WorldWideScience

Sample records for cell growth inhibition

  1. Inhibition of cancer cell growth by ruthenium complexes.

    Science.gov (United States)

    Iida, Joji; Bell-Loncella, Elisabeth T; Purazo, Marc L; Lu, Yifeng; Dorchak, Jesse; Clancy, Rebecca; Slavik, Julianna; Cutler, Mary Lou; Shriver, Craig D

    2016-02-12

    Previous studies suggest that certain transition metal complexes, such as cisplatin, are efficacious for treating various cancer types, including ovarian, lung, and breast. In order to further evaluate ruthenium (Ru) complexes as potential anti-cancer agents, we synthesized and evaluated Ru-arene complexes. Two complexes with the general formula [Ru (η (6)-p-cym) (N-N) Cl](+) were tested for their abilities to inhibit cancer cells. The complex with o-phenylenediamine as the N-N ligand (o-PDA) significantly inhibited growth of breast (MDA-MB-231, MCF-7, SKBR-3, and SUM149), lymphoma (Raji), melanoma (Bowes), and osteosarcoma (HT1080); however, the complex with o-benzoquinonediimine (o-BQDI) was ineffective except for SUM149. In contrast, o-PDA failed to inhibit growth of human breast epithelial cells, MCF-10A. Treatment of MDA-MBA-231 cells with o-PDA resulted in a significant reduction of productions of PDGF-AA, GM-CSF, and VEGF-A proteins at the transcriptional levels. Finally, we demonstrated that o-PDA synergistically inhibited MDA-MB-231 cell growth with cyclophosphamide but not doxorubicin or paclitaxel. These results suggest that Ru-arene complexes are promising anti-cancer drugs that inhibit progression and metastasis by blocking multiple processes for breast and other types of cancer.

  2. Autophagy contributes to gefitinib-induced glioma cell growth inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Cheng-Yi [Department of Surgery, Fong-Yuan Hospital, Taichung 420, Taiwan (China); Graduate Institute of Pharmaceutical Science and Technology, Central Taiwan University of Science and Technology, Taichung 406, Taiwan (China); Kuan, Yu-Hsiang [Department of Pharmacology, School of Medicine, Chung Shan Medical University, Taichung 402, Taiwan (China); Department of Pharmacy, Chung Shan Medical University Hospital, Taichung 402, Taiwan (China); Ou, Yen-Chuan; Li, Jian-Ri [Division of Urology, Taichung Veterans General Hospital, Taichung 407, Taiwan (China); Wu, Chih-Cheng [Department of Anesthesiology, Taichung Veterans General Hospital, Taichung 407, Taiwan (China); Department of Financial and Computational Mathematics, Providence University, Taichung 433, Taiwan (China); Pan, Pin-Ho [Department of Pediatrics, Tungs’ Taichung MetroHarbor Hospital, Taichung 435, Taiwan (China); Chen, Wen-Ying [Department of Veterinary Medicine, National Chung Hsing University, Taichung 402, Taiwan (China); Huang, Hsuan-Yi [Department of Surgery, Fong-Yuan Hospital, Taichung 420, Taiwan (China); Chen, Chun-Jung, E-mail: cjchen@vghtc.gov.tw [Department of Medical Research, Taichung Veterans General Hospital, Taichung 407, Taiwan (China); Institute of Biomedical Sciences, National Chung Hsing University, Taichung 402, Taiwan (China); Rong Hsing Research Center for Translational Medicine, National Chung Hsing University, Taichung 402, Taiwan (China); Center for General Education, Tunghai University, Taichung 407, Taiwan (China); Department of Nursing, HungKuang University, Taichung 433, Taiwan (China)

    2014-09-10

    Epidermal growth factor receptor tyrosine kinase inhibitors, including gefitinib, have been evaluated in patients with malignant gliomas. However, the molecular mechanisms involved in gefitinib-mediated anticancer effects against glioma are incompletely understood. In the present study, the cytostatic potential of gefitinib was demonstrated by the inhibition of glioma cell growth, long-term clonogenic survival, and xenograft tumor growth. The cytostatic consequences were accompanied by autophagy, as evidenced by monodansylcadaverine staining of acidic vesicle formation, conversion of microtubule-associated protein-1 light chain 3-II (LC3-II), degradation of p62, punctate pattern of GFP-LC3, and conversion of GFP-LC3 to cleaved-GFP. Autophagy inhibitor 3-methyladenosine and chloroquine and genetic silencing of LC3 or Beclin 1 attenuated gefitinib-induced growth inhibition. Gefitinib-induced autophagy was not accompanied by the disruption of the Akt/mammalian target of rapamycin signaling. Instead, the activation of liver kinase-B1/AMP-activated protein kinase (AMPK) signaling correlated well with the induction of autophagy and growth inhibition caused by gefitinib. Silencing of AMPK suppressed gefitinib-induced autophagy and growth inhibition. The crucial role of AMPK activation in inducing glioma autophagy and growth inhibition was further supported by the actions of AMP mimetic AICAR. Gefitinib was shown to be capable of reducing the proliferation of glioma cells, presumably by autophagic mechanisms involving AMPK activation. - Highlights: • Gefitinib causes cytotoxic and cytostatic effect on glioma. • Gefitinib induces autophagy. • Gefitinib causes cytostatic effect through autophagy. • Gefitinib induces autophagy involving AMPK.

  3. Griseofulvin inhibits the growth of adrenocortical cancer cells in vitro.

    Science.gov (United States)

    Bramann, E L; Willenberg, H S; Hildebrandt, B; Müller-Mattheis, V; Schott, M; Scherbaum, W A; Haase, M

    2013-04-01

    Supernumerary centrosomes and aneuploidy are associated with a malignant phenotype of tumor cells. Centrosomal clustering is a mechanism used by cancer cells with supernumerary centrosomes to solve the threatening problem of multipolar spindles. Griseofulvin is an antifungal substance that interferes with the microtubule apparatus and inhibits centrosomal clustering. It has also been demonstrated that griseofulvin inhibits the growth of tumor cells in vitro and in vivo. However, it is not yet known whether treatment with griseofulvin inhibits growth of adrenocortical tumor cells. We studied the viability and antiproliferative effects of griseofulvin on cultured NCI-H295R adrenocortical carcinoma cells using Wst-1-, BrdUrd-, and [³H]-thymidine assays. For the detection of apoptosis we used a caspase 3/7 cleavage assay and light microscopy techniques. We observed that incubation with griseofulvin for 24-48 h leads to a decrease in the viability and proliferation of NCI-H295R cells in a dose-dependent manner. Significant effects could be observed after incubation with griseofulvin as measured by Wst-1-, BrdUrd-, and [³H]dT- uptake assays. Apoptosis of NCI-H295R cells was increased in a dose-dependent manner up to 4.5-fold after incubation with griseofulvin 40 μM for 24 h as shown by caspase 3/7 cleavage assay and light microscopy. With regard to new treatment strategies for adrenocortical cancer, griseofulvin, and possibly other agents, which interfere with the microtubule apparatus and inhibit centrosomal clustering, may turn out to be interesting targets for further research. © Georg Thieme Verlag KG Stuttgart · New York.

  4. E-cadherin homophilic ligation inhibits cell growth and epidermal growth factor receptor signaling independently of other cell interactions

    DEFF Research Database (Denmark)

    Perrais, Michaël; Chen, Xiao; Perez-Moreno, Mirna

    2007-01-01

    growth inhibitory signals. To address this question, we have selectively formed E-cadherin homophilic bonds at the cell surface of isolated epithelial cells by using functionally active recombinant E-cadherin protein attached to microspheres. We find that E-cadherin ligation alone reduces the frequency...... of cells entering the S phase, demonstrating that E-cadherin ligation directly transduces growth inhibitory signals. E-cadherin binding to beta-catenin is required for cell growth inhibition, but beta-catenin/T-cell factor transcriptional activity is not involved in growth inhibition resulting from...... homophilic binding. Neither E-cadherin binding to p120-catenin nor beta-catenin binding to alpha-catenin, and thereby the actin cytoskeleton, is required for growth inhibition. E-cadherin ligation also inhibits epidermal growth factor (EGF) receptor-mediated growth signaling by a beta...

  5. p8 inhibits the growth of human pancreatic cancer cells and its expression is induced through pathways involved in growth inhibition and repressed by factors promoting cell growth

    Directory of Open Access Journals (Sweden)

    Vasseur Sophie

    2003-11-01

    Full Text Available Abstract Background p8 is a stress-induced protein with multiple functions and biochemically related to the architectural factor HMG-I/Y. We analyzed the expression and function of p8 in pancreatic cancer-derived cells. Methods Expression of p8 was silenced in the human pancreatic cancer cell lines Panc-1 and BxPc-3 by infection with a retrovirus expressing p8 RNA in the antisense orientation. Cell growth was measured in control and p8-silenced cells. Influence on p8 expression of the induction of intracellular pathways promoting cellular growth or growth arrest was monitored. Results p8-silenced cells grew more rapidly than control cells transfected with the empty retrovirus. Activation of the Ras→Raf→MEK→ERK and JNK intracellular pathways down-regulated p8 expression. In addition, the MEK1/2 inhibitor U0126 and the JNK inhibitor SP600125 up-regulates expression of p8. Conversely, p38 or TGFβ-1 induced p8 expression whereas the specific p38 inhibitor SB203580 down-regulated p8 expression. Finally, TGFβ-1 induction was in part mediated through p38. Conclusions p8 inhibits the growth of human pancreatic cancer cells. p8 expression is induced through pathways involved in growth inhibition and repressed by factors that promote cell growth. These results suggest that p8 belongs to a pathway regulating the growth of pancreatic cancer cells.

  6. Tempol inhibits growth of As4.1 juxtaglomerular cells via cell cycle arrest and apoptosis.

    Science.gov (United States)

    Han, Yong Hwan; Park, Woo Hyun

    2012-03-01

    A stable nitroxide 4-hydroxy-2,2,6,6-tetramethylpiperidine-N-osyl (Tempol) is widely used as an antioxidant in vitro and in vivo. In this study, we investigated the effects of Tempol on the growth of As4.1 juxtaglomerular cells in relation to cell cycle and cell death. Tempol dose-dependently decreased the growth of As4.1 cells with an IC50 of ~1 mM at 48 h. DNA flow cytometry analysis and BrdU staining indicated that Tempol induced S phase arrest, which is accompanied by a downregulation of cyclin A. Tempol also induced apoptotic cell death, which was accompanied by the loss of mitochondrial membrane potential (MMP; ∆Ψm), an activation of caspase-3 and cleavage of poly(ADP-ribose)polymerase-1 (PARP-1). Furthermore, Tempol increased reactive oxygen species (ROS) levels, and the phosphorylation of extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK). MEK and JNK inhibitors significantly attenuated a growth inhibition in Tempol-treated As4.1 cells. In conclusion, Tempol inhibited the growth of As4.1 cells via cell cycle arrest and apoptosis. Tempol also activated ERK and JNK signaling, which was responsible for cell growth inhibition. Our present data provide useful information for the toxicological effects of Tempol in juxtaglomerular cells in relation to cell growth inhibition and cell death.

  7. Pumpkin seed extract: Cell growth inhibition of hyperplastic and cancer cells, independent of steroid hormone receptors.

    Science.gov (United States)

    Medjakovic, Svjetlana; Hobiger, Stefanie; Ardjomand-Woelkart, Karin; Bucar, Franz; Jungbauer, Alois

    2016-04-01

    Pumpkin seeds have been known in folk medicine as remedy for kidney, bladder and prostate disorders since centuries. Nevertheless, pumpkin research provides insufficient data to back up traditional beliefs of ethnomedical practice. The bioactivity of a hydro-ethanolic extract of pumpkin seeds from the Styrian pumpkin, Cucurbita pepo L. subsp. pepo var. styriaca, was investigated. As pumpkin seed extracts are standardized to cucurbitin, this compound was also tested. Transactivational activity was evaluated for human androgen receptor, estrogen receptor and progesterone receptor with in vitro yeast assays. Cell viability tests with prostate cancer cells, breast cancer cells, colorectal adenocarcinoma cells and a hyperplastic cell line from benign prostate hyperplasia tissue were performed. As model for non-hyperplastic cells, effects on cell viability were tested with a human dermal fibroblast cell line (HDF-5). No transactivational activity was found for human androgen receptor, estrogen receptor and progesterone receptor, for both, extract and cucurbitin. A cell growth inhibition of ~40-50% was observed for all cell lines, with the exception of HDF-5, which showed with ~20% much lower cell growth inhibition. Given the receptor status of some cell lines, a steroid-hormone receptor independent growth inhibiting effect can be assumed. The cell growth inhibition for fast growing cells together with the cell growth inhibition of prostate-, breast- and colon cancer cells corroborates the ethnomedical use of pumpkin seeds for a treatment of benign prostate hyperplasia. Moreover, due to the lack of androgenic activity, pumpkin seed applications can be regarded as safe for the prostate. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Hedgehog pathway inhibition in chondrosarcoma using the smoothened inhibitor IPI-926 directly inhibits sarcoma cell growth.

    Science.gov (United States)

    Campbell, Veronica T; Nadesan, Puviindran; Ali, S Amanda; Wang, Chang Ye Yale; Whetstone, Heather; Poon, Raymond; Wei, Qingxia; Keilty, John; Proctor, Jennifer; Wang, Lauren W; Apte, Suneel S; McGovern, Karen; Alman, Benjamin A; Wunder, Jay S

    2014-05-01

    Hedgehog (Hh) pathway inhibition in cancer has been evaluated in both the ligand-independent and ligand-dependent settings, where Hh signaling occurs either directly within the cancer cells or within the nonmalignant cells of the tumor microenvironment. Chondrosarcoma is a malignant tumor of cartilage in which there is ligand-dependent activation of Hh signaling. IPI-926 is a potent, orally delivered small molecule that inhibits Hh pathway signaling by binding to Smoothened (SMO). Here, the impact of Hh pathway inhibition on primary chondrosarcoma xenografts was assessed. Mice bearing primary human chondrosarcoma xenografts were treated with IPI-926. The expression levels of known Hh pathway genes, in both the tumor and stroma, and endpoint tumor volumes were measured. Gene expression profiling of tumors from IPI-926-treated mice was conducted to identify potential novel Hh target genes. Hh target genes were studied to determine their contribution to the chondrosarcoma neoplastic phenotype. IPI-926 administration results in downmodulation of the Hh pathway in primary chondrosarcoma xenografts, as demonstrated by evaluation of the Hh target genes GLI1 and PTCH1, as well as inhibition of tumor growth. Chondrosarcomas exhibited autocrine and paracrine Hh signaling, and both were affected by IPI-926. Decreased tumor growth is accompanied by histopathologic changes, including calcification and loss of tumor cells. Gene profiling studies identified genes differentially expressed in chondrosarcomas following IPI-926 treatment, one of which, ADAMTSL1, regulates chondrosarcoma cell proliferation. These studies provide further insight into the role of the Hh pathway in chondrosarcoma and provide a scientific rationale for targeting the Hh pathway in chondrosarcoma.

  9. Compounds in a particular production lot of tryptic soy broth inhibit Staphylococcus aureus cell growth.

    Science.gov (United States)

    Ishii, Masaki; Matsumoto, Yasuhiko; Sekimizu, Kazuhisa

    2015-06-01

    Staphylococcus aureus Newman strain and several methicillin-resistant S. aureus (MRSA) clinical isolates were grown on agar plates prepared with conventional lots of tryptic soy broth (TSB). Cell growth of these strains was inhibited on agar plates containing TSB of a particular product lot (lot A), whereas the cell growth of S. aureus RN4220 strain and several other MRSA clinical isolates was not inhibited. The cell growth of a strain of S. epidermidis was also inhibited on agar plates containing TSB of lot A, whereas the cell growth of Bacillus subtilis, Lactococcus lactis, Klebsiella pneumonia, Salmonella enterica, Serratia marcescens, Pseudomonas aeruginosa, and Escherichia coli was not inhibited. Although cell growth of the Newman strain was inhibited on agar plates containing TSB of lot A that was autoclaved in stainless steel or glass containers, cell growth inhibition was not observed when the medium was autoclaved in polypropylene containers. Compounds that inhibited the cell growth of the Newman strain were extracted from a polypropylene tube that was preincubated with liquid medium prepared from TSB of lot A. These findings suggest that polypropylene-binding compounds in TSB of lot A inhibited the cell growth of S. aureus Newman strain, some MRSA clinical isolates, and S. epidermidis.

  10. Zebularine inhibits the growth of A549 lung cancer cells via cell cycle arrest and apoptosis.

    Science.gov (United States)

    You, Bo Ra; Park, Woo Hyun

    2014-11-01

    Zebularine (Zeb) is a DNA methyltransferase (DNMT) inhibitor to that has an anti-tumor effect. Here, we evaluated the anti-growth effect of Zeb on A549 lung cancer cells in relation to reactive oxygen species (ROS) levels. Zeb inhibited the growth of A549 cells with an IC50 of approximately 70 µM at 72 h. Cell cycle analysis indicated that Zeb induced an S phase arrest in A549 cells. Zeb also induced A549 cell death, which was accompanied by the loss of mitochondrial membrane potential (MMP; ΔΨm ), Bcl-2 decrease, Bax increase, p53 increase and activation of caspase-3 and -8. In contrast, Zeb mildly inhibited the growth of human pulmonary fibroblast (HPF) normal cells and lead to a G1 phase arrest. Zeb did not induce apoptosis in HPF cells. In relation to ROS level, Zeb increased ROS level in A549 cells and induced glutathione (GSH) depletion. The well-known antioxidant, N-acetyl cysteine (NAC) prevented the death of Zeb-treated A549 cells. Moreover, Zeb increased the level of thioredoxin reductase 1 (TrxR1) in A549 cells. While the overexpression of TrxR1 attenuated death and ROS level in Zeb-treated A549 cells, the downregulation of TrxR1 intensified death and ROS level in these cells. In conclusion, Zeb inhibited the growth of A549 lung cancer cells via cell cycle arrest and apoptosis. The inhibition was influenced by ROS and TrxR1 levels. © 2013 Wiley Periodicals, Inc.

  11. Ginger inhibits cell growth and modulates angiogenic factors in ovarian cancer cells

    Directory of Open Access Journals (Sweden)

    Huang Jennifer

    2007-12-01

    Full Text Available Abstract Background Ginger (Zingiber officinale Rosc is a natural dietary component with antioxidant and anticarcinogenic properties. The ginger component [6]-gingerol has been shown to exert anti-inflammatory effects through mediation of NF-κB. NF-κB can be constitutively activated in epithelial ovarian cancer cells and may contribute towards increased transcription and translation of angiogenic factors. In the present study, we investigated the effect of ginger on tumor cell growth and modulation of angiogenic factors in ovarian cancer cells in vitro. Methods The effect of ginger and the major ginger components on cell growth was determined in a panel of epithelial ovarian cancer cell lines. Activation of NF-κB and and production of VEGF and IL-8 was determined in the presence or absence of ginger. Results Ginger treatment of cultured ovarian cancer cells induced profound growth inhibition in all cell lines tested. We found that in vitro, 6-shogaol is the most active of the individual ginger components tested. Ginger treatment resulted in inhibition of NF-kB activation as well as diminished secretion of VEGF and IL-8. Conclusion Ginger inhibits growth and modulates secretion of angiogenic factors in ovarian cancer cells. The use of dietary agents such as ginger may have potential in the treatment and prevention of ovarian cancer.

  12. Ergosterol peroxide inhibits ovarian cancer cell growth through multiple pathways.

    Science.gov (United States)

    Tan, Weiwei; Pan, Meihong; Liu, Hui; Tian, Hequn; Ye, Qing; Liu, Hongda

    2017-01-01

    Ergosterol peroxide (EP), a sterol derived from medicinal mushrooms, has been reported to exert antitumor activity in several tumor types. However, the role of EP toward ovarian cancer cells has not been investigated. In this study, we analyzed the cytotoxicity of EP in various cell lines representing high-grade serous ovarian cancer and low-grade serous ovarian cancer, respectively. Although EP showed no significant inhibition of the viability of normal ovarian surface epithelial cells, it impaired the proliferation and invasion capacities of tumor cells in a dose-dependent manner. We further figured out key modulators involved in its antitumor effects by quantitative reverse transcription polymerase chain reaction, ELISA, and Western blot. The nuclear β-catenin was down-regulated upon EP treatment, subsequently reducing the Cyclin D1 and c-Myc expression levels. Meanwhile, the protein level of protein tyrosine phosphatase SHP2 was up-regulated in EP treated cells, whereas Src kinase activity was inhibited. Both activation of SHP2 phosphatase and inhibition of Src kinase decreased the phosphorylation level of transducer and activator of STAT3 protein, which was implicated in oncogenesis. On the other hand, EP remarkably inhibited the expression and secretion of VEGF-C, implying its involvement in counteracting tumor angiogenesis. Moreover, EP treatment showed comparable cytotoxic effect with β-catenin knock-down or STAT3 inhibition. Taken together, our results demonstrated that EP showed antitumor effects toward ovarian cancer cells through both β-catenin and STAT3 signaling pathways, making it a promising candidate for drug development.

  13. Ergosterol peroxide inhibits ovarian cancer cell growth through multiple pathways

    Directory of Open Access Journals (Sweden)

    Tan W

    2017-07-01

    Full Text Available Weiwei Tan,1,* Meihong Pan,1,* Hui Liu,1 Hequn Tian,1 Qing Ye,1 Hongda Liu2 1Department of Traditional Chinese Medicine, Yidu Central Hospital of Weifang, Weifang, Shandong, China; 2Department of General Surgery, Qilu Hospital Affiliated to Shandong University, Jinan, Shandong, China *These authors contributed equally to this work Abstract: Ergosterol peroxide (EP, a sterol derived from medicinal mushrooms, has been reported to exert antitumor activity in several tumor types. However, the role of EP toward ovarian cancer cells has not been investigated. In this study, we analyzed the cytotoxicity of EP in various cell lines representing high-grade serous ovarian cancer and low-grade serous ovarian cancer, respectively. Although EP showed no significant inhibition of the viability of normal ovarian surface epithelial cells, it impaired the proliferation and invasion capacities of tumor cells in a dose-dependent manner. We further figured out key modulators involved in its antitumor effects by quantitative reverse transcription polymerase chain reaction, ELISA, and Western blot. The nuclear β-catenin was down-regulated upon EP treatment, subsequently reducing the Cyclin D1 and c-Myc expression levels. Meanwhile, the protein level of protein tyrosine phosphatase SHP2 was up-regulated in EP treated cells, whereas Src kinase activity was inhibited. Both activation of SHP2 phosphatase and inhibition of Src kinase decreased the phosphorylation level of transducer and activator of STAT3 protein, which was implicated in oncogenesis. On the other hand, EP remarkably inhibited the expression and secretion of VEGF-C, implying its involvement in counteracting tumor angiogenesis. Moreover, EP treatment showed comparable cytotoxic effect with β-catenin knock-down or STAT3 inhibition. Taken together, our results demonstrated that EP showed antitumor effects toward ovarian cancer cells through both β-catenin and STAT3 signaling pathways, making it a

  14. Inhibition of telomerase activity and cell growth by free and ...

    African Journals Online (AJOL)

    Furthermore, the telomerase activity of the nanoliposomal punicalagin-treated cells was significantly inhibited in a time- and dose-dependent manner. Conclusion: Punicalagin shows a novel mechanism of anti-telomerase activity, particularly in the nanoliposomal form, and may provide a basis for the future development of ...

  15. Lobaplatin inhibits growth of gastric cancer cells by inducing apoptosis

    Science.gov (United States)

    Yin, Chu-Yang; Lin, Xiao-Lin; Tian, Lei; Ye, Ming; Yang, Xin-Ying; Xiao, Xiu-Ying

    2014-01-01

    AIM: To assess the anti-cancer effect of lobaplatin on human gastric cancer cells, and to explore the underlying molecular mechanisms. METHODS: The human gastric cancer cell lines MKN-28, AGS and MKN-45 were used. The cytotoxicity of lobaplatin was detected using an MTS cell proliferation assay. Flow cytometry was used to detect cell apoptosis using Annexin V-FITC Apoptosis Detection Kit. The expression of apoptosis-regulated genes was examined at the protein level using Western blot. RESULTS: Lobaplatin inhibited the proliferation of human gastric cancer cells and induced apoptosis, which may be associated with the up-regulation of Bax expression, poly(ADP-ribose) polymerase (PARP) cleavage, p53 expression and the reduction of Bcl-2 expression. CONCLUSION: The cytotoxicity of lobaplatin may be due to its ability of inducing apoptosis of gastric cancer cells, which would support the potential use of lobaplatin for the therapy of gastric cancer. PMID:25516654

  16. Cell binding and growth inhibition by hexachlorophene of decanoate and their reversibility.

    Science.gov (United States)

    Levin, B C; Freese, E

    1978-01-01

    More than 80% of the hexachlorophene added to a Bacillus subtilis culture binds to the cells. Complete growth inhibition requires 6 x 10(5) molecules bound per cell. In contrast, more than 99% decanoate remains in solution and 3.8 x 10(7) molecules bound per cell are needed to inhibit growth. Centrifugation and resuspension of cells in growth medium removes only decanoate, whereas the addition of 1% bovine serum albumin to the growth medium removes both inhibitors from their binding sites on the cells. The addition of untreated cells to a hexachlorophene-treated culture enables the hexachlorophene molecules to redistribute among all the cells with the result that the inhibited cells can resume growth.

  17. Human keloid cell characterization and inhibition of growth with human Wharton's jelly stem cell extracts.

    Science.gov (United States)

    Fong, Chui-Yee; Biswas, Arijit; Subramanian, Arjunan; Srinivasan, Akshaya; Choolani, Mahesh; Bongso, Ariff

    2014-05-01

    Keloids are firm rubbery growths that grow beyond the boundaries of human wounds and their treatment has met with limited success. Their properties and growth behavior have not been properly characterized and it has been suggested that a benign neoplastic stem cell-like phenotype in an altered cytokine microenvironment drives their uncontrolled cell proliferation. Modification of the stem cell niche may be an attractive approach to its prevention. We studied the growth behavior, stemness, and tumorigenic characteristics of keloid cells in prolonged culture. Since human Wharton's jelly stem cells (hWJSCs) secrete high levels of cytokines and have anti-tumorigenic properties we explored its role on the inhibition of keloid growth in vitro. Keloid cells grew readily in both adherent and sphere culture and expressed high levels of mesenchymal CD and tumor-associated fibroblast (TAF) markers up to passage 10. When they were exposed to repeat doses of hWJSC conditioned medium (hWJSC-CM) and lysate (hWJSC-CL) every 72 h up to 9 days their growth was inhibited with a reduction in CD and TAF marker expression. On Days 3, 6, and 9 treated keloid cells showed linear decreases in cell proliferation (BrdU), increases in Annexin V-FITC and TUNEL-positive cells, interruptions of the cell cycle and inhibition of migration in scratch-wound assays. Immunocytochemistry and qRT-PCR confirmed a significant downregulation of TAF and anti-apoptotic-related gene (SURVIVIN) expression and upregulation of autophagy-related (BAX, ATG5, ATG7, BECLIN-1) gene expression. The results suggest that hWJSCs or molecules secreted by them may be of therapeutic value in the treatment of keloids. © 2013 Wiley Periodicals, Inc.

  18. Depletion of Pokemon gene inhibits hepatocellular carcinoma cell growth through inhibition of H-ras.

    Science.gov (United States)

    Zhang, Quan-Le; Tian, De-An; Xu, Xiang-Jiang

    2011-01-01

    Pokemon is a transcription repressor which plays a critical role in cell transformation and malignancy. However, little is known about its effect on the development and progression of hepatocellular carcinoma (HCC). The aim of this study was to investigate the expression of Pokemon in human HCC tissues and the biological behavior of Pokemon in HCC cells in which it is overexpressed. We also explored the expression of potential downstream cofactors of Pokemon. Reverse transcription polymerase chain reaction and Western blot analysis were used to investigate the expression of Pokemon in tissues of 30 HCC patients. We then examined cell proliferation or apoptosis and β-catenin or H-ras expression in Pokemon-depleted HepG(2) cells using DNA vector-based RNA interference technology. Pokemon was markedly expressed in 22/30 (73.3%) HCC tissues, with expression levels higher than in adjacent normal liver tissues (p Pokemon inhibited proliferation of HepG(2) or induced apoptosis. Also, H-ras expression decreased to a large extent. Pokemon exerts its oncogenic activity in the development of HCC by promoting cancer cell growth and reducing apoptosis, and the effect may be mediated by H-ras. Copyright © 2011 S. Karger AG, Basel.

  19. Isoliquiritigenin Induces Autophagy and Inhibits Ovarian Cancer Cell Growth

    Directory of Open Access Journals (Sweden)

    Hsin-Yuan Chen

    2017-09-01

    Full Text Available Ovarian cancer is one of the commonest gynecologic malignancies, which has a poor prognosis for patients at the advanced stage. Isoliquiritigenin (ISL, an active flavonoid component of the licorice plant, previously demonstrated antioxidant, anti-inflammatory, and tumor suppressive effects. In this study, we investigated the antitumor effect of ISL on human ovarian cancer in vitro using the human ovarian cancer cell lines, OVCAR5 and ES-2, as model systems. Our results show that ISL significantly inhibited the viability of cancer cells in a concentration- and time-dependent manner. Flow cytometry analysis indicated that ISL induced G2/M phase arrest. Furthermore, the expression of cleaved PARP, cleaved caspase-3, Bax/Bcl-2 ratio, LC3B-II, and Beclin-1 levels were increased in western blot analysis. To clarify the role of autophagy and apoptosis in the effect of ISL, we used the autophagy inhibitor—3-methyladenine (3-MA to attenuate the punctate fluorescence staining pattern of the p62/sequestosome 1 (SQSTM1, red fluorescence and LC3 (green fluorescence proteins after ISL treatment, and 3-MA inhibited the cytotoxicity of ISL. These findings provide new information about the link between ISL-induced autophagy and apoptosis and suggest that ISL is a candidate agent for the treatment of human ovarian cancer.

  20. Prolyl oligopeptidase inhibition-induced growth arrest of human gastric cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Kanayo [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Sakaguchi, Minoru, E-mail: sakaguti@gly.oups.ac.jp [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Tanaka, Satoshi [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan); Yoshimoto, Tadashi [Department of Life Science, Setsunan University, 17-8 Ikeda-Nakamachi, Neyagawa, Osaka 572-8508 (Japan); Takaoka, Masanori [Laboratory of Cell Biology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094 (Japan)

    2014-01-03

    Highlights: •We examined the effects of prolyl oligopeptidase (POP) inhibition on p53 null gastric cancer cell growth. •POP inhibition-induced cell growth suppression was associated with an increase in a quiescent G{sub 0} state. •POP might regulate the exit from and/or reentry into the cell cycle. -- Abstract: Prolyl oligopeptidase (POP) is a serine endopeptidase that hydrolyzes post-proline peptide bonds in peptides that are <30 amino acids in length. We recently reported that POP inhibition suppressed the growth of human neuroblastoma cells. The growth suppression was associated with pronounced G{sub 0}/G{sub 1} cell cycle arrest and increased levels of the CDK inhibitor p27{sup kip1} and the tumor suppressor p53. In this study, we investigated the mechanism of POP inhibition-induced cell growth arrest using a human gastric cancer cell line, KATO III cells, which had a p53 gene deletion. POP specific inhibitors, 3-((4-[2-(E)-styrylphenoxy]butanoyl)-L-4-hydroxyprolyl)-thiazolidine (SUAM-14746) and benzyloxycarbonyl-thioprolyl-thioprolinal, or RNAi-mediated POP knockdown inhibited the growth of KATO III cells irrespective of their p53 status. SUAM-14746-induced growth inhibition was associated with G{sub 0}/G{sub 1} cell cycle phase arrest and increased levels of p27{sup kip1} in the nuclei and the pRb2/p130 protein expression. Moreover, SUAM-14746-mediated cell cycle arrest of KATO III cells was associated with an increase in the quiescent G{sub 0} state, defined by low level staining for the proliferation marker, Ki-67. These results indicate that POP may be a positive regulator of cell cycle progression by regulating the exit from and/or reentry into the cell cycle by KATO III cells.

  1. Mixed metal oxide nanoparticles inhibit growth of Mycobacterium tuberculosis into THP-1 cells

    Directory of Open Access Journals (Sweden)

    A R Jafari

    2016-01-01

    Conclusion: Although Ag NPs exhibited low cytotoxicity, they were unable to inhibit Mtb growth in vitro. ZnO NPs exhibited strong anti-Mtb activity and inhibited bacterial growth, but exhibited high cytotoxicity to human macrophage cells. By mixing Ag and ZnO NPs at a ratio of 8ZnO/2Ag, we acquired a mixture that exhibited potent antibacterial activity against Mtb and no cytotoxic effects on THP-1 cells, resulting in inhibition of both in vitro and ex vivo Mtb growth [Figure 1],[Figure 2],[Figure 3], [Table 1],[Table 2],[Table 3].{Figure 1}{Figure 2}{Figure 3} {Table 1}{Table 2}{Table 3}

  2. The resveratrol analogue trimethoxystilbene inhibits cancer cell growth by inducing multipolar cell mitosis.

    Science.gov (United States)

    Traversi, Gianandrea; Fiore, Mario; Percario, Zulema; Degrassi, Francesca; Cozzi, Renata

    2017-03-01

    Natural compounds are extensively studied for their potential use in traditional and non-traditional medicine. Several natural and synthetic Resveratrol analogues have shown interesting biological activities in the field of cancer chemoprevention. In the present study, we have focused on the ability of Resveratrol and two methoxylated derivatives (Trimethoxystilbene and Pterostilbene) to inhibit human cancer cell growth particularly analyzing their ability to interfere with tubulin dynamics at mitosis. We show that Trimethoxystilbene, differently from Resveratrol and Pterostilbene, alters microtubule polymerization dynamics in HeLa cells specifically inducing multipolar spindles and mitotic arrest coupled to a reduction of cell growth and an increase in apoptotic death by mitotic catastrophe. This work demonstrates that the structural modification of Rsv causes substantial changes in the mechanism of action of the derivatives. The presence of three extra methyl groups renders Trimethoxy very efficient in impairing cell proliferation by inducing mitotic catastrophe in cancer cells. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Andrographolide inhibits growth of acute promyelocytic leukaemia cells by inducing retinoic acid receptor-independent cell differentiation and apoptosis.

    Science.gov (United States)

    Manikam, Shiamala D; Manikam, Shiamala T; Stanslas, Johnson

    2009-01-01

    The growth inhibiting potential of andrographolide was evaluated in three acute promyelocytic leukaemia cell line models (HL-60, NB4 and all-trans retinoic acid (ATRA)-resistant NB4-R2). In elucidating the mechanisms of growth inhibition, a special emphasis was placed on assessing the induction of differentiation and apoptosis by andrographolide in the primary acute promyelocytic leukaemia NB4 cells. The compound was 2- and 3-fold more active in inhibiting the growth of HL-60 and NB4-R2 cells compared with NB4 cells, respectively. At IC50 (concentration at which growth of 50% of the cells (compared with medium only treated control cells) is inhibited; 4.5 microM) the compound exhibited strong cell-differentiating activity in NB4 cells, similar to ATRA (IC50 1.5 microM). In the presence of a pure retinoic acid receptor antagonist AGN193109, the growth inhibition of NB4 cells by ATRA was reversed, whereas the activity of andrographolide was not affected. This clearly suggested that andrographolide's cell differentiating activity to induce growth inhibition of NB4 cells most likely occurred via a retinoic acid receptor-independent pathway. At higher concentration (2xIC50), andrographolide was an efficient inducer of apoptosis in NB4 cells. Taken together, these results suggest andrographolide and its derivatives, apparently with a novel cell differentiating mechanism and with ability to induce apoptosis, might be beneficial in the treatment of primary and ATRA-resistant acute promyelocytic leukaemia.

  4. Combination of imatinib and clotrimazole enhances cell growth inhibition in T47D breast cancer cells.

    Science.gov (United States)

    Motawi, Tarek M K; Sadik, Nermin A H; Fahim, Sally A; Shouman, Samia A

    2015-05-25

    Imatinib mesylate (IM), a tyrosine kinase inhibitor, is used as targeted cancer therapy. However, mono-targeting by IM does not always achieve full tumor eradication and thus it is recommended to combine IM with other anticancer agents. Clotrimazole (CLT) is an antifungal azole derivative with promising anticancer effects due to inhibiting the activity of glycolytic enzymes. The present study aimed to evaluate the effect of combining CLT with IM on breast cancer cell line in an attempt to establish effective new combination. T47D human breast cancer cell line was treated with different concentrations of IM and/or CLT for 48 h. IM-CLT interaction was determined by isobologram equation and combination index. Cell viability was confirmed by measuring LDH activity. As indicators of glycolysis inhibition, the expression of hexokinase-2 (HK-2) and 6-phosphofructo-1-kinase (PFK-1) plus the activity of intracellular lactate dehydrogenase (LDH) and pyruvate kinase (PK) were determined. In addition, glucose consumption and adenosine triphosphate (ATP) production were measured. Moreover, nitric oxide (NO), vascular endothelial growth factor (VEGF) and hypoxia inducible factor-α (HIF-α) were also determined as they are modulators for glycolysis. This study demonstrated that IM or CLT synergistically inhibited cell growth in T47D as shown by combination and dose reduction indices. The combination of 15 μM IM and 20 μM CLT significantly decreased glucose consumption, activity of both PK and intracellular LDH, while increased leaked LDH, VEGF and NO in the medium compared to each drug alone. Furthermore the combination decreased gene expression of HK-2, PFK-1 and ATP content compared to the control. In conclusion, the synergistic effect of CLT on IM cytotoxicity in T47D cell line maybe mediated through inhibition of glycolysis and increasing both NO and VEGF. Further studies are required to confirm the efficiency and safety of this combination. Copyright © 2015 Elsevier

  5. Knockdown of asparagine synthetase (ASNS) suppresses cell proliferation and inhibits tumor growth in gastric cancer cells.

    Science.gov (United States)

    Yu, Qingxiang; Wang, Xiaoyu; Wang, Li; Zheng, Jia; Wang, Jiang; Wang, Bangmao

    2016-10-01

    Asparagine synthetase (ASNS) gene encodes an enzyme that catalyzes the glutamine- and ATP-dependent conversion of aspartic acid to asparagine. ASNS is deemed as a promising therapeutic target and its expression is associated with the chemotherapy resistance in several human cancers. However, its role in gastric cancer tumorigenesis has not been investigated. In this study, we employed small interfering RNA (siRNA) to transiently knockdown ASNS in two gastric cancer cell lines, AGS and MKN-45, followed by growth rate assay and colony formation assay. Dose response curve analysis was performed in AGS and MKN-45 cells with stable ASNS knockdown to assess sensitivity to cisplatin. Xenograft experiment was performed to examine in vivo synergistic effects of ASNS depletion and cisplatin on tumor growth. Expression level of ASNS was evaluated in human patient samples using quantitative PCR. Kaplan-Meier curve analysis was performed to evaluate association between ASNS expression and patient survival. Transient knockdown of ASNS inhibited cell proliferation and colony formation in AGS and MKN-45 cells. Stable knockdown of ASNS conferred sensitivity to cisplatin in these cells. Depletion of ASNS and cisplatin treatment exerted synergistic effects on tumor growth in AGS xenografts. Moreover, ASNS was found to be up-regulated in human gastric cancer tissues compared with matched normal colon tissues. Low expression of ASNS was significantly associated with better survival in gastric cancer patients. ASNS may contribute to gastric cancer tumorigenesis and may represent a novel therapeutic target for prevention or intervention of gastric cancer.

  6. Synergistic growth inhibition of cancer cells harboring the RET/PTC1 ...

    Indian Academy of Sciences (India)

    Synergistic growth inhibition of cancer cells harboring the RET/PTC1 oncogene by staurosporine and rotenone involves enhanced cell death. ANTÓNIO PEDRO GONÇALVES, ARNALDO VIDEIRA, VALDEMAR MÁXIMO and PAULA SOARES. J. Biosci. 36(4), September 2011, 639-648, © Indian Academy of Sciences.

  7. Raman spectrum reveals Mesenchymal stem cells inhibiting HL60 cells growth

    Science.gov (United States)

    Su, Xin; Fang, Shaoyin; Zhang, Daosen; Zhang, Qinnan; Lu, Xiaoxu; Tian, Jindong; Fan, Jinping; Zhong, Liyun

    2017-04-01

    Though some research results reveals that Mesenchymal stem cells (MSCs) have the ability of inhibiting tumor cells proliferation, it remains controversial about the precise interaction mechanism during MSCs and tumor cells co-culture. In this study, combing Raman spectroscopic data and principle component analysis (PCA), the biochemical changes of MSCs or Human promyelocytic leukemia (HL60) cells during their co-culture were presented. The obtained results showed that some main Raman peaks of HL60 assigned to nucleic acids or proteins were greatly higher in intensity in the late stage of co-culture than those in the early stage of co-culture while they were still lower relative to the control group, implicating that the effect of MSCs inhibiting HL60 proliferation appeared in the early stage but gradually lost the inhibiting ability in the late stage of co-culture. Moreover, some other peaks of HL60 assigned to proteins were decreased in intensity in the early stage of co-culture relative to the control group but rebounded to the level similar to the control group in the late stage, showing that the content and structure changes of these proteins might be generated in the early stage but returned to the original state in the late stage of co-culture. As a result, in the early stage of MSCs-HL60 co-culture, along with the level of Akt phosphorylation of HL60 was lowered relative to its control group, the proliferation rate of HL60 cells was decreased. And in the late stage of co-culture, along with the level of Akt phosphorylation was rebounded, the reverse transfer of Raman peaks within 875-880 cm- 1 appeared, thus MSCs lost the ability to inhibit HL60 growth and HL60 proliferation was increased. In addition, it was observed that the peak at 811 cm- 1, which is a marker of RNA, was higher in intensity in the late stage than that in the control group, indicating that MSCs might be differentiated into myofibroblast-like MSCs. In addition, PCA results also exhibited

  8. Protein turnover and cellular autophagy in growing and growth-inhibited 3T3 cells

    Energy Technology Data Exchange (ETDEWEB)

    Papadopoulos, T.; Pfeifer, U. (Univ. of Wuerzburg (West Germany))

    1987-07-01

    The relationship between growth, protein degradation, and cellular autophagy was tested in growing and in growth-inhibited 3T3 cell monolayers. For the biochemical evaluation of DNA and protein metabolism, growth-inhibited 3T3 cell monolayers with high cell density and growing 3T3 cell monolayers with low cell density were labeled simultaneously with ({sup 14}C)thymidine and ({sup 3}H)leucine. The evaluation of the DNA turnover and additional ({sup 3}H)thymidine autoradiography showed that 24 to 5% of 3T3 cells continue to replicate even in the growth-inhibited state, where no accumulation of protein and DNA can be observed. Cell loss, therefore, has to be assumed to compensate for the ongoing cell proliferation. When the data of protein turnover were corrected for cell loss, it was found that the rate constant of protein synthesis in nongrowing monolayers was reduced to half the value found in growing monolayers. Simultaneously, the rate constant of protein degradation in nongrowing monolayers was increased to about 1.5-fold the value of growing monolayers. These data are in agreement with the assumption that cellular autophagy represents a major pathway of regulating protein degradation in 3T3 cells and that the regulation of autophagic protein degradation is of relevance for the transition from a growing to a nongrowing state.

  9. Thiol-reducing agents prevent sulforaphane-induced growth inhibition in ovarian cancer cells.

    Science.gov (United States)

    Kim, Seung Cheol; Choi, Boyun; Kwon, Youngjoo

    2017-01-01

    The inhibitory potential of sulforaphane against cancer has been suggested for different types of cancer, including ovarian cancer. We examined whether this effect is mediated by mitogen-activated protein kinase (MAPK) and reactive oxygen species (ROS), important signaling molecules related to cell survival and proliferation, in ovarian cancer cells. Sulforaphane at a concentration of 10 μM effectively inhibited the growth of cancer cells. Use of specific inhibitors revealed that activation of MAPK pathways by sulforaphane is unlikely to mediate sulforaphane-induced growth inhibition. Sulforaphane did not generate significant levels of intracellular ROS. Pretreatment with thiol reducers, but not ROS scavengers, prevented sulforaphane-induced growth inhibition. Furthermore, diamide, a thiol-oxidizing agent, enhanced both growth inhibition and cell death induced by sulforaphane, suggesting that the effect of sulforaphane on cell growth may be related to oxidation of protein thiols or change in cellular redox status. Our data indicate that supplementation with thiol-reducing agents should be avoided when sulforaphane is used to treat cancer.

  10. Eugenol and its synthetic analogues inhibit cell growth of human cancer cells (Part I)

    Energy Technology Data Exchange (ETDEWEB)

    Carrasco A, H.; Cardona, W. [Universidad Andres Bello, Vina del Mar (Chile). Dept. de Ciencias Quimicas]. E-mail: hcarrasco@unab.cl; Espinoza C, L.; Gallardo, C.; Catalan M, K. [Universidad Tecnica Federico Santa Maria, Valparaiso (Chile). Dept. de Quimica; Cardile, V.; Lombardo, L. [University of Catania (Italy). Dept. of Physiological Sciences; Cuellar F, M. [Universidad de Valparaiso (Chile). Facultad de Farmacia; Russo, A. [University of Catania (Italy). Dept. of Biological Chemistry, Medical Chemistry and Molecular Biology

    2008-07-01

    Eugenol (4-allyl-2-methoxyphenol) (1) has been reported to possess antioxidant and anticancer properties. In an attempt to enhance intrinsic activity of this natural compound, some derivatives were synthesized. Eugenol was extracted from cloves oil and further, the eugenol analogues (2-6) were obtained through acetylation and nitration reactions. Eugenol (1) and its analogues (2-6) were examined by in vitro model of cancer using two human cancer cell lines: DU-145 (androgeninsensitive prostate cancer cells) and KB (oral squamous carcinoma cells). Cell viability, by tetrazolium salts assay, was measured. Lactic dehydrogenase (LDH) release was also investigated to evaluate the presence of cell toxicity as a result of cell disruption, subsequent to membrane rupture. In the examined cancer cells, all compounds showed cell-growth inhibition activity. The obtained results demonstrate that the compounds 5-allyl-3-nitrobenzene-1,2-diol (3) and 4-allyl- 2-methoxy-5-nitrophenyl acetate (5) were significantly (p < 0,001) more active than eugenol, with IC{sub 50} values in DU-145 cells of 19.02 x 10{sup -6} and 21.5 x 10{sup -6} mol L{sup -1}, respectively, and in KB cells of 18.11 x 10{sup -6} and 21.26 x 10{sup -6} mol L{sup -1}, respectively, suggesting that the presence of nitro and hydroxyl groups could be important in the activity of these compounds. In addition, our results seem to indicate that apoptotic cell demise appears to be induced in KB and DU-145 cells. In fact, in our experimental conditions, no statistically significant increase in LDH release was observed in cancer cells treated with eugenol and its analogues. (author)

  11. Mevastatin-induced inhibition of cell growth in avocado suspension ...

    African Journals Online (AJOL)

    Cell suspension cultures were established using soft, friable callus derived from nucellar tissue of 'Hass' avocado (Persea americana Mill.) seed from fruit harvested 190 days after full bloom. Cell cultures were maintained in liquid medium supplemented with naphthalene acetic acid (NAA), isopentenyl adenine (iP) and ...

  12. Inhibition of telomerase activity and cell growth by free and ...

    African Journals Online (AJOL)

    found in some plants such as Punica granatum,. Terminalia catappa and Combretum molle [10]. It has inhibitory effect on different kinds of cancer cells including prostate and colon cancer cells. [11,12]. However, the in vivo instability of punicalagin has restricted its use in biomedical research [13]. Previous studies showed ...

  13. Nanoprodrugs of NSAIDs Inhibit the Growth of U87-MG Glioma Cells

    Directory of Open Access Journals (Sweden)

    Bong-Seop Lee

    2010-01-01

    Full Text Available Several recent reports have demonstrated that nonsteroidal anti-inflammatory drugs (NSAIDs inhibit the growth of various malignant cells suggesting their application as anticancer agents. In this study, we prepared six nanometer-sized prodrugs (nanoprodrugs of NSAIDs, ibuprofen, indomethacin, and naproxen through the spontaneous emulsification mechanism using monomeric and dimeric derivatives of the NSAIDs. We evaluated their effect on the proliferation of U87-MG glioma cells by cell counting, WST-1 cell proliferation reagent, and propidium iodide incorporation. The two ibuprofen nanoprodrugs inhibited the cell growth more potently than the indomethacin nanoprodrugs, whereas the naproxen nanoprodrugs did not show any significant effect. Remarkably, ibuprofen did not show any effect at an equimolar concentration. Approximately, 4.4% of the ibuprofen nanoprodrugs was found in the cell, whereas no ibuprofen could be detected suggesting that the superior effect of the nanoprodrugs can be attributed to the efficient cellular uptake of the nanoprodrugs.

  14. Puerariae radix isoflavones and their metabolites inhibit growth and induce apoptosis in breast cancer cells

    International Nuclear Information System (INIS)

    Lin, Y.-J.; Hou, Y.C.; Lin, C.-H.; Hsu, Y.-A.; Sheu, Jim J.C.; Lai, C.-H.; Chen, B.-H.; Lee Chao, Pei-Dawn; Wan Lei; Tsai, F.-J.

    2009-01-01

    Puerariae radix (PR) is a popular natural herb and a traditional food in Asia, which has antithrombotic and anti-allergic properties and stimulates estrogenic activity. In the present study, we investigated the effects of the PR isoflavones puerarin, daidzein, and genistein on the growth of breast cancer cells. Our data revealed that after treatment with PR isoflavones, a dose-dependent inhibition of cell growth occurred in HS578T, MDA-MB-231, and MCF-7 cell lines. Results from cell cycle distribution and apoptosis assays revealed that PR isoflavones induced cell apoptosis through a caspase-3-dependent pathway and mediated cell cycle arrest in the G2/M phase. Furthermore, we observed that the serum metabolites of PR (daidzein sulfates/glucuronides) inhibited proliferation of the breast cancer cells at a 50% cell growth inhibition (GI 50 ) concentration of 2.35 μM. These results indicate that the daidzein constituent of PR can be metabolized to daidzein sulfates or daidzein glucuronides that exhibit anticancer activities. The protein expression levels of the active forms of caspase-9 and Bax in breast cancer cells were significantly increased by treatment with PR metabolites. These metabolites also increased the protein expression levels of p53 and p21. We therefore suggest that PR may act as a chemopreventive and/or chemotherapeutic agent against breast cancer by reducing cell viability and inducing apoptosis.

  15. [Inhibition of rhodiola on the growth of EVC-304 cell line].

    Science.gov (United States)

    Sui, Xiu-lan; Yang, Feng; Chen, Rong-hua; Ga, Bu; Yan, Hui; Zhang, Shi-fu; Zhang, Jing-ling

    2006-07-01

    To observe the effect of rhodiola on human umbilical vein endothelial cell line EVC-304. EVC-304 was cultured and divided into two groups: control group and rhodiola-treated group. Three days after treatment, cell survival rate-drug concentration curve was obtained by counting the survival cells, and cells in each group were stained by Wright's stain and observed under microscope. Cell cycle was determined by flow cytometry (FCM). The survival cells in rhodiola-treated group was much less than those in control group. More cells in rhodiola-treated group stayed in G(1) phase while less in S phase when compared with those in control group by FCM. Rhodiola can inhibit the growth of human endothelial cell line EVC-304, perhaps through inhibiting the proliferation of the cells. This may lay the foundation for the mechanism study and clinical application of rhodiola in prevention of pulmonary artery hypertension.

  16. Thiol-reducing agents prevent sulforaphane-induced growth inhibition in ovarian cancer cells

    OpenAIRE

    Kim, Seung Cheol; Choi, Boyun; Kwon, Youngjoo

    2017-01-01

    ABSTRACT The inhibitory potential of sulforaphane against cancer has been suggested for different types of cancer, including ovarian cancer. We examined whether this effect is mediated by mitogen-activated protein kinase (MAPK) and reactive oxygen species (ROS), important signaling molecules related to cell survival and proliferation, in ovarian cancer cells. Sulforaphane at a concentration of 10 μM effectively inhibited the growth of cancer cells. Use of specific inhibitors revealed that act...

  17. Growth inhibition of human cancer cells in vitro by T-type calcium channel blockers.

    Science.gov (United States)

    Lee, Jae Yeol; Park, Seong Jun; Park, Sung Jun; Lee, Min Joo; Rhim, Hyewhon; Seo, Seon Hee; Kim, Ki-Sun

    2006-10-01

    This paper describes the preliminary biological results that novel T-type calcium channel blockers inhibit the growth of human cancer cells by blocking calcium influx into the cell, based on unknown mechanism on the cell cycle responsible for cellular proliferation. Among the selected compounds from compound library, compound 9c (KYS05041) was identified to be nearly equipotent with Cisplatin against some human cancers in the micromolar range.

  18. Pu-erh Tea Inhibits Tumor Cell Growth by Down-Regulating Mutant p53

    Science.gov (United States)

    Zhao, Lanjun; Jia, Shuting; Tang, Wenru; Sheng, Jun; Luo, Ying

    2011-01-01

    Pu-erh tea is a kind of fermented tea with the incorporation of microorganisms’ metabolites. Unlike green tea, the chemical characteristics and bioactivities of Pu-erh tea are still not well understood. Using water extracts of Pu-erh tea, we analyzed the tumor cell growth inhibition activities on several genetically engineered mouse tumor cell lines. We found that at the concentration that did not affect wild type mouse embryo fibroblasts (MEFs) growth, Pu-erh tea extracts could inhibit tumor cell growth by down-regulated S phase and cause G1 or G2 arrest. Further study showed that Pu-erh tea extracts down-regulated the expression of mutant p53 in tumor cells at the protein level as well as mRNA level. The same concentration of Pu-erh tea solution did not cause p53 stabilization or activation of its downstream pathways in wild type cells. We also found that Pu-erh tea treatment could slightly down-regulate both HSP70 and HSP90 protein levels in tumor cells. These data revealed the action of Pu-erh tea on tumor cells and provided the possible mechanism for Pu-erh tea action, which explained its selectivity in inhibiting tumor cells without affecting wild type cells. Our data sheds light on the application of Pu-erh tea as an anti-tumor agent with low side effects. PMID:22174618

  19. Methylselenol, a selenium metabolite, inhibits colon cancer cell growth in vitro and in vivo

    Science.gov (United States)

    Methylselenol is hypothesized to be a critical selenium (Se) metabolite for anticancer activity. Submicromolar methylselenol exposure inhibited cell growth and led to an increase in the G1 and G2 fractions with a concomitant drop in the S-phase, and an induction of apoptosis in cancerous colon HCT11...

  20. Growth inhibition of mouse embryonic stem (ES) cells on the feeders ...

    African Journals Online (AJOL)

    ajl4

    Mouse embryonic stem cells (mESCs) can be propagated in vitro on the feeders of mouse embryonic fibroblasts. In this study, we found growth inhibition of mESCs cultured on embryonic fibroblast feeders derived from different livestock animals. Under the same condition, mESCs derived from mouse embryonic fibroblast ...

  1. Fluoro-sorafenib (Regorafenib) effects on hepatoma cells: growth inhibition, quiescence and recovery

    Science.gov (United States)

    Carr, Brian I.; Cavallini, Aldo; Lippolis, Catia; D’Alessandro, Rosalba; Messa, Caterina; Refolo, Maria Grazia; Tafaro, Angela

    2015-01-01

    To evaluate the growth-inhibitory properties of the potent multi-kinase antagonist Regorafenib (Fluoro-Sorafenib), which was synthesized as a more potent Sorafenib, a Raf inhibitor and to determine whether similar mechanisms were involved, human hepatoma cell lines were grown in the presence or absence of Regorafanib and examined for growth inhibition. Western blots were performed for Raf targets, for apoptosis and autophagy. Regorafenib inhibited growth of human Hep3B, PLC/PRF/5 and HepG2 cells in a concentration- and time-dependent manner. Multiple signaling pathways were altered, including MAP kinases phospho-ERK and phospho-JNK and its target phospho-c-Jun. There was evidence for apoptosis by FACS, cleavage of caspases and increased Bax levels; as well as induction of autophagy, as judged by increased Beclin-1 and LC3 (II) levels. Prolonged drug exposure resulted in cell quiescence. Full growth recovery occurred after drug removal, unlike with doxorubicin chemotherapy. Regorafenib is a potent inhibitor of cell growth. Cells surviving Regorafenib treatment remain viable, but quiescent and capable of regrowth following drug removal. The reversibility of tumor cell growth suppression after drug removal may have clinical implications. PMID:22777740

  2. Troglitazone inhibits cell growth and induces apoptosis of B-cell acute lymphoblastic leukemia cells with t(14;18).

    Science.gov (United States)

    Takenokuchi, M; Saigo, K; Nakamachi, Y; Kawano, S; Hashimoto, M; Fujioka, T; Koizumi, T; Tatsumi, E; Kumagai, S

    2006-01-01

    Peroxisome proliferator-activated receptor-gamma (PPARgamma), a member of the nuclear receptor superfamily, has been detected in several human leukemia cells. Recent studies reported that PPARgamma ligands inhibit cell proliferation and induce apoptosis in both normal and malignant B-lineage cells. We investigated the expression of PPARgamma and the effects of PPARgamma ligands on UTree-O2, Bay91 and 380, three B-cell acute lymphoblastic leukemia (B-ALL) cell lines with t(14;18), which show a poor prognosis, accompanying c-myc abnormality. Western blot analysis identified expression of PPARgamma protein and real-time PCR that of PPARgamma mRNA on the three cell lines. Troglitazone (TGZ), a synthetic PPARgamma ligand, inhibited cell growth in these cell lines in a dose-dependent manner, which was associated with G(1) cell cycle arrest and apoptosis. We also found this effect PPARgamma independent since PPARgamma antagonists failed to reverse this effect. We assessed the expression of c-myc, an apoptosis-regulatory gene, since c-myc abnormality was detected in most B-ALL cells with t(14;18). TGZ was found to dose-dependently downregulate the expression of c-myc mRNA and c-myc protein in the three cell lines. These results suggest that TGZ inhibits cell growth via induction of G(1) cell cycle arrest and apoptosis in these cell lines and that TGZ-induced apoptosis, at least in part, may be related to the downregulation of c-myc expression. Moreover, the downregulation of c-myc expression by TGZ may depend on a PPARgamma-independent mechanism. Further studies indicate that PPARgamma ligands may serve as a therapeutic agent in B-ALL with t(14;18).

  3. Potential mechanisms for the inhibition of tumor cell growth by manganese superoxide dismutase.

    Science.gov (United States)

    Kim, K H; Rodriguez, A M; Carrico, P M; Melendez, J A

    2001-06-01

    Studies from many laboratories have shown that overexpression of manganese superoxide dismutase (MnSOD) inhibits the growth of numerous tumor cell types. The inhibition of tumor cell growth can be attributed to the increase in the steady-state levels of H2O2 as a result of the increased dismuting activity of MnSOD. Here we demonstrate that overexpression of MnSOD enhances the activity of the superoxide (O2*-)-sensitive enzyme aconitase, decreases the intracellular GSH/GSSG ratio, and dose-dependently inhibits pyruvate carboxylase activity. Thus, alterations in the steady-state concentrations of mitochondrial O2*- and H2O2 as a result of MnSOD overexpression can alter the metabolic capacity of the cell leading to inhibition of cell growth. Furthermore, we propose that MnSOD overexpression can modulate the activity of nitric oxide (*NO) by preventing its reaction with O2*-. This hypothesis suggests that the redox environment of the mitochondria can be altered to favor the activity of *NO rather than peroxynitrite (ONOO-) and may explain the enhanced toxicity of *NO-generating compounds toward MnSOD-overexpressing cell lines. These findings indicate that therapeutic strategies targeted at overexpressing MnSOD in tumor tissue may be more effective when used in combination with agents that deplete the oxidant-buffering and enhance the *NO-generating capacity of the tumor and host, respectively.

  4. Methylthioadenosine (MTA inhibits melanoma cell proliferation and in vivo tumor growth

    Directory of Open Access Journals (Sweden)

    Cortés Javier

    2010-06-01

    Full Text Available Abstract Background Melanoma is the most deadly form of skin cancer without effective treatment. Methylthioadenosine (MTA is a naturally occurring nucleoside with differential effects on normal and transformed cells. MTA has been widely demonstrated to promote anti-proliferative and pro-apoptotic responses in different cell types. In this study we have assessed the therapeutic potential of MTA in melanoma treatment. Methods To investigate the therapeutic potential of MTA we performed in vitro proliferation and viability assays using six different mouse and human melanoma cell lines wild type for RAS and BRAF or harboring different mutations in RAS pathway. We also have tested its therapeutic capabilities in vivo in a xenograft mouse melanoma model and using variety of molecular techniques and tissue culture we investigated its anti-proliferative and pro-apoptotic properties. Results In vitro experiments showed that MTA treatment inhibited melanoma cell proliferation and viability in a dose dependent manner, where BRAF mutant melanoma cell lines appear to be more sensitive. Importantly, MTA was effective inhibiting in vivo tumor growth. The molecular analysis of tumor samples and in vitro experiments indicated that MTA induces cytostatic rather than pro-apoptotic effects inhibiting the phosphorylation of Akt and S6 ribosomal protein and inducing the down-regulation of cyclin D1. Conclusions MTA inhibits melanoma cell proliferation and in vivo tumor growth particularly in BRAF mutant melanoma cells. These data reveal a naturally occurring drug potentially useful for melanoma treatment.

  5. Positional isomerism markedly affects the growth inhibition of colon cancer cells by NOSH-aspirin: COX inhibition and modeling.

    Science.gov (United States)

    Vannini, Federica; Chattopadhyay, Mitali; Kodela, Ravinder; Rao, Praveen P N; Kashfi, Khosrow

    2015-12-01

    We recently reported the synthesis of NOSH-aspirin, a novel hybrid that releases both nitric oxide (NO) and hydrogen sulfide (H2S). In NOSH-aspirin, the two moieties that release NO and H2S are covalently linked at the 1, 2 positions of acetyl salicylic acid, i.e. ortho-NOSH-aspirin (o-NOSH-aspirin). In the present study, we compared the effects of the positional isomers of NOSH-ASA (o-NOSH-aspirin, m-NOSH-aspirin and p-NOSH-aspirin) to that of aspirin on growth of HT-29 and HCT 15 colon cancer cells, belonging to the same histological subtype, but with different expression of cyclooxygenase (COX) enzymes; HT-29 express both COX-1 and COX-2, whereas HCT 15 is COX-null. We also analyzed the effect of these compounds on proliferation and apoptosis in HT-29 cells. Since the parent compound aspirin, inhibits both COX-1 and COX-2, we also evaluated the effects of these compounds on COX-1 and COX-2 enzyme activities and also performed modeling of the interactions between the positional isomers of NOSH-aspirin and COX-1 and COX-2 enzymes. We observed that the three positional isomers of NOSH aspirin inhibited the growth of both colon cancer cell lines with IC50s in the nano-molar range. In particular in HT-29 cells the IC50s for growth inhibition were: o-NOSH-ASA, 0.04±0.011 µM; m-NOSH-ASA, 0.24±0.11 µM; p-NOSH-ASA, 0.46±0.17 µM; and in HCT 15 cells the IC50s for o-NOSH-ASA, m-NOSH-ASA, and p-NOSH-ASA were 0.062 ±0.006 µM, 0.092±0.004 µM, and 0.37±0.04 µM, respectively. The IC50 for aspirin in both cell lines was >5mM at 24h. The reduction of cell growth appeared to be mediated through inhibition of proliferation, and induction of apoptosis. All 3 positional isomers of NOSH-aspirin preferentially inhibited COX-1 over COX-2. These results suggest that the three positional isomers of NOSH-aspirin have the same biological actions, but that o-NOSH-ASA displayed the strongest anti-neoplastic potential. Copyright © 2015 The Authors. Published by Elsevier B.V. All

  6. Zika virus infection dysregulates human neural stem cell growth and inhibits differentiation into neuroprogenitor cells

    Science.gov (United States)

    Devhare, Pradip; Meyer, Keith; Steele, Robert; Ray, Ratna B; Ray, Ranjit

    2017-01-01

    The current outbreak of Zika virus-associated diseases in South America and its threat to spread to other parts of the world has emerged as a global health emergency. A strong link between Zika virus and microcephaly exists, and the potential mechanisms associated with microcephaly are under intense investigation. In this study, we evaluated the effect of Zika virus infection of Asian and African lineages (PRVABC59 and MR766) in human neural stem cells (hNSCs). These two Zika virus strains displayed distinct infection pattern and growth rates in hNSCs. Zika virus MR766 strain increased serine 139 phosphorylation of histone H2AX (γH2AX), a known early cellular response proteins to DNA damage. On the other hand, PRVABC59 strain upregulated serine 15 phosphorylation of p53, p21 and PUMA expression. MR766-infected cells displayed poly (ADP-ribose) polymerase (PARP) and caspase-3 cleavage. Interestingly, infection of hNSCs by both strains of Zika virus for 24 h, followed by incubation in astrocyte differentiation medium, induced rounding and cell death. However, astrocytes generated from hNSCs by incubation in differentiation medium when infected with Zika virus displayed minimal cytopathic effect at an early time point. Infected hNSCs incubated in astrocyte differentiating medium displayed PARP cleavage within 24–36 h. Together, these results showed that two distinct strains of Zika virus potentiate hNSC growth inhibition by different mechanisms, but both viruses strongly induce death in early differentiating neuroprogenitor cells even at a very low multiplicity of infection. Our observations demonstrate further mechanistic insights for impaired neuronal homeostasis during active Zika virus infection. PMID:29022904

  7. CytoregR inhibits growth and proliferation of human adenocarcinoma cells via induction of apoptosis

    Directory of Open Access Journals (Sweden)

    Hassanhi M

    2006-01-01

    Full Text Available Abstract Background Cancer is one of the devastating neovascular diseases that incapacitate so many people the world over. Recent reports from the National Cancer Institute indicate some significant gain therapy and cancer management as seen in the increase in the 5-year survival rate over the past two decades. Although near-perfect cure rate have been reported in the early-stage disease, these data reveal high recurrence rate and serious side effects including second malignancies and fatalities. Most of the currently used anticancer agents are only effective against proliferating cancer cells. Thus attention has been focused on potential anti-cancer agents capable of killing cancer cells independent of the cell cycle state, to ensure effective elimination of most cancer cells. The objective of this study was to test the chemosensitivity and potential mechanism of action of a novel cancer drug, CytoregR, in a panel of human cancer cells. Methods the study was performed using a series of bioassays including Trypan blue exclusion, MTS Growth inhibition, LDH-cytotoxicity, TUNEL-Terminal DNA fragmentation Apoptosis Assay, and the Caspase protease CPP32 activity assays. Results CytoregR induced significant dose- and time-dependent inhibition of growth in all the cells; with significant differences in chemosensitivity (P < 0.05 between the target cells becoming more apparent at 48 hr exposure. CytoregR showed no significant effect on normal cells relative to the tumor cells. Growth inhibition in all the cells was due to induction of apoptosis at lower concentrations of cytoregR (> 1:300. CytoregR-induced caspase protease-3 (CPP32 activation significantly and positively correlated with apoptosis induction and growth inhibition; thus implicating CPP32 as the principal death pathway in cytoregR-induced apoptosis. Conclusion CytoregR exerted a dose-and time-dependent growth inhibitory effect in all the target cells through induction of apoptosis via the

  8. Transactivation of the TIEG1 confers growth inhibition of transforming growth factor-β-susceptible hepatocellular carcinoma cells

    Science.gov (United States)

    Jiang, Lei; Lai, Yiu-Kay; Zhang, Jin-Fang; Chan, Chu-Yan; Lu, Gang; Lin, Marie CM; He, Ming-Liang; Li, Ji-Cheng; Kung, Hsiang-Fu

    2012-01-01

    AIM: To investigate the role of transforming growth factor (TGF)-β-inducible early gene 1 (TIEG1) in TGF-β-induced growth inhibition in hepatocellular carcinoma (HCC) cells. METHODS: Human hepatocyte and HCC cell lines with varied susceptibilities to TGF-β1 were tested by methylthiazoletetrazolium (MTT) assay. The expression changes of Smad2, Smad3, Smad4, Smad7, TIEG1 and TIEG2 gene following treatment with TGF-β1 in a TGF-β-sensitive hepatocyte cell line (MIHA), a TGF-β-sensitive hepatoma cell line (Hep3B) and two TGF-β-insensitive hepatoma cell lines (HepG2 and Bel7404) were examined. SiRNA targeting TIEG1 was transfected into Hep3B cells and the sensitivity of cells to TGF-β1 was examined. Overexpression of TIEG1 was induced by lentiviral-mediated transduction in TGF-β1-resistant hepatoma cell lines (Bel7404 and HepG2). MTT assay and 4’,6-Diamidino-2-phenylindole staining were used to identify cell viability and apoptosis, respectively. The expression level of stathmin was measured by reverse transcriptase polymerase chain reaction and Western-blotting analysis, and stathmin promoter activity by TIEG1 was monitored by a luciferase reporter gene system. RESULTS: TIEG1 was significantly upregulated by TGF-β1 in the TGF-β1-sensitive HCC cell line, Hep3B, but not in the resistant cell lines. The suppression of TIEG1 by siRNAs decreased the sensitivity of Hep3B cells to TGF-β1, whereas the overexpression of TIEG1 mediated growth inhibition and apoptosis in TGF-β1-resistant HCC cell lines, which resembled those of TGF-β1-sensitive HCC cells treated with TGF-β1. Our data further suggested that stathmin was a direct target of TIEG1, as stathmin was significantly downregulated by TIEG1 overexpression, and stathmin promoter activity was inhibited by TIEG1 in a dose-dependent manner. CONCLUSION: Our data suggest that transactivation of TIEG1 conferred growth inhibition of TGF-β-susceptible human HCC cells. PMID:22563190

  9. Radix Astragali and Tanshinone Help Carboplatin Inhibit B16 Tumor Cell Growth.

    Science.gov (United States)

    Wu, Jinyi; Xu, Haiming; Zhang, Lei; Zhang, Xiuying

    2016-08-01

    Excessive UV radiation causes increased melanoma incidence. Postoperation chemotherapy will destroy lymphocytes and compromise immune response. Immunodepression is also detected in patients with cancers. Previous studies suggested that polysaccharide-protein complexes manifested immunomodulatory and antitumor activities. Radix Astragali (RA) extract is a product of polysaccharide-protein complexes, which has been used in the treatment of a variety of diseases because of its low toxicity to the host. Tanshinone (TA) is a derivative of phenanthrenequinone isolated from Danshen, which is suggested to inhibit tumor growth by inducing apoptosis in tumor cells. Carboplatin (CA) is a commonly used chemotherapeutic drug in melanoma treatment. Therefore, we hypothesized that the combination of RA and TA will help CA better inhibit the B16 cell growth. The study will test that the efficacy of growth inhibition of tumor cell produced by CA + RA + TA is better than CA + RA or CA + TA. The B16 tumor cells were injected to Swiss-Hauschka (ICR) mice subcutaneously. Twenty-four hours later, mice received CA intraperitoneally, CA + RA (RA were administered gastrically at the dosage of 10 g/kg body weight), CA + TA (TA were administered gastrically at the dosage of 0.5 g/kg body weight), or no treatment (model group). Tumor weight, volume, latency, incidence, the percentage of CD4(+) and CD8(+) in spleen, and natural killer (NK), and cytotoxic lymphocyte (CTL) activities were measured and compared among different groups. Compared with mice treated with CA + RA, CA + TA, or CA alone, the mice treated with CA + RA + TA showed (1) significantly smaller tumor weight and tumor volume; (2) significantly longer tumor latency; (3) significantly lower tumor incidence; and (4) significantly increased percentage of CD4(+) and CD8(+) in spleen and increased activities of NK and CTL. Combination of RA and TA can help CA produce more effective inhibition on B16 cell growth. © The Author(s) 2015.

  10. Curcumin Inhibits Growth of Human NCI-H292 Lung Squamous Cell Carcinoma Cells by Increasing FOXA2 Expression.

    Science.gov (United States)

    Tang, Lingling; Liu, Jinjin; Zhu, Linyun; Chen, Qingge; Meng, Ziyu; Sun, Li; Hu, Junsheng; Ni, Zhenhua; Wang, Xiongbiao

    2018-01-01

    Lung squamous cell carcinoma (LSCC) is a common histological lung cancer subtype, but unlike lung adenocarcinoma, limited therapeutic options are available for treatment. Curcumin, a natural compound, may have anticancer effects in various cancer cells, but how it may be used to treat LSCC has not been well studied. Here, we applied curcumin to a human NCI-H292 LSCC cell line to test anticancer effects and explored underlying potential mechanisms of action. Curcumin treatment inhibited NCI-H292 cell growth and increased FOXA2 expression in a time-dependent manner. FOXA2 expression was decreased in LSCC tissues compared with adjacent normal tissues and knockdown of FOXA2 increased NCI-H292 cells proliferation. Inhibition of cell proliferation by curcumin was attenuated by FOXA2 knockdown. Moreover inhibition of STAT3 pathways by curcumin increased FOXA2 expression in NCI-H292 cells whereas a STAT3 activator (IL-6) significantly inhibited curcumin-induced FOXA2 expression. Also, SOCS1 and SOCS3, negative regulators of STAT3 activity, were upregulated by curcumin treatment. Thus, curcumin inhibited human NCI-H292 cells growth by increasing FOXA2 expression via regulation of STAT3 signaling pathways.

  11. Curcumin Inhibits Growth of Human NCI-H292 Lung Squamous Cell Carcinoma Cells by Increasing FOXA2 Expression

    Directory of Open Access Journals (Sweden)

    Lingling Tang

    2018-02-01

    Full Text Available Lung squamous cell carcinoma (LSCC is a common histological lung cancer subtype, but unlike lung adenocarcinoma, limited therapeutic options are available for treatment. Curcumin, a natural compound, may have anticancer effects in various cancer cells, but how it may be used to treat LSCC has not been well studied. Here, we applied curcumin to a human NCI-H292 LSCC cell line to test anticancer effects and explored underlying potential mechanisms of action. Curcumin treatment inhibited NCI-H292 cell growth and increased FOXA2 expression in a time-dependent manner. FOXA2 expression was decreased in LSCC tissues compared with adjacent normal tissues and knockdown of FOXA2 increased NCI-H292 cells proliferation. Inhibition of cell proliferation by curcumin was attenuated by FOXA2 knockdown. Moreover inhibition of STAT3 pathways by curcumin increased FOXA2 expression in NCI-H292 cells whereas a STAT3 activator (IL-6 significantly inhibited curcumin-induced FOXA2 expression. Also, SOCS1 and SOCS3, negative regulators of STAT3 activity, were upregulated by curcumin treatment. Thus, curcumin inhibited human NCI-H292 cells growth by increasing FOXA2 expression via regulation of STAT3 signaling pathways.

  12. KAEMPFEROL, A FLAVONOID COMPOUND FROM GYNURA MEDICA INDUCED APOPTOSIS AND GROWTH INHIBITION IN MCF-7 BREAST CANCER CELL

    OpenAIRE

    Yi, Xiaofang; Zuo, Jiangcheng; Tan, Chao; Xian, Sheng; Luo, Chunhua; Chen, Sai; Yu, Liangfang; Luo, Yucheng

    2016-01-01

    Background: Kaempferol, a natural flavonoid, has been shown to induce cancer cell apoptosis and cell growth inhibition in several tumors. Previously we have conducted a full investigation on the chemical constituents of Gynura medica, kaempferol and its glycosides are the major constituents of G. medica. Here we investigated the growth inhibition and apoptosis induction effect of kaempferol extracted from G. medica. Materials and Methods: The inhibition effects of kaempferol were evaluated by...

  13. A novel peptide sansalvamide analogue inhibits pancreatic cancer cell growth through G0/G1 cell-cycle arrest

    International Nuclear Information System (INIS)

    Ujiki, Michael B.; Milam, Ben; Ding Xianzhong; Roginsky, Alexandra B.; Salabat, M. Reza; Talamonti, Mark S.; Bell, Richard H.; Gu Wenxin; Silverman, Richard B.; Adrian, Thomas E.

    2006-01-01

    Patients with pancreatic cancer have little hope for cure because no effective therapies are available. Sansalvamide A is a cyclic depsipeptide produced by a marine fungus. We investigated the effect of a novel sansalvamide A analogue on growth, cell-cycle phases, and induction of apoptosis in human pancreatic cancer cells in vitro. The sansalvamide analogue caused marked time- and concentration-dependent inhibition of DNA synthesis and cell proliferation of two human pancreatic cancer cell lines (AsPC-1 and S2-013). The analogue induced G0/G1 phase cell-cycle arrest and morphological changes suggesting induction of apoptosis. Apoptosis was confirmed by annexin V binding. This novel sansalvamide analogue inhibits growth of pancreatic cancer cells through G0/G1 arrest and induces apoptosis. Sansalvamide analogues may be valuable for the treatment of pancreatic cancer

  14. Plant-made trastuzumab (herceptin inhibits HER2/Neu+ cell proliferation and retards tumor growth.

    Directory of Open Access Journals (Sweden)

    Tatiana V Komarova

    Full Text Available BACKGROUND: Plant biotechnology provides a valuable contribution to global health, in part because it can decrease the cost of pharmaceutical products. Breast cancer can now be successfully treated by a humanized monoclonal antibody (mAb, trastuzumab (Herceptin. A course of treatment, however, is expensive and requires repeated administrations of the mAb. Here we used an Agrobacterium-mediated transient expression system to produce trastuzumab in plant cells. METHODOLOGY/PRINCIPAL FINDINGS: We describe the cloning and expression of gene constructs in Nicotiana benthamiana plants using intron-optimized Tobacco mosaic virus- and Potato virus X-based vectors encoding, respectively, the heavy and light chains of trastuzumab. Full-size antibodies extracted and purified from plant tissues were tested for functionality and specificity by (i binding to HER2/neu on the surface of a human mammary gland adenocarcinoma cell line, SK-BR-3, in fluorescence-activated cell sorting assay and (ii testing the in vitro and in vivo inhibition of HER-2-expressing cancer cell proliferation. We show that plant-made trastuzumab (PMT bound to the Her2/neu oncoprotein of SK-BR-3 cells and efficiently inhibited SK-BR-3 cell proliferation. Furthermore, mouse intraperitoneal PMT administration retarded the growth of xenografted tumors derived from human ovarian cancer SKOV3 Her2+ cells. CONCLUSIONS/SIGNIFICANCE: We conclude that PMT is active in suppression of cell proliferation and tumor growth.

  15. Pekinenin E Inhibits the Growth of Hepatocellular Carcinoma by Promoting Endoplasmic Reticulum Stress Mediated Cell Death

    Directory of Open Access Journals (Sweden)

    Lu Fan

    2017-06-01

    Full Text Available Hepatocellular carcinoma (HCC is a malignant primary liver cancer with poor prognosis. In the present study, we report that pekinenin E (PE, a casbane diterpenoid derived from the roots of Euphorbia pekinensis, has a strong antitumor activity against human HCC cells both in vitro and in vivo. PE suppressed the growth of human HCC cells Hep G2 and SMMC-7721. In addition, PE-mediated endoplasmic reticulum (ER stress caused increasing expressions of C/EBP homologous protein (CHOP, leading to apoptosis in HCC cells both in vitro and in vivo. Inhibition of ER stress with CHOP small interfering RNA or 4-phenyl-butyric acid partially reversed PE-induced cell death. Furthermore, PE induced S cell cycle arrest, which could also be partially reversed by CHOP knockdown. In all, these findings suggest that PE causes ER stress-associated cell death and cell cycle arrest, and it may serve as a potent agent for curing human HCC.

  16. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  17. Effect of Sterols Isolated from Myrtillocactus geometrizans on Growth Inhibition of Colon and Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Mario Augusto Bolaños-Carrillo

    2015-01-01

    Full Text Available Objective. To explore the effect of peniocerol and macdougallin on HCT-15 and MCF-7 cells proliferation, cell cycle, apoptosis, and PARP cleavage. Methods. HCT-15 and MCF-7 cells were treated with various concentrations of peniocerol and macdougallin (10–80 μM during 24 or 48 h. Crystal Violet Assay was used to evaluate the inhibition effect. Cell cycle regulation was examined by a propidium iodide method. Cell apoptosis was detected through both Annexin–V FLUOS/PI double-labeled cytometry assays and Western blot was applied to assess PARP cleavage. Results. Peniocerol and macdougallin induced growth inhibition and apoptosis in vitro in a time- and dose-dependent manner. Moreover, peniocerol and macdougallin induced arrest of cell cycle-dependent manner and increased the proportion of cells in G0/G1 phase. PARP cleavage in HCT-15 and MCF-7 cells was induced by treatment with peniocerol and macdougallin after 36 hours. Conclusions. Our results showed that the mechanism of cytotoxicity displayed by peniocerol and macdougallin is related to cell cycle arrest and apoptosis in both cell lines. This is a significant observation because it helps to understand the way some oxysterols isolated from Myrtillocactus geometrizans develop their biological activities against cancer cells.

  18. Growth-arrest-specific protein 2 inhibits cell division in Xenopus embryos.

    Directory of Open Access Journals (Sweden)

    Tong Zhang

    Full Text Available Growth-arrest-specific 2 gene was originally identified in murine fibroblasts under growth arrest conditions. Furthermore, serum stimulation of quiescent, non-dividing cells leads to the down-regulation of gas2 and results in re-entry into the cell cycle. Cytoskeleton rearrangements are critical for cell cycle progression and cell division and the Gas2 protein has been shown to co-localize with actin and microtubules in interphase mammalian cells. Despite these findings, direct evidence supporting a role for Gas2 in the mechanism of cell division has not been reported.To determine whether the Gas2 protein plays a role in cell division, we over-expressed the full-length Gas2 protein and Gas2 truncations containing either the actin-binding CH domain or the tubulin-binding Gas2 domain in Xenopus laevis embryos. We found that both the full-length Gas2 protein and the Gas2 domain, but not the CH domain, inhibited cell division and resulted in multinucleated cells. The observation that Gas2 domain alone can arrest cell division suggests that Gas2 function is mediated by microtubule binding. Gas2 co-localized with microtubules at the cell cortex of Gas2-injected Xenopus embryos using cryo-confocal microscopy and co-sedimented with microtubules in cytoskeleton co-sedimentation assays. To investigate the mechanism of Gas2-induced cell division arrest, we showed, using a wound-induced contractile array assay, that Gas2 stabilized microtubules. Finally, electron microscopy studies demonstrated that Gas2 bundled microtubules into higher-order structures.Our experiments show that Gas2 inhibits cell division in Xenopus embryos. We propose that Gas2 function is mediated by binding and bundling microtubules, leading to cell division arrest.

  19. Glutamate/glutamine metabolism coupling between astrocytes and glioma cells: neuroprotection and inhibition of glioma growth.

    Science.gov (United States)

    Yao, Pei-Sen; Kang, De-Zhi; Lin, Ru-Ying; Ye, Bing; Wang, Wei; Ye, Zu-Cheng

    2014-07-18

    Glioma glutamate release has been shown to promote the growth of glioma cells and induce neuronal injuries from epilepsy to neuronal death. However, potential counteractions from normal astrocytes against glioma glutamate release have not been fully evaluated. In this study, we investigated the glutamate/glutamine cycling between glioma cells and astrocytes and their impact on neuronal function. Co-cultures of glioma cells with astrocytes (CGA) in direct contact were established under different mix ratio of astrocyte/glioma. Culture medium conditioned in these CGAs were sampled for HPLC measurement, for neuronal ratiometric calcium imaging, and for neuronal survival assay. We found: (1) High levels of glutaminase expression in glioma cells, but not in astrocytes, glutaminase enables glioma cells to release large amount of glutamate in the presence of glutamine. (2) Glutamate levels in CGAs were directly determined by the astrocyte/glioma ratios, indicating a balance between glioma glutamate release and astrocyte glutamate uptake. (3) Culture media from CGAs of higher glioma/astrocyte ratios induced stronger neuronal Ca(2+) response and more severe neuronal death. (4) Co-culturing with astrocytes significantly reduced the growth rate of glioma cells. These results indicate that normal astrocytes in the brain play pivotal roles in glioma growth inhibition and in reducing neuronal injuries from glioma glutamate release. However, as tumor growth, the protective role of astrocytes gradually succumb to glioma cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Inhibition of oxidative stress-elicited AKT activation facilitates PPARγ agonist-mediated inhibition of stem cell character and tumor growth of liver cancer cells.

    Directory of Open Access Journals (Sweden)

    Lanlan Liu

    Full Text Available Emerging evidence suggests that tumor-initiating cells (TICs are the most malignant cell subpopulation in tumors because of their resistance to chemotherapy or radiation treatment. Targeting TICs may be a key innovation for cancer treatment. In this study, we found that PPARγ agonists inhibited the cancer stem cell-like phenotype and attenuated tumor growth of human hepatocellular carcinoma (HCC cells. Reactive oxygen species (ROS initiated by NOX2 upregulation were partially responsible for the inhibitory effects mediated by PPARγ agonists. However, PPARγ agonist-mediated ROS production significantly activated AKT, which in turn promoted TIC survival by limiting ROS generation. Inhibition of AKT, by either pharmacological inhibitors or AKT siRNA, significantly enhanced PPARγ agonist-mediated inhibition of cell proliferation and stem cell-like properties in HCC cells. Importantly, in nude mice inoculated with HCC Huh7 cells, we demonstrated a synergistic inhibitory effect of the PPARγ agonist rosiglitazone and the AKT inhibitor triciribine on tumor growth. In conclusion, we observed a negative feedback loop between oxidative stress and AKT hyperactivation in PPARγ agonist-mediated suppressive effects on HCCs. Combinatory application of an AKT inhibitor and a PPARγ agonist may provide a new strategy for inhibition of stem cell-like properties in HCCs and treatment of liver cancer.

  1. Kaempferol suppresses bladder cancer tumor growth by inhibiting cell proliferation and inducing apoptosis.

    Science.gov (United States)

    Dang, Qiang; Song, Wenbin; Xu, Defeng; Ma, Yanmin; Li, Feng; Zeng, Jin; Zhu, Guodong; Wang, Xinyang; Chang, Luke S; He, Dalin; Li, Lei

    2015-09-01

    The effects of the flavonoid compound, kaempferol, which is an inhibitor of cancer cell proliferation and an inducer of cell apoptosis have been shown in various cancers, including lung, pancreatic, and ovarian, but its effect has never been studied in bladder cancer. Here, we investigated the effects of kaempferol on bladder cancer using multiple in vitro cell lines and in vivo mice studies. The MTT assay results on various bladder cancer cell lines showed that kaempferol enhanced bladder cancer cell cytotoxicity. In contrast, when analyzed by the flow cytometric analysis, DNA ladder experiment, and TUNEL assay, kaempferol significantly was shown to induce apoptosis and cell cycle arrest. These in vitro results were confirmed in in vivo mice studies using subcutaneous xenografted mouse models. Consistent with the in vitro results, we found that treating mice with kaempferol significant suppression in tumor growth compared to the control group mice. Tumor tissue staining results showed decreased expressions of the growth related markers, yet increased expressions in apoptosis markers in the kaempferol treated group mice tissues compared to the control group mice. In addition, our in vitro and in vivo data showed kaempferol can also inhibit bladder cancer invasion and metastasis. Further mechanism dissection studies showed that significant down-regulation of the c-Met/p38 signaling pathway is responsible for the kaempferol mediated cell proliferation inhibition. All these findings suggest kaempferol might be an effective and novel chemotherapeutic drug to apply for the future therapeutic agent to combat bladder cancer. © 2014 Wiley Periodicals, Inc.

  2. Growth inhibition and cell cycle arrest effects of epigallocatechin gallate in the NBT-II bladder tumour cell line.

    Science.gov (United States)

    Chen, J J; Ye, Z-Q; Koo, M W L

    2004-05-01

    To examine the growth inhibition and cell cycle arrest effects of epigallocatechin gallate (EGCG), a major constituent of green tea polyphenols, on the NBT-II bladder tumour cell line. Growth inhibition and cell cycle arrest effects of EGCG were evaluated by the tetrazolium assay, flow cytometry and apoptotic DNA ladder tests. The cell cycle-related oncogene and protein expressions in NBT-II bladder tumour cells, when incubated with EGCG, were detected with reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis. EGCG inhibited growth of the NBT-II bladder tumour cells in a dose- and time-dependent manner. Flow cytometry showed a G0/G1 arrest in cells when cultured with EGCG at doses of 10, 20 or 40 micro mol/L for 48 or 72 h. The apoptotic DNA ladder test showed that EGCG at 10 micro mol/L induced early apoptosis after 48 h of incubation. A down-regulation of cyclin D1 was detected by RT-PCR when the cells were incubated with EGCG (20 micro mol/L for 48 h. EGCG also down-regulated protein expression of cyclin D1, cyclin-dependent kinase 4/6 and phosphorylated retinoblastoma protein, in both a time- and dose-dependent manner, when detected by Western blot. EGCG had growth inhibition and cell-cycle arrest effects in NBT-II bladder tumour cells by down-regulating the cyclin D1, cyclin-dependent kinase 4/6 and retinoblastoma protein machinery for regulating cell-cycle progression.

  3. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  4. Resveratrol inhibits myeloma cell growth, prevents osteoclast formation, and promotes osteoblast differentiation

    DEFF Research Database (Denmark)

    Boissy, Patrice; Andersen, Thomas L; Abdallah, Basem M

    2005-01-01

    , a challenge for treating multiple myeloma is discovering drugs targeting not only myeloma cells but also osteoclasts and osteoblasts. Because resveratrol (trans-3,4',5-trihydroxystilbene) is reported to display antitumor activities on a variety of human cancer cells, we investigated the effects...... of this natural compound on myeloma and bone cells. We found that resveratrol reduces dose-dependently the growth of myeloma cell lines (RPMI 8226 and OPM-2) by a mechanism involving cell apoptosis. In cultures of human primary monocytes, resveratrol inhibits dose-dependently receptor activator of nuclear factor......RNA and cell surface protein levels and a decrease of NFATc1 stimulation and NF-kappaB nuclear translocation, whereas the gene expression of c-fms, CD14, and CD11a is up-regulated. Finally, resveratrol promotes dose-dependently the expression of osteoblast markers like osteocalcin and osteopontin in human bone...

  5. MiR-214 inhibits cell growth in hepatocellular carcinoma through suppression of {beta}-catenin

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xiaojun [Liver Diseases Center, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Chen, Ji [Department of Gastrointestinal Surgery, Shanghai Changzheng Hospital, Second Military Medical University, Shanghai (China); Li, Feng [Department of Pathology, Fujian Provincial Hospital, Fuzhou (China); Lin, Yanting [Liver Diseases Center, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Zhang, Xiaoping; Lv, Zhongwei [Department of Interventional Therapy, Shanghai 10th People' s Hospital, School of Medicine, Tongji University, Shanghai (China); Jiang, Jiaji, E-mail: jiang_jjcn@yahoo.com.cn [Liver Diseases Center, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)

    2012-11-30

    Highlights: Black-Right-Pointing-Pointer miR-214 is frequently downregulated in human HCC cell lines and tissues. Black-Right-Pointing-Pointer miR-214 overexpression inhibits HCC cell growth in vitro and in vivo. Black-Right-Pointing-Pointer miR-214 directly targets {beta}-catenin 3 Prime -UTR in HCC cells. Black-Right-Pointing-Pointer miR-214 regulates {beta}-catenin downstream signaling molecules. -- Abstract: Mounting evidence has shown that microRNAs (miRNAs) are implicated in carcinogenesis and can function as oncogenes or tumor suppressor genes in human cancers. Recent profile studies of miRNA expression have documented a deregulation of miRNA (miR-214) in hepatocellular carcinoma (HCC). However, its potential functions and underlying mechanisms in hepatocarcinogenesis remain largely unknown. Here, we confirmed that miR-214 is significantly downregulated in HCC cells and specimens. Ectopic overexpression of miR-214 inhibited proliferation of HCC cells in vitro and tumorigenicity in vivo. Further studies revealed that miR-214 could directly target the 3 Prime -untranslated region (3 Prime -UTR) of {beta}-catenin mRNA and suppress its protein expression. Similar to the restoring miR-214 expression, {beta}-catenin downregulation inhibited cell growth, whereas restoring the {beta}-catenin expression abolished the function of miR-214. Moreover, miR-214-mediated reduction of {beta}-catenin resulted in suppression of several downstream genes including c-Myc, cyclinD1, TCF-1, and LEF-1. These findings indicate that miR-214 serves as tumor suppressor and plays substantial roles in inhibiting the tumorigenesis of HCC through suppression of {beta}-catenin. Given these, miR-214 may serve as a useful prognostic or therapeutic target for treatment of HCC.

  6. Lactose inhibits the growth of Rhizobium meliloti cells that contain an actively expressed Escherichia coli lactose operon.

    OpenAIRE

    Timblin, C R; Kahn, M L

    1984-01-01

    Expression of the Escherichia coli lactose operon in Rhizobium meliloti 104A14 made the cells sensitive to the addition of the beta-galactosides lactose, phenyl-beta-D-galactoside, and lactobionic acid. Growth stopped when the beta-galactoside was added and viability decreased modestly during the next few hours, but little cell lysis was observed and the cells appeared normal. Protein synthesis was not inhibited. Growth was inhibited only when beta-galactosidase expression was greater than 16...

  7. Targeting SPARC by lentivirus-mediated RNA interference inhibits cervical cancer cell growth and metastasis

    Directory of Open Access Journals (Sweden)

    Chen Jie

    2012-10-01

    Full Text Available Abstract Background Secreted protein acidic and rich in cysteine (SPARC, a calcium-binding matricellular glycoprotein, is implicated in the progressions of some cancers. However, no information has been available to date regarding the function of SPARC in cervical cancer cell growth and metastasis. Methods In this study, we isolated and established high invasive subclones and low invasive subclones from human cervical cancer cell lines HeLa and SiHa by the limited dilution method. Real-time q-RT-PCR, Western Blot and ICC were performed to investigate SPARC mRNA and protein expressions in high invasive subclones and low invasive subclones. Then lentivirus vector with SPARC shRNA was constructed and infected the highly invasive subclones. Real-time q-RT-PCR, Western Blot and ICC were also performed to investigate the changes of SPARC expression after viral infection. In functional assays, effects of SPARC knockdown on the biological behaviors of cervical cancer cells were investigated. The mechanisms of SPARC in cervical cancer proliferation, apoptosis and invasion were also researched. Results SPARC was over-expressed in the highly invasive subclones compared with the low invasive subclones. Knockdown of SPARC significantly suppressed cervical cancer cell proliferation, and induced cell cycle arrest at the G1/G0 phase through the p53/p21 pathway, also caused cell apoptosis accompanied by the decreased ratio of Bcl-2/Bax, and inhibited cell invasion and metastasis accompanied by down-regulated MMP2 and MMP9 expressions and up-regulated E-cadherin expression. Conclusion SPARC is related to the invasive phenotype of cervical cancer cells. Knockdown of SPARC significantly suppresses cervical cancer cell proliferation, induces cell apoptosis and inhibits cell invasion and metastasis. SPARC as a promoter improves cervical cancer cell growth and metastasis.

  8. Effect of crude saponins from Gaultheria trichophylla extract on growth inhibition in human colorectal cancer cells

    Directory of Open Access Journals (Sweden)

    Fiaz Alam

    2015-03-01

    Full Text Available The genus Gaultheria also comprised of species with reported cytotoxic activities. Current research work was carried out to evaluate G. trichophylla crude extract and respective saponins fraction against human colorectal cancer cell line (Caco-2 based on cell viability assays. Caco-2 cells treated with the crude extract showed significant growth inhibition (p< 0.001 in a dose dependent manner with apparent IC50 value of 200 μg/mL and 100 μg/mL in MTT and NRU assays respectively. The fractioned crude saponins showed an enhanced response and inhibited the growth of Caco-2 by 93.6 and 97.4% in MTT and NRU assays respectively, with compared to actinomycin-D (65%. The DAPI staining of cell treated with crude saponins observed under confocal microscope showed shrunken nuclei with apparent nuclear fragmentation and chromatin condensation indicating apoptosis mode of cell death. The study exhibited that the G. Trichophylla saponins induced apoptosis of Caco-2 cell lines. This study provides new evidences to further explore this plant for the novel targets in anticancer drug development.

  9. The Cephalostatins. 24. Isolation, Structure, and Cancer Cell Growth Inhibition of Cephalostatin 20.

    Science.gov (United States)

    Pettit, George R; Xu, Jun-Ping; Chapuis, Jean-Charles; Melody, Noeleen

    2015-06-26

    For the purpose of advancing knowledge of the structural variations available in the natural cephalostatins contained in the marine worm Cephalodiscus gilchristi, the isolation and structure of the 20th member (1) has been accomplished (10(-7) % yield). In turn cephalostatin 20 (1) proved to be enough for an initial SAR study comprising six important human cancer cell lines. A parallel objective was aimed at the possible discovery of a natural cephalostatin with a more accessible structure for total synthesis and/or synthetic modifications, but with powerful cancer cell growth inhibition.

  10. Simvastatin and metformin inhibit cell growth in hepatitis C virus infected cells via mTOR increasing PTEN and autophagy.

    Science.gov (United States)

    Del Campo, José A; García-Valdecasas, Marta; Gil-Gómez, Antonio; Rojas, Ángela; Gallego, Paloma; Ampuero, Javier; Gallego-Durán, Rocío; Pastor, Helena; Grande, Lourdes; Padillo, Francisco J; Muntané, Jordi; Romero-Gómez, Manuel

    2018-01-01

    Hepatitis C virus (HCV) infection has been related to increased risk of development of hepatocellular carcinoma (HCC) while metformin (M) and statins treatment seemed to protect against HCC development. In this work, we aim to identify the mechanisms by which metformin and simvastatin (S) could protect from liver cancer. Huh7.5 cells were infected with HCV particles and treated with M+S. Human primary hepatocytes were treated with M+S. Treatment with both drugs inhibited Huh7.5 cell growth and HCV infection. In non-infected cells S increased translational controlled tumor protein (TCTP) and phosphatase and tensin homolog (PTEN) proteins while M inhibited mammalian target of rapamycin (mTOR) and TCTP. Simvastatin and metformin co-administered down-regulated mTOR and TCTP, while PTEN was increased. In cells infected by HCV, mTOR, TCTP, p62 and light chain 3B II (LC3BII) were increased and PTEN was decreased. S+M treatment increased PTEN, p62 and LC3BII in Huh7.5 cells. In human primary hepatocytes, metformin treatment inhibited mTOR and PTEN, but up-regulated p62, LC3BII and Caspase 3. In conclusion, simvastatin and metformin inhibited cell growth and HCV infection in vitro. In human hepatocytes, metformin increased cell-death markers. These findings suggest that M+S treatment could be useful in therapeutic prevention of HCV-related hepatocellular carcinoma.

  11. Simvastatin and metformin inhibit cell growth in hepatitis C virus infected cells via mTOR increasing PTEN and autophagy.

    Directory of Open Access Journals (Sweden)

    José A Del Campo

    Full Text Available Hepatitis C virus (HCV infection has been related to increased risk of development of hepatocellular carcinoma (HCC while metformin (M and statins treatment seemed to protect against HCC development. In this work, we aim to identify the mechanisms by which metformin and simvastatin (S could protect from liver cancer. Huh7.5 cells were infected with HCV particles and treated with M+S. Human primary hepatocytes were treated with M+S. Treatment with both drugs inhibited Huh7.5 cell growth and HCV infection. In non-infected cells S increased translational controlled tumor protein (TCTP and phosphatase and tensin homolog (PTEN proteins while M inhibited mammalian target of rapamycin (mTOR and TCTP. Simvastatin and metformin co-administered down-regulated mTOR and TCTP, while PTEN was increased. In cells infected by HCV, mTOR, TCTP, p62 and light chain 3B II (LC3BII were increased and PTEN was decreased. S+M treatment increased PTEN, p62 and LC3BII in Huh7.5 cells. In human primary hepatocytes, metformin treatment inhibited mTOR and PTEN, but up-regulated p62, LC3BII and Caspase 3. In conclusion, simvastatin and metformin inhibited cell growth and HCV infection in vitro. In human hepatocytes, metformin increased cell-death markers. These findings suggest that M+S treatment could be useful in therapeutic prevention of HCV-related hepatocellular carcinoma.

  12. Simvastatin and metformin inhibit cell growth in hepatitis C virus infected cells via mTOR increasing PTEN and autophagy

    Science.gov (United States)

    Gil-Gómez, Antonio; Rojas, Ángela; Gallego, Paloma; Ampuero, Javier; Gallego-Durán, Rocío; Pastor, Helena; Grande, Lourdes; Padillo, Francisco J.; Muntané, Jordi; Romero-Gómez, Manuel

    2018-01-01

    Hepatitis C virus (HCV) infection has been related to increased risk of development of hepatocellular carcinoma (HCC) while metformin (M) and statins treatment seemed to protect against HCC development. In this work, we aim to identify the mechanisms by which metformin and simvastatin (S) could protect from liver cancer. Huh7.5 cells were infected with HCV particles and treated with M+S. Human primary hepatocytes were treated with M+S. Treatment with both drugs inhibited Huh7.5 cell growth and HCV infection. In non-infected cells S increased translational controlled tumor protein (TCTP) and phosphatase and tensin homolog (PTEN) proteins while M inhibited mammalian target of rapamycin (mTOR) and TCTP. Simvastatin and metformin co-administered down-regulated mTOR and TCTP, while PTEN was increased. In cells infected by HCV, mTOR, TCTP, p62 and light chain 3B II (LC3BII) were increased and PTEN was decreased. S+M treatment increased PTEN, p62 and LC3BII in Huh7.5 cells. In human primary hepatocytes, metformin treatment inhibited mTOR and PTEN, but up-regulated p62, LC3BII and Caspase 3. In conclusion, simvastatin and metformin inhibited cell growth and HCV infection in vitro. In human hepatocytes, metformin increased cell-death markers. These findings suggest that M+S treatment could be useful in therapeutic prevention of HCV-related hepatocellular carcinoma. PMID:29385181

  13. Nexrutine Inhibits Cancer Cell Growth as a Consequence of Mitochondrial Damage and Mitophagy

    Directory of Open Access Journals (Sweden)

    Xiang Wu

    2015-05-01

    Full Text Available Background/Aims: Nexrutine is an herbal extract of Phellodendron amurense and has been used as nutrient supplement in China as well as America. Potential protection effect of Nexrutine has been reported. Methods: To investigate the mechanism of Nexrutine, we used the HeLa, U2OS and HCT116 as a model. Based on the acidification of cell culture media, we examined the lactate, mitochondria damage as well as mitophagy status by corresponding assay. Results: Our data suggest that Nexrutine alters the cellular glucose metabolism to promote lactate production. This effect is caused by mitochondrial damage, not an alteration to lactate dehydrogenase activity. As a result of the mitochondrial damage, cell proliferation was inhibited and was associated with an elevation in p21/p27 proteins, which are both important cell cycle inhibitors. As another consequence of the mitochondrial damage, mitophagy was highly activated in Nexrutine-treated cells in a dose-dependent manner. When the autophagy pathway was blocked by siRNAs against BECN1 or ATG7, the growth inhibition caused by Nexrutine was reversed. Conclusion: Our study revealed that autophagy plays an important role in the inhibition of cancer cell proliferation by Nexrutine.

  14. Traditional preparations of kava (Piper methysticum) inhibit the growth of human colon cancer cells in vitro.

    Science.gov (United States)

    Einbond, L S; Negrin, A; Kulakowski, D M; Wu, H-A; Antonetti, V; Jalees, F; Law, W; Roller, M; Redenti, S; Kennelly, E J; Balick, M J

    2017-01-15

    Epidemiological studies indicate there is low incidence of colon cancer in the South Pacific islands, including Fiji, West Samoa, and Vanuatu. Cancer incidence has been shown to be inversely associated with kava (Piper methysticum G. Forst.) ingestion. Hypothesis/Purpose: Kava prepared traditionally will inhibit the growth of human cancer cells. This investigation entails preparation and analysis of kava extracts and study of the growth inhibitory activity of the extracts, alone and combined with hibiscus. We will prepare kava as in Micronesia - as a water extract, high in particulate content, alone or combined with sea hibiscus (Hibiscus tiliaceus L.) - and examine the components and growth inhibitory activity. We obtained ground kava prepared in the traditional way from lateral roots and sea hibiscus mucilage and sap from different sources in Micronesia, and prepared water extracts (unfiltered, as well as filtered, since in traditional use the kava beverage contains a high particulate content) and partitions. We used the MTT assay to determine the growth inhibitory activity of the preparations on colon and breast cancer cells and nonmalignant intestinal epithelial cells. LC-MS analysis was used to examine the components of the kava and sea hibiscus extracts and partitions. Traditional preparations of kava inhibit the growth of breast and colon cancer cells. Among the kava preparations, the order of decreasing activity was Fiji(2), Fiji(1), Hawaii; the unfiltered preparations from Fiji were more active than the filtered. Phytochemical analysis indicated that filtering reduced most kavalactone and chalcone content. For example, for Fiji(2), the ratio of dihydromethysticin in filtered/unfiltered kava was 0.01. Thus, for the extracts from Fiji, growth inhibitory activity correlates with the content of these compounds. Unfiltered and filtered kava from Fiji(1) were more active on malignant than nonmalignant intestinal epithelial cells. Since kava is prepared in

  15. CASK inhibits ECV304 cell growth and interacts with Id1

    International Nuclear Information System (INIS)

    Qi Jie; Su Yongyue; Sun Rongju; Zhang Fang; Luo Xiaofeng; Yang Zongcheng; Luo Xiangdong

    2005-01-01

    Calcium/calmodulin-dependent serine protein kinase (CASK) is generally known as a scaffold protein. Here we show that overexpression of CASK resulted in a reduced rate of cell growth, while inhibition of expression of endogenous CASK via RNA-mediated interference resulted in an increased rate of cell growth in ECV304 cells. To explore the molecular mechanism, we identified a novel CASK-interacting protein, inhibitor of differentiation 1 (Id1) with a yeast two-hybrid screening. Furthermore, endogenous CASK and Id1 proteins were co-precipitated from the lysates of ECV304 cells by immunoprecipitation. Mammalian two-hybrid protein-protein interaction assays indicated that CASK possessed a different binding activity for Id1 and its alternative splicing variant. It is known that Id proteins play important roles in regulation of cell proliferation and differentiation. Thus, we speculate that the regulation of cell growth mediated by CASK may be involved in Id1. Our findings indicate a novel function of CASK, the mechanism that remains to be further investigated

  16. Mycoepoxydiene suppresses HeLa cell growth by inhibiting glycolysis and the pentose phosphate pathway.

    Science.gov (United States)

    Jin, Kehua; Li, Li; Sun, Xihuan; Xu, Qingyan; Song, Siyang; Shen, Yuemao; Deng, Xianming

    2017-05-01

    Upregulation of glycolysis and the pentose phosphate pathway (PPP) is a major characteristic of the metabolic reprogramming of cancer and provides cancer cells with energy and vital metabolites to support their rapid proliferation. Targeting glycolysis and the PPP has emerged as a promising antitumor therapeutic strategy. Marine natural products are attractive sources for anticancer therapeutics, as evidenced by the antitumor drug Yondelis. Mycoepoxydiene (MED) is a natural product isolated from a marine fungus that has shown promising inhibitory efficacy against HeLa cells in vitro. We used a proteomic approach with two-dimensional gel electrophoresis (2-DE) coupled with mass spectrometry to explore the cellular targets of MED and to unravel the molecular mechanisms underlying the antitumor activity of MED in HeLa cells. Our proteomic data showed that triosephosphate isomerase (TPI) and 6-phosphogluconolactonase (PGLS), which participate in glycolysis and the PPP, respectively, were significantly downregulated by MED treatment. Functional studies revealed that the expression levels of several other enzymes involved in glycolysis and the PPP, including hexokinase 2 (HK2), phosphofructokinase 1 (PFKM), aldolase A (ALDOA), enolase 1 (ENO1), lactate dehydrogenase A (LDHA), and glucose-6-phosphate dehydrogenase (G6PD), were also reduced in a dose-dependent manner. Moreover, the LDHA and G6PD enzymatic activities in HeLa cells were inhibited by MED, and overexpression of these downregulated enzymes rescued HeLa cells from the growth inhibition induced by MED. Our data suggest that MED suppresses HeLa cell growth by inhibiting glycolysis and the PPP, which provides a mechanistic basis for the development of new therapeutics against cervical cancer.

  17. Artesunate inhibits the growth and induces apoptosis of human gastric cancer cells by downregulating COX-2.

    Science.gov (United States)

    Zhang, Ping; Luo, He-Sheng; Li, Ming; Tan, Shi-Yun

    2015-01-01

    Artesunate, a derivative of artemisinin isolated from Artemisia annua L., has been traditionally used to treat malaria, and artesunate has demonstrated cytotoxic effects against a variety of cancer cells. However, there is little available information about the antitumor effects of artesunate on human gastric cancer cells. In the present study, we investigated the antitumor effect of artesunate on human gastric cancer cells and whether its antitumor effect is associated with reduction in COX-2 expression. The effects of artesunate on the growth and apoptosis of gastric cancer cells were investigated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, flow cytometric analysis of annexin V-fluorescein isothiocyanate/propidium iodide staining, rhodamine 123 staining, and Western blot analysis. Results indicate that artesunate exhibits antiproliferative effects and apoptosis-inducing activities. Artesunate markedly inhibited gastric cancer cell proliferation in a time- and dose-dependent manner and induced apoptosis in gastric cancer cells a dose-dependent manner, which was associated with a reduction in COX-2 expression. Treatment with the selective COX-2 inhibitor celecoxib, or transient transfection of gastric cancer cells with COX-2 siRNA, also inhibited cell proliferation and induced apoptosis. Furthermore, the treatment with artesunate promoted the expression of proapoptotic factor Bax and suppressed the expression of antiapoptotic factor Bcl-2. In addition, caspase-3 and caspase-9 were activated, and artesunate induced loss of mitochondrial membrane potential, suggesting that the apoptosis is mediated by mitochondrial pathways. These results demonstrate that artesunate has an effect on anti-gastric cancer cells. One of the antitumor mechanisms of artesunate may be that its inhibition of COX-2 led to reduced proliferation and induction of apoptosis, connected with mitochondrial dysfunction. Artesunate might be a potential therapeutic

  18. Inhibition of Human Cervical Cancer Cell Growth by Ethanolic Extract of Boerhaavia diffusa Linn. (Punarnava Root

    Directory of Open Access Journals (Sweden)

    Rakhi Srivastava

    2011-01-01

    Full Text Available In Indian traditional medicine, Boerhaavia diffusa (punarnava roots have been widely used for the treatment of dyspepsia, jaundice, enlargement of spleen, abdominal pain and as an anti-stress agent. Pharmacological evaluation of the crude ethanolic extract of B. diffusa roots has been shown to possess antiproliferative and immunomodulatory properties. The extract of B. diffusa was studied for anti-proliferative effects on the growth of HeLa cells and for its effect on cell cycle. Bio-assays of extracts from B. diffusa root showed that a methanol : chloroform fraction (BDF 5 had an antiproliferative effect on HeLa cells. After 48 h of exposure, this fraction at a concentration of 200 μg mL−1 significantly reduced cell proliferation with visible morphological changes in HeLa cells. Cell cycle analysis suggests that antiproliferative effect of BDF 5 could be due to inhibition of DNA synthesis in S-phase of cell cycle in HeLa cells, whereas no significant change in cell cycle was detected in control cells. The fraction BDF 5 caused cell death via apoptosis as evident from DNA fragmentation and caspase-9 activation. Thus the extract has potential to be evaluated in detail to assess the molecular mechanism-mediated anticancer activities of this plant.

  19. Hypoxia inhibits growth, proliferation, and increases response to chemotherapy in retinoblastoma cells.

    Science.gov (United States)

    Yang, Qian; Tripathy, Arushi; Yu, Wayne; Eberhart, Charles G; Asnaghi, Laura

    2017-09-01

    Retinoblastoma is a malignant tumor of the retina and the most frequent intraocular cancer in children. Low oxygen tension (hypoxia) is a common phenomenon in advanced retinoblastomas, but its biological effect on retinoblastoma growth is not clearly understood. Here we studied how hypoxia altered retinoblastoma gene expression and modulated growth and response to chemotherapy. The hypoxic marker lysyl oxidase (LOX) was expressed in 8 of 12 human retinoblastomas analyzed by immunohistochemistry, suggesting that a hypoxic microenvironment is present in up to two thirds of the cases. WERI Rb1 and Y79 retinoblastoma lines were exposed to 1% or 5% pO 2 , cobalt chloride (CoCl 2 ), or to normoxia (21% pO 2 ) for up to 8 days. Both 1% and 5% pO 2 inhibited growth of both lines by more than 50%. Proliferation was reduced by 25-50% when retinoblastoma cells were exposed to 1% vs 21% pO 2 , as determined by Ki67 assay. Surprisingly, Melphalan, Carboplatin, and Etoposide produced greater reduction in growth and survival of hypoxic cells than normoxic ones. Gene expression profile analysis of both lines, exposed for 48 h to 1%, 5%, or 21% pO 2 , showed that glycolysis and glucose transport were the most up-regulated pathways, whereas oxidative phosphorylation was the most down-regulated pathway in hypoxia as compared to normoxia. These data support a role for hypoxia in suppressing growth, proliferation, and enhancing response of retinoblastoma cells to chemotherapy, possibly by impairing energy production through activation of glycolysis and inhibition of mitochondrial respiration. Targeting glucose metabolism or enhancing delivery of chemotherapeutic agents to hypoxic regions may improve treatment of advanced retinoblastomas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Rottlerin-mediated inhibition of Toxoplasma gondii growth in BeWo trophoblast-like cells.

    Science.gov (United States)

    Ietta, Francesca; Maioli, Emanuela; Daveri, Elena; Gonzaga Oliveira, Juliana; da Silva, Rafaela José; Romagnoli, Roberta; Cresti, Laura; Maria Avanzati, Anna; Paulesu, Luana; Barbosa, Bellisa de Freitas; Gomes, Angelica de Oliveira; Roberto Mineo, José; Ferro, Eloisa Amália Vieira

    2017-04-28

    Autophagy is a crucial and physiological process for cell survival from yeast to mammals, including protozoan parasites. Toxoplasma gondii, an intracellular parasite, typically exploits autophagic machinery of host cell; however host cell upregulates autophagy to combat the infection. Herein we tested the efficacy of Rottlerin, a natural polyphenol with autophagic promoting properties, against Toxoplasma infection on the chorioncarcinoma-derived cell line BeWo. We found that Rottlerin, at sub-toxic doses, induced morphological and biochemical alterations associated with autophagy and decreased Toxoplasma growth in infected cells. Although autophagy was synergically promoted by Toxoplasma infection in combination with Rottlerin treatment, the use of the autophagy inhibitor chloroquine revealed that Rottlerin anti-parasitic effect was largely autophagy-independent and likely mediated by the converging inhibitory effect of Rottlerin and Toxoplasma in host protein translation, mediated by mTOR inhibition and eIF2α phosphorylation. Both events, which on one hand could explain the additive effect on autophagy induction, on the other hand led to inhibition of protein synthesis, thereby depriving Toxoplasma of metabolically essential components for multiplication. We suggest that modulation of the competition between pathogen requirement and host cell defense might be an attractive, novel therapeutic approach against Toxoplasma infection and encourage the development of Rottlerin-based new therapeutic formulations.

  1. Aspirin Inhibits Colon Cancer Cell and Tumor Growth and Downregulates Specificity Protein (Sp) Transcription Factors

    Science.gov (United States)

    Pathi, Satya; Jutooru, Indira; Chadalapaka, Gayathri; Nair, Vijayalekshmi; Lee, Syng-Ook; Safe, Stephen

    2012-01-01

    Acetylsalicylic acid (aspirin) is highly effective for treating colon cancer patients postdiagnosis; however, the mechanisms of action of aspirin in colon cancer are not well defined. Aspirin and its major metabolite sodium salicylate induced apoptosis and decreased colon cancer cell growth and the sodium salt of aspirin also inhibited tumor growth in an athymic nude mouse xenograft model. Colon cancer cell growth inhibition was accompanied by downregulation of Sp1, Sp3 and Sp4 proteins and decreased expression of Sp-regulated gene products including bcl-2, survivin, VEGF, VEGFR1, cyclin D1, c-MET and p65 (NFκB). Moreover, we also showed by RNA interference that β-catenin, an important target of aspirin in some studies, is an Sp-regulated gene. Aspirin induced nuclear caspase-dependent cleavage of Sp1, Sp3 and Sp4 proteins and this response was related to sequestration of zinc ions since addition of zinc sulfate blocked aspirin-mediated apoptosis and repression of Sp proteins. The results demonstrate an important underlying mechanism of action of aspirin as an anticancer agent and, based on the rapid metabolism of aspirin to salicylate in humans and the high salicylate/aspirin ratios in serum, it is likely that the anticancer activity of aspirin is also due to the salicylate metabolite. PMID:23110215

  2. 1-o-acetylbritannilactone (ABL) inhibits angiogenesis and lung cancer cell growth through regulating VEGF-Src-FAK signaling

    Energy Technology Data Exchange (ETDEWEB)

    Zhengfu, He; Hu, Zhang; Huiwen, Miao; Zhijun, Li [Department of Thoracic Surgery, Sir Run Run Shaw Hospital of Zhejiang University School of Medicine, Hangzhou (China); Jiaojie, Zhou [Zhejiang University School of Medicine, Hangzhou (China); Xiaoyi, Yan, E-mail: xiaoyiyan163@163.com [Zhejiang University School of Medicine, Hangzhou (China); Xiujun, Cai, E-mail: xiujuncaomaj@163.com [Sir Run Run Shaw Hospital of Zhejiang University School of Medicine, Hangzhou (China)

    2015-08-21

    The search for safe, effective and affordable therapeutics against non-small cell lung cancer (NSCLC) and other lung cancers is important. Here we explored the potential effect of 1-o-acetylbritannilactone (ABL), a novel extract from Inula britannica-F, on angiogenesis and lung cancer cell growth. We demonstrated that ABL dose-dependently inhibited vascular endothelial growth factor (VEGF)-induced proliferation, migration, and capillary structure formation of cultured human umbilical vascular endothelial cells (HUVECs). In vivo, ABL administration suppressed VEGF-induced new vasculature formation in Matrigel plugs. For the mechanism investigations, we found that ABL largely inhibited VEGF-mediated activation of Src kinase and focal adhesion kinase (FAK) in HUVECs. Furthermore, treatment of A549 NSCLC cells with ABL resulted in cell growth inhibition and Src-FAK in-activation. Significantly, administration of a single dose of ABL (12 mg/kg/day) remarkably suppressed growth of A549 xenografts in nude mice. In vivo microvessels formation and Src activation were also significantly inhibited in ABL-treated xenograft tumors. Taken together, our findings suggest that ABL suppresses angiogenesis and lung cancer cell growth possibly via regulating the VEGFR-Src-FAK signaling. - Highlights: • 1-o-acetylbritannilactone (ABL) inhibits VEGF-induced angiogenesis in vivo. • ABL inhibits VEGF-induced HUVEC migration, proliferation, capillary tube formation. • ABL inhibits VEGF-mediated activation of Src and FAK in HUVECs. • ABL inhibits growth and Src-FAK activation in A549 cells. • ABL administration inhibits A549 tumor angiogenesis and growth in nude mice.

  3. Exercise-induced muscle-derived cytokines inhibit mammary cancer cell growth.

    Science.gov (United States)

    Hojman, Pernille; Dethlefsen, Christine; Brandt, Claus; Hansen, Jakob; Pedersen, Line; Pedersen, Bente Klarlund

    2011-09-01

    Regular physical activity protects against the development of breast and colon cancer, since it reduces the risk of developing these by 25-30%. During exercise, humoral factors are released from the working muscles for endocrinal signaling to other organs. We hypothesized that these myokines mediate some of the inhibitory effects of exercise on mammary cancer cell proliferation. Serum and muscles were collected from mice after an exercise bout. Incubation with exercise-conditioned serum inhibited MCF-7 cell proliferation by 52% and increased caspase activity by 54%. A similar increase in caspase activity was found after incubation of MCF-7 cells with conditioned media from electrically stimulated myotubes. PCR array analysis (CAPM-0838E; SABiosciences) revealed that seven genes were upregulated in the muscles after exercise, and of these oncostatin M (OSM) proved to inhibit MCF-7 proliferation by 42%, increase caspase activity by 46%, and induce apoptosis. Blocking OSM signaling with anti-OSM antibodies reduced the induction of caspase activity by 51%. To verify that OSM was a myokine, we showed that it was significantly upregulated in serum and in three muscles, tibialis cranialis, gastronemius, and soleus, after an exercise bout. In contrast, OSM expression remained unchanged in subcutaneous and visceral adipose tissue, liver, and spleen (mononuclear cells). We conclude that postexercise serum inhibits mammary cancer cell proliferation and induces apoptosis of these cells. We suggest that one or more myokines secreted from working muscles may be mediating this effect and that OSM is a possible candidate. These findings emphasize that role of physical activity in cancer treatment, showing a direct link between exercise-induced humoral factors and decreased tumor cell growth.

  4. Inhibition of DNA topoisomerase I and growth inhibition of human cancer cell lines by an oleanane from Junellia aspera (Verbenaceae).

    Science.gov (United States)

    Pungitore, C R; Padron, J M; Leon, L G; Garcia, C; Ciuffo, G M; Martin, V S; Tonn, C E

    2007-05-15

    DNA topoisomerases and DNA polymerases are enzymes that play a crucial role in DNA metabolism events such as replication, transcription, recombination, and chromosome segregation during mitosis. Thus, DNA topoisomerases and DNA polymerases inhibitors could be expected to have antitumor effects. Naturally occurring triterpenoids isolated from Junellia aspera (Gillies & Hook; Moldenke) (Verbenaceae) were assayed for human DNA topoisomerase I and Taq DNA polymerase inhibitory activities. Maslinic acid (2) and its diacetyl derivative (7) showed human DNA topoisomerase I inhibitory activity with IC50 values in the range of 76-80 microM and growth inhibition against various human solid tumour cell lines with GI50 values in the range of 5-18 microM. The triterpene frames could be used for screening new inhibitors of the enzyme, and computer-simulated drug design using the frame and pocket structure of enzyme may in theory be a possible approach to develop new inhibitors.

  5. Mechanisms of neuroblastoma cell growth inhibition by CARP-1 functional mimetics.

    Directory of Open Access Journals (Sweden)

    Magesh Muthu

    Full Text Available Neuroblastomas (NBs are a clinically heterogeneous group of extra cranial pediatric tumors. Patients with high-risk, metastatic NBs have a long-term survival rate of below 40%, and are often resistant to current therapeutic modalities. Due to toxic side effects associated with radiation and chemotherapies, development of new agents is warranted to overcome resistance and effectively treat this disease in clinic. CARP-1 functional mimetics (CFMs are an emerging class of small molecule compounds that inhibit growth of diverse cancer cell types. Here we investigated NB inhibitory potential of CFMs and the molecular mechanisms involved. CFM-1, -4, and -5 inhibited NB cell growth, in vitro, independent of their p53 and MYCN status. CFM-4 and -5 induced apoptosis in NB cells in part by activating pro-apoptotic stress-activated kinases (SAPKs p38 and JNK, stimulating CARP-1 expression and cleavage of PARP1, while promoting loss of the oncogenes C and N-myc as well as mitotic cyclin B1. Treatments of NB cells with CFM-4 or -5 also resulted in loss of Inhibitory κB (IκB α and β proteins. Micro-RNA profiling revealed upregulation of XIAP-targeting miR513a-3p in CFM-4-treated NB, mesothelioma, and breast cancer cells. Moreover, exposure of NB and breast cancer cells to CFM-4 or -5 resulted in diminished expression of anti-apoptotic XIAP1, cIAP1, and Survivin proteins. Expression of anti-miR513a-5p or miR513a-5p mimic, however, interfered with or enhanced, respectively, the breast cancer cell growth inhibition by CFM-4. CFMs also impacted biological properties of the NB cells by blocking their abilities to migrate, form colonies in suspension, and invade through the matrix-coated membranes. Our studies indicate anti-NB properties of CFM-4 and 5, and suggest that these CFMs and/or their future analogs have potential as anti-NB agents.

  6. Inhibition of human chronic myelogenous leukemia K562 cell growth following combination treatment with resveratrol and imatinib mesylate.

    Science.gov (United States)

    Wang, X J; Li, Y H

    2015-06-11

    To investigate the effect of treatment with resveratrol combined with imatinib mesylate on human chronic myelogenous leukemia K562 cell growth inhibition and apoptosis, in vitro cultured human chronic myelogenous leukemia K562 cells were incubated with different concentrations of resveratrol and imatinib mesylate when the cells were in the logarithmic phase. Next, the cell growth inhibition was evaluated using the MTT assay and cellular morphology observation. Apoptosis was determined using Annexin V fluorescein isothiocyanate/propidium iodide double staining. The results demonstrated that treatment with resveratrol (concentration-dependent) and imatinib mesylate showed significantly greater inhibition of K562 cell growth and a higher apoptosis rate of K562 cells than imatinib mesylate medication alone and the control group (P imatinib mesylate medication alone group showed significant inhibition of K562 cell growth and apoptosis rate of K562 cells compared to the control group (P imatinib mesylate and resveratrol are potent drug treatments for human chronic myelogenous leukemia, offering a promising means of inhibiting cell growth and apoptosis.

  7. Phagocytosis of Extracellular Vesicles Extruded From the Placenta by Ovarian Cancer Cells Inhibits Growth of the Cancer Cells.

    Science.gov (United States)

    Chen, Qi; Rutten, Victoria; Cheng, Wei-Tzu; Tong, Mancy; Wei, Jia; Stone, Peter; Ching, Lai-Ming; Chamley, Lawrence W

    2018-03-01

    Ovarian cancer is a common gynecological cancer, and parity is negatively associated with the incidence of this disease. This negative association is hypothesized to be due in part to shifting the balance of estrogen and progesterone toward more progesterone and reduced ovulation during pregnancy. However, studies suggested that parity is also associated with estrogen-independent gynecological cancers suggesting balance of hormones may not be the only protective factor. Extracellular vesicles (EVs) play an important role in cell-to-cell communication in physiological and pathological conditions. During pregnancy, large amounts of EVs are extruded from the placenta, and they seem to be involved in the remarkable adaptation of a woman's body to normal pregnancy. We hypothesized that EVs extruded from the placenta play a role in this protective effect. Placental EVs were collected from first-trimester placentae, and cancer cell EVs were isolated from ovarian cancer cells. The EVs were exposed to ovarian cancer cells for 48 hours. The proliferation of cancer cells and the cell cycle were measured. In addition, phagocytosis of deported placental EVs by cancer cells was also measured. The proliferation of cancer cells was significantly reduced by treatment with placental EVs (P = 0.001, analysis of variance), but not EVs from monocytes (P = 0.195), compared with untreated cancer cells. Furthermore, placental EVs also prevented the proliferation of cancer cells induced by cancer cell-derived EVs (P = 0.001). This inhibition of proliferation of ovarian cancer cells was partially due to phagocytosis of placental EVs by cancer cells. Phagocytosis of placental EVs delayed progression through the cell cycle. Calreticulin, a phagocytic "eat me" signal carried by placental EVs significantly inhibited ovarian cancer growth (P = 0.001). Our data demonstrated that EVs extruded from the placenta prevented ovarian cancer cell growth by a mechanism that involved delaying progression

  8. Silencing ofECHDC1inhibits growth of gemcitabine-resistant bladder cancer cells.

    Science.gov (United States)

    Asai, Seiji; Miura, Noriyoshi; Sawada, Yuichiro; Noda, Terutaka; Kikugawa, Tadahiko; Tanji, Nozomu; Saika, Takashi

    2018-01-01

    Combined gemcitabine and cisplatin (GC) treatment is a first line chemotherapy for bladder cancer. However, acquired resistance to GC has been a major problem. To address the mechanism of gemcitabine resistance, and to identify potential biomarkers or target proteins for its therapy, we aimed to identify candidate proteins associated with gemcitabine resistance using proteomic analysis. We established gemcitabine-resistant human bladder cancer cell lines (UMUC3GR and HT1376GR) from gemcitabine-sensitive human bladder cancer cell lines (UMUC3 and HT1376). We compared the protein expression of parental and gemcitabine-resistant cell lines using isobaric tags for relative and absolute quantification (iTRAQ) and liquid chromatography tandem mass spectrometry. Among the identified proteins, ethylmalonyl-CoA decarboxylase (ECHDC1) expression was significantly increased in both of the gemcitabine-resistant cell lines compared to the respective parental cell lines. Silencing of ECHDC1 reduced ECHDC1 expression and significantly inhibited the proliferation of UMUC3GR cells. Furthermore, silencing of ECHDC1 induced upregulation of p27, which is critical for cell cycle arrest in the G1 phase, and induced G1 arrest. In conclusion, ECHDC1 expression is increased in gemcitabine-resistant bladder cancer cells, and is involved in their cell growth. ECHDC1, which is a metabolite proofreading enzyme, may be a novel potential target for gemcitabine-resistant bladder cancer therapy.

  9. Morphine Can Inhibit the Growth of Breast Cancer MCF-7 Cells by Arresting the Cell Cycle and Inducing Apoptosis.

    Science.gov (United States)

    Chen, Yanhua; Qin, Yi; Li, Li; Chen, Jing; Zhang, Xu; Xie, Yubo

    2017-10-01

    Morphine is widely used for relieving cancer pain in patients with advanced cancer. However, whether morphine can suppress or promote the progression of cancer in breast cancer patients receiving morphine analgesia remains unclear. Therefore, we used an in vitro model treated with morphine and naloxone to investigate the effects of morphine on breast cancer cell line MCF-7. MCF-7 cells were cultured with different concentrations (0.01 to 10 µM) of morphine at 12th, 24th, 36th, 48th, 60th and 72nd hours. Then, cell viability was measured through the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, and cell cycle and apoptosis assays were detected by flow cytometry (FCM). In addition, cell proliferation was conducted by colony formation assay. In this study, we have found that morphine (0.01 to 10 µM) could significantly reduce the cell vitality, growth and colony formation rate of MCF-7 cells, which has a certain relationship with cell cycle progression arrested at the G0/G1 and G2/M phase and MCF-7 cells apoptosis. Moreover, naloxone along with morphine could not reverse these effects, which indicates that the inhibition of MCF-7 breast cancer cell growth and proliferation by morphine could be its independent effect, not associated with opioid receptors. Morphine can inhibit cell growth by blocking the cell cycle and promote apoptosis in MCF-7 cells. Hence, morphine may be unable to promote the progression of cancer in breast cancer patients receiving morphine analgesia.

  10. By reducing hexokinase 2, resveratrol induces apoptosis in HCC cells addicted to aerobic glycolysis and inhibits tumor growth in mice

    Science.gov (United States)

    Xia, Yujing; He, Lei; Chen, Kan; Li, Jingjing; Li, Sainan; Liu, Tong; Zheng, Yuanyuan; Wang, Jianrong; Lu, Wenxia; Zhou, Yuqing; Yin, Qin; Abudumijiti, Huerxidan; Chen, Rongxia; Zhang, Rong; Zhou, Li; Zhou, Zheng; Zhu, Rong; Yang, Jing; Wang, Chengfen; Zhang, Huawei; Zhou, Yingqun; Xu, Ling; Guo, Chuanyong

    2015-01-01

    Cancer cells exhibit an altered metabolic phenotype known as the aerobic glycolysis. The expression of HK2 changes the metabolic phenotype of cells to support cancerous growth. In the present study, we investigated the inhibitory effect of resveratrol on HK2 expression and hepatocellular carcinoma (HCC) cell glycolysis. Aerobic glycolysis was observed in four HCC cell lines compared to the normal hepatic cells. Resveratrol sensitized aerobic glycolytic HCC cells to apoptosis, and this effect was attenuated by glycolytic inhibitors. The induction of mitochondrial apoptosis was associated with the decrease of HK2 expression by resveratrol in HCC cells. In addition, resveratrol enhanced sorafenib induced cell growth inhibition in aerobic glycolytic HCC cells. Combination treatment with both reagents inhibited the growth and promoted apoptosis of HCC-bearing mice. The reduction of HK2 by resveratrol provides a new dimension to clinical HCC therapies aimed at preventing disease progression. PMID:25938543

  11. Irisin inhibition of growth hormone secretion in cultured tilapia pituitary cells.

    Science.gov (United States)

    Lian, Anji; Li, Xin; Jiang, Quan

    2017-01-05

    Irisin, the product of fibronectin type III domain-containing protein 5 (FNDC5) gene, is well-documented to be a regulator of energy metabolism. At present, not much is known about its biological function in non-mammalian species. In this study, a full-length tilapia FDNC5 was cloned and its tissue expression pattern has been confirmed. Based on the sequence obtained, we produced and purified recombinant irisin which could induce uncoupling protein 1 (UCP1) gene expression in tilapia hepatocytes. Further, the rabbit polyclonal irisin antiserum was produced and its specificity was confirmed by antiserum preabsorption. In tilapia pituitary cells, irisin inhibited growth hormone (GH) gene expression and secretion and triggered rapid phosphorylation of Akt, Erk1/2, and p38 MAPK. Furthermore, irisin-inhibited GH mRNA expression could be prevented by inhibiting PI3K/Akt, MEK1/2, and p38 MAPK, respectively. Apparently, fish irisin can act directly at the pituitary level to inhibit GH transcript expression via multiple signaling pathways. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Photodynamic therapy with ATX-S10.Na(II) inhibits synovial sarcoma cell growth.

    Science.gov (United States)

    Takeda, Ken; Kunisada, Toshiyuki; Miyazawa, Shinichi; Nakae, Yoshinori; Ozaki, Toshifumi

    2008-07-01

    Photodynamic therapy (PDT) is an effective cancer treatment modality that allows selective destruction of malignant tumor cells. We asked whether PDT could inhibit in vivo and in vitro growth of synovial sarcoma cells. We analyzed PDT using ATX-S10.Na(II) and a diode laser for a synovial sarcoma cell line (SYO-1). Photodynamic therapy with ATX-S10.Na(II) showed an in vitro cytotoxic effect on the cultured SYO-1 cells. The in vitro effect of PDT depended on the treatment concentration of ATX-S10.Na(II) and the laser dose of irradiation. ATX-S10.Na(II) was detected in the tumor tissue specimens that were excised from nude mice bearing SYO-1 within 6 hours after intravenous injection, but it was eliminated from the tumor 12 hours after injection. Photodynamic therapy suppressed the tumor growth of nude mice bearing SYO-1, and high-dose irradiation induced no viable tumor cells in histologic specimens. Photodynamic therapy performed after marginal resection of the tumor of nude mice bearing SYO-1 reduced the rate of local recurrence of the tumor. Our results suggest PDT using ATX-S10.Na(II) and laser irradiation may be a potentially useful treatment for synovial sarcoma, especially to reduce the surgical margin and preserve critical anatomic structures adjacent to the tumor.

  13. Cannabidiol rather than Cannabis sativa extracts inhibit cell growth and induce apoptosis in cervical cancer cells.

    Science.gov (United States)

    Lukhele, Sindiswa T; Motadi, Lesetja R

    2016-09-01

    Cervical cancer remains a global health related issue among females of Sub-Saharan Africa, with over half a million new cases reported each year. Different therapeutic regimens have been suggested in various regions of Africa, however, over a quarter of a million women die of cervical cancer, annually. This makes it the most lethal cancer amongst black women and calls for urgent therapeutic strategies. In this study we compare the anti-proliferative effects of crude extract of Cannabis sativa and its main compound cannabidiol on different cervical cancer cell lines. To achieve our aim, phytochemical screening, MTT assay, cell growth analysis, flow cytometry, morphology analysis, Western blot, caspase 3/7 assay, and ATP measurement assay were conducted. Results obtained indicate that both cannabidiol and Cannabis sativa extracts were able to halt cell proliferation in all cell lines at varying concentrations. They further revealed that apoptosis was induced by cannabidiol as shown by increased subG0/G1 and apoptosis through annexin V. Apoptosis was confirmed by overexpression of p53, caspase 3 and bax. Apoptosis induction was further confirmed by morphological changes, an increase in Caspase 3/7 and a decrease in the ATP levels. In conclusion, these data suggest that cannabidiol rather than Cannabis sativa crude extracts prevent cell growth and induce cell death in cervical cancer cell lines.

  14. Extract of Cordyceps militaris inhibits angiogenesis and suppresses tumor growth of human malignant melanoma cells.

    Science.gov (United States)

    Ruma, I Made Winarsa; Putranto, Endy Widya; Kondo, Eisaku; Watanabe, Risayo; Saito, Ken; Inoue, Yusuke; Yamamoto, Ken-Ichi; Nakata, Susumu; Kaihata, Masaji; Murata, Hitoshi; Sakaguchi, Masakiyo

    2014-07-01

    Angiogenesis is essential for tumor development and metastasis. Among several angiogenic factors, vascular endothelial growth factor receptor (VEGF) is important for tumor-derived angiogenesis and commonly overexpressed in solid tumors. Thus, many antitumor strategies targeting VEGF have been developed to inhibit cancer angiogenesis, offering insights into the successful treatment of solid cancers. However, there are a number of issues such as harmful effects on normal vascularity in clinical trials. Taking this into consideration, we employed Cordyceps militaris as an antitumor approach due to its biological safety in vivo. The herbal medicinal mushroom Cordyceps militaris has been reported to show potential anticancer properties including anti-angiogenic capacity; however, its concrete properties have yet to be fully demonstrated. In this study, we aimed to elucidate the biological role of Cordyceps militaris extract in tumor cells, especially in regulating angiogenesis and tumor growth of a human malignant melanoma cell line. We demonstrated that Cordyceps militaris extract remarkably suppressed tumor growth via induction of apoptotic cell death in culture that links to the abrogation of VEGF production in melanoma cells. This was followed by mitigation of Akt1 and GSK-3β activation, while p38α phosphorylation levels were increased. Extract treatment in mouse model xenografted with human melanoma cells resulted in a dramatic antitumor effect with down-regulation of VEGF expression. The results suggest that suppression of tumor growth by Cordyceps militaris extract is, at least, mediated by its anti-angiogenicity and apoptosis induction capacities. Cordyceps militaris extract may be a potent antitumor herbal drug for solid tumors.

  15. 1082-39, an analogue of sorafenib, inhibited human cancer cell growth more potently than sorafenib.

    Science.gov (United States)

    Chu, Jia-Hui; Zhao, Cui-Rong; Song, Zhi-Yu; Wang, Rui-Qi; Qin, Yi-Zhuo; Li, Wen-Bao; Qu, Xian-Jun

    2014-04-01

    1082-39, an analogue of sorafenib, is a derivative of indazole diarylurea. We evaluated the activity of 1082-39 against human cancer cell growth. Its effects and mechanisms of action were then compared with those of sorafenib. The experiments were performed in human melanoma M21 cells. Cell viability was estimated by using the colorimetric assay. Annexin V-FITC/PI staining assay was used to recognize the apoptotic cells. Further analysis of the mitochondria membrane potential (MMP) was performed by the JC-1 fluorescence probe staining. The levels of apoptotic proteins and kinases related to cancer proliferation were determined by western blotting assay. 1082-39 possessed the activity against cancer cell proliferation with time- and dose-dependent manner. 1082-39 induced M21 cell to apoptosis, showing the increase of annexin V-FITC/PI staining cells, the MMP collapse and releasing cytochrome c from mitochondria. Western blotting analysis showed the activation of the mitochondria-mediated intrinsic pathway, showing the increase of cleaved caspase-9, cleaved caspase-3 and cleaved PARP. Statistical analysis suggested that 1082-39 possessed greater activities than sorafenib in the inhibition of M21 proliferation and induction of apoptosis. These effects of 1082-39 might arise from its activity of regulation the PI3K/Akt and Wnt/β-catenin signaling pathways. 1082-39 is a promising candidate compound which could develop as a potent anticancer agent. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  16. Polo-like kinase 1 (PLK1 inhibition suppresses cell growth and enhances radiation sensitivity in medulloblastoma cells

    Directory of Open Access Journals (Sweden)

    Harris Peter S

    2012-03-01

    Full Text Available Abstract Background Medulloblastoma is the most common malignant brain tumor in children and remains a therapeutic challenge due to its significant therapy-related morbidity. Polo-like kinase 1 (PLK1 is highly expressed in many cancers and regulates critical steps in mitotic progression. Recent studies suggest that targeting PLK1 with small molecule inhibitors is a promising approach to tumor therapy. Methods We examined the expression of PLK1 mRNA in medulloblastoma tumor samples using microarray analysis. The impact of PLK1 on cell proliferation was evaluated by depleting expression with RNA interference (RNAi or by inhibiting function with the small molecule inhibitor BI 2536. Colony formation studies were performed to examine the impact of BI 2536 on medulloblastoma cell radiosensitivity. In addition, the impact of depleting PLK1 mRNA on tumor-initiating cells was evaluated using tumor sphere assays. Results Analysis of gene expression in two independent cohorts revealed that PLK1 mRNA is overexpressed in some, but not all, medulloblastoma patient samples when compared to normal cerebellum. Inhibition of PLK1 by RNAi significantly decreased medulloblastoma cell proliferation and clonogenic potential and increased cell apoptosis. Similarly, a low nanomolar concentration of BI 2536, a small molecule inhibitor of PLK1, potently inhibited cell growth, strongly suppressed the colony-forming ability, and increased cellular apoptosis of medulloblastoma cells. Furthermore, BI 2536 pretreatment sensitized medulloblastoma cells to ionizing radiation. Inhibition of PLK1 impaired tumor sphere formation of medulloblastoma cells and decreased the expression of SRY (sex determining region Y-box 2 (SOX2 mRNA in tumor spheres indicating a possible role in targeting tumor inititiating cells. Conclusions Our data suggest that targeting PLK1 with small molecule inhibitors, in combination with radiation therapy, is a novel strategy in the treatment of

  17. Polo-like kinase 1 (PLK1) inhibition suppresses cell growth and enhances radiation sensitivity in medulloblastoma cells

    International Nuclear Information System (INIS)

    Harris, Peter S; Foreman, Nicholas K; Vibhakar, Rajeev; Venkataraman, Sujatha; Alimova, Irina; Birks, Diane K; Donson, Andrew M; Knipstein, Jeffrey; Dubuc, Adrian; Taylor, Michael D; Handler, Michael H

    2012-01-01

    Medulloblastoma is the most common malignant brain tumor in children and remains a therapeutic challenge due to its significant therapy-related morbidity. Polo-like kinase 1 (PLK1) is highly expressed in many cancers and regulates critical steps in mitotic progression. Recent studies suggest that targeting PLK1 with small molecule inhibitors is a promising approach to tumor therapy. We examined the expression of PLK1 mRNA in medulloblastoma tumor samples using microarray analysis. The impact of PLK1 on cell proliferation was evaluated by depleting expression with RNA interference (RNAi) or by inhibiting function with the small molecule inhibitor BI 2536. Colony formation studies were performed to examine the impact of BI 2536 on medulloblastoma cell radiosensitivity. In addition, the impact of depleting PLK1 mRNA on tumor-initiating cells was evaluated using tumor sphere assays. Analysis of gene expression in two independent cohorts revealed that PLK1 mRNA is overexpressed in some, but not all, medulloblastoma patient samples when compared to normal cerebellum. Inhibition of PLK1 by RNAi significantly decreased medulloblastoma cell proliferation and clonogenic potential and increased cell apoptosis. Similarly, a low nanomolar concentration of BI 2536, a small molecule inhibitor of PLK1, potently inhibited cell growth, strongly suppressed the colony-forming ability, and increased cellular apoptosis of medulloblastoma cells. Furthermore, BI 2536 pretreatment sensitized medulloblastoma cells to ionizing radiation. Inhibition of PLK1 impaired tumor sphere formation of medulloblastoma cells and decreased the expression of SRY (sex determining region Y)-box 2 (SOX2) mRNA in tumor spheres indicating a possible role in targeting tumor inititiating cells. Our data suggest that targeting PLK1 with small molecule inhibitors, in combination with radiation therapy, is a novel strategy in the treatment of medulloblastoma that warrants further investigation

  18. Growth Inhibition of Refractory Human Gallbladder Cancer Cells by Retinol, and Its Mechanism of Action.

    Science.gov (United States)

    Li, Chuan; Imai, Masahiko; Hasegawa, Shinya; Yamasaki, Masahiro; Takahashi, Noriko

    2017-04-01

    Among the constituents of the essential nutrient vitamin A, retinol is a potent suppressor of refractory cancer cell growth linked to tumor progression, showing greater efficacy than retinoic acid (RA). However, the mechanisms of retinol action on human refractory cancer are not known well. In the current study, we examined the actions of retinol on proliferation of human gallbladder cancer NOZ C-1 cells. Retinol and RA inhibited the proliferation of human NOZ C-1 cells in dose-dependent manner, while RA was less potent than retinol. Cell incorporation of RA was approximately two-fold higher than retinol and was not correlated with anti-proliferative activity. Retinol did not affect caspase-3 activity or mRNA expression of Bax and Bcl-2, which are associated with apoptosis. In addition, protein expression of phosphorylated extracellular signal-regulated kinase (p-ERK)/ERK and p-Akt/Akt were not significantly changed by retinol treatment. In contrast, retinol treatment significantly increased the mRNA expression of endoplasmic reticulum (ER) stress factors (heme oxygenase 1 (HMOX1), CCAAT/enhancer-binding protein homologous protein (CHOP), 78 kDa glucose-regulated protein (GRP78), and DnaJ (Hsp40) homolog, subfamily B, member 9 (DNAJB9)). Furthermore, the number of cells in the G 0 /G 1 phase was increased, while the number of cells in the S phase were decreased by retinol treatment. Retinol increased expression of the autophagy-associated protein, LC3-II. These results indicate that retinol is a potent suppressor of gallbladder cancer cell growth by mechanisms that involve ER stress, which results in autophagy and cell cycle delay. This suggests that retinol might be useful for anticancer prevention and therapy in the clinic.

  19. Inhibition of cell growth by EGR-1 in human primary cultures from malignant glioma

    Directory of Open Access Journals (Sweden)

    Gagliardi Franco

    2004-01-01

    Full Text Available Abstract Background The aim of this work was to investigate in vitro the putative role of EGR-1 in the growth of glioma cells. EGR-1 expression was examined during the early passages in vitro of 17 primary cell lines grown from 3 grade III and from 14 grade IV malignant astrocytoma explants. The explanted tumors were genetically characterized at the p53, MDM2 and INK4a/ARF loci, and fibronectin expression and growth characteristics were examined. A recombinant adenovirus overexpressing EGR-1 was tested in the primary cell lines. Results Low levels of EGR-1 protein were found in all primary cultures examined, with lower values present in grade IV tumors and in cultures carrying wild-type copies of p53 gene. The levels of EGR-1 protein were significantly correlated to the amount of intracellular fibronectin, but only in tumors carrying wild-type copies of the p53 gene (R = 0,78, p = 0.0082. Duplication time, plating efficiency, colony formation in agarose, and contact inhibition were also altered in the p53 mutated tumor cultures compared to those carrying wild-type p53. Growth arrest was achieved in both types of tumor within 1–2 weeks following infection with a recombinant adenovirus overexpressing EGR-1 but not with the control adenovirus. Conclusions Suppression of EGR-1 is a common event in gliomas and in most cases this is achieved through down-regulation of gene expression. Expression of EGR-1 by recombinant adenovirus infection almost completely abolishes the growth of tumor cells in vitro, regardless of the mutational status of the p53 gene.

  20. Arctigenin inhibits prostate tumor cell growth in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Piwen Wang

    2017-06-01

    Full Text Available The low bioavailability of most phytochemicals limits their translation to humans. We investigated whether arctigenin, a novel anti-inflammatory lignan from the seeds of Arctium lappa, has favorable bioavailability/potency against prostate cancer. The anticarcinogenic activity of arctigenin was investigated both in vitro using the androgen-sensitive LNCaP and LAPC-4 human prostate cancer cells and pre-malignant WPE1-NA22 cells, and in vivo using xenograft mouse models. Arctigenin at lower doses (<2 μM significantly inhibited the proliferation of LNCaP and LAPC-4 cells by 30–50% at 48 h compared to control, and inhibited WPE1-NA22 cells by 75%, while did not affect normal prostate epithelial cells. Male severe combined immunodeficiency (SCID mice were implanted subcutaneously with LAPC-4 cells for in vivo studies. In one experiment, the intervention started one week after tumor implantation. Mice received arctigenin at 50 mg/kg (LD or 100 mg/kg (HD b.w. daily or vehicle control by oral gavage. After 6 weeks, tumor growth was inhibited by 50% (LD and 70% (HD compared to control. A stronger tumor inhibitory effect was observed in a second experiment where arctigenin intervention started two weeks prior to tumor implantation. Arc was detectable in blood and tumors in Arc groups, with a mean value up to 2.0 μM in blood, and 8.3 nmol/g tissue in tumors. Tumor levels of proliferation marker Ki67, total and nuclear androgen receptor, and growth factors including VEGF, EGF, and FGF-β were significantly decreased by Arc, along with an increase in apoptosis marker of Bax/Bcl-2 ratio. Genes responsive to arctigenin were identified including TIMP3 and ZNF185, and microRNAs including miR-126-5p, and miR-21-5p. This study provides the first in vivo evidence of the strong anticancer activity of arctigenin in prostate cancer. The effective dose of arctigenin in vitro is physiologically achievable in vivo, which provides a high promise in its

  1. Inhibition of tumor cell growth by Sigma1 ligand mediated translational repression

    International Nuclear Information System (INIS)

    Kim, Felix J.; Schrock, Joel M.; Spino, Christina M.; Marino, Jacqueline C.; Pasternak, Gavril W.

    2012-01-01

    Highlights: ► Sigma1 ligand treatment mediates decrease in tumor cell mass. ► Identification of a Sigma1 ligand with reversible translational repressor actions. ► Demonstration of a role for Sigma1 in cellular protein synthesis. -- Abstract: Treatment with sigma1 receptor (Sigma1) ligands can inhibit cell proliferation in vitro and tumor growth in vivo. However, the cellular pathways engaged in response to Sigma1 ligand treatment that contribute to these outcomes remain largely undefined. Here, we show that treatment with putative antagonists of Sigma1 decreases cell mass. This effect corresponds with repressed cap-dependent translation initiation in multiple breast and prostate cancer cell lines. Sigma1 antagonist treatment suppresses phosphorylation of translational regulator proteins p70S6K, S6, and 4E-BP1. RNAi-mediated knockdown of Sigma1 also results in translational repression, consistent with the effects of antagonist treatment. Sigma1 antagonist mediated translational repression and decreased cell size are both reversible. Together, these data reveal a role for Sigma1 in tumor cell protein synthesis, and demonstrate that small molecule Sigma1 ligands can be used as modulators of protein translation.

  2. Inhibition of tumor cell growth by Sigma1 ligand mediated translational repression

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Felix J., E-mail: fkim@drexelmed.edu [Department of Pharmacology and Physiology, Drexel University College of Medicine, Philadelphia, PA 19102-1192 (United States); Schrock, Joel M. [Molecular Pharmacology and Chemistry Program, Sloan-Kettering Institute, Memorial Sloan-Kettering Cancer Center, New York, NY 10065 (United States); Spino, Christina M. [Department of Pharmacology and Physiology, Drexel University College of Medicine, Philadelphia, PA 19102-1192 (United States); Marino, Jacqueline C.; Pasternak, Gavril W. [Molecular Pharmacology and Chemistry Program, Sloan-Kettering Institute, Memorial Sloan-Kettering Cancer Center, New York, NY 10065 (United States)

    2012-09-21

    Highlights: Black-Right-Pointing-Pointer Sigma1 ligand treatment mediates decrease in tumor cell mass. Black-Right-Pointing-Pointer Identification of a Sigma1 ligand with reversible translational repressor actions. Black-Right-Pointing-Pointer Demonstration of a role for Sigma1 in cellular protein synthesis. -- Abstract: Treatment with sigma1 receptor (Sigma1) ligands can inhibit cell proliferation in vitro and tumor growth in vivo. However, the cellular pathways engaged in response to Sigma1 ligand treatment that contribute to these outcomes remain largely undefined. Here, we show that treatment with putative antagonists of Sigma1 decreases cell mass. This effect corresponds with repressed cap-dependent translation initiation in multiple breast and prostate cancer cell lines. Sigma1 antagonist treatment suppresses phosphorylation of translational regulator proteins p70S6K, S6, and 4E-BP1. RNAi-mediated knockdown of Sigma1 also results in translational repression, consistent with the effects of antagonist treatment. Sigma1 antagonist mediated translational repression and decreased cell size are both reversible. Together, these data reveal a role for Sigma1 in tumor cell protein synthesis, and demonstrate that small molecule Sigma1 ligands can be used as modulators of protein translation.

  3. Inhibition of TMEM16A expression suppresses growth and invasion in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Yujie Sui

    Full Text Available Metastasis leads to poor prognosis in colorectal cancer patients, and there is a growing need for new therapeutic targets. TMEM16A (ANO1, DOG1 or TAOS2 has recently been identified as a calcium-activated chloride channel (CaCC and is reported to be overexpressed in several malignancies; however, its expression and function in colorectal cancer (CRC remains unclear. In this study, we found expression of TMEM16A mRNA and protein in high-metastatic-potential SW620, HCT116 and LS174T cells, but not in primary HCT8 and SW480 cells, using RT-PCR, western blotting and immunofluorescence labeling. Patch-clamp recordings detected CaCC currents regulated by intracellular Ca(2+ and voltage in SW620 cells. Knockdown of TMEM16A by short hairpin RNAs (shRNA resulted in the suppression of growth, migration and invasion of SW620 cells as detected by MTT, wound-healing and transwell assays. Mechanistically, TMEM16A depletion was accompanied by the dysregulation of phospho-MEK, phospho-ERK1/2 and cyclin D1 expression. Flow cytometry analysis showed that SW620 cells were inhibited from the G1 to S phase of the cell cycle in the TMEM16A shRNA group compared with the control group. In conclusion, our results indicate that TMEM16A CaCC is involved in growth, migration and invasion of metastatic CRC cells and provide evidence for TMEM16A as a potential drug target for treating metastatic colorectal carcinoma.

  4. Inhibition of growth and alteration of host cell interactions of Pasteurella multocida with natural byproducts.

    Science.gov (United States)

    Salaheen, S; Almario, J A; Biswas, D

    2014-06-01

    Pasteurella multocida is a leading cause of fowl cholera in both free-range pasture and conventional/commercially raised poultry. Its infection is a serious threat to poultry health and overall flock viability. Organic poultry is comparatively more vulnerable to this pathogen. It is a significant cause of production loss and price increase of poultry products, specifically organic poultry products. Some plant products are well documented as sources of natural antimicrobials such as polyphenols found in different berry pomaces and citrus oil. Pomace, a byproduct (primarily of seeds and skins) of fruits used for juice and wine production, and citrus oil, the byproduct of citrus juice production, show promising antimicrobial activity against various pathogens. Here, we showed for the first time that blackberry and blueberry pomace extracts and citrus oil inhibited P. multocida growth. Minimum bactericidal concentrations were determined as 0.3 and 0.4 mg/mL gallic acid equivalent for blackberry and blueberry pomace extracts, respectively. Similarly, only 0.05% citrus oil (vol/vol) completely inhibited P. multocida growth. Under shaking conditions, the antimicrobial activity of both pomace extracts and citrus oil was more intensive. Even citrus oil vapor also significantly reduced the growth of P. multocida. In addition, cell surface hydrophobicity of P. multocida was increased by 2- to 3-fold and its adherence to chicken fibroblast (DF1) and bovine mammary gland (MacT) cells was reduced significantly in the presence of pomace extracts only. This study indicates that these natural products might be good alternatives to conventional antimicrobial agents, and hence, may be used as feed or water supplements to control fowl cholera and reduce production loss caused by P. multocida. Poultry Science Association Inc.

  5. Knockdown of Mgat5 inhibits breast cancer cell growth with activation of CD4+ T cells and macrophages.

    Science.gov (United States)

    Li, Dongqing; Li, Yanmei; Wu, Xianglei; Li, Qiao; Yu, Jing; Gen, Jie; Zhang, Xiao-Lian

    2008-03-01

    N-acetylglucosaminyltransferase V (Mgat5 or GnT-V) is an enzyme that catalyzes beta1-6 branching of N-acetylglucosamine on asparagine (N)-linked oligosaccharides (N-glycan) of cell proteins. The levels of Mgat5 glycan products commonly are increased in malignancies. Although Mgat5 is known to be important in tumor metastases, the effects of Mgat5 on host immune responses are not fully defined. In this study, a Mgat5 specific-short hairpin RNA (shRNA) vector was transfected into murine mammary adenocarcinoma MA782 cells to assess the effects of Mgat5 on tumor cell growth, T cells, and macrophages following inoculation of mice with shRNA-transfected cancer cells. The results showed that blocking expression of Mgat5-modified glycans in MA782 cells significantly suppressed tumor progression both in vivo and in vitro, strongly stimulated Th1 cytokine production, and enhanced opsonophagocytic capability of macrophages in vivo. Importantly, reduction of complex N-glycans on MA782 tumor cells by Mgat5-shRNA resulted in significantly increased proliferation and CD45 surface expression of CD4+ T cells. Our data suggest Mgat5-shRNA could serve as a useful tool to treat breast cancer as well as a powerful tool for the functional investigation of N-glycans and glycoprotein synthesis. Our data suggest that knockdown of Mgat5 inhibits breast cancer cells' growth with activation of CD4+ T cells and macrophages.

  6. Components in aqueous Hibiscus rosa-sinensis flower extract inhibit in vitro melanoma cell growth

    Directory of Open Access Journals (Sweden)

    Karina H. Goldberg

    2017-01-01

    Full Text Available Skin cancer is extremely common, and melanoma causes about 80% of skin cancer deaths. In fact, melanoma kills over 50 thousand people around the world each year, and these numbers are rising. Clearly, standard treatments are not effectively treating melanoma, and alternative therapies are needed to address this problem. Hibiscus tea has been noted to have medicinal properties, including anticancer effects. Extracts from Hibiscus have been shown to inhibit the growth of a variety of cancer cells. In particular, recent studies found that polyphenols extracted from Hibiscus sabdariffa by organic solvents can inhibit melanoma cell growth. However, effects of aqueous extracts from Hibiscus rosa-sinesis flowers, which are commonly used to make traditional medicinal beverages, have not been examined on melanoma cells. Here, we report that aqueous H. rosa-sinesis flower extract contains compounds that inhibit melanoma cell growth in a dose dependent manner at concentrations that did not affect the growth of nontransformed cells. In addition, these extracts contain low molecular weight growth inhibitory compounds below 3 kD in size that combine with larger compounds to more effectively inhibit melanoma cell growth. Future work should identify these compounds, and evaluate their potential to prevent and treat melanoma and other cancers.

  7. Bioactive phytochemical proanthocyanidins inhibit growth of head and neck squamous cell carcinoma cells by targeting multiple signaling molecules.

    Directory of Open Access Journals (Sweden)

    Ram Prasad

    Full Text Available Despite advances in surgical and medical therapies, approximate 50% survival rate of head and neck squamous cell carcinoma (HNSCC has had marginal improvement in the last 30 years. Therefore, alternative strategies are required for the management of HNSCC. Here, we report the chemotherapeutic effect of proanthocyanidins on HNSCC cells using in vitro and in vivo models. Treatment of human HNSCC cell lines from different sub-sites, such as oral cavity (SCC1, larynx (SCC5, tongue (OSC19 and pharynx (FaDu, with grape seed proanthocyanidins (GSPs reduced their cell viability and induced cell death in a dose- and time-dependent manner. GSPs induced inhibition of cell viability was associated with: (i G1-phase arrest, (ii inhibition of expressions of cyclins (cyclin D1 and Cyclin D2 and cyclin-dependent kinases (Cdk, (iii increased expression of the Cdk inhibitory proteins (Cip1/p21, Kip1/p27, enhanced binding of Cdk inhibitors to Cdks, and downregulation of E2F transcription factor. GSPs significantly (P<0.05-0.001 increased apoptosis of SCC1 and OSC19 cells with induction of Bax, reduced expression of Bcl-2, and activation of caspase-3. GSPs also reduced the expression of epidermal growth factor receptor (EGFR, and treatment of SCC1 cells with erlotinib, an EGFR-targeting small molecule tyrosine kinase inhibitor, significantly (P<0.05-0.001 reduced cell viability and increased cell death. Dietary administration of GSPs (0.5%, w/w in supplementation with AIN76A control diet inhibited the growth of SCC1 tumor xenografts in athymic nude mice, which was associated with: (i inhibition of cell proliferation, (ii induction of apoptosis of tumor xenograft cells, (iii decreased expression of cyclins and Cdks, (iv decreased expression of EGFR, and (v increased expression of Cip1/p21 and Kip1/p27 proteins and their increased binding to Cdks in tumor xenograft samples. Together, these results suggest that GSPs may be a promising candidate for head and neck

  8. Silibinin inhibits accumulation of myeloid-derived suppressor cells and tumor growth of murine breast cancer

    International Nuclear Information System (INIS)

    Forghani, Parvin; Khorramizadeh, Mohammad R; Waller, Edmund K

    2014-01-01

    Myeloid-derived suppressor cells (MDSC)s increase in blood and accumulate in the tumor microenvironment of tumor-bearing animals, contributing to immune suppression in cancer. Silibinin, a natural flavonoid from the seeds of milk thistle, has been developed as an anti-inflammatory agent and supportive care agent to reduce the toxicity of cancer chemotherapy. The goals of this study were to evaluate the effect of silibinin on MDSCs in tumor-bearing mice and antitumor activity of silibinin in a mouse model of breast cancer. 4T1 luciferase-transfected mammary carcinoma cells were injected into in the mammary fat pad female BALB/c mice, and female CB17-Prkdc Scid/J mice. Silibinin treatment started on day 4 or day 14 after tumor inoculation continued every other day. Tumor growth was monitored by bioluminescent imaging (BLI) measuring total photon flux. Flow cytometry measured total leukocytes, CD11b + Gr-1 + MDSC, and T cells in the blood and tumors of tumor-bearing mice. The effects of silibinin on 4T1 cell viability in vitro were measured by BLI. Treatment with silibinin increased overall survival in mice harboring tumors derived from the 4T1-luciferase breast cancer cell line, and reduced tumor volumes and numbers of CD11b + Gr-1 + MDSCs in the blood and tumor, and increased the content of T cells in the tumor microenvironment. Silibinin failed to inhibit tumor growth in immunocompromised severe combined immunodeficiency mice, supporting the hypothesis that anticancer effect of silibinin is immune-mediated. The antitumor activity of silibinin requires an intact host immune system and is associated with decreased accumulation of blood and tumor-associated MDSCs

  9. Rhodiola crenulata induces death and inhibits growth of breast cancer cell lines.

    Science.gov (United States)

    Tu, Yifan; Roberts, Louis; Shetty, Kalidas; Schneider, Sallie Smith

    2008-09-01

    Diverse compounds from many different chemical classes are currently targeted in preclinical analyses for their ability to act as both chemopreventive and chemotherapeutic agents. Phenolic phytochemicals from Rhodiola crenulata has such potential. This Rhodiola species is a perennial plant that grows in the Tundra, Siberia, and high-elevation regions of Tibet. The phenolic secondary metabolites isolated from R. crenulata were recently analyzed in a preclinical setting for their ability to treat lymphosarcomas and superficial bladder cancers. However, the effects of R. crenulata have yet to be examined for its implications in breast cancer prevention or for its chemotherapeutic abilities. Therefore this study investigated the effects of R. crenulata on breast cancer both in vivo and in vitro. Experiments using aggressive human-derived MDA-MB-231 and mouse-derived V14 breast cancer cell lines demonstrated that phenolic-enriched R. crenulata extract was capable of inhibiting the proliferation, motility, and invasion of these cells. In addition, the extracts induced autophagic-like vesicles in all cell lines, eventually leading to death of the tumor cell lines but not the immortal or normal human mammary epithelial cells. Finally, an in vivo experiment showed that phenolic-enriched dietary R. crenulata is effective in preventing the initiation of tumors and slowing down the tumor growth in mice bearing tumor grafts, thereby further demonstrating its possible potential for treatment of breast cancer progression and metastasis.

  10. Delivery of CdiA nuclease toxins into target cells during contact-dependent growth inhibition.

    Science.gov (United States)

    Webb, Julia S; Nikolakakis, Kiel C; Willett, Julia L E; Aoki, Stephanie K; Hayes, Christopher S; Low, David A

    2013-01-01

    Bacterial contact-dependent growth inhibition (CDI) is mediated by the CdiB/CdiA family of two-partner secretion proteins. CDI systems deploy a variety of distinct toxins, which are contained within the polymorphic C-terminal region (CdiA-CT) of CdiA proteins. Several CdiA-CTs are nucleases, suggesting that the toxins are transported into the target cell cytoplasm to interact with their substrates. To analyze CdiA transfer to target bacteria, we used the CDI system of uropathogenic Escherichia coli 536 (UPEC536) as a model. Antibodies recognizing the amino- and carboxyl-termini of CdiA(UPEC536) were used to visualize transfer of CdiA from CDI(UPEC536+) inhibitor cells to target cells using fluorescence microscopy. The results indicate that the entire CdiA(UPEC536) protein is deposited onto the surface of target bacteria. CdiA(UPEC536) transfer to bamA101 mutants is reduced, consistent with low expression of the CDI receptor BamA on these cells. Notably, our results indicate that the C-terminal CdiA-CT toxin region of CdiA(UPEC536) is translocated into target cells, but the N-terminal region remains at the cell surface based on protease sensitivity. These results suggest that the CdiA-CT toxin domain is cleaved from CdiA(UPEC536) prior to translocation. Delivery of a heterologous Dickeya dadantii CdiA-CT toxin, which has DNase activity, was also visualized. Following incubation with CDI(+) inhibitor cells targets became anucleate, showing that the D.dadantii CdiA-CT was delivered intracellularly. Together, these results demonstrate that diverse CDI toxins are efficiently translocated across target cell envelopes.

  11. 1-o-acetylbritannilactone (ABL) inhibits angiogenesis and lung cancer cell growth through regulating VEGF-Src-FAK signaling.

    Science.gov (United States)

    Zhengfu, He; Hu, Zhang; Huiwen, Miao; Zhijun, Li; Jiaojie, Zhou; Xiaoyi, Yan; Xiujun, Cai

    2015-08-21

    The search for safe, effective and affordable therapeutics against non-small cell lung cancer (NSCLC) and other lung cancers is important. Here we explored the potential effect of 1-o-acetylbritannilactone (ABL), a novel extract from Inula britannica-F, on angiogenesis and lung cancer cell growth. We demonstrated that ABL dose-dependently inhibited vascular endothelial growth factor (VEGF)-induced proliferation, migration, and capillary structure formation of cultured human umbilical vascular endothelial cells (HUVECs). In vivo, ABL administration suppressed VEGF-induced new vasculature formation in Matrigel plugs. For the mechanism investigations, we found that ABL largely inhibited VEGF-mediated activation of Src kinase and focal adhesion kinase (FAK) in HUVECs. Furthermore, treatment of A549 NSCLC cells with ABL resulted in cell growth inhibition and Src-FAK in-activation. Significantly, administration of a single dose of ABL (12 mg/kg/day) remarkably suppressed growth of A549 xenografts in nude mice. In vivo microvessels formation and Src activation were also significantly inhibited in ABL-treated xenograft tumors. Taken together, our findings suggest that ABL suppresses angiogenesis and lung cancer cell growth possibly via regulating the VEGFR-Src-FAK signaling. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Tocotrienol-adjuvanted dendritic cells inhibit tumor growth and metastasis: a murine model of breast cancer.

    Directory of Open Access Journals (Sweden)

    Sitti Rahma Abdul Hafid

    Full Text Available Tocotrienol-rich fraction (TRF from palm oil is reported to possess anti-cancer and immune-enhancing effects. In this study, TRF supplementation was used as an adjuvant to enhance the anti-cancer effects of dendritic cells (DC-based cancer vaccine in a syngeneic mouse model of breast cancer. Female BALB/c mice were inoculated with 4T1 cells in mammary pad to induce tumor. When the tumor was palpable, the mice in the experimental groups were injected subcutaneously with DC-pulsed with tumor lysate (TL from 4T1 cells (DC+TL once a week for three weeks and fed daily with 1 mg TRF or vehicle. Control mice received unpulsed DC and were fed with vehicle. The combined therapy of using DC+TL injections and TRF supplementation (DC+TL+TRF inhibited (p<0.05 tumor growth and metastasis. Splenocytes from the DC+TL+TRF group cultured with mitomycin-C (MMC-treated 4T1 cells produced higher (p<0.05 levels of IFN-γ and IL-12. The cytotoxic T-lymphocyte (CTL assay also showed enhanced tumor-specific killing (p<0.05 by CD8(+ T-lymphocytes isolated from mice in the DC+TL+TRF group. This study shows that TRF has the potential to be used as an adjuvant to enhance effectiveness of DC-based vaccines.

  13. PREPARATION, DRUG RELEASE, AND CELL GROWTH INHIBITION OF A GELATIN – DOXORUBICIN CONJUGATE

    Science.gov (United States)

    Wu, Darren C.; Cammarata, Christopher R.; Park, Hyun Joo; Rhodes, Brian T.; Ofner, Clyde M.

    2013-01-01

    Purpose To demonstrate the feasibility of a novel macromolecular delivery system for doxorubicin (DOX) which combines pH dependent DOX release with a high molecular weight and biodegradable gelatin carrier. Methods DOX was conjugated to gelatin using an acid labile hydrazone bond and a glycylglycine linker. The gelatin-doxorubicin conjugate (G-DOX) was evaluated for hydrazide and DOX content by spectrophotometry, molecular weight by HPLC-SEC, in vitro DOX release at various pH, and cell growth inhibition using EL4 mouse lymphoma and PC3 human prostate cells. Results G-DOX hydrazide and DOX content was 47% and 5-7%, respectively of theoretical gelatin carboxylic acid sites. During preparation of G-DOX, the molecular weight decreased to 22 kDa. DOX release was 48% in pH 4.8 phosphate buffer, 22% at pH 6.5, but 10% at pH 7.4. The G-DOX IC50 values in EL4 and PC3 cells were 0.26 μM and 0.77 μM, respectively; the latter value 3 times greater than that of free DOX. Conclusions A 22 kDa macromolecular DOX conjugate containing 3.4-5.0% w/w DOX has been prepared. The pH dependent drug release in combination with a biodegradable gelatin carrier offer potential therapeutic advantages of enhanced tumor cell localization and reduced systemic toxicities of the drug. PMID:23686374

  14. Lactose inhibits the growth of Rhizobium meliloti cells that contain an actively expressed Escherichia coli lactose operon.

    Science.gov (United States)

    Timblin, C R; Kahn, M L

    1984-01-01

    Expression of the Escherichia coli lactose operon in Rhizobium meliloti 104A14 made the cells sensitive to the addition of the beta-galactosides lactose, phenyl-beta-D-galactoside, and lactobionic acid. Growth stopped when the beta-galactoside was added and viability decreased modestly during the next few hours, but little cell lysis was observed and the cells appeared normal. Protein synthesis was not inhibited. Growth was inhibited only when beta-galactosidase expression was greater than 160 U. Lactose-resistant mutants had defects in the plasmid-carried E. coli beta-galactosidase or beta-galactoside permease and in the R. meliloti genome. We speculate that uncontrolled production of galactose by the action of the lactose operon proteins was responsible for growth inhibition. PMID:6427192

  15. Growth inhibition and apoptosis in cancer cells induced by polyphenolic compounds of Acacia hydaspica: Involvement of multiple signal transduction pathways

    Science.gov (United States)

    Afsar, Tayyaba; Trembley, Janeen H.; Salomon, Christine E.; Razak, Suhail; Khan, Muhammad Rashid; Ahmed, Khalil

    2016-01-01

    Acacia hydaspica R. Parker is known for its medicinal uses in multiple ailments. In this study, we performed bioassay-guided fractionation of cytotoxic compounds from A. hydaspica and investigated their effects on growth and signaling activity in prostate and breast cancer cell lines. Four active polyphenolic compounds were identified as 7-O-galloyl catechin (GC), catechin (C), methyl gallate (MG), and catechin-3-O-gallate (CG). The four compounds inhibited prostate cancer PC-3 cell growth in a dose-dependent manner, whereas CG and MG inhibited breast cancer MDA-MB-231 cell growth. All tested compounds inhibited cell survival and colony growth in both cell lines, and there was evidence of chromatin condensation, cell shrinkage and apoptotic bodies. Further, acridine orange, ethidium bromide, propidium iodide and DAPI staining demonstrated that cell death occurred partly via apoptosis in both PC-3 and MDA-MB-231 cells. In PC-3 cells treatment repressed the expression of anti-apoptotic molecules Bcl-2, Bcl-xL and survivin, coupled with down-regulation of signaling pathways AKT, NFκB, ERK1/2 and JAK/STAT. In MDA-MB-231 cells, treatment induced reduction of CK2α, Bcl-xL, survivin and xIAP protein expression along with suppression of NFκB, JAK/STAT and PI3K pathways. Our findings suggest that certain polyphenolic compounds derived from A. hydaspica may be promising chemopreventive/therapeutic candidates against cancer. PMID:26975752

  16. Combination of α-Tomatine and Curcumin Inhibits Growth and Induces Apoptosis in Human Prostate Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Huarong Huang

    Full Text Available α-Tomatine is a glycoalkaloid found in tomatoes and curcumin is a major yellow pigment of turmeric. In the present study, the combined effect of these two compounds on prostate cancer cells was studied. Treatment of different prostate cancer cells with curcumin or α-tomatine alone resulted in growth inhibition and apoptosis in a concentration-dependent manner. Combinations of α-tomatine and curcumin synergistically inhibited the growth and induced apoptosis in prostate cancer PC-3 cells. Effects of the α-tomatine and curcumin combination were associated with synergistic inhibition of NF-κB activity and a potent decrease in the expression of its downstream gene Bcl-2 in the cells. Moreover, strong decreases in the levels of phospho-Akt and phosphor-ERK1/2 were found in PC-3 cells treated with α-tomatine and curcumin in combination. In animal experiment, SCID mice with PC-3 xenograft tumors were treated with α-tomatine and curcumin. Combination of α-tomatine and curcumin more potently inhibited the growth of PC-3 tumors than either agent alone. Results from the present study indicate that α-tomatine in combination with curcumin may be an effective strategy for inhibiting the growth of prostate cancer.

  17. Autophagy Interplay with Apoptosis and Cell Cycle Regulation in the Growth Inhibiting Effect of Resveratrol in Glioma Cells

    Science.gov (United States)

    Filippi-Chiela, Eduardo C.; Villodre, Emilly Schlee; Zamin, Lauren L.; Lenz, Guido

    2011-01-01

    Prognosis of patients with glioblastoma (GBM) remains very poor, thus making the development of new drugs urgent. Resveratrol (Rsv) is a natural compound that has several beneficial effects such as neuroprotection and cytotoxicity for several GBM cell lines. Here we evaluated the mechanism of action of Rsv on human GBM cell lines, focusing on the role of autophagy and its crosstalk with apoptosis and cell cycle control. We further evaluated the role of autophagy and the effect of Rsv on GBM Cancer Stem Cells (gCSCs), involved in GBM resistance and recurrence. Glioma cells treated with Rsv was tested for autophagy, apoptosis, necrosis, cell cycle and phosphorylation or expression levels of key players of these processes. Rsv induced the formation of autophagosomes in three human GBM cell lines, accompanied by an upregulation of autophagy proteins Atg5, beclin-1 and LC3-II. Inhibition of Rsv-induced autophagy triggered apoptosis, with an increase in Bax and cleavage of caspase-3. While inhibition of apoptosis or autophagy alone did not revert Rsv-induced toxicity, inhibition of both processes blocked this toxicity. Rsv also induced a S-G2/M phase arrest, accompanied by an increase on levels of pCdc2(Y15), cyclin A, E and B, and pRb (S807/811) and a decrease of cyclin D1. Interestingly, this arrest was dependent on the induction of autophagy, since inhibition of Rsv-induced autophagy abolishes cell cycle arrest and returns the phosphorylation of Cdc2(Y15) and Rb(S807/811), and levels of cyclin A, and B to control levels. Finally, inhibition of autophagy or treatment with Rsv decreased the sphere formation and the percentage of CD133 and OCT4-positive cells, markers of gCSCs. In conclusion, the crosstalk among autophagy, cell cycle and apoptosis, together with the biology of gCSCs, has to be considered in tailoring pharmacological interventions aimed to reduce glioma growth using compounds with multiple targets such as Rsv. PMID:21695150

  18. Endophytic fungi from mangrove inhibit lung cancer cell growth and angiogenesis in vitro.

    Science.gov (United States)

    Liu, Xin; Wu, Xin; Ma, Yuefan; Zhang, Wenzhang; Hu, Liang; Feng, Xiaowei; Li, Xiangyong; Tang, Xudong

    2017-03-01

    The secondary metabolites of mangrove-derived endophytic fungi contain multiple substances with novel structures and biological activities. In the present study, three types of mangrove plants, namely Kandelia candel, Rhizophora stylosa and Rhizophoraceae from Zhanjiang region including the leaves, roots and stems were collected, and endophytic fungi were isolated, purified and identified from these mangrove plants. MTT assay was used to observe the effects of the isolated endophytic fungi on the growth of A549 and NCI-H460 lung cancer cells. The effect of the endophytic fungi on lung cancer angiogenesis in vitro induced by the HPV-16 E7 oncoprotein was observed. Our results showed that 28 strains of endophytic fungi were isolated, purified and identified from the three types of mangrove plants. Ten strains of endophytic fungi significantly suppressed the growth of A549 and NCI-H460 cells. The average inhibitory rates in the A549 cells were 64.4, 59.5, 81.9, 43.9, 58.3, 56.2, 48.3, 42.4, 93.0 and 49.7%, respectively. The average inhibitory rates in the NCI-H460 cells were 41.2, 49.3, 82.7, 40.7, 53.9, 52.6, 56.8, 64.3, 91.0 and 45.6%, respectively. Particularly, three strains of endophytic fungi markedly inhibited HPV-16 E7 oncoprotein‑induced lung cancer angiogenesis in vitro. These findings contribute to the further screening of potential chemotherapeutic agents from mangrove-derived endophytic fungi.

  19. Effusanin E suppresses nasopharyngeal carcinoma cell growth by inhibiting NF-κB and COX-2 signaling.

    Directory of Open Access Journals (Sweden)

    Mingzhu Zhuang

    Full Text Available Rabdosia serra is well known for its antibacterial, anti-inflammatory and antitumor activities, but no information has been available for the active compounds derived from this plant in inhibiting human nasopharyngeal carcinoma (NPC cell growth. In this study, we isolated and purified a natural diterpenoid from Rabdosia serra and identified its chemical structure as effusanin E and elucidated its underlying mechanism of action in inhibiting NPC cell growth. Effusanin E significantly inhibited cell proliferation and induced apoptosis in NPC cells. Effusanin E also induced the cleavage of PARP, caspase-3 and -9 proteins and inhibited the nuclear translocation of p65 NF-κB proteins. Moreover, effusanin E abrogated the binding of NF-κB to the COX-2 promoter, thereby inhibiting the expression and promoter activity of COX-2. Pretreatment with a COX-2 or NF-κB-selective inhibitor (celecoxib or ammonium pyrrolidinedithiocarbamate had an additive effect on the effusanin E-mediated inhibition of proliferation, while pretreatment with an activator of NF-κB/COX-2 (lipopolysaccharides abrogated the effusanin E-mediated inhibition of proliferation. Effusanin E also significantly suppressed tumor growth in a xenograft mouse model without obvious toxicity, furthermore, the expression of p50 NF-κB and COX-2 were down-regulated in the tumors of nude mice. These data suggest that effusanin E suppresses p50/p65 proteins to down-regulate COX-2 expression, thereby inhibiting NPC cell growth. Our findings provide new insights into exploring effusanin E as a potential therapeutic compound for the treatment of human nasopharyngeal carcinoma.

  20. Growth inhibition of thyroid follicular cell-derived cancers by the opioid growth factor (OGF - opioid growth factor receptor (OGFr axis

    Directory of Open Access Journals (Sweden)

    Donahue Renee N

    2009-10-01

    Full Text Available Abstract Background Carcinoma of the thyroid gland is an uncommon cancer, but the most frequent malignancy of the endocrine system. Most thyroid cancers are derived from the follicular cell. Follicular carcinoma (FTC is considered more malignant than papillary thyroid carcinoma (PTC, and anaplastic thyroid cancer (ATC is one of the most lethal human cancers. Opioid Growth Factor (OGF; chemical term - [Met5]-enkephalin and its receptor, OGFr, form an inhibitory axis regulating cell proliferation. Both the peptide and receptor have been detected in a wide variety of cancers, and OGF is currently used clinically as a biotherapy for some non-thyroid neoplasias. This study addressed the question of whether the OGF-OGFr axis is present and functional in human thyroid follicular cell - derived cancer. Methods Utilizing human ATC (KAT-18, PTC (KTC-1, and FTC (WRO 82-1 cell lines, immunohistochemistry was employed to ascertain the presence and location of OGF and OGFr. The growth characteristics in the presence of OGF or the opioid antagonist naltrexone (NTX, and the specificity of opioid peptides for proliferation of ATC, were established in KAT-18 cells. Dependence on peptide and receptor were investigated using neutralization studies with antibodies and siRNA experiments, respectively. The mechanism of peptide action on DNA synthesis and cell survival was ascertained. The ubiquity of the OGF-OGFr axis in thyroid follicular cell-derived cancer was assessed in KTC-1 (PTC and WRO 82-1 (FTC tumor cells. Results OGF and OGFr were present in KAT-18 cells. Concentrations of 10-6 M OGF inhibited cell replication up to 30%, whereas NTX increased cell growth up to 35% relative to cultures treated with sterile water. OGF treatment reduced cell number by as much as 38% in KAT-18 ATC in a dose-dependent and receptor-mediated manner. OGF antibodies neutralized the inhibitory effects of OGF, and siRNA knockdown of OGFr negated growth inhibition by OGF. Cell survival

  1. A novel muscarinic antagonist R2HBJJ inhibits non-small cell lung cancer cell growth and arrests the cell cycle in G0/G1.

    Directory of Open Access Journals (Sweden)

    Nan Hua

    Full Text Available Lung cancers express the cholinergic autocrine loop, which facilitates the progression of cancer cells. The antagonists of mAChRs have been demonstrated to depress the growth of small cell lung cancers (SCLCs. In this study we intended to investigate the growth inhibitory effect of R2HBJJ, a novel muscarinic antagonist, on non-small cell lung cancer (NSCLC cells and the possible mechanisms. The competitive binding assay revealed that R2HBJJ had a high affinity to M3 and M1 AChRs. R2HBJJ presented a strong anticholinergic activity on carbachol-induced contraction of guinea-pig trachea. R2HBJJ markedly suppressed the growth of NSCLC cells, such as H1299, H460 and H157. In H1299 cells, both R2HBJJ and its leading compound R2-PHC displayed significant anti-proliferative activity as M3 receptor antagonist darifenacin. Exogenous replenish of ACh could attenuate R2HBJJ-induced growth inhibition. Silencing M3 receptor or ChAT by specific-siRNAs resulted in a growth inhibition of 55.5% and 37.9% on H1299 cells 96 h post transfection, respectively. Further studies revealed that treatment with R2HBJJ arrested the cell cycle in G0/G1 by down-regulation of cyclin D1-CDK4/6-Rb. Therefore, the current study reveals that NSCLC cells express an autocrine and paracrine cholinergic system which stimulates the growth of NSCLC cells. R2HBJJ, as a novel mAChRs antagonist, can block the local cholinergic loop by antagonizing predominantly M3 receptors and inhibit NSCLC cell growth, which suggest that M3 receptor antagonist might be a potential chemotherapeutic regimen for NSCLC.

  2. In vitro selective growth inhibition of breast adenocarcinoma cell lines by Pseudomonas sp. UW4 metabolites

    Directory of Open Access Journals (Sweden)

    Maedeh Pasiar

    2016-12-01

    Full Text Available Background: Breast cancer is a malignant proliferation of epithelial cells that lining the ducts or lobules of the breast. It is the second common cancer, after lung cancer in women. Since growth inhibition is an important strategy in cancer treatment, many attempts are in program to find new apoptotic inducer agents. Today there is some reports about effect of metabolites of Pseudomonas on cancer cells, hence, metabolites of Pseudomonas sp. UW4, were isolated and anti-cancer and anti-microbial activity of these metabolites was studied. Methods: This experimental study was performed in cellular and developmental biology of Shahrekord Islamic Azad University from April 2015 to August 2015. Anti-microbial activity of metabolites of Pseudomonas sp. UW4 was tested against a pathogenic bacteria, including Escherichia coli, Bacillus cereus and Staphylococcus aureus. For anti-cancer activity, in this study SKBR3 cells and normal fibroblast cells (HU-02 were cultured in DMEM medium with 10% fetal bovine serum (FBS. The cells were treated by various concentrations of these metabolites 5, 10, 15 and 20 mg/ml for 24, 48 and 72 h. Cell viability was assessed by MTS assay. Cells were seeded at 5×103 cells/ml in 96 well plates and incubated for 24 hr. Then metabolites of bacteria were added, after indicated times MTS (20 µl was added and the absorbance was measured at 492 nm using ELISA plate reader. Results: Pseudomonas sp. UW4 was able to produce antimicrobial metabolites against Staphylococcus aureus. Metabolites decreases the viability of SKBR3 cell line in a time and dose dependent manner, so that the most effective concentration of this substance was 20 mg/ml and 72 h after treatment (P< 0.01. While Pseudomonas sp. UW4 in various concentrations had no significant effect on normal fibroblast cells (P= 0.24. Conclusion: Bioactive compounds produced by of Pseudomonas sp. UW4 could be used for elimination of infections and treatment of breast cancer SK

  3. A RNA antagonist of hypoxia-inducible factor-1alpha, EZN-2968, inhibits tumor cell growth

    DEFF Research Database (Denmark)

    Greenberger, Lee M; Horak, Ivan D; Filpula, David

    2008-01-01

    Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that plays a critical role in angiogenesis, survival, metastasis, drug resistance, and glucose metabolism. Elevated expression of the alpha-subunit of HIF-1 (HIF-1alpha), which occurs in response to hypoxia or activation of growth factor...... the expression of HIF-1alpha mRNA. In vitro, in human prostate (15PC3, PC3, and DU145) and glioblastoma (U373) cells, EZN-2968 induced a potent, selective, and durable antagonism of HIF-1 mRNA and protein expression (IC(50), 1-5 nmol/L) under normoxic and hypoxic conditions associated with inhibition of tumor......-regulation of endogenous HIF-1alpha and vascular endothelial growth factor in the liver. The effect can last for days after administration of single dose of EZN-2968 and is associated with long residence time of locked nucleic acid in certain tissues. In efficacy studies, tumor reduction was found in nude mice implanted...

  4. Ganoderma lucidum suppresses growth of breast cancer cells through the inhibition of Akt/NF-kappaB signaling.

    Science.gov (United States)

    Jiang, Jiahua; Slivova, Veronika; Harvey, Kevin; Valachovicova, Tatiana; Sliva, Daniel

    2004-01-01

    Ganoderma lucidum (Reishi, Lingzhi) is a popular Asian mushroom that has been used for more than 2 millennia for the general promotion of health and was therefore called the "Mushroom of Immortality." Ganoderma lucidum was also used in traditional Chinese medicine to prevent or treat a variety of diseases, including cancer. We previously demonstrated that Ganoderma lucidum suppresses the invasive behavior of breast cancer cells by inhibiting the transcription factor NF-kappaB. However, the molecular mechanisms responsible for the inhibitory effects of Ganoderma lucidum on the growth of highly invasive and metastatic breast cancer cells has not been fully elucidated. Here, we show that Ganoderma lucidum inhibits proliferation of breast cancer MDA-MB-231 cells by downregulating Akt/NF-kappaB signaling. Ganoderma lucidum suppresses phosphorylation of Akt on Ser473 and downregulates the expression of Akt, which results in the inhibition of NF-kappaB activity in MDA-MB-231 cells. The biological effect of Ganoderma lucidum was demonstrated by cell cycle arrest at G0/G1, which was the result of the downregulation of expression of NF-kappaB-regulated cyclin D1, followed by the inhibition of cdk4. Our results suggest that Ganoderma lucidum inhibits the growth of MDA-MB-231 breast cancer cells by modulating Akt/NF-kappaB signaling and could have potential therapeutic use for the treatment of breast cancer.

  5. A class of DNA-binding peptides from wheat bud causes growth inhibition, G2 cell cycle arrest and apoptosis induction in HeLa cells

    Directory of Open Access Journals (Sweden)

    Elgjo Kjell

    2009-07-01

    Full Text Available Abstract Background Deproteinized DNA from eukaryotic and prokaryotic cells still contains a low-molecular weight peptidic fraction which can be dissociated by alkalinization of the medium. This fraction inhibits RNA transcription and tumor cell growth. Removal from DNA of normal cells causes amplification of DNA template activity. This effect is lower or absent in several cancer cell lines. Likewise, the amount of active peptides in cancer cell DNA extracts is lower than in DNA preparation of the corresponding normal cells. Such evidence, and their ubiquitous presence, suggests that they are a regulatory, conserved factor involved in the control of normal cell growth and gene expression. Results We report that peptides extracted from wheat bud chromatin induce growth inhibition, G2 arrest and caspase-dependent apoptosis in HeLa cells. The growth rate is decreased in cells treated during the S phase only and it is accompanied by DNA damage and DNA synthesis inhibition. In G2 cells, this treatment induces inactivation of the CDK1-cyclin B1 complex and an increase of active chk1 kinase expression. Conclusion The data indicate that the chromatin peptidic pool inhibits HeLa cell growth by causing defective DNA replication which, in turn, arrests cell cycle progression to mitosis via G2 checkpoint pathway activation.

  6. Arctigenin inhibits prostate tumor cell growth in vitro and in vivo.

    Science.gov (United States)

    Wang, Piwen; Solorzano, Walter; Diaz, Tanya; Magyar, Clara E; Henning, Susanne M; Vadgama, Jaydutt V

    2017-06-01

    The low bioavailability of most phytochemicals limits their translation to humans. We investigated whether arctigenin, a novel anti-inflammatory lignan from the seeds of Arctium lappa , has favorable bioavailability/potency against prostate cancer. The anticarcinogenic activity of arctigenin was investigated both in vitro using the androgen-sensitive LNCaP and LAPC-4 human prostate cancer cells and pre-malignant WPE1-NA22 cells, and in vivo using xenograft mouse models. Arctigenin at lower doses (arctigenin at 50mg/kg (LD) or 100mg/kg (HD) b.w. daily or vehicle control by oral gavage. After 6 weeks, tumor growth was inhibited by 50% (LD) and 70% (HD) compared to control. A stronger tumor inhibitory effect was observed in a second experiment where arctigenin intervention started two weeks prior to tumor implantation. Arc was detectable in blood and tumors in Arc groups, with a mean value up to 2.0 μM in blood, and 8.3 nmol/g tissue in tumors. Tumor levels of proliferation marker Ki67, total and nuclear androgen receptor, and growth factors including VEGF, EGF, and FGF-β were significantly decreased by Arc, along with an increase in apoptosis marker of Bax/Bcl-2 ratio. Genes responsive to arctigenin were identified including TIMP3 and ZNF185, and microRNAs including miR-126-5p, and miR-21-5p. This study provides the first in vivo evidence of the strong anticancer activity of arctigenin in prostate cancer. The effective dose of arctigenin in vitro is physiologically achievable in vivo , which provides a high promise in its translation to human application.

  7. FXR blocks the growth of liver cancer cells through inhibiting mTOR-s6K pathway

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Xiongfei, E-mail: xiongfeihuang@hotmail.com [Department of Pathology and Institute of Oncology, Preclinical School, Fujian Medical University, Fuzhou 350108, Fujian (China); Key Laboratory of Ministry of Education for Gastrointestinal Cancer, Fujian Medical University, Fuzhou 350108, Fujian (China); Zeng, Yeting [Department of Pathology and Institute of Oncology, Preclinical School, Fujian Medical University, Fuzhou 350108, Fujian (China); Wang, Xinrui [Department of Biochemistry and Molecular Biology, Fujian Medical University, Fuzhou 350108, Fujian (China); Ma, Xiaoxiao [Department of Diabetes Complications and Metabolism, Diabetes & Metabolism Research Institute, Beckman Research Institute, City of Hope, CA 91010 (United States); Li, Qianqian; Li, Ningbo; Su, Hongying [Department of Pathology and Institute of Oncology, Preclinical School, Fujian Medical University, Fuzhou 350108, Fujian (China); Huang, Wendong [Department of Diabetes Complications and Metabolism, Diabetes & Metabolism Research Institute, Beckman Research Institute, City of Hope, CA 91010 (United States)

    2016-05-27

    The nuclear receptor Farnesoid X Receptor (FXR) is likely a tumor suppressor in liver tissue but its molecular mechanism of suppression is not well understood. In this study, the gene expression profile of human liver cancer cells was investigated by microarray. Bioinformatics analysis of these data revealed that FXR might regulate the mTOR/S6K signaling pathway. This was confirmed by altering the expression level of FXR in liver cancer cells. Overexpression of FXR prevented the growth of cells and induced cell cycle arrest, which was enhanced by the mTOR/S6K inhibitor rapamycin. FXR upregulation also intensified the inhibition of cell growth by rapamycin. Downregulation of FXR produced the opposite effect. Finally, we found that ectopic expression of FXR in SK-Hep-1 xenografts inhibits tumor growth and reduces expression of the phosphorylated protein S6K. Taken together, our data provide the first evidence that FXR suppresses proliferation of human liver cancer cells via the inhibition of the mTOR/S6K signaling pathway. FXR expression can be used as a biomarker of personalized mTOR inhibitor treatment assessment for liver cancer patients. -- Highlights: •FXR inhibits the proliferation of liver cancer cells by prolonging G0/G1 phase. •Microarray results indicate that mTOR-S6k signaling is involved in cellular processes in which FXR plays an important role. •FXR blocks the growth of liver cancer cells via the inhibition of the mTOR/S6K signaling pathway in vitro and in vivo.

  8. Curcumin induces chemo/radio-sensitization in ovarian cancer cells and curcumin nanoparticles inhibit ovarian cancer cell growth

    Directory of Open Access Journals (Sweden)

    Yallapu Murali M

    2010-04-01

    Full Text Available Abstract Background Chemo/radio-resistance is a major obstacle in treating advanced ovarian cancer. The efficacy of current treatments may be improved by increasing the sensitivity of cancer cells to chemo/radiation therapies. Curcumin is a naturally occurring compound with anti-cancer activity in multiple cancers; however, its chemo/radio-sensitizing potential is not well studied in ovarian cancer. Herein, we demonstrate the effectiveness of a curcumin pre-treatment strategy for chemo/radio-sensitizing cisplatin resistant ovarian cancer cells. To improve the efficacy and specificity of curcumin induced chemo/radio sensitization, we developed a curcumin nanoparticle formulation conjugated with a monoclonal antibody specific for cancer cells. Methods Cisplatin resistant A2780CP ovarian cancer cells were pre-treated with curcumin followed by exposure to cisplatin or radiation and the effect on cell growth was determined by MTS and colony formation assays. The effect of curcumin pre-treatment on the expression of apoptosis related proteins and β-catenin was determined by Western blotting or Flow Cytometry. A luciferase reporter assay was used to determine the effect of curcumin on β-catenin transcription activity. The poly(lactic acid-co-glycolic acid (PLGA nanoparticle formulation of curcumin (Nano-CUR was developed by a modified nano-precipitation method and physico-chemical characterization was performed by transmission electron microscopy and dynamic light scattering methods. Results Curcumin pre-treatment considerably reduced the dose of cisplatin and radiation required to inhibit the growth of cisplatin resistant ovarian cancer cells. During the 6 hr pre-treatment, curcumin down regulated the expression of Bcl-XL and Mcl-1 pro-survival proteins. Curcumin pre-treatment followed by exposure to low doses of cisplatin increased apoptosis as indicated by annexin V staining and cleavage of caspase 9 and PARP. Additionally, curcumin pre

  9. Methylselenol, a selenium metabolite, inhibits colon cancer cell growth and cancer xenografts in C57BL/6 mice

    Science.gov (United States)

    Data indicate that methylselenol is a critical selenium (Se) metabolite for anticancer activity in vivo but its role in colon cancer prevention remains to be characterized. This study tested the hypothesis that methylselenol inhibits the growth of colon cancer cells and tumors. We found that submicr...

  10. Inhibition of Human Immunodeficiency Virus and Growth of Infected T Cells by the Immunosuppressive Drugs Cyclosporin A and FK 506

    Science.gov (United States)

    Karpas, Abraham; Lowdell, Mark; Jacobson, S. Kim; Hill, Fergal

    1992-09-01

    The effects of the immunosuppressive drugs cyclosporin A and FK 506 were studied on cells chronically infected with human immunodeficiency virus type 1 (HIV-1) as well as on uninfected and newly infected cells. When cells chronically infected with HIV-1 or with HIV-2 were cocultivated with uninfected cells in the presence of cyclosporin A or FK 506 there was a delay in the formation of syncytia and of cytopathic effects. This inhibitory effect was not due to decreased membrane expression of CD4. In addition, there was an ≈100-fold reduction in the yield of infectious HIV-1 when the infected cells were grown in the presence of these drugs, a finding consistent with other evidence of decreased HIV expression. Both drugs were found to inhibit the growth of chronically infected cells at concentrations that did not inhibit the growth of the uninfected cells. These results, demonstrating that cyclosporin A and FK 506 interfere with HIV production and selectively inhibit the growth of infected cells, suggest that they may be useful in the treatment of this infection and indicate further cellular targets for antiviral agents.

  11. Antiprogestin mifepristone inhibits the growth of cancer cells of reproductive and non-reproductive origin regardless of progesterone receptor expression

    Directory of Open Access Journals (Sweden)

    Ortbahn Casey T

    2011-05-01

    Full Text Available Abstract Background Mifepristone (MF has been largely used in reproductive medicine due to its capacity to modulate the progesterone receptor (PR. The study of MF has been expanded to the field of oncology; yet it remains unclear whether the expression of PR is required for MF to act as an anti-cancer agent. Our laboratory has shown that MF is a potent inhibitor of ovarian cancer cell growth. In this study we questioned whether the growth inhibitory properties of MF observed in ovarian cancer cells would translate to other cancers of reproductive and non-reproductive origin and, importantly, whether its efficacy is related to the expression of cognate PR. Methods Dose-response experiments were conducted with cancer cell lines of the nervous system, breast, prostate, ovary, and bone. Cultures were exposed to vehicle or increasing concentrations of MF for 72 h and analysed for cell number and cell cycle traverse, and hypodiploid DNA content characteristic of apoptotic cell death. For all cell lines, expression of steroid hormone receptors upon treatment with vehicle or cytostatic doses of MF for 24 h was studied by Western blot, whereas the activity of the G1/S regulatory protein Cdk2 in both treatment groups was monitored in vitro by the capacity of Cdk2 to phosphorylate histone H1. Results MF growth inhibited all cancer cell lines regardless of tissue of origin and hormone responsiveness, and reduced the activity of Cdk2. Cancer cells in which MF induced G1 growth arrest were less susceptible to lethality in the presence of high concentrations of MF, when compared to cancer cells that did not accumulate in G1. While all cancer cell lines were growth inhibited by MF, only the breast cancer MCF-7 cells expressed cognate PR. Conclusions Antiprogestin MF inhibits the growth of different cancer cell lines with a cytostatic effect at lower concentrations in association with a decline in the activity of the cell cycle regulatory protein Cdk2, and

  12. Plant lectin can target receptors containing sialic acid, exemplified by podoplanin, to inhibit transformed cell growth and migration.

    Directory of Open Access Journals (Sweden)

    Jhon Alberto Ochoa-Alvarez

    Full Text Available Cancer is a leading cause of death of men and women worldwide. Tumor cell motility contributes to metastatic invasion that causes the vast majority of cancer deaths. Extracellular receptors modified by α2,3-sialic acids that promote this motility can serve as ideal chemotherapeutic targets. For example, the extracellular domain of the mucin receptor podoplanin (PDPN is highly O-glycosylated with α2,3-sialic acid linked to galactose. PDPN is activated by endogenous ligands to induce tumor cell motility and metastasis. Dietary lectins that target proteins containing α2,3-sialic acid inhibit tumor cell growth. However, anti-cancer lectins that have been examined thus far target receptors that have not been identified. We report here that a lectin from the seeds of Maackia amurensis (MASL with affinity for O-linked carbohydrate chains containing sialic acid targets PDPN to inhibit transformed cell growth and motility at nanomolar concentrations. Interestingly, the biological activity of this lectin survives gastrointestinal proteolysis and enters the cardiovascular system to inhibit melanoma cell growth, migration, and tumorigenesis. These studies demonstrate how lectins may be used to help develop dietary agents that target specific receptors to combat malignant cell growth.

  13. miR-449 overexpression inhibits papillary thyroid carcinoma cell growth by targeting RET kinase-β-catenin signaling pathway.

    Science.gov (United States)

    Li, Zongyu; Huang, Xin; Xu, Jinkai; Su, Qinghua; Zhao, Jun; Ma, Jiancang

    2016-10-01

    Papillary thyroid carcinoma (PTC) is the most common thyroid cancer and represent approximately 80% of all thyroid cancers. The present study is aimed to investigate the role of microRNA (miR)-449 in the progression of PTC. Our results revealed that miR-449 was underexpressed in the collected PTC specimens compared with non-cancerous PTC tissues. Overexpression of miR-449 induced a cell cycle arrest at G0/G1 phase and inhibited PTC cell growth in vitro. Further studies revealed that RET proto-oncogene (RET) is a novel miR-449 target, due to miR-449 bound directly to its 3'-untranslated region and miR-449 mimic reduced the protein expression of RET. Similar to the effects of miR-449 overexpression, RET downregulation inhibited cell growth, whereas RET overexpression reversed the inhibitive effect of miR-449 mimic. Furthermore, miR-449 overexpression inhibited the nuclear translocation of β-catenin and reduced the expression of several downstream genes, including c-Myc, cyclin D1, T cell-specific transcription factor (TCF) and lymphoid enhancer-binding factor 1 (LEF-1), and inactivated the β-catenin pathway in TPC-1 cells. Moreover, overexpression of β-catenin prevented miR-449-reduced cell cycle arrest and cell viability. In xenograft animal experiments, miR-449 overexpression effectively suppressed the tumor growth of PTC. Taken together, our research indicated that miR-449 functions as an anti-oncogene by targeting RET, and that miR-449 overexpression inhibited the growth of PTC by inactivating the β-catenin pathway. Thus, miR-449 may serve as a potential therapeutic strategy for the treatment of PTC.

  14. Belinostat-induced apoptosis and growth inhibition in pancreatic cancer cells involve activation of TAK1-AMPK signaling axis

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bing, E-mail: wangbin69@yahoo.com; Wang, Xin-bao; Chen, Li-yu; Huang, Ling; Dong, Rui-zen

    2013-07-19

    Highlights: •Belinostat activates AMPK in cultured pancreatic cancer cells. •Activation of AMPK is important for belinostat-induced cytotoxic effects. •ROS and TAK1 are involved in belinostat-induced AMPK activation. •AMPK activation mediates mTOR inhibition by belinostat. -- Abstract: Pancreatic cancer accounts for more than 250,000 deaths worldwide each year. Recent studies have shown that belinostat, a novel pan histone deacetylases inhibitor (HDACi) induces apoptosis and growth inhibition in pancreatic cancer cells. However, the underlying mechanisms are not fully understood. In the current study, we found that AMP-activated protein kinase (AMPK) activation was required for belinostat-induced apoptosis and anti-proliferation in PANC-1 pancreatic cancer cells. A significant AMPK activation was induced by belinostat in PANC-1 cells. Inhibition of AMPK by RNAi knockdown or dominant negative (DN) mutation significantly inhibited belinostat-induced apoptosis in PANC-1 cells. Reversely, AMPK activator AICAR and A-769662 exerted strong cytotoxicity in PANC-1 cells. Belinostat promoted reactive oxygen species (ROS) production in PANC-1 cells, increased ROS induced transforming growth factor-β-activating kinase 1 (TAK1)/AMPK association to activate AMPK. Meanwhile, anti-oxidants N-Acetyl-Cysteine (NAC) and MnTBAP as well as TAK1 shRNA knockdown suppressed belinostat-induced AMPK activation and PANC-1 cell apoptosis. In conclusion, we propose that belinostat-induced apoptosis and growth inhibition require the activation of ROS-TAK1-AMPK signaling axis in cultured pancreatic cancer cells.

  15. Andrographis paniculata extracts and major constituent diterpenoids inhibit growth of intrahepatic cholangiocarcinoma cells by inducing cell cycle arrest and apoptosis.

    Science.gov (United States)

    Suriyo, Tawit; Pholphana, Nanthanit; Rangkadilok, Nuchanart; Thiantanawat, Apinya; Watcharasit, Piyajit; Satayavivad, Jutamaad

    2014-05-01

    Andrographis paniculata is an important herbal medicine widely used in several Asian countries for the treatment of various diseases due to its broad range of pharmacological activities. The present study reports that A. paniculata extracts potently inhibit the growth of liver (HepG2 and SK-Hep1) and bile duct (HuCCA-1 and RMCCA-1) cancer cells. A. paniculata extracts with different contents of major diterpenoids, including andrographolide, 14-deoxy-11,12-didehydroandrographolide, neoandrographolide, and 14-deoxyandrographolide, exhibited a different potency of growth inhibition. The ethanolic extract of A. paniculata at the first true leaf stage, which contained a high amount of 14-deoxyandrographolide but a low amount of andrographolide, showed a cytotoxic effect to cancer cells about 4 times higher than the water extract of A. paniculata at the mature leaf stage, which contained a high amount of andrographolide but a low amount of 14-deoxyandrographolide. Andrographolide, not 14-deoxy-11,12-didehydroandrographolide, neoandrographolide, or 14-deoxyandrographolide, possessed potent cytotoxic activity against the growth of liver and bile duct cancer cells. The cytotoxic effect of the water extract of A. paniculata at the mature leaf stage could be explained by the present amount of andrographolide, while the cytotoxic effect of the ethanolic extract of A. paniculata at the first true leaf stage could not. HuCCA-1 cells showed more sensitivity to A. paniculata extracts and andrographolide than RMCCA-1 cells. Furthermore, the ethanolic extract of A. paniculata at the first true leaf stage increased cell cycle arrest at the G0/G1 and G2/M phases, and induced apoptosis in both HuCCA-1 and RMCCA-1 cells. The expressions of cyclin-D1, Bcl-2, and the inactive proenzyme form of caspase-3 were reduced by the ethanolic extract of A. paniculata in the first true leaf stage treatment, while a proapoptotic protein Bax was increased. The cleavage of poly (ADP

  16. Splenectomy inhibits non-small cell lung cancer growth by modulating anti-tumor adaptive and innate immune response

    Science.gov (United States)

    Levy, Liran; Mishalian, Inbal; Bayuch, Rachel; Zolotarov, Lida; Michaeli, Janna; Fridlender, Zvi G

    2015-01-01

    It has been shown that inhibitors of the immune system reside in the spleen and inhibit the endogenous antitumor effects of the immune system. We hypothesized that splenectomy would inhibit the growth of relatively large non-small lung cancer (NSCLC) tumors by modulating the systemic inhibition of the immune system, and in particular Myeloid Derived Suppressor Cells (MDSC). The effect of splenectomy was evaluated in several murine lung cancer models. We found that splenectomy reduces tumor growth and the development of lung metastases, but only in advanced tumors. In immune-deficient NOD-SCID mice the effect of splenectomy on tumor growth and metastatic spread disappeared. Splenectomy significantly reduced the presence of MDSC, and especially monocytic-MDSC in the circulation and inside the tumor. Specific reduction of the CCR2+ subset of monocytic MDSC was demonstrated, and the importance of the CCL2-CCR2 axis was further shown by a marked reduction in CCL2 following splenectomy. These changes were followed by changes in the macrophages contents of the tumors to become more antitumorigenic, and by increased activation of CD8+ Cytotoxic T-cells (CTL). By MDSC depletion, and adoptive transfer of MDSCs, we demonstrated that the effect of splenectomy on tumor growth was substantially mediated by MDSC cells. We conclude that the spleen is an important contributor to tumor growth and metastases, and that splenectomy can blunt this effect by depletion of MDSC, changing the amount and characteristics of myeloid cells and enhancing activation of CTL. PMID:26137413

  17. Inhibition of Akt sensitises neuroblastoma cells to gold(III) porphyrin 1a, a novel antitumour drug induced apoptosis and growth inhibition.

    Science.gov (United States)

    Li, W; Xie, Y; Sun, R W-Y; Liu, Q; Young, J; Yu, W-Y; Che, C-M; Tam, P K; Ren, Y

    2009-07-21

    Gold(III) porphyrin 1a is a new class of anticancer drug, which inhibits cell proliferation of wide range of human cancer cell lines and induces apoptosis in human nasopharyngeal carcinoma cells. However, the underlying signalling mechanism by which gold(III) porphyrin 1a modifies the intracellular apoptosis pathways in tumour cells has not been explained in detail in neuroblastoma cells. Cell proliferation and apoptosis were determined by measuring 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and Annexin V binding, respectively. Western blot assay was used to detect proteins involved in apoptotic and Akt pathways. In vivo tumour growth was assessed by inoculating tumour cells to nude mice subcutaneously, and gold(III) porphyrin 1a was administrated intravenously. This study assessed the antitumour effect and mechanism of gold(III) porphyrin 1a on neuroblastoma in vitro and in vivo. Gold(III) porphyrin 1a displayed a growth inhibition and induction of apoptosis in neuroblastoma cells effectively in vitro, which was accompanied with release of cytochrome c and Smac/DIABLO and caspases activation. Further studies indicated that gold(III) porphyrin 1a inhibited X-linked inhibitor of apoptosis (XIAP). However, we found that gold(III) porphyrin 1a can induce a survival signal, Akt activation within minutes and could last for at least 24 h. To further confirm association between activation of Akt and the effectiveness of gold(III) porphyrin 1a, neuroblastoma cells were treated with API-2, an Akt-specific inhibitor. API-2 sensitised cells to gold(III) porphyrin 1a-induced apoptosis and growth inhibition. These results suggested that Akt may be considered as a molecular 'brake' that neuroblastoma cells rely on to slow down gold(III) porphyrin 1a-induced apoptosis and antiproliferation. Gold(III) porphyrin 1a is a mitochondrial apoptotic stimulus but also activates Akt, suggesting an involvement of Akt in mediating the effectiveness to growth

  18. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    Science.gov (United States)

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  19. Expression of an amino-terminal BRCA1 deletion mutant causes a dominant growth inhibition in MCF10A cells.

    Science.gov (United States)

    You, Fanglei; Chiba, Natsuko; Ishioka, Chikashi; Parvin, Jeffrey D

    2004-07-29

    Expression of deletion mutants of the breast and ovarian cancer-specific tumor suppressor protein, BRCA1, in the mammary epithelial cell line MCF10A revealed a powerful growth suppressive effect by a mutant that has the amino-terminal 302 amino acids deleted (DeltaN-BRCA1). The growth suppression is associated with an increase in apoptosis and amplification in centrosome number. The growth inhibitory effect of DeltaN-BRCA1 was not observed in cervical epithelial HeLa cells, suggesting that the phenotypes of BRCA1 mutant proteins differ depending on the cell line being tested. An internal domain, including BRCA1 residues 303-1292, caused the suppression of MCF10A cell growth, and the amino terminus of BRCA1 autoinhibited the growth suppression. Single point mutations that disrupted the amino-terminal RING domain of BRCA1 caused significant suppression of growth in MCF10A cells. These results suggest that the proper function of the RING domain, likely to be ubiquitin ligase function, is important in regulating the growth of the mammary epithelial cell line and in autoregulating the powerful internal growth-inhibiting domain of the BRCA1 tumor suppressor.

  20. Regorafenib inhibited gastric cancer cells growth and invasion via CXCR4 activated Wnt pathway.

    Science.gov (United States)

    Lin, Xiao-Lin; Xu, Qi; Tang, Lei; Sun, Li; Han, Ting; Wang, Li-Wei; Xiao, Xiu-Ying

    2017-01-01

    Regorafenib is an oral small-molecule multi kinase inhibitor. Recently, several clinical trials have revealed that regorafenib has an anti-tumor activity in gastric cancer. However, only part of patients benefit from regorafenib, and the mechanisms of regorafenib's anti-tumor effect need further demonstrating. In this study, we would assess the potential anti-tumor effects and the underlying mechanisms of regorafenib in gastric cancer cells, and explore novel biomarkers for patients selecting of regorafenib. The anti-tumor effects of regorafenib on gastric cancer cells were analyzed via cell proliferation and invasion. The underlying mechanisms were demonstrated using molecular biology techniques. We found that regorafenib inhibited cell proliferation and invasion at the concentration of 20μmol/L and in a dose dependent manner. The anti-tumor effects of regorafenib related to the decreased expression of CXCR4, and elevated expression and activation of CXCR4 could reverse the inhibition effect of regorafenib on gastric cancer cells. Further studies revealed that regorafenib reduced the transcriptional activity of Wnt/β-Catenin pathway and led to decreased expression of Wnt pathway target genes, while overexpression and activation of CXCR4 could attenuate the inhibition effect of regorafenib on Wnt/β-Catenin pathway. Our findings demonstrated that regorafenib effectively inhibited cell proliferation and invasion of gastric cancer cells via decreasing the expression of CXCR4 and further reducing the transcriptional activity of Wnt/β-Catenin pathway.

  1. Matrine Activates PTEN to Induce Growth Inhibition and Apoptosis in V600EBRAF Harboring Melanoma Cells

    Directory of Open Access Journals (Sweden)

    Shuiying Wang

    2013-07-01

    Full Text Available Here, we report a natural chemical Matrine, which exhibits anti-melanoma potential with its PTEN activation mechanism. Matrine effectively inhibited proliferation of several carcinoma cell lines, including melanoma V600EBRAF harboring M21 cells. Flow cytometry analysis showed Matrine induced G0/G1 cell cycle arrest in M21 cells dose-dependently. Apoptosis in M21 cells induced by Matrine was identified by Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL analysis and Annexin-V/FITC staining. Molecular mechanistic study suggested that Matrine upregulated both mRNA level and protein expression level of phosphatase and tensin homolog deleted on chromosome ten (PTEN, leading to inhibition of the PI3K/Akt pathway. Downregulation of phosphor-Aktser473 by Matrine activated p21 and Bax, which contributed to G0/G1 cell cycle and apoptosis. Besides, Matrine enhanced the PI3K/Akt inhibition effects to inhibit the cell proliferation with PI3K inhibitor, LY2940002. In summary, our findings suggest Matrine is a promising antitumor drug candidate with its possible PTEN activation mechanisms for treating cancer diseases, such as melanomas.

  2. SphK1 inhibitor II (SKI-II) inhibits acute myelogenous leukemia cell growth in vitro and in vivo.

    Science.gov (United States)

    Yang, Li; Weng, Wei; Sun, Zhi-Xin; Fu, Xian-Jie; Ma, Jun; Zhuang, Wen-Fang

    2015-05-15

    Previous studies have identified sphingosine kinase 1 (SphK1) as a potential drug target for treatment of acute myeloid leukemia (AML). In the current study, we investigated the potential anti-leukemic activity of a novel and specific SphK1 inhibitor, SKI-II. We demonstrated that SKI-II inhibited growth and survival of human AML cell lines (HL-60 and U937 cells). SKI-II was more efficient than two known SphK1 inhibitors SK1-I and FTY720 in inhibiting AML cells. Meanwhile, it induced dramatic apoptosis in above AML cells, and the cytotoxicity by SKI-II was almost reversed by the general caspase inhibitor z-VAD-fmk. SKI-II treatment inhibited SphK1 activation, and concomitantly increased level of sphingosine-1-phosphate (S1P) precursor ceramide in AML cells. Conversely, exogenously-added S1P protected against SKI-II-induced cytotoxicity, while cell permeable short-chain ceramide (C6) aggravated SKI-II's lethality against AML cells. Notably, SKI-II induced potent apoptotic death in primary human AML cells, but was generally safe to the human peripheral blood mononuclear cells (PBMCs) isolated from healthy donors. In vivo, SKI-II administration suppressed growth of U937 leukemic xenograft tumors in severe combined immunodeficient (SCID) mice. These results suggest that SKI-II might be further investigated as a promising anti-AML agent. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Inhibition by 2-deoxy-D-ribose of DNA synthesis and growth in Raji cells

    International Nuclear Information System (INIS)

    Ulrich, F.

    1988-01-01

    When Raji cells were cultured for 3 days in serum-free medium, addition of 2-deoxy-D-ribose at the start of culture inhibited incorporation of [ 3 H]thymidine and cell division. At deoxyribose concentrations between 1 and 5 mM, viability was 80% or greater after 3 days of culture even though 5 mM deoxyribose inhibited thymidine incorporation 95-99%. Inhibition by deoxyribose could be completely reversed if the culture medium was replaced with fresh medium up to 8 hr after the start of culture. The inhibition was specific for deoxyribose since other monosaccharides had no effect. Inhibition of DNA synthesis did not appear to be due to depletion of essential nutrients in the medium since the percentage inhibition of thymidine incorporation by cells cultured either in suboptimal serum-free media or in media supplemented with 0.025-5% human AB serum was similar. When DNA repair synthesis was measured as hydroxyurea-resistant thymidine incorporation, addition of deoxyribose to Raji cultures caused increased thymidine incorporation. These results, together with data from others,suggest that deoxyribose damages DNA

  4. Targeting DTL induces cell cycle arrest and senescence and suppresses cell growth and colony formation through TPX2 inhibition in human hepatocellular carcinoma cells.

    Science.gov (United States)

    Chen, Yu-Chia; Chen, I-Shu; Huang, Guan-Jin; Kang, Chi-Hsiang; Wang, Kuo-Chiang; Tsao, Min-Jen; Pan, Hung-Wei

    2018-01-01

    Hepatocellular carcinoma (HCC) has an increasing incidence and high mortality. Surgical operation is not a comprehensive strategy for liver cancer. Moreover, tolerating systemic chemotherapy is difficult for patients with HCC because hepatic function is often impaired due to underlying cirrhosis. Therefore, a comprehensive strategy for cancer treatment should be developed. DTL (Cdc10-dependent transcript 2) is a critical regulator of cell cycle progression and genomic stability. In our previous study, the upregulation of DTL expression in aggressive HCC correlated positively with tumor grade and poor patient survival. We hypothesize that targeting DTL may provide a novel therapeutic strategy for liver cancer. DTL small interference RNAs were used to knock down DTL protein expression. A clonogenic assay, immunostaining, double thymidine block, imaging flow cytometry analysis, and a tumor spheroid formation assay were used to analyze the role of DTL in tumor cell growth, cell cycle progression, micronucleation, ploidy, and tumorigenicity. Our results demonstrated that targeting DTL reduced cell cycle regulators and chromosome segregation genes, resulting in increased cell micronucleation. DTL depletion inhibited liver cancer cell growth, increased senescence, and reduced tumorigenesis. DTL depletion resulted in the disruption of the mitotic proteins cyclin B, CDK1, securin, seprase, Aurora A, and Aurora B as well as the upregulation of the cell cycle arrest gene p21 . A rescue assay indicated that DTL should be targeted through TPX2 downregulation for cancer cell growth inhibition. Moreover, DTL silencing inhibited the growth of patient-derived primary cultured HCC cells. Our study results indicate that DTL is a potential novel target gene for treating liver cancer through liver cancer cell senescence induction. Furthermore, our results provide insights into molecular mechanisms for targeting DTL in liver cancer cells. The results also indicate several other starting

  5. The growth inhibition of human breast cancer cells by a novel synthetic progestin involves the induction of transforming growth factor beta.

    OpenAIRE

    Colletta, A A; Wakefield, L M; Howell, F V; Danielpour, D; Baum, M; Sporn, M B

    1991-01-01

    Recent experimental work has identified a novel intracellular binding site for the synthetic progestin, Gestodene, that appears to be uniquely expressed in human breast cancer cells. Gestodene is shown here to inhibit the growth of human breast cancer cells in a dose-dependent fashion, but has no effect on endocrine-responsive human endometrial cancer cells. Gestodene induced a 90-fold increase in the secretion of transforming growth factor-beta (TGF-beta) by T47D human breast cancer cells. O...

  6. The clinically used photosensitizer Verteporfin (VP) inhibits YAP-TEAD and human retinoblastoma cell growth in vitro without light activation

    Science.gov (United States)

    Brodowska, Katarzyna; Moujahed, Ahmad; Marmalidou, Anna; zu Horste, Melissa Meyer; Cichy, Joanna; Miller, Joan W.; Gragoudas, Evangelos; Vavvas, Demetrios G.

    2014-01-01

    Verteporfin (VP), a benzoporphyrin derivative, is clinically used in photodynamic therapy for neovascular macular degeneration. Recent studies indicate that VP may inhibit growth of hepatoma cells without photoactivation hrough inhibition of YAP-TEAD complex. In this study, we examined the effects of VP without light activation on human retinoblastoma cell lines. Verteporfin but not vehicle control inhibited the growth, proliferation and viability of human retinoblastoma cell lines (Y79 and WERI) in a dose-dependent manner and was associated with downregulation of YAP-TEAD associated downstream proto-oncogenes such as c-myc, axl, and surviving. In addition VP affected signals involved in cell migration and angiogenesis such as CTGF, cyr61, and VEGF-A but was not associated with significant effect on the mTOR/autophagy pathway. Of interest the pluripotency marker Oct4 were downregulated by Verteporfin treatment. Our results indicate that the clinically used photosensitizer VP is a potent inhibitor of cell growth in retinoblastoma cells, disrupting YAPTEAD signaling and pluripotential marker OCT4. This study highlights for the first time the role of the YAP-TEAD pathway in Retinoblastoma and suggests that VP may be a useful adjuvant therapeutic tool in treating Rb patients. PMID:24837142

  7. microRNA-218 inhibits prostate cancer cell growth and promotes apoptosis by repressing TPD52 expression

    Energy Technology Data Exchange (ETDEWEB)

    Han, Guangye, E-mail: guangyehan@126.com; Fan, Maochuan, E-mail: maochunfan@outlook.com; Zhang, Xinjun, E-mail: xinjunzhang11@163.com

    2015-01-16

    Highlights: • miR-218 expression is downregulated in prostate cancer. • miR-218 inhibits prostate tumor cells proliferation partially through promoting apoptosis. • miR-218 targets TPD52 by binding to its 3′-UTR. • miR-218 suppresses prostate cancer cell growth through inhibiting TPD52 expression. - Abstract: The tumor protein D52 (TPD52) is an oncogene overexpressed in prostate cancer (PC) due to gene amplification. Although the oncogenic effect of TPD52 is well recognized, how its expression is regulated is still not clear. This study tried to explore the regulative role of miR-218, a tumor suppressing miRNA on TPD52 expression and prostate cancer cell proliferation. We found the expression of miR-218 was significantly lower in PC specimens. Based on gain and loss of function analysis, we found miR-218 significantly inhibit cancer cell proliferation by inducing apoptosis. These results strongly suggest that miR-218 plays a tumor suppressor role in PC cells. In addition, our data firstly demonstrated that miR-218 directly regulates oncogenic TPD52 in PC3 cells and the miR-218-TPD52 axis can regulate growth of this prostate cancer cell line. Knockdown of TPD52 resulted in significantly increased cancer cell apoptosis. Clearly understanding of oncogenic TPD52 pathways regulated by miR-218 might be helpful to reveal new therapeutic targets for PC.

  8. [Prosapogenin A inhibits cell growth of MCF7 via downregulating STAT3 and glycometabolism-related gene].

    Science.gov (United States)

    Wang, Tian-xiao; Shi, Xiao-yan; Cong, Yue; Zhang, Zhong-qing; Liu, Ying-hua

    2013-09-01

    This study is to investigate the inhibitory effect and mechanism of prosapogenin A (PSA) on MCF7. MTT assay was performed to determine the inhibitory effect of PSA on MCF7 cells. PI/Hoechst 33342 double staining was used to detect cell apoptosis. RT-PCR was used to test the mRNA levels of STAT3, GLUT1, HK and PFKL. Western blotting was performed to determine the expression of STAT3 and pSTAT3 protein in MCF7 cells. The results showed that PSA could dose-dependently inhibit cell growth of MCF7 followed by IC50 of 9.65 micrmol x L(-1) and promote cell apoptosis of MCF7. Reduced mRNA levels of STAT3, HK and PFKL were observed in MCF7 cells treated with 5 micromol x L(-1) of PSA. PSA also decreased the level of pSTAT3 protein. STAT3 siRNA caused decrease of mRNA of GLUT1, HK and PFKL which indicated STAT3 could regulate the expressions of GLUT1, HK and PFKL. The results suggested that PSA could inhibit cell growth and promote cell apoptosis of MCF7 via inhibition of STAT3 and glycometabolism-related gene.

  9. Salinomycin inhibits proliferation and induces apoptosis of human nasopharyngeal carcinoma cell in vitro and suppresses tumor growth in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Danxin; Zhang, Yu; Huang, Jie; Fan, Zirong; Shi, Fengrong; Wang, Senming, E-mail: wsenming@126.com

    2014-01-10

    Highlight: •We first evaluated the effect of salinomycin on nasopharyngeal carcinoma (NPC). •Salinomycin could inhibit Wnt/β-catenin signaling and induce apoptosis in NPC. •So salinomycin may be a good potential candidate for the chemotherapy of NPC. -- Abstract: Salinomycin (Sal) is a polyether ionophore antibiotic that has recently been shown to induce cell death in various human cancer cells. However, whether salinomycin plays a functional role in nasopharyngeal carcinoma (NPC) has not been determined to date. The present study investigated the chemotherapeutic efficacy of salinomycin and its molecular mechanisms of action in NPC cells. Salinomycin efficiently inhibited proliferation and invasion of 3 NPC cell lines (CNE-1, CNE-2, and CNE-2/DDP) and activated a extensive apoptotic process that is accompanied by activation of caspase-3 and caspase-9, and decreased mitochondrial membrane potential. Meanwhile, the protein expression level of the Wnt coreceptor lipoprotein receptor related protein 6 (LRP6) and β-catenin was down-regulated, which showed that the Wnt/β-catenin signaling was involved in salinomycin-induced apoptosis of NPC cells. In a nude mouse NPC xenograft model, the anti-tumor effect of salinomycin was associated with the downregulation of β-catenin expression. The present study demonstrated that salinomycin can effectively inhibit proliferation and invasion, and induce apoptosis of NPC cells in vitro and inhibit tumor growth in vivo, probably via the inhibition of Wnt/β-catenin signaling, suggesting salinomycin as a potential candidate for the chemotherapy of NPC.

  10. Nitrogen deficiency inhibits leaf blade growth in Lolium perenne by increasing cell cycle duration and decreasing mitotic and post-mitotic growth rates.

    Science.gov (United States)

    Kavanová, Monika; Lattanzi, Fernando Alfredo; Schnyder, Hans

    2008-06-01

    Nitrogen deficiency severely inhibits leaf growth. This response was analysed at the cellular level by growing Lolium perenne L. under 7.5 mM (high) or 1 mM (low) nitrate supply, and performing a kinematic analysis to assess the effect of nitrogen status on cell proliferation and cell growth in the leaf blade epidermis. Low nitrogen supply reduced leaf elongation rate (LER) by 43% through a similar decrease in the cell production rate and final cell length. The former was entirely because of a decreased average cell division rate (0.023 versus 0.032 h(-1)) and thus longer cell cycle duration (30 versus 22 h). Nitrogen status did not affect the number of division cycles of the initial cell's progeny (5.7), and accordingly the meristematic cell number (53). Meristematic cell length was unaffected by nitrogen deficiency, implying that the division and mitotic growth rates were equally impaired. The shorter mature cell length arose from a considerably reduced post-mitotic growth rate (0.033 versus 0.049 h(-1)). But, nitrogen stress did not affect the position where elongation stopped, and increased cell elongation duration. In conclusion, nitrogen deficiency limited leaf growth by increasing the cell cycle duration and decreasing mitotic and post-mitotic elongation rates, delaying cell maturation.

  11. KAEMPFEROL, A FLAVONOID COMPOUND FROM GYNURA MEDICA INDUCED APOPTOSIS AND GROWTH INHIBITION IN MCF-7 BREAST CANCER CELL.

    Science.gov (United States)

    Yi, Xiaofang; Zuo, Jiangcheng; Tan, Chao; Xian, Sheng; Luo, Chunhua; Chen, Sai; Yu, Liangfang; Luo, Yucheng

    2016-01-01

    Kaempferol, a natural flavonoid, has been shown to induce cancer cell apoptosis and cell growth inhibition in several tumors. Previously we have conducted a full investigation on the chemical constituents of Gynura medica , kaempferol and its glycosides are the major constituents of G. medica . Here we investigated the growth inhibition and apoptosis induction effect of kaempferol extracted from G. medica . The inhibition effects of kaempferol were evaluated by MTS assay and soft agar colony formation assay. Fluorescence staining and western blotting were be used to study the apoptosis. The structure was identified by 1 H- NMR), 13 C-NMR and ESI-MS analyses. Our results showed that kaempferol's inhibition of MCF-7 breast cancer cell growth may through inducing apoptosis and downregulation of Bcl2 expression. Kaempferol is a promising cancer preventive and therapeutic agent for breast cancer. List of non-standard abbreviations: MTS: 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, HPLC: High-performance liquid chromatography, NMR: Nuclear Magnetic Resonance, ESI-MS Electrospray Ionization Mass Spectral, PARP: Poly ADP-ribose polymerase.

  12. A rapid [3H]glucose incorporation assay for determination of lymphoid cell-mediated inhibition of Candida albicans growth

    International Nuclear Information System (INIS)

    Djeu, J.Y.; Parapanissios, A.; Halkias, D.; Friedman, H.

    1986-01-01

    [ 3 H]glucose uptake by Candida albicans after interaction with lymphoid effector cells was used to provide a quick, accurate and objective assessment of the growth inhibitory potential of lymphoid cells on candida. After 18 h coincubation of effector cells with candida, [ 3 H]glucose was added for 3 h and the amount of radiolabel incorporated into residual candida was measured. The results showed that [ 3 H]glucose uptake was proportional to the number of candida organisms left in the microwell and is dose dependent on the effector/target (E/T) ratio. At an E/T ratio of 300/1, complete inhibition of candida was seen, with significant inhibition still present at 30/1. In addition, monocytes and polymorphonuclear cells were found to be the primary cells responsible for eliminating candida. (Auth.)

  13. Inhibition of microbial growth on air cathodes of single chamber microbial fuel cells by incorporating enrofloxacin into the catalyst layer.

    Science.gov (United States)

    Liu, Weifeng; Cheng, Shaoan; Sun, Dan; Huang, Haobin; Chen, Jie; Cen, Kefa

    2015-10-15

    The inevitable growth of aerobic bacteria on the surface of air cathodes is an important factor reducing the performance stability of air cathode single-chamber membrane-free microbial fuel cells (MFCs). Thus searching for effective methods to inhibit the cathodic microbial growth is critical for the practical application of MFCs. In this study, enrofloxacin (ENR), a broad spectrum fluoroquinolone antibiotic, was incorporated into the catalyst layer of activated carbon air cathodes (ACACs) to inhibit the cathodic microbial growth. The biomass content on ACACs was substantially reduced by 60.2% with ENR treatment after 91 days of MFCs operation. As a result of the inhibited microbial growth, the oxygen reduction catalytic performance of the ENR treated ACACs was much stable compared to the fast performance decline of the untreated control. Consequently, a quite stable electricity production was obtained for the MFCs with the ENR treated ACACs, in contrast with a 22.5% decrease in maximum power density of the MFCs with the untreated cathode. ENR treatment of ACACs showed minimal effects on the anode performance. These results indicate that incorporating antibiotics into ACACs should be a simple and effective strategy to inhibit the microbial growth and improve the long-term stability of the performance of air cathode and the electricity production of MFCs. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Exercise-induced muscle-derived cytokines inhibit mammary cancer cell growth

    DEFF Research Database (Denmark)

    Hojman, Pernille; Dethlefsen, Christine; Brandt, Claus

    2011-01-01

    in caspase activity was found after incubation of MCF-7 cells with conditioned media from electrically stimulated myotubes. PCR array analysis (CAPM-0838E; SABiosciences) revealed that seven genes were upregulated in the muscles after exercise, and of these oncostatin M (OSM) proved to inhibit MCF-7...

  15. Inhibition of beta cell growth and function by bone morphogenetic proteins

    DEFF Research Database (Denmark)

    Bruun, Christine; Christensen, Gitte Lund; Jacobsen, Marie L B

    2014-01-01

    proliferation of rodent beta cells. The expression of Id mRNAs was induced by BMP4 in rat and human islets. Finally, glucose-induced insulin secretion was significantly impaired in rodent and human islets pre-treated with BMP4, and inhibition of BMP activity resulted in enhanced insulin release. CONCLUSIONS...

  16. Synergistic growth inhibition of cancer cells harboring the RET/PTC1 ...

    Indian Academy of Sciences (India)

    TPC-1 is a highly proliferative thyroid papillary carcinoma-derived cell line. These cells express the RET/PTC1 fusion protein, whose isoforms are characterized in this work. The bacterial alkaloid staurosporine and the plant extract rotenone are death-inducing drugs that have an inhibitory synergistic effect on the growth of ...

  17. Isoalantolactone inhibits UM-SCC-10A cell growth via cell cycle arrest and apoptosis induction.

    Directory of Open Access Journals (Sweden)

    Minjun Wu

    Full Text Available Isoalantolactone is a sesquiterpene lactone compound isolated from the roots of Inula helenium L. Previous studies have demonstrated that isoalantolactone possesses antifungal, anti-bacterial, anti-helminthic and anti-proliferative properties in a variety of cells, but there are no studies concerning its effects on head and neck squamous cell carcinoma (HNSCC. In the present study, an MTT assay demonstrated that isoalantolactone has anti-proliferative activity against the HNSCC cell line (UM-SCC-10A. Immunostaining identified that this compound induced UM-SCC-10A cell apoptosis but not necrosis. To explain the molecular mechanisms underlying its effects, flow cytometry and western blot analysis showed that the apoptosis was associated with cell cycle arrest during the G1 phase, up-regulation of p53 and p21, and down-regulation of cyclin D. Furthermore, our results revealed that induction of apoptosis through a mitochondrial pathway led to up-regulation of pro-apoptotic protein expression (Bax, down-regulation of anti-apoptotic protein expression (Bcl-2, mitochondrial release of cytochrome c (Cyto c, reduction of mitochondrial membrane potential (MMP and activation of caspase-3 (Casp-3. Involvement of the caspase apoptosis pathway was confirmed using caspase inhibitor Z-VAD-FMK pretreatment. Together, our findings suggest that isoalantolactone induced caspase-dependent apoptosis via a mitochondrial pathway and was associated with cell cycle arrest in the G1 phase in UM-SCC-10A cells. Therefore, isoalantolactone may become a potential drug for treating HNSCC.

  18. Inhibition of root growth by narciclasine is caused by DNA damage-induced cell cycle arrest in lettuce seedlings.

    Science.gov (United States)

    Hu, Yanfeng; Li, Jiaolong; Yang, Lijing; Nan, Wenbin; Cao, Xiaoping; Bi, Yurong

    2014-09-01

    Narciclasine (NCS) is an Amaryllidaceae alkaloid isolated from Narcissus tazetta bulbs. Its phytotoxic effects on plant growth were examined in lettuce (Lactuca sativa L.) seedlings. Results showed that high concentrations (0.5-5 μM) of NCS restricted the growth of lettuce roots in a dose-dependent manner. In NCS-treated lettuce seedlings, the following changes were detected: reduction of mitotic cells and cell elongation in the mature region, inhibition of proliferation of meristematic cells, and cell cycle. Moreover, comet assay and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay indicated that higher levels NCS (0.5-5 μM) induced DNA damage in root cells of lettuce. The decrease in meristematic cells and increase in DNA damage signals in lettuce roots in responses to NCS are in a dose-dependent manner. NCS-induced reactive oxygen species accumulation may explain an increase in DNA damage in lettuce roots. Thus, the restraint of root growth is due to cell cycle arrest which is caused by NCS-induced DNA damage. In addition, it was also found that NCS (0.5-5 μM) inhibited the root hair development of lettuce seedlings. Further investigations on the underlying mechanism revealed that both auxin and ethylene signaling pathways are involved in the response of root hairs to NCS.

  19. Hispolon inhibits the growth of estrogen receptor positive human breast cancer cells through modulation of estrogen receptor alpha

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Eun Hyang; Jang, Soon Young; Cho, In-Hye [Department of Pharmacy, Graduate School, Kyung Hee University, 26 Kyungheedae-ro, Dongdaemun-gu, Seoul 130-701 (Korea, Republic of); Hong, Darong [Department of Life and Nanopharmaceutical Science, Graduate School, Kyung Hee University, 26 Kyungheedae-ro, Dongdaemun-gu, Seoul 130-701 (Korea, Republic of); Jung, Bom; Park, Min-Ju [Department of Pharmacy, Graduate School, Kyung Hee University, 26 Kyungheedae-ro, Dongdaemun-gu, Seoul 130-701 (Korea, Republic of); Kim, Jong-Ho, E-mail: jonghokim@khu.ac.kr [Department of Pharmacy, Graduate School, Kyung Hee University, 26 Kyungheedae-ro, Dongdaemun-gu, Seoul 130-701 (Korea, Republic of)

    2015-08-07

    Human estrogen receptor α (ERα) is a nuclear transcription factor that is a major therapeutic target in breast cancer. The transcriptional activity of ERα is regulated by certain estrogen-receptor modulators. Hispolon, isolated from Phellinus linteus, a traditional medicinal mushroom called Sanghwang in Korea, has been used to treat various pathologies, such as inflammation, gastroenteric disorders, lymphatic diseases, and cancers. In this latter context, Hispolon has been reported to exhibit therapeutic efficacy against various cancer cells, including melanoma, leukemia, hepatocarcinoma, bladder cancer, and gastric cancer cells. However, ERα regulation by Hispolon has not been reported. In this study, we investigated the effects of Hispolon on the growth of breast cancer cells. We found that Hispolon decreased expression of ERα at both mRNA and the protein levels in MCF7 and T47D human breast cancer cells. Luciferase reporter assays showed that Hispolon decreased the transcriptional activity of ERα. Hispolon treatment also inhibited expression of the ERα target gene pS2. We propose that Hispolon, an anticancer drug extracted from natural sources, inhibits cell growth through modulation of ERα in estrogen-positive breast cancer cells and is a candidate for use in human breast cancer chemotherapy. - Highlights: • Hispolon decreased ERα expression at both mRNA and protein levels. • Hispolon decreased ERα transcriptional activity. • Hispolon treatment inhibited expression of ERα target gene pS2. • Shikonin is a candidate chemotherapeutic target in the treatment of human breast cancer.

  20. Growth inhibition and chemosensitization of exogenous nitric oxide released from NONOates in glioma cells in vitro.

    Science.gov (United States)

    Weyerbrock, Astrid; Baumer, Brunhilde; Papazoglou, Anna

    2009-01-01

    Exogenous nitric oxide (NO) from NO donors has cytotoxic, chemosensitizing, and radiosensitizing effects, and increases vascular permeability and blood flow in tumors. Yet little is known about whether these cytotoxic and chemosensitizing effects can be observed in glioma cells at doses that alter tumor physiological characteristics in vivo and whether these effects are tumor selective. The effect of NO released from proline NONOate, diethylamine NONOate, spermine NONOate, and sodium nitrite on cell proliferation, apoptosis, and chemosensitivity to carboplatin of cultured glioma cells was studied in C6, U87 glioma cells, human glioblastoma cells, and human astrocytes and fibroblasts. Although proline NONOate failed to induce cell death, the other NO donors induced growth arrest when present in high concentrations (10(-2) M) in all cell lines. Chemosensitization was observed after concomitant incubation with spermine NONOate and carboplatin in C6 and human glioblastoma cells. There is strong evidence that cell death occurs primarily by necrosis and to a lesser degree by apoptosis. The NO doses, which altered tumor physiology in vivo, were not cytotoxic, indicating that NO alters vascular permeability and cell viability in vivo by different mechanisms. The authors found that NO-generating agents at high concentrations are potent growth inhibitors and might also be useful as chemosensitizers in glioma cells. These data corroborate the theory that the use of NOgenerating agents may play a role in the multimodal treatment of malignant gliomas but that the NO release must be targeted more specifically to tumor cells to improve selectivity and efficacy.

  1. Tanshinones inhibit the growth of breast cancer cells through epigenetic modification of Aurora A expression and function.

    Directory of Open Access Journals (Sweden)

    Yi Gong

    Full Text Available The objectives of this study were to evaluate the effects of tanshinones from a Chinese herb Salvia Miltiorrhiza on the growth of breast cancer cells, and to elucidate cellular and molecular mechanisms of action. Tanshinones showed the dose-dependent effect on the growth inhibition of breast cancer cells in vitro, with tanshinone I (T1 the most potent agent. T1 was also the only tanshinone to have potent activity in inhibiting the growth of the triple-negative breast cancer cell line MDA-MB231. T1 caused cell cycle arrests of both estrogen-dependent and estrogen-independent cell lines associated with alterations of cyclinD, CDK4 and cyclinB, and induced breast cancer cell apoptosis associated with upregulation of c-PARP and downregulation of survivin and Aurora A. Among these associated biomarkers, Aurora A showed the most consistent pattern with the anti-growth activity of tanshinones. Overexpression of Aurora A was also verified in breast tumors. The gene function assay showed that knockdown of Aurora A by siRNA dramatically reduced the growth-inhibition and apoptosis-induction activities of T1, suggesting Aurora A as an important functional target of T1 action. On the other hand, tanshinones had much less adverse effects on normal mammary epithelial cells. Epigenetic mechanism studies showed that overexpression of Aurora A gene in breast cancer cells was not regulated by gene promoter DNA methylation, but by histone acetylation. T1 treatment significantly reduced acetylation levels of histone H3 associated with Aurora A gene. Our results supported the potent activity of T1 in inhibiting the growth of breast cancer cells in vitro in part by downregulation of Aurora A gene function. Our previous studies also demonstrated that T1 had potent anti-angiogenesis activity and minimal side effects in vivo. Altogether, this study warrants further investigation to develop T1 as an effective and safe agent for the therapy and prevention of breast cancer.

  2. Derricin and derricidin inhibit Wnt/β-catenin signaling and suppress colon cancer cell growth in vitro.

    Directory of Open Access Journals (Sweden)

    Barbara F Fonseca

    Full Text Available Overactivation of the Wnt/β-catenin pathway in adult tissues has been implicated in many diseases, such as colorectal cancer. Finding chemical substances that can prevent this phenomenon is an emerging problem. Recently, several natural compounds have been described as Wnt/β-catenin inhibitors and might be promising agents for the control of carcinogenesis. Here, we describe two natural substances, derricin and derricidin, belonging to the chalcone subclass, that show potent transcriptional inhibition of the Wnt/β-catenin pathway. Both chalcones are able to affect the cell distribution of β-catenin, and inhibit Wnt-specific reporter activity in HCT116 cells and in Xenopus embryos. Derricin and derricidin also strongly inhibited canonical Wnt activity in vitro, and rescued the Wnt-induced double axis phenotype in Xenopus embryos. As a consequence of Wnt/β-catenin inhibition, derricin and derricidin treatments reduce cell viability and lead to cell cycle arrest in colorectal cancer cell lines. Taken together, our results strongly support these chalcones as novel negative modulators of the Wnt/β-catenin pathway and colon cancer cell growth in vitro.

  3. Derricin and Derricidin Inhibit Wnt/β-Catenin Signaling and Suppress Colon Cancer Cell Growth In Vitro

    Science.gov (United States)

    Fonseca, Barbara F.; Predes, Danilo; Cerqueira, Debora M.; Reis, Alice H.; Amado, Nathalia G.; Cayres, Marina C. L.; Kuster, Ricardo M.; Oliveira, Felipe L.; Mendes, Fabio A.; Abreu, Jose G.

    2015-01-01

    Overactivation of the Wnt/β-catenin pathway in adult tissues has been implicated in many diseases, such as colorectal cancer. Finding chemical substances that can prevent this phenomenon is an emerging problem. Recently, several natural compounds have been described as Wnt/β-catenin inhibitors and might be promising agents for the control of carcinogenesis. Here, we describe two natural substances, derricin and derricidin, belonging to the chalcone subclass, that show potent transcriptional inhibition of the Wnt/β-catenin pathway. Both chalcones are able to affect the cell distribution of β-catenin, and inhibit Wnt-specific reporter activity in HCT116 cells and in Xenopus embryos. Derricin and derricidin also strongly inhibited canonical Wnt activity in vitro, and rescued the Wnt-induced double axis phenotype in Xenopus embryos. As a consequence of Wnt/β-catenin inhibition, derricin and derricidin treatments reduce cell viability and lead to cell cycle arrest in colorectal cancer cell lines. Taken together, our results strongly support these chalcones as novel negative modulators of the Wnt/β-catenin pathway and colon cancer cell growth in vitro. PMID:25775405

  4. Sevoflurane suppresses hypoxia-induced growth and metastasis of lung cancer cells via inhibiting hypoxia-inducible factor-1α.

    Science.gov (United States)

    Liang, Hua; Yang, Cheng Xiang; Zhang, Bin; Wang, Han Bing; Liu, Hong Zhen; Lai, Xiao Hong; Liao, Mei Juan; Zhang, Tao

    2015-12-01

    Hypoxia promotes the progression of lung cancer cells. Unfortunately, anesthetic technique might aggravate hypoxia of lung cancer cells. Sevoflurane is a commonly used anesthetic. Its effect on hypoxia-induced aggressiveness of lung cancer cells remains unknown. The aim of the study is to investigate the effects of sevoflurane on hypoxia-induced growth and metastasis of lung cancer cells. As hypoxia-inducible factor-1α (HIF-1α) plays a pivotal role in mediating the adaptation and tolerance of cancer cells under hypoxic microenvironment, the role of HIF-1α in the effect of sevoflurane on hypoxia-induced growth and metastasis has also been elucidated. A549 cells were treated with normoxia, hypoxia, co-treatment of sevoflurane and hypoxia, and dimethyloxaloylglycine (DMOG, a HIF-1α agonist) for 4 h, respectively. MTT assay and colony formation assay were used to evaluate cell growth. Transwell assay was performed to detect invasion and migration ability. The protein level of HIF-1α, X-linked inhibitor of apoptosis protein (XIAP), survivin, fascin, heparanase (HPA), and p38 MAPK were determined by Western blotting. Hypoxia enhanced proliferation and metastatic potential of cells. Sevoflurane could suppress hypoxia-induced growth and metastasis ability of cells. Furthermore, HIF-1α, XIAP, survivin, fascin and HPA were down-regulated significantly by the co-treatment of sevoflurane and hypoxia as compared to hypoxia treatment. DMOG abolished the inhibiting effects of sevoflurane on hypoxia-induced growth and metastasis ability of cells. In addition, sevoflurane partly reversed the increase of p38 MAPK activity that was induced by hypoxia. Sevoflurane could suppress hypoxia-induced growth and metastasis of lung cancer cells, which might be associated with modulating HIF-1α and its down-stream genes. Moreover, p38 MAPK signaling pathway was involved in the regulation of HIF-1α by sevoflurane.

  5. Inhibition of Curcumin on ZAKα Activity Resultant in Apoptosis and Anchorage-Independent Growth in Cancer Cells.

    Science.gov (United States)

    Lee, Jin-Sun; Wang, Tsu-Shing; Lin, Ming Cheng; Lin, Wei-Wen; Yang, Jaw-Ji

    2017-10-31

    Curcumin, a popular yellow pigment of the dietary spice turmeric, has been reported to inhibit cell growth and to induce apoptosis in a wide variety of cancer cells. Although numerous studies have investigated anticancer effects of curcumin, the precise molecular mechanism of action remains unidentified. Whereas curcumin mediates cell survival and apoptosis through mitogen-activated protein kinase (MAPK) and nuclear factor-kappa B (NF-κB) signaling cascades, its impact on the upstream regulation of MAPK is unclear. The leucine-zipper and sterile-α motif kinase alpha (ZAKα), a mitogen-activated protein kinase kinase kinase (MAP3K), activates the c-Jun N-terminal kinase (JNK) and NF-κB pathway. This paper investigated the prospective involvement of ZAKα in curcumin-induced effects on cancer cells. Our results suggest that the antitumor activity of curcumin is mediated via a mechanism involving inhibition of ZAKα activity.

  6. PTEN and rapamycin inhibiting the growth of K562 cells through regulating mTOR signaling pathway

    Directory of Open Access Journals (Sweden)

    Chen Hao

    2008-12-01

    Full Text Available Abstract Objective To investigate, in vitro, the regulatory effects of tumor-suppressing gene PTEN on mTOR (mammalian target of rapamycin signaling pathway, the effects of transfected PTEN and rapamycin on the growth inhibition, and apoptosis induction for human leukemia cell line K562 cells. Methods K562 cells were transfected with recombined adenovirus-PTEN vector containing green fluorescent protein (Ad-PTEN-GFP, followed by the treatment of the cells with or without rapamycin. The proliferation inhibition rate and apoptotic rate of these transfected and/or rapamycin treated K562 cells were measured by MTT assay and flow cytometry (FCM, the expression levels of PTEN-, mTOR-, cyclinD1- and P27kip1- mRNA were measured by real-time fluorescent relative-quantification reverse transcriptional PCR (FQ-PCR, the protein expression levels of PTEN, Akt, p-Akt were detected by western blotting. Results The proliferation of K562 cells was inhibited by PTEN gene transfection with/without the treatment of rapamycin. The expression levels of PTEN- and P27kip1- mRNA were up-regulated, and the mTOR- and cyclinD1- mRNA were down-regulated in K562 cells after the cells transfected with wild type PTEN gene and treated with rapamycin. Conclusion PTEN and rapamycin inhibited mTOR expression by acting as an upstream regulator of mTOR. Low dose rapamycin in combination with over-expressed PTEN might have synergistic effects on inhibiting the proliferation and promoting apoptosis of K562 cells.

  7. Althaea rosea Cavanil and Plantago major L. suppress neoplastic cell transformation through the inhibition of epidermal growth factor receptor kinase.

    Science.gov (United States)

    Choi, Eun-Sun; Cho, Sung-Dae; Shin, Ji-Ae; Kwon, Ki Han; Cho, Nam-Pyo; Shim, Jung-Hyun

    2012-10-01

    For thousands of years in Asia, Althaea rosea Cavanil (ARC) and Plantago major L. (PML) have been used as powerful non-toxic therapeutic agents that inhibit inflammation. However, the anticancer mechanisms and molecular targets of ARC and PML are poorly understood, particularly in epidermal growth factor (EGF)-induced neoplastic cell transformation. The aim of this study was to evaluate the chemopreventive effects and mechanisms of the methanol extracts from ARC (MARC) and PML (MPML) in EGF-induced neoplastic cell transformation of JB6 P+ mouse epidermal cells using an MTS assay, anchorage-independent cell transformation assay and western blotting. Our results showed that MARC and MPML significantly suppressed neoplastic cell transformation by inhibiting the kinase activity of the EGF receptor (EGFR). The activation of EGFR by EGF was suppressed by MARC and MPML treatment in EGFR(+/+) cells, but not in EGFR(-/-) cells. In addition, MARC and MPML inhibited EGF-induced cell proliferation in EGFR-expressing murine embryonic fibroblasts (EGFR(+/+)). These results strongly indicate that EGFR targeting by MARC and MPML may be a good strategy for chemopreventive or chemotherapeutic applications.

  8. Effects of vinegar–egg on growth inhibition, differentiation human leukemic U937 cells and its immunomodulatory activity

    Directory of Open Access Journals (Sweden)

    Shiu-Yu Wang

    2018-04-01

    Full Text Available Vinegar and eggs have rich nutrients. In this study, the mixed form of both derived products, vinegar–egg solution and its products (vinegar–egg concentrate and vinegar–egg condensate were chosen for an assessment of their biological activity. To further our understanding regarding the anticancer and immunomodulatory effects of vinegar–egg, we investigated its effects on the proliferation and differentiation of U937 cells. Vinegar–egg was treated using spray drying, freeze drying and vacuum concentration and used to stimulate human mononuclear cells. The conditioned media obtained from these cultures by filtration were used to treat U937 cells. Three conditioned media inhibited U937 cell growth by 22.1–67.25% more effectively than PHA-treated control (22.53%. CD11b and CD14 expression on the treated U937 cells were 29.1–45.4% and 31.6–47.2%, respectively. High levels of cytokines IL-1β, IFN-γ and TNF-α were detected in the three conditioned media. Vinegar–egg stimulates human mononuclear cells to secrete cytokines, which inhibit the growth of U937 cells and induce their differentiation. Keywords: Cytokines, Differentiation, Immunomodulatory activity, Leukemic U937 cells, Vinegar–egg

  9. A CD13-targeting peptide integrated protein inhibits human liver cancer growth by killing cancer stem cells and suppressing angiogenesis.

    Science.gov (United States)

    Zheng, Yan-Bo; Gong, Jian-Hua; Liu, Xiu-Jun; Li, Yi; Zhen, Yong-Su

    2017-05-01

    CD13 is a marker of angiogenic endothelial cells, and recently it is proved to be a biomarker of human liver cancer stem cells (CSCs). Herein, the therapeutic effects of NGR-LDP-AE, a fusion protein composed of CD13-targeting peptide NGR and antitumor antibiotic lidamycin, on human liver cancer and its mechanism were studied. Western blot and immunofluorescence assay demonstrated that CD13 (WM15 epitope) was expressed in both human liver cancer cell lines and vascular endothelial cells, while absent in normal liver cells. MTT assay showed that NGR-LDP-AE displayed potent cytotoxicity to cultured tumor cell lines with IC 50 values at low nanomolar level. NGR-LDP-AE inhibited tumorsphere formation of liver cancer cells, and the IC 50 values were much lower than that in MTT assay, indicating selectively killing of CSCs. In endothelial tube formation assay, NGR-LDP-AE at low cytotoxic dose significantly inhibited the formation of intact tube networks. Animal experiment demonstrated that NGR-LDP-AE inhibited the growth of human liver cancer xenograft. Immunohistochemical analysis showed that NGR-LDP-AE induced the down-regulation of CD13. In vitro experiment using cultured tumor cells also confirmed this result. NGR-LDP-AE activated both apoptotic and autophagic pathways in cultured tumor cells, while the induced autophagy protected cells from death. Conclusively, NGR-LDP-AE exerts its antitumor activity via killing liver CSCs and inhibiting angiogenesis. With one targeting motif, NGR-LDP-AE acts on both liver CSCs and angiogenic endothelial cells. It is a promising dual targeting fusion protein for liver cancer therapy, especially for advanced or relapsed cancers. © 2017 Wiley Periodicals, Inc.

  10. Synergistic Effects of Natural Medicinal Plant Extracts on Growth Inhibition of Carcinoma (KB) Cells under Oxidative Stress

    International Nuclear Information System (INIS)

    Kim, Jeong Hee; Ju, Eun Mi; Kim, Jin Kyu

    2000-01-01

    Medicinal plants with synergistic effects on growth inhibition of cancer cells under oxidative stress were screened in this study. Methanol extracts from 51 natural medicinal plants, which were reported to have anticancer effect on hepatoma, stomach cancer or colon cancers which are frequently found in Korean, were prepared and screened for their synergistic activity on growth inhibition of cancer cells under chemically-induced oxidative stress by using MTT assay. Twenty seven samples showed synergistic activity on the growth inhibition in various extent under chemically-induced oxidative stress. Among those samples, eleven samples, such as Melia azedarach, Agastache rugosa, Catalpa ovata, Prunus persica, Sinomenium acutum, Pulsatilla koreana, Oldenlandia diffiusa, Anthriscus sylvestris, Schizandra chinensis, Gleditsia sinensis, Cridium officinale, showed decrease in IC 50 values more than 50%, other 16 samples showed decrease in IC 50 values between 50-25%, compared with the value acquired when medicinal plant sample was used alone. Among those 11 samples, extract of Catalpa ovata showed the highest activity. IC 50 values were decrease to 61% and 28% when carcinoma cells were treated with Catalpa ovata extract in combination of 75 and 100 μM of hydrogen peroxide, respectively

  11. The broad-spectrum metalloproteinase inhibitor BB-94 inhibits growth, HER3 and Erk activation in fulvestrant-resistant breast cancer cell lines

    DEFF Research Database (Denmark)

    Kirkegaard, Tove; Yde, Christina Westmose; Kveiborg, Marie

    2014-01-01

    and consequently increased cell growth. In this study, we investigated the importance of HER receptors, in particular HER3, and HER ligand shedding for growth and signaling in human MCF-7 breast cancer cells and MCF-7-derived sublines resistant to the antiestrogen fulvestrant. The HER3/HER4 ligand heregulin 1β...... induced phosphorylation of HER3, Akt and Erk, and partly rescued fulvestrant-inhibited growth of MCF-7 cells. HER3 ligands were found to be produced and shed from the fulvestrant-resistant cells as conditioned medium from fulvestrant-resistant MCF-7 cells induced phosphorylation of HER3 and Akt in MCF-7......-resistant cells, was able to inhibit growth and activation of HER3 and Erk in resistant cells. Compared to MCF-7, fulvestrant-resistant cells have increased HER3 phosphorylation, but knockdown of HER3 had no inhibitory effect on resistant cell growth. The EGFR inhibitor gefitinib exhibited only a minor growth...

  12. beta-TrCP inhibition reduces prostate cancer cell growth via upregulation of the aryl hydrocarbon receptor.

    Directory of Open Access Journals (Sweden)

    Udi Gluschnaider

    2010-02-01

    Full Text Available Prostate cancer is a common and heterogeneous disease, where androgen receptor (AR signaling plays a pivotal role in development and progression. The initial treatment for advanced prostate cancer is suppression of androgen signaling. Later on, essentially all patients develop an androgen independent stage which does not respond to anti hormonal treatment. Thus, alternative strategies targeting novel molecular mechanisms are required. beta-TrCP is an E3 ligase that targets various substrates essential for many aspects of tumorigenesis.Here we show that beta-TrCP depletion suppresses prostate cancer and identify a relevant growth control mechanism. shRNA targeted against beta-TrCP reduced prostate cancer cell growth and cooperated with androgen ablation in vitro and in vivo. We found that beta-TrCP inhibition leads to upregulation of the aryl hydrocarbon receptor (AhR mediating the therapeutic effect. This phenomenon could be ligand independent, as the AhR ligand 2,3,7,8-Tetrachlorodibenzo-p-Dioxin (TCDD did not alter prostate cancer cell growth. We detected high AhR expression and activation in basal cells and atrophic epithelial cells of human cancer bearing prostates. AhR expression and activation is also significantly higher in tumor cells compared to benign glandular epithelium.Together these observations suggest that AhR activation may be a cancer counteracting mechanism in the prostate. We maintain that combining beta-TrCP inhibition with androgen ablation could benefit advanced prostate cancer patients.

  13. NO-donating aspirin inhibits the growth of leukemic Jurkat cells and modulates β-catenin expression

    International Nuclear Information System (INIS)

    Nath, Niharika; Labaze, Georges; Rigas, Basil; Kashfi, Khosrow

    2004-01-01

    β-Catenin has been implicated in leukemic cell proliferation. We compared the effects of aspirin (ASA) and the ortho, meta, and para positional isomers of NO-donating aspirin (NO-ASA) on cell growth and β-catenin expression in human Jurkat T leukemic cells. Cell growth inhibition was strong: IC 50 for p-, o-, and m- were 20 ± 1.6 (mean ± SEM), 15 ± 1.5, and 200 ± 12 μM, respectively, in contrast to that of ASA (3200 ± 375 μM). The para isomer of NO-ASA degraded β-catenin in a dose- and time-dependent manner coinciding with increasing expression of activated caspase-3. The caspase inhibitor ZVAD blocked β-catenin cleavage by p-NO-ASA and partially reversed cell growth inhibition by p-NO-ASA but not that by ASA. A denitrated analog of p-NO-ASA did not degrade β-catenin indicating the importance of the NO-donating moiety. Our findings suggest that NO-ASA merits further study as an agent against leukemia

  14. Oxamate, but Not Selective Targeting of LDH-A, Inhibits Medulloblastoma Cell Glycolysis, Growth and Motility

    Directory of Open Access Journals (Sweden)

    Cara J. Valvona

    2018-03-01

    Full Text Available Medulloblastoma is the most common malignant paediatric brain tumour and current therapies often leave patients with severe neurological disabilities. Four major molecular groups of medulloblastoma have been identified (Wnt, Shh, Group 3 and Group 4, which include additional, recently defined subgroups with different prognosis and genetic characteristics. Lactate dehydrogenase A (LDHA is a key enzyme in the aerobic glycolysis pathway, an abnormal metabolic pathway commonly observed in cancers, associated with tumour progression and metastasis. Studies indicate MBs have a glycolytic phenotype; however, LDHA has not yet been explored as a therapeutic target for medulloblastoma. LDHA expression was examined in medulloblastoma subgroups and cell lines. The effects of LDHA inhibition by oxamate or LDHA siRNA on medulloblastoma cell line metabolism, migration and proliferation were examined. LDHA was significantly overexpressed in Group 3 and Wnt MBs compared to non-neoplastic cerebellum. Furthermore, we found that oxamate significantly attenuated glycolysis, proliferation and motility in medulloblastoma cell lines, but LDHA siRNA did not. We established that aerobic glycolysis is a potential therapeutic target for medulloblastoma, but broader LDH inhibition (LDHA, B, and C may be more appropriate than LDHA inhibition alone.

  15. K562 human erythroleukemia cell variants resistant to growth inhibition by butyrate have deficient histone acetylation.

    OpenAIRE

    Ohlsson-Wilhelm, B M; Farley, B A; Kosciolek, B; La Bella, S; Rowley, P T

    1984-01-01

    K562 is an established human erythroleukemia cell line, inducible for hemoglobin synthesis by a variety of compounds including n-butyrate. To elucidate the role of butyrate-induced histone acetylation in the regulation of gene expression in K562 cells, we isolated 20 variants resistant to the growth inhibitory effect of butyrate. Four variants having different degrees of resistance were selected for detailed study. All four were found to be resistant to the hemoglobin-inducing effect of butyr...

  16. The growth inhibition of human breast cancer cells by a novel synthetic progestin involves the induction of transforming growth factor beta.

    Science.gov (United States)

    Colletta, A A; Wakefield, L M; Howell, F V; Danielpour, D; Baum, M; Sporn, M B

    1991-01-01

    Recent experimental work has identified a novel intracellular binding site for the synthetic progestin, Gestodene, that appears to be uniquely expressed in human breast cancer cells. Gestodene is shown here to inhibit the growth of human breast cancer cells in a dose-dependent fashion, but has no effect on endocrine-responsive human endometrial cancer cells. Gestodene induced a 90-fold increase in the secretion of transforming growth factor-beta (TGF-beta) by T47D human breast cancer cells. Other synthetic progestins had no effect, indicating that this induction is mediated by the novel Gestodene binding site and not by the conventional progesterone receptor. Furthermore, in four breast cancer cell lines, the extent of induction of TGF-beta correlated with intracellular levels of Gestodene binding site. No induction of TGF-beta was observed with the endometrial cancer line, HECl-B, which lacks the Gestodene binding site, but which expresses high levels of progesterone receptor. The inhibition of growth of T47D cells by Gestodene is partly reversible by a polyclonal antiserum to TGF-beta. These data indicate that the growth-inhibitory action of Gestodene may be mediated in part by an autocrine induction of TGF-beta. Images PMID:1985102

  17. A peptide antagonist of the ErbB1 receptor inhibits receptor activation, tumor cell growth and migration in vitro and xenograft tumor growth in vivo

    DEFF Research Database (Denmark)

    Xu, Ruodan; Povlsen, Gro Klitgaard; Soroka, Vladislav

    2010-01-01

    The epidermal growth factor family of receptor tyrosine kinases (ErbBs) plays essential roles in tumorigenesis and cancer disease progression, and therefore has become an attractive target for structure-based drug design. ErbB receptors are activated by ligand-induced homo- and heterodimerization......B1 phosphorylation, cell growth, and migration in two human tumor cell lines, A549 and HN5, expressing moderate and high ErbB1 levels, respectively. Furthermore, we show that Inherbin3 inhibits tumor growth in vivo and induces apoptosis in a tumor xenograft model employing the human non-small cell...... lung cancer cell line A549. The Inherbin3 peptide may be a useful tool for investigating the mechanisms of ErbB receptor homo- and heterodimerization. Moreover, the here described biological effects of Inherbin3 suggest that peptide-based targeting of ErbB receptor dimerization is a promising anti...

  18. Cystatin A suppresses tumor cell growth through inhibiting epithelial to mesenchymal transition in human lung cancer.

    Science.gov (United States)

    Ma, Yunxia; Chen, Yuan; Li, Yong; Grün, Katja; Berndt, Alexander; Zhou, Zhongwei; Petersen, Iver

    2018-03-06

    Cystatin A ( CSTA ), belonging to type 1 cystatin super-family, is expressed primarily in epithelial and lymphoid tissues for protecting cells from proteolysis of cytoplasmic and cytoskeletal proteins by cathepsins B, H and L. CSTA acts as a tumor suppressor in esophageal cancer, however, its role in lung cancer has not yet been elucidated. Here we found that CSTA was down-regulated in all lung cancer cell lines compared to normal lung epithelial cells. CSTA was restored in most lung cancer cell lines after treatment with demethylation agent 5-aza-2-deoxycytidine and deacetylation agent Trichostatin. Bisulfite sequencing revealed that CSTA was partially methylated in the promoter and exon 1. In primary lung tumors, squamous cell carcinoma (SCC) significantly expressed more CSTA compared to adenocarcinoma (pgrade (ptransition (MET) and prevented the TGF-β1-induced epithelial to mesenchymal transition (EMT) through inhibiting the ERK/MAPK pathway. In conclusion, our date indicate 1) epigenetic regulation is associated with CSTA gene silencing; 2) CSTA exerts tumor suppressive function through inhibiting MAPK and AKT pathways; 3) Overexpression of CSTA leads to MET and prevents TGF-β1-induced EMT by modulating the MAPK pathway; 4) CSTA may be a potential biomarker for lung SCC and tumor differentiation.

  19. Demethoxycurcumin inhibited human epithelia ovarian cancer cells' growth via up-regulating miR-551a.

    Science.gov (United States)

    Du, Zhenhua; Sha, Xianqun

    2017-03-01

    Curcumin is a natural agent that has ability to dampen tumor cells' growth. However, the natural form of curcumin is prone to degrade and unstable in vitro. Here, we demonstrated that demethoxycurcumin (a curcumin-related demethoxy compound) could inhibit cell proliferation and induce apoptosis of ovarian cancer cells. Moreover, IRS2/PI3K/Akt axis was inactivated in cells treated with demethoxycurcumin. Quantitative real-time reverse transcription polymerase chain reaction demonstrated that miR-551a was down-regulated in ovarian cancer tissues and ovarian cancer cell lines. Over-expression of miR-551a inhibited cell proliferation and induced apoptosis of ovarian cancer cells, whereas down-regulation of miR-551a exerted the opposite function. Luciferase assays confirmed that there was a binding site of miR-551a in IRS2, and we found that miR-551a exerted tumor-suppressive function by targeting IRS2 in ovarian cancer cells. Remarkably, miR-551a was up-regulated in the cells treated with demethoxycurcumin, and demethoxycurcumin suppressed IRS2 by restoration of miR-551a. In conclusion, demethoxycurcumin hindered ovarian cancer cells' malignant progress via up-regulating miR-551a.

  20. Suppression of Homologous Recombination by insulin-like growth factor-1 inhibition sensitizes cancer cells to PARP inhibitors

    International Nuclear Information System (INIS)

    Amin, Oreekha; Beauchamp, Marie-Claude; Nader, Paul Abou; Laskov, Ido; Iqbal, Sanaa; Philip, Charles-André; Yasmeen, Amber; Gotlieb, Walter H.

    2015-01-01

    Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of IGF-1R results in growth inhibition and apoptosis of ovarian tumor cells. In the current study, we aimed to investigate the correlation between HR and sensitivity to IGF-1R inhibition. Further, we hypothesized that IGF-1R inhibition might sensitize HR proficient cancers to Poly ADP ribose polymerase (PARP) inhibitors. Using ovarian and breast cancer cellular models with known BRCA1 status, we evaluated their HR functionality by RAD51 foci formation assay. The 50 % lethal concentration (LC50) of Insulin-like growth factor type 1 receptor kinase inhibitor (IGF-1Rki) in these cells was assessed, and western immunoblotting was performed to determine the expression of proteins involved in the IGF-1R pathway. Moreover, IGF-1R inhibitors were added on HR proficient cell lines to assess mRNA and protein expression of RAD51 by qPCR and western blot. Also, we explored the interaction between RAD51 and Insulin receptor substance 1 (IRS-1) by immunoprecipitation. Next, combination effect of IGF-1R and PARP inhibitors was evaluated by clonogenic assay. Cells with mutated/methylated BRCA1 showed an impaired HR function, and had an overactivation of the IGF-1R pathway. These cells were more sensitive to IGF-1R inhibition compared to HR proficient cells. In addition, the IGF-IR inhibitor reduced RAD51 expression at mRNA and protein levels in HR proficient cells, and sensitized these cells to PARP inhibitor. Targeting IGF-1R might lead to improved personalized therapeutic approaches in cancer patients with HR deficiency. Targeting both PARP and IGF-1R might increase the clinical efficacy in HR deficient patients and increase the population of patients who may benefit from PARP inhibitors

  1. Differential growth inhibition of cancer cell lines and antioxidant activity of extracts of red, brown, and green marine algae.

    Science.gov (United States)

    Murugan, Kavitha; Iyer, Vidhya V

    2013-05-01

    As the use of various anticancer drugs is associated with many undesirable side effects, there is an urgent need for the discovery of new, better, and specific anticancer compounds. Antioxidant and antiproliferative activities as well as effects on cell morphology were investigated for methanol (M), chloroform (C), ethyl acetate (E), and aqueous (A) extracts of Caulerpa peltata, Gelidiella acerosa, Padina gymnospora, and Sargassum wightii using 2,2-diphenyl-1-picrylhydrazyl radical-scavenging, ferrous ion chelation, and resazurin-based growth inhibition (in A549, HCT-15, MG-63, and PC-3 cell lines) assays. A general trend was the greater extraction of phenols and flavonoids by chloroform and ethyl acetate, which showed higher activity in many assays. These non-polar C and E extracts showed higher DPPH radical-scavenging and growth inhibitory activities in A549, HCT-15, and PC-3 cells. However, higher ferrous ion chelation (A extracts) and growth inhibition in MG-63 cells (M and A extracts) were seen for the polar extracts. Furthermore, P. gymnospora and C. peltata emerged as promising sources for antiproliferative agents that could be explored for their own activity and as leads for the development of other compounds.

  2. Inhibition of epidermal growth factor receptor by ferulic acid and 4-vinylguaiacol in human breast cancer cells.

    Science.gov (United States)

    Sudhagar, S; Sathya, S; Anuradha, R; Gokulapriya, G; Geetharani, Y; Lakshmi, B S

    2018-02-01

    To examine the potential of ferulic acid and 4-vinylguaiacol for inhibiting epidermal growth factor receptor (EGFR) in human breast cancer cells in vitro. Ferulic acid and 4-vinylguaiacol limit the EGF (epidermal growth factor)-induced breast cancer proliferation and new DNA synthesis. Western blot analysis revealed both ferulic acid and 4-vinylguaiacol exhibit sustained inhibition of EGFR activation through down-regulation of Tyr 1068 autophosphorylation. Molecular docking analysis shows ferulic acid forming hydrogen bond interaction with Lys 745 and Met 793 whereas, 4-vinylguaiacol forms two hydrogen bonds with Phe 856 and exhibits stronger hydrophobic interactions with multiple amino acid residues at the EGFR kinase domain. Ferulic acid and 4-vinylguaiacol could serve as a potential structure for the development of new small molecule therapeutics against EGFR.

  3. Valproic acid inhibits glioblastoma multiforme cell growth via paraoxonase 2 expression.

    Science.gov (United States)

    Tseng, Jen-Ho; Chen, Cheng-Yi; Chen, Pei-Chun; Hsiao, Sheng-Huang; Fan, Chi-Chen; Liang, Yu-Chih; Chen, Chie-Pein

    2017-02-28

    We studied the potential mechanisms of valproic acid (VPA) in the treatment of glioblastoma multiforme (GBM). Using the human U87, GBM8401, and DBTRG-05MG GBM-derived cell lines, VPA at concentrations of 5 to 20 mM induced G2/M cell cycle arrest and increased the production of reactive oxygen species (ROS). Stress-related molecules such as paraoxonase 2 (PON2), cyclin B1, cdc2, and Bcl-xL were downregulated, but p27, p21 and Bim were upregulated by VPA treatment. VPA response element on the PON2 promoter was localized at position -400/-1. PON2 protein expression was increased in GBM cells compared with normal brain tissue and there was a negative correlation between the expression of PON2 and Bim. These findings were confirmed by the public Bredel GBM microarray (Gene Expression Omnibus accession: GSE2223) and the Cancer Genome Atlas GBM microarray datasets. Overexpression of PON2 in GBM cells significantly decreased intracellular ROS levels, and PON2 expression was decreased after VPA stimulation compared with controls. Bim expression was significantly induced by VPA in GBM cells with PON2 silencing. These observations were further shown in the subcutaneous GBM8401 cell xenograft of BALB/c nude mice. Our results suggest that VPA reduces PON2 expression in GBM cells, which in turn increases ROS production and induces Bim production that inhibits cancer progression via the PON2-Bim cascade.

  4. Downregulation of the Adenosine A2b Receptor by RNA Interference Inhibits Hepatocellular Carcinoma Cell Growth

    OpenAIRE

    Xiang, Hong-Jun; Chai, Fu-Lu; Wang, De-Sheng; Dou, Ke-Feng

    2011-01-01

    To investigate the biological effect of adenosine A2b receptor (A2bR) on the human hepatocellular carcinoma cell line HepG2, three A2bR siRNA constructs were transiently transfected into HepG2 cells. The results showed that A2bR siRNA reduced the levels of A2bR mRNA and protein. In order to further detect the function of A2bR, we established a stable hepatocellular carcinoma cell line (HepG2) expressing siRNA targeting the adenosine A2b receptor. Targeted RNAi significantly inhibited tumor ce...

  5. Sulindac Induces Apoptosis and Inhibits Tumor Growth In Vivo in Head and Neck Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Mark A. Scheper

    2007-03-01

    Full Text Available Sulindac has antineoplastic effects on various cancer cell lines; consequently, we assessed sulindac's effects on laryngeal squamous cell carcinoma (SCC cells in vitro and in vivo. In vitro, SCC (HEP-2 cells treated with various cyclooxygenase inhibitors or transfected with constitutively active signal transducer and activator of transcription 3 (Stat3 or survivin vectors were analyzed using Western blot analysis, annexin V assay, and cell proliferation assay. In parallel, nude mice injected subcutaneously with HEP-2 cells were either treated intraperitoneally with sulindac or left untreated, and analyzed for tumor weight, survivin expression, and tyrosine-phosphorylated Stat3 expression. In vitro studies confirmed the selective antiproliferative and proapoptotic effects of sulindac, which also downregulated Stat3 and survivin protein expression. Stat3 or survivin forced expression partially rescued the antiproliferative effects of sulindac. In vivo studies showed significant repression of HEP-2 xenograft growth in sulindactreated mice versus controls, with near-complete resolution at 10 days. Additionally, tumor specimens treated with sulindac showed downregulation of phosphorylated tyrosine-705 Stat3 and survivin expression. Taken together, our data suggest, for the first time, a specific inhibitory effect of sulindac on tumor growth and survivin expression in laryngeal cancer, both in vitro and in vivo, in a Stat3-dependent manner, suggesting a novel therapeutic approach to head and neck cancer.

  6. Enhanced MTT-reducing activity under growth inhibition by resveratrol in CEM-C7H2 lymphocytic leukemia cells.

    Science.gov (United States)

    Bernhard, David; Schwaiger, Wolfgang; Crazzolara, Roman; Tinhofer, Inge; Kofler, Reinhard; Csordas, Adam

    2003-06-10

    Inhibition of proliferation by resveratrol of CEM-C7H2 lymphocytic leukemia cells was paradoxically associated with an enhanced cellular 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT)-reducing activity. This phenomenon was most pronounced at the sub-apoptotic concentration range of 5-20 microM resveratrol. The results of our study show that the MTT-reducing activity can be increased by the polyphenolic antioxidant resveratrol without a corresponding increase in the number of living cells and that this occurs at a concentration range of the antioxidant which is not sufficient to induce apoptosis but suffices to slow down cell growth. This phenomenon appears to be restricted to proliferation inhibitors with antioxidant properties and is cell type-specific. Thus, in determining the effects of flavonoids and polyphenols on proliferation, in certain cell types this might represent a pitfall in the MTT proliferation assay.

  7. Sepia ink oligopeptide induces apoptosis and growth inhibition in human lung cancer cells.

    Science.gov (United States)

    Zhang, Zhi; Sun, Lei; Zhou, Guoren; Xie, Peng; Ye, Jinjun

    2017-04-04

    Sepia ink oligopeptide (SIO), as a tripeptide extracted from Sepia ink, could be used as an inducer of apoptosis in human prostate cancer cells. We designed a cyclo-mimetic peptide of SIO by introducing a disulfide bond to stabilize the native peptide into beta turn structure, and produced a peptide with higher cell permeability and stability. Through labeling an FITC to the N-terminus of the peptide, the cell permeability was examined. Stabilized peptide showed enhanced cellular uptake than linear tripeptide as indicated by flow cytometry and cell fluorescent imaging. The high intracellular delivery of stable SIO could more efficiently inhibit cell proliferation and induce apoptosis. Furthermore, the expression of the anti-apoptotic protein Bcl-2 was down-regulated, whereas pro-apoptotic proteins P53 and caspase-3 were up-regulated by stable SIO. In conclusion, our study is the first to use stable SIO to induce apoptosis in two lung cancer cells A549 and H1299.

  8. Phytochemical Compositions of Immature Wheat Bran, and Its Antioxidant Capacity, Cell Growth Inhibition, and Apoptosis Induction through Tumor Suppressor Gene

    Directory of Open Access Journals (Sweden)

    Mi Jeong Kim

    2016-09-01

    Full Text Available The purpose of this study was to investigate the phytochemical compositions and antioxidant capacity, cell growth inhibition, and apoptosis induction in extracts of immature wheat bran. Immature wheat bran (IWB was obtained from immature wheat harvested 10 days earlier than mature wheat. The phytochemical compositions of bran extract samples were analyzed by ultra-high performance liquid chromatography. The total ferulic acid (3.09 mg/g and p-coumaric acid (75 µg/g in IWB were significantly higher than in mature wheat bran (MWB, ferulic acid: 1.79 mg/g; p-coumaric acid: 55 µg/g. The oxygen radical absorbance capacity (ORAC: 327 µM Trolox equivalents (TE/g and cellular antioxidant activity (CAA: 4.59 µM Quercetin equivalents (QE/g of the IWB were higher than those of the MWB (ORAC: 281 µM TE/g; CAA: 0.63 µM QE/g. When assessing cell proliferation, the IWB extracts resulted in the lowest EC50 values against HT-29 (18.9 mg/mL, Caco-2 (7.74 mg/mL, and HeLa cells (8.17 mg/mL among bran extract samples. Additionally, the IWB extracts increased the gene expression of p53 and PTEN (tumor suppressor genes in HT-29 cells, indicating inhibited cell growth and induced apoptosis through tumor suppressor genes.

  9. Growth differentiation factor-15 suppresses maturation and function of dendritic cells and inhibits tumor-specific immune response.

    Directory of Open Access Journals (Sweden)

    Zhizhong Zhou

    Full Text Available Dendritic cells (DCs play a key role in the initiation stage of an antigen-specific immune response. A variety of tumor-derived factors (TDFs can suppress DC maturation and function, resulting in defects in the tumor-specific immune response. To identify unknown TDFs that may suppress DCs maturation and function, we established a high-throughput screening technology based on a human liver tumor T7 phage cDNA library and screened all of the proteins derived from hepatoma cells that potentially interact with immature DCs. Growth/differentiation factor-15 (GDF-15 was detected and chosen for further study. By incubation of DCs cultures with GDF-15, we demonstrate that GDF-15 can inhibit surface protrusion formation during DC maturation; suppress the membrane expression of CD83, CD86 and HLA-DR on DCs; enhance phagocytosis by DCs; reduce IL-12 and elevate TGF-β1 secretion by DCs; inhibit T cell stimulation and cytotoxic T lymphocyte (CTL activation by DCs. By building tumor-bearing mouse models, we demonstrate that GDF-15 can inhibit the ability of DCs to stimulate a tumor-specific immune response in vivo. These results indicate that GDF-15 may be one of the critical molecules that inhibit DC maturation and function and are involved in tumor immune escape. Thus, GDF-15 may be a novel target in tumor immunotherapy.

  10. Growth inhibition of human breast cancer cells and down-regulation of ODC1 and ADA genes by Nepeta binaloudensis

    Directory of Open Access Journals (Sweden)

    Akbar Safipour Afshar

    Full Text Available ABSTRACT Nepeta binaloudensis Jamzad, Lamiaceae, is a rare medicinal plant endemic to Iran. In spite of many studies about the chemical constituents and antibacterial effects of this species, no report has been provided about its cytotoxic and anticancer activities. In this study we have evaluated the effects of EtOH 70%, hexane and aqueous extracts of N. binaloudensis on the cell proliferation and n-hexane extract on the expression of adenosine deaminase and ornithine decarboxylase 1 genes in breast cancer cell lines (MCF-7, MDA-MB-231 compared to non-cancer line (MCF-10A. The cell lines were subjected to increasing doses of the extracts ranging from 10 to 320 µg/ml. Cell viability was quantified by MTS assay. Expression of adenosine deaminase and ornithine decarboxylase 1 genes was analyzed by real time PCR. N. binaloudensis inhibited the growth of malignant cells in a time and dose-dependent manner. Among extracts of N. binaloudensis, the hexane extract was found to be more toxic compared to other extracts. Results showed a marked decrease in the expression of ornithine decarboxylase 1 and adenosine deaminase genes in cancer cell lines. At 60 µg/ml concentration of N. binaloudensis hexane extract ornithine decarboxylase 1 and adenosine deaminase mRNA expression were reduced 4.9 fold and 3.5 fold in MCF-7 cell line and 3.6 fold and 2.6 fold in MDA-MB-231 cell line compared to control, respectively. The result of our study highlights the potential influences of N. binaloudensis hexane extract on ornithine decarboxylase 1 and adenosine deaminase genes expression in breast cancer cells and its relation to inhibition of cancer cell growth.

  11. Koelreuteria Formosana Extract Induces Growth Inhibition and Cell Death in Human Colon Carcinoma Cells via G2/M Arrest and LC3-II Activation-Dependent Autophagy.

    Science.gov (United States)

    Horng, Chi-Ting; Wu, Yueh-Jung; Chen, Pei-Ni; Chu, Shu-Chen; Tsai, Chun-Miao; Hsieh, Yih-Shou

    2017-01-01

    Autophagy is a self-destructive process that degrades cytoplasmic constituents. In our previous study, Koelreuteria formosana ethanolic extract (KFEE), which is obtained from natural plants endemic to Taiwan, has inhibited cell metastasis in renal carcinoma cells. However, the anticancer effects of KFEE on colon cancer remain unclear. In this study, KFEE exerted a strong cytotoxic effect on DLD-1 and COLO 205 human colorectal cancer cell lines. KFEE effectively inhibited cancer cell proliferation, induced G2/M-phase arrest associated with downregulaton of cyclin E, cyclin B and cdc25C and upregulation of p21, and induced cell death by activating autophagy but did not cause apoptotic cell death. Exposed KFEE cells showed increased levels of acridine orange, autophagic vacuoles, and LC3-II proteins, which are specific autophagic markers. Bcl-2, p-Akt, and p-mTOR levels, which have been implicated in autophagic downregulation, were decreased after KFEE treatment. Autophagy inhibitor 3-methyladenosine and bafilomycin-A1 and genetic silencing of LC3 attenuated KFEE-induced growth inhibition. These findings suggested that KFEE causes cytostatic effect through autophagy. In xenograft studies, oral administration of KFEE had significantly inhibited the tumor growth in nude mice that had received subcutaneous injection of DLD-1 cells. KFEE is a promising candidate in phytochemical-based, mechanistic, and pathway-targeted cancer prevention strategies.

  12. The strawberry gene FaGAST affects plant growth through inhibition of cell elongation.

    Science.gov (United States)

    de la Fuente, José I; Amaya, Iraida; Castillejo, Cristina; Sánchez-Sevilla, José F; Quesada, Miguel A; Botella, Miguel A; Valpuesta, Victoriano

    2006-01-01

    The strawberry (Fragaria x ananassa) FaGAST gene encodes a small protein with 12 cysteine residues conserved in the C-terminal region similar to a group of proteins identified in other species with diverse assigned functions such as cell division, elongation, or elongation arrest. This gene is expressed in the fruit receptacle, with two peaks during ripening at the white and the red-ripe stages, both coincident with an arrest in the growth pattern. Expression is also high in the roots but confined to the cells at the end of the elongation zone. Exogenous application of gibberellin increased the transcript level of the FaGAST gene in strawberry fruits. Ectopic expression of FaGAST in transgenic Fragaria vesca under the control of the CaMV-35S promoter caused both delayed growth of the plant and fruits with reduced size. The same growth defect was observed in Arabidopsis thaliana plants overexpressing FaGAST. In addition, the transgenic plants exhibited late flowering and low sensitivity to exogenous gibberellin. Taken together, the expression pattern, the regulation by gibberellin, and the transgenic phenotypes point to a role for FaGAST in arresting cell elongation during strawberry fruit ripening.

  13. ISG15 Inhibits IFN-α-Resistant Liver Cancer Cell Growth

    Directory of Open Access Journals (Sweden)

    Xin-xing Wan

    2013-01-01

    Full Text Available Hepatocellular carcinoma (HCC is one of the most prevalent tumors worldwide. Interferon-α (IFN-α has been widely used in the treatment of HCC, but patients eventually develop resistance. ISG15 ubiquitin-like modifier (ISG15 is a ubiquitin-like protein transcriptionally regulated by IFN-α which shows antivirus and antitumor activities. However, the exact role of ISG15 is unknown. In the present study, we showed that IFN-α significantly induced ISG15 expression but failed to induce HepG2 cell apoptosis, whereas transient overexpression of ISG15 dramatically increased HepG2 cell apoptosis. ISG15 overexpression increased overall protein ubiquitination, which was not observed in cells with IFN-α-induced ISG15 expression, suggesting that IFN-α treatment not only induced the expression of ISG15 but also inhibited ISG15-mediated ubiquitination. The tumor suppressor p53 and p21 proteins are the key regulators of cell survival and death in response to stress signals such as DNA damage. We showed that p53 or p21 is only up regulated in HepG2 cells ectopically expressing ISG15, but not in the presence of IFN-α-induced ISG15. Our results suggest that ISG15 overexpression could be developed into a powerful gene-therapeutic tool for treating IFN-α-resistant HCC.

  14. Straw blood cell count, growth, inhibition and comparison to apoptotic bodies

    Directory of Open Access Journals (Sweden)

    Tomkins Jeffrey P

    2008-05-01

    Full Text Available Abstract Background Mammalian cells transform into individual tubular straw cells naturally in tissues and in response to desiccation related stress in vitro. The transformation event is characterized by a dramatic cellular deformation process which includes: condensation of certain cellular materials into a much smaller tubular structure, synthesis of a tubular wall and growth of filamentous extensions. This study continues the characterization of straw cells in blood, as well as the mechanisms of tubular transformation in response to stress; with specific emphasis placed on investigating whether tubular transformation shares the same signaling pathway as apoptosis. Results There are approximately 100 billion, unconventional, tubular straw cells in human blood at any given time. The straw blood cell count (SBC is 45 million/ml, which accounts for 6.9% of the bloods dry weight. Straw cells originating from the lungs, liver and lymphocytes have varying nodules, hairiness and dimensions. Lipid profiling reveals severe disruption of the plasma membrane in CACO cells during transformation. The growth rates for the elongation of filaments and enlargement of rabbit straw cells is 0.6~1.1 (μm/hr and 3.8 (μm3/hr, respectively. Studies using apoptosis inhibitors and a tubular transformation inhibitor in CACO2 cells and in mice suggested apoptosis produced apoptotic bodies are mediated differently than tubular transformation produced straw cells. A single dose of 0.01 mg/kg/day of p38 MAPK inhibitor in wild type mice results in a 30% reduction in the SBC. In 9 domestic animals SBC appears to correlate inversely with an animal's average lifespan (R2 = 0.7. Conclusion Straw cells are observed residing in the mammalian blood with large quantities. Production of SBC appears to be constant for a given animal and may involve a stress-inducible protein kinase (P38 MAPK. Tubular transformation is a programmed cell survival process that diverges from apoptosis

  15. Sunitinib inhibits renal cancer cell growth and invasion in vitro through Wnt/β-catenin signaling pathway: an experimental study

    Directory of Open Access Journals (Sweden)

    Yu Yang

    2017-04-01

    Full Text Available Objective: To study the effect of sunitinib on renal cancer cell growth and invasion in vitro as well as Wnt/β-catenin signaling pathway. Methods: Renal cancer cell lines ACHN were cultured and processed with different doses of sunitinib (1 μmol/L, 2 μmol/L, 4 μmol/ L and 8 μmol/L, and sunitinib-free processing condition was used as negative control. 24 h after processing, the mRNA expression levels of apoptosis genes, invasion genes and Wnt/ β-catenin signaling pathways in cells were detected. Results: 24 h after treatment, NPRL2, Bax, caspase-3 and caspase-9 mRNA expression in 1 μmol/L, 2 μmol/L, 4 μmol/L and 8 μmol/ L sunitinib groups were significantly higher than those in negative control group while MMP2, MMP9, Vimentin, N-cadherin, Wnt and β-catenin mRNA expression were significantly lower than those in negative control group; the higher the dose of sunitinib, the higher the NPRL2, Bax, caspase-3 and caspase-9 mRNA expression while the lower the MMP2, MMP9, Vimentin, N-cadherin, Wnt and β-catenin mRNA expression in cells. Conclusion: Sunitinib can inhibit the Wnt/β-catenin signaling pathway in renal cancer cells to increase the expression of apoptosis genes, inhibit the expression of invasion genes and thereby inhibit the cell growth and invasion.

  16. Quercetin abrogates IL-6/STAT3 signaling and inhibits glioblastoma cell line growth and migration

    Energy Technology Data Exchange (ETDEWEB)

    Michaud-Levesque, Jonathan; Bousquet-Gagnon, Nathalie; Beliveau, Richard, E-mail: oncomol@nobel.si.uqam.ca

    2012-05-01

    Evidence has suggested that STAT3 functions as an oncogene in gliomagenesis. As a consequence, changes in the inflammatory microenvironment are thought to promote tumor development. Regardless of its origin, cancer-related inflammation has many tumor-promoting effects, such as the promotion of cell cycle progression, cell proliferation, cell migration and cell survival. Given that IL-6, a major cancer-related inflammatory cytokine, regulates STAT3 activation and is upregulated in glioblastoma, we sought to investigate the inhibitory effects of the chemopreventive flavonoid quercetin on glioblastoma cell proliferation and migration triggered by IL-6, and to determine the underlying mechanisms of action. In this study, we show that quercetin is a potent inhibitor of the IL-6-induced STAT3 signaling pathway in T98G and U87 glioblastoma cells. Exposure to quercetin resulted in the reduction of GP130, JAK1 and STAT3 activation by IL-6, as well as a marked decrease of the proliferative and migratory properties of glioblastoma cells induced by IL-6. Interestingly, quercetin also modulated the expression of two target genes regulated by STAT3, i.e. cyclin D1 and matrix metalloproteinase-2 (MMP-2). Moreover, quercetin reduced the recruitment of STAT3 at the cyclin D1 promoter and inhibited Rb phosphorylation in the presence of IL-6. Overall, these results provide new insight into the role of quercetin as a blocker of the STAT3 activation pathway stimulated by IL-6, with a potential role in the prevention and treatment of glioblastoma.

  17. Structure-function relationships of anthocyanins from various anthocyanin-rich extracts on the inhibition of colon cancer cell growth.

    Science.gov (United States)

    Jing, Pu; Bomser, Joshua A; Schwartz, Steven J; He, Jian; Magnuson, Bernadene A; Giusti, M Mónica

    2008-10-22

    Anthocyanins are potent antioxidants and may be chemoprotective. However, the structure-function relationships are not well understood. The objectives of this study were to compare the chemoprotective properties of anthocyanin-rich extracts (AREs) with variable anthocyanin profiles to understand the relationship between anthocyanin chemical structure and chemoprotective activity, measured as inhibition of colon cancer cell proliferation. Additionally, the chemoprotective interaction of anthocyanins and other phenolics was investigated. AREs with different anthocyanin profiles from purple corn, chokeberry, bilberry, purple carrot, grape, radish, and elderberry were tested for growth inhibition (GI 50) using a human colorectal adenocarcinoma (HT29) cell line. All AREs suppressed HT29 cell growth to various degrees as follows: purple corn (GI 50 approximately 14 microg of cy-3-glu equiv/mL) > chokeberry and bilberry > purple carrot and grape > radish and elderberry (GI 50 > 100 microg of cy-3-glu equiv/mL). Anthocyanins played a major role in AREs' chemoprotection and exerted an additive interaction with the other phenolics present. Statistical analyses suggested that anthocyanin chemical structure affected chemoprotection, with nonacylated monoglycosylated anthocyanins having greater inhibitory effect on HT-29 cell proliferation, whereas anthocyanins with pelargonidin, triglycoside, and/or acylation with cinnamic acid exerted the least effect. These findings should be considered for crop selection and the development of anthocyanin-rich functional foods.

  18. A Vitex agnus-castus extract inhibits cell growth and induces apoptosis in prostate epithelial cell lines.

    Science.gov (United States)

    Weisskopf, M; Schaffner, W; Jundt, G; Sulser, T; Wyler, S; Tullberg-Reinert, H

    2005-10-01

    Extracts of Vitex agnus-castus fruits (VACF) are described to have beneficial effects on disorders related to hyperprolactinemia (cycle disorders, premenstrual syndrome). A VACF extract has recently been shown to exhibit antitumor activities in different human cancer cell lines. In the present study, we explored the antiproliferative effects of a VACF extract with a particular focus on apoptosis-inducing and potential cytotoxic effects. Three different human prostate epithelial cell lines (BPH-1, LNCaP, PC-3) representing different disease stages and androgen responsiveness were chosen. The action of VACF on cell viability was assessed using the WST-8-tetrazolium assay. Cell proliferation in cells receiving VACF alone or in combination with a pan-caspase inhibitor (Z-VAD-fmk) was quantified using a Crystal Violet assay. Flow cytometric cell cycle analysis and measurement of DNA fragmentation using an ELISA method were used for studying the induction of apoptosis. Lactate dehydrogenase (LDH) activity was determined as a marker of cytotoxicity. The extract inhibited proliferation of all three cell lines in a concentration-dependent manner with IC (50) values below 10 microg/mL after treatment for 48 h. Cell cycle analysis and DNA fragmentation assays suggest that part of the cells were undergoing apoptosis. The VACF-induced decrease in cell number was partially inhibited by Z-VAD-fmk, indicating a caspase-dependent apoptotic cell death. However, the concentration-dependent LDH activity of VACF treated cells indicated cytotoxic effects as well. These data suggest that VACF contains components that inhibit proliferation and induce apoptosis in human prostate epithelial cell lines. The extract may be useful for the prevention and/or treatment not only of benign prostatic hyperplasia but also of human prostate cancer.

  19. Resibufogenin inhibits the growth of human osteosarcoma MG-63 cells via mitochondrial pathway

    Directory of Open Access Journals (Sweden)

    Yue Zhang

    2014-08-01

    Full Text Available Resibufogenin, a low molecular weight bufanolide steroid compound, is isolated from the secretion of Asiatic toad Bufogargarizansa Cantor. It possessed both pharmacological and toxicological effects that were experimentally shown by in vitro and in vivo studies. However, the molecular mechanism of cell apoptosis induced by resibufogenin remains elusive. Here, we investigated the apoptosis in resibufogenin-treated human osteosarcoma MG-63 cells. The results showed that resibufogenin could inhibit cell proliferation and induce apoptosis in a dose- and time-dependent manner. Additional investigations proved that a disruption of mitochondrial transmembrane potential and an up-regulation of reactive oxygen species (ROS in resibufogenin-treated cells were occurred. Upon western blot analysis, it was found that the up-regulation of Apaf-1, cleaved PARP, cleaved caspase-3, cleaved caspase-9, and Bax/Bcl-2, varied with different concentration of resibufogenin. Overall findings suggested that resibufogenin could be used as an effective anti-tumor agent in therapy of osteosarcoma.

  20. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Minyong Kang

    2017-02-01

    Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

  1. Methylseleninic acid (MSA) inhibits 17β-estradiol-induced cell growth in breast cancer T47D cells via enhancement of the antioxidative thioredoxin/ thioredoxin reductase system.

    Science.gov (United States)

    Okuno, Tomofumi; Miura, Kiyoshi; Sakazaki, Fumitoshi; Nakamuro, Katsuhiko; Ueno, Hitoshi

    2012-01-01

    The purpose of this study was to clarify the cell growth inhibitory mechanism of human breast cancer cells caused by selenium (Se) compounds. In the presence of 17β-estradiol (E(2)) at physiological concentrations, growth of estrogen receptor α (ERα)-positive T47D cells was markedly inhibited by 1 × 10(-6) mol/L methylseleninic acid (MSA) with no Se related toxicity.Under conditions where cell growth was inhibited, MSA decreased ERα mRNA levels and subsequent protein levels; further decreasing expression of estrogen-responsive finger protein (Efp) which is a target gene product of ERα and promotes G2/M progression of the cell cycle. Therefore, the decline in Efp expression is presumed to be involved in G2 arrest. Coincidentally, the antioxidative thioredoxin/ thioredoxin reductase (Trx/TrxR) system in cells was enhanced by the synergistic action of E(2) and MSA. It has been reported that ROS-induced oxidative stress enhanced ERα expression. E(2) increased production of intracellular ROS in T47D cells. Meanwhile, MSA significantly decreased E(2)-induced ROS accumulation. From these results, activation of the Trx/TrxR system induced by the coexistence of MSA and E(2) suppresses oxidative stress and decreases expression of ERα, and finally induces the growth arrest of T47D cells through disruption of ERα signaling.

  2. PI3K/Akt signaling mediated Hexokinase-2 expression inhibits cell apoptosis and promotes tumor growth in pediatric osteosarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Zhuo, Baobiao; Li, Yuan; Li, Zhengwei; Qin, Haihui; Sun, Qingzeng; Zhang, Fengfei; Shen, Yang; Shi, Yingchun [Department of Surgery, The Children' s Hospital of Xuzhou, Xuzhou, Jiangsu Province 221006 (China); Wang, Rong, E-mail: wangrong2008163@163.com [Department of Ultrasonography, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu Province 221006 (China)

    2015-08-21

    Accumulating evidence has shown that PI3K/Akt pathway is frequently hyperactivated in osteosarcoma (OS) and contributes to tumor initiation and progression. Altered phenotype of glucose metabolism is a key hallmark of cancer cells including OS. However, the relationship between PI3K/Akt pathway and glucose metabolism in OS remains largely unexplored. In this study, we showed that elevated Hexokinase-2 (HK2) expression, which catalyzes the first essential step of glucose metabolism by conversion of glucose into glucose-6-phosphate, was induced by activated PI3K/Akt signaling. Immunohistochemical analysis showed that HK2 was overexpressed in 83.3% (25/30) specimens detected and was closely correlated with Ki67, a cell proliferation index. Silencing of endogenous HK2 resulted in decreased aerobic glycolysis as demonstrated by reduced glucose consumption and lactate production. Inhibition of PI3K/Akt signaling also suppressed aerobic glycolysis and this effect can be reversed by reintroduction of HK2. Furthermore, knockdown of HK2 led to increased cell apoptosis and reduced ability of colony formation; meanwhile, these effects were blocked by 2-Deoxy-D-glucose (2-DG), a glycolysis inhibitor through its actions on hexokinase, indicating that HK2 functions in cell apoptosis and growth were mediated by altered aerobic glycolysis. Taken together, our study reveals a novel relationship between PI3K/Akt signaling and aerobic glycolysis and indicates that PI3K/Akt/HK2 might be potential therapeutic approaches for OS. - Highlights: • PI3K/Akt signaling contributes to elevated expression of HK2 in osteosarcoma. • HK2 inhibits cell apoptosis and promotes tumor growth through enhanced Warburg effect. • Inhibition of glycolysis blocks the oncogenic activity of HK2.

  3. PI3K/Akt signaling mediated Hexokinase-2 expression inhibits cell apoptosis and promotes tumor growth in pediatric osteosarcoma

    International Nuclear Information System (INIS)

    Zhuo, Baobiao; Li, Yuan; Li, Zhengwei; Qin, Haihui; Sun, Qingzeng; Zhang, Fengfei; Shen, Yang; Shi, Yingchun; Wang, Rong

    2015-01-01

    Accumulating evidence has shown that PI3K/Akt pathway is frequently hyperactivated in osteosarcoma (OS) and contributes to tumor initiation and progression. Altered phenotype of glucose metabolism is a key hallmark of cancer cells including OS. However, the relationship between PI3K/Akt pathway and glucose metabolism in OS remains largely unexplored. In this study, we showed that elevated Hexokinase-2 (HK2) expression, which catalyzes the first essential step of glucose metabolism by conversion of glucose into glucose-6-phosphate, was induced by activated PI3K/Akt signaling. Immunohistochemical analysis showed that HK2 was overexpressed in 83.3% (25/30) specimens detected and was closely correlated with Ki67, a cell proliferation index. Silencing of endogenous HK2 resulted in decreased aerobic glycolysis as demonstrated by reduced glucose consumption and lactate production. Inhibition of PI3K/Akt signaling also suppressed aerobic glycolysis and this effect can be reversed by reintroduction of HK2. Furthermore, knockdown of HK2 led to increased cell apoptosis and reduced ability of colony formation; meanwhile, these effects were blocked by 2-Deoxy-D-glucose (2-DG), a glycolysis inhibitor through its actions on hexokinase, indicating that HK2 functions in cell apoptosis and growth were mediated by altered aerobic glycolysis. Taken together, our study reveals a novel relationship between PI3K/Akt signaling and aerobic glycolysis and indicates that PI3K/Akt/HK2 might be potential therapeutic approaches for OS. - Highlights: • PI3K/Akt signaling contributes to elevated expression of HK2 in osteosarcoma. • HK2 inhibits cell apoptosis and promotes tumor growth through enhanced Warburg effect. • Inhibition of glycolysis blocks the oncogenic activity of HK2

  4. Inhibition of growth of human breast cancer cells in culture by neutron capture using liposomes containing 10B.

    Science.gov (United States)

    Yanagië, H; Kobayashi, H; Takeda, Y; Yoshizaki, I; Nonaka, Y; Naka, S; Nojiri, A; Shinnkawa, H; Furuya, Y; Niwa, H; Ariki, K; Yasuhara, H; Eriguchi, M

    2002-03-01

    Cell destruction in boron neutron capture therapy is effected by nuclear reaction between 10B and thermal neutrons with the release of alpha-particles (4He) and lithium-7 ions (7Li). 4He kills cells within 10 microm of the site of 4He generation, therefore it is theoretically possible to destroy tumour cells without affecting adjacent healthy tissue, given selective delivery of compounds containing 10B. Liposomes wore prepared by vortex dispersion of solutions containing 10B compounds with dried lipid films and the effects of those compounds on human breast cancer cells in culture were examined after thermal neutral irradiation. [3H]-TdR incorporation by MRKnu/nu-1 cells treated with 10B-containing liposomes showed 40% suppression compared with liposomes without 10B, at 2 x 1012 n/cm2 thermal neutron fluence. Inhibition of tumour cell growth with liposomes prepared with 100 mm 10B-compound was as significant as with those made with 500 ppm 10B solution. The concentration of 10B in liposomes was 76.5 +/- 3.4 microg/mL. Boronated liposomes can thus deliver sufficient 10B atoms to this line of breast cancer cells in culture to effect cytotoxicity and suppression of growth after thermal neutron irradiation.

  5. Combination of verteporfin-PDT and PI3K inhibitors enhances cell growth inhibition and apoptosis in endothelial cells

    Science.gov (United States)

    Kraus, Daniel; Chen, Bin

    2016-03-01

    Vascular targeted photodynamic therapy is a promising cancer treatment modality by ablating tumor vasculature. The effectiveness of this treatment is often compromised by regrowth of endothelial cells, which causes tumor recurrence. In this preliminary report, we showed that activated PI3K signaling was involved in endothelial cell regrowth after PDT with verteporfin and combination between verteporfin-PDT and PI3K pathway inhibitor BEZ235 induced more cell apoptosis and greater inhibition in cell proliferation. These results suggest that rational combination of verteporfin-PDT and PI3K inhibitors result in enhanced treatment outcomes.

  6. Knockdown of RAGE inhibits growth and invasion of gastric cancer cells

    Directory of Open Access Journals (Sweden)

    X.C. Xu

    2013-11-01

    Full Text Available The receptor for advanced glycation endproducts (RAGE is an oncogenic trans-membranous receptor, which is overexpressed in multiple human cancers. However, the role of RAGE in gastric cancer is still elusive. In this study, we investigated the expression and molecular mechanisms of RAGE in gastric cancer cells. Forty cases of gastric cancer and corresponding adjacent non-cancerous tissues (ANCT were collected, and the expression of RAGE was assessed using immunohistochemistry (IHC in biopsy samples. Furthermore, RAGE signaling was blocked by constructed recombinant small hairpin RNA lentiviral vector (Lv-shRAGE used to transfect into human gastric cancer SGC-7901 cells. The expression of AKT, proliferating cell nuclear antigen (PCNA and matrix metallopeptidase-2 (MMP-2 was detected by Real-time PCR and Western blot assays. Cell proliferative activities and invasive capability were respectively determined by MTT and Transwell assays. Cell apoptosis and cycle distribution were analyzed by flow cytometry. As a consequence, RAGE was found highly expressed in cancer tissues compared with the ANCT (70.0% vs 45.0%, P=0.039, and correlated with lymph node metastases (P=0.026. Knockdown of RAGE reduced cell proliferation and invasion of gastric cancer with decreased expression of AKT, PCNA and MMP-2, and induced cell apoptosis and cycle arrest. Altogether, upregulation of RAGE expression is associated with lymph node metastases of gastric cancer, and blockade of RAGE signaling suppresses growth and invasion of gastric cancer cells through AKT pathway, suggesting that RAGE may represent a potential therapeutic target for this aggressive malignancy.

  7. L-carnitine is an endogenous HDAC inhibitor selectively inhibiting cancer cell growth in vivo and in vitro.

    Directory of Open Access Journals (Sweden)

    Hongbiao Huang

    Full Text Available L-carnitine (LC is generally believed to transport long-chain acyl groups from fatty acids into the mitochondrial matrix for ATP generation via the citric acid cycle. Based on Warburg's theory that most cancer cells mainly depend on glycolysis for ATP generation, we hypothesize that, LC treatment would lead to disturbance of cellular metabolism and cytotoxicity in cancer cells. In this study, Human hepatoma HepG2, SMMC-7721 cell lines, primary cultured thymocytes and mice bearing HepG2 tumor were used. ATP content was detected by HPLC assay. Cell cycle, cell death and cell viability were assayed by flow cytometry and MTS respectively. Gene, mRNA expression and protein level were detected by gene microarray, Real-time PCR and Western blot respectively. HDAC activities and histone acetylation were detected both in test tube and in cultured cells. A molecular docking study was carried out with CDOCKER protocol of Discovery Studio 2.0 to predict the molecular interaction between L-carnitine and HDAC. Here we found that (1 LC treatment selectively inhibited cancer cell growth in vivo and in vitro; (2 LC treatment selectively induces the expression of p21(cip1 gene, mRNA and protein in cancer cells but not p27(kip1; (4 LC increases histone acetylation and induces accumulation of acetylated histones both in normal thymocytes and cancer cells; (5 LC directly inhibits HDAC I/II activities via binding to the active sites of HDAC and induces histone acetylation and lysine-acetylation accumulation in vitro; (6 LC treatment induces accumulation of acetylated histones in chromatin associated with the p21(cip1 gene but not p27(kip1 detected by ChIP assay. These data support that LC, besides transporting acyl group, works as an endogenous HDAC inhibitor in the cell, which would be of physiological and pathological importance.

  8. L-carnitine is an endogenous HDAC inhibitor selectively inhibiting cancer cell growth in vivo and in vitro.

    Science.gov (United States)

    Huang, Hongbiao; Liu, Ningning; Guo, Haiping; Liao, Siyan; Li, Xiaofen; Yang, Changshan; Liu, Shouting; Song, Wenbin; Liu, Chunjiao; Guan, Lixia; Li, Bing; Xu, Li; Zhang, Change; Wang, Xuejun; Dou, Q Ping; Liu, Jinbao

    2012-01-01

    L-carnitine (LC) is generally believed to transport long-chain acyl groups from fatty acids into the mitochondrial matrix for ATP generation via the citric acid cycle. Based on Warburg's theory that most cancer cells mainly depend on glycolysis for ATP generation, we hypothesize that, LC treatment would lead to disturbance of cellular metabolism and cytotoxicity in cancer cells. In this study, Human hepatoma HepG2, SMMC-7721 cell lines, primary cultured thymocytes and mice bearing HepG2 tumor were used. ATP content was detected by HPLC assay. Cell cycle, cell death and cell viability were assayed by flow cytometry and MTS respectively. Gene, mRNA expression and protein level were detected by gene microarray, Real-time PCR and Western blot respectively. HDAC activities and histone acetylation were detected both in test tube and in cultured cells. A molecular docking study was carried out with CDOCKER protocol of Discovery Studio 2.0 to predict the molecular interaction between L-carnitine and HDAC. Here we found that (1) LC treatment selectively inhibited cancer cell growth in vivo and in vitro; (2) LC treatment selectively induces the expression of p21(cip1) gene, mRNA and protein in cancer cells but not p27(kip1); (4) LC increases histone acetylation and induces accumulation of acetylated histones both in normal thymocytes and cancer cells; (5) LC directly inhibits HDAC I/II activities via binding to the active sites of HDAC and induces histone acetylation and lysine-acetylation accumulation in vitro; (6) LC treatment induces accumulation of acetylated histones in chromatin associated with the p21(cip1) gene but not p27(kip1) detected by ChIP assay. These data support that LC, besides transporting acyl group, works as an endogenous HDAC inhibitor in the cell, which would be of physiological and pathological importance.

  9. Targeting non-small cell lung cancer cells by dual inhibition of the insulin receptor and the insulin-like growth factor-1 receptor.

    Directory of Open Access Journals (Sweden)

    Emma E Vincent

    Full Text Available Phase III trials of the anti-insulin-like growth factor-1 receptor (IGF1R antibody figitumumab in non-small cell lung cancer (NSCLC patients have been discontinued owing to lack of survival benefit. We investigated whether inhibition of the highly homologous insulin receptor (IR in addition to the IGF1R would be more effective than inhibition of the IGF1R alone at preventing the proliferation of NSCLC cells. Signalling through IGF1R and IR in the NSCLC cell lines A549 and Hcc193 was stimulated by a combination of IGF1, IGF2 and insulin. It was inhibited by antibodies that block ligand binding, αIR3 (IGF1R and IR47-9 (IR, and by the ATP-competitive small molecule tyrosine kinase inhibitors AZ12253801 and NVPAWD742 which inhibit both IGF1R and IR tyrosine kinases. The effect of inhibitors was determined by an anchorage-independent proliferation assay and by analysis of Akt phosphorylation. In Hcc193 cells the reduction in cell proliferation and Akt phosphorylation due to anti-IGF1R antibody was enhanced by antibody-mediated inhibition of the IR whereas in A549 cells, with a relatively low IR:IGF1R expression ratio, it was not. In each cell line proliferation and Akt phosphorylation were more effectively inhibited by AZ12253801 and NVPAWD742 than by combined αIR3 and IR47-9. When the IGF1R alone is inhibited, unencumbered signalling through the IR can contribute to continued NSCLC cell proliferation. We conclude that small molecule inhibitors targeting both the IR and IGF1R more effectively reduce NSCLC cell proliferation in a manner independent of the IR:IGF1R expression ratio, providing a therapeutic rationale for the treatment of this disease.

  10. Notch1 signaling inhibits growth of human hepatocellular carcinoma through induction of cell cycle arrest and apoptosis.

    Science.gov (United States)

    Qi, Runzi; An, Huazhang; Yu, Yizhi; Zhang, Minghui; Liu, Shuxun; Xu, Hongmei; Guo, Zhenghong; Cheng, Tao; Cao, Xuetao

    2003-12-01

    Notch signaling plays a critical role in maintaining the balance between cell proliferation, differentiation, and apoptosis; hence, perturbed Notch signaling may contribute to tumorigenesis. Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in Africa and Asia. The mechanisms that orchestrate the multiple oncogenic insults required for initiation and progression of HCC are not clear. We constitutively overexpressed active Notch1 in human HCC to explore the effects of Notch1 signaling on HCC cell growth and to investigate the underlying molecular mechanisms. We show here that overexpression of Notch1 was able to inhibit the growth of HCC cells in vitro and in vivo. Biochemical analysis revealed the involvement of cell cycle regulated proteins in Notch1-mediated G(0)/G(1) arrest of HCC cells. Compared with green fluorescent protein (GFP) control, transient transfection of Notch1 ICN decreased expression of cyclin A (3.5-fold), cyclin D1 (2-fold), cyclin E (4.5-fold), CDK2 (2.8-fold), and the phosphorylated form of retinoblastoma protein (3-fold). Up-regulation of p21(waf/cip1) protein expression was observed in SMMC7721-ICN cells stably expressing active Notch1 but not in SMMC7721-GFP cells, which only express GFP. Furthermore, a 12-fold increase in p53 expression and an increase (4.8-fold) in Jun-NH(2)-terminal kinase activation were induced in SMMC7721-ICN cells compared with SMMC7721-GFP cells. In contrast, expression of the antiapoptotic Bcl-2 protein could not be detected in SMMC7721-ICN cells. These findings suggest that Notch1 signaling may participate in the development of HCC cells, affecting multiple pathways that control both cell proliferation and apoptosis.

  11. MiR-940 Inhibited Cell Growth and Migration in Triple-Negative Breast Cancer

    Science.gov (United States)

    Hou, Lingmi; Chen, Maoshan; Yang, Hongwei; Xing, Tianyong; Li, Jingdong; Li, Guangwu; Zhang, Lina; Deng, Shishan; Hu, Jiani; Zhao, Xiaobo; Jiang, Jun

    2016-01-01

    Background Breast cancer is the main type of cancer in women, and triple-negative breast cancer (TNBC) is a unique subtype of breast cancer. The expression of miR-940 has been shown to play an important role in various cancers; however, the role of miR-940 in TNBC remains unknown. Material/Methods The expression of miR-940 in TNBC tissues or cells were tested by qRT-PCR; the expression of miR-940 in cells were overexpressed by miR-940 mimics, and suppressed by anti-miR-940. Bioinformatics algorithms from TargetScanHuman were used to predict the target genes of miR-940. The interaction between miR-940 and ZNF24 was confirmed by dual luciferase assays. The protein level was assayed by Western blot. Results TNBC tissues and cells showed lower miR-940 levels. Conclusions MiR-940 inhibited cellular proliferation and migration in TNBC. PMID:27731867

  12. Transforming growth factor-beta1 inhibits tissue engineering cartilage absorption via inducing the generation of regulatory T cells.

    Science.gov (United States)

    Li, Chichi; Bi, Wei; Gong, Yiming; Ding, Xiaojun; Guo, Xuehua; Sun, Jian; Cui, Lei; Yu, Youcheng

    2016-02-01

    The objective of the present study was to explore the mechanisms of transforming growth factor (TGF)-β1 inhibiting the absorption of tissue engineering cartilage. We transfected TGF-β1 gene into bone marrow mesenchymal stem cells (BMMSCs) and co-cultured with interferon (IFN)-γ and tumour necrosis factor (TNF)-α and CD4(+) CD25(-) T lymphocytes. We then characterized the morphological changes, apoptosis and characterization of chondrogenic-committed cells from TGF-β1(+) BMMSCs and explored their mechanisms. Results showed that BMMSCs apoptosis and tissue engineering cartilage absorption in the group with added IFN-γ and TNF-α were greater than in the control group. In contrast, there was little BMMSC apoptosis and absorption by tissue engineering cartilage in the group with added CD4(+) CD25(-) T lymphocytes; Foxp3(+) T cells and CD25(+) CD39(+) T cells were found. In contrast, no type II collagen or Foxp3(+) T cells or CD25(+) CD39(+) T cells was found in the TGF-β1(-) BMMSC group. The data suggest that IFN-γ and TNF-α induced BMMSCs apoptosis and absorption of tissue engineering cartilage, but the newborn regulatory T (Treg) cells inhibited the function of IFN-γ and TNF-α and protected BMMSCs and tissue engineering cartilage. TGF-β1not only played a cartilage inductive role, but also inhibited the absorption of tissue engineering cartilage. The pathway proposed in our study may simulate the actual reaction procedure after implantation of BMMSCs and tissue engineering cartilage in vivo. Copyright © 2013 John Wiley & Sons, Ltd.

  13. SRJ23, a new semisynthetic andrographolide derivative: in vitro growth inhibition and mechanisms of cell cycle arrest and apoptosis in prostate cancer cells.

    Science.gov (United States)

    Wong, Hui Chyn; Wong, Charng Choon; Sagineedu, Sreenivasa Rao; Loke, Seng Cheong; Lajis, Nordin Haji; Stanslas, Johnson

    2014-10-01

    3,19-(3-Chloro-4-fluorobenzylidene)andrographolide (SRJ23), a new semisynthetic derivative of andrographolide (AGP), exhibited selectivity against prostate cancer cells in the US National Cancer Institute (NCI) in vitro anti-cancer screen. Herein, we report the in vitro growth inhibition and mechanisms of cell cycle arrest and apoptosis induced by SRJ23. 3-(4,5-Dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay was used in assessing in vitro growth inhibition of compounds against prostate cancer (PC-3, DU-145 and LNCaP) and mouse macrophage (RAW 264.7) cell lines. Flow cytometry was utilised to analyse cell cycle distribution, whereas fluorescence microscopy was performed to determine morphological cell death. DNA fragmentation and annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) flow cytometry were done to confirm apoptosis induced by SRJ23. Quantitation of cell cycle and apoptotic regulatory proteins were determined by immunoblotting. AGP and SRJ23 selectively inhibited the growth of prostate cancer cells compared with RAW 264.7 cells at low micromolar concentrations; however, SRJ23 was more potent. Mechanistically, SRJ23-treated PC-3 cells displayed down-regulation of cyclin-dependent kinase (CDK) 1 without affecting levels of CDK4 and cyclin D1. However, SRJ23 induced down-regulation of CDK4 and cyclin D1 but without affecting CDK1 in DU145 and LNCaP cell lines. DNA histogram analysis revealed that the SRJ23 induced G2/M in PC-3 cells but G1 arrest in DU-145 and LNCaP cells. Morphologically, both compounds induced predominantly apoptosis, which was further confirmed by DNA fragmentation and annexin V-FITC staining. The DNA fragmentation was inhibited in the presence of caspase 8 inhibitor (Z-IETD-FMK). Apoptosis was associated with an increase in caspase 8 expression and activation. This thought to have induced cleavage of Bid into t-Bid. Additionally, increased expression and activation of caspase 9 and Bax proteins were

  14. Net expression inhibits the growth of pancreatic ductal adenocarcinoma cell PL45 in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Baiwen Li

    Full Text Available Pancreatic ductal adenocarcinoma has a poor prognosis due to late diagnosis and a lack of effective therapeutic options. Thus, it is important to better understand its molecular mechanisms and to develop more effective treatments for the disease. The ternary complex factor Net, which exerts its strong inhibitory function on transcription of proto-oncogene gene c-fos by forming ternary complexes with a second transcription factor, has been suspected of being involved in pancreatic cancer and other tumors biology. In this study, we found that the majority of pancreatic ductal adenocarcinoma tissues and cell lines had weak or no expression of Net, whereas significantly high level of Net expression occurred in paired adjacent normal tissues we studied. Furthermore, using in vitro and in vivo model systems, we found that overexpression of Net inhibited cell growth and survival and induced cell apoptosis in human pancreatic ductal adenocarcinoma cell PL45; the mechanisms by which Net inhibited the cell cycle progression were mainly through P21-Cyclin D1/CDK4 Pathway. Our data thus suggested that Net might play an important role in pancreatic carcinogenesis, possibly by acting as a tumor suppressor gene.

  15. A membrane penetrating peptide aptamer inhibits STAT3 function and suppresses the growth of STAT3 addicted tumor cells

    Science.gov (United States)

    Borghouts, Corina; Delis, Natalia; Brill, Boris; Weiss, Astrid; Mack, Laura; Lucks, Peter; Groner, Bernd

    2012-01-01

    Cancer cells are characterized by the aberrant activation of signaling pathways governing proliferation, survival, angiogenesis, migration and immune evasion. These processes are partially regulated by the transcription factor STAT3. This factor is inappropriately activated in diverse tumor types. Since tumor cells can become dependent on its persistent activation, STAT3 is a favorable drug target. Here, we describe the functional characterization of the recombinant STAT3 inhibitor, rS3-PA. This inhibitor is based on a 20 amino acid peptide which specifically interacts with the dimerization domain of STAT3. It is integrated into a thioredoxin scaffold and fused to a protein transduction domain. Protein gel blot and immunofluorescence analyses showed that rS3-PA is efficiently taken up by cells via an endocytosis independent mechanism. Intracellularly, it reduces the phosphorylation of STAT3 and enhances its degradation. This leads to the downregulation of STAT3 target gene expression on the mRNA and protein levels. Subsequently, tumor cell proliferation, survival and migration and the induction of angiogenesis are inhibited. In contrast, normal cells remain unaffected. Systemic administration of rS3-PA at doses of 7.5 mg/kg reduced P-STAT3 levels and significantly inhibited tumor growth up to 35% in a glioblastoma xenograft mouse model. PMID:24058750

  16. EGCG inhibits activation of the insulin-like growth factor-1 receptor in human colon cancer cells

    International Nuclear Information System (INIS)

    Shimizu, Masahito; Deguchi, Atsuko; Hara, Yukihiko; Moriwaki, Hisataka; Weinstein, I. Bernard

    2005-01-01

    The IGF/IGF-1R system, which includes the IGF, IGF-1R, and IGFBPs proteins, plays an important role in the development and growth of colorectal cancer. We previously reported that in the HT29 human colon cancer cell line EGCG, the major biologically active component of green tea, inhibits activation of the RTKs EGFR, HER2, and HER3, and that this is associated with inhibition of multiple downstream signaling pathways. Since IGF-1R is also a RTK, in this study we examined the effects of EGCG on the activity of IGF/IGF-1R system in human colon cancer cells. We found that the colon cancer cell lines Caco2, HT29, SW837, and SW480 express high levels of the IGF-1R receptor, and that both SW837 and SW480 cells display constitutive activation of this receptor. Treatment of SW837 cells with 20 μg/ml of EGCG (the IC 50 concentration for growth inhibition) caused within 6 h a decrease in the phosphorylated (i.e., activated) form of the IGF-1R protein. At 12 h, there was a decrease in the levels of both IGF-1 protein and mRNA and within 3-6 h there was an increase in the levels of both IGFBP-3 protein and mRNA. The increased expression of the latter protein was sustained for at least 48 h. When SW837 cells were treated with EGCG for a longer time, i.e., 96 h, a very low concentration (1.0 μg/ml) of EGCG also caused inhibition of activation of IGF-1R, a decrease in the IGF-1 protein, and an increase in the IGFBP-3 protein. EGCG also caused a decrease in the levels of mRNAs that encode MMPs-7 and -9, proteins that proteolyze IGFBP-3. In addition, treatment with EGCG caused a transient increase in the expression of TGF-β2, an inducer of IGFBP-3 expression. These findings expand the roles of EGCG as an inhibitor of critical RTKs involved in cell proliferation, providing further evidence that EGCG and related compounds may be useful in the chemoprevention or treatment of colorectal cancer

  17. The chalcone butein from Rhus verniciflua Stokes inhibits clonogenic growth of human breast cancer cells co-cultured with fibroblasts

    Directory of Open Access Journals (Sweden)

    Tan Jenny

    2005-03-01

    Full Text Available Abstract Background Butein (3,4,2',4'-tetrahydroxychalone, a plant polyphenol, is a major biologically active component of the stems of Rhus verniciflua Stokes. It has long been used as a food additive in Korea and as an herbal medicine throughout Asia. Recently, butein has been shown to suppress the functions of fibroblasts. Because fibroblasts are believed to play an important role in promoting the growth of breast cancer cells, we investigated the ability of butein to inhibit the clonogenic growth of small numbers of breast cancer cells co-cultured with fibroblasts in vitro. Methods We first measured the clonogenic growth of small numbers of the UACC-812 human breast cancer cell line co-cultured on monolayers of serum-activated, human fibroblasts in the presence of butein (2 μg/mL or various other modulators of fibroblast function (troglitazone-1 μg/mL; GW9662-1 μM; meloxican-1 μM; and 3,4 dehydroproline-10 μg/mL. In a subsequent experiment, we measured the dose-response effect on the clonogenic growth of UACC-812 breast cancer cells by pre-incubating the fibroblasts with varying concentrations of butein (10 μg/ml-1.25 μg/mL. Finally, we measured the clonogenic growth of primary breast cancer cells obtained from 5 clinical specimens with normal fibroblasts and with fibroblasts that had been pre-treated with a fixed dose of butein (2.5 μg/mL. Results Of the five modulators of fibroblast function that we tested, butein was by far the most potent inhibitor of clonogenic growth of UACC-812 breast cancer cells co-cultured with fibroblasts. Pre-treatment of fibroblasts with concentrations of butein as low as 2.5 μg/mL nearly abolished subsequent clonogenic growth of UACC-812 breast cancer cells co-cultured with the fibroblasts. A similar dose of butein had no effect on the clonogenic growth of breast cancer cells cultured in the absence of fibroblasts. Significantly, clonogenic growth of the primary breast cancer cells was also

  18. Targeting both IGF-1R and mTOR synergistically inhibits growth of renal cell carcinoma in vitro

    International Nuclear Information System (INIS)

    Cardillo, Thomas M; Trisal, Preeti; Arrojo, Roberto; Goldenberg, David M; Chang, Chien-Hsing

    2013-01-01

    Advanced or metastatic renal cell carcinoma (RCC) has a poor prognosis, because it is relatively resistant to conventional chemotherapy or radiotherapy. Treatments with human interferon-α2b alone or in combination with mammalian target of rapamycin (mTOR) inhibitors have led to only a modest improvement in clinical outcome. One observation made with mTOR inhibitors is that carcinomas can overcome these inhibitory effects by activating the insulin-like growth factor-I (IGF-I) signaling pathway. Clinically, there is an association of IGF-I receptor (IGF-IR) expression in RCC and poor long-term patient survival. We have developed a humanized anti-IGF-IR monoclonal antibody, hR1, which binds to RCC, resulting in effective down-regulation of IGF-IR and moderate inhibition of cell proliferation in vitro. In this work, we evaluate the anti-tumor activity of two novel IGF-1R-targeting agents against renal cell carcinoma given alone or in combination with an mTOR inhibitor. hR1 was linked by the DOCK-AND-LOCK™ (DNL™) method to four Fabs of hR1, generating Hex-hR1, or to four molecules of interferon-α2b, generating 1R-2b. Eight human RCC cell lines were screened for IGF-1R expression and sensitivity to treatment with hR1 in vitro. Synergy with an mTOR inhibitor, temsirolimus, was tested in a cell line (ACHN) with low sensitivity to hR1. Hex-hR1 induced the down-regulation of IGF-IR at 10-fold lower concentrations compared to the parental hR1. Sensitivity to growth inhibition mediated by hR1 and Hex-hR1 treatments correlated with IGF-1R expression (higher expression was more sensitive). The potency of 1R-2b to inhibit the in vitro growth of RCC was also demonstrated in two human cell lines, ACHN and 786-O, with EC 50 –values of 63 and 48 pM, respectively. When combined with temsirolimus, a synergistic growth-inhibition with hR1, Hex-hR1, and 1R-2b was observed in ACHN cells at concentrations as low as 10 nM for hR1, 1 nM for Hex-hR1, and 2.6 nM for 1R-2b. Both Hex-hR1

  19. Methylferulate from Tamarix aucheriana inhibits growth and enhances chemosensitivity of human colorectal cancer cells: possible mechanism of action.

    Science.gov (United States)

    Abaza, Mohamed Salah I; Afzal, Mohammad; Al-Attiyah, Raja'a J; Guleri, Radhika

    2016-10-01

    Natural products are valuable sources for anticancer agents. In the present study, methylferulate (MF) was identified for the first time from Tamarix aucheriana. Spectral data were used for identification of MF. The potential of MF to control cell growth, cell cycle, apoptosis, generation of reactive oxygen species (ROS), cancer cell invasion, nuclear factor kappa B (NFkB) DNA-binding activity and proteasomal activities, as well as the enhancement of chemosensitivity in human colorectal cancer cells, were evaluated. The possible molecular mechanism of MF's therapeutic efficacy was also assessed. Column chromatography and spectral data were used for isolation and identification of MF. MTT, immunofluorescence, flow cytometry, in vitro invasion, fluoremetry, EIA and Real time qPCR were used to measure antiproliferative, chemo-sensitizing effects and other biochemical parameters. MF showed a dose-dependent anti-proliferative effect on colorectal cancer cells (IC 50  = 1.73 - 1.9 mM) with a nonsignificant cytotoxicity toward normal human fibroblast. Colony formation inhibition (P ≤ 0.001, 0.0001) confirmed the growth inhibition by MF. MF arrested cell cycle progression in the S and G2/M phases; induced apoptosis and ROS generation; and inhibited NF-kB DNA-binding activity, proteasomal activities and cell invasion in colorectal cancer cells. MF up-regulated cyclin-dependent kinase inhibitors (p19 INK4D , p21 WAF1/CIP1 , p27 KIP1 ), pro-apoptotic gene expression (Bax, Bad, Apaf1, Bid, Bim, Smac) and caspases (caspase 2, 3, 6, 7, 8, 9). Moreover, MF down-regulated cyclin-dependent kinases (Cdk1, Cdk2) and anti-apoptotic gene expression (c-IAP-1, c-IAP-2, Bcl2,FLIP). In addition, MF differentially potentiated the sensitivity of colorectal cancer cells to standard chemotherapeutic drugs. MF showed a multifaceted anti-proliferative and chemosensitizing effects. These results suggest the chemotherapeutic and co-adjuvant potential of MF.

  20. Autocrine Human Growth Hormone Promotes Invasive and Cancer Stem Cell-Like Behavior of Hepatocellular Carcinoma Cells by STAT3 Dependent Inhibition of CLAUDIN-1 Expression

    Directory of Open Access Journals (Sweden)

    Yi-Jun Chen

    2017-06-01

    Full Text Available Despite progress in diagnosis and treatment of hepatocellular carcinoma (HCC, the clinical outcome is still unsatisfactory. Increased expression of human growth hormone (hGH in HCC has been reported and is associated with poor survival outcome in HCC patients. Herein, we investigated the mechanism of the oncogenic effects of hGH in HCC cell lines. In vitro functional assays demonstrated that forced expression of hGH in these HCC cell lines promoted cell proliferation, cell survival, anchorage-independent growth, cell migration, and invasion, as previously reported. In addition, forced expression of hGH promoted cancer stem cell (CSC-like properties of HCC cells. The increased invasive and CSC-like properties of HCC cells with forced expression of hGH were mediated by inhibition of the expression of the tight junction component CLAUDIN-1. Consistently, depletion of CLAUDIN-1 expression increased the invasive and CSC-like properties of HCC cell lines. Moreover, forced expression of CLAUDIN-1 abrogated the acquired invasive and CSC-like properties of HCC cell lines with forced expression of hGH. We further demonstrated that forced expression of hGH inhibited CLAUDIN-1 expression in HCC cell lines via signal transducer and activator of transcription 3 (STAT3 mediated inhibition of CLAUDIN-1 transcription. Hence, we have elucidated a novel hGH-STAT3-CLAUDIN-1 axis responsible for invasive and CSC-like properties in HCC. Inhibition of hGH should be considered as a therapeutic option to hinder progression and relapse of HCC.

  1. Autocrine Human Growth Hormone Promotes Invasive and Cancer Stem Cell-Like Behavior of Hepatocellular Carcinoma Cells by STAT3 Dependent Inhibition of CLAUDIN-1 Expression.

    Science.gov (United States)

    Chen, Yi-Jun; You, Ming-Liang; Chong, Qing-Yun; Pandey, Vijay; Zhuang, Qiu-Shi; Liu, Dong-Xu; Ma, Lan; Zhu, Tao; Lobie, Peter E

    2017-06-15

    Despite progress in diagnosis and treatment of hepatocellular carcinoma (HCC), the clinical outcome is still unsatisfactory. Increased expression of human growth hormone (hGH) in HCC has been reported and is associated with poor survival outcome in HCC patients. Herein, we investigated the mechanism of the oncogenic effects of hGH in HCC cell lines. In vitro functional assays demonstrated that forced expression of hGH in these HCC cell lines promoted cell proliferation, cell survival, anchorage-independent growth, cell migration, and invasion, as previously reported. In addition, forced expression of hGH promoted cancer stem cell (CSC)-like properties of HCC cells. The increased invasive and CSC-like properties of HCC cells with forced expression of hGH were mediated by inhibition of the expression of the tight junction component CLAUDIN-1. Consistently, depletion of CLAUDIN-1 expression increased the invasive and CSC-like properties of HCC cell lines. Moreover, forced expression of CLAUDIN-1 abrogated the acquired invasive and CSC-like properties of HCC cell lines with forced expression of hGH. We further demonstrated that forced expression of hGH inhibited CLAUDIN-1 expression in HCC cell lines via signal transducer and activator of transcription 3 (STAT3) mediated inhibition of CLAUDIN-1 transcription. Hence, we have elucidated a novel hGH-STAT3-CLAUDIN-1 axis responsible for invasive and CSC-like properties in HCC. Inhibition of hGH should be considered as a therapeutic option to hinder progression and relapse of HCC.

  2. The Iron Chelator, Dp44mT, Effectively Inhibits Human Oral Squamous Cell Carcinoma Cell Growth in Vitro and in Vivo

    Directory of Open Access Journals (Sweden)

    Jehn-Chuan Lee

    2016-08-01

    Full Text Available Oral squamous cell carcinoma (OSCC is a common malignancy with a growing worldwide incidence and prevalence. The N-myc downstream regulated gene (NDRG family of NDRG1, 2, 3, and mammary serine protease inhibitor (Maspin gene are well-known modulators in the neoplasia process. Current research has considered iron chelators as new anti-cancer agents; however, the anticancer activities of iron chelators and their target genes in OSCC have not been well investigated. We showed that iron chelators (Dp44mT, desferrioxamine (DFO, and deferasirox all significantly inhibit SAS cell growth. Flow cytometry further indicated that Dp44mT inhibition of SAS cells growth was partly due to induction of G1 cell cycle arrest. Iron chelators enhanced expressions of NDRG1 and NDRG3 while repressing cyclin D1 expression in OSCC cells. The in vivo antitumor effect on OSCC and safety of Dp44mT were further confirmed through a xenograft animal model. The Dp44mT treatment also increased Maspin protein levels in SAS and OECM-1 cells. NDRG3 knockdown enhanced the growth of OECM-1 cells in vitro and in vivo. Our results indicated that NDRG3 is a tumor suppressor gene in OSCC cells, and Dp44mT could be a promising therapeutic agent for OSCC treatment.

  3. MicroRNA-375 Inhibits Growth and Enhances Radiosensitivity in Oral Squamous Cell Carcinoma by Targeting Insulin Like Growth Factor 1 Receptor

    Directory of Open Access Journals (Sweden)

    Bin Zhang

    2017-08-01

    Full Text Available Background: MicroRNAs (miRNAs have emerged as key players in various human biological processes, including tumorigenesis. Here, we investigated the roles of miR-375 in the pathogenesis of oral squamous cell carcinoma (OSCC. Methods: We performed quantitative real-time PCR (qRT-PCR to detect miR-375 expression in OSCC tissues and corresponding normal oral epithelial tissues and analyze the correlation of miR-375 expression with OSCC metastasis and patient’s survival. Then, the effects of miR-375 expression on proliferation, cell cycle, apoptosis and radiosensitivity in OSCC cells were determined by using MTT, flow cytometry and clonogenic survival assays. A dual-luciferase reporter assay was performed to test whether miR-375 binds to the 3’-untranslated region (3’-UTR of target mRNA. Results: The expression level of miR-375 in OSCC tissues was significantly lower than that in normal oral epithelial tissues, and low miR-375 expression was correlated with higher incidence of lymph node metastasis and poor survival of OSCC patients. Upregulation of miR-375 significantly inhibits growth, induces cell cycle arrest in G0/G1 phase, increases apoptosis and enhances radiosensitivity in OSCC cells. Analysis of luciferase activity demonstrated that miR-375 binds to the 3’-UTR of insulin like growth factor 1 receptor (IGF-1R. Small interfering RNA (shRNA-mediated IGF-1R knockdown mimics the effects of miR-375 upregulation, while overexpression of IGF-1R partially reverses those effects in OSCC cells. Conclusion: It was obviously demonstrated that miRNA-375 inhibits growth and enhances radiosensitivity in OSCC cells by targeting IGF-1R, suggesting that miR-375 may be a potential therapeutic target for OSCC patients.

  4. Antimicrobial peptides secreted by equine mesenchymal stromal cells inhibit the growth of bacteria commonly found in skin wounds.

    Science.gov (United States)

    Harman, Rebecca M; Yang, Steven; He, Megan K; Van de Walle, Gerlinde R

    2017-07-04

    The prevalence of chronic skin wounds in humans is high, and treatment is often complicated by the presence of pathogenic bacteria. Therefore, safe and innovative treatments to reduce the bacterial load in cutaneous wounds are needed. Mesenchymal stromal cells (MSC) are known to provide paracrine signals that act on resident skin cells to promote wound healing, but their potential antibacterial activities are not well described. The present study was designed to examine the antibacterial properties of MSC from horses, as this animal model offers a readily translatable model for MSC therapies in humans. Specifically, we aimed to (i) evaluate the in vitro effects of equine MSC on the growth of representative gram-negative and gram-positive bacterial species commonly found in skin wounds and (ii) define the mechanisms by which MSC inhibit bacterial growth. MSC were isolated from the peripheral blood of healthy horses. Gram-negative E. coli and gram-positive S. aureus were cultured in the presence of MSC and MSC conditioned medium (CM), containing all factors secreted by MSC. Bacterial growth was measured by plating bacteria and counting viable colonies or by reading the absorbance of bacterial cultures. Bacterial membrane damage was detected by incorporation of N-phenyl-1-naphthylamine (NPN). Antimicrobial peptide (AMP) gene and protein expression by equine MSC were determined by RT-PCR and Western blot analysis, respectively. Blocking of AMP activity of MSC CM was achieved using AMP-specific antibodies. We found that equine MSC and MSC CM inhibit the growth of E. coli and S. aureus, and that MSC CM depolarizes the cell membranes of these bacteria. In addition, we found that equine MSC CM contains AMPs, and blocking these AMPs with antibodies reduces the effects of MSC CM on bacteria. Our results demonstrate that equine MSC inhibit bacterial growth and secrete factors that compromise the membrane integrity of bacteria commonly found in skin wounds. We also identified

  5. MiR-375 inhibits the hepatocyte growth factor-elicited migration of mesenchymal stem cells by downregulating Akt signaling.

    Science.gov (United States)

    He, Lihong; Wang, Xianyao; Kang, Naixin; Xu, Jianwei; Dai, Nan; Xu, Xiaojing; Zhang, Huanxiang

    2018-04-01

    The migration of mesenchymal stem cells (MSCs) is critical for their use in cell-based therapies. Accumulating evidence suggests that microRNAs are important regulators of MSC migration. Here, we report that the expression of miR-375 was downregulated in MSCs treated with hepatocyte growth factor (HGF), which strongly stimulates the migration of these cells. Overexpression of miR-375 decreased the transfilter migration and the migration velocity of MSCs triggered by HGF. In our efforts to determine the mechanism by which miR-375 affects MSC migration, we found that miR-375 significantly inhibited the activation of Akt by downregulating its phosphorylation at T308 and S473, but had no effect on the activity of mitogen-activated protein kinases. Further, we showed that 3'phosphoinositide-dependent protein kinase-1 (PDK1), an upstream kinase necessary for full activation of Akt, was negatively regulated by miR-375 at the protein level. Moreover, miR-375 suppressed the phosphorylation of focal adhesion kinase (FAK) and paxillin, two important regulators of focal adhesion (FA) assembly and turnover, and decreased the number of FAs at cell periphery. Taken together, our results demonstrate that miR-375 inhibits HGF-elicited migration of MSCs through downregulating the expression of PDK1 and suppressing the activation of Akt, as well as influencing the tyrosine phosphorylation of FAK and paxillin and FA periphery distribution.

  6. Methyl Sartortuoate Inhibits Colon Cancer Cell Growth by Inducing Apoptosis and G2/M-Phase Arrest.

    Science.gov (United States)

    Lan, Qiusheng; Li, Shoufeng; Lai, Wei; Xu, Heyang; Zhang, Yang; Zeng, Yujie; Lan, Wenjian; Chu, Zhonghua

    2015-08-17

    The potential anti-neoplastic activity of terpenoids is of continued interest. In this study, we investigate whether methyl sartortuoate, a terpenoid isolated from soft coral, induced cell cycle arrest and apoptosis in a human colon cancer cell line. Culture studies found that methyl sartortuoate inhibited colon cancer cell (LoVo and RKO) growth and caused apoptotic death in a concentration- and time-dependent manner, by activation of caspase-8, caspase-9, caspase-3, p53 and Bax, and inactivation of B-cell lymphoma 2 (Bcl-2) apoptosis regulating proteins. Methyl sartortuoate treatment led to reduced expression of cdc2 and up-regulated p21 and p53, suggesting that Methyl sartortuoate induced G2-M arrest through modulation of p53/p21/cdc2 pathways. Methyl sartortuoate also up-regulated phospho-JNK and phospho-p38 expression levels. This resulted in cell cycle arrest at the G2-M phase and apoptosis in LoVo and RKO cells. Treatment with the JNK inhibitor SP600125 and the p38 MAPK inhibitor SB203580 prevented methyl sartortuoate-induced apoptosis in LoVo cells. Moreover, methyl sartortuoate also prevented neoplasm growth in NOD-SCID nude mice inoculated with LoVo cells. Taken together, these findings suggest that methyl sartortuoate is capable of leading to activation of caspase-8, -9, -3, increasing p53 and Bax/Bcl-2 ratio apoptosis through MAPK-dependent apoptosis and results in G2-M phase arrest in LoVo and RKO cells. Thus, methyl sartortuoate may be a promising anticancer candidate.

  7. Inhibition of connective tissue growth factor attenuates paraquat-induced lung fibrosis in a human MRC-5 cell line.

    Science.gov (United States)

    Huang, Min; Yang, Huifang; Zhu, Lingqin; Li, Honghui; Zhou, Jian; Zhou, Zhijun

    2016-11-01

    Chronic exposure to Paraquat (PQ) may result in progressive pulmonary fibrosis and subsequent chronic obstructive pulmonary malfunction. Connective tissue growth factor (CTGF) has been proposed as a key determinant in the development of lung fibrosis. We investigated thus whether knock down of CTGF can prevent human lung fibroblasts (MRC-5) activation and proliferation with the subsequent inhibition of PQ-induced fibrosis. MRC-5 was transfected with CTGF-siRNAs and exposed to different concentrations of PQ. The siRNA-silencing efficacy was evaluated using western blotting analyses, qRT-PCR and flow cytometry. Next, the viability and migration of MRC-5 was determined. MMP-2, MMP-9, and TIMP-1 accumulation were quantified to evaluate the lung fibrosis exposure to PQ. Over expression of CTGF mRNA was observed in human MRC-5 cell as early as 6 h following PQ stimulation. CTGF gene expression in MRC-5 cells was substantially reduced by RNAi, which significantly suppressed the expression of the lung fibrosis markers such as tissue inhibitor of metalloproteinase-2 (TIMP-2), Matrix metalloproteinase-2 (MMP-2) and Matrix metalloproteinase-9 (MMP-9) that were stimulated by PQ. Inhibition of CTGF expression suppressed impeded the proliferation and migration ability of MRC-5 cells and resulted in cell-extracellular matrix (ECM) protein accumulation in cells. Our results suggest that CTGF promoted the development of PQ-induced lung fibrosis in collaboration with transforming growth factor β1 (TGFβ1). Furthermore, the observed arresting effects of CTGF knock down during this process suggested that CTGF is the potential target site for preventing PQ-induced pulmonary fibrosis. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 1620-1626, 2016. © 2015 Wiley Periodicals, Inc.

  8. Andrographolide inhibits growth of human T-cell acute lymphoblastic leukemia Jurkat cells by downregulation of PI3K/AKT and upregulation of p38 MAPK pathways.

    Science.gov (United States)

    Yang, Tingfang; Yao, Shuluan; Zhang, Xianfeng; Guo, Yan

    2016-01-01

    T-cell acute lymphoblastic leukemia (T-ALL) as a prevalent hematologic malignancy is one of the most common malignant tumors worldwide in children. Andrographolide (Andro), the major active component from Andrographis paniculata, has been shown to possess antitumor activities in several types of cancer cells. However, whether Andro would inhibit T-ALL cell growth remains unclear. In this study, we investigated the cytotoxic effect of Andro on human T-ALL Jurkat cells and explored the mechanisms of cell death. Cell apoptosis was assayed by flow cytometry, and the signaling transduction for Andro was analyzed by Western blotting. The results indicated 10 μg/mL Andro could significantly induce Jurkat cells' apoptosis, depending on the inhibition of PI3K/AKT pathway. Moreover, Andro-induced apoptosis is enhanced by AKT-selective inhibitor LY294002. ERK- or JNK-selective inhibitors PD98059 and SP600125 had no effect on Andro-induced apoptosis. In addition, p38 inhibitor SB203580 could reverse Andro-induced apoptosis in Jurkat cells. We also found that the protein expression of p-p53 and p-p38 were increased after Andro treatments. The result of an in vivo study also demonstrated Andro's dose-dependent inhibition in subcutaneous Jurkat xenografts. In conclusion, our findings explained a novel mechanism of drug action by Andro in Jurkat cells and suggested that Andro might be developed into a new candidate therapy for T-ALL patients in the coming days.

  9. RNAi-mediated knock-down of arylamine N-acetyltransferase-1 expression induces E-cadherin up-regulation and cell-cell contact growth inhibition.

    Directory of Open Access Journals (Sweden)

    Jacky M Tiang

    Full Text Available Arylamine N-acetyltransferase-1 (NAT1 is an enzyme that catalyzes the biotransformation of arylamine and hydrazine substrates. It also has a role in the catabolism of the folate metabolite p-aminobenzoyl glutamate. Recent bioinformatics studies have correlated NAT1 expression with various cancer subtypes. However, a direct role for NAT1 in cell biology has not been established. In this study, we have knocked down NAT1 in the colon adenocarcinoma cell-line HT-29 and found a marked change in cell morphology that was accompanied by an increase in cell-cell contact growth inhibition and a loss of cell viability at confluence. NAT1 knock-down also led to attenuation in anchorage independent growth in soft agar. Loss of NAT1 led to the up-regulation of E-cadherin mRNA and protein levels. This change in E-cadherin was not attributed to RNAi off-target effects and was also observed in the prostate cancer cell-line 22Rv1. In vivo, NAT1 knock-down cells grew with a longer doubling time compared to cells stably transfected with a scrambled RNAi or to parental HT-29 cells. This study has shown that NAT1 affects cell growth and morphology. In addition, it suggests that NAT1 may be a novel drug target for cancer therapeutics.

  10. Inhibition of insulin-like growth factor-1 receptor signaling enhances growth-inhibitory and proapoptotic effects of gefitinib (Iressa) in human breast cancer cells

    International Nuclear Information System (INIS)

    Camirand, Anne; Zakikhani, Mahvash; Young, Fiona; Pollak, Michael

    2005-01-01

    Gefitinib (Iressa, ZD 1839, AstraZeneca) blocks the tyrosine kinase activity of the epidermal growth factor receptor (EGFR) and inhibits proliferation of several human cancer cell types including breast cancer. Phase II clinical trials with gefitinib monotherapy showed an objective response of 9 to 19% in non-small-cell lung cancer patients and less than 10% for breast cancer, and phase III results have indicated no benefit of gefitinib in combination with chemotherapy over chemotherapy alone. In order to improve the antineoplastic activity of gefitinib, we investigated the effects of blocking the signalling of the insulin-like growth factor 1 receptor (IGF-1R), a tyrosine kinase with a crucial role in malignancy that is coexpressed with EGFR in most human primary breast carcinomas. AG1024 (an inhibitor of IGF-1R) was used with gefitinib for treatment of MDA468, MDA231, SK-BR-3, and MCF-7 breast cancer lines, which express similar levels of IGF-1R but varying levels of EGFR. Proliferation assays, apoptosis induction studies, and Western blot analyses were conducted with cells treated with AG1024 and gefitinib as single agents and in combination. Gefitinib and AG1024 reduced proliferation in all lines when used as single agents, and when used in combination revealed an additive-to-synergistic effect on cell growth inhibition. Flow cytometry measurements of cells stained with annexin V-propidium iodide and cells stained for caspase-3 activation indicated that adding an IGF-1R-targeting strategy to gefitinib results in higher levels of apoptosis than are achieved with gefitinib alone. Gefitinib either reduced or completely inhibited p42/p44 Erk kinase phosphorylation, depending on the cell line, while Akt phosphorylation was reduced by a combination of the two agents. Overexpression of IGF-1R in SK-BR-3 cells was sufficient to cause a marked enhancement in gefitinib resistance. These results indicate that IGF-1R signaling reduces the antiproliferative effects of

  11. Octa-arginine mediated delivery of wild-type Lnk protein inhibits TPO-induced M-MOK megakaryoblastic leukemic cell growth by promoting apoptosis.

    Science.gov (United States)

    Looi, Chung Yeng; Imanishi, Miki; Takaki, Satoshi; Sato, Miki; Chiba, Natsuko; Sasahara, Yoji; Futaki, Shiroh; Tsuchiya, Shigeru; Kumaki, Satoru

    2011-01-01

    Lnk plays a non-redundant role by negatively regulating cytokine signaling of TPO, SCF or EPO. Retroviral expression of Lnk has been shown to suppress hematopoietic leukemic cell proliferation indicating its therapeutic value in cancer therapy. However, retroviral gene delivery carries risks of insertional mutagenesis. To circumvent this undesired consequence, we fused a cell permeable peptide octa-arginine to Lnk and evaluated the efficacy of inhibition of leukemic cell proliferation in vitro. In this study, proliferation assays, flow cytometry, Western Blot analyses were performed on wild-type (WT), mutant Lnk R8 or BSA treated M-MOK cells. We found that delivered WT, but not mutant Lnk R8 blocked TPO-induced M-MOK megakaryoblastic leukemic cell proliferation. In contrast, WT Lnk R8 showed no growth inhibitive effect on non-hematopoietic HELA or COS-7 cell. Moreover, we demonstrated that TPO-induced M-MOK cell growth inhibition by WT Lnk R8 was dose-dependent. Penetrated WT Lnk R8 induced cell cycle arrest and apoptosis. Immunoprecipitation and Western blots data indicated WT Lnk R8 interacted with endogeneous Jak2 and downregulated Jak-Stat and MAPK phosphorylation level in M-MOK cells after TPO stimulation. Treatment with specific inhibitors (TG101348 and PD98059) indicated Jak-Stat and MAPK pathways were crucial for TPO-induced proliferation of M-MOK cells. Further analyses using TF-1 and HEL leukemic cell-lines showed that WT Lnk R8 inhibited Jak2-dependent cell proliferation. Using cord blood-derived CD34+ stem cells, we found that delivered WT Lnk R8 blocked TPO-induced megakaryopoiesis in vitro. Intracellular delivery of WT Lnk R8 fusion protein efficiently inhibited TPO-induced M-MOK leukemic cell growth by promoting apoptosis. WT Lnk R8 protein delivery may provide a safer and more practical approach to inhibit leukemic cell growth worthy of further development.

  12. Inhibition of breast cancer cell growth by the combination of clofarabine and sulforaphane involves epigenetically mediated CDKN2A upregulation.

    Science.gov (United States)

    Lubecka, Katarzyna; Kaufman-Szymczyk, Agnieszka; Fabianowska-Majewska, Krystyna

    2018-04-10

    Many antineoplastic nucleoside analogue-based combinatorial strategies focused on remodelling aberrant DNA methylation patterns have been developed. The number of studies demonstrate high efficacy of bioactive phytochemicals in support of conventional chemotherapy. Our recent discoveries of the epigenetic effects of clofarabine (2'-deoxyadenosine analogue, antileukaemic drug) and clofarabine-based combinations with dietary bioactive compounds in breast cancer cells led us to look for more DNA methylation targets of these cancer-preventive agents. In the present study, using methylation-sensitive restriction analysis (MSRA) and qPCR, we showed that clofarabine in combination with sulforaphane, a phytochemical from cruciferous vegetables, significantly reactivates DNA methylation-silenced CDKN2A tumour suppressor and inhibits cancer cell growth at a non-invasive breast cancer stage.

  13. Triazole-dithiocarbamate based selective lysine specific demethylase 1 (LSD1) inactivators inhibit gastric cancer cell growth, invasion, and migration.

    Science.gov (United States)

    Zheng, Yi-Chao; Duan, Ying-Chao; Ma, Jin-Lian; Xu, Rui-Min; Zi, Xiaolin; Lv, Wen-Lei; Wang, Meng-Meng; Ye, Xian-Wei; Zhu, Shun; Mobley, David; Zhu, Yan-Yan; Wang, Jun-Wei; Li, Jin-Feng; Wang, Zhi-Ru; Zhao, Wen; Liu, Hong-Min

    2013-11-14

    Lysine specific demethylase 1 (LSD1), the first identified histone demethylase, plays an important role in epigenetic regulation of gene activation and repression. The up-regulated LSD1's expression has been reported in several malignant tumors. In the current study, we designed and synthesized five series of 1,2,3-triazole-dithiocarbamate hybrids and screened their inhibitory activity toward LSD1. We found that some of these compounds, especially compound 26, exhibited the most specific and robust inhibition of LSD1. Interestingly, compound 26 also showed potent and selective cytotoxicity against LSD1 overexpressing gastric cancer cell lines MGC-803 and HGC-27, as well as marked inhibition of cell migration and invasion, compared to 2-PCPA. Furthermore, compound 26 effectively reduced the tumor growth bared by human gastric cancer cells in vivo with no signs of adverse side effects. These findings suggested that compound 26 deserves further investigation as a lead compound in the treatment of LSD1 overexpressing gastric cancer.

  14. Metformin-mediated growth inhibition involves suppression of the IGF-I receptor signalling pathway in human pancreatic cancer cells

    International Nuclear Information System (INIS)

    Karnevi, Emelie; Said, Katarzyna; Andersson, Roland; Rosendahl, Ann H

    2013-01-01

    Epidemiological studies have shown direct associations between type 2 diabetes and obesity, both conditions associated with hyperglycaemia and hyperinsulinemia, and the risk of pancreatic cancer. Up to 80% of pancreatic cancer patients present with either new-onset type 2 diabetes or impaired glucose tolerance at the time of diagnosis. Recent population studies indicate that the incidence of pancreatic cancer is reduced among diabetics taking metformin. In this study, the effects of exposure of pancreatic cancer cells to high glucose levels on their growth and response to metformin were investigated. The human pancreatic cancer cell lines AsPC-1, BxPC-3, PANC-1 and MIAPaCa-2 were grown in normal (5 mM) or high (25 mM) glucose conditions, with or without metformin. The influence by metformin on proliferation, apoptosis and the AMPK and IGF-IR signalling pathways were evaluated in vitro. Metformin significantly reduced the proliferation of pancreatic cancer cells under normal glucose conditions. Hyperglycaemia however, protected against the metformin-induced growth inhibition. The anti-proliferative actions of metformin were associated with an activation of AMP-activated protein kinase AMPK Thr172 together with an inhibition of the insulin/insulin-like growth factor-I (IGF-I) receptor activation and downstream signalling mediators IRS-1 and phosphorylated Akt. Furthermore, exposure to metformin during normal glucose conditions led to increased apoptosis as measured by poly(ADP-ribose) polymerase (PARP) cleavage. In contrast, exposure to high glucose levels promoted a more robust IGF-I response and Akt activation which correlated to stimulated AMPK Ser485 phosphorylation and impaired AMPK Thr172 phosphorylation, resulting in reduced anti-proliferative and apoptotic effects by metformin. Our results indicate that metformin has direct anti-tumour activities in pancreatic cancer cells involving AMPK Thr172 activation and suppression of the insulin/IGF signalling pathways

  15. Dieckol, isolated from the edible brown algae Ecklonia cava, induces apoptosis of ovarian cancer cells and inhibits tumor xenograft growth.

    Science.gov (United States)

    Ahn, Ji-Hye; Yang, Yeong-In; Lee, Kyung-Tae; Choi, Jung-Hye

    2015-02-01

    Ecklonia cava is an abundant brown alga and has been reported to possess various bioactive compounds having anti-inflammatory effect. However, the anticancer effects of dieckol, a major active compound in E. cava, are poorly understood. In the present study, we investigated the anti-tumor activity of dieckol and its molecular mechanism in ovarian cancer cells and in a xenograft mouse model . MTT assay, PI staining, and PI and Annexin double staining were performed to study cell cytotoxicity, cell cycle distribution, and apoptosis. We also investigated reactive oxygen species (ROS) production and protein expression using flow cytometry and Western blot analysis, respectively. Anti-tumor effects of dieckol were evaluated in SKOV3 tumor xenograft model. We found that the E. cava extract and its phlorotannins have cytotoxic effects on A2780 and SKOV3 ovarian cancer cells. Dieckol induced the apoptosis of SKOV3 cells and suppressed tumor growth without any significant adverse effect in the SKOV3-bearing mouse model. Dieckol triggered the activation of caspase-8, caspase-9, and caspase-3, and pretreatment with caspase inhibitors neutralized the pro-apoptotic activity of dieckol. Furthermore, treatment with dieckol caused mitochondrial dysfunction and suppressed the levels of anti-apoptotic proteins. We further demonstrated that dieckol induced an increase in intracellular ROS, and the antioxidant N-acetyl-L-cysteine (NAC) significantly reversed the caspase activation, cytochrome c release, Bcl-2 downregulation, and apoptosis that were caused by dieckol. Moreover, dieckol inhibited the activity of AKT and p38, and overexpression of AKT and p38, at least in part, reversed dieckol-induced apoptosis in SKOV3 cells. These data suggest that dieckol suppresses ovarian cancer cell growth by inducing caspase-dependent apoptosis via ROS production and the regulation of AKT and p38 signaling.

  16. PPARγ induces growth inhibition and apoptosis through upregulation of insulin-like growth factor-binding protein-3 in gastric cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, S.Y. [Department of Pediatrics, Chonbuk National University Hospital, Jeonju (Korea, Republic of); Biomedical Research Institute, School of Medicine, Chonbuk National University Hospital, Jeonju (Korea, Republic of); Kim, M.S.; Lee, M.K. [Department of Pediatrics, Chonbuk National University Hospital, Jeonju (Korea, Republic of); Kim, J.S.; Yi, H.K. [Department of Biochemistry, School of Dentistry, Chonbuk National University, Jeonju (Korea, Republic of); Nam, S.Y. [Department of Alternative Therapy, Jeonju University, Jeonju (Korea, Republic of); Lee, D.Y.; Hwang, P.H. [Department of Pediatrics, Chonbuk National University Hospital, Jeonju (Korea, Republic of); Biomedical Research Institute, School of Medicine, Chonbuk National University Hospital, Jeonju (Korea, Republic of)

    2015-01-13

    Peroxisome proliferator activator receptor-gamma (PPARγ) is a ligand-activated transcriptional factor involved in the carcinogenesis of various cancers. Insulin-like growth factor-binding protein-3 (IGFBP-3) is a tumor suppressor gene that has anti-apoptotic activity. The purpose of this study was to investigate the anticancer mechanism of PPARγ with respect to IGFBP-3. PPARγ was overexpressed in SNU-668 gastric cancer cells using an adenovirus gene transfer system. The cells in which PPARγ was overexpressed exhibited growth inhibition, induction of apoptosis, and a significant increase in IGFBP-3 expression. We investigated the underlying molecular mechanisms of PPARγ in SNU-668 cells using an IGFBP-3 promoter/luciferase reporter system. Luciferase activity was increased up to 15-fold in PPARγ transfected cells, suggesting that PPARγ may directly interact with IGFBP-3 promoter to induce its expression. Deletion analysis of the IGFBP-3 promoter showed that luciferase activity was markedly reduced in cells without putative p53-binding sites (-Δ1755, -Δ1795). This suggests that the critical PPARγ-response region is located within the p53-binding region of the IGFBP-3 promoter. We further demonstrated an increase in PPARγ-induced luciferase activity even in cells treated with siRNA to silence p53 expression. Taken together, these data suggest that PPARγ exhibits its anticancer effect by increasing IGFBP-3 expression, and that IGFBP-3 is a significant tumor suppressor.

  17. SphK1 inhibitor II (SKI-II) inhibits acute myelogenous leukemia cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Yang, Li; Weng, Wei; Sun, Zhi-Xin; Fu, Xian-Jie; Ma, Jun; Zhuang, Wen-Fang

    2015-01-01

    Previous studies have identified sphingosine kinase 1 (SphK1) as a potential drug target for treatment of acute myeloid leukemia (AML). In the current study, we investigated the potential anti-leukemic activity of a novel and specific SphK1 inhibitor, SKI-II. We demonstrated that SKI-II inhibited growth and survival of human AML cell lines (HL-60 and U937 cells). SKI-II was more efficient than two known SphK1 inhibitors SK1-I and FTY720 in inhibiting AML cells. Meanwhile, it induced dramatic apoptosis in above AML cells, and the cytotoxicity by SKI-II was almost reversed by the general caspase inhibitor z-VAD-fmk. SKI-II treatment inhibited SphK1 activation, and concomitantly increased level of sphingosine-1-phosphate (S1P) precursor ceramide in AML cells. Conversely, exogenously-added S1P protected against SKI-II-induced cytotoxicity, while cell permeable short-chain ceramide (C6) aggravated SKI-II's lethality against AML cells. Notably, SKI-II induced potent apoptotic death in primary human AML cells, but was generally safe to the human peripheral blood mononuclear cells (PBMCs) isolated from healthy donors. In vivo, SKI-II administration suppressed growth of U937 leukemic xenograft tumors in severe combined immunodeficient (SCID) mice. These results suggest that SKI-II might be further investigated as a promising anti-AML agent. - Highlights: • SKI-II inhibits proliferation and survival of primary and transformed AML cells. • SKI-II induces apoptotic death of AML cells, but is safe to normal PBMCs. • SKI-II is more efficient than two known SphK1 inhibitors in inhibiting AML cells. • SKI-II inhibits SphK1 activity, while increasing ceramide production in AML cells. • SKI-II dose-dependently inhibits U937 xenograft growth in SCID mice

  18. Progesterone receptor (PR) polyproline domain (PPD) mediates inhibition of epidermal growth factor receptor (EGFR) signaling in non-small cell lung cancer cells.

    Science.gov (United States)

    Kawprasertsri, Sornsawan; Pietras, Richard J; Marquez-Garban, Diana C; Boonyaratanakornkit, Viroj

    2016-05-01

    Recent evidence has suggested a possible role for progesterone receptor (PR) in the progression of non-small cell lung cancer (NSCLC). However, little is known concerning roles of PR in NSCLC. PR contains a polyproline domain (PPD), which directly binds to the SH3 domain of signaling molecules. Because PPD-SH3 interactions are essential for EGFR signaling, we hypothesized that the presence of PR-PPD interfered with EGFR-mediated signaling and cell proliferation. We examined the role of PR-PPD in cell proliferation and signaling by stably expressing PR-B, or PR-B with disrupting mutations in the PPD (PR-BΔSH3), from a tetracycline-regulated promoter in A549 NSCLC cells. PR-B dose-dependently inhibited cell growth in the absence of ligand, and progestin (R5020) treatment further suppressed the growth. Treatment with RU486 abolished PR-B- and R5020-mediated inhibition of cell proliferation. Expression of PR-BΔSH3 and treatment with R5020 or RU486 had no effect on cell proliferation. Furthermore, PR-B expression but not PR-BΔSH3 expression reduced EGF-induced A549 proliferation and activation of ERK1/2, in the absence of ligand. Taken together, our data demonstrated the significance of PR extranuclear signaling through PPD interactions in EGFR-mediated proliferation and signaling in NSCLC. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. MiR-138 Inhibits Tumor Growth Through Repression of EZH2 in Non-Small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Huijun Zhang

    2013-01-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play important roles in tumorigenesis. We investigated the roles and mechanisms of miR-138 in human non-small cell lung cancer (NSCLC. Methods: The expression of miR-138 was first examined in NSCLC cell lines and tumourtissues by real-time PCR The in vitro and in vivo functional effect of miR-138 was examined further. A luciferase reporter assay was conducted to confirm target association between miR-138 and the enhancer of zeste homolog 2 (EZH2. Results: miR-138 was frequently downregulated in NSCLC cells and tissues. Overexpression of miR-138 inhibited proliferation of NSCLC cells in vitro and tumor growth in vivo. The EZH2 oncogene, which is often overexpressed in various human cancers and acts as an important regulator of cell growth and tumor invasion, was identified as a novel target of miR-138. miR-138 can bind to the 3′ untranslated region (3′ UTR of EZH2 and suppress the expression of EZH2 at both mRNA and protein levels. Furthermore, knockdown of EZH2 phenocopied the tumor suppressive effects of miR-138 in cell models, whereas ectopic expression of EZH2 rescued the suppressive effects of miR-138. Conclusion: These findings define a tumor suppressor function for miR-138 in NSCLC and further suggest that miR-138 may represent a potential therapeutic target for NSCLC patients.

  20. Total Alkaloids of Sophora alopecuroides Inhibit Growth and Induce Apoptosis in Human Cervical Tumor HeLa Cells In vitro.

    Science.gov (United States)

    Li, Jian-Guang; Yang, Xiao-Yi; Huang, Wei

    2016-05-01

    Uygur females of Xinjiang have the higher incidence of cervical tumor in the country. Alkaloids are the major active ingredients in Sophora alopecuroides, and its antitumor effect was recognized by the medical profession. Xinjiang is the main site of S. alopecuroides production in China so these plants are abundant in the region. Studies on the antitumor properties of total alkaloids of S. alopecuroides (TASA) can take full use of the traditional folk medicine in antitumor unique utility. To explore the effects of TASA on proliferation and apoptosis of human cervical tumor HeLa cells in vitro. TASA was extracted, purified, and each monomer component was analyzed by high-performance liquid chromatography. The effect of TASA at different concentrations on the survival of HeLa cells was determined after 24 h using the Cell Counting Kit-8. In addition, cells were photographed using an inverted microscope to document morphological changes. The effect of TASA on apoptotic rate of HeLa cells was assessed by flow cytometry. Monomers of TASA were found to be sophoridine, matrine, and sophocarpine. On treatment with 8.75 mg/ml of TASA, more than 50% of HeLa cells died, and cell death rate increased further with longer incubation. The apoptotic rates of HeLa cells in the experimental groups were 16.0% and 33.3% at concentrations of 6.25 mg/ml and 12.50 mg/ml, respectively. TASA can induce apoptosis in cervical tumor HeLa cells, and it has obvious inhibitory effects on cell growth. Total alkaloids of Sophora alopecuroides (TASA) exhibits anti-human cervical tumor propertiesMonomer component of TASA was analyzed by high-performance liquid chromatography, and its main effect component are sophoridine, matrine, and sophocarpineTASA inhibits growth and induces apoptosis in HeLa cells. Abbreviations used: TASA: Total alkaloids of S. alopecuroides, CCK-8: Cell Counting Kit-8, FBS: Fetal bovine serum, PBS: Phosphate buffered saline, DMEM: Dulbecco's modified Eagle medium.

  1. Gallic acid inhibits gastric cancer cells metastasis and invasive growth via increased expression of RhoB, downregulation of AKT/small GTPase signals and inhibition of NF-κB activity

    Energy Technology Data Exchange (ETDEWEB)

    Ho, Hsieh-Hsun [Institute of Biochemistry and Biotechnology, Chung Shan Medical University, Taichung 402, Taiwan (China); Chang, Chi-Sen [Department of Medicine, Chung Shan Medical University, Taichung 402, Taiwan (China); Division of Gastroenterology, Taichung Veterans General Hospital, Taichung 402, Taiwan (China); Ho, Wei-Chi [Division of Gastroenterology, Jen-Ai Hospital, Taichung 402, Taiwan (China); Liao, Sheng-You [Institute of Biochemistry and Biotechnology, Chung Shan Medical University, Taichung 402, Taiwan (China); Lin, Wea-Lung [Department of Pathology, School of Medicine, Chung Shan Medical University, Taichung 402, Taiwan (China); Department of Pathology, Chung Shan Medical University Hospital, Taichung 402, Taiwan (China); Wang, Chau-Jong, E-mail: wcj@csmu.edu.tw [Institute of Biochemistry and Biotechnology, Chung Shan Medical University, Taichung 402, Taiwan (China); Department of Medical Research, Chung Shan Medical University Hospital, Taichung 402, Taiwan (China)

    2013-01-01

    Our previous study demonstrated the therapeutic potential of gallic acid (GA) for controlling tumor metastasis through its inhibitory effect on the motility of AGS cells. A noteworthy finding in our previous experiment was increased RhoB expression in GA-treated cells. The aim of this study was to evaluate the role of RhoB expression on the inhibitory effects of GA on AGS cells. By applying the transfection of RhoB siRNA into AGS cells and an animal model, we tested the effect of GA on inhibition of tumor growth and RhoB expression. The results confirmed that RhoB-siRNA transfection induced GA to inhibit AGS cells’ invasive growth involving blocking the AKT/small GTPase signals pathway and inhibition of NF-κB activity. Finally, we evaluated the effect of GA on AGS cell metastasis by colonization of tumor cells in nude mice. It showed GA inhibited tumor cells growth via the expression of RhoB. These data support the inhibitory effect of GA which was shown to inhibit gastric cancer cell metastasis and invasive growth via increased expression of RhoB, downregulation of AKT/small GTPase signals and inhibition of NF-κB activity. Thus, GA might be a potential agent in treating gastric cancer. Highlights: ► GA could downregulate AKT signal via increased expression of RhoB. ► GA inhibits metastasis in vitro in gastric carcinoma. ► GA inhibits tumor growth in nude mice model.

  2. Metformin inhibits the proliferation of human prostate cancer PC-3 cells via the downregulation of insulin-like growth factor 1 receptor

    Energy Technology Data Exchange (ETDEWEB)

    Kato, Haruo, E-mail: hal.kato@gunma-u.ac.jp; Sekine, Yoshitaka; Furuya, Yosuke; Miyazawa, Yoshiyuki; Koike, Hidekazu; Suzuki, Kazuhiro

    2015-05-22

    Metformin is a biguanide drug that is widely used for the treatment of type 2 diabetes. Recent studies have shown that metformin inhibits cancer cell proliferation and tumor growth both in vitro and in vivo. The anti-tumor mechanisms of metformin include activation of the AMP-activated protein kinase/mTOR pathway and direct inhibition of insulin/insulin-like growth factor (IGF)-mediated cellular proliferation. However, the anti-tumor mechanism in prostate cancer remains unclear. Because activation of the IGF-1 receptor (IGF-1R) is required for prostate cell proliferation, IGF-1R inhibitors may be of therapeutic value. Accordingly, we examined the effects of metformin on IGF-1R signaling in prostate cancer cells. Metformin significantly inhibited PC-3 cell proliferation, migration, and invasion. IGF-1R mRNA expression decreased significantly after 48 h of treatment, and IGF-1R protein expression decreased in a similar manner. IGF-1R knockdown by siRNA transfection led to inhibited proliferation, migration and invasion of PC-3 cells. IGF-1 activated both ERK1/2 and Akt, but these effects were attenuated by metformin treatment. In addition, intraperitoneal treatment with metformin significantly reduced tumor growth and IGF-1R mRNA expression in PC-3 xenografts. Our results suggest that metformin is a potent inhibitor of the IGF-1/IGF-1R system and may be beneficial in prostate cancer treatment. - Highlights: • Metformin inhibited PC-3 cell proliferation, migration, and invasion. • Metformin decreased IGF-1R mRNA and protein expressions in PC-3 cells. • Metformin inhibited IGF-1 induced ERK and Akt phosphorylations in PC-3 cells. • Metformin treatment inhibited PC-3 cell growth and IGF-1R expression in vivo. • Metformin may be a potent inhibitor of the IGF-1/IGF-1R signaling.

  3. Metformin inhibits the proliferation of human prostate cancer PC-3 cells via the downregulation of insulin-like growth factor 1 receptor

    International Nuclear Information System (INIS)

    Kato, Haruo; Sekine, Yoshitaka; Furuya, Yosuke; Miyazawa, Yoshiyuki; Koike, Hidekazu; Suzuki, Kazuhiro

    2015-01-01

    Metformin is a biguanide drug that is widely used for the treatment of type 2 diabetes. Recent studies have shown that metformin inhibits cancer cell proliferation and tumor growth both in vitro and in vivo. The anti-tumor mechanisms of metformin include activation of the AMP-activated protein kinase/mTOR pathway and direct inhibition of insulin/insulin-like growth factor (IGF)-mediated cellular proliferation. However, the anti-tumor mechanism in prostate cancer remains unclear. Because activation of the IGF-1 receptor (IGF-1R) is required for prostate cell proliferation, IGF-1R inhibitors may be of therapeutic value. Accordingly, we examined the effects of metformin on IGF-1R signaling in prostate cancer cells. Metformin significantly inhibited PC-3 cell proliferation, migration, and invasion. IGF-1R mRNA expression decreased significantly after 48 h of treatment, and IGF-1R protein expression decreased in a similar manner. IGF-1R knockdown by siRNA transfection led to inhibited proliferation, migration and invasion of PC-3 cells. IGF-1 activated both ERK1/2 and Akt, but these effects were attenuated by metformin treatment. In addition, intraperitoneal treatment with metformin significantly reduced tumor growth and IGF-1R mRNA expression in PC-3 xenografts. Our results suggest that metformin is a potent inhibitor of the IGF-1/IGF-1R system and may be beneficial in prostate cancer treatment. - Highlights: • Metformin inhibited PC-3 cell proliferation, migration, and invasion. • Metformin decreased IGF-1R mRNA and protein expressions in PC-3 cells. • Metformin inhibited IGF-1 induced ERK and Akt phosphorylations in PC-3 cells. • Metformin treatment inhibited PC-3 cell growth and IGF-1R expression in vivo. • Metformin may be a potent inhibitor of the IGF-1/IGF-1R signaling

  4. Peroxisome Proliferator-Activated Receptor-γ Inhibits Transformed Growth of Non-Small Cell Lung Cancer Cells through Selective Suppression of Snail

    Directory of Open Access Journals (Sweden)

    Rashmi Choudhary

    2010-03-01

    Full Text Available Work from our laboratory and others has demonstrated that activation of the nuclear receptor peroxisome proliferator-activated receptor-γ (PPARγ inhibits transformed growth of non-small cell lung cancer (NSCLC cell lines in vitro and in vivo. We have demonstrated that activation of PPARγ promotes epithelial differentiation of NSCLC by increasing expression of E-cadherin, as well as inhibiting expression of COX-2 and nuclear factor-κB. The Snail family of transcription factors, which includes Snail (Snail1, Slug (Snail2, and ZEB1, is an important regulator of epithelial-mesenchymal transition, as well as cell survival. The goal of this study was to determine whether the biological responses to rosiglitazone, a member of the thiazolidinedione family of PPARγ activators, are mediated through the regulation of Snail family members. Our results indicate that, in two independent NSCLC cell lines, rosiglitazone specifically decreased expression of Snail, with no significant effect on either Slug or ZEB1. Suppression of Snail using short hairpin RNA silencing mimicked the effects of PPARγ activation, in inhibiting anchorage-independent growth, promoting acinar formation in three-dimensional culture, and inhibiting invasiveness. This was associated with the increased expression of E-cadherin and decreased expression of COX-2 and matrix metaloproteinases. Conversely, overexpression of Snail blocked the biological responses to rosiglitazone, increasing anchorage-independent growth, invasiveness, and promoting epithelial-mesenchymal transition. The suppression of Snail expression by rosiglitazone seemed to be independent of GSK-3 signaling but was rather mediated through suppression of extracellular signal-regulated kinase activity. These findings suggest that selective regulation of Snail may be critical in mediating the antitumorigenic effects of PPARγ activators.

  5. Fibroblast growth factor 23 inhibits osteoblastic gene expression and induces osteoprotegerin in vascular smooth muscle cells.

    Science.gov (United States)

    Nakahara, Takehiro; Kawai-Kowase, Keiko; Matsui, Hiroki; Sunaga, Hiroaki; Utsugi, Toshihiro; Iso, Tatsuya; Arai, Masashi; Tomono, Shouichi; Kurabayashi, Masahiko

    2016-10-01

    Elevated fibroblast growth factor 23 (FGF23) levels are associated with cardiovascular mortality in patients with chronic kidney disease. However, both clinical and basic research have demonstrated conflicting evidence regarding the pathophysiological role of FGF23 in vascular calcification. The aim of this study was to determine the role of FGF23 in the osteoblastic gene expression in vascular smooth muscle cells (SMCs). We transduce human aortic SMCs (HASMCs) expressing klotho and FGF receptors with the adenovirus expressing human FGF23 (Ad-FGF23). We observed significant decreases in the expression of osteoblast-marker genes including BMP2, BMP4, MSX2, RUNX2 and ALP, as well as reduced calcification. Notably, Ad-FGF23 increased mRNA and protein levels of osteoprotegerin (OPG), and human OPG promoter was activated by FGF23. Moreover, in HASMCs overexpressing klotho, FGF23 upregulated OPG expression, whereas depletion of klotho by siRNA attenuated FGF23-induced OPG expression. Furthermore, in 73 consecutive patients with type 2 diabetes mellitus undergoing cardiac computed tomography to determine coronary calcium scores (CCSs), serum FGF23 levels were positively correlated with OPG independent of phosphate and estimated glomerular filtration rate (eGFR, r = 0.65, p < 0.01). Serum FGF23 levels were significantly elevated in patients with high CCSs (≧100) compared to those with low CCSs (<100). Our in vitro results indicate that FGF23 suppresses osteoblastic gene expression and induces OPG expression in HASMCs. Together with our cross-sectional clinical assessment, the present study lends support to our hypothesis that FGF23 counteracts osteogenic conversion of vascular SMCs as a part of a compensatory mechanism to mitigate vascular calcification. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. Anti-cancer effect of bee venom on colon cancer cell growth by activation of death receptors and inhibition of nuclear factor kappa B.

    Science.gov (United States)

    Zheng, Jie; Lee, Hye Lim; Ham, Young Wan; Song, Ho Sueb; Song, Min Jong; Hong, Jin Tae

    2015-12-29

    Bee venom (BV) has been used as a traditional medicine to treat arthritis, rheumatism, back pain, cancerous tumors, and skin diseases. However, the effects of BV on the colon cancer and their action mechanisms have not been reported yet. We used cell viability assay and soft agar colony formation assay for testing cell viability, electro mobility shift assay for detecting DNA binding activity of nuclear factor kappa B (NF-κB) and Western blotting assay for detection of apoptosis regulatory proteins. We found that BV inhibited growth of colon cancer cells through induction of apoptosis. We also found that the expression of death receptor (DR) 4, DR5, p53, p21, Bax, cleaved caspase-3, cleaved caspase-8, and cleaved caspase-9 was increased by BV treatment in a dose dependent manner (0-5 μg/ml). Consistent with cancer cell growth inhibition, the DNA binding activity of nuclear factor kappa B (NF-κB) was also inhibited by BV treatment. Besides, we found that BV blocked NF-κB activation by directly binding to NF-κB p50 subunit. Moreover, combination treatment with BV and p50 siRNA or NF-κB inhibitor augmented BV-induced cell growth inhibition. However, p50 mutant plasmid (C62S) transfection partially abolished BV-induced cell growth inhibiton. In addition, BV significantly suppressed tumor growth in vivo. Therefore, these results suggested that BV could inhibit colon cancer cell growth, and these anti-proliferative effects may be related to the induction of apoptosis by activation of DR4 and DR5 and inhibition of NF-κB.

  7. Apium graveolens Extract Inhibits Cell Proliferation and Expression of Vascular Endothelial Growth Factor and Induces Apoptosis in the Human Prostatic Carcinoma Cell Line LNCaP.

    Science.gov (United States)

    Köken, Tülay; Koca, Buğra; Özkurt, Mete; Erkasap, Nilüfer; Kuş, Gökhan; Karalar, Mustafa

    2016-12-01

    Apium graveolens has been shown to inhibit the growth of a variety of cancer tissues. In this study, we investigated the anticancer effect of A. graveolens on the human prostatic carcinoma cell line LNCaP. LNCaP cells were treated with increasing concentrations of an ethanolic extract of A. graveolens ranging from 1000 to 3000 μg/mL, and viability was determined after 24 and 48 h using the XTT cell proliferation assay. The levels of cleaved poly (ADP-ribose) polymerase (PARP), one of the best biomarkers of apoptosis, were analyzed. Finally, quantitative gene expression analysis of vascular endothelial growth factor (VEGF), a critical mediator of angiogenesis, was performed using real-time reverse transcription-polymerase chain reaction. A. graveolens extract inhibited cell viability in both a time- and dose-dependent manner. Data from cleaved PARP assays suggested that A. graveolens caused induction of apoptosis in these cells. Treatment of cells with A. graveolens also resulted in downregulation of VEGF expression. This study showed that the antiproliferative effect exerted by an ethanolic extract of A. graveolens is triggered by induction of apoptosis. We also demonstrated that VEGF expression was downregulated by treatment with A. graveolens extract.

  8. p21WAF1/CIP1 gene transcriptional activation exerts cell growth inhibition and enhances chemosensitivity to cisplatin in lung carcinoma cell

    International Nuclear Information System (INIS)

    Wei, Junxia; Zhao, Jiang; Long, Min; Han, Yuan; Wang, Xi; Lin, Fang; Ren, Jihong; He, Ting; Zhang, Huizhong

    2010-01-01

    Non-small-cell lung carcinomas (NSCLCs) exhibit poor prognosis and are usually resistant to conventional chemotherapy. Absence of p21WAF1/CIP1, a cyclin-dependent kinase (cdk) inhibitor, has been linked to drug resistance in many in vitro cellular models. RNA activation (RNAa) is a transcriptional activation phenomena guided by double-strand RNA (dsRNA) targeting promoter region of target gene. In this study, we explored the effect of up-regulation of p21 gene expression on drug-resistance in A549 non-small-cell lung carcinoma cells by transfecting the dsRNA targeting the promoter region of p21 into A549 cells. Enhanced p21 expression was observed in A549 cells after transfection of dsRNA, which was correlated with a significant growth inhibition and enhancement of chemosensitivity to cisplatin in A549 cells in vitro. Moreover, in vivo experiment showed that saRNA targeting the promoter region of p21 could significantly inhibit A549 xenograft tumor growth. These results indicate that p21 plays a role in lung cancer drug-resistance process. In addition, this study also provides evidence for the usage of saRNA as a therapeutic option for up-regulating lower-expression genes in lung cancer

  9. p21WAF1/CIP1 gene transcriptional activation exerts cell growth inhibition and enhances chemosensitivity to cisplatin in lung carcinoma cell

    Directory of Open Access Journals (Sweden)

    Ren Jihong

    2010-11-01

    Full Text Available Abstract Background Non-small-cell lung carcinomas (NSCLCs exhibit poor prognosis and are usually resistant to conventional chemotherapy. Absence of p21WAF1/CIP1, a cyclin-dependent kinase (cdk inhibitor, has been linked to drug resistance in many in vitro cellular models. RNA activation (RNAa is a transcriptional activation phenomena guided by double-strand RNA (dsRNA targeting promoter region of target gene. Methods In this study, we explored the effect of up-regulation of p21 gene expression on drug-resistance in A549 non-small-cell lung carcinoma cells by transfecting the dsRNA targeting the promoter region of p21 into A549 cells. Results Enhanced p21 expression was observed in A549 cells after transfection of dsRNA, which was correlated with a significant growth inhibition and enhancement of chemosensitivity to cisplatin in A549 cells in vitro. Moreover, in vivo experiment showed that saRNA targeting the promoter region of p21 could significantly inhibit A549 xenograft tumor growth. Conclusions These results indicate that p21 plays a role in lung cancer drug-resistance process. In addition, this study also provides evidence for the usage of saRNA as a therapeutic option for up-regulating lower-expression genes in lung cancer.

  10. p21WAF1/CIP1 gene transcriptional activation exerts cell growth inhibition and enhances chemosensitivity to cisplatin in lung carcinoma cell.

    Science.gov (United States)

    Wei, Junxia; Zhao, Jiang; Long, Min; Han, Yuan; Wang, Xi; Lin, Fang; Ren, Jihong; He, Ting; Zhang, Huizhong

    2010-11-19

    Non-small-cell lung carcinomas (NSCLCs) exhibit poor prognosis and are usually resistant to conventional chemotherapy. Absence of p21WAF1/CIP1, a cyclin-dependent kinase (cdk) inhibitor, has been linked to drug resistance in many in vitro cellular models. RNA activation (RNAa) is a transcriptional activation phenomena guided by double-strand RNA (dsRNA) targeting promoter region of target gene. In this study, we explored the effect of up-regulation of p21 gene expression on drug-resistance in A549 non-small-cell lung carcinoma cells by transfecting the dsRNA targeting the promoter region of p21 into A549 cells. Enhanced p21 expression was observed in A549 cells after transfection of dsRNA, which was correlated with a significant growth inhibition and enhancement of chemosensitivity to cisplatin in A549 cells in vitro. Moreover, in vivo experiment showed that saRNA targeting the promoter region of p21 could significantly inhibit A549 xenograft tumor growth. These results indicate that p21 plays a role in lung cancer drug-resistance process. In addition, this study also provides evidence for the usage of saRNA as a therapeutic option for up-regulating lower-expression genes in lung cancer.

  11. Inhibition of SENP5 by Cucurbitacin B Suppresses Cell Growth and ...

    African Journals Online (AJOL)

    The decrease in mRNA and protein levels of SENP5 led to decrease in proliferation of U2OS and Saos-2 cells. The 48 h cell cultures containing 50 mg of cucurbitacin B caused induction of apoptosis in 54.72 ± 5.42 % of the total cell population in U2OS cells. Similarly, in Saos-2 cells, exposure to 50 mg/mL cucurbitacin B ...

  12. Nerve growth factor inhibits osmotic swelling of rat retinal glial (Müller) and bipolar cells by inducing glial cytokine release.

    Science.gov (United States)

    Garcia, Tarcyane Barata; Pannicke, Thomas; Vogler, Stefanie; Berk, Benjamin-Andreas; Grosche, Antje; Wiedemann, Peter; Seeger, Johannes; Reichenbach, Andreas; Herculano, Anderson Manoel; Bringmann, Andreas

    2014-11-01

    Osmotic swelling of neurons and glial cells contributes to the development of retinal edema and neurodegeneration. We show that nerve growth factor (NGF) inhibits the swelling of glial (Müller) and bipolar cells in rat retinal slices induced by barium-containing hypoosmotic solution. NGF also reduced Müller and bipolar cell swelling in the post-ischemic retina. On the other hand, NGF prevented the swelling of freshly isolated Müller cells, but not of isolated bipolar cells, suggesting that NGF induces a release of factors from Müller cells that inhibit bipolar cell swelling in retinal slices. The inhibitory effect of NGF on Müller cell swelling was mediated by activation of TrkA (the receptor tyrosine kinase A), but not p75(NTR) , and was prevented by blockers of metabotropic glutamate, P2Y1 , adenosine A1 , and fibroblast growth factor receptors. Basic fibroblast growth factor fully inhibited the swelling of freshly isolated Müller cells, but only partially the swelling of isolated bipolar cells. In addition, glial cell line-derived neurotrophic factor and transforming growth factor-β1, but not epidermal growth factor and platelet-derived growth factor, reduced the swelling of bipolar cells. Both Müller and bipolar cells displayed TrkA immunoreactivity, while Müller cells were also immunostained for p75(NTR) and NGF. The data suggest that the neuroprotective effect of NGF in the retina is in part mediated by prevention of the cytotoxic glial and bipolar cell swelling. Cytotoxic cell swelling contributes to retinal neurodegeneration. Nerve growth factor (NGF) inhibits the osmotic swelling of glial cells by acting at TrkA, release of bFGF, and opening of K(+) and Cl(-) channels. The NGF-induced glial release of cytokines like bFGF inhibits the osmotic swelling of bipolar cells, suggesting that the neuroprotective effect of NGF is in part mediated by prevention of cytotoxic cell swelling. © 2014 International Society for Neurochemistry.

  13. The dual mTORC1 and mTORC2 inhibitor AZD8055 inhibits head and neck squamous cell carcinoma cell growth in vivo and in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Li, Qiang; Song, Xin-mao; Ji, Yang-yang; Jiang, Hui; Xu, Lin-gen, E-mail: drlingenxu@126.com

    2013-11-01

    Highlights: •AZD8055 induces significant cytotoxic effects in cultured HNSCC cells. •AZD8055 blocks mTORC1 and mTORC2 activation in cultured HNSCC cells. •JNK activation is required for AZD8055-induced HNSCC cell death. •AZD8055 inhibits Hep-2 cell growth in vivo, and was more efficient than rapamycin. -- Abstract: The serine/threonine kinase mammalian target of rapamycin (mTOR) promotes cell survival and proliferation, and is constitutively activated in head and neck squamous cell carcinoma (HNSCC). Thus mTOR is an important target for drug development in this disease. Here we tested the anti-tumor ability of AZD8055, the novel mTOR inhibitor, in HNSCC cells. AZD8055 induced dramatic cell death of HNSCC lines (Hep-2 and SCC-9) through autophagy. AZD8055 blocked both mTOR complex (mTORC) 1 and mTORC2 activation without affecting Erk in cultured HNSCC cells. Meanwhile, AZD8055 induced significant c-Jun N-terminal kinase (JNK) activation, which was also required for cancer cell death. JNK inhibition by its inhibitors (SP 600125 and JNK-IN-8), or by RNA interference (RNAi) alleviated AZD8055-induced cell death. Finally, AZD8055 markedly increased the survival of Hep-2 transplanted mice through a significant reduction of tumor growth, without apparent toxicity, and its anti-tumor ability was more potent than rapamycin. Meanwhile, AZD8055 administration activated JNK while blocking mTORC1/2 in Hep-2 tumor engrafts. Our current results strongly suggest that AZD8055 may be further investigated for HNSCC treatment in clinical trials.

  14. A Novel Strategy to Inhibit Hedgehog Signaling and Control Growth of Androgen Independent Prostate Cancer Cells

    Science.gov (United States)

    2013-06-01

    activation) inhibition studies: Conduct western blotting and qRT-PCR for expression of Gli and Gli targets, including Ptch1, FoxL1, SNAIL , TWIST and...isolated for hybridization to Signal Transduction Pathway Finder oligo arrays (SA Biosciences) as described by the manufacturer. The resulting images were

  15. Novel piplartine-containing ruthenium complexes: synthesis, cell growth inhibition, apoptosis induction and ROS production on HCT116 cells

    Science.gov (United States)

    D’Sousa Costa, Cinara O.; Araujo Neto, João H.; Baliza, Ingrid R.S.; Dias, Rosane B.; Valverde, Ludmila de F.; Vidal, Manuela T.A.; Sales, Caroline B.S.; Rocha, Clarissa A.G.; Moreira, Diogo R.M.; Soares, Milena B.P.; Batista, Alzir A.; Bezerra, Daniel P.

    2017-01-01

    Piplartine (piperlongumine) is a plant-derived molecule that has been receiving intense interest due to its anticancer characteristics that target the oxidative stress. In the present paper, two novel piplartine-containing ruthenium complexes [Ru(piplartine)(dppf)(bipy)](PF6)2 (1) and [Ru(piplartine)(dppb)(bipy)](PF6)2 (2) were synthesized and investigated for their cellular and molecular responses on cancer cell lines. We found that both complexes are more potent than metal-free piplartine in a panel of cancer cell lines on monolayer cultures, as well in 3D model of cancer multicellular spheroids formed from human colon carcinoma HCT116 cells. Mechanistic studies uncovered that the complexes reduced the cell growth and caused phosphatidylserine externalization, internucleosomal DNA fragmentation, caspase-3 activation and loss of the mitochondrial transmembrane potential on HCT116 cells. Moreover, the pre-treatment with Z-VAD(OMe)-FMK, a pan-caspase inhibitor, reduced the complexes-induced apoptosis, indicating cell death by apoptosis through caspase-dependent and mitochondrial intrinsic pathways. Treatment with the complexes also caused a marked increase in the production of reactive oxygen species (ROS), including hydrogen peroxide, superoxide anion and nitric oxide, and decreased reduced glutathione levels. Application of N-acetyl-cysteine, an antioxidant, reduced the ROS levels and apoptosis induced by the complexes, indicating activation of ROS-mediated apoptosis pathway. RNA transcripts of several genes, including gene related to the cell cycle, apoptosis and oxidative stress, were regulated under treatment. However, the complexes failed to induce DNA intercalation. In conclusion, the complexes are more potent than piplartine against different cancer cell lines and are able to induce caspase-dependent and mitochondrial intrinsic apoptosis on HCT116 cells by ROS-mediated pathway. PMID:29262647

  16. Quercetin inhibits angiogenesis through thrombospondin-1 upregulation to antagonize human prostate cancer PC-3 cell growth in vitro and in vivo.

    Science.gov (United States)

    Yang, Feiya; Jiang, Xian; Song, Liming; Wang, Huiping; Mei, Zhu; Xu, Zhiqing; Xing, Nianzeng

    2016-03-01

    The rapid growth, morbidity and mortality of prostate cancer, and the lack of effective treatment have attracted great interests of researchers to find novel cancer therapies aiming to inhibit angiogenesis and tumor growth. Quercetin is a flavonoid compound that widely exists in the nature. Our previous study preliminarily demonstrated that quercetin effectively inhibited human prostate cancer cell xenograft tumor growth by inhibiting angiogenesis. Thrombospondin-1 (TSP-1) is the first reported endogenous anti-angiogenic factor that can inhibit angiogenesis and tumorigenesis. However, the relationship between quercetin inhibiting angiogenesis and TSP-1 upregulation in prostate cancer has not been determined. Thus, we explored the important role of TSP-1 upregulation in reducing angiogenesis and anti-prostate cancer effect of quercetin both in vitro and in vivo for the first time. After the selected doses were used for a certain time, quercetin i) significantly inhibited PC-3 and human umbilical vein endothelial cells (HUVECs) proliferation, migration and invasion in a dose-dependent manner; ⅱ) effectively inhibited prostate cancer PC-3 cell xenograft tumor growth by 37.5% with 75 mg/kg as compared to vehicle control group, more effective than 25 (22.85%) and 50 mg/kg (29.6%); ⅲ) was well tolerated by BALB/c mice and no obvious toxic reactions were observed; ⅳ) greatly reduced angiogenesis and led to higher TSP-1 protein and mRNA expression both in vitro and in vivo in a dose-dependent manner. Therefore, quercetin could increase TSP-1 expression to inhibit angiogenesis resulting in antagonizing prostate cancer PC-3 cell and xenograft tumor growth. The present study can lay a good basis for the subsequent concrete mechanism study and raise the possibility of applying quercetin to clinical for human prostate cancer in the near future.

  17. Extracts of Opuntia humifusa Fruits Inhibit the Growth of AGS Human Gastric Adenocarcinoma Cells.

    Science.gov (United States)

    Hahm, Sahng-Wook; Park, Jieun; Park, Kun-Young; Son, Yong-Suk; Han, Hyungchul

    2016-03-01

    Opuntia humifusa (OHF) has been used as a nutraceutical source for the prevention of chronic diseases. In the present study, the inhibitory effects of ethyl acetate extracts of OHF on the proliferation of AGS human gastric cancer cells and the mode of action were investigated. To elucidate the antiproliferative mechanisms of OHF in cancer cells, the expression of genes related to apoptosis and cell cycle arrest were determined with real-time PCR and western blot. The cytotoxic effect of OHF on AGS cells was observed in a dose-dependent manner. Exposure to OHF (100 μg/mL) significantly induced (P<0.05) the G1 phase cell cycle arrest. Additionally, the apoptotic cell population was greater (P<0.05) in OHF (200 μg/mL) treated AGS cells when compared to the control. The expression of genes associated with cell cycle progression (Cdk4, Cdk2, and cyclin E) was significantly downregulated (P<0.05) by the OHF treatment. Moreover, the expression of Bax and caspase-3 in OHF treated cells was higher (P<0.05) than in the control. These findings suggest that OHF induces the G1 phase cell cycle arrest and activation of mitochondria-mediated apoptosis pathway in AGS human gastric cancer cells.

  18. Inhibition of gastric acid secretion by epidermal growth factor. Effects on cyclic AMP and on prostaglandin production in rat isolated parietal cells.

    OpenAIRE

    Hatt, J F; Hanson, P J

    1988-01-01

    Histamine (0.5 mM) stimulated the cyclic AMP content of cell suspensions containing greater than 80% parietal cells. Epidermal growth factor (EGF) inhibited this stimulatory effect of histamine, but had no effect on basal cyclic AMP content. The half-maximally effective concentration of EGF for inhibition of histamine-stimulated cyclic AMP was 3.9 nM. The equivalent measurement for the inhibition of histamine-stimulated aminopyrine accumulation was 3.0 nM. Aminopyrine accumulation was measure...

  19. Pectocin M1 (PcaM1 Inhibits Escherichia coli Cell Growth and Peptidoglycan Biosynthesis through Periplasmic Expression

    Directory of Open Access Journals (Sweden)

    Dimitri Chérier

    2016-10-01

    Full Text Available Colicins are bacterial toxins produced by some Escherichia coli strains. They exhibit either enzymatic or pore-forming activity towards a very limited number of bacterial species, due to the high specificity of their reception and translocation systems. Yet, we succeeded in making the colicin M homologue from Pectobacterium carotovorum, pectocin M1 (PcaM1, capable of inhibiting E. coli cell growth by bypassing these reception and translocation steps. This goal was achieved through periplasmic expression of this pectocin. Indeed, when appropriately addressed to the periplasm of E. coli, this pectocin could exert its deleterious effects, i.e., the enzymatic degradation of the peptidoglycan lipid II precursor, which resulted in the arrest of the biosynthesis of this essential cell wall polymer, dramatic morphological changes and, ultimately, cell lysis. This result leads to the conclusion that colicin M and its various orthologues constitute powerful antibacterial molecules able to kill any kind of bacterium, once they can reach their lipid II target. They thus have to be seriously considered as promising alternatives to antibiotics.

  20. Prostacyclin Inhibits Non-Small Cell Lung Cancer Growth by a Frizzled 9-Dependent Pathway That Is Blocked by Secreted Frizzled-Related Protein 1

    Directory of Open Access Journals (Sweden)

    Meredith A. Tennis

    2010-03-01

    Full Text Available The goal of this study was to assess the ability of iloprost, an orally active prostacyclin analog, to inhibit transformed growth of human non-small cell lung cancer (NSCLC and to define the mechanism of iloprost's tumor suppressive effects. In a panel of NSCLC cell lines, the ability of iloprost to inhibit transformed cell growth was not correlated with the expression of the cell surface receptor for prostacyclin, but instead was correlated with the presence of Frizzled 9 (Fzd 9 and the activation of peroxisome proliferator-activated receptor-γ (PPARγ. Silencing of Fzd 9 blocked PPARγ activation by iloprost, and expression of Fzd 9 in cells lacking the protein resulted in iloprost's activation of PPARγ and inhibition of transformed growth. Interestingly, soluble Frizzled-related protein-1, a well-known inhibitor of Wnt/Fzd signaling, also blocked the effects of iloprost and Fzd 9. Moreover, mice treated with iloprost had reduced lung tumors and increased Fzd 9 expression. These studies define a novel paradigm, linking the eicosanoid pathway and Wnt signaling. In addition, these data also suggest that prostacyclin analogs may represent a new class of therapeutic agents in the treatment of NSCLC where the restoration of noncanonical Wnt signaling maybe important for the inhibition of transformed cell growth.

  1. Sepia ink oligopeptide induces apoptosis and growth inhibition in human lung cancer cells

    OpenAIRE

    Zhang, Zhi; Sun, Lei; Zhou, Guoren; Xie, Peng; Ye, Jinjun

    2017-01-01

    Sepia ink oligopeptide (SIO), as a tripeptide extracted from Sepia ink, could be used as an inducer of apoptosis in human prostate cancer cells. We designed a cyclo-mimetic peptide of SIO by introducing a disulfide bond to stabilize the native peptide into beta turn structure, and produced a peptide with higher cell permeability and stability. Through labeling an FITC to the N-terminus of the peptide, the cell permeability was examined. Stabilized peptide showed enhanced cellular uptake than ...

  2. Extracts of Opuntia humifusa Fruits Inhibit the Growth of AGS Human Gastric Adenocarcinoma Cells

    OpenAIRE

    Hahm, Sahng-Wook; Park, Jieun; Park, Kun-Young; Son, Yong-Suk; Han, Hyungchul

    2016-01-01

    Opuntia humifusa (OHF) has been used as a nutraceutical source for the prevention of chronic diseases. In the present study, the inhibitory effects of ethyl acetate extracts of OHF on the proliferation of AGS human gastric cancer cells and the mode of action were investigated. To elucidate the antiproliferative mechanisms of OHF in cancer cells, the expression of genes related to apoptosis and cell cycle arrest were determined with real-time PCR and western blot. The cytotoxic effect of OHF o...

  3. Sulindac Sulfide, but Not Sulindac Sulfone, Inhibits Colorectal Cancer Growth

    Directory of Open Access Journals (Sweden)

    Christopher S. Williams

    1999-06-01

    Full Text Available Sulindac sulfide, a metabolite of the nonsteroidal antiinflammatory drug (NSAID sulindac sulfoxide, is effective at reducing tumor burden in both familial adenomatous polyposis patients and in animals with colorectal cancer. Another sulindac sulfoxide metabolite, sulindac sulfone, has been reported to have antitumor properties without inhibiting cyclooxygenase activity. Here we report the effect of sulindac sulfone treatment on the growth of colorectal carcinoma cells. We observed that sulindac sulfide or sulfone treatment of HCA-7 cells led to inhibition of prostaglandin E2 production. Both sulindac sulfide and sulfone inhibited HCA-7 and HCT-116 cell growth in vitro. Sulindac sulfone had no effect on the growth of either HCA-7 or HCT-116 xenografts, whereas the sulfide derivative inhibited HCA-7 growth in vivo. Both sulindac sulfide and sulfone inhibited colon carcinoma cell growth and prostaglandin production in vitro, but sulindac sulfone had no effect on the growth of colon cancer cell xenografts in nude mice.

  4. Pectic polysaccharide from corn (Zea mays L.) effectively inhibited multi-step mediated cancer cell growth and metastasis.

    Science.gov (United States)

    Jayaram, Smitha; Kapoor, Sabeeta; Dharmesh, Shylaja M

    2015-06-25

    Corn pectic polysaccharide (COPP) inhibited galectin-3 mediated hemagglutination at Minimum Inhibitory Concentration (MIC) of 4.08 μg/mL as opposed to citrus pectin (25 μg/mL), a well known galectin-3 inhibitor and lactose (4.16 μg/mL)--sugar specific to galectin-3. COPP effectively (72%) inhibited invasion and metastasis in experimental animals. In vivo results were substantiated by modulation of cancer specific markers such as galectin-3, which is a key molecule for initiation of metastatic cascade, vascular endothelial growth factor (VEGF) that enhances angiogenesis, matrix metalloproteinases 2 and 9 that are required for invasion, NF-κB, a transcription factor for proliferative potency of tumor cells and a phosphoglucoisomerase (PGI), the activity of which favors cancer cell growth. Structural characterization studies indicate the active component (relatively less acidic, 0.05 M ammonium carbonate, 160 kDa fraction) which showed antimetastatic potency in vitro with MIC of 0.09 μg/mL, and ∼ 45 fold increase in the activity when compared to that of COPP. Gas liquid chromatographic analysis indicated the presence of rhamnose (1%), arabinose (20%), xylose (3%), mannose (4%), galactose (54%) and uronic acid (10%) in different proportions. However, correlative data attributed galectin-3 inhibitory activity to enhanced levels of arabinose and galactose. FTIR, HPLC and NMR spectroscopic analysis further highlights that COPP is an arabinogalactan with methyl/ethyl esters. It is therefore suggested that the blockade of galectin-3 mediated lung metastasis appears to be a result of an inhibition of mixed functions induced during metastasis. The data signifies the importance of dietary carbohydrate as cancer-preventive agent. Although pectin digestibility and absorption are issues of concern, promising in vivo data provides evidence for the cancer preventive property of corn. The present study reveals for the first time a new component of corn, i.e.,--corn pectin

  5. Recombinant FIP-gat, a Fungal Immunomodulatory Protein from Ganoderma atrum, Induces Growth Inhibition and Cell Death in Breast Cancer Cells.

    Science.gov (United States)

    Xu, Hui; Kong, Ying-Yu; Chen, Xin; Guo, Meng-Yuan; Bai, Xiao-Hui; Lu, Yu-Jia; Li, Wei; Zhou, Xuan-Wei

    2016-04-06

    FIP-gat, an immunomodulatory protein isolated from Ganoderma atrum, is a new member of the FIP family. Little is known, however, about its expressional properties and antitumor activities. It was availably expressed in Escherichia coli with a total yield of 29.75 mg/L. The migration of recombinant FIP-gat (rFIP-gat) on SDS-PAGE corresponded to the predicted molecular mass, and the band was correctly detected by a specific antibody. To characterize the direct effects of rFIP-gat on MDA-MB-231 breast cancer cells, MDA-MB-231 cells were treated with different concentrations of rFIP-gat in vitro; the results showed that this protein could reduce cell viability dose-dependently with a median inhibitory concentration (IC50) of 9.96 μg/mL and agglutinate the MDA-MB-231 cells at a concentration as low as 5 μg/mL. Furthermore, FIP-gat at a concentration of 10 μg/mL can induce significant growth inhibition and cell death in MDA-MB-231 cells. Notably, FIP-gat treatment triggers significant cell cycle arrest at the G1/S transition and pronounced increase in apoptotic cell population. Molecular assays based on microarray and real-time PCR further revealed the potential mechanisms encompassing growth arrest, apoptosis, and autophagy underlying the phenotypic effects.

  6. Andrographolide inhibits growth of human T-cell acute lymphoblastic leukemia Jurkat cells by downregulation of PI3K/AKT and upregulation of p38 MAPK pathways

    Directory of Open Access Journals (Sweden)

    Yang T

    2016-04-01

    Full Text Available Tingfang Yang,1 Shuluan Yao,2 Xianfeng Zhang,3 Yan Guo2 1Department of Pediatrics, Jining No 1 People’s Hospital, Shandong Province, People’s Republic of China; 2Department of Respiratory Medicine, Jining Medical University Affiliated Hospital, Shandong Province, People’s Republic of China; 3Department of Psychiatry, Jining Psychiatric Hospital, Shandong Province, People’s Republic of China Abstract: T-cell acute lymphoblastic leukemia (T-ALL as a prevalent hematologic malignancy is one of the most common malignant tumors worldwide in children. Andrographolide (Andro, the major active component from Andrographis paniculata, has been shown to possess antitumor activities in several types of cancer cells. However, whether Andro would inhibit T-ALL cell growth remains unclear. In this study, we investigated the cytotoxic effect of Andro on human T-ALL Jurkat cells and explored the mechanisms of cell death. Cell apoptosis was assayed by flow cytometry, and the signaling transduction for Andro was analyzed by Western blotting. The results indicated 10 µg/mL Andro could significantly induce Jurkat cells’ apoptosis, depending on the inhibition of PI3K/AKT pathway. Moreover, Andro-induced apoptosis is enhanced by AKT-selective inhibitor LY294002. ERK- or JNK-selective inhibitors PD98059 and SP600125 had no effect on Andro-induced apoptosis. In addition, p38 inhibitor SB203580 could reverse Andro-induced apoptosis in Jurkat cells. We also found that the protein expression of p-p53 and p-p38 were increased after Andro treatments. The result of an in vivo study also demonstrated Andro’s dose-dependent inhibition in subcutaneous Jurkat xenografts. In conclusion, our findings explained a novel mechanism of drug action by Andro in Jurkat cells and suggested that Andro might be developed into a new candidate therapy for T-ALL patients in the coming days. Keywords: andrographolide, PI3K, AKT, Burkitt lymphoma, Jurkat cell

  7. Lawsone inhibits cell growth and improves the efficacy of cisplatin in ...

    African Journals Online (AJOL)

    Cell cycle analysis was done by Flow cytometric studies, Immunoblotting studies for protein expression was done, proteins controlling cell cycle such as cyclinD1, cyclin E, cyclin A, cyclin B1 and Cip1/p21 and p53 which also are cyclin dependent inhibitors of protein kinase were estimated. Annexin V staining was done to ...

  8. Transforming growth factor-beta, but not ciliary neurotrophic factor, inhibits DNA synthesis of adrenal medullary cells in vitro

    DEFF Research Database (Denmark)

    Wolf, N; Krohn, K; Bieger, S

    1999-01-01

    by the neuroendocrine chromaffin cells, which also express the transforming growth factor-beta receptor type II. In contrast to the developmentally related sympathetic neurons, chromaffin cells continue to proliferate throughout postnatal life. Using 5-bromo-2'-deoxyuridine pulse labeling and tyrosine hydroxylase......Transforming growth factor-betas are members of a superfamily of multifunctional cytokines regulating cell growth and differentiation. Their functions in neural and endocrine cells are not well understood. We show here that transforming growth factor-betas are synthesized, stored and released...... immunocytochemistry as a marker for young postnatal rat chromaffin cells, we show that treatment with fibroblast growth factor-2 (1 nM) and insulin-like growth factor-II (10 nM) increased the fraction of 5-bromo-2'-deoxyuridine-labeled nuclei from 1% to about 40% of the cells in the absence of serum. In the presence...

  9. Apigenin Inhibits Human SW620 Cell Growth by Targeting Polyamine Catabolism

    Directory of Open Access Journals (Sweden)

    Jing Wang

    2017-01-01

    Full Text Available Apigenin is a nonmutagenic flavonoid that has antitumor properties. Polyamines are ubiquitous cellular polycations, which play an important role in the proliferation and differentiation of cancer cells. Highly regulated pathways control the biosynthesis and degradation of polyamines. Ornithine decarboxylase (ODC is the rate-limiting enzyme in the metabolism, and spermidine/spermine-N1-Acetyl transferase (SSAT is the rate-limiting enzyme in the catabolism of polyamines. In the current study, the effect of increasing concentrations of apigenin on polyamine levels, ODC and SSAT protein expression, mRNA expression, cell proliferation and apoptosis, and the production of reactive oxygen species (ROS was investigated in SW620 colon cancer cells. The results showed that apigenin significantly reduced cell proliferation, decreased the levels of spermidine and spermine, and increased previously downregulated putrescine contents. Apigenin also enhanced SSAT protein and mRNA levels and the production of reactive oxygen species in SW620 cells, though it had no significant effect on the levels of ODC protein or mRNA. Apigenin appears to decrease the proliferation rate of human SW620 cells by facilitating SSAT expression to induce polyamine catabolism and increasing ROS levels to induce cell apoptosis.

  10. Dipeptidyl peptidase-IV inhibits glioma cell growth independent of its enzymatic activity

    Czech Academy of Sciences Publication Activity Database

    Busek, P.; Stremeňová, J.; Sromová, L.; Hilser, M.; Balaziová, E.; Kosek, D.; Trylcová, J.; Strnad, Hynek; Křepela, E.; Šedo, A.

    2012-01-01

    Roč. 44, č. 5 (2012), s. 738-747 ISSN 1357-2725 Institutional support: RVO:68378050 Keywords : protease * tumour suppression * primary cell cultures * astrocytoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.152, year: 2012

  11. Petiveria alliacea extracts uses multiple mechanisms to inhibit growth of human and mouse tumoral cells

    OpenAIRE

    Urue?a, Claudia; Cifuentes, Claudia; Casta?eda, Diana; Arango, Amparo; Kaur, Punit; Asea, Alexzander; Fiorentino, Susana

    2008-01-01

    Abstract Background There is ethnopharmacological evidence that Petiveria alliacea can have antitumor activity; however, the mechanism of its cytotoxic activity is not well understood. We assessed multiple in vitro biological activities of an ethyl acetate soluble plant fraction over several tumor cell lines. Methods Tumor cell lines were evaluated using the following tests: trypan blue exclusion test, MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide], flow cytometry, cytosk...

  12. Growth differentiation factor-15 secreted by prostate cancer cells inhibits differentiation of osteoclasts

    Czech Academy of Sciences Publication Activity Database

    Vaňhara, P.; Lincová, Eva; Souček, Karel; Šmarda, J.

    2009-01-01

    Roč. 276, č. 1 (2009), s. 226 ISSN 1742-464X. [34th FEBS Congress. 04.07.2009-09.07.2009, Prague] R&D Projects: GA ČR(CZ) GA204/07/0834 Grant - others:GA ČR(CZ) GA301/09/1115 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : growth-differentiation factor-15 * osteoclasts * differentiation Subject RIV: BO - Biophysics

  13. Andrographolide inhibits growth of human T-cell acute lymphoblastic leukemia Jurkat cells by downregulation of PI3K/AKT and upregulation of p38 MAPK pathways

    Science.gov (United States)

    Yang, Tingfang; Yao, Shuluan; Zhang, Xianfeng; Guo, Yan

    2016-01-01

    T-cell acute lymphoblastic leukemia (T-ALL) as a prevalent hematologic malignancy is one of the most common malignant tumors worldwide in children. Andrographolide (Andro), the major active component from Andrographis paniculata, has been shown to possess antitumor activities in several types of cancer cells. However, whether Andro would inhibit T-ALL cell growth remains unclear. In this study, we investigated the cytotoxic effect of Andro on human T-ALL Jurkat cells and explored the mechanisms of cell death. Cell apoptosis was assayed by flow cytometry, and the signaling transduction for Andro was analyzed by Western blotting. The results indicated 10 μg/mL Andro could significantly induce Jurkat cells’ apoptosis, depending on the inhibition of PI3K/AKT pathway. Moreover, Andro-induced apoptosis is enhanced by AKT-selective inhibitor LY294002. ERK- or JNK-selective inhibitors PD98059 and SP600125 had no effect on Andro-induced apoptosis. In addition, p38 inhibitor SB203580 could reverse Andro-induced apoptosis in Jurkat cells. We also found that the protein expression of p-p53 and p-p38 were increased after Andro treatments. The result of an in vivo study also demonstrated Andro’s dose-dependent inhibition in subcutaneous Jurkat xenografts. In conclusion, our findings explained a novel mechanism of drug action by Andro in Jurkat cells and suggested that Andro might be developed into a new candidate therapy for T-ALL patients in the coming days. PMID:27114702

  14. TRAF6 inhibits proangiogenic signals in endothelial cells and regulates the expression of vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bruneau, Sarah; Datta, Dipak; Flaxenburg, Jesse A.; Pal, Soumitro [Transplantation Research Center, Division of Nephrology, Department of Medicine, Children' s Hospital Boston, Boston, MA (United States); Department of Pediatrics, Harvard Medical School, Boston, MA (United States); Briscoe, David M., E-mail: david.briscoe@childrens.harvard.edu [Transplantation Research Center, Division of Nephrology, Department of Medicine, Children' s Hospital Boston, Boston, MA (United States); Department of Pediatrics, Harvard Medical School, Boston, MA (United States)

    2012-03-02

    Highlights: Black-Right-Pointing-Pointer TNF-receptor associated factors (TRAFs) function in the angiogenesis response. Black-Right-Pointing-Pointer TRAF6 regulates basal and inducible expression of VEGF in endothelial cells (EC). Black-Right-Pointing-Pointer TRAF6 is an endogenous inhibitor of EC proliferation and migration in EC. Black-Right-Pointing-Pointer TRAF6 inhibits VEGF expression in part via its ability to regulate Src signaling. -- Abstract: TNF-family molecules induce the expression Vascular Endothelial Growth Factor (VEGF) in endothelial cells (EC) and elicit signaling responses that result in angiogenesis. However, the role of TNF-receptor associated factors (TRAFs) as upstream regulators of VEGF expression or as mediators of angiogenesis is not known. In this study, HUVEC were cotransfected with a full-length VEGF promoter-luciferase construct and siRNAs to TRAF 1, -2, -3, -5, -6, and promoter activity was measured. Paradoxically, rather than inhibiting VEGF expression, we found that knockdown of TRAF6 resulted in a 4-6-fold increase in basal VEGF promoter activity compared to control siRNA-transfected EC (P < 0.0001). In addition, knockdown of TRAF 1, -2, -3 or -5 resulted in a slight increase or no change in VEGF promoter activation. Using [{sup 3}H]thymidine incorporation assays as well as the in vitro wound healing assay, we also found that basal rates of EC proliferation and migration were increased following TRAF6 knockdown; and this response was inhibited by the addition of a blocking anti-VEGF antibody into cell cultures. Using a limited protein array to gain insight into TRAF6-dependent intermediary signaling responses, we observed that TRAF6 knockdown resulted in an increase in the activity of Src family kinases. In addition, we found that treatment with AZD-0530, a pharmacological Src inhibitor, reduced the regulatory effect of TRAF6 knockdown on VEGF promoter activity. Collectively, these findings define a novel pro-angiogenic signaling

  15. The E1 copper binding domain of full-length amyloid precursor protein mitigates copper-induced growth inhibition in brain metastatic prostate cancer DU145 cells

    Energy Technology Data Exchange (ETDEWEB)

    Gough, Mallory, E-mail: m.gough1@lancaster.ac.uk; Blanthorn-Hazell, Sophee, E-mail: s.blanthorn-hazell@lancaster.ac.uk; Delury, Craig, E-mail: c.delury@lancaster.ac.uk; Parkin, Edward, E-mail: e.parkin@lancaster.ac.uk

    2014-10-31

    Highlights: • Copper levels are elevated in the tumour microenvironment. • APP mitigates copper-induced growth inhibition of DU145 prostate cancer (PCa) cells. • The APP intracellular domain is a prerequisite; soluble forms have no effect. • The E1 CuBD of APP is also a prerequisite. • APP copper binding potentially mitigates copper-induced PCa cell growth inhibition. - Abstract: Copper plays an important role in the aetiology and growth of tumours and levels of the metal are increased in the serum and tumour tissue of patients affected by a range of cancers including prostate cancer (PCa). The molecular mechanisms that enable cancer cells to proliferate in the presence of elevated copper levels are, therefore, of key importance in our understanding of tumour growth progression. In the current study, we have examined the role played by the amyloid precursor protein (APP) in mitigating copper-induced growth inhibition of the PCa cell line, DU145. A range of APP molecular constructs were stably over-expressed in DU145 cells and their effects on cell proliferation in the presence of copper were monitored. Our results show that endogenous APP expression was induced by sub-toxic copper concentrations in DU145 cells and over-expression of the wild-type protein was able to mitigate copper-induced growth inhibition via a mechanism involving the cytosolic and E1 copper binding domains of the full-length protein. APP likely represents one of a range of copper binding proteins that PCa cells employ in order to ensure efficient proliferation despite elevated concentrations of the metal within the tumour microenvironment. Targeting the expression of such proteins may contribute to therapeutic strategies for the treatment of cancers.

  16. Pterostilbene Inhibits the Growth of Human Esophageal Cancer Cells by Regulating Endoplasmic Reticulum Stress

    Directory of Open Access Journals (Sweden)

    Yingtong Feng

    2016-03-01

    Full Text Available Background/Aims: Pterostilbene (PTE, a natural dimethylated resveratrol analog from blueberries, is known to have diverse pharmacological activities, including anticancer properties. In this study, we investigated the anticancer activity of PTE against human esophageal cancer cells both in vitro and in vivo and explored the role of endoplasmic reticulum (ER stress (ERS signaling in this process. Methods: Cell viability, the apoptotic index, Caspase 3 activity, adhesion, migration, reactive oxygen species (ROS levels, and glutathione (GSH levels were detected to explore the effect of PTE on human EC109 esophageal cancer cells. Furthermore, siRNA transfection and a chemical inhibitor were employed to confirm the role of ERS. Results: PTE treatment dose- and time-dependently decreased the viability of human esophageal cancer EC109 cells. PTE also decreased tumor cell adhesion, migration and intracellular GSH levels while increasing the apoptotic index, Caspase 3 activity and ROS levels, which suggest the strong anticancer activity of PTE. Furthermore, PTE treatment increased the expression of ERS-related molecules (GRP78, ATF6, p-PERK, p-eIF2α and CHOP, upregulated the pro-apoptosis-related protein PUMA and downregulated the anti-apoptosis-related protein Bcl-2 while promoting the translocation of cytochrome c from mitochondria to cytosol and the activation of Caspase 9 and Caspase 12. The downregulation of ERS signaling by CHOP siRNA desensitized esophageal cancer cells to PTE treatment, whereas upregulation of ERS signaling by thapsigargin (THA had the opposite effect. N-Acetylcysteine (NAC, a ROS scavenger, also desensitized esophageal cancer cells to PTE treatment. Conclusions: Overall, the results indicate that PTE is a potent anti-cancer pharmaceutical against human esophageal cancer, and the possible mechanism involves the activation of ERS signaling pathways.

  17. A small molecule disruptor of Rb/Raf-1 interaction inhibits cell proliferation, angiogenesis, and growth of human tumor xenografts in nude mice.

    Science.gov (United States)

    Kinkade, Rebecca; Dasgupta, Piyali; Carie, Adam; Pernazza, Daniele; Carless, Melanie; Pillai, Smitha; Lawrence, Nicholas; Sebti, Said M; Chellappan, Srikumar

    2008-05-15

    Although it is well established that cyclin-dependent kinases phosphorylate and inactivate Rb, the Raf-1 kinase physically interacts with Rb and initiates the phosphorylation cascade early in the cell cycle. We have identified an orally active small molecule, Rb/Raf-1 disruptor 251 (RRD-251), that potently and selectively disrupts the Rb/Raf-1 but not Rb/E2F, Rb/prohibitin, Rb/cyclin E, and Rb/HDAC binding. The selective inhibition of Rb/Raf-1 binding suppressed the ability of Rb to recruit Raf-1 to proliferative promoters and inhibited E2F1-dependent transcriptional activity. RRD-251 inhibited anchorage-dependent and anchorage-independent growth of human cancer cells and knockdown of Rb with short hairpin RNA or forced expression of E2F1 rescued cells from RRD-251-mediated growth arrest. P.o. treatment of mice resulted in significant tumor growth suppression only in tumors with functional Rb, and this was accompanied by inhibition of angiogenesis, inhibition of proliferation, decreased phosphorylated Rb levels, and inhibition of Rb/Raf-1 but not Rb/E2F1 binding in vivo. Thus, selective targeting of Rb/Raf-1 interaction seems to be a promising approach for developing novel chemotherapeutic agents.

  18. Petiveria alliacea extracts uses multiple mechanisms to inhibit growth of human and mouse tumoral cells.

    Science.gov (United States)

    Urueña, Claudia; Cifuentes, Claudia; Castañeda, Diana; Arango, Amparo; Kaur, Punit; Asea, Alexzander; Fiorentino, Susana

    2008-11-18

    There is ethnopharmacological evidence that Petiveria alliacea can have antitumor activity; however, the mechanism of its cytotoxic activity is not well understood. We assessed multiple in vitro biological activities of an ethyl acetate soluble plant fraction over several tumor cell lines. Tumor cell lines were evaluated using the following tests: trypan blue exclusion test, MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide], flow cytometry, cytoskeleton organization analysis, cell cycle, mitochondria membrane depolarization, clonogenicity test, DNA fragmentation test and differential protein expression by HPLC-Chip/MS analysis. F4 fraction characterization was made by HPLC-MS. Petiveria alliacea fraction characterized by de-replication was found to alter actin cytoskeleton organization, induce G2 cell cycle arrest and cause apoptotic cell death in a mitochondria independent way. In addition, we found down regulation of cytoskeleton, chaperone, signal transduction proteins, and proteins involved in metabolic pathways. Finally up regulation of proteins involved in translation and intracellular degradation was also observed. The results of this study indicate that Petiveria alliacea exerts multiple biological activities in vitro consistent with cytotoxicity. Further studies in animal models are needed but Petiveria alliacea appears to be a good candidate to be used as an antitumor agent.

  19. Petiveria alliacea extracts uses multiple mechanisms to inhibit growth of human and mouse tumoral cells

    Directory of Open Access Journals (Sweden)

    Kaur Punit

    2008-11-01

    Full Text Available Abstract Background There is ethnopharmacological evidence that Petiveria alliacea can have antitumor activity; however, the mechanism of its cytotoxic activity is not well understood. We assessed multiple in vitro biological activities of an ethyl acetate soluble plant fraction over several tumor cell lines. Methods Tumor cell lines were evaluated using the following tests: trypan blue exclusion test, MTT [3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide], flow cytometry, cytoskeleton organization analysis, cell cycle, mitochondria membrane depolarization, clonogenicity test, DNA fragmentation test and differential protein expression by HPLC-Chip/MS analysis. F4 fraction characterization was made by HPLC-MS. Results Petiveria alliacea fraction characterized by de-replication was found to alter actin cytoskeleton organization, induce G2 cell cycle arrest and cause apoptotic cell death in a mitochondria independent way. In addition, we found down regulation of cytoskeleton, chaperone, signal transduction proteins, and proteins involved in metabolic pathways. Finally up regulation of proteins involved in translation and intracellular degradation was also observed. Conclusion The results of this study indicate that Petiveria alliacea exerts multiple biological activities in vitro consistent with cytotoxicity. Further studies in animal models are needed but Petiveria alliacea appears to be a good candidate to be used as an antitumor agent.

  20. A metabolite of nobiletin, 4'-demethylnobiletin and atorvastatin synergistically inhibits human colon cancer cell growth by inducing G0/G1 cell cycle arrest and apoptosis.

    Science.gov (United States)

    Wu, Xian; Song, Mingyue; Qiu, Peiju; Li, Fang; Wang, Minqi; Zheng, Jinkai; Wang, Qi; Xu, Fei; Xiao, Hang

    2018-01-24

    Combining different chemopreventive agents is a promising strategy to reduce cancer incidence and mortality due to potential synergistic interactions between these agents. Previously, we demonstrated that oral administration of nobiletin (NBT, a citrus flavonoid) at 0.05% (w/w, in diet) together with atorvastatin (ATST, a lipid-lowering drug) at 0.02% (w/w, in diet) produced much stronger inhibition against colon carcinogenesis in rats in comparison with that produced by NBT (at 0.1% w/w in diet) or ATST (at 0.04% w/w in diet) alone at higher doses. To further elucidate the mechanism of this promising synergy between NBT and ATST, herein, we measured the levels of NBT, its major metabolites and ATST in the colonic tissue of rats fed NBT (0.05% w/w, in diet) + ATST (0.02% w/w, in diet), and determined the mode of interaction between the major NBT metabolite and ATST in inhibiting colon cancer cell growth. HPLC-MS analysis showed that 4'-demethylnobiletin (4DN) is the most abundant metabolite of NBT with a level about 5-fold as high as that of NBT in the colonic tissue, which indicated the potential significance of 4DN in mediating the biological effects of NBT in the colon. We found that co-treatments of 4DN/ATST at 2 : 1 concentration ratio produced much stronger growth inhibitory effects on human colon cancer HT-29 cells than 4DN or ATST alone, and isobologram analysis confirmed that this enhanced inhibitory effect by the 4DN/ATST combination was highly synergistic. The co-treatment of 4DN/ATST led to G0/G1 cell cycle arrest and induced extensive apoptosis in HT-29 cells. Furthermore, the 4DN/ATST co-treatment profoundly modulated key signaling proteins related to the regulation of the cell cycle and apoptosis. Our results demonstrated a strong synergy produced by the 4DN/ATST co-treatment in inhibiting colon cancer cell growth, which provided a novel mechanism by which NBT/ATST in combination synergistically inhibit colon carcinogenesis.

  1. Wnt/β-Catenin Small-Molecule Inhibitor CWP232228 Preferentially Inhibits the Growth of Breast Cancer Stem-like Cells.

    Science.gov (United States)

    Jang, Gyu-Beom; Hong, In-Sun; Kim, Ran-Ju; Lee, Su-Youn; Park, Se-Jin; Lee, Eun-Sook; Park, Jung Hyuck; Yun, Chi-Ho; Chung, Jae-Uk; Lee, Kyoung-June; Lee, Hwa-Yong; Nam, Jeong-Seok

    2015-04-15

    Breast cancer stem cells (BCSC) are resistant to conventional chemotherapy and radiotherapy, which may destroy tumor masses but not all BCSC that can mediate relapses. In the present study, we showed that the level of Wnt/β-catenin signaling in BCSC is relatively higher than in bulk tumor cells, contributing to a relatively higher level of therapeutic resistance. We designed a highly potent small-molecule inhibitor, CWP232228, which antagonizes binding of β-catenin to T-cell factor (TCF) in the nucleus. Notably, although CWP232228 inhibited the growth of both BCSC and bulk tumor cells by inhibiting β-catenin-mediated transcription, BCSC exhibited greater growth inhibition than bulk tumor cells. We also documented evidence of greater insulin-like growth factor-I (IGF-I) expression by BCSC than by bulk tumor cells and that CWP232228 attenuated IGF-I-mediated BCSC functions. These results suggested that the inhibitory effect of CWP232228 on BCSC growth might be achieved through the disruption of IGF-I activity. Taken together, our findings indicate that CWP232228 offers a candidate therapeutic agent for breast cancer that preferentially targets BCSC as well as bulk tumor cells. ©2015 American Association for Cancer Research.

  2. Inhibition of adipose triglyceride lipase (ATGL) by the putative tumor suppressor G0S2 or a small molecule inhibitor attenuates the growth of cancer cells.

    Science.gov (United States)

    Zagani, Rachid; El-Assaad, Wissal; Gamache, Isabelle; Teodoro, Jose G

    2015-09-29

    The G0/G1 switch gene 2 (G0S2) is methylated and silenced in a wide range of human cancers. The protein encoded by G0S2 is an endogenous inhibitor of lipid catabolism that directly binds adipose triglyceride lipase (ATGL). ATGL is the rate-limiting step in triglyceride metabolism. Although the G0S2 gene is silenced in cancer, the impact of ATGL in the growth and survival of cancer cells has never been addressed. Here we show that ectopic expression of G0S2 in non-small cell lung carcinomas (NSCL) inhibits triglyceride catabolism and results in lower cell growth. Similarly, knockdown of ATGL increased triglyceride levels, attenuated cell growth and promoted apoptosis. Conversely, knockdown of endogenous G0S2 enhanced the growth and invasiveness of cancer cells. G0S2 is strongly induced in acute promyelocytic leukemia (APL) cells in response to all trans retinoic acid (ATRA) and we show that inhibition of ATGL in these cells by G0S2 is required for efficacy of ATRA treatment. Our data uncover a novel tumor suppressor mechanism by which G0S2 directly inhibits activity of a key intracellular lipase. Our results suggest that elevated ATGL activity may be a general property of many cancer types and potentially represents a novel target for chemotherapy.

  3. EphB4 Tyrosine Kinase Stimulation Inhibits Growth of MDA-MB-231 Breast Cancer Cells in a Dose and Time Dependent Manner

    Directory of Open Access Journals (Sweden)

    Farnaz Barneh

    2013-01-01

    Full Text Available Background. EphB4 receptor tyrosine kinase is of diagnostic and therapeutic value due to its overexpression in breast tumors. Dual functions of tumor promotion and suppression have been reported for this receptor based on presence or absence of its ligand. To elucidate such discrepancy, we aimed to determine the effect of time- and dose-dependent stimulation of EphB4 on viability and invasion of breast cancer cells via recombinant ephrinB2-Fc. Methods. Cells were seeded into multiwell plates and were stimulated by various concentrations of preclustered ephrinB2-Fc. Cell viability was measured on days 3 and 6 following treatment using alamar-blue when cells were in different states of confluence. Results. Stimulation of cells with ephrinB2 did not pose any significant effect on cell viability before reaching confluence, while inhibition of cell growth was detected after 6 days when cells were in postconfluent state following a dose-dependent manner. EphrinB2 treatment did not affect tubular formation and invasion on matrigel. Conclusion. This study showed that EphB4 can differentially inhibit cells at post confluent state and that presence of ligand manifests growth-inhibitory properties of EphB4 receptor. It is concluded that growth inhibition has occurred possibly due to long treatment with ligand, a process which leads to receptor downregulation.

  4. Constitutive STAT3-activation in Sezary syndrome: tyrphostin AG490 inhibits STAT3-activation, interleukin-2 receptor expression and growth of leukemic Sezary cells

    DEFF Research Database (Denmark)

    Eriksen, K W; Kaltoft, K; Mikkelsen, G

    2001-01-01

    kinase inhibitor, tyrphostine AG490, inhibits STAT3 activation, STAT3 DNA binding, and IL-2Ralpha mRNA and protein expression in parallel; and (4) tyrphostine AG490 inhibits IL-2 driven mitogenesis and triggers apoptosis in SS tumor cells. In conclusion, we provide the first example of a constitutive...... STAT3 activation in SS tumor cells. Moreover, our findings suggest that STAT3 activation might play an important role in the constitutive IL-2Ralpha expression, survival, and growth of malignant SS cells....

  5. Mactosylceramide Prevents Glial Cell Overgrowth by Inhibiting Insulin and Fibroblast Growth Factor Receptor Signaling

    DEFF Research Database (Denmark)

    Gerdøe-Kristensen, Stine; Lund, Viktor K; Wandall, Hans H

    2017-01-01

    Receptor Tyrosine Kinase (RTK) signaling controls key aspects of cellular differentiation, proliferation, survival, metabolism, and migration. Deregulated RTK signaling also underlies many cancers. Glycosphingolipids (GSL) are essential elements of the plasma membrane. By affecting clustering...... hyperactivation is caused by absence of MacCer and not by GlcCer accumulation. We conclude that an early product in GSL biosynthesis, MacCer, prevents inappropriate activation of Insulin and Fibroblast Growth Factor Receptors in Drosophila glia. This article is protected by copyright. All rights reserved....

  6. Activation of arylhydrocarbon receptor (AhR) in T lineage cells inhibits cellular growth

    Energy Technology Data Exchange (ETDEWEB)

    Nohara, K.; Tomohiro, I.; Chiharu, T. [National Institute for Environmental Studies, Tsukuba (Japan)

    2004-09-15

    Dioxins, including the most toxic congener, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), exert their toxic effects by binding and activating the arylhydrocarbon receptor (AhR), a liganddependent transcription factor. Upon binding dioxins, the AhR in the cytoplasm is activated and translocated to the nucleus, where it heterodimerizes with another transcription factor, ARNT. The AhR/ARNT heterodimer modulates expressions of various genes by binding xenobiotic responsive elements (XREs) in their enhancer regions or modifies cellular functions through protein-protein interactions. The AhR activation by TCDD exposure induces various immunotoxic reactions including thymus involution and suppression of T cell-dependent antibody production. We have investigated the roles of AhR activation in T lineage cells and their underlying mechanisms by generating transgenic (Tg) mice expressing a constitutively active AhR (CA-AhR) mutant specifically in T cells and by transiently expressing the CA-AhR mutant in Jurkat T cells.

  7. Procyanidins from Pinus koraiensis bark inhibits HeLa cell growth by ...

    African Journals Online (AJOL)

    Recently, the development of herbal medicine is an important advancement in anticancer therapy. Pinus koraiensis ... PKBPE could make the agarose gel electrophoresis of HeLa cells appear with “ladder” zone in a dose-dependent manner, increase the expression of Bax, reduce Bcl-2 and survivin protein expressions.

  8. Procyanidins from Pinus koraiensis bark inhibits HeLa cell growth by ...

    African Journals Online (AJOL)

    Jane

    that the mechanism of PKBPE inducing apoptosis might be associated with increasing the expression of Bax protein, reducing Bcl-2 and survivin protein expressions. Key words: Pinus koraiensis bark, procyanidins, HeLa cell, apoptosis. INTRODUCTION ..... dent apoptosis, mitosis regulation and apoptosis suppression, but ...

  9. The farnesyltransferase inhibitor, LB42708, inhibits growth and induces apoptosis irreversibly in H-ras and K-ras-transformed rat intestinal epithelial cells

    International Nuclear Information System (INIS)

    Kim, Han-Soo; Kim, Ju Won; Gang, Jingu; Wen, Jing; Koh, Sang Seok; Koh, Jong Sung; Chung, Hyun-Ho; Song, Si Young

    2006-01-01

    LB42708 (LB7) and LB42908 (LB9) are pyrrole-based orally active farnesyltransferase inhibitors (FTIs) that have similar structures. The in vitro potencies of these compounds against FTase and GGTase I are remarkably similar, and yet they display different activity in apoptosis induction and morphological reversion of ras-transformed rat intestinal epithelial (RIE) cells. Both FTIs induced cell death despite K-ras prenylation, implying the participation of Ras-independent mechanism(s). Growth inhibition by these two FTIs was accompanied by G1 and G2/M cell cycle arrests in H-ras and K-ras-transformed RIE cells, respectively. We identified three key markers, p21 CIP1/WAF1 , RhoB and EGFR, that can explain the differences in the molecular mechanism of action between two FTIs. Only LB7 induced the upregulation of p21 CIP1/WAF1 and RhoB above the basal level that led to the cell cycle arrest and to distinct morphological alterations of ras-transformed RIE cells. Both FTIs successfully inhibited the ERK and activated JNK in RIE/K-ras cells. While the addition of conditioned medium from RIE/K-ras reversed the growth inhibition of ras-transformed RIE cells by LB9, it failed to overcome the growth inhibitory effect of LB7 in both H-ras- and K-ras-transformed RIE cells. We found that LB7, but not LB9, decreased the expression of EGFRs that confers the cellular unresponsiveness to EGFR ligands. These results suggest that LB7 causes the induction of p21 CIP1/WAF1 and RhoB and downregulation of EGFR that may serve as critical steps in the mechanism by which FTIs trigger irreversible inhibitions on the cell growth and apoptosis in ras-transformed cells

  10. RNA interference-mediated c-MYC inhibition prevents cell growth and decreases sensitivity to radio- and chemotherapy in childhood medulloblastoma cells

    International Nuclear Information System (INIS)

    Bueren, André O von; Shalaby, Tarek; Oehler-Jänne, Christoph; Arnold, Lucia; Stearns, Duncan; Eberhart, Charles G; Arcaro, Alexandre; Pruschy, Martin; Grotzer, Michael A

    2009-01-01

    With current treatment strategies, nearly half of all medulloblastoma (MB) patients die from progressive tumors. Accordingly, the identification of novel therapeutic strategies remains a major goal. Deregulation of c-MYC is evident in numerous human cancers. In MB, over-expression of c-MYC has been shown to cause anaplasia and correlate with unfavorable prognosis. To study the role of c-MYC in MB biology, we down-regulated c-MYC expression by using small interfering RNA (siRNA) and investigated changes in cellular proliferation, cell cycle analysis, apoptosis, telomere maintenance, and response to ionizing radiation (IR) and chemotherapeutics in a representative panel of human MB cell lines expressing different levels of c-MYC (DAOY wild-type, DAOY transfected with the empty vector, DAOY transfected with c-MYC, D341, and D425). siRNA-mediated c-MYC down-regulation resulted in an inhibition of cellular proliferation and clonogenic growth, inhibition of G1-S phase cell cycle progression, and a decrease in human telomerase reverse transcriptase (hTERT) expression and telomerase activity. On the other hand, down-regulation of c-MYC reduced apoptosis and decreased the sensitivity of human MB cells to IR, cisplatin, and etoposide. This effect was more pronounced in DAOY cells expressing high levels of c-MYC when compared with DAOY wild-type or DAOY cells transfected with the empty vector. In human MB cells, in addition to its roles in growth and proliferation, c-MYC is also a potent inducer of apoptosis. Therefore, targeting c-MYC might be of therapeutic benefit when used sequentially with chemo- and radiotherapy rather than concomitantly

  11. Sialic acid-binding lectin from bullfrog eggs inhibits human malignant mesothelioma cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Takeo Tatsuta

    Full Text Available Malignant mesothelioma is an aggressive cancer that results from exposure to asbestos. The therapeutic options for this type of cancer are limited; therefore, the development of novel therapeutic agents is urgently required. Sialic acid-binding lectin isolated from Rana catesbeiana oocytes (cSBL is a novel therapeutic candidate for cancer, which exhibits antitumor activity mediated through RNA degradation. In the present study, we evaluated the effect of cSBL in vitro and in vivo. Xenograft-competent H2452 and MSTO human mesothelioma cell lines were treated with cSBL, and the pathway by which cSBL induces apoptosis was analyzed. In vivo studies were performed using nude mice inoculated with one of the two cell lines, and the effects of cSBL and pemetrexed were monitored simultaneously. Furthermore, the pharmacological interactions between the three agents (pemetrexed, cisplatin and cSBL were statistically assessed. It was demonstrated that cSBL treatments caused morphological and biochemical apoptotic changes in both cell lines. Caspase cascade analysis revealed that an intrinsic pathway mediated cSBL-induced apoptosis. The administration of cSBL significantly inhibited tumor growth in two xenograft models, without any adverse effects. Furthermore, the combination index and dose reduction index values indicated that the cSBL + pemetrexed combination showed the highest synergism, and thus potential for reducing dosage of each drug, compared with the other combinations, including the existing pemetrexed + cisplatin regimen. cSBL exerted prominent antitumor effects on malignant mesothelioma cells in vitro and in vivo, and showed favorable effects when combined with pemetrexed. These results suggest that cSBL has potential as a novel drug for the treatment of malignant mesothelioma.

  12. Molecular mechanisms involved in the inhibition of tumor cells proliferation exposed to elevated concentrations of the epidermal growth factor

    International Nuclear Information System (INIS)

    Guillen, Isabel A; Berlanga, Jorge; Camacho, Hanlet

    2013-01-01

    The EGF promotes inhibition of cell proliferation in vitro and in vivo models depending on its concentration, application schema and the type of tumor cells on which it acts. Our research hypothesis was based on the fact that the EGF varies the expression of genes involved in a negative regulation of tumor cell lines proliferation carrying high levels of its receptor (EGFR). Our objectives were, to obtain information about the effect of EGF on tumor cell proliferation in vitro and in vivo models and, know the gene expression patterns of a group of genes involved in cancer signaling pathways and EGFR. The results showed that EGF at nanomolar concentrations inhibits the tumor cells proliferation bearing high levels of EGFR and, promotes the survival of treated animals, establishing a direct relationship between the inhibition of cell proliferation, high concentrations of EGF and, high amount of EGFR in the cells. The differential gene expression profile showed a variation in a group of genes which exert a powerful control over the cell cycle progression, gene transcription and apoptosis. It was concluded that the inhibition of tumor cell proliferation by the action of EGF is due to activation of molecular mechanisms controlling cell cycle progression. This work won the Annual Award of the Cuban Academy of Sciences in 2012

  13. Verrucarin A, a protein synthesis inhibitor, induces growth inhibition and apoptosis in breast cancer cell lines MDA-MB-231 and T47D.

    Science.gov (United States)

    Palanivel, Kandasamy; Kanimozhi, Veerasamy; Kadalmani, Balamuthu; Akbarsha, Mohammad Abdulkader

    2013-09-01

    Verrucarin A (VA), a protein synthesis inhibitor, derived from the pathogen fungus Myrothecium verrucaria, inhibits growth of leukemia cell lines and activates caspases and apoptosis and inflammatory signaling in macrophages. We have investigated VA-induced growth inhibition in breast cancer cells MDA-MB-231 and T47D and, particularly, the mechanism of VA-induced apoptosis. VA treatment brought about apoptotic cell death in a dose- and time-dependent manner which was associated with chromatin condensation, cell shrinkage, nuclear fragmentation and intracellular ROS production. Mitochondrial membrane depolarization, activation of caspase-3, down-regulation of Bcl-2 expression and up-regulation of Bax and p53 expression were observed. VA thus affects the viability of both the breast cancer cells by triggering ROS-mediated intrinsic mechanism of apoptosis.

  14. Embelin suppresses growth of human pancreatic cancer xenografts, and pancreatic cancer cells isolated from KrasG12D mice by inhibiting Akt and Sonic hedgehog pathways.

    Directory of Open Access Journals (Sweden)

    Minzhao Huang

    Full Text Available Pancreatic cancer is a deadly disease, and therefore effective treatment and/or prevention strategies are urgently needed. The objectives of this study were to examine the molecular mechanisms by which embelin inhibited human pancreatic cancer cell growth in vitro, and xenografts in Balb C nude mice, and pancreatic cancer cell growth isolated from KrasG12D transgenic mice. XTT assays were performed to measure cell viability. AsPC-1 cells were injected subcutaneously into Balb c nude mice and treated with embelin. Cell proliferation and apoptosis were measured by Ki67 and TUNEL staining, respectively. The expression of Akt, and Sonic Hedgehog (Shh and their target gene products were measured by the immunohistochemistry, and Western blot analysis. The effects of embelin on pancreatic cancer cells isolated from 10-months old KrasG12D mice were also examined. Embelin inhibited cell viability in pancreatic cancer AsPC-1, PANC-1, MIA PaCa-2 and Hs 766T cell lines, and these inhibitory effects were blocked either by constitutively active Akt or Shh protein. Embelin-treated mice showed significant inhibition in tumor growth which was associated with reduced expression of markers of cell proliferation (Ki67, PCNA and Bcl-2 and cell cycle (cyclin D1, CDK2, and CDK6, and induction of apoptosis (activation of caspase-3 and cleavage of PARP, and increased expression of Bax. In addition, embelin inhibited the expression of markers of angiogenesis (COX-2, VEGF, VEGFR, and IL-8, and metastasis (MMP-2 and MMP-9 in tumor tissues. Antitumor activity of embelin was associated with inhibition of Akt and Shh pathways in xenografts, and pancreatic cancer cells isolated from KrasG12D mice. Furthermore, embelin also inhibited epithelial-to-mesenchymal transition (EMT by up-regulating E-cadherin and inhibiting the expression of Snail, Slug, and ZEB1. These data suggest that embelin can inhibit pancreatic cancer growth, angiogenesis and metastasis by suppressing Akt and

  15. Regorafenib inhibited gastric cancer cells growth and invasion via CXCR4 activated Wnt pathway

    OpenAIRE

    Lin, Xiao-Lin; Xu, Qi; Tang, Lei; Sun, Li; Han, Ting; Wang, Li-Wei; Xiao, Xiu-Ying

    2017-01-01

    Aim Regorafenib is an oral small-molecule multi kinase inhibitor. Recently, several clinical trials have revealed that regorafenib has an anti-tumor activity in gastric cancer. However, only part of patients benefit from regorafenib, and the mechanisms of regorafenib?s anti-tumor effect need further demonstrating. In this study, we would assess the potential anti-tumor effects and the underlying mechanisms of regorafenib in gastric cancer cells, and explore novel biomarkers for patients selec...

  16. Process for inhibiting the growth of a culture of lactic acid bacteria, and optionally lysing the bacterial cells, and uses of the resulting lysed culture

    NARCIS (Netherlands)

    Nauta, Arjen; Venema, Gerard; Kok, Jan; Ledeboer, Aat M.

    1995-01-01

    The invention provides a process for inhibiting the growth of a culture of lactic acid bacteria, or a product containing such culture e.g. a cheese product, in which in the cells of the lactic acid bacteria a holin obtainable from bacteriophages of Gram-positive bacteria, esp. from bacteriophages of

  17. Chlorella sorokiniana induces mitochondrial-mediated apoptosis in human non-small cell lung cancer cells and inhibits xenograft tumor growth in vivo.

    Science.gov (United States)

    Lin, Ping-Yi; Tsai, Ching-Tsan; Chuang, Wan-Ling; Chao, Ya-Hsuan; Pan, I-Horng; Chen, Yu-Kuo; Lin, Chi-Chen; Wang, Bing-Yen

    2017-02-01

    Lung cancer is one of the leading causes of cancer related deaths worldwide. Marine microalgae are a source of biologically active compounds and are widely consumed as a nutritional supplement in East Asian countries. It has been reported that Chlorella or Chlorella extracts have various beneficial pharmacological compounds that modulate immune responses; however, no studies have investigated the anti-cancer effects of Chlorella sorokiniana (CS) on non-small cell lung cancer (NSCLC). In this study, we evaluated the anti-cancer effects of CS in two human NSCLC cell lines (A549 and CL1-5 human lung adenocarcinoma cells), and its effects on tumor growth in a subcutaneous xenograft tumor model. We also investigated the possible molecular mechanisms governing the pharmacological function of CS. Our results showed that exposure of the two cell lines to CS resulted in a concentration-dependent reduction in cell viability. In addition, the percentage of apoptotic cells increased in a dose-dependent manner, suggesting that CS might induce apoptosis in human NSCLC cells. Western blot analysis revealed that exposure to CS resulted in increased protein expression of the cleaved/activated forms of caspase-3, caspase-9, and PARP, except caspase-8. ZDEVD (caspase-3 inhibitor) and Z-LEHD (caspase-9 inhibitor) were sufficient at preventing apoptosis in both A549 and CL1-5 cells, proving that CS induced cell death via the mitochondria-mediated apoptotic pathway. Exposure of A549 and CL1-5 cells to CS for 24 h resulted in decreased expression of Bcl-2 protein and increased expression of Bax protein as well as decreased expression of two IAP family proteins, survivin and XIAP. We demonstrated that CS induces mitochondrial-mediated apoptosis in NSCLC cells via downregulation of Bcl-2, XIAP and survivin. In addition, we also found that the tumors growth of subcutaneous xenograft in vivo was markedly inhibited after oral intake of CS.

  18. Synergistic effects of acyclic retinoid and OSI-461 on growth inhibition and gene expression in human hepatoma cells.

    Science.gov (United States)

    Shimizu, Masahito; Suzui, Masumi; Deguchi, Atsuko; Lim, Jin T E; Xiao, Danhua; Hayes, Julia H; Papadopoulos, Kyriakos P; Weinstein, I Bernard

    2004-10-01

    Hepatoma is one of the most frequently occurring cancers worldwide. However, effective chemotherapeutic agents for this disease have not been developed. Acyclic retinoid, a novel synthetic retinoid, can reduce the incidence of postsurgical recurrence of hepatoma and improve the survival rate. OSI-461, a potent derivative of exisulind, can increase intracellular levels of cyclic GMP, which leads to activation of protein kinase G and induction of apoptosis in cancer cells. In the present study, we examined the combined effects of acyclic retinoid plus OSI-461 in the HepG2 human hepatoma cell line. We found that the combination of as little as 1.0 micromol/L acyclic retinoid and 0.01 micromol/L OSI-461 exerted synergistic inhibition of the growth of HepG2 cells. Combined treatment with low concentrations of these two agents also acted synergistically to induce apoptosis in HepG2 cells through induction of Bax and Apaf-1, reduction of Bcl-2 and Bcl-xL, and activation of caspase-3, -8, and -9. OSI-461 enhanced the G0-G1 arrest caused by acyclic retinoid, and the combination of these agents caused a synergistic decrease in the levels of expression of cyclin D1 protein and mRNA, inhibited cyclin D1 promoter activity, decreased the level of hyperphosphorylated forms of the Rb protein, induced increased cellular levels of the p21(CIP1) protein and mRNA, and stimulated p21(CIP1) promoter activity. Moreover, OSI-461 enhanced the ability of acyclic retinoid to induce increased cellular levels of retinoic acid receptor beta and to stimulate retinoic acid response element-chloramphenicol acetyltransferase activity. A hypothetical model involving concerted effects on p21(CIP1) and retinoic acid receptor beta expression is proposed to explain these synergistic effects. Our results suggest that the combination of acyclic retinoid plus OSI-461 might be an effective regimen for the chemoprevention and chemotherapy of human hepatoma and possibly other malignancies.

  19. MicroRNA 128a increases intracellular ROS level by targeting Bmi-1 and inhibits medulloblastoma cancer cell growth by promoting senescence.

    Directory of Open Access Journals (Sweden)

    Sujatha Venkataraman

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are a class of short non-coding RNAs that regulate cell homeostasis by inhibiting translation or degrading mRNA of target genes, and thereby can act as tumor suppressor genes or oncogenes. The role of microRNAs in medulloblastoma has only recently been addressed. We hypothesized that microRNAs differentially expressed during normal CNS development might be abnormally regulated in medulloblastoma and are functionally important for medulloblastoma cell growth. METHODOLOGY AND PRINCIPAL FINDINGS: We examined the expression of microRNAs in medulloblastoma and then investigated the functional role of one specific one, miR-128a, in regulating medulloblastoma cell growth. We found that many microRNAs associated with normal neuronal differentiation are significantly down regulated in medulloblastoma. One of these, miR-128a, inhibits growth of medulloblastoma cells by targeting the Bmi-1 oncogene. In addition, miR-128a alters the intracellular redox state of the tumor cells and promotes cellular senescence. CONCLUSIONS AND SIGNIFICANCE: Here we report the novel regulation of reactive oxygen species (ROS by microRNA 128a via the specific inhibition of the Bmi-1 oncogene. We demonstrate that miR-128a has growth suppressive activity in medulloblastoma and that this activity is partially mediated by targeting Bmi-1. This data has implications for the modulation of redox states in cancer stem cells, which are thought to be resistant to therapy due to their low ROS states.

  20. UV-B inhibition of hypocotyl growth in etiolated Arabidopsis thaliana seedlings is a consequence of cell cycle arrest initiated by photodimer accumulation

    Science.gov (United States)

    Biever, Jessica J.; Brinkman, Doug; Gardner, Gary

    2014-01-01

    Ultraviolet (UV) radiation is an important constituent of sunlight that determines plant morphology and growth. It induces photomorphogenic responses but also causes damage to DNA. Arabidopsis mutants of the endonucleases that function in nucleotide excision repair, xpf-3 and uvr1-1, showed hypersensitivity to UV-B (280–320nm) in terms of inhibition of hypocotyl growth. SOG1 is a transcription factor that functions in the DNA damage signalling response after γ-irradiation. xpf mutants that carry the sog1-1 mutation showed hypocotyl growth inhibition after UV-B irradiation similar to the wild type. A DNA replication inhibitor, hydroxyurea (HU), also inhibited hypocotyl growth in etiolated seedlings, but xpf-3 was not hypersensitive to HU. UV-B irradiation induced accumulation of the G2/M-specific cell cycle reporter construct CYCB1;1-GUS in wild-type Arabidopsis seedlings that was consistent with the expected accumulation of photodimers and coincided with the time course of hypocotyl growth inhibition after UV-B treatment. Etiolated mutants of UVR8, a recently described UV-B photoreceptor gene, irradiated with UV-B showed inhibition of hypocotyl growth that was not different from that of the wild type, but they lacked UV-B-specific expression of chalcone synthase (CHS), as expected from previous reports. CHS expression after UV-B irradiation was not different in xpf-3 compared with the wild type, nor was it altered after HU treatment. These results suggest that hypocotyl growth inhibition by UV-B light in etiolated Arabidopsis seedlings, a photomorphogenic response, is dictated by signals originating from UV-B absorption by DNA that lead to cell cycle arrest. This process occurs distinct from UVR8 and its signalling pathway responsible for CHS induction. PMID:24591052

  1. Octa-arginine mediated delivery of wild-type Lnk protein inhibits TPO-induced M-MOK megakaryoblastic leukemic cell growth by promoting apoptosis.

    Directory of Open Access Journals (Sweden)

    Chung Yeng Looi

    Full Text Available BACKGROUND: Lnk plays a non-redundant role by negatively regulating cytokine signaling of TPO, SCF or EPO. Retroviral expression of Lnk has been shown to suppress hematopoietic leukemic cell proliferation indicating its therapeutic value in cancer therapy. However, retroviral gene delivery carries risks of insertional mutagenesis. To circumvent this undesired consequence, we fused a cell permeable peptide octa-arginine to Lnk and evaluated the efficacy of inhibition of leukemic cell proliferation in vitro. METHODOLOGY/PRINCIPAL FINDINGS: In this study, proliferation assays, flow cytometry, Western Blot analyses were performed on wild-type (WT, mutant Lnk R8 or BSA treated M-MOK cells. We found that delivered WT, but not mutant Lnk R8 blocked TPO-induced M-MOK megakaryoblastic leukemic cell proliferation. In contrast, WT Lnk R8 showed no growth inhibitive effect on non-hematopoietic HELA or COS-7 cell. Moreover, we demonstrated that TPO-induced M-MOK cell growth inhibition by WT Lnk R8 was dose-dependent. Penetrated WT Lnk R8 induced cell cycle arrest and apoptosis. Immunoprecipitation and Western blots data indicated WT Lnk R8 interacted with endogeneous Jak2 and downregulated Jak-Stat and MAPK phosphorylation level in M-MOK cells after TPO stimulation. Treatment with specific inhibitors (TG101348 and PD98059 indicated Jak-Stat and MAPK pathways were crucial for TPO-induced proliferation of M-MOK cells. Further analyses using TF-1 and HEL leukemic cell-lines showed that WT Lnk R8 inhibited Jak2-dependent cell proliferation. Using cord blood-derived CD34+ stem cells, we found that delivered WT Lnk R8 blocked TPO-induced megakaryopoiesis in vitro. CONCLUSIONS/SIGNIFICANCE: Intracellular delivery of WT Lnk R8 fusion protein efficiently inhibited TPO-induced M-MOK leukemic cell growth by promoting apoptosis. WT Lnk R8 protein delivery may provide a safer and more practical approach to inhibit leukemic cell growth worthy of further development.

  2. Enhanced Growth Inhibition of Osteosarcoma by Cytotoxic Polymerized Liposomal Nanoparticles Targeting the Alcam Cell Surface Receptor

    Directory of Open Access Journals (Sweden)

    Noah Federman

    2012-01-01

    Full Text Available Osteosarcoma is the most common primary malignancy of bone in children, adolescents, and adults. Despite extensive surgery and adjuvant aggressive high-dose systemic chemotherapy with potentially severe bystander side effects, cure is attainable in about 70% of patients with localized disease and only 20%–30% of those patients with metastatic disease. Targeted therapies clearly are warranted in improving our treatment of this adolescent killer. However, a lack of osteosarcoma-associated/specific markers has hindered development of targeted therapeutics. We describe a novel osteosarcoma-associated cell surface antigen, ALCAM. We, then, create an engineered anti-ALCAM-hybrid polymerized liposomal nanoparticle immunoconjugate (α-AL-HPLN to specifically target osteosarcoma cells and deliver a cytotoxic chemotherapeutic agent, doxorubicin. We have demonstrated that α-AL-HPLNs have significantly enhanced cytotoxicity over untargeted HPLNs and over a conventional liposomal doxorubicin formulation. In this way, α-AL-HPLNs are a promising new strategy to specifically deliver cytotoxic agents in osteosarcoma.

  3. Exploring adjuvant epidermal growth factor receptor inhibition in non-small cell lung cancer.

    Science.gov (United States)

    Stella, Giulia M; Piloni, Davide

    2017-06-01

    Lung cancer is among the most important causes of death worldwide. Despite the relevant progresses in the personalized approach to lung cancer, patients' survival is still poor. Only a minor fraction of patients can be addressed to surgery for radical tumor removal. Adjuvant chemotherapy is currently recommended for resected stages II and III patients although it is known that it can modestly contribute to survival prolongation. A better identification of molecular markers, predictive of adjuvant chemo response is now mandatory, in order to reduce useless toxicities and identify those patients who could really benefit. Here we present and analyze a recent paper by Huang et al. aimed at evaluating the prognostic role of epidermal growth factor receptor (EGFR) activation in adjuvant setting in order to determine whether the administration of EGFR tyrosine-kinase inhibitors could improve the outcomes of patients affected by NSCLC undergoing complete resection. Moreover we provide an exhaustive literature revision that could be helpful for a proper management of that small cohort of EGFR-mutated resected NSCLC.

  4. A small molecule disruptor of Rb-Raf-1 interaction inhibits cell proliferation, angiogenesis and growth of human tumor xenografts in nude mice

    Science.gov (United States)

    Kinkade, Rebecca; Dasgupta, Piyali; Carie, Adam; Pernazza, Daniele; Carless, Melanie; Pillai, Smitha; Lawrence, Nicholas; Sebti, Said M.; Chellappan, Srikumar

    2011-01-01

    Though it is well established that cyclin-dependent kinases phosphorylate and inactivate Rb, the Raf-1 kinase physically interacts with Rb and initiates the phosphorylation cascade early in the cell cycle. We have identified an orally-active small molecule, RRD-251 (Rb – Raf-1 Disruptor 251), that potently and selectively disrupts the Rb/Raf-1 but not Rb/E2F, Rb/Prohibitin, Rb/Cyclin E and Rb/HDAC binding. The selective inhibition of Rb/Raf-1 binding suppressed the ability of Rb to recruit Raf-1 to proliferative promoters and inhibited E2F1-dependent transcriptional activity. RRD-251 inhibited anchorage-dependent and –independent growth of human cancer cells; and knockdown of Rb with shRNA or forced expression of E2F1 rescued from RRD251-mediated growth arrest. Oral treatment of mice resulted in significant tumor growth suppression only in tumors with functional Rb; and this was accompanied by inhibition of angiogenesis, inhibition of proliferation, decreased phospho-Rb levels, and inhibition of Rb/Raf-1 but not Rb/E2F1 binding in vivo. Thus, selective targeting of Rb-Raf-1 interaction appears to be a promising approach for developing novel chemotherapeutic agents. PMID:18483265

  5. Effects of short-hairpin RNA-inhibited {beta}-catenin expression on the growth of human multiple myeloma cells in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Wenqing, E-mail: liangwenqing_1234@126.com [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Yang, Chengwei [Department of Spinal Surgery, Lanzhou General Hospital, Lanzhou Military Area Command, 333 Nanbinhe Road, Lanzhou 730050 (China); Qian, Yu [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Fu, Qiang, E-mail: chyygklwq@hotmail.com [Department of Orthopaedics, Changhai Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200433 (China)

    2012-06-15

    Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interference was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.

  6. AS1411-Induced Growth Inhibition of Glioma Cells by Up-Regulation of p53 and Down-Regulation of Bcl-2 and Akt1 via Nucleolin.

    Directory of Open Access Journals (Sweden)

    Ye Cheng

    Full Text Available AS1411 binds nucleolin (NCL and is the first oligodeoxynucleotide aptamer to reach phase I and II clinical trials for the treatment of several cancers. However, the mechanisms by which AS1411 targets and kills glioma cells and tissues remain unclear. Here we report that AS1411 induces cell apoptosis and cycle arrest, and inhibits cell viability by up-regulation of p53 and down-regulation of Bcl-2 and Akt1 in human glioma cells. NCL was overexpressed in both nucleus and cytoplasm in human glioma U87, U251 and SHG44 cells compared to normal human astrocytes (NHA. AS1411 bound NCL and inhibited the proliferation of glioma cells but not NHA, which was accompanied with up-regulation of p53 and down-regulation of Bcl-2 and Akt1. Moreover, AS1411 treatment resulted in the G2/M cell cycle arrest in glioma cells, which was however abolished by overexpression of NCL. Further, AS1411 induced cell apoptosis, which was prevented by silencing of p53 and overexpression of Bcl-2. In addition, AS1411 inhibited the migration and invasion of glioma cells in an Akt1-dependent manner. Importantly, AS1411 inhibited the growth of glioma xenograft and prolonged the survival time of glioma tumor-bearing mice. These results revealed a promising treatment of glioma by oligodeoxynucleotide aptamer.

  7. Induction of reactive oxygen intermediates-dependent programmed cell death in human malignant ex vivo glioma cells and inhibition of the vascular endothelial growth factor production by taurolidine.

    Science.gov (United States)

    Rodak, Roksana; Kubota, Hisashi; Ishihara, Hideyuki; Eugster, Hans-Pietro; Könü, Dilek; Möhler, Hanns; Yonekawa, Yasuhiro; Frei, Karl

    2005-06-01

    Taurolidine, a derivative of the amino acid taurin, was recently found to display a potent antineoplastic effect both in vitro and in vivo. The authors therefore initiated studies to assess the potential antineoplastic activity of taurolidine in human glioma cell lines and in ex vivo malignant cell cultures. They also studied the mechanisms that induce cell death and the impact of taurolidine on tumor-derived vascular endothelial growth factor (VEGF) production. Cytotoxicity and clonogenic assays were performed using crystal violet staining. In the cytotoxicity assay 100% of glioma cell lines (eight of eight) and 74% of ex vivo glioma cultures (14 of 19) demonstrated sensitivity to taurolidine, with a mean median effective concentration (EC50) of 51 +/- 28 microg/ml and 56 +/- 23 microg/ml, respectively. Colony formation was inhibited by taurolidine, with a mean EC50 of 7 +/- 3 microg/ml for the cell lines and a mean EC50 of 3.5 +/- 1.7 microg/ml for the ex vivo glioma cultures. On observing this high activity of taurolidine in both assays, the authors decided to evaluate its cell death mechanisms. Fragmentation of DNA, externalization of phosphatidylserine, activation of poly(adenosine diphosphate-ribose) polymerase, loss of the mitochondrial membrane potential followed by a release of apoptosis-inducing factor, and typical apoptotic features were found after taurolidine treatment. Cell death was preceded by the generation of reactive O2 intermediates, which was abrogated by N-acetylcysteine but not by benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone. Moreover, taurolidine also induced suppression of VEGF production on the protein and messenger RNA level, as shown by an enzyme-linked immunosorbent assay and by reverse transcription-polymerase chain reaction. Given all these findings, taurolidine may be a promising new agent in the treatment of malignant gliomas; it displays a combination of antineoplastic and antiangiogenic activities, inducing tumor cell

  8. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  9. Non-small-cell lung cancer cells combat epidermal growth factor receptor tyrosine kinase inhibition through immediate adhesion-related responses

    Directory of Open Access Journals (Sweden)

    Wang HY

    2016-05-01

    Full Text Available Hsian-Yu Wang,1,2 Min-Kung Hsu,3,4 Kai-Hsuan Wang,1 Ching-Ping Tseng,2,4 Feng-Chi Chen,3,4 John T-A Hsu1,4 1Institute of Biotechnology and Pharmaceutical Research, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 2Institute of Molecular Medicine and Bioengineering, National Chiao Tung University (NCTU, Hsinchu, 3Division of Biostatistics and Bioinformatics, Institute of Population Health Sciences, National Health Research Institutes (NHRI, Zhunan, Miaoli County, 4Department of Biological Science and Technology, National Chiao Tung University (NCTU, Hsinchu, Taiwan, Republic of China Background: Epidermal growth factor receptor (EGFR tyrosine kinase inhibitors (TKIs, such as gefitinib, erlotinib, and afatinib, have greatly improved treatment efficacy in non-small cell lung cancer (NSCLC patients with drug-sensitive EGFR mutations. However, in some TKI responders, the benefits of such targeted therapies are limited by the rapid development of resistance, and strategies to overcome this resistance are urgently needed. Studies of drug resistance in cancer cells typically involve long term in vitro induction to obtain stably acquired drug-resistant cells followed by elucidation of resistance mechanisms, but the immediate responses of cancer cells upon drug treatment have been ignored. The aim of this study was to investigate the immediate responses of NSCLC cells upon treatment with EGFR TKIs.Results: Both NSCLC cells, ie, PC9 and H1975, showed immediate enhanced adhesion-related responses as an apoptosis-countering mechanism upon first-time TKI treatment. By gene expression and pathway analysis, adhesion-related pathways were enriched in gefitinib-treated PC9 cells. Pathway inhibition by small-hairpin RNAs or small-molecule drugs revealed that within hours of EGFR TKI treatment, NSCLC cells used adhesion-related responses to combat the drugs. Importantly, we show here that the Src family inhibitor, dasatinib, dramatically inhibits

  10. MicroRNA-145 Inhibits Cell Migration and Invasion and Regulates Epithelial-Mesenchymal Transition (EMT) by Targeting Connective Tissue Growth Factor (CTGF) in Esophageal Squamous Cell Carcinoma.

    Science.gov (United States)

    Han, Qiang; Zhang, Hua-Yong; Zhong, Bei-Long; Wang, Xiao-Jing; Zhang, Bing; Chen, Hua

    2016-10-23

    BACKGROUND This study investigated the mechanism of miR-145 in targeting connective tissue growth factor (CTGF), which affects the proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) of ESCC cells. MATERIAL AND METHODS A total of 50 ESCC tissues and their corresponding normal adjacent esophageal tissue samples were collected. Then, miR-145 expression in both ESCC clinical specimens and cell lines was detected using quantitative real-time PCR. CTGF protein was detected using immunohistochemistry. Dual luciferase reporter gene assay was employed to assess the effect of miR-145 on the 3'UTR luciferase activity of CTGF. Eca109 cells were transfected with miR-145 mimics and CTGF siRNA, respectively, and changes in cellular proliferation, migration, and invasion were detected via MTT assay, wound-healing assay, and Transwell assay, respectively. Western blotting assay was used to detect the expression of marker genes related to EMT. RESULTS MiR-145 was significantly down-regulated in ESCC tissues and cell lines compared with normal tissues and cell lines (Ptissues was than in normal adjacent esophageal tissues (Ptissues and cell lines, while the protein expression of CTGF exhibited the opposite trend. MiR-145 inhibited the proliferation, migration, invasiveness, and the EMT process of ESCC cells through targeted regulation of CTGF expression.

  11. The nonsteroidal anti-inflammatory drug tolfenamic acid inhibits BT474 and SKBR3 breast cancer cell and tumor growth by repressing erbB2 expression.

    Science.gov (United States)

    Liu, Xinyi; Abdelrahim, Maen; Abudayyeh, Ala; Lei, Ping; Safe, Stephen

    2009-05-01

    Tolfenamic acid (TA) is a nonsteroidal anti-inflammatory drug that inhibits pancreatic cancer cell and tumor growth through decreasing expression of specificity protein (Sp) transcription factors. TA also inhibits growth of erbB2-overexpressing BT474 and SKBR3 breast cancer cells; however, in contrast to pancreatic cancer cells, TA induced down-regulation of erbB2 but not Sp proteins. TA-induced erbB2 down-regulation was accompanied by decreased erbB2-dependent kinase activities, induction of p27, and decreased expression of cyclin D1. TA also decreased erbB2 mRNA expression and promoter activity, and this was due to decreased mRNA stability in BT474 cells and, in both cell lines, TA decreased expression of the YY1 and AP-2 transcription factors required for basal erbB2 expression. In addition, TA also inhibited tumor growth in athymic nude mice in which BT474 cells were injected into the mammary fat pad. TA represents a novel and promising new anticancer drug that targets erbB2 by decreasing transcription of this oncogene.

  12. The clinically used photosensitizer Verteporfin (VP) inhibits YAP-TEAD and human retinoblastoma cell growth in vitro without light activation.

    Science.gov (United States)

    Brodowska, Katarzyna; Al-Moujahed, Ahmad; Marmalidou, Anna; Meyer Zu Horste, Melissa; Cichy, Joanna; Miller, Joan W; Gragoudas, Evangelos; Vavvas, Demetrios G

    2014-07-01

    Verteporfin (VP), a benzoporphyrin derivative, is clinically used in photodynamic therapy for neovascular macular degeneration. Recent studies indicate that VP may inhibit growth of hepatoma cells without photoactivation through inhibition of YAP-TEAD complex. In this study, we examined the effects of VP without light activation on human retinoblastoma cell lines. Verteporfin but not vehicle control inhibited the growth, proliferation and viability of human retinoblastoma cell lines (Y79 and WERI) in a dose-dependent manner and was associated with downregulation of YAP-TEAD associated downstream proto-oncogenes such as c-myc, Axl, and surviving. In addition VP affected signals involved in cell migration and angiogenesis such as CTGF, cyr61, and VEGF-A but was not associated with significant effect on the mTOR/autophagy pathway. Of interest the pluripotency marker Oct4 were downregulated by Verteporfin treatment. Our results indicate that the clinically used photosensitizer VP is a potent inhibitor of cell growth in retinoblastoma cells, disrupting YAP-TEAD signaling and pluripotential marker OCT4. This study highlights for the first time the role of the YAP-TEAD pathway in Retinoblastoma and suggests that VP may be a useful adjuvant therapeutic tool in treating Rb patients. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. The synthetic peptide P111-136 derived from the C-terminal domain of heparin affin regulatory peptide inhibits tumour growth of prostate cancer PC-3 cells

    Science.gov (United States)

    2011-01-01

    Background Heparin affin regulatory peptide (HARP), also called pleiotrophin, is a heparin-binding, secreted factor that is overexpressed in several tumours and associated to tumour growth, angiogenesis and metastasis. The C-terminus part of HARP composed of amino acids 111 to 136 is particularly involved in its biological activities and we previously established that a synthetic peptide composed of the same amino acids (P111-136) was capable of inhibiting the biological activities of HARP. Here we evaluate the ability of P111-136 to inhibit in vitro and in vivo the growth of a human tumour cell line PC-3 which possess an HARP autocrine loop. Methods A total lysate of PC-3 cells was incubated with biotinylated P111-136 and pulled down for the presence of the HARP receptors in Western blot. In vitro, the P111-136 effect on HARP autocrine loop in PC-3 cells was determined by colony formation in soft agar. In vivo, PC-3 cells were inoculated in the flank of athymic nude mice. Animals were treated with P111-136 (5 mg/kg/day) for 25 days. Tumour volume was evaluated during the treatment. After the animal sacrifice, the tumour apoptosis and associated angiogenesis were evaluated by immunohistochemistry. In vivo anti-angiogenic effect was confirmed using a mouse Matrigel™ plug assay. Results Using pull down experiments, we identified the HARP receptors RPTPβ/ζ, ALK and nucleolin as P111-136 binding proteins. In vitro, P111-136 inhibits dose-dependently PC-3 cell colony formation. Treatment with P111-136 inhibits significantly the PC-3 tumour growth in the xenograft model as well as tumour angiogenesis. The angiostatic effect of P111-136 on HARP was also confirmed using an in vivo Matrigel™ plug assay in mice Conclusions Our results demonstrate that P111-136 strongly inhibits the mitogenic effect of HARP on in vitro and in vivo growth of PC-3 cells. This inhibition could be linked to a direct or indirect binding of this peptide to the HARP receptors (ALK, RPTP

  14. Growth-inhibiting effect of tumor necrosis factor on human umbilical vein endothelial cells is enhanced with advancing age in vitro

    International Nuclear Information System (INIS)

    Shimada, Y.; Kaji, K.; Ito, H.; Noda, K.; Matsuo, M.

    1990-01-01

    We have examined the effects of in vitro aging on the growth capacity of human umbilical vein endothelial cells (HUVECs) under the influence of tumor necrosis factor (TNF) with or without interferon-gamma (IFN-gamma). The growth and colony-forming abilities of control cells were impaired with advancing age in vitro, especially at later stages (more than 70-80% of life span completed). It was found that treatment with TNF inhibited growth and colony-forming efficiency at any in vitro age. The effects of TNF were shown to increase with increasing in vitro age, as reflected by a more pronounced increase in doubling times, a decrease in saturation density, and a reduction in colony-forming efficiency. However, the characteristics of TNF receptors, including the dissociation constant, and the number of TNF-binding sites per cell-surface area remained rather constant. The effect of TNF was augmented by IFN-gamma at a dose that alone affected growth and colony formation only slightly. The augmentation by IFN-gamma was also found to depend on in vitro age; the synergy with TNF in the deterioration of colony-forming ability was observed only in aged cells. These results suggest that the intrinsic responsiveness of HUVECs to growth-inhibiting factors, as well as to growth-stimulating factors, changes during aging in vitro

  15. Betulinic acid inhibits colon cancer cell and tumor growth and induces proteasome-dependent and -independent downregulation of specificity proteins (Sp) transcription factors

    International Nuclear Information System (INIS)

    Chintharlapalli, Sudhakar; Papineni, Sabitha; Lei, Ping; Pathi, Satya; Safe, Stephen

    2011-01-01

    Betulinic acid (BA) inhibits growth of several cancer cell lines and tumors and the effects of BA have been attributed to its mitochondriotoxicity and inhibition of multiple pro-oncogenic factors. Previous studies show that BA induces proteasome-dependent degradation of specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 in prostate cancer cells and this study focused on the mechanism of action of BA in colon cancer cells. The effects of BA on colon cancer cell proliferation and apoptosis and tumor growth in vivo were determined using standardized assays. The effects of BA on Sp proteins and Sp-regulated gene products were analyzed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a) and ZBTB10 mRNA expression. BA inhibited growth and induced apoptosis in RKO and SW480 colon cancer cells and inhibited tumor growth in athymic nude mice bearing RKO cells as xenograft. BA also decreased expression of Sp1, Sp3 and Sp4 transcription factors which are overexpressed in colon cancer cells and decreased levels of several Sp-regulated genes including survivin, vascular endothelial growth factor, p65 sub-unit of NFκB, epidermal growth factor receptor, cyclin D1, and pituitary tumor transforming gene-1. The mechanism of action of BA was dependent on cell context, since BA induced proteasome-dependent and proteasome-independent downregulation of Sp1, Sp3 and Sp4 in SW480 and RKO cells, respectively. In RKO cells, the mechanism of BA-induced repression of Sp1, Sp3 and Sp4 was due to induction of reactive oxygen species (ROS), ROS-mediated repression of microRNA-27a, and induction of the Sp repressor gene ZBTB10. These results suggest that the anticancer activity of BA in colon cancer cells is due, in part, to downregulation of Sp1, Sp3 and Sp4 transcription factors; however, the mechanism of this response is cell context-dependent

  16. 1‑O‑acetylbritannilactone combined with gemcitabine elicits growth inhibition and apoptosis in A549 human non‑small cell lung cancer cells.

    Science.gov (United States)

    Wang, Feng; Li, Hong; Qiao, Jian-Ou

    2015-10-01

    Non‑small‑cell lung cancer (NSCLC) accounts for ~85% of all lung cancer cases, with a 5‑year survival rate of britannica, a Chinese traditional medicine, has been demonstrated to have anticancer activity. In the present study, the antiproliferative and proapoptotic abilities of ABL alone or in combination with gemcitabine in a human NSCLC cell line were investigated. A549 cells were treated in vitro with ABL, gemcitabine, and a combination of ABL and gemcitabine for 72 h. The results demonstrated that ABL and gemcitabine inhibited cell growth and induced apoptosis of A549 cells. These effects were more potent following the combination of ABL and gemcitabine treatment than either agent alone. Furthermore, the signal transduction analysis revealed nuclear factor (NF)‑κB expression was significantly decreased by ABL and the combination treatment. The inhibitor nuclear factor κBα (IκBα) and Bax levels were upregulated whereas Bcl‑2 was substantially downregulated following treatment. The present findings suggest that ABL combined with gemcitabine elicits potent apoptosis of lung cancer cells and therefore, ABL has the potential to be developed as a chemotherapeutic agent.

  17. Toosendanin inhibits growth and induces apoptosis in colorectal cancer cells through suppression of AKT/GSK-3β/β-catenin pathway.

    Science.gov (United States)

    Wang, Ge; Feng, Cheng-Cheng; Chu, Shao-Jun; Zhang, Rui; Lu, Yun-Min; Zhu, Jin-Shui; Zhang, Jing

    2015-11-01

    AKT/GSK-3β/β-catenin signaling pathway plays an important role in the progression of colorectal cancer (CRC). Toosendanin (TSN) is a triterpenoid extracted from the bark or fruits of Melia toosendan Sieb et Zucc and possesses antitumour effects on various human cancer cells. However, its effect on CRC remains poorly understood. The present study investigated the effect of TSN on CRC SW480 cells and the AKT/GSK-3β/β-catenin signaling. Proliferation assay, flow cytometry and Hoechst 33342 nuclear staining demonstrated TSN dose-dependently inhibited cell viability and induced cell apoptosis as well as cell cycle arrest in S phase. Confocal laser scanning microscope showed β-catenin transferred to the outside of the nucleus in TSN-treated cells. Quantitative real-time PCR and western blot analysis found that TSN effectively modulated molecules related to apoptosis and AKT/GSK-3β/β-catenin signaling. Moreover, TSN administration significantly inhibited CRC growth in a mouse tumor xenograft model. In conclusion, our findings indicate that TSN inhibits growth and induces apoptosis in CRC cells through suppression of AKT/GSK-3β/β-catenin pathway, suggesting that TSN may have potential for use in CRC treatment.

  18. Growth inhibition, cell-cycle alteration and apoptosis in stimulated human peripheral blood lymphocytes by multiwalled carbon nanotube buckypaper.

    Science.gov (United States)

    Zeni, Olga; Sannino, Anna; Romeo, Stefania; Micciulla, Federico; Bellucci, Stefano; Scarfi, Maria Rosaria

    2015-02-01

    This study was designed to investigate the cytotoxicity of multiwalled carbon nanotube buckypaper (BP) in stimulated human peripheral blood lymphocytes. Materials & methods & results: BP treatment led to a delay in the cell growth, as proven by a minor increase in the cell number over time relative to that seen in untreated cells, assessed by trypan blue, resazurin and neutral red assays. The analysis of cell-cycle profile, by propidium iodide staining, indicated that BP treatment blocked cell-cycle progression by arresting cells at the G0/G1 phase. Moreover, increased apoptosis was also recorded by Annexin V-fluorescein isothiocyanate/propidium iodide staining. The results presented here demonstrate an inhibitor effect of BP on cell growth that was likely through cytostatic and cytotoxic events.

  19. Menaquinone analogs inhibit growth of bacterial pathogens.

    Science.gov (United States)

    Schlievert, Patrick M; Merriman, Joseph A; Salgado-Pabón, Wilmara; Mueller, Elizabeth A; Spaulding, Adam R; Vu, Bao G; Chuang-Smith, Olivia N; Kohler, Petra L; Kirby, John R

    2013-11-01

    Gram-positive bacteria cause serious human illnesses through combinations of cell surface and secreted virulence factors. We initiated studies with four of these organisms to develop novel topical antibacterial agents that interfere with growth and exotoxin production, focusing on menaquinone analogs. Menadione, 1,4-naphthoquinone, and coenzymes Q1 to Q3 but not menaquinone, phylloquinone, or coenzyme Q10 inhibited the growth and to a greater extent exotoxin production of Staphylococcus aureus, Bacillus anthracis, Streptococcus pyogenes, and Streptococcus agalactiae at concentrations of 10 to 200 μg/ml. Coenzyme Q1 reduced the ability of S. aureus to cause toxic shock syndrome in a rabbit model, inhibited the growth of four Gram-negative bacteria, and synergized with another antimicrobial agent, glycerol monolaurate, to inhibit S. aureus growth. The staphylococcal two-component system SrrA/B was shown to be an antibacterial target of coenzyme Q1. We hypothesize that menaquinone analogs both induce toxic reactive oxygen species and affect bacterial plasma membranes and biosynthetic machinery to interfere with two-component systems, respiration, and macromolecular synthesis. These compounds represent a novel class of potential topical therapeutic agents.

  20. Calycosin inhibits the in vitro and in vivo growth of breast cancer cells through WDR7-7-GPR30 Signaling.

    Science.gov (United States)

    Tian, Jing; Wang, Yong; Zhang, Xing; Ren, Qianyao; Li, Rong; Huang, Yue; Lu, Huiling; Chen, Jian

    2017-11-02

    Clinically, breast cancer is generally classified into estrogen receptor-positive (ER+) or estrogen receptor-negative (ER-) subtypes. The phytoestrogen calycosin has been shown to inhibit the proliferation of ER+ cells, which may be mediated by a feedback loop that involves miR-375, RAS dexamethasone-induced 1 (RASD1), and ERα. However, how calycosin acts on ER- breast cancer cells remains unclear. Here, we show that calycosin inhibited the proliferation of both ER- (MDA-MB-468 and SKBR3) and ER+ breast cancer cells (MCF-7 and T47D) and that these inhibitory effects were associated with the up-regulation of the long non-coding RNA (lncRNA) WDR7-7. For the first time, we demonstrate that the expression of WDR7-7 is reduced in breast cancer cell lines and that the overexpression of WDR7-7 inhibits growth through a mechanism that involves G-protein coupled estrogen receptor 30 (GPR30). Meanwhile, we show that calycosin stimulated the WDR7-7-GPR30 signaling pathway in MCF-7, T47D, MDA-MB-468, and SKBR3 breast cancer cells. In contrast, in MCF10A and GPR30-deficient MDA-MB-231 cells, due to a lack of WDR7-7-GPR30 for activation, calycosin failed to inhibit cell growth. Additionally, in all four GPR30-positive breast cancer lines, calycosin decreased the phosphorylation levels of SRC, EGFR, ERK1/2 and Akt, but the inhibition of WDR7-7 blocked these changes and increased proliferation. In mice bearing MCF-7 or SKBR3 xenografts, tumor growth was inhibited by calycosin, and changes in expression the levels of WDR7-7 and GPR30 in tumor tissues were similar to those in cultured MCF-7 and SKBR3 cells. These results suggest the possibility that calycosin inhibited the proliferation of breast cancer cells, at least partially, through WDR7-7-GPR30 signaling, which may explain why calycosin can exert inhibitory effects on ER- breast cancer.

  1. Calycosin inhibits the in vitro and in vivo growth of breast cancer cells through WDR7-7-GPR30 Signaling

    Directory of Open Access Journals (Sweden)

    Jing Tian

    2017-11-01

    Full Text Available Abstract Background Clinically, breast cancer is generally classified into estrogen receptor-positive (ER+ or estrogen receptor-negative (ER− subtypes. The phytoestrogen calycosin has been shown to inhibit the proliferation of ER+ cells, which may be mediated by a feedback loop that involves miR-375, RAS dexamethasone-induced 1 (RASD1, and ERα. However, how calycosin acts on ER− breast cancer cells remains unclear. Results Here, we show that calycosin inhibited the proliferation of both ER− (MDA-MB-468 and SKBR3 and ER+ breast cancer cells (MCF-7 and T47D and that these inhibitory effects were associated with the up-regulation of the long non-coding RNA (lncRNA WDR7-7. For the first time, we demonstrate that the expression of WDR7-7 is reduced in breast cancer cell lines and that the overexpression of WDR7-7 inhibits growth through a mechanism that involves G-protein coupled estrogen receptor 30 (GPR30. Meanwhile, we show that calycosin stimulated the WDR7-7-GPR30 signaling pathway in MCF-7, T47D, MDA-MB-468, and SKBR3 breast cancer cells. In contrast, in MCF10A and GPR30-deficient MDA-MB-231 cells, due to a lack of WDR7-7-GPR30 for activation, calycosin failed to inhibit cell growth. Additionally, in all four GPR30-positive breast cancer lines, calycosin decreased the phosphorylation levels of SRC, EGFR, ERK1/2 and Akt, but the inhibition of WDR7-7 blocked these changes and increased proliferation. In mice bearing MCF-7 or SKBR3 xenografts, tumor growth was inhibited by calycosin, and changes in expression the levels of WDR7-7 and GPR30 in tumor tissues were similar to those in cultured MCF-7 and SKBR3 cells. Conclusions These results suggest the possibility that calycosin inhibited the proliferation of breast cancer cells, at least partially, through WDR7-7-GPR30 signaling, which may explain why calycosin can exert inhibitory effects on ER− breast cancer.

  2. Transforming growth factor-beta, but not ciliary neurotrophic factor, inhibits DNA synthesis of adrenal medullary cells in vitro

    DEFF Research Database (Denmark)

    Wolf, N; Krohn, K; Bieger, S

    1999-01-01

    of fibroblast growth factor-2 and insulin-like growth factor-II, transforming growth factor-beta1 (0.08 nM) reduced 5-bromo-2'-deoxyuridine labeling by about 50%, without interfering with chromaffin cell survival or death. Doses lower and higher than 0.08 nM were less effective. Similar effects were seen...... immunocytochemistry as a marker for young postnatal rat chromaffin cells, we show that treatment with fibroblast growth factor-2 (1 nM) and insulin-like growth factor-II (10 nM) increased the fraction of 5-bromo-2'-deoxyuridine-labeled nuclei from 1% to about 40% of the cells in the absence of serum. In the presence...... by the neuroendocrine chromaffin cells, which also express the transforming growth factor-beta receptor type II. In contrast to the developmentally related sympathetic neurons, chromaffin cells continue to proliferate throughout postnatal life. Using 5-bromo-2'-deoxyuridine pulse labeling and tyrosine hydroxylase...

  3. Growth inhibition of the intestinal parasite Giardia lamblia by a dietary lectin is associated with arrest of the cell cycle.

    OpenAIRE

    Ortega-Barria, E; Ward, H D; Keusch, G T; Pereira, M E

    1994-01-01

    Giardia lamblia, a cause of diarrheal disease throughout the world, is a protozoan parasite that thrives in the small intestine. It is shown here that wheat germ agglutinin (WGA), a naturally occurring lectin widely consumed in normal human diets, reversibly inhibits the growth of G. lamblia trophozoites in vitro, and reduces infection by G. muris in the adult mouse model of giardiasis. The inhibitory effect was dose related, not associated with cytotoxicity and reversed by N-acetyl-D-glucosa...

  4. Comparison of growth inhibition profiles and mechanisms of apoptosis induction in human colon cancer cell lines by isothiocyanates and indoles from Brassicaceae

    Energy Technology Data Exchange (ETDEWEB)

    Pappa, Gerlinde [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany); Lichtenberg, Maike [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany); Iori, Renato [Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Istituto Sperimentale Colture Industriali, 40129 Bologna (Italy); Barillari, Jessica [Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Istituto Sperimentale Colture Industriali, 40129 Bologna (Italy); Bartsch, Helmut [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany); Gerhaeuser, Clarissa [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany)]. E-mail: c.gerhauser@dkfz.de

    2006-07-25

    The isothiocyanates sulforaphane and PEITC ({beta}-phenethyl isothiocyanate) as well as the indoles indole-3-carbinol and its condensation product 3,3'-diindolylmethane are known to inhibit cancer cell proliferation and induce apoptosis. In this study, we compared the cell growth inhibitory potential of the four compounds on the p53 wild type human colon cancer cell line 40-16 (p53{sup +/+}) and its p53 knockout derivative 379.2 (p53{sup -/-}) (both derived from HCT116). Using sulforhodamin B staining to assess cell proliferation, we found that the isothiocyanates were strongly cytotoxic, whereas the indoles inhibited cell growth in a cytostatic manner. Half-maximal inhibitory concentrations of all four compounds in both cell lines ranged from 5-15 {mu}M after 24, 48 and 72 h of treatment. Apoptosis induction was analyzed by immunoblotting of poly(ADP-ribose)polymerase (PARP). Treatment with sulforaphane (15 {mu}M), PEITC (10 {mu}M), indole-3-carbinol (10 {mu}M) and 3,3'-diindolylmethane (10 {mu}M) induced PARP cleavage after 24 and 48 h in both 40-16 and the 379.2 cell lines, suggestive of a p53-independent mechanism of apoptosis induction. In cultured 40-16 cells, activation of caspase-9 and -7 detected by Western blotting indicated involvement of the mitochondrial pathway. We detected time- and concentration-dependent changes in protein expression of anti-apoptotic Bcl-x{sub L} as well as pro-apoptotic Bax and Bak proteins. Of note is that for sulforaphane only, ratios of pro- to anti-apoptotic Bcl-2 family protein levels directly correlated with apoptosis induction measured by PARP cleavage. Taken together, we demonstrated that the glucosinolate breakdown products investigated in this study have distinct profiles of cell growth inhibition, potential to induce p53-independent apoptosis and to modulate Bcl-2 family protein expression in human colon cancer cell lines.

  5. Odontogenic ameloblast-associated protein (ODAM) inhibits growth and migration of human melanoma cells and elicits PTEN elevation and inactivation of PI3K/AKT signaling

    International Nuclear Information System (INIS)

    Foster, James S; Fish, Lindsay M; Phipps, Jonathan E; Bruker, Charles T; Lewis, James M; Bell, John L; Solomon, Alan; Kestler, Daniel P

    2013-01-01

    The Odontogenic Ameloblast-associated Protein (ODAM) is expressed in a wide range of normal epithelial, and neoplastic tissues, and we have posited that ODAM serves as a novel prognostic biomarker for breast cancer and melanoma. Transfection of ODAM into breast cancer cells yields suppression of cellular growth, motility, and in vivo tumorigenicity. Herein we have extended these studies to the effects of ODAM on cultured melanoma cell lines. The A375 and C8161 melanoma cell lines were stably transfected with ODAM and assayed for properties associated with tumorigenicity including cell growth, motility, and extracellular matrix adhesion. In addition, ODAM–transfected cells were assayed for signal transduction via AKT which promotes cell proliferation and survival in many neoplasms. ODAM expression in A375 and C8161 cells strongly inhibited cell growth and motility in vitro, increased cell adhesion to extracellular matrix, and yielded significant cytoskeletal/morphologic rearrangement. Furthermore, AKT activity was downregulated by ODAM expression while an increase was noted in expression of the PTEN (phosphatase and tensin homolog on chromosome 10) tumor suppressor gene, an antagonist of AKT activation. Increased PTEN in ODAM-expressing cells was associated with increases in PTEN mRNA levels and de novo protein synthesis. Silencing of PTEN expression yielded recovery of AKT activity in ODAM-expressing melanoma cells. Similar PTEN elevation and inhibition of AKT by ODAM was observed in MDA-MB-231 breast cancer cells while ODAM expression had no effect in PTEN-deficient BT-549 breast cancer cells. The apparent anti-neoplastic effects of ODAM in cultured melanoma and breast cancer cells are associated with increased PTEN expression, and suppression of AKT activity. This association should serve to clarify the clinical import of ODAM expression and any role it may serve as an indicator of tumor behavior

  6. SENP1 inhibition induces apoptosis and growth arrest of multiple myeloma cells through modulation of NF-κB signaling

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Jun [Graduate School of Anhui Medical University, Hefei (China); Department of Experimental Hematology, Beijing Institute of Radiation Medicine, Beijing 100850 (China); Sun, Hui-Yan; Xiao, Feng-Jun; Wang, Hua [Department of Experimental Hematology, Beijing Institute of Radiation Medicine, Beijing 100850 (China); Yang, Yang [Department of Hematology, General Hospital of Air Force, Beijing (China); Wang, Lu; Gao, Chun-Ji [Department of Hematology, PLA General Hospital, Beijing (China); Guo, Zi-Kuan [Department of Experimental Hematology, Beijing Institute of Radiation Medicine, Beijing 100850 (China); Wu, Chu-Tse [Department of Experimental Hematology, Beijing Institute of Radiation Medicine, Beijing 100850 (China); Collaborative Innovation Center for Biotherapy, West China Hospital, Sichuan University, Chengdu (China); Wang, Li-Sheng, E-mail: Wangls@bmi.ac.cn [Department of Experimental Hematology, Beijing Institute of Radiation Medicine, Beijing 100850 (China); Collaborative Innovation Center for Biotherapy, West China Hospital, Sichuan University, Chengdu (China)

    2015-05-01

    SUMO/sentrin specific protease 1 (Senp1) is an important regulation protease in the protein sumoylation, which affects the cell cycle, proliferation and differentiation. The role of Senp1 mediated protein desumoylation in pathophysiological progression of multiple myeloma is unknown. In this study, we demonstrated that Senp1 is overexpressed and induced by IL-6 in multiple myeloma cells. Lentivirus-mediated Senp1 knockdown triggers apoptosis and reduces viability, proliferation and colony forming ability of MM cells. The NF-κB family members including P65 and inhibitor protein IkBα play important roles in regulation of MM cell survival and proliferation. We further demonstrated that Senp1 inhibition decreased IL-6-induced P65 and IkBα phosphorylation, leading to inactivation of NF-kB signaling in MM cells. These results delineate a key role for Senp1in IL-6 induced proliferation and survival of MM cells, suggesting it may be a potential new therapeutic target in MM. - Highlights: • Senp1 is overexpressed and induced by IL-6 in multiple myeloma cells. • Senp1 knockdown triggers apoptosis and reduces proliferation of MM cells. • Senp1 inhibition decreased IL-6-induced P65 and IkBα phosphorylation.

  7. SENP1 inhibition induces apoptosis and growth arrest of multiple myeloma cells through modulation of NF-κB signaling

    International Nuclear Information System (INIS)

    Xu, Jun; Sun, Hui-Yan; Xiao, Feng-Jun; Wang, Hua; Yang, Yang; Wang, Lu; Gao, Chun-Ji; Guo, Zi-Kuan; Wu, Chu-Tse; Wang, Li-Sheng

    2015-01-01

    SUMO/sentrin specific protease 1 (Senp1) is an important regulation protease in the protein sumoylation, which affects the cell cycle, proliferation and differentiation. The role of Senp1 mediated protein desumoylation in pathophysiological progression of multiple myeloma is unknown. In this study, we demonstrated that Senp1 is overexpressed and induced by IL-6 in multiple myeloma cells. Lentivirus-mediated Senp1 knockdown triggers apoptosis and reduces viability, proliferation and colony forming ability of MM cells. The NF-κB family members including P65 and inhibitor protein IkBα play important roles in regulation of MM cell survival and proliferation. We further demonstrated that Senp1 inhibition decreased IL-6-induced P65 and IkBα phosphorylation, leading to inactivation of NF-kB signaling in MM cells. These results delineate a key role for Senp1in IL-6 induced proliferation and survival of MM cells, suggesting it may be a potential new therapeutic target in MM. - Highlights: • Senp1 is overexpressed and induced by IL-6 in multiple myeloma cells. • Senp1 knockdown triggers apoptosis and reduces proliferation of MM cells. • Senp1 inhibition decreased IL-6-induced P65 and IkBα phosphorylation

  8. EGCG Inhibits Proliferation, Invasiveness and Tumor Growth by Up-Regulation of Adhesion Molecules, Suppression of Gelatinases Activity, and Induction of Apoptosis in Nasopharyngeal Carcinoma Cells

    Directory of Open Access Journals (Sweden)

    Chih-Yeu Fang

    2015-01-01

    Full Text Available (−-Epigallocatechin-3-gallate (EGCG, a major green tea polyphenol, has been shown to inhibit the proliferation of a variety of tumor cells. Epidemiological studies have shown that drinking green tea can reduce the incidence of nasopharyngeal carcinoma (NPC, yet the underlying mechanism is not well understood. In this study, the inhibitory effect of EGCG was tested on a set of Epstein Barr virus-negative and -positive NPC cell lines. Treatment with EGCG inhibited the proliferation of NPC cells but did not affect the growth of a non-malignant nasopharyngeal cell line, NP460hTert. Moreover, EGCG treated cells had reduced migration and invasive properties. The expression of the cell adhesion molecules E-cadherin and β-catenin was found to be up-regulated by EGCG treatment, while the down-regulation of matrix metalloproteinases (MMP-2 and MMP-9 were found to be mediated by suppression of extracellular signal-regulated kinase (ERK phosphorylation and AP-1 and Sp1 transactivation. Spheroid formation by NPC cells in suspension was significantly inhibited by EGCG. Oral administration of EGCG was capable of suppressing tumor growth in xenografted mice bearing NPC tumors. Treatment with EGCG was found to elevate the expression of p53 and p21, and eventually led to apoptosis of NPC cells via caspase 3 activation. The nuclear translocation of NF-κB and β-catenin was also suppressed by EGCG treatment. These results indicate that EGCG can inhibit the proliferation and invasiveness, and induce apoptosis, of NPC cells, making it a promising agent for chemoprevention or adjuvant therapy of NPC.

  9. Imatinib mesylate exerts anti-proliferative effects on osteosarcoma cells and inhibits the tumour growth in immunocompetent murine models.

    Directory of Open Access Journals (Sweden)

    Bérengère Gobin

    Full Text Available Osteosarcoma is the most common primary malignant bone tumour characterized by osteoid production and/or osteolytic lesions of bone. A lack of response to chemotherapeutic treatments shows the importance of exploring new therapeutic methods. Imatinib mesylate (Gleevec, Novartis Pharma, a tyrosine kinase inhibitor, was originally developed for the treatment of chronic myeloid leukemia. Several studies revealed that imatinib mesylate inhibits osteoclast differentiation through the M-CSFR pathway and activates osteoblast differentiation through PDGFR pathway, two key cells involved in the vicious cycle controlling the tumour development. The present study investigated the in vitro effects of imatinib mesylate on the proliferation, apoptosis, cell cycle, and migration ability of five osteosarcoma cell lines (human: MG-63, HOS; rat: OSRGA; mice: MOS-J, POS-1. Imatinib mesylate was also assessed as a curative and preventive treatment in two syngenic osteosarcoma models: MOS-J (mixed osteoblastic/osteolytic osteosarcoma and POS-1 (undifferentiated osteosarcoma. Imatinib mesylate exhibited a dose-dependent anti-proliferative effect in all cell lines studied. The drug induced a G0/G1 cell cycle arrest in most cell lines, except for POS-1 and HOS cells that were blocked in the S phase. In addition, imatinib mesylate induced cell death and strongly inhibited osteosarcoma cell migration. In the MOS-J osteosarcoma model, oral administration of imatinib mesylate significantly inhibited the tumour development in both preventive and curative approaches. A phospho-receptor tyrosine kinase array kit revealed that PDGFRα, among 7 other receptors (PDFGFRβ, Axl, RYK, EGFR, EphA2 and 10, IGF1R, appears as one of the main molecular targets for imatinib mesylate. In the light of the present study and the literature, it would be particularly interesting to revisit therapeutic evaluation of imatinib mesylate in osteosarcoma according to the tyrosine-kinase receptor

  10. Imatinib mesylate exerts anti-proliferative effects on osteosarcoma cells and inhibits the tumour growth in immunocompetent murine models.

    Science.gov (United States)

    Gobin, Bérengère; Moriceau, Gatien; Ory, Benjamin; Charrier, Céline; Brion, Régis; Blanchard, Frederic; Redini, Françoise; Heymann, Dominique

    2014-01-01

    Osteosarcoma is the most common primary malignant bone tumour characterized by osteoid production and/or osteolytic lesions of bone. A lack of response to chemotherapeutic treatments shows the importance of exploring new therapeutic methods. Imatinib mesylate (Gleevec, Novartis Pharma), a tyrosine kinase inhibitor, was originally developed for the treatment of chronic myeloid leukemia. Several studies revealed that imatinib mesylate inhibits osteoclast differentiation through the M-CSFR pathway and activates osteoblast differentiation through PDGFR pathway, two key cells involved in the vicious cycle controlling the tumour development. The present study investigated the in vitro effects of imatinib mesylate on the proliferation, apoptosis, cell cycle, and migration ability of five osteosarcoma cell lines (human: MG-63, HOS; rat: OSRGA; mice: MOS-J, POS-1). Imatinib mesylate was also assessed as a curative and preventive treatment in two syngenic osteosarcoma models: MOS-J (mixed osteoblastic/osteolytic osteosarcoma) and POS-1 (undifferentiated osteosarcoma). Imatinib mesylate exhibited a dose-dependent anti-proliferative effect in all cell lines studied. The drug induced a G0/G1 cell cycle arrest in most cell lines, except for POS-1 and HOS cells that were blocked in the S phase. In addition, imatinib mesylate induced cell death and strongly inhibited osteosarcoma cell migration. In the MOS-J osteosarcoma model, oral administration of imatinib mesylate significantly inhibited the tumour development in both preventive and curative approaches. A phospho-receptor tyrosine kinase array kit revealed that PDGFRα, among 7 other receptors (PDFGFRβ, Axl, RYK, EGFR, EphA2 and 10, IGF1R), appears as one of the main molecular targets for imatinib mesylate. In the light of the present study and the literature, it would be particularly interesting to revisit therapeutic evaluation of imatinib mesylate in osteosarcoma according to the tyrosine-kinase receptor status of patients.

  11. p21WAF1 expression induced by MEK/ERK pathway activation or inhibition correlates with growth arrest, myogenic differentiation and onco-phenotype reversal in rhabdomyosarcoma cells

    Directory of Open Access Journals (Sweden)

    Giacinti Cristina

    2005-12-01

    Full Text Available Abstract Background p21WAF1, implicated in the cell cycle control of both normal and malignant cells, can be induced by p53-dependent and independent mechanisms. In some cells, MEKs/ERKs regulate p21WAF1 transcriptionally, while in others they also affect the post-transcriptional processes. In myogenic differentiation, p21WAF1 expression is also controlled by the myogenic transcription factor MyoD. We have previously demonstrated that the embryonal rhabdomyosarcoma cell line undergoes growth arrest and myogenic differentiation following treatments with TPA and the MEK inhibitor U0126, which respectively activate and inhibit the ERK pathway. In this paper we attempt to clarify the mechanism of ERK-mediated and ERK-independent growth arrest and myogenic differentiation of embryonal and alveolar rhabdomyosarcoma cell lines, particularly as regards the expression of the cell cycle inhibitor p21WAF1. Results p21WAF1 expression and growth arrest are induced in both embryonal (RD and alveolar (RH30 rhabdomyosarcoma cell lines following TPA or MEK/ERK inhibitor (U0126 treatments, whereas myogenic differentiation is induced in RD cells alone. Furthermore, the TPA-mediated post-transcriptional mechanism of p21WAF1-enhanced expression in RD cells is due to activation of the MEK/ERK pathway, as shown by transfections with constitutively active MEK1 or MEK2, which induces p21WAF1 expression, and with ERK1 and ERK2 siRNA, which prevents p21WAF1 expression. By contrast, U0126-mediated p21WAF1 expression is controlled transcriptionally by the p38 pathway. Similarly, myogenin and MyoD expression is induced both by U0126 and TPA and is prevented by p38 inhibition. Although MyoD and myogenin depletion by siRNA prevents U0126-mediated p21WAF1 expression, the over-expression of these two transcription factors is insufficient to induce p21WAF1. These data suggest that the transcriptional mechanism of p21WAF1 expression in RD cells is rescued when MEK/ERK inhibition

  12. RA-XII inhibits tumour growth and metastasis in breast tumour-bearing mice via reducing cell adhesion and invasion and promoting matrix degradation.

    Science.gov (United States)

    Leung, Hoi-Wing; Zhao, Si-Meng; Yue, Grace Gar-Lee; Lee, Julia Kin-Ming; Fung, Kwok-Pui; Leung, Ping-Chung; Tan, Ning-Hua; Lau, Clara Bik-San

    2015-11-23

    Cancer cells acquire invasive ability to degrade and adhere to extracellular matrix (ECM) and migrate to adjacent tissues. This ultimately results metastasis. Hence, the present study investigated the in vitro effects of cyclopeptide glycoside, RA-XII on cell adhesion, invasion, proliferation and matrix degradation, and its underlying mechanism in murine breast tumour cells, 4T1. The effect of RA-XII on tumour growth and metastasis in 4T1-bearing mice was also investigated. Our results showed that RA-XII inhibited tumour cell adhesion to collagen, fibronectin and laminin, RA-XII also reduced the expressions of vascular cell adhesion molecule, intracellular adhesion molecule and integrins, and integrin binding. In addition, RA-XII significantly inhibited breast tumour cell migration via interfering cofilin signaling and chemokine receptors. The activities of matrix metalloproteinase-9 and urokinase-type of plasminogen activator, and the expressions of ECM-associated proteinases were attenuated significantly by RA-XII. Furthermore, RA-XII induced G1 phase arrest and inhibited the expressions of cyclins and cyclin-dependent kinases. RA-XII inhibited the expressions of molecules in PI3K/AKT, NF-kappaB, FAK/pSRC, MAPK and EGFR signaling. RA-XII was also shown to have anti-tumour, anti-angiogenic and anti-metastatic activities in metastatic breast tumour-bearing mice. These findings strongly suggested that RA-XII is a potential anti-metastatic agent for breast cancer.

  13. Role of isothiocyanate conjugate of pterostilbene on the inhibition of MCF-7 cell proliferation and tumor growth in Ehrlich ascitic cell induced tumor bearing mice

    International Nuclear Information System (INIS)

    Nikhil, Kumar; Sharan, Shruti; Chakraborty, Ajanta; Bodipati, Naganjaneyulu; Krishna Peddinti, Rama; Roy, Partha

    2014-01-01

    Naturally occurring pterostilbene (PTER) and isothiocyanate (ITC) attract great attention due to their wide range of biological properties, including anti-cancer, anti-leukemic, anti-bacterial and anti-inflammatory activities. A novel class of hybrid compound synthesized by introducing an ITC moiety on PTER backbone was evaluated for its anti-cancer efficacy in hormone-dependent breast cancer cell line (MCF-7) in vitro and Ehrlich ascitic tumor bearing mice model in vivo. The novel hybrid molecule showed significant in vitro anti-cancer activity (IC 50 =25±0.38) when compared to reference compound PTER (IC 50 =65±0.42). The conjugate molecule induced both S and G2/M phase cell cycle arrest as indicated by flow cytometry analysis. In addition, the conjugate induced cell death was characterized by changes in cell morphology, DNA fragmentation, activation of caspase-9, release of cytochrome-c into cytosol and increased Bax: Bcl-2 ratio. The conjugate also suppressed the phosphorylation of Akt and ERK. The conjugate induced cell death was significantly increased in presence of A6730 (a potent Akt1/2 kinase inhibitor) and PD98059 (a specific ERK inhibitor). Moreover, the conjugated PTER inhibited tumor growth in Ehrlich ascitic cell induced tumor bearing mice as observed by reduction in tumor volume compared to untreated animals. Collectively, the pro-apoptotic effect of conjugate is mediated through the activation of caspases, and is correlated with the blockade of the Akt and ERK signaling pathways in MCF-7 cells. - Highlights: • Conjugate was prepared by appending isothiocyanate moiety on pterostilbene backbone. • Conjugate showed anticancer effects at comparatively lower dose than pterostilbene. • Conjugate caused blockage of the Akt and ERK signaling pathways in MCF-7 cells. • Conjugate significantly reduced solid tumor volume as compared to pterostilbene

  14. Down-regulation of tumor-associated NADH oxidase, tNOX (ENOX2), enhances capsaicin-induced inhibition of gastric cancer cell growth.

    Science.gov (United States)

    Wang, His-Ming; Chuang, Show-Mei; Su, Yu-Ching; Li, Yi-Hui; Chueh, Pin Ju

    2011-11-01

    Gastric cancer is a common human malignancy and a major contributor to cancer-related deaths worldwide. Unfortunately, the prognosis of most gastric cancer patients is poor because they are generally diagnosed at a late stage after the cancer has already metastasized. Most current research, therefore, emphasizes selective targeting of cancer cells by apoptosis-inducing agents. One such therapeutic agent is capsaicin, a component of chili peppers that has been shown to possess anti-growth activity against various cancer cell lines. Here, we examined the effect of capsaicin on SNU-1 and TMC-1 gastric cancer cells and found differing outcomes between the two cell lines. Our results show that capsaicin induced significant cytotoxicity with increases in oxidative stress, PARP cleavage, and apoptosis in sensitive SNU-1 cells. In contrast, TMC-1 cells were much less sensitive to capsaicin, exhibiting low cytotoxicity and very little apoptosis in response to capsaicin treatment. Capsaicin-induced apoptosis in SNU-1 cells was associated with down-regulation of tumor-associated NADH oxidase (tNOX) mRNA and protein. On the contrary, tNOX expression was scarcely affected by capsaicin in TMC-1 cells. We further showed that tNOX-knockdown sensitized TMC-1 cells to capsaicin-induced apoptosis and G1 phase accumulation, and led to decreased cell growth, demonstrating that tNOX is essential for cancer cell growth. Collectively, these results indicate that capsaicin induces divergent effects of the growth of gastric cancer cells that parallel its effects on tNOX expression, and demonstrate that forced tNOX down-regulation restored capsaicin-induced growth inhibition in TMC-1 cells.

  15. NO-donating nonsteroidal antiinflammatory drugs (NSAIDs) inhibit colon cancer cell growth more potently than traditional NSAIDs: a general pharmacological property?

    Science.gov (United States)

    Yeh, Raymond K; Chen, Jie; Williams, Jennie L; Baluch, Mehdi; Hundley, Thomas R; Rosenbaum, Raphael E; Kalala, Srinivas; Traganos, Frank; Benardini, Francesca; del Soldato, Piero; Kashfi, Khosrow; Rigas, Basil

    2004-06-15

    The novel nitric oxide-donating nonsteroidal antiinflammatory drugs (NO-NSAIDs), consisting of a traditional NSAID to which a NO releasing moiety is covalently attached, may have an important role in colon cancer prevention and/or treatment. Preclinical studies have shown that NO-aspirin (NO-ASA) is more potent than traditional ASA in preventing colon cancer. Preclinical and clinical studies have also documented its superior safety, compared to traditional ASA. To evaluate the role of this structural modification on the cancer cell growth inhibitory effect of NSAIDs, we studied seven pairs of traditional NSAIDs (ASA, salicylic acid, indomethacin, sulindac, ibuprofen, flurbiprofen, piroxicam) and their corresponding NO-NSAIDs. All NO-NSAIDs (except NO-piroxicam which is a salt and not a true NO-NSAID) have greater potency in inhibiting HT-29 and HCT-15 colon cancer cell growth compared to their NSAID counterparts: the IC(50)s of the NO-NSAIDs were enhanced between 7- and 689-fold in HT-29 cells and 1.7- to 1083-fold in HCT-15 cells over those of the corresponding NSAIDs. Their growth inhibitory effect is due to a profound cell kinetic effect consisting of reduced cell proliferation and enhanced cell death. Since HT-29 cells express cyclooxygenases but HCT-15 do not, this effect appears independent of cyclooxygenase in the colon cancer cells. Thus the structural modification of these traditional NSAIDs leading to NO-NSAIDs enhances their potency in inhibiting colon cancer cell growth. Our findings suggest that the enhanced potency imparted on NSAIDs by this structural modification represents a pharmacological property that may be a general one for this class of compounds.

  16. Glycogen synthase kinase-3 inhibitors suppress the AR-V7-mediated transcription and selectively inhibit cell growth in AR-V7-positive prostate cancer cells.

    Science.gov (United States)

    Nakata, Daisuke; Koyama, Ryokichi; Nakayama, Kazuhide; Kitazawa, Satoshi; Watanabe, Tatsuya; Hara, Takahito

    2017-06-01

    Recent evidence suggests that androgen receptor (AR) splice variants, including AR-V7, play a pivotal role in resistance to androgen blockade in prostate cancer treatment. The development of new therapeutic agents that can suppress the transcriptional activities of AR splice variants has been anticipated as the next generation treatment of castration-resistant prostate cancer. High-throughput screening of AR-V7 signaling inhibitors was performed using an AR-V7 reporter system. The effects of a glycogen synthase kinase-3 (GSK3) inhibitor, LY-2090314, on endogenous AR-V7 signaling were evaluated in an AR-V7-positive cell line, JDCaP-hr, by quantitative reverse transcription polymerase chain reaction. The relationship between AR-V7 signaling and β-catenin signaling was assessed using RNA interference. The effect of LY-2090314 on cell growth in various prostate cancer cell lines was also evaluated. We identified GSK3 inhibitors as transcriptional suppressors of AR-V7 using a high-throughput screen with an AR-V7 reporter system. LY-2090314 suppressed the reporter activity and endogenous AR-V7 activity in JDCaP-hr cells. Because silencing of β-catenin partly rescued the suppression, it was evident that the suppression was mediated, at least partially, via the activation of β-catenin signaling. AR-V7 signaling and β-catenin signaling reciprocally regulate each other in JDCaP-hr cells, and therefore, GSK3 inhibition can repress AR-V7 transcriptional activity by accumulating intracellular β-catenin. Notably, LY-2090314 selectively inhibited the growth of AR-V7-positive prostate cancer cells in vitro. Our findings demonstrate the potential of GSK3 inhibitors in treating advanced prostate cancer driven by AR splice variants. In vivo evaluation of AR splice variant-positive prostate cancer models will help illustrate the overall significance of GSK3 inhibitors in treating prostate cancer. © 2017 Wiley Periodicals, Inc.

  17. Reversible lysine-specific demethylase 1 antagonist HCI-2509 inhibits growth and decreases c-MYC in castration- and docetaxel-resistant prostate cancer cells.

    Science.gov (United States)

    Gupta, S; Weston, A; Bearrs, J; Thode, T; Neiss, A; Soldi, R; Sharma, S

    2016-12-01

    Lysine-specific demethylase 1 (LSD1 or KDM1A) overexpression correlates with poor survival and castration resistance in prostate cancer. LSD1 is a coregulator of ligand-independent androgen receptor signaling promoting c-MYC expression. We examined the antitumor efficacy of LSD1 inhibition with HCI-2509 in advanced stages of prostate cancer. Cell survival, colony formation, histone methylation, c-MYC level, c-MYC expression, cell cycle changes and in vivo efficacy were studied in castration-resistant prostate cancer cells upon treatment with HCI-2509. In vitro combination studies, using HCI-2509 and docetaxel, were performed to assess the synergy. Cell survival, colony formation, histone methylation and c-myc levels were studied in docetaxel-resistant prostate cancer cells treated with HCI-2509. HCI-2509 is cytotoxic and inhibits colony formation in castration-resistant prostate cancer cells. HCI-2509 treatment causes a dose-dependent increase in H3K9me2 (histone H3lysine 9) levels, a decrease in c-MYC protein, inhibition of c-MYC expression and accumulation in the G0/G1 phase of the cell cycle in these cells. PC3 xenografts in mice have a significant reduction in tumor burden upon treatment with HCI-2509 with no associated myelotoxicity or weight loss. More synergy is noted at sub-IC 50 (half-maximal inhibitory concentration) doses of docetaxel and HCI-2509 in PC3 cells than in DU145 cells. HCI-2509 has growth-inhibitory efficacy and decreases the c-myc level in docetaxel-resistant prostate cancer cells. LSD1 inhibition with HCI-2509 decreases the c-MYC level in poorly differentiated prostate cancer cell lines and has a therapeutic potential in castration- and docetaxel-resistant prostate cancer.

  18. Inhibition of Tumor Growth of Human Hepatocellular Carcinoma HepG2 Cells in a Nude Mouse Xenograft Model by the Total Flavonoids from Arachniodes exilis

    Directory of Open Access Journals (Sweden)

    Huimin Li

    2017-01-01

    Full Text Available A tumor growth model of human hepatocellular carcinoma HepG2 cells in nude mice was employed to investigate the antitumor activity of the total flavonoids extracted from Arachniodes exilis (TFAE in vivo. Several biochemical assays including hematoxylin-eosin (HE staining, immunohistochemistry, and Western blot were performed to elucidate the mechanism of action of total flavonoids extracted from Arachniodes exilis (TFAE. The results showed that TFAE effectively inhibited the tumor growth of hepatocellular carcinoma in nude mice and had no significant effect on body weight, blood system, and functions of liver and kidney. Expression levels of proapoptotic proteins Bax and cleaved caspase-3 remarkably increased while the expressions of Bcl-2, HIF-1α, and VEGF were suppressed by TFAE. These results suggested that the antitumor potential of TFEA was implied by the apoptosis of tumor cells and the inhibition of angiogenesis in tumor tissue.

  19. Dietary agent, benzyl isothiocyanate inhibits signal transducer and activator of transcription 3 phosphorylation and collaborates with sulforaphane in the growth suppression of PANC-1 cancer cells

    Directory of Open Access Journals (Sweden)

    Deangelis Stephanie

    2009-08-01

    Full Text Available Abstract The Signal Transducer and Activator of Transcription (STAT proteins comprise a family of latent transcription factors with diverse functions. STAT3 has well established roles in cell proliferation, growth and survival, and its persistent activation has been detected with high frequency in many human cancers. As constitutive activation of STAT3 appears to be vital for the continued survival of these cancerous cells, it has emerged as an attractive target for chemotherapeutics. We examined whether the inhibitory activities of bioactive compounds from cruciferous vegetables, such as Benzyl isothiocyanate (BITC and sulforaphane, extended to STAT3 activation in PANC-1 human pancreatic cancer cells. BITC and sulforaphane were both capable of inhibiting cell viability and inducing apoptosis in PANC-1. Sulforaphane had minimal effect on the direct inhibition of STAT3 tyrosine phosphorylation, however, suggesting its inhibitory activities are most likely STAT3-independent. Conversely, BITC was shown to inhibit the tyrosine phosphorylation of STAT3, but not the phosphorylation of ERK1/2, MAPK and p70S6 kinase. These results suggest that STAT3 may be one of the targets of BITC-mediated inhibition of cell viability in PANC-1 cancer cells. In addition, we show that BITC can prevent the induction of STAT3 activation by Interleukin-6 in MDA-MB-453 breast cancer cells. Furthermore, combinations of BITC and sulforaphane inhibited cell viability and STAT3 phosphorylation more dramatically than either agent alone. These findings suggest that the combination of the dietary agents BITC and sulforaphane has potent inhibitory activity in pancreatic cancer cells and that they may have translational potential as chemopreventative or therapeutic agents.

  20. Role of Smad proteins in resistance to BMP-induced growth inhibition in B-cell lymphoma.

    Directory of Open Access Journals (Sweden)

    Kanutte Huse

    Full Text Available Bone morphogenetic protein (BMP expression and signaling are altered in a variety of cancers, but the functional impact of these alterations is uncertain. In this study we investigated the impact of expression of multiple BMPs and their signaling pathway components in human B-cell lymphoma. BMP messages, in particular BMP7, were detected in normal and malignant B cells. Addition of exogenous BMPs inhibited DNA synthesis in most lymphoma cell lines examined, but some cell lines were resistant. Tumor specimens from three out of five lymphoma patients were also resistant to BMPs, as determined by no activation of the BMP effectors Smad1/5/8. We have previously shown that BMP-7 potently induced apoptosis in normal B cells, which was in contrast to no or little inhibitory effect of this BMP in the lymphoma cells tested. BMP-resistance mechanisms were investigated by comparing sensitive and resistant cell lines. While BMP receptors are downregulated in many cancers, we documented similar receptor levels in resistant and sensitive lymphoma cells. We found a positive correlation between activation of Smad1/5/8 and inhibition of DNA synthesis. Gene expression analysis of two independent data sets showed that the levels of inhibitory Smads varied across different B-cell lymphoma. Furthermore, stable overexpression of Smad7 in two different BMP-sensitive cell lines with low endogenous levels of SMAD7, rendered them completely resistant to BMPs. This work highlights the role of Smads in determining the sensitivity to BMPs and shows that upregulation of Smad7 in cancer cells is sufficient to escape the negative effects of BMPs.

  1. Camptothecin inhibits platelet-derived growth factor-BB-induced proliferation of rat aortic vascular smooth muscle cells through inhibition of PI3K/Akt signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Park, Eun-Seok [Department of Applied Biochemistry, Division of Life Science, College of Health and Biomedical Science, Konkuk University, Chungju, Chungbuk (Korea, Republic of); Kang, Shin-il [College of Pharmacy Medical Research Center, Chungbuk National University, Cheongju (Korea, Republic of); Yoo, Kyu-dong [Hazardous Substances Analysis Division, Gwangju Regional Food and Drug Administration, Gwangju (Korea, Republic of); Lee, Mi-Yea [Department of Nursing Kyungbok University, Pocheon (Korea, Republic of); Yoo, Hwan-Soo; Hong, Jin-Tae [College of Pharmacy Medical Research Center, Chungbuk National University, Cheongju (Korea, Republic of); Shin, Hwa-Sup [Department of Applied Biochemistry, Division of Life Science, College of Health and Biomedical Science, Konkuk University, Chungju, Chungbuk (Korea, Republic of); Kim, Bokyung [Department of Physiology, Konkuk Medical School, Konkuk University, Chungju, Chungbuk (Korea, Republic of); Yun, Yeo-Pyo, E-mail: ypyun@chungbuk.ac.kr [College of Pharmacy Medical Research Center, Chungbuk National University, Cheongju (Korea, Republic of)

    2013-04-15

    The abnormal proliferation of vascular smooth muscle cells (VSMCs) in arterial wall is a major cause of vascular disorders such as atherosclerosis and restenosis after angioplasty. In this study, we investigated not only the inhibitory effects of camptothecin (CPT) on PDGF-BB-induced VSMC proliferation, but also its molecular mechanism of this inhibition. CPT significantly inhibited proliferation with IC50 value of 0.58 μM and the DNA synthesis of PDGF-BB-stimulated VSMCs in a dose-dependent manner (0.5–2 μM ) without any cytotoxicity. CPT induced the cell cycle arrest at G0/G1 phase. Also, CPT decreased the expressions of G0/G1-specific regulatory proteins including cyclin-dependent kinase (CDK)2, cyclin D1 and PCNA in PDGF-BB-stimulated VSMCs. Pre-incubation of VSMCs with CPT significantly inhibited PDGF-BB-induced Akt activation, whereas CPT did not affect PDGF-receptor beta phosphorylation, extracellular signal-regulated kinase (ERK) 1/2 phosphorylation and phospholipase C (PLC)-γ1 phosphorylation in PDGF-BB signaling pathway. Our data showed that CPT pre-treatment inhibited VSMC proliferation, and that the inhibitory effect of CPT was enhanced by LY294002, a PI3K inhibitor, on PDGF-BB-induced VSMC proliferation. In addition, inhibiting the PI3K/Akt pathway by LY294002 significantly enhanced the suppression of PCNA expression and Akt activation by CPT. These results suggest that the anti-proliferative activity of CPT is mediated in part by downregulating the PI3K/Akt signaling pathway. - Highlights: ► CPT inhibits proliferation of PDGF-BB-induced VSMC without cytotoxicity. ► CPT arrests the cell cycle in G0/G1 phase by downregulation of cyclin D1 and CDK2. ► CPT significantly attenuates Akt phosphorylation in PDGF-BB signaling pathway. ► LY294002 enhanced the inhibitory effect of CPT on VSMC proliferation. ► Thus, CPT is mediated by downregulating the PI3K/Akt signaling pathway.

  2. Epidermal growth factor inhibits glycylsarcosine transport and hPepT1 expression in a human intestinal cell line

    DEFF Research Database (Denmark)

    Nielsen, C U; Amstrup, J; Steffansen, B

    2001-01-01

    The human intestinal cell line Caco-2 was used as a model system to study the effects of epidermal growth factor (EGF) on peptide transport. EGF decreased apical-to-basolateral fluxes of [(14)C]glycylsarcosine ([(14)C]Gly-Sar) up to 50.2 +/- 3.6% (n = 6) of control values. Kinetic analysis......) in cells treated with EGF. Western blotting indicated a decrease in hPepT1 protein in cell lysates. We conclude that EGF treatment decreases Gly-Sar transport in Caco-2 cells by decreasing the number of peptide transporter molecules in the apical membrane....

  3. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  4. A novel long noncoding RNA AK001796 acts as an oncogene and is involved in cell growth inhibition by resveratrol in lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Qiaoyuan [Institute for Chemical Carcinogenesis, State Key Laboratory of Respiratory Diseases, Guangzhou Medical University, Guangzhou 510182 (China); Xu, Enwu [Department of Thoracic Surgery, General Hospital of Guangzhou Military Command of Chinese People' s Liberation Army, Guangzhou 510010 (China); Dai, Jiabin; Liu, Binbin; Han, Zhiyuan; Wu, Jianjun; Zhang, Shaozhu; Peng, Baoying [Institute for Chemical Carcinogenesis, State Key Laboratory of Respiratory Diseases, Guangzhou Medical University, Guangzhou 510182 (China); Zhang, Yajie [Department of Pathology, Guangzhou Medical University, Guangzhou 510182 (China); Jiang, Yiguo, E-mail: jiangyiguo@vip.163.com [Institute for Chemical Carcinogenesis, State Key Laboratory of Respiratory Diseases, Guangzhou Medical University, Guangzhou 510182 (China)

    2015-06-01

    Lung cancer is the most common form of cancer throughout the world. The specific targeting of long noncoding RNAs (lncRNAs) by resveratrol opened a new avenue for cancer chemoprevention. In this study, we found that 21 lncRNAs were upregulated and 19 lncRNAs were downregulated in lung cancer A549 cells with 25 μmol/L resveratrol treatment determined by microarray analysis. AK001796, the lncRNA with the most clearly altered expression, was overexpressed in lung cancer tissues and cell lines, but its expression was downregulated in resveratrol-treated lung cancer cells. By monitoring cell proliferation and growth in vitro and tumor growth in vivo, we observed a significant reduction in cell viability in lung cancer cells and a slow growth in the tumorigenesis following AK001796 knockdown. We also found that AK001796 knockdown caused a cell-cycle arrest, with significant increases in the percentage of cells in G{sub 0}/G{sub 1} in lung cancer cells. By using cell cycle pathway-specific PCR arrays, we detected changes in a number of cell cycle-related genes related to lncRNA AK001796 knockdown. We further investigated whether AK001796 participated in the anticancer effect of resveratrol and the results showed that reduced lncRNA AK001796 level potentially impaired the inhibitory effect of resveratrol on cell proliferation. To our knowledge, this is the first study to report the changes in an lncRNA expression profile induced by resveratrol in lung cancer. - Highlights: • LncRNA AK001796 played an oncogenic role in lung carcinogenesis. • LncRNA AK001796 was downregulated in resveratrol-treated lung cancer cells. • LncRNA AK001796 was involved in the inhibition of cell growth by resveratrol.

  5. Retracted: siRNA Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells

    Science.gov (United States)

    Huang, Wei-Yi; Chen, Dong-Hui; Ning, Li; Wang, Li-Wei

    2017-10-27

    Retraction: Retracted: siRNA mediated silencing of NIN1/RPN12 binding protein 1 homolog inhibits proliferation and growth of breast cancer cells Asian Pacific Journal of Cancer Prevention has retracted the article titled “siRNA mediated silencing of NIN1/RPN12 binding protein 1 homolog inhibits proliferation and growth of breast cancer cells”(1) for reason of similarity with a series of articles identified by Byrne and Labbé (2). 1. Huang WY1, Chen DH, Ning L, Wang LW. siRNA mediated silencing of NIN1/RPN12 binding protein 1 homolog inhibits proliferation and growth of breast cancer cells. Asian Pac J Cancer Prev. 2012;13(5):1823-7. 2. J. A. Byrne and C. Labbé, “Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines,” Scientometrics, vol. 110, no. 3, pp. 1471–1493, 2017. Authors did not respond to request for comment.

  6. Transforming growth factor-β inhibits CCAAT/enhancer-binding protein expression and PPARγ activity in unloaded bone marrow stromal cells

    International Nuclear Information System (INIS)

    Ahdjoudj, S.; Kaabeche, K.; Holy, X.; Fromigue, O.; Modrowski, D.; Zerath, E.; Marie, P.J.

    2005-01-01

    The molecular mechanisms regulating the adipogenic differentiation of bone marrow stromal cells in vivo remain largely unknown. In this study, we investigated the regulatory effects of transforming growth factor beta-2 (TGF-β2) on transcription factors involved in adipogenic differentiation induced by hind limb suspension in rat bone marrow stromal cells in vivo. Time course real-time quantitative reverse-transcription polymerase chain reaction (RT-PCR) analysis of gene expression showed that skeletal unloading progressively increases the expression of CCAAT/enhancer-binding protein (C/EBP)α and C/EBPβ α at 5 days in bone marrow stromal cells resulting in increased peroxisome proliferator-activated receptor γ (PPARγ2) transcripts at 7 days. TGF-β2 administration in unloaded rats corrected the rise in C/EBPα and C/EBPβ transcripts induced by unloading in bone marrow stromal cells. This resulted in inhibition of PPARγ2 expression that was associated with increased Runx2 expression. Additionally, the inhibition of C/EBPα and C/EBPβ expression by TGF-β2 was associated with increased PPARγ serine phosphorylation in bone marrow stromal cells, a mechanism that inhibits PPARγ transactivating activity. The sequential inhibitory effect of TGF-β2 on C/EBPα, C/EBPβ, and PPARγ2 resulted in reduced LPL expression and abolition of bone marrow stromal cell adipogenic differentiation, which contributed to prevent bone loss induced by skeletal unloading. We conclude that TGF-β2 inhibits the excessive adipogenic differentiation of bone marrow stromal cells induced by skeletal unloading by inhibiting C/EBPα, C/EBPβ, and PPARγ expression and activity, which provides a sequential mechanism by which TGF-β2 regulates adipogenic differentiation of bone marrow stromal cells in vivo

  7. Inhibition of enzyme activity of Rhipicephalus (Boophilus) microplus triosephosphate isomerase and BME26 cell growth by monoclonal antibodies.

    Science.gov (United States)

    Saramago, Luiz; Franceschi, Mariana; Logullo, Carlos; Masuda, Aoi; Vaz, Itabajara da Silva; Farias, Sandra Estrazulas; Moraes, Jorge

    2012-10-12

    In the present work, we produced two monoclonal antibodies (BrBm37 and BrBm38) and tested their action against the triosephosphate isomerase of Rhipicephalus (Boophilus) microplus (RmTIM). These antibodies recognize epitopes on both the native and recombinant forms of the protein. rRmTIM inhibition  by BrBm37 was up to 85% whereas that of BrBrm38 was 98%, depending on the antibody-enzyme ratio. RmTIM activity was lower in ovarian, gut, and fat body tissue extracts treated with BrBm37 or BrBm38 mAbs. The proliferation of the embryonic tick cell line (BME26) was inhibited by BrBm37 and BrBm38 mAbs. In summary, the results reveal that it is possible to interfere with the RmTIM function using antibodies, even in intact cells.

  8. Inhibition of Enzyme Activity of Rhipicephalus (Boophilus microplus Triosephosphate Isomerase and BME26 Cell Growth by Monoclonal Antibodies

    Directory of Open Access Journals (Sweden)

    Jorge Moraes

    2012-10-01

    Full Text Available In the present work, we produced two monoclonal antibodies (BrBm37 and BrBm38 and tested their action against the triosephosphate isomerase of Rhipicephalus (Boophilus microplus (RmTIM. These antibodies recognize epitopes on both the native and recombinant forms of the protein. rRmTIM inhibition  by BrBm37 was up to 85% whereas that of BrBrm38 was 98%, depending on the antibody-enzyme ratio. RmTIM activity was lower in ovarian, gut, and fat body tissue extracts treated with BrBm37 or BrBm38 mAbs. The proliferation of the embryonic tick cell line (BME26 was inhibited by BrBm37 and BrBm38 mAbs. In summary, the results reveal that it is possible to interfere with the RmTIM function using antibodies, even in intact cells.

  9. MiR-124 Inhibits Growth and Enhances Radiation-Induced Apoptosis in Non-Small Cell Lung Cancer by Inhibiting STAT3

    Directory of Open Access Journals (Sweden)

    Mengjie Wang

    2017-12-01

    Full Text Available Background/Aims: A growing body of evidence indicates that the abnormal expression of microRNAs (miRNAs play an important role in sensitizing the cellular response to ionizing radiation (IR. The aim of this study was to investigate whether the expression of miR-124 correlated with radiosensitivity in the context of non-small-cell lung carcinoma (NSCLC. Methods: Quantitative reverse transcription polymerase chain reaction (RT-PCR was used to quantify miR-124 expression in NSCLC tissues and cell lines. The role of miR-124 in NSCLC proliferation and radiosensitivity was analyzed using CCK-8 and flow cytometry apoptosis assays. Luciferase activity assays, RT-PCR, and Western blot assays were performed to confirm the target gene of miR-124. Results: In this study, we found that miR-124 was downregulated both in clinical NSCLC samples and in cell lines. miR-124 inhibited the proliferation of NSCLC cells and enhanced the apoptosis of NSCLC cells exposed to ionizing radiation. We identified signal transducer and activator of transcription 3 (STAT3 as a direct target of miR-124 by using target prediction algorithms and luciferase assays. Overexpression of STAT3 in A549 cell lines restored the enhanced radiosensitivity induced by miR-124. Conclusion: Taking these observations into consideration, we illustrated that miR-124 is a potential target for enhancing the radiosensitivity of NSCLC cells by targeting STAT3.

  10. Fluoroquinolone-mediated inhibition of cell growth, S-G2/M cell cycle arrest, and apoptosis in canine osteosarcoma cell lines.

    Directory of Open Access Journals (Sweden)

    Kyoung won Seo

    Full Text Available Despite significant advancements in osteosarcoma research, the overall survival of canine and human osteosarcoma patients has remained essentially static over the past 2 decades. Post-operative limb-spare infection has been associated with improved survival in both species, yet a mechanism for improved survival has not been clearly established. Given that the majority of canine osteosarcoma patients experiencing post-operative infections were treated with fluoroquinolone antibiotics, we hypothesized that fluoroquinolone antibiotics might directly inhibit the survival and proliferation of canine osteosarcoma cells. Ciprofloxacin or enrofloxacin were found to inhibit p21(WAF1 expression resulting in decreased proliferation and increased S-G(2/M accumulation. Furthermore, fluoroquinolone exposure induced apoptosis of canine osteosarcoma cells as demonstrated by cleavage of caspase-3 and PARP, and activation of caspase-3/7. These results support further studies examining the potential impact of quinolones on survival and proliferation of osteosarcoma.

  11. Metformin combined with aspirin significantly inhibit pancreatic cancer cell growth in vitro and in vivo by suppressing anti-apoptotic proteins Mcl-1 and Bcl-2.

    Science.gov (United States)

    Yue, Wen; Zheng, Xi; Lin, Yong; Yang, Chung S; Xu, Qing; Carpizo, Darren; Huang, Huarong; DiPaola, Robert S; Tan, Xiang-Lin

    2015-08-28

    Metformin and aspirin have been studied extensively as cancer preventive or therapeutic agents. However, the effects of their combination on pancreatic cancer cells have not been investigated. Herein, we evaluated the effects of metformin and aspirin, alone or in combination, on cell viability, migration, and apoptosis as well as the molecular changes in mTOR, STAT3 and apoptotic signaling pathways in PANC-1 and BxPC3 cells. Metformin and aspirin, at relatively low concentrations, demonstrated synergistically inhibitory effects on cell viability. Compared to the untreated control or individual drug, the combination of metformin and aspirin significantly inhibited cell migration and colony formation of both PANC-1 and BxPC-3 cells. Metformin combined with aspirin significantly inhibited the phosphorylation of mTOR and STAT3, and induced apoptosis as measured by caspase-3 and PARP cleavage. Remarkably, metformin combined with aspirin significantly downregulated the anti-apoptotic proteins Mcl-1 and Bcl-2, and upregulated the pro-apoptotic proteins Bim and Puma, as well as interrupted their interactions. The downregulation of Mcl-1 and Bcl-2 was independent of AMPK or STAT3 pathway but partially through mTOR signaling and proteasome degradation. In a PANC-1 xenograft mouse model, we demonstrated that the combination of metformin and aspirin significantly inhibited tumor growth and downregulated the protein expression of Mcl-1 and Bcl-2 in tumors. Taken together, the combination of metformin and aspirin significantly inhibited pancreatic cancer cell growth in vitro and in vivo by regulating the pro- and anti-apoptotic Bcl-2 family members, supporting the continued investigation of this two drug combination as chemopreventive or chemotherapeutic agents for pancreatic cancer.

  12. Metformin combined with aspirin significantly inhibit pancreatic cancer cell growth in vitro and in vivo by suppressing anti-apoptotic proteins Mcl-1 and Bcl-2

    Science.gov (United States)

    Yue, Wen; Zheng, Xi; Lin, Yong; Yang, Chung S.; Xu, Qing; Carpizo, Darren; Huang, Huarong; DiPaola, Robert S.; Tan, Xiang-Lin

    2015-01-01

    Metformin and aspirin have been studied extensively as cancer preventive or therapeutic agents. However, the effects of their combination on pancreatic cancer cells have not been investigated. Herein, we evaluated the effects of metformin and aspirin, alone or in combination, on cell viability, migration, and apoptosis as well as the molecular changes in mTOR, STAT3 and apoptotic signaling pathways in PANC-1 and BxPC3 cells. Metformin and aspirin, at relatively low concentrations, demonstrated synergistically inhibitory effects on cell viability. Compared to the untreated control or individual drug, the combination of metformin and aspirin significantly inhibited cell migration and colony formation of both PANC-1 and BxPC-3 cells. Metformin combined with aspirin significantly inhibited the phosphorylation of mTOR and STAT3, and induced apoptosis as measured by caspase-3 and PARP cleavage. Remarkably, metformin combined with aspirin significantly downregulated the anti-apoptotic proteins Mcl-1 and Bcl-2, and upregulated the pro-apoptotic proteins Bim and Puma, as well as interrupted their interactions. The downregulation of Mcl-1 and Bcl-2 was independent of AMPK or STAT3 pathway but partially through mTOR signaling and proteasome degradation. In a PANC-1 xenograft mouse model, we demonstrated that the combination of metformin and aspirin significantly inhibited tumor growth and downregulated the protein expression of Mcl-1 and Bcl-2 in tumors. Taken together, the combination of metformin and aspirin significantly inhibited pancreatic cancer cell growth in vitro and in vivo by regulating the pro- and anti-apoptotic Bcl-2 family members, supporting the continued investigation of this two drug combination as chemopreventive or chemotherapeutic agents for pancreatic cancer. PMID:26056043

  13. PHA665752, a small-molecule inhibitor of c-Met, inhibits hepatocyte growth factor-stimulated migration and proliferation of c-Met-positive neuroblastoma cells

    International Nuclear Information System (INIS)

    Crosswell, Hal E; Dasgupta, Anindya; Alvarado, Carlos S; Watt, Tanya; Christensen, James G; De, Pradip; Durden, Donald L; Findley, Harry W

    2009-01-01

    c-Met is a tyrosine kinase receptor for hepatocyte growth factor/scatter factor (HGF/SF), and both c-Met and its ligand are expressed in a variety of tissues. C-Met/HGF/SF signaling is essential for normal embryogenesis, organogenesis, and tissue regeneration. Abnormal c-Met/HGF/SF signaling has been demonstrated in different tumors and linked to aggressive and metastatic tumor phenotypes. In vitro and in vivo studies have demonstrated inhibition of c-Met/HGF/SF signaling by the small-molecule inhibitor PHA665752. This study investigated c-Met and HGF expression in two neuroblastoma (NBL) cell lines and tumor tissue from patients with NBL, as well as the effects of PHA665752 on growth and motility of NBL cell lines. The effect of the tumor suppressor protein PTEN on migration and proliferation of tumor cells treated with PHA665752 was also evaluated. Expression of c-Met and HGF in NBL cell lines SH-EP and SH-SY5Y and primary tumor tissue was assessed by immunohistochemistry and quantitative RT-PCR. The effect of PHA665752 on c-Met/HGF signaling involved in NBL cell proliferation and migration was evaluated in c-Met-positive cells and c-Met-transfected cells. The transwell chemotaxis assay and the MTT assay were used to measure migration and proliferation/cell-survival of tumor cells, respectively. The PPAR-γ agonist rosiglitazone was used to assess the effect of PTEN on PHA665752-induced inhibition of NBL cell proliferation/cell-survival and migration High c-Met expression was detected in SH-EP cells and primary tumors from patients with advanced-stage disease. C-Met/HGF signaling induced both migration and proliferation of SH-EP cells. Migration and proliferation/cell-survival were inhibited by PHA665752 in a dose-dependent manner. We also found that induced overexpression of PTEN following treatment with rosiglitazone significantly enhanced the inhibitory effect of PHA665752 on NBL-cell migration and proliferation. c-Met is highly expressed in most tumors from

  14. [Adenovirus-mediated delivery of nm23-H1 gene inhibits growth of colorectal carcinoma cell line Lovo].

    Science.gov (United States)

    Wang, Qi; He, Xueling; Liu, Yan; Yin, Hailin

    2010-12-01

    This experimental study sought to find out the inhibitory effects of Ad-GFP-nm23-H1 on proliferation and metastasis of human colorectal carcinoma cell line Lovo, and, further, to gain an insight into some theoretical and methodical basis for instituting nm23-H1 gene therapy of cancers. MTT assay and Transwell chamber were used to detect the rates of proliferation and invasion as well as the adhesion of Lovo cells in vitro. The results demonstrated that the proliferation inhibition rates of Lovo cells treated with Ad-GFP-nm23-H1 of 10(10) PFU/ml, 10(9) PFU/ml and 10(8) PFU/ml were 84.9% +/- 1.51%, 48.5% +/- 7.23% and 22.5% +/- 5.47%, that the adherence inhibition rates of Lovo cells treated with Ad-GFP-nm23-H1 of 10(10) PFU/ml, 10(9) PFU/ml and 10(8) PFU/ml were 70.3% +/- 2.40%, 60.1% +/- 5.68% and 18.5% +/- 3.61%, and that the invasiveness inhibition rates of Lovo cells treated with Ad-GFP-nm23-H1 of 10(10) PFU/ml, 10(9) PFU/ml and 10(8) PFU/ml were 83.2% +/- 5.71%, 52.2% +/- 6.94% and 28.1% +/- 8.21%. These data suggested that Ad-GFP-nm23-H1 exerted significant inhibitory effects on the proliferation and metastasis of human colorectal carcinoma cell line Lovo in a dose-dependent way.

  15. Effect of inhibition of the Ubiquitin-Proteasome System and Hsp90 on growth and survival of Rhabdomyosarcoma cells in vitro

    Directory of Open Access Journals (Sweden)

    Peron Marica

    2012-06-01

    Full Text Available Abstract Background The ubiquitin-proteasome system (UPS and the heat shock response (HSR are two critical regulators of cell homeostasis, as their inhibition affects growth and survival of normal cells, as well as stress response and invasiveness of cancer cells. We evaluated the effects of the proteasome inhibitor Bortezomib and of 17-DMAG, a competitive inhibitor of Hsp90, in rhabdomyosarcoma (RMS cells, and analyzed the efficacy of single-agent exposures with combination treatments. Methods To assess cytotoxicity induced by Bortezomib and 17-DMAG in RMS cells, viability was measured by MTT assay after 24, 48 and 72 hours. Western blotting and immunofluorescence analyses were carried out to elucidate the mechanisms of action. Apoptosis was measured by FACS with Annexin-V-FITC and Propidium Iodide. Results Bortezomib and 17-DMAG, when combined at single low-toxic concentrations, enhanced growth inhibition of RMS cells, with signs of autophagy that included intensive cytoplasmic vacuolization and conversion of cytosolic LC3-I protein to its autophagosome-associated form. Treatment with lysosomal inhibitor chloroquine facilitates apoptosis, whereas stimulation of autophagy by rapamycin prevents LC3-I conversion and cell death, suggesting that autophagy is a resistance mechanism in RMS cells exposed to proteotoxic drugs. However, combination treatment also causes caspase-dependent apoptosis, PARP cleavage and Annexin V staining, as simultaneous inhibition of both UPS and HSR systems limits cytoprotective autophagy, exacerbating stress resulting from accumulation of misfolded proteins. Conclusion The combination of proteasome inhibitor Bortezomib with Hsp90 inhibitor 17-DMAG, appears to have important therapeutic advantages in the treatment of RMS cells compared with single-agent exposure, because compensatory survival mechanisms that occur as side effects of treatment may be prevented.

  16. Inhibiting oncogenic signaling by sorafenib activates PUMA via GSK3β and NF-κB to suppress tumor cell growth

    Science.gov (United States)

    Dudgeon, Crissy; Peng, Rui; Wang, Peng; Sebastiani, Andrea; Yu, Jian; Zhang, Lin

    2011-01-01

    Aberrant Ras/Raf/MEK/ERK signaling is one of the most prevalent oncogenic alterations and confers survival advantage to tumor cells. Inhibition of this pathway can effectively suppress tumor cell growth. For example, sorafenib, a multi-kinase inhibitor targeting c-Raf and other oncogenic kinases, has been used clinically for treating advanced liver and kidney tumors, and also has shown efficacy against other malignancies. However, how inhibition of oncogenic signaling by sorafenib and other drugs suppresses tumor cell growth remains unclear. In this study, we found that sorafenib kills cancer cells by activating PUMA, a p53 target and a BH3-only Bcl-2 family protein. Sorafenib treatment induces PUMA in a variety of cancer cells irrespective of their p53 status. Surprisingly, the induction of PUMA by sorafenib is mediated by IκB-independent activation of NF-κB, which directly binds to the PUMA promoter to activate its transcription. NF-κB activation by sorafenib requires GSK3β activation, subsequent to ERK inhibition. Deficiency in PUMA abrogates sorafenib-induced apoptosis and caspase activation, and renders sorafenib resistance in colony formation and xenograft tumor assays. Furthermore, the chemosensitization effect of sorafenib is dependent on PUMA, and involves concurrent PUMA induction through different pathways. BH3 mimetics potentiate the anticancer effects of sorafenib, and restore sorafenib sensitivity in resistant cells. Together, these results demonstrate a key role of PUMA-dependent apoptosis in therapeutic inhibition of Ras/Raf/MEK/ERK signaling. They provide a rationale for manipulating the apoptotic machinery to improve sensitivity and overcome resistance to the therapies that target oncogenic kinase signaling. PMID:22286758

  17. Dendritic cells pulsed with tumor cells killed by high hydrostatic pressure inhibit prostate tumor growth in TRAMP mice

    Czech Academy of Sciences Publication Activity Database

    Mikyšková, Romana; Indrová, Marie; Štěpánek, Ivan; Kanchev, Ivan; Bieblová, Jana; Vošahlíková, Š.; Moserová, I.; Truxová, I.; Fučíková, J.; Bartunkova, J.; Spisek, R.; Sedláček, Radislav; Reiniš, Milan

    2017-01-01

    Roč. 6, č. 12 (2017), č. článku e1362528. ISSN 2162-402X R&D Projects: GA MŠk(CZ) LM2015040; GA MŠk(CZ) ED1.1.00/02.0109; GA MŠk ED2.1.00/19.0395; GA ČR GA15-24769S Institutional support: RVO:68378050 Keywords : dendritic cells * docetaxel * high hydrostatic pressure * immunotherapy * prostate cancer Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Immunology Impact factor: 7.719, year: 2016

  18. The unique C- and N-terminal sequences of Metallothionein isoform 3 mediate growth inhibition and Vectorial active transport in MCF-7 cells.

    Science.gov (United States)

    Voels, Brent; Wang, Liping; Sens, Donald A; Garrett, Scott H; Zhang, Ke; Somji, Seema

    2017-05-25

    The 3rd isoform of the metallothionein (MT3) gene family has been shown to be overexpressed in most ductal breast cancers. A previous study has shown that the stable transfection of MCF-7 cells with the MT3 gene inhibits cell growth. The goal of the present study was to determine the role of the unique C-terminal and N-terminal sequences of MT3 on phenotypic properties and gene expression profiles of MCF-7 cells. MCF-7 cells were transfected with various metallothionein gene constructs which contain the insertion or the removal of the unique MT3 C- and N-terminal domains. Global gene expression analysis was performed on the MCF-7 cells containing the various constructs and the expression of the unique C- and N- terminal domains of MT3 was correlated to phenotypic properties of the cells. The results of the present study demonstrate that the C-terminal sequence of MT3, in the absence of the N-terminal sequence, induces dome formation in MCF-7 cells, which in cell cultures is the phenotypic manifestation of a cell's ability to perform vectorial active transport. Global gene expression analysis demonstrated that the increased expression of the GAGE gene family correlated with dome formation. Expression of the C-terminal domain induced GAGE gene expression, whereas the N-terminal domain inhibited GAGE gene expression and that the effect of the N-terminal domain inhibition was dominant over the C-terminal domain of MT3. Transfection with the metallothionein 1E gene increased the expression of GAGE genes. In addition, both the C- and the N-terminal sequences of the MT3 gene had growth inhibitory properties, which correlated to an increased expression of the interferon alpha-inducible protein 6. Our study shows that the C-terminal domain of MT3 confers dome formation in MCF-7 cells and the presence of this domain induces expression of the GAGE family of genes. The differential effects of MT3 and metallothionein 1E on the expression of GAGE genes suggests unique roles of

  19. Inhibition of Hepatitis C virus (HCV Core protein- induced Cell Growth by Non-structural Protein 4A (NS4A is Mediated by Mitochondrial Dysregulation

    Directory of Open Access Journals (Sweden)

    Denis Selimović

    2008-02-01

    Full Text Available Hepatitis C virus (HCV is a significant health problem facing the world. More than 170 million people are infected with HCV worldwide. HCV encodes a large polyprotein precursor that is processed into at least 10 distinct products including structural (core, E1 and E2 and non-structural (NS2, NS3, NS4A, NS4B, NS5A and NS5B. Besides its importance in virus replication, NS4A functions as a cofactor for NS3 and contributes to viral pathogenesis by influencing cellular functions. Here, we investigated the effect of NS4A protein on the growth rate induced by core protein in liver cells. Using our established tetracycline inducible system, we demonstrated the ability of NS4A protein to inhibit core protein-induced cell growth in Hepatoma cell line, HepG2. Induction of both core and NS4A proteins in HepG2- core/NS4A transfectants inhibited core-induced growth advantage in HepG2-core transfectants and blocked NS4A protein-induced cell growth inhibition in HepG2-NS4A transfectants. Using both immune fluorescence staining and Western blot analysis, we confirmed the localization of NS4A protein to the mitochondria in HepG2-NS4A transfectants expressing NS4A protein. Data obtained from flow cytometry analysis, using JC-1 demonstrated the loss of mitochondrial membrane potential (ΔΨ^ by the expression of NS4A protein in HepG2-NS4A transfectants, but not by the expression of core protein in HepG2-core transfectants. Whereas, the induction of the expression of both core and NS4A proteins in HepG2-core/NS4A transfectants blocked NS4A-induced loss of ΔΨm in HepG2 cells. Taken together, our data suggest an important role for mitochondria in the modulation HCV NS4A-induced inhibition of HCV core-mediated cell growth.

  20. 1,25-dihydroxyvitamin D(3) and PI3K/AKT inhibitors synergistically inhibit growth and induce senescence in prostate cancer cells.

    Science.gov (United States)

    Axanova, Linara S; Chen, Yong Q; McCoy, Thomas; Sui, Guangchao; Cramer, Scott D

    2010-11-01

    1-Alpha, 25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) inhibits proliferation of multiple cancer cell types including prostate cells and upregulates p21 and/or p27, while loss of Pten and PI3K/AKT activation stimulates survival and downregulates p21 and p27. We hypothesized that inhibition of the PI3K/AKT pathway synergizes with the antiproliferative signaling of 1,25(OH)(2)D(3). Viability, cell cycle and senescence of cells were evaluated upon combinational treatment with 1,25(OH)(2)D(3) and pharmacological PI3K/AKT inhibitors. Pharmacological inhibitors of PI3K or Akt and 1,25(OH)(2)D(3) synergistically inhibited growth of DU145, LNCaP, primary human prostate cancer cell strains and Pten null mouse prostatic epithelial cells (MPEC). The inhibitors used included API-2 (Triciribine) and GSK690693 which are currently in clinical trials for treatment of cancer. A novel mechanism for antiproliferative effects of 1,25(OH)(2)D(3) in prostate cells, induction of senescence, was discovered. Combination of 1,25(OH)(2)D(3) and AKT inhibitor cooperated to induce G(1) arrest, senescence, and p21 levels in prostate cancer cells. As AKT is commonly activated by PTEN loss, we evaluated the role of Pten in responsiveness to 1,25(OH)(2)D(3) using shRNA knockdown and by in vitro knockout of Pten. MPEC that lost Pten expression remained sensitive to the antiproliferative action of 1,25(OH)(2)D(3), and showed higher degree of synergism between AKT inhibitor and 1,25(OH)(2)D(3) compared to Pten-expressing counterparts. These findings provide the rationale for the development of therapies utilizing 1,25(OH)(2)D(3) or its analogs combined with inhibition of PI3K/AKT for the treatment of prostate cancer.

  1. 1,25-Dihydroxyvitamin D3 and PI3K/AKT Inhibitors Synergistically Inhibit Growth and Induce Senescence in Prostate Cancer Cells

    Science.gov (United States)

    Axanova, Linara S.; Chen, Yong Q.; McCoy, Thomas; Sui, Guangchao; Cramer, Scott D.

    2011-01-01

    BACKGROUND 1-Alpha, 25-dihydroxyvitamin D3 (1,25(OH)2D3) inhibits proliferation of multiple cancer cell types including prostate cells and upregulates p21 and/or p27, while loss of Pten and PI3K/AKT activation stimulates survival and down regulates p21 and p27. We hypothesized that inhibition of the PI3K/AKT pathway synergizes with the antiproliferative signaling of 1,25(OH)2D3. METHODS Viability, cell cycle and senescence of cells were evaluated upon combinational treatment with 1,25(OH)2D3 and pharmacological PI3K/AKT inhibitors. RESULTS Pharmacological inhibitors of PI3K or Akt and 1,25(OH)2D3 synergistically inhibited growth of DU145, LNCaP, primary human prostate cancer cell strains and Pten null mouse prostatic epithelial cells (MPEC). The inhibitors used included API-2 (Triciribine) and GSK690693 which are currently in clinical trials for treatment of cancer. A novel mechanism for antiproliferative effects of 1,25(OH)2D3 in prostate cells, induction of senescence, was discovered. Combination of 1,25(OH)2D3 and AKT inhibitor cooperated to induce G1 arrest, senescence, and p21 levels in prostate cancer cells. As AKT is commonly activated by PTEN loss, we evaluated the role of Pten in responsiveness to 1,25(OH)2D3 using shRNA knockdown and by in vitro knockout of Pten. MPEC that lost Pten expression remained sensitive to the antiproliferative action of 1,25(OH)2D3, and showed higher degree of synergism between AKT inhibitor and 1,25(OH)2D3 compared to Pten-expressing counterparts. CONCLUSIONS These findings provide the rationale for the development of therapies utilizing 1,25(OH)2D3 or its analogs combined with inhibition of PI3K/AKT for the treatment of prostate cancer. PMID:20583132

  2. Anti-insulin-like growth factor-IIP3 DNAzymes inhibit cell proliferation and induce caspase-dependent apoptosis in human hepatocarcinoma cell lines

    Directory of Open Access Journals (Sweden)

    Zhang M

    2013-10-01

    Full Text Available Min Zhang,1 Gregor PC Drummen,2 Su Luo11Medical Department, Beihua University, Jilin, People's Republic of China; 2Cellular Stress and Ageing Program, Bionanoscience and Bio-Imaging Program, Bio & Nano-Solutions, Düsseldorf, GermanyBackground: Insulin-like growth factor II (IGF-II is a fetal growth protein and an important proangiogenic factor controlled by four promoters (P, of which P2–P4 are inactive in the adult liver. Reactivation and dysregulation of IGF-IIP3 in particular is associated with the attenuation of apoptosis and increased proliferation in a number of liver cancer cell types. Its involvement in experimental liver carcinogenesis makes it a potential target for cancer gene therapy. We designed two IGF-IIP3 specific DNAzymes (DRz1 and DRz2 that target IGF-IIP3 messenger RNA (mRNA with the aim of reducing IGF-II expression through promoter 3.Methods: IGF-IIP3 mRNA and protein expression levels were assessed using real-time polymerase chain reaction and gel electrophoresis/western blotting after transfection with Lipofectamine® in SMMC-7721, Huh7, and HepG2 cell lines. Cell proliferation was determined via MTT assay; apoptosis was evaluated by fluorescence microscopy and with flow cytometry; procaspase-3 and -9 expression were detected via western blotting; and caspase activity was assayed colorimetrically. Standard procedures were used to calculate means and standard deviations, and P-values below 0.05 were considered to indicate significant differences.Results: DRzs were transfected into hepatocellular carcinoma cells and the results showed that DRz1, in particular, could decrease the expression of IGF-IIP3 by nearly 50%. Furthermore, DRz1 significantly inhibited cell proliferation and induced apoptosis. In addition, the downregulation of IGF-IIP3 expression was associated with increased caspase-3 and -9 activity in SMMC-7721 cells after 24 hours of transfection. In all experiments, the efficacy of DRz2 to influence IGF-IIP3

  3. Nitric oxide from inflammatory origin impairs neural stem cell proliferation by inhibiting epidermal growth factor receptor signaling

    Directory of Open Access Journals (Sweden)

    Bruno Pereira Carreira

    2014-10-01

    Full Text Available Neuroinflammation is characterized by activation of microglial cells, followed by production of nitric oxide (NO, which may have different outcomes on neurogenesis, favoring or inhibiting this process. In the present study, we investigated how the inflammatory mediator NO can affect proliferation of neural stem cells (NSC, and explored possible mechanisms underlying this effect. We investigated which mechanisms are involved in the regulation of NSC proliferation following treatment with an inflammatory stimulus (LPS plus IFN-γ, using a culture system of subventricular zone (SVZ-derived NSC mixed with microglia cells obtained from wild-type mice (iNOS+/+ or from iNOS knockout mice (iNOS-/-. We found an impairment of NSC cell proliferation in iNOS+/+ mixed cultures, which was not observed in iNOS-/- mixed cultures. Furthermore, the increased release of NO by activated iNOS+/+ microglial cells decreased the activation of the ERK/MAPK signaling pathway, which was concomitant with an enhanced nitration of the EGF receptor. Preventing nitrogen reactive species formation with MnTBAP, a scavenger of peroxynitrite, or using the peroxynitrite degradation catalyst FeTMPyP, cell proliferation and ERK signaling were restored to basal levels in iNOS+/+ mixed cultures. Moreover, exposure to the NO donor NOC-18 (100 µM, for 48 h, inhibited SVZ-derived NSC proliferation. Regarding the antiproliferative effect of NO, we found that NOC-18 caused the impairment of signaling through the ERK/MAPK pathway, which may be related to increased nitration of the EGF receptor in NSC. Using MnTBAP nitration was prevented, maintaining ERK signaling, rescuing NSC proliferation. We show that NO from inflammatory origin leads to a decreased function of the EGF receptor, which compromised proliferation of NSC. We also demonstrated that NO-mediated nitration of the EGF receptor caused a decrease in its phosphorylation, thus preventing regular proliferation signaling through the

  4. Fusion toxin BLyS-gelonin inhibits growth of malignant human B cell lines in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Troy A Luster

    Full Text Available B lymphocyte stimulator (BLyS is a member of the TNF superfamily of cytokines. The biological activity of BLyS is mediated by three cell surface receptors: BR3/BAFF-R, TACI and BCMA. The expression of these receptors is highly restricted to B cells, both normal and malignant. A BLyS-gelonin fusion toxin (BLyS-gel was generated consisting of the recombinant plant-derived toxin gelonin fused to the N-terminus of BLyS and tested against a large and diverse panel of B-NHL cell lines. Interestingly, B-NHL subtypes mantle cell lymphoma (MCL, diffuse large B cell lymphoma (DLBCL and B cell precursor-acute lymphocytic leukemia (BCP-ALL were preferentially sensitive to BLyS-gel mediated cytotoxicity, with low picomolar EC(50 values. BLyS receptor expression did not guarantee sensitivity to BLyS-gel, even though the construct was internalized by both sensitive and resistant cells. Resistance to BLyS-gel could be overcome by treatment with the endosomotropic drug chloroquine, suggesting BLyS-gel may become trapped within endosomal/lysosomal compartments in resistant cells. BLyS-gel induced cell death was caspase-independent and shown to be at least partially mediated by the "ribotoxic stress response." This response involves activation of p38 MAPK and JNK/SAPK, and BLyS-gel mediated cytotoxicity was inhibited by the p38/JNK inhibitor SB203580. Finally, BLyS-gel treatment was shown to localize to sites of disease, rapidly reduce tumor burden, and significantly prolong survival in xenograft mouse models of disseminated BCP-ALL, DLBCL, and MCL. Together, these findings suggest BLyS has significant potential as a targeting ligand for the delivery of cytotoxic "payloads" to malignant B cells.

  5. The soy-derived peptide Vglycin inhibits the growth of colon cancer cells in vitro and in vivo.

    Science.gov (United States)

    Gao, Chang; Sun, Rui; Xie, Ya-Rong; Jiang, An-Li; Lin, Mei; Li, Min; Chen, Zheng-Wang; Zhang, Ping; Jin, Honglin; Feng, Jue-Ping

    2017-05-01

    Vglycin, a novel natural polypeptide isolated from pea seeds, possesses antidiabetic properties. Our previous studies have shown that Vglycin can induce the differentiation of human colon adenocarcinoma cells. We aimed to determine the anticancer activity of Vglycin against colon cancer cells and to elucidate related apoptosis-inducing mechanisms. Treatment with purified Vglycin significantly reduced growth, viability, and colony formation of CT-26, SW480, and NCL-H716 colon cancer cells in a dose-dependent manner while down-regulating the expression of proliferating cell nuclear antigen. Mouse xenograft studies showed a 38% inhibition of colon cancer growth in mice treated with Vglycin (20 mg/kg/day) at day 21. Furthermore, the potential mechanisms involved in Vglycin-induced cell apoptosis were examined using cell cycle studies, ultrastructural examination, as well as apoptosis-associated pathway analysis. The results showed that Vglycin significantly promoted apoptosis and G1/S phase cell cycle arrest. As revealed by Western blot, the expression of CDK2 and Cyclin D1 was down-regulated in all three Vglycin-treated colon cancer cells, indicating that the CDK2/Cyclin D1 cell cycle pathway involved in the initiation and progression of colon cancer. Moreover, the inhibition of Vglycin-induced cell proliferation in colon cancer cells was accompanied by alteration of the expression levels of the apoptosis-related proteins Bax, Bcl-2 and Mcl-1, and an increase of caspase-3 activity. Together, our results suggest that Vglycin may be another plant-derived peptide that suppresses colon cancer, supporting the continued investigation of Vglycin as therapeutic agent for colon cancer. Impact statement The antidiabetic properties and the capability of inducing differentiation of human colon adenocarcinoma cells of Vglycin have been reported in our previous studies. However, the anticancer potential of Vglycin on colon cancer cells and its possible related mechanisms were

  6. The combination of gefitinib and RAD001 inhibits growth of HER2 overexpressing breast cancer cells and tumors irrespective of trastuzumab sensitivity

    Directory of Open Access Journals (Sweden)

    Masin Dana

    2011-10-01

    Full Text Available Abstract Background HER2-positive breast cancers exhibit high rates of innate and acquired resistance to trastuzumab (TZ, a HER2-directed antibody used as a first line treatment for this disease. TZ resistance may in part be mediated by frequent co-expression of EGFR and by sustained activation of the mammalian target of rapamycin (mTOR pathway. Here, we assessed feasibility of combining the EGFR inhibitor gefitinib and the mTOR inhibitor everolimus (RAD001 for treating HER2 overexpressing breast cancers with different sensitivity to TZ. Methods The gefitinib and RAD001 combination was broadly evaluated in TZ sensitive (SKBR3 and MCF7-HER2 and TZ resistant (JIMT-1 breast cancer models. The effects on cell growth were measured in cell based assays using the fixed molar ratio design and the median effect principle. In vivo studies were performed in Rag2M mice bearing established tumors. Analysis of cell cycle, changes in targeted signaling pathways and tumor characteristics were conducted to assess gefitinib and RAD001 interactions. Results The gefitinib and RAD001 combination inhibited cell growth in vitro in a synergistic fashion as defined by the Chou and Talalay median effect principle and increased tumor xenograft growth delay. The improvement in therapeutic efficacy by the combination was associated in vitro with cell line dependent increases in cytotoxicity and cytostasis while treatment in vivo promoted cytostasis. The most striking and consistent therapeutic effect of the combination was increased inhibition of the mTOR pathway (in vitro and in vivo and EGFR signaling in vivo relative to the single drugs. Conclusions The gefitinib and RAD001 combination provides effective control over growth of HER2 overexpressing cells and tumors irrespective of the TZ sensitivity status.

  7. PF573,228 inhibits vascular tumor cell growth, migration as well as angiogenesis, induces apoptosis and abrogates PRAS40 and S6RP phosphorylation.

    Science.gov (United States)

    Mabeta, Peace

    2016-09-01

    PF573,228 is a compound that targets focal adhesion kinase (FAK), a non-receptor protein kinase, which is over-expressed in various tumors. The aim of this study was to evaluate the effects of PF573,228 on the cells derived from mouse vascular tumors, namely, endothelioma cells. The treatment of endothelioma cells with PF573,228 reduced their growth with an IC50 of approximately 4.6 μmol L-1 and inhibited cell migration with an IC50 of about 0.01 μmol L-1. Microscopic studies revealed morphological attributes of apoptosis. These observations were confirmed by ELISA, which showed increased caspase-3 activity. PF573,228 also inhibited angiogenesis in a dose-dependent manner, with an IC50 of approximately 3.7 μmol L-1, and abrogated the phosphorylation of cell survival proteins, proline-rich Akt substrate (PRAS40) and S6 ribosomal protein (S6RP). Array data further revealed that PF573,228 induced caspase-3 activation, thus promoting apoptosis. Since all the processes inhibited by PF573,228 provide important support to tumor survival and progression, the drug may have a potential role in the treatment of vascular tumors.

  8. Bioactive chemical constituents of Curcuma longa L. rhizomes extract inhibit the growth of human hepatoma cell line (HepG2

    Directory of Open Access Journals (Sweden)

    Abdel-Lateef Ezzat

    2016-09-01

    Full Text Available The present study was designed to identify the chemical constituents of the methanolic extract of Curcuma longa L. rhizomes and their inhibitory effect on a hepatoma cell line. The methanolic extract was subjected to GC-MS analysis to identify the volatile constituents and the other part of the same extract was subjected to liquid column chromatographic separation to isolate curcumin. The inhibition of cell growth in the hepatoma cell line and the cytopathological changes were studied. GC-MS analysis showed the presence of fifty compounds in the methanolic extract of C. longa. The major compounds were ar-turmerone (20.50 %, β-sesquiphellandrene (5.20 % and curcumenol (5.11 %. Curcumin was identified using IR, 1H and 13C NMR. The inhibition of cell growth by curcumin (IC50 = 41.69 ± 2.87 μg mL-1 was much more effective than that of methanolic extract (IC50 = 196.12 ± 5.25 μg mL-1. Degenerative and apoptotic changes were more evident in curcumin- treated hepatoma cells than in those treated with the methanol extract. Antitumor potential of the methanolic extract may be attributed to the presence of sesquiterpenes and phenolic constituents including curcumin (0.051 %, 511.39 μg g-1 dried methanol extract in C. longa rhizomes.

  9. 3',5'-Cyclic diguanylic acid (c-di-GMP) inhibits basal and growth factor-stimulated human colon cancer cell proliferation

    International Nuclear Information System (INIS)

    Karaolis, David K.R.; Cheng, Kunrong; Lipsky, Michael; Elnabawi, Ahmed; Catalano, Jennifer; Hyodo, Mamoru; Hayakawa, Yoshihiro; Raufman, Jean-Pierre

    2005-01-01

    The novel cyclic dinucleotide, 3',5'-cyclic diguanylic acid, cGpGp (c-di-GMP), is a naturally occurring small molecule that regulates important signaling mechanisms in prokaryotes. Recently, we showed that c-di-GMP has 'drug-like' properties and that c-di-GMP treatment might be a useful antimicrobial approach to attenuate the virulence and pathogenesis of Staphylococcus aureus and prevent or treat infection. In the present communication, we report that c-di-GMP (≤50 μM) has striking properties regarding inhibition of cancer cell proliferation in vitro. c-di-GMP inhibits both basal and growth factor (acetylcholine and epidermal growth factor)-induced cell proliferation of human colon cancer (H508) cells. Toxicity studies revealed that exposure of normal rat kidney cells and human neuroblastoma cells to c-di-GMP at biologically relevant doses showed no lethal cytotoxicity. Cyclic dinucleotides, such as c-di-GMP, represent an attractive and novel 'drug-platform technology' that can be used not only to develop new antimicrobial agents, but also to develop novel therapeutic agents to prevent or treat cancer

  10. Bioactive chemical constituents of Curcuma longa L. rhizomes extract inhibit the growth of human hepatoma cell line (HepG2).

    Science.gov (United States)

    Abdel-Lateef, Ezzat; Mahmoud, Faten; Hammam, Olfat; El-Ahwany, Eman; El-Wakil, Eman; Kandil, Sherihan; Abu Taleb, Hoda; El-Sayed, Mortada; Hassenein, Hanaa

    2016-09-01

    The present study was designed to identify the chemical constituents of the methanolic extract of Curcuma longa L. rhizomes and their inhibitory effect on a hepatoma cell line. The methanolic extract was subjected to GC-MS analysis to identify the volatile constituents and the other part of the same extract was subjected to liquid column chromatographic separation to isolate curcumin. The inhibition of cell growth in the hepatoma cell line and the cytopathological changes were studied. GC-MS analysis showed the presence of fifty compounds in the methanolic extract of C. longa. The major compounds were ar-turmerone (20.50 %), β-sesquiphellandrene (5.20 %) and curcumenol (5.11 %). Curcumin was identified using IR, 1H and 13C NMR. The inhibition of cell growth by curcumin (IC50 = 41.69 ± 2.87 μg mL-1) was much more effective than that of methanolic extract (IC50 = 196.12 ± 5.25 μg mL-1). Degenerative and apoptotic changes were more evident in curcumin- treated hepatoma cells than in those treated with the methanol extract. Antitumor potential of the methanolic extract may be attributed to the presence of sesquiterpenes and phenolic constituents including curcumin (0.051 %, 511.39 μg g-1 dried methanol extract) in C. longa rhizomes.

  11. Protein-Bound Polysaccharide from Corbicula fluminea Inhibits Cell Growth in MCF-7 and MDA-MB-231 Human Breast Cancer Cells.

    Science.gov (United States)

    Liao, Ningbo; Zhong, Jianjun; Zhang, Ronghua; Ye, Xingqian; Zhang, Yanjun; Wang, Wenjun; Wang, Yuexia; Chen, Shiguo; Liu, Donghong; Liu, Ruihai

    2016-01-01

    A novel protein-bound polysaccharide, CFPS-1, isolated from Corbicula fluminea, is composed predominantly of mannose (Man) and glucose (Glc) in a molar ratio of 3.1:12.7. The polysaccharide, with an average molecular weight of about 283 kDa, also contains 10.8% protein. Atomic force microscopy, high-performance liquid chromatography, Fourier transform infrared spectroscopy, gas chromatography/mass spectrometry, and nuclear magnetic resonance spectroscopy analyses revealed that CFPS-1 has a backbone of 1,6-linked and 1,4,6-linked-α-D-Glc, which is terminated with a 1-linked-α-D-Man residue at the O-4 position of 1,4,6-linked-α-D-Glc, in a molar ratio of 3:1:1. Preliminary in vitro bioactivity tests revealed that CFPS-1 effectively and dose-dependently inhibits human breast cancer MCF-7 and MDA-MB-231 cell growth, with an IC50 of 243 ± 6.79 and 1142 ± 14.84 μg/mL, respectively. In MCF-7, CFPS-1 produced a significant up-regulation of p53, p21, Bax and cleaved caspase-7 and down-regulation of Cdk4, cyclin D1, Bcl-2 and caspase-7. These effects resulted in cell cycle blockade at the S-phase and apoptosis induction. In contrast, in MDA-MB-231, with limited degree of change in cell cycle distribution, CFPS-1 increases the proportion of cells in apoptotic sub-G1 phase executed by down-regulation of Bcl-2 and caspase-7 and up-regulation of Bax and cleaved caspase-7. This study extends our understanding of the anticancer mechanism of C. fluminea protein-bound polysaccharide.

  12. Protein-Bound Polysaccharide from Corbicula fluminea Inhibits Cell Growth in MCF-7 and MDA-MB-231 Human Breast Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ningbo Liao

    Full Text Available A novel protein-bound polysaccharide, CFPS-1, isolated from Corbicula fluminea, is composed predominantly of mannose (Man and glucose (Glc in a molar ratio of 3.1:12.7. The polysaccharide, with an average molecular weight of about 283 kDa, also contains 10.8% protein. Atomic force microscopy, high-performance liquid chromatography, Fourier transform infrared spectroscopy, gas chromatography/mass spectrometry, and nuclear magnetic resonance spectroscopy analyses revealed that CFPS-1 has a backbone of 1,6-linked and 1,4,6-linked-α-D-Glc, which is terminated with a 1-linked-α-D-Man residue at the O-4 position of 1,4,6-linked-α-D-Glc, in a molar ratio of 3:1:1. Preliminary in vitro bioactivity tests revealed that CFPS-1 effectively and dose-dependently inhibits human breast cancer MCF-7 and MDA-MB-231 cell growth, with an IC50 of 243 ± 6.79 and 1142 ± 14.84 μg/mL, respectively. In MCF-7, CFPS-1 produced a significant up-regulation of p53, p21, Bax and cleaved caspase-7 and down-regulation of Cdk4, cyclin D1, Bcl-2 and caspase-7. These effects resulted in cell cycle blockade at the S-phase and apoptosis induction. In contrast, in MDA-MB-231, with limited degree of change in cell cycle distribution, CFPS-1 increases the proportion of cells in apoptotic sub-G1 phase executed by down-regulation of Bcl-2 and caspase-7 and up-regulation of Bax and cleaved caspase-7. This study extends our understanding of the anticancer mechanism of C. fluminea protein-bound polysaccharide.

  13. Epidermal growth factor inhibits glycylsarcosine transport and hPepT1 expression in a human intestinal cell line

    DEFF Research Database (Denmark)

    Nielsen, C U; Amstrup, J; Steffansen, B

    2001-01-01

    The human intestinal cell line Caco-2 was used as a model system to study the effects of epidermal growth factor (EGF) on peptide transport. EGF decreased apical-to-basolateral fluxes of [(14)C]glycylsarcosine ([(14)C]Gly-Sar) up to 50.2 +/- 3.6% (n = 6) of control values. Kinetic analysis......(max) decreased from 2.61 +/- 0.4 to 1.06 +/- 0.1 nmol x cm(-2) x min(-1) (n = 3, P T1 mRNA (using glucose-6-phosphate dehydrogenase mRNA as control......) in cells treated with EGF. Western blotting indicated a decrease in hPepT1 protein in cell lysates. We conclude that EGF treatment decreases Gly-Sar transport in Caco-2 cells by decreasing the number of peptide transporter molecules in the apical membrane....

  14. Inhibition of transforming growth factor-activated kinase 1 (TAK1 blocks and reverses epithelial to mesenchymal transition of mesothelial cells.

    Directory of Open Access Journals (Sweden)

    Raffaele Strippoli

    Full Text Available Peritoneal fibrosis is a frequent complication of peritoneal dialysis following repeated low grade inflammatory and pro-fibrotic insults. This pathological process may lead to ultrafiltration failure and eventually to the discontinuing of the therapy. Fibrosis is linked to epithelial to mesenchymal transition (EMT of the peritoneal mesothelial cells, which acquire invasive and fibrogenic abilities. Here, we analyzed the role of the transforming growth factor-activated kinase-1 (TAK1 in the EMT of primary mesothelial cells from human peritoneum. The inhibition of TAK1 in mesenchymal-like mesothelial cells from the effluents of patients undergoing peritoneal dialysis led to the reacquisition of the apical to basolateral polarity, to increased expression of epithelial and to down-regulation of mesenchymal markers. TAK1 inhibition also resulted in decreased migratory/invasive abilities of effluent-derived mesothelial cells. Simultaneous inhibition of ERK1/2 and TAK1 pathways did not lead to an additive effect in the reacquisition of the epithelial phenotype. Inhibition of TAK1 also blocked EMT in vitro and reduced the levels of PAI-1, which is involved in fibrosis and invasion. Analysis of signalling pathways downstream of TAK1 involved in EMT induction, showed that TAK1 inhibition reduced the transcriptional activity of NF-κB and Smad3, as well as the phosphorylation of c-jun, while enhancing Smad1-5-8 activity. These results demonstrate that TAK1 is a cross-point in a network including different pro-EMT transcription factors, such as NF-κB, Snail, AP-1 and Smads. The identification of TAK1 as a main biochemical mediator of EMT and fibrosis in mesothelial cells from human peritoneum and the study of signalling pathways induced by its activity may be relevant in the design of new therapies aimed to counteract peritoneal fibrosis.

  15. Benzylidene derivatives of andrographolide inhibit growth of breast and colon cancer cells in vitro by inducing G1 arrest and apoptosis

    Science.gov (United States)

    Jada, S R; Matthews, C; Saad, M S; Hamzah, A S; Lajis, N H; Stevens, M F G; Stanslas, J

    2008-01-01

    Background and purpose: Andrographolide, the major phytoconstituent of Andrographis paniculata, was previously shown by us to have activity against breast cancer. This led to synthesis of new andrographolide analogues to find compounds with better activity than the parent compound. Selected benzylidene derivatives were investigated for their mechanisms of action by studying their effects on the cell cycle progression and cell death. Experimental approach: Microculture tetrazolium, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) and sulphorhodamine B (SRB) assays were utilized in assessing the in vitro growth inhibition and cytotoxicity of compounds. Flow cytometry was used to analyse the cell cycle distribution of control and treated cells. CDK1 and CDK4 levels were determined by western blotting. Apoptotic cell death was assessed by fluorescence microscopy and flow cytometry. Key results: Compounds, in nanomolar to micromolar concentrations, exhibited growth inhibition and cytotoxicity in MCF-7 (breast) and HCT-116 (colon) cancer cells. In the NCI screen, 3,19-(2-bromobenzylidene) andrographolide (SRJ09) and 3,19-(3-chloro-4-fluorobenzylidene) andrographolide (SRJ23) showed greater cytotoxic potency and selectivity than andrographolide. SRJ09 and SRJ23 induced G1 arrest and apoptosis in MCF-7 and HCT-116 cells, respectively. SRJ09 downregulated CDK4 but not CDK1 level in MCF-7 cells. Apoptosis induced by SRJ09 and SRJ23 in HCT-116 cells was confirmed by annexin V-FITC/PI flow cytometry analysis. Conclusion and implications: The new benzylidene derivatives of andrographolide are potential anticancer agents. SRJ09 emerged as the lead compound in this study, exhibiting anticancer activity by downregulating CDK4 to promote a G1 phase cell cycle arrest, coupled with induction of apoptosis. PMID:18806812

  16. Benzylidene derivatives of andrographolide inhibit growth of breast and colon cancer cells in vitro by inducing G(1) arrest and apoptosis.

    Science.gov (United States)

    Jada, S R; Matthews, C; Saad, M S; Hamzah, A S; Lajis, N H; Stevens, M F G; Stanslas, J

    2008-11-01

    Andrographolide, the major phytoconstituent of Andrographis paniculata, was previously shown by us to have activity against breast cancer. This led to synthesis of new andrographolide analogues to find compounds with better activity than the parent compound. Selected benzylidene derivatives were investigated for their mechanisms of action by studying their effects on the cell cycle progression and cell death. Microculture tetrazolium, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) and sulphorhodamine B (SRB) assays were utilized in assessing the in vitro growth inhibition and cytotoxicity of compounds. Flow cytometry was used to analyse the cell cycle distribution of control and treated cells. CDK1 and CDK4 levels were determined by western blotting. Apoptotic cell death was assessed by fluorescence microscopy and flow cytometry. Compounds, in nanomolar to micromolar concentrations, exhibited growth inhibition and cytotoxicity in MCF-7 (breast) and HCT-116 (colon) cancer cells. In the NCI screen, 3,19-(2-bromobenzylidene) andrographolide (SRJ09) and 3,19-(3-chloro-4-fluorobenzylidene) andrographolide (SRJ23) showed greater cytotoxic potency and selectivity than andrographolide. SRJ09 and SRJ23 induced G(1) arrest and apoptosis in MCF-7 and HCT-116 cells, respectively. SRJ09 downregulated CDK4 but not CDK1 level in MCF-7 cells. Apoptosis induced by SRJ09 and SRJ23 in HCT-116 cells was confirmed by annexin V-FITC/PI flow cytometry analysis. The new benzylidene derivatives of andrographolide are potential anticancer agents. SRJ09 emerged as the lead compound in this study, exhibiting anticancer activity by downregulating CDK4 to promote a G(1) phase cell cycle arrest, coupled with induction of apoptosis.

  17. Interleukin 21 therapy increases the density of tumor infiltrating CD8+ T cells and inhibits the growth of syngeneic tumors

    DEFF Research Database (Denmark)

    Søndergaard, Henrik; Frederiksen, Klaus S; Thygesen, Peter

    2007-01-01

    infiltrating T cells. We treated mice bearing established subcutaneous B16 melanomas or RenCa renal cell carcinomas with intraperitoneal (i.p.) or subcutaneous (s.c.) IL-21 protein therapy and subsequently scored the densities of tumor infiltrating CD4(+) and CD8(+) T cells by immunohistochemistry. Whereas.......c. administration, which could account for the apparent increase in anti-tumor activity. Specific depletion of CD8(+) T cells with monoclonal antibodies completely abrogated the anti-tumor activity, whereas NK1.1(+) cell depletion did not affect tumor growth. In accordance, both routes of IL-21 administration...... significantly increased the density of tumor infiltrating CD8(+) T cells in both B16 and RenCa tumors; and in the RenCa model s.c. administration of IL-21 led to a significantly higher density of tumor infiltrating CD8(+) T cells compared to i.p. administration. The densities of CD4(+) T cells were unchanged...

  18. Hypericin damages the ectatic capillaries in a Roman cockscomb model and inhibits the growth of human endothelial cells more potently than hematoporphyrin does through induction of apoptosis.

    Science.gov (United States)

    Li, Zhuo-heng; Meng, De-sheng; Li, Yuan-yuan; Lu, Lai-chun; Yu, Cai-ping; Zhang, Qian; Guan, Hai-yan; Li, Chen-wen; Yang, Xue; Fu, Ruo-qiu

    2014-01-01

    Hypericin (HY) is a promising photosensitizer (PS) for use in photodynamic therapy (PDT). Port-wine stains (PWSs) are congenital superficial dermal capillary malformations. In this study, we evaluated the photocytotoxic effects of HY for PDT in human vascular endothelial cells and a chicken cockscomb model. HY significantly inhibited the growth of human umbilical vein endothelial cells (HUVECs), as determined by colorimetric assays and morphological observation, and flow cytometry assays indicated induction of apoptosis and collapse of the mitochondrial membrane potential. In addition, HY more effectively inhibited growth of and induced apoptosis in HUVECs compared with hematoporphyrin (HP). Further experiments performed in a Roman chicken cockscomb model also showed a clear photocytotoxic effect on the cockscomb dermal capillary upon intravenous injection of HY. This effect may be due to the role of HY in the induction of apoptosis. Transmission electron microscopical analysis showed mitochondrial morphological changes such as incomplete ridges and swelling, and immunohistochemical assays showed an increase in the release of cytochrome c. In conclusion, HY exhibited a greater photocytotoxic activity than did HP toward the growth of endothelial cells and may thus represent a potent PS for PWS PDT. © 2014 The American Society of Photobiology.

  19. Silencing of the hTERT gene by shRNA inhibits colon cancer SW480 cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Ai-Qun Liu

    Full Text Available Human telomerase reverse transcriptase (hTERT is the key enzyme responsible for synthesizing and maintaining the telomeres on the ends of chromosomes, and it is essential for cell proliferation. This has made hTERT a focus of oncology research and an attractive target for anticancer drug development. In this study, we designed a small interfering RNA (siRNA targeting the catalytic subunit of hTERT and tested its effects on the growth of telomerase-positive human colon carcinoma SW480 cells in vitro, as well as on the tumorigenicity of these cells in nude mice. Transient and stable transfection of hTERT siRNA into colon cancer SW480 cells suppressed hTERT expression, reduced telomerase activity and inhibited cell growth and proliferation. Knocking down hTERT expression in SW480 tumors xenografted into nude mice significantly slowed tumor growth and promoted tumor cell apoptosis. Our results suggest that hTERT is involved in carcinogenesis of human colon carcinoma, and they highlight the therapeutic potential of a hTERT knock-down approach.

  20. Compounds isolated from the aerial part of Crataegus azarolus inhibit growth of B16F10 melanoma cells and exert a potent inhibition of the melanin synthesis.

    Science.gov (United States)

    Mustapha, Nadia; Bzéouich, Imèn Mokdad; Ghedira, Kamel; Hennebelle, Thierry; Chekir-Ghedira, Leila

    2015-02-01

    Poor therapeutic results have been reported for treatment of malignant melanoma; therefore in this study, we have investigated inhibitory capacity of vitexin-2''-O-rhamnoside as well as the extract from which it was isolated, i.e. the ethyl acetate extract obtained from the leaves of Crataegus azarolus, on mouse melanoma (B16F10) proliferation. Cell viability was determined using the 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. In addition, amounts of melanin and tyrosinase were measured spectrophotometrically at 475nm. Ethyl acetate extract and vitexin-2''-O-rhamnoside exhibited significant anti-proliferative activity against B16F10 melanoma cells after incubation for 48hours with IC50s of 50μg/mL and 20μM, respectively. Furthermore, these two compounds have the ability to reduce the melanin content by inhibiting the tyrosinase activity of B16F10 cells. Thus, further investigations are merited to ascertain their potential application in treating hyperpigmentation disorders. Copyright © 2014. Published by Elsevier Masson SAS.

  1. Salinomycin inhibits metastatic colorectal cancer growth and interferes with Wnt/β-catenin signaling in CD133+ human colorectal cancer cells

    International Nuclear Information System (INIS)

    Klose, Johannes; Eissele, Jana; Volz, Claudia; Schmitt, Steffen; Ritter, Alina; Ying, Shen; Schmidt, Thomas; Heger, Ulrike; Schneider, Martin; Ulrich, Alexis

    2016-01-01

    The polyether antibiotic Salinomycin (Sal) is regarded as an inhibitor of cancer stem cells. Its effectiveness on human colorectal cancer (CRC) cells in vitro has been demonstrated before. The aim of this study was to establish a murine model to investigate the effectiveness of Sal in vivo. Furthermore, we investigated the impact of Sal on Wnt/β-catenin signaling in human CD133 + CRC cells. The two murine CRC cell lines MC38 and CT26 were used to analyze the impact of Sal on tumor cell proliferation, viability, migration, cell cycle progression and cell death in vitro. For in vivo studies, CT26 cells were injected into syngeneic BALB/c mice to initiate (i) subcutaneous, (ii) orthotopic, or (iii) metastatic CRC growth. Sal was administered daily, 5-Fluoruracil served as a control. For mechanistic studies, the CD133 + and CD133 - subpopulations of human CRC cells were separated by flow cytometry and separately exposed to increasing concentrations of Sal. The impact on Wnt/β-catenin signaling was determined by Western blotting and quantitative PCR. Sal markedly impaired tumor cell viability, proliferation and migration, and induced necrotic cell death in vitro. CRC growth in vivo was likewise inhibited upon Sal treatment. Interference with Wnt signaling and reduced expression of the Wnt target genes Fibronectin and Lgr5 indicates a novel molecular mechanism, mediating anti-tumoral effects of Sal in CRC. Sal effectively impairs CRC growth in vivo. Furthermore, Sal acts as an inhibitor of Wnt/β-catenin signaling. Thus, Salinomycin represents a promising candidate for clinical CRC treatment. The online version of this article (doi:10.1186/s12885-016-2879-8) contains supplementary material, which is available to authorized users

  2. Hypoxic stress simultaneously stimulates vascular endothelial growth factor via hypoxia-inducible factor-1α and inhibits stromal cell-derived factor-1 in human endometrial stromal cells.

    Science.gov (United States)

    Tsuzuki, Tomoko; Okada, Hidetaka; Cho, Hisayuu; Tsuji, Shoko; Nishigaki, Akemi; Yasuda, Katsuhiko; Kanzaki, Hideharu

    2012-02-01

    Hypoxia of the human endometrium is a physiologic event occurring during the perimenstrual period and the local stimulus for angiogenesis. The aim of this study was to investigate the effects of hypoxic stress on the regulation of vascular endothelial growth factor (VEGF) and stromal cell-derived factor-1 (SDF-1/CXCL12), and the potential role of hypoxia-inducible factor-1α (HIF-1α) in the endometrium. Human endometrial stromal cells (ESCs, n= 22 samples) were studied in vitro. ESCs were cultured under hypoxic and normoxic conditions and treated with cobalt chloride (CoCl₂; a hypoxia-mimicking agent) and/or echinomycin, a small-molecule inhibitor of HIF-1α activity. The mRNA levels and production of VEGF and SDF-1 were assessed by real-time PCR and ELISA, respectively. The HIF-1α protein levels were measured using western blot analysis. Hypoxia simultaneously induced the expression of mRNA and production of VEGF and attenuated the expression and production of SDF-1 from ESCs in a time-dependent manner. Similar changes were observed in the ESCs after stimulation with CoCl₂ in a dose-dependent manner. CoCl₂ significantly induced the expression of HIF-1α protein, and its highest expression was observed at 6 h. Echinomycin inhibited hypoxia-induced VEGF production without affecting the HIF-1α protein level and cell toxicity and had no effect on SDF-1 secretion (P hypoxic conditions that could influence angiogenesis in the human endometrium.

  3. Growth inhibition of HeLa cell by internalization of Mycobacterium bovis Bacillus Calmette-Guérin (BCG Tokyo

    Directory of Open Access Journals (Sweden)

    Asahina Izumi

    2009-12-01

    Full Text Available Abstract Background Intravesical BCG immunotherapy is effective for preventing recurrence and progression in none muscle-invasive bladder cancer but the dosing schedule and duration of treatment remain empirical. The mechanisms by which intravesical BCG treatment mediates antitumor activity are currently poorly understood. Results HeLa cell infected with Mycobacterium bovis Bacillus Calmette-Guérin(BCG Tokyo which were different multiplicity of infection(MOI. Proliferation of HeLa cell reduced in a dose-dependent manner by live BCG. The cytoplasm of the HeLa cell showed variety lysosomal stages by internalized and interacted BCG. Conclusion Proliferated Live BCG secreted the protein and depressed the growth of tumor. The possibility for clinical introduction of BCG therapy for carcinoma reported with review of literature.

  4. N-3 poly-unsaturated fatty acids shift estrogen signaling to inhibit human breast cancer cell growth.

    Directory of Open Access Journals (Sweden)

    Wenqing Cao

    Full Text Available Although evidence has shown the regulating effect of n-3 poly-unsaturated fatty acid (n-3 PUFA on cell signaling transduction, it remains unknown whether n-3 PUFA treatment modulates estrogen signaling. The current study showed that docosahexaenoic acid (DHA, C22:6, eicosapentaenoic acid (EPA, C20:5 shifted the pro-survival and proliferative effect of estrogen to a pro-apoptotic effect in human breast cancer (BCa MCF-7 and T47D cells. 17 β-estradiol (E2 enhanced the inhibitory effect of n-3 PUFAs on BCa cell growth. The IC50 of DHA or EPA in MCF-7 cells decreased when combined with E2 (10 nM treatment (from 173 µM for DHA only to 113 µM for DHA+E2, and from 187 µm for EPA only to 130 µm for EPA+E2. E2 also augmented apoptosis in n-3 PUFA-treated BCa cells. In contrast, in cells treated with stearic acid (SA, C18:0 as well as cells not treated with fatty acid, E2 promoted breast cancer cell growth. Classical (nuclear estrogen receptors may not be involved in the pro-apoptotic effects of E2 on the n-3 PUFA-treated BCa cells because ERα agonist failed to elicit, and ERα knockdown failed to block E2 pro-apoptotic effects. Subsequent studies reveal that G protein coupled estrogen receptor 1 (GPER1 may mediate the pro-apoptotic effect of estrogen. N-3 PUFA treatment initiated the pro-apoptotic signaling of estrogen by increasing GPER1-cAMP-PKA signaling response, and blunting EGFR, Erk 1/2, and AKT activity. These findings may not only provide the evidence to link n-3 PUFAs biologic effects and the pro-apoptotic signaling of estrogen in breast cancer cells, but also shed new insight into the potential application of n-3 PUFAs in BCa treatment.

  5. Impact of adjuvant inhibition of vascular endothelial growth factor receptor tyrosine kinases on tumor growth delay and local tumor control after fractionated irradiation in human squamous cell carcinomas in nude mice

    International Nuclear Information System (INIS)

    Zips, Daniel; Hessel, Franziska; Krause, Mechthild; Schiefer, Yvonne; Hoinkis, Cordelia; Thames, Howard D.; Haberey, Martin; Baumann, Michael

    2005-01-01

    Purpose: Previous experiments have shown that adjuvant inhibition of the vascular endothelial growth factor receptor after fractionated irradiation prolonged tumor growth delay and may also improve local tumor control. To test the latter hypothesis, local tumor control experiments were performed. Methods and materials: Human FaDu and UT-SCC-14 squamous cell carcinomas were studied in nude mice. The vascular endothelial growth factor receptor tyrosine kinase inhibitor PTK787/ZK222584 (50 mg/kg body weight b.i.d.) was administered for 75 days after irradiation with 30 fractions within 6 weeks. Tumor growth time and tumor control dose 50% (TCD 50 ) were determined and compared to controls (carrier without PTK787/ZK222584). Results: Adjuvant administration of PTK787/ZK222584 significantly prolonged tumor growth time to reach 5 times the volume at start of drug treatment by an average of 11 days (95% confidence interval 0.06;22) in FaDu tumors and 29 days (0.6;58) in UT-SCC-14 tumors. In both tumor models, TCD 50 values were not statistically significantly different between the groups treated with PTK787/ZK222584 compared to controls. Conclusions: Long-term inhibition of angiogenesis after radiotherapy significantly reduced the growth rate of local recurrences but did not improve local tumor control. This indicates that recurrences after irradiation depend on vascular endothelial growth factor-driven angiogenesis, but surviving tumor cells retain their clonogenic potential during adjuvant antiangiogenic treatment with PTK787/ZK222584

  6. Choline Phospholipid Metabolites of Human Vascular Endothelial Cells Altered by Cyclooxygenase Inhibition, Growth Factor Depletion, and Paracrine Factors Secreted by Cancer Cells

    Directory of Open Access Journals (Sweden)

    Noriko Mori

    2003-04-01

    Full Text Available Magnetic resonance studies have previously shown that solid tumors and cancer cells in culture typically exhibit high phosphocholine and total choline. Treatment of cancer cells with the anti-inflammatory agent, indomethacin (INDO, reverted the phenotype of choline phospholipid metabolites in cancer cells towards a less malignant phenotype. Since endothelial cells form a key component of tumor vasculature, in this study, we used MR spectroscopy to characterize the phenotype of choline phospholipid metabolites in human umbilical vein endothelial cells (HUVECs. We determined the effect of growth factors, the anti-inflammatory agent INDO, and conditioned media obtained from a malignant cell line, on choline phospholipid metabolites. Growth factor depletion or treatment with INDO induced similar changes in the choline phospholipid metabolites of HUVECs. Treatment with conditioned medium obtained from MDA-MB-231 cancer cells induced changes similar to the presence of growth factor supplements. These results suggest that cancer cells secrete growth factors and/or other molecules that influence the choline phospholipid metabolism of HUVECs. The ability of INDO to alter choline phospholipid metabolism in the presence of growth factor supplements suggests that the inflammatory response pathways of HUVECs may play a role in cancer cell-HUVEC interaction and in the response of HUVECs to growth factors.

  7. miR-143 inhibits intracellular salmonella growth by targeting ATP6V1A in macrophage cells in pig.

    Science.gov (United States)

    Huang, Tinghua; Huang, Xiali; Yao, Min

    2018-04-01

    Salmonella infects many vertebrate species, and animals such as pigs can be colonized with Salmonella and become established carriers. Analyzing the roles of microRNA in intracellular proliferation is important for understanding the process of Salmonella infection. The objective of this study is to verify the regulation effect of miR-143 on ATP6V1A and its functions in the intracellular growth of Salmonella. A new miR-143 binding site was discovered in the 3' UTR of ATP6V1A using a newly developed prediction tool. The binding site was confirmed by binding site deletion assay. Real-time PCR results indicated that ATP6V1A was predominantly expressed in bone-marrow-derived macrophages, and the expression of miR-143 in different tissues was negatively correlated with ATP6V1A. The Salmonella proliferation assay showed that the expression of miR-143 could inhibit intracellular Salmonella growth in macrophages by target ATP6V1A. The results strongly suggest that miR-143 plays important regulatory roles in the development of Salmonella infection in animals. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Antibody to human α-fetoprotein inhibits cell growth of human hepatocellular carcinoma cells by resuscitating the PTEN molecule: in vitro experiments.

    Science.gov (United States)

    Ohkawa, Kiyoshi; Asakura, Tadashi; Tsukada, Yutaka; Matsuura, Tomokazu

    2017-06-01

    It has been proposed that α-fetoprotein (AFP) is a new member of the intracellular signaling molecule family of the phosphoinositide 3-kinase (PI3K)/AKT signaling pathway via interaction with the phosphatase and tensin homolog (PTEN). In this study, the effects of anti-human AFP antibody on the functions of PTEN were examined using an AFP-producing human hepatoma cell line. The antibody caused significant inhibition of cell growth, compared to a normal IgG control, with the accumulation of intracellular immune complexes followed by significant reduction of cytosolic functional AFP. Decrease in the amount of AKT phosphorylated on serine (S) 473 indicated that PI3K/AKT signaling was suppressed in the cells. S380-phosphorylated PTEN increased markedly by the second day after antibody treatment, with slight but significant increase in the PTEN protein level. Since phosphorylation at S380 is critical for PTEN stability, the increase in S380-phosphorylated PTEN indicated maintenance of the number of PTEN molecules and the related potential to control PI3K/AKT signaling. p53 protein (P53) significantly, but slightly increased during antibody treatment, because PTEN expression increased the stability and function of P53 via both molecular interactions. P53 phosphorylated at S20 or at S392 dramatically increased, suggesting an increase in the stability, accumulation and activation of P53. Glucose transporter 1 (GLUT1) increased immediately after antibody treatment, pointing to a deficiency of glucose in the cells. Immunofluorescence cytology revealed that antibody-treatment re-distributed GLUT1 molecules throughout the cytoplasm with a reduction of their patchy localization on the cell surface. This suggested that translocation of GLUT1 depends on the PI3K/AKT pathway, in particular on PTEN expression. Antibody therapy targeted at AFP-producing tumor cells showed an inhibitory effect on the PI3K/AKT pathway via the liberation, restoration and functional stabilization of

  9. Sodium butyrate induces growth inhibition and apoptosis in human prostate cancer DU145 cells by up-regulation of the expression of annexin A1.

    Directory of Open Access Journals (Sweden)

    Dawei Mu

    Full Text Available BACKGROUND: Sodium butyrate, a histone deacetylase inhibitor, has emerged as a promising anticancer drug for multiple cancers. Recent studies have indicated that sodium butyrate could inhibit the progression of prostate cancer; however, the exact mechanism is still unclear. The aim of this study was to investigate the mechanism of sodium butyrate action in prostate cancer DU145 cells. METHODS: The inhibitory effects of NaB on cell growth were detected by the 3-(4, 5-dimethylthiazol-2-yl-2, 5-diphenyltetrrazolium bromide assay. Cell apoptosis was determined by flow cytometric analysis of DU145 cells stained with annexin V and PI. Hoechst 33258 and fluorescence microscopes were used to observe the nuclear morphology of DU145 cells after treatment with NaB. ANXA1 knockdown cells were established through transfection with ANXA1 siRNA. ANXA1 mRNA levels were measured by qRT-PCR. Bcl-2, Bax, ANXA1, ERK1/2 and pERK1/2 were detected by western blot. RESULTS: NaB significantly inhibited the growth and induction apoptosis of DU145 and PC3 cells in a dose-dependent manner. Expression of the anti-apoptosis gene Bcl-xl and Bcl-2 in DU145 cells are decreased and expression of the pro-apoptosis gene Bax and Bak increased after NaB treatment. Further studies have demonstrated that NaB up-regulated the expression of ANXA1 and that the tumor inhibition action of NaB was reduced markedly through knockdown of the ANXA1 gene in DU145 cells. Moreover, the siANXA1 cells showed that cell proliferation increased and cell apoptosis was induced by the inactivation of extracellular regulated kinase (ERK. CONCLUSION: Our results support a significant correlation between NaB functions and ANXA1 expression in prostate cancer, and pave the way for further studying the molecular mechanism of NaB actions in cancers.

  10. Cholecalciferol (vitamin D3) inhibits growth and invasion by up-regulating nuclear receptors and 25-hydroxylase (CYP27A1) in human prostate cancer cells.

    Science.gov (United States)

    Tokar, Erik J; Webber, Mukta M

    2005-01-01

    Epidemiological evidence suggests an inverse relationship between prostate cancer and serum vitamin D levels. We examined the ability of cholecalciferol (vitamin D(3)), a calcitriol precursor, to inhibit or reverse cellular changes associated with malignant transformation and invasion and explored its mechanisms of action. The RWPE2-W99 human prostate epithelial cell line, which forms slow-growing tumors in nude mice, was used because it mimics the behavior of the majority of primary human prostate cancers. Cholecalciferol, at physiological levels: (i) inhibited anchorage-dependent and -independent growth; (ii) induced differentiation by decreasing vimentin expression with a concomitant decrease in motility/chemotaxis; (iii) decreased MMP-9 and MMP-2 activity with concomitant decrease in invasion; and (iv) exerted its effects by up-regulating vitamin D receptor (VDR), retinoid-X receptor-alpha (RXR-alpha), and androgen receptor (AR) in a dose-dependent manner. Furthermore, we found that RWPE2-W99 prostate cancer cells, similar to RWPE-1 cells (Tokar and Webber. Clin Exp Metast 2005; 22: 265-73), constitutively express the enzyme 25-hydroxylase CYP27A1 which is markedly up-regulated by cholecalciferol. Cholecalciferol has effects similar to those of calcitriol on growth, MMP activity, and VDR. The ability of CYP27A1 to catalyze the conversion of cholecalciferol to 25(OH)D(3) and of 25(OH)D(3) to calcitriol has been reported. RWPE2-W99 cells, similar to RWPE-1 cells, appear to have the rare ability to locally convert cholecalciferol to the active hormone calcitriol. Because it can inhibit cellular changes associated with malignant transformation and invasion, we propose that cholecalciferol may be an effective agent for the treatment of prostate cancer.

  11. Cross-linked hyaluronic acid gel inhibits metastasis and growth of gastric and hepatic cancer cells: in vitro and in vivo studies

    Science.gov (United States)

    Lan, Ting; Pang, Ji; Wu, Yan; Zhu, Miaolin; Yao, Xiaoyuan; Wu, Min; Qian, Hai; Zhang, Zhenyu; Gao, Jizong; Chen, Yongchang

    2016-01-01

    Cross-linked hyaluronic acid gel (CHAG) has been used to prevent postoperative adhesion of abdominal tumorectomy. However, its effect on tumor cells is still unknown. This paper was designed to investigate the effect of CHAG on metastasis and growth of tumor cells. Migration and invasion assays, Western blotting, pull down assay, siRNA interference, and nude mice implantation tumor model were applied in this study. The results of in vitro experiments with gastric cancer cell line AGS and hepatic cancer cell line HepG2 showed that CHAG inhibited the migration and invasion activities, the MAPK and PI3K/Akt mediated signaling, the activation of small G proteins Rac1 and RhoA, and the expression of MMPs and PCNA initiated by EGF, through blocking the activation of EGFR. CHAG also had inhibitory effect on activation of other membrane receptors, including integrin and VEGFR. When the expression of hyaluronic acid receptors (CD44 or RHAMM) was interfered, the above inhibitory effects of CHAG still existed. In vivo experimental results showed that CHAG suppressed colonization, growth and metastasis of gastric cancer cell line SGC-7901 in peritoneal cavity of nude mice. In conclusion, CHAG had inhibitory effect on tumor cells, through covering cell surface and blocking the interaction between extracellular stimulative factors and their receptors. PMID:27589842

  12. Beta1 integrin inhibitory antibody induces apoptosis of breast cancer cells, inhibits growth, and distinguishes malignant from normal phenotype in three dimensional cultures and in vivo.

    Science.gov (United States)

    Park, Catherine C; Zhang, Hui; Pallavicini, Maria; Gray, Joe W; Baehner, Frederick; Park, Chong J; Bissell, Mina J

    2006-02-01

    Current therapeutic approaches to cancer are designed to target molecules that contribute to malignant behavior but leave normal tissues intact. beta(1) integrin is a candidate target well known for mediating cell-extracellular matrix (ECM) interactions that influence diverse cellular functions; its aberrant expression has been implicated in breast cancer progression and resistance to cytotoxic therapy. The addition of beta(1) integrin inhibitory agents to breast cancer cells at a single-cell stage in a laminin-rich ECM (three-dimensional lrECM) culture was shown to down-modulate beta(1) integrin signaling, resulting in malignant reversion. To investigate beta(1) integrin as a therapeutic target, we modified the three-dimensional lrECM protocol to approximate the clinical situation: before treatment, we allowed nonmalignant cells to form organized acinar structures and malignant cells to form tumor-like colonies. We then tested the ability of beta(1) integrin inhibitory antibody, AIIB2, to inhibit tumor cell growth in several breast cancer cell lines (T4-2, MDA-MB-231, BT474, SKBR3, and MCF-7) and one nonmalignant cell line (S-1). We show that beta(1) integrin inhibition resulted in a significant loss of cancer cells, associated with a decrease in proliferation and increase in apoptosis, and a global change in the composition of residual colonies. In contrast, nonmalignant cells that formed tissue-like structures remained resistant. Moreover, these cancer cell-specific antiproliferative and proapoptotic effects were confirmed in vivo with no discernible toxicity to animals. Our findings indicate that beta(1) integrin is a promising therapeutic target, and that the three-dimensional lrECM culture assay can be used to effectively distinguish malignant and normal tissue response to therapy.

  13. Combination of arabinogalactan and curcumin induces apoptosis in breast cancer cells in vitro and inhibits tumor growth via overexpression of p53 level in vivo.

    Science.gov (United States)

    Moghtaderi, Hassan; Sepehri, Houri; Attari, Farnoosh

    2017-04-01

    Increased mortality associated with breast cancer in women has spurred the studies to develop new drugs. Arabinogalactan (AG) and curcumin (Cur) are two natural products broadly explored in cancer therapy. Our major goal in the current study was to assess anticancer properties of combination these reagents in vitro on human breast cancer cells and in vivo utilizing animal model of breast cancer. We evaluated cell proliferation, apoptosis, cell cycle, and protein expression in vitro on MDA-MB-231 human breast cancer cells. For in vivo studies, murine breast cancer cells were implanted into BALB/c mice. Thereafter, volume of the developing tumor was calculated and expression of Ki67 and p53 proteins was evaluated to analyze cell proliferation and apoptosis. Combination of AG and Cur significantly decreased cell growth in human breast cancer cells without any significant effect on normal cell growth. This combination could increase cell population in sub-G1 phase, which was indicative of apoptosis. Western blotting showed that the combination of AG and Cur significantly increased Bax/Bcl2 ratio as well as cleaved-caspase3 level in MDA-MB-231 cells. Combination of AG and Cur promoted apoptosis by increasing ROS level, changing mitochondrial membrane and reduction of glutathione. In addition, in vivo studies in mouse showed that this combination could inhibit the progression of breast tumors through over-expression of p53 and reduction of Ki67 levels. Our findings suggest that the combination of AG and Cur is of great potential to induce apoptosis in breast cancer cells in vitro and in vivo. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Aurora kinase inhibitors attached to iron oxide nanoparticles enhances inhibition of the growth of liver cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiquan [Southeast University, State Key Laboratory of Bioelectronics and Jiangsu Key Laboratory for Biomaterials and Devices, School of Biological Science & Medical Engineering (China); Xie, Li [Southeast University, Zhongda Hospital, School of Medicine (China); Zheng, Ming; Yao, Juan [Jiangsu Chai Tai Tianqing Pharmaceutical Co. Ltd. (China); Song, Lina [Southeast University, State Key Laboratory of Bioelectronics and Jiangsu Key Laboratory for Biomaterials and Devices, School of Biological Science & Medical Engineering (China); Chang, Weiwei [Jiangsu Chai Tai Tianqing Pharmaceutical Co. Ltd. (China); Zhang, Yu; Ji, Min, E-mail: minji888@hotmail.com; Gu, Ning, E-mail: guning@seu.edu.cn [Southeast University, State Key Laboratory of Bioelectronics and Jiangsu Key Laboratory for Biomaterials and Devices, School of Biological Science & Medical Engineering (China); Zhan, Xi, E-mail: zhan01@gmail.com [University of Maryland School of Medicine, The Center of Vascular and Inflammatory Diseases, The Department of Pathology (United States)

    2015-06-15

    We have developed a novel Aurora kinase inhibitor (AKI) AM-005, an analogue of pan-AKI AT-9283. To improve the intracellular efficacy of AM-005 and AT-9283, we utilized magnetite nanoparticles (NPs) to deliver AM-005 and AT-9283 into human SMMC-7721 and HepG2 liver cancer cells. The drug-loaded NPs were prepared through quasi-emulsion solvent diffusion of magnetite NPs with AM-005 or AT-9283. The encapsulated drugs were readily released from NPs, preferentially at low pHs. Upon exposure, cancer cells effectively internalized drug-loaded NPs into lysosome-like vesicles, which triggered a series of cellular changes, including the formation of enlarged cytoplasm, the significant increase of membrane permeability, and the generation of reactive oxygen species (ROS). The increased ROS synthesis sustained over 72 h, whereas that in the cells treated with free-form drugs declined rapidly after 48 h. However, chemical sequestration of the iron core of NPs had a minor influence on the generation of intracellular ROS. On the other hand, uncoupling of AM-005 uptake with NP internalization into cells failed to induce ROS synthesis. Overall, our approach achieved two-fold increase in suppressing the viability of tumor cells in vitro and the growth of tumors in vivo. We conclude that magnetite NPs can be used as pH responsive nanocarriers that are able to improve the efficacy of AKIs.

  15. The Oligo Fucoidan Inhibits Platelet-Derived Growth Factor-Stimulated Proliferation of Airway Smooth Muscle Cells

    Directory of Open Access Journals (Sweden)

    Chao-Huei Yang

    2016-01-01

    Full Text Available In the pathogenesis of asthma, the proliferation of airway smooth muscle cells (ASMCs is a key factor in airway remodeling and causes airway narrowing. In addition, ASMCs are also the effector cells of airway inflammation. Fucoidan extracted from marine brown algae polysaccharides has antiviral, antioxidant, antimicrobial, anticlotting, and anticancer properties; however, its effectiveness for asthma has not been elucidated thus far. Platelet-derived growth factor (PDGF-treated primary ASMCs were cultured with or without oligo-fucoidan (100, 500, or 1000 µg/mL to evaluate its effects on cell proliferation, cell cycle, apoptosis, and Akt, ERK1/2 signaling pathway. We found that PDGF (40 ng/mL increased the proliferation of ASMCs by 2.5-fold after 48 h (p < 0.05. Oligo-fucoidan reduced the proliferation of PDGF-stimulated ASMCs by 75%–99% after 48 h (p < 0.05 and induced G1/G0 cell cycle arrest, but did not induce apoptosis. Further, oligo-fucoidan supplementation reduced PDGF-stimulated extracellular signal-regulated kinase (ERK1/2, Akt, and nuclear factor (NF-κB phosphorylation. Taken together, oligo-fucoidan supplementation might reduce proliferation of PDGF-treated ASMCs through the suppression of ERK1/2 and Akt phosphorylation and NF-κB activation. The results provide basis for future animal experiments and human trials.

  16. Inhibiting Vimentin or beta 1-integrin Reverts Prostate Tumor Cells in IrECM and Reduces Tumor Growth

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xueping; Fournier, Marcia V.; Ware, Joy L.; Bissell, Mina J.; Zehner, Zendra E.

    2009-07-27

    Prostate epithelial cells grown embedded in laminin-rich extracellular matrix (lrECM) undergo morphological changes that closely resemble their architecture in vivo. In this study, growth characteristics of three human prostate epithelial sublines derived from the same cellular lineage, but displaying different tumorigenic and metastatic properties in vivo, were assessed in three-dimensional (3D) lrECM gels. M12, a highly tumorigenic and metastatic subline, was derived from the parental prostate epithelial P69 cell line by selection in nude mice and found to contain a deletion of 19p-q13.1. The stable reintroduction of an intact human chromosome 19 into M12 resulted in a poorly tumorigenic subline, designated F6. When embedded in lrECM gels, the nontumorigenic P69 line produced acini with clearly defined lumena. Immunostaining with antibodies to {beta}-catenin, E-cadherin or {alpha}6-, {beta}4- and {beta}1-integrins showed polarization typical of glandular epithelium. In contrast, the metastatic M12 subline produced highly disorganized cells with no evidence of polarization. The F6 subline reverted to acini-like structures exhibiting basal polarity marked with integrins. Reducing either vimentin levels via siRNA interference or {beta}1-integrin expression by the addition of the blocking antibody, AIIB2, reorganized the M12 subline into forming polarized acini. The loss of vimentin significantly reduced M12-Vim tumor growth when assessed by subcutaneous injection in athymic mice. Thus, tumorigenicity in vivo correlated with disorganized growth in 3D lrECM gels. These studies suggest that the levels of vimentin and {beta}1-integrin play a key role in the homeostasis of the normal acini in prostate and that their dysregulation may lead to tumorigenesis.

  17. Selective JAK2 inhibition specifically decreases Hodgkin lymphoma and mediastinal large B-cell lymphoma growth in vitro and in vivo.

    Science.gov (United States)

    Hao, Yansheng; Chapuy, Bjoern; Monti, Stefano; Sun, Heather H; Rodig, Scott J; Shipp, Margaret A

    2014-05-15

    Classical Hodgkin lymphoma (cHL) and primary mediastinal large B-cell lymphoma (MLBCL) share similar histologic, clinical, and genetic features. In recent studies, we found that disease-specific chromosome 9p24.1/JAK2 amplification increased JAK2 expression and activity in both cHL and MLBCL. This prompted us to assess the activity of a clinical grade JAK2 selective inhibitor, fedratinib (SAR302503/TG101348), in in vitro and in vivo model systems of cHL and MLBCL with defined JAK2 copy numbers. We used functional and immunohistochemical analyses to investigate the preclinical activity of fedratinib and associated biomarkers in cell lines and murine xenograft models of cHL and MLBCL with known 9p24.1/JAK2 copy number. Chemical JAK2 inhibition decreased the cellular proliferation of cHL and MLBCL cell lines and induced their apoptosis. There was an inverse correlation between 9p24.1/JAK2 copy number and the EC50 of fedratinib. Chemical JAK2 inhibition decreased phosphorylation of JAK2, STAT1, STAT3, and STAT6 and reduced the expression of additional downstream targets, including PD-L1, in a copy number-dependent manner. In murine xenograft models of cHL and MLBCL with 9p24.1/JAK2 amplification, chemical JAK2 inhibition significantly decreased JAK2/STAT signaling and tumor growth and prolonged survival. In in vitro and in vivo studies, pSTAT3 was an excellent biomarker of baseline JAK2 activity and the efficacy of chemical JAK2 inhibition. In in vitro and in vivo analyses, cHL and MLBCL with 9p24.1/JAK2 copy gain are sensitive to chemical JAK2 inhibition suggesting that clinical evaluation of JAK2 blockade is warranted. ©2014 American Association for Cancer Research.

  18. Stromal Cells Positively and Negatively Modulate the Growth of Cancer Cells: Stimulation via the PGE2-TNFα-IL-6 Pathway and Inhibition via Secreted GAPDH-E-Cadherin Interaction

    Science.gov (United States)

    Kawada, Manabu; Inoue, Hiroyuki; Ohba, Shun-ichi; Yoshida, Junjiro; Masuda, Tohru; Yamasaki, Manabu; Usami, Ihomi; Sakamoto, Shuichi; Abe, Hikaru; Watanabe, Takumi; Yamori, Takao; Shibasaki, Masakatsu; Nomoto, Akio

    2015-01-01

    Fibroblast-like stromal cells modulate cancer cells through secreted factors and adhesion, but those factors are not fully understood. Here, we have identified critical stromal factors that modulate cancer growth positively and negatively. Using a cell co-culture system, we found that gastric stromal cells secreted IL-6 as a growth and survival factor for gastric cancer cells. Moreover, gastric cancer cells secreted PGE2 and TNFα that stimulated IL-6 secretion by the stromal cells. Furthermore, we found that stromal cells secreted glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Extracellular GAPDH, or its N-terminal domain, inhibited gastric cancer cell growth, a finding confirmed in other cell systems. GAPDH bound to E-cadherin and downregulated the mTOR-p70S6 kinase pathway. These results demonstrate that stromal cells could regulate cancer cell growth through the balance of these secreted factors. We propose that negative regulation of cancer growth using GAPDH could be a new anti-cancer strategy. PMID:25785838

  19. Abalone visceral extract inhibit tumor growth and metastasis by modulating Cox-2 levels and CD8+ T cell activity

    Directory of Open Access Journals (Sweden)

    II Kim Jae

    2010-10-01

    Full Text Available Abstract Background Abalone has long been used as a valuable food source in East Asian countries. Although the nutritional importance of abalone has been reported through in vitro and in vivo studies, there is little evidence about the potential anti-tumor effects of abalone visceral extract. The aim of the present study is to examine anti-tumor efficacy of abalone visceral extract and to elucidate its working mechanism. Methods In the present study, we used breast cancer model using BALB/c mouse-derived 4T1 mammary carcinoma and investigated the effect of abalone visceral extract on tumor development. Inhibitory effect against tumor metastasis was assessed by histopathology of lungs. Cox-2 productions by primary and secondary tumor were measured by real-time RT-PCR and immunoblotting (IB. Proliferation assay based on [3H]-thymidine incorporation and measurement of cytokines and effector molecules by RT-PCR were used to confirm tumor suppression efficacy of abalone visceral extract by modulating cytolytic CD8+ T cells. The cytotoxicity of CD8+ T cell was compared by JAM test. Results Oral administration of abalone visceral extract reduced tumor growth (tumor volume and weight and showed reduced metastasis as confirmed by decreased level of splenomegaly (spleen size and weight and histological analysis of the lung metastasis (gross analysis and histological staining. Reduced expression of Cox-2 (mRNA and protein from primary tumor and metastasized lung was also detected. In addition, treatment of abalone visceral extract increased anti-tumor activities of CD8+ T cells by increasing the proliferation capacity and their cytolytic activity. Conclusions Our results suggest that abalone visceral extract has anti-tumor effects by suppressing tumor growth and lung metastasis through decreasing Cox-2 expression level as well as promoting proliferation and cytolytic function of CD8+ T cells.

  20. Decreased growth-induced water potential: A primary cause of growth inhibition at low water potentials

    Energy Technology Data Exchange (ETDEWEB)

    Nonami, Hiroshi [Ehime Univ., Matsuyama (Japan); Wu, Yajun; Boyer, J.S. [Univ. of Delaware, Lewes, DE (United States)

    1997-06-01

    Cell enlargement depends on a growth-induced difference in water potential to move water into the cells. Water deficits decrease this potential difference and inhibit growth. To investigate whether the decrease causes the growth inhibition, pressure was applied to the roots of soybean seedlings and the growth and potential difference were monitored in the stems. In water-limited plants, the inhibited stem growth increased when the roots were pressurized and it reverted to the previous rate when the pressure was released. The pressure around the roots was perceived as an increased turgor in the stem in small cells next to the xylem, but not in outlying cortical cells. This local effect implied that water transport was impeded by the small cells. The diffusivity for water was much less in the small cells than in the outlying cells. The small cells thus were a barrier that caused the growth-induced potential difference to be large during rapid growth, but to reverse locally during the early part of a water deficit. Such a barrier may be a frequent property of meristems. Because stem growth responded to the pressure-induced recovery of the potential difference across this barrier, we conclude that a decrease in the growth-induced potential difference was a primary cause of the inhibition.