nanoparticles on H37Rv Mycobacterium tuberculosis phagocytized by THP-1 cell lines.

    Science.gov (United States)

    Jafari, Alireza; Mosavari, Nader; Movahedzadeh, Farahnaz; Nodooshan, Saeedeh Jafari; Safarkar, Roya; Moro, Rossella; Kamalzadeh, Morteza; Majidpour, Ali; Boustanshenas, Mina; Mosavi, Tahereh

    2017-09-01

    The purpose of this research project was to infection of human macrophages (THP-1) cell lines by H 37 Rv strain of Mycobacterium tuberculosis (H 37 RvMTB) and find out the ratio/dilution of mixture silver (Ag NPs) and zinc oxide nanoparticles (ZnO NPs) whose ability to eliminate phagocytized bacteria compared to rifampicin. The colloidal Ag NPs and ZnO NPs were synthesized and their characteristics were evaluated. The THP-1 cell lines were infected with different concentration of H 37 RvMTB. Next, the infected cells were treated with different ratios/dilutions of Ag NPs, ZnO NPs and rifampicin. The THP-1 were lysed and were cultured in Lowenstein-Jensen agar medium, for eight weeks. The TEM and AFM images of NPs and H 37 RvMTB were supplied. It is observed that Ag NPs, 2 Ag :8 ZnO and 8 Ag :2 ZnO did not have any anti-tubercular effects on phagocytized H 37 RvMTB. Conversely, ZnO NPs somehow eliminated 18.7 × 10 4  CFU ml -1 of H 37 RvMTB in concentration of ∼ 0.468 ppm. To compare with 40 ppm of rifampicin, ∼ 0.663 ppm of 5 Ag :5 ZnO had the ability to kill of H 37 RvMTB, too. Based on previous research, ZnO NPs had strong anti-tubercular impact against H 37 RvMTB to in-vitro condition, but it was toxic in concentration of ∼ 0.468 ppm to both of THP-1 and normal lung (MRC-5) cell lines. It also seems that 5 Ag :5 ZnO is justified because in concentration of ∼ 0.663 ppm of 5 Ag :5 ZnO , phagocytized H 37 RvMTB into the THP-1 had died without any toxicity effects against THP-1 and also MRC-5 cell lines. It is obvious that the mixture of colloidal silver and zinc oxide NPs with ratio of 5 Ag :5 ZnO would be trustworthy options as anti-tubercular nano-drugs in future researches. Copyright © 2017. Published by Elsevier Ltd.

  4. Anticancer activity of ethyl acetate and n-butanol extracts from ...

    African Journals Online (AJOL)

    user

    2011-04-25

    Apr 25, 2011 ... 7 and MDA-MB231 and the lung cancer cell line NCI-H1299 were used. The cells were ... The plants in the genus Agapetes, which are rich sources of ..... novel assay to measure loss of plasma membrane asymmetry during.

  5. 42 CFR 460.98 - Service delivery.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Service delivery. 460.98 Section 460.98 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED..., national origin, religion, sex, age, sexual orientation, mental or physical disability, or source of...

  6. 42 CFR 460.18 - CMS evaluation of applications.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false CMS evaluation of applications. 460.18 Section 460... ELDERLY (PACE) PACE Organization Application and Waiver Process § 460.18 CMS evaluation of applications. CMS evaluates an application for approval as a PACE organization on the basis of the following...

  7. Epigenetic status of H19/IGF2 and SNRPN imprinted genes in aborted and successfully derived embryonic stem cell lines in non-human primates

    Directory of Open Access Journals (Sweden)

    Florence Wianny

    2016-05-01

    Full Text Available The imprinted genes of primate embryonic stem cells (ESCs often show altered DNA methylation. It is unknown whether these alterations emerge while deriving the ESCs. Here we studied the methylation patterns of two differentially methylated regions (DMRs, SNRPN and H19/IGF2 DMRs, during the derivation of monkey ESCs. We show that the SNRPN DMR is characteristically methylated at maternal alleles, whereas the H19/IGF2 DMR is globally highly methylated, with unusual methylation on the maternal alleles. These methylation patterns remain stable from the early stages of ESC derivation to late passages of monkey ESCs and following differentiation. Importantly, the methylation status of H19/IGF2 DMR and the expression levels of IGF2, H19, and DNMT3B mRNAs in early embryo-derived cells were correlated with their capacity to generate genuine ESC lines. Thus, we propose that these markers could be useful to predict the outcomes of establishing an ESC line in primates.

  8. 42 CFR 460.20 - Notice of CMS determination.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Notice of CMS determination. 460.20 Section 460.20... ELDERLY (PACE) PACE Organization Application and Waiver Process § 460.20 Notice of CMS determination. (a... application to CMS, CMS takes one of the following actions: (1) Approves the application. (2) Denies the...

  9. Disturbance of DKK1 level is partly involved in survival of lung cancer cells via regulation of ROMO1 and γ-radiation sensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Gyu, E-mail: igkim@kaeri.re.kr [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Department of Radiation Biotechnology and Applied Radioisotope, University of Science and Technology (UST), 989-111 Daedeok-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of); Kim, Seo Yoen [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Biomedical Translational Research Center, Korea Research Institute of Bioscience and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806 (Korea, Republic of); Kim, Hyun A; Kim, Jeong Yul [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Lee, Jae Ha; Choi, Soo Im [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Department of Radiation Biotechnology and Applied Radioisotope, University of Science and Technology (UST), 989-111 Daedeok-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of); Han, Jeong Ran; Kim, Kug Chan [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, P.O. Box 105, Yuseong, Daejeon 305-600 (Korea, Republic of); Cho, Eun Wie [Biomedical Translational Research Center, Korea Research Institute of Bioscience and Biotechnology, 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806 (Korea, Republic of)

    2014-01-03

    Highlights: •DKK1 was expressed differently among non-small-cell lung cancer cell lines. •DKK1 negatively regulated ROMO1 gene expression. •Disturbance of DKK1 level induced the imbalance of cellular ROS. •DKK1/ROMO1-induced ROS imbalance is involved in cell survival in NSCLC. -- Abstract: Dickkopf1 (DKK1), a secreted protein involved in embryonic development, is a potent inhibitor of the Wnt signaling pathway and has been postulated to be a tumor suppressor or tumor promoter depending on the tumor type. In this study, we showed that DKK1 was expressed differently among non-small-cell lung cancer cell lines. The DKK1 expression level was much higher in A549 cells than in H460 cells. We revealed that blockage of DKK1 expression by silencing RNA in A549 cells caused up-regulation of intracellular reactive oxygen species (ROS) modulator (ROMO1) protein, followed by partial cell death, cell growth inhibition, and loss of epithelial–mesenchymal transition property caused by ROS, and it also increased γ-radiation sensitivity. DKK1 overexpression in H460 significantly inhibited cell survival with the decrease of ROMO1 level, which induced the decrease of cellular ROS. Thereafter, exogenous N-acetylcysteine, an antioxidant, or hydrogen peroxide, a pro-oxidant, partially rescued cells from death and growth inhibition. In each cell line, both overexpression and blockage of DKK1 not only elevated p-RB activation, which led to cell growth arrest, but also inactivated AKT/NF-kB, which increased radiation sensitivity and inhibited cell growth. This study is the first to demonstrate that strict modulation of DKK1 expression in different cell types partially maintains cell survival via tight regulation of the ROS-producing ROMO1 and radiation resistance.

  10. Disturbance of DKK1 level is partly involved in survival of lung cancer cells via regulation of ROMO1 and γ-radiation sensitivity

    International Nuclear Information System (INIS)

    Kim, In Gyu; Kim, Seo Yoen; Kim, Hyun A; Kim, Jeong Yul; Lee, Jae Ha; Choi, Soo Im; Han, Jeong Ran; Kim, Kug Chan; Cho, Eun Wie

    2014-01-01

    Highlights: •DKK1 was expressed differently among non-small-cell lung cancer cell lines. •DKK1 negatively regulated ROMO1 gene expression. •Disturbance of DKK1 level induced the imbalance of cellular ROS. •DKK1/ROMO1-induced ROS imbalance is involved in cell survival in NSCLC. -- Abstract: Dickkopf1 (DKK1), a secreted protein involved in embryonic development, is a potent inhibitor of the Wnt signaling pathway and has been postulated to be a tumor suppressor or tumor promoter depending on the tumor type. In this study, we showed that DKK1 was expressed differently among non-small-cell lung cancer cell lines. The DKK1 expression level was much higher in A549 cells than in H460 cells. We revealed that blockage of DKK1 expression by silencing RNA in A549 cells caused up-regulation of intracellular reactive oxygen species (ROS) modulator (ROMO1) protein, followed by partial cell death, cell growth inhibition, and loss of epithelial–mesenchymal transition property caused by ROS, and it also increased γ-radiation sensitivity. DKK1 overexpression in H460 significantly inhibited cell survival with the decrease of ROMO1 level, which induced the decrease of cellular ROS. Thereafter, exogenous N-acetylcysteine, an antioxidant, or hydrogen peroxide, a pro-oxidant, partially rescued cells from death and growth inhibition. In each cell line, both overexpression and blockage of DKK1 not only elevated p-RB activation, which led to cell growth arrest, but also inactivated AKT/NF-kB, which increased radiation sensitivity and inhibited cell growth. This study is the first to demonstrate that strict modulation of DKK1 expression in different cell types partially maintains cell survival via tight regulation of the ROS-producing ROMO1 and radiation resistance

  11. hERG1 channels are overexpressed in glioblastoma multiforme and modulate VEGF secretion in glioblastoma cell lines

    Science.gov (United States)

    Masi, A; Becchetti, A; Restano-Cassulini, R; Polvani, S; Hofmann, G; Buccoliero, A M; Paglierani, M; Pollo, B; Taddei, G L; Gallina, P; Di Lorenzo, N; Franceschetti, S; Wanke, E; Arcangeli, A

    2005-01-01

    Recent studies have led to considerable advancement in our understanding of the molecular mechanisms that underlie the relentless cell growth and invasiveness of human gliomas. Partial understanding of these mechanisms has (1) improved the classification for gliomas, by identifying prognostic subgroups, and (2) pointed to novel potential therapeutic targets. Some classes of ion channels have turned out to be involved in the pathogenesis and malignancy of gliomas. We studied the expression and properties of K+ channels in primary cultures obtained from surgical specimens: human ether a gò-gò related (hERG)1 voltage-dependent K+ channels, which have been found to be overexpressed in various human cancers, and human ether a gò-gò-like 2 channels, that share many of hERG1's biophysical features. The expression pattern of these two channels was compared to that of the classical inward rectifying K+ channels, IRK, that are widely expressed in astrocytic cells and classically considered a marker of astrocytic differentiation. In our study, hERG1 was found to be specifically overexpressed in high-grade astrocytomas, that is, glioblastoma multiforme (GBM). In addition, we present evidence that, in GBM cell lines, hERG1 channel activity actively contributes to malignancy by promoting vascular endothelial growth factor secretion, thus stimulating the neoangiogenesis typical of high-grade gliomas. Our data provide important confirmation for studies proposing the hERG1 channel as a molecular marker of tumour progression and a possible target for novel anticancer therapies. PMID:16175187

  12. Radiation induced expression of survivin in Ewing sarcoma cell-lines

    International Nuclear Information System (INIS)

    Sheikh-Mounessi, F.; Willich, N.; Greve, B.

    2009-01-01

    Full text: Introduction: Survivin belongs to the Inhibitor of Apoptosis Protein Family (IAP), is a protein of 16.5 kD and active as a homodimer. It is overexpressed in nearly all human tumors and has a vital function in cell division and apoptotic processes. Beside its role as a relevant prognostic and predictive factor it was described to be a molecular target to improve effectiveness of radiotherapy. We investigated the radiation induced survivin expression in Ewing sarcoma cell-lines. Methods: Ewing sarcoma cells were either irradiated with 10 Gy X-ray and harvested at different time points (0, 2, 4, 6, 10 and 24 h) or irradiated with different doses (0, 2, 5 and 10 Gy) and harvested 24 h later. Protein and mRNA expression was analysed by Westernblot or Real-Time PCR. Results: Directly after irradiation with 10 Gy X-ray survivin mRNA expression was increased in relation to the reference GAPDH. Protein expression was increased in a time dependent manner and reached a maximum after 24h. Three of four investigated cell-lines showed a significant dose dependent increase of survivin protein concentration 24h after irradiation. The same three cell-lines showed a LD50 of >30 Gy. The line with the lowest dose dependent survivin induction was investigated to be most radiosensitive (LD50 = 24 Gy). Discussion: Ewing sarcoma is a childhood tumor with relatively poor prognosis. This tumor often shows significant therapeutic resistance to chemo- and/or radiotherapy. It would be of high interest to find new therapeutic approaches for its treatment. We found a remarkable overexpression of survivin in untreated Ewing sarcoma and a time and dose dependent increase of survivin protein concentration after irradiation with X-ray. The cell-line with the lowest survivin induction showed the highest radiosensitivity. In conclusion, our results show that survivin is an inducible radioresistance factor in Ewing sarcoma. This may open new therapeutic options to treat this aggressive

  13. Fe3O4 nanoparticle loaded paclitaxel induce multiple myeloma apoptosis by cell cycle arrest and increase cleavage of caspases in vitro

    Science.gov (United States)

    Yang, Cuiping; He, Xiangfeng; Chen, Junsong; Chen, Dengyu; Liu, Yunjing; Xiong, Fei; Shi, Fangfang; Dou, Jun; Gu, Ning

    2013-08-01

    Multiple myeloma (MM) still remains an incurable disease in spite of extending the patient survival by new therapies. The hypothesis of cancer stem cells (CSCs) states that although chemotherapy kills most tumor cells, it is believed to leave a reservoir of CSCs that allows the tumor cell propagation. The objective of this research was to evaluate the therapeutic effect of new paclitaxel-Fe3O4 nanoparticles (PTX-NPs) with an average size range of 7.17 ± 1.31 nm on MM CSCs in vitro. The characteristics of CD138-CD34- cells, isolated from human MM RPMI 8226 and NCI-H929 cell lines by the magnetic associated cell sorting method, were identified by the assays of colony formation, cell proliferation, drug resistance, cell migration, and tumorigenicity in non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mice, respectively. Inhibitory effects of PTX-NPs on CD138-CD34- cells were evaluated by a variety of assays in vitro. The results showed that the CD138-CD34- cells were capable of forming colonies, exhibited high proliferative and migratory ability, possessed a strong drug resistance, and had powerful tumorigenicity in NOD/SCID mice compared to non-CD138-CD34- cells. PTX-NPs significantly inhibited CD138- CD34- cell viability and invasive ability, and resulted in G0/G1 cell cycle arrest and apoptosis compared with PTX alone. We concluded that the CD138-CD34- phenotype cells might be CSCs in RPMI 8226 and NCI-H929 cell lines. PTX-NPs had an obvious inhibitory effect on MM CD138-CD34- CSCs. The findings may provide a guideline for PTX-NPs' treatment of MM CSCs in preclinical investigation.

  14. Fe3O4 nanoparticle loaded paclitaxel induce multiple myeloma apoptosis by cell cycle arrest and increase cleavage of caspases in vitro

    International Nuclear Information System (INIS)

    Yang, Cuiping; He, Xiangfeng; Chen, Junsong; Chen, Dengyu; Liu, Yunjing; Xiong, Fei; Shi, Fangfang; Dou, Jun; Gu, Ning

    2013-01-01

    Multiple myeloma (MM) still remains an incurable disease in spite of extending the patient survival by new therapies. The hypothesis of cancer stem cells (CSCs) states that although chemotherapy kills most tumor cells, it is believed to leave a reservoir of CSCs that allows the tumor cell propagation. The objective of this research was to evaluate the therapeutic effect of new paclitaxel-Fe 3 O 4 nanoparticles (PTX-NPs) with an average size range of 7.17 ± 1.31 nm on MM CSCs in vitro. The characteristics of CD138 − CD34 − cells, isolated from human MM RPMI 8226 and NCI-H929 cell lines by the magnetic associated cell sorting method, were identified by the assays of colony formation, cell proliferation, drug resistance, cell migration, and tumorigenicity in non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mice, respectively. Inhibitory effects of PTX-NPs on CD138 − CD34 − cells were evaluated by a variety of assays in vitro. The results showed that the CD138 − CD34 − cells were capable of forming colonies, exhibited high proliferative and migratory ability, possessed a strong drug resistance, and had powerful tumorigenicity in NOD/SCID mice compared to non-CD138 − CD34 − cells. PTX-NPs significantly inhibited CD138 − CD34 − cell viability and invasive ability, and resulted in G0/G1 cell cycle arrest and apoptosis compared with PTX alone. We concluded that the CD138 − CD34 − phenotype cells might be CSCs in RPMI 8226 and NCI-H929 cell lines. PTX-NPs had an obvious inhibitory effect on MM CD138 − CD34 − CSCs. The findings may provide a guideline for PTX-NPs’ treatment of MM CSCs in preclinical investigation

  15. 21 CFR 522.460 - Cloprostenol sodium.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Cloprostenol sodium. 522.460 Section 522.460 Food... Cloprostenol sodium. (a)(1) Specifications. Each milliliter of the aqueous solution contains 263 micrograms of cloprostenol sodium (equivalent to 250 micrograms of cloprostenol) in a sodium citrate, anhydrous citric acid...

  16. Cell surface glycopeptides from human intestinal epithelial cell lines derived from normal colon and colon adenocarcinomas

    International Nuclear Information System (INIS)

    Youakim, A.; Herscovics, A.

    1985-01-01

    The cell surface glycopeptides from an epithelial cell line (CCL 239) derived from normal human colon were compared with those from three cell lines (HCT-8R, HCT-15, and CaCo-2) derived independently from human colonic adenocarcinomas. Cells were incubated with D-[2- 3 H]mannose or L-[5,6- 3 H]fucose for 24 h and treated with trypsin to release cell surface components which were then digested exhaustively with Pronase and fractionated on Bio-Gel P-6 before and after treatment with endo-beta-N-acetylglucosaminidase H. The most noticeable difference between the labeled glycopeptides from the tumor and CCL 239 cells was the presence in the former of an endo-beta-N-acetylglucosaminidase H-resistant high molecular weight glycopeptide fraction which was eluted in the void volume of Bio-Gel P-6. This fraction was obtained with both labeled mannose and fucose as precursors. However, acid hydrolysis of this fraction obtained after incubation with [2- 3 H]mannose revealed that as much as 60-90% of the radioactivity was recovered as fucose. Analysis of the total glycopeptides (cell surface and cell pellet) obtained after incubation with [2- 3 H]mannose showed that from 40-45% of the radioactivity in the tumor cells and less than 10% of the radioactivity in the CCL 239 cells was recovered as fucose. After incubation of the HCT-8R cells with D-[1,6- 3 H]glucosamine and L-[1- 14 C]fucose, strong acid hydrolysis of the labeled glycopeptide fraction excluded from Bio-Gel P-6 produced 3 H-labeled N-acetylglucosamine and N-acetylgalactosamine

  17. Novel electrospun gelatin/oxycellulose nanofibers as a suitable platform for lung disease modeling

    Energy Technology Data Exchange (ETDEWEB)

    Švachová, Veronika, E-mail: xcsvachova@fch.vutbr.cz [Institute of Materials Chemistry, Brno University of Technology (Czech Republic); Vojtová, Lucy [CEITEC – Central European Institute of Technology, Brno University of Technology (Czech Republic); SCITEG, a.s., Brno (Czech Republic); Pavliňák, David [Department of Physical Electronics, Masaryk University (Czech Republic); Vojtek, Libor [Institute of Experimental Biology, Masaryk University (Czech Republic); Sedláková, Veronika [Department of Histology and Embryology, Masaryk University (Czech Republic); International Clinical Research, St. Anne' s University Hospital, Brno (Czech Republic); Hyršl, Pavel [Institute of Experimental Biology, Masaryk University (Czech Republic); Alberti, Milan [Department of Physical Electronics, Masaryk University (Czech Republic); Jaroš, Josef; Hampl, Aleš [Department of Histology and Embryology, Masaryk University (Czech Republic); International Clinical Research, St. Anne' s University Hospital, Brno (Czech Republic); Jančář, Josef [Institute of Materials Chemistry, Brno University of Technology (Czech Republic); CEITEC – Central European Institute of Technology, Brno University of Technology (Czech Republic); SCITEG, a.s., Brno (Czech Republic)

    2016-10-01

    Novel hydrolytically stable gelatin nanofibers modified with sodium or calcium salt of oxycellulose were prepared by electrospinning method. The unique inhibitory effect of these nanofibers against Escherichia coli bacteria was examined by luminometric method. Biocompatibility of these gelatin/oxycellulose nanofibers with eukaryotic cells was tested using human lung adenocarcinoma cell line NCI-H441. Cells firmly adhered to nanofiber surface, as determined by scanning electron microscopy, and no signs of cell dying were detected by fluorescent live/dead assay. We propose that the newly developed gelatin/oxycellulose nanofibers could be used as promising scaffold for lung disease modeling and anti-cancer drug testing. - Highlights: • Novel hydrolytically stable gelatin nanofibers modified with oxycellulose were prepared by electrospinning. • ATR–FTIR spectroscopy and EDX confirmed the presence of oxycellulose in the nanofibers. • Nanofibers modified with calcium salt of oxycellulose exhibited significant antibacterial properties. • Nanofibers modified with sodium salt of oxycellulose revealed excellent biocompatibility with cell line NCI-H441.

  18. Proteasome inhibitors block DNA repair and radiosensitize non-small cell lung cancer.

    Directory of Open Access Journals (Sweden)

    Kyle R Cron

    Full Text Available Despite optimal radiation therapy (RT, chemotherapy and/or surgery, a majority of patients with locally advanced non-small cell lung cancer (NSCLC fail treatment. To identify novel gene targets for improved tumor control, we performed whole genome RNAi screens to identify knockdowns that most reproducibly increase NSCLC cytotoxicity. These screens identified several proteasome subunits among top hits, including the topmost hit PSMA1, a component of the core 20 S proteasome. Radiation and proteasome inhibition showed synergistic effects. Proteasome inhibition resulted in an 80-90% decrease in homologous recombination (HR, a 50% decrease in expression of NF-κB-inducible HR genes BRCA1 and FANCD2, and a reduction of BRCA1, FANCD2 and RAD51 ionizing radiation-induced foci. IκBα RNAi knockdown rescued NSCLC radioresistance. Irradiation of mice with NCI-H460 xenografts after inducible PSMA1 shRNA knockdown markedly increased murine survival compared to either treatment alone. Proteasome inhibition is a promising strategy for NSCLC radiosensitization via inhibition of NF-κB-mediated expression of Fanconi Anemia/HR DNA repair genes.

  19. 16 CFR 460.11 - Rounding off R-values.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Rounding off R-values. 460.11 Section 460.11... INSULATION § 460.11 Rounding off R-values. R-values shown in labels, fact sheets, ads, or other promotional materials must be rounded to the nearest tenth. However, R-values of 10 or more may be rounded to the...

  20. Generation, isolation, and maintenance of rodent mast cells and mast cell lines

    DEFF Research Database (Denmark)

    Jensen, Bettina M; Swindle, Emily J; Iwaki, Shoko

    2006-01-01

    Antigen-mediated mast cell activation, with subsequent mediator release, is a major initiator of the inflammatory allergic response associated with such conditions as asthma. A comprehensive understanding of the principles involved in this process therefore is key to the development of novel...... therapies for the treatment of these disease states. In vitro models of mast cell function have allowed significant progress to be made in the recognition of the fundamental principles of mast cell activation via the high-affinity IgE receptor (FcvarepsilonRI) and, more recently, other receptors expressed...... on mast cells. In addition to human mast cells, the major cell culture systems employed to investigate these responses are rat and mouse peritoneal mast cells, mouse bone-marrow-derived mast cells, the rat basophilic leukemia cell line RBL-2H3, and the mouse MC/9 mast cell line. In this unit, we describe...

  1. Cooperative regulation of non-small cell lung carcinoma by nicotinic and beta-adrenergic receptors: a novel target for intervention.

    Directory of Open Access Journals (Sweden)

    Hussein A N Al-Wadei

    Full Text Available Lung cancer is the leading cause of cancer death; 80-85% of lung cancer cases are non-small cell lung cancer (NSCLC. Smoking is a documented risk factor for the development of this cancer. Although nicotine does not have the ability to initiate carcinogenic events, recent studies have implicated nicotine in growth stimulation of NSCLC. Using three NSCLC cell lines (NCI-H322, NCI-H441 and NCI-H1299, we identified the cooperation of nicotinic acetylcholine receptors (nAChRs and β-adrenergic receptors (β-ARs as principal regulators of these effects. Proliferation was measured by thymidine incorporation and MTT assays, and Western blots were used to monitor the upregulation of the nAChRs and activation of signaling molecules. Noradrenaline and GABA were measured by immunoassays. Nicotine-treated NSCLC cells showed significant induction of the α7nAChR and α4nAChR, along with significant inductions of p-CREB and p-ERK1/2 accompanied by increases in the stress neurotransmitter noradrenaline, which in turn led to the observed increase in DNA synthesis and cell proliferation. Effects on cell proliferation and signaling proteins were reversed by the α7nAChR antagonist α-BTX or the β-blocker propranolol. Nicotine treatment also down-regulated expression of the GABA synthesizing enzyme GAD 65 and the level of endogenous GABA, while treatment of NSCLC cells with GABA inhibited cell proliferation. Interestingly, GABA acts by reducing β-adrenergic activated cAMP signaling. Our findings suggest that nicotine-induced activation of this autocrine noradrenaline-initiated signaling cascade and concomitant deficiency in inhibitory GABA, similar to modulation of these neurotransmitters in the nicotine-addicted brain, may contribute to the development of NSCLC in smokers. Our data suggest that exposure to nicotine either by tobacco smoke or nicotine supplements facilitates growth and progression of NSCLC and that pharmacological intervention by β blocker may

  2. NCI Pediatric Preclinical Testing Consortium

    Science.gov (United States)

    NCI has awarded grants to five research teams to participate in its Pediatric Preclinical Testing Consortium, which is intended to help to prioritize which agents to pursue in pediatric clinical trials.

  3. Fe{sub 3}O{sub 4} nanoparticle loaded paclitaxel induce multiple myeloma apoptosis by cell cycle arrest and increase cleavage of caspases in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Cuiping [Medical School, Southeast University, Department of Pathogenic Biology and Immunology (China); He, Xiangfeng [Affiliated Tumor Hospital of Nantong University, Department of Medical Oncology (China); Chen, Junsong; Chen, Dengyu; Liu, Yunjing [Medical School, Southeast University, Department of Pathogenic Biology and Immunology (China); Xiong, Fei [Southeast University, School of Biological Science and Medical Engineering (China); Shi, Fangfang [Zhongda Hospital, Southeast University, Department of Oncology (China); Dou, Jun, E-mail: njdoujun@yahoo.com.cn [Medical School, Southeast University, Department of Pathogenic Biology and Immunology (China); Gu, Ning, E-mail: guning@seu.edu.cn [Southeast University, School of Biological Science and Medical Engineering (China)

    2013-08-15

    Multiple myeloma (MM) still remains an incurable disease in spite of extending the patient survival by new therapies. The hypothesis of cancer stem cells (CSCs) states that although chemotherapy kills most tumor cells, it is believed to leave a reservoir of CSCs that allows the tumor cell propagation. The objective of this research was to evaluate the therapeutic effect of new paclitaxel-Fe{sub 3}O{sub 4} nanoparticles (PTX-NPs) with an average size range of 7.17 {+-} 1.31 nm on MM CSCs in vitro. The characteristics of CD138{sup -}CD34{sup -} cells, isolated from human MM RPMI 8226 and NCI-H929 cell lines by the magnetic associated cell sorting method, were identified by the assays of colony formation, cell proliferation, drug resistance, cell migration, and tumorigenicity in non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mice, respectively. Inhibitory effects of PTX-NPs on CD138{sup -}CD34{sup -} cells were evaluated by a variety of assays in vitro. The results showed that the CD138{sup -}CD34{sup -} cells were capable of forming colonies, exhibited high proliferative and migratory ability, possessed a strong drug resistance, and had powerful tumorigenicity in NOD/SCID mice compared to non-CD138{sup -}CD34{sup -} cells. PTX-NPs significantly inhibited CD138{sup -} CD34{sup -} cell viability and invasive ability, and resulted in G0/G1 cell cycle arrest and apoptosis compared with PTX alone. We concluded that the CD138{sup -}CD34{sup -} phenotype cells might be CSCs in RPMI 8226 and NCI-H929 cell lines. PTX-NPs had an obvious inhibitory effect on MM CD138{sup -}CD34{sup -} CSCs. The findings may provide a guideline for PTX-NPs' treatment of MM CSCs in preclinical investigation.

  4. Comparison of mammalian and fish cell line cytotoxicity: impact of endpoint and exposure duration

    International Nuclear Information System (INIS)

    Guelden, Michael; Moerchel, Sabine; Seibert, Hasso

    2005-01-01

    Comparisons of acute toxic concentrations of chemicals to fish in vivo and cytotoxic concentrations to fish cell lines in vitro reveal rather good correlations of the toxic potencies in vitro and in vivo, but a clearly lower sensitivity of the fish cells. To examine whether the low sensitivity is specific for fish cells, cytotoxic potencies of reference chemicals from the Multicenter Evaluation of In Vitro Cytotoxicity program (MEIC) reported for the fish cell lines R1 and RTG-2 were compared with those obtained with the mouse Balb/c 3T3 cell line. Cytotoxic potencies (EC 50 values) for MEIC reference chemicals were determined with exponentially growing Balb/c 3T3 cells using three different test protocols. To assess both endpoints, cell proliferation and cell survival, EC 50 values were measured for the decrease in final cell protein after 24 and 72 h of exposure and for the reduction of cell protein increase during 24 h of exposure. EC 50 values obtained with the fish cell lines R1 and RTG-2 using cell survival as endpoint were taken from the MEIC data base. The comparison of cytotoxic potencies shows that, in general, the fish cell lines and the mammalian cell line are almost equally sensitive towards the cytotoxic action of chemicals. The mammalian cell line assay, however, becomes considerably more sensitive, by factors of 3.4-8.5, than the fish cell line assays, if cell growth instead of cell survival is used as endpoint. It is concluded, that cell proliferation might be a better endpoint than cell survival and that mammalian cell lines might be suited to assess fish acute toxicity

  5. Cell lines derived from the squash bug, Anasa tristis (Coreidae: Hemiptera).

    Science.gov (United States)

    Goodman, Cynthia L; Ringbauer, Joseph A; Li, Yao-Fa; Lincoln, Tamra Reall; Stanley, David

    2017-05-01

    The squash bug, Anasa tristis, is a pest of cucurbits that exerts direct damage on crops and is a vector of plant pathogens. We established cell lines from this insect to serve as tools for basic biology, including virology and immunology, as well as applied studies, such as insecticide development programs. We initiated 15 cell cultures, using nine media or combinations of media. The media yielding the best results were a modification of Kimura's medium and a combination of two commercially available cell culture media (EX-CELL 420 and L15). We designated the two cell lines as BCIRL-AtE-CLG11 and BCIRL-AtE-CLG15. From the AtE-CLG15 line, we isolated two sub-lines, A and B. Of these, the most consistently replicating line was AtE-CLG15A. We determined the doubling time of this line (190 h) and its mean cell diameter (14.5 ± 0.7 μm). We characterized the AtE-CLG15A line using DAF-PCR. The BCIRL-AtE-CLG15A cell line is now available for researchers world-wide.

  6. Role of Insulin-Like Growth Factor-1 Signaling Pathway in Cisplatin-Resistant Lung Cancer Cells

    International Nuclear Information System (INIS)

    Sun Yunguang; Zheng Siyuan; Torossian, Artour; Speirs, Christina K.; Schleicher, Stephen; Giacalone, Nicholas J.; Carbone, David P.; Zhao Zhongming; Lu Bo

    2012-01-01

    Purpose: The development of drug-resistant phenotypes has been a major obstacle to cisplatin use in non–small-cell lung cancer. We aimed to identify some of the molecular mechanisms that underlie cisplatin resistance using microarray expression analysis. Methods and Materials: H460 cells were treated with cisplatin. The differences between cisplatin-resistant lung cancer cells and parental H460 cells were studied using Western blot, MTS, and clonogenic assays, in vivo tumor implantation, and microarray analysis. The cisplatin-R cells were treated with human recombinant insulin-like growth factor (IGF) binding protein-3 and siRNA targeting IGF-1 receptor. Results: Cisplatin-R cells illustrated greater expression of the markers CD133 and aldehyde dehydrogenase, more rapid in vivo tumor growth, more resistance to cisplatin- and etoposide-induced apoptosis, and greater survival after treatment with cisplatin or radiation than the parental H460 cells. Also, cisplatin-R demonstrated decreased expression of insulin-like growth factor binding protein-3 and increased activation of IGF-1 receptor signaling compared with parental H460 cells in the presence of IGF-1. Human recombinant IGF binding protein-3 reversed cisplatin resistance in cisplatin-R cells and targeting of IGF-1 receptor using siRNA resulted in sensitization of cisplatin-R-cells to cisplatin and radiation. Conclusions: The IGF-1 signaling pathway contributes to cisplatin-R to cisplatin and radiation. Thus, this pathway represents a potential target for improved lung cancer response to treatment.

  7. Role of Insulin-Like Growth Factor-1 Signaling Pathway in Cisplatin-Resistant Lung Cancer Cells

    Energy Technology Data Exchange (ETDEWEB)

    Sun Yunguang [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Zheng Siyuan [Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN (United States); Torossian, Artour; Speirs, Christina K.; Schleicher, Stephen; Giacalone, Nicholas J. [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Carbone, David P. [Department of Hematology and Oncology, Vanderbilt University Medical Center, Nashville, TN (United States); Zhao Zhongming, E-mail: zhongming.zhao@vanderbilt.edu [Department of Biomedical Informatics, Vanderbilt University Medical Center, Nashville, TN (United States); Lu Bo, E-mail: bo.lu@vanderbilt.edu [Department of Radiation Oncology, Vanderbilt University Medical Center, Nashville, TN (United States)

    2012-03-01

    Purpose: The development of drug-resistant phenotypes has been a major obstacle to cisplatin use in non-small-cell lung cancer. We aimed to identify some of the molecular mechanisms that underlie cisplatin resistance using microarray expression analysis. Methods and Materials: H460 cells were treated with cisplatin. The differences between cisplatin-resistant lung cancer cells and parental H460 cells were studied using Western blot, MTS, and clonogenic assays, in vivo tumor implantation, and microarray analysis. The cisplatin-R cells were treated with human recombinant insulin-like growth factor (IGF) binding protein-3 and siRNA targeting IGF-1 receptor. Results: Cisplatin-R cells illustrated greater expression of the markers CD133 and aldehyde dehydrogenase, more rapid in vivo tumor growth, more resistance to cisplatin- and etoposide-induced apoptosis, and greater survival after treatment with cisplatin or radiation than the parental H460 cells. Also, cisplatin-R demonstrated decreased expression of insulin-like growth factor binding protein-3 and increased activation of IGF-1 receptor signaling compared with parental H460 cells in the presence of IGF-1. Human recombinant IGF binding protein-3 reversed cisplatin resistance in cisplatin-R cells and targeting of IGF-1 receptor using siRNA resulted in sensitization of cisplatin-R-cells to cisplatin and radiation. Conclusions: The IGF-1 signaling pathway contributes to cisplatin-R to cisplatin and radiation. Thus, this pathway represents a potential target for improved lung cancer response to treatment.

  8. Radiation Response of Cancer Stem-Like Cells From Established Human Cell Lines After Sorting for Surface Markers

    International Nuclear Information System (INIS)

    Al-Assar, Osama; Muschel, Ruth J.; Mantoni, Tine S.; McKenna, W. Gillies; Brunner, Thomas B.

    2009-01-01

    Purpose: A subpopulation of cancer stem-like cells (CSLC) is hypothesized to exist in different cancer cell lines and to mediate radioresistance in solid tumors. Methods and Materials: Cells were stained for CSLC markers and sorted (fluorescence-activated cell sorter/magnetic beads) to compare foci and radiosensitivity of phosphorylated histone H2AX at Ser 139 (γ-H2AX) in sorted vs. unsorted populations in eight cell lines from different organs. CSLC properties were examined using anchorage-independent growth and levels of activated Notch1. Validation consisted of testing tumorigenicity and postirradiation enrichment of CSLC in xenograft tumors. Results: The quantity of CSLC was generally in good agreement with primary tumors. CSLC from MDA-MB-231 (breast) and Panc-1 and PSN-1 (both pancreatic) cells had fewer residual γ-H2AX foci than unsorted cells, pointing to radioresistance of CSLC. However, only MDA-MB-231 CSLC were more radioresistant than unsorted cells. Furthermore, MDA-MB-231 CSLC showed enhanced anchorage-independent growth and overexpression of activated Notch1 protein. The expression of cancer stem cell surface markers in the MDA-MB-231 xenograft model was increased after exposure to fractionated radiation. In contrast to PSN-1 cells, a growth advantage for MDA-MB-231 CSLC xenograft tumors was found compared to tumors arising from unsorted cells. Conclusions: CSLC subpopulations showed no general radioresistant phenotype, despite the quantities of CSLC subpopulations shown to correspond relatively well in other reports. Likewise, CSLC characteristics were found in some but not all of the tested cell lines. The reported problems in testing for CSLC in cell lines may be overcome by additional techniques, beyond sorting for markers.

  9. A comparative evaluation of in vitro skin sensitisation tests: the human cell-line activation test (h-CLAT) versus the local lymph node assay (LLNA).

    Science.gov (United States)

    Ashikaga, Takao; Sakaguchi, Hitoshi; Sono, Sakiko; Kosaka, Nanae; Ishikawa, Makie; Nukada, Yuko; Miyazawa, Masaaki; Ito, Yuichi; Nishiyama, Naohiro; Itagaki, Hiroshi

    2010-08-01

    We previously developed the human cell-line activation test (h-CLAT) in vitro skin sensitisation test, based on our reported finding that a 24-hour exposure of THP-1 cells (a human monocytic leukaemia cell line) to sensitisers is sufficient to induce the augmented expression of CD86 and CD54. The aim of this study is to confirm the predictive value of h-CLAT for skin sensitisation activity by employing a larger number of test chemicals. One hundred chemicals were selected, according to their categorisation in the local lymph node assay (LLNA), as being: extreme, strong, moderate and weak sensitisers, and non-sensitisers. The correlation of the h-CLAT results with the LLNA results was 84%. There were some false negatives (e.g. benzoyl peroxide, hexyl cinnamic aldehyde) and some false positives (e.g. 1-bromobutane, diethylphthalate). Eight out of the 9 false negatives (89%) were water-insoluble chemicals. The h-CLAT could positively predict not only extreme and strong sensitisers, but also moderate and weak sensitisers, though the detection rates of weak sensitisers and non-sensitisers were comparatively low. Some sensitisers enhanced both CD86 and CD54 levels, and some enhanced the level of only one of them. The use of the combination of CD86 and CD54 induction as a positive indicator, improved the accuracy of the test. In conclusion, the h-CLAT is expected to be a useful cell-based in vitro method for predicting skin sensitisation potential. 2010 FRAME.

  10. Single-cell intracellular nano-pH probes†

    Science.gov (United States)

    Özel, Rıfat Emrah; Lohith, Akshar; Mak, Wai Han; Pourmand, Nader

    2016-01-01

    Within a large clonal population, such as cancerous tumor entities, cells are not identical, and the differences between intracellular pH levels of individual cells may be important indicators of heterogeneity that could be relevant in clinical practice, especially in personalized medicine. Therefore, the detection of the intracellular pH at the single-cell level is of great importance to identify and study outlier cells. However, quantitative and real-time measurements of the intracellular pH of individual cells within a cell population is challenging with existing technologies, and there is a need to engineer new methodologies. In this paper, we discuss the use of nanopipette technology to overcome the limitations of intracellular pH measurements at the single-cell level. We have developed a nano-pH probe through physisorption of chitosan onto hydroxylated quartz nanopipettes with extremely small pore sizes (~100 nm). The dynamic pH range of the nano-pH probe was from 2.6 to 10.7 with a sensitivity of 0.09 units. We have performed single-cell intracellular pH measurements using non-cancerous and cancerous cell lines, including human fibroblasts, HeLa, MDA-MB-231 and MCF-7, with the pH nanoprobe. We have further demonstrated the real-time continuous single-cell pH measurement capability of the sensor, showing the cellular pH response to pharmaceutical manipulations. These findings suggest that the chitosan-functionalized nanopore is a powerful nano-tool for pH sensing at the single-cell level with high temporal and spatial resolution. PMID:27708772

  11. Single-cell intracellular nano-pH probes.

    Science.gov (United States)

    Özel, Rıfat Emrah; Lohith, Akshar; Mak, Wai Han; Pourmand, Nader

    2015-01-01

    Within a large clonal population, such as cancerous tumor entities, cells are not identical, and the differences between intracellular pH levels of individual cells may be important indicators of heterogeneity that could be relevant in clinical practice, especially in personalized medicine. Therefore, the detection of the intracellular pH at the single-cell level is of great importance to identify and study outlier cells. However, quantitative and real-time measurements of the intracellular pH of individual cells within a cell population is challenging with existing technologies, and there is a need to engineer new methodologies. In this paper, we discuss the use of nanopipette technology to overcome the limitations of intracellular pH measurements at the single-cell level. We have developed a nano-pH probe through physisorption of chitosan onto hydroxylated quartz nanopipettes with extremely small pore sizes (~100 nm). The dynamic pH range of the nano-pH probe was from 2.6 to 10.7 with a sensitivity of 0.09 units. We have performed single-cell intracellular pH measurements using non-cancerous and cancerous cell lines, including human fibroblasts, HeLa, MDA-MB-231 and MCF-7, with the pH nanoprobe. We have further demonstrated the real-time continuous single-cell pH measurement capability of the sensor, showing the cellular pH response to pharmaceutical manipulations. These findings suggest that the chitosan-functionalized nanopore is a powerful nano-tool for pH sensing at the single-cell level with high temporal and spatial resolution.

  12. Effect of pentoxifylline on P-glycoprotein mediated vincristine resistance of L1210 mouse leukemic cell line

    International Nuclear Information System (INIS)

    Breier, A.; Uhrik, B.; Barancik, M.; Stefankova, Z.; Tribulova, N.

    1994-01-01

    Effect of pentoxifylline (PTX) on vincristine (VCR) resistance of multidrug resistant L1210/VCR mouse leukemic cell line was studied. Reversal effect of PTX (in concentration 50-150 mg dm -3 ) on vincristine resistance, i.e. potentiation of vincristine cytotoxicity on L1210/VCR cells by PTX was found. PTX alone in the above concentration did not exert any significant effect on sensitive or resistant cell lines in the absence of vincristine. Resistance of L1210/VCR cell line was found previously to be accompanied with overexpression of drug transporting P-glycoprotein. Indeed, lower level of 3 H-vincristine accumulation by resistant L1210/VCR cell line in comparison with sensitive L1210 cell line was observed. Accumulation of 3 H-vincristine by L1210/VCR cell line was significantly increased in the presence of PTX. PTX in the same condition did not exert any considerable effect on accumulation of 3 H-vincristine by nonresistant L1210 cells. Observable morphological damage was observed in 1210/VCR cells cultivated in medium containing vincristine (0.2 mg dm -3 ) and pentoxifylline (100 mg dm -3 ) in comparison with the non-damaged cells in the presence of vincristine or pentoxifylline alone. The results obtained indicate that pentoxifylline may be considered as a reversal agent in multidrug resistance. (author)

  13. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  14. Effects of hypoxia on human cancer cell line chemosensitivity

    Science.gov (United States)

    2013-01-01

    Background Environment inside even a small tumor is characterized by total (anoxia) or partial oxygen deprivation, (hypoxia). It has been shown that radiotherapy and some conventional chemotherapies may be less effective in hypoxia, and therefore it is important to investigate how different drugs act in different microenvironments. In this study we perform a large screening of the effects of 19 clinically used or experimental chemotherapeutic drugs on five different cell lines in conditions of normoxia, hypoxia and anoxia. Methods A panel of 19 commercially available drugs: 5-fluorouracil, acriflavine, bortezomib, cisplatin, digitoxin, digoxin, docetaxel, doxorubicin, etoposide, gemcitabine, irinotecan, melphalan, mitomycin c, rapamycin, sorafenib, thalidomide, tirapazamine, topotecan and vincristine were tested for cytotoxic activity on the cancer cell lines A2780 (ovarian), ACHN (renal), MCF-7 (breast), H69 (SCLC) and U-937 (lymphoma). Parallel aliquots of the cells were grown at different oxygen pressures and after 72 hours of drug exposure viability was measured with the fluorometric microculture cytotoxicity assay (FMCA). Results Sorafenib, irinotecan and docetaxel were in general more effective in an oxygenated environment, while cisplatin, mitomycin c and tirapazamine were more effective in a low oxygen environment. Surprisingly, hypoxia in H69 and MCF-7 cells mostly rendered higher drug sensitivity. In contrast ACHN appeared more sensitive to hypoxia, giving slower proliferating cells, and consequently, was more resistant to most drugs. Conclusions A panel of standard cytotoxic agents was tested against five different human cancer cell lines cultivated at normoxic, hypoxic and anoxic conditions. Results show that impaired chemosensitivity is not universal, in contrast different cell lines behave different and some drugs appear even less effective in normoxia than hypoxia. PMID:23829203

  15. Safety and performance analysis of acriflavine and methylene blue for in vivo imaging of precancerous lesions using fibered confocal fluorescence microscopy (FCFM): an experimental study.

    Science.gov (United States)

    Obstoy, Bérengère; Salaun, Mathieu; Veresezan, Liana; Sesboüé, Richard; Bohn, Pierre; Boland, François-Xavier; Thiberville, Luc

    2015-03-31

    Fibered confocal fluorescence microscopy (FCFM) allows in vivo investigation of pulmonary microstructures. However, the bronchial epithelium can only be imaged using exogenous fluorophores. The objective of this study is to compare methylene blue (MB) and acriflavine genotoxicity and to assess FCFM performance for in vivo imaging of precancerous lesions. Genotoxicity was assessed using the comet assay on both cultured human lymphocytes and NCI-H460 cells, which had been exposed to MB or acriflavine before being illuminated at 660 or 488 nm, respectively. FCFM was performed on precancerous lesions in the hamster cheek pouch model, following topical application of the fluorophores. FCFM data were analyzed according to histology. No genotoxicity was found using 0.01% (w/v) MB after illumination at 660 nm for 2 and 15 min (5 mW). Acriflavine exposure (0.025%) led to DNA damages, increasing from 2 to 15 min of light exposure at 448 nm in both lymphocytes (83.4 to 88%, p = 0.021) and NCI H460 cell populations (79.9 to 84.6%, p = 0.045). In total, 11 invasive carcinoma, 24 reserve cell hyperplasia, and 17 dysplasia lesions were imaged using FCFM in vivo. With both fluorophores, the cellular density increased from hyperplasia to high-grade dysplasia (p < 0.05). With MB, the cellular diameter significantly decreased (48.9 to 13.9 μm) from hyperplasia to carcinoma (p < 0.05). In this model, a cut-off diameter of 30 μm enabled the diagnosis of high-grade lesions with a sensitivity of 94.7% and a specificity of 97%. Methylene blue can be used safely to image precancerous lesions in vivo. This study does not support the use of acriflavine in humans.

  16. NCI's Role in Immunotherapy Research

    Science.gov (United States)

    ... Reporting & Auditing Grant Transfer Grant Closeout Contracts & Small Business Training Cancer Training at NCI (Intramural) Resources for ... promising immunotherapies to the clinic more efficiently and cost effectively. For ... of the checkpoint inhibitor pembrolizumab in patients with ...

  17. Functional expression of a proton-coupled organic cation (H+/OC antiporter in human brain capillary endothelial cell line hCMEC/D3, a human blood–brain barrier model

    Directory of Open Access Journals (Sweden)

    Shimomura Keita

    2013-01-01

    Full Text Available Abstract Background Knowledge of the molecular basis and transport function of the human blood–brain barrier (BBB is important for not only understanding human cerebral physiology, but also development of new central nervous system (CNS-acting drugs. However, few studies have been done using human brain capillary endothelial cells, because human brain materials are difficult to obtain. The purpose of this study is to clarify the functional expression of a proton-coupled organic cation (H+/OC antiporter in human brain capillary endothelial cell line hCMEC/D3, which has been recently developed as an in vitro human BBB model. Methods Diphenhydramine, [3H]pyrilamine and oxycodone were used as cationic drugs that proved to be H+/OC antiporter substrates. The in vitro uptake experiments by hCMEC/D3 cells were carried out under several conditions. Results Diphenhydramine and [3H]pyrilamine were both transported into hCMEC/D3 cells in a time- and concentration-dependent manner with Km values of 59 μM and 19 μM, respectively. Each inhibited uptake of the other in a competitive manner, suggesting that a common mechanism is involved in their transport. The diphenhydramine uptake was significantly inhibited by amantadine and quinidine, but not tetraethylammonium and 1-methyl-4-phenylpyridinium (substrates for well-known organic cation transporters. The uptake was inhibited by metabolic inhibitors, but was insensitive to extracellular sodium and membrane potential. Further, the uptake was increased by extracellular alkalization and intracellular acidification. These transport properties are completely consistent with those of previously characterized H+/OC antiporter in rat BBB. Conclusions The present results suggest that H+/OC antiporter is functionally expressed in hCMEC/D3 cells.

  18. Cell lines authentication and mycoplasma detection as minimun quality control of cell lines in biobanking.

    Science.gov (United States)

    Corral-Vázquez, C; Aguilar-Quesada, R; Catalina, P; Lucena-Aguilar, G; Ligero, G; Miranda, B; Carrillo-Ávila, J A

    2017-06-01

    Establishment of continuous cell lines from human normal and tumor tissues is an extended and useful methodology for molecular characterization of cancer pathophysiology and drug development in research laboratories. The exchange of these cell lines between different labs is a common practice that can compromise assays reliability due to contamination with microorganism such as mycoplasma or cells from different flasks that compromise experiment reproducibility and reliability. Great proportions of cell lines are contaminated with mycoplasma and/or are replaced by cells derived for a different origin during processing or distribution process. The scientific community has underestimated this problem and thousand of research experiment has been done with cell lines that are incorrectly identified and wrong scientific conclusions have been published. Regular contamination and authentication tests are necessary in order to avoid negative consequences of widespread misidentified and contaminated cell lines. Cell banks generate, store and distribute cell lines for research, being mandatory a consistent and continuous quality program. Methods implementation for guaranteeing both, the absence of mycoplasma and authentication in the supplied cell lines, has been performed in the Andalusian Health System Biobank. Specifically, precise results were obtained using real time PCR detection for mycoplasma and 10 STRs identification by capillary electrophoresis for cell line authentication. Advantages and disadvantages of these protocols are discussed.

  19. Radio recombination lines from H II regions

    International Nuclear Information System (INIS)

    Silverglate, P.R.

    1978-01-01

    Radio recombination lines have been observed from forty-six H II regions. The Arecibo 1000-foot radio telescope was used to provide high sensitivity and high angular resolution at 1400 MHz (gain approx. 7.7 0 K/Jy, HPBW = 3:2) and 2372 MHZ (gain approx. 6.3 0 K/Jy, HPBW = 2'). Observations were made at 1400 MHz in the frequency switching mode, and at 2372 MHz in the total power mode. Gaussians were fit to be observed lines to derive velocities, line widths, and line temperatures. From the velocities kinematic distances were derived. For eleven sources H I absorption measurements were also made. The absorption spectra enabled the kinematic distance ambiguity to be resolved for some sources. The absorption spectra themselves were found to have extremely sharp, non-gaussian edges. One explanation for these is a model where the interstellar medium contains many H I cloudlets with T/sub s/less than or equal to 100 0 K and turbulent velocities less than or equal to 3 km/s. The H I absorption spectrum is then a superposition of many narrow gaussian profiles. It was also found from a comparison of H I absorption velocities with radio recombination line velocities that peculiar motions exist in the interstellar medium with velocities of up to 10 km/s. Using the measured line temperatures and continuum temperatures, estimates were desired of emission measures, electron temperatures, and electron densities, using a non-LTE analysis. Non-LTE effects were important only for the hottest and densest H II regions. The non-LTE calculations were checked through a comparison derivation of electron temperatures using hydrogen beta lines

  20. Sulforaphane causes epigenetic repression of hTERT expression in human breast cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Syed M Meeran

    Full Text Available BACKGROUND: Sulforaphane (SFN, an isothiocyanate found in cruciferous vegetables, is a common dietary component that has histone deacetylase inhibition activity and exciting potential in cancer prevention. The mechanisms by which SFN imparts its chemopreventive properties are of considerable interest and little is known of its preventive potential for breast cancer. PRINCIPAL FINDINGS: We found that SFN significantly inhibits the viability and proliferation of breast cancer cells in vitro while it has negligible effects on normal breast cells. Inhibition of telomerase has received considerable attention because of its high expression in cancer cells and extremely low level of expression in normal cells. SFN treatment dose- and time-dependently inhibited human telomerase reverse transcriptase (hTERT, the catalytic regulatory subunit of telomerase, in both MCF-7 and MDA-MB-231 human breast cancer cells. DNA methyltransferases (DNMTs, especially DNMT1 and DNMT3a, were also decreased in SFN-treated breast cancer cells suggesting that SFN may repress hTERT by impacting epigenetic pathways. Down-regulation of DNMTs in response to SFN induced site-specific CpG demethylation occurring primarily in the first exon of the hTERT gene thereby facilitating CTCF binding associated with hTERT repression. Chromatin immunoprecipitation (ChIP analysis of the hTERT promoter revealed that SFN increased the level of active chromatin markers acetyl-H3, acetyl-H3K9 and acetyl-H4, whereas the trimethyl-H3K9 and trimethyl-H3K27 inactive chromatin markers were decreased in a dose-dependent manner. SFN-induced hyperacetylation facilitated the binding of many hTERT repressor proteins such as MAD1 and CTCF to the hTERT regulatory region. Depletion of CTCF using siRNA reduced the SFN-induced down-regulation of hTERT mRNA transcription in these breast cancer cells. In addition, down-regulation of hTERT expression facilitated the induction of cellular apoptosis in human breast

  1. Osimertinib induces autophagy and apoptosis via reactive oxygen species generation in non-small cell lung cancer cells

    International Nuclear Information System (INIS)

    Tang, Zheng-Hai; Cao, Wen-Xiang; Su, Min-Xia; Chen, Xiuping; Lu, Jin-Jian

    2017-01-01

    Osimertinib (OSI), also known as AZD9291, is a third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor that has been approved for the treatment of non-small cell lung cancer (NSCLC) patients harboring EGFR T790M mutation. Herein, we indicated for the first time that OSI increased the accumulations of cytoplasmic vacuoles, the expression of phosphatidylethanolamine-modified microtubule-associated protein light-chain 3 (LC3-II), and the formation of GFP-LC3 puncta in various cancer cells. The OSI-induced expression of LC3-II was further increased when combined treatment with chloroquine (CQ), an autophagy inhibitor, and the mRFP-EGFP-LC3 plasmid-transfected cells exposed to OSI led to the production of more red-fluorescent puncta than green-fluorescent puncta, indicating OSI induced autophagic flux in the NSCLC cells. Knockdown of EGFR showed no effect on the OSI-induced expression of LC3-II in NCI-H1975 cells. In addition, OSI increased reactive oxygen species (ROS) generation and scavenge of ROS via pretreatment with N-acetyl-L-cysteine (NAC), catalase (CAT), or vitamin E (Vita E) significantly inhibited OSI-induced the accumulations of cytoplasmic vacuoles, the expression of LC3-II, as well as the formation of GFP-LC3 puncta. Combinative treatment with CQ could not remarkably change the OSI-induced cell viability decrease, whereas the OSI-induced cell viability decrease and apoptosis could be reversed through pretreatment with NAC, CAT, and Vita E, respectively. Taken together, this is the first report that OSI induces an accompanied autophagy and the generation of ROS is critical for the OSI-induced autophagy, cell viability decrease, and apoptosis in NSCLC cells. - Highlights: • Osimertinib induced the expressions of cytoplasmic vacuoles and autophagic markers in different cancer cells. • Osimertinib induced autophagic flux in NSCLC NCI-H1975 and HCC827 cell lines. • ROS generation contributed to osimertinib-induced cytoplasmic

  2. Osimertinib induces autophagy and apoptosis via reactive oxygen species generation in non-small cell lung cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Zheng-Hai; Cao, Wen-Xiang; Su, Min-Xia; Chen, Xiuping; Lu, Jin-Jian, E-mail: jinjianlu@umac.mo

    2017-04-15

    Osimertinib (OSI), also known as AZD9291, is a third-generation epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor that has been approved for the treatment of non-small cell lung cancer (NSCLC) patients harboring EGFR T790M mutation. Herein, we indicated for the first time that OSI increased the accumulations of cytoplasmic vacuoles, the expression of phosphatidylethanolamine-modified microtubule-associated protein light-chain 3 (LC3-II), and the formation of GFP-LC3 puncta in various cancer cells. The OSI-induced expression of LC3-II was further increased when combined treatment with chloroquine (CQ), an autophagy inhibitor, and the mRFP-EGFP-LC3 plasmid-transfected cells exposed to OSI led to the production of more red-fluorescent puncta than green-fluorescent puncta, indicating OSI induced autophagic flux in the NSCLC cells. Knockdown of EGFR showed no effect on the OSI-induced expression of LC3-II in NCI-H1975 cells. In addition, OSI increased reactive oxygen species (ROS) generation and scavenge of ROS via pretreatment with N-acetyl-L-cysteine (NAC), catalase (CAT), or vitamin E (Vita E) significantly inhibited OSI-induced the accumulations of cytoplasmic vacuoles, the expression of LC3-II, as well as the formation of GFP-LC3 puncta. Combinative treatment with CQ could not remarkably change the OSI-induced cell viability decrease, whereas the OSI-induced cell viability decrease and apoptosis could be reversed through pretreatment with NAC, CAT, and Vita E, respectively. Taken together, this is the first report that OSI induces an accompanied autophagy and the generation of ROS is critical for the OSI-induced autophagy, cell viability decrease, and apoptosis in NSCLC cells. - Highlights: • Osimertinib induced the expressions of cytoplasmic vacuoles and autophagic markers in different cancer cells. • Osimertinib induced autophagic flux in NSCLC NCI-H1975 and HCC827 cell lines. • ROS generation contributed to osimertinib-induced cytoplasmic

  3. Dose selenomethionine have radio-protective effect on cell lines with wild type p53?

    International Nuclear Information System (INIS)

    Tsuji, K.; Hagihira, T.; Ohnishi, K.; Ohnishi, T.; Matsumoto, H.

    2003-01-01

    Full text: Selenium compounds are known to have cancer preventive effects. It is reported recently that selenium in the form of selenomethionine (SeMet) can protect cells with wild type p53 from UV-induced cell killing by activating the DNA repair mechanism of p53 tumor suppressor protein via redox factor Ref1 by reducing p53 cysteine residue 275 and 277. In contrast, SeMet has no protective effect on UV-induced cell killing in p53-null cells. If SeMet also has protective effect in cells with wild type p53 on cell killing by photon irradiation, SeMet can be used as normal tissue radio-protector. We examined the effect of SeMet on cell killing by X-ray irradiation in several cell lines with different p53 status at exponentially growing phase. Cell lines used in this experiment were as follows: H1299/neo; human lung cancer cell line of p53 null type tranfected with control vector with no p53, H1299/wp53; wild type p53 transfected counterpart. A172/neo; human glioblastoma cell line with wild type p53, A172/mp53-248; mp53-248 (248-mutant, ARG >TRP) transfected counterpart. SAS/neo; human tongue cancer cell line with wild type p53, and SAS/mp53-248; mp53-248 transfected counterpart. Cells were subcultured at monolayer in D-MEM containing 10% FBS. Survivals of the cells were determined by colony forming ability. Ten-MV linac X-ray was used to irradiate the cells. Exponentially growing cells were incubated with 20μM of SeMet for 15 hours before irradiation. After 24 hours exposure of SeMet, cells were incubated up to two weeks in growth medium for colony formation. Twenty-four hours exposure of 20μM of SeMet had no cytotoxicity on these cell lines. SeMet had no modification effect on cell killing by photon irradiation in H1299/neo, H1299/wp53, SAS/neo, SAS/mp53-248, and A172/mp53-248. On the other hand, SeMet sensitized A172/neo in radiation cell killing. The effects of p53 on interaction of SeMet and photon irradiation differ according to cell lines

  4. Radiation Response in Two HPV-Infected Head-and-Neck Cancer Cell Lines in Comparison to a Non-HPV-Infected Cell Line and Relationship to Signaling Through AKT

    International Nuclear Information System (INIS)

    Gupta, Anjali K.; Lee, John H.; Wilke, Werner W.; Quon, Harry; Smith, Gareth; Maity, Amit; Buatti, John M.; Spitz, Douglas R.

    2009-01-01

    Purpose: Human papilloma virus (HPV)-associated cancers of the head and neck (H and N) are increasing in frequency and are often treated with radiation. There are conflicting data in the literature regarding the radiation response in the presence of HPV infection, with some data suggesting they may be more sensitive to radiation. There are few studies looking at in vitro effects of HPV and further sensitization by inhibitors of specific signaling pathways. We are in the process of starting a clinical trial in H and N cancer patients using nelfinavir (NFV) (which inhibits Akt) and it would be important to know the effect of HPV on radiation response ± NFV. Methods and Materials: Two naturally infected HPV-16 cell lines (UPCI-SCC90 and UMSCC47) and the HPV-negative SQ20B H and N squamous carcinoma cells were used. Western blots with or without 10 uM NFV were done to evaluate signaling from the PI3K-Akt pathway. Clonogenic assays were done in the three cell lines with or without NFV. Results: Both UPCI-SCC90 and UMSCC47 cells were sensitive to radiation as compared with SQ20B and the degree corresponded to Akt activation. The SQ20B cell line has an activating mutation in EGFR resulting in phosphorylation (P) of Akt; UMSCC47 has decreased P-phosphatase and TENsin (PTEN), resulting in increased P-Akt; UPCI-SCC90 had overexpression of P-PTEN and decreased P-Akt. NFV resulted in downregulation of Akt in all three cell lines, resulting in sensitization to radiation. Conclusions: HPV-infected H and N cancers are sensitive to radiation. The degree of sensitivity correlates to Akt activation and they can be further sensitized by NFV.

  5. Protective effect of p-coumaric acid against doxorubicin induced toxicity in H9c2 cardiomyoblast cell lines

    Directory of Open Access Journals (Sweden)

    Sunitha M. Chacko

    2015-01-01

    Full Text Available Doxorubicin (Dox has been used for more than four decades to treat cancer, particularly solid tumours and haematological malignancies. However, the administration of this drug is a matter of concern in the clinical community, since Dox therapy is commonly associated with dose-dependent cardiotoxicity. Attempts at alleviating drug generated cardiac damage using naturally occurring compounds with radical scavenging property are a promising area of research. p-Coumaric acid (pCA is one such compound which has significant antiradical scavenging effect. This study aims to investigate the effect of pre and co-administration of pCA on mitigating or preventing Dox induced cardiotoxicity in vitro using H9c2 cardiomyoblast cell lines. Addition of pCA and Dox were performed for both treatment and control sets on H9c2 cells. Sulphorhodamine B assay was used to study the cytotoxic effect of pCA and Dox. The effect of the drug on cell morphology, cell viability and nuclear damage was studied using AO/EB and DAPI staining. ROS production was studied using DCFH-DA staining. Mitochondrial membrane potential and intracellular calcium levels were assessed by rhodamine 123 and Fura 2AM staining. pCA showed strong ABTS cation radical scavenging activity and FRAP activity in a dose dependent manner. The results showed that Dox has significant cytotoxic effect in a dose dependent manner while pCA, even at higher concentrations did not display any significant cytotoxicity on H9c2 cells. Both pre treatment and co- administration of pCA reduced the drug induced toxic effects on cell morphology and enhanced the number of viable cells in comparison to the Dox treated cells as evident from the AO/EB and DAPI staining images. The Dox induced ROS production was found to be significantly reduced in pCA pre-treated and co-administered cells. Dox induced changes in mitochondrial membrane potential and intracellular calcium levels were remarkably improved following pre and co

  6. Cost-effective master cell bank validation of multiple clinical-grade human pluripotent stem cell lines from a single donor.

    Science.gov (United States)

    Devito, Liani; Petrova, Anastasia; Miere, Cristian; Codognotto, Stefano; Blakely, Nicola; Lovatt, Archie; Ogilvie, Caroline; Khalaf, Yacoub; Ilic, Dusko

    2014-10-01

    Standardization guidelines for human pluripotent stem cells are still very broadly defined, despite ongoing clinical trials in the U.S., U.K., and Japan. The requirements for validation of human embryonic (hESCs) and induced pluripotent stem cells (iPSCs) in general follow the regulations for other clinically compliant biologics already in place but without addressing key differences between cell types or final products. In order to realize the full potential of stem cell therapy, validation criteria, methodology, and, most importantly, strategy, should address the shortfalls and efficiency of current approaches; without this, hESC- and, especially, iPSC-based therapy will not be able to compete with other technologies in a cost-efficient way. We addressed the protocols for testing cell lines for human viral pathogens and propose a novel strategy that would significantly reduce costs. It is highly unlikely that the multiple cell lines derived in parallel from a tissue sample taken from one donor would have different profiles of endogenous viral pathogens; we therefore argue that samples from the Master Cell Banks of sibling lines could be safely pooled for validation. We illustrate this approach with tiered validation of two sibling clinical-grade hESC lines, KCL033 and KCL034 (stage 1, sterility; stage 2, specific human pathogens; and stage 3, nonspecific human pathogens). The results of all tests were negative. This cost-effective strategy could also be applied for validation of Master Cell Banks of multiple clinical-grade iPSC lines derived from a single donor. ©AlphaMed Press.

  7. Radiation sensitivity of Merkel cell carcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Leonard, J.H.; Ramsay, J.R.; Birrell, G.W. [Queensland Institute of Medical Research (Australia)] [and others

    1995-07-30

    Merkel cell carcinoma (MCC), being a small cell carcinoma, would be expected to be sensitive to radiation. Clinical analysis of patients at our center, especially those with macroscopic disease, would suggest the response is quite variable. We have recently established a number of MCC cell lines from patients prior to radiotherapy, and for the first time are in a position to determine their sensitivity under controlled conditions. Some of the MCC lines grew as suspension cultures and could not be single cell cloned; therefore, it was not possible to use clonogenic survival for all cell lines. A tetrazolium based (MTT) assay was used for these lines, to estimate cell growth after {gamma} irradiation. Control experiments were conducted on lymphoblastoid cell lines (LCL) and the adherent MCC line, MCC13, to demonstrate that the two assays were comparable under the conditions used. We have examined cell lines from MCC, small cell lung cancer (SCLC), malignant melanomas, Epstein Barr virus (EBV) transformed lymphocytes (LCL), and skin fibroblasts for their sensitivity to {gamma} irradiation using both clonogenic cell survival and MTT assays. The results show that the tumor cell lines have a range of sensitivities, with melanoma being more resistant (surviving fraction at 2 Gy (SF2) 0.57 and 0.56) than the small cell carcinoma lines, MCC (SF2 range 0.21-0.45, mean SF2 0.30, n = 8) and SCLC (SF2 0.31). Fibroblasts were the most sensitive (SF2 0.13-0.20, mean 0.16, n = 5). The MTT assay, when compared to clonogenic assay for the MCC13 adherent line and the LCL, gave comparable results under the conditions used. Both assays gave a range of SF2 values for the MCC cell lines, suggesting that these cancers would give a heterogeneous response in vivo. The results with the two derivative clones of MCC14 (SF2 for MCC14/1 0.38, MCC14/2 0.45) would further suggest that some of them may develop resistance during clonogenic evolution. 25 refs., 3 figs., 1 tab.

  8. Radiation sensitivity of Merkell cell carcinoma cell lines

    International Nuclear Information System (INIS)

    Leonard, J. Helen; Ramsay, Jonathan R.; Kearsley, John H.; Birrell, Geoff W.

    1995-01-01

    Purpose: Merkel cell carcinoma (MCC), being a small cell carcinoma, would be expected to be sensitive to radiation. Clinical analysis of patients at our center, especially those with macroscopic disease, would suggest the response is quite variable. We have recently established a number of MCC cell lines from patients prior to radiotherapy, and for the first time are in a position to determine their sensitivity under controlled conditions. Methods and Materials: Some of the MCC lines grew as suspension cultures and could not be single cell cloned; therefore, it was not possible to use clonogenic survival for all cell lines. A tetrazolium based (MTT) assay was used for these lines, to estimate cell growth after γ irradiation. Control experiments were conducted on lymphoblastoid cell lines (LCL) and the adherent MCC line, MCC13, to demonstrate that the two assays were comparable under the conditions used. Results: We have examined cell lines from MCC, small cell lung cancer (SCLC), malignant melanomas, Epstein Barr virus (EBV) transformed lymphocytes (LCL), and skin fibroblasts for their sensitivity to γ irradiation using both clonogenic cell survival and MTT assays. The results show that the tumor cell lines have a range of sensitivities, with melanoma being more resistant (surviving fraction at 2 Gy (SF2) 0.57 and 0.56) than the small cell carcinoma lines, MCC (SF2 range 0.21-0.45, mean SF2 0.30, n = 8) and SCLC (SF2 0.31). Fibroblasts were the most sensitive (SF2 0.13-0.20, mean 0.16, n = 5). The MTT assay, when compared to clonogenic assay for the MCC13 adherent line and the LCL, gave comparable results under the conditions used. Conclusion: Both assays gave a range of SF2 values for the MCC cell lines, suggesting that these cancers would give a heterogeneous response in vivo. The results with the two derivative clones of MCC14 (SF2 for MCC14/1 0.38, MCC14/2 0.45) would further suggest that some of them may develop resistance during clonogenic evolution

  9. Derivation of Huntington Disease affected Genea046 human embryonic stem cell line

    Directory of Open Access Journals (Sweden)

    Biljana Dumevska

    2016-03-01

    Full Text Available The Genea046 human embryonic stem cell line was derived from a donated, fully commercially consented ART blastocyst, carrying HTT gene CAG expansion of 45 repeats, indicative of Huntington Disease. Following ICM outgrowth on inactivated human feeders, karyotype was confirmed as 46, XX by CGH and STR analysis demonstrated a female Allele pattern. The hESC line had pluripotent cell morphology, 85% of cells expressed Nanog, 92% Oct4, 75% Tra1–60 and 99% SSEA4 and demonstrated Alkaline Phosphatase activity. The cell line was negative for Mycoplasma and visible contamination.

  10. The human leukocyte antigen G promotes trophoblast fusion and β-hCG production through the Erk1/2 pathway in human choriocarcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ji-meng [School of Medicine, Nankai University, Tianjin 300071 (China); State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101 (China); Zhao, Hong-xi [Department of Obstetrics and Gynecology, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038 (China); Wang, Li [Department of Obstetrics and Gynecology, General Hospital of Chinese People’s Liberation Army, Beijing 100853 (China); Gao, Zhi-ying, E-mail: gaozy301@yahoo.com.cn [Department of Obstetrics and Gynecology, General Hospital of Chinese People’s Liberation Army, Beijing 100853 (China); Yao, Yuan-qing, E-mail: yqyao@126.com [Department of Obstetrics and Gynecology, General Hospital of Chinese People’s Liberation Army, Beijing 100853 (China)

    2013-05-10

    Highlights: •HLA-G expression promotes BeWo cells fusion and fusogenic gene expression. •HLA-G is capable of inducing β-hCG production in human choriocarcinoma cell lines. •Up-regulation of β-hCG production by HLA-G is mediated via the Erk1/2 pathway. -- Abstract: The human leukocyte antigen G (HLA-G) is expressed on the fetal–maternal interface and plays a role in protecting fetal-derived trophoblasts from the maternal immune response, allowing trophoblasts to invade the uterus. However, HLA-G also possesses immune suppressing-independent functions. We found that HLA-G expressing BeWo choriocarcinoma cells increased cell–cell fusion compared to control BeWo cells under forskolin treatment. Regardless of forskolin treatment, the expression of fusogenic gene mRNAs, including syncytin-1, the transcription factor glial cell missing 1 (Gcm1), and beta human chorionic gonadotropin (β-hCG) were elevated. HLA-G up-regulates β-hCG production in human choriocarcinoma cells because HLA-G knockdown in JEG-3 cells induces a dramatic decrease in β-hCG compared with control cells. The defect in β-hCG production in HLA-G knocked-down cells could not be completely overcome by stimulating hCG production through increasing intracellular cAMP levels. HLA-G expressing cells have increased phosphorylation levels for extracellular signal-regulated kinase1/2 (Erk1/2) in BeWo cells. The Erk1/2 pathway is inactivated after the inhibition of HLA-G expression in JEG-3 cells. Finally, Erk1/2 inhibition was able to suppress the increased hCG production induced by HLA-G expression. Together, these data suggest novel roles for HLA-G in regulating β-hCG production via the modulation of the Erk1/2 pathway and by inducing trophoblast cell fusion.

  11. NCI-MATCH Trial Links Targeted Drugs to Mutations

    Science.gov (United States)

    Investigators for the nationwide trial, NCI-MATCH: Molecular Analysis for Therapy Choice, announced that the trial will seek to determine whether targeted therapies for people whose tumors have specific gene mutations will be effective regardless of their cancer type. NCI-MATCH will incorporate more than 20 different study drugs or drug combinations, each targeting a specific gene mutation, in order to match each patient in the trial with a therapy that targets a molecular abnormality in their tumor.

  12. Electronic cigarettes induce DNA strand breaks and cell death independently of nicotine in cell lines.

    Science.gov (United States)

    Yu, Vicky; Rahimy, Mehran; Korrapati, Avinaash; Xuan, Yinan; Zou, Angela E; Krishnan, Aswini R; Tsui, Tzuhan; Aguilera, Joseph A; Advani, Sunil; Crotty Alexander, Laura E; Brumund, Kevin T; Wang-Rodriguez, Jessica; Ongkeko, Weg M

    2016-01-01

    Evaluate the cytotoxicity and genotoxicity of short- and long-term e-cigarette vapor exposure on a panel of normal epithelial and head and neck squamous cell carcinoma (HNSCC) cell lines. HaCaT, UMSCC10B, and HN30 were treated with nicotine-containing and nicotine-free vapor extract from two popular e-cigarette brands for periods ranging from 48 h to 8 weeks. Cytotoxicity was assessed using Annexin V flow cytometric analysis, trypan blue exclusion, and clonogenic assays. Genotoxicity in the form of DNA strand breaks was quantified using the neutral comet assay and γ-H2AX immunostaining. E-cigarette-exposed cells showed significantly reduced cell viability and clonogenic survival, along with increased rates of apoptosis and necrosis, regardless of e-cigarette vapor nicotine content. They also exhibited significantly increased comet tail length and accumulation of γ-H2AX foci, demonstrating increased DNA strand breaks. E-cigarette vapor, both with and without nicotine, is cytotoxic to epithelial cell lines and is a DNA strand break-inducing agent. Further assessment of the potential carcinogenic effects of e-cigarette vapor is urgently needed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. The high-risk HPV E6 target scribble (hScrib is required for HPV E6 expression in cervical tumour-derived cell lines

    Directory of Open Access Journals (Sweden)

    Christian Kranjec

    2016-12-01

    Full Text Available The ability of high-risk HPV E6 oncoproteins to target cellular proteins which harbor PDZ domains is believed to play an important role in the virus life cycle and to influence the ability of these viruses to bring about malignant transformation. Whilst many of these PDZ proteins are potential tumour suppressors, involved in the control of cell polarity and cell-contact, recent studies suggest that mislocalisation or overexpression might result in the emergence of oncogenic functions. This has been shown most clearly for two E6 targets, hDlg and hScrib. In this study we show that hScrib plays such a role in HeLa cells, where its expression is required for maintaining high levels of HPV-18 E6 protein. Loss of hScrib has no effect on E6 stability but results in lower levels of E6 transcription and a reduced rate of E6 translation. We further show that, in the context of cervical tumour-derived cell lines, both hScrib and E6 cooperate in the activation of the S6 kinase signaling pathway, and thereby contribute towards maintaining high rates of protein translation. These results indicate that the residual hScrib that is present within HPV transformed cells is pro-oncogenic, and highlights the dual functions of E6 cell polarity targets. Keywords: HPV E6, hScrib, S6 kinase, Protein translation

  14. Cell Line Data Base: structure and recent improvements towards molecular authentication of human cell lines.

    Science.gov (United States)

    Romano, Paolo; Manniello, Assunta; Aresu, Ottavia; Armento, Massimiliano; Cesaro, Michela; Parodi, Barbara

    2009-01-01

    The Cell Line Data Base (CLDB) is a well-known reference information source on human and animal cell lines including information on more than 6000 cell lines. Main biological features are coded according to controlled vocabularies derived from international lists and taxonomies. HyperCLDB (http://bioinformatics.istge.it/hypercldb/) is a hypertext version of CLDB that improves data accessibility by also allowing information retrieval through web spiders. Access to HyperCLDB is provided through indexes of biological characteristics and navigation in the hypertext is granted by many internal links. HyperCLDB also includes links to external resources. Recently, an interest was raised for a reference nomenclature for cell lines and CLDB was seen as an authoritative system. Furthermore, to overcome the cell line misidentification problem, molecular authentication methods, such as fingerprinting, single-locus short tandem repeat (STR) profile and single nucleotide polymorphisms validation, were proposed. Since this data is distributed, a reference portal on authentication of human cell lines is needed. We present here the architecture and contents of CLDB, its recent enhancements and perspectives. We also present a new related database, the Cell Line Integrated Molecular Authentication (CLIMA) database (http://bioinformatics.istge.it/clima/), that allows to link authentication data to actual cell lines.

  15. Characteristics of nobiletin-mediated alteration of gene expression in cultured cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Nemoto, Kiyomitsu, E-mail: nemoto@u-shizuoka-ken.ac.jp [Department of Molecular Toxicology, School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan); Ikeda, Ayaka; Yoshida, Chiaki; Kimura, Junko; Mori, Junki [Department of Molecular Toxicology, School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan); Fujiwara, Hironori [Department of Anti-Dementia Functional Food Development, Research Center of Supercritical Fluid Technology, Graduate School of Engineering, Tohoku University, 6-6-7 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Yokosuka, Akihito; Mimaki, Yoshihiro [Department of Medicinal Pharmacognosy, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, 1432-1 Horinouchi, Hachioji 192-0392 (Japan); Ohizumi, Yasushi [Department of Molecular Toxicology, School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan); Department of Anti-Dementia Functional Food Development, Research Center of Supercritical Fluid Technology, Graduate School of Engineering, Tohoku University, 6-6-7 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Laboratory of Kampo Medicines, Yokohama College of Pharmacy, 601 Matano-cho, Totsuka-ku, Yokohama 245-0066 (Japan); Degawa, Masakuni [Department of Molecular Toxicology, School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan)

    2013-02-15

    Highlights: ► Nobiletin-mediated alterations of gene expression were examined with DNA microarrays. ► Three organ-derived cell lines were treated with 100 μM nobiletin for 24 h. ► In all cell lines, 3 endoplasmic reticulum stress-responsive genes were up-regulated. ► Some cell cycle-regulating and oxidative stress-promoting genes were down-regulated. ► These alterations may contribute to nobiletin-mediated biological effects. -- Abstract: Nobiletin, a polymethoxylated flavonoid that is highly contained in the peels of citrus fruits, exerts a wide variety of beneficial effects, including anti-proliferative effects in cancer cells, repressive effects in hyperlipidemia and hyperglycemia, and ameliorative effects in dementia at in vitro and in vivo levels. In the present study, to further understand the mechanisms of these actions of nobiletin, the nobiletin-mediated alterations of gene expression in three organ-derived cell lines – 3Y1 rat fibroblasts, HuH-7 human hepatocarcinoma cells, and SK-N-SH human neuroblastoma cells – were first examined with DNA microarrays. In all three cell lines, treatments with nobiletin (100 μM) for 24 h resulted in more than 200% increases in the expression levels of five genes, including the endoplasmic reticulum stress-responsive genes Ddit3, Trib3, and Asns, and in less than 50% decreases in the expression levels of seven genes, including the cell cycle-regulating genes Ccna2, Ccne2, and E2f8 and the oxidative stress-promoting gene Txnip. It was also confirmed that in each nobiletin-treated cell line, the levels of the DDIT3 (DNA-damage-inducible transcript 3, also known as CHOP and GADD153) and ASNS (asparagine synthetase) proteins were increased, while the level of the TXNIP (thioredoxin-interacting protein, also known as VDUP1 and TBP-2) protein was decreased. All these findings suggest that nobiletin exerts a wide variety of biological effects, at least partly, through induction of endoplasmic reticulum stress and

  16. Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9

    Directory of Open Access Journals (Sweden)

    So-Jung Kim

    2017-03-01

    Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.

  17. [Effects of 17-AAG on the proliferation and apoptosis of human lung cancer A549 and H446 cells].

    Science.gov (United States)

    Niu, Ben; Lin, Jingshuang; Feng, Tao

    2015-04-01

    To observe the effect of 17-(allylamino)-17-demethoxygeldanamycin (17-AAG) on the apoptosis of human lung cancer cell lines A549 and H446, and to investigate the potential mechanisms. Proliferation inhibition and apoptosis assays, and the cell cycles were detected by MTT and flow cytometry respectively. Western blot was used to determine the expression level of proteins such as Hsp90, Hsp70, AKt, Her-2, Bcl-2 and Bax. After treated with 17-AAG, the proliferation of both A549 and H446 cells was inhibited significantly in a dose-dependent manner; as the concentration of 17-AAG was from 50 to 500 nmol/L, the IC₅₀ values to A549 and H446 cell lines were (222 ± 13) nmol/L and (189 ± 7) nmol/L respectively at 48 h. Cell cycle assays showed that 17-AAG was able to arrest cell cycles of A549 and H446 cell lines at the G₂/M phase. Apoptosis assay showed that 17-AAG was capable of inducing apoptosis in A549 and H446 cell lines. After treated with 17-AAG for 48 h, there were significant differences between the 400 nmol/L groups(46.3% for A549 cell line and 56.9% for H446 cell line) and the control group (11.9% for A549 cell line and 6.9% for H446 cell line, P AAG treatment: Akt and Her-2 decreased significantly while the expression of Hsp70 increased. Meanwhile, the expression of Bcl-2 decreased but that of Bax increased, indicating that 17-AAG was able to promote apoptosis mode in A549 and H446 cells. 17-AAG can regulate the expression level of apoptosis-related proteins such as Bax and Bcl-2 by Hsp90 signaling pathway in A549 and H446 cells, and ultimately inhibit cell proliferation and induce apoptosis.

  18. First human hNT neurons patterned on parylene-C/silicon dioxide substrates: Combining an accessible cell line and robust patterning technology for the study of the pathological adult human brain.

    Science.gov (United States)

    Unsworth, C P; Graham, E S; Delivopoulos, E; Dragunow, M; Murray, A F

    2010-12-15

    In this communication, we describe a new method which has enabled the first patterning of human neurons (derived from the human teratocarcinoma cell line (hNT)) on parylene-C/silicon dioxide substrates. We reveal the details of the nanofabrication processes, cell differentiation and culturing protocols necessary to successfully pattern hNT neurons which are each key aspects of this new method. The benefits in patterning human neurons on silicon chip using an accessible cell line and robust patterning technology are of widespread value. Thus, using a combined technology such as this will facilitate the detailed study of the pathological human brain at both the single cell and network level. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Identification of 4 ataxia telangiectasia cell lines hypersensitive to. gamma. -irradiation but not to hydrogen peroxide

    Energy Technology Data Exchange (ETDEWEB)

    Cantoni, O.; Sestili, P.; Santoro, M.P.; Tannoia, M.C.; Cattabeni, F. (Universita degli Studi di Urbino (Italy). Istituto di Farmacologia e Farmacognosia and Centro di Farmacologia Oncologia Sperimentale); Novelli, G.; Dallapiccola, B. (Universit degli Studi di Urbino (Italy). Cattedra di Genetica); Fiorilli, M. (Universita di Roma ' La Sapienze' (Italy). Cattedra di Allergologia e Immunologia Clinica)

    1989-09-01

    The effct of hydrogen peroxide on the rate of semi-conservative DNA synthesis in ataxia telangiectasia (AT) and normal human lymphoblastoid cells was investigated. The rate of DNA synthesis in AT cells was not depressed to a lesser extent than in normal cells, as might have been expected since H{sub 2O2} is a radiomimetic agent. On the contrary, 4 AT cell lines displayed a higher sensitivity to the inhibitory effect of H{sub 2O2} on DNA synthesis than 2 normal cell lines. Comparable levels of cytotoxicity were detected in cell vaibility studies. Furthermore, neither the level of DNA breakage produced by H{sub 2O2}, nor the rate of repair of these lesions was signigicantly different in normal and AT cells. Together, these results indicate that the AT cell lines utilized in this study are not hypersensitive to the oxidant. It is suggested that H-2-O-2 may not induce lethality via the direct ation of the hydroxyl radical (OH). (Author). 20 refs.; 3 figs.; 1 tab.

  20. Identification of 4 ataxia telangiectasia cell lines hypersensitive to γ-irradiation but not to hydrogen peroxide

    International Nuclear Information System (INIS)

    Cantoni, O.; Sestili, P.; Santoro, M.P.; Tannoia, M.C.; Cattabeni, F.; Novelli, G.; Dallapiccola, B.; Fiorilli, M.

    1989-01-01

    The effct of hydrogen peroxide on the rate of semi-conservative DNA synthesis in ataxia telangiectasia (AT) and normal human lymphoblastoid cells was investigated. The rate of DNA synthesis in AT cells was not depressed to a lesser extent than in normal cells, as might have been expected since H 2O2 is a radiomimetic agent. On the contrary, 4 AT cell lines displayed a higher sensitivity to the inhibitory effect of H 2O2 on DNA synthesis than 2 normal cell lines. Comparable levels of cytotoxicity were detected in cell vaibility studies. Furthermore, neither the level of DNA breakage produced by H 2O2 , nor the rate of repair of these lesions was signigicantly different in normal and AT cells. Together, these results indicate that the AT cell lines utilized in this study are not hypersensitive to the oxidant. It is suggested that H-2-O-2 may not induce lethality via the direct ation of the hydroxyl radical (OH). (Author). 20 refs.; 3 figs.; 1 tab

  1. Contributions of Cell Metabolism and H+ Diffusion to the Acidic pH of Tumors

    Directory of Open Access Journals (Sweden)

    Paul A. Schornack

    2003-03-01

    Full Text Available The tumor microenvironment is hypoxic and acidic. These conditions have a significant impact on tumor progression and response to therapies. There is strong evidence that tumor hypoxia results from inefficient perfusion due to a chaotic vasculature. Consequently, some tumor regions are well oxygenated and others are hypoxic. It is commonly believed that hypoxic regions are acidic due to a stimulation of glycolysis through hypoxia, yet this is not yet demonstrated. The current study investigates the causes of tumor acidity by determining acid production rates and the mechanism of diffusion for H+ equivalents through model systems. Two breast cancer cell lines were investigated with divergent metabolic profiles: nonmetastatic MCF-7/s and highly metastatic MDA-mb-435 cells. Glycolysis and acid production are inhibited by oxygen in MCF-7/s cells, but not in MDA-mb-435 cells. Tumors of MDAmb-435 cells are significantly more acidic than are tumors of MCF-7/s cells, suggesting that tumor acidity is primarily caused by endogenous metabolism, not the lack of oxygen. Metabolically produced protons are shown to diffuse in association with mobile buffers, in concordance with previous studies. The metabolic and diffusion data were analyzed using a reaction-diffusion model to demonstrate that the consequent pH profiles conform well to measured pH values for tumors of these two cell lines.

  2. 26 CFR 1.460-0 - Outline of regulations under section 460.

    Science.gov (United States)

    2010-04-01

    ... Step One. (i) Hypothetical reallocation of income among prior tax years. (ii) Treatment of estimated... tax liability that generated a subsequent refund. (d) Simplified marginal impact method. (1...) INCOME TAX (CONTINUED) INCOME TAXES Taxable Year for Which Items of Gross Income Included § 1.460-0...

  3. Histone deacetylase inhibitors up-regulate LL-37 expression independent of toll-like receptor mediated signalling in airway epithelial cells.

    Science.gov (United States)

    Liu, Quan; Liu, Juan; Roschmann, Kristina Irene Lisolette; van Egmond, Danielle; Golebski, Korneliusz; Fokkens, Wytske Johanna; Wang, Dehui; van Drunen, Cornelis Maria

    2013-04-11

    HDAC inhibitors have been proposed as anticancer agents. However, their roles in innate genes expression remain not well known. Cathelicidin LL-37 is one of the few human bactericidal peptides, but the regulation of histone acetylation on LL-37 expression in airway epithelium remains largely unknown. Therefore, we investigated the effects of two non-selective HDACi, trichostatin A (TSA) and sodium butyrate (SB), on the expression of the cathelicidin LL-37 in human airway epithelial cells. LL37 in human NCI-H292 airway epithelial cells and the primary cultures of normal nasal epithelial cells(PNEC) in response to HDAC inhibitors with or without poly (I:C) stimulation was assessed using real-time PCR and western blot. In parallel, IL-6 expression was evaluated by ELISA. Our results showed that HDAC inhibitors up-regulated LL-37 gene expression independent of poly (I:C) stimulation in PNEC as well as in NCI-H292 cells. HDAC inhibitors increased LL37 protein expression in NCI-H292 cells but not in PNEC. In addition, HDAC inhibitors significantly inhibited poly (I:C)-induced IL-6 production in both of the epithelial cells. In conclusion, HDAC inhibitors directly up-regulated LL-37 gene expression in human airway epithelial cells.

  4. Find an NCI-Designated Cancer Center

    Science.gov (United States)

    Find the locations of NCI-designated cancer centers by area, region, state, or name that includes contact information to help health care providers and cancer patients with referrals to clinical trials.

  5. Basal HIF-1a expression levels are not predictive for radiosensitivity of human cancer cell lines

    International Nuclear Information System (INIS)

    Schilling, D.; Multhoff, G.; Helmholtz Center Munich, CCG - Innate Immunity in Tumor Biology, Munich; Bayer, C.; Emmerich, K.; Molls, M.; Vaupel, P.; Huber, R.M.

    2012-01-01

    High levels of hypoxia inducible factor (HIF)-1a in tumors are reported to be associated with tumor progression and resistance to therapy. To examine the impact of HIF-1a on radioresistance under normoxia, the sensitivity towards irradiation was measured in human tumor cell lines that differ significantly in their basal HIF-1a levels. HIF-1a levels were quantified in lysates of H1339, EPLC-272H, A549, SAS, XF354, FaDu, BHY, and CX- tumor cell lines by ELISA. Protein levels of HIF-1a, HIF-2a, carbonic anhydrase IX (CA IX), and GAPDH were assessed by Western blot analysis. Knock-down experiments were performed using HIF-1a siRNA. Clonogenic survival after irradiation was determined by the colony forming assay. According to their basal HIF-1a status, the tumor cell lines were divided into low (SAS, XF354, FaDu, A549, CX-), intermediate (EPLC-272H, BHY), and high (H1339) HIF-1a expressors. The functionality of the high basal HIF-1a expression in H1339 cells was proven by reduced CA IX expression after knocking-down HIF-1a. Linear regression analysis revealed no correlation between basal HIF-1a levels and the survival fraction at either 2 or 4 Gy in all tumor cell lines investigated. Our data suggest that basal HIF-1a levels in human tumor cell lines do not predict their radiosensitivity under normoxia. (orig.)

  6. TRX is up-regulated by fibroblast growth factor-2 in lung carcinoma.

    Science.gov (United States)

    Deng, Zheng-Hao; Cao, Hui-Qiu; Hu, Yong-Bin; Wen, Ji-Fang; Zhou, Jian-Hua

    2011-01-01

    We have previously shown that exogenous fibroblast growth factor-2 (FGF-2) inhibits apoptosis of the small-cell lung cancer (SCLC) cell line NCI-H446, but the underlying mechanism remains unknown. In this study, the protein profiles of FGF-2-treated and untreated NCI-H446 cells were determined by 2-D gel electrophoresis combined with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and bioinformatics. Differential expression analysis of the protein profiles after FGF-2 treatment identified a total of 24 protein spots, of which nine were up-regulated and 15 were down-regulated. Four proteins were identified by MALDI-TOF-MS: thioredoxin (TRX), visfatin, ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) and Cu/Zn superoxide dismutase (CuZn-SOD). Western blotting revealed that TRX was up-regulated in NCI-H446 and A549 cells treated with FGF-2. Furthermore, immunohistochemical staining confirmed that both FGF-2 and TRX were overexpressed in lung cancer tissues and could be correlated with both lymph node metastasis and clinical stage. These data indicate that TRX may be involved in the FGF-2 signaling pathway. © 2010 The Authors. APMIS © 2010 APMIS.

  7. CLO : The cell line ontology

    NARCIS (Netherlands)

    Sarntivijai, Sirarat; Lin, Yu; Xiang, Zuoshuang; Meehan, Terrence F.; Diehl, Alexander D.; Vempati, Uma D.; Schuerer, Stephan C.; Pang, Chao; Malone, James; Parkinson, Helen; Liu, Yue; Takatsuki, Terue; Saijo, Kaoru; Masuya, Hiroshi; Nakamura, Yukio; Brush, Matthew H.; Haendel, Melissa A.; Zheng, Jie; Stoeckert, Christian J.; Peters, Bjoern; Mungall, Christopher J.; Carey, Thomas E.; States, David J.; Athey, Brian D.; He, Yongqun

    2014-01-01

    Background: Cell lines have been widely used in biomedical research. The community-based Cell Line Ontology (CLO) is a member of the OBO Foundry library that covers the domain of cell lines. Since its publication two years ago, significant updates have been made, including new groups joining the CLO

  8. NCI's Transdisciplinary High Performance Scientific Data Platform

    Science.gov (United States)

    Evans, Ben; Antony, Joseph; Bastrakova, Irina; Car, Nicholas; Cox, Simon; Druken, Kelsey; Evans, Bradley; Fraser, Ryan; Ip, Alex; Kemp, Carina; King, Edward; Minchin, Stuart; Larraondo, Pablo; Pugh, Tim; Richards, Clare; Santana, Fabiana; Smillie, Jon; Trenham, Claire; Wang, Jingbo; Wyborn, Lesley

    2016-04-01

    The Australian National Computational Infrastructure (NCI) manages Earth Systems data collections sourced from several domains and organisations onto a single High Performance Data (HPD) Node to further Australia's national priority research and innovation agenda. The NCI HPD Node has rapidly established its value, currently managing over 10 PBytes of datasets from collections that span a wide range of disciplines including climate, weather, environment, geoscience, geophysics, water resources and social sciences. Importantly, in order to facilitate broad user uptake, maximise reuse and enable transdisciplinary access through software and standardised interfaces, the datasets, associated information systems and processes have been incorporated into the design and operation of a unified platform that NCI has called, the National Environmental Research Data Interoperability Platform (NERDIP). The key goal of the NERDIP is to regularise data access so that it is easily discoverable, interoperable for different domains and enabled for high performance methods. It adopts and implements international standards and data conventions, and promotes scientific integrity within a high performance computing and data analysis environment. NCI has established a rich and flexible computing environment to access to this data, through the NCI supercomputer; a private cloud that supports both domain focused virtual laboratories and in-common interactive analysis interfaces; as well as remotely through scalable data services. Data collections of this importance must be managed with careful consideration of both their current use and the needs of the end-communities, as well as its future potential use, such as transitioning to more advanced software and improved methods. It is therefore critical that the data platform is both well-managed and trusted for stable production use (including transparency and reproducibility), agile enough to incorporate new technological advances and

  9. 76 FR 28439 - Submission for OMB Review; Comment Request; NCI Cancer Genetics Services Directory Web-Based...

    Science.gov (United States)

    2011-05-17

    ...; Comment Request; NCI Cancer Genetics Services Directory Web-Based Application Form and Update Mailer... currently valid OMB control number. Proposed Collection: Title: NCI Cancer Genetics Services Directory Web... included in the NCI Cancer Genetics Services Directory on NCI's Cancer.gov Web site. The information...

  10. Preclinical Testing of an Oncolytic Parvovirus: Standard Protoparvovirus H-1PV Efficiently Induces Osteosarcoma Cell Lysis In Vitro.

    Science.gov (United States)

    Geiss, Carsten; Kis, Zoltán; Leuchs, Barbara; Frank-Stöhr, Monika; Schlehofer, Jörg R; Rommelaere, Jean; Dinsart, Christiane; Lacroix, Jeannine

    2017-10-17

    Osteosarcoma is the most frequent malignant disease of the bone. On the basis of early clinical experience in the 1960s with H-1 protoparvovirus (H-1PV) in osteosarcoma patients, this effective oncolytic virus was selected for systematic preclinical testing on various osteosarcoma cell cultures. A panel of five human osteosarcoma cell lines (CAL 72, H-OS, MG-63, SaOS-2, U-2OS) was tested. Virus oncoselectivity was confirmed by infecting non-malignant human neonatal fibroblasts and osteoblasts used as culture models of non-transformed mesenchymal cells. H-1PV was found to enter osteosarcoma cells and to induce viral DNA replication, transcription of viral genes, and translation to viral proteins. After H-1PV infection, release of infectious viral particles from osteosarcoma cells into the supernatant indicated successful viral assembly and egress. Crystal violet staining revealed progressive cytomorphological changes in all osteosarcoma cell lines. Infection of osteosarcoma cell lines with the standard H-1PV caused an arrest of the cell cycle in the G2 phase, and these lines had a limited capacity for standard H-1PV virus replication. The cytotoxicity of wild-type H-1PV virus towards osteosarcoma cells was compared in vitro with that of two variants, Del H-1PV and DM H-1PV, previously described as fitness variants displaying higher infectivity and spreading in human transformed cell lines of different origins. Surprisingly, wild-type H-1PV displayed the strongest cytostatic and cytotoxic effects in this analysis and thus seems the most promising for the next preclinical validation steps in vivo.

  11. Entrainment of Breast Cell Lines Results in Rhythmic Fluctuations of MicroRNAs

    Directory of Open Access Journals (Sweden)

    Rafael Chacolla-Huaringa

    2017-07-01

    Full Text Available Circadian rhythms are essential for temporal (~24 h regulation of molecular processes in diverse species. Dysregulation of circadian gene expression has been implicated in the pathogenesis of various disorders, including hypertension, diabetes, depression, and cancer. Recently, microRNAs (miRNAs have been identified as critical modulators of gene expression post-transcriptionally, and perhaps involved in circadian clock architecture or their output functions. The aim of the present study is to explore the temporal expression of miRNAs among entrained breast cell lines. For this purpose, we evaluated the temporal (28 h expression of 2006 miRNAs in MCF-10A, MCF-7, and MDA-MB-231 cells using microarrays after serum shock entrainment. We noted hundreds of miRNAs that exhibit rhythmic fluctuations in each breast cell line, and some of them across two or three cell lines. Afterwards, we validated the rhythmic profiles exhibited by miR-141-5p, miR-1225-5p, miR-17-5p, miR-222-5p, miR-769-3p, and miR-548ay-3p in the above cell lines, as well as in ZR-7530 and HCC-1954 using RT-qPCR. Our results show that serum shock entrainment in breast cells lines induces rhythmic fluctuations of distinct sets of miRNAs, which have the potential to be related to endogenous circadian clock, but extensive investigation is required to elucidate that connection.

  12. Authentication of M14 melanoma cell line proves misidentification of MDA‐MB‐435 breast cancer cell line

    Science.gov (United States)

    Korch, Christopher; Hall, Erin M.; Dirks, Wilhelm G.; Ewing, Margaret; Faries, Mark; Varella‐Garcia, Marileila; Robinson, Steven; Storts, Douglas; Turner, Jacqueline A.; Wang, Ying; Burnett, Edward C.; Healy, Lyn; Kniss, Douglas; Neve, Richard M.; Nims, Raymond W.; Reid, Yvonne A.; Robinson, William A.

    2017-01-01

    A variety of analytical approaches have indicated that melanoma cell line UCLA‐SO‐M14 (M14) and breast carcinoma cell line MDA‐MB‐435 originate from a common donor. This indicates that at some point in the past, one of these cell lines became misidentified, meaning that it ceased to correspond to the reported donor and instead became falsely identified (through cross‐contamination or other means) as a cell line from a different donor. Initial studies concluded that MDA‐MB‐435 was the misidentified cell line and M14 was the authentic cell line, although contradictory evidence has been published, resulting in further confusion. To address this question, we obtained early samples of the melanoma cell line (M14), a lymphoblastoid cell line from the same donor (ML14), and donor serum preserved at the originator's institution. M14 samples were cryopreserved in December 1975, before MDA‐MB‐435 cells were established in culture. Through a series of molecular characterizations, including short tandem repeat (STR) profiling and cytogenetic analysis, we demonstrated that later samples of M14 and MDA‐MB‐435 correspond to samples of M14 frozen in 1975, to the lymphoblastoid cell line ML14, and to the melanoma donor's STR profile, sex and blood type. This work demonstrates conclusively that M14 is the authentic cell line and MDA‐MB‐435 is misidentified. With clear provenance information and authentication testing of early samples, it is possible to resolve debates regarding the origins of problematic cell lines that are widely used in cancer research. PMID:28940260

  13. Ethyl Acetate Extract of Scindapsus cf. hederaceus Exerts the Inhibitory Bioactivity on Human Non-Small Cell Lung Cancer Cells through Modulating ER Stress

    Directory of Open Access Journals (Sweden)

    Chon-Kit Chou

    2018-06-01

    Full Text Available Unfolded protein response (UPR is a cytoprotective mechanism that alleviates the protein-folding burden in eukaryotic organisms. Moderate activation of UPR is required for maintaining endoplasmic reticulum (ER homeostasis and profoundly contributes to tumorigenesis. Defects in UPR signaling are implicated in the attenuation of various malignant phenotypes including cell proliferation, migration, and invasion, as well as angiogenesis. This suggests UPR as a promising target in cancer therapy. The pharmacological effects of the plant Scindapsus cf. hederaceus on human cancer cell lines is not understood. In this study, we identified an ethyl acetate extract from Scindapsus cf. hederaceus (SH-EAE, which markedly altered the protein expression of UPR-related genes in human non-small cell lung cancer (NSCLC cells. Treatment with the SH-EAE led to the dose-dependent suppression of colony forming ability of both H1299 and H460 cells, but not markedly in normal bronchial epithelial BEAS-2B cells. SH-EAE treatment also attenuated the migration and invasion ability of H1299 and H460 cells. Moreover, SH-EAE strikingly suppressed the protein expression of two ER stress sensors, including inositol requiring enzyme-1α (IRE-1α and protein kinase R-like ER kinase (PERK, and antagonized the induction of C/EBP homologous protein (CHOP expression by thapsigargin, an ER stress inducer. SH-EAE induced the formation of massive vacuoles which are probably derived from ER. Importantly, SH-EAE impaired the formation of intersegmental vessels (ISV in zebrafish larvae, an index of angiogenesis, but had no apparent effect on the rate of larval development. Together, our findings demonstrate, for the first time, that the ability of SH-EAE specifically targets the two sensors of UPR, with significant anti-proliferation and anti-migration activities as a crude extract in human NSCLC cells. Our finding also indicates potential applications of SH-EAE in preventing UPR

  14. 42 CFR 460.90 - PACE benefits under Medicare and Medicaid.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false PACE benefits under Medicare and Medicaid. 460.90 Section 460.90 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN... FOR THE ELDERLY (PACE) PACE Services § 460.90 PACE benefits under Medicare and Medicaid. If a Medicare...

  15. Comparison of the usefulness of the CACO-2 cell line with standard substrates for isolation of swine influenza A viruses.

    Science.gov (United States)

    Chiapponi, Chiara; Zanni, Irene; Garbarino, Chiara; Barigazzi, Giuseppe; Foni, Emanuela

    2010-01-01

    Influenza A virus isolation is undertaken routinely in embryonated chicken eggs, but to improve virus detection various cell lines can be used. The CACO-2 cell line was compared to the MDCK cell line and embryonated chicken eggs for the isolation of H1N1, H1N2, H3N2 swine influenza A virus subtypes from clinical specimens. From 2006 to 2008, 104 influenza A samples found positive by PCR from 42 respiratory outbreaks in Italian swine farms were examined by virus isolation. Sixty swine influenza A viruses were isolated (16 H1N1, 28 H1N2 and 16 H3N2) and their growth behaviour on the different substrates was examined. 16/16 H1N1, 28/28 H1N2 and 8/16 of H3N2 viruses were isolated from the CACO-2 cell line, while 7/16 H1N1, 3/28 H1N2 and 16/16 H3N2 viruses were isolated using embryonated chicken eggs. Only 9/16 H1N1, 1/28 H1N2 and 6/16 H3N2 viruses replicated in MDCK cells. A link was found between viral hemagglutinin and the isolation rate on the various substrates. The CACO-2 line was statistically more sensitive (Fisher's exact test, pH1N2 subtypes. In contrast influenza A H3N2 virus was isolated more readily in embryonated chicken eggs than in cultured cells (Fisher's exact test, p<0.01).

  16. [SP600125-induced polyploidization of megakaryocytic leukemia cell lines by ribosomal protein S6 kinase 1 depends on the degree of cell differentiation].

    Science.gov (United States)

    Wang, Lili; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Zhao, Song; Ma, Dongchu

    2016-10-01

    Objective To investigate regulatory role of ribosomal protein S6 kinase 1 (S6K1) in the polyploidization of different megakaryocytic leukemia cell lines at the different differentiation stages. Methods Megakaryocytic leukemia cell lines (Dami, Meg-01 and HEL cells) were induced towards polyploidization by SP600125, a c-Jun N-terminal kinase (JNK) inhibitor. The SP600125-inducing process was blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor. The phenotype (CD41a, CD42a and CD42b) and DNA ploidy were detected by flow cytometry. The expression and phosphorylation of S6K1 and related proteins were detected by Western blotting. Results SP600125 induced polyploidization and increased the phosphorylation of eukaryotic initiation factor 4E binding protein 1 (4E-BP1) in Dami, Meg-01 and HEL cells. However, the effect of SP600125 on polyploidization of the three cell lines was different, with the strongest effect on Dami cells and the weakest on Meg-01 cells. Moreover, SP600125 increased the phosphorylation of S6K1 Thr421/Ser424 and decreased the phosphorylation of Thr389 in Dami cells. However, it only increased the phosphorylation of Thr389 in HEL cells and had no effect on the phosphorylation of S6K1 in Meg-01 cells. Interestingly, H-89 only partially blocked the polyploidization of Dami cells, although it decreased the phosphorylation of 4E-BP1 in all SP600125-induced three cell lines. Noticeably, H-89 decreased the phosphorylation of S6K1 Thr421/Ser424 and increased the phosphorylation of Thr389 in Dami cells. However, H-89 had no effect on the phosphorylation of Thr421/Ser424, although it increased the phosphorylation of Thr389 in Meg-01 and HEL cells. Phenotypic analysis showed that the three cell lines were at different levels of differentiation in megakaryocytic lineage, with the highest differentiation in Dami and the lowest in Meg-01 cells. Conclusion SP600125-induced polyploidization of megakaryocytic leukemia cell lines is dependent on the effect

  17. DISSENYAR EXPERIÈNCIES AMB VALOR TURÍSTIC: PAISATGES URBANS

    Directory of Open Access Journals (Sweden)

    Francesc Fusté

    2015-10-01

    Full Text Available Aquest article tracta sobre les possibilitats que la creació d’experiències té en relació al desenvolupament empresarial i regional, gràcies a la tematització del sector turístic i la modificació intencional de l’entorn, tant cultural com natural. El paisatge caracteritza els espais en funció de la seva configuració territorial i també arquitectònica i urbana. Les estructures arquitectòniques, els esdeveniments i les activitats que impliquen la participació activa dels usuaris són la clau de l’èxit del disseny de les experiències amb un valor afegit, on les noves tecnologies ajuden a emfatitzar-ne l’impacte. Sigui com sigui, convertir els llocs en experiències tant pels residents com pels visitants.

  18. Tumour-Derived Interleukin-1 Beta Induces Pro-inflammatory Response in Human Mesenchymal Stem Cells

    DEFF Research Database (Denmark)

    Alajez, Nehad M; Al-toub, Mashael; Almusa, Abdulaziz

    ’ secreted factors as represented by a panel of human cancer cell lines (breast (MCF7 and MDA-MB-231); prostate (PC-3); lung (NCI-H522); colon (HT-29) and head & neck (FaDu)) on the biological characteristics of MSCs. Background Over the past several years, significant amount of research has emerged......, the goal of this study was to assess the cellular and molecular changes in MSCs in response to secreted factors present in conditioned media (CM) from a panel of human tumor cell lines covering a spectrum of human cancers (Breast, Prostate, Lung, colon, and head and neck). Research Morphological changes...... with bipolar processes. In association with phenotypic changes, genome-wide gene expression and bioinformatics analysis revealed an enhanced pro-inflammatory response of those MSCs. Pharmacological inhibitions of FAK and MAPKK severely impaired the pro-inflammatory response of MSCs to tumor CM (~80-99%, and 55...

  19. Co-targeting Deoxyribonucleic Acid–Dependent Protein Kinase and Poly(Adenosine Diphosphate-Ribose) Polymerase-1 Promotes Accelerated Senescence of Irradiated Cancer Cells

    International Nuclear Information System (INIS)

    Azad, Arun; Bukczynska, Patricia; Jackson, Susan; Haput, Ygal; Cullinane, Carleen; McArthur, Grant A.; Solomon, Benjamin

    2014-01-01

    Purpose: To examine the effects of combined blockade of DNA-dependent protein kinase (DNA-PK) and poly(adenosine diphosphate-ribose) polymerase-1 (PARP-1) on accelerated senescence in irradiated H460 and A549 non-small cell lung cancer cells. Methods and Materials: The effects of KU5788 and AG014699 (inhibitors of DNA-PK and PARP-1, respectively) on clonogenic survival, DNA double-strand breaks (DSBs), apoptosis, mitotic catastrophe, and accelerated senescence in irradiated cells were examined in vitro. For in vivo experiments, H460 xenografts established in athymic nude mice were treated with BEZ235 (a DNA-PK, ATM, and phosphatidylinositol 3-kinase/mammalian target of rapamycin inhibitor) and AG014699 to determine effects on proliferation, DNA DSBs, and accelerated senescence after radiation. Results: Compared with either inhibitor alone, combination treatment with KU57788 and AG014699 reduced postradiation clonogenic survival and significantly increased persistence of Gamma-H2AX (γH2AX) foci in irradiated H460 and A549 cells. Notably, these effects coincided with the induction of accelerated senescence in irradiated cells as reflected by positive β-galactosidase staining, G2-M cell-cycle arrest, enlarged and flattened cellular morphology, increased p21 expression, and senescence-associated cytokine secretion. In irradiated H460 xenografts, concurrent therapy with BEZ235 and AG014699 resulted in sustained Gamma-H2AX (γH2AX) staining and prominent β-galactosidase activity. Conclusion: Combined DNA-PK and PARP-1 blockade increased tumor cell radiosensitivity and enhanced the prosenescent properties of ionizing radiation in vitro and in vivo. These data provide a rationale for further preclinical and clinical testing of this therapeutic combination

  20. Co-targeting Deoxyribonucleic Acid–Dependent Protein Kinase and Poly(Adenosine Diphosphate-Ribose) Polymerase-1 Promotes Accelerated Senescence of Irradiated Cancer Cells

    Energy Technology Data Exchange (ETDEWEB)

    Azad, Arun, E-mail: arun.azad@bccancer.bc.ca [Division of Cancer Research, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Department of Pathology, St. Vincent' s Hospital, University of Melbourne, Parkville, Victoria (Australia); Bukczynska, Patricia; Jackson, Susan [Division of Cancer Research, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Haput, Ygal; Cullinane, Carleen [Division of Cancer Research, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Sir Peter MacCallum Department of Oncology, University of Melbourne, Parkville, Victoria (Australia); McArthur, Grant A.; Solomon, Benjamin [Division of Cancer Research, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Division of Cancer Medicine, Peter MacCallum Cancer Centre, East Melbourne, Victoria (Australia); Department of Medicine, St. Vincent' s Hospital, University of Melbourne, Parkville, Victoria (Australia); Sir Peter MacCallum Department of Oncology, University of Melbourne, Parkville, Victoria (Australia)

    2014-02-01

    Purpose: To examine the effects of combined blockade of DNA-dependent protein kinase (DNA-PK) and poly(adenosine diphosphate-ribose) polymerase-1 (PARP-1) on accelerated senescence in irradiated H460 and A549 non-small cell lung cancer cells. Methods and Materials: The effects of KU5788 and AG014699 (inhibitors of DNA-PK and PARP-1, respectively) on clonogenic survival, DNA double-strand breaks (DSBs), apoptosis, mitotic catastrophe, and accelerated senescence in irradiated cells were examined in vitro. For in vivo experiments, H460 xenografts established in athymic nude mice were treated with BEZ235 (a DNA-PK, ATM, and phosphatidylinositol 3-kinase/mammalian target of rapamycin inhibitor) and AG014699 to determine effects on proliferation, DNA DSBs, and accelerated senescence after radiation. Results: Compared with either inhibitor alone, combination treatment with KU57788 and AG014699 reduced postradiation clonogenic survival and significantly increased persistence of Gamma-H2AX (γH2AX) foci in irradiated H460 and A549 cells. Notably, these effects coincided with the induction of accelerated senescence in irradiated cells as reflected by positive β-galactosidase staining, G2-M cell-cycle arrest, enlarged and flattened cellular morphology, increased p21 expression, and senescence-associated cytokine secretion. In irradiated H460 xenografts, concurrent therapy with BEZ235 and AG014699 resulted in sustained Gamma-H2AX (γH2AX) staining and prominent β-galactosidase activity. Conclusion: Combined DNA-PK and PARP-1 blockade increased tumor cell radiosensitivity and enhanced the prosenescent properties of ionizing radiation in vitro and in vivo. These data provide a rationale for further preclinical and clinical testing of this therapeutic combination.

  1. Publishing SNP genotypes of human embryonic stem cell lines: policy statement of the International Stem Cell Forum Ethics Working Party.

    Science.gov (United States)

    Knoppers, Bartha M; Isasi, Rosario; Benvenisty, Nissim; Kim, Ock-Joo; Lomax, Geoffrey; Morris, Clive; Murray, Thomas H; Lee, Eng Hin; Perry, Margery; Richardson, Genevra; Sipp, Douglas; Tanner, Klaus; Wahlström, Jan; de Wert, Guido; Zeng, Fanyi

    2011-09-01

    Novel methods and associated tools permitting individual identification in publicly accessible SNP databases have become a debatable issue. There is growing concern that current technical and ethical safeguards to protect the identities of donors could be insufficient. In the context of human embryonic stem cell research, there are no studies focusing on the probability that an hESC line donor could be identified by analyzing published SNP profiles and associated genotypic and phenotypic information. We present the International Stem Cell Forum (ISCF) Ethics Working Party's Policy Statement on "Publishing SNP Genotypes of Human Embryonic Stem Cell Lines (hESC)". The Statement prospectively addresses issues surrounding the publication of genotypic data and associated annotations of hESC lines in open access databases. It proposes a balanced approach between the goals of open science and data sharing with the respect for fundamental bioethical principles (autonomy, privacy, beneficence, justice and research merit and integrity).

  2. NCI Scientists Awarded National Medal of Technology and Innovation by President Obama | Poster

    Science.gov (United States)

    Two NCI scientists received the National Medal of Technology and Innovation, the nation’s highest honor for technological achievement. The award was announced by President Obama in October. The honorees, John Schiller, Ph.D., Laboratory of Cellular Oncology (LCO), Center for Cancer Research, NCI, and Douglas Lowy, M.D., also from LCO and NCI deputy director, received their medals at a White House ceremony on Nov. 20.

  3. Peptide gH625 enters into neuron and astrocyte cell lines and crosses the blood–brain barrier in rats

    Directory of Open Access Journals (Sweden)

    Valiante S

    2015-03-01

    Full Text Available Salvatore Valiante,1,* Annarita Falanga,2,3,* Luisa Cigliano,1 Giuseppina Iachetta,1 Rosa Anna Busiello,1 Valeria La Marca,1 Massimiliano Galdiero,4 Assunta Lombardi,1 Stefania Galdiero1,2 1Department of Biology, 2Department of Pharmacy, 3DFM Scarl, University of Naples Federico II, 4Department of Experimental Medicine, II University of Naples, Naples, Italy *These authors contributed equally to this paper and are considered joint first authors Abstract: Peptide gH625, derived from glycoprotein H of herpes simplex virus type 1, can enter cells efficiently and deliver a cargo. Nanoparticles armed with gH625 are able to cross an in vitro model of the blood–brain barrier (BBB. In the present study, in vitro experiments were performed to investigate whether gH625 can enter and accumulate in neuron and astrocyte cell lines. The ability of gH625 to cross the BBB in vivo was also evaluated. gH625 was administered in vivo to rats and its presence in the liver and in the brain was detected. Within 3.5 hours of intravenous administration, gH625 can be found beyond the BBB in proximity to cell neurites. gH625 has no toxic effects in vivo, since it does not affect the maximal oxidative capacity of the brain or the mitochondrial respiration rate. Our data suggest that gH625, with its ability to cross the BBB, represents a novel nanocarrier system for drug delivery to the central nervous system. These results open up new possibilities for direct delivery of drugs into patients in the field of theranostics and might address the treatment of several human diseases. Keywords: drug delivery, neurons, astrocytes, blood–brain barrier, peptide

  4. Derivation of NEM2 affected human embryonic stem cell line Genea079

    Directory of Open Access Journals (Sweden)

    Biljana Dumevska

    2016-03-01

    Full Text Available The Genea079 human embryonic stem cell line was derived from a donated, fully commercially consented ART blastocyst, carrying compound heterozygous mutations in the NEB gene, exon 55 deletion & c.15110dupA, indicative of Nemaline Myopathy Type 2 (NEM2. Following ICM outgrowth on inactivated human feeders, karyotype was confirmed as 46, XY and STR analysis demonstrated a male Allele pattern. The hESC line had pluripotent cell morphology, 86% of cells expressed Nanog, 95% Oct4, 54% Tra1-60 and 98% SSEA4 and gave a PluriTest Pluripotency score of 30.25, Novelty of 1.21. The cell line was negative for Mycoplasma and visible contamination.

  5. Antioxidant activity and cytotoxic profie of Chuquiraga spinosa Lessing on human tumor cell lines: A promissory plant from Peruvian flra

    Directory of Open Access Journals (Sweden)

    Oscar Herrera-Calderon

    2017-05-01

    Full Text Available Objective: To determine the phytochemical content, antioxidant activity in vitro and cytotoxicity of crude ethanol extract (CEE, n-hexane fraction (NHF, petroleum ether fraction (PEF, chloroform fraction (CLF and ethyl acetate fraction (EAF of aerial parts of Chuquiraga spinosa (C. spinosa Lessing. Methods: Phytochemical screening was developed by color and precipitated formation. The evaluation of antioxidant activity was assessed using hydroxyl and nitric oxide radical. Total phenolic content (TPC and total flavonoids content (TFC were measured by using standard methods by spectrophotometry. The cytotoxic effect was determined on human tumor cell lines including MCF-7, H-460, HT-29, M-14, HUTU-80, K-562 and DU-145. Results: Phytochemical analysis confirmed the presence of phenols, flavonoids in crude extract and its all fractions. The CEE showed the highest antioxidant activity, for OH and NO radical scavenging tests (IC50 = 15.16 ± 3.45 μg/mL and IC50 = 18.91 ± 1.13 μg/mL, respectively. TPC was found to be the highest in the CEE (121.36 mg of gallic acid equivalent/g of dried extract compared to other fractions. The ranking order of NHF, PEF, CLF, EAF and CEE for TFC was 21.17 < 35.20 < 62.19 < 70.25 < 78.25 mg quercetin equivalent/g of dried extract. The crude ethanolic extract (μg/mL showed a high cytotoxicity on MCF-7 (IC50 = 9.25 ± 0.81, K-562 (IC50 = 7.34 ± 1.00, HT-29 (IC50 = 8.52 ± 2.69, H-460 (IC50 = 5.32 ± 1.05, M-14 (IC50 = 8.30 ± 0.60, DU-145 (IC50 = 7.09 ± 0.09, HUTU-80 (IC50 = 6.20 ± 0.50. Conclusions: The study showed that CEE of the aerial parts of C. spinosa can be measured as a natural source of antioxidant which might be effective towards preventing or slowing oxidative stress related to chronic diseases as well as cytotoxic agent.

  6. Preclinical Testing of an Oncolytic Parvovirus: Standard Protoparvovirus H-1PV Efficiently Induces Osteosarcoma Cell Lysis In Vitro

    Directory of Open Access Journals (Sweden)

    Carsten Geiss

    2017-10-01

    Full Text Available Osteosarcoma is the most frequent malignant disease of the bone. On the basis of early clinical experience in the 1960s with H-1 protoparvovirus (H-1PV in osteosarcoma patients, this effective oncolytic virus was selected for systematic preclinical testing on various osteosarcoma cell cultures. A panel of five human osteosarcoma cell lines (CAL 72, H-OS, MG-63, SaOS-2, U-2OS was tested. Virus oncoselectivity was confirmed by infecting non-malignant human neonatal fibroblasts and osteoblasts used as culture models of non-transformed mesenchymal cells. H-1PV was found to enter osteosarcoma cells and to induce viral DNA replication, transcription of viral genes, and translation to viral proteins. After H-1PV infection, release of infectious viral particles from osteosarcoma cells into the supernatant indicated successful viral assembly and egress. Crystal violet staining revealed progressive cytomorphological changes in all osteosarcoma cell lines. Infection of osteosarcoma cell lines with the standard H-1PV caused an arrest of the cell cycle in the G2 phase, and these lines had a limited capacity for standard H-1PV virus replication. The cytotoxicity of wild-type H-1PV virus towards osteosarcoma cells was compared in vitro with that of two variants, Del H-1PV and DM H-1PV, previously described as fitness variants displaying higher infectivity and spreading in human transformed cell lines of different origins. Surprisingly, wild-type H-1PV displayed the strongest cytostatic and cytotoxic effects in this analysis and thus seems the most promising for the next preclinical validation steps in vivo.

  7. Selected Publications by the NCI Director

    Science.gov (United States)

    Dr. Norman Sharpless's written work on cancer research appears in many leading scientific journals, as well as a variety of other publications. This page lists some of the articles published by Dr. Sharpless since becoming NCI director.

  8. [PHI regulates histone methylation and acetylation in Burkitt lymphoma Daudi cell line].

    Science.gov (United States)

    Hong, Ling-Ling; Ma, Xu-Dong; Huang, Yi-Qun

    2011-02-01

    This study was purposed to investigate the effects of phenylhexyl isothiocyanate (PHI) on Burkitt lymphoma Daudi cell line and regulation of histone acetylation and methylation in Daudi cells, and to explore the potential mechanism. The apoptotic rate of Daudi cells treated with PHI was measured by flow cytometry, the changes of histone H3 and H4 acetylation, histone H3K9 and H3K4 methylation in Daudi cells treated with PHI were detected by Western blot. The results showed that PHI could induce apoptosis of Daudi cells, increased the acetylation level of H3 and H4, enhanced the methylation of H3K4, but reduced the methylation of H3K9. It is concluded that the PHI can up-regulate the acetylation level of histone H3 associated with transcription stimulation and the methylation of histone H3K4, down-regulate the methylation on histone H3K9 associated with transcription inhibition, promotes the apoptosis of Daudi cells. PHI may be a potential agent for target therapy of lymphoma.

  9. 14 CFR 460.9 - Informing crew of risk.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Informing crew of risk. 460.9 Section 460.9 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... risk. An operator must inform in writing any individual serving as crew that the United States...

  10. Interaction between x-irradiated plateau-phase bone marrow stromal cell lines and co-cultivated factor-dependent cell lines leading to leukemogenesis in vitro

    International Nuclear Information System (INIS)

    Naparstek, E.; Anklesaria, P.; FitzGerald, T.J.; Sakakeeny, M.A.; Greenberger, J.S.

    1987-01-01

    Plateau-phase mouse clonal bone marrow stromal cell lines D2XRII and C3H cl 11 produce decreasing levels of M-CSF (CSF-1), a specific macrophage progenitor cell humoral regulator, following X-irradiation in vitro. The decrease did not go below 40% of control levels, even after irradiation doses of 50,000 rad (500 Gy). In contrast, a distinct humoral regulator stimulating growth of GM-CSF/IL-3 factor-dependent (FD) hematopoietic progenitor cell lines was detected following radiation to doses above 2000 rad. This humoral factor was not detectable in conditioned medium from irradiated cells, weakly detected using factor-dependent target cell populations in agar overlay, and was prominently detected by liquid co-cultivation of factor-dependent cells with irradiated stromal cell cultures. Subclonal lines of FD cells, derived after co-cultivation revealed karyotypic abnormalities and induced myeloblastic tumors in syngeneic mice. Five-eight weeks co-cultivation was required for induction of factor independence and malignancy and was associated with dense cell to cell contact between FD cells and stromal cells demonstrated by light and electron microscopy. Increases in hematopoietic to stromal cell surface area, total number of adherent cells per flask, total non-adherent cell colonies per flask, and cumulative non-adherent cell production were observed after irradiation. The present data may prove very relevant to an understanding of the cell to cell interactions during X-irradiation-induced leukemia

  11. Inhibitory effect and molecular mechanism of mesenchymal stem cells on NSCLC cells.

    Science.gov (United States)

    Pan, Mengwu; Hou, Lingling; Zhang, Jingsi; Zhao, Diandian; Hua, Jilei; Wang, Ziling; He, Jinsheng; Jiang, Hong; Hu, Honggang; Zhang, Lishu

    2018-04-01

    Non-small-cell lung cancer (NSCLC) is still the main threat of cancer-associated death. Current treatment of NSCLC has limited effectiveness, and unfortunately, the prognosis of NSCLC remains poor. Therefore, a novel strategy for cancer therapy is urgently needed. Stem cell therapy has significant potential for cancer treatment. Mesenchymal stem cells (MSCs) with capacity for self-renewal and differentiation into various cells types exhibit the feature of homing to tumor site and immunosuppression, have been explored as a new treatment for various cancers. Studies revealed that the broad repertoire of trophic factors secreted by MSCs extensively involved in the interplay between MSCs and tumor cells. In this study, we confirmed that MSCs do have the paracrine effect on proliferation and migration of NSCLC cells (A549, NCI-H460, and SK-MES-1). Co-culture system and conditioned medium experiments results showed that soluble factors secreted by MSCs inhibited the proliferation of NSCLC cells in vitro. The scratch assay showed that conditioned medium of MSCs could suppress the migration of NSCLC cells in vitro. Western blot results showed that the expression of proteins relevant to cell proliferation, anti-apoptosis, and migration was remarkably decreased via MAPK/eIF4E signaling pathway. We speculated that soluble factors secreted by MSCs might be responsible for inhibitory mechanism of NSCLC cells. By Human Gene Expression Microarray Assay and recombinant Vascular Endothelial Growth Factor 165 (VEGF165) neutralizing experiment, we verified that VEGF might be responsible for the down-regulation of proteins related to cell proliferation, anti-apoptosis, and migration by suppressing translation initiation factor eIF4E via MAPK signaling pathway. Taken together, our study demonstrated that a possible trophic factor secreted by MSCs could manipulate translation initiation of NSCLC cells via MAPK signaling pathway, and significantly affect the fate of tumor cells, which

  12. Generation of H1 PAX6WT/EGFP reporter cells to purify PAX6 positive neural stem/progenitor cells.

    Science.gov (United States)

    Wu, Wei; Liu, Juli; Su, Zhenghui; Li, Zhonghao; Ma, Ning; Huang, Ke; Zhou, Tiancheng; Wang, Linli

    2018-08-25

    Neural conversion from human pluripotent cells (hPSCs) is a potential therapy to neurological disease in the future. However, this is still limited by efficiency and stability of existed protocols used for neural induction from hPSCs. To overcome this obstacle, we developed a reporter system to screen PAX6 + neural progenitor/stem cells using transcription activator like effector nuclease (TALEN). We found that knock-in 2 A-EGFP cassette into PAX6 exon of human embryonic stem cells H1 with TALEN-based homology recombination could establish PAX6 WT/EGFP H1 reporter cell line fast and efficiently. This reporter cell line could differentiate into PAX6 and EGFP double positive neural progenitor/stem cells (NPCs/NSCs) after neural induction. Those PAX6 WT/EGFP NPCs could be purified, expanded and specified to post-mitotic neurons in vitro efficiently. With this reporter cell line, we also screened out 1 NPC-specific microRNA, hsa-miR-99a-5p, and 3 ESCs-enriched miRNAs, hsa-miR-302c-5p, hsa-miR-512-3p and hsa-miR-518 b. In conclusion, the TALEN-based neural stem cell screening system is safe and efficient and could help researcher to acquire adequate and pure neural progenitor cells for further application. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. 16 CFR 460.2 - What is home insulation.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false What is home insulation. 460.2 Section 460.2 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME..., semirigid, flexible, or loose-fill form. Home insulation is for use in old or new homes, condominiums...

  14. Establishment and characterization of a novel osteosarcoma cell line: CHOS.

    Science.gov (United States)

    Liu, Yunlu; Feng, Xiaobo; Zhang, Yukun; Jiang, Hongyan; Cai, Xianyi; Yan, Xinxin; Huang, Zengfa; Mo, Fengbo; Yang, Wen; Yang, Cao; Yang, Shuhua; Liu, Xianzhe

    2016-12-01

    Osteosarcoma has a well-recognized bimodal distribution, with the first peak in adolescence and another in the elderly age-group. The elderly patients have different clinical features and a poorer prognosis as compared to adolescents. To better understand the biological features of osteosarcoma in the elderly population, we established a new human osteosarcoma cell line from a 58-year-old man with primary chondroblastic osteosarcoma. After 6 months of continuous culture in vitro for over 50 passages, an immortalized cell line CHOS was established. The cell line was well-characterized by cytogenetic, biomarker, functional, and histological analyses. The CHOS cells exhibited a spindle-shaped morphology and a doubling time of 36 h. Cytogenetic analysis of CHOS cells revealed the loss of chromosome Y and the gain of chromosome 12. Quantitative real-time polymerase chain reaction (RT-PCR), Western blotting and/or immunofluorescence revealed the expression of chondroblastic, mesenchymal and tumor metastasis markers in the CHOS cells. Compared with the osteosarcoma cell line, the CHOS cells were found to be more sensitive to cisplatin and doxorubicin, but were resistant to methotrexate. The cell line was highly tumorigenic and maintained the histological characteristics and invasive nature of the original tumor. Furthermore, on immunohistochemical analysis, the xenografts and metastases were found to co-express collagen II, aggrecan, vimentin and S100A4 that resembled the original tumor cells. Our results indicate, the potential of CHOS cell line to serve as a useful tool for further studies on the molecular biology of osteosarcoma, especially in the elderly patients. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:2116-2125, 2016. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  15. Lithium-Acetate-Mediated Biginelli One-Pot Multicomponent Synthesis under Solvent-Free Conditions and Cytotoxic Activity against the Human Lung Cancer Cell Line A549 and Breast Cancer Cell Line MCF7

    Directory of Open Access Journals (Sweden)

    Harshita Sachdeva

    2012-01-01

    Full Text Available Various Biginelli compounds (dihydropyrimidinones have been synthesized efficiently and in high yields under mild, solvent-free, and eco-friendly conditions in a one-pot reaction of 1,3-dicarbonyl compounds, aldehydes, and urea/thiourea/acetyl thiourea using lithium-acetate as a novel catalyst without the addition of any proton source. Comparative catalytic efficiency of lithium-acetate and polyphosphoric acid to catalyze Biginelli condensation is also studied under neat conditions. The reaction is carried out in the absence of any solvent and represents an improvement of the classical Biginelli protocol and an advantage in comparison with FeCl3·6H2O, NiCl2·6H2O and CoCl2·6H2O that were used with HCl as a cocatalyst. Compared to classical Biginelli reaction conditions, the present method has advantages of good yields, short reaction times, and experimental simplicity. The obtained products have been identified by spectral (1H NMR and IR data and their melting points. The prepared compounds are evaluated for anticancer activity against two human cancer cell lines (lung cancer cell line A549 and breast cancer cell line MCF7.

  16. Intercellular Uptake of Technetium-99m Pertechnetate by Different Types of Cell Lines

    International Nuclear Information System (INIS)

    Safri Zainal Abidin; Raizulnasuha Abdul Rashid; Muhammad Afiq Khairil Anuar; Wan Nordiana A Abd Rahman

    2015-01-01

    The purpose of this study is to determine the technetium-99m pertechnetate ( 99m TcO 4 ) intercellular uptake by different types of cell lines. HeLa, human fetal osteoblast (hFOB), glial and glioma cell lines grown in 6-wells culture plates were incubated with 99m TcO 4 of activity of 200, 400, 600, 800 and 1000 μCi for 30 minutes at 37 degree Celsius and 5 % CO 2 humidified atmosphere. After incubation, the cells were washed 3 times with phosphate buffer saline to remove the extracellular traces of 99m TcO 4 . Measurement of the intercellular 99m TcO 4 into the cells was calculated. The intercellular uptake of 99m TcO 4 was found to be inversely correlate to the radioactivity. HHeLa cell shows the highest uptake followed by hFOB, glial and glioma cell lines. Comparison of uptake between normal and cancer cells present indistinguishable results. The findings of this study suggest that the intercellular uptake of 99m TcO 4 is highly dependent on the type of cells despite no significant different of uptake was found between normal and cancer cell lines. The level of radioactivity is also an important determinant factor that influence the uptake of 99m TcO 4 into the cell. The study will be the first precedent toward understanding the cellular characteristics and pharmacokinetic of non-invasive imaging tracer for future molecular imaging and therapy. (author)

  17. Regulation of intracellular pH in LLC-PK1 cells by Na+/H+ exchange.

    Science.gov (United States)

    Montrose, M H; Murer, H

    1986-01-01

    Suspensions of LLC-PK1 cells (a continuous epitheliod cell line with renal characteristics) are examined for mechanisms of intracellular pH regulation using the fluorescent probe BCECF. Initial experiments determine suitable calibration procedures for use of the BCECF fluorescent signal. They also determine that the cell suspension contains cells which (after 4 hr in suspension) have Na+ and K+ gradients comparable to those of cells in monolayer culture. The steady-state intracellular pH (7.05 +/- 0.01, n = 5) of cells which have recovered in (pH 7.4) Na+-containing medium is not affected over several minutes by addition of 100 microM amiloride or removal of extracellular Na+ (Na+o less than 1 mM). In contrast, when the cells recover from an acid load (caused by NH4 preincubation and removal), the recovery is largely Na+ dependent and is sensitive to 100 microM amiloride. These results suggest that with resting pH near neutrality, both Na+o/H+i and Na+i/H+o exchange reactions are functionally inactive (compared to cellular buffering capacity). In contrast, Na+o/H+i exchange is activated by an increased cellular acid load. This activation may be observed directly either as a stimulation of net H+ efflux or net Na+ influx with decreasing intracellular pH. The extrapolation of this latter data suggests a "set point" of Na+/H+ exchange of approximately pH 7.0, consistent with the observed resting intracellular pH of approximately 7.05.

  18. Cardiomyocyte H9c2 cells present a valuable alternative to fish lethal testing for azoxystrobin

    International Nuclear Information System (INIS)

    Rodrigues, Elsa T.; Pardal, Miguel Â.; Laizé, Vincent; Cancela, M. Leonor; Oliveira, Paulo J.; Serafim, Teresa L.

    2015-01-01

    The present study aims at identifying, among six mammalian and fish cell lines, a sensitive cell line whose in vitro median inhibitory concentration (IC_5_0) better matches the in vivo short-term Sparus aurata median lethal concentration (LC_5_0). IC_5_0_s and LC_5_0 were assessed after exposure to the widely used fungicide azoxystrobin (AZX). Statistical results were relevant for most cell lines after 48 h of AZX exposure, being H9c2 the most sensitive cells, as well as the ones which provided the best prediction of fish toxicity, with a LC_5_0_,_9_6_h/IC_5_0_,_4_8_h = 0.581. H9c2 cell proliferation upon 72 h of AZX exposure revealed a LC_5_0_,_9_6_h/IC_5_0_,_7_2_h = 0.998. Therefore, identical absolute sensitivities were attained for both in vitro and in vivo assays. To conclude, the H9c2 cell-based assay is reliable and represents a suitable ethical alternative to conventional fish assays for AZX, and could be used to get valuable insights into the toxic effects of other pesticides. - Highlights: • Fish toxicity data are still considered standard information in ecotoxicology. • Alternatives to animal testing have become an important topic of research. • Cell-based assays are currently a promising in vitro alternative. • Comparative studies to accelerate the validation of cell-based methods are required. • H9c2 cell line proved to produce in vitro reliable toxicity results for azoxystrobin. - The application of cell-based assays for environmental toxicity studies would greatly reduce the number of fish needed for toxicity testing without any loss of reliability.

  19. δ-Aminolevulinic acid cytotoxic effects on human hepatocarcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    De Siervi, Adriana; Vazquez, Elba S; Rezaval, Carolina; Rossetti, María V; Batlle, Alcira M del [Centro de Investigaciones sobre Porfirinas y Porfirias (CIPYP), Argentine National Research Council (CONICET), Department of Biological Chemistry, FCEN, University of Buenos Aires (Argentina)

    2002-01-01

    Acute Intermittent Porphyria is a genetic disorder of heme metabolism, characterized by increased levels of porphyrin precursors, δ-aminolevulinic acid (ALA) and porphobilinogen (PBG). ALA has been reported to generate reactive oxygen species and to cause oxidative damage to proteins, subcellular structures and DNA. It is known that oxidative stress can induce apoptosis. The aim of this work was to study the cytotoxic effect of ALA on two hepatocarcinoma cell lines. We have determined the impact of ALA on HEP G2 and HEP 3B hepatocarcinoma cell lines survival as measured by the MTT assay. ALA proved to be cytotoxic in both cell lines however; HEP G2 was more sensitive to ALA than HEP 3B. Addition of hemin or glucose diminished ALA cytotoxicity in HEP G2 cells; instead it was enhanced in HEP 3B cells. Because apoptosis is usually associated with DNA fragmentation, the DNA of ALA treated and untreated cells were analyzed. The characteristic pattern of DNA fragmentation ladders was observed in ALA treated cells. To elucidate the mechanisms of ALA induced apoptosis, we examined its effect on p53 expression. No changes in p53 mRNA levels were observed after exposure of both cell lines to ALA for 24 h. CDK2 and CDK4 protein levels were reduced after ALA treatment at physiological concentrations.

  20. δ-Aminolevulinic acid cytotoxic effects on human hepatocarcinoma cell lines

    Directory of Open Access Journals (Sweden)

    del Batlle Alcira M

    2002-03-01

    Full Text Available Abstract Background Acute Intermittent Porphyria is a genetic disorder of heme metabolism, characterized by increased levels of porphyrin precursors, δ-aminolevulinic acid (ALA and porphobilinogen (PBG. ALA has been reported to generate reactive oxygen species and to cause oxidative damage to proteins, subcellular structures and DNA. It is known that oxidative stress can induce apoptosis. The aim of this work was to study the cytotoxic effect of ALA on two hepatocarcinoma cell lines. Results We have determined the impact of ALA on HEP G2 and HEP 3B hepatocarcinoma cell lines survival as measured by the MTT assay. ALA proved to be cytotoxic in both cell lines however; HEP G2 was more sensitive to ALA than HEP 3B. Addition of hemin or glucose diminished ALA cytotoxicity in HEP G2 cells; instead it was enhanced in HEP 3B cells. Because apoptosis is usually associated with DNA fragmentation, the DNA of ALA treated and untreated cells were analyzed. The characteristic pattern of DNA fragmentation ladders was observed in ALA treated cells. To elucidate the mechanisms of ALA induced apoptosis, we examined its effect on p53 expression. No changes in p53 mRNA levels were observed after exposure of both cell lines to ALA for 24 h. CDK2 and CDK4 protein levels were reduced after ALA treatment at physiological concentrations.

  1. δ-Aminolevulinic acid cytotoxic effects on human hepatocarcinoma cell lines

    International Nuclear Information System (INIS)

    De Siervi, Adriana; Vazquez, Elba S; Rezaval, Carolina; Rossetti, María V; Batlle, Alcira M del

    2002-01-01

    Acute Intermittent Porphyria is a genetic disorder of heme metabolism, characterized by increased levels of porphyrin precursors, δ-aminolevulinic acid (ALA) and porphobilinogen (PBG). ALA has been reported to generate reactive oxygen species and to cause oxidative damage to proteins, subcellular structures and DNA. It is known that oxidative stress can induce apoptosis. The aim of this work was to study the cytotoxic effect of ALA on two hepatocarcinoma cell lines. We have determined the impact of ALA on HEP G2 and HEP 3B hepatocarcinoma cell lines survival as measured by the MTT assay. ALA proved to be cytotoxic in both cell lines however; HEP G2 was more sensitive to ALA than HEP 3B. Addition of hemin or glucose diminished ALA cytotoxicity in HEP G2 cells; instead it was enhanced in HEP 3B cells. Because apoptosis is usually associated with DNA fragmentation, the DNA of ALA treated and untreated cells were analyzed. The characteristic pattern of DNA fragmentation ladders was observed in ALA treated cells. To elucidate the mechanisms of ALA induced apoptosis, we examined its effect on p53 expression. No changes in p53 mRNA levels were observed after exposure of both cell lines to ALA for 24 h. CDK2 and CDK4 protein levels were reduced after ALA treatment at physiological concentrations

  2. BETULINIC ACID WAS MORE CYTOTOXIC TOWARDS THE HUMAN BREAST CANCER CELL LINE MDA-MB-231 THAN THE HUMAN PROMYELOCYTIC LEUKAEMIA CELL LINE HL-60

    Directory of Open Access Journals (Sweden)

    LATIFAH SAIFUL YAZAN

    2009-01-01

    Full Text Available Betulinic acid (BA is a pentacyclic triterpene found in several botanical sources that has been shown to cause apoptosis in a number of cell lines. This study was undertaken to determine the in vitro cytotoxic properties of BA towards the human mammary carcinoma cell line MDA-MB-231 and the human promyelocytic leukaemia cell line HL-60 and the mode of the induced cell death. The cytotoxicity and mode of cell death of BA were determined using the MTT assay and DNAfragmentation analysis, respectively. In our study, the compound was found to be cytotoxic to MDA-MB-231 and HL-60 cells with IC50 values of 58 μg/mL and 134 μg/mL, respectively. Cells treated with high concentrations of BA exhibited features characteristic of apoptosis such as blebbing, shrinking and a number of small cytoplasm body masses when viewed under an inverted light microscope after 24 h. The incidence of apoptosis in MDA-MB-231 was further confirmed bythe DNA fragmentation analysis, with the formation of DNA fragments of oligonucleosomal size (180-200 base pairs, giving a ladder-like pattern on agarose gel electrophoresis. BA was more cytotoxic towards MDA-MB-231 than HL-60 cells, and induced apoptosis in MDA-MB-231 cells.

  3. Adenosine Deaminase Inhibitor EHNA Exhibits a Potent Anticancer Effect Against Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Yasuhiro Nakajima

    2015-01-01

    Full Text Available Background/Aims: Malignant pleural mesothelioma (MPM is an aggressive malignant tumor and an effective therapy has been little provided as yet. The present study investigated the possibility for the adenosine deaminase (ADA inhibitor EHNA as a target of MPM treatment. Methods: MTT assay, TUNEL staining, monitoring of intracellular adenosine concentrations, and Western blotting were carried out in cultured human MPM cell lines without and with knocking-down ADA. The in vivo effect of EHNA was assessed in mice inoculated with NCI-H2052 MPM cells. Results: EHNA induced apoptosis of human MPM cell lines in a concentration (0.01-1 mM- and treatment time (24-48 h-dependent manner, but such effect was not obtained with another ADA inhibitor pentostatin. EHNA increased intracellular adenosine concentrations in a treatment time (3-9 h-dependent manner. EHNA-induced apoptosis of MPM cells was mimicked by knocking-down ADA, and the effect was neutralized by the adenosine kinase inhibitor ABT-702. EHNA clearly suppressed tumor growth in mice inoculated with NCI-H2052 MPM cells. Conclusion: The results of the present study show that EHNA induces apoptosis of MPM cells by increasing intracellular adenosine concentrations, to convert to AMP, and effectively prevents MPM cell proliferation. This suggests that EHNA may be useful for treatment of the tragic neoplasm MPM.

  4. Tumor cell proliferation and cyclooxygenase inhibitory constituents in horseradish (Armoracia rusticana) and Wasabi (Wasabia japonica).

    Science.gov (United States)

    Weil, Marvin J; Zhang, Yanjun; Nair, Muraleedharan G

    2005-03-09

    Cyclooxygenase and human tumor cell growth inhibitory extracts of horseradish (Armoracia rusticana) and wasabi (Wasabia japonica) rhizomes upon purification yielded active compounds 1-3 from horseradish and 4 and 5 from wasabi rhizomes. Spectroscopic analyses confirmed the identities of these active compounds as plastoquinone-9 (1), 6-O-acyl-beta-d-glucosyl-beta-sitosterol (2), 1,2-dilinolenoyl-3-galactosylglycerol (3), linolenoyloleoyl-3-beta-galactosylglycerol (4), and 1,2-dipalmitoyl-3-beta-galactosylglycerol (5). 3-Acyl-sitosterols, sinigrin, gluconasturtiin, and phosphatidylcholines isolated from horseradish and alpha-tocopherol and ubiquinone-10 from wasabi rhizomes isolated were inactive in our assays. At a concentration of 60 microg/mL, compounds 1 and 2 selectively inhibited COX-1 enzyme by 28 and 32%, respectively. Compounds 3, 4, and 5 gave 75, 42, and 47% inhibition of COX-1 enzyme, respectively, at a concentration of 250 microg/mL. In a dose response study, compound 3 inhibited the proliferation of colon cancer cells (HCT-116) by 21.9, 42.9, 51.2, and 68.4% and lung cancer cells (NCI-H460) by 30, 39, 44, and 71% at concentrations of 7.5, 15, 30, and 60 microg/mL, respectively. At a concentration of 60 microg/mL, compound 4 inhibited the growth of colon, lung, and stomach cancer cells by 28, 17, and 44%, respectively. This is the first report of the COX-1 enzyme and cancer cell growth inhibitory monogalactosyl diacylglycerides from wasabi and horseradish rhizomes.

  5. In Vitro Differentiation and Propagation of Urothelium from Pluripotent Stem Cell Lines.

    Science.gov (United States)

    Osborn, Stephanie L; Kurzrock, Eric A

    2018-01-01

    Bioengineering of bladder tissue, particularly for those patients who have advanced bladder disease, requires a source of urothelium that is healthy, capable of significant proliferation in vitro and immunologically tolerated upon transplant. As pluripotent stem cells have the potential to fulfill such criteria, they provide a critical cell source from which urothelium might be derived in vitro and used clinically. Herein, we describe the in vitro differentiation of urothelium from the H9 human embryonic stem cell (hESC) line through the definitive endoderm (DE) phase via selective culture techniques. The protocol can be used to derive urothelium from other hESCs or human-induced pluripotent stem cells.

  6. Thermotolerance and thermosensitization in CHO and R1H cells: a comparative study

    International Nuclear Information System (INIS)

    Dikomey, E.; Eickhoff, J.; Jung, H.

    1984-01-01

    In CHO and R1H cells thermotolerance was induced by a pre-incubation at 40 0 C, by an acute heat shock at 43 0 C followed by a time interval at 37 0 C, and during continuous heating at 42 0 C. Thermotolerance, which was tested at 43 0 , primarily causes an increase in D 0 of the heat-response curve. The degree of maximum thermotolerance was found to be generally more pronounced in CHO than in R1H cells, but the time interval at 37 0 C, as well as at 40 0 C, to reach this maximum level was the same in both cell lines. CHO and R1H cells could be sensitized to 40 0 C by a pre-treatment at 43 0 C. When compared for the same survival rate after pre-treatment at 43 0 C alone the degree of thermosensitization was about the same in both cell lines. In either cell line thermosensitization was found to be suppressed when cells were made thermotolerant by a previous incubation at 40 0 C for 16 hours. (author)

  7. Immunological response induced by cryoablation against murine H22 hepatoma cell line in vivo.

    Science.gov (United States)

    Yang, Xueling; Li, Xiaoli; Guo, Zhi; Si, Tongguo; Yu, Haipeng; Xing, Wenge

    2018-02-01

    To describe immunological consequences induced by cryoablation against H22 cells in vivo. Adult BALB/c mice underwent subcutaneous implantation of H22 cells. All of them were assigned into three groups randomly: group A (false surgery), group B (cryoablation) and group C (cryoablation plus Freund's adjuvant). Animals were sacrificed 1, 2 and 3 weeks after treatment. Serum IFN-γ and IL-4, Th1/Th2 in spleens and cytotoxicity were detected. Compared with that of group A, (1) INF-γ of group B was higher, but IL-4 was lower; cryoablation plus Freund's adjuvant enhanced these effects. (2) Th1/Th2 rose significantly in both group B and group C. (3) Strong cytolytic activity against H22 cells of group B and group C was found on day 7, 14 and 21. Our study showed a marked shift toward Th1 and IFN-γ expression after cryoablation, with an immuno-stimulatory effect against murine H22 hepatoma Cell. Copyright © 2017. Published by Elsevier Inc.

  8. Interim report on intrathoracic radiotherapy of human small-cell lung carcinoma in nude mice with Re-188-RC-160, a radiolabeled somatostatin analogue

    International Nuclear Information System (INIS)

    Zamora, P.O.; Bender, H.; Biersack, H.J.; Knapp, F.F. Jr.

    1995-01-01

    The purpose of this study was to evaluate the therapeutic efficacy of Re-188-RC-160 in experimental models of human small cell lung carcinomas which mimic the clinical presentation. In the experimental model, cells from the human small cell lung carcinoma cell line NCI-H69 cells were inoculated into the thoracic cavity of athymic mice and rats. Subsequently, the biodistribution of Re-188-RC-160 after injection into the pleural cavity, a radiolabeled somatostatin analogue, was monitored as was the effect on the subsequent growth of tumors. The results presented here, and which are a part of a larger series of studies, suggest that Re-188-RC-160 can be effectively used in this animal model to restrict the growth of small cell lung carcinoma in the thoracic cavity

  9. Invention Development Program Helps Nurture NCI at Frederick Technologies | Poster

    Science.gov (United States)

    The Invention Development Fund (IDF) was piloted by the Technology Transfer Center (TTC) in 2014 to facilitate the commercial development of NCI technologies. The IDF received a second round of funding from the NCI Office of the Director and the Office of Budget and Management to establish the Invention Development Program (IDP) for fiscal year 2016. The IDP is using these funds to help advance a second set of inventions.

  10. Limitations of the hCMEC/D3 cell line as a model for Aβ clearance by the human blood-brain barrier.

    Science.gov (United States)

    Biemans, Elisanne A L M; Jäkel, Lieke; de Waal, Robert M W; Kuiperij, H Bea; Verbeek, Marcel M

    2017-07-01

    Alzheimer's disease and cerebral amyloid angiopathy are characterized by accumulation of amyloid-β (Aβ) at the cerebrovasculature due to decreased clearance at the blood-brain barrier (BBB). However, the exact mechanism of Aβ clearance across this barrier has not been fully elucidated. The hCMEC/D3 cell line has been characterized as a valid model for the BBB. In this study we evaluated the use of this model to study Aβ clearance across the BBB, with an emphasis on brain-to-blood directional permeability. Barrier integrity of hCMEC/D3 monolayers was confirmed for large molecules in both the apical to basolateral and the reverse direction. However, permeability for smaller molecules was substantially higher, especially in basolateral to apical direction, and barrier formation for Aβ was completely absent in this direction. In addition, hCMEC/D3 cells failed to develop a high TEER, possibly caused by incomplete formation of tight junctions. We conclude that the hCMEC/D3 model has several limitations to study the cerebral clearance of Aβ. Therefore, the model needs further characterization before this cell system can be generally applied as a model to study cerebral Aβ clearance. © 2016 The Authors Journal of Neuroscience Research Published by Wiley Periodicals, Inc. © 2016 The Authors Journal of Neuroscience Research Published by Wiley Periodicals, Inc.

  11. Dose rate effect models for biological reaction to ionizing radiation in human cell lines

    International Nuclear Information System (INIS)

    Magae, Junji; Ogata, Hiromitsu

    2008-01-01

    Full text: Because of biological responses to ionizing radiation are dependent on irradiation time or dose rate as well as dose, simultaneous inclusion of dose and dose rate is required to evaluate the risk of long term irradiation at low dose rates. We previously published a novel statistical model for dose rate effect, modified exponential (MOE) model, which predicts irradiation time-dependent biological response to low dose rate ionizing radiation, by analyzing micronucleus formation and growth inhibition in a human osteosarcoma cell line, exposed to wide range of doses and dose rates of gamma-rays. MOE model demonstrates that logarithm of median effective dose exponentially increases in low dose rates, and thus suggests that the risk approaches to zero at infinitely low dose rate. In this paper, we extend the analysis in various kinds of human cell lines exposed to ionizing radiation for more than a year. We measured micronucleus formation and [ 3 H]thymidine uptake in human cell lines including an osteosarcoma, a DNA-dependent protein kinase-deficient glioma, a SV40-transformed fibroblast derived from an ataxia telangiectasia patient, a normal fibroblast, and leukemia cell lines. Cells were exposed to gamma-rays in irradiation room bearing 50,000 Ci of cobalt-60. After the irradiation, they were cultured for 24 h in the presence of cytochalasin B to block cytokinesis, and cytoplasm and nucleus were stained with DAPI and prospidium iodide. The number of binuclear cells bearing a micronucleus was counted under a fluorescence microscope. For proliferation inhibition, cells were cultured for 48 h after the irradiation and [ 3 H] thymidine was pulsed for 4 h before harvesting. We statistically analyzed the data for quantitative evaluation of radiation risk. While dose and dose rate relationship cultured within one month followed MOE model in cell lines holding wild-type DNA repair system, dose rate effect was greatly impaired in DNA repair-deficient cell lines

  12. Oxidation of hydroxylamine by cytochrome P-460 of the obligate methylotroph Methylococcus capsulatus Bath.

    Science.gov (United States)

    Zahn, J A; Duncan, C; DiSpirito, A A

    1994-01-01

    An enzyme capable of the oxidation of hydroxylamine to nitrite was isolated from the obligate methylotroph Methylococcus capsulatus Bath. The absorption spectra in cell extracts, electron paramagnetic resonance spectra, molecular weight, covalent attachment of heme group to polypeptide, and enzymatic activities suggest that the enzyme is similar to cytochrome P-460, a novel iron-containing protein previously observed only in Nitrosomonas europaea. The native and subunit molecular masses of the M. capsulatus Bath protein were 38,900 and 16,390 Da, respectively; the isoelectric point was 6.98. The enzyme has approximately one iron and one copper atom per subunit. The electron paramagnetic resonance spectrum of the protein showed evidence for a high-spin ferric heme. In contrast to the enzyme from N. europaea, a 13-nm blue shift in the soret band of the ferrocytochrome (463 nm in cell extracts to 450 nm in the final sample) occurred during purification. The amino acid composition and N-terminal amino acid sequence of the enzyme from M. capsulatus Bath was similar but not identical to those of cytochrome P-460 of N. europaea. In cell extracts, the identity of the biological electron acceptor is as yet unestablished. Cytochrome c-555 is able to accept electrons from cytochrome P-460, although the purified enzyme required phenazine methosulfate for maximum hydroxylamine oxidation activity (specific activity, 366 mol of O2 per s per mol of enzyme). Hydroxylamine oxidation rates were stimulated approximately 2-fold by 1 mM cyanide and 1.5-fold by 0.1 mM 8-hydroxyquinoline. Images PMID:7928947

  13. About TTC | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    The TTC facilitates licensing and co-development partnerships between biomedical industry, academia, and government agencies and the research laboratories of the NCI and nine other institutes and centers of NIH.

  14. Life Outside NCI | Cancer Prevention Fellowship Program

    Science.gov (United States)

    The CPFP Office is located at the NCI facilities in Rockville, Maryland, near the Nation’s Capital. With the convenient Metro subway reaching throughout the metropolitan area, transportation is within easy reach.

  15. H α and H β Raman scattering line profiles of the symbiotic star AG Pegasi

    Science.gov (United States)

    Lee, Seong-Jae; Hyung, Siek

    2018-04-01

    The H α and H β line profiles of the symbiotic star AG Pegasi, observed in 1998 September (phase ϕ = 10.24), display top narrow double Gaussian components and bottom broad components (FWHM = 200-400 km s-1). The photoionization model indicates that the ionized zone, responsible for the hydrogen Balmer and Lyman lines, is radiation-bounded, with a hydrogen gas number density of nH ˜ 109.85 cm-3 and a gas temperature of Te = 12 000-15 000 K. We have carried out Monte Carlo simulations to fit the Raman scattering broad wings, assuming that the hydrogen Ly β and Ly γ lines emitted within the radiation-bounded H II zone around a white dwarf have the same double Gaussian line profile shape as the hydrogen Balmer lines. The simulation shows that the scattering H I zones are attached to (or located just outside) the inner H II shells. The best fit to the observed broad H I line profiles indicates that the column density of the scattering neutral zone is NH ≃ 3-5 × 1019 cm-2. We have examined whether the geometrical structure responsible for the observed H α and H β line profiles is a bipolar conical shell structure, consisting of the radiation-bounded ionized zone and the outer material bounded neutral zone. The expanding bipolar structure might be two opposite regions of the common envelope or the outer shell of the Roche lobe around the hot white dwarf, formed through the mass inflows from the giant star and pushed out by the fast winds from the hot white dwarf.

  16. Development and characterization of a hydrogen peroxide-resistant cholangiocyte cell line: A novel model of oxidative stress-related cholangiocarcinoma genesis

    Energy Technology Data Exchange (ETDEWEB)

    Thanan, Raynoo [Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Techasen, Anchalee [Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Faculty of Associated Medical Science, Khon Kaen University, Khon Kaen 40002 (Thailand); Hou, Bo [Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Tsu, Mie 514-8507 (Japan); Jamnongkan, Wassana; Armartmuntree, Napat [Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Yongvanit, Puangrat, E-mail: puangrat@kku.ac.th [Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002 (Thailand); Murata, Mariko, E-mail: mmurata@doc.medic.mie-u.ac.jp [Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Tsu, Mie 514-8507 (Japan)

    2015-08-14

    Oxidative stress is a cause of inflammation–related diseases, including cancers. Cholangiocarcinoma is a liver cancer with bile duct epithelial cell phenotypes. Our previous studies in animal and human models indicated that oxidative stress is a major cause of cholangiocarcinoma development. Hydrogen peroxide (H{sub 2}O{sub 2}) can generate hydroxyl radicals, which damage lipids, proteins, and nucleic acids, leading to cell death. However, some cells can survive by adapting to oxidative stress conditions, and selective clonal expansion of these resistant cells would be involved in oxidative stress-related carcinogenesis. The present study aimed to establish H{sub 2}O{sub 2}-resistant cell line from an immortal cholangiocyte cell line (MMNK1) by chronic treatment with low-concentration H{sub 2}O{sub 2} (25 μM). After 72 days of induction, H{sub 2}O{sub 2}-resistant cell lines (ox-MMNK1-L) were obtained. The ox-MMNK1-L cell line showed H{sub 2}O{sub 2}-resistant properties, increasing the expression of the anti-oxidant genes catalase (CAT), superoxide dismutase-1 (SOD1), superoxide dismutase-2 (SOD2), and superoxide dismutase-3 (SOD3) and the enzyme activities of CAT and intracellular SODs. Furthermore, the resistant cells showed increased expression levels of an epigenetics-related gene, DNA methyltransferase-1 (DNMT1), when compared to the parental cells. Interestingly, the ox-MMNK1-L cell line had a significantly higher cell proliferation rate than the MMNK1 normal cell line. Moreover, ox-MMNK1-L cells showed pseudopodia formation and the loss of cell-to-cell adhesion (multi-layers) under additional oxidative stress (100 μM H{sub 2}O{sub 2}). These findings suggest that H{sub 2}O{sub 2}-resistant cells can be used as a model of oxidative stress-related cholangiocarcinoma genesis through molecular changes such as alteration of gene expression and epigenetic changes. - Highlights: • An H{sub 2}O{sub 2}-resistant ox-MMNK1-L cells was established from

  17. At