WorldWideScience

Sample records for cell culture supernatants

  1. Cell culture supernatants for detection perforin ELISA

    African Journals Online (AJOL)

    Najwa

    2014-02-19

    Feb 19, 2014 ... Leukemia is a cancer originating in any of hematopoietic cell that tends to ... treatment of children (Borek and Jaskolski, 2001). The current study was .... which led to the best results at 48 h of exposure than after 72 h of cells ...

  2. Suppression of in vitro primary immune response by L1210 cells and their culture supernatant: evidence for cytotoxic effects

    International Nuclear Information System (INIS)

    Huget, R.P.; Flad, H.D.; Opitz, H.G.

    1977-01-01

    L1210 cells and their culture supernatants were found to inhibit the generation of PFC in the in vitro primary immune response of spleen cells to SRBC. As few as 1 percent of L1210 cells and 1 percent of culture fluid were inhibitory. Inhibition of DNA or protein synthesis of L1210 cells did not abolish their immunosuppressive activity, excluding exhaustion of culture medium as a possible mechanism of inhibition of PFC. Heating of the supernatant completely abrogated the suppressive effect and resulted in a marked increase of PFC. Daily evaluation of cell viability in the cultures revealed that, in the presence of L1210 and supernatants, the fraction of surviving cells is markedly reduced. We conclude that a direct cytotoxic effect on splenic lymphocytes and macrophages is the predominant immunosuppressive mechanism of L1210 cells and their culture supernatants

  3. Culture Supernatants of Lactobacillus gasseri and L. crispatus Inhibit Candida albicans Biofilm Formation and Adhesion to HeLa Cells.

    Science.gov (United States)

    Matsuda, Yuko; Cho, Otomi; Sugita, Takashi; Ogishima, Daiki; Takeda, Satoru

    2018-03-30

    Vulvovaginal candidiasis (VVC) is a common superficial infection of the vaginal mucous membranes caused by the fungus Candida albicans. The aim of this study was to assess the mechanisms underlying the inhibitory effects of the culture supernatants of Lactobacillus gasseri and L. crispatus, the predominant microbiota in Asian healthy women, on C. albicans biofilm formation. The inhibition of C. albicans adhesion to HeLa cells by Lactobacillus culture supernatant was also investigated. Candida albicans biofilm was formed on polystyrene flat-bottomed 96-well plates, and the inhibitory effects on the initial colonization and maturation phases were determined using the XTT reduction assay. The expression levels of biofilm formation-associated genes (HWP1, ECE1, ALS3, BCR1, EFG1, TEC1, and CPH1) were determined by reverse transcription quantitative polymerase chain reaction. The inhibition of C. albicans adhesion to HeLa cells by Lactobacillus culture supernatant was evaluated by enumerating viable C. albicans cells. The culture supernatants of both Lactobacillus species inhibited the initial colonization and maturation of C. albicans biofilm. The expression levels of all biofilm formation-related genes were downregulated in the presence of Lactobacillus culture supernatant. The culture supernatant also inhibited C. albicans adhesion to HeLa cells. The culture supernatants of L. gasseri and L. crispatus inhibited C. albicans biofilm formation by downregulating biofilm formation-related genes and C. albicans adhesion to HeLa cells. These findings support the notion that Lactobacillus metabolites may be useful alternatives to antifungal drugs for the management of VVC.

  4. Comparison of EBV DNA viral load in whole blood, plasma, B-cells and B-cell culture supernatant.

    Science.gov (United States)

    Ouedraogo, David Eric; Bollore, Karine; Viljoen, Johannes; Foulongne, Vincent; Reynes, Jacques; Cartron, Guillaume; Vendrell, Jean-Pierre; Van de Perre, Philippe; Tuaillon, Edouard

    2014-05-01

    Epstein-Barr virus (EBV) genome quantitation in whole blood is used widely for therapeutic monitoring of EBV-associated disorders in immunosuppressed individuals and in patients with EBV-associated lymphoma. However, the most appropriate biological material to be used for EBV DNA quantitation remains a subject of debate. This study compare the detection rate and levels of EBV DNA from whole blood, plasma, enriched B-cells, and B-cell short-term culture supernatant using quantitative real-time PCR. Samples were collected from 33 subjects with either HIV infection or B-cell lymphoma. Overall, EBV DNA was detected in 100% of enriched B-cell samples, in 82% of B-cell culture supernatants, in 57% of plasma, and 42% of whole blood samples. A significant correlation for EBV viral load was found between enriched B-cell and B-cell culture supernatant material (ρ = 0.92; P cells (ρ = -0.02; P = 0.89), whole blood and plasma (ρ = 0.24; P = 0.24), or enriched B-cells and plasma (ρ = 0.08; P = 0.77). Testing of enriched B-cells appeared to be the most sensitive method for detection of EBV DNA as well as for exploration of the cellular reservoir. Quantitation of EBV DNA in plasma and B-cell culture supernatant may be of interest to assess EBV reactivation dynamics and response to treatment as well as to decipher EBV host-pathogen interactions in various clinical scenarios. © 2013 Wiley Periodicals, Inc.

  5. Products of cells from gliomas: VIII. Multiple-well immunoperoxidase assay of immunoreactivity of primary hybridoma supernatants with human glioma and brain tissue and cultured glioma cells.

    Science.gov (United States)

    McKeever, P E; Wahl, R L; Shakui, P; Jackson, G A; Letica, L H; Liebert, M; Taren, J A; Beierwaltes, W H; Hoff, J T

    1990-06-01

    To test the feasibility of primary screening of hybridoma supernatants against human glioma tissue, over 5000 combinations of hybridoma supernatants with glioma tissue, cultured glioma cells, and normal central neural tissue were screened with a new multiple-well (M-well) screening system. This is an immunoperoxidase assay system with visual endpoints for screening 20-30 hybridoma supernatants per single microscope slide. There were extensive differences between specificities to tissue and to cultured glioma cells when both were screened with M-wells and when cultured cells were screened with standard semi-automated fluorescence. Primary M-well screening with glioma tissue detected seven hybridoma supernatants that specifically identified parenchymal cells of glioma tissue and that were not detected with cultured cells. Immunoreactivities of individual supernatants for vascular components (nine supernatants), necrosis (five supernatants), and nuclei (three supernatants) were detected. Other supernatants bound multiple sites on glioma tissue and/or subpopulations of neurons and glia of normal tissue. The results show that primary screening with glioma tissue detects a number of different specificities of hybridoma supernatants to gliomas not detected by conventional screening with cultured cells. These are potentially applicable to diagnosis and therapy.

  6. Optimized exosome isolation protocol for cell culture supernatant and human plasma

    Directory of Open Access Journals (Sweden)

    Richard J. Lobb

    2015-07-01

    Full Text Available Extracellular vesicles represent a rich source of novel biomarkers in the diagnosis and prognosis of disease. However, there is currently limited information elucidating the most efficient methods for obtaining high yields of pure exosomes, a subset of extracellular vesicles, from cell culture supernatant and complex biological fluids such as plasma. To this end, we comprehensively characterize a variety of exosome isolation protocols for their efficiency, yield and purity of isolated exosomes. Repeated ultracentrifugation steps can reduce the quality of exosome preparations leading to lower exosome yield. We show that concentration of cell culture conditioned media using ultrafiltration devices results in increased vesicle isolation when compared to traditional ultracentrifugation protocols. However, our data on using conditioned media isolated from the Non-Small-Cell Lung Cancer (NSCLC SK-MES-1 cell line demonstrates that the choice of concentrating device can greatly impact the yield of isolated exosomes. We find that centrifuge-based concentrating methods are more appropriate than pressure-driven concentrating devices and allow the rapid isolation of exosomes from both NSCLC cell culture conditioned media and complex biological fluids. In fact to date, no protocol detailing exosome isolation utilizing current commercial methods from both cells and patient samples has been described. Utilizing tunable resistive pulse sensing and protein analysis, we provide a comparative analysis of 4 exosome isolation techniques, indicating their efficacy and preparation purity. Our results demonstrate that current precipitation protocols for the isolation of exosomes from cell culture conditioned media and plasma provide the least pure preparations of exosomes, whereas size exclusion isolation is comparable to density gradient purification of exosomes. We have identified current shortcomings in common extracellular vesicle isolation methods and provide a

  7. Cell-free culture supernatant of Bifidobacterium breve CNCM I-4035 decreases pro-inflammatory cytokines in human dendritic cells challenged with Salmonella typhi through TLR activation.

    Science.gov (United States)

    Bermudez-Brito, Miriam; Muñoz-Quezada, Sergio; Gomez-Llorente, Carolina; Matencio, Esther; Bernal, Maria J; Romero, Fernando; Gil, Angel

    2013-01-01

    Dendritic cells (DCs) constitute the first point of contact between gut commensals and our immune system. Despite growing evidence of the immunomodulatory effects of probiotics, the interactions between the cells of the intestinal immune system and bacteria remain largely unknown. Indeed,, the aim of this work was to determine whether the probiotic Bifidobacterium breve CNCM I-4035 and its cell-free culture supernatant (CFS) have immunomodulatory effects in human intestinal-like dendritic cells (DCs) and how they respond to the pathogenic bacterium Salmonella enterica serovar Typhi, and also to elucidate the molecular mechanisms involved in these interactions. Human DCs were directly challenged with B. breve/CFS, S. typhi or a combination of these stimuli for 4 h. The expression pattern of genes involved in Toll-like receptor (TLR) signaling pathway and cytokine secretion was analyzed. CFS decreased pro-inflammatory cytokines and chemokines in human intestinal DCs challenged with S. typhi. In contrast, the B. breve CNCM I-4035 probiotic strain was a potent inducer of the pro-inflammatory cytokines and chemokines tested, i.e., TNF-α, IL-8 and RANTES, as well as anti-inflammatory cytokines including IL-10. CFS restored TGF-β levels in the presence of Salmonella. Live B.breve and its supernatant enhanced innate immune responses by the activation of TLR signaling pathway. These treatments upregulated TLR9 gene transcription. In addition, CFS was a more potent inducer of TLR9 expression than the probiotic bacteria in the presence of S. typhi. Expression levels of CASP8 and IRAK4 were also increased by CFS, and both treatments induced TOLLIP gene expression. Our results indicate that the probiotic strain B. breve CNCM I-4035 affects the intestinal immune response, whereas its supernatant exerts anti-inflammatory effects mediated by DCs. This supernatant may protect immune system from highly infectious agents such as Salmonella typhi and can down-regulate pro

  8. Cell-free culture supernatant of Bifidobacterium breve CNCM I-4035 decreases pro-inflammatory cytokines in human dendritic cells challenged with Salmonella typhi through TLR activation.

    Directory of Open Access Journals (Sweden)

    Miriam Bermudez-Brito

    Full Text Available Dendritic cells (DCs constitute the first point of contact between gut commensals and our immune system. Despite growing evidence of the immunomodulatory effects of probiotics, the interactions between the cells of the intestinal immune system and bacteria remain largely unknown. Indeed,, the aim of this work was to determine whether the probiotic Bifidobacterium breve CNCM I-4035 and its cell-free culture supernatant (CFS have immunomodulatory effects in human intestinal-like dendritic cells (DCs and how they respond to the pathogenic bacterium Salmonella enterica serovar Typhi, and also to elucidate the molecular mechanisms involved in these interactions. Human DCs were directly challenged with B. breve/CFS, S. typhi or a combination of these stimuli for 4 h. The expression pattern of genes involved in Toll-like receptor (TLR signaling pathway and cytokine secretion was analyzed. CFS decreased pro-inflammatory cytokines and chemokines in human intestinal DCs challenged with S. typhi. In contrast, the B. breve CNCM I-4035 probiotic strain was a potent inducer of the pro-inflammatory cytokines and chemokines tested, i.e., TNF-α, IL-8 and RANTES, as well as anti-inflammatory cytokines including IL-10. CFS restored TGF-β levels in the presence of Salmonella. Live B.breve and its supernatant enhanced innate immune responses by the activation of TLR signaling pathway. These treatments upregulated TLR9 gene transcription. In addition, CFS was a more potent inducer of TLR9 expression than the probiotic bacteria in the presence of S. typhi. Expression levels of CASP8 and IRAK4 were also increased by CFS, and both treatments induced TOLLIP gene expression. Our results indicate that the probiotic strain B. breve CNCM I-4035 affects the intestinal immune response, whereas its supernatant exerts anti-inflammatory effects mediated by DCs. This supernatant may protect immune system from highly infectious agents such as Salmonella typhi and can down

  9. Inhibition of the early stage of Salmonella enterica serovar Enteritidis biofilm development on stainless steel by cell-free supernatant of a Hafnia alvei culture.

    Science.gov (United States)

    Chorianopoulos, Nikos G; Giaouris, Efstathios D; Kourkoutas, Yiannis; Nychas, George-John E

    2010-03-01

    Compounds present in Hafnia alvei cell-free culture supernatant cumulatively negatively influence the early stage of biofilm development by Salmonella enterica serovar Enteritidis on stainless steel while they also reduce the overall metabolic activity of S. Enteritidis planktonic cells. Although acylhomoserine lactones (AHLs) were detected among these compounds, the use of several synthetic AHLs was not able to affect the initial stage of biofilm formation by this pathogen.

  10. [Effects of combined application of culture supernatant of human umbilical cord mesenchymal stem cells and ciprofloxacin on Staphylococcus aureus in vitro].

    Science.gov (United States)

    Zhou, B; Tu, H L; Ba, T; Wang, L F; Wang, S J; Nie, S Y

    2017-06-20

    Objective: To explore the effects of combined application of culture supernatant of human umbilical cord mesenchymal stem cells (hUCMSCs) and ciprofloxacin on Staphylococcus aureus (SA) in vitro. Methods: hUCMSCs were isolated from umbilical cord tissue of full-term healthy fetus after cesarean section and cultured. Cells in the third passage were used in the experiments after identification. SA strains isolated from wounds of burn patients in our burn wards were used in the experiments. Cells were divided into 0, 10, 100, and 1 000 ng/mL lipopolysaccharide (LPS) groups according to the random number table (the same dividing method below). Cells were cultured with culture medium of mesenchymal stem cells (MSCs) after being treated with medium containing the corresponding mass concentrations of LPS for 12 h. At post culture hour (PCH) 6, 12, and 24, 6 wells of culture supernatant of cells in each group were obtained to measure the content of LL-37 with enzyme-linked immunosorbent assay. Ninety blood agar plates were divided into ciprofloxacin control group (CC), ciprofloxacin+ supernatant group (CS), and ciprofloxacin+ supernatant+ LL-37 antibody group (CSL), with 30 blood agar plates in each group. Blood agar plates in group CC were coated with 1.5×10(8) colony forming unit (CFU)/mL bacteria solution prepared with normal saline. Blood agar plates in group CS were coated with 1.5×10(8) CFU/mL bacteria solution prepared with normal saline and culture supernatant of hUCMSCs (cultured by culture medium of MSCs, the same below) in double volume of normal saline. Blood agar plates in group CSL were coated with 1.5×10(8) CFU/mL bacteria solution prepared with normal saline, culture supernatant of hUCMSCs in double volume of normal saline, and 2.6 μL LL-37 antibody in the concentration of 2 μg/mL. At PCH 12, 24, and 48, 10 blood agar plates of each group were harvested to observe the distribution of SA colony on blood agar plate and to measure the diameter of

  11. Culture supernatants from V. cholerae O1 El Tor strains isolated from different geographic areas induce cell vacuolation and cytotoxicity.

    Science.gov (United States)

    Vidal, Jorge E; Enríquez-Rincón, Fernando; Giono-Cerezo, Silvia; Ribas-Aparicio, Rosa María; Figueroa-Arredondo, Paula

    2009-01-01

    To investigate whether the HlyA-induced vacuolating effect is produced by V. cholerae O1 ElTor strains isolated from different geographic origins, including Mexico. Supernatant-induced haemolysis, vacuolating activity and cytotoxicity in Vero cells were recorded. PCR, RFLP analysis and molecular cloning were performed. All ElTor strains analyzed induced cellular vacuolation. Ribotype 2 strains isolates from the U.S. gulf coast yielded the highest titer of vacuolating activity. Eight of nine strains were haemolytic, while all strains were PCR positive for the hlyA gene. We cloned the hlyA gene from two ElTor strains, a toxigenic (2514-88, ctxAB+) and a non-toxigenic Mexican strain (CM 91-3, ctxAB-). Supernatant from those recombinant E. coli strains induced haemolysis, cell vacuolation and cytotoxicity. RFLP-PCR analysis revealed similarities in the hlyA gene from all strains tested. The HlyA-induced vacuolating effect is a widespread phenotype of epidemic V. cholerae O1 ElTor strains.

  12. Ultrastructural Histopathology of Vervet Monkey Colonic Epithelium After In Vitro Exposure to Cell-free Supernatants of Shigella Cultures

    OpenAIRE

    Hill, R. R.; Collins, N. E.; Cowley, H. M.

    2011-01-01

    The full dysentery syndrome of human shigellosis is often preceded by a transient diarrhoea that may be induced by bacterial extracellular products before invasion of the colonic mucosa and development of subsequent pathology. To examine this hypothesis, we studied the effects of cell-free cultures of Shigella sp. on the ultrastructure of monkey colonic epithelium in vitro. Clinical isolates of shigella strains were grown in a niche-simulating medium. Sheets of colon wall collected from verve...

  13. Analysis of glutathione in supernatants and lysates of a human proximal tubular cell line from perfusion culture upon intoxication with cadmium chloride by HPLC and LC-ESI-MS

    NARCIS (Netherlands)

    Hahn, Hans; Huck, Christian W; Rainer, Matthias; Najam-ul-Haq, Muhammad; Bakry, Rania; Abberger, Thomas; Jennings, Paul; Pfaller, Walter; Bonn, Günther K

    A simple and highly effective reversed-phase (RP) high-performance liquid chromatography (HPLC) method is described for analysing glutathione (GSH) and glutathione disulfide (GSSG) in out-flowing supernatants and lysates of perfusion cell cultures of human kidney cells (HK-2 cells) continuously

  14. The effects of three types of macrophages culture supernatant on CFU-GM in irradiated mice

    International Nuclear Information System (INIS)

    Quan Hongxun; Fu Li; Zhao Fengchen; Han Fen

    2008-01-01

    Objective: To study the effects of peritional macrophyge(PM), alveolar macrophage (AM), and Kupffer cell (KC) on colony forming unite granulacyte/macrophage (CFU -GM) in irradiated mice. Methods: Using techniques of hemopoietic progenitors in vitro, the authors studied the effects of three types of macrophages culture supernatant on CFU - GM. Results: It is shown that three types of macrophages culture supernatant may stimulate proliferation and differentiation of CFU-GM in irradiated mice, and KC is the best one in comparison to others. Conclusion: three types of macrophages culture supernatant may protect CFU-GM irradiated mice with KC being the best method. (authors)

  15. The culture of Chlorella vulgaris in a recycled supernatant: Effects on biomass production and medium quality

    KAUST Repository

    Hadj-Romdhane, F.; Zheng, Xing; Jaouen, Pascal; Pruvost, Jé ré my; Grizeau, Dominique; Croue, Jean-Philippe; Bourseau, Patrick

    2013-01-01

    Reusing supernatant of microalgae culture medium can have inhibitory or toxic effects on the biomass production because of the release of organic metabolites by cells in the culture medium during their growth. This work investigated the impact of Chlorella vulgaris medium recycling on culture productivity, cells quality and accumulation of excreted metabolites in the culture medium. No significant impact on the C. vulgaris growth was observed after 63days of recycling, the productivity remained stable at around 0.55kgm-3day-1. Organic matters accumulated in supernatant were identified as biopolymers (BP) poor in nitrogen and with a size above 40kDa (probably polysaccharides), and small organic molecules (SOM) richer in nitrogen with a molecular size ranging from 1 to 3kDa. The concentration of biopolymers in the supernatant increased till to a maximum and then decreased, possibly consumed by bacteria, whereas small organic compounds accumulated in the medium. © 2013 Elsevier Ltd.

  16. The culture of Chlorella vulgaris in a recycled supernatant: Effects on biomass production and medium quality

    KAUST Repository

    Hadj-Romdhane, F.

    2013-03-01

    Reusing supernatant of microalgae culture medium can have inhibitory or toxic effects on the biomass production because of the release of organic metabolites by cells in the culture medium during their growth. This work investigated the impact of Chlorella vulgaris medium recycling on culture productivity, cells quality and accumulation of excreted metabolites in the culture medium. No significant impact on the C. vulgaris growth was observed after 63days of recycling, the productivity remained stable at around 0.55kgm-3day-1. Organic matters accumulated in supernatant were identified as biopolymers (BP) poor in nitrogen and with a size above 40kDa (probably polysaccharides), and small organic molecules (SOM) richer in nitrogen with a molecular size ranging from 1 to 3kDa. The concentration of biopolymers in the supernatant increased till to a maximum and then decreased, possibly consumed by bacteria, whereas small organic compounds accumulated in the medium. © 2013 Elsevier Ltd.

  17. Culture supernatants of oral cancer cells induce impaired IFN-α production of pDCs partly through the down-regulation of TLR-9 expression.

    Science.gov (United States)

    Han, Nannan; Zhang, Zun; Jv, Houyu; Hu, Jingzhou; Ruan, Min; Zhang, Chenping

    2018-06-05

    The aim of the present study was to investigate whether tumor-derived supernatants down-regulate the immune function of plasmacytoid dendritic cells (pDCs) in oral cancer and the potential molecular mechanisms of this effect. Immunohistochemistry (IHC) and flow cytometry were used to detect tumor-infiltrating and peripheral blood pDCs. MTS and flow cytometry were employed to evaluate the immune response of CD4 + T cells. Real-time PCR and ELISA assays were used to identify TLR-7 and TLR-9 expression, IFN-α production and tumor-secreted soluble cytokines. The proportion of pDCs (0.121%±0.043%) was significantly higher in Oral squamous cell carcinoma (OSCC) samples than in normal tissue (0.023%±0.016%) (P = 0.021). TLR9 mRNA was significantly lower in tumor-infiltrating pDCs and positively correlated to low IFN-α production (r = 0.956; Poral cancer cells negatively regulated TLR9 mRNA expression and the subsequent IFN-α production of pDCs, which inhibited the immune response of CD4 + T cells. The neutralizing antibodies blocking assay showed that the specific inhibitory effect of pDC functionality was associated with the soluble fraction of the oral cancer environment, which is mainly mediated by IL-10 and TGF-β cooperation. Tumor-derived supernatants may impair the function of tumor-infiltrating pDCs, which subsequently decreases the immune response of CD4 + T cells in human oral cancer through TGF-β- and IL-10- dependent mechanisms. Careful manipulation of these impaired pDCs may help develop an important alternative immunotherapy for the treatment of oral cancer. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Solid-phase radioimmunoassay for Epstein-Barr virus-associated membrane antigen prepared from B95-8 cell culture supernatants

    International Nuclear Information System (INIS)

    Doelken, G.; Klein, G.

    1977-01-01

    Epstein-Barr virus (EBV)-associated membrane antigen (MA) was concentrated from B95-8 cell culture media by precipitation with polyethylene glycol followed by chromatography on Bio-Gel A-50m. In a RAJI cell-binding assay, MA-positive material could only be found in the void volume of the column. After ultracentrifugation all antigenic activity appeared in the pellet, which suggested that MA was present in aggregates, presumably fragments of cellular membranes and/or virus envelopes. The MA-containing preparation was photopolymerized in polyacrylamide gel. The homogenized gel was used in a solid-phase radioimmunoassay with 125 I-labeled IgG from an anti-MA positive reference serum and an anti-MA negative control serum. The specificity of the reaction was confirmed in blocking tests with anti-EBV positive and negative sera. A good correlation was found between the results obtained in the radioimmunoassay and the results obtained in direct immunofluorescence tests for the detection of MA. The existence of at least two subspecificities of the MA complex could be confirmed by this radioimmunoassay

  19. Cell culture supernatants for detection perforin ELISA

    African Journals Online (AJOL)

    Najwa

    2014-02-19

    Feb 19, 2014 ... filtration chromatography using Sephadex G-150, and the study utilized an in vitro ... 1.73 U/mg in crude extract to 2.29 U/mg after ion-exchange and 10.5 U/mg ..... survival: application to proliferation and cytotoxicity assays .J.

  20. Transformation of carbon tetrachloride and chloroform by trichloroethene respiring anaerobic mixed cultures and supernatant.

    Science.gov (United States)

    Vickstrom, Kyle E; Azizian, Mohammad F; Semprini, Lewis

    2017-09-01

    Carbon tetrachloride (CT) and chloroform (CF) were transformed in batch reactor experiments conducted with anaerobic dechlorinating cultures and supernatant (ADC + S) harvested from continuous flow reactors. The Evanite (EV) and Victoria/Stanford (VS) cultures, capable of respiring trichloroethene (TCE), 1,2-cis-dichloroethene (cDCE), and vinyl chloride (VC) to ethene (ETH), were grown in continuous flow reactors receiving an influent feed of saturated TCE (10 mM; 60 mEq) and formate (45 mM; 90 mEq) but no CT or CF. Cells and supernatant were harvested from the chemostats and inoculated into batch reactors at the onset of each experiment. CT transformation was complete following first order kinetics with CF, DCM and CS 2 as the measurable transformation products, representing 20-40% of the original mass of CT, with CO 2 likely the unknown transformation product. CF was transformed to DCM and likely CO 2 at an order of magnitude rate lower than CT, while DCM was not further transformed. An analytical first order model including multiple key reactions effectively simulated CT transformation, product formation and transformation, and provided reasonable estimates of transformation rate coefficients. Biotic and abiotic treatments indicated that CT was mainly transformed via abiotic processes. However, the presence of live cells was associated with the transformation of CF to DCM. In biotic tests both TCE and CT were simultaneously transformed, with TCE transformed to ETH and approximately 15-53% less CF formed via CT transformation. A 14-day exposure to CF (CF max  = 1.4 μM) reduced all rates of chlorinated ethene respiration by a factor of 10 or greater. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Characterization of culture supernatant proteins from Brucella abortus and its protection effects against murine brucellosis.

    Science.gov (United States)

    Lee, Jin Ju; Lim, Jeong Ju; Kim, Dae Geun; Simborio, Hannah Leah; Kim, Dong Hyeok; Reyes, Alisha Wehdnesday Bernardo; Min, WonGi; Lee, Hu Jang; Kim, Dong Hee; Chang, Hong Hee; Kim, Suk

    2014-09-01

    In this study, we characterized the secreted proteins of Brucella abortus into the enriched media under the bacterial laboratory growth condition and investigated the pathogenic importance of culture supernatant (CS) proteins to B. abortus infection. CS proteins from stationary phase were concentrated and analyzed using 2D electrophoresis. In MALDI TOF/TOF analysis, more than 27 proteins including CuZn SOD, Dps, Tat, OMPs, Adh, LivF, Tuf, SucC, GroEL and DnaK were identified. Cytotoxic effects of CS proteins were found to increase in a dose-dependent manner in RAW 264.7 cells. Upon B. abortus challenge into phagocytes, however, CS proteins pre-treated cells exhibited lower bacterial uptake and intracellular replication compared to untreated cells. Immunization with CS proteins induced a strong humoral and cell mediated immune responses and exhibited significant higher degree of protection against virulence of B. abortus infection compared to mice immunized with Brucella broth protein (BBP). Taken together, these results indicate that B. abortus secreted a number of soluble immunogenic proteins under laboratory culture condition, which can promote antibody production resulted in enhancing host defense against to subsequently bacterial infection. Moreover, further analysis of CS proteins may help to understand the pathogenic mechanism of B. abortus infection and host-pathogen interaction. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. SalB inactivation modulates culture supernatant exoproteins and affects autolysis and viability in Enterococcus faecalis OG1RF.

    Science.gov (United States)

    Shankar, Jayendra; Walker, Rachel G; Wilkinson, Mark C; Ward, Deborah; Horsburgh, Malcolm J

    2012-07-01

    The culture supernatant fraction of an Enterococcus faecalis gelE mutant of strain OG1RF contained elevated levels of the secreted antigen SalB. Using differential fluorescence gel electrophoresis (DIGE) the salB mutant was shown to possess a unique complement of exoproteins. Differentially abundant exoproteins were identified using matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry. Stress-related proteins including DnaK, Dps family protein, SOD, and NADH peroxidase were present in greater quantity in the OG1RF salB mutant culture supernatant. Moreover, several proteins involved in cell wall synthesis and cell division, including d-Ala-d-Lac ligase and EzrA, were present in reduced quantity in OG1RF salB relative to the parent strain. The salB mutant displayed reduced viability and anomalous cell division, and these phenotypes were exacerbated in a gelE salB double mutant. An epistatic relationship between gelE and salB was not identified with respect to increased autolysis and cell morphological changes observed in the salB mutant. SalB was purified as a six-histidine-tagged protein to investigate peptidoglycan hydrolytic activity; however, activity was not evident. High-pressure liquid chromatography (HPLC) analysis of reduced muropeptides from peptidoglycan digested with mutanolysin revealed that the salB mutant and OG1RF were indistinguishable.

  3. Long acting β2-agonist and corticosteroid restore airway glandular cell function altered by bacterial supernatant

    Directory of Open Access Journals (Sweden)

    Nawrocki-Raby Béatrice

    2010-01-01

    Full Text Available Abstract Background Staphylococcus aureus releases virulence factors (VF that may impair the innate protective functions of airway cells. The aim of this study was to determine whether a long-acting β2 adrenergic receptor agonist (salmeterol hydroxynaphthoate, Sal combined with a corticosteroid (fluticasone propionate, FP was able to regulate ion content and cytokine expression by airway glandular cells after exposure to S. aureus supernatant. Methods A human airway glandular cell line was incubated with S. aureus supernatant for 1 h and then treated with the combination Sal/FP for 4 h. The expression of actin and CFTR proteins was analyzed by immunofluorescence. Videomicroscopy was used to evaluate chloride secretion and X-ray microanalysis to measure the intracellular ion and water content. The pro-inflammatory cytokine expression was assessed by RT-PCR and ELISA. Results When the cells were incubated with S. aureus supernatant and then with Sal/FP, the cellular localisation of CFTR was apical compared to the cytoplasmic localisation in cells incubated with S. aureus supernatant alone. The incubation of airway epithelial cells with S. aureus supernatant reduced by 66% the chloride efflux that was fully restored by Sal/FP treatment. We also observed that Sal/FP treatment induced the restoration of ion (Cl and S and water content within the intracellular secretory granules of airway glandular cells and reduced the bacterial supernatant-dependent increase of pro-inflammatory cytokines IL8 and TNFα. Conclusions Our results demonstrate that treatment with the combination of a corticosteroid and a long-acting β2 adrenergic receptor agonist after bacterial infection restores the airway glandular cell function. Abnormal mucus induced by defective ion transport during pulmonary infection could benefit from treatment with a combination of β2 adrenergic receptor agonist and glucocorticoid.

  4. In vitro and in vivo antitumor effects of 50 to 100-KDa components from B16 melanoma culture supernatant.

    Science.gov (United States)

    Qin, Ying-Song; Zhang, X U; Zhang, Xiang-Yu

    2015-07-01

    The development of immunological therapies for melanoma has been of considerable concern in recent years. Whole tumor cell lysates have been used to develop antitumor vaccines, but the effective components of the lysates have not been identified. In the present study, protein elements were purified from the B16 supernatant to analyze the in vitro chemotaxis towards mouse spleen lymphocytes using a Boyden chamber. Prior to establishing a B16 melanoma model, C57BL/6 mice were vaccinated with these proteins, and melanoma growth, tumor appearance time and behavioral changes were observed. Next, the cytotoxicity and subsets of the tumor infiltrating lymphocytes, and the histological characteristics of the melanoma were analyzed. The isolated purified fragments of B16 melanoma culture supernatant had strong antitumor effects. The possible antitumor mechanism was delineated, and was identified to possibly be through the activation of cluster of differentiation 8-positive T cells and the promotion of B16 cell differentiation. These methods will provide a novel insight into understanding antitumor immunological mechanisms and provide a potential avenue for immunotherapy.

  5. Antifungal performance of extracellular chitinases and culture supernatants of Streptomyces galilaeus CFFSUR-B12 against Mycosphaerella fijiensis Morelet.

    Science.gov (United States)

    Castillo, Benjamín Moreno; Dunn, Michael F; Navarro, Karina Guillén; Meléndez, Francisco Holguín; Ortiz, Magdalena Hernández; Guevara, Sergio Encarnación; Palacios, Graciela Huerta

    2016-03-01

    The tropical and mycoparasite strain Streptomyces galilaeus CFFSUR-B12 was evaluated as an antagonist of Mycosphaerella fijiensis Morelet, causal agent of the Black Sigatoka Disease (BSD) of banana. On zymograms of CFFSUR-B12 culture supernatants, we detected four chitinases of approximately 32 kDa (Chi32), 20 kDa (Chi20), and two with masses well over 170 kDa (ChiU) that showed little migration during denaturing electrophoresis at different concentrations of polyacrylamide. The thymol-sulphuric acid assay showed that the ChiU were glycosylated chitinases. Moreover, matrix assisted laser desorption ionization time-of-flight MS analysis revealed that the ChiU are the same protein and identical to a family 18 chitinase from Streptomyces sp. S4 (gi|498328075). Chi32 was similar to an extracellular protein from Streptomyces albus J1074 (gi|478687481) and Chi20 was non-significantly similar to chitinases from five different strains of Streptomyces (P > 0.05). Subsequently, Chi32 and Chi20 were partially purified by anion exchange and hydrophobic interaction chromatography and tested against M. fijiensis. Chitinases failed to inhibit ascospore germination, but inhibited up to 35 and 62% of germ tube elongation and mycelial growth, respectively. We found that crude culture supernatant and living cells of S. galilaeus CFFSUR-B12 were the most effective in inhibiting M. fijiensis and are potential biocontrol agents of BSD.

  6. Incubation of Aquilaria subintegra with Microbial Culture Supernatants Enhances Production of Volatile Compounds and Improves Quality of Agarwood Oil.

    Science.gov (United States)

    Monggoot, Sakon; Kulsing, Chadin; Wong, Yong Foo; Pripdeevech, Patcharee

    2018-06-01

    Incubation with microbial culture supernatants improved essential oil yield from Aquilaria subintegra woodchips. The harvested woodchips were incubated with de man, rogosa and sharpe (MRS) agar, yeast mold (YM) agar medium and six different microbial culture supernatants obtained from Lactobacillus bulgaricus , L. acidophilus , Streptococcus thermophilus , Lactococcus lactis , Saccharomyces carlsbergensis and S. cerevisiae prior to hydrodistillation. Incubation with lactic acid bacteria supernatants provided higher yield of agarwood oil (0.45% w/w) than that obtained from yeast (0.25% w/w), agar media (0.23% w/w) and water (0.22% w/w). The composition of agarwood oil from all media and microbial supernatant incubations was investigated by using gas chromatography-mass spectrometry. Overall, three major volatile profiles were obtained, which corresponded to water soaking (control), as well as, both YM and MRS media, lactic acid bacteria, and yeast supernatant incubations. Sesquiterpenes and their oxygenated derivatives were key components of agarwood oil. Fifty-two volatile components were tentatively identified in all samples. Beta-agarofuran, α-eudesmol, karanone, α-agarofuran and agarospirol were major components present in most of the incubated samples, while S. cerevisiae -incubated A. subintegra provided higher amount of phenyl acetaldehyde. Microbial culture supernatant incubation numerically provided the highest yield of agarwood oil compared to water soaking traditional method, possibly resulting from activity of extracellular enzymes produced by the microbes. Incubation of agarwood with lactic acid bacteria supernatant significantly enhanced oil yields without changing volatile profile/composition of agarwood essential oil, thus this is a promising method for future use.

  7. ACVP-05: Virus Genetic Analysis from Cell-Free Plasma, Virally Infected Cells or Tissues and Cultured Supernatant Via Single Genome Amplification and Direct Sequencing | Frederick National Laboratory for Cancer Research

    Science.gov (United States)

    The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested

  8. Isolation and Purification of an Early Pregnancy Factor–Like Molecule from Culture Supernatants Obtained from Lymphocytes of Pregnant Women

    OpenAIRE

    Aranha, Clara; Natraj, Usha; Iyer, K. S.; Shahani, Savitri

    1998-01-01

    Purpose:Our purpose was to determine whether lymphocytes synthesize proteins during pregnancy, to observe whether one of the proteins synthesized has early pregnancy factor (EPF)–like activity and to isolate and purify this molecule from culture supernatants obtained from stimulated lymphocytes of pregnant women.

  9. Hemolytic activity of Fusobacterium necrophorum culture supernatants due to presence of phospholipase A and lysophospholipase.

    Science.gov (United States)

    Abe, P M; Kendall, C J; Stauffer, L R; Holland, J W

    1979-01-01

    Culture supernatants of Fusobacterium necrophorum demonstrated hemolytic activity. The hemolysin(s), which was partially purified by ammonium sulfate precipitation, was temperature-dependent and heat labile. The spectrum of hemolytic activity against various erythrocytes included rabbit, human, and dog erythrocytes. Goats, sheep, and bovine erythrocytes showed only trace hemolysis. According to results of thin-layer chromatography, the hemolysin hydrolyzed rabbit erythrocyte phosphatidyl choline, phosphatidyl ethanolamine, lysophosphatidyl choline, and bovine phosphatidyl choline. Hydrolysis of egg yolk phosphatidyl choline, bovine phosphatidyl ethanolamine, cholesterol, 1,2-dipalmitin, 1,3-dipalmitin, sphingomyelin, or triolein was not detected by thin layer chromatography. A more sensitive procedure utilizing gas-liquid chromatography revealed that, of the substrates tested, the following were bein hydrolyzed: bovine and egg yolk phosphatidyl choline, lysophosphatidyl choline, alpha-palmito-beta-eleoyl-L-alpha lecithin and alpha-oleoyl-betal-palmitoyl-L-alpha lecithin. Substrates which were weakly hydrolyzed were bovine phosphatidyl ethanolamine, DL-alpha-hosphatidyl ethanolamine dipalmitoyl, 1,2-dipalmitin, 1,3-dipalmitin, and triolein.

  10. Supernatants from culture of type I collagen-stimulated PBMC from patients with cutaneous systemic sclerosis versus localized scleroderma demonstrate suppression of MMP-1 by fibroblasts.

    Science.gov (United States)

    Brown, Monica; Postlethwaite, Arnold E; Myers, Linda K; Hasty, Karen A

    2012-06-01

    Systemic sclerosis (SSc) is a chronic fibrosing disease characterized by vasculopathy, autoimmunity, and an accumulation of collagen in tissues. Numerous studies have shown that compared to healthy or diseased controls, the peripheral blood mononuclear cells (PBMC) from patients with SSc produce a variety of cytokines or proliferate when cultured with solubilized type I collagen (CI) or constituent α1(II) and α2(I) polypeptide chains. The purpose of this study was to determine whether PBMC isolated from patients with SSc and cultured in vitro with soluble CI elaborated soluble mediators that inhibit the production of collagenase (i.e., matrix metalloproteinase, MMP-1) by fibroblasts. Supernatants of CI-stimulated PBMC from juvenile and adult diffuse cutaneous (dc)SSc patients significantly reduced MMP-1 production by SSc dermal fibroblasts, while supernatants of CI-stimulated PBMC from patients with localized scleroderma (LS) did not. CI-stimulated PBMC culture supernatants from patients with dcSSc in contrast to patients with LS exhibited increased levels of platelet-derived growth factor (PDGF)-AA, PDGF-BB, TNF-α, IL-13, and EGF. Prolonged culture of SSc dermal fibroblasts with recombinant PDGF-BB or IL-13 inhibited the induction of MMP-1 in response to subsequent TNF-α stimulation. These data suggest that therapies aimed at reducing these cytokines may decrease collagen accumulation in SSc, preventing the development of chronic fibrosis.

  11. Influence of Helicobacter pylori culture supernatant on the ecological balance of a dual-species oral biofilm.

    Science.gov (United States)

    Zhang, Wenling; Deng, Xiaohong; Zhou, Xuedong; Hao, Yuqing; Li, Yuqing

    2018-01-01

    Dental caries is a chronic progressive disease occurring in the tooth hard tissue due to multiple factors, in which bacteria are the initial cause. Both Streptococcus mutans and Streptococcus sanguinis are main members of oral biofilm. Helicobacter pylori may also be detected in dental plaque, playing an important role in the development of dental caries. The aim of this study was to investigate the effect of H. pylori culture supernatant on S. mutans and S. sanguinis dual-species biofilm and to evaluate its potential ability on affecting dental health. The effect of H. pylori supernatant on single-species and dual-species biofilm was measured by colony forming units counting and fluorescence in situ hybridization (FISH) assay, respectively. The effect of H. pylori supernatant on S. mutans and S. sanguinis extracellular polysaccharides (EPS) production was measured by both confocal laser scanning microscopy observation and anthrone-sulfuric acid method. The effect of H. pylori supernatant on S. mutans gene expression was measured by quantitative real-time PCR (qRT-PCR) assays. H. pylori supernatant could inhibit both S. mutans and S. sanguinis biofilm formation and EPS production. S. sanguinis inhibition rate was significantly higher than that of S. mutans. Finally, S. mutans bacteriocin and acidogenicity related genes expression were affected by H. pylori culture supernatant. Our results showed that H. pylori could destroy the balance between S. mutans and S. sanguinis in oral biofilm, creating an advantageous environment for S. mutans, which became the dominant bacteria, promoting the formation and development of dental caries.

  12. Influence of Helicobacter pylori culture supernatant on the ecological balance of a dual-species oral biofilm

    Directory of Open Access Journals (Sweden)

    Wenling Zhang

    2018-02-01

    Full Text Available Abstract Dental caries is a chronic progressive disease occurring in the tooth hard tissue due to multiple factors, in which bacteria are the initial cause. Both Streptococcus mutans and Streptococcus sanguinis are main members of oral biofilm. Helicobacter pylori may also be detected in dental plaque, playing an important role in the development of dental caries. Objective The aim of this study was to investigate the effect of H. pylori culture supernatant on S. mutans and S. sanguinis dual-species biofilm and to evaluate its potential ability on affecting dental health. Material and methods The effect of H. pylori supernatant on single-species and dual-species biofilm was measured by colony forming units counting and fluorescence in situ hybridization (FISH assay, respectively. The effect of H. pylori supernatant on S. mutans and S. sanguinis extracellular polysaccharides (EPS production was measured by both confocal laser scanning microscopy observation and anthrone-sulfuric acid method. The effect of H. pylori supernatant on S. mutans gene expression was measured by quantitative real-time PCR (qRT-PCR assays. Results H. pylori supernatant could inhibit both S. mutans and S. sanguinis biofilm formation and EPS production. S. sanguinis inhibition rate was significantly higher than that of S. mutans. Finally, S. mutans bacteriocin and acidogenicity related genes expression were affected by H. pylori culture supernatant. Conclusion Our results showed that H. pylori could destroy the balance between S. mutans and S. sanguinis in oral biofilm, creating an advantageous environment for S. mutans, which became the dominant bacteria, promoting the formation and development of dental caries.

  13. Cell mediated lympholysis: CML. A microplate technique requiring few target cells and employing a new method of supernatant collection

    International Nuclear Information System (INIS)

    Hirschberg, A.; Thorsby, E.

    1977-01-01

    A micromethod for the 51 Cr release assay is described. Allogeneically induced cytotoxic lymphocytes are generated in mixed lymphocyte microcultures in the wells of microplates. Their cytotoxic capacity is assayed by adding 51 Cr-labelled PHA derived lymphoblasts directly into the microcultures with no pooling or transfer of the cytotoxic effector cells being required. The 51 Cr isotope released into the cell supernatants is collected by inserting a cellulose acetate absorption cartridge into each well. A glass fiber filter attached to the cartridge effectively separates the supernatant from the cellular elemets. This system allows the simultaneous collection of the supernatant from 96 wells, and can be used with either adherent or non-adherent target cells

  14. Isotope inequilibrium of glucose metabolites in intact cells and particlefree supernatants of Ehrlich ascites tumor

    International Nuclear Information System (INIS)

    Daehnfeldt, J.L.; Winge, P.

    1975-01-01

    With an enzyme degradative technique, isotope inequilibrium of glucose metabolites was demonstrated in intact cells and particle-free supernatants of Ehrlich ascites tumor using I- 14 C-glucose as tracer. Inequilibrium was found between glucose and glucose-6-phosphate, glucose and fructose-6-phosphate, glucose and 6-phosphogluconate, while glucose-6-phosphate and fructose-6-phosphate were found to be in near equilibrium within the incubation time investigated. Glucose and lactate were found to be in near equilibrium after 8 min in intact cells. Calculations based on the equilibrium levels found, showed that these inequilibria could not be explained by the effects of the pentose cycle. (U.S.)

  15. Influence of Helicobacter pylori culture supernatant on the ecological balance of a dual-species oral biofilm

    OpenAIRE

    Wenling Zhang; Xiaohong Deng; Xuedong Zhou; Yuqing Hao; Yuqing Li

    2018-01-01

    Abstract Dental caries is a chronic progressive disease occurring in the tooth hard tissue due to multiple factors, in which bacteria are the initial cause. Both Streptococcus mutans and Streptococcus sanguinis are main members of oral biofilm. Helicobacter pylori may also be detected in dental plaque, playing an important role in the development of dental caries. Objective The aim of this study was to investigate the effect of H. pylori culture supernatant on S. mutans and S. sanguinis dual...

  16. Putative new heat-stable cytotoxic and enterotoxic factors in culture supernatant of Escherichia coli isolated from drinking water

    Directory of Open Access Journals (Sweden)

    DA Ribeiro

    2011-01-01

    Full Text Available Enteric infections caused by the ingestion of contaminated water, especially by Escherichia coli, are important to define the virulence properties of these bacteria. Due to frequent infantile diarrhea in the city of Ouro Preto, Minas Gerais state, Brazil, the phenotypic and genotypic diarrheagenic properties of E. coli isolated from drinking water were studied. The culture supernatants of 39 (40% among a total of 97 E. coli isolates from drinking water were positive by suckling mouse assay and induced cytotoxic effects on Vero cells. The enterotoxic and cytotoxic activities were present in the fraction with less than 10 kDa and were not lost when heated up to 60°C and 100°C for 30 minutes. PCR assays showed that among these 39 Vero cytotoxigenic E. coli, four (10.2% were positive for ST II (estB and two (5% positive for αHly (hlyA. Gene amplification of SLT (stx 1, stx 2, ST I (estA, LT (eltI, eltII, EAST1 (astA, EHly (enhly and plasmid-encoded enterotoxin (pet were not observed. This heat-stable cytotoxic enterotoxin of E. coli is probably a new putative diarrheagenic virulence factor, as a toxin presenting these characteristics has not yet been described.

  17. Antimicrobial Activity of Cell Free Supernatant of Irradiated Lactic Acid Bacteria Isolates

    International Nuclear Information System (INIS)

    Abdelaleem, M.A.; AL-Hagar, O.E.Aa.

    2015-01-01

    Attempts were made to isolate bio preservatives using food wastes with no value and low cost. Whey is the raw material achieved that value. Whey and many other food wastes are used in our study to isolate Lactic acid bacteria (LAB). Cell free supernatants (CFS) of isolates are used to evaluate their antimicrobial activity against indicator pathogenic bacterial strains. CFS-9 isolate from whey has the highest inhibitory activity compared to all other isolates. The inhibitory activity of CFS-9, Nisin (400 IU / ml) and the standard Lactococcus Lactis Subsp. Lactis ATCC 11454 (Lacto) were determined. Furthermore, isolate-9 and Lacto strains were exposed to irradiation at different doses. The inhibition zones of; control isolate-9 (non-irradiated) showed the highest values against all indicator strains, CFS of irradiated Lacto at dose 250 Gy was the highest value against Bacillus cereus and Escherichia coli compared to other irradiation treatments, CFS of irradiated Lacto at dose 100 Gy was the highest value against Staph aureus, while the inhibition zone was in the highest value in CFS of irradiated Lacto at dose 500 Gy against Salmonella typhimurium. Nisin (400 IU / ml) was significantly higher than all CFS of irradiated isolate-9 while, the inhibition zones of all CFS-Lacto (irradiated and nonirradiated) are better and higher than nisin-400

  18. Peroxynitrite decomposition catalyst prevents apoptotic cell death in a human astrocytoma cell line incubated with supernatants of HIV-infected macrophages

    Directory of Open Access Journals (Sweden)

    Perno Carlo

    2002-09-01

    Full Text Available Abstract Background Oxidative stress has shown to contribute in the mechanisms underlying apoptotic cell death occuring in AIDS-dementia complex. Here we investigated the role of peroxynitrite in apoptosis occurring in astroglial cells incubated with supernatants of HIV-infected human primary macrophages (M/M. Results Flow cytometric analysis (FACS of human cultured astrocytes shortly incubated with HIV-1-infected M/M supernatants showed apoptotic cell death, an effect accompanied by pronounced staining for nitrotyrosine (footprint of peroxynitrite and by abnormal formation of malondialdehyde (MDA. Pretreatment of astrocytes with the peroxynitrite decomposition catalyst FeTMPS antagonized HIV-related astrocytic apoptosis, MDA formation and nitrotyrosine staining. Conclusions Taken together, our results suggest that inibition of peroxynitrite leads to protection against peroxidative stress accompanying HIV-related apoptosis of astrocytes. Overall results support the role of peroxynitrite in HIV-related programmed death of astrocytes and suggest the use of peroxynitrite decomposition catalyst to counteract HIV-1-related neurological disorders.

  19. Biological synthesis of very small silver nanoparticles by culture supernatant of Klebsiella pneumonia: The effects of visible-light irradiation and the liquid mixing process

    International Nuclear Information System (INIS)

    Mokhtari, Narges; Daneshpajouh, Shahram; Seyedbagheri, Seyedali; Atashdehghan, Reza; Abdi, Khosro; Sarkar, Saeed; Minaian, Sara; Shahverdi, Hamid Reza; Shahverdi, Ahmad Reza

    2009-01-01

    This study has investigated different visible-light irradiation's effect on the formation of silver nanoparticles from silver nitrate using the culture supernatant of Klebsiella pneumonia. Our study shows that visible-light emission can significantly prompt the synthesis of silver nanoparticles. Also, the study experimentally investigated the liquid mixing process effect on silver nanoparticle synthesis by visible-light irradiation. This study successfully synthesized uniformly dispersed silver nanoparticles with a uniform size and shape in the range of 1-6 nm with an average size of 3 nm. Furthermore, the study investigated the mechanism of the reduction of silver ions by culture supernatant of K. pneumonia, and used X-ray diffraction to characterize silver chloride as an intermediate compound. Silver chloride was prepared synthetically and used as a substrate for the synthesis of silver nanoparticles by culture supernatant of K. pneumonia. The silver nanoparticles have been prepared from silver chloride during this investigation for the first time.

  20. Biological synthesis of very small silver nanoparticles by culture supernatant of Klebsiella pneumonia: The effects of visible-light irradiation and the liquid mixing process

    Energy Technology Data Exchange (ETDEWEB)

    Mokhtari, Narges [Department of Pharmaceutical Biotechnology and Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Daneshpajouh, Shahram; Seyedbagheri, Seyedali; Atashdehghan, Reza [Hydrometallurgy Research Unit, Research and Development Center, National Iranian Copper Industries Company, Sarcheshmeh, Rafsanjan (Iran, Islamic Republic of); Abdi, Khosro [Department of Pharmaceutical Biotechnology and Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Sarkar, Saeed [Research Center for Science and Technology in Medicine, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Minaian, Sara [Department of Pharmaceutical Biotechnology and Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Shahverdi, Hamid Reza [Department of Material Science, Faculty of Engineering, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Shahverdi, Ahmad Reza, E-mail: shahverd@sina.tums.ac.ir [Department of Pharmaceutical Biotechnology and Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of)

    2009-06-03

    This study has investigated different visible-light irradiation's effect on the formation of silver nanoparticles from silver nitrate using the culture supernatant of Klebsiella pneumonia. Our study shows that visible-light emission can significantly prompt the synthesis of silver nanoparticles. Also, the study experimentally investigated the liquid mixing process effect on silver nanoparticle synthesis by visible-light irradiation. This study successfully synthesized uniformly dispersed silver nanoparticles with a uniform size and shape in the range of 1-6 nm with an average size of 3 nm. Furthermore, the study investigated the mechanism of the reduction of silver ions by culture supernatant of K. pneumonia, and used X-ray diffraction to characterize silver chloride as an intermediate compound. Silver chloride was prepared synthetically and used as a substrate for the synthesis of silver nanoparticles by culture supernatant of K. pneumonia. The silver nanoparticles have been prepared from silver chloride during this investigation for the first time.

  1. Rapid Biosynthesis of Silver Nanoparticles Using Culture Supernatant of Bacteria with Microwave Irradiation

    Directory of Open Access Journals (Sweden)

    N. Saifuddin

    2009-01-01

    Full Text Available The development of rapid and reliable processes for the synthesis of nanosized materials is of great importance in the field of nanotechnology. Synthesis of silver nanoparticles using microorganism have been reported, but the process is rather slow. In this paper, we describe a novel combinatorial synthesis approach which is rapid, simple and “green” for the synthesis of metallic nanostructures of noble metals such as silver (Ag, by using a combination of culture supernatanant of Bacillus subtilis and microwave (MW irradiation in water in absence of a surfactant or soft template. It was found that exposure of culture supernatanant of Bacillus subtilis and microwave irradiation to silver ion lead to the formation of silver nanoparticles. The silver nanoparticles were in the range of 5-60 nm in dimension. The nanoparticles were examined using UV-Visible Spectroscopy, and Transmission Electron Microscopy (TEM analyses. The formation of nanoparticles by this method is extremely rapid, requires no toxic chemicals and the nanoparticles are stable for several months. The main conclusion is that the bio-reduction method to produce nanoparticles is a good alternative to the electrochemical methods.

  2. Evaluation of Synergistic Interactions Between Cell-Free Supernatant of Lactobacillus Strains and Amikacin and Genetamicin Against Pseudomonas aeruginosa

    OpenAIRE

    Aminnezhad, Sargol; Kermanshahi, Rouha Kasra; Ranjbar, Reza

    2015-01-01

    Background: The indiscriminate use of antibiotics in the treatment of infectious diseases can increase the development of antibiotic resistance. Therefore, there is a big demand for new sources of antimicrobial agents and alternative treatments for reduction of antibiotic dosage required to decrease the associated side effects. Objectives: In this study, the synergistic action of aminoglycoside antibiotics and cell-free supernatant (CFS) of probiotic (Lactobacillus rahmnosus and L. casei) aga...

  3. Performance of hemicellulolytic enzymes in culture supernatants from a wide range of fungi on insoluble wheat straw and corn fiber fractions

    NARCIS (Netherlands)

    Gool, van M.P.; Toth, K.; Schols, H.A.; Szakacs, G.; Gruppen, H.

    2012-01-01

    Filamentous fungi are a good source of hemicellulolytic enzymes for biomass degradation. Enzyme preparations were obtained as culture supernatants from 78 fungal isolates grown on wheat straw as carbon source. These enzyme preparations were utilized in the hydrolysis of insoluble wheat straw and

  4. High-throughput screening of hybridoma supernatants using multiplexed fluorescent cell barcoding on live cells.

    Science.gov (United States)

    Lu, Mei; Chan, Brian M; Schow, Peter W; Chang, Wesley S; King, Chadwick T

    2017-12-01

    With current available assay formats using either immobilized protein (ELISA, enzyme-linked immunosorbent assay) or immunostaining of fixed cells for primary monoclonal antibody (mAb) screening, researchers often fail to identify and characterize antibodies that recognize the native conformation of cell-surface antigens. Therefore, screening using live cells has become an integral and important step contributing to the successful identification of therapeutic antibody candidates. Thus the need for developing high-throughput screening (HTS) technologies using live cells has become a major priority for therapeutic mAb discovery and development. We have developed a novel technique called Multiplexed Fluorescent Cell Barcoding (MFCB), a flow cytometry-based method based upon the Fluorescent Cell Barcoding (FCB) technique and the Luminex fluorescent bead array system, but is applicable to high-through mAb screens on live cells. Using this technique in our system, we can simultaneously identify or characterize the antibody-antigen binding of up to nine unique fluorescent labeled cell populations in the time that it would normally take to process a single population. This has significantly reduced the amount of time needed for the identification of potential lead candidates. This new technology enables investigators to conduct large-scale primary hybridoma screens using flow cytometry. This in turn has allowed us to screen antibodies more efficiently than before and streamline identification and characterization of lead molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Comparison of DOT-ELISA and Standard-ELISA for Detection of the Vibrio cholerae Toxin in Culture Supernatants of Bacteria Isolated from Human and Environmental Samples.

    Science.gov (United States)

    Meza-Lucas, Antonio; Pérez-Villagómez, María-Fernanda; Martínez-López, José-Patricio; García-Rodea, Ricardo; Martínez-Castelán, María-Guadalupe; Escobar-Gutiérrez, Alejandro; de-la-Rosa-Arana, Jorge-Luis; Villanueva-Zamudio, Altagracia

    2016-09-01

    A comparison of DOT-ELISA and Standard-ELISA was made for detection of Vibrio cholerae toxin in culture supernatants of bacteria isolated from human and environmental samples. A total of 293 supernatants were tested in a double blind assay. A correlation of 100 % was obtained between both techniques. The cholera toxin was found in 20 Inaba and 3 Ogawa strains. Positive samples were from seafood (17 samples), potable water (1 sample) and sewage (5 samples). The DOT-ELISA was useful as the standard-ELISA to confirm the presence of cholera toxin in the environmental samples.

  6. Properties of Two Novel Esterases Identified from Culture Supernatant of Penicillium purpurogenum Grown on Sugar Beet Pulp.

    Science.gov (United States)

    Oleas, Gabriela; Callegari, Eduardo; Sepulveda, Romina; Eyzaguirre, Jaime

    2016-01-01

    The filamentous fungus Penicillium purpurogenum grows on a variety of natural carbon sources, such as sugar beet pulp, and secretes to the medium a large number of enzymes that degrade the carbohydrate components of lignocellulose. Sugar beet pulp is rich in pectin, and the purpose of this work is to identify novel esterases produced by the fungus, which may participate in pectin degradation. Partially purified culture supernatants of the fungus grown on sugar beet pulp were subjected to mass spectrometry analysis. Peptides thus identified, which may be part of potential esterases were probed against the proteins deduced from the fungal genome sequence. The cDNAs of two putative esterases identified were expressed in Pichia pastoris and their properties studied. One of these enzymes, named FAET, is a feruloyl esterase, while the other, PE, is classified as a pectin methyl esterase. These findings add to our knowledge of the enzymology of pectin degradation by Penicillium purpurogenum, and define properties of two novel esterases acting on de-esterification of pectin. Their availability may be useful as tools for the study of pectin structure and degradation.

  7. Compounds from Lactobacillus plantarum culture supernatants with potential pro-healing and anti-pathogenic properties in skin chronic wounds.

    Science.gov (United States)

    Ramos, Alberto N; Sesto Cabral, Maria E; Arena, Mario E; Arrighi, Carlos F; Arroyo Aguilar, Abel A; Valdéz, Juan C

    2015-03-01

    It is necessary to advance the field of alternative treatments for chronic wounds that are financially accessible to the least economically developed countries. Previously we demonstrated that topical applications of Lactobacillus plantarum culture supernatants (LAPS) on human-infected chronic wounds reduce the pathogenic bioburden, the amount of necrotic tissue, and the wound area, as well as promote debridement, granulation tissue, and wound healing. To study LAPS chemically and biologically and to find potential molecules responsible for its pro-healing and anti-pathogenic properties in chronic wounds. (1) Chemical analysis: extracts were subjected to a column chromatography and the fractions obtained were studied by GCMS. (2) Quantification: dl-lactic acid (commercial kit), phenolic compounds (Folin-Ciocalteu), H2O2 (micro-titration), and cations (flame photometry). (3) Biological analysis: autoinducers type 2 (AI-2) (Vibrio harveyi BB170 bioassay), DNAase activity (Agar DNAase), and Pseudomonas aeruginosa biofilm inhibition (crystal violet technique). According to its biological activity, the most significant molecules found by GCMS were the following: antimicrobials (mevalonolactone, 5-methyl-hydantoine, benzoic acid, etc.); surfactants (di-palmitin, distearin, and 1,5-monolinolein); anesthetics (barbituric acid derivatives), and AI-2 precursors (4,5-dihydroxy-2,3-pentanedione and 2-methyl-2,3,3,4-tetrahydroxytetrahydrofurane). Concentrations measured (µg/mL): DL-lactic acid (11.71 ± 1.53) and H2O2 (36 ± 2.0); phenolic compounds (485.2 ± 15.20); sodium (370 ± 17); potassium 920 ± 24); calcium (20 ± 4); and magnesium (15 ± 3). DNAase from LAPS had activity on genomic DNA from PMNs and P. aeruginosa. The molecules and biological activities found in LAPS could explain the observed effects in human chronic wounds.

  8. Anti-adherence potential of Enterococcus durans cells and its cell-free supernatant on plastic and stainless steel against foodborne pathogens.

    Science.gov (United States)

    Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun

    2015-07-01

    It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P < 0.05) inhibition potential of the pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.

  9. Gastric cancer cell supernatant causes apoptosis and fibrosis in the peritoneal tissues and results in an environment favorable to peritoneal metastases, in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Na Di

    2012-04-01

    Full Text Available Abstract Background In this study, we examined effects of soluble factors released by gastric cancer cells on peritoneal mesothelial cells in vitro and in vivo. Methods HMrSV5, a human peritoneal mesothelial cell line, was incubated with supernatants from gastric cancer cells. Morphological changes of HMrSV5 cells were observed. Apoptosis of HMrSV5 cells was observed under a transmission electron microscope and quantitatively determined by MTT assay and flow cytometry. Expressions of apoptosis-related proteins (caspase-3, caspase-8, Bax, bcl-2 were immunochemically evaluated. Results Conspicuous morphological changes indicating apoptosis were observed in HMrSV5 cells 24 h after treatment with the supernatants of gastric cancer cells. In vivo, peritoneal tissues treated with gastric cancer cell supernatant were substantially thickened and contained extensive fibrosis. Conclusions These findings demonstrate that supernatants of gastric cancer cells can induce apoptosis and fibrosis in HMrSV5 human peritoneal mesothelial cells through supernatants in the early peritoneal metastasis, in a time-dependent manner, and indicate that soluble factors in the peritoneal cavity affect the morphology and function of mesothelial cells so that the resulting environment can become favorable to peritoneal metastases.

  10. Culture supernatants from V. cholerae O1 ElTor strains isolated from different geographic areas induce cell vacuolation and cytotoxicity Cepas de V. cholerae O1 biotipo ElTor aisladas de diferente origen geográfico inducen vacuolización celular y citotoxicidad

    Directory of Open Access Journals (Sweden)

    Jorge E Vidal

    2009-02-01

    Full Text Available OBJECTIVE: To investigate whether the HlyA-induced vacuolating effect is produced by V. cholerae O1 ElTor strains isolated from different geographic origins, including Mexico. MATERIAL AND METHODS: Supernatant-induced haemolysis, vacuolating activity and cytotoxicity in Vero cells were recorded. PCR, RFLP analysis and molecular cloning were performed. RESULTS: All ElTor strains analyzed induced cellular vacuolation. Ribotype 2 strains isolates from the U.S. gulf coast yielded the highest titer of vacuolating activity. Eight of nine strains were haemolytic, while all strains were PCR positive for the hlyA gene. We cloned the hlyA gene from two ElTor strains, a toxigenic (2514-88, ctxAB+ and a non-toxigenic Mexican strain (CM 91-3, ctxAB-. Supernatant from those recombinant E. coli strains induced haemolysis, cell vacuolation and cytotoxicity. RFLP-PCR analysis revealed similarities in the hlyA gene from all strains tested. CONCLUSION: The HlyA-induced vacuolating effect is a widespread phenotype of epidemic V. cholerae O1 ElTor strains.OBJETIVO: Analizar el efecto vacuolizante de cepas de V. cholerae O1 ElTor aisladas de diferente origen geográfico, incluyendo México. MATERIAL Y MÉTODOS: Se realizaron pruebas de hemolisis, vacuolización y citotoxicidad en células Vero, así como PCR, análisis por RFLP y clonación molecular. RESULTADOS: Todas las cepas indujeron el efecto vacuolizante. Las cepas del ribotipo 2, aisladas de las costas del Golfo en Estados Unidos, presentaron títulos altos de vacuolización. El gen hlyA fue amplificado en las nueve cepas mediante PCR, aunque sólo ocho fueron hemolíticas. Se clonó el gen hlyA de una cepa toxigénica (2514-88, ctxAB+ y de una cepa no toxigénica aislada en México (CM 91-3, ctxAB-. El sobrenadante de las clonas recombinantes indujo hemólisis, efecto vacuolizante y citotoxicidad. El RFLP mostró alta similitud del gen hlyA de las cepas estudiadas. CONCLUSIÓN: El efecto vacuolizante es un

  11. Adult T-cell leukemia-associated antigen (ATLA): detection of a glycoprotein in cell- and virus-free supernatant.

    Science.gov (United States)

    Yamamoto, N; Schneider, J; Hinuma, Y; Hunsmann, G

    1982-01-01

    A glycoprotein of an apparent molecular mass of 46,000, gp 46, was enriched by affinity chromatography from the virus- and cell-free culture medium of adult T-cell leukemia virus (ATLV) infected cells. gp 46 was specifically precipitated with sera from patients with adult T-cell leukemia associated antigen (ATLA). Thus, gp 46 is a novel component of the ATLA antigen complex.

  12. Use of QuantiFERON®-TB Gold in-tube culture supernatants for measurement of antibody responses.

    Directory of Open Access Journals (Sweden)

    Simon G Kimuda

    Full Text Available QuantiFERON®-TB Gold in-tube (QFT-GIT supernatants may be important samples for use in assessment of anti-tuberculosis (TB antibodies when only limited volumes of blood can be collected and when a combination of antibody and cytokine measurements are required. These analytes, when used together, may also have the potential to differentiate active pulmonary TB (APTB from latent TB infection (LTBI. However, few studies have explored the use of QFT-GIT supernatants for investigations of antibody responses. This study determined the correlation and agreement between anti-CFP-10 and anti-ESAT-6 antibody concentrations in QFT-GIT nil supernatant and serum pairs from 68 TB household contacts. We also explored the ability of Mycobacterium tuberculosis (M.tb specific antibodies, or ratios of antibody to interferon gamma (IFN-γ in QFT-GIT supernatants, to differentiate 97 APTB cases from 58 individuals with LTBI. Sputum smear microscopy was used to define APTB, whereas the QFT-GIT and tuberculin skin test were used to define LTBI. There were strong and statistically significant correlations between anti-CFP-10 and anti-ESAT-6 antibodies in unstimulated QFT-GIT supernatants and sera (r = 0.89; p<0.0001 for both, and no significant differences in antibody concentration between them. Anti-CFP-10 & anti-ESAT-6 antibodies differentiated APTB from LTBI with sensitivities of 88.7% & 71.1% and specificities of 41.4% & 51.7% respectively. Anti-CFP-10 antibody/M.tb specific IFN-γ and anti-ESAT-6 antibody/M.tb specific IFN-γ ratios had sensitivities of 48.5% & 54.6% and specificities of 89.7% and 75.9% respectively. We conclude that QFT-GIT nil supernatants may be used in the place of sera when measuring antibody responses, reducing blood volumes needed for such investigations. Antibodies in QFT-GIT nil supernatants on their own discriminate APTB from LTBI with high sensitivity but have poor specificity, whereas the reverse is true when antibodies are used in

  13. Evaluation of Synergistic Interactions Between Cell-Free Supernatant of Lactobacillus Strains and Amikacin and Genetamicin Against Pseudomonas aeruginosa.

    Science.gov (United States)

    Aminnezhad, Sargol; Kermanshahi, Rouha Kasra; Ranjbar, Reza

    2015-04-01

    The indiscriminate use of antibiotics in the treatment of infectious diseases can increase the development of antibiotic resistance. Therefore, there is a big demand for new sources of antimicrobial agents and alternative treatments for reduction of antibiotic dosage required to decrease the associated side effects. In this study, the synergistic action of aminoglycoside antibiotics and cell-free supernatant (CFS) of probiotic (Lactobacillus rahmnosus and L. casei) against Pseudomonas aeruginosa PTCC 1430 was evaluated. A growth medium for culturing of probiotic bacteria was separated by centrifugation. The antimicrobial effects of CFS of probiotic bacteria were evaluated using the agar well diffusion assay. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were evaluated using the micro dilution method. Finally, an interaction between CFS and amikacin or gentamicin against P. aeruginosa PTCC 1430 was examined through the checkerboard method and fractional inhibitory concentration (FIC). Furthermore, CFSs from Lactobacillus strains were analyzed by reversed phase HPLC (RP-HPLC) for antimicrobial compounds. The results showed a significant effect of CFS on the growth of P. aeruginosa. The MIC and MBC of CFS from L. casei were 62.5 µL⁄mL while the MIC and MBC of CFS from L. rhamnosus were 62.5 μL⁄mL and 125 μL⁄mL, respectively. Using the FIC indices, synergistic interactions were observed in combination of CFS and antibiotics. Fractional Inhibitory Concentration indices of CFS from L. casei and aminoglycoside antibiotics were 0.124 and 0.312 while FIC indices of CFS from L. rhamnosus and aminoglycoside antibiotics were 0.124 and 0.56, respectively showing a synergism effect. The results of RP-HPLC showed that CFS of Lactobacillus strains contained acetic acid, lactic acid and hydrogen peroxide (H2O2). Our findings indicate that probiotic bacterial strains of Lactobacillus have a significant inhibitory effect on the

  14. Effect of bacterial components of mixed culture supernatants of planktonic and biofilm Pseudomonas aeruginosa with commensal Escherichia coli on the neutrophil response in vitro.

    Science.gov (United States)

    Maslennikova, Irina L; Kuznetsova, Marina V; Nekrasova, Irina V; Shirshev, Sergei V

    2017-11-30

    Pseudomonas aeruginosa (PA) responsible for acute and chronic infections often forms a well-organized bacterial population with different microbial species including commensal strains of Escherichia coli. Bacterial extracellular components of mixed culture can modulate the influence of bacteria on the neutrophil functions. The objective of this study was to compare the effect of pyocyanin, pyoverdine, LPS, exopolysaccharide of single species and mixed culture supernatants of PA strains and E. coli K12 on microbicidal, secretory activity of human neutrophils in vitro. Bacterial components of E. coli K12 in mixed supernatants with 'biofilm' PA strains (PA ATCC, PA BALG) enhanced short-term microbicidal mechanisms and inhibited neutrophil secretion delayed in time. The influence of 'planktonic' PA (PA 9-3) exometabolites in mixed culture is almost mimicked by E. coli K12 effect on functional neutrophil changes. This investigation may help to understand some of the mechanisms of neutrophil response to mixed infections of different PA with other bacteria species. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Supernatants from oral epithelial cells and gingival fibroblasts modulate human immunodeficiency virus type 1 promoter activation induced by periodontopathogens in monocytes/macrophages.

    Science.gov (United States)

    González, O A; Ebersole, J L; Huang, C B

    2010-04-01

    Bacterial and host cell products during coinfections of Human Immunodeficiency Virus type 1-positive (HIV-1(+)) patients regulate HIV-1 recrudescence in latently infected cells (e.g. T cells, monocytes/macrophages), impacting highly active antiretroviral therapy (HAART) failure and progression of acquired immunodeficiency syndrome. A high frequency of oral opportunistic infections (e.g. periodontitis) in HIV-1(+) patients has been demonstrated; however, their potential to impact HIV-1 exacerbation is unclear. We sought to determine the ability of supernatants derived from oral epithelial cells (OKF4) and human gingival fibroblasts (Gin-4) challenged with periodontal pathogens, to modulate the HIV-1 promoter activation in monocytes/macrophages. BF24 monocytes/macrophages transfected with the HIV-1 promoter driving the expression of chloramphenicol acetyltransferase (CAT) were stimulated with Porphyromonas gingivalis, Fusobacterium nucleatum, or Treponema denticola in the presence of supernatants from OKF4 or Gin4 cells either unstimulated or previously pulsed with bacteria. CAT levels were determined by enzyme-linked immunosorbent assay and cytokine production was evaluated by Luminex beadlyte assays. OKF4 and Gin4 supernatants enhanced HIV-1 promoter activation particularly related to F. nucleatum challenge. An additive effect was observed in HIV-1 promoter activation when monocytes/macrophages were simultaneously stimulated with gingival cell supernatants and bacterial extracts. OKF4 cells produced higher levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukins -6 and -8 in response to F. nucleatum and P. gingivalis. Preincubation of OKF4 supernatants with anti-GM-CSF reduced the additive effect in periodontopathogen-induced HIV-1 promoter activation. These results suggest that soluble mediators produced by gingival resident cells in response to periodontopathogens could contribute to HIV-1 promoter activation in monocytes

  16. Supernatant from bifidobacterium differentially modulates transduction signaling pathways for biological functions of human dendritic cells.

    Directory of Open Access Journals (Sweden)

    Cyrille Hoarau

    Full Text Available BACKGROUND: Probiotic bacteria have been shown to modulate immune responses and could have therapeutic effects in allergic and inflammatory disorders. However, the signaling pathways engaged by probiotics are poorly understood. We have previously reported that a fermentation product from Bifidobacterium breve C50 (BbC50sn could induce maturation, high IL-10 production and prolonged survival of DCs via a TLR2 pathway. We therefore studied the roles of mitogen-activated protein kinases (MAPK, glycogen synthase kinase-3 (GSK3 and phosphatidylinositol 3-kinase (PI3K pathways on biological functions of human monocyte-derived DCs treated with BbC50sn. METHODOLOGY/PRINCIPAL FINDINGS: DCs were differentiated from human monocytes with IL-4 and GM-CSF for 5 days and cultured with BbC50sn, lipopolysaccharide (LPS or Zymosan, with or without specific inhibitors of p38MAPK (SB203580, ERK (PD98059, PI3K (LY294002 and GSK3 (SB216763. We found that 1 the PI3K pathway was positively involved in the prolonged DC survival induced by BbC50sn, LPS and Zymosan in contrast to p38MAPK and GSK3 which negatively regulated DC survival; 2 p38MAPK and PI3K were positively involved in DC maturation, in contrast to ERK and GSK3 which negatively regulated DC maturation; 3 ERK and PI3K were positively involved in DC-IL-10 production, in contrast to GSK3 that was positively involved in DC-IL-12 production whereas p38MAPK was positively involved in both; 4 BbC50sn induced a PI3K/Akt phosphorylation similar to Zymosan and a p38MAPK phosphorylation similar to LPS. CONCLUSION/SIGNIFICANCE: We report for the first time that a fermentation product of a bifidobacteria can differentially activate MAPK, GSK3 and PI3K in order to modulate DC biological functions. These results give new insights on the fine-tuned balance between the maintenance of normal mucosal homeostasis to commensal and probiotic bacteria and the specific inflammatory immune responses to pathogen bacteria.

  17. Injection of embryo culture supernatant to the endometrial cavity does not affect outcomes in IVF/ICSI or oocyte donation cycles: a randomized clinical trial.

    Science.gov (United States)

    Prapas, Yannis; Petousis, Stamatios; Panagiotidis, Yannis; Gullo, Giuseppe; Kasapi, Lia; Papadeothodorou, Achilleas; Prapas, Nikos

    2012-06-01

    To evaluate whether intrauterine injection of embryo culture supernatant before embryo transfer has any impact on pregnancy and implantation rates. A total of 400 cycles, of which 200 IVF/ICSI and 200 oocyte donor (OD), were randomly assigned to have their uterine cavity injected (group I) or not (group II). Primary endpoints to be studied were pregnancy and implantation rates. Clinical pregnancy rate per transfer (47.87%, 90/188 versus 48.45%, 94/194) based on transvaginal scan findings at 7 weeks of gestation and implantation rate (25.6% versus 26.5%) were similar in the two groups. The day of embryo transfer, day 3 or day 5, did not affect the final outcome. Injection of embryo culture supernatant into the uterine cavity, 30 min before the embryo transfer on either day 3 or 5, neither improves nor adversely affects the pregnancy rate in IVF/ICSI or oocyte donation cycles. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  18. Evaluation of entomopathogenic nematodes and the supernatants of the in vitro culture medium of their mutualistic bacteria for the control of the root-knot nematodes Meloidogyne incognita and M. arenaria.

    Science.gov (United States)

    Kepenekci, Ilker; Hazir, Selcuk; Lewis, Edwin E

    2016-02-01

    The suppressive effects of various formulations of four entomopathogenic nematode (EPN) species and the supernatants of their mutualistic bacteria on the root-knot nematodes (RKNs) Meloidogyne incognita and M. arenaria in tomato roots were evaluated. The EPNs Steinernema carpocapsae, S. feltiae, S. glaseri and Heterorhabditis bacteriophora were applied as either live infective juveniles (IJs) or infected insect cadavers. Spent medium from culturing the bacterial symbionts Xenorhabdus bovienii and Photorhabdus luminescens kayaii with the cells removed was also applied without their nematode partners. The aqueous suspensions of IJs, infected cadaver applications of EPNs and especially treatments of X. bovienii supernatant suppressed the negative impact of RKNs on tomatoes. Specific responses to treatment were reduced RKN egg masses, increased plant height and increased fresh and dry weights compared with the control where only RKNs were applied. Among the treatments tested, the plant-dipping method of X. bovienii into bacterial culture fluid may be the most practical and effective method for M. incognita and M. arenaria control. © 2015 Society of Chemical Industry.

  19. Determining antioxidant activities of lactobacilli cell-free supernatants by cellular antioxidant assay: a comparison with traditional methods.

    Directory of Open Access Journals (Sweden)

    Jiali Xing

    Full Text Available Antioxidant activity of lactic acid bacteria is associated with multiple health-protective effects. Traditional indexes of chemical antioxidant activities poorly reflect the antioxidant effects of these bacteria in vivo. Cellular antioxidant activity (CAA assay was used in this study to determine the antioxidant activity of cell-free supernatants (CFSs of 10 Lactobacillus strains. The performance of the CAA assay was compared with that of four chemical antioxidant activity assays, namely, DPPH radical scavenging, hydroxyl radical scavenging (HRS, reducing power (RP, and inhibition of linoleic acid peroxidation (ILAP. Results of the CAA assay were associated with those of DPPH and ILAP assays, but not with those of RP and HRS assays. The inter- and intra-specific antioxidant activities of CFS were characterized by chemical and CAA assays. L. rhamnosus CCFM 1107 displayed a high antioxidative effect similar to positive control L. rhamnosus GG ATCC 53103 in all of the assays. The CAA assay is a potential method for the detection of antioxidant activities of lactobacilli CFSs.

  20. Rapid point-of-care testing for epidermal growth factor receptor gene mutations in patients with lung cancer using cell-free DNA from cytology specimen supernatants.

    Science.gov (United States)

    Asaka, Shiho; Yoshizawa, Akihiko; Saito, Kazusa; Kobayashi, Yukihiro; Yamamoto, Hiroshi; Negishi, Tatsuya; Nakata, Rie; Matsuda, Kazuyuki; Yamaguchi, Akemi; Honda, Takayuki

    2018-06-01

    Epidermal growth factor receptor (EGFR) mutations are associated with responses to EGFR tyrosine kinase inhibitors (EGFR-TKIs) in non-small-cell lung cancer (NSCLC). Our previous study revealed a rapid point-of-care system for detecting EGFR mutations. This system analyzes cell pellets from cytology specimens using droplet-polymerase chain reaction (d-PCR), and has a reaction time of 10 min. The present study aimed to validate the performance of the EGFR d-PCR assay using cell-free DNA (cfDNA) from supernatants obtained from cytology specimens. Assay results from cfDNA supernatant analyses were compared with those from cell pellets for 90 patients who were clinically diagnosed with, or suspected of having, lung cancer (80 bronchial lavage fluid samples, nine pleural effusion samples and one spinal fluid sample). EGFR mutations were identified in 12 and 15 cases using cfDNA supernatants and cell pellets, respectively. The concordance rates between cfDNA-supernatant and cell‑pellet assay results were 96.7% [kappa coefficient (K)=0.87], 98.9% (K=0.94), 98.9% (K=0.79) and 98.9% (K=0.79) for total EGFR mutations, L858R, E746_A750del and T790M, respectively. All 15 patients with EGFR mutation-positive results, as determined by EGFR d-PCR assay using cfDNA supernatants or cell pellets, also displayed positive results by conventional EGFR assays using tumor tissue or cytology specimens. Notably, EGFR mutations were even detected in five cfDNA supernatants for which the cytological diagnoses of the corresponding cell pellets were 'suspicious for malignancy', 'atypical' or 'negative for malignancy.' In conclusion, this rapid point-of-care system may be considered a promising novel screening method that may enable patients with NSCLC to receive EGFR-TKI therapy more rapidly, whilst also reserving cell pellets for additional morphological and molecular analyses.

  1. A novel approach to enhance biological nutrient removal using a culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (Rpf) in SBR process.

    Science.gov (United States)

    Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng

    2016-03-01

    A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.

  2. Screening for epitope specificity directly on culture supernatants in the early phase of monoclonal antibody production by an ELISA with biotin-labeled antigen.

    Science.gov (United States)

    Andersen, Ditte C; Jensen, Charlotte H; Gregersen, Annemette; Brandt, Jette; Kliem, Anette; Skjødt, Karsten; Koch, Claus; Teisner, Børge

    2004-01-01

    This report describes an assay for comparison of epitope specificity in groups of monoclonal antibodies against a given antigen. The only prerequisite is the biotin-labeled antigen. One of the monoclonal antibodies is captured onto a plastic surface via a rabbit anti-mouse Ig, and the other preincubated with biotinylated antigen. When the two antibodies react with the same epitope subsequent binding of the biotin-labeled antigen is abolished (inhibition). In the cases where no inhibition was observed, the two antibodies were considered to react with distinct, independent epitopes. The obvious advantages using this assay, are that it can be performed directly on culture supernatants in the early phase of monoclonal antibody production, and also works for antigens with repetitive epitopes. Moreover, the bonus effect, i.e., a signal in excess of the reference signal when sets of monoclonal antibodies with different epitope specificity are compared, gives a relative measure of affinity.

  3. Treatment of serum with supernatants from cultures of Candida albicans reduces its serum-dependent phagocytosis Tratamento de soro com sobrenadante de cultura de Candida albicans reduz a fagocitose soro-dependente

    Directory of Open Access Journals (Sweden)

    Aderbal Antonio dos Santos

    2002-01-01

    Full Text Available Candida albicans is a potent activator of the complement system, and heat labile opsonins produced by activation of C3 (C3b and iC3b enhance phagocytosis of C. albicans mediated by complement receptors. In this study we treated mouse serum with supernatants from cultures of a protease producer strain of C. albicans and evaluated the ability of this serum to enhance phagocytosis of C. albicans. Cell-free supernatants from cultures of C. albicans were concentrated 5 fold and added to mouse serum for 30 min at 37ºC, before using this serum for opsonization of glutaraldehyde-fixed yeast cells. We observed that normal mouse serum increased about 3 fold the phagocytosis of C. albicans by mice peritoneal macrophages, whereas supernatant-treated serum did not increase phagocytosis. This effect of supernatants on serum was prevented by addition of pepstatin (5 µg/ ml; an inhibitor of C. albicans acid proteases to the medium. Serum treated with supernatants from cultures of a protease-deficient mutant of C. albicans also increased about 3 fold phagocytosis of the yeast. These results suggest that a protease produced by C. albicans causes proteolysis of serum opsonins, thereby reducing the phagocytosis of the yeast.Candida albicans é um potente ativador do sistema complemento, e opsoninas lábeis ao calor produzidas por ativação de C3 (C3b e iC3b aumentam a fagocitose de C. albicans mediada por receptores de complemento. Neste estudo, tratamos o soro de camundongo com sobrenadante de culturas de uma cepa de C. albicans produtora de proteases e avaliamos a capacidade deste soro reduzir a fagocitose de C. albicans. Sobrenadantes livres de células obtidos de cultura de C. albicans foram concentrados 5 vezes e adicionados ao soro de camundongo por 30 minutos a 37ºC, antes deste soro ser usado para opsonização de C. albicans na forma de levedura e fixadas em glutaraldeido. Nós observamos que soro normal aumentou 3 vezes a fagocitose de C. albicans por

  4. A fast and simple dot-immunobinding assay for quantifiction of mouse immunoglobulins in hybridoma culture supernatants

    Czech Academy of Sciences Publication Activity Database

    Sulimenko, Tetyana; Dráber, Pavel

    2004-01-01

    Roč. 289, - (2004), s. 89-95 ISSN 0022-1759 R&D Projects: GA AV ČR IBS5052301; GA MŠk LN00A026; GA MŠk 1P04OE158 Keywords : dot-immunobinding assay * hybridoma culture superntatants * mouse immunoglobulins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.464, year: 2004

  5. Discovery of Novel Secreted Virulence Factors from Salmonella enterica Serovar Typhimurium by Proteomic Analysis of Culture Supernatants

    Energy Technology Data Exchange (ETDEWEB)

    Niemann, George; Brown, Roslyn N.; Gustin, Jean K.; Stufkens, Afke; Shaikh-Kidwai, Afshan S.; Li, Jie; McDermott, Jason E.; Brewer, Heather M.; Schepmoes, Athena A.; Smith, Richard D.; Adkins, Joshua N.; Heffron, Fred

    2011-01-01

    The intracellular pathogen Salmonella enterica serovar Typhimurium is a leading cause of acute gastroenteritis in the world. This pathogen has two type-III secretion systems (TTSS) necessary for virulence that are encoded in Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2) and are expressed during extracellular or intracellular infectious states, respectively, to deliver virulence factors (effectors) to the host cell cytoplasm. While many have been identified and at least partially characterized, the full repertoire of effectors has not been catalogued. In this mass spectrometry-based proteomics study, we identified effector proteins secreted under minimal acidic medium growth conditions that induced the SPI-2 TTSS and its effectors, and compared the secretome from the parent strain to the secretome from strains missing either essential (SsaK) or regulatory components (SsaL) of the SPI-2 secretion apparatus. We identified 75% of the known TTSS effector repertoire. Excluding translocon components, 95% of the known effectors were biased for identification in the ssaL mutant background, which demonstrated that SsaL regulates SPI-2 type III secretion. To confirm secretion to animal cells, we made translational fusions of several of the best candidates to the calmodulin-dependent adenylate cyclase of Bordetella pertussis and assayed cAMP levels of infected J774 macrophage-like cells. From these infected cells we identified six new TTSS effectors and two others that are secreted independent of TTSS. Our results substantiate reports of additional secretion systems encoded by Salmonella other than TTSS.

  6. Soluble suppressor supernatants elaborated by concanavalin A-activated human mononuclear cells. Characterization of a soluble suppressor of B cell immunoglobulin production

    International Nuclear Information System (INIS)

    Fleisher, T.A.; Greene, W.C.; Blaese, R.M.; Waldmann, T.A.

    1981-01-01

    Human peripheral blood mononuclear cells (PBMC) activated with the mitogenic lectin concanavalin A (Con A) elaborate a soluble immune suppressor supernatant (SISS) that contains at least 2 distinct suppressor factors. One of these, SISS-B, inhibits polyclonal B cell immunoglobulin production, whereas the other, SISS-T, suppresses T cell proliferation to both mitogens and antigens. The latter mediator is discussed in the companion paper. Characteristics of the human soluble suppressor of B cell immunoglobulin production (SISS-B) include: 1) inhibition by a noncytotoxic mechanism, 2) loss of activity in the presence of the monosaccharide L-rhamnose, 3) appearance within 8 to 16 hr after the addition of Con A, 4) elaboration by cells irradiated with 500 or 2000 rads, 5) production by highly purified T cells, 6) stability at pH 2.5 but instability at 56/sup o/C, and 7) m.w. of 60 to 80,000. These data indicate that after Con A activation, selected T cells not only become potent suppressor cells, but also generate a soluble saccharide-specific factor(s) that inhibits polyclonal immunoglobulin production by human B cells

  7. Antibody-based enzyme-linked lectin assay (ABELLA) for the sialylated recombinant human erythropoietin present in culture supernatant.

    Science.gov (United States)

    Kim, Hyoung Jin; Lee, Seung Jae; Kim, Hong-Jin

    2008-11-04

    The terminal sialic acid of human erythropoietin (hEPO) is essential for in vivo activity. The current resorcinol and HPLC methods for analyzing alpha2,3-linked sialic acid require more than a microgram of purified rhEPO, and purification takes a great deal of time and labor. In this study, we assessed the use of an antibody-based enzyme-linked lectin assay (ABELLA) for analyzing non-purified recombinant hEPO (rhEPO). The major problem of this method was the high background due to terminal sialylation of components of the assay (antibody and bovine serum albumin) other than rhEPO. To solve this problem, we used a monoclonal antibody (Mab 287) to capture the rhEPO, and oxidized the bovine serum albumin used for blocking with meta-periodate. The sialic acid content of non-purified rhEPO measured by ABELLA was similar to that obtained by the resorcinol method on purified rhEPO. ABELLA has advantages such as adaptability and need for minimal amounts of rhEPO (40 ng/ml). Our observations suggest that ABELLA should reduce the time and labor needed to improve culture conditions so as to increase protein sialylation, and also facilitate the study of sialylation mechanisms.

  8. Calcium carbonate mediates higher lignin peroxidase activity in the culture supernatant of Streptomyces Viridosporus T7A

    Directory of Open Access Journals (Sweden)

    J. M. B. MACEDO

    1999-06-01

    Full Text Available Lignin peroxidase (LiP production has been extensively studied due to the potential use of this enzyme in environmental pollution control. Important aspects of the production of the enzyme by S. viridosporus T7A which have been studied include the improvement of yield and enzyme stabilization. In experiments performed in agitated flasks containing culture media composed of yeast extract as the source of nitrogen, mineral salts and different carbon sources, the use of glucose resulted in the highest values for LiP activity (350 U/L, specific LiP activity (450 U/g and productivity (7 U/L/h. As the profile obtained with glucose-containing medium suggested enzyme instability, the effect of calcium carbonate was evaluated. The addition of CaCO3 in two different concentrations, 0.5% and 5.0%, resulted in higher values of maximum LiP activity, 600 and 900 U/L, respectively. The presence of this salt also anticipated enzyme activity peaks and allowed the detection of higher enzyme activities in the extracellular medium for longer periods of time. These results indicate a positive effect of calcium carbonate on LiP production, which is extremely relevant for industrial processes.

  9. Insect Cell Culture

    NARCIS (Netherlands)

    Oers, van M.M.; Lynn, D.E.

    2010-01-01

    Insect cell cultures are widely used in studies on insect cell physiology, developmental biology and microbial pathology. In particular, insect cell culture is an indispensable tool for the study of insect viruses. The first continuously growing insect cell cultures were established from

  10. Analysis of metal Bioleaching from thermal power plant fly ash by Aspergillus niger 34770 culture supernatant and reduction of phytotoxicity during the process.

    Science.gov (United States)

    Jadhav, Umesh U; Hocheng, Hong

    2015-01-01

    Aspergillus niger culture supernatant is used for bioleaching process. Before starting bioleaching process, fly ash was washed with distilled water. This removed 100 % sodium, 47 % (±0.45) boron, 38.07 % (±0.12) calcium, 29.89 % (±0.78) magnesium, and 11.8 % (±0.05) potassium. The pH was reduced from 10.5 to 8.5 after water washing. During bioleaching process, around 100 % metal removal was achieved in 4 h for all metals except chromium 93 % (±1.18), nickel 83 % (±0.32), arsenic 78 % (±0.52), and lead 70 % (±0.20). The process parameters including temperature, shaking speed, and solid/liquid ratio were optimized for bioleaching process. Experiments were conducted to evaluate effect of fly ash on growth of mung bean (Vigna radiata). At 20 g/100 ml fly ash concentration no germination of V. radiata seeds was observed. With an increasing concentration of untreated fly ash, a gradual decrease in root/shoot length was observed. After bioleaching process 78 % (±0.19) germination of V. radiata was observed with 20 g/100 ml fly ash. This study will help to develop an efficient process to remove the toxic metals from fly ash.

  11. Use of an adaptable cell culture kit for performing lymphocyte and monocyte cell cultures in microgravity

    Science.gov (United States)

    Hatton, J. P.; Lewis, M. L.; Roquefeuil, S. B.; Chaput, D.; Cazenave, J. P.; Schmitt, D. A.

    1998-01-01

    The results of experiments performed in recent years on board facilities such as the Space Shuttle/Spacelab have demonstrated that many cell systems, ranging from simple bacteria to mammalian cells, are sensitive to the microgravity environment, suggesting gravity affects fundamental cellular processes. However, performing well-controlled experiments aboard spacecraft offers unique challenges to the cell biologist. Although systems such as the European 'Biorack' provide generic experiment facilities including an incubator, on-board 1-g reference centrifuge, and contained area for manipulations, the experimenter must still establish a system for performing cell culture experiments that is compatible with the constraints of spaceflight. Two different cell culture kits developed by the French Space Agency, CNES, were recently used to perform a series of experiments during four flights of the 'Biorack' facility aboard the Space Shuttle. The first unit, Generic Cell Activation Kit 1 (GCAK-1), contains six separate culture units per cassette, each consisting of a culture chamber, activator chamber, filtration system (permitting separation of cells from supernatant in-flight), injection port, and supernatant collection chamber. The second unit (GCAK-2) also contains six separate culture units, including a culture, activator, and fixation chambers. Both hardware units permit relatively complex cell culture manipulations without extensive use of spacecraft resources (crew time, volume, mass, power), or the need for excessive safety measures. Possible operations include stimulation of cultures with activators, separation of cells from supernatant, fixation/lysis, manipulation of radiolabelled reagents, and medium exchange. Investigations performed aboard the Space Shuttle in six different experiments used Jurkat, purified T-cells or U937 cells, the results of which are reported separately. We report here the behaviour of Jurkat and U937 cells in the GCAK hardware in ground

  12. Growth Inhibition of Cronobacter sakazakii in Experimentally Contaminated Powdered Infant Formula by Kefir Supernatant.

    Science.gov (United States)

    Kim, Dong-Hyeon; Chon, Jung-Whan; Kang, Il-Byeong; Kim, Hyunsook; Kim, Hong-Seok; Song, Kwang-Young; Seo, Kun-Ho

    2015-09-01

    Kefir is a type of fermented milk containing lactic and acetic acid bacteria and yeast. In this study, we evaluated the antimicrobial activity of kefir supernatant against Cronobacter sakazakii in powdered infant formula (PIF). In a spot-on-lawn test, the growth of 20 C. sakazakii strains, including 10 clinical and 10 food isolates, was completely inhibited in the presence of kefir supernatant. Significant differences in the diameters of inhibition zones were observed upon treatment with kefir compared with the results for Lactobacillus kefiri and Candida kefyr culture supernatants or solutions of lactic and acetic acid and ethyl alcohol in the agar well diffusion test (P < 0.05). The addition of 100 μl of kefir supernatant to 1 ml of nutrient broth completely inhibited the growth of C. sakazakii, as evaluated by spectrophotometry. The antimicrobial activity of kefir supernatant in experimentally contaminated PIF was also tested; we found no viable C. sakazakii cells remaining in PIF rehydrated with 30% kefir supernatant solution for 1 h, demonstrating that the antimicrobial activity of kefir supernatant against C. sakazakii could be applied in real food samples.

  13. Fermentation supernatants of Lactobacillus delbrueckii inhibit growth of human colon cancer cells and induce apoptosis through a caspase 3-dependent pathway.

    Science.gov (United States)

    Wan, Ying; Xin, Yi; Zhang, Cuili; Wu, Dachang; Ding, Dapeng; Tang, Li; Owusu, Lawrence; Bai, Jing; Li, Weiling

    2014-05-01

    Probiotic bacteria are known to exert a wide range of beneficial effects on their animal hosts. Therefore, the present study explored the effect of the supernatants obtained from Lactobacillus delbrueckii fermentation (LBF) on colon cancer. The results indicated that the proliferation of LBF solution-treated colon cancer SW620 cells was arrested and accumulated in the G1 phase in a concentration-dependent manner. The LBF solution efficiently induced apoptosis through the intrinsic caspase 3-depedent pathway, with a corresponding decreased expression of Bcl-2. The activity of matrix metalloproteinase 9, which is associated with the invasion of colon cancer cells, was also decreased in the LBF-treated cells. In conclusion, the results demonstrate the antitumor effect of LBF in vitro and may contribute to the development of novel therapies for the treatment of colon cancer.

  14. Cell Culture Made Easy.

    Science.gov (United States)

    Dye, Frank J.

    1985-01-01

    Outlines steps to generate cell samples for observation and experimentation. The procedures (which use ordinary laboratory equipment) will establish a short-term primary culture of normal mammalian cells. Information on culture vessels and cell division and a list of questions to generate student interest and involvement in the topics are…

  15. Effect of different stress factors on IL-6 and leptin expression in HELA cell cultures

    International Nuclear Information System (INIS)

    Chu Zhenwei; Yang Tao; Wang Luhuan; Hao Xiuhua; Yan Guangtao

    2009-01-01

    Objective: To study the effect of three stress factors high glucose (HG), lipopolysaccharide (LPS) and hydrogen peroxide (H 2 O 2 ) on the expression of culture supernatant IL-6 (IL-6) and leptin contents of HELA cell line. Methods: HELA cell culture models of severe inflammatory response syndrome were prepared with cultures treated with 50 mmol/L glucose (HG), 4 μg/ ml LPS and 100 μmol/L H 2 O 2 respectively and supernatant contents of IL-6 and leptin were measured with RIA at 1h, 6h and 24h. Results: Generally speaking, the culture supernatant contents of IL-6 gradually increased and leptin contents gradually decreased with significant differences from those in cultures not treated with either stress factor at 6h and 12h (P<0.05). Conclusion: Leptin as a possible anti-inflammatory cytokine might plays an important protective role in severe inflammatory response. (authors)

  16. Aneuploidy assessed by DNA index influences the effect of iron status on plasma and/or supernatant cytokine levels and progression of cells through the cell cycle in a mouse model.

    Science.gov (United States)

    Kuvibidila, Solo; Porretta, Connie; Baliga, Surendra

    2014-02-01

    Aneuploidy, a condition associated with altered chromosome number, hence DNA index, is frequently seen in many diseases including cancers and affects immunity. Iron, an essential nutrient for humans, modulates the immune function and the proliferation of normal and cancer cells. To determine whether impaired immunity seen in iron-deficient subjects may be related to aneuploidy, we measured spleen cell DNA index, percent of cells in different phases of the cell cycle, plasma and/or supernatant IL-2, IL-10, IL-12, and interferon-gamma in control, pair-fed, iron-deficient, and iron-replete mice (N=20-22/group). The test and control diets differed only in iron content (0.09mmol/kg versus 0.9mmol/kg) and were fed for 68days. Mean levels of hemoglobin and liver iron stores of iron-deficient and iron-replete mice were 40-60% lower than those of control and pair-fed mice (P<0.05). Mean plasma levels of IL-10, interferon-gamma and percent of cells in S+G2/M phases were lower in mice with than in those without aneuploidy (P<0.05). Lowest plasma IL-12 and interferon-gamma concentrations were observed in iron-deficient mice with aneuploidy. Mean percents of cultures with aneuploidy and DNA indexes were higher in iron-deficient and iron-replete than in control and pair-fed mice likely due to delayed cell division (P<0.05). Aneuploidy decreased the concentration of IL-2 and interferon-gamma in baseline cultures while it increased that of interferon-gamma in anti-CD3 treated cultures. Aneuploidic indexes negatively correlated with cytokine levels, percents of cells in S+G2/M phases and indicators of iron status (P<0.05). Although chromosome cytogenetics was not performed, for the first time, we report that increased aneuploidy rate may modulate the immune function during iron-deficiency. Copyright © 2014. Published by Elsevier Ltd.

  17. DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

    International Nuclear Information System (INIS)

    Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

    1986-01-01

    A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

  18. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Ozcan

    2011-01-01

    in water instead of phosphate-buffered saline. Passively adsorbed IL-4 was observed to induce differentiation to dendritic cells, but analysis of cell culture supernatants revealed that leakage of IL-4 into solution could account for the differentiation observed. Covalent attachment resulted in bound IL-4...... at similar concentrations to the passive adsorption process, as measured by enzyme-linked immunosorbent assays, and the bound IL-4 did not leak into solution to any measurable extent during cell culture. However, covalently bound IL-4 was incapable of inducing monocyte differentiation. This may be caused...

  19. Mammalian Cell Culture Simplified.

    Science.gov (United States)

    Moss, Robert; Solomon, Sondra

    1991-01-01

    A tissue culture experiment that does not require elaborate equipment and that can be used to teach sterile technique, the principles of animal cell line maintenance, and the concept of cell growth curves is described. The differences between cancerous and normal cells can be highlighted. The procedure is included. (KR)

  20. Bacterial cell culture

    OpenAIRE

    sprotocols

    2014-01-01

    ### Materials 1. Glass culture tubes with metal caps and labels - Growth medium, from media room or customized - Glass pipette tubes - Parafilm ### Equipment 1. Vortexer - Fireboy or Bunsen burner - Motorized pipette - Micropipettes and sterile tips ### Procedure For a typical liquid culture, use 5 ml of appropriate medium. The amount in each tube does not have to be exact if you are just trying to culture cells for their precious DNA. 1. Streak an a...

  1. Assessment of real-time PCR method for detection of EGFR mutation using both supernatant and cell pellet of malignant pleural effusion samples from non-small-cell lung cancer patients.

    Science.gov (United States)

    Shin, Saeam; Kim, Juwon; Kim, Yoonjung; Cho, Sun-Mi; Lee, Kyung-A

    2017-10-26

    EGFR mutation is an emerging biomarker for treatment selection in non-small-cell lung cancer (NSCLC) patients. However, optimal mutation detection is hindered by complications associated with the biopsy procedure, tumor heterogeneity and limited sensitivity of test methodology. In this study, we evaluated the diagnostic utility of real-time PCR using malignant pleural effusion samples. A total of 77 pleural fluid samples from 77 NSCLC patients were tested using the cobas EGFR mutation test (Roche Molecular Systems). Pleural fluid was centrifuged, and separated cell pellets and supernatants were tested in parallel. Results were compared with Sanger sequencing and/or peptide nucleic acid (PNA)-mediated PCR clamping of matched tumor tissue or pleural fluid samples. All samples showed valid real-time PCR results in one or more DNA samples extracted from cell pellets and supernatants. Compared with other molecular methods, the sensitivity of real-time PCR method was 100%. Concordance rate of real-time PCR and Sanger sequencing plus PNA-mediated PCR clamping was 98.7%. We have confirmed that real-time PCR using pleural fluid had a high concordance rate compared to conventional methods, with no failed samples. Our data demonstrated that the parallel real-time PCR testing using supernatant and cell pellet could offer reliable and robust surrogate strategy when tissue is not available.

  2. Supernatant treatment system design through testing

    International Nuclear Information System (INIS)

    Ploetz, D.K.; Leonard, I.M.

    1988-12-01

    The main purpose of the Supernatant Treatment System (STS) is to remove more than 99.9 percent of the radioactive cesium (Cs-137) from the high-level waste stored in tank 8D-2. Cesium removal is accomplished in the STS by processing the supernatant (liquid) portion of the high-level waste through three or four ion exchange columns filled with zeolite. After treatment in the STS, the decontaminated supernatant is processed as low-level waste and finally encapsulated in cement for eventual disposal. The Cs-137 removed from the waste and absorbed onto zeolite ion exchange material is temporarily stored in tank 8D-1 until it can be encapsulated in glass and disposed of as high-level waste. This report discusses construction and testing of the STS. Design of the STS was started in 1982 in parallel with the selection of the ion exchange material. The construction of this system was accomplished in five phase in parallel with completion of design to allow for faster completion of the project. The existing high-level waste storage tanks -- 8D-1, 8D-2, and 8D-3 -- required major renovations to permit transfer of the high-level waste from tank 8D-2 to tank 8D-1, to house the components that comprise the STS in tank 8D-1, and to store decontaminated wastes in tank 8D-3. Testing in the STS started before construction was complete and was accomplished by first testing components individually. Then the system was retested using simulated supernatant. Integrated testing of the whole Integrated Radwaste Treatment System (IRTS), which includes the STS, Liquid Waste Treatment System (LWTS), Cement Solidification System (CSS), and the Drum Cell, was also performed using simulated supernatant. Finally, slightly radioactive condensate water from tank 8D-1 was processed. After successfully completing this testing, the STS started operations with radioactive supernatant on May 23, 1988. 21 refs., 33 figs., 21 tabs

  3. Liver Cell Culture Devices

    NARCIS (Netherlands)

    Andria, B.; Bracco, A.; Cirino, G.; Chamuleau, R. A. F. M.

    2010-01-01

    In the last 15 years many different liver cell culture devices, consisting of functional liver cells and artificial materials, have been developed. They have been devised for numerous different applications, such as temporary organ replacement (a bridge to liver transplantation or native liver

  4. Cell Culturing of Cytoskeleton

    Science.gov (United States)

    2004-01-01

    Biomedical research offers hope for a variety of medical problems, from diabetes to the replacement of damaged bone and tissues. Bioreactors, which are used to grow cells and tissue cultures, play a major role in such research and production efforts. Cell culturing, such as this bone cell culture, is an important part of biomedical research. The BioDyn payload includes a tissue engineering investigation. The commercial affiliate, Millenium Biologix, Inc., has been conducting bone implant experiments to better understand how synthetic bone can be used to treat bone-related illnesses and bone damaged in accidents. On STS-95, the BioDyn payload will include a bone cell culture aimed to help develop this commercial synthetic bone product. Millenium Biologix, Inc., is exploring the potential for making human bone implantable materials by seeding its proprietary artificial scaffold material with human bone cells. The product of this tissue engineering experiment using the Bioprocessing Modules (BPMs) on STS-95 is space-grown bone implants, which could have potential for dental implants, long bone grafts, and coating for orthopedic implants such as hip replacements.

  5. Oscillating Cell Culture Bioreactor

    Science.gov (United States)

    Freed, Lisa E.; Cheng, Mingyu; Moretti, Matteo G.

    2010-01-01

    To better exploit the principles of gas transport and mass transport during the processes of cell seeding of 3D scaffolds and in vitro culture of 3D tissue engineered constructs, the oscillatory cell culture bioreactor provides a flow of cell suspensions and culture media directly through a porous 3D scaffold (during cell seeding) and a 3D construct (during subsequent cultivation) within a highly gas-permeable closed-loop tube. This design is simple, modular, and flexible, and its component parts are easy to assemble and operate, and are inexpensive. Chamber volume can be very low, but can be easily scaled up. This innovation is well suited to work with different biological specimens, particularly with cells having high oxygen requirements and/or shear sensitivity, and different scaffold structures and dimensions. The closed-loop changer is highly gas permeable to allow efficient gas exchange during the cell seeding/culturing process. A porous scaffold, which may be seeded with cells, is fixed by means of a scaffold holder to the chamber wall with scaffold/construct orientation with respect to the chamber determined by the geometry of the scaffold holder. A fluid, with/without biological specimens, is added to the chamber such that all, or most, of the air is displaced (i.e., with or without an enclosed air bubble). Motion is applied to the chamber within a controlled environment (e.g., oscillatory motion within a humidified 37 C incubator). Movement of the chamber induces relative motion of the scaffold/construct with respect to the fluid. In case the fluid is a cell suspension, cells will come into contact with the scaffold and eventually adhere to it. Alternatively, cells can be seeded on scaffolds by gel entrapment prior to bioreactor cultivation. Subsequently, the oscillatory cell culture bioreactor will provide efficient gas exchange (i.e., of oxygen and carbon dioxide, as required for viability of metabolically active cells) and controlled levels of fluid

  6. Cervical Cancer Cell Supernatants Induce a Phenotypic Switch from U937-Derived Macrophage-Activated M1 State into M2-Like Suppressor Phenotype with Change in Toll-Like Receptor Profile

    Directory of Open Access Journals (Sweden)

    Karina Sánchez-Reyes

    2014-01-01

    Full Text Available Cervical cancer (CC is the second most common cancer among women worldwide. Infection with human papillomavirus (HPV is the main risk factor for developing CC. Macrophages are important immune effector cells; they can be differentiated into two phenotypes, identified as M1 (classically activated and M2 (alternatively activated. Macrophage polarization exerts profound effects on the Toll-like receptor (TLR profile. In this study, we evaluated whether the supernatant of human CC cells HeLa, SiHa, and C-33A induces a shift of M1 macrophage toward M2 macrophage in U937-derived macrophages. Results. The results showed that soluble factors secreted by CC cells induce a change in the immunophenotype of macrophages from macrophage M1 into macrophage M2. U937-derived macrophages M1 released proinflammatory cytokines and nitric oxide; however, when these cells were treated with the supernatant of CC cell lines, we observed a turnover of M1 toward M2. These cells increased CD163 and IL-10 expression. The expression of TLR-3, -7, and -9 is increased when the macrophages were treated with the supernatant of CC cells. Conclusions. Our result strongly suggests that CC cells may, through the secretion of soluble factors, induce a change of immunophenotype M1 into M2 macrophages.

  7. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Özcan

    2011-01-01

    Standard cell culture plastic was surface modified by passive adsorption or covalent attachment of interleukin (IL)-4 and investigated for its ability to induce differentiation of human monocytes into mature dendritic cells, a process dose-dependently regulated by IL-4. Covalent attachment of IL-4...... in water instead of phosphate-buffered saline. Passively adsorbed IL-4 was observed to induce differentiation to dendritic cells, but analysis of cell culture supernatants revealed that leakage of IL-4 into solution could account for the differentiation observed. Covalent attachment resulted in bound IL-4...... at similar concentrations to the passive adsorption process, as measured by enzyme-linked immunosorbent assays, and the bound IL-4 did not leak into solution to any measurable extent during cell culture. However, covalently bound IL-4 was incapable of inducing monocyte differentiation. This may be caused...

  8. Plant cell culture initiation

    NARCIS (Netherlands)

    Hall, R.D.

    2000-01-01

    The use of cultured plant cells in either organized or unorganized form has increased vey considerably in the last 10-15 yr. Many new technologies have been developed and applications in both fundamental and applied research have led to the development of some powerful tools for improving our

  9. Morphology of primary human venous endothelial cell cultures before and after culture medium exchange.

    Science.gov (United States)

    Krüger-Genge, A; Fuhrmann, R; Jung, F; Franke, R P

    2015-01-01

    The evaluation of the interaction of human, venous endothelial cells (HUVEC) with body foreign materials on the cellular level cannot be performed in vivo, but is investigated in vitro under standard culture conditions. To maintain the vitality, proliferation and morphology of HUVEC seeded on body foreign substrates over days, the cell culture medium is usually exchanged every second day. It is well known, that alterations in the microenvironment of cells bear the risk of influencing cell morphology and function. In the current study the influence of cell culture medium exchange on HUVEC cytoskeletal microfilament structure and function was investigated. HUVEC in the third passage were seeded on extracellular matrix (ECM) - which was secreted from bovine corneal endothelial cells on glass- until functional confluence was reached. The experiment started 11 days after HUVEC seeding with an exchange of the cell culture medium followed by a staining of the actin microfilaments with phalloidin-rhodamin 1.5 and 5 minutes after medium exchange. The microfilaments were documented by use of an Olympus microscope (IMT-2) equipped with a UV lamp and online connected to a TV chain (Sony XC 50 ST/monochrome) implying an OPTIMAS - Image analysis system. Prostacyclin was analysed in the cell culture supernatant. 1.5 min after culture medium exchange in the functionally confluent cultures a slight disturbance of the actin microfilament structure with a broadening of the marginal filament band, a partial disconnection of cell-cell contacts and the appearance of intercellular fenestrations were observed. 5 minutes after medium exchange a redevelopment of the slightly disturbed microfilament structure with a condensation and narrowing of the marginal filament band was seen. 12 h later a further consolidation of the microfilament structure occurred. In addition, a perturbation of the cultured HUVEC occurred after cell culture medium exchange. The prostacyclin concentration in the

  10. Epithelial Cell Cultures

    Directory of Open Access Journals (Sweden)

    Imran S. Chaudhry

    2011-01-01

    Full Text Available The biological effects of only a finite number of tobacco toxins have been studied. Here, we describe exposure of cultures of human bronchial epithelial cells to low concentrations of tobacco carcinogens: nickel sulphate, benzo(bfluoranthene, N-nitrosodiethylamine, and 4-(methylnitrosamino-1-(3-pyridyl-1-butanone (NNK. After a 24-hour exposure, EGFR was expressed in cell membrane and cytoplasm, BCL-2 was expressed only in the irregular nuclei of large atypical cells, MKI67 was expressed in nuclei with no staining in larger cells, cytoplasmic BIRC5 with stronger nuclear staining was seen in large atypical cells, and nuclear TP53 was strongly expressed in all cells. After only a 24-hour exposure, cells exhibited atypical nuclear and cytoplasmic features. After a 48-hour exposure, EGFR staining was localized to the nucleus, BCL-2 was slightly decreased in intensity, BIRC5 was localized to the cytoplasm, and TP53 staining was increased in small and large cells. BCL2L1 was expressed in both the cytoplasm and nuclei of cells at 24- and 48-hour exposures. We illustrate that short-termexposure of a bronchial epithelial cell line to smoking-equivalent concentrations of tobacco carcinogens alters the expression of key proliferation regulatory genes, EGFR, BCL-2, BCL2L1, BIRC5, TP53, and MKI67, similar to that reported in biopsy specimens of pulmonary epithelium described to be preneoplastic lesions.

  11. Perfusion based cell culture chips

    DEFF Research Database (Denmark)

    Heiskanen, Arto; Emnéus, Jenny; Dufva, Martin

    2010-01-01

    Performing cell culture in miniaturized perfusion chambers gives possibilities to experiment with cells under near in vivo like conditions. In contrast to traditional batch cultures, miniaturized perfusion systems provide precise control of medium composition, long term unattended cultures...... and tissue like structuring of the cultures. However, as this chapter illustrates, many issues remain to be identified regarding perfusion cell culture such as design, material choice and how to use these systems before they will be widespread amongst biomedical researchers....

  12. Microfluidic Cell Culture Device

    Science.gov (United States)

    Takayama, Shuichi (Inventor); Cabrera, Lourdes Marcella (Inventor); Heo, Yun Seok (Inventor); Smith, Gary Daniel (Inventor)

    2014-01-01

    Microfluidic devices for cell culturing and methods for using the same are disclosed. One device includes a substrate and membrane. The substrate includes a reservoir in fluid communication with a passage. A bio-compatible fluid may be added to the reservoir and passage. The reservoir is configured to receive and retain at least a portion of a cell mass. The membrane acts as a barrier to evaporation of the bio-compatible fluid from the passage. A cover fluid may be added to cover the bio-compatible fluid to prevent evaporation of the bio-compatible fluid.

  13. Development of an indirect ELISA to detect Corynebacterium pseudotuberculosis specific antibodies in sheep employing T1 strain culture supernatant as antigen

    Directory of Open Access Journals (Sweden)

    Miriam F. Rebouças

    2013-11-01

    Full Text Available Corynebacterium pseudotuberculosis is the etiologic agent of caseous lymphadenitis (CLA, a chronic disease that affects goats and sheep, characterized by granuloma formation in subcutaneous and internal lymph nodes. CLA causes significant economic losses to commercial goat herds. In this study, we aimed to test secreted antigens secreted from T1 strain bacteria grown in brain heart infusion (BHI broth in an indirect ELISA system to determine the presence of specific immunoglobulins against C. pseudotuberculosis. We analyzed the BHI antigen electrophoretic profile and the recognition pattern by infected sheep sera samples. The ELISA results were compared with multiplex PCR assay and IFN-gamma production. The ELISA was able to discriminate between negative and positive animals, with a sensitivity of 89% and a specificity of 99%, using microbiological isolation as gold standard. When this assay was compared with multiplex PCR and specific IFN-gamma quantification, six discrepant results were found among thirty-two samples. We concluded that the ELISA using antigens secreted from C. pseudotuberculosis T1 strain growth in BHI broth culture can be used for the serodiagnosis of CLA in sheep.

  14. Distinct galactofuranose antigens in the cell wall and culture supernatants as a means to differentiate Fusarium from AspergillusspeciesAnnegret

    DEFF Research Database (Denmark)

    Wiedemann, Annegret; Kakoschke, Tamara Katharina; Speth, Cornelia

    2016-01-01

    tDetection of carbohydrate antigens is an important means for diagnosis of invasive fungal infections. Fordiagnosis of systemic Aspergillus infections, galactomannan is commonly used, the core antigenic struc-ture of which consists of chains of several galactofuranose moieties. In this study, we ....... fumigatus and Fusar-ium hyphae in immunohistology. Moreover, since Fusarium releases the AB135-8 antigen, it appears tobe a promising target antigen for a serological detection of Fusarium infections....

  15. Detecting pM concentrations of prostaglandins in cell culture supernatants by capillary SCX-LC-MS/MS

    DEFF Research Database (Denmark)

    Dahl, Sandra Rinne; Kleiveland, Charlotte Ramstad; Kassem, Moustapha

    2008-01-01

    A highly sensitive, improved online strong cation exchange (SCX)--RP capillary liquid chromatographic (cLC) method with IT mass spectrometric (IT-MS/MS) detection for the simultaneous determination of prostaglandin (PG)A(1), PGD(2), PGE(1), PGE(2), PGF(2alpha), 8-iso-(8i)PGF(2alpha), 6-keto-(6k...

  16. Principles of cancer cell culture.

    Science.gov (United States)

    Cree, Ian A

    2011-01-01

    The basics of cell culture are now relatively common, though it was not always so. The pioneers of cell culture would envy our simple access to manufactured plastics, media and equipment for such studies. The prerequisites for cell culture are a well lit and suitably ventilated laboratory with a laminar flow hood (Class II), CO(2) incubator, benchtop centrifuge, microscope, plasticware (flasks and plates) and a supply of media with or without serum supplements. Not only can all of this be ordered easily over the internet, but large numbers of well-characterised cell lines are available from libraries maintained to a very high standard allowing the researcher to commence experiments rapidly and economically. Attention to safety and disposal is important, and maintenance of equipment remains essential. This chapter should enable researchers with little prior knowledge to set up a suitable laboratory to do basic cell culture, but there is still no substitute for experience within an existing well-run laboratory.

  17. Lactobacillus rhamnosus GG supernatant enhance neonatal resistance to systemic Escherichia coli K1 infection by accelerating development of intestinal defense

    OpenAIRE

    Xiaolong He; Qing Zeng; Santhosh Puthiyakunnon; Zhijie Zeng; Weijun Yang; Jiawen Qiu; Lei Du; Swapna Boddu; Tongwei Wu; Danxian Cai; Sheng-He Huang; Hong Cao

    2017-01-01

    The objective of this study was to determine whether Lactobacillus rhamnosus GG culture supernatant (LCS) has a preventive effect against gut-derived systemic neonatal Escherichia coli (E. coli) K1 infection. The preventive effects were evaluated in human colonic carcinoma cell line Caco-2 and neonatal rat models. Our in vitro results showed that LCS could block adhesion, invasion and translocation of E. coli K1 to Caco-2 monolayer via up-regulating mucin production and maintaining intestinal...

  18. Mutation in cultured mammalian cells

    International Nuclear Information System (INIS)

    Nakamura, N.; Okada, S.

    1982-01-01

    Mammalian cell cultures were exposed to gamma-rays at various dose rates. Dose-rate effects were observed in cultured somatic cells of the mouse for cell killing and mutations resistant to 6-thioguanine (TGsup(r)) and to methotrexate (MTXsup(r)). Linear quadratic model may be applied to cell killing and TGsup(r) mutations in some cases but can not explain the whole data. Results at low doses with far low dose-rate were not predictable from data at high doses with acute or chronic irradiation. Radioprotective effects of dimethyl sulfoxide were seen only after acute exposure but not after chronic one, suggesting that damages by indirect action of radiations may be potentially reparable by cells. TGsup(r) mutations seem to contain gross structural changes whereas MTXsup(r) ones may have smaller alterations. (Namekawa, K.)

  19. Cell culture compositions

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

    2014-03-18

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  20. Immunoglobulin production in human mixed lymphocyte cultures: implications for co-cultures of cells from patients and healthy donors

    International Nuclear Information System (INIS)

    Ruemke, H.C.; Terpstra, F.G.; Huis, B.; Out, T.A.; Zeijlemaker, W.P.

    1982-01-01

    When human peripheral blood lymphocytes (PBL) are cultured in the presence of irradiated allogeneic lymphocytes, the resulting mixed lymphocyte reaction (MLR) leads to the secretion into the supernatant of substantial amounts of IgM and IgG, derived from nonirradiated responder B lymphocytes. Our data indicate that stimulation to Ig production by responder B cells may result from different types of of interactions. First, B cells and monocytes among the irradiated stimulator cells activate T responder B cells to produce Ig; second, ''responder'' B cells activate irradiated ''stimulator'' T cells, leading to a ''helper'' signal, back to the responder B cells and leading to Ig production. The latter system is radiosensitive, because allogeneic T cells, irradiated at a dose of 4000 rad or more, failed to induce Ig production by responder B cells. In some combinations of human allogeneic lymphocytes, the co-culture of the cells leads to inhibition of Ig production, both in the presence and in the absence of PWM. Thus, co-culture of allogeneic cells may cause ''positive'' as well as ''negative'' allogeneic effects. The implications of these findings for the interpretation of co-cultures that are aimed at establishing defects in lymphocytes from patients with, for example, immunodeficiencies, who fail to produce Ig in the presence of PWM are discussed

  1. IL-10 release by bovine epithelial cells cultured with Trichomonas vaginalis and Tritrichomonas foetus

    Directory of Open Access Journals (Sweden)

    Ricardo Chaves Vilela

    2013-02-01

    Full Text Available Trichomonas vaginalis and Tritrichomonas foetus are parasitic protists of the human and bovine urogenital tracts, respectively. Several studies have described the cytotoxic effects of trichomonads on urogenital tract epithelial cells. However, little is known about the host cell response against trichomonads. The aim of this study was to determine whether T. foetus and T. vaginalis stimulated the release of the cytokine interleukin (IL-10 from cultured bovine epithelial cells. To characterise the inflammatory response induced by these parasites, primary cultures of bovine oviduct epithelial cells were exposed to either T. vaginalis or T. foetus. Within 12 h after parasite challenge, supernatants were collected and cytokine production was analysed. Large amounts of IL-10 were detected in the supernatants of cultures that had been stimulated with T. foetus. Interestingly, T. vaginalis induced only a small increase in the release of IL-10 upon exposure to the same bovine cells. Thus, the inflammatory response of the host cell is species-specific. Only T. foetus and not T. vaginalis induced the release of IL-10 by bovine oviduct epithelial cells.

  2. 9 CFR 101.6 - Cell cultures.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Cell cultures. 101.6 Section 101.6..., SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS DEFINITIONS § 101.6 Cell cultures. When used in conjunction with or in reference to cell cultures, which may be referred to as tissue cultures...

  3. Evaluation of the Antibody in Lymphocyte Supernatant Assay to Detect Active Tuberculosis.

    Directory of Open Access Journals (Sweden)

    Margaretha Sariko

    Full Text Available We aimed to evaluate the antibody in lymphocyte supernatant (ALS assay as a biomarker to diagnose tuberculosis among adults from Tanzania with and without HIV.Adults admitted with suspicion for tuberculosis had sputa obtained for GeneXpert MTB/RIF, acid-fast bacilli smear and mycobacterial culture; blood was obtained prior to treatment initiation and after 4 weeks. Adults hospitalized with non-infectious conditions served as controls. Peripheral blood mononuclear cells were cultured unstimulated for 72 hours. Anti-mycobacterial antibodies were measured from culture supernatants by ELISA, using BCG vaccine as the coating antigen. Median ALS responses were compared between cases and controls at baseline and between cases over time.Of 97 TB cases, 85 were microbiologically confirmed and 12 were clinically diagnosed. Median ALS responses from TB cases (0.366 OD from confirmed cases and 0.285 from clinical cases were higher compared to controls (0.085, p<0.001. ALS responses did not differ based on HIV status, CD4 count or sputum smear status. Over time, the median ALS values declined significantly (0.357 at baseline; 0.198 after 4-weeks, p<0.001.Robust ALS responses were mounted by patients with TB regardless of HIV status, CD4 count, or low sputum bacillary burden, potentially conferring a unique niche for this immunologic biomarker for TB.

  4. Youth Culture and Cell Phone

    Directory of Open Access Journals (Sweden)

    mohammad saeed zokaei

    2009-11-01

    Full Text Available Iranian youth’s leisure culture has been immediately affected by the digital media culture. As a communicative media, cell phone has crossed borders of youth norms and identity; and in addition to facilitating their communication, has changed its patterns. Applying Bourdieu’s concepts of habitus and field, and relied on the qualitative and quantitative data gathered from the mobile youth users, the present study argues that mobile has produced a new field in which youth’s opportunities for leisure, entertainment, communication, and independence have extended. In addition, cell phone has facilitated and compensated for some defects in public sphere, and therefore empowered youth agency, individuality, and power. Despite this strengthening, cell phone does not cross borders of gender and class differences, or the levels of social capital.

  5. Effects of external radiation in a co-culture model of endothelial cells and adipose-derived stem cells

    International Nuclear Information System (INIS)

    Haubner, Frank; Leyh, Michaela; Ohmann, Elisabeth; Pohl, Fabian; Prantl, Lukas; Gassner, Holger G

    2013-01-01

    The inflammatory response clinically observed after radiation has been described to correlate with elevated expression of cytokines and adhesion molecules by endothelial cells. Therapeutic compensation for this microvascular compromise could be an important approach in the treatment of irradiated wounds. Clinical reports describe the potential of adipose-derived stem cells to enhance wound healing, but the underlying cellular mechanisms remain largely unclear. Human dermal microvascular endothelial cells (HDMEC) and human adipose-derived stem cells (ASC) were cultured in a co-culture setting and irradiated with sequential doses of 2 to 12 Gy. Cell count was determined 48 h after radiation using a semi-automated cell counting system. Levels of interleukin-6 (IL-6), basic fibroblast growth factor (FGF), intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) were determined in the supernatants using enzyme-linked immunosorbent assay (ELISA). Irradiated HDMEC and ASC as well as non-irradiated co-cultures, HDMEC or ASC respectively were used as controls. Cell count was significantly reduced in irradiated co-cultures of HDMEC and ASC compared to non-irradiated controls. Levels of IL-6, FGF, ICAM-1 and VCAM-1 in the supernatants of the co-cultures were significantly less affected by external radiation in comparison to HDMEC. The increased expression of cytokines and adhesion molecules by HDMEC after external radiation is mitigated in the co-culture setting with ASC. These in vitro changes seem to support the clinical observation that ASC may have a stabilizing effect when injected into irradiated wounds

  6. Fluorescence Spectrum and Decay Measurement for Hsil VS Normal Cytology Differentiation in Liquid Pap Smear Supernatant

    Science.gov (United States)

    Vaitkuviene, A.; Gegzna, V.; Juodkazis, S.; Jursenas, S.; Miasojedovas, S.; Kurtinaitiene, R.; Rimiene, J.; Vaitkus, J.

    2009-06-01

    Cervical smear material contains endo and exocervical cells, mucus and inflammative, immune cells in cases of pathology. Just not destroyed keratinocytes lay on the glass for microscopy. Liquid cytology supernatant apart other diagnostics could be used for photodiagnostic. The spectroscopic parameters suitable for Normal and HSIL cytology groups supernatant differentiation are demonstrated. The dried liquid PAP supernatant fractions—sediment and liquid were investigated. Excitation and emission matrices (EEM), supernatant fluorescence decay measured under 280 nm diode short pulse excitation and fluorescence spectroscopy by excitation with 355 nm laser light were analyzed. The differences between Normal and HSIL groups were statistically proven in the certain spectral regions. Fluorescence decay peculiarities show spectral regions consisting of few fluorophores. Obtained results on fluorescence differences in Normal and HSIL groups' supernatant shows the potency of photodiagnosis application in cervical screening.

  7. Multistage carcinogenesis in cell culture.

    Science.gov (United States)

    Rubin, H

    2001-01-01

    Rodent fibroblasts explanted from embryos to culture undergo a period of declining growth rate in serial passages leading to crisis, followed by the appearance of variants which can multiply indefinitely. If the "immortal" cell line was established by low density passage, i.e., 3T3 cells, it has a low saturation density and is non-tumorigenic. If it was established by high density passage, it has a high saturation density and is tumorigenic. The establishment of cells goes through successive stages, including increased capacity to multiply in low serum concentration, growth to high saturation density, growth in suspension, assisted tumour formation in susceptible hosts and unassisted tumour formation. Chromosome aberrations and aneuploidy occur long before the capacity to produce tumours appears. Contrary to conventional belief, human fibroblast populations also undergo a continuous loss of capacity to multiply from the time of explantation, with only the longest surviving clone reaching the Hayflick limit. Neoplastic transformation of rodent cells is strongly favoured by maintaining them in a quiescent state at confluence for prolonged periods, which results in genetic damage to the cells. It also produces a large variety of chromosomal aberrations in human cells and extends their replicative lifespan. Individual clones are more susceptible to spontaneous transformation than their heterogeneous parental cultures. The implications of these results for tumour development in vivo are that oncogenic genetic changes may be common under stressful conditions which restrict replication, and that such changes are maximized when a rogue clone reaches a critical size that reduces stabilizing interactions with neighbouring clones. An alternative explanation, described in the Addendum, which we retrospectively favor is that the easily transformed clones are a minority in the uncloned parental population. The reason they transform before the parental population is that when

  8. Evaluation of Antigen-Specific IgM and IgG Production during an In Vitro Peripheral Blood Mononuclear Cell Culture Assay

    Directory of Open Access Journals (Sweden)

    Yoshiko Matsuda

    2017-07-01

    Full Text Available The recent attention given to diseases associated with memory B-cell (mBC-produced antibodies (Abs suggests the need for a similar in vitro assay to evaluate the functions of mBCs. Here, we cultured peripheral blood mononuclear cells (PBMCs with the intent to collect mBC-derived Abs in vitro and maintain their cell–cell contact-dependent interactions with helper T-cells. PBMCs were cultured with interleukin (IL-21, CpG-oligodeoxynucleotides (ODN, phorbol myristate acetate (PMA, and phytohemagglutinin/leucoagglutinin (PHA-L in 24-well flat-bottom plates (5 × 105 cells/well. A culture supernatant analysis of PBMCs from healthy donors (n = 10 indicated that antigen-specific IgM Ab levels in a PBMC culture supernatant might be better able to demonstrate the antigen sensitization status in a smaller peripheral blood sample, compared to IgG because Epstein–Barr virus-specific IgM mBCs circulate peripherally at a significantly higher frequency once antiviral humoral immunity has stabilized. Thus, our in vitro assay demonstrated the potential significance of antigen-specific IgM Ab production in the culture supernatants. Furthermore, an analysis of cultured PBMCs from allograft kidney recipients (n = 16 sensitized with de novo donor-specific human leukocyte antigen (HLA-specific Abs (DSAs showed that IgM-type HLA-specific Abs were detected mainly from the culture supernatants from PBMCs of patients with stable graft function, whereas IgG isotype HLA Abs were detectable only from patients with biopsy-proven antibody-mediated rejection. In other words, these IgG isotype Abs also represented an activated humoral immune response in vivo. Additionally, IgM- and IgG-expressing mBCs from healthy donors (n = 5 were cultured with IL-21, CpG-ODN, and a supernatant produced by stimulating CD19+ B-cell-depleted PBMCs with PHA-L and PMA in 24-well flat-bottom plates (1 × 105 cells/well, and the resulting in vitro analysis provided some

  9. Dynamized Preparations in Cell Culture

    Directory of Open Access Journals (Sweden)

    Ellanzhiyil Surendran Sunila

    2009-01-01

    Full Text Available Although reports on the efficacy of homeopathic medicines in animal models are limited, there are even fewer reports on the in vitro action of these dynamized preparations. We have evaluated the cytotoxic activity of 30C and 200C potencies of ten dynamized medicines against Dalton's Lymphoma Ascites, Ehrlich's Ascites Carcinoma, lung fibroblast (L929 and Chinese Hamster Ovary (CHO cell lines and compared activity with their mother tinctures during short-term and long-term cell culture. The effect of dynamized medicines to induce apoptosis was also evaluated and we studied how dynamized medicines affected genes expressed during apoptosis. Mother tinctures as well as some dynamized medicines showed significant cytotoxicity to cells during short and long-term incubation. Potentiated alcohol control did not produce any cytotoxicity at concentrations studied. The dynamized medicines were found to inhibit CHO cell colony formation and thymidine uptake in L929 cells and those of Thuja, Hydrastis and Carcinosinum were found to induce apoptosis in DLA cells. Moreover, dynamized Carcinosinum was found to induce the expression of p53 while dynamized Thuja produced characteristic laddering pattern in agarose gel electrophoresis of DNA. These results indicate that dynamized medicines possess cytotoxic as well as apoptosis-inducing properties.

  10. Monitoring Dynamic Interactions between Breast Cancer Cells and Human Bone Tissue in a Co-Culture Model

    Science.gov (United States)

    Contag, Christopher H.; Lie, Wen-Rong; Bammer, Marie C.; Hardy, Jonathan W.; Schmidt, Tobi L.; Maloney, William J.; King, Bonnie L.

    2015-01-01

    Purpose Bone is a preferential site of breast cancer metastasis and models are needed to study this process at the level of the microenvironment. We have used bioluminescence imaging (BLI) and multiplex biomarker immunoassays to monitor dynamic breast cancer cell behaviors in co-culture with human bone tissue. Procedures Femur tissue fragments harvested from hip replacement surgeries were co-cultured with luciferase-positive MDA-MB-231-fLuc cells. BLI was performed to quantify breast cell division and track migration relative to bone tissue. Breast cell colonization of bone tissues was assessed with immunohistochemistry. Biomarkers in co-culture supernatants were profiled with MILLIPLEX® immunoassays. Results BLI demonstrated increased MDA-MB-231-fLuc proliferation (pbones, and revealed breast cell migration toward bone. Immunohistochemistry illustrated MDA-MB-231-fLuc colonization of bone, and MILLIPLEX® profiles of culture supernatants suggested breast/bone crosstalk. Conclusions Breast cell behaviors that facilitate metastasis occur reproducibly in human bone tissue co-cultures and can be monitored and quantified using BLI and multiplex immunoassays. PMID:24008275

  11. In vitro culture and characterization of human umbilical cord blood-derived plasmacytoid dendritic cell subsets

    Directory of Open Access Journals (Sweden)

    PENG Jianping

    2015-11-01

    Full Text Available ObjectiveTo establish a method for in vitro culture of plasmacytoid dendritic cell (pDC. MethodsUmbilical cord blood (40 ml was collected from healthy parturients in the First Affiliated Hospital of Hunan University of Chinese Medicine, and cord blood mononuclear cell (CBMC were isolated. The CBMC were cultured for 7 days with RPMI 1640 complete medium containing rh Flt3-ligand (Flt3-L (100 ng/ml and rh interleukin (IL-3 (10 ng/ml, and the medium was half changed every 2 days. On the eighth day, CpG ODN (2 μg/ml was added to the cells, and the attached cells and supernatant were collected 24 h later for flow cytometry and interferon (IFNα measurement, respectively. On days 1, 3, 5, 7, and 8 of cell culture, the morphological changes of pDC were observed. Results After 2 h of culture, the CBMC showed circular, flat morphology. Twenty-four hours later, the cells began to adhere to the wall, with extended cytoplasm and increased volumes, and they became round and translucent, with scattered small colonies. On days 3-4 of culture, the cell volume continued increasing; most cells were round, and some had small protrusions; few cells were spindle-, tadpole-, star- or irregularly shaped; the number and volumes of colonies increased substantially. On days 5-8 of culture, the number of colonies and the number of cells in colonies gradually decreased, and suspended cells that were round or had small protrusions gradually increased in the medium. The cells expressing CD123, BDCA-2, and BDCA-4, which were considered pDC, were detected by flow cytometry. Flow cytometry revealed that the proportion of pDC in CBMC increased during the culture: increasing from 1.08% at the beginning of culture to 5.32% on day 4, and finally reaching a peak of 19.8% on day 8. On day 8, the level of IFNα in pDC culture supernatant was(11 302.61±1745.31 pg/ml. ConclusionpDC can be successfully induced in vitro by rh Flt3-L combined with IL-3 from human umbilical CBMC.

  12. DEVELOPMENT OF PRIMARY CELL CULTURE FROM TAIL EPIDERMAL TISSUE OF KOI CARP (Cyprinus carpio koi

    Directory of Open Access Journals (Sweden)

    Lila Gardenia

    2014-06-01

    Full Text Available Primary cell culture from tail epidermal tissue of koi carp (Cyprinus carpio koi was developed. Cells were grown in Leibovits-15 medium supplemented with 20% fetal bovine serum and antibiotics (Penicillin/Streptomycin and Kanamycin. Cell growth was observed in a range of incubation temperature (17oC±2oC, 22oC±2oC, 27oC±2oC, and 32oC±2oC in order to determine the optimum temperature. The cells were able to grow at a range of temperature between 17oC to 32oC with optimal growth at 22oC. Primary cells infected with koi herpes virus produced typical cytopathic effects characterized by severe vacuolation and deformation of nuclei, which is consistent with those of previous reports. Artificial injection experiment by using supernatant koi herpes virus SKBM-1 isolate revealed that it could cause 90% mortality in infected fish within two weeks. PCR test with Sph I-5 specific primers carried out with DNA template from supernatant virus, pellet cell, and gills of infected fish showed positive results in all samples (molecular weight of DNA target 290 bp. The cells were found to be susceptible to koi herpes virus and can be used for virus propagation.

  13. Microfluidic cell culture systems for drug research.

    Science.gov (United States)

    Wu, Min-Hsien; Huang, Song-Bin; Lee, Gwo-Bin

    2010-04-21

    In pharmaceutical research, an adequate cell-based assay scheme to efficiently screen and to validate potential drug candidates in the initial stage of drug discovery is crucial. In order to better predict the clinical response to drug compounds, a cell culture model that is faithful to in vivo behavior is required. With the recent advances in microfluidic technology, the utilization of a microfluidic-based cell culture has several advantages, making it a promising alternative to the conventional cell culture methods. This review starts with a comprehensive discussion on the general process for drug discovery and development, the role of cell culture in drug research, and the characteristics of the cell culture formats commonly used in current microfluidic-based, cell-culture practices. Due to the significant differences in several physical phenomena between microscale and macroscale devices, microfluidic technology provides unique functionality, which is not previously possible by using traditional techniques. In a subsequent section, the niches for using microfluidic-based cell culture systems for drug research are discussed. Moreover, some critical issues such as cell immobilization, medium pumping or gradient generation in microfluidic-based, cell-culture systems are also reviewed. Finally, some practical applications of microfluidic-based, cell-culture systems in drug research particularly those pertaining to drug toxicity testing and those with a high-throughput capability are highlighted.

  14. Cell Culture as an Alternative in Education.

    Science.gov (United States)

    Nardone, Roland M.

    1990-01-01

    Programs that are intended to inform and provide "hands-on" experience for students and to facilitate the introduction of cell culture-based laboratory exercises into the high school and college laboratory are examined. The components of the CellServ Program and the Cell Culture Toxicology Training Programs are described. (KR)

  15. Cell culture techniques in honey bee research

    Science.gov (United States)

    Cell culture techniques are indispensable in most if not all life science disciplines to date. Wherever cell culture models are lacking scientific development is hampered. Unfortunately this has been and still is the case in honey bee research because permanent honey bee cell lines have not yet been...

  16. Replication of cultured lung epithelial cells

    International Nuclear Information System (INIS)

    Guzowski, D.; Bienkowski, R.

    1986-01-01

    The authors have investigated the conditions necessary to support replication of lung type 2 epithelial cells in culture. Cells were isolated from mature fetal rabbit lungs (29d gestation) and cultured on feeder layers of mitotically inactivated 3T3 fibroblasts. The epithelial nature of the cells was demonstrated by indirect immunofluorescent staining for keratin and by polyacid dichrome stain. Ultrastructural examination during the first week showed that the cells contained myofilaments, microvilli and lamellar bodies (markers for type 2 cells). The following changes were observed after the first week: increase in cell size; loss of lamellar bodies and appearance of multivesicular bodies; increase in rough endoplasmic reticulum and golgi; increase in tonafilaments and well-defined junctions. General cell morphology was good for up to 10 wk. Cells cultured on plastic surface degenerated after 1 wk. Cell replication was assayed by autoradiography of cultures exposed to ( 3 H)-thymidine and by direct cell counts. The cells did not replicate during the first week; however, between 2-10 wk the cells incorporated the label and went through approximately 6 population doublings. They have demonstrated that lung alveolar epithelial cells can replicate in culture if they are maintained on an appropriate substrate. The coincidence of ability to replicate and loss of markers for differentiation may reflect the dichotomy between growth and differentiation commonly observed in developing systems

  17. 3D Cell Culture in Alginate Hydrogels

    Directory of Open Access Journals (Sweden)

    Therese Andersen

    2015-03-01

    Full Text Available This review compiles information regarding the use of alginate, and in particular alginate hydrogels, in culturing cells in 3D. Knowledge of alginate chemical structure and functionality are shown to be important parameters in design of alginate-based matrices for cell culture. Gel elasticity as well as hydrogel stability can be impacted by the type of alginate used, its concentration, the choice of gelation technique (ionic or covalent, and divalent cation chosen as the gel inducing ion. The use of peptide-coupled alginate can control cell–matrix interactions. Gelation of alginate with concomitant immobilization of cells can take various forms. Droplets or beads have been utilized since the 1980s for immobilizing cells. Newer matrices such as macroporous scaffolds are now entering the 3D cell culture product market. Finally, delayed gelling, injectable, alginate systems show utility in the translation of in vitro cell culture to in vivo tissue engineering applications. Alginate has a history and a future in 3D cell culture. Historically, cells were encapsulated in alginate droplets cross-linked with calcium for the development of artificial organs. Now, several commercial products based on alginate are being used as 3D cell culture systems that also demonstrate the possibility of replacing or regenerating tissue.

  18. A dense cell retention culture system using stirred ceramic membrane reactor.

    Science.gov (United States)

    Suzuki, T; Sato, T; Kominami, M

    1994-11-20

    A novel reactor design incorporating porous ceramic tubes into a stirred jar fermentor was developed. The stirred ceramic membrane reactor has two ceramic tubular membrane units inside the vessel and maintains high filtration flux by alternating use for filtering and recovering from clogging. Each filter unit was linked for both extraction of culture broth and gas sparging. High permeability was maintained for long periods by applying the periodical control between filtering and air sparging during the stirred retention culture of Saccharomyces cerevisiae. The ceramic filter aeration system increased the k(L)a to about five times that of ordinary gas sparing. Using the automatic feeding and filtering system, cell mass concentration reached 207 g/L in a short time, while it was 64 g/L in a fed-batch culture. More than 99% of the growing cells were retained in the fermentor by the filtering culture. Both yield and productivity of cells were also increased by controlling the feeding of fresh medium and filtering the supernatant of the dense cells culture. (c) 1994 John Wiley & Sons, Inc.

  19. Advances in cell culture: anchorage dependence

    Science.gov (United States)

    Merten, Otto-Wilhelm

    2015-01-01

    Anchorage-dependent cells are of great interest for various biotechnological applications. (i) They represent a formidable production means of viruses for vaccination purposes at very large scales (in 1000–6000 l reactors) using microcarriers, and in the last decade many more novel viral vaccines have been developed using this production technology. (ii) With the advent of stem cells and their use/potential use in clinics for cell therapy and regenerative medicine purposes, the development of novel culture devices and technologies for adherent cells has accelerated greatly with a view to the large-scale expansion of these cells. Presently, the really scalable systems—microcarrier/microcarrier-clump cultures using stirred-tank reactors—for the expansion of stem cells are still in their infancy. Only laboratory scale reactors of maximally 2.5 l working volume have been evaluated because thorough knowledge and basic understanding of critical issues with respect to cell expansion while retaining pluripotency and differentiation potential, and the impact of the culture environment on stem cell fate, etc., are still lacking and require further studies. This article gives an overview on critical issues common to all cell culture systems for adherent cells as well as specifics for different types of stem cells in view of small- and large-scale cell expansion and production processes. PMID:25533097

  20. Advances in 3D neuronal cell culture

    NARCIS (Netherlands)

    Frimat, Jean Philippe; Xie, Sijia; Bastiaens, Alex; Schurink, Bart; Wolbers, Floor; Den Toonder, Jaap; Luttge, Regina

    2015-01-01

    In this contribution, the authors present our advances in three-dimensional (3D) neuronal cell culture platform technology contributing to controlled environments for microtissue engineering and analysis of cellular physiological and pathological responses. First, a micromachined silicon sieving

  1. Culture of Mouse Neural Stem Cell Precursors

    OpenAIRE

    Currle, D. Spencer; Hu, Jia Sheng; Kolski-Andreaco, Aaron; Monuki, Edwin S.

    2007-01-01

    Primary neural stem cell cultures are useful for studying the mechanisms underlying central nervous system development. Stem cell research will increase our understanding of the nervous system and may allow us to develop treatments for currently incurable brain diseases and injuries. In addition, stem cells should be used for stem cell research aimed at the detailed study of mechanisms of neural differentiation and transdifferentiation and the genetic and environmental signals that direct the...

  2. Sponge cell culture? A molecular identification method for sponge cells

    NARCIS (Netherlands)

    Sipkema, D.; Heilig, G.H.J.; Akkermans, A.D.L.; Osinga, R.; Tramper, J.; Wijffels, R.H.

    2003-01-01

    Dissociated sponge cells are easily confused with unicellular organisms. This has been an obstacle in the development of sponge-cell lines. We developed a molecular detection method to identify cells of the sponge Dysidea avara in dissociated cell cultures. The 18S ribosomal RNA gene from a Dysidea

  3. [Effects of non-saccharomyces albicans metabolic products on the proliferation of human umbilical vein endothelial cell ECV304].

    Science.gov (United States)

    Chen, Bin; Che, Tuanjie; Bai, Decheng; He, Xiangyi

    2013-04-01

    To evaluate the effects of non-Saccharomyces albicans metabolic products on the cell cycle distribution and proliferation of human umbilical vein endothelial cell ECV304 cells in vitro. The parallel dilution supernatant of Saccharomyces tropicalis, Saccharomyces krusei and Saccharomyces glabrata were prepared, and 1, 4, 16-fold(s) diluted concentration and control group were set up. The line of human umbilical vein endothelial cell ECV304 was cultured in vitro and treated by non-Saccharomyces albicans supernatant. The proliferous effect of ECV304 induced by non-Saccharomyces albicans supernatant after 24, 48, 72 h was detected by the methods of MTT, and the changes of cell density and cycle after 48 h were investigated by inverted microscope and flow cytometry. At the 24th hour, all of the higher concentration (1-fold) of non-Saccharomyces albicans supernatant and the 4-folds diluted Saccharomyces krusei could promote ECV304 proliferation(P Saccharomyces albicans supernatant at 48h and 72th hour, Saccharomyces krusei supernatant and Saccharomyces glabrata supernatant significantly increased proliferation rate of ECV304, while Saccharomyces tropicalis supernatant group showed no significant change no matter which concentration was tested. At 48th hour after adding the non-Saccharomyces albicans supernatant, the ECV304 cells density treated by Saccharomyces krusei supernatant and Saccharomyces glabrata supernatant were significantly higher under the inverted microscope. The G0/G1 population of ECV304 cells decreased while cell proliferation index (PI) increased after incubated with Saccharomyces krusei supernatant and Saccharomyces glabrata supernatant for 48 hours (P Saccharomyces tropicalis group showed no significant change (P > 0.05). The metabolic products of Sacharoymces krusei and Saccharomyces glabrata could induce proliferation of ECV304 cell, which suggests non-Saccharomyces albicans should be undergone more attention clinically in detection and treatment.

  4. Treatment of supernatant from sewage sludge by elctron beam irradiation

    International Nuclear Information System (INIS)

    Arai, Hidehiko; Sugiyama, Masashi; Shimizu, Ken.

    1988-01-01

    Part of the results was presented on the investigation of treatment of supernatant from sewage sludge by combination of electron beam irradiation and microbiological treatment. Supernatant is electron-beam irradiated after microbiologically treated, and then treated microbiologically again. Based this method, by irradiation of 10 kGy, chemical oxygen demand (COD) in supernatant can be decreased lower than 30 ppm. Moreover, electron-beam irradiation induces remarkable decolorization and deodorization. (author)

  5. Melphalan metabolism in cultured cells

    International Nuclear Information System (INIS)

    Seagrave, J.C.; Valdez, J.G.; Tobey, R.A.; Gurley, L.R.

    1985-06-01

    Procedures are presented for the adaptation of reversed-phase-HPLC methods to accomplish separation and isolation of the cancer therapeutic drug melphalan (L-phenylalanine mustard) and its metabolic products from whole cells. Five major degradation products of melphalan were observed following its hydrolysis in phosphate buffer in vitro. The two most polar of these products (or modifications of them) were also found in the cytosol of Chinese hamster CHO cells. The amounts of these two polar products (shown not to be mono- or dihydroxymelphalan) were significantly changed by the pretreatment of cells with ZnC1 2 , one being increased in amount while the other was reduced to an insignificant level. In ZnC1 2 -treated cells, there was also an increased binding of melphalan (or its derivatives) to one protein fraction resolved by gel filtration-HPLC. These observations suggest that changes in polar melphalan products, and perhaps their interaction with a protein, may by involved in the reduction of melphalan cytotoxicity observed in ZnC1 2 -treated cells. While ZnC1 2 is also known to increase the level of glutathione in cells, no significant amounts of glutathione-melphalan derivatives of the type formed non-enzymatically in vitro could be detected in ZnC1 2 -treated or untreated cells. Formation of derivatives of melphalan with glutathione catabolic products in ZnC1 2 -treated cells has not yet been eliminated, however. 17 refs., 5 figs., 1 tab

  6. G protein-coupled receptor 120 (GPR120) transcription in intestinal epithelial cells is significantly affected by bacteria belonging to the Bacteroides, Proteobacteria, and Firmicutes phyla

    DEFF Research Database (Denmark)

    Fredborg, Marlene; Theil, Peter Kappel; Jensen, Bent Borg

    2012-01-01

    RNA abundance. Supernatants of the 12 bacteria were added to differentiated Caco-2 intestinal epithelial cells cultured on filter inserts in concentrations corresponding to a cell:bacteria ratio of 1:200. After 4 h of incubation, changes in cellular mRNA of GLP-1 and GPR120 by bacterial supernatant were...

  7. Phenotypic and Genetic Evaluation of the Influence of Pseudomonas aeruginosa Culture Fractions on the Human Mesenchymal Stem Cells Viability, Apoptotic Pathways and Cytokine Profile.

    Science.gov (United States)

    Holban, Alina Maria; Bleotu, Coralia; Chifiriuc, Mariana Carmen; Lazar, Veronica

    2017-01-01

    The objective of this study was to investigate the effects of P. aeruginosa PAO1 cellular and soluble culture fractions on human mesenchymal stem cells (MSCs) death signaling pathways and cytokine profile. The bone marrow isolated MSCs, incubated for different periods of time with one of the three P. aeruginosa PAO1 culture fractions, i.e. low density whole cultures, heat inactivated bacterial cultures sediments and sterile supernatants, were submitted to the following assays: i) fluorescence microscopy evaluation of cellular morphology and viability; ii) bax, caspase 9, relA and bcl-2 genes expression analysis by qRT-PCR; and iii) quantification of the level of IL-1β, IL-6, IL-8 and IL-10 cytokines released in the MSCs supernatants determined by ELISA. Results were statistically analyzed using the GraphPad In Stat software. The PAO1 whole cultures exhibited the most relevant influences, impacting on MSCs morphology and viability, interfering with apoptotic pathways and significantly stimulating the production of IL-1β and IL-10, while decreasing the production of IL-6 and IL-8. The culture supernatants increased the production of IL-1β and reduced the secretion of all other tested cytokines, while heat-inactivated bacterial cells significantly stimulated both IL-1β and IL-10 production. These data could suggest that in vivo, the fate of P. aeruginosa infection depends on the proportion between different bacterial culture fractions (i.e. the number of viable bacterial cells, the number of dead cells and the amount of bacterial soluble products accumulated locally) that could be influenced by the initial infective dose, by the host defense mechanisms, and also by the administered antimicrobial treatment that may thus interfere with the evolution and magnitude of the induced lesions. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. A novel cell growth-promoting factor identified in a B cell leukemia cell line, BALL-1

    International Nuclear Information System (INIS)

    Dao, T.; Holan, V.; Minowada, J.

    1993-01-01

    A novel leukemia cell growth-promoting activity has been identified in the culture supernatant from a human B cell leukemia cell line, BALL-1. The supernatant from unstimulated cultures of the BALL-1 cells significantly promoted the growth of 16 out of 24 leukemia/lymphoma cell lines of different lineages (T, B and non-lymphoid) in a minimal concentration of fetal bovine serum (FBS), and 5 out of 12 cases of fresh leukemia cells in FBS-free medium. The growth-promoting sieve filtration and dialysis. The MW of the factor was less than 10 kDa. The growth-promoting activity was heat and acid stable and resistant to trypsin treatment. The factor isolated from the BALL-1 supernatant was distinct from known polypeptide growth factors with MW below 10 kDa, such as epidermal growth factor, transforming growth factor α, insulin-like growth factor I (IGF-I), IGF-II and insulin, as determine by specific antibodies and by cell-growth-promoting tests. The factor is the BALL-1 supernatant did not promote the proliferation of normal human fresh peripheral blood lymphocytes or mouse fibroblast cell line, BALB/C 3T3. In addition to the BALL-1 supernatant, a similar growth-promoting activity was found in the culture supernatant from 13 of 17 leukemia/lymphoma cell lines tested. The activity in these culture supernatant promoted the growth of leukemia/lymphoma cell lines in autocrine and/or paracrine fashions. These observations suggest that the low MW cell growth-promoting activity found in the BALL-1 culture supernatant is mediated by a novel factor which may be responsible for the clonal expansion of particular leukemic clones. (author)

  9. Fast and simple online sample preparation coupled with capillary LC-MS/MS for determination of prostaglandins in cell culture supernatants

    DEFF Research Database (Denmark)

    Rinne, Sandra; Ramstad Kleiveland, Charlotte; Kassem, Moustapha

    2007-01-01

    An online 2-D strong cation exchange (SCX)-RP capillary liquid chromatographic (cLC) method with IT mass spectrometric (IT-MS/MS) detection for the simultaneous determination of prostaglandin (PG) A(1), PGD(2), PGE(1), PGE(2), PGF(2a), 6-keto-(6k)PGF(1a), and 15-Delta(12,14)-deoxy-PGJ(2) (15dPGJ(2...

  10. Flux analysis of mammalian cell culture

    NARCIS (Netherlands)

    Martens, D.E.; Tramper, J.

    2010-01-01

    Animal cells are used for the production of vaccines and pharmaceutical proteins. The increase in demand for these products requires an increase in volumetric productivity of animal cell culture processes, which can be attained through an increase in biomass concentration and/or specific

  11. Recovery of urinary nanovesicles from ultracentrifugation supernatants.

    Science.gov (United States)

    Musante, Luca; Saraswat, Mayank; Ravidà, Alessandra; Byrne, Barry; Holthofer, Harry

    2013-06-01

    Urinary vesicles represent a newly established source of biological material, widely considered to faithfully represent pathological events in the kidneys and the urogenital epithelium. The majority of currently applied isolation protocols involve cumbersome centrifugation steps to enrich vesicles from urine. To date, the efficiency of these approaches has not been investigated with respect to performing quantitative and qualitative analyses of vesicle populations in the pellet and supernatant (SN) fractions. After the series of differential centrifugations, the final SN was reduced to one-twentieth of the original volume by ammonium sulphate precipitation, with the precipitate pellet subjected to another round of differential centrifugations. Electron microscopy, dynamic light scattering and western blot analysis were used to characterize the vesicles present in individual fractions of interest. Pellets obtained after the second set of centrifugations at 200 000 g revealed the presence of vesicles which share a common marker profile, but with distinct differences from those seen in the initial 200 000 g pellet used as the reference. This suggests an enrichment of previously uncharacterized urinary vesicles still in solution after the initial centrifugation steps. Analysis of protein yields recovered post-ultracentrifugation revealed an additional 40% of vesicles retained from the SN. Moreover, these structures showed a formidable resistance to harsh treatments (e.g. 95% ammonium sulphate saturation, hypotonic dialysis, 0.3 M sodium hydroxide). Methods which employ differential centrifugations of native urine are remarkably ineffective and may lose a substantial population of biologically important vesicle species.

  12. Quantitative volumetric Raman imaging of three dimensional cell cultures

    KAUST Repository

    Kallepitis, Charalambos; Bergholt, Mads S.; Mazo, Manuel M.; Leonardo, Vincent; Skaalure, Stacey C.; Maynard, Stephanie A.; Stevens, Molly M.

    2017-01-01

    in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies

  13. Increasing cell culture population doublings for long-term growth of finite life span human cell cultures

    Science.gov (United States)

    Stampfer, Martha R; Garbe, James C

    2015-02-24

    Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.

  14. Substrate utilisation by plant-cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, M W

    1982-01-01

    Plant cell cultures have been grown on a wide range of carbon sources in addition to the traditional ones of sucrose and glucose. Biomass yields and growth rates vary greatly between the different carbon sources and there is a variation in response between different cell cultures to individual carbon sources. Some attempts have been made to grow cell cultures on 'waste' and related carbon sources, such as lactose, maltose, starch, molasses and milk whey. Only maltose was found to support growth to anything near the levels observed with glucose and sucrose. In the case of molasses carbon source cell growth was either non-existent or only just measurable. All the data point to glucose as being the most suitable carbon source, principally on the grounds of biomass yield and growth rate. It should be noted, however, that other carbon sources do appear to have a major (positive) influence on natural product synthesis. Uptake into the cell is an important aspect of carbohydrate utilisation. There is strong evidence that from disaccharides upwards, major degradation to smaller units occurs before uptake. In some cases the necessary enzymes appear to be excreted into the culture broth, in others they may be located within the cell wall; invertase that hydrolyses sucrose is a good example. Once the products of carbohydrate degradation and mobilisation enter the cell they may suffer one of two fates, oxidation or utilisation for biosynthesis. The precise split between these two varies depending on such factors as cell growth rate, cell size, nutrient broth composition and carbohydrate status of the cells. In general rapidly growing cells have a high rate of oxidation, whereas cells growing more slowly tend to be more directed towards biosynthesis. Carbohydrate utilisation is a key area of study, underpinning as it does both biomass yield and natural product synthesis. (Refs. 13).

  15. Cell culture experiments planned for the space bioreactor

    Science.gov (United States)

    Morrison, Dennis R.; Cross, John H.

    1987-01-01

    Culturing of cells in a pilot-scale bioreactor remains to be done in microgravity. An approach is presented based on several studies of cell culture systems. Previous and current cell culture research in microgravity which is specifically directed towards development of a space bioprocess is described. Cell culture experiments planned for a microgravity sciences mission are described in abstract form.

  16. Response to Dengue virus infections altered by cytokine-like substances from mosquito cell cultures

    Directory of Open Access Journals (Sweden)

    Laosutthipong Chaowanee

    2010-11-01

    Full Text Available Abstract Background With both shrimp and commercial insects such as honey bees, it is known that stable, persistent viral infections characterized by absence of disease can sometimes shift to overt disease states as a result of various stress triggers and that this can result in serious economic losses. The main research interest of our group is to understand the dynamics of stable viral infections in shrimp and how they can be destabilized by stress. Since there are no continuous cell lines for crustaceans, we have used a C6/36 mosquito cell line infected with Dengue virus to test hypotheses regarding these interactions. As a result, we accidentally discovered two new cytokine-like substances in 5 kDa extracts from supernatant solutions of acutely and persistently infected mosquito cells. Results Naïve C6/36 cells were exposed for 48 h to 5 kDa membrane filtrates prepared from the supernatant medium of stable C6/36 mosquito cell cultures persistently-infected with Dengue virus. Subsequent challenge of naïve cells with a virulent stock of Dengue virus 2 (DEN-2 and analysis by confocal immunofluorescence microscopy using anti-DEN-2 antibody revealed a dramatic reduction in the percentage of DEN-2 infected cells when compared to control cells. Similar filtrates prepared from C6/36 cells with acute DEN-2 infections were used to treat stable C6/36 mosquito cell cultures persistently-infected with Dengue virus. Confocal immunofluorescence microscopy revealed destabilization in the form of an apoptosis-like response. Proteinase K treatment removed the cell-altering activities indicating that they were caused by small polypeptides similar to those previously reported from insects. Conclusions This is the first report of cytokine-like substances that can alter the responses of mosquito cells to Dengue virus. This simple model system allows detailed molecular studies on insect cytokine production and on cytokine activity in a standard insect cell line.

  17. Stable lentiviral transformation of CHO cells for the expression of the hemagglutinin H5 of avian influenza virus in suspension culture

    Directory of Open Access Journals (Sweden)

    Alaín González Pose

    2014-09-01

    Full Text Available Avian influenza virus H5N1 has caused extensive damage worldwide among poultry and humans. Effective expression systems are needed for the production of viral proteins required for monitoring this devastating disease. The present study deals with the establishment of a stable expression system for the hemagglutinin H5 (HAH5 of avian influenza virus using CHO cells in suspension culture transduced with a recombinant lentiviral vector. The synthetic gene coding the HAH5 protein was inserted in a lentiviral vector with the aim of performing a stable transduction of CHO cells. After the selection of recombinant clones, the one with the highest expression level was adapted to suspension culture and the HAH5 protein was purified by immunoaffinity chromatography from the culture supernatant. There were no significant differences when this protein, purified or direct from the culture supernatant of CHO or SiHa cells, was utilized in an immunologic assay using positive and negative sera as reference. It was also demonstrated that the HAH5 protein in its purified form is able to bind anti-HAH5 antibodies generated with proper and non-proper folded proteins. The results demonstrate that the CHO cell line stably transduced with a lentiviral vector coding the sequence of the HAH5 protein and cultured in suspension can be a suitable expression system to obtain this protein for diagnostic purpose in a consistent and reliable manner.

  18. Use of a solid-phase 3H-radioimmunoassay for the measurement of immunoglobulin produced in short-term cultures of antibody-secreting cells

    International Nuclear Information System (INIS)

    Mongini, P.K.A.; Heber-Katz, E.

    1982-01-01

    A solid-phase radioimmunoassay (RIA) for assaying immunoglobulin produced from antibody-secreting myeloma, hybridoma and immune spleen cells is described. Specific antibody is detected by culturing antibody-producing cells on antigen-coated flexible polyvinylchloride microtiter wells, washing away the cells, and measuring the bound specific antibody with tritiated affinity-purified anti-isotype reagents. Antibody produced from 10 3 myeloma cells can be detected with as little as 4 h of incubation. With 24-48 h of incubation, antibody from as few as approximately 3-15 myeloma, hybridoma or immune spleen plaque-forming cells (PFC) can be detected. This culture-well RIA has certain distinct advantages over the hemolytic PFC assay and RIA assays in which antibody in culture supernatants is measured. (Auth.)

  19. Transfection in Primary Cultured Neuronal Cells.

    Science.gov (United States)

    Marwick, Katie F M; Hardingham, Giles E

    2017-01-01

    Transfection allows the introduction of foreign nucleic acid into eukaryotic cells. It is an important tool in understanding the roles of NMDARs in neurons. Here, we describe using lipofection-mediated transfection to introduce cDNA encoding NMDAR subunits into postmitotic rodent primary cortical neurons maintained in culture.

  20. Cell Culture Microfluidic Biochips: Experimental Throughput Maximization

    DEFF Research Database (Denmark)

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan

    2011-01-01

    Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory, integrating all necessary functionalities on-chip in order to perform biochemical applications. Researchers have started to propose computer-aided design tools for the synthesis of such biochips. Our focus...... metaheuristic for experimental design generation for the cell culture microfluidic biochips, and we have evaluated our approach using multiple experimental setups....

  1. Plant Cell Culture Initiation: practical tips

    NARCIS (Netherlands)

    Hall, R.D.

    2001-01-01

    The use of cultured plant cells in either organized or unorganized form has increased vey considerably in the last 10-15 yr. Many new technologies have been developed and applications in both fundamental and applied research have led to the development of some powerful tools for improving our

  2. Cell culture from sponges: pluripotency and immortality

    NARCIS (Netherlands)

    Caralt Bosch, de S.; Uriz, M.J.; Wijffels, R.H.

    2007-01-01

    Sponges are a source of compounds with potential pharmaceutical applications. In this article, methods of sponge cell culture for production of these bioactive compounds are reviewed, and new approaches for overcoming the problem of metabolite supply are examined. The use of embryos is proposed as a

  3. Nanotechnology, Cell Culture and Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Kazutoshi Haraguchi

    2011-01-01

    Full Text Available We have fabricated new types of polymer hydrogels and polymer nanocomposites, i.e., nanocomposite gels (NC gels and soft, polymer nanocomposites (M-NCs: solid, with novel organic/inorganic network structures. Both NC gels and M-NCs were synthesized by in-situ free-radical polymerization in the presence of exfoliated clay platelets in aqueous systems and were obtained in various forms such as film, sheet, tube, coating, etc. and sizes with a wide range of clay contents. Here, disk-like inorganic clay nanoparticles act as multi-functional crosslinkers to form new types of network systems. Both NC gels and M-NCs have extraordinary optical and mechanical properties including ultra-high reversible extensibility, as well as a number of new characteristics relating to optical anisotropy, polymer/clay morphology, biocompatibility, stimuli-sensitive surfaces, micro-patterning, etc. For examples, the biological testing of medical devices, comprised of a sensitization test, an irritation test, an intracutaneous test and an in vitro cytotoxicity test,was carried out for NC gels and M-NCs. The safety of NC gels and M-NCs was confirmed in all tests. Also, the interaction of living tissue with NC gel was investigated in vivo by implantation in live goats; neither inflammation nor concrescence occurred around the NC gels. Furthermore, it was found that both N-NC gels consisting of poly(N-isopropylacrylamide(PNIPA/clay network and M-NCs consisting of poly(2-methoxyethyacrylate(PMEA/clay network show characteristic cell culture and subsequent cell detachment on their surfaces, although it was almost impossible to culture cells on conventional, chemically-crosslinked PNIPA hydrogels and chemically crossslinked PMEA, regardless of their crosslinker concentration. Various kinds of cells, such ashumanhepatoma cells (HepG2, normal human dermal fibroblast (NHDF, and human umbilical vein endothelial cells (HUVEC, could be cultured to be confluent on the surfaces of N

  4. Cell Culture Assay for Human Noroviruses [response

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Honer Zu Bentrup, Kerstin; Orosz Coghlan, Patricia; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza A.; Nickerson, Cheryl A.

    2007-07-01

    We appreciate the comments provided by Leung et al., in response to our recently published article “In Vitro Cell Culture Infectivity Assay for Human Noroviruses” by Straub et al. (1). The specific aim of our project was to develop an in vitro cell culture infectivity assay for human noroviruses (hNoV) to enhance risk assessments when they are detected in water supplies. Reverse transcription (RT) qualitative or quantitative PCR are the primary assays for waterborne NoV monitoring. However, these assays cannot distinguish between infectious vs. non-infectious virions. When hNoV is detected in water supplies, information provided by our infectivity assay will significantly improve risk assessment models and protect human health, regardless of whether we are propagating NoV. Indeed, in vitro cell culture infectivity assays for the waterborne pathogen Cryptosporidium parvum that supplement approved fluorescent microscopy assays, do not result in amplification of the environmentally resistant hard-walled oocysts (2). However, identification of life cycle stages in cell culture provides evidence of infectious oocysts in a water supply. Nonetheless, Leung et al.’s assertion regarding the suitability of our method for the in vitro propagation of high titers of NoV is valid for the medical research community. In this case, well-characterized challenge pools of virus would be useful for developing and testing diagnostics, therapeutics, and vaccines. As further validation of our published findings, we have now optimized RT quantitative PCR to assess the level of viral production in cell culture, where we are indeed finding significant increases in viral titer. The magnitude and time course of these increases is dependent on both virus strain and multiplicity of infection. We are currently preparing a manuscript that will discuss these findings in greater detail, and the implications this may have for creating viral challenge pools

  5. The allogeneic umbilical cord mesenchymal stem cells regulate the function of T helper 17 cells from patients with rheumatoid arthritis in an in vitro co-culture system

    Directory of Open Access Journals (Sweden)

    Wang Qin

    2012-12-01

    Full Text Available Abstract Background Previous in vivo studies have shown that mesenchymal stem cell (MSC transplantation significantly improves the condition of a number of autoimmune diseases including autoimmune cerebrospinal meningitis, multiple sclerosis, glomerulonephritis and systemic lupus erythematosus. Methods To investigate the immunoregulatory effect of stem cell transplantation, human umbilical cord MSCs were co-cultured with peripheral blood mononuclear cells (PBMCs from patients with rheumatoid arthritis (RA. Orphan nuclear receptor gamma (ROR-γ mRNA and protein expression was detected with real-time PCR and Western blotting. Interleukin (IL-17, IL-6 and tumor necrosis factor (TNF-α in the cell culture supernatant were measured using a flow cytometric bead capture method. Results After 72 hours of co-culture, the mRNA and protein expression levels of ROR-γ in co-cultured PBMCs were decreased compared with that in PBMC of RA patients cultured alone (p  Conclusions In vitro co-culture with MSCs down-regulated the inflammatory response of PBMCs from RA patients with severe disease activity, but had no significant effect on PBMCs from healthy controls or patients with mild disease activity, suggesting that the immunoregulatory role of MSCs may associate with the occurrence of inflammatory mediators.

  6. A biocompatible micro cell culture chamber (mu CCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, Anders Michael

    2006-01-01

    culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...... on cell survival. Low grade light exposure was however compatible with optical recordings as well as cell viability. These results strongly indicate that a cell culture chip could be constructed that allowed for on-line optical recording of cellular events without affecting the cell culturing condition...

  7. A biocompatible micro cell culture chamber (microCCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, A M

    2006-01-01

    culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...... on cell survival. Low grade light exposure was however compatible with optical recordings as well as cell viability. These results strongly indicate that a cell culture chip could be constructed that allowed for on-line optical recording of cellular events without affecting the cell culturing condition...

  8. Lipoprotein receptors in cultured bovine endothelial cells

    International Nuclear Information System (INIS)

    Struempfer, A.E.M.

    1983-07-01

    In this study, receptors that may be involved in the uptake of low density lipoproteins (LDL) and low density lipoproteins which have been modified by acetylation (AcLDL), were characterized. Aortic epithelial cells were used and a cell culture system which closely resembled the in vivo monolayer was established. Endothelial cell and lipoprotein interactions were examined by incubating the cells with 125 l-labelled lipoproteins under various conditions. The receptor affinity of bovine aortic endothelial cells was higher for AcLDL than that for LDL. Competition studies demonstrated that there were two distinct receptors for LDL and AcLDL on the endothelial cells. AcLDL did not compete with LDL for the LDL receptor, and conversely LDL did not compete with AcLDL for the AcLDL receptor. The receptor activities for LDL and AcLDL were examined as a function of culture age. Whereas the LDL receptor could be regulated, the AcLDL receptor was not as susceptible to regulation. Upon exposing endothelial cells for 72 h to either LDL or AcLDL, it was found that the total amount of cellular cholesterol increased by about 50%. However, the increase of total cholesterol was largely in the form of free cholesterol. This is in contrast to macrophages, where the increase in total cholesterol upon exposure to AcLDL is largely in the form cholesteryl esters

  9. Dynamic cell culture system (7-IML-1)

    Science.gov (United States)

    Cogoli, Augusto

    1992-01-01

    This experiment is one of the Biorack experiments being flown on the International Microgravity Laboratory 1 (MIL-1) mission as part of an investigation studying cell proliferation and performance in space. One of the objectives of this investigation is to assess the potential benefits of bioprocessing in space with the ultimate goal of developing a bioreactor for continuous cell cultures in space. This experiment will test the operation of an automated culture chamber that was designed for use in a Bioreactor in space. The device to be tested is called the Dynamic Cell Culture System (DCCS). It is a simple device in which media are renewed or chemicals are injected automatically, by means of osmotic pumps. This experiment uses four Type I/O experiment containers. One DCCS unit, which contains a culture chamber with renewal of medium and a second chamber without a medium supply fits in each container. Two DCCS units are maintained under zero gravity conditions during the on-orbit period. The other two units are maintained under 1 gh conditions in a 1 g centrifuge. The schedule for incubator transfer is given.

  10. 21 CFR 864.2280 - Cultured animal and human cells.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cultured animal and human cells. 864.2280 Section... Cultured animal and human cells. (a) Identification. Cultured animal and human cells are in vitro cultivated cell lines from the tissue of humans or other animals which are used in various diagnostic...

  11. Mouse cell culture - Methods and protocols

    Directory of Open Access Journals (Sweden)

    CarloAlberto Redi

    2010-12-01

    Full Text Available The mouse is, out of any doubt, the experimental animal par excellence for many many colleagues within the scientific community, notably for those working in mammalian biology (in a broad sense, from basic genetic to modeling human diseases, starting at least from 1664 Robert Hooke experiments on air’s propertyn. Not surprising then that mouse cell cultures is a well established field of research itself and that there are several handbooks devoted to this discipline. Here, Andrew Ward and David Tosh provide a necessary update of the protocols currently needed. In fact, nearly half of the book is devoted to stem cells culture protocols, mainly embryonic, from a list of several organs (kidney, lung, oesophagus and intestine, pancreas and liver to mention some........

  12. Advantages and challenges of microfluidic cell culture in polydimethylsiloxane devices.

    Science.gov (United States)

    Halldorsson, Skarphedinn; Lucumi, Edinson; Gómez-Sjöberg, Rafael; Fleming, Ronan M T

    2015-01-15

    Culture of cells using various microfluidic devices is becoming more common within experimental cell biology. At the same time, a technological radiation of microfluidic cell culture device designs is currently in progress. Ultimately, the utility of microfluidic cell culture will be determined by its capacity to permit new insights into cellular function. Especially insights that would otherwise be difficult or impossible to obtain with macroscopic cell culture in traditional polystyrene dishes, flasks or well-plates. Many decades of heuristic optimization have gone into perfecting conventional cell culture devices and protocols. In comparison, even for the most commonly used microfluidic cell culture devices, such as those fabricated from polydimethylsiloxane (PDMS), collective understanding of the differences in cellular behavior between microfluidic and macroscopic culture is still developing. Moving in vitro culture from macroscopic culture to PDMS based devices can come with unforeseen challenges. Changes in device material, surface coating, cell number per unit surface area or per unit media volume may all affect the outcome of otherwise standard protocols. In this review, we outline some of the advantages and challenges that may accompany a transition from macroscopic to microfluidic cell culture. We focus on decisive factors that distinguish macroscopic from microfluidic cell culture to encourage a reconsideration of how macroscopic cell culture principles might apply to microfluidic cell culture. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Differentiation of mammalian skeletal muscle cells cultured on microcarrier beads in a rotating cell culture system

    Science.gov (United States)

    Torgan, C. E.; Burge, S. S.; Collinsworth, A. M.; Truskey, G. A.; Kraus, W. E.

    2000-01-01

    The growth and repair of adult skeletal muscle are due in part to activation of muscle precursor cells, commonly known as satellite cells or myoblasts. These cells are responsive to a variety of environmental cues, including mechanical stimuli. The overall goal of the research is to examine the role of mechanical signalling mechanisms in muscle growth and plasticity through utilisation of cell culture systems where other potential signalling pathways (i.e. chemical and electrical stimuli) are controlled. To explore the effects of decreased mechanical loading on muscle differentiation, mammalian myoblasts are cultured in a bioreactor (rotating cell culture system), a model that has been utilised to simulate microgravity. C2C12 murine myoblasts are cultured on microcarrier beads in a bioreactor and followed throughout differentiation as they form a network of multinucleated myotubes. In comparison with three-dimensional control cultures that consist of myoblasts cultured on microcarrier beads in teflon bags, myoblasts cultured in the bioreactor exhibit an attenuation in differentiation. This is demonstrated by reduced immunohistochemical staining for myogenin and alpha-actinin. Western analysis shows a decrease, in bioreactor cultures compared with control cultures, in levels of the contractile proteins myosin (47% decrease, p < 0.01) and tropomyosin (63% decrease, p < 0.01). Hydrodynamic measurements indicate that the decrease in differentiation may be due, at least in part, to fluid stresses acting on the myotubes. In addition, constraints on aggregate size imposed by the action of fluid forces in the bioreactor affect differentiation. These results may have implications for muscle growth and repair during spaceflight.

  14. In silico characterization of cell-cell interactions using a cellular automata model of cell culture.

    Science.gov (United States)

    Kihara, Takanori; Kashitani, Kosuke; Miyake, Jun

    2017-07-14

    Cell proliferation is a key characteristic of eukaryotic cells. During cell proliferation, cells interact with each other. In this study, we developed a cellular automata model to estimate cell-cell interactions using experimentally obtained images of cultured cells. We used four types of cells; HeLa cells, human osteosarcoma (HOS) cells, rat mesenchymal stem cells (MSCs), and rat smooth muscle A7r5 cells. These cells were cultured and stained daily. The obtained cell images were binarized and clipped into squares containing about 10 4 cells. These cells showed characteristic cell proliferation patterns. The growth curves of these cells were generated from the cell proliferation images and we determined the doubling time of these cells from the growth curves. We developed a simple cellular automata system with an easily accessible graphical user interface. This system has five variable parameters, namely, initial cell number, doubling time, motility, cell-cell adhesion, and cell-cell contact inhibition (of proliferation). Within these parameters, we obtained initial cell numbers and doubling times experimentally. We set the motility at a constant value because the effect of the parameter for our simulation was restricted. Therefore, we simulated cell proliferation behavior with cell-cell adhesion and cell-cell contact inhibition as variables. By comparing growth curves and proliferation cell images, we succeeded in determining the cell-cell interaction properties of each cell. Simulated HeLa and HOS cells exhibited low cell-cell adhesion and weak cell-cell contact inhibition. Simulated MSCs exhibited high cell-cell adhesion and positive cell-cell contact inhibition. Simulated A7r5 cells exhibited low cell-cell adhesion and strong cell-cell contact inhibition. These simulated results correlated with the experimental growth curves and proliferation images. Our simulation approach is an easy method for evaluating the cell-cell interaction properties of cells.

  15. Differentiation of human mesenchymal stromal cells cultured on collagen sponges for cartilage repair.

    Science.gov (United States)

    Sanjurjo-Rodríguez, Clara; Martínez-Sánchez, Adela Helvia; Hermida-Gómez, Tamara; Fuentes-Boquete, Isaac; Díaz-Prado, Silvia; Blanco, Francisco J

    2016-11-01

    The aim of this study was to evaluate proliferation and chondrogenic differentiation of human bone-marrow mesenchymal stromal cells (hBMSCs) cultured on collagen biomaterials. hBMSCs were seeded on five different collagen (Col) sponges: C1C2 (types I and II Col), C1C2HS (types I and II Col plus heparan sulphate (HS)), C1C2CHS (types I and II Col plus chondroitin sulphate (CHS)), C1-OLH3 (type I Col plus low molecular weight heparin) and C1CHS (type I Col plus CHS). The resulting constructs were analyzed by histological and immunohistochemical staining, molecular biology and electron microscopy. Col released into culture media was measured by a dye-binding method Results: hBMSCs on biomaterials C1C2, C1C2HS and C1C2CHS had more capacity to attach, proliferate and synthesize Col II and proteoglycans in the extracellular matrix (ECM) than on C1-OLH3 and C1CHS. The presence of aggrecan was detected only at the gene level. Total Col liberated by the cells in the supernatants in all scaffold cultures was detected. The level of Col I in the ECM was lower in C1-OLH3 and that of Col II was highest in C1C2 and C1C2HS. Electron microscopy showed differently shaped cells, from rounded to flattened, in all constructs. Col fibers in bundles were observed in C1C2CHS by transmission electron microscopy. The results show that Col I and Col II (C1C2, C1C2HS and C1C2CHS) biomaterials allowed cell proliferation and chondrogenic-like differentiation of hBMSCs at an early stage. Constructs cultured on C1C2HS and C1C2CHS showed better cartilage-like phenotype than the other ones.

  16. [Comparison of two types of cell cultures for preparation of sTNFRII-gAD fusion protein].

    Science.gov (United States)

    Huang, Shigao; Yin, Yuting; Xiong, Chunhui; Wang, Caihong; Lü, Jianxin; Gao, Jimin

    2013-01-01

    In this study we used two types of cell cultures, i.e., anchorage-dependent basket and full suspension batch cultures of sTNFRII-gAD-expressing CHO cells in the CelliGen 310 bioreactor (7.5 L) to compare their yields in order to optimize the culturing conditions for efficient expression of sTNFRII-gAD fusion protein consisting of soluble tumor necrosis factor receptor II and globular domain of adiponectin. The anchorage-dependent basket culture was performed in 4L 10% serum-containing medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 3 days, and then switched to 4 L serum-free LK021 medium to continue the culture for 4 days. The full suspension batch culture was carried out in the 4 L serum-free LK021 medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 7 days. The culturing conditions were monitored in real-time to maintain pH and dissolved oxygen stability through the whole process. The supernatants were collected by centrifuge, and the protein was concentrated through Pellicon flow ultrafiltration system and then purified by DEAE anion exchange. The results showed that the yields of sTNFRII-gAD fusion protein were 8.0 mg/L with 95% purity and 7.5 mg/L with 98% purity in the anchorage-dependent basket and the full suspension batch cultures, respectively. The study provided the framework for the pilot production of sTNFRII-gAD fusion protein.

  17. Soft sensor for monitoring biomass subpopulations in mammalian cell culture processes.

    Science.gov (United States)

    Kroll, Paul; Stelzer, Ines V; Herwig, Christoph

    2017-11-01

    Biomass subpopulations in mammalian cell culture processes cause impurities and influence productivity, which requires this critical process parameter to be monitored in real-time. For this reason, a novel soft sensor concept for estimating viable, dead and lysed cell concentration was developed, based on the robust and cheap in situ measurements of permittivity and turbidity in combination with a simple model. It could be shown that the turbidity measurements contain information about all investigated biomass subpopulations. The novelty of the developed soft sensor is the real-time estimation of lysed cell concentration, which is directly correlated to process-related impurities such as DNA and host cell protein in the supernatant. Based on data generated by two fed-batch processes the developed soft sensor is described and discussed. The presented soft sensor concept provides a tool for viable, dead and lysed cell concentration estimation in real-time with adequate accuracy and enables further applications with respect to process optimization and control.

  18. Rapid detection of bacterial contamination in cell or tissue cultures based on Raman spectroscopy

    Science.gov (United States)

    Bolwien, Carsten; Sulz, Gerd; Becker, Sebastian; Thielecke, Hagen; Mertsching, Heike; Koch, Steffen

    2008-02-01

    Monitoring the sterility of cell or tissue cultures is an essential task, particularly in the fields of regenerative medicine and tissue engineering when implanting cells into the human body. We present a system based on a commercially available microscope equipped with a microfluidic cell that prepares the particles found in the solution for analysis, a Raman-spectrometer attachment optimized for non-destructive, rapid recording of Raman spectra, and a data acquisition and analysis tool for identification of the particles. In contrast to conventional sterility testing in which samples are incubated over weeks, our system is able to analyze milliliters of supernatant or cell suspension within hours by filtering relevant particles and placing them on a Raman-friendly substrate in the microfluidic cell. Identification of critical particles via microscopic imaging and subsequent image analysis is carried out before micro-Raman analysis of those particles is then carried out with an excitation wavelength of 785 nm. The potential of this setup is demonstrated by results of artificial contamination of samples with a pool of bacteria, fungi, and spores: single-channel spectra of the critical particles are automatically baseline-corrected without using background data and classified via hierarchical cluster analysis, showing great promise for accurate and rapid detection and identification of contaminants.

  19. Bacterial Population in Intestines of Litopenaeus vannamei Fed Different Probiotics or Probiotic Supernatant.

    Science.gov (United States)

    Sha, Yujie; Liu, Mei; Wang, Baojie; Jiang, Keyong; Qi, Cancan; Wang, Lei

    2016-10-28

    The interactions of microbiota in the gut play an important role in promoting or maintaining the health of hosts. In this study, in order to investigate and compare the effects of dietary supplementation with Lactobacillus pentosus HC-2 (HC-2), Enterococcus faecium NRW-2, or the bacteria-free supernatant of a HC-2 culture on the bacterial composition of Litopenaeus vannamei , Illumina sequencing of the V1-V2 region of the 16S rRNA gene was used. The results showed that unique species exclusively existed in specific dietary groups, and the abundance of Actinobacteria was significantly increased in the intestinal bacterial community of shrimp fed with the bacteria-free supernatant of an HC-2 culture compared with the control. In addition, the histology of intestines of the shrimp from the four dietary groups was also described, but no obvious improvements in the intestinal histology were observed. The findings in this work will help to promote the understanding of the roles of intestinal bacteria in shrimps when fed with probiotics or probiotic supernatant.

  20. How do culture media influence in vitro perivascular cell behavior?

    Science.gov (United States)

    Huber, Birgit; Volz, Ann-Cathrin; Kluger, Petra Juliane

    2015-12-01

    Perivascular cells are multilineage cells located around the vessel wall and important for wall stabilization. In this study, we evaluated a stem cell media and a perivascular cell-specific media for the culture of primary perivascular cells regarding their cell morphology, doubling time, stem cell properties, and expression of cell type-specific markers. When the two cell culture media were compared to each other, perivascular cells cultured in the stem cell medium had a more elongated morphology and a faster doubling rate and cells cultured in the pericyte medium had a more typical morphology, with several filopodia, and a slower doubling rate. To evaluate stem cell properties, perivascular cells, CD146(-) cells, and mesenchymal stem cells (MSCs) were differentiated into the adipogenic, osteogenic, and chondrogenic lineages. It was seen that perivascular cells, as well as CD146(-) cells and MSCs, cultured in stem cell medium showed greater differentiation than cells cultured in pericyte-specific medium. The expression of pericyte-specific markers CD146, neural/glial antigen 2 (NG2), platelet-derived growth factor receptor-β (PDGFR-β), myosin, and α-smooth muscle actin (α-SMA) could be found in both pericyte cultures, as well as to varying amounts in CD146(-) cells, MSCs, and endothelial cells. The here presented work shows that perivascular cells can adapt to their in vitro environment and cell culture conditions influence cell functionality, such as doubling rate or differentiation behavior. Pericyte-specific markers were shown to be expressed also from cells other than perivascular cells. We can further conclude that CD146(+) perivascular cells are inhomogeneous cell population probably containing stem cell subpopulations, which are located perivascular around capillaries. © 2015 International Federation for Cell Biology.

  1. Reversible gelling culture media for in-vitro cell culture in three-dimensional matrices

    Science.gov (United States)

    An, Yuehuei H.; Mironov, Vladimir A.; Gutowska, Anna

    2000-01-01

    A gelling cell culture medium useful for forming a three dimensional matrix for cell culture in vitro is prepared by copolymerizing an acrylamide derivative with a hydrophilic comonomer to form a reversible (preferably thermally reversible) gelling linear random copolymer in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum gelling molecular weight cutoff, mixing the copolymer with an aqueous solvent to form a reversible gelling solution and adding a cell culture medium to the gelling solution to form the gelling cell culture medium. Cells such as chondrocytes or hepatocytes are added to the culture medium to form a seeded culture medium, and temperature of the medium is raised to gel the seeded culture medium and form a three dimensional matrix containing the cells. After propagating the cells in the matrix, the cells may be recovered by lowering the temperature to dissolve the matrix and centrifuging.

  2. Traditional and Modern Cell Culture in Virus Diagnosis.

    Science.gov (United States)

    Hematian, Ali; Sadeghifard, Nourkhoda; Mohebi, Reza; Taherikalani, Morovat; Nasrolahi, Abbas; Amraei, Mansour; Ghafourian, Sobhan

    2016-04-01

    Cell cultures are developed from tissue samples and then disaggregated by mechanical, chemical, and enzymatic methods to extract cells suitable for isolation of viruses. With the recent advances in technology, cell culture is considered a gold standard for virus isolation. This paper reviews the evolution of cell culture methods and demonstrates why cell culture is a preferred method for identification of viruses. In addition, the advantages and disadvantages of both traditional and modern cell culture methods for diagnosis of each type of virus are discussed. Detection of viruses by the novel cell culture methods is considered more accurate and sensitive. However, there is a need to include some more accurate methods such as molecular methods in cell culture for precise identification of viruses.

  3. Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge

    Energy Technology Data Exchange (ETDEWEB)

    Pestana, Carlos J.; Reeve, Petra J.; Sawade, Emma [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); Voldoire, Camille F. [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); École Européenne de Chimie, Polymères et Matériaux (ECPM), Strasbourg 67087 (France); Newton, Kelly; Praptiwi, Radisti [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); Collingnon, Lea [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); École Européenne de Chimie, Polymères et Matériaux (ECPM), Strasbourg 67087 (France); Dreyfus, Jennifer [Allwater, Adelaide Services Alliance, Wakefield St, Adelaide, SA 5001 (Australia); Hobson, Peter [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); Gaget, Virginie [University of Adelaide, Ecology and Environmental Sciences, School of Biological Sciences, Adelaide, SA 5005 (Australia); Newcombe, Gayle, E-mail: gayle.newcombe@sawater.com.au [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia)

    2016-09-15

    In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10 days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. - Highlights: • Cyanobacteria in water treatment sludge significantly impact supernatant quality • Cyanobacteria can survive, and thrive, in sludge lagoon supernatant and in treatment sludge • Metabolite concentrations in cyanobacteria in sludge can increase up to 500% • The risk associated with supernatant recycling was assessed relative to available treatment barriers.

  4. Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge

    International Nuclear Information System (INIS)

    Pestana, Carlos J.; Reeve, Petra J.; Sawade, Emma; Voldoire, Camille F.; Newton, Kelly; Praptiwi, Radisti; Collingnon, Lea; Dreyfus, Jennifer; Hobson, Peter; Gaget, Virginie; Newcombe, Gayle

    2016-01-01

    In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10 days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. - Highlights: • Cyanobacteria in water treatment sludge significantly impact supernatant quality • Cyanobacteria can survive, and thrive, in sludge lagoon supernatant and in treatment sludge • Metabolite concentrations in cyanobacteria in sludge can increase up to 500% • The risk associated with supernatant recycling was assessed relative to available treatment barriers

  5. PHYTOCHEMICAL STUDY OF CELL CULTURE JATROPHA CURCAS

    Directory of Open Access Journals (Sweden)

    KOMAR RUSLAN

    2011-01-01

    Full Text Available Jatropha curcas belongs to the Euphorbiaceae family which has potential economically. This plant has been reported to contain toxic compounds such as curcin and phorbol ester and its derivatives. These compounds may become a problem if J. curcas will be explored as a source of biofuel. In order to provide safety plants, the research on the study of phytochemical and initiation of cell and organ culture have been carried out. J curcas which has been collected from different regions in Indonesia showed to contain relatively the same profile of chemical contents. Dominant compounds that were detected by GCMS are hidrocarbon such as 2-heptenal, decadienal, hexsadecane, pentadecane, cyclooctane etc, fatty acid such as oktadecanoate acid, etthyl linoleate, ethyl stearate, heksadecanoate acid and steroid such as stigmasterol, fucosterol, sitosterol. No phorbol ester and its derivatives have been detected yet by the GCMS method. Callus and suspension cultures of J. curcas have been established to be used for further investigation.

  6. TR146 cells grown on filters as a model of human buccal epithelium

    DEFF Research Database (Denmark)

    Mørck Nielsen, H; Rømer Rassing, M; Nielsen, Hanne Mørck

    2000-01-01

    cell culture model, and human and porcine buccal epithelium were compared. The esterase activity in the intact cell culture model and in the porcine buccal mucosa was compared. Further, the TR146 cell culture model was used to study the permeability rate and metabolism of leu-enkephalin. The activity...... of the three enzymes in the TR146 homogenate supernatants was in the same range as the activity in homogenate supernatants of human buccal epithelium. In the TR146 cell culture model, the activity of aminopeptidase (13.70+/-2.10 nmol/min per mg protein) was approx. four times the activity of carboxypeptidase...

  7. Good cell culture practices &in vitro toxicology.

    Science.gov (United States)

    Eskes, Chantra; Boström, Ann-Charlotte; Bowe, Gerhard; Coecke, Sandra; Hartung, Thomas; Hendriks, Giel; Pamies, David; Piton, Alain; Rovida, Costanza

    2017-12-01

    Good Cell Culture Practices (GCCP) is of high relevance to in vitro toxicology. The European Society of Toxicology In Vitro (ESTIV), the Center for Alternatives for Animal Testing (CAAT) and the In Vitro Toxicology Industrial Platform (IVTIP) joined forces to address by means of an ESTIV 2016 pre-congress session the different aspects and applications of GCCP. The covered aspects comprised the current status of the OECD guidance document on Good In Vitro Method Practices, the importance of quality assurance for new technological advances in in vitro toxicology including stem cells, and the optimized implementation of Good Manufacturing Practices and Good Laboratory Practices for regulatory testing purposes. General discussions raised the duality related to the difficulties in implementing GCCP in an academic innovative research framework on one hand, and on the other hand, the need for such GCCP principles in order to ensure reproducibility and robustness of in vitro test methods for toxicity testing. Indeed, if good cell culture principles are critical to take into consideration for all uses of in vitro test methods for toxicity testing, the level of application of such principles may depend on the stage of development of the test method as well as on the applications of the test methods, i.e., academic innovative research vs. regulatory standardized test method. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Enhanced infectivity of bluetongue virus in cell culture by centrifugation.

    OpenAIRE

    Sundin, D R; Mecham, J O

    1989-01-01

    The effects of centrifugation of the infection of cell culture with bluetongue virus (BTV) were investigated. Baby hamster kidney cells were infected with BTV with or without centrifugation. Viral antigen was detected by immunofluorescence at 24 h in both centrifuged and noncentrifuged cultures. However, after 24 h of infection, the production of PFU in centrifuged cell cultures was 10- to 20-fold greater than that seen in cultures not centrifuged. In addition, centrifugation enhanced the dir...

  9. The Importance of Caveolin-1 as Key-Regulator of Three-Dimensional Growth in Thyroid Cancer Cells Cultured under Real and Simulated Microgravity Conditions

    Directory of Open Access Journals (Sweden)

    Stefan Riwaldt

    2015-11-01

    Full Text Available We recently demonstrated that the CAV1 gene was down-regulated, when poorly differentiated thyroid FTC-133 cancer cells formed spheroids under simulated microgravity conditions. Here, we present evidence that the caveolin-1 protein is involved in the inhibition of spheroid formation, when confluent monolayers are exposed to microgravity. The evidence is based on proteins detected in cells and their supernatants of the recent spaceflight experiment: “NanoRacks-CellBox-Thyroid Cancer”. The culture supernatant had been collected in a special container adjacent to the flight hardware incubation chamber and stored at low temperature until it was analyzed by Multi-Analyte Profiling (MAP technology, while the cells remaining in the incubation chamber were fixed by RNAlater and examined by mass spectrometry. The soluble proteins identified by MAP were investigated in regard to their mutual interactions and their influence on proteins, which were associated with the cells secreting the soluble proteins and had been identified in a preceding study. A Pathway Studio v.11 analysis of the soluble and cell-associated proteins together with protein kinase C alpha (PRKCA suggests that caveolin-1 is involved, when plasminogen enriched in the extracellular space is not activated and the vascular cellular adhesion molecule (VCAM-1 mediated cell–cell adhesion is simultaneously strengthened and activated PRKCA is recruited in caveolae, while the thyroid cancer cells do not form spheroids.

  10. Cardiac Cells Beating in Culture: A Laboratory Exercise

    Science.gov (United States)

    Weaver, Debora

    2007-01-01

    This article describes how to establish a primary tissue culture, where cells are taken directly from an organ of a living animal. Cardiac cells are taken from chick embryos and transferred to culture dishes. These cells are not transformed and therefore have a limited life span. However, the unique characteristics of cardiac cells are maintained…

  11. Ethanol extracts of black pepper or turmeric down-regulated SIRT1 protein expression in Daudi culture cells.

    Science.gov (United States)

    Nishimura, Yuri; Kitagishi, Yasuko; Yoshida, Hitomi; Okumura, Naoko; Matsuda, Satoru

    2011-01-01

    SIRT1 is a mammalian candidate molecule involved in longevity and diverse metabolic processes. The present study aimed to determine the effects of certain herbs and spices on SIRT1 expression. Human cell lines Daudi, Jurkat, U937 and K562 were cultured in RPMI-1640. Herb and spice powders were prepared and the supernatants were collected. RT-PCR was used to quantify the expression level of the gene. Protein samples were then analyzed by Western blotting. Western blotting revealed the down-regulation of SIRT1 protein expression in Daudi cells treated with extracts of black pepper or turmeric. On the other hand, the effect on the SIRT1 gene expression examined by reverse transcription polymerase chain reaction was unaltered. In conclusion, component(s) of certain herbs and spices may induce the down-regulation of SIRT1 protein.

  12. DNA MUTAGENESIS IN PANAX GINSENG CELL CULTURES

    Directory of Open Access Journals (Sweden)

    Kiselev K.V.

    2012-08-01

    Full Text Available At the present time, it is well documented that plant tissue culture induces a number of mutations and chromosome rearrangements termed “somaclonal variations”. However, little is known about the nature and the molecular mechanisms of the tissue culture-induced mutagenesis and the effects of long-term subculturing on the rate and specific features of the mutagenesis. The aim of the present study was to investigate and compare DNA mutagenesis in different genes of Panax ginseng callus cultures of different age. It has previously been shown that the nucleotide sequences of the Agrobacterium rhizogenes rolC locus and the selective marker nptII developed mutations during long-term cultivation of transgenic cell cultures of P. ginseng. In the present work, we analyzed nucleotide sequences of selected plant gene families in a 2-year-old and 20-year-old P. ginseng 1c cell culture and in leaves of cultivated P. ginseng plants. We analysed sequence variability between the Actin genes, which are a family of house-keeping genes; the phenylalanine ammonia-lyase (PAL and dammarenediol synthase (DDS genes, which actively participate in the biosynthesis of ginsenosides; and the somatic embryogenesis receptor kinase (SERK genes, which control plant development. The frequency of point mutations in the Actin, PAL, DDS, and SERK genes in the 2-year-old callus culture was markedly higher than that in cultivated plants but lower than that in the 20-year-old callus culture of P. ginseng. Most of the mutations in the 2- and 20-year-old P. ginseng calli were A↔G and T↔C transitions. The number of nonsynonymous mutations was higher in the 2- and 20-year-old callus cultures than the number of nonsynonymous mutations in the cultivated plants of P. ginseng. Interestingly, the total number of N→G or N→C substitutions in the analyzed genes was 1.6 times higher than the total number of N→A or N→T substitutions. Using methylation-sensitive DNA fragmentation

  13. Turbulent Dynamics of Epithelial Cell Cultures

    Science.gov (United States)

    Blanch-Mercader, C.; Yashunsky, V.; Garcia, S.; Duclos, G.; Giomi, L.; Silberzan, P.

    2018-05-01

    We investigate the large length and long time scales collective flows and structural rearrangements within in vitro human bronchial epithelial cell (HBEC) cultures. Activity-driven collective flows result in ensembles of vortices randomly positioned in space. By analyzing a large population of vortices, we show that their area follows an exponential law with a constant mean value and their rotational frequency is size independent, both being characteristic features of the chaotic dynamics of active nematic suspensions. Indeed, we find that HBECs self-organize in nematic domains of several cell lengths. Nematic defects are found at the interface between domains with a total number that remains constant due to the dynamical balance of nucleation and annihilation events. The mean velocity fields in the vicinity of defects are well described by a hydrodynamic theory of extensile active nematics.

  14. Recombinant Protein Production and Insect Cell Culture and Process

    Science.gov (United States)

    Spaulding, Glenn F. (Inventor); Goodwin, Thomas J. (Inventor); OConnor, Kim C. (Inventor); Francis, Karen M. (Inventor); Andrews, Angela D. (Inventor); Prewett, Tracey L. (Inventor)

    1997-01-01

    A process has been developed for recombinant production of selected polypeptides using transformed insect cells cultured in a horizontally rotating culture vessel modulated to create low shear conditions. A metabolically transformed insect cell line is produced using the culture procedure regardless of genetic transformation. The recombinant polypeptide can be produced by an alternative process using virtually infected or stably transformed insect cells containing a gene encoding the described polypeptide. The insect cells can also be a host for viral production.

  15. Differential marker expression by cultures rich in mesenchymal stem cells

    Science.gov (United States)

    2013-01-01

    Background Mesenchymal stem cells have properties that make them amenable to therapeutic use. However, the acceptance of mesenchymal stem cells in clinical practice requires standardized techniques for their specific isolation. To date, there are no conclusive marker (s) for the exclusive isolation of mesenchymal stem cells. Our aim was to identify markers differentially expressed between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. We compared and contrasted the phenotype of tissue cultures in which mesenchymal stem cells are rich and rare. By initially assessing mesenchymal stem cell differentiation, we established that bone marrow and breast adipose cultures are rich in mesenchymal stem cells while, in our hands, foreskin fibroblast and olfactory tissue cultures contain rare mesenchymal stem cells. In particular, olfactory tissue cells represent non-stem cell mesenchymal cells. Subsequently, the phenotype of the tissue cultures were thoroughly assessed using immuno-fluorescence, flow-cytometry, proteomics, antibody arrays and qPCR. Results Our analysis revealed that all tissue cultures, regardless of differentiation potential, demonstrated remarkably similar phenotypes. Importantly, it was also observed that common mesenchymal stem cell markers, and fibroblast-associated markers, do not discriminate between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. Examination and comparison of the phenotypes of mesenchymal stem cell and non-stem cell mesenchymal cell cultures revealed three differentially expressed markers – CD24, CD108 and CD40. Conclusion We indicate the importance of establishing differential marker expression between mesenchymal stem cells and non-stem cell mesenchymal cells in order to determine stem cell specific markers. PMID:24304471

  16. Protection of cultured mammalian cells by rebamipide

    Energy Technology Data Exchange (ETDEWEB)

    Antoku, Shigetoshi; Aramaki, Ryoji [Kyushu Univ., Fukuoka (Japan). Faculty of Medicine; Tanaka, Hisashi; Kusumoto, Naotoshi

    1997-06-01

    Rebamipide which is used as a drug for gastritis and stomach ulcer has large capability for OH radical scavenging. It is expected that rebamipide has protective effect against ionizing radiations. The present paper deals with protective effect of rebamipide for cultured mammalian cells exposed to ionizing radiations. As rebamipide is insoluble in water, three solvents were used to dissolve. Rebamipide dissolved in dimethyl sulfoxide (DMSO), dimethyl formamide (DMFA) and 0.02 N NaOH was added to the cells in Eagle`s minimum essential medium (MEM) supplemented with 10% fetal calf serum and the cells were irradiated with X-rays. After irradiation, the cells were trypsinized, plated in MEM with 10% fetal calf serum and incubated for 7 days in a CO{sub 2} incubator to form colonies. Rebamipide dissolved in 0.02 N NaOH exhibited the protective effect expected its OH radical scavenging capability. However, the protective effect of rebamipide dissolved in DMSO was about half of that expected by its radical scavenging capability and that of rebamipide dissolved in DMFA was not observed. Uptake of rebamipide labeled with {sup 14}C increased with increasing contact time with rebamipide. These rebamipide mainly distributed in nucleus rather than cytoplasm. (author)

  17. Protection of cultured mammalian cells by rebamipide

    International Nuclear Information System (INIS)

    Antoku, Shigetoshi; Aramaki, Ryoji; Tanaka, Hisashi; Kusumoto, Naotoshi.

    1997-01-01

    Rebamipide which is used as a drug for gastritis and stomach ulcer has large capability for OH radical scavenging. It is expected that rebamipide has protective effect against ionizing radiations. The present paper deals with protective effect of rebamipide for cultured mammalian cells exposed to ionizing radiations. As rebamipide is insoluble in water, three solvents were used to dissolve. Rebamipide dissolved in dimethyl sulfoxide (DMSO), dimethyl formamide (DMFA) and 0.02 N NaOH was added to the cells in Eagle's minimum essential medium (MEM) supplemented with 10% fetal calf serum and the cells were irradiated with X-rays. After irradiation, the cells were trypsinized, plated in MEM with 10% fetal calf serum and incubated for 7 days in a CO 2 incubator to form colonies. Rebamipide dissolved in 0.02 N NaOH exhibited the protective effect expected its OH radical scavenging capability. However, the protective effect of rebamipide dissolved in DMSO was about half of that expected by its radical scavenging capability and that of rebamipide dissolved in DMFA was not observed. Uptake of rebamipide labeled with 14 C increased with increasing contact time with rebamipide. These rebamipide mainly distributed in nucleus rather than cytoplasm. (author)

  18. The evolution of chicken stem cell culture methods.

    Science.gov (United States)

    Farzaneh, M; Attari, F; Mozdziak, P E; Khoshnam, S E

    2017-12-01

    1. The avian embryo is an excellent model for studying embryology and the production of pharmaceutical proteins in transgenic chickens. Furthermore, chicken stem cells have the potential for proliferation and differentiation and emerged as an attractive tool for various cell-based technologies. 2. The objective of these studies is the derivation and culture of these stem cells is the production of transgenic birds for recombinant biomaterials and vaccine manufacture, drug and cytotoxicity testing, as well as to gain insight into basic science, including cell tracking. 3. Despite similarities among the established chicken stem cell lines, fundamental differences have been reported between their culture conditions and applications. Recent conventional protocols used for expansion and culture of chicken stem cells mostly depend on feeder cells, serum-containing media and static culture. 4. Utilising chicken stem cells for generation of cell-based transgenic birds and a variety of vaccines requires large-scale cell production. However, scaling up the conventional adherent chicken stem cells is challenging and labour intensive. Development of a suspension cell culture process for chicken embryonic stem cells (cESCs), chicken primordial germ cells (PGCs) and chicken induced pluripotent stem cells (ciPSCs) will be an important advance for increasing the growth kinetics of these cells. 6. This review describes various approaches and suggestions to achieve optimal cell growth for defined chicken stem cells cultures and use in future manufacturing applications.

  19. Half-liter supernatant sampler system engineering work plan

    International Nuclear Information System (INIS)

    Ritter, G.A.

    1995-01-01

    The Tank Waste Remediation System (TWRS) pretreatment facility project W-236B, known as the Initial Pretreatment Module (IPM), requires samples of supernatants and sludges from 200 Area tank farms for planned hot testing work in support of IPM design. The IPM project has proposed the development of several new sampler systems. These systems include a 0.5-l supernatant sampler, 3-l and 25-l supernatant and sludge samplers, and a 4,000-l sampler system. The 0.5-l sampler will support IPM sampling needs in the 1 to 3 l range starting in late fiscal year 1995. This sampler is intended to be used in conjunction with the existing 100 ml bottle-on-a-string. The 3-l and 25-l systems will be based on the Savannah River Site's sampler system and will support IPM sampling needs in the 3 to 100 liter range. Most of the hot testing required for design of the IPM must be accomplished in the next 3 years. This work plan defines the tasks associated with the development of a 0.5-l sampler system. This system will be referred to as the Half-Liter Supernatant Sampler System (HLSSS). Specifically, this work plan will define the scope of work, identify organizational responsibilities, identify major technical requirements, describe configuration control and verification requirements, and provide estimated costs and schedule. The sampler system will be fully operational, including trained staff and operating procedures, upon completion of this task

  20. X-ray microanalysis of single and cultured cells

    International Nuclear Information System (INIS)

    Wroblewski, J.; Roomans, G.M.

    1984-01-01

    X-ray microanalysis of single or cultured cells is often a useful alternative or complement to the analysis of the corresponding tissue. It also allows the analysis of individual cells in a cell population. Preparation for X-ray microanalysis poses a number of typical problems. Suspensions of single cells can be prepared by either of two pathways: (1) washing - mounting - drying, or (2) centrifugation - freezing or fixation - sectioning. The washing step in the preparation of single or cultured cells presents the most severe problems. Cultured cells are generally grown on a substrate that is compatible with both the analysis and the culture, washed and dried. In some cases, sectioning of cultured cell monolayers has been performed. Special problems in quantitative analysis occur in those cases where the cells are analyzed on a thick substrate, since the substrate contributes to the spectral background

  1. Establishment and characterization of American elm cell suspension cultures

    Science.gov (United States)

    Steven M. Eshita; Joseph C. Kamalay; Vicki M. Gingas; Daniel A. Yaussy

    2000-01-01

    Cell suspension cultures of Dutch elm disease (DED)-tolerant and DED-susceptible American elms clones have been established and characterized as prerequisites for contrasts of cellular responses to pathogen-derived elicitors. Characteristics of cultured elm cell growth were monitored by A700 and media conductivity. Combined cell growth data for all experiments within a...

  2. Electrospinning of microbial polyester for cell culture

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Oh Hyeong [Department of Polymer Science and Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Lee, Ik Sang [Department of Polymer Science and Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Ko, Young-Gwang [Department of Polymer Science and Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Meng, Wan [Department of Polymer Science, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Jung, Kyung-Hye [Department of Polymer Science, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Kang, Inn-Kyu [Department of Polymer Science, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Ito, Yoshihiro [Kanagawa Academy of Science and Technology, KSP East 309, Sakado 3-2-1, Takatsu-ku, Kawasaki 213-0012 (Japan)

    2007-03-01

    Biodegradable and biocompatible poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), a copolymer of microbial polyester, was fabricated as a nanofibrous mat by electrospinning. The specific surface area and the porosity of electrospun PHBV nanofibrous mat were determined. When the mechanical properties of flat film and electrospun PHBV nanofibrous mats were investigated, both the tensile modulus and strength of electrospun PHBV were less than those of cast PHBV film. However, the elongation ratio of nanofiber mat was higher than that of the cast film. The structure of electrospun nanofibers using PHBV-trifluoroethanol solutions depended on the solution concentrations. When x-ray diffraction patterns of bulk PHBV before and after electrospinning were compared, the crystallinity of PHBV was not significantly affected by the electrospinning process. Chondrocytes adhered and grew on the electrospun PHBV nanofibrous mat better than on the cast PHBV film. Therefore, the electrospun PHBV was considered to be suitable for cell culture.

  3. Sildenafil Effect on Nitric Oxide Secretion by Normal Human Endometrial Epithelial Cells Cultured In vitro

    Directory of Open Access Journals (Sweden)

    Farzaneh Chobsaz

    2011-01-01

    Full Text Available Background: Sildenafil is a selective inhibitor of cyclic-guanosine monphosphat-specificphosphodiesterase type 5. It increases intracellular nitric oxide (NO production in some cells.There are reports on its positive effect on uterine circulation, endometrial thickness, and infertilityimprovement. Endometrial epithelial cells (EEC play an important role in embryo attachment andimplantation. The present work investigates the effect of sildenafil on human EEC and their NOsecretion in vitro.Materials and Methods: In this experimental in vitro study, endometrial biopsies (n=10 werewashed in a phosphate buffered solution (PBS and digested with collagenase I (2 mg/ml in DMEM/F12 medium at 37°C for 90 minutes. Epithelial glands were collected by sequential filtrationthrough nylon meshes (70 and 40 μm pores, respectively. Epithelial glands were then treated withtrypsin to obtain individual cells. The cells were counted and divided into four groups: control and1, 10, and 20 μM sildenafil concentrations. Cells were cultured for 15 days at 37ºC and 5% CO2; themedia were changed every 3 days, and their supernatants were collected for the NO assay. NO wasmeasured by standard Greiss methods. Data were analyzed by one way ANOVA.Results: There was no significant difference between groups in cell count and NO secretion, but thelevel of NO increased slightly in the experimental groups. The 10 μM dose showed the highest cellcount. EEC morphology changed into long spindle cells in the case groups.Conclusion: Sildenafil (1, 10, and 20 μM showed a mild proliferative effect on human EECnumbers, but no significant change was seen in NO production.

  4. Stimulation of the proliferation of hemopoietic stem cells in irradiated bone marrow cell culture

    International Nuclear Information System (INIS)

    Mori, K.J.; Izumi, H.; Seto, A.

    1981-01-01

    Long-term hemopoiesis was established in bone marrow cell culture in vitro. This culture was shown to support the recovery proliferation of hemopoietic stem cells completely in vitro after irradiation. Hemopoietic stem cells were stimulated into proliferation in culture when normal bone marrow cells were overlayed on top of the irradiated adherent cell colonies. These results indicate that proliferation and differentiation of hemopoietic stem cells in vitro are also supported by stromahemopoietic cell interactions

  5. Evaluation of the effects of different culture media on the myogenic differentiation potential of adipose tissue- or bone marrow-derived human mesenchymal stem cells.

    Science.gov (United States)

    Stern-Straeter, Jens; Bonaterra, Gabriel Alejandro; Juritz, Stephanie; Birk, Richard; Goessler, Ulrich Reinhart; Bieback, Karen; Bugert, Peter; Schultz, Johannes; Hörmann, Karl; Kinscherf, Ralf; Faber, Anne

    2014-01-01

    The creation of functional muscles/muscle tissue from human stem cells is a major goal of skeletal muscle tissue engineering. Mesenchymal stem cells (MSCs) from fat/adipose tissue (AT-MSCs), as well as bone marrow (BM-MSCs) have been shown to bear myogenic potential, which makes them candidate stem cells for skeletal muscle tissue engineering applications. The aim of this study was to analyse the myogenic differentiation potential of human AT-MSCs and BM-MSCs cultured in six different cell culture media containing different mixtures of growth factors. The following cell culture media were used in our experiments: mesenchymal stem cell growth medium (MSCGM)™ as growth medium, MSCGM + 5-azacytidine (5-Aza), skeletal muscle myoblast cell growth medium (SkGM)-2 BulletKit™, and 5, 30 and 50% conditioned cell culture media, i.e., supernatant of human satellite cell cultures after three days in cell culture mixed with MSCGM. Following the incubation of human AT-MSCs or BM-MSCs for 0, 4, 8, 11, 16 or 21 days with each of the cell culture media, cell proliferation was measured using the alamarBlue® assay. Myogenic differentiation was evaluated by quantitative gene expression analyses, using quantitative RT-PCR (qRT-PCR) and immunocytochemical staining (ICC), using well-defined skeletal markers, such as desmin (DES), myogenic factor 5 (MYF5), myosin, heavy chain 8, skeletal muscle, perinatal (MYH8), myosin, heavy chain 1, skeletal muscle, adult (MYH1) and skeletal muscle actin-α1 (ACTA1). The highest proliferation rates were observed in the AT-MSCs and BM-MSCs cultured with SkGM-2 BulletKit medium. The average proliferation rate was higher in the AT-MSCs than in the BM-MSCs, taking all six culture media into account. qRT-PCR revealed the expression levels of the myogenic markers, ACTA1, MYH1 and MYH8, in the AT-MSC cell cultures, but not in the BM-MSC cultures. The muscle-specific intermediate filament, DES, was only detected (by ICC) in the AT-MSCs, but not in the BM

  6. Particle Trajectories in Rotating Wall Cell Culture Devices

    Science.gov (United States)

    Ramachandran N.; Downey, J. P.

    1999-01-01

    Cell cultures are extremely important to the medical community since such cultures provide an opportunity to perform research on human tissue without the concerns inherent in experiments on individual humans. Development of cells in cultures has been found to be greatly influenced by the conditions of the culture. Much work has focused on the effect of the motions of cells in the culture relative to the solution. Recently rotating wall vessels have been used with success in achieving improved cellular cultures. Speculation and limited research have focused on the low shear environment and the ability of rotating vessels to keep cells suspended in solution rather than floating or sedimenting as the primary reasons for the improved cellular cultures using these devices. It is widely believed that the cultures obtained using a rotating wall vessel simulates to some degree the effect of microgravity on cultures. It has also been speculated that the microgravity environment may provide the ideal acceleration environment for culturing of cellular tissues due to the nearly negligible levels of sedimentation and shear possible. This work predicts particle trajectories of cells in rotating wall vessels of cylindrical and annular design consistent with the estimated properties of typical cellular cultures. Estimates of the shear encountered by cells in solution and the interactions with walls are studied. Comparisons of potential experiments in ground and microgravity environments are performed.

  7. Microfluidic engineered high cell density three-dimensional neural cultures

    Science.gov (United States)

    Cullen, D. Kacy; Vukasinovic, Jelena; Glezer, Ari; La Placa, Michelle C.

    2007-06-01

    Three-dimensional (3D) neural cultures with cells distributed throughout a thick, bioactive protein scaffold may better represent neurobiological phenomena than planar correlates lacking matrix support. Neural cells in vivo interact within a complex, multicellular environment with tightly coupled 3D cell-cell/cell-matrix interactions; however, thick 3D neural cultures at cell densities approaching that of brain rapidly decay, presumably due to diffusion limited interstitial mass transport. To address this issue, we have developed a novel perfusion platform that utilizes forced intercellular convection to enhance mass transport. First, we demonstrated that in thick (>500 µm) 3D neural cultures supported by passive diffusion, cell densities =104 cells mm-3), continuous medium perfusion at 2.0-11.0 µL min-1 improved viability compared to non-perfused cultures (p death and matrix degradation. In perfused cultures, survival was dependent on proximity to the perfusion source at 2.00-6.25 µL min-1 (p 90% viability in both neuronal cultures and neuronal-astrocytic co-cultures. This work demonstrates the utility of forced interstitial convection in improving the survival of high cell density 3D engineered neural constructs and may aid in the development of novel tissue-engineered systems reconstituting 3D cell-cell/cell-matrix interactions.

  8. Ion exchange flowsheet for recovery of cesium from purex sludge supernatant at B Plant

    International Nuclear Information System (INIS)

    Carlstrom, R.F.

    1977-01-01

    Purex Sludge Supernatant (PSS) contains significant amounts of 137 Cs left after removal of strontium from fission product bearing Purex wastes. To remove cesium from PSS, an Ion Exchange Recovery system has been set up in Cells 17-21 at B Plant. The cesium that is recovered is stored within B Plant for eventual purification through the Cesium Purification process in Cell 38 and eventual encapsulation and storage in a powdered form at the Waste Encapsulation Storage Facility. Cesium depleted waste streams from the Ion Exchange processes are transferred to underground storage

  9. Usability and Applicability of Microfluidic Cell Culture Systems

    DEFF Research Database (Denmark)

    Hemmingsen, Mette

    possibilities for, for example, precise control of the chemical environment, 3D cultures, controlled co-culture of different cell types or automated, individual control of up to 96 cell culture chambers in one integrated system. Despite the great new opportunities to perform novel experimental designs......Microfluidic cell culture has been a research area with great attention the last decade due to its potential to mimic the in vivo cellular environment more closely compared to what is possible by conventional cell culture methods. Many exciting and complex devices have been presented providing......, these devices still lack general implementation into biological research laboratories. In this project, the usability and applicability of microfluidic cell culture systems have been investigated. The tested systems display good properties regarding optics and compatibility with standard laboratory equipment...

  10. THE ALKALOID CYTISINE IN THE CELL CULTURE

    Directory of Open Access Journals (Sweden)

    Gazaliev A.M.

    2012-08-01

    Full Text Available Alkaloids are vegetative establishments of complex and original structure with nitrous heterocycles in the basis. For a long time they drew researchers’ attention because of their unique and specific physiological effect on alive organisms. Not all the representatives of the globe’s flora contain these unique substances. Alkaloid cytisine is to be found mainly in the plants of the fabaceous family - Fabaceae. For the cytisine production the seeds of Thermopsis lanceolata R.Br (T. lanceolata R.Br and Cytisus laburnum (C. laburnum are used as a raw material. The object of the research is T. lanceolata cell culture. Sterile sprouts are used at the first stage of the experiment. Callus genesis is accompanied with dedifferentiation. It leads to the cellular organization simplification. Based on an important property of a plant cell, such as totipotency, there appears the formation of the “de novo” biosynthetic device. The cultivation algorithm consists of two basic stages: (i the cultivation conditions optimization of callus with a high level of the primary metabolites biosynthesis (Aspartat – lysine; (ii the research of cultivation chemical and physical factors influence on the secondary metabolite (cytisine biosynthesis and accumulation. During the cultivation the Murashige and Skoog classical recipe of nutrient medium will be used. Optimization of the cultivation conditions will concern the phytohormones, macro- and micronutrients content, as the purpose of optimization is the production of the determined high-level competence embriogenical callus. The main problem is genetic heterogeneity of a cellular population and instability of morpho-physiological processes. The correct management of higher plants cells population is possible at the synchronization of a cellular cycle phases. The references analysis has shown that it is almost impossible to synchronize cellular cycles in the culture of plant tissue. The application of chemical

  11. Isolation and culture of larval cells from C. elegans.

    Directory of Open Access Journals (Sweden)

    Sihui Zhang

    Full Text Available Cell culture is an essential tool to study cell function. In C. elegans the ability to isolate and culture cells has been limited to embryonically derived cells. However, cells or blastomeres isolated from mixed stage embryos terminally differentiate within 24 hours of culture, thus precluding post-embryonic stage cell culture. We have developed an efficient and technically simple method for large-scale isolation and primary culture of larval-stage cells. We have optimized the treatment to maximize cell number and minimize cell death for each of the four larval stages. We obtained up to 7.8×10(4 cells per microliter of packed larvae, and up to 97% of adherent cells isolated by this method were viable for at least 16 hours. Cultured larval cells showed stage-specific increases in both cell size and multinuclearity and expressed lineage- and cell type-specific reporters. The majority (81% of larval cells isolated by our method were muscle cells that exhibited stage-specific phenotypes. L1 muscle cells developed 1 to 2 wide cytoplasmic processes, while L4 muscle cells developed 4 to 14 processes of various thicknesses. L4 muscle cells developed bands of myosin heavy chain A thick filaments at the cell center and spontaneously contracted ex vivo. Neurons constituted less than 10% of the isolated cells and the majority of neurons developed one or more long, microtubule-rich protrusions that terminated in actin-rich growth cones. In addition to cells such as muscle and neuron that are high abundance in vivo, we were also able to isolate M-lineage cells that constitute less than 0.2% of cells in vivo. Our novel method of cell isolation extends C. elegans cell culture to larval developmental stages, and allows use of the wealth of cell culture tools, such as cell sorting, electrophysiology, co-culture, and high-resolution imaging of subcellular dynamics, in investigation of post-embryonic development and physiology.

  12. Biogelx: Cell Culture on Self-Assembling Peptide Gels.

    Science.gov (United States)

    Harper, Mhairi M; Connolly, Michael L; Goldie, Laura; Irvine, Eleanore J; Shaw, Joshua E; Jayawarna, Vineetha; Richardson, Stephen M; Dalby, Matthew J; Lightbody, David; Ulijn, Rein V

    2018-01-01

    Aromatic peptide amphiphiles can form self-supporting nanostructured hydrogels with tunable mechanical properties and chemical compositions. These hydrogels are increasingly applied in two-dimensional (2D) and three-dimensional (3D) cell culture, where there is a rapidly growing need to store, grow, proliferate, and manipulate naturally derived cells within a hydrated, 3D matrix. Biogelx Limited is a biomaterials company, created to commercialize these bio-inspired hydrogels to cell biologists for a range of cell culture applications. This chapter describes methods of various characterization and cell culture techniques specifically optimized for compatibility with Biogelx products.

  13. Development of a microfluidic perfusion 3D cell culture system

    Science.gov (United States)

    Park, D. H.; Jeon, H. J.; Kim, M. J.; Nguyen, X. D.; Morten, K.; Go, J. S.

    2018-04-01

    Recently, 3-dimensional in vitro cell cultures have gained much attention in biomedical sciences because of the closer relevance between in vitro cell cultures and in vivo environments. This paper presents a microfluidic perfusion 3D cell culture system with consistent control of long-term culture conditions to mimic an in vivo microenvironment. It consists of two sudden expansion reservoirs to trap incoming air bubbles, gradient generators to provide a linear concentration, and microchannel mixers. Specifically, the air bubbles disturb a flow in the microfluidic channel resulting in the instability of the perfusion cell culture conditions. For long-term stable operation, the sudden expansion reservoir is designed to trap air bubbles by using buoyancy before they enter the culture system. The performance of the developed microfluidic perfusion 3D cell culture system was examined experimentally and compared with analytical results. Finally, it was applied to test the cytotoxicity of cells infected with Ewing’s sarcoma. Cell death was observed for different concentrations of H2O2. For future work, the developed microfluidic perfusion 3D cell culture system can be used to examine the behavior of cells treated with various drugs and concentrations for high-throughput drug screening.

  14. Systems Biology for Organotypic Cell Cultures

    Energy Technology Data Exchange (ETDEWEB)

    Grego, Sonia [RTI International, Research Triangle Park, NC (United States); Dougherty, Edward R. [Texas A & M Univ., College Station, TX (United States); Alexander, Francis J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Auerbach, Scott S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Berridge, Brian R. [GlaxoSmithKline, Research Triangle Park, NC (United States); Bittner, Michael L. [Translational Genomics Research Inst., Phoenix, AZ (United States); Casey, Warren [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Cooley, Philip C. [RTI International, Research Triangle Park, NC (United States); Dash, Ajit [HemoShear Therapeutics, Charlottesville, VA (United States); Ferguson, Stephen S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Fennell, Timothy R. [RTI International, Research Triangle Park, NC (United States); Hawkins, Brian T. [RTI International, Research Triangle Park, NC (United States); Hickey, Anthony J. [RTI International, Research Triangle Park, NC (United States); Kleensang, Andre [Johns Hopkins Univ., Baltimore, MD (United States). Center for Alternatives to Animal Testing; Liebman, Michael N. [IPQ Analytics, Kennett Square, PA (United States); Martin, Florian [Phillip Morris International, Neuchatel (Switzerland); Maull, Elizabeth A. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Paragas, Jason [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Qiao, Guilin [Defense Threat Reduction Agency, Ft. Belvoir, VA (United States); Ramaiahgari, Sreenivasa [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Sumner, Susan J. [RTI International, Research Triangle Park, NC (United States); Yoon, Miyoung [The Hamner Inst. for Health Sciences, Research Triangle Park, NC (United States); ScitoVation, Research Triangle Park, NC (United States)

    2016-08-04

    Translating in vitro biological data into actionable information related to human health holds the potential to improve disease treatment and risk assessment of chemical exposures. While genomics has identified regulatory pathways at the cellular level, translation to the organism level requires a multiscale approach accounting for intra-cellular regulation, inter-cellular interaction, and tissue/organ-level effects. Tissue-level effects can now be probed in vitro thanks to recently developed systems of three-dimensional (3D), multicellular, “organotypic” cell cultures, which mimic functional responses of living tissue. However, there remains a knowledge gap regarding interactions across different biological scales, complicating accurate prediction of health outcomes from molecular/genomic data and tissue responses. Systems biology aims at mathematical modeling of complex, non-linear biological systems. We propose to apply a systems biology approach to achieve a computational representation of tissue-level physiological responses by integrating empirical data derived from organotypic culture systems with computational models of intracellular pathways to better predict human responses. Successful implementation of this integrated approach will provide a powerful tool for faster, more accurate and cost-effective screening of potential toxicants and therapeutics. On September 11, 2015, an interdisciplinary group of scientists, engineers, and clinicians gathered for a workshop in Research Triangle Park, North Carolina, to discuss this ambitious goal. Participants represented laboratory-based and computational modeling approaches to pharmacology and toxicology, as well as the pharmaceutical industry, government, non-profits, and academia. Discussions focused on identifying critical system perturbations to model, the computational tools required, and the experimental approaches best suited to generating key data. This consensus report summarizes the discussions held.

  15. A method for culturing human hair follicle cells.

    Science.gov (United States)

    Weterings, P J; Vermorken, A J; Bloemendal, H

    1981-01-01

    For the first time a method for culturing human hair follicle cells is described. The bovine eye lens capsule, a basement membrane-like structure, is used as the substrate for the cultures. In a culture medium supplemented with hydrocortisone and insulin about 70% of the original follicles will form growing colonies of diploid keratinocytes.

  16. Cell cycle regulation in human embryonic stem cells: links to adaptation to cell culture.

    Science.gov (United States)

    Barta, Tomas; Dolezalova, Dasa; Holubcova, Zuzana; Hampl, Ales

    2013-03-01

    Cell cycle represents not only a tightly orchestrated mechanism of cell replication and cell division but it also plays an important role in regulation of cell fate decision. Particularly in the context of pluripotent stem cells or multipotent progenitor cells, regulation of cell fate decision is of paramount importance. It has been shown that human embryonic stem cells (hESCs) show unique cell cycle characteristics, such as short doubling time due to abbreviated G1 phase; these properties change with the onset of differentiation. This review summarizes the current understanding of cell cycle regulation in hESCs. We discuss cell cycle properties as well as regulatory machinery governing cell cycle progression of undifferentiated hESCs. Additionally, we provide evidence that long-term culture of hESCs is accompanied by changes in cell cycle properties as well as configuration of several cell cycle regulatory molecules.

  17. Rabbit uterine epithelial cells: Co-culture with spermatozoa

    International Nuclear Information System (INIS)

    Boice, M.L.

    1988-01-01

    A primary culture of rabbit uterine epithelial cells was established and their effects on sperm function were examined in vitro. Epithelial cells were isolated from uteri of estrous rabbits and cultured on floating collagen gels in phenol red-free medium supplemented with 5% fetal bovine serum. Light microscopy and keratin staining showed that the epithelial cell population established in culture had morphological characteristics similar to that seen in the intact endometrium. Cells were cultured with 3 H-leucine and uptake of label by cells and its incorporation into cellular and secretory proteins determined. When compared to cells cultured for 24-48 h, incorporation of label into cellular protein was lower at 72-96 h, but secretion increased. Estradiol 17-β did not affect label uptake or incorporation, but did enhance proliferation of cells as judged by total DNA content of the cell population. Analysis of proteins in media by sodium dodecyl sulfate polyacrylamide gel electrophoresis and fluorography suggested that epithelial and stromal cells synthesis proteins that may be secretory in nature during 72-96 h culture. Twenty-nine to thirty-one h after initiation of epithelial cultures, 1-2 x 10 6 sperm were co-incubated with cells and sperm viability, motility, loss of acrosome and fertilizing ability determined

  18. Long-term maintenance of human induced pluripotent stem cells by automated cell culture system.

    Science.gov (United States)

    Konagaya, Shuhei; Ando, Takeshi; Yamauchi, Toshiaki; Suemori, Hirofumi; Iwata, Hiroo

    2015-11-17

    Pluripotent stem cells, such as embryonic stem cells and induced pluripotent stem (iPS) cells, are regarded as new sources for cell replacement therapy. These cells can unlimitedly expand under undifferentiated conditions and be differentiated into multiple cell types. Automated culture systems enable the large-scale production of cells. In addition to reducing the time and effort of researchers, an automated culture system improves the reproducibility of cell cultures. In the present study, we newly designed a fully automated cell culture system for human iPS maintenance. Using an automated culture system, hiPS cells maintained their undifferentiated state for 60 days. Automatically prepared hiPS cells had a potency of differentiation into three germ layer cells including dopaminergic neurons and pancreatic cells.

  19. The impact of cell culture equipment on energy loss.

    Science.gov (United States)

    Davies, Lleucu B; Kiernan, Michael N; Bishop, Joanna C; Thornton, Catherine A; Morgan, Gareth

    2014-01-01

    Light energy of discrete wavelengths supplied via lasers and broadband intense pulsed light have been used therapeutically for many years. In vitro models complement clinical studies, especially for the elucidation of underlying mechanisms of action. Clarification that light energy reaches the cells is necessary when developing protocols for the treatment of cells using in vitro models. Few studies report on energy loss in cell culture equipment. The ability of energy from light with therapeutic potential to reach cells in culture needs to be determined; this includes determining the proportion of light energy lost within standard cell culture media and cell culture vessels. The energy absorption of cell culture media, with/without the pH indicator dye phenol red, and the loss of energy within different plastics and glassware used typically for in vitro cell culture were investigated using intense pulsed light and a yellow pulsed dye laser. Media containing phenol red have a distinctive absorption peak (560 nm) absent in phenol red-free media and restored by the addition of phenol red. For both light sources, energy loss was lowest in standard polystyrene tissue culture flasks or multi-well plates and highest in polypropylene vessels or glass tubes. The effects of phenol red-free media on the absorption of energy varied with the light source used. Phenol red-free media are the media of choice; polystyrene vessels with flat surfaces such as culture flasks or multi-well plates should be used in preference to polypropylene or glass vessels.

  20. Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR.

    Science.gov (United States)

    Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier

    2017-11-01

    Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.

  1. Biona-C Cell Culture pH Monitoring System

    Science.gov (United States)

    Friedericks, C.

    1999-01-01

    Sensors 2000! is developing a system to demonstrate the ability to perform accurate, real-time measurements of pH and CO2 in a cell culture media in Space. The BIONA-C Cell Culture pH Monitoring System consists of S2K! developed ion selective sensors and control electronics integrated with the fluidics of a cell culture system. The integrated system comprises a "rail" in the Cell Culture Module (CCM) of WRAIR (Space Biosciences of Walter Read Army Institute of Research). The CCM is a Space Shuttle mid-deck locker experiment payload. The BIONA-C is displayed along with associated graphics and text explanations. The presentation will stimulate interest in development of sensor technology for real-time cell culture measurements. The transfer of this technology to other applications will also be of interest. Additional information is contained in the original document.

  2. Sequential cancer mutations in cultured human intestinal stem cells

    NARCIS (Netherlands)

    Drost, Jarno; van Jaarsveld, Richard H.; Ponsioen, Bas; Zimberlin, Cheryl; van Boxtel, Ruben; Buijs, Arjan; Sachs, Norman; Overmeer, René M.; Offerhaus, G. Johan; Begthel, Harry; Korving, Jeroen; van de Wetering, Marc; Schwank, Gerald; Logtenberg, Meike; Cuppen, Edwin; Snippert, Hugo J.; Medema, Jan Paul; Kops, Geert J. P. L.; Clevers, Hans

    2015-01-01

    Crypt stem cells represent the cells of origin for intestinal neoplasia. Both mouse and human intestinal stem cells can be cultured in medium containing the stem-cell-niche factors WNT, R-spondin, epidermal growth factor (EGF) and noggin over long time periods as epithelial organoids that remain

  3. PECULIARITIES OF SECONDARY METABOLITES BIOSYNTHESIS IN PLANT CELL CULTURES

    Directory of Open Access Journals (Sweden)

    A.M. NOSOV

    2014-06-01

    Full Text Available metabolites formation in plant cell cultures of Panax spp., (ginsenosides; Dioscorea deltoidea (steroid glycosides; Ajuga reptans, Serratula coronata, Rhaponticum carthamoides (ecdisteroids; Polyscias spp., (triterpene glycosides, Taxus spp. (taxoids, Stevia rebaudiana (diterpene steviol-glycosides, Stephania glabra (alkaloids. They are some regular trends of secondary metabolites synthesis in the plant cell culture:It can be noted the stable synthesis of the compound promoting cell proliferation. Indeed, cell cultures of Dioscorea deltoidea were demonstrated to accumulate only furostanol glycosides, which promoted cell division. Furostanol glycoside content of Dioscorea strain DM-0.5 was up to 6 - 12% by dry biomass.Panax ginseng and P. japonicus plant cell cultures synthesize as minimum seven triterpene glycosides (ginsenosides, the productivity of these compounds was up to 6.0 - 8.0% on dry biomass.By contrast, the detectable synthesis of diterpene steviol-glycosides in cultivated cells of Stevia rebaudiana initiated in the mixotrophic cultures during chloroplast formation only.Despite these differences, or mainly due to them, plant cell cultures have become an attractive source of phytochemicals in alternative to collecting wild plants. It provides a guideline to bioreactor-based production of isoprenoids using undifferentiated plant cell cultures

  4. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  5. Morphological and Immunohistochemical Characterization of Canine Osteosarcoma Spheroid Cell Cultures.

    Science.gov (United States)

    Gebhard, C; Gabriel, C; Walter, I

    2016-06-01

    Spheroid cell culture emerges as powerful in vitro tool for experimental tumour research. In this study, we established a scaffold-free three-dimensional spheroid system built from canine osteosarcoma (OS) cells (D17). Spheroids (7, 14 and 19 days of cultivation) and monolayer cultures (2 and 7 days of cultivation) were evaluated and compared on light and electron microscopy. Monolayer and spheroid cultures were tested for vimentin, cytokeratin, alkaline phosphatase, osteocalcin and collagen I by means of immunohistochemistry. The spheroid cell culture exhibited a distinct network of collagen I in particular after 19-day cultivation, whereas in monolayer cultures, collagen I was arranged as a lamellar basal structure. Necrotic centres of large spheroids, as observed in 14- and 19-day cultures, were characterized by significant amounts of osteocalcin. Proliferative activity as determined by Ki-67 immunoreactivity showed an even distribution in two-dimensional cultures. In spheroids, proliferation was predominating in the peripheral areas. Metastasis-associated markers ezrin and S100A4 were shown to be continuously expressed in monolayer and spheroid cultures. We conclude that the scaffold-free spheroid system from canine OS cells has the ability to mimic the architecture of the in vivo tumour, in particular cell-cell and cell-matrix interactions. © 2015 The Authors. Anatomia, Histologia, Embryologia Published by Blackwell Verlag GmbH.

  6. Cytokine profiles of tumor supernatants in invasive ductal cancer and fibroadenoma of the breast and its relationship with VEGF-A expression in the tumors.

    Science.gov (United States)

    Autenshlyus, Alexander I; Arkhipov, Sergey A; Kunts, Tatiana A; Marinkin, Igor O; Mikhailova, Elena S; Karpukhina, Xenia V; Varaksin, Nikolay A

    2017-03-01

    Interrelations between cytokines, produced by invasive ductal carcinoma (IDC) and fibroadenoma (FA) of the breast, and angiogenic growth factor VEGF-A, expressed in IDC and FA, were investigated. The analysis of the cytokine profiles of IDC and FA was performed by cultivation of tumor biopsy specimens in vitro. Testing of the cytokine-producing reserve of the tumors for production of VEGF-A was conducted by culturing samples of IDC and FA in a medium containing polyclonal activator (a complex of phytohemagglutinin, concanavalin A, and lipopolysaccharide). Levels of cytokines and growth factors (IL-2, IL-6, IL-8, IL-10, IL-17, IL-18, IL-1β, IL-1Ra, TNF-α, IFN-γ, G-CSF, GM-CSF, VEGF-A) and MCP-1 (monocyte chemoattractant protein-1) in tumor supernatants were determined by an ELISA. Expression of VEGF-A was analyzed in tumor biopsy specimens by immunohistochemical analysis. In the IDC supernatants, the concentrations of IL-17, IL-18, and IFN-γ were higher and the concentrations of IL-10 and MCP-1 were lower in comparison with the FA supernatants. We observed negative correlations between the macrophage infiltration and VEGF-A concentration in the IDC supernatants (r = -0.508; P = 0.011) and between VEGF-A expression and the IDC vascularization degree (r = -0.423, P = 0.039). Spontaneous expression of VEGF-A in samples of IDC significantly exceeded the VEGF-A expression in FA. There was no difference between IDC and FA in VEGF-A expression after treatment with the polyclonal activators. Our results indicate that greater malignancy may have a paradoxical effect that is controlled by cytokines and characterized by weakening of tumor angiogenesis during overproduction of VEGF-A. These findings point to complex mechanisms of positive and negative regulation of tumor angiogenesis by cytokines that are produced by the tumor and by cells in its microenvironment, whose cytokine profiles may change at different stages of tumor progression.

  7. 21st Century Cell Culture for 21st Century Toxicology.

    Science.gov (United States)

    Pamies, David; Hartung, Thomas

    2017-01-17

    There is no good science in bad models. Cell culture is especially prone to artifacts. A number of novel cell culture technologies have become more broadly available in the 21st century, which allow overcoming limitations of traditional culture and are more physiologically relevant. These include the use of stem-cell derived human cells, cocultures of different cell types, scaffolds and extracellular matrices, perfusion platforms (such as microfluidics), 3D culture, organ-on-chip technologies, tissue architecture, and organ functionality. The physiological relevance of such models is further enhanced by the measurement of biomarkers (e.g., key events of pathways), organ specific functionality, and more comprehensive assessment cell responses by high-content methods. These approaches are still rarely combined to create microphysiological systems. The complexity of the combination of these technologies can generate results closer to the in vivo situation but increases the number of parameters to control, bringing some new challenges. In fact, we do not argue that all cell culture needs to be that sophisticated. The efforts taken are determined by the purpose of our experiments and tests. If only a very specific molecular target to cell response is of interest, a very simple model, which reflects this, might be much more suited to allow standardization and high-throughput. However, the less defined the end point of interest and cellular response are, the better we should approximate organ- or tissue-like culture conditions to make physiological responses more probable. Besides these technologic advances, important progress in the quality assurance and reporting on cell cultures as well as the validation of cellular test systems brings the utility of cell cultures to a new level. The advancement and broader implementation of Good Cell Culture Practice (GCCP) is key here. In toxicology, this is a major prerequisite for meaningful and reliable results, ultimately

  8. Radiosensitivity of primary cultured fish cells with different ploidy

    International Nuclear Information System (INIS)

    Mitani, Hiroshi; Egami, Nobuo; Kobayashi, Hiromu.

    1986-01-01

    The radiosensitivity of primary cultured goldfish cells (Carassius auratus) was investigated by colony formation assay. The radiosensitivity of cells from two varieties of goldfish, which show different sensitivity to lethal effect of ionizing radiation in vivo, was almost identical. Primary cultured cells from diploid, triploid and tetraploid fish retained their DNA content as measured by microfluorometry, and the nuclear size increases as ploidy increases. However, radiosensitivity was not related to ploidy. (author)

  9. Multizone Paper Platform for 3D Cell Cultures

    Science.gov (United States)

    Derda, Ratmir; Hong, Estrella; Mwangi, Martin; Mammoto, Akiko; Ingber, Donald E.; Whitesides, George M.

    2011-01-01

    In vitro 3D culture is an important model for tissues in vivo. Cells in different locations of 3D tissues are physiologically different, because they are exposed to different concentrations of oxygen, nutrients, and signaling molecules, and to other environmental factors (temperature, mechanical stress, etc). The majority of high-throughput assays based on 3D cultures, however, can only detect the average behavior of cells in the whole 3D construct. Isolation of cells from specific regions of 3D cultures is possible, but relies on low-throughput techniques such as tissue sectioning and micromanipulation. Based on a procedure reported previously (“cells-in-gels-in-paper” or CiGiP), this paper describes a simple method for culture of arrays of thin planar sections of tissues, either alone or stacked to create more complex 3D tissue structures. This procedure starts with sheets of paper patterned with hydrophobic regions that form 96 hydrophilic zones. Serial spotting of cells suspended in extracellular matrix (ECM) gel onto the patterned paper creates an array of 200 micron-thick slabs of ECM gel (supported mechanically by cellulose fibers) containing cells. Stacking the sheets with zones aligned on top of one another assembles 96 3D multilayer constructs. De-stacking the layers of the 3D culture, by peeling apart the sheets of paper, “sections” all 96 cultures at once. It is, thus, simple to isolate 200-micron-thick cell-containing slabs from each 3D culture in the 96-zone array. Because the 3D cultures are assembled from multiple layers, the number of cells plated initially in each layer determines the spatial distribution of cells in the stacked 3D cultures. This capability made it possible to compare the growth of 3D tumor models of different spatial composition, and to examine the migration of cells in these structures. PMID:21573103

  10. Feeding Frequency Affects Cultured Rat Pituitary Cells in Low Gravity

    Science.gov (United States)

    Hymer, W. C.; Grindeland, R. E.; Salada, T.; Cenci, R.; Krishnan, K.; Mukai, C.; Nagaoka, S.

    1996-01-01

    In this report, we describe the results of a rat pituitary cell culture experiment done on STS-65 in which the effect of cell feeding on the release of the six anterior pituitary hormones was studied. We found complex microgravity related interactions between the frequency of cell feeding and the quantity and quality (i.e. biological activity) of some of the six hormones released in flight. Analyses of growth hormone (GH) released from cells into culture media on different mission days using gel filtration and ion exchange chromatography yielded qualitatively similar results between ground and flight samples. Lack of cell feeding resulted in extensive cell clumping in flight (but not ground) cultures. Vigorous fibroblast growth occurred in both ground and flight cultures fed 4 times. These results are interpreted within the context of autocrine and or paracrine feedback interactions. Finally the payload specialist successfully prepared a fresh trypsin solution in microgravity, detached the cells from their surface and reinserted them back into the culture chamber. These cells reattached and continued to release hormone in microgravity. In summary, this experiment shows that pituitary cells are microgravity sensitive and that coupled operations routinely associated with laboratory cel1 culture can also be accomplished in low gravity.

  11. Radiation adaptive response for the growth of cultured glial cells

    International Nuclear Information System (INIS)

    Suzuki, S.; Miura, Y.; Kano, M.; Toda, T.; Urano, S.

    2003-01-01

    Full text: To examine the molecular mechanism of radiation adaptive response (RAR) for the growth of cultured glial cells and to investigate the influence of aging on the response, glial cells were cultured from young and aged rats (1 month and 24 months old). RAR for the growth of glial cells conditioned with a low dose of X-rays and subsequently exposed to a high dose of X-rays was examined for cell number and BrdU incorporation. Involvement of the subcellular signaling pathway factors in RAR was investigated using their inhibitors, activators and mutated glial cells. RAR was observed in cells cultured from young rats, but was not in cells from aged rats. The inhibitors of protein kinase C (PKC) and DNA-dependent protein kinase (DNA-PK) or phosphatidylinositol 3-kinase (PI3K) suppressed RAR. The activators of PKC instead of low dose irradiation also caused RAR. Moreover, glial cells cultured from severe combined immunodeficiency (scid) mice (CB-17 scid) and ataxia-telangiectasia (AT) cells from AT patients showed no RAR. These results indicated that PKC, ATM, DNAPK and/or PI3K were involved in RAR for growth and BrdU incorporation of cultured glial cells and RAR decreased with aging. Proteomics data of glial cells exposed to severe stress of H 2 O 2 or X-rays also will be presented in the conference since little or no difference has not been observed with slight stress yet

  12. Controlling the diversity of cell populations in a stem cell culture

    NARCIS (Netherlands)

    Heo, Inha; Clevers, Hans

    2015-01-01

    Culturing intestinal stem cells into 3D organoids results in heterogeneous cell populations, reflecting the in vivo cell type diversity. In a recent paper published in Nature, Wang et al. established a culture condition for a highly homogeneous population of intestinal stem cells.

  13. Novel culturing platform for brain slices and neuronal cells

    DEFF Research Database (Denmark)

    Svendsen, Winnie Edith; Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya

    2015-01-01

    In this paper we demonstrate a novel culturing system for brain slices and neuronal cells, which can control the concentration of nutrients and the waste removal from the culture by adjusting the fluid flow within the device. The entire system can be placed in an incubator. The system has been...... tested successfully with brain slices and PC12 cells. The culture substrate can be modified using metal electrodes and/or nanostructures for conducting electrical measurements while culturing and for better mimicking the in vivo conditions....

  14. Stimulation and support of haemopoietic stem cell proliferation by irradiated stroma cell colonies in bone marrow cell culture in vitro

    International Nuclear Information System (INIS)

    Mori, K.J.; Izumi, Hiroko; Seto, Akira

    1981-01-01

    A culture system was established in which haemopoietic stem cells can undergo a recovery proliferation after a depletion of the stem cells, completely in vitro. To elucidate the source of the stimulatory factors, normal bone marrow cells were overlayed on top of the irradiated adherent 'stromal' cell colonies in the bone marrow cell culture. This stimulated the proliferation of haemopoietic stem cells in the cultured cells in suspension. The present results indicate that the stromal cells produce factors which stimulate stem cell proliferation. Whether the stimulation is evoked by direct cell-cell interactions or by humoral factors is as yet to be studied. (author)

  15. Quantitative volumetric Raman imaging of three dimensional cell cultures

    Science.gov (United States)

    Kallepitis, Charalambos; Bergholt, Mads S.; Mazo, Manuel M.; Leonardo, Vincent; Skaalure, Stacey C.; Maynard, Stephanie A.; Stevens, Molly M.

    2017-03-01

    The ability to simultaneously image multiple biomolecules in biologically relevant three-dimensional (3D) cell culture environments would contribute greatly to the understanding of complex cellular mechanisms and cell-material interactions. Here, we present a computational framework for label-free quantitative volumetric Raman imaging (qVRI). We apply qVRI to a selection of biological systems: human pluripotent stem cells with their cardiac derivatives, monocytes and monocyte-derived macrophages in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies and cytoskeletal structures in 3D with unprecedented biomolecular specificity for vibrational microspectroscopy.

  16. Validation of shortened 2-day sterility testing of mesenchymal stem cell-based therapeutic preparation on an automated culture system.

    Science.gov (United States)

    Lysák, Daniel; Holubová, Monika; Bergerová, Tamara; Vávrová, Monika; Cangemi, Giuseppina Cristina; Ciccocioppo, Rachele; Kruzliak, Peter; Jindra, Pavel

    2016-03-01

    Cell therapy products represent a new trend of treatment in the field of immunotherapy and regenerative medicine. Their biological nature and multistep preparation procedure require the application of complex release criteria and quality control. Microbial contamination of cell therapy products is a potential source of morbidity in recipients. The automated blood culture systems are widely used for the detection of microorganisms in cell therapy products. However the standard 2-week cultivation period is too long for some cell-based treatments and alternative methods have to be devised. We tried to verify whether a shortened cultivation of the supernatant from the mesenchymal stem cell (MSC) culture obtained 2 days before the cell harvest could sufficiently detect microbial growth and allow the release of MSC for clinical application. We compared the standard Ph. Eur. cultivation method and the automated blood culture system BACTEC (Becton Dickinson). The time to detection (TTD) and the detection limit were analyzed for three bacterial and two fungal strains. The Staphylococcus aureus and Pseudomonas aeruginosa were recognized within 24 h with both methods (detection limit ~10 CFU). The time required for the detection of Bacillus subtilis was shorter with the automated method (TTD 10.3 vs. 60 h for 10-100 CFU). The BACTEC system reached significantly shorter times to the detection of Candida albicans and Aspergillus brasiliensis growth compared to the classical method (15.5 vs. 48 and 31.5 vs. 48 h, respectively; 10-100 CFU). The positivity was demonstrated within 48 h in all bottles, regardless of the size of the inoculum. This study validated the automated cultivation system as a method able to detect all tested microorganisms within a 48-h period with a detection limit of ~10 CFU. Only in case of B. subtilis, the lowest inoculum (~10 CFU) was not recognized. The 2-day cultivation technique is then capable of confirming the microbiological safety of MSC and

  17. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  18. Surface modified alginate microcapsules for 3D cell culture

    Science.gov (United States)

    Chen, Yi-Wen; Kuo, Chiung Wen; Chueh, Di-Yen; Chen, Peilin

    2016-06-01

    Culture as three dimensional cell aggregates or spheroids can offer an ideal platform for tissue engineering applications and for pharmaceutical screening. Such 3D culture models, however, may suffer from the problems such as immune response and ineffective and cumbersome culture. This paper describes a simple method for producing microcapsules with alginate cores and a thin shell of poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG) to encapsulate mouse induced pluripotent stem (miPS) cells, generating a non-fouling surface as an effective immunoisolation barrier. We demonstrated the trapping of the alginate microcapsules in a microwell array for the continuous observation and culture of a large number of encapsulated miPS cells in parallel. miPS cells cultured in the microcapsules survived well and proliferated to form a single cell aggregate. Droplet formation of monodisperse microcapsules with controlled size combined with flow cytometry provided an efficient way to quantitatively analyze the growth of encapsulated cells in a high-throughput manner. The simple and cost-effective coating technique employed to produce the core-shell microcapsules could be used in the emerging field of cell therapy. The microwell array would provide a convenient, user friendly and high-throughput platform for long-term cell culture and monitoring.

  19. PDMS/glass microfluidic cell culture system for cytotoxicity tests and cells passage

    DEFF Research Database (Denmark)

    Ziolkowska, K.; Jedrych, E.; Kwapiszewski, R.

    2010-01-01

    In this paper, hybrid (PDMS/glass) microfluidic cell culture system (MCCS) integrated with the concentration gradient generator (CGG) is presented. PDMS gas permeability enabled cells' respiration in the fabricated microdevices and excellent glass hydrophilicity allowed successful cells' seeding...

  20. Application of cell co-culture system to study fat and muscle cells.

    Science.gov (United States)

    Pandurangan, Muthuraman; Hwang, Inho

    2014-09-01

    Animal cell culture is a highly complex process, in which cells are grown under specific conditions. The growth and development of these cells is a highly unnatural process in vitro condition. Cells are removed from animal tissues and artificially cultured in various culture vessels. Vitamins, minerals, and serum growth factors are supplied to maintain cell viability. Obtaining result homogeneity of in vitro and in vivo experiments is rare, because their structure and function are different. Living tissues have highly ordered complex architecture and are three-dimensional (3D) in structure. The interaction between adjacent cell types is quite distinct from the in vitro cell culture, which is usually two-dimensional (2D). Co-culture systems are studied to analyze the interactions between the two different cell types. The muscle and fat co-culture system is useful in addressing several questions related to muscle modeling, muscle degeneration, apoptosis, and muscle regeneration. Co-culture of C2C12 and 3T3-L1 cells could be a useful diagnostic tool to understand the muscle and fat formation in animals. Even though, co-culture systems have certain limitations, they provide a more realistic 3D view and information than the individual cell culture system. It is suggested that co-culture systems are useful in evaluating the intercellular communication and composition of two different cell types.

  1. Microfluidic bioreactors for culture of non-adherent cells

    DEFF Research Database (Denmark)

    Shah, Pranjul Jaykumar; Vedarethinam, Indumathi; Kwasny, Dorota

    2011-01-01

    Microfluidic bioreactors (μBR) are becoming increasingly popular for cell culture, sample preparation and analysis in case of routine genetic and clinical diagnostics. We present a novel μBR for non-adherent cells designed to mimic in vivo perfusion of cells based on diffusion of media through...

  2. Enhanced casein kinase II activity in human tumour cell cultures

    DEFF Research Database (Denmark)

    Prowald, K; Fischer, H; Issinger, O G

    1984-01-01

    Casein kinase II (CKII) activity is enhanced as much as 2-3 fold in established and 4-5-fold in transformed human cell lines when compared to that of fibroblasts and primary human tumour cell cultures where CKII activity never exceeded a basic level. The high activity of CKII in transformed cells...

  3. Protein biosynthesis in cultured human hair follicle cells.

    Science.gov (United States)

    Weterings, P J; Vermorken, A J; Bloemendal, H

    1980-10-31

    A new technique has been used for culturing human keratinocytes. The cells grow on the basement membrane-like capsules of bovine lenses. Lens cells were removed from the capsules by rigid trypsinization. In order to exclude any contamination with remaining living cells the isolated capsules were irradiated with X-rays at a dose of 10,000 rad. In this way human epithelial cells can be brought in culture from individual hair follicles. Since feeder cells are not used in this culture technique, the biosynthesis of keratinocyte proteins can be studied in these cultures. The newly synthesized proteins can be separated into a water-soluble, a urea-soluble, and a urea-insoluble fraction. Product analysis has been performed on the first two fractions revealing protein patterns identical to those of intact hair follicles. Product analysis of the urea-soluble fractions of microdissected hair follicles shows that the protein pattern of the cultured keratinocytes resembles the protein pattern of the hair follicle sheath. Studies on the metabolism of benzo(a)pyrene revealed that the enzyme aryl hydrocarbon hydroxylase (AHH) is present in cultured hair follicle cells. A possible use of our culture system for eventual detection of inherited predisposition for smoking-dependent lung cancer is discussed.

  4. Production and release of infectious hepatitis C virus from human liver cell cultures in the three-dimensional radial-flow bioreactor

    International Nuclear Information System (INIS)

    Aizaki, Hideki; Nagamori, Seishi; Matsuda, Mami; Kawakami, Hayato; Hashimoto, Osamu; Ishiko, Hiroaki; Kawada, Masaaki; Matsuura, Tomokazu; Hasumura, Satoshi; Matsuura, Yoshiharu; Suzuki, Tetsuro; Miyamura, Tatsuo

    2003-01-01

    Lack of efficient culture systems for hepatitis C virus (HCV) has been a major obstacle in HCV research. Human liver cells grown in a three-dimensional radial-flow bioreactor were successfully infected following inoculation with plasma from an HCV carrier. Subsequent detection of increased HCV RNA suggested viral replication. Furthermore, transfection of HCV RNA transcribed from full-length cDNA also resulted in the production and release of HCV virions into supernatant. Infectivity was shown by successful secondary passage to a new culture. Introduction of mutations in RNA helicase and polymerase regions of HCV cDNA abolished virus replication, indicating that reverse genetics of this system is possible. The ability to replicate and detect the extracellular release of HCV might provide clues with regard to the persistent nature of HCV infection. It will also accelerate research into the pathogenicity of HCV, as well as the development of prophylactic agents and new therapy

  5. Immunoproteomic analysis of antibody in lymphocyte supernatant in patients with typhoid fever in Bangladesh.

    Science.gov (United States)

    Charles, Richelle C; Liang, Li; Khanam, Farhana; Sayeed, M Abu; Hung, Chris; Leung, Daniel T; Baker, Stephen; Ludwig, Albrecht; Harris, Jason B; Larocque, Regina C; Calderwood, Stephen B; Qadri, Firdausi; Felgner, Philip L; Ryan, Edward T

    2014-03-01

    We have previously shown that an assay based on detection of anti-Salmonella enterica serotype Typhi antibodies in supernatant of lymphocytes harvested from patients presenting with typhoid fever (antibody in lymphocyte supernatant [ALS] assay) can identify 100% of patients with blood culture-confirmed typhoid fever in Bangladesh. In order to define immunodominant proteins within the S. Typhi membrane preparation used as antigen in these prior studies and to identify potential biomarkers unique to S. Typhi bacteremic patients, we probed microarrays containing 2,724 S. Typhi proteins with ALS collected at the time of clinical presentation from 10 Bangladeshis with acute typhoid fever. We identified 62 immunoreactive antigens when evaluating both the IgG and IgA responses. Immune responses to 10 of these antigens discriminated between individuals with acute typhoid infection and healthy control individuals from areas where typhoid infection is endemic, as well as Bangladeshi patients presenting with fever who were subsequently confirmed to have a nontyphoid illness. Using an ALS enzyme-linked immunosorbent assay (ELISA) format and purified antigen, we then confirmed that immune responses against the antigen with the highest immunoreactivity (hemolysin E [HlyE]) correctly identified individuals with acute typhoid or paratyphoid fever in Dhaka, Bangladesh. These observations suggest that purified antigens could be used with ALS and corresponding acute-phase activated B lymphocytes in diagnostic platforms to identify acutely infected patients, even in areas where enteric fever is endemic.

  6. Control of fibronectin synthesis by rat granulosa cells in culture

    International Nuclear Information System (INIS)

    Skinner, M.K.; Dorrington, J.H.

    1984-01-01

    The secreted and cellular [ 35 S]methionine-radiolabeled proteins of cultured rat granulosa cells were separated by electrophoresis on sodium dodecylsulfate (SDS) polyacrylamide gradient slab gels. From 24 to 72 h of culture FSH increased the intensity of labeling of most of the secreted proteins. A 220,000-dalton protein, however, increased in intensity only in control cultures and became the major secreted protein after 72 h, comprising 20% of the total radiolabeled proteins. This protein was identified as fibronectin by immunoprecipitation. There was no increase in the secreted or cellular fibronectin in FSH- or testosterone- and insulin-treated cultures. These studies indicate that a component of extracellular matrix is a major secretory product of unstimulated immature granulosa cells. As hormones induce the differentiated functions of granulosa cells in culture, the secretion of fibronectin is inhibited

  7. Cytotoxicity of TSP in 3D Agarose Gel Cultured Cell.

    Directory of Open Access Journals (Sweden)

    Song-I Chun

    Full Text Available A reference reagent, 3-(trimethylsilyl propionic-2, 2, 3, 3-d4 acid sodium (TSP, has been used frequently in nuclear magnetic resonance (NMR and magnetic resonance spectroscopy (MRS as an internal reference to identify cell and tissue metabolites, and determine chemical and protein structures. This reference material has been exploited for the quantitative and dynamic analyses of metabolite spectra acquired from cells. The aim of this study was to evaluate the cytotoxicity of TSP on three-dimensionally, agarose gel, cultured cells.A human osteosarcoma cell line (MG-63 was selected, and cells were three dimensionally cultured for two weeks in an agarose gel. The culture system contained a mixture of conventional culture medium and various concentrations (0, 1, 3, 5, 7, 10, 20 30 mM of TSP. A DNA quantification assay was conducted to assess cell proliferation using Quant-iT PicoGreen dsDNA reagent and kit, and cell viability was determined using a LIVE/DEAD Viability/Cytotoxicity kit. Both examinations were performed simultaneously at 1, 3, 7 and 14 days from cell seeding.In this study, the cytotoxicity of TSP in the 3D culture of MG-63 cells was evaluated by quantifying DNA (cell proliferation and cell viability. High concentrations of TSP (from 10 to 30 mM reduced both cell proliferation and viability (to 30% of the control after one week of exposure, but no such effects were found using low concentrations of TSP (0-10 mM.This study shows that low concentrations of TSP in 3D cell culture medium can be used for quantitative NMR or MRS examinations for up to two weeks post exposure.

  8. Microfluidic perfusion culture of human induced pluripotent stem cells under fully defined culture conditions.

    Science.gov (United States)

    Yoshimitsu, Ryosuke; Hattori, Koji; Sugiura, Shinji; Kondo, Yuki; Yamada, Rotaro; Tachikawa, Saoko; Satoh, Taku; Kurisaki, Akira; Ohnuma, Kiyoshi; Asashima, Makoto; Kanamori, Toshiyuki

    2014-05-01

    Human induced pluripotent stem cells (hiPSCs) are a promising cell source for drug screening. For this application, self-renewal or differentiation of the cells is required, and undefined factors in the culture conditions are not desirable. Microfluidic perfusion culture allows the production of small volume cultures with precisely controlled microenvironments, and is applicable to high-throughput cellular environment screening. Here, we developed a microfluidic perfusion culture system for hiPSCs that uses a microchamber array chip under defined extracellular matrix (ECM) and culture medium conditions. By screening various ECMs we determined that fibronectin and laminin are appropriate for microfluidic devices made out of the most popular material, polydimethylsiloxane (PDMS). We found that the growth rate of hiPSCs under pressure-driven perfusion culture conditions was higher than under static culture conditions in the microchamber array. We applied our new system to self-renewal and differentiation cultures of hiPSCs, and immunocytochemical analysis showed that the state of the hiPSCs was successfully controlled. The effects of three antitumor drugs on hiPSCs were comparable between microchamber array and 96-well plates. We believe that our system will be a platform technology for future large-scale screening of fully defined conditions for differentiation cultures on integrated microfluidic devices. © 2013 Wiley Periodicals, Inc.

  9. Quantitative volumetric Raman imaging of three dimensional cell cultures

    KAUST Repository

    Kallepitis, Charalambos

    2017-03-22

    The ability to simultaneously image multiple biomolecules in biologically relevant three-dimensional (3D) cell culture environments would contribute greatly to the understanding of complex cellular mechanisms and cell–material interactions. Here, we present a computational framework for label-free quantitative volumetric Raman imaging (qVRI). We apply qVRI to a selection of biological systems: human pluripotent stem cells with their cardiac derivatives, monocytes and monocyte-derived macrophages in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies and cytoskeletal structures in 3D with unprecedented biomolecular specificity for vibrational microspectroscopy.

  10. Adherence of Moraxella bovis to cell cultures of bovine origin.

    Science.gov (United States)

    Annuar, B O; Wilcox, G E

    1985-09-01

    The adherence of five strains of Moraxella bovis to cell cultures was investigated. M bovis adhered to cultures of bovine corneal epithelial and Madin-Darby bovine kidney cells but not to cell types of non-bovine origin. Both piliated and unpiliated strains adhered but piliated strains adhered to a greater extent than unpiliated strains. Antiserum against pili of one strain inhibited adherence of piliated strains but caused only slight inhibition of adherence to the unpiliated strains. Treatment of bacteria with magnesium chloride caused detachment of pili from the bacterial cell and markedly inhibited adherence of piliated strains but caused only slight inhibition of adherence by the unpiliated strains. The results suggested that adhesion of piliated strains to cell cultures was mediated via pili but that adhesins other than pili may be involved in the attachment of unpiliated strains of M bovis to cells.

  11. Long-term culture and differentiation of porcine red bone marrow hematopoietic cells co-cultured with immortalized mesenchymal cells.

    Science.gov (United States)

    Garba, Abubakar; Acar, Delphine D; Roukaerts, Inge D M; Desmarets, Lowiese M B; Devriendt, Bert; Nauwynck, Hans J

    2017-09-01

    Mesenchymal cells are multipotent stromal cells with self-renewal, differentiation and immunomodulatory capabilities. We aimed to develop a co-culture model for differentiating hematopoietic cells on top of immortalized mesenchymal cells for studying interactions between hematopoietic and mesenchymal cells, useful for adequately exploring the therapeutic potential of mesenchymal cells. In this study, we investigated the survival, proliferation and differentiation of porcine red bone marrow hematopoietic cells co-cultured with immortalized porcine bone marrow mesenchymal cells for a period of five weeks. Directly after collection, primary porcine bone marrow mesenchymal cells adhered firmly to the bottom of the culture plates and showed a fibroblast-like appearance, one week after isolation. Upon immortalization, porcine bone marrow mesenchymal cells were continuously proliferating. They were positive for simian virus 40 (SV40) large T antigen and the mesenchymal cell markers CD44 and CD55. Isolated red bone marrow cells were added to these immortalized mesenchymal cells. Five weeks post-seeding, 92±6% of the red bone marrow hematopoietic cells were still alive and their number increased 3-fold during five weekly subpassages on top of the immortalized mesenchymal cells. The red bone marrow hematopoietic cells were originally small and round; later, the cells increased in size. Some of them became elongated, while others remained round. Tiny dendrites appeared attaching hematopoietic cells to the underlying immortalized mesenchymal cells. Furthermore, weekly differential-quick staining of the cells indicated the presence of monoblasts, monocytes, macrophages and lymphocytes in the co-cultures. At three weeks of co-culture, flow cytometry analysis showed an increased surface expression of CD172a, CD14, CD163, CD169, CD4 and CD8 up to 37±0.8%, 40±8%, 41±4%, 23±3% and 19±5% of the hematopoietic cells, respectively. In conclusion, continuous mesenchymal cell

  12. Cell-cycle distributions and radiation responses of Chinese hamster cells cultured continuously under hypoxic conditions

    International Nuclear Information System (INIS)

    Tokita, N.; Carpenter, S.G.; Raju, M.R.

    1984-01-01

    Cell-cycle distributions were measured by flow cytometry for Chinese hamster (CHO) cells cultured continuously under hypoxic conditions. DNA histograms showed an accumulation of cells in the early S phase followed by a traverse delay through the S phase, and a G 2 block. During hypoxic culturing, cell viability decreased rapidly to less than 0.1% at 120 h. Radiation responses for cells cultured under these conditions showed an extreme radioresistance at 72 h. Results suggest that hypoxia induces a condition similar to cell synchrony which itself changes the radioresistance of hypoxic cells. (author)

  13. In vitro production of azadirachtin from cell suspension cultures of ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    proven effective in the control of agricultural pests in an environmentally ..... Prakash G and Srivastava A K 2005 Statistical media optimization for cell growth and ... Juss. suspension cultures; Process Biochemistry 40 3795–3800. Prakash G ...

  14. Establishment of the callus and cell suspension culture of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-05

    Oct 5, 2009 ... Full Length Research Paper. Establishment of the callus ... study provided an efficient way for E. angustifolia cell suspension culture to produce secondary metabolite. .... was also observed that in these treatments the stem.

  15. Enhancement of Diosgenin Production in Plantlet and Cell Cultures ...

    African Journals Online (AJOL)

    Enhancement of Diosgenin Production in Plantlet and Cell Cultures of Dioscorea zingiberensis by Palmarumycin C13 from the Endophytic fungus, Berkleasmium sp. Dzf12. Y Mou, K Zhou, D Xu, R Yu, J Li, C Yin, L Zhou ...

  16. Establishment of sorghum cell suspension culture system for ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-03-18

    Mar 18, 2008 ... Additionally, sorghum cell suspension cultures have been initiated from the friable ... proteomics technologies. The field of proteomics is .... air dried at room temperature and resuspended in 2 ml of urea buffer [9 M urea, 2 M ...

  17. Immunocytochemical characterization of explant cultures of human prostatic stromal cells

    NARCIS (Netherlands)

    A. Kooistra (Anko); A.M.J. Elissen (Arianne ); J.J. Konig (Josee); M. Vermey; Th.H. van der Kwast (Theo); J.C. Romijn (Johannes); F.H. Schröder (Fritz)

    1995-01-01

    textabstractThe study of stromal-epithelial interactions greatly depends on the ability to culture both cell types separately, in order to permit analysis of their interactions under defined conditions in reconstitution experiments. Here we report the establishment of explant cultures of human

  18. Epithelial cell detachment by Porphyromonas gingivalis biofilm and planktonic cultures

    NARCIS (Netherlands)

    Huang, L.; van Loveren, C.; Ling, J.; Wei, X.; Crielaard, W.; Deng, D.M.

    2016-01-01

    Porphyromonas gingivalis is present as a biofilm at the sites of periodontal infections. The detachment of gingival epithelial cells induced by P. gingivalis biofilms was examined using planktonic cultures as a comparison. Exponentially grown planktonic cultures or 40-h biofilms were co-incubated

  19. Free-energy carriers in human cultured muscle cells

    NARCIS (Netherlands)

    Bolhuis, P. A.; de Zwart, H. J.; Ponne, N. J.; de Jong, J. M.

    1985-01-01

    Creatine phosphate (CrP), adenosine triphosphate (ATP), creatine kinase (CK), adenylate kinase (AK), protein, and DNA were quantified in human muscle cell cultures undergoing transition from dividing myoblasts to multinucleate myotubes. CrP is negligible in cultures grown in commonly applied media

  20. Radiation effects on cultured human lymphoid cells

    International Nuclear Information System (INIS)

    Johansson, L.; Nilsson, K.; Carlsson, J.; Larsson, B.; Jakobsson, P.

    1981-01-01

    The cloning efficiency of human normal and malignant lymphoid cells is usually low. Radiation effects in vitro on such cells can therefore not be analysed with conventional cloning. However, this problem can be circumscribed by using the growth extrapolation method. A panel of human leukemia-lymphoma cell-lines representing Epstein-Barr virus carrying lymphoblastoid cells of presumed non-neoplastic derivation and neoplastic T- and B-lymphocytes was used to test the efficiency of this method. The sensitivity to radiation could be determined for all these cell types. The growth extrapolation method gave generally the same result as conventional cloning demonstrated by comparison with one exceptional cell-line with capacity for cloning in agar. The sensitivity varied largely between the different cell types. A common feature was that none of the cell lines had a good capacity to accumulate sublethal radiation injury. (Auth.)

  1. Radiosensitivity of cultured insect cells: II. Diptera

    International Nuclear Information System (INIS)

    Koval, T.M.

    1983-01-01

    The radiosensitivity of five dipteran cell lines representing three mosquito genera and one fruit fly genus were examined. These lines are: (1) ATC-10, Aedes aegypti; (2) RU-TAE-14, Toxorhynchites amboinensis; (3) RU-ASE-2A, Anopheles stephensi; (4) WR69-DM-1, Drosophila melanogaster; and (5) WR69-DM-2, Drosophila melanogaster. Population doubling times for these lines range from approximately 16 to 48 hr. Diploid chromosome numbers are six for the mosquito cells and eight for the fruit fly cells D 0 values are 5.1 and 6.5 Gy for the Drosophila cell lines and 3.6, 6.2, and 10.2 Gy for the mosquito cell lines. The results of this study demonstrate that dipteran insect cells are a few times more resistant to radiation than mammalian cells, but not nearly as radioresistant as lepidopteran cells

  2. Impact of cell culture process changes on endogenous retrovirus expression.

    Science.gov (United States)

    Brorson, Kurt; De Wit, Christina; Hamilton, Elizabeth; Mustafa, Mehnaz; Swann, Patrick G; Kiss, Robert; Taticek, Ron; Polastri, Gian; Stein, Kathryn E; Xu, Yuan

    2002-11-05

    Cell culture process changes (e.g., changes in scale, medium formulation, operational conditions) and cell line changes are common during the development life cycle of a therapeutic protein. To ensure that the impact of such process changes on product quality and safety is minimal, it is standard practice to compare critical product quality and safety attributes before and after the changes. One potential concern introduced by cell culture process improvements is the possibility of increased endogenous retrovirus expression to a level above the clearance capability of the subsequent purification process. To address this, retrovirus expression was measured in scaled down and full production scaled Chinese hamster ovary (CHO) cell cultures of four monoclonal antibodies and one recombinant protein before and after process changes. Two highly sensitive, quantitative (Q)-PCR-based assays were used to measure endogenous retroviruses. It is shown that cell culture process changes that primarily alter media components, nutrient feed volume, seed density, cell bank source (i.e., master cell bank vs. working cell bank), and vial size, or culture scale, singly or in combination, do not impact the rate of retrovirus expression to an extent greater than the variability of the Q-PCR assays (0.2-0.5 log(10)). Cell culture changes that significantly alter the metabolic state of the cells and/or rates of protein expression (e.g., pH and temperature shifts, NaButyrate addition) measurably impact the rate of retrovirus synthesis (up to 2 log(10)). The greatest degree of variation in endogenous retrovirus expression was observed between individual cell lines (up to 3 log(10)). These data support the practice of measuring endogenous retrovirus output for each new cell line introduced into manufacturing or after process changes that significantly increase product-specific productivity or alter the metabolic state, but suggest that reassessment of retrovirus expression after other

  3. 5-Fluorouracil-induced apoptosis in cultured oral cancer cells.

    Science.gov (United States)

    Tong, D; Poot, M; Hu, D; Oda, D

    2000-03-01

    Chemotherapy is commonly used to treat advanced oral squamous cell carcinoma (SCC) and is known to kill cancer cells through apoptosis. Our hypothesis states that 5-fluorouracil (5FU) also kills cultured oral epithelial cells through programmed cell death or apoptosis. Cultured oral cancer cells were exposed to an optimum dose of 20 mg/ml of 5FU. Cells were analyzed for changes in cell cycle distribution and induction of cell death including apoptosis. Normal control, human papilloma virus-immortalized (PP), ATCC SCC cell line (CA1) and two primary oral SCC cell lines (CA3 and -4) were studied. Inhibition of apoptosis by a pan-caspase inhibitor was used. SYTO 11 flow cytometry showed increased apoptosis in all 5FU-treated cell cultures compared to untreated controls. The results show biological variation in apoptotic response. CA1 had the lowest apoptotic rate of the cancer cell lines at 1.5%. Next lowest was CA3, followed by CA4 and PP. In addition, alteration in the G1 and S phase fractions were found. Untreated CA1 showed 28% G1, 53% S compared to 43% G1, and 40% S of treated. We investigated the pathway of apoptosis using the pan-caspase inhibitor IDN-1529 by methylthiazolyl diphenyl tetrazolium bromide (MTT) colorimetric analysis. Results showed mild inhibition of cell death when cells were incubated with 50 microM IDN-1529 for 24 h. This suggests a probable caspase-dependent apoptotic pathway. In conclusion, our data suggest that 5FU induces oral cancer cell death through apoptosis and that biological variation exists between normal and cancer cells and between different types of cancer cells themselves. Our data indicate that cultures of a useful in vitro model for chemosensitivity assays are possible. Our results also suggest a caspase-dependent pathway for chemocytotoxicity in oral SCC.

  4. Human hematopoietic cell culture, transduction, and analyses

    DEFF Research Database (Denmark)

    Bonde, Jesper; Wirthlin, Louisa; Kohn, Donald B

    2008-01-01

    This unit provides methods for introducing genes into human hematopoietic progenitor cells. The Basic Protocol describes isolation of CD34(+) cells, transduction of these cells with a retroviral vector on fibronectin-coated plates, assaying the efficiency of transduction, and establishing long-te...

  5. Good Cell Culture Practice for stem cells and stem-cell-derived models.

    Science.gov (United States)

    Pamies, David; Bal-Price, Anna; Simeonov, Anton; Tagle, Danilo; Allen, Dave; Gerhold, David; Yin, Dezhong; Pistollato, Francesca; Inutsuka, Takashi; Sullivan, Kristie; Stacey, Glyn; Salem, Harry; Leist, Marcel; Daneshian, Mardas; Vemuri, Mohan C; McFarland, Richard; Coecke, Sandra; Fitzpatrick, Suzanne C; Lakshmipathy, Uma; Mack, Amanda; Wang, Wen Bo; Yamazaki, Daiju; Sekino, Yuko; Kanda, Yasunari; Smirnova, Lena; Hartung, Thomas

    2017-01-01

    The first guidance on Good Cell Culture Practice (GCCP) dates back to 2005. This document expands this to include aspects of quality assurance for in vitro cell culture focusing on the increasingly diverse cell types and culture formats used in research, product development, testing and manufacture of biotechnology products and cell-based medicines. It provides a set of basic principles of best practice that can be used in training new personnel, reviewing and improving local procedures, and helping to assure standard practices and conditions for the comparison of data between laboratories and experimentation performed at different times. This includes recommendations for the documentation and reporting of culture conditions. It is intended as guidance to facilitate the generation of reliable data from cell culture systems, and is not intended to conflict with local or higher level legislation or regulatory requirements. It may not be possible to meet all recommendations in this guidance for practical, legal or other reasons. However, when it is necessary to divert from the principles of GCCP, the risk of decreasing the quality of work and the safety of laboratory staff should be addressed and any conclusions or alternative approaches justified. This workshop report is considered a first step toward a revised GCCP 2.0.

  6. Primary microglia isolation from mixed glial cell cultures of neonatal rat brain tissue.

    Science.gov (United States)

    Tamashiro, Tami T; Dalgard, Clifton Lee; Byrnes, Kimberly R

    2012-08-15

    by density gradient centrifugation to yield primary microglia. However, the centrifugation is of moderate length (45 min) and may cause cellular damage and activation, as well as, cause enriched microglia and other cellular populations. Another protocol has been utilized to isolate primary microglia in a variety of organisms by prolonged (16 hr) shaking while in culture. After shaking, the media supernatant is centrifuged to isolate microglia. This longer two-step isolation method may also perturb microglial function and activation. We chiefly utilize the following microglia isolation protocol in our laboratory for a number of reasons: (1) primary microglia simulate in vivo biology more faithfully than immortalized rodent microglia cell lines, (2) nominal mechanical disruption minimizes potential cellular dysfunction or activation, and (3) sufficient yield can be obtained without passage of the mixed glial cell cultures. It is important to note that this protocol uses brain tissue from neonatal rat pups to isolate microglia and that using older rats to isolate microglia can significantly impact the yield, activation status, and functional properties of isolated microglia. There is evidence that aging is linked with microglia dysfunction, increased neuroinflammation and neurodegenerative pathologies, so previous studies have used ex vivo adult microglia to better understand the role of microglia in neurodegenerative diseases where aging is important parameter. However, ex vivo microglia cannot be kept in culture for prolonged periods of time. Therefore, while this protocol extends the life of primary microglia in culture, it should be noted that the microglia behave differently from adult microglia and in vitro studies should be carefully considered when translated to an in vivo setting.

  7. Cell proliferation and radiosensitivity of cow lymphocytes in culture

    International Nuclear Information System (INIS)

    Modave, C.; Fabry, L.; Leonard, A.

    1982-01-01

    The harlequin-staining technique has been used to study, after PHA-stimulation, the cell proliferation of cow lymphocytes in culture and to assess the radiosensitivity in first mitosis cells. At the 48 h fixation time, only 34% of the cells are in first mitosis whereas 55% are already in second and 11% in third mitosis. The exposure of cow lymphocytes to 200 rad X-rays result in the production of 16% dicentric chromosomes in first mitosis cells [fr

  8. Topological defects control collective dynamics in neural progenitor cell cultures

    Science.gov (United States)

    Kawaguchi, Kyogo; Kageyama, Ryoichiro; Sano, Masaki

    2017-04-01

    Cultured stem cells have become a standard platform not only for regenerative medicine and developmental biology but also for biophysical studies. Yet, the characterization of cultured stem cells at the level of morphology and of the macroscopic patterns resulting from cell-to-cell interactions remains largely qualitative. Here we report on the collective dynamics of cultured murine neural progenitor cells (NPCs), which are multipotent stem cells that give rise to cells in the central nervous system. At low densities, NPCs moved randomly in an amoeba-like fashion. However, NPCs at high density elongated and aligned their shapes with one another, gliding at relatively high velocities. Although the direction of motion of individual cells reversed stochastically along the axes of alignment, the cells were capable of forming an aligned pattern up to length scales similar to that of the migratory stream observed in the adult brain. The two-dimensional order of alignment within the culture showed a liquid-crystalline pattern containing interspersed topological defects with winding numbers of +1/2 and -1/2 (half-integer due to the nematic feature that arises from the head-tail symmetry of cell-to-cell interaction). We identified rapid cell accumulation at +1/2 defects and the formation of three-dimensional mounds. Imaging at the single-cell level around the defects allowed us to quantify the velocity field and the evolving cell density; cells not only concentrate at +1/2 defects, but also escape from -1/2 defects. We propose a generic mechanism for the instability in cell density around the defects that arises from the interplay between the anisotropic friction and the active force field.

  9. Characterization of glucocerebrosidase in peripheral blood cells and cultured blastoid cells

    NARCIS (Netherlands)

    Aerts, J. M.; Heikoop, J.; van Weely, S.; Donker-Koopman, W. E.; Barranger, J. A.; Tager, J. M.; Schram, A. W.

    1988-01-01

    We have characterized glucocerebrosidase in various cell types of peripheral blood of control subjects and in cultured human blastoid cells. The intracellular level of glucocerebrosidase in cultured blastoid cells (10-30 nmol substrate hydrolyzed/h.mg protein) resembles closely values observed for

  10. EXPLANTATION OF MESANGIAL CELL HILLOCKS - A METHOD FOR OBTAINING HUMAN MESANGIAL CELLS IN CULTURE

    NARCIS (Netherlands)

    MULLER, EW; KIM, Y; MICHAEL, AF; VERNIER, RL; VANDERHEM, GK; VANDERWOUDE, FJ

    A simple method is presented for selective cell culture of human mesangial cells using explanatation of mesangial cell hillocks. Glomeruli which had been incubated with collagenase were explanted on plastic tissue culture flasks. Three to 6 weeks after explantation, a rapidly growing multilayer of

  11. Introducing Mammalian Cell Culture and Cell Viability Techniques in the Undergraduate Biology Laboratory.

    Science.gov (United States)

    Bowey-Dellinger, Kristen; Dixon, Luke; Ackerman, Kristin; Vigueira, Cynthia; Suh, Yewseok K; Lyda, Todd; Sapp, Kelli; Grider, Michael; Crater, Dinene; Russell, Travis; Elias, Michael; Coffield, V McNeil; Segarra, Verónica A

    2017-01-01

    Undergraduate students learn about mammalian cell culture applications in introductory biology courses. However, laboratory modules are rarely designed to provide hands-on experience with mammalian cells or teach cell culture techniques, such as trypsinization and cell counting. Students are more likely to learn about cell culture using bacteria or yeast, as they are typically easier to grow, culture, and manipulate given the equipment, tools, and environment of most undergraduate biology laboratories. In contrast, the utilization of mammalian cells requires a dedicated biological safety cabinet and rigorous antiseptic techniques. For this reason, we have devised a laboratory module and method herein that familiarizes students with common cell culture procedures, without the use of a sterile hood or large cell culture facility. Students design and perform a time-efficient inquiry-based cell viability experiment using HeLa cells and tools that are readily available in an undergraduate biology laboratory. Students will become familiar with common techniques such as trypsinizing cells, cell counting with a hemocytometer, performing serial dilutions, and determining cell viability using trypan blue dye. Additionally, students will work with graphing software to analyze their data and think critically about the mechanism of death on a cellular level. Two different adaptations of this inquiry-based lab are presented-one for non-biology majors and one for biology majors. Overall, these laboratories aim to expose students to mammalian cell culture and basic techniques and help them to conceptualize their application in scientific research.

  12. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tissue culture media for human ex vivo tissue and cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture...

  13. Aromatase inhibitor (anastrozole) affects growth of endometrioma cells in culture.

    Science.gov (United States)

    Badawy, Shawky Z A; Brown, Shereene; Kaufman, Lydia; Wojtowycz, Martha A

    2015-05-01

    To study the effects of aromatase inhibitor (anastrozole) on the growth and estradiol secretion of endometrioma cells in culture. Endometrioma cells are grown in vitro until maximum growth before used in this study. This was done in the research laboratory for tissue culture, in an academic hospital. Testosterone at a concentration of 10 μg/mL was added as a substrate for the intracellular aromatase. In addition, aromatase inhibitor was added at a concentration of 200 and 300 μg/mL. The effect on cell growth and estradiol secretion is evaluated using Student's t-test. The use of testosterone increased estradiol secretion by endometrioma cells in culture. The use of aromatase inhibitor significantly inhibited the growth of endometrioma cells, and estradiol secretion. Aromatase inhibitor (anastrozole) may be an effective treatment for endometriosis due to inhibition of cellular aromatase. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Determination of thymidine in serum used for cell culture media

    International Nuclear Information System (INIS)

    Schaer, J.C.; Maurer, U.; Schindler, R.

    1978-01-01

    Thymidine concentrations in serum used for cell culture media were determined with an assay based on isotope dilution. In this assay, incorporation of (3H)-thymidine into DNA of cultured cells was measured in the presence of 5 and 20% serum as a function of the concentration of unlabeled thymidine added to the medium. Thymidine concentrations were measured using horse serum as well as fetal calf serum in the culture media. Dialysis of serum resulted in a reduction of thymidine levels by factors of at least 10

  15. Callus and cell suspension cultures of carnation

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1972-01-01

    Callus cultures of carnation, Dianthus caryophyllus L. ev. G. J. Sim, were grown on a synthetic medium of half strength Murashige and Skoog salts, 3 % sucrose, 100 mg/l of myo-inositol, 0.5 mg/l each of thiamin, HCl, pyridoxin, HCl and nicotinic acid and 10 g/l agar. Optimal concentrations...

  16. Improved Performance in Mammalian Cell Perfusion Cultures by Growth Inhibition.

    Science.gov (United States)

    Wolf, Moritz K F; Closet, Aurélie; Bzowska, Monika; Bielser, Jean-Marc; Souquet, Jonathan; Broly, Hervé; Morbidelli, Massimo

    2018-05-21

    Mammalian cell perfusion cultures represent a promising alternative to the current fed-batch technology for the production of various biopharmaceuticals. Long-term operation at a fixed viable cell density (VCD) requires a viable culture and a constant removal of excessive cells. Product loss in the cell removing bleed stream deteriorates the process yield. In this study, the authors investigate the use of chemical and environmental growth inhibition on culture performance by either adding valeric acid (VA) to the production media or by reducing the culture temperature (33.0 °C) with respect to control conditions (36.5 °C, no VA). Low temperature significantly reduces cellular growth, thus, resulting in lower bleed rates accompanied by a reduced product loss of 11% compared to 26% under control conditions. Additionally, the cell specific productivity of the target protein improves and maintained stable leading to media savings per mass of product. VA shows initially an inhibitory effect on cellular growth. However, cells seemed to adapt to the presence of the inhibitor resulting in a recovery of the cellular growth. Cell cycle and Western blot analyses support the observed results. This work underlines the role of temperature as a key operating variable for the optimization of perfusion cultures. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Cell death in Tetrahymena thermophila: new observations on culture conditions.

    Science.gov (United States)

    Christensen, S T; Sørensen, H; Beyer, N H; Kristiansen, K; Rasmussen, L; Rasmussen, M I

    2001-01-01

    We previously suggested that the cell fate of the protozoan ciliate, Tetrahymena thermophila, effectively relates to a quorum-sensing mechanism where cell-released factors support cell survival and proliferation. The cells have to be present above a critical initial density in a chemically defined nutrient medium in order to release a sufficient level of these factors to allow a new colony to flourish. At a relatively high rate of metabolism and/or macromolecular synthesis and below this critical density, cells began to die abruptly within 30 min of inoculation, and this death took the form of an explosive disintegration lasting less than 50 milliseconds. The cells died at any location in the culture, and the frequency of cell death was always lower in well-filled vials than those with medium/air interface. Cell death was inhibited by the addition of Actinomycin D or through modifications of the culture conditions either by reducing the oxygen tension or by decreasing the temperature of the growth medium. In addition, plastic caps in well-filled vials release substances, which promote cell survival. The fate of low-density cultures is related to certain 'physical' conditions, in addition to the availability of oxygen within closed culture systems. Copyright 2001 Academic Press.

  18. Contributions of 3D Cell Cultures for Cancer Research.

    Science.gov (United States)

    Ravi, Maddaly; Ramesh, Aarthi; Pattabhi, Aishwarya

    2017-10-01

    Cancer cell lines have contributed immensely in understanding the complex physiology of cancers. They are excellent material for studies as they offer homogenous samples without individual variations and can be utilised with ease and flexibility. Also, the number of assays and end-points one can study is almost limitless; with the advantage of improvising, modifying or altering several variables and methods. Literally, a new dimension to cancer research has been achieved by the advent of 3Dimensional (3D) cell culture techniques. This approach increased many folds the ways in which cancer cell lines can be utilised for understanding complex cancer biology. 3D cell culture techniques are now the preferred way of using cancer cell lines to bridge the gap between the 'absolute in vitro' and 'true in vivo'. The aspects of cancer biology that 3D cell culture systems have contributed include morphology, microenvironment, gene and protein expression, invasion/migration/metastasis, angiogenesis, tumour metabolism and drug discovery, testing chemotherapeutic agents, adaptive responses and cancer stem cells. We present here, a comprehensive review on the applications of 3D cell culture systems for these aspects of cancers. J. Cell. Physiol. 232: 2679-2697, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Suspension culture of pluripotent stem cells: effect of shear on stem cell fate.

    Science.gov (United States)

    Keller, Kevin C; Rodrigues, Beatriz; zur Nieden, Nicole I

    2014-01-01

    Despite significant promise, the routine usage of suspension cell culture to manufacture stem cell-derived differentiated cells has progressed slowly. Suspension culture is an innovative way of either expanding or differentiating cells and sometimes both are combined into a single bioprocess. Its advantages over static 2D culturing include a homogeneous and controllable culture environment and producing a large quantity of cells in a fraction of time. This feature makes suspension cell culture ideal for use in stem cell research and eventually ideal in the large-scale production of differentiated cells for regenerative medicine. Because of their tremendous differentiation capacities and unlimited growth properties, pluripotent stem cells (PSCs) in particular are considered potential sources for future cell-replacement therapies. Currently, expansion of PSCs is accomplished in 2D, which only permits a limited amount of cell growth per culture flask before cells need to be passaged. However, before stem cells can be applied clinically, several aspects of their expansion, such as directed growth, but also differentiation, need to be better controlled. This review will summarize recent advantages in suspension culture of PSCs, while at the same time highlighting current challenges.

  20. Culture conditions for bovine embryonic stem cell-like cells isolated from blastocysts after external fertilization

    OpenAIRE

    Jin, Muzi; Wu, Asga; Dorzhin, Sergei; Yue, Qunhua; Ma, Yuzhen; Liu, Dongjun

    2012-01-01

    Although isolation and characterization of embryonic stem cells have been successful in cattle, maintenance of bovine embryonic stem cells in culture remains difficult. In this study, we compared different methods of cell passaging, feeder cell layers and medium conditions for bovine embryonic stem cell-like cells. We found that a murine embryonic fibroblast feeder layer is more suitable for embryonic stem cell-like cells than bovine embryonic fibroblasts. When murine embryonic fibroblasts we...

  1. Stability of resazurin in buffers and mammalian cell culture media

    DEFF Research Database (Denmark)

    Rasmussen, Eva; Nicolaisen, G.M.

    1999-01-01

    The utility of a ferricyanide/ferrocyanide system used in the AlamarBlue(TM) (Serotec, Oxford, UK) vital. dye to inhibit the reduction of resazurin by mammalian cell culture media is questioned. Resazurin was found to be relatively stable when dissolved in phosphate-buffered saline (PBS). The use...... of HEPES resulted in a huge immediate dye reduction, which was significantly enhanced by exposure to diffuse light from fluorescent tubes in the laboratory 8 h per day. The reduction of resazurin by various cell culture media was time and temperature dependent, and it was significantly enhanced......'s nutrient mixture F-10 and F-12. Fetal calf serum (5-20%) slightly decreased resazurin reduction during the first 2 days of incubation. The reduction of resazurin by mammalian cell culture media do not appear to be problematic under normal culture conditions, and it is primarily dependent upon the presence...

  2. Automation of 3D cell culture using chemically defined hydrogels.

    Science.gov (United States)

    Rimann, Markus; Angres, Brigitte; Patocchi-Tenzer, Isabel; Braum, Susanne; Graf-Hausner, Ursula

    2014-04-01

    Drug development relies on high-throughput screening involving cell-based assays. Most of the assays are still based on cells grown in monolayer rather than in three-dimensional (3D) formats, although cells behave more in vivo-like in 3D. To exemplify the adoption of 3D techniques in drug development, this project investigated the automation of a hydrogel-based 3D cell culture system using a liquid-handling robot. The hydrogel technology used offers high flexibility of gel design due to a modular composition of a polymer network and bioactive components. The cell inert degradation of the gel at the end of the culture period guaranteed the harmless isolation of live cells for further downstream processing. Human colon carcinoma cells HCT-116 were encapsulated and grown in these dextran-based hydrogels, thereby forming 3D multicellular spheroids. Viability and DNA content of the cells were shown to be similar in automated and manually produced hydrogels. Furthermore, cell treatment with toxic Taxol concentrations (100 nM) had the same effect on HCT-116 cell viability in manually and automated hydrogel preparations. Finally, a fully automated dose-response curve with the reference compound Taxol showed the potential of this hydrogel-based 3D cell culture system in advanced drug development.

  3. Phosphate removal from digested sludge supernatant using modified fly ash.

    Science.gov (United States)

    Xu, Ke; Deng, Tong; Liu, Juntan; Peng, Weigong

    2012-05-01

    The removal of phosphate in digested sludge supernatant by modified coal fly ash was investigated in this study. Modification of the fly ash by the addition of sulfuric acid could significantly enhance its immobilization ability. The experimental results also showed that adsorption of phosphate by the modified fly ash was rapid with the removal percentage of phosphate reaching an equilibrium of 98.62% in less than 5 minutes. The optimum pH for phosphate removal was 9 and the removal percentage increased with increasing adsorbent dosage. The effect of temperature on phosphate removal efficiency was not significant from 20 to 40 degrees C. X-ray diffraction and scanning electron microscope analyses showed that phosphate formed an amorphous precipitate with water-soluble calcium, aluminum, and iron ions in the modified fly ash.

  4. Electrolytic destruction of oxalate ions in plutonium oxalate supernatant

    International Nuclear Information System (INIS)

    Michael, K.M.; Talnikar, S.G.; Jambunathan, U.; Kapoor, S.C.; Ramanujam, A.; Venkataraman, N.

    1996-01-01

    A simple and efficient electrolytic method is described for the destruction of the oxalate ions present in plutonium oxalate supernatant. Using platinum electrode and very little KMnO 4 , in situ generation of Mn 3+ ions is achieved which in turn destroys the oxalate. The use of lower current density helps in achieving maximum current efficiency. The end point is easily detectable by the pink colour of permanganate. By reversing the current, this slight excess of permanganate can be destroyed, thus avoiding the use of hydrogen peroxide. By this simple electrolytic method, the corrosive oxalate ion is completely destroyed and the salt content of the waste solution is considerably reduced. (author). 4 refs., 1 fig., 6 tabs

  5. A Simple Hydrophilic Treatment of SU-8 Surfaces for Cell Culturing and Cell Patterning

    DEFF Research Database (Denmark)

    Wang, Zhenyu; Stangegaard, Michael; Dufva, Hans Martin

    2005-01-01

    SU-8, an epoxy-based photoresist, widely used in constitution different mTAS systems, is incompatible with mammalian cell adhesion and culture in its native form. Here, we demonstrate a simple, cheap and robust two-step method to render a SU-8 surface hydrophilic and compatible with cell culture........ The contact angle of SU-8 surface was significantly reduced from 90° to 25° after the surface modification. The treated SU-8 surfaces provided a cell culture environment that was comparable with cell culture flask surface in terms of generation time and morphology....

  6. Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge.

    Science.gov (United States)

    Pestana, Carlos J; Reeve, Petra J; Sawade, Emma; Voldoire, Camille F; Newton, Kelly; Praptiwi, Radisti; Collingnon, Lea; Dreyfus, Jennifer; Hobson, Peter; Gaget, Virginie; Newcombe, Gayle

    2016-09-15

    In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Differential heat shock response of primary human cell cultures and established cell lines

    DEFF Research Database (Denmark)

    Richter, W W; Issinger, O G

    1986-01-01

    degrees C treatment, whereas in immortalized cell lines usually 90% of the cells were found in suspension. Enhanced expression of the major heat shock protein (hsp 70) was found in all heat-treated cells. In contrast to the primary cell cultures, established and transformed cell lines synthesized...

  8. Isolation and Characterization of Poliovirus in Cell Culture Systems.

    Science.gov (United States)

    Thorley, Bruce R; Roberts, Jason A

    2016-01-01

    The isolation and characterization of enteroviruses by cell culture was accepted as the "gold standard" by clinical virology laboratories. Methods for the direct detection of all enteroviruses by reverse transcription polymerase chain reaction, targeting a conserved region of the genome, have largely supplanted cell culture as the principal diagnostic procedure. However, the World Health Organization's Global Polio Eradication Initiative continues to rely upon cell culture to isolate poliovirus due to the lack of a reliable sensitive genetic test for direct typing of enteroviruses from clinical specimens. Poliovirus is able to infect a wide range of mammalian cell lines, with CD155 identified as the primary human receptor for all three seroytpes, and virus replication leads to an observable cytopathic effect. Inoculation of cell lines with extracts of clinical specimens and subsequent passaging of the cells leads to an increased virus titre. Cultured isolates of poliovirus are suitable for testing by a variety of methods and remain viable for years when stored at low temperature.This chapter describes general procedures for establishing a cell bank and routine passaging of cell lines. While the sections on specimen preparation and virus isolation focus on poliovirus, the protocols are suitable for other enteroviruses.

  9. Animal-cell culture in aqueous two-phase systems

    NARCIS (Netherlands)

    Zijlstra, G.M.

    1998-01-01

    In current industrial biotechnology, animal-cell culture is an important source of therapeutic protein products. The conventional animal-cell production processes, however, include many unit operations as part of the fermentation and downstream processing strategy. The research described in

  10. Endothelial cell cultures as a tool in biomaterial research

    NARCIS (Netherlands)

    Kirkpatrick, CJ; Otto, M; van Kooten, T; Krump, [No Value; Kriegsmann, J; Bittinger, F

    1999-01-01

    Progress in biocompatibility and tissue engineering would today be inconceivable without the aid of in vitro techniques. Endothelial cell cultures represent a valuable tool not just in haemocompatibility testing, but also in the concept of designing hybrid organs. In the past endothelial cells (EC)

  11. Differentiation of oligodendrocyte progenitor cells from dissociated monolayer and feeder-free cultured pluripotent stem cells.

    Science.gov (United States)

    Yamashita, Tomoko; Miyamoto, Yuki; Bando, Yoshio; Ono, Takashi; Kobayashi, Sakurako; Doi, Ayano; Araki, Toshihiro; Kato, Yosuke; Shirakawa, Takayuki; Suzuki, Yutaka; Yamauchi, Junji; Yoshida, Shigetaka; Sato, Naoya

    2017-01-01

    Oligodendrocytes myelinate axons and form myelin sheaths in the central nervous system. The development of therapies for demyelinating diseases, including multiple sclerosis and leukodystrophies, is a challenge because the pathogenic mechanisms of disease remain poorly understood. Primate pluripotent stem cell-derived oligodendrocytes are expected to help elucidate the molecular pathogenesis of these diseases. Oligodendrocytes have been successfully differentiated from human pluripotent stem cells. However, it is challenging to prepare large amounts of oligodendrocytes over a short amount of time because of manipulation difficulties under conventional primate pluripotent stem cell culture methods. We developed a proprietary dissociated monolayer and feeder-free culture system to handle pluripotent stem cell cultures. Because the dissociated monolayer and feeder-free culture system improves the quality and growth of primate pluripotent stem cells, these cells could potentially be differentiated into any desired functional cells and consistently cultured in large-scale conditions. In the current study, oligodendrocyte progenitor cells and mature oligodendrocytes were generated within three months from monkey embryonic stem cells. The embryonic stem cell-derived oligodendrocytes exhibited in vitro myelinogenic potency with rat dorsal root ganglion neurons. Additionally, the transplanted oligodendrocyte progenitor cells differentiated into myelin basic protein-positive mature oligodendrocytes in the mouse corpus callosum. This preparative method was used for human induced pluripotent stem cells, which were also successfully differentiated into oligodendrocyte progenitor cells and mature oligodendrocytes that were capable of myelinating rat dorsal root ganglion neurons. Moreover, it was possible to freeze, thaw, and successfully re-culture the differentiating cells. These results showed that embryonic stem cells and human induced pluripotent stem cells maintained in a

  12. Radiosensitivity of cultured insect cells: I. Lepidoptera

    International Nuclear Information System (INIS)

    Koval, T.M.

    1983-01-01

    The radiosensitivity of five lepidopteran insect cell lines representing five different genera has been investigated. These lines are: (1) TN-368, Trichoplusia ni; (2) IPLB-SF-1254, Spodoptera frugiperda; (3) IPLB-1075, Heliothis zea; (4) MRRL-CHl, clone GVl, Manduca sexta; and (5) IAL-PID2, Plodia interpunctella. The cell lines grew at different rates and had population doubling times that ranged from 19 to 52 hr. All of the lines are highly heteroploid and have approximate chromosome numbers near or above 100. The chromosomes are very small. All of the lines are extremely radioresistant; cell populations are able to recover from 260 kVp X-ray exposures up to and including 400 Gy, the highest dose examined. Cell survival curves were obtainable for only the TN-368 and IPLB-SF-1254 lines. The TN-368 cells displayed a biphasic survival response with D 0 , d/sub q/, and n values of 65.7 and 130.2 Gy, 9.0 and -36.1 Gy, and 1.2 and 0.8, respectively, for the steep and shallow portions of the curve. The IPLB-SF-1254 cells had a D 0 of 63.9 Gy. D/sub q/ of 19.0 Gy, and n value of 1.4. These studies provide definitive evidence of the radioresistance of lepidopteran cells, and suggest that this radioresistance is a characteristic of lepidopteran insects

  13. Adenosine formation in contracting primary rat skeletal muscle cells and endothelial cells in culture

    DEFF Research Database (Denmark)

    Hellsten, Ylva; Frandsen, Ulrik

    1997-01-01

    1. The present study examined the capacity for adenosine formation, uptake and metabolism in contracting primary rat muscle cells and in microvascular endothelial cells in culture. 2. Strong and moderate electrical simulation of skeletal muscle cells led to a significantly greater increase....... 3. Addition of microvascular endothelial cells to the cultured skeletal muscle cells enhanced the contraction-induced accumulation of extracellular adenosine (P Skeletal muscle cells were...... in the extracellular adenosine concentration (421 +/- 91 and 235 +/- 30 nmol (g protein)-1, respectively; P muscle cells (161 +/- 20 nmol (g protein)-1). The ATP concentration was lower (18%; P contracted, but not in the moderately contracted muscle cells...

  14. Thymic epithelial cells. I. Expression of strong suppressive (veto) activity in mouse thymic epithelial cell cultures

    DEFF Research Database (Denmark)

    Claesson, Mogens Helweg; Ropke, C

    1990-01-01

    We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level. It is conclu......We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level...

  15. Culture and Characterization of Circulating Endothelial Progenitor Cells in Patients with Renal Cell Carcinoma.

    Science.gov (United States)

    Gu, Wenyu; Sun, Wei; Guo, Changcheng; Yan, Yang; Liu, Min; Yao, Xudong; Yang, Bin; Zheng, Junhua

    2015-07-01

    Although emerging evidence demonstrates increased circulating endothelial progenitor cells in patients with solid tumors, to our knowledge it is still unknown whether such cells can be cultured from patients with highly angiogenic renal cell carcinoma. We cultured and characterized circulating endothelial progenitor cells from patients with renal cell carcinoma. The circulating endothelial progenitor cell level (percent of CD45(-)CD34(+) VEGF-R2(+) cells in total peripheral blood mononuclear cells) was quantified in 47 patients with renal cell carcinoma and 40 healthy controls. Peripheral blood mononuclear cells were then isolated from 33 patients with renal cell carcinoma and 30 healthy controls to culture and characterize circulating endothelial progenitor cells. The circulating endothelial progenitor cell level was significantly higher in patients with renal cell carcinoma than in healthy controls (0.276% vs 0.086%, p cells first emerged significantly earlier in patient than in control preparations (6.72 vs 14.67 days, p culture success rate (87.8% vs 40.0% of participants) and the number of colonies (10.06 vs 1.83) were significantly greater for patients than for controls (each p cell level correlated positively with the number of patient colonies (r = 0.762, p Cells cultured from patients and controls showed a similar growth pattern, immunophenotype, ability to uptake Ac-LDL and bind lectin, and form capillary tubes in vitro. However, significantly more VEGF-R2(+) circulating endothelial progenitor cells were found in preparations from patients with renal cell carcinoma than from healthy controls (21.1% vs 13.4%, p cell colonies, a higher cell culture success rate and more colonies were found for patients with renal cell carcinoma than for healthy controls. Results indicate the important significance of VEGF-R2(+) circulating endothelial progenitors in patients with renal cell carcinoma. Copyright © 2015 American Urological Association Education and Research

  16. Duchenne muscular dystrophy: normal ATP turnover in cultured cells

    International Nuclear Information System (INIS)

    Fox, I.H.; Bertorini, T.; Palmieri, G.M.A.; Shefner, R.

    1986-01-01

    This paper examines ATP metabolism in cultured muscle cells and fibroblasts from patients with Duchenne dystrophy. ATP and ADP levels were the same in cultured cells from normal subjects and patients and there was no difference in ATP synthesis or degradation. The ATP synthesis was measured by the incorporation of C 14-U-adenine into aTP and ADP. although there was a significant decrease in radioactively labelled ATP after incubation with deoxyglucose in Duchenne muscle cells, there was no difference in ATP concentration of ADP metabolism

  17. Cloning higher plants from aseptically cultured tissues and cells

    Science.gov (United States)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  18. Miniature Bioreactor System for Long-Term Cell Culture

    Science.gov (United States)

    Gonda, Steve R.; Kleis, Stanley J.; Geffert, Sandara K.

    2010-01-01

    A prototype miniature bioreactor system is designed to serve as a laboratory benchtop cell-culturing system that minimizes the need for relatively expensive equipment and reagents and can be operated under computer control, thereby reducing the time and effort required of human investigators and reducing uncertainty in results. The system includes a bioreactor, a fluid-handling subsystem, a chamber wherein the bioreactor is maintained in a controlled atmosphere at a controlled temperature, and associated control subsystems. The system can be used to culture both anchorage-dependent and suspension cells, which can be either prokaryotic or eukaryotic. Cells can be cultured for extended periods of time in this system, and samples of cells can be extracted and analyzed at specified intervals. By integrating this system with one or more microanalytical instrument(s), one can construct a complete automated analytical system that can be tailored to perform one or more of a large variety of assays.

  19. The Evolution of Polystyrene as a Cell Culture Material.

    Science.gov (United States)

    Lerman, Max J; Lembong, Josephine; Muramoto, Shin; Gillen, Greg; Fisher, John P

    2018-04-10

    Polystyrene (PS) has brought in vitro cell culture from its humble beginnings to the modern era, propelling dozens of research fields along the way. This review discusses the development of the material, fabrication, and treatment approaches to create the culture material. However, native PS surfaces poorly facilitate cell adhesion and growthin vitro. To overcome this, liquid surface deposition, energetic plasma activation, and emerging functionalization methods transform the surface chemistry. This review seeks to highlight the many potential applications of the first widely accepted polymer growth surface. Although the majority of in vitro research occurs on 2D surfaces, the importance of 3D culture models cannot be overlooked. Here the methods to transition PS to specialized 3D culture surfaces are also reviewed. Specifically, casting, electrospinning, 3D printing, and microcarrier approaches to shift PS to a 3D culture surface are highlighted. The breadth of applications of the material makes it impossible to highlight every use, but the aim remains to demonstrate the versatility and potential as both a general and custom cell culture surface. The review concludes with emerging scaffolding approaches and, based on the findings, presents our insights on the future steps for PS as a tissue culture platform.

  20. The replacement of serum by hormones in cell culture media.

    Science.gov (United States)

    Sato, G; Hayashi, I

    1976-12-01

    The replacement of serum by hormones in cell culture media. (Reemplazo del suero por hormonas en el medio de cultivo de células). Arch. Biol. Med. Exper. 10: 120-121, 1976. The serum used in cell culture media can be replaced by a mixture of hormones and some accesory blood factors. The pituitary cell line GH3 can be grown in a medium in which serum is replaced by triiodothyronine, transferrin, parathormone, tyrotrophin releasing hormone and somatomedins. Hela and BHK cell strains can also be grown in serum free medium supplemented with hormones. Each cell type appears to have different hormonal requirements yet it may found that some hormones are required for most cell types.

  1. Multidimensional fractionation is a requirement for quantitation of Golgi-resident glycosylation enzymes from cultured human cells.

    Science.gov (United States)

    Lin, Chi-Hung; Chik, Jenny H L; Packer, Nicolle H; Molloy, Mark P

    2015-02-06

    Glycosylation results from the concerted action of glycosylation enzymes in the secretory pathway. In general, gene expression serves as the primary control mechanism, but post-translational fine-tuning of glycosylation enzyme functions is often necessary for efficient synthesis of specific glycan epitopes. While the field of glycomics has rapidly advanced, there lacks routine proteomic methods to measure expression of specific glycosylation enzymes needed to fill the gap between mRNA expression and the glycomic profile in a "reverse genomics" workflow. Toward developing this workflow we enriched Golgi membranes from two human colon cancer cell lines by sucrose density centrifugation and further mass-based fractionation by SDS-PAGE. We then applied mass spectrometry to demonstrate a doubling in the number of Golgi resident proteins identified, compared to the unenriched, low speed centrifuged supernatant of lysed cells. A total of 35 Golgi-resident glycosylation enzymes, of which 23 were glycosyltransferases, were identified making this the largest protein database so far of Golgi resident glycosylation enzymes experimentally identified in cultured human cells. We developed targeted mass spectrometry assays for specific quantitation of many of these glycosylation enzymes. Our results show that alterations in abundance of glycosylation enzymes at the protein level were generally consistent with the resultant glycomic profiles, but not necessarily with the corresponding glycosyltransferase mRNA expression as exemplified by the case of O-glycan core 1 T synthase.

  2. A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

    Science.gov (United States)

    Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

    2018-02-01

    Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Hypoxic contraction of cultured pulmonary vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Murray, T.R.; Chen, L.; Marshall, B.E.; Macarak, E.J.

    1990-01-01

    The cellular events involved in generating the hypoxic pulmonary vasoconstriction response are not clearly understood, in part because of the multitude of factors that alter pulmonary vascular tone. The goal of the present studies was to determine if a cell culture preparation containing vascular smooth muscle (VSM) cells could be made to contract when exposed to a hypoxic atmosphere. Cultures containing only fetal bovine pulmonary artery VSM cells were assessed for contractile responses to hypoxic stimuli by two methods. In the first, tension forces generated by cells grown on a flexible growth surface (polymerized polydimethyl siloxane) were manifested as wrinkles and distortions of the surface under the cells. Wrinkling of the surface was noted to progressively increase with time as the culture medium bathing the cells was made hypoxic (PO2 approximately 25 mmHg). The changes were sometimes reversible upon return to normoxic conditions and appeared to be enhanced in cells already exhibiting evidence of some baseline tone. Repeated passage in culture did not diminish the hypoxic response. Evidence for contractile responses to hypoxia was also obtained from measurements of myosin light chain (MLC) phosphorylation. Conversion of MLC to the phosphorylated species is an early step in the activation of smooth muscle contraction. Lowering the PO2 in the culture medium to 59 mmHg caused a 45% increase in the proportion of MLC in the phosphorylated form as determined by two-dimensional gel electrophoresis. Similarly, cultures preincubated for 4 h with 32P and then exposed to normoxia or hypoxia for a 5-min experimental period showed more than twice as much of the label in MLCs of the hypoxic cells

  4. Animal-cell culture media: History, characteristics, and current issues.

    Science.gov (United States)

    Yao, Tatsuma; Asayama, Yuta

    2017-04-01

    Cell culture technology has spread prolifically within a century, a variety of culture media has been designed. This review goes through the history, characteristics and current issues of animal-cell culture media. A literature search was performed on PubMed and Google Scholar between 1880 and May 2016 using appropriate keywords. At the dawn of cell culture technology, the major components of media were naturally derived products such as serum. The field then gradually shifted to the use of chemical-based synthetic media because naturally derived ingredients have their disadvantages such as large batch-to-batch variation. Today, industrially important cells can be cultured in synthetic media. Nevertheless, the combinations and concentrations of the components in these media remain to be optimized. In addition, serum-containing media are still in general use in the field of basic research. In the fields of assisted reproductive technologies and regenerative medicine, some of the medium components are naturally derived in nearly all instances. Further improvements of culture media are desirable, which will certainly contribute to a reduction in the experimental variation, enhance productivity among biopharmaceuticals, improve treatment outcomes of assisted reproductive technologies, and facilitate implementation and popularization of regenerative medicine.

  5. Dose verification by OSLDs in the irradiation of cell cultures

    International Nuclear Information System (INIS)

    Meca C, E. A.; Bourel, V.; Notcovich, C.; Duran, H.

    2015-10-01

    The determination of value of irradiation dose presents difficulties when targets are irradiated located in regions where electronic equilibrium of charged particle is not reached, as in the case of irradiation -in vitro- of cell lines monolayer-cultured, in culture dishes or flasks covered with culture medium. The present study aimed to implement a methodology for dose verification in irradiation of cells in culture media by optically stimulated luminescence dosimetry (OSLD). For the determination of the absorbed dose in terms of cell proliferation OSL dosimeters of aluminum oxide doped with carbon (Al 2 O 3 :C) were used, which were calibrated to the irradiation conditions of culture medium and at doses that ranged from 0.1 to 15 Gy obtained with a linear accelerator of 6 MV photons. Intercomparison measurements were performed with an ionization chamber of 6 cm 3 . Different geometries were evaluated by varying the thicknesses of solid water, air and cell culture medium. The results showed deviations below 2.2% when compared with the obtained doses of OSLDs and planning system used. Also deviations were observed below 3.4% by eccentric points of the irradiation plane, finding homogeneous dose distribution. Uncertainty in the readings was less than 2%. The proposed methodology contributes a contribution in the dose verification in this type of irradiations, eliminating from the calculation uncertainties, potential errors in settling irradiation or possible equipment failure with which is radiating. It also provides certainty about the survival curves to be plotted with the experimental data. (Author)

  6. A microwell cell culture platform for the aggregation of pancreatic β-cells.

    Science.gov (United States)

    Bernard, Abigail B; Lin, Chien-Chi; Anseth, Kristi S

    2012-08-01

    Cell-cell contact between pancreatic β-cells is important for maintaining survival and normal insulin secretion. Various techniques have been developed to promote cell-cell contact between β-cells, but a simple yet robust method that affords precise control over three-dimensional (3D) β-cell cluster size has not been demonstrated. To address this need, we developed a poly(ethylene glycol) (PEG) hydrogel microwell platform using photolithography. This microwell cell-culture platform promotes the formation of 3D β-cell aggregates of defined sizes from 25 to 210 μm in diameter. Using this platform, mouse insulinoma 6 (MIN6) β-cells formed aggregates with cell-cell adherin junctions. These naturally formed cell aggregates with controllable sizes can be removed from the microwells for macroencapsulation, implantation, or other biological assays. When removed and subsequently encapsulated in PEG hydrogels, the aggregated cell clusters demonstrated improved cellular viability (>90%) over 7 days in culture, while the β-cells encapsulated as single cells maintained only 20% viability. Aggregated MIN6 cells also exhibited more than fourfold higher insulin secretion in response to a glucose challenge compared with encapsulated single β-cells. Further, the cell aggregates stained positively for E-cadherin, indicative of the formation of cell junctions. Using this hydrogel microwell cell-culture method, viable and functional β-cell aggregates of specific sizes were created, providing a platform from which other biologically relevant questions may be answered.

  7. Isolation and Culture of Postnatal Stem Cells from Deciduous Teeth

    OpenAIRE

    Olávez, Daniela; Facultad de Odontología Universidad de Los Andes; Salmen, Siham; Instituto de Inmunología Clínica, Universidad de Los Andes.; Padrón, Karla; Facultad de Odontología. Univerisdad de Los Andes.; Lobo, Carmine; Facultad de Odontología. Univerisdad de Los Andes.; Díaz, Nancy; Facultad de Odontología, Universidad de Los Andes.; Berrueta, Lisbeth; Doctora en Inmunología por Instituto Venezolano de Investigaciones Científicas (IVIC). Instituto de Inmunología Clínica, Facultad de Medicina, Universidad de Los Andes, Venezuela.; Solorzanio, Eduvigis; Facultad de Odontología, Universidad de Los Andes.

    2014-01-01

    Background: Currently, degenerative diseases represent a public health problem; therefore, the development and implementation of strategies to fully or partially recover of damaged tissues has a special interest in the biomedical field. Therapeutic strategies based on mesenchymal stem cells transplantation from dental pulp have been proposed as an alternative. Purpose: To develop a mesenchymal stem cells culture isolated from dental pulp of deciduous teeth. Methods: The mesenchymal stem cells...

  8. Formation and action of oxygen activated species in cell cultures

    International Nuclear Information System (INIS)

    Hoffmann, M.E.; Meneghini, R.

    1982-01-01

    The differences of hydrogen peroxide sensibility of mammal cell lineages (man, mouse, chinese hamster) in culture are studied. The cellular survival and the frequency of DNA induced breaks by hydrogen peroxide are analysed. The efficiency of elimination of DNA breaks by cells is determined. The possible relation between the cell capacity of repair and its survival to hydrogen peroxide action is also discussed. (M.A.) [pt

  9. System-level modeling and simulation of the cell culture microfluidic biochip ProCell

    DEFF Research Database (Denmark)

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan

    2010-01-01

    Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory. There are two technologies for the microfluidic biochips: droplet-based and flow-based. In this paper we are interested in flow-based microfluidic biochips, where the liquid flows continuously through pre......-defined micro-channels using valves and pumps. We present an approach to the system-level modeling and simulation of a cell culture microfluidic biochip called ProCell, Programmable Cell Culture Chip. ProCell contains a cell culture chamber, which is envisioned to run 256 simultaneous experiments (viewed...

  10. Induction of pluripotent stem cells from fibroblast cultures.

    Science.gov (United States)

    Takahashi, Kazutoshi; Okita, Keisuke; Nakagawa, Masato; Yamanaka, Shinya

    2007-01-01

    Clinical application of embryonic stem (ES) cells faces difficulties regarding use of embryos, as well as tissue rejection after implantation. One way to circumvent these issues is to generate pluripotent stem cells directly from somatic cells. Somatic cells can be reprogrammed to an embryonic-like state by the injection of a nucleus into an enucleated oocyte or by fusion with ES cells. However, little is known about the mechanisms underlying these processes. We have recently shown that the combination of four transcription factors can generate ES-like pluripotent stem cells directly from mouse fibroblast cultures. The cells, named induced pluripotent stem (iPS) cells, can be differentiated into three germ layers and committed to chimeric mice. Here we describe detailed methods and tips for the generation of iPS cells.

  11. Influence of in vitro irradiation upon LIF production by ConA stimulated mononuclear cells

    International Nuclear Information System (INIS)

    Sandru, G.; Veraguth, P.

    1981-01-01

    Leukocyte migration inhibitory factor (LIF) activity of culture supernatants of in vitro irradiated Concanavalin A (ConA) stimulated lymphocytes was tested by measuring granulocyte migration from clotted plasma droplets placed in flat bottom microplates. The specificity of inhibition was assured by pretreating the assay supernatants with anti-LIF antibodies which abrogated granulocyte migration inhibition but did not impair guinea pig Peritoneal Exudate Cells (PEC) migration inhibition. In vitro irradiation (150-1200 rads) of MNC cultures either before or after ConA stimulation did not impair lymphokine production and sometimes significantly improved the supernatants' LIF activity as compared with that of unirradiated cultures. The existence of radiosensitive suppressor cells regulating LIF production by ConA stimulated mononuclear cells is suggested

  12. B16-BL6 melanoma cells release inhibitory factor(s) of active pump activity in isolated lymph vessels.

    Science.gov (United States)

    Nakaya, K; Mizuno, R; Ohhashi, T

    2001-12-01

    We investigated whether supernatant cultured with melanoma cell lines B16-BL6 and K1735 or the Lewis lung carcinoma cell line (LLC) can regulate lymphatic pump activity with bioassay preparations isolated from murine iliac lymph vessels. B16-BL6 and LLC supernatants caused significant dilation of lymph microvessels with cessation of pump activity. B16-BL6 supernatant produced dose-related cessation of lymphatic pump activity. There was no significant tachyphylaxis in the supernatant-mediated inhibitory response of lymphatic pump activity. Pretreatment with 3 x 10(-5) M N(omega)-nitro-L-arginine methyl ester (L-NAME) or 10(-7) M or 10(-6) M glibenclamide and 5 x 10(-4) M 5-hydroxydecanoic acid caused significant reduction of supernatant-mediated inhibitory responses. Simultaneous treatment with 10(-3) M L-arginine and 3 x 10(-5) M L-NAME significantly lessened L-NAME-induced inhibition of the supernatant-mediated response, suggesting that endogenous nitric oxide (NO) plays important roles in supernatant-mediated inhibitory responses. Chemical treatment dialyzed substances of B16-BL6 cells may release nonpeptide substance(s) of <1,000 MW, resulting in significant cessation of lymphatic pump activity via production and release of endogenous NO and activation of mitochondrial ATP-sensitive K(+) channels.

  13. 40 CFR 798.5300 - Detection of gene mutations in somatic cells in culture.

    Science.gov (United States)

    2010-07-01

    ... cells in culture. 798.5300 Section 798.5300 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5300 Detection of gene mutations in somatic cells in culture. (a) Purpose. Mammalian cell culture... selected by resistance to ouabain. (2) Description. Cells in suspension or monolayer culture are exposed to...

  14. Cell sources for in vitro human liver cell culture models

    Science.gov (United States)

    Freyer, Nora; Damm, Georg; Seehofer, Daniel; Knöspel, Fanny

    2016-01-01

    In vitro liver cell culture models are gaining increasing importance in pharmacological and toxicological research. The source of cells used is critical for the relevance and the predictive value of such models. Primary human hepatocytes (PHH) are currently considered to be the gold standard for hepatic in vitro culture models, since they directly reflect the specific metabolism and functionality of the human liver; however, the scarcity and difficult logistics of PHH have driven researchers to explore alternative cell sources, including liver cell lines and pluripotent stem cells. Liver cell lines generated from hepatomas or by genetic manipulation are widely used due to their good availability, but they are generally altered in certain metabolic functions. For the past few years, adult and pluripotent stem cells have been attracting increasing attention, due their ability to proliferate and to differentiate into hepatocyte-like cells in vitro. However, controlling the differentiation of these cells is still a challenge. This review gives an overview of the major human cell sources under investigation for in vitro liver cell culture models, including primary human liver cells, liver cell lines, and stem cells. The promises and challenges of different cell types are discussed with a focus on the complex 2D and 3D culture approaches under investigation for improving liver cell functionality in vitro. Finally, the specific application options of individual cell sources in pharmacological research or disease modeling are described. PMID:27385595

  15. Bystander Host Cell Killing Effects of Clostridium perfringens Enterotoxin

    Directory of Open Access Journals (Sweden)

    Archana Shrestha

    2016-12-01

    Full Text Available Clostridium perfringens enterotoxin (CPE binds to claudin receptors, e.g., claudin-4, and then forms a pore that triggers cell death. Pure cultures of host cells that do not express claudin receptors, e.g., fibroblasts, are unaffected by pathophysiologically relevant CPE concentrations in vitro. However, both CPE-insensitive and CPE-sensitive host cells are present in vivo. Therefore, this study tested whether CPE treatment might affect fibroblasts when cocultured with CPE-sensitive claudin-4 fibroblast transfectants or Caco-2 cells. Under these conditions, immunofluorescence microscopy detected increased death of fibroblasts. This cytotoxic effect involved release of a toxic factor from the dying CPE-sensitive cells, since it could be reproduced using culture supernatants from CPE-treated sensitive cells. Supernatants from CPE-treated sensitive cells, particularly Caco-2 cells, were found to contain high levels of membrane vesicles, often containing a CPE species. However, most cytotoxic activity remained in those supernatants even after membrane vesicle depletion, and CPE was not detected in fibroblasts treated with supernatants from CPE-treated sensitive cells. Instead, characterization studies suggest that a major cytotoxic factor present in supernatants from CPE-treated sensitive cells may be a 10- to 30-kDa host serine protease or require the action of that host serine protease. Induction of caspase-3-mediated apoptosis was found to be important for triggering release of the cytotoxic factor(s from CPE-treated sensitive host cells. Furthermore, the cytotoxic factor(s in these supernatants was shown to induce a caspase-3-mediated killing of fibroblasts. This bystander killing effect due to release of cytotoxic factors from CPE-treated sensitive cells could contribute to CPE-mediated disease.

  16. HUMAN CELLS IN CULTURE: REVISlTED*

    African Journals Online (AJOL)

    advantages, e.g. the generation time is reduced to about. 1/10000 that of the ... or less reflects the cellular biology of the donor tissut:'Y .... X-linked. Autosomal recessive. Autosomal recessive. Autosomal recessive mothers of affected males, however, show that only 50% of the cell population is defective, which furnishes an.

  17. Cultural relativism: maintenance of genomic imprints in pluripotent stem cell culture systems.

    Science.gov (United States)

    Greenberg, Maxim Vc; Bourc'his, Déborah

    2015-04-01

    Pluripotent stem cells (PSCs) in culture have become a widely used model for studying events occurring during mammalian development; they also present an exciting avenue for therapeutics. However, compared to their in vivo counterparts, cultured PSC derivatives have unique properties, and it is well established that their epigenome is sensitive to medium composition. Here we review the specific effects on genomic imprints in various PSC types and culture systems. Imprinted gene regulation is developmentally important, and imprinting defects have been associated with several human diseases. Therefore, imprint abnormalities in PSCs may have considerable consequences for downstream applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Allergen-stimulated T lymphocytes from allergic patients induce vascular cell adhesion molecule-1 (VCAM-1) expression and IL-6 production by endothelial cells.

    Science.gov (United States)

    Delneste, Y; Jeannin, P; Gosset, P; Lassalle, P; Cardot, E; Tillie-Leblond, I; Joseph, M; Pestel, J; Tonnel, A B

    1995-01-01

    Adhesion of inflammatory cells to endothelium is a critical step for their transvascular migration to inflammatory sites. To evaluate the relationship between T lymphocytes (TL) and vascular endothelium, supernatants from allergen-stimulated TL obtained from patients sensitive to Dermatophagoides pteronyssinus (Dpt) versus healthy subjects were added to endothelial cell (EC) cultures. TL were stimulated by autologous-activated antigen-presenting cells (APC) previously fixed in paraformaldehyde to prevent monokine secretion. Two parameters were measured: the expression of adhesion molecule and the production of IL-6. Related allergen-stimulated TL supernatants from allergic patients induced an increase of VCAM-1 and intercellular adhesion molecule-1 (ICAM-1) expression when supernatants of the control groups (TL exposed to an unrelated allergen or not stimulated or TL obtained from healthy subjects) did not. E-selectin expression was not modulated whatever the supernatant added to EC culture. IL-6 production by EC was significantly enhanced after activation with related allergen-stimulated TL supernatants from allergics compared with control supernatants. Induction of VCAM-1 expression was inhibited by adding neutralizing antibodies against IL-4, whereas IL-6 production and ICAM-1 expression were inhibited by anti-interferon-gamma (IFN-gamma) antibodies. Enhanced production of IL-4 and IFN-gamma was detected in related allergen-stimulated TL supernatants from allergic subjects compared with the different supernatants. These data suggest that allergen-specific TL present in the peripheral blood of allergic patients are of Th1 and Th2 subtypes. Their stimulation in allergic patients may lead to the activation of endothelial cells and thereby participate in leucocyte recruitment towards the inflammatory site. PMID:7542574

  19. Dynamic cell culture system: a new cell cultivation instrument for biological experiments in space

    Science.gov (United States)

    Gmunder, F. K.; Nordau, C. G.; Tschopp, A.; Huber, B.; Cogoli, A.

    1988-01-01

    The prototype of a miniaturized cell cultivation instrument for animal cell culture experiments aboard Spacelab is presented (Dynamic cell culture system: DCCS). The cell chamber is completely filled and has a working volume of 200 microliters. Medium exchange is achieved with a self-powered osmotic pump (flowrate 1 microliter h-1). The reservoir volume of culture medium is 230 microliters. The system is neither mechanically stirred nor equipped with sensors. Hamster kidney (Hak) cells growing on Cytodex 3 microcarriers were used to test the biological performance of the DCCS. Growth characteristics in the DCCS, as judged by maximal cell density, glucose consumption, lactic acid secretion and pH, were similar to those in cell culture tubes.

  20. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma.

    Science.gov (United States)

    Palmini, Gaia; Zonefrati, Roberto; Mavilia, Carmelo; Aldinucci, Alessandra; Luzi, Ettore; Marini, Francesca; Franchi, Alessandro; Capanna, Rodolfo; Tanini, Annalisa; Brandi, Maria Luisa

    2016-10-14

    The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains poor when metastasis has occurred. The Cancer Stem Cell (CSC) theory holds that there is a subset of tumor cells within the tumor that have stem-like characteristics, including the capacity to maintain the tumor and to resist multidrug chemotherapy. Therefore, a better understanding of OS biology and pathogenesis is needed in order to advance the development of targeted therapies to eradicate this particular subset and to reduce morbidity and mortality among patients. Isolating CSCs, establishing cell cultures of CSCs, and studying their biology are important steps to improving our understanding of OS biology and pathogenesis. The establishment of human-derived OS-CSCs from biopsies of OS has been made possible using several methods, including the capacity to create 3-dimensional stem cell cultures under nonadherent conditions. Under these conditions, CSCs are able to create spherical floating colonies formed by daughter stem cells; these colonies are termed "cellular spheres". Here, we describe a method to establish CSC cultures from primary cell cultures of conventional OS obtained from OS biopsies. We clearly describe the several passages required to isolate and characterize CSCs.

  1. Cytotoxicity of extracts of spices to cultured cells.

    Science.gov (United States)

    Unnikrishnan, M C; Kuttan, R

    1988-01-01

    The cytotoxicity of the extracts from eight different spices used in the Indian diet was determined using Dalton's lymphoma ascites tumor cells and human lymphocytes in vitro and Chinese Hamster Ovary cells and Vero cells in tissue culture. Alcoholic extracts of the spices were found to be more cytotoxic to these cells than their aqueous extracts. Alcoholic extracts of several spices inhibited cell growth at concentrations of 0.2-1 mg/ml in vitro and 0.12-0.3 mg/ml in tissue culture. Ginger, pippali (native to India; also called dried catkins), pepper, and garlic showed the highest activity followed by asafetida, mustard, and horse-gram (native to India). These extracts also inhibited the thymidine uptake into DNA.

  2. Isolation of Lysosomes from Mammalian Tissues and Cultured Cells.

    Science.gov (United States)

    Aguado, Carmen; Pérez-Jiménez, Eva; Lahuerta, Marcos; Knecht, Erwin

    2016-01-01

    Lysosomes participate within the cells in the degradation of organelles, macromolecules, and a wide variety of substrates. In any study on specific roles of lysosomes, both under physiological and pathological conditions, it is advisable to include methods that allow their reproducible and reliable isolation. However, purification of lysosomes is a difficult task, particularly in the case of cultured cells. This is mainly because of the heterogeneity of these organelles, along with their low number and high fragility. Also, isolation methods, while disrupting plasma membranes, have to preserve the integrity of lysosomes, as the breakdown of their membranes releases enzymes that could damage all cell organelles, including themselves. The protocols described below have been routinely used in our laboratory for the specific isolation of lysosomes from rat liver, NIH/3T3, and other cultured cells, but can be adapted to other mammalian tissues or cell lines.

  3. Optimization of human corneal endothelial cell culture: density dependency of successful cultures in vitro.

    Science.gov (United States)

    Peh, Gary S L; Toh, Kah-Peng; Ang, Heng-Pei; Seah, Xin-Yi; George, Benjamin L; Mehta, Jodhbir S

    2013-05-03

    Global shortage of donor corneas greatly restricts the numbers of corneal transplantations performed yearly. Limited ex vivo expansion of primary human corneal endothelial cells is possible, and a considerable clinical interest exists for development of tissue-engineered constructs using cultivated corneal endothelial cells. The objective of this study was to investigate the density-dependent growth of human corneal endothelial cells isolated from paired donor corneas and to elucidate an optimal seeding density for their extended expansion in vitro whilst maintaining their unique cellular morphology. Established primary human corneal endothelial cells were propagated to the second passage (P2) before they were utilized for this study. Confluent P2 cells were dissociated and seeded at four seeding densities: 2,500 cells per cm2 ('LOW'); 5,000 cells per cm2 ('MID'); 10,000 cells per cm2 ('HIGH'); and 20,000 cells per cm2 ('HIGH(×2)'), and subsequently analyzed for their propensity to proliferate. They were also subjected to morphometric analyses comparing cell sizes, coefficient of variance, as well as cell circularity when each culture became confluent. At the two lower densities, proliferation rates were higher than cells seeded at higher densities, though not statistically significant. However, corneal endothelial cells seeded at lower densities were significantly larger in size, heterogeneous in shape and less circular (fibroblastic-like), and remained hypertrophic after one month in culture. Comparatively, cells seeded at higher densities were significantly homogeneous, compact and circular at confluence. Potentially, at an optimal seeding density of 10,000 cells per cm2, it is possible to obtain between 10 million to 25 million cells at the third passage. More importantly, these expanded human corneal endothelial cells retained their unique cellular morphology. Our results demonstrated a density dependency in the culture of primary human corneal endothelial

  4. Lingual Epithelial Stem Cells and Organoid Culture of Them

    Directory of Open Access Journals (Sweden)

    Hiroko Hisha

    2016-01-01

    Full Text Available As tongue cancer is one of the major malignant cancers in the world, understanding the mechanism of maintenance of lingual epithelial tissue, which is known to be the origin of tongue cancer, is unquestionably important. However, the actual stem cells that are responsible for the long-term maintenance of the lingual epithelium have not been identified. Moreover, a simple and convenient culture method for lingual epithelial stem cells has not yet been established. Recently, we have shown that Bmi1-positive cells, residing at the second or third layer of the epithelial cell layer at the base of the interpapillary pit (IPP, were slow-cycling and could supply keratinized epithelial cells for over one year, indicating that Bmi1-positive cells are long-term lingual epithelial stem cells. In addition, we have developed a novel lingual epithelium organoid culture system using a three-dimensional matrix and growth factors. Here, we discuss current progress in the identification of lingual stem cells and future applications of the lingual culture system for studying the regulatory mechanisms of the lingual epithelium and for regenerative medicine.

  5. Bridging the gap between cell culture and live tissue

    Directory of Open Access Journals (Sweden)

    Stefan Przyborski

    2017-11-01

    Full Text Available Traditional in vitro two-dimensional (2-D culture systems only partly imitate the physiological and biochemical features of cells in their original tissue. In vivo, in organs and tissues, cells are surrounded by a three-dimensional (3-D organization of supporting matrix and neighbouring cells, and a gradient of chemical and mechanical signals. Furthermore, the presence of blood flow and mechanical movement provides a dynamic environment (Jong et al., 2011. In contrast, traditional in vitro culture, carried out on 2-D plastic or glass substrates, typically provides a static environment, which, however is the base of the present understanding of many biological processes, tissue homeostasis as well as disease. It is clear that this is not an exact representation of what is happening in vivo and the microenvironment provided by in vitro cell culture models are significantly different and can cause deviations in cell response and behaviour from those distinctive of in vivo tissues. In order to translate the present basic knowledge in cell control, cell repair and regeneration from the laboratory bench to the clinical application, we need a better understanding of the cell and tissue interactions. This implies a detailed comprehension of the natural tissue environment, with its organization and local signals, in order to more closely mimic what happens in vivo, developing more physiological models for efficient in vitro systems. In particular, it is imperative to understand the role of the environmental cues which can be mainly divided into those of a chemical and mechanical nature.

  6. Batch variation between branchial cell cultures: An analysis of variance

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Grosell, M.; Kristensen, L.

    2003-01-01

    We present in detail how a statistical analysis of variance (ANOVA) is used to sort out the effect of an unexpected batch-to-batch variation between cell cultures. Two separate cultures of rainbow trout branchial cells were grown on permeable filtersupports ("inserts"). They were supposed...... and introducing the observed difference between batches as one of the factors in an expanded three-dimensional ANOVA, we were able to overcome an otherwisecrucial lack of sufficiently reproducible duplicate values. We could thereby show that the effect of changing the apical medium was much more marked when...... the radioactive lipid precursors were added on the apical, rather than on the basolateral, side. Theinsert cell cultures were obviously polarized. We argue that it is not reasonable to reject troublesome experimental results, when we do not know a priori that something went wrong. The ANOVA is a very useful...

  7. A single-cell and feeder-free culture system for monkey embryonic stem cells.

    Science.gov (United States)

    Ono, Takashi; Suzuki, Yutaka; Kato, Yosuke; Fujita, Risako; Araki, Toshihiro; Yamashita, Tomoko; Kato, Hidemasa; Torii, Ryuzo; Sato, Naoya

    2014-01-01

    Primate pluripotent stem cells (PSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), hold great potential for research and application in regenerative medicine and drug discovery. To maximize primate PSC potential, a practical system is required for generating desired functional cells and reproducible differentiation techniques. Much progress regarding their culture systems has been reported to date; however, better methods would still be required for their practical use, particularly in industrial and clinical fields. Here we report a new single-cell and feeder-free culture system for primate PSCs, the key feature of which is an originally formulated serum-free medium containing FGF and activin. In this culture system, cynomolgus monkey ESCs can be passaged many times by single-cell dissociation with traditional trypsin treatment and can be propagated with a high proliferation rate as a monolayer without any feeder cells; further, typical PSC properties and genomic stability can be retained. In addition, it has been demonstrated that monkey ESCs maintained in the culture system can be used for various experiments such as in vitro differentiation and gene manipulation. Thus, compared with the conventional culture system, monkey ESCs grown in the aforementioned culture system can serve as a cell source with the following practical advantages: simple, stable, and easy cell maintenance; gene manipulation; cryopreservation; and desired differentiation. We propose that this culture system can serve as a reliable platform to prepare primate PSCs useful for future research and application.

  8. Aragonite precipitation by "proto-polyps" in coral cell cultures.

    Directory of Open Access Journals (Sweden)

    Tali Mass

    Full Text Available The mechanisms of coral calcification at the molecular, cellular and tissue levels are poorly understood. In this study, we examine calcium carbonate precipitation using novel coral tissue cultures that aggregate to form "proto-polyps". Our goal is to establish an experimental system in which calcification is facilitated at the cellular level, while simultaneously allowing in vitro manipulations of the calcifying fluid. This novel coral culturing technique enables us to study the mechanisms of biomineralization and their implications for geochemical proxies. Viable cell cultures of the hermatypic, zooxanthellate coral, Stylophora pistillata, have been maintained for 6 to 8 weeks. Using an enriched seawater medium with aragonite saturation state similar to open ocean surface waters (Ω(arag~4, the primary cell cultures assemble into "proto-polyps" which form an extracellular organic matrix (ECM and precipitate aragonite crystals. These extracellular aragonite crystals, about 10 µm in length, are formed on the external face of the proto-polyps and are identified by their distinctive elongated crystallography and X-ray diffraction pattern. The precipitation of aragonite is independent of photosynthesis by the zooxanthellae, and does not occur in control experiments lacking coral cells or when the coral cells are poisoned with sodium azide. Our results demonstrate that proto-polyps, aggregated from primary coral tissue culture, function (from a biomineralization perspective similarly to whole corals. This approach provides a novel tool for investigating the biophysical mechanism of calcification in these organisms.

  9. Testicular Sertoli cells influence the proliferation and immunogenicity of co-cultured endothelial cells

    International Nuclear Information System (INIS)

    Fan, Ping; He, Lan; Pu, Dan; Lv, Xiaohong; Zhou, Wenxu; Sun, Yining; Hu, Nan

    2011-01-01

    Research highlights: → The proliferation of dramatic increased by co-cultured with Sertoli cells. → VEGF receptor-2 expression of ECs was up-regulated by co-cultured with Sertoli cells. → The MHC expression of ECs induced by INF-γ and IL-6, IL-8 and sICAM induced by TNF-α decreased respectively after co-cultured with Sertoli cells. → ECs co-cultured with Sertoli cells also didn't increase the stimulation index of spleen lymphocytes. -- Abstract: The major problem of the application of endothelial cells (ECs) in transplantation is the lack of proliferation and their immunogenicity. In this study, we co-cultured ECs with Sertoli cells to monitor whether Sertoli cells can influence the proliferation and immunogenicity of co-cultured ECs. Sertoli cells were isolated from adult testicular tissue. ECs were divided into the control group and the experimental group, which included three sub-groups co-cultured with 1 x 10 3 , 1 x 10 4 or 1 x 10 5 cell/ml of Sertoli cells. The growth and proliferation of ECs were observed microscopically, and the expression of vascular endothelial growth factor (VEGF) receptor-2 (KDR) was examined by Western blotting. In another experiment, ECs were divided into the control group, the single culture group and the co-culture group with the optimal concentration of Sertoli cells. After INF-γ and TNF-α were added to the culture medium, MHC II antigen expression was detected by immunofluorescence staining and western blotting; interleukin (IL)-6, IL-8 and soluble intercellular adhesion molecule (sICAM) were measured in the culture medium by ELISA. We demonstrated that 1 x 10 4 cell/ml Sertoli cells promoted the proliferation of co-cultured ECs more dramatically than that in other groups (P 4 cell/ml of the Sertoli cells was most effective in the up-regulation of KDR expression in the co-cultured ECs (P < 0.05). Sertoli cells can effectively suppress INF-γ-induced MHC II antigen expression in co-cultured ECs compared with single

  10. Identification of differences in gene expression in primary cell cultures of human endometrial epithelial cells and trophoblast cells following their interaction

    DEFF Research Database (Denmark)

    Høgh, Mette; Islin, Henrik; Møller, Charlotte

    2006-01-01

    The interaction between the cell types was simulated in vitro by growing primary cell cultures of human endometrial epithelial cells and trophoblast cells together (co-culture) and separately (control cultures). Gene expression in the cell cultures was compared using the Differential Display method and confirmed...

  11. High-Throughput Cancer Cell Sphere Formation for 3D Cell Culture.

    Science.gov (United States)

    Chen, Yu-Chih; Yoon, Euisik

    2017-01-01

    Three-dimensional (3D) cell culture is critical in studying cancer pathology and drug response. Though 3D cancer sphere culture can be performed in low-adherent dishes or well plates, the unregulated cell aggregation may skew the results. On contrary, microfluidic 3D culture can allow precise control of cell microenvironments, and provide higher throughput by orders of magnitude. In this chapter, we will look into engineering innovations in a microfluidic platform for high-throughput cancer cell sphere formation and review the implementation methods in detail.

  12. Ultrafiltration and Characterization of AW-101 Supernatant and Entrained Solids

    International Nuclear Information System (INIS)

    Brooks, K.P.; Bredt, P.R.; Golcar, G.R.; Hartley, S.A.; Urie, M.W.; Tingey, J.M.; Rappe, K.G.; Jagoda, L.K.

    1999-01-01

    The River Protection Project Waste Treatment Plant (RPP-WTP) (1996) flow sheet uses cross-flow filtration as the solid/liquid separation technique. Unlike traditional dead-end filtration, which has a declining rate caused by the growth of a filter cake on the surface of the filter medium, in cross-flow filtration, the filter cake is swept away by the fluid flowing across it. This filtration method is especially beneficial when there are very fine particles and when system simplicity is required. The objective of this work was to test cross-flow filtration using actual Envelope A Hanford tank waste. Similar to the Phase 1A study, they evaluated the permeability of an Envelope A feed through a single element filter as a function of transmembrane pressure, axial velocity, solids concentration, and time. In addition, the efficiency of back pulse and chemical cleaning on the filter performance was evaluated. The chemical and radiochemical composition of the filtrate and solids was measured to determine efficiency of the filtration process. This report describes the test apparatus, the experimental approach, the results of the tests, and the chemical and radiochemical analysis for supernatants taken from Hanford Tank AW-101. This report also provides a means of transmitting to British Nuclear Fuels, Limited (BNFL) the completed test instruction and raw filtration and analytical data

  13. A study of chromosomal aberrations in amniotic fluid cell cultures.

    Science.gov (United States)

    Wolstenholme, J; Crocker, M; Jonasson, J

    1988-06-01

    This paper represents the analysis of 1916 routine amniotic fluid specimens harvested by an in situ fixation technique in a prospective study with regard to cultural chromosome anomalies. Excluding constitutional abnormalities, 2.9 per cent of 19,432 cells analysed showed some form of chromosome anomaly, terminal deletions (57 per cent) and chromatid/chromosome breaks and gaps (18 per cent) being the most frequent, followed by interchange aberrations (13 per cent) and trisomy (5 per cent). No case was found of more than one colony from the same culture showing the same anomaly without it being present in other cultures from the same fluid. The wholly abnormal colonies had a surplus of trisomies and from the mathematical considerations presented one may infer that these are likely to reflect the presence of abnormal cells in the amniotic fluid. Partly abnormal colonies appeared at a frequency that would correspond to virtual absence of selection against chromosomally abnormal cells when cultured in vitro. The aberrations found were similar to those seen as single cell anomalies, except for chromatid breaks and exchanges. The data suggest a basic preferential induction of trisomy for chromosomes 2, 18, 21, and the Y-chromosome. Structural aberrations showed a marked clustering of breakpoints around the centromeres. The frequency of mutant cells was low (1.4 X 10(-3)) before culture was initiated. At harvest, the frequency of abnormal cells was much higher (3 X 10(-2)) corresponding to 3 X 10(-3) mutations per cell per generation accumulating over approximately ten generations in vitro.

  14. Testing of serum atherogenicity in cell cultures: questionable data published

    Directory of Open Access Journals (Sweden)

    Sergei V. Jargin

    2012-01-01

    Full Text Available In a large series of studies was reported that culturing of smooth muscle cells with serum from atherosclerosis patients caused intracellular lipid accumulation, while serum from healthy controls had no such effect. Cultures were used for evaluation of antiatherogenic drugs. Numerous substances were reported to lower serum atherogenicity: statins, trapidil, calcium antagonists, garlic derivatives etc. On the contrary, beta-blockers, phenothiazines and oral hypoglycemics were reported to be pro-atherogenic. Known antiatherogenic agents can influence lipid metabolism and cholesterol synthesis, intestinal absorption or endothelium-related mechanisms. All these targets are absent in cell monocultures. Inflammatory factors, addressed by some antiatherogenic drugs, are also not reproduced. In vivo, relationship between cholesterol uptake by cells and atherogenesis must be inverse rather than direct: in familial hypercholesterolemia, inefficient clearance of LDL-cholesterol by cells predisposes to atherosclerosis. Accordingly, if a pharmacological agent reduces cholesterol uptake by cells in vitro, it should be expected to elevate cholesterol in vivo. Validity of clinical recommendations, based on serum atherogenicity testing in cell monocultures, is therefore questionable. These considerations pertain also to the drugs developed on the basis of the cell culture experiments.

  15. Arsenic exposure induces the Warburg effect in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Fei; Severson, Paul; Pacheco, Samantha; Futscher, Bernard W.; Klimecki, Walter T., E-mail: klimecki@pharmacy.arizona.edu

    2013-08-15

    Understanding how arsenic exacts its diverse, global disease burden is hampered by a limited understanding of the particular biological pathways that are disrupted by arsenic and underlie pathogenesis. A reductionist view would predict that a small number of basic pathways are generally perturbed by arsenic, and manifest as diverse diseases. Following an initial observation that arsenite-exposed cells in culture acidify their media more rapidly than control cells, the report here shows that low level exposure to arsenite (75 ppb) is sufficient to induce aerobic glycolysis (the Warburg effect) as a generalized phenomenon in cultured human primary cells and cell lines. Expanded studies in one such cell line, the non-malignant pulmonary epithelial line, BEAS-2B, established that the arsenite-induced Warburg effect was associated with increased accumulation of intracellular and extracellular lactate, an increased rate of extracellular acidification, and inhibition by the non-metabolized glucose analog, 2-deoxy-D-glucose. Associated with the induction of aerobic glycolysis was a pathway-wide induction of glycolysis gene expression, as well as protein accumulation of an established glycolysis master-regulator, hypoxia-inducible factor 1A. Arsenite-induced alteration of energy production in human cells represents the type of fundamental perturbation that could extend to many tissue targets and diseases. - Highlights: • Chronic arsenite exposure induces aerobic glycolysis, dubbed the “Warburg effect”. • Arsenite-induced Warburg effect is a general phenomenon in cultured human cells. • HIF-1A may mediate arsenite induced Warburg effect.

  16. Transfection in perfused microfluidic cell culture devices: A case study.

    Science.gov (United States)

    Raimes, William; Rubi, Mathieu; Super, Alexandre; Marques, Marco P C; Veraitch, Farlan; Szita, Nicolas

    2017-08-01

    Automated microfluidic devices are a promising route towards a point-of-care autologous cell therapy. The initial steps of induced pluripotent stem cell (iPSC) derivation involve transfection and long term cell culture. Integration of these steps would help reduce the cost and footprint of micro-scale devices with applications in cell reprogramming or gene correction. Current examples of transfection integration focus on maximising efficiency rather than viable long-term culture. Here we look for whole process compatibility by integrating automated transfection with a perfused microfluidic device designed for homogeneous culture conditions. The injection process was characterised using fluorescein to establish a LabVIEW-based routine for user-defined automation. Proof-of-concept is demonstrated by chemically transfecting a GFP plasmid into mouse embryonic stem cells (mESCs). Cells transfected in the device showed an improvement in efficiency (34%, n = 3) compared with standard protocols (17.2%, n = 3). This represents a first step towards microfluidic processing systems for cell reprogramming or gene therapy.

  17. Cell culture media impact on drug product solution stability.

    Science.gov (United States)

    Purdie, Jennifer L; Kowle, Ronald L; Langland, Amie L; Patel, Chetan N; Ouyang, Anli; Olson, Donald J

    2016-07-08

    To enable subcutaneous administration of monoclonal antibodies, drug product solutions are often needed at high concentrations. A significant risk associated with high drug product concentrations is an increase in aggregate level over the shelf-life dating period. While much work has been done to understand the impact of drug product formulation on aggregation, there is limited understanding of the link between cell culture process conditions and soluble aggregate growth in drug product. During cell culture process development, soluble aggregates are often measured at harvest using cell-free material purified by Protein A chromatography. In the work reported here, cell culture media components were evaluated with respect to their impact on aggregate levels in high concentration solution drug product during accelerated stability studies. Two components, cysteine and ferric ammonium citrate, were found to impact aggregate growth rates in our current media (version 1) leading to the development of new chemically defined media and concentrated feed formulations. The new version of media and associated concentrated feeds (version 2) were evaluated across four cell lines producing recombinant IgG4 monoclonal antibodies and a bispecific antibody. In all four cell lines, the version 2 media reduced aggregate growth over the course of a 12 week accelerated stability study compared with the version 1 media, although the degree to which aggregate growth decreased was cell line dependent. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:998-1008, 2016. © 2016 American Institute of Chemical Engineers.

  18. Arsenic exposure induces the Warburg effect in cultured human cells

    International Nuclear Information System (INIS)

    Zhao, Fei; Severson, Paul; Pacheco, Samantha; Futscher, Bernard W.; Klimecki, Walter T.

    2013-01-01

    Understanding how arsenic exacts its diverse, global disease burden is hampered by a limited understanding of the particular biological pathways that are disrupted by arsenic and underlie pathogenesis. A reductionist view would predict that a small number of basic pathways are generally perturbed by arsenic, and manifest as diverse diseases. Following an initial observation that arsenite-exposed cells in culture acidify their media more rapidly than control cells, the report here shows that low level exposure to arsenite (75 ppb) is sufficient to induce aerobic glycolysis (the Warburg effect) as a generalized phenomenon in cultured human primary cells and cell lines. Expanded studies in one such cell line, the non-malignant pulmonary epithelial line, BEAS-2B, established that the arsenite-induced Warburg effect was associated with increased accumulation of intracellular and extracellular lactate, an increased rate of extracellular acidification, and inhibition by the non-metabolized glucose analog, 2-deoxy-D-glucose. Associated with the induction of aerobic glycolysis was a pathway-wide induction of glycolysis gene expression, as well as protein accumulation of an established glycolysis master-regulator, hypoxia-inducible factor 1A. Arsenite-induced alteration of energy production in human cells represents the type of fundamental perturbation that could extend to many tissue targets and diseases. - Highlights: • Chronic arsenite exposure induces aerobic glycolysis, dubbed the “Warburg effect”. • Arsenite-induced Warburg effect is a general phenomenon in cultured human cells. • HIF-1A may mediate arsenite induced Warburg effect

  19. Culturing of PC12 Cells, Neuronal Cells, Astrocytes Cultures and Brain Slices in an Open Microfluidic System

    DEFF Research Database (Denmark)

    Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya; Rømer Sørensen, Ane

    The brain is the center of the nervous system, where serious neurodegenerative diseases such as Parkinson’s, Alzheimer’s and Huntington’s are products of functional loss in the neural cells (1). Typical techniques used to investigate these diseases lack precise control of the cellular surroundings......, in addition to isolating the neural tissue from nutrient delivery and to creating unwanted gradients (2). This means that typical techniques used to investigate neurodegenerative diseases cannot mimic in vivo conditions, as closely as desired. We have developed a novel microfluidic system for culturing PC12...... cells, neuronal cells, astrocytes cultures and brain slices. The microfluidic system provides efficient nutrient delivery, waste removal, access to oxygen, fine control over the neurochemical environment and access to modern microscopy. Additionally, the setup consists of an in vitro culturing...

  20. Production of betalaines by Myrtillocactus cell cultures. Passage from heterotrophic state to autotrophic state with Asparagus cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Bulard, C; Mary, J; Chaumont, D; Gudin, C

    1982-11-01

    Myrtillocactus tissue cultures are grown from the epicotyl of young plantlets. With an appropriate growing medium it is possible, after transfer of fragments of these cultures to a liquid environment, to obtain dissociation and proliferation of cells. The production of betalaic pigments is induced in solid surroundings by adjustement of the growing medium composition and can be maintained in a liquid environment. The multiplication of pigmented cells in suspension may thus be obtained. The conversion of Asparagus cell suspensions from the heterotrophic state (use of lactose as source of carbon) to the autotrophic state (carbon supplied by CO/sub 2/) is obtained by a gradual reduction in the sugar concentration of the medium combined with a rise in the CO/sub 2/ content of the gas mixture atmosphere injected into the cultivator. The passage to the autotrophic state of a Myrtillocactus suspension would enable the production conditions of a metabolite (Betalaine) to be studied by micro-algae culture techniques.

  1. Identifying developmental toxicity pathways for a subset of ToxCast chemicals using human embryonic stem cells and metabolomics

    Science.gov (United States)

    Metabolomics analysis was performed on the supernatant of human embryonic stem (hES) cell cultures exposed to a blinded subset of 11 chemicals selected from the chemical library of EPA's ToxCast™ chemical screening and prioritization research project. Metabolites from hES cultur...

  2. Biocompatibility of Tygon® tubing in microfluidic cell culture.

    Science.gov (United States)

    Jiang, Xiao; Jeffries, Rex E; Acosta, Miguel A; Tikunov, Andrey P; Macdonald, Jeffrey M; Walker, Glenn M; Gamcsik, Michael P

    2015-02-01

    Growth of the MDA-MB-231 breast cancer cell line in microfluidic channels was inhibited when culture media was delivered to the channels via microbore Tygon® tubing. Culture media incubated within this tubing also inhibited growth of these cells in conventional 96-well plates. These detrimental effects were not due to depletion of critical nutrients due to adsorption of media components onto the tubing surface. A pH change was also ruled out as a cause. Nuclear magnetic resonance spectroscopy of the cell growth media before and after incubation in the tubing confirmed no detectable loss of media components but did detect the presence of additional unidentified signals in the aliphatic region of the spectrum. These results indicate leaching of a chemical species from microbore Tygon® tubing that can affect cell growth in microfluidic devices.

  3. ALTERED EXPRESSION OF SURFACE RECEPTORS AT EA.HY926 ENDOTHELIAL CELL LINE INDUCED WITH PLACENTAL SECRETORY FACTORS

    Directory of Open Access Journals (Sweden)

    O. I. Stepanova

    2012-01-01

    Full Text Available Abstract. Placental cell populations produce a great variety of angiogenic factors and cytokines than control angiogenesis in placenta. Functional regulation of endothelial cells proceeds via modulation of endothelial cell receptors for endogenous angiogenic and apoptotic signals. Endothelial phenotype alteration during normal pregnancy and in cases of preclampsia is not well understood. The goal of this investigation was to evaluate altered expression of angiogenic and cytokine receptors at EA.hy926 endothelial cells under the influence of placental tissue supernatants. Normal placental tissue supernatants from 1st and 3rd trimesters, and pre-eclamptic placental tissue supernatants (3rd trimester stimulated angiogenic and cytokine receptors expression by the cultured endothelial cells, as compared with their background expression. Tissue supernatants from placental samples of 3rd trimester caused a decreased expression of angiogenic and cytokine receptors by endothelial cells, thus reflecting maturation of placental vascular system at these terms. Supernatants from preeclamptic placental tissue induced an increase of CD119 expression, in comparison with normal placental supernatants from the 3rd trimester. This finding suggests that IFNγ may be a factor of endothelial activation in pre-eclampsia. The study was supported by grants ГК №02.740.11.0711, НШ-3594.2010.7., and МД-150.2011.7.

  4. Human disc cells in monolayer vs 3D culture: cell shape, division and matrix formation

    Directory of Open Access Journals (Sweden)

    Hanley Edward N

    2000-10-01

    Full Text Available Abstract Background The relationship between cell shape, proliferation, and extracellular matrix (ECM production, important aspects of cell behavior, is examined in a little-studied cell type, the human annulus cell from the intervertebral disc, during monolayer vs three-dimensional (3D culture. Results Three experimental studies showed that cells respond specifically to culture microenvironments by changes in cell shape, mitosis and ECM production: 1 Cell passages showed extensive immunohistochemical evidence of Type I and II collagens only in 3D culture. Chondroitin sulfate and keratan sulfate were abundant in both monolayer and 3D cultures. 2 Cells showed significantly greater proliferation in monolayer in the presence of platelet-derived growth factor compared to cells in 3D. 3 Cells on Matrigel™-coated monolayer substrates became rounded and formed nodular colonies, a finding absent during monolayer growth. Conclusions The cell's in vivo interactions with the ECM can regulate shape, gene expression and other cell functions. The shape of the annulus cell changes markedly during life: the young, healthy disc contains spindle shaped cells and abundant collagen. With aging and degeneration, many cells assume a strikingly different appearance, become rounded and are surrounded by unusual accumulations of ECM products. In vitro manipulation of disc cells provides an experimental window for testing how disc cells from given individuals respond when they are grown in environments which direct cells to have either spindle- or rounded-shapes. In vitro assessment of the response of such cells to platelet-derived growth factor and to Matrigel™ showed a continued influence of cell shape even in the presence of a growth factor stimulus. These findings contribute new information to the important issue of the influence of cell shape on cell behavior.

  5. Enhancement effect of shikonin in cell suspension culture and transfermanant culture by radiation application

    International Nuclear Information System (INIS)

    Kim, Jae Sung; Lee, Young Keun; Chung, Byung Yeoup; Lee, Young Bok; Hwang Hye Yeon

    2004-10-01

    The cell lines 679, 679-29 and 622-46 of L. erythrorhizon could be selected on LS agar medium for the production shikonin in cell suspension culture. The shikonin was increased moderately in suspension culture of cell line 622-46 in LS liquid medium containing BA 2 mg·L -1 and IAA 0.2 mg·L -1 in the dark, and was increased by adding 1 μM Cu 2+ and 100 μM methyl jasmonate The accumulation of shikonin in the liquid medium was increased significantly by 2 Gy irradiation to callus of cell line 622-46 and culture in LS liquid medium containing BA 2 mg·L -1 and IAA 0.2 mg·L -1 in the dark and shikonin in cell debris was higher by 16 Gy irradiation. The activity of p-hydroxybenzoate geranyltransferase was increased by irradiation of 2 Gy and 16 Gy of γ radiation. Seedling hypocotyles of L. erythrorhizon were infected with Agrogacterium rhizogenes strain 15834 harboring a binary vector with an intron bearing the GUS (β-glucuronidase) gene driven by cauliflower mosaic virus (CaMV) 35S promotor as well as the HPT (hygromycin phosphotransferase) gene as the selection marker. Hairy roots isolated were hygromycin resistant and had integrated GUS gene in DNA. The root tip grown on M-9 medium showed normal pigment production pattern in border cells and root hairs

  6. T cell resistance to activation by dendritic cells requires long-term culture in simulated microgravity

    Science.gov (United States)

    Bradley, Jillian H.; Stein, Rachel; Randolph, Brad; Molina, Emily; Arnold, Jennifer P.; Gregg, Randal K.

    2017-11-01

    Immune impairment mediated by microgravity threatens the success of space exploration requiring long-duration spaceflight. The cells of most concern, T lymphocytes, coordinate the host response against microbial and cancerous challenges leading to elimination and long-term protection. T cells are activated upon recognition of specific microbial peptides bound on the surface of antigen presenting cells, such as dendritic cells (DC). Subsequently, this engagement results in T cell proliferation and differentiation into effector T cells driven by autocrine interleukin-2 (IL-2) and other cytokines. Finally, the effector T cells acquire the weaponry needed to destroy microbial invaders and tumors. Studies conducted on T cells during spaceflight, or using Earth-based culture systems, have shown reduced production of cytokines, proliferation and effector functions as compared to controls. This may account for the cases of viral reactivation events and opportunistic infections associated with astronauts of numerous missions. This work has largely been based upon the outcome of T cell activation by stimulatory factors that target select T cell signaling pathways rather than the complex, signaling events related to the natural process of antigen presentation by DC. This study tested the response of an ovalbumin peptide-specific T cell line, OT-II TCH, to activation by DC when the T cells were cultured 24-120 h in a simulated microgravity (SMG) environment generated by a rotary cell culture system. Following 72 h culture of T cells in SMG (SMG-T) or control static (Static-T) conditions, IL-2 production by the T cells was reduced in SMG-T cells compared to Static-T cells upon stimulation by phorbol 12-myristate 13-acetate (PMA) and ionomycin. However, when the SMG-T cells were stimulated with DC and peptide, IL-2 was significantly increased compared to Static-T cells. Such enhanced IL-2 production by SMG-T cells peaked at 72 h SMG culture time and decreased thereafter. When

  7. T cell resistance to activation by dendritic cells requires long-term culture in simulated microgravity.

    Science.gov (United States)

    Bradley, Jillian H; Stein, Rachel; Randolph, Brad; Molina, Emily; Arnold, Jennifer P; Gregg, Randal K

    2017-11-01

    Immune impairment mediated by microgravity threatens the success of space exploration requiring long-duration spaceflight. The cells of most concern, T lymphocytes, coordinate the host response against microbial and cancerous challenges leading to elimination and long-term protection. T cells are activated upon recognition of specific microbial peptides bound on the surface of antigen presenting cells, such as dendritic cells (DC). Subsequently, this engagement results in T cell proliferation and differentiation into effector T cells driven by autocrine interleukin-2 (IL-2) and other cytokines. Finally, the effector T cells acquire the weaponry needed to destroy microbial invaders and tumors. Studies conducted on T cells during spaceflight, or using Earth-based culture systems, have shown reduced production of cytokines, proliferation and effector functions as compared to controls. This may account for the cases of viral reactivation events and opportunistic infections associated with astronauts of numerous missions. This work has largely been based upon the outcome of T cell activation by stimulatory factors that target select T cell signaling pathways rather than the complex, signaling events related to the natural process of antigen presentation by DC. This study tested the response of an ovalbumin peptide-specific T cell line, OT-II TCH, to activation by DC when the T cells were cultured 24-120 h in a simulated microgravity (SMG) environment generated by a rotary cell culture system. Following 72 h culture of T cells in SMG (SMG-T) or control static (Static-T) conditions, IL-2 production by the T cells was reduced in SMG-T cells compared to Static-T cells upon stimulation by phorbol 12-myristate 13-acetate (PMA) and ionomycin. However, when the SMG-T cells were stimulated with DC and peptide, IL-2 was significantly increased compared to Static-T cells. Such enhanced IL-2 production by SMG-T cells peaked at 72 h SMG culture time and decreased thereafter

  8. Cell-free DNA in a three-dimensional spheroid cell culture model

    DEFF Research Database (Denmark)

    Aucamp, Janine; Calitz, Carlemi; Bronkhorst, Abel J.

    2017-01-01

    Background Investigating the biological functions of cell-free DNA (cfDNA) is limited by the interference of vast numbers of putative sources and causes of DNA release into circulation. Utilization of three-dimensional (3D) spheroid cell cultures, models with characteristics closer to the in vivo...... cultures can serve as effective, simplified in vivo-simulating “closed-circuit” models since putative sources of cfDNA are limited to only the targeted cells. In addition, cfDNA can also serve as an alternative or auxiliary marker for tracking spheroid growth, development and culture stability. Biological...... significance 3D cell cultures can be used to translate “closed-circuit” in vitro model research into data that is relevant for in vivo studies and clinical applications. In turn, the utilization of cfDNA during 3D culture research can optimize sample collection without affecting the stability of the growth...

  9. A Novel Counter Sheet-flow Sandwich Cell Culture Device for Mammalian Cell Growth in Space

    Science.gov (United States)

    Sun, Shujin; Gao, Yuxin; Shu, Nanjiang; Tang, Zemei; Tao, Zulai; Long, Mian

    2008-08-01

    Cell culture and growth in space is crucial to understand the cellular responses under microgravity. The effects of microgravity were coupled with such environment restrictions as medium perfusion, in which the underlying mechanism has been poorly understood. In the present work, a customer-made counter sheet-flow sandwich cell culture device was developed upon a biomechanical concept from fish gill breathing. The sandwich culture unit consists of two side chambers where the medium flow is counter-directional, a central chamber where the cells are cultured, and two porous polycarbonate membranes between side and central chambers. Flow dynamics analysis revealed the symmetrical velocity profile and uniform low shear rate distribution of flowing medium inside the central culture chamber, which promotes sufficient mass transport and nutrient supply for mammalian cell growth. An on-orbit experiment performed on a recovery satellite was used to validate the availability of the device.

  10. Cultured meat from stem cells: challenges and prospects.

    Science.gov (United States)

    Post, Mark J

    2012-11-01

    As one of the alternatives for livestock meat production, in vitro culturing of meat is currently studied. The generation of bio-artificial muscles from satellite cells has been ongoing for about 15 years, but has never been used for generation of meat, while it already is a great source of animal protein. In order to serve as a credible alternative to livestock meat, lab or factory grown meat should be efficiently produced and should mimic meat in all of its physical sensations, such as visual appearance, smell, texture and of course, taste. This is a formidable challenge even though all the technologies to create skeletal muscle and fat tissue have been developed and tested. The efficient culture of meat will primarily depend on culture conditions such as the source of medium and its composition. Protein synthesis by cultured skeletal muscle cells should further be maximized by finding the optimal combination of biochemical and physical conditions for the cells. Many of these variables are known, but their interactions are numerous and need to be mapped. This involves a systematic, if not systems, approach. Given the urgency of the problems that the meat industry is facing, this endeavor is worth undertaking. As an additional benefit, culturing meat may provide opportunities for production of novel and healthier products. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Oxidative Stress Induces Senescence in Cultured RPE Cells.

    Science.gov (United States)

    Aryan, Nona; Betts-Obregon, Brandi S; Perry, George; Tsin, Andrew T

    2016-01-01

    The aim of this research is to determine whether oxidative stress induces cellular senescence in human retinal pigment epithelial cells. Cultured ARPE19 cells were subjected to different concentrations of hydrogen peroxide to induce oxidative stress. Cells were seeded into 24-well plates with hydrogen peroxide added to cell medium and incubated at 37°C + 5% CO2 for a 90-minute period [at 0, 300, 400 and 800 micromolar (MCM) hydrogen peroxide]. The number of viable ARPE19 cells were recorded using the Trypan Blue Dye Exclusion Method and cell senescence was measured by positive staining for senescence-associated beta-galactosidase (SA-beta-Gal) protein. Without hydrogen peroxide treatment, the number of viable ARPE19 cells increased significantly from 50,000 cells/well to 197,000 within 72 hours. Treatment with hydrogen peroxide reduced this level of cell proliferation significantly (to 52,167 cells at 400 MCM; to 49,263 cells at 800 MCM). Meanwhile, cells with a high level of positive senescence-indicator SA-Beta-Gal-positive staining was induced by hydrogen peroxide treatment (from a baseline level of 12% to 80% at 400 MCM and at 800 MCM). Our data suggests that oxidative stress from hydrogen peroxide treatment inhibited ARPE19 cell proliferation and induced cellular senescence.

  12. Enrichment of skin-derived neural precursor cells from dermal cell populations by altering culture conditions.

    Science.gov (United States)

    Bayati, Vahid; Gazor, Rohoullah; Nejatbakhsh, Reza; Negad Dehbashi, Fereshteh

    2016-01-01

    As stem cells play a critical role in tissue repair, their manipulation for being applied in regenerative medicine is of great importance. Skin-derived precursors (SKPs) may be good candidates for use in cell-based therapy as the only neural stem cells which can be isolated from an accessible tissue, skin. Herein, we presented a simple protocol to enrich neural SKPs by monolayer adherent cultivation to prove the efficacy of this method. To enrich neural SKPs from dermal cell populations, we have found that a monolayer adherent cultivation helps to increase the numbers of neural precursor cells. Indeed, we have cultured dermal cells as monolayer under serum-supplemented (control) and serum-supplemented culture, followed by serum free cultivation (test) and compared. Finally, protein markers of SKPs were assessed and compared in both experimental groups and differentiation potential was evaluated in enriched culture. The cells of enriched culture concurrently expressed fibronectin, vimentin and nestin, an intermediate filament protein expressed in neural and skeletal muscle precursors as compared to control culture. In addition, they possessed a multipotential capacity to differentiate into neurogenic, glial, adipogenic, osteogenic and skeletal myogenic cell lineages. It was concluded that serum-free adherent culture reinforced by growth factors have been shown to be effective on proliferation of skin-derived neural precursor cells (skin-NPCs) and drive their selective and rapid expansion.

  13. Mesenchymal stem cells enhance the metastasis of 3D-cultured hepatocellular carcinoma cells

    International Nuclear Information System (INIS)

    Liu, Chang; Liu, Yang; Xu, Xiao-xi; Guo, Xin; Sun, Guang-wei; Ma, Xiao-jun

    2016-01-01

    Accumulating evidences have demonstrated that mesenchymal stem cells (MSC) could be recruited to the tumor microenvironment. Umbilical cord mesenchymal stem cells (UCMSC) were attractive vehicles for delivering therapeutic agents against cancer. Nevertheless, the safety of UCMSC in the treatment of tumors including hepatocellular carcinoma (HCC) was still undetermined. In this study, an in vitro co-culture system was established to evaluate the effect of UCMSC on the cell growth, cancer stem cell (CSC) characteristics, drug resistance, metastasis of 3D-cultured HCC cells, and the underlying mechanism was also investigated. It was found that after co-cultured with UCMSC, the metastatic ability of 3D-cultured HCC cells was significantly enhanced as indicated by up-regulation of matrix metalloproteinase (MMP), epithelial-mesenchymal transition (EMT)-related genes, and migration ability. However, cell growth, drug resistance and CSC-related gene expression of HCC cells were not affected by UCMSC. Moreover, EMT was reversed, MMP-2 expression was down-regulated, and migration ability of HCC cell was significantly inhibited when TGF-β receptor inhibitor SB431542 was added into the co-culture system. Therefore, these data indicated that UCMSC could significantly enhance the tumor cell metastasis, which was due to the EMT of HCC cells induced by TGF-β. The online version of this article (doi:10.1186/s12885-016-2595-4) contains supplementary material, which is available to authorized users

  14. Maxisorp RAST. A sensitive method for detection of antigen-specific human IgE in culture fluids

    DEFF Research Database (Denmark)

    Poulsen, L K; Pedersen, M F; Malling, H J

    1989-01-01

    For determination of allergen-specific IgE in cell culture supernatants and other highly diluted IgE preparations a radioallergosorbent test (RAST) based on high adsorption polystyrene test tubes has been developed ("Maxisorp RAST"). Cladosporium herbarum extract was used as a model allergen...

  15. Effects of viscoelastic ophthalmic solutions on cell cultures

    Directory of Open Access Journals (Sweden)

    Madhavan Hajib

    1998-01-01

    Full Text Available The development of mild but significant inflammation probably attributable to viscoelastic ophthalmic solutions in cataract surgery was recently brought to the notice of the authors, and hence a study of the effects of these solutions available in India, on cell cultures was undertaken. We studied the effects of 6 viscoelastic ophthalmic solutions (2 sodium hyaluronate designated as A and B, and 4 hydroxypropylmethylcellulose designated as C, D, E and F on HeLa, Vero and BHK-21 cell lines in tissue culture microtitre plates using undiluted, 1:10 and 1:100 dilutions of the solutions, and in cover slip cultures using undiluted solutions. Phase contrast microscopic examination of the solutions was also done to determine the presence of floating particles. The products D and F produced cytotoxic changes in HeLa cell line and these products also showed the presence of floating particles under phase contrast microscopy. Other products did not have any adverse effects on the cell lines nor did they show floating particles. The viscoelastic ophthalmic pharmaceutical products designated D and F have cytotoxic effects on HeLa cell line which appears to be a useful cell line for testing these products for their toxicity. The presence of particulate materials in products D and F indicates that the methods used for purification of the solution are not effective.

  16. Staurosporine induces different cell death forms in cultured rat astrocytes

    International Nuclear Information System (INIS)

    Simenc, Janez; Lipnik-Stangelj, Metoda

    2012-01-01

    Astroglial cells are frequently involved in malignant transformation. Besides apoptosis, necroptosis, a different form of regulated cell death, seems to be related with glioblastoma genesis, proliferation, angiogenesis and invasion. In the present work we elucidated mechanisms of necroptosis in cultured astrocytes, and compared them with apoptosis, caused by staurosporine. Cultured rat cortical astrocytes were used for a cell death studies. Cell death was induced by different concentrations of staurosporine, and modified by inhibitors of apoptosis (z-vad-fmk) and necroptosis (nec-1). Different forms of a cell death were detected using flow cytometry. We showed that staurosporine, depending on concentration, induces both, apoptosis as well as necroptosis. Treatment with 10 −7 M staurosporine increased apoptosis of astrocytes after the regeneration in a staurosporine free medium. When caspases were inhibited, apoptosis was attenuated, while necroptosis was slightly increased. Treatment with 10 −6 M staurosporine induced necroptosis that occurred after the regeneration of astrocytes in a staurosporine free medium, as well as without regeneration period. Necroptosis was significantly attenuated by nec-1 which inhibits RIP1 kinase. On the other hand, the inhibition of caspases had no effect on necroptosis. Furthermore, staurosporine activated RIP1 kinase increased the production of reactive oxygen species, while an antioxidant BHA significantly attenuated necroptosis. Staurosporine can induce apoptosis and/or necroptosis in cultured astrocytes via different signalling pathways. Distinction between different forms of cell death is crucial in the studies of therapy-induced necroptosis

  17. Endocytic activity of Sertoli cells grown in bicameral culture chambers

    International Nuclear Information System (INIS)

    Dai, R.X.; Djakiew, D.; Dym, M.

    1987-01-01

    Immature rat Sertoli cells were cultured for 7 to 14 days on Millipore filters impregnated with a reconstituted basement membrane extract in dual-environment (bicameral) culture chambers. Electron microscopy of the cultured cells revealed the presence of rod-shaped mitochondria, Golgi apparatus, rough endoplasmic reticulum, and Sertoli-Sertoli tight junctions, typical of these cells in vivo. The endocytic activity of both the apical and basal surfaces of the Sertoli cells was examined by either adding alpha 2-macroglobulin (alpha 2-M) conjugated to 20 nm gold particles to the apical chamber or by adding 125 I labeled alpha 2-M to the basal chamber. During endocytosis from the apical surface of Sertoli cells, the alpha 2-M-gold particles were bound initially to coated pits and then internalized into coated vesicles within 5 minutes. After 10 minutes, the alpha 2-M-gold was found in multi-vesicular bodies (MVBs) and by 30 minutes it was present in the lysosomes. The proportion of alpha 2-M-gold found within endocytic cell organelles after 1 hour of uptake was used to estimate the approximate time that this ligand spent in each type of organelle. The alpha 2-M-gold was present in coated pits, coated vesicles, multivesicular bodies, and lysosomes for approximately 3, 11, 22, and 24 minutes, respectively. This indicates that the initial stages of endocytosis are rapid, whereas MVBs and lysosomes are relatively long-lived

  18. Apple derived cellulose scaffolds for 3D mammalian cell culture.

    Directory of Open Access Journals (Sweden)

    Daniel J Modulevsky

    Full Text Available There are numerous approaches for producing natural and synthetic 3D scaffolds that support the proliferation of mammalian cells. 3D scaffolds better represent the natural cellular microenvironment and have many potential applications in vitro and in vivo. Here, we demonstrate that 3D cellulose scaffolds produced by decellularizing apple hypanthium tissue can be employed for in vitro 3D culture of NIH3T3 fibroblasts, mouse C2C12 muscle myoblasts and human HeLa epithelial cells. We show that these cells can adhere, invade and proliferate in the cellulose scaffolds. In addition, biochemical functionalization or chemical cross-linking can be employed to control the surface biochemistry and/or mechanical properties of the scaffold. The cells retain high viability even after 12 continuous weeks of culture and can achieve cell densities comparable with other natural and synthetic scaffold materials. Apple derived cellulose scaffolds are easily produced, inexpensive and originate from a renewable source. Taken together, these results demonstrate that naturally derived cellulose scaffolds offer a complementary approach to existing techniques for the in vitro culture of mammalian cells in a 3D environment.

  19. Somatic embryogenesis in cell cultures of Glycine species.

    Science.gov (United States)

    Gamborg, O L; Davis, B P; Stahlhut, R W

    1983-08-01

    This report describes the development of procedures for the production of somatic embryos in cell cultures of Glycine species including soybean. The conditions for callus induction and initiation of rapidly growing cell suspension cultures were defined. Methods for inducing embryogenesis were tested on 16 lines of several Glycine species and cultivars of soybean. The SB-26 Culture of a G. soja gave the best results and was used in the experiments. Embryogenesis required the presence of picloram or 2,4-D. AMO 1618, CCC, PP-333 and Ancymidol enhanced the embryogenesis frequency. Plants of the G. soja (SB-26) were grown to maturity from seed-derived shoot tips. Characteristics of the plants are discussed.

  20. Radiation transformation in differentiated human cells in culture

    International Nuclear Information System (INIS)

    Mothersill, C.; Seymour, C.; Moriarty, M.; Malone, J.; Byrne, P.; Hennessy, T.

    1986-01-01

    A tissue culture technique is described for human thyroid tissue as an approach to studying mechanisms of human radiation carcinogenesis. Normal human tissue obtained from surgery is treated in one of two ways, depending upon size of specimen. Large pieces are completely digested in trypsin/ collagenase solution to a single cell suspension. Small pieces of tissue are plated as explants following partial digestion in trypsin/collagenase solution. Following irradiation of the primary differentiated monolayers (normally 10 days after plating), the development of transformed characteristics is monitored in the subsequent subcultures. A very high level of morphological and functional differentiation is apparent in the primary cultures. Over a period of approx. 6 months, the irradiated surviving cells continue to grow in culture, unlike the unirradiated controls which senesce after 2-3 subcultures. (UK)

  1. Disposable Bioreactors for Plant Micropropagation and Mass Plant Cell Culture

    Science.gov (United States)

    Ducos, Jean-Paul; Terrier, Bénédicte; Courtois, Didier

    Different types of bioreactors are used at Nestlé R&D Centre - Tours for mass propagation of selected plant varieties by somatic embryogenesis and for large scale culture of plants cells to produce metabolites or recombinant proteins. Recent studies have been directed to cut down the production costs of these two processes by developing disposable cell culture systems. Vegetative propagation of elite plant varieties is achieved through somatic embryogenesis in liquid medium. A pilot scale process has recently been set up for the industrial propagation of Coffea canephora (Robusta coffee). The current production capacity is 3.0 million embryos per year. The pre-germination of the embryos was previously conducted by temporary immersion in liquid medium in 10-L glass bioreactors. An improved process has been developed using a 10-L disposable bioreactor consisting of a bag containing a rigid plastic box ('Box-in-Bag' bioreactor), insuring, amongst other advantages, a higher light transmittance to the biomass due to its horizontal design. For large scale cell culture, two novel flexible plastic-based disposable bioreactors have been developed from 10 to 100 L working volumes, validated with several plant species ('Wave and Undertow' and 'Slug Bubble' bioreactors). The advantages and the limits of these new types of bioreactor are discussed, based mainly on our own experience on coffee somatic embryogenesis and mass cell culture of soya and tobacco.

  2. The bioconversion process of deoxypodophyllotoxin with Linum flavum cell cultures

    NARCIS (Netherlands)

    Koulman, A; Beekman, A.C; Pras, N.; Quax, Wim

    2003-01-01

    The in vitro cell suspension culture of Linum flavum is able to convert high amounts of the 2,7'-cyclolignan deoxypodophyllotoxin into 6-methoxypodophyllotoxin 7-O-glucoside. We studied this conversion in detail by monitoring the intermediates and side-products after feeding different concentrations

  3. Using Haworthia Cultured Cells as an Aid in Teaching Botany

    Science.gov (United States)

    Majumdar, Shyamal K.; Castellano, John M.

    1977-01-01

    Callus induction from species of Haworthia can be done quickly in the laboratory with minimal equipment to study tissue dedifferentiation and cellular redifferentiation. It is shown that the cultured cell can also be used to study and evaluate the effects of various mutagens, carcinogens, and pesticides in controlled environments. (Author/MA)

  4. Rapid method for culturing embryonic neuron-glial cell cocultures

    DEFF Research Database (Denmark)

    Svenningsen, Åsa Fex; Shan, Wei-Song; Colman, David R

    2003-01-01

    neurons is seen after 3 weeks (2 weeks in ascorbic acid), suggesting that basal lamina production is important even for glial ensheathment in the enteric nervous system. No overgrowth of fibroblasts or other nonneuronal cells was noted in any cultures, and myelination of the peripheral nervous system...

  5. Plant Cell Cultures as Source of Cosmetic Active Ingredients

    Directory of Open Access Journals (Sweden)

    Ani Barbulova

    2014-04-01

    Full Text Available The last decades witnessed a great demand of natural remedies. As a result, medicinal plants have been increasingly cultivated on a commercial scale, but the yield, the productive quality and the safety have not always been satisfactory. Plant cell cultures provide useful alternatives for the production of active ingredients for biomedical and cosmetic uses, since they represent standardized, contaminant-free and biosustainable systems, which allow the production of desired compounds on an industrial scale. Moreover, thanks to their totipotency, plant cells grown as liquid suspension cultures can be used as “biofactories” for the production of commercially interesting secondary metabolites, which are in many cases synthesized in low amounts in plant tissues and differentially distributed in the plant organs, such as roots, leaves, flowers or fruits. Although it is very widespread in the pharmaceutical industry, plant cell culture technology is not yet very common in the cosmetic field. The aim of the present review is to focus on the successful research accomplishments in the development of plant cell cultures for the production of active ingredients for cosmetic applications.

  6. Establishment of the callus and cell suspension culture of ...

    African Journals Online (AJOL)

    The objective of this work was the optimization of the conditions of callus and cell suspension culture of Elaeagnus angustifolia for the production of condensed tannins. The effects of different conditions on the callus growth and the production of condensed tannins were researched. The leaf tissue part of E. angustifolia was ...

  7. The presence of pMRC01 promotes greater cell permeability and autolysis in lactococcal starter cultures.

    Science.gov (United States)

    Fallico, Vincenzo; McAuliffe, Olivia; Fitzgerald, Gerald F; Hill, Colin; Ross, R Paul

    2009-08-15

    Conjugative transfer of plasmid-associated properties is routinely used to generate food-grade derivatives of lactococcal starter strains with improved technological traits. However, the introduction of one or more plasmids in a single strain is likely to impose a burden on regular cell metabolism and may affect the growth characteristics of the transconjugant culture. The aim of this study was to evaluate the impact of the 60.2-kb plasmid pMRC01 (encoding for an abortive infection bacteriophage resistance system and production of the anti-microbial, lacticin 3147) on starter performance. Five lactococcal strains (L. lactis HP, 255A, SK1, 712 and IL1403) and their pMRC01-containing derivatives were compared in terms of technological properties, including analysis of growth, acidification and autolysis rates. The transconjugants exhibited lower specific growth rates and higher generation times compared to the parental strains when grown at 30 degrees C in glucose-M17, but the presence of pMRC01 did not significantly affect the acidification capacity of strains in 11% reconstituted skimmed milk and synthetic media. Levels of lactate dehydrogenase were two-fold higher in supernatants of transconjugants than in those of parental strains, after 24 and 72 h of growth at 30 degrees C in glucose-M17, suggesting that the presence of pMRC01 somehow accelerates and promotes cellular autolysis. Analysis by flow cytometry following live/dead staining confirmed this result by showing larger populations of injured and dead cells in pMRC01-carrying cultures compared to the parental strains. The results of this study reveal that the plasmid pMRC01 places a burden on lactococcal host metabolism, which is associated with an increased cell permeability and autolysis, without significantly affecting the acidification capacity of the starter. While the magnitude of these effects appears to be strain dependent, the production of the bacteriocin lacticin 3147 may not be involved.

  8. Ultrastructure of cells of Ulmus americana cultured in vitro and exposed to the culture filtrate of Ceratocystis ulmi

    Science.gov (United States)

    Paula M. Pijut; R. Daniel Lineberger; Subhash C. Domir; Jann M. Ichida; Charles R. Krause

    1990-01-01

    Calli of American elm susceptible and resistant to Dutch elm disease were exposed to a culture filtrate of a pathogenic isolate of Ceratocystis ulmi. Cells from untreated tissue exhibited typical internal composition associated with healthy, actively growing cells. All cells exposed to culture filtrate showed appreciable ultrastructural changes....

  9. Lethal impacts of cigarette smoke in cultured tobacco cells

    Directory of Open Access Journals (Sweden)

    Kawano Tomonori

    2011-07-01

    Full Text Available Abstract Background In order to understand and generalize the toxic mechanism of cigarette smoke in living cells, comparison of the data between animal systems and other biological system such as microbial and plant systems is highly beneficial. Objective By employing the tobacco cells as model materials for cigarette smoke toxicity assay, the impacts of the combustion by-products such as nitrogen oxides could be highlighted as the toxic impacts of the plant-derived endogenous chemicals could be excluded in the plant cells. Methods Cigarette smoke-induced cell death was assessed in tobacco cell suspension cultures in the presence and absence of pharmacological inhibitors. Results Cigarette smoke was effective in induction of cell death. The smoke-induced cell death could be partially prevented by addition of nitric oxide (NO scavenger, suggesting the role for NO as the cell death mediator. Addition of NO donor to tobacco cells also resulted in development of partial cell death further confirming the role of NO as cell death mediator. Members of reactive oxygen species and calcium ion were shown to be protecting the cells from the toxic action of smoke-derived NO.

  10. Porcine platelet lysate as a supplement for animal cell culture

    Science.gov (United States)

    Aldén, Anna; Gonzalez, Lorena; Persson, Anna; Christensson, Kerstin; Holmqvist, Olov

    2007-01-01

    A novel supplementation of cell growth media based on a porcine platelet lysate was developed for culture of animal-derived cells. The platelet lysate was produced from porcine blood and contained lysate of platelets and plasma components. It showed satisfactory microbiological integrity and it carried only low amount of endotoxins (platelet lysate supported well proliferation of Vero (African green monkey transformed kidney epithelial cells), Chinese hamster ovary (CHO) and hybridoma cells comparable to fetal bovine serum (FBS). Platelet lysate shows promise as a viable choice over FBS as it can be produced in large quantities, high lot-to-lot consistency and with an attractive price structure. Furthermore it is a strong alternative to FBS for ethical reasons. It is expected that it can be used as a general supplementation for most animal cells for research studies on the proliferation of cells and their expression of products. PMID:19002989

  11. Maintenance of mesenchymal stem cells culture due to the cells with reduced attachment rate

    Directory of Open Access Journals (Sweden)

    Shuvalova N. S.

    2013-01-01

    Full Text Available Aim. The classic detachment techniques lead to changes in cells properties. We offer a simple method of cultivating the population of cells that avoided an influence on the surface structures. Methods. Mesenchymal stem cells (MSC from human umbilical cord matrix were obtained and cultivated in standard conditions. While substituting the culture media by a fresh portion, the conditioned culture medium, where the cells were maintained for three days, was transferred to other culture flacks with addition of serum and growth factors. Results. In the flacks, one day after medium transfer, we observed attached cells with typical MSC morphology. The cultures originated from these cells had the same rate of surface markers expression and clonogenic potential as those replated by standard methods. Conclusions. MSC culture, derived by preserving the cells with reduced attachment ability, actually has the properties of «parent» passage. Using this method with accepted techniques of cells reseeding would allow maintaining the cells that avoided an impact on the cell surface proteins.

  12. Mechanism for multiplicity of steady states with distinct cell concentration in continuous culture of mammalian cells.

    Science.gov (United States)

    Yongky, Andrew; Lee, Jongchan; Le, Tung; Mulukutla, Bhanu Chandra; Daoutidis, Prodromos; Hu, Wei-Shou

    2015-07-01

    Continuous culture for the production of biopharmaceutical proteins offers the possibility of steady state operations and thus more consistent product quality and increased productivity. Under some conditions, multiplicity of steady states has been observed in continuous cultures of mammalian cells, wherein with the same dilution rate and feed nutrient composition, steady states with very different cell and product concentrations may be reached. At those different steady states, cells may exhibit a high glycolysis flux with high lactate production and low cell concentration, or a low glycolysis flux with low lactate and high cell concentration. These different steady states, with different cell concentration, also have different productivity. Developing a mechanistic understanding of the occurrence of steady state multiplicity and devising a strategy to steer the culture toward the desired steady state is critical. We establish a multi-scale kinetic model that integrates a mechanistic intracellular metabolic model and cell growth model in a continuous bioreactor. We show that steady state multiplicity exists in a range of dilution rate in continuous culture as a result of the bistable behavior in glycolysis. The insights from the model were used to devise strategies to guide the culture to the desired steady state in the multiple steady state region. The model provides a guideline principle in the design of continuous culture processes of mammalian cells. © 2015 Wiley Periodicals, Inc.

  13. Characterization of primary human mammary epithelial cells isolated and propagated by conditional reprogrammed cell culture.

    Science.gov (United States)

    Jin, Liting; Qu, Ying; Gomez, Liliana J; Chung, Stacey; Han, Bingchen; Gao, Bowen; Yue, Yong; Gong, Yiping; Liu, Xuefeng; Amersi, Farin; Dang, Catherine; Giuliano, Armando E; Cui, Xiaojiang

    2018-02-20

    Conditional reprogramming methods allow for the inexhaustible in vitro proliferation of primary epithelial cells from human tissue specimens. This methodology has the potential to enhance the utility of primary cell culture as a model for mammary gland research. However, few studies have systematically characterized this method in generating in vitro normal human mammary epithelial cell models. We show that cells derived from fresh normal breast tissues can be propagated and exhibit heterogeneous morphologic features. The cultures are composed of CK18, desmoglein 3, and CK19-positive luminal cells and vimentin, p63, and CK14-positive myoepithelial cells, suggesting the maintenance of in vivo heterogeneity. In addition, the cultures contain subpopulations with different CD49f and EpCAM expression profiles. When grown in 3D conditions, cells self-organize into distinct structures that express either luminal or basal cell markers. Among these structures, CK8-positive cells enclosing a lumen are capable of differentiation into milk-producing cells in the presence of lactogenic stimulus. Furthermore, our short-term cultures retain the expression of ERα, as well as its ability to respond to estrogen stimulation. We have investigated conditionally reprogrammed normal epithelial cells in terms of cell type heterogeneity, cellular marker expression, and structural arrangement in two-dimensional (2D) and three-dimensional (3D) systems. The conditional reprogramming methodology allows generation of a heterogeneous culture from normal human mammary tissue in vitro . We believe that this cell culture model will provide a valuable tool to study mammary cell function and malignant transformation.

  14. Imprint lithography provides topographical nanocues to guide cell growth in primary cortical cell culture

    NARCIS (Netherlands)

    Xie, S.; Luttge, R.

    2014-01-01

    In this paper, we describe a technology platform to study the effect of nanocues on the cell growth direction in primary cortical cell culture. Topographical cues to cells are provided using nanoscale features created by Jet and Flash Imprint Lithography, coated with polyethylenimine. We

  15. Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions.

    Science.gov (United States)

    Kaji, Hirokazu; Camci-Unal, Gulden; Langer, Robert; Khademhosseini, Ali

    2011-03-01

    Inside the body, cells lie in direct contact or in close proximity to other cell types in a tightly controlled architecture that often regulates the resulting tissue function. Therefore, tissue engineering constructs that aim to reproduce the architecture and the geometry of tissues will benefit from methods of controlling cell-cell interactions with microscale resolution. We discuss the use of microfabrication technologies for generating patterned co-cultures. In addition, we categorize patterned co-culture systems by cell type and discuss the implications of regulating cell-cell interactions in the resulting biological function of the tissues. Patterned co-cultures are a useful tool for fabricating tissue engineered constructs and for studying cell-cell interactions in vitro, because they can be used to control the degree of homotypic and heterotypic cell-cell contact. In addition, this approach can be manipulated to elucidate important factors involved in cell-matrix interactions. Patterned co-culture strategies hold significant potential to develop biomimetic structures for tissue engineering. It is expected that they would create opportunities to develop artificial tissues in the future. This article is part of a Special Issue entitled Nanotechnologies - Emerging Applications in Biomedicine. 2010 Elsevier B.V. All rights reserved.

  16. The major bovine mastitis pathogens have different cell tropisms in cultures of bovine mammary gland cells

    NARCIS (Netherlands)

    Lammers, A.; Vorstenbosch, van C.J.; Erkens, J.H.F.; Smith, H.E.

    2001-01-01

    We previously showed that Staphylococcus aureus cells adhered mainly to an elongated cell type, present in cultures of bovine mammary gland cells. Moreover. we showed that this adhesion was mediated by binding to fibronectin. The same in vitro model was used here, to study adhesion of other

  17. MEMS-based dynamic cell-to-cell culture platforms using electrochemical surface modifications

    International Nuclear Information System (INIS)

    Chang, Jiyoung; Lin, Liwei; Yoon, Sang-Hee; Mofrad, Mohammad R K

    2011-01-01

    MEMS-based biological platforms with the capability of both spatial placements and time releases of living cells for cell-to-cell culture experiments have been designed and demonstrated utilizing electrochemical surface modification effects. The spatial placement is accomplished by electrochemical surface modification of substrate surfaces to be either adhesive or non-adhesive for living cells. The time control is achieved by the electrical activation of the selective indium tin oxide co-culture electrode to allow the migration of living cells onto the electrode to start the cell-to-cell culture studies. Prototype devices have a three-electrode design with an electrode size of 50 × 50 µm 2 and the separation gaps of 2 µm between them. An electrical voltage of −1.5 V has been used to activate the electrodes independently and sequentially to demonstrate the dynamic cell-to-cell culture experiments of NIH 3T3 fibroblast and Madin Darby canine kidney cells. As such, this MEMS platform could be a basic yet versatile tool to characterize transient cell-to-cell interactions

  18. Cell culture density affects the proliferation activity of human adipose tissue stem cells.

    Science.gov (United States)

    Kim, Dae Seong; Lee, Myoung Woo; Ko, Young Jong; Chun, Yong Hoon; Kim, Hyung Joon; Sung, Ki Woong; Koo, Hong Hoe; Yoo, Keon Hee

    2016-01-01

    In this study, we investigated the effect of cell density on the proliferation activity of human mesenchymal stem cells (MSCs) derived from adipose tissue (AT-MSCs) over time in culture. Passage #4 (P4) and #12 (P12) AT-MSCs from two donors were plated at a density of 200 (culture condition 1, CC1) or 5000 (culture condition 2, CC2) cells cm(-2) . After 7 days of incubation, P4 and P12 AT-MSCs cultured in CC1 were thin and spindle-shaped, whereas those cultured in CC2 had extensive cell-to-cell contacts and an expanded cell volume. In addition, P4 and P12 AT-MSCs in CC1 divided more than three times, while those in CC2 divided less than once on average. Flow cytometric analysis using 5(6)-carboxyfluorescein diacetate N-succinimidyl ester dye showed that the fluorescence intensity of AT-MSCs was lower in CC1 than in CC2. Furthermore, expression of proliferation-associated genes, such as CDC45L, CDC20A and KIF20A, in P4 AT-MSCs was higher in CC1 than in CC2, and this difference was also observed in P12 AT-MSCs. These data demonstrated that cell culture density affects the proliferation activity of MSCs, suggesting that it is feasible to design a strategy to prepare suitable MSCs using specific culture conditions. Copyright © 2016 John Wiley & Sons, Ltd.

  19. Plant cell tissue culture: A potential source of chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Scott, C.D.; Dougall, D.K.

    1987-08-01

    Higher plants produce many industrially important products. Among these are drugs and medicinal chemicals, essential oils and flavors, vegetable oils and fats, fine and specialty chemicals, and even some commodity chemicals. Although, currently, whole-plant extraction is the primary means of harvesting these materials, the advent of plant cell tissue culture could be a much more effective method of producing many types of phytochemicals. The use of immobilized plant cells in an advanced bioreactor configuration with excretion of the product into the reactor medium may represent the most straightforward way of commercializing such techniques for lower-value chemicals. Important research and development opportunities in this area include screening for plant cultures for nonmedical, lower-value chemicals; understanding and controlling plant cell physiology and biochemistry; optimizing effective immobilization methods; developing more efficient bioreactor concepts; and perfecting product extraction and purification techniques. 62 refs., 2 figs.

  20. Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models

    Science.gov (United States)

    Marquette, Michele L.; Sognier, Marguerite A.

    2013-01-01

    An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.

  1. Diagnosing feline infectious peritonitis using the Sysmex XT-2000iV based on frozen supernatants from cavitary effusions.

    Science.gov (United States)

    Stranieri, Angelica; Paltrinieri, Saverio; Giordano, Alessia

    2017-05-01

    The delta total nucleated cells (ΔTNC) measurement with the Sysmex XT-2000iV (Sysmex Europe, Norderstedt, Germany) has high diagnostic accuracy on effusions in feline infectious peritonitis (FIP) cases, but the test can be performed only on fresh samples. We evaluated whether supernatants from effusions retain the ability to induce cell clumping and assessed the diagnostic accuracy of this modified ΔTNC method. Effusions were collected from FIP cats ( n = 19) and from cats with other diseases ( n = 15). ΔTNC was measured on fresh samples and on frozen-thawed supernatants after the addition of feline blood at 1:10 dilution. Diagnostic accuracy was assessed at the cutoffs of suggestive of FIP (ΔTNC = 1.7) and consistent with FIP (ΔTNC = 3.4). The influence of the protein content, number of added cells, and magnitude of dilution were also investigated. Specificity and positive predictive value were 100% for both the methods. Sensitivity and negative predictive value were higher for the modified ΔTNC (84.2% and 83.3%, respectively, at the cutoff of 1.7; 78.9% and 78.9%, respectively, at the cutoff of 3.4) than for the ΔTNC on fresh samples (78.6% and 81.3%, respectively, at the cutoff of 1.7; 57.1% and 68.4%, respectively, at the cutoff of 3.4). Protein content, total cell count of the added blood, and magnitude of dilutions did not influence the results. Supernatants of frozen effusions from FIP cats retain the ability to induce cell clumping, thus the modified ΔTNC measurement is a reliable tool to diagnose FIP on samples that cannot be analyzed immediately.

  2. Growth and Plating of Cell Suspension Cultures of Datura Innoxia

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1974-01-01

    Suspension cultures of Datura innoxia Mill, were successfully grown on a modified Murashige and Skoog medium with 2,4–D, NAA or BAP as growth substances, provided the micronutrient levels were reduced to 1/10. Normal amounts of micronutrients were toxic. Attempts to identify the toxic elements did...... not succeed. Cultures grew exponentially on a shaker at 27°C in the light. Their doubling times varied from 1.1 days on 2,4–D (10–6M) or NAA (10−5M)+ 1 g/1 casein hydrolysate to 2.7 days on BAP (3 × 10−7M) and 5.1 days on supraoptimal levels of 2,4-D (10−5M). Cultures grew on NH4+-N alone (from ammonium...... malate) or on NO3−-N alone. Dry weight yield was proportional to the amount of nitrate-N added (47 mg/mg N). Filtered suspension cultures containing single cells (plating cultures) could be grown in agar in petri dishes when NAA or 2,4-D were used as growth substances. Cells grew at densities above 500...

  3. Trophic Effects of Mesenchymal Stem Cells in Chondrocyte Co-Cultures are Independent of Culture Conditions and Cell Sources

    NARCIS (Netherlands)

    Wu, Ling; Prins, H.J.; Helder, M.; van Blitterswijk, Clemens; Karperien, Hermanus Bernardus Johannes

    2012-01-01

    Earlier, we have shown that the increased cartilage production in pellet co-cultures of chondrocytes and bone marrow-derived mesenchymal stem cells (BM-MSCs) is due to a trophic role of the MSC in stimulating chondrocyte proliferation and matrix production rather than MSCs actively undergoing

  4. Trophic effects of mesenchymal stem cells in chondrocyte co-cultures are independent of culture conditions and cell sources

    NARCIS (Netherlands)

    Wu, L.; Prins, H.J.; Helder, M.N.; van Blitterswijk, C.A.; Karperien, M.

    2012-01-01

    Earlier, we have shown that the increased cartilage production in pellet co-cultures of chondrocytes and bone marrow-derived mesenchymal stem cells (BM-MSCs) is due to a trophic role of the MSC in stimulating chondrocyte proliferation and matrix production rather than MSCs actively undergoing

  5. The Effect of Spaceflight on Bone Cell Cultures

    Science.gov (United States)

    Landis, William J.

    1999-01-01

    Understanding the response of bone to mechanical loading (unloading) is extremely important in defining the means of adaptation of the body to a variety of environmental conditions such as during heightened physical activity or in extended explorations of space or the sea floor. The mechanisms of the adaptive response of bone are not well defined, but undoubtedly they involve changes occurring at the cellular level of bone structure. This proposal has intended to examine the hypothesis that the loading (unloading) response of bone is mediated by specific cells through modifications of their activity cytoskeletal elements, and/or elaboration of their extracellular matrices. For this purpose, this laboratory has utilized the results of a number of previous studies defining molecular biological, biochemical, morphological, and ultrastructural events of the reproducible mineralization of a primary bone cell (osteoblast) culture system under normal loading (1G gravity level). These data and the culture system then were examined following the use of the cultures in two NASA shuttle flights, STS-59 and STS-63. The cells collected from each of the flights were compared to respective synchronous ground (1G) control cells examined as the flight samples were simultaneously analyzed and to other control cells maintained at 1G until the time of shuttle launch, at which point they were terminated and studied (defined as basal cells). Each of the cell cultures was assayed in terms of metabolic markers- gene expression; synthesis and secretion of collagen and non-collagenous proteins, including certain cytoskeletal components; assembly of collagen into macrostructural arrays- formation of mineral; and interaction of collagen and mineral crystals during calcification of the cultures. The work has utilized a combination of biochemical techniques (radiolabeling, electrophoresis, fluorography, Western and Northern Blotting, and light microscopic immunofluorescence) and structural

  6. Alginate as a cell culture substrate for growth and differentiation of human retinal pigment epithelial cells.

    Science.gov (United States)

    Heidari, Razeih; Soheili, Zahra-Soheila; Samiei, Shahram; Ahmadieh, Hamid; Davari, Maliheh; Nazemroaya, Fatemeh; Bagheri, Abouzar; Deezagi, Abdolkhalegh

    2015-03-01

    The purpose of this study was to evaluate retinal pigment epithelium (RPE) cells' behavior in alginate beads that establish 3D environment for cellular growth and mimic extracellular matrix versus the conventional 2D monolayer culture. RPE cells were encapsulated in alginate beads by dripping alginate cell suspension into CaCl2 solution. Beads were suspended in three different media including Dulbecco's modified Eagle's medium (DMEM)/F12 alone, DMEM/F12 supplemented with 10 % fetal bovine serum (FBS), and DMEM/F12 supplemented with 30 % human amniotic fluid (HAF). RPE cells were cultivated on polystyrene under the same conditions as controls. Cell phenotype, cell proliferation, cell death, and MTT assay, immunocytochemistry, and real-time RT-PCR were performed to evaluate the effect of alginate on RPE cells characteristics and integrity. RPE cells can survive and proliferate in alginate matrixes. Immunocytochemistry analysis exhibited Nestin, RPE65, and cytokeratin expressions in a reasonable number of cultured cells in alginate beads. Real-time PCR data demonstrated high levels of Nestin, CHX10, RPE65, and tyrosinase gene expressions in RPE cells immobilized in alginate when compared to 2D monolayer culture systems. The results suggest that alginate can be used as a reliable scaffold for maintenance of RPE cells' integrity and in vitro propagation of human retinal progenitor cells for cell replacement therapies in retinal diseases.

  7. Cell chirality: emergence of asymmetry from cell culture.

    Science.gov (United States)

    Wan, Leo Q; Chin, Amanda S; Worley, Kathryn E; Ray, Poulomi

    2016-12-19

    Increasing evidence suggests that intrinsic cell chirality significantly contributes to the left-right (LR) asymmetry in embryonic development, which is a well-conserved characteristic of living organisms. With animal embryos, several theories have been established, but there are still controversies regarding mechanisms associated with embryonic LR symmetry breaking and the formation of asymmetric internal organs. Recently, in vitro systems have been developed to determine cell chirality and to recapitulate multicellular chiral morphogenesis on a chip. These studies demonstrate that chirality is indeed a universal property of the cell that can be observed with well-controlled experiments such as micropatterning. In this paper, we discuss the possible benefits of these in vitro systems to research in LR asymmetry, categorize available platforms for single-cell chirality and multicellular chiral morphogenesis, and review mathematical models used for in vitro cell chirality and its applications in in vivo embryonic development. These recent developments enable the interrogation of the intracellular machinery in LR axis establishment and accelerate research in birth defects in laterality.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Author(s).

  8. Endothelial cells stimulate growth of normal and cancerous breast epithelial cells in 3D culture

    Directory of Open Access Journals (Sweden)

    Magnusson Magnus K

    2010-07-01

    Full Text Available Abstract Background Epithelial-stromal interaction provides regulatory signals that maintain correct histoarchitecture and homeostasis in the normal breast and facilitates tumor progression in breast cancer. However, research on the regulatory role of the endothelial component in the normal and malignant breast gland has largely been neglected. The aim of the study was to investigate the effects of endothelial cells on growth and differentiation of human breast epithelial cells in a three-dimensional (3D co-culture assay. Methods Breast luminal and myoepithelial cells and endothelial cells were isolated from reduction mammoplasties. Primary cells and established normal and malignant breast cell lines were embedded in reconstituted basement membrane in direct co-culture with endothelial cells and by separation of Transwell filters. Morphogenic and phenotypic profiles of co-cultures was evaluated by phase contrast microscopy, immunostaining and confocal microscopy. Results In co-culture, endothelial cells stimulate proliferation of both luminal- and myoepithelial cells. Furthermore, endothelial cells induce a subpopulation of luminal epithelial cells to form large acini/ducts with a large and clear lumen. Endothelial cells also stimulate growth and cloning efficiency of normal and malignant breast epithelial cell lines. Transwell and gradient co-culture studies show that endothelial derived effects are mediated - at least partially - by soluble factors. Conclusion Breast endothelial cells - beside their role in transporting nutrients and oxygen to tissues - are vital component of the epithelial microenvironment in the breast and provide proliferative signals to the normal and malignant breast epithelium. These growth promoting effects of endothelial cells should be taken into consideration in breast cancer biology.

  9. Co-culture with Sertoli cells promotes proliferation and migration of umbilical cord mesenchymal stem cells

    International Nuclear Information System (INIS)

    Zhang, Fenxi; Hong, Yan; Liang, Wenmei; Ren, Tongming; Jing, Suhua; Lin, Juntang

    2012-01-01

    Highlights: ► Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). ► Presence of SCs dramatically increased proliferation and migration of UCMSCs. ► Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of “nurse” cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.

  10. Co-culture with Sertoli cells promotes proliferation and migration of umbilical cord mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Fenxi, E-mail: fxzhang0824@gmail.com [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Hong, Yan; Liang, Wenmei [Department of Histology and Embryology, Guiyang Medical University, Guizhou 550004, People' s Republic of China (China); Ren, Tongming [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Jing, Suhua [ICU Center, The Third Hospital of Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Lin, Juntang [Stem Cell Center, Xinxiang Medical University, Henan 453003, People' s Republic of China (China)

    2012-10-12

    Highlights: Black-Right-Pointing-Pointer Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). Black-Right-Pointing-Pointer Presence of SCs dramatically increased proliferation and migration of UCMSCs. Black-Right-Pointing-Pointer Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of 'nurse' cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.

  11. PC-3 prostate carcinoma cells release signal substances that influence the migratory activity of cells in the tumor's microenvironment

    Directory of Open Access Journals (Sweden)

    Zänker Kurt S

    2010-07-01

    Full Text Available Abstract Background Tumor cells interact with the cells of the microenvironment not only by cell-cell-contacts but also by the release of signal substances. These substances are known to induce tumor vascularization, especially under hypoxic conditions, but are also supposed to provoke other processes such as tumor innervation and inflammatory conditions. Inflammation is mediated by two organ systems, the neuroendocrine system and the immune system. Therefore, we investigated the influence of substances released by PC-3 human prostate carcinoma cells on SH-SY5Y neuroblastoma cells as well as neutrophil granulocytes and cytotoxic T lymphocytes, especially with regard to their migratory activity. Results PC-3 cells express several cytokines and growth factors including vascular endothelial growth factors, fibroblast growth factors, interleukins and neurotrophic factors. SH-SY5Y cells are impaired in their migratory activity by PC-3 cell culture supernatant, but orientate chemotactically towards the source. Neutrophil granulocytes increase their locomotory activity only in response to cell culture supernantant of hypoxic but not of normoxic PC-3 cells. In contrast, cytotoxic T lymphocytes do not change their migratory activity in response to either culture supernatant, but increase their cytotoxicity, whereas supernatant of normoxic PC-3 cells leads to a stronger increase than that of hypoxic PC-3 cells. Conclusions PC-3 cells release several signal substances that influence the behavior of the cells in the tumor's microenvironment, whereas no clear pattern towards proinflammatory or immunosuppressive conditions can be seen.

  12. The assessment of cytokines in Quantiferon supernatants for the diagnosis of latent TB infection in a tribal population of Melghat, India.

    Science.gov (United States)

    Bapat, Prachi R; Husain, Aliabbas A; Daginawala, Hatim F; Agrawal, Neha P; Panchbhai, Milind S; Satav, Ashish R; Taori, Girdhar M; Kashyap, Rajpal S

    2015-01-01

    The tuberculin skin test (TST) and interferon-gamma release assays (IGRA), namely, the QuantiFERON-TB Gold test (QFT), remain the standard immunological diagnostic tools for latent tuberculosis (TB) infection (LTBI). However, the sub-optimal detection rates of both of these tests are major impediments in recognizing the population at risk. This study was aimed at evaluating additional cytokines besides interferon-gamma (IFN-γ) as biomarkers for improving LTBI diagnosis in the tribal population of Melghat, India. Seventy-four close TB contacts were stratified by QFT and TST results into: (i) QFT+/TST+ (n = 26), (ii) QFT+/TST- (n = 12), (iii) QFT-/TST- (n = 35) and (iv) QFT-/TST+ (n = 1) groups. A panel of cytokines (IL-6, IL-10, TNF-α and IL-2R) was then evaluated in antigen-stimulated QFT cell-free culture supernatants using IMMULITE-1000, an automated immunoassay analyzer. Cytokine estimation showed significantly higher levels of IL-6 in the QFT+/TST+ group, while significantly higher levels of IL-10 were found in the QFT-/TST- group. Correlation analysis identified a positive correlation between IL-6 and the QFT response (r = 0.6723, P < 0.0001), while a negative correlation was seen between QFT and IL-10 expression (r = -0.3271, P = 0.0044). Similarly, IL-6 was positively correlated with TST levels (r = 0.6631, P <0 .0001), and conversely, a negative correlation was found between TST and IL-10 expression (r = -0.5698, P < 0.0001). The positive and negative predictive values of IL-6 were found to be 92.59 and 93.33%, respectively, and the positive and negative predictive values of IL-10 were 96.55 and 91.18%, respectively. No significant impact of the demographic characteristics on cytokine positivity was observed. Our preliminary results suggest that the evaluation of additional cytokines in QFT cell-free culture supernatants may be valuable for the identification of LTBI. Combining IL-6 and IL-10 with QFT and/or TST could markedly improve the detection

  13. The assessment of cytokines in Quantiferon supernatants for the diagnosis of latent TB infection in a tribal population of Melghat, India

    Directory of Open Access Journals (Sweden)

    Prachi R. Bapat

    2015-07-01

    Full Text Available Summary: The tuberculin skin test (TST and interferon-gamma release assays (IGRA, namely, the QuantiFERON-TB Gold test (QFT, remain the standard immunological diagnostic tools for latent tuberculosis (TB infection (LTBI. However, the sub-optimal detection rates of both of these tests are major impediments in recognizing the population at risk. This study was aimed at evaluating additional cytokines besides interferon-gamma (IFN-γ as biomarkers for improving LTBI diagnosis in the tribal population of Melghat, India. Seventy-four close TB contacts were stratified by QFT and TST results into: (i QFT+/TST+ (n = 26, (ii QFT+/TST− (n = 12, (iii QFT−/TST− (n = 35 and (iv QFT−/TST+ (n = 1 groups. A panel of cytokines (IL-6, IL-10, TNF-α and IL-2R was then evaluated in antigen-stimulated QFT cell-free culture supernatants using IMMULITE-1000, an automated immunoassay analyzer. Cytokine estimation showed significantly higher levels of IL-6 in the QFT+/TST+ group, while significantly higher levels of IL-10 were found in the QFT−/TST− group. Correlation analysis identified a positive correlation between IL-6 and the QFT response (r = 0.6723, P < 0.0001, while a negative correlation was seen between QFT and IL-10 expression (r = −0.3271, P = 0.0044. Similarly, IL-6 was positively correlated with TST levels (r = 0.6631, P < 0.0001, and conversely, a negative correlation was found between TST and IL-10 expression (r = −0.5698, P < 0.0001. The positive and negative predictive values of IL-6 were found to be 92.59 and 93.33%, respectively, and the positive and negative predictive values of IL-10 were 96.55 and 91.18%, respectively. No significant impact of the demographic characteristics on cytokine positivity was observed. Our preliminary results suggest that the evaluation of additional cytokines in QFT cell-free culture supernatants may be valuable for the identification of LTBI. Combining IL-6 and IL-10 with QFT and

  14. Human lung mast cells modulate the functions of airway smooth muscle cells in asthma.

    Science.gov (United States)

    Alkhouri, H; Hollins, F; Moir, L M; Brightling, C E; Armour, C L; Hughes, J M

    2011-09-01

    Activated mast cell densities are increased on the airway smooth muscle in asthma where they may modulate muscle functions and thus contribute to airway inflammation, remodelling and airflow obstruction. To determine the effects of human lung mast cells on the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Freshly isolated human lung mast cells were stimulated with IgE/anti-IgE. Culture supernatants were collected after 2 and 24 h and the mast cells lysed. The supernatants/lysates were added to serum-deprived, subconfluent airway smooth muscle cells for up to 48 h. Released chemokines and extracellular matrix were measured by ELISA, proliferation was quantified by [(3) H]-thymidine incorporation and cell counting, and intracellular signalling by phospho-arrays. Mast cell 2-h supernatants reduced CCL11 and increased CXCL8 and fibronectin production from both asthmatic and nonasthmatic muscle cells. Leupeptin reversed these effects. Mast cell 24-h supernatants and lysates reduced CCL11 release from both muscle cell types but increased CXCL8 release by nonasthmatic cells. The 24-h supernatants also reduced asthmatic, but not nonasthmatic, muscle cell DNA synthesis and asthmatic cell numbers over 5 days through inhibiting extracellular signal-regulated kinase (ERK) and phosphatidylinositol (PI3)-kinase pathways. However, prostaglandins, thromboxanes, IL-4 and IL-13 were not involved in reducing the proliferation. Mast cell proteases and newly synthesized products differentially modulated the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Thus, mast cells may modulate their own recruitment and airway smooth muscle functions locally in asthma. © 2011 John Wiley & Sons A/S.

  15. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  16. Propagation and isolation of ranaviruses in cell culture

    DEFF Research Database (Denmark)

    Ariel, Ellen; Nicolajsen, Nicole; Christophersen, Maj-Britt

    2009-01-01

    The optimal in vitro propagation procedure for a panel of ranavirus isolates and the best method for isolation of Epizootic haematopoietic necrosis virus (EHNV) from organ material in cell-culture were investigated. The panel of ranavirus isolates included: Frog virus 3 (FV3), Bohle iridovirus (BIV......), Pike-perch iridovirus (PPIV), European catfish virus (ECV), European sheatfish virus (ESV), EHNV, Doctor fish virus (DFV), Guppy virus 6 (GF6), short-finned eel virus (SERV) and Rana esculenta virus Italy 282/102 (REV 282/102). Each isolate was titrated in five cell lines: bluegill fry (BF-2......), epithelioma papulosum cyprini (EPC), chinook salmon embryo (CHSE-214) rainbow trout gonad (RTG-2) and fathead minnow (FHM), and incubated at 10, 15, 20, 24 and 28 °C for two weeks. BF-2, EPC and CHSE-214 cells performed well and titers obtained in the three cell lines were similar, whereas FHM and RTG-2 cells...

  17. Characterizing parameters of Jatropha curcas cell cultures for microgravity studies

    Science.gov (United States)

    Vendrame, Wagner A.; Pinares, Ania

    2013-06-01

    Jatropha (Jatropha curcas) is a tropical perennial species identified as a potential biofuel crop. The oil is of excellent quality and it has been successfully tested as biodiesel and in jet fuel mixes. However, studies on breeding and genetic improvement of jatropha are limited. Space offers a unique environment for experiments aiming at the assessment of mutations and differential gene expression of crops and in vitro cultures of plants are convenient for studies of genetic variation as affected by microgravity. However, before microgravity studies can be successfully performed, pre-flight experiments are necessary to characterize plant material and validate flight hardware environmental conditions. Such preliminary studies set the ground for subsequent spaceflight experiments. The objectives of this study were to compare the in vitro growth of cultures from three explant sources (cotyledon, leaf, and stem sections) of three jatropha accessions (Brazil, India, and Tanzania) outside and inside the petriGAP, a modified group activation pack (GAP) flight hardware to fit petri dishes. In vitro jatropha cell cultures were established in petri dishes containing a modified MS medium and maintained in a plant growth chamber at 25 ± 2 °C in the dark. Parameters evaluated were surface area of the explant tissue (A), fresh weight (FW), and dry weight (DW) for a period of 12 weeks. Growth was observed for cultures from all accessions at week 12, including subsequent plantlet regeneration. For all accessions differences in A, FW and DW were observed for inside vs. outside the PetriGAPs. Growth parameters were affected by accession (genotype), explant type, and environment. The type of explant influenced the type of cell growth and subsequent plantlet regeneration capacity. However, overall cell growth showed no abnormalities. The present study demonstrated that jatropha in vitro cell cultures are suitable for growth inside PetriGAPs for a period of 12 weeks. The parameters

  18. A microfluidic cell culture array with various oxygen tensions.

    Science.gov (United States)

    Peng, Chien-Chung; Liao, Wei-Hao; Chen, Ying-Hua; Wu, Chueh-Yu; Tung, Yi-Chung

    2013-08-21

    Oxygen tension plays an important role in regulating various cellular functions in both normal physiology and disease states. Therefore, drug testing using conventional in vitro cell models under normoxia often possesses limited prediction capability. A traditional method of setting an oxygen tension in a liquid medium is by saturating it with a gas mixture at the desired level of oxygen, which requires bulky gas cylinders, sophisticated control, and tedious interconnections. Moreover, only a single oxygen tension can be tested at the same time. In this paper, we develop a microfluidic cell culture array platform capable of performing cell culture and drug testing under various oxygen tensions simultaneously. The device is fabricated using an elastomeric material, polydimethylsiloxane (PDMS) and the well-developed multi-layer soft lithography (MSL) technique. The prototype device has 4 × 4 wells, arranged in the same dimensions as a conventional 96-well plate, for cell culture. The oxygen tensions are controlled by spatially confined oxygen scavenging chemical reactions underneath the wells using microfluidics. The platform takes advantage of microfluidic phenomena while exhibiting the combinatorial diversities achieved by microarrays. Importantly, the platform is compatible with existing cell incubators and high-throughput instruments (liquid handling systems and plate readers) for cost-effective setup and straightforward operation. Utilizing the developed platform, we successfully perform drug testing using an anti-cancer drug, triapazamine (TPZ), on adenocarcinomic human alveolar basal epithelial cell line (A549) under three oxygen tensions ranging from 1.4% to normoxia. The developed platform is promising to provide a more meaningful in vitro cell model for various biomedical applications while maintaining desired high throughput capabilities.

  19. Platelet lysate as a novel serum-free media supplement for the culture of equine bone marrow-derived mesenchymal stem cells.

    Science.gov (United States)

    Naskou, Maria C; Sumner, Scarlett M; Chocallo, Anna; Kemelmakher, Hannah; Thoresen, Merrilee; Copland, Ian; Galipeau, Jacques; Peroni, John F

    2018-03-22

    Mesenchymal stem cells (MSCs) produced for clinical purposes rely on culture media containing fetal bovine serum (FBS) which is xenogeneic and has the potential to significantly alter the MSC phenotype, rendering these cells immunogenic. As a result of bovine-derived exogenous proteins expressed on the cell surface, MSCs may be recognized by the host immune system as non-self and be rejected. Platelet lysate (PL) may obviate some of these concerns and shows promising results in human medicine as a possible alternative to FBS. Our goal was to evaluate the use of equine platelet lysate (ePL) pooled from donor horses in place of FBS to culture equine MSCs. We hypothesized that ePL, produced following apheresis, will function as the sole media supplement to accelerate the expansion of equine bone marrow-derived MSCs without altering their phenotype and their immunomodulatory capacity. Platelet concentrate was obtained via plateletpheresis and ePL were produced via freeze-thaw and centrifugation cycles. Population doublings (PD) and doubling time (DT) of bone marrow-derived MSCs (n = 3) cultured with FBS or ePL media were calculated. Cell viability, immunophenotypic analysis, and trilineage differentiation capacity of MSCs were assessed accordingly. To assess the ability of MSCs to modulate inflammatory responses, E. coli lipopolysaccharide (LPS)-stimulated monocytes were cocultured with MSCs cultured in the two different media formulations, and cell culture supernatants were assayed for the production of tumor necrosis factor (TNF)-α. Our results showed that MSCs cultured in ePL media exhibited similar proliferation rates (PD and DT) compared with those cultured in FBS at individual time points. MSCs cultured in ePL showed a statistically significant increased viability following a single washing step, expressed similar levels of MSC markers compared to FBS, and were able to differentiate towards the three lineages. Finally, MSCs cultured in ePL efficiently suppressed

  20. Evaluation of the osteogenic differentiation of gingiva-derived stem cells grown on culture plates or in stem cell spheroids: Comparison of two- and three-dimensional cultures.

    Science.gov (United States)

    Lee, Sung-Il; Ko, Youngkyung; Park, Jun-Beom

    2017-09-01

    Three-dimensional cell culture systems provide a convenient in vitro model for the study of complex cell-cell and cell-matrix interactions in the absence of exogenous substrates. The current study aimed to evaluate the osteogenic differentiation potential of gingiva-derived stem cells cultured in two-dimensional or three-dimensional systems. To the best of our knowledge, the present study is the first to compare the growth of gingiva-derived stem cells in monolayer culture to a three-dimensional culture system with microwells. For three-dimensional culture, gingiva-derived stem cells were isolated and seeded into polydimethylsiloxane-based concave micromolds. Alkaline phosphatase activity and alizarin red S staining assays were then performed to evaluate osteogenesis and the degree of mineralization, respectively. Stem cell spheroids had a significantly increased level of alkaline phosphatase activity and mineralization compared with cells from the two-dimensional culture. In addition, an increase in mineralized deposits was observed with an increase in the loading cell number. The results of present study indicate that gingiva-derived stem cell spheroids exhibit an increased osteogenic potential compared with stem cells from two-dimensional culture. This highlights the potential of three-dimensional culture systems using gingiva-derived stem cells for regenerative medicine applications requiring stem cells with osteogenic potential.

  1. Differentiation of Human Pluripotent Stem Cells into Functional Endothelial Cells in Scalable Suspension Culture

    Directory of Open Access Journals (Sweden)

    Ruth Olmer

    2018-05-01

    Full Text Available Summary: Endothelial cells (ECs are involved in a variety of cellular responses. As multifunctional components of vascular structures, endothelial (progenitor cells have been utilized in cellular therapies and are required as an important cellular component of engineered tissue constructs and in vitro disease models. Although primary ECs from different sources are readily isolated and expanded, cell quantity and quality in terms of functionality and karyotype stability is limited. ECs derived from human induced pluripotent stem cells (hiPSCs represent an alternative and potentially superior cell source, but traditional culture approaches and 2D differentiation protocols hardly allow for production of large cell numbers. Aiming at the production of ECs, we have developed a robust approach for efficient endothelial differentiation of hiPSCs in scalable suspension culture. The established protocol results in relevant numbers of ECs for regenerative approaches and industrial applications that show in vitro proliferation capacity and a high degree of chromosomal stability. : In this article, U. Martin and colleagues show the generation of hiPSC endothelial cells in scalable cultures in up to 100 mL culture volume. The generated ECs show in vitro proliferation capacity and a high degree of chromosomal stability after in vitro expansion. The established protocol allows to generate hiPSC-derived ECs in relevant numbers for regenerative approaches. Keywords: hiPSC differentiation, endothelial cells, scalable culture

  2. Single molecule microscopy in 3D cell cultures and tissues.

    Science.gov (United States)

    Lauer, Florian M; Kaemmerer, Elke; Meckel, Tobias

    2014-12-15

    From the onset of the first microscopic visualization of single fluorescent molecules in living cells at the beginning of this century, to the present, almost routine application of single molecule microscopy, the method has well-proven its ability to contribute unmatched detailed insight into the heterogeneous and dynamic molecular world life is composed of. Except for investigations on bacteria and yeast, almost the entire story of success is based on studies on adherent mammalian 2D cell cultures. However, despite this continuous progress, the technique was not able to keep pace with the move of the cell biology community to adapt 3D cell culture models for basic research, regenerative medicine, or drug development and screening. In this review, we will summarize the progress, which only recently allowed for the application of single molecule microscopy to 3D cell systems and give an overview of the technical advances that led to it. While initially posing a challenge, we finally conclude that relevant 3D cell models will become an integral part of the on-going success of single molecule microscopy. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Calcium exchange, structure, and function in cultured adult myocardial cells

    International Nuclear Information System (INIS)

    Langer, G.A.; Frank, J.S.; Rich, T.L.; Orner, F.B.

    1987-01-01

    Cells digested from adult rat heart and cultured for 14 days demonstrate all the structural elements, in mature form, associated with the process of excitation-contraction (EC) coupling. The transverse tubular (TT) system is well developed with an extensive junctional sarcoplasmic reticulum (JSR). In nonphosphate-containing buffer contraction of the cells is lost as rapidly as zero extracellular Ca concentration ([Ca] 0 ) solution is applied and a negative contraction staircase is produced on increase of stimulation frequency. Structurally and functionally the cells have the characteristics of adult cells in situ. 45 Ca exchange and total 45 Ca measurement in N-2-hydroxyethylpiperazine N'-2-ethanesulfonic acid (HEPES)-buffered perfusate define three components of cellular Ca: 1) a rapidly exchangeable component accounting for 36% of total Ca, 2) a slowly exchangeable component (t/sub 1/2/ 53 min) accounting for 7% total Ca, and 3) the remaining 57% cellular Ca is inexchangeable (demonstrates no significant exchange within 60 min). The slowly exchangeable component can be increased 10-fold within 60 min by addition of phosphate to the perfusate. The Ca distribution and exchange characteristics are little different from those of 3-day cultures of neonatal rat heart previously studied. The results suggest that the cells are representative of adult cells in situ and that both sarcolemmal-bound and sarcoplasmic reticular Ca contribute to the component of Ca that is rapidly exchangeable

  4. Diffusion chamber culture of mouse bone marrow cells, (1)

    International Nuclear Information System (INIS)

    Sigeta, Chiharu; Tanaka, Kimio; Kawakami, Masahito; Takahashi, Hiroshi; Ohkita, Takeshi

    1980-01-01

    Mouse bone marrow cells were cultured in diffusion chambers (DC) implanted in the peritoneal cavity of host mice. Host mice were subjected to (1) irradiation ( 60 Co 800 rad) and/or (2) phenylhydrazine induced anemia and then receiving irradiation ( 60 Co 600 rad). After culture periods of 3-7 days, the total number of cells in DC was increased. A marked increase in DC is due to the proliferation of granulocyte series. When host mice were subjected to anemia and irradiation, the start of cell proliferation in DC was delay about two days. On the whole, anemia and irradiation host reduced a little cell growth in DC. The number of immature granulocytes grown in DC in irradiated hosts or anemia and irradiated hosts increased and reached a plateu at day 5. During the plateu period, the proportions between immature and mature granulocytes in DC were kept constantly. The number of macrophages showed a two-phase increasing. Erythroid cells and lymphocytes rapidly disappeared from the chambers during 3 days. The number of erythroid cells was not significantly influenced even in anemia and irradiation hosts. (author)

  5. Clonal variation in proliferation rate of cultures of GPK cells.

    Science.gov (United States)

    Riley, P A; Hola, M

    1981-09-01

    Pedigrees of twenty-six clones of a line of keratocytes derived from guinea-pig ear epidermis (GPK cells) were analysed from time-lapse film. The mean interdivision time (IDT) for the culture was 1143 +/- 215 (SD) min. The mean generation rates (mean reciprocal interdivision times) of clones varied over a range of 3.93--10.2 x 10(-4)/min and the standard deviation of the clonal mean generation rates was 16.8% of the average value. Transient intraclonal variations in IDT due to mitoses in a plane perpendicular to the substratum were observed. The data were also analysed on the basis of cell location in sixteen equal zones (quadrats) of the filmed area. The mean generation rate of quadrats was 8.73 x 10(-4)/min (SD = 4.9%). The spatial distribution showed some clustering of cells. The mean local density of the clones (2.25 +/- 0.62 cells/10(-4) cm2) was significantly higher than the quadrat density (1.76 +/- 0.8 cells/10(-4) cm2). There was no significant correlation between clonal density and mean generation rates, whereas for quadrats a significant negative correlation was found (P = 2.7%). The results support the proposition that cell lineage is the major determinant of the proliferation rate of subconfluent cultures.

  6. Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis

    International Nuclear Information System (INIS)

    Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.

    1988-01-01

    Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)

  7. Cytokine profiles of HeLa and human diploid cells induced by different fractions of Vibrio parahaemolyticus cultures exposed to stress conditions.

    Science.gov (United States)

    Chifiriuc, Mariana Carmen; Bleotu, Coralia; Pîrcălăbioru, Gratiela; Israil, Anca Michaela; Dinu, Sorin; Rută, Simona Maria; Grancea, Camelia; Lazăr, Veronica

    2010-01-01

    Vibrio (V.) parahaemolyticus is an aquatic halophilic bacteria which produces gastroenteritis and in rare cases septicaemia after the consumption of raw or under-cooked contaminated seafood.The severity of diarrheal illness caused by this bacterium is closely related to the presence of two types of hemolysins (the thermostable direct hemolysin-TDH and TDH related hemolysin-TRH) and also of type III secretion system (TTSS) proteins. The TTSS type 1 induces a wide array of effects on infected HeLa cells such as autophagy, oncosis, cell rounding and lysis. Previous studies have shown that heat shock proteins have the ability to stimulate the production of interleukins in different cellular cultures. In our studies we have stimulated two cellular lines (HeLa and human diploid cells) with different V. parahaemolyticus culture fractions in order to observe the effect on cytokines production. Thus, the purpose of this study was to analyze the expression of IL-1, IL-2, IL-4, IL-6, IL-10 and TNF-alpha induced by the cell treatment with total cellular lysate, periplasmic fractions and culture supernatants extracted from V. parahaemolyticus exposed to normal and also to stress conditions. The ELISA assay of the cytokine profile of the HeLa and HDC cell lines stimulated with different bacterial fractions revealed that in the V. parahemolyticus cultures submitted to osmotic and heat shock stress are accumulating factors (probably heat shock proteins) which are exhibiting immunomodulatory activity, responsible for the induction of a pro-inflammatory response associated with increased levels of IL-6 and TNF-alpha expression, however balanced by the stimulation of the anti-inflammatory cytokine IL-4 synthesis.

  8. Peptide Hydrogelation and Cell Encapsulation for 3D Culture of MCF-7 Breast Cancer Cells

    Science.gov (United States)

    Sun, Xiuzhi S.; Nguyen, Thu A.

    2013-01-01

    Three-dimensional (3D) cell culture plays an invaluable role in tumor biology by providing in vivo like microenviroment and responses to therapeutic agents. Among many established 3D scaffolds, hydrogels demonstrate a distinct property as matrics for 3D cell culture. Most of the existing pre-gel solutions are limited under physiological conditions such as undesirable pH or temperature. Here, we report a peptide hydrogel that shows superior physiological properties as an in vitro matrix for 3D cell culture. The 3D matrix can be accomplished by mixing a self-assembling peptide directly with a cell culture medium without any pH or temperature adjustment. Results of dynamic rheological studies showed that this hydrogel can be delivered multiple times via pipetting without permanently destroying the hydrogel architecture, indicating the deformability and remodeling ability of the hydrogel. Human epithelial cancer cells, MCF-7, are encapsulated homogeneously in the hydrogel matrix during hydrogelation. Compared with two-dimensional (2D) monolayer culture, cells residing in the hydrogel matrix grow as tumor-like clusters in 3D formation. Relevant parameters related to cell morphology, survival, proliferation, and apoptosis were analyzed using MCF-7 cells in 3D hydrogels. Interestingly, treatment of cisplatin, an anti-cancer drug, can cause a significant decrease of cell viability of MCF-7 clusters in hydrogels. The responses to cisplatin were dose- and time-dependent, indicating the potential usage of hydrogels for drug testing. Results of confocal microscopy and Western blotting showed that cells isolated from hydrogels are suitable for downstream proteomic analysis. The results provided evidence that this peptide hydrogel is a promising 3D cell culture material for drug testing. PMID:23527204

  9. Ultra-thin Polyethylene glycol Coatings for Stem Cell Culture

    Science.gov (United States)

    Schmitt, Samantha K.

    Human mesenchymal stem cells (hMSCs) are a widely accessible and a clinically relevant cell type that are having a transformative impact on regenerative medicine. However, current clinical expansion methods can lead to selective changes in hMSC phenotype resulting from relatively undefined cell culture surfaces. Chemically defined synthetic surfaces can aid in understanding stem cell behavior. In particular we have developed chemically defined ultra-thin coatings that are stable over timeframes relevant to differentiation of hMSCs (several weeks). The approach employs synthesis of a copolymer with distinct chemistry in solution before application to a substrate. This provides wide compositional flexibility and allows for characterization of the orthogonal crosslinking and peptide binding groups. Characterization is done in solution by proton NMR and after crosslinking by X-ray photoelectron spectroscopy (XPS). The solubility of the copolymer in ethanol and low temperature crosslinking, expands its applicability to plastic substrates, in addition to silicon, glass, and gold. Cell adhesive peptides, namely Arg-Gly-Asp (RGD) fragments, are coupled to coating via different chemistries resulting in the urethane, amide or the thioester polymer-peptide bonds. Development of azlactone-based chemistry allowed for coupling in water at low peptide concentrations and resulted in either an amide or thioester bonds, depending on reactants. Characterization of the peptide functionalized coating by XPS, infrared spectroscopy and cell culture assays, showed that the amide linkages can present peptides for multiple weeks, while shorter-term presentation of a few days is possible using the more labile thioester bond. Regardless, coatings promoted initial adhesion and spreading of hMSCs in a peptide density dependent manner. These coatings address the following challenges in chemically defined cell culture simultaneously: (i) substrate adaptability, (ii) scalability over large areas

  10. Matrix Metalloproteinase-9 Expression Is Enhanced in Renal Parietal Epithelial Cells of Zucker Diabetic Fatty Rats and Is Induced by Albumin in In Vitro Primary Parietal Cell Culture

    Science.gov (United States)

    Zhang, Yuanyuan; George, Jasmine; Li, Yun; Olufade, Rebecca; Zhao, Xueying

    2015-01-01

    As a subfamily of matrix metalloproteinases (MMPs), gelatinases including MMP-2 and MMP-9 play an important role in remodeling and homeostasis of the extracellular matrix. However, conflicting results have been reported regarding their expression level and activity in the diabetic kidney. This study investigated whether and how MMP-9 expression and activity were changed in glomerular epithelial cells upon albumin overload. In situ zymography, immunostaining and Western blot for renal MMP gelatinolytic activity and MMP-9 protein expression were performed in Zucker lean and Zucker diabetic rats. Confocal microscopy revealed a focal increase in gelatinase activity and MMP-9 protein in the glomeruli of diabetic rats. Increased glomerular MMP-9 staining was mainly observed in hyperplastic parietal epithelial cells (PECs) expressing claudin-1 in the diabetic kidneys. Interestingly, increased parietal MMP-9 was often accompanied by decreased staining for podocyte markers (nephrin and podocalyxin) in the sclerotic area of affected glomeruli in diabetic rats. Additionally, urinary excretion of podocyte marker proteins was significantly increased in association with the levels of MMP-9 and albumin in the urine of diabetic animals. To evaluate the direct effect of albumin on expression and activity of MMP-9, primary cultured rat glomerular PECs were incubated with rat serum albumin (0.25 - 1 mg/ml) for 24 - 48 hrs. MMP-9 mRNA levels were significantly increased following albumin treatment. Meanwhile, albumin administration resulted in a dose-dependent increase in MMP-9 protein and activity in culture supernatants of PECs. Moreover, albumin activated p44/42 mitogen-activated protein kinase (MAPK) in PECs. Inhibition of p44/42 MAPK suppressed albumin-induced MMP-9 secretion from glomerular PECs. Taken together, we have demonstrated that an up-regulation of MMP-9 in activated parietal epithelium is associated with a loss of adjacent podocytes in progressive diabetic nephropathy

  11. Tumor necrosis factor (cachetin) decreases adipose cell differentiation in primary cell culture

    International Nuclear Information System (INIS)

    Martin, R.J.; Jones, D.D.; Jewell, D.E.; Hausman, G.J.

    1986-01-01

    Cachetin has been shown to effect gene product expression in the established adipose cell line 3T3-L1. Expression of messenger RNA for lipoprotein lipase is suppressed in cultured adipocytes. The purpose of this study was to determine the effect of Cachetin on adipose cell differentiation in primary cell culture. Stromalvascular cells obtained from the inguinal fat pad of 4-5 week old Sprague-Dawley rats were grown in culture for two weeks. During the proliferative growth phase all cells were grown on the same medium and labelled with 3 H-thymidine. Cachetin treatment (10 -6 to 10 -10 M) was initiated on day 5, the initial phase of preadipocyte differentiation. Adipocytes and stromal cells were separated using density gradient, and 3 H-thymidine was determined for both cell types. Thymidine incorporation into adipose cells was decreased maximally (∼ 50%) at 10 -10 M. Stromalvascular cells were not influenced at any of the doses tested. Adipose cell lipid content as indicated by oil red-O staining was decreased by Cachetin. Esterase staining by adipose cells treated with Cachetin was increased indicating an increase in intracellular lipase. These studies show that Cachetin has specific effects on primary adipose cell differentiation

  12. Micro fluidic System for Culturing and Monitoring of Neuronal Cells and Tissue

    DEFF Research Database (Denmark)

    Bakmand, Tanya; Waagepetersen, Helle S.

    The aim of this Ph.D. project was to combine experience within cell and tissue culturing, electrochemistry and microfabrication in order to develop an in vivo-like fluidic culturing platform, challenging the traditional culturing methods. The first goal was to develope a fluidic system for cultur...... with mass production. The last part of this thesis also includes perspectives on how to expand the latest designed device to facilitate culturing of tissue and co-culturing of cells....

  13. Radiation-induced bystander effects in cultured human stem cells.

    Directory of Open Access Journals (Sweden)

    Mykyta V Sokolov

    2010-12-01

    Full Text Available The radiation-induced "bystander effect" (RIBE was shown to occur in a number of experimental systems both in vitro and in vivo as a result of exposure to ionizing radiation (IR. RIBE manifests itself by intercellular communication from irradiated cells to non-irradiated cells which may cause DNA damage and eventual death in these bystander cells. It is known that human stem cells (hSC are ultimately involved in numerous crucial biological processes such as embryologic development; maintenance of normal homeostasis; aging; and aging-related pathologies such as cancerogenesis and other diseases. However, very little is known about radiation-induced bystander effect in hSC. To mechanistically interrogate RIBE responses and to gain novel insights into RIBE specifically in hSC compartment, both medium transfer and cell co-culture bystander protocols were employed.Human bone-marrow mesenchymal stem cells (hMSC and embryonic stem cells (hESC were irradiated with doses 0.2 Gy, 2 Gy and 10 Gy of X-rays, allowed to recover either for 1 hr or 24 hr. Then conditioned medium was collected and transferred to non-irradiated hSC for time course studies. In addition, irradiated hMSC were labeled with a vital CMRA dye and co-cultured with non-irradiated bystander hMSC. The medium transfer data showed no evidence for RIBE either in hMSC and hESC by the criteria of induction of DNA damage and for apoptotic cell death compared to non-irradiated cells (p>0.05. A lack of robust RIBE was also demonstrated in hMSC co-cultured with irradiated cells (p>0.05.These data indicate that hSC might not be susceptible to damaging effects of RIBE signaling compared to differentiated adult human somatic cells as shown previously. This finding could have profound implications in a field of radiation biology/oncology, in evaluating radiation risk of IR exposures, and for the safety and efficacy of hSC regenerative-based therapies.

  14. Handbook of plant cell culture. Volume 2. Crop species

    Energy Technology Data Exchange (ETDEWEB)

    Sharp, W.R.; Evans, D.A.; Ammirato, P.V.; Yamada, Y. (eds.)

    1984-01-01

    In this volume the state-of-the-art plant cell culture techniques described in the first volume are applied to several agricultural and horticultural crops. In 21 chapters, they include maize, oats, wheat, beans, red clover and other forage legumes, asparagus, celery, cassava, sweet potato, banana, pawpaw, apple, grapes, conifers, date palm, rubber, sugarcane and tobacco. Each chapter contains (1) detailed protocols to serve as the foundation for current research, (2) a critical review of the literature, and (3) in-depth evaluations of the potential shown by plant cell culture for crop improvement. The history and economic importance of each crop are discussed. This volume also includes an essay, ''Oil from plants'', by M. Calvin.

  15. Isolation and culture of Celosia cristata L cell suspension protoplasts

    Directory of Open Access Journals (Sweden)

    Retno Mastuti

    2003-06-01

    Full Text Available Developmental competence of Celosia cristata L. cell suspension-derived protoplasts was investigated. The protoplasts were isolatedfrom 3- to 9-d old cultures in enzyme solution containing 2% (w/v Cellulase YC and 0.5% (w/v Macerozyme R-10 which was dissolvedin washing solution (0.4 M mannitol and 10 mM CaCl2 at pH 5.6 for 3 hours. The highest number of viable protoplasts was releasedfrom 5-d old culture of a homogenous cell suspension. Subsequently, three kinds of protoplast culture media were simultaneously examinedwith four kinds of concentration of gelling agent. Culturing the protoplasts on KM8p medium solidified with 1.2% agarose significantlyenhanced plating efficiency as well as microcolony formation. Afterwards, the microcalli actively proliferated into friable watery calluswhen they were subcultured on MS medium supplemented with 0.3 mg/l 2,4-D and 1.0 mg/l kinetin. Although the plant regenerationfrom the protoplasts-derived calli has not yet been obtained, the reproducible developmental step from protoplasts to callus in thisstudy may facilitate the establishment of somatic hybridization using C. cristata as one parent.

  16. An introduction to plant cell culture: the future ahead.

    Science.gov (United States)

    Loyola-Vargas, Víctor M; Ochoa-Alejo, Neftalí

    2012-01-01

    Plant cell, tissue, and organ culture (PTC) techniques were developed and established as an experimental necessity for solving important fundamental questions in plant biology, but they currently represent very useful biotechnological tools for a series of important applications such as commercial micropropagation of different plant species, generation of disease-free plant materials, production of haploid and doublehaploid plants, induction of epigenetic or genetic variation for the isolation of variant plants, obtention of novel hybrid plants through the rescue of hybrid embryos or somatic cell fusion from intra- or intergeneric sources, conservation of valuable plant germplasm, and is the keystone for genetic engineering of plants to produce disease and pest resistant varieties, to engineer metabolic pathways with the aim of producing specific secondary metabolites or as an alternative for biopharming. Some other miscellaneous applications involve the utilization of in vitro cultures to test toxic compounds and the possibilities of removing them (bioremediation), interaction of root cultures with nematodes or mycorrhiza, or the use of shoot cultures to maintain plant viruses. With the increased worldwide demand for biofuels, it seems that PTC will certainly be fundamental for engineering different plants species in order to increase the diversity of biofuel options, lower the price marketing, and enhance the production efficiency. Several aspects and applications of PTC such as those mentioned above are the focus of this edition.

  17. [Biological characteristics of mesenchymal stem cell and hematopoietic stem cell in the co-culture system].

    Science.gov (United States)

    Wei, Wei; Xu, Chao; Ye, Zhi-Yong; Huang, Xiao-Jun; Yuan, Jia-En; Ma, Tian-Bao; Lin, Han-Biao; Chen, Xiu-Qiong

    2016-10-25

    The aim of the present study was to obtain the qualified hematopoietic stem/progenitor cells (HSC/HPC) and human umbilical cord-mesenchymal stem cells (MSC) in vitro in the co-culture system. Cord blood mononuclear cells were separated from umbilical cord blood by Ficoll lymphocyte separation medium, and then CD34 + HSC was collected by MACS immunomagnetic beads. The selected CD34 + HSC/HPC and MSC were transferred into culture flask. IMDM culture medium with 15% AB-type cord plasma supplemented with interleukin-3 (IL-3), IL-6, thrombopoietin (TPO), stem cell factor (SCF) and FMS-like tyrosine kinase 3 ligand (Flt-3L) factors were used as the co-culture system for the amplification of HSC/HPC and MSC. The cellular growth status and proliferation on day 6 and 10 after co-culture were observed by using inverted microscope. The percentage of positive expression of CD34 in HSC/HPC, as well as the percentages of positive expressions of CD105, CD90, CD73, CD45, CD34 and HLA-DR in the 4 th generation MSC, was tested by flow cytometry. Semisolid colony culture was used to test the HSC/HPC colony forming ability. The osteogenic, chondrogenesis and adipogenic ability of the 4 th generation MSC were assessed. The karyotype analysis of MSC was conducted by colchicines. The results demonstrated that the HSC/HPC of co-culture group showed higher ability of amplification, CFU-GM and higher CD34 + percentage compared with the control group. The co-cultured MSC maintained the ability to differentiate into bone cells, fat cells and chondrocytes. And the karyotype stability of MSC remained normal. These results reveal that the appropriate co-culture system for MSC and HSC is developed, and via this co-culture system we could gain both two kinds of these cells. The MSCs under the co-culture system maintain the biological characteristics. The CFU-GM ability, cell counting and the flow cytometry results of HSC/HPC under the co-culture system are conform to the criterion, showing that

  18. Enhanced chondrocyte culture and growth on biologically inspired nanofibrous cell culture dishes.

    Science.gov (United States)

    Bhardwaj, Garima; Webster, Thomas J

    2016-01-01

    Chondral and osteochondral defects affect a large number of people in which treatment options are currently limited. Due to its ability to mimic the natural nanofibrous structure of cartilage, this current in vitro study aimed at introducing a new scaffold, called XanoMatrix™, for cartilage regeneration. In addition, this same scaffold is introduced here as a new substrate onto which to study chondrocyte functions. Current studies on chondrocyte functions are limited due to nonbiologically inspired cell culture substrates. With its polyethylene terephthalate and cellulose acetate composition, good mechanical properties and nanofibrous structure resembling an extracellular matrix, XanoMatrix offers an ideal surface for chondrocyte growth and proliferation. This current study demonstrated that the XanoMatrix scaffolds promote chondrocyte growth and proliferation as compared with the Corning and Falcon surfaces normally used for chondrocyte cell culture. The XanoMatrix scaffolds also have greater hydrophobicity, three-dimensional surface area, and greater tensile strength, making them ideal candidates for alternative treatment options for chondral and osteochondral defects as well as cell culture substrates to study chondrocyte functions.

  19. Cell division requirement for activation of murine leukemia virus in cell culture by irradiation

    International Nuclear Information System (INIS)

    Otten, J.A.; Quarles, J.M.; Tennant, R.W.

    1976-01-01

    Actively dividing cultures of AKR mouse cells were exposed to relatively low dose-rates of γ radiation and tested for activation of endogenous leukemia viruses. Efficient and reproducible induction of virus was obtained with actively dividing cells, but cultures deprived of serum to inhibit cell division before and during γ irradiation were not activated, even when medium with serum was added immediately after irradiation. These results show that cell division was required for virus induction but that a stable intermediate similar to the state induced by halogenated pyrimidines was not formed. In actively dividing AKR cell cultures, virus activation appeared to be proportional to the dose of γ radiation; the estimated frequency of activation was 1-8 x 10 - 5 per exposed cell and the efficiency of activation was approximately 0.012 inductions per cell per rad. Other normal primary and established mouse cell cultures tested were not activated by γ radiation. The requirement of cell division for radiation and chemical activation may reflect some common mechanism for initiation of virus expression

  20. Mesenchymal stem cells cultured on magnetic nanowire substrates

    Science.gov (United States)

    Perez, Jose E.; Ravasi, Timothy; Kosel, Jürgen

    2017-02-01

    Stem cells have been shown to respond to extracellular mechanical stimuli by regulating their fate through the activation of specific signaling pathways. In this work, an array of iron nanowires (NWs) aligned perpendicularly to the surface was fabricated by pulsed electrodepositon in porous alumina templates followed by a partial removal of the alumina to reveal 2-3 μm of the NWs. This resulted in alumina substrates with densely arranged NWs of 33 nm in diameter separated by 100 nm. The substrates were characterized by scanning electron microscopy (SEM) energy dispersive x-ray analysis and vibrating sample magnetometer. The NW array was then used as a platform for the culture of human mesenchymal stem cells (hMSCs). The cells were stained for the cell nucleus and actin filaments, as well as immuno-stained for the focal adhesion protein vinculin, and then observed by fluorescence microscopy in order to characterize their spreading behavior. Calcein AM/ethidium homodimer-1 staining allowed the determination of cell viability. The interface between the cells and the NWs was studied using SEM. Results showed that hMSCs underwent a re-organization of actin filaments that translated into a change from an elongated to a spherical cell shape. Actin filaments and vinculin accumulated in bundles, suggesting the attachment and formation of focal adhesion points of the cells on the NWs. Though the overall number of cells attached on the NWs was lower compared to the control, the attached cells maintained a high viability (>90%) for up to 6 d. Analysis of the interface between the NWs and the cells confirmed the re-organization of F-actin and revealed the adhesion points of the cells on the NWs. Additionally, a net of filopodia surrounded each cell, suggesting the probing of the array to find additional adhesion points. The cells maintained their round shape for up to 6 d of culture. Overall, the NW array is a promising nanostructured platform for studying and influencing h

  1. Mesenchymal stem cells cultured on magnetic nanowire substrates

    KAUST Repository

    Perez, Jose E.

    2016-12-28

    Stem cells have been shown to respond to extracellular mechanical stimuli by regulating their fate through the activation of specific signaling pathways. In this work, an array of iron nanowires (NWs) aligned perpendicularly to the surface was fabricated by pulsed electrodepositon in porous alumina templates followed by a partial removal of the alumina to reveal 2-3 μm of the NWs. This resulted in alumina substrates with densely arranged NWs of 33 nm in diameter separated by 100 nm. The substrates were characterized by scanning electron microscopy (SEM) energy dispersive x-ray analysis and vibrating sample magnetometer. The NW array was then used as a platform for the culture of human mesenchymal stem cells (hMSCs). The cells were stained for the cell nucleus and actin filaments, as well as immuno-stained for the focal adhesion protein vinculin, and then observed by fluorescence microscopy in order to characterize their spreading behavior. Calcein AM/ethidium homodimer-1 staining allowed the determination of cell viability. The interface between the cells and the NWs was studied using SEM. Results showed that hMSCs underwent a re-organization of actin filaments that translated into a change from an elongated to a spherical cell shape. Actin filaments and vinculin accumulated in bundles, suggesting the attachment and formation of focal adhesion points of the cells on the NWs. Though the overall number of cells attached on the NWs was lower compared to the control, the attached cells maintained a high viability (>90%) for up to 6 d. Analysis of the interface between the NWs and the cells confirmed the re-organization of F-actin and revealed the adhesion points of the cells on the NWs. Additionally, a net of filopodia surrounded each cell, suggesting the probing of the array to find additional adhesion points. The cells maintained their round shape for up to 6 d of culture. Overall, the NW array is a promising nanostructured platform for studying and influencing h

  2. New 2-arylbenzofuran metabolite from cell cultures of Morus alba.

    Science.gov (United States)

    Zhang, De-Wu; Tao, Xiao-Yu; Yu, Li-Yan; Dai, Jun-Gui

    2015-01-01

    A new 2-arylbenzofuran compound, 5-dehydroxy-moracin U (1), along with 10 known compounds (2-11), were isolated from cell cultures of Morus alba. Their structures were elucidated on the basis of extensive spectroscopic analyses. The anti-inflammatory activity assay of 1-8 showed that 2 and 8 exhibited significant inhibitory effect on LPS-induced NO production with the values of 76.4% and 98.7% at 10(- 5) M, respectively.

  3. Rotary orbital suspension culture of embryonic stem cell-derived neural stem/progenitor cells: impact of hydrodynamic culture on aggregate yield, morphology and cell phenotype.

    Science.gov (United States)

    Laundos, Tiago L; Silva, Joana; Assunção, Marisa; Quelhas, Pedro; Monteiro, Cátia; Oliveira, Carla; Oliveira, Maria J; Pêgo, Ana P; Amaral, Isabel F

    2017-08-01

    Embryonic stem (ES)-derived neural stem/progenitor cells (ES-NSPCs) constitute a promising cell source for application in cell therapies for the treatment of central nervous system disorders. In this study, a rotary orbital hydrodynamic culture system was applied to single-cell suspensions of ES-NSPCs, to obtain homogeneously-sized ES-NSPC cellular aggregates (neurospheres). Hydrodynamic culture allowed the formation of ES-NSPC neurospheres with a narrower size distribution than statically cultured neurospheres, increasing orbital speeds leading to smaller-sized neurospheres and higher neurosphere yield. Neurospheres formed under hydrodynamic conditions (72 h at 55 rpm) showed higher cell compaction and comparable percentages of viable, dead, apoptotic and proliferative cells. Further characterization of cellular aggregates provided new insights into the effect of hydrodynamic shear on ES-NSPC behaviour. Rotary neurospheres exhibited reduced protein levels of N-cadherin and β-catenin, and higher deposition of laminin (without impacting fibronectin deposition), matrix metalloproteinase-2 (MMP-2) activity and percentage of neuronal cells. In line with the increased MMP-2 activity levels found, hydrodynamically-cultured neurospheres showed higher outward migration on laminin. Moreover, when cultured in a 3D fibrin hydrogel, rotary neurospheres generated an increased percentage of neuronal cells. In conclusion, the application of a constant orbital speed to single-cell suspensions of ES-NSPCs, besides allowing the formation of homogeneously-sized neurospheres, promoted ES-NSPC differentiation and outward migration, possibly by influencing the expression of cell-cell adhesion molecules and the secretion of proteases/extracellular matrix proteins. These findings are important when establishing the culture conditions needed to obtain uniformly-sized ES-NSPC aggregates, either for use in regenerative therapies or in in vitro platforms for biomaterial development or

  4. Photodamage of the cells in culture sensitized with bilirubin

    Science.gov (United States)

    Kozlenkova, O. A.; Plavskaya, L. G.; Mikulich, A. V.; Leusenko, I. A.; Tretyakova, A. I.; Plavskii, V. Yu

    2016-08-01

    It has been shown that exposure to radiation of LED sources of light with an emission band maximum at about 465 and 520 nm having substantially identical damaging effects on animal cells in culture, that are in a logarithmic growth phase and preincubated with pigment. Photobiological effect is caused by photodynamic processes involving singlet oxygen generated by triplet excited sensitizer. Mono-exponential type dependence of cell survival on the energy dose indicates that it is bilirubin that acts as a sensitizer but not its photoproducts. The inclusion of bilirubin in the cells, where it is primarily localized in the mitochondria cells, it is accompanied by multiple amplification photochemical stability compared to pigment molecules bound with albumin

  5. Neural differentiation of adipose-derived stem cells by indirect co-culture with Schwann cells

    Directory of Open Access Journals (Sweden)

    Li Xiaojie

    2009-01-01

    Full Text Available To investigate whether adipose-derived stem cells (ADSCs could be subject to neural differentiation induced only by Schwann cell (SC factors, we co-cultured ADSCs and SCs in transwell culture dishes. Immunoassaying, Western blot analysis, and RT-PCR were performed (1, 3, 7, 14 d and the co-cultured ADSCs showed gene and protein expression of S-100, Nestin, and GFAP. Further, qRT-PCR disclosed relative quantitative differences in the above three gene expressions. We think ADSCs can undergo induced neural differentiation by being co-cultured with SCs, and such differentia­tions begin 1 day after co-culture, become apparent after 7 days, and thereafter remain stable till the 14th day.

  6. Computerized microfluidic cell culture using elastomeric channels and Braille displays.

    Science.gov (United States)

    Gu, Wei; Zhu, Xiaoyue; Futai, Nobuyuki; Cho, Brenda S; Takayama, Shuichi

    2004-11-09

    Computer-controlled microfluidics would advance many types of cellular assays and microscale tissue engineering studies wherever spatiotemporal changes in fluidics need to be defined. However, this goal has been elusive because of the limited availability of integrated, programmable pumps and valves. This paper demonstrates how a refreshable Braille display, with its grid of 320 vertically moving pins, can power integrated pumps and valves through localized deformations of channel networks within elastic silicone rubber. The resulting computerized fluidic control is able to switch among: (i) rapid and efficient mixing between streams, (ii) multiple laminar flows with minimal mixing between streams, and (iii) segmented plug-flow of immiscible fluids within the same channel architecture. The same control method is used to precisely seed cells, compartmentalize them into distinct subpopulations through channel reconfiguration, and culture each cell subpopulation for up to 3 weeks under perfusion. These reliable microscale cell cultures showed gradients of cellular behavior from C2C12 myoblasts along channel lengths, as well as differences in cell density of undifferentiated myoblasts and differentiation patterns, both programmable through different flow rates of serum-containing media. This technology will allow future microscale tissue or cell studies to be more accessible, especially for high-throughput, complex, and long-term experiments. The microfluidic actuation method described is versatile and computer programmable, yet simple, well packaged, and portable enough for personal use.

  7. Cell cultures for schistosomes - Chances of success or wishful thinking?

    Science.gov (United States)

    Quack, T; Wippersteg, V; Grevelding, C G

    2010-08-01

    Due to their worldwide importance for human and animal health, schistosomes are in the focus of national and international research activities. Their aims are to elucidate the genome, the transcriptome, the proteome and the glycome of schistosomes with the expectation to understand the biology of these blood flukes and to identify new candidate antigens for the development of a vaccine, or target molecules for the design of novel pharmaceutical compounds. All of these efforts have delivered a vast amount of information about the genetic equipment of schistosomes. In the emerging era of post-genomic research, however, methods and tools are necessary to interpret all available data and to characterise molecules of interest in more detail. In addition to transgenesis, it is generally accepted that cell lines for schistosomes are among the requirements to overcome present research limitations. In our commentary the prospect of establishing cell cultures for schistosomes is discussed. To this end we summarise the comprehensive endeavours made in the past regarding the establishment of invertebrate cell lines pointing to critical parameters that should be considered when making new attempts towards schistosome cell culturing. Furthermore, based on preliminary data with pilot-character, we discuss recent advances indicating the possibility of overcoming existing restrictions with respect to the 'immortalisation' of cells by oncogenes. Copyright 2010 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  8. Agent-Based Computational Modeling of Cell Culture ...

    Science.gov (United States)

    Quantitative characterization of cellular dose in vitro is needed for alignment of doses in vitro and in vivo. We used the agent-based software, CompuCell3D (CC3D), to provide a stochastic description of cell growth in culture. The model was configured so that isolated cells assumed a “fried egg shape” but became increasingly cuboidal with increasing confluency. The surface area presented by each cell to the overlying medium varies from cell-to-cell and is a determinant of diffusional flux of toxicant from the medium into the cell. Thus, dose varies among cells for a given concentration of toxicant in the medium. Computer code describing diffusion of H2O2 from medium into each cell and clearance of H2O2 was calibrated against H2O2 time-course data (25, 50, or 75 uM H2O2 for 60 min) obtained with the Amplex Red assay for the medium and the H2O2-sensitive fluorescent reporter, HyPer, for cytosol. Cellular H2O2 concentrations peaked at about 5 min and were near baseline by 10 min. The model predicted a skewed distribution of surface areas, with between cell variation usually 2 fold or less. Predicted variability in cellular dose was in rough agreement with the variation in the HyPer data. These results are preliminary, as the model was not calibrated to the morphology of a specific cell type. Future work will involve morphology model calibration against human bronchial epithelial (BEAS-2B) cells. Our results show, however, the potential of agent-based modeling

  9. CDB-4124 does not cause apoptosis in cultured fibroid cells.

    Science.gov (United States)

    Roeder, Hilary; Jayes, Friederike; Feng, Liping; Leppert, Phyllis C

    2011-09-01

    Selective progesterone receptor modulators (SPRMs), such as asoprisnil (J867) and ulipristal (CDB-2914), have been shown to reduce fibroid volume in vivo and to induce apoptosis in vitro. CDB-4124 (telapristone), a SPRM with different side groups, also reduced fibroid volume in vivo, and we hypothesized that this SPRM would also cause apoptosis in cultured fibroid cells. Immortalized, progesterone receptor-positive fibroid cells, known to be capable of apoptosis, were grown to 80% confluence in serum-containing media. Cells were then treated for 48 hours in serum-free media with 0, 10, 100, or 1000 nmol/L CDB-4124. Actinomycin-D and staurosporine were used as positive controls to induce apoptosis. Apoptosis was quantified using a TUNEL-fluorescein kit. Images were captured with a widefield-fluorescence microscope and analyzed using MetaMorph image analysis software. To validate results, Western blots of total cell lysates were probed for cleaved caspase-3 (c-CASP3). Experiments were repeated 3 times using independent cell batches. Analysis of 19 712 nuclei indicated 14.8% ± 10.9% (mean ± SEM), 8.4% ± 4.6%, 8.2% ± 4.7%, and 9.3% ± 6.3% apoptosis in 0, 10, 100, and 1000 nmol/L CDB-4124-treated cells, respectively. There was no evidence of elevated c-CASP3 over vehicle control after treatment with CDB-4124. CDB-4124 did not significantly induce apoptosis in cultured fibroid cells under the conditions described suggesting apoptosis may not be the main pathway responsible for CDB-4124-induced fibroid shrinkage. Variations in SPRM biological effects may be due to differences in fibroid source cells, binding kinetics, or extracellular matrix characteristics, and can be exploited in further investigations of the mechanisms of action of SPRMs in fibroid biology.

  10. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  11. Flow field measurements in the cell culture unit

    Science.gov (United States)

    Walker, Stephen; Wilder, Mike; Dimanlig, Arsenio; Jagger, Justin; Searby, Nancy

    2002-01-01

    The cell culture unit (CCU) is being designed to support cell growth for long-duration life science experiments on the International Space Station (ISS). The CCU is a perfused loop system that provides a fluid environment for controlled cell growth experiments within cell specimen chambers (CSCs), and is intended to accommodate diverse cell specimen types. Many of the functional requirements depend on the fluid flow field within the CSC (e.g., feeding and gas management). A design goal of the CCU is to match, within experimental limits, all environmental conditions, other than the effects of gravity on the cells, whether the hardware is in microgravity ( micro g), normal Earth gravity, or up to 2g on the ISS centrifuge. In order to achieve this goal, two steps are being taken. The first step is to characterize the environmental conditions of current 1g cell biology experiments being performed in laboratories using ground-based hardware. The second step is to ensure that the design of the CCU allows the fluid flow conditions found in 1g to be replicated from microgravity up to 2g. The techniques that are being used to take these steps include flow visualization, particle image velocimetry (PIV), and computational fluid dynamics (CFD). Flow visualization using the injection of dye has been used to gain a global perspective of the characteristics of the CSC flow field. To characterize laboratory cell culture conditions, PIV is being used to determine the flow field parameters of cell suspension cultures grown in Erlenmeyer flasks on orbital shakers. These measured parameters will be compared to PIV measurements in the CSCs to ensure that the flow field that cells encounter in CSCs is within the bounds determined for typical laboratory experiments. Using CFD, a detailed simulation is being developed to predict the flow field within the CSC for a wide variety of flow conditions, including microgravity environments. Results from all these measurements and analyses of the

  12. Feeder Cell Type Affects the Growth of In Vitro Cultured Bovine Trophoblast Cells

    Directory of Open Access Journals (Sweden)

    Islam M. Saadeldin

    2017-01-01

    Full Text Available Trophectoderm cells are the foremost embryonic cells to differentiate with prospective stem-cell properties. In the current study, we aimed at improving the current approach for trophoblast culture by using granulosa cells as feeders. Porcine granulosa cells (PGCs compared to the conventional mouse embryonic fibroblasts (MEFs were used to grow trophectoderm cells from hatched bovine blastocysts. Isolated trophectoderm cells were monitored and displayed characteristic epithelial/cuboidal morphology. The isolated trophectoderm cells expressed mRNA of homeobox protein (CDX2, cytokeratin-8 (KRT8, and interferon tau (IFNT. The expression level was higher on PGCs compared to MEFs throughout the study. In addition, primary trophectoderm cell colonies grew faster on PGCs, with a doubling time of approximately 48 hrs, compared to MEFs. PGCs feeders produced a fair amount of 17β-estradiol and progesterone. We speculated that the supplementation of sex steroids and still-unknown factors during the trophoblasts coculture on PGCs have helped to have better trophectoderm cell’s growth than on MEFs. This is the first time to use PGCs as feeders to culture trophectoderm cells and it proved superior to MEFs. We propose PGCs as alternative feeders for long-term culture of bovine trophectoderm cells. This model will potentially benefit studies on the early trophoblast and embryonic development in bovines.

  13. Cell Culture in Microgravity: Opening the Door to Space Cell Biology

    Science.gov (United States)

    Pellis, Neal R.; Dawson, David L. (Technical Monitor)

    1999-01-01

    Adaptational response of human cell populations to microgravity is investigated using simulation, short-term Shuttle experiments, and long-term microgravity. Simulation consists of a clinostatically-rotated cell culture system. The system is a horizontally-rotated cylinder completely filled with culture medium. Low speed rotation results in continuous-fall of the cells through the fluid medium. In this setting, cells: 1) aggregate, 2) propagate in three dimensions, 3) synthesize matrix, 4) differentiate, and 5) form sinusoids that facilitate mass transfer. Space cell culture is conducted in flight bioreactors and in static incubators. Cells grown in microgravity are: bovine cartilage, promyelocytic leukemia, kidney proximal tubule cells, adrenal medulla, breast and colon cancer, and endothelium. Cells were cultured in space to test specific hypotheses. Cartilage cells were used to determine structural differences in cartilage grown in space compared to ground-based bioreactors. Results from a 130-day experiment on Mir revealed that cartilage grown in space was substantially more compressible due to insufficient glycosaminoglycan in the matrix. Interestingly, earth-grown cartilage conformed better to the dimensions of the scaffolding material, while the Mir specimens were spherical. The other cell populations are currently being analyzed for cell surface properties, gene expression, and differentiation. Results suggest that some cells spontaneously differentiate in microgravity. Additionally, vast changes in gene expression may occur in response to microgravity. In conclusion, the transition to microgravity may constitute a physical perturbation in cells resulting in unique gene expressions, the consequences of which may be useful in tissue engineering, disease modeling, and space cell biology.

  14. Effect of Lactobacillus sp. isolates supernatant on Escherichia coli O157:H7 enhances the role of organic acids production as a factor for pathogen control

    Directory of Open Access Journals (Sweden)

    Larissa B. Poppi

    2015-04-01

    Full Text Available Many attempts have been made to establish the control of foodborne pathogens through Lactobacillus isolates and their metabolism products with success being obtained in several situations. The aim of this study was to investigate the antagonistic effect of eight Lactobacillus isolates, including L. casei subsp. pseudoplantarum, L. plantarum, L. reuteri and L. delbrueckii subsp. delbrueckii, on the pathogenic Escherichia colistrain O157:H7. The inhibitory effect of pure cultures and two pooled cultures supernatants of Lactobacillus on the growth of pathogenic bacteria was evaluated by the spot agar method and by monitoring turbidity. Antimicrobial activity was confirmed for L. reuteri and L. delbrueckii subsp. delbrueckii and for a pool of lactic acid bacteria. The neutralized supernatant of the pool exerted a higher antimicrobial activity than that of the individual strains. Furthermore, D-lactic acid and acetic acid were produced during growth of the Lactobacillus isolates studied.

  15. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure.

    Science.gov (United States)

    Akahane, M; Shimizu, T; Kira, T; Onishi, T; Uchihara, Y; Imamura, T; Tanaka, Y

    2016-11-01

    To assess the structure and extracellular matrix molecule expression of osteogenic cell sheets created via culture in medium with both dexamethasone (Dex) and ascorbic acid phosphate (AscP) compared either Dex or AscP alone. Osteogenic cell sheets were prepared by culturing rat bone marrow stromal cells in a minimal essential medium (MEM), MEM with AscP, MEM with Dex, and MEM with Dex and AscP (Dex/AscP). The cell number and messenger (m)RNA expression were assessed in vitro, and the appearance of the cell sheets was observed after mechanical retrieval using a scraper. β-tricalcium phosphate (β-TCP) was then wrapped with the cell sheets from the four different groups and subcutaneously implanted into rats. After mechanical retrieval, the osteogenic cell sheets from the MEM, MEM with AscP, and MEM with Dex groups appeared to be fragmented or incomplete structures. The cell sheets cultured with Dex/AscP remained intact after mechanical retrieval, without any identifiable tears. Culture with Dex/AscP increased the mRNA and protein expression of extracellular matrix proteins and cell number compared with those of the other three groups. More bridging bone formation was observed after transplantation of the β-TCP scaffold wrapped with cell sheets cultured with Dex/AscP, than in the other groups. These results suggest that culture with Dex/AscP improves the mechanical integrity of the osteogenic cell sheets, allowing retrieval of the confluent cells in a single cell sheet structure. This method may be beneficial when applied in cases of difficult tissue reconstruction, such as nonunion, bone defects, and osteonecrosis.Cite this article: M. Akahane, T. Shimizu, T. Kira, T. Onishi, Y. Uchihara, T. Imamura, Y. Tanaka. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure. Bone Joint Res 2016;5:569-576. DOI: 10.1302/2046-3758.511.BJR-2016-0013.R1. © 2016 Akahane et al.

  16. Survival of Peripheral Blood Neutrophil Following Treatment with Soluble Factors from Rat Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    S Hamounnavard

    2014-11-01

    Full Text Available Introduction: Mesenchymal stem cells have immunomodulatory properties and own extensive potentials to proliferate and differentiate into different cell lineages. Thus, this study was conducted to investigate the effect of supernatant of rat MSCs on the neutrophils viability. Methods: MSCs was isolated from femoral and tibial bone marrow of rat (6-8 weeks and was cultured in DMEM. After maturation of MSCs, its supernatant was incubated with neutrophils isolated from peripheral blood of rat at 37 ° C for 1 h. Neutrophil survival was measured at 6 and 24 h incubation with supernatant of MSCs by flow cytometric analysis using An/PI. Data were analyzed by one-way ANOVA followed by Tukey test (P˂0.05. Results: 6-hour incubation of neutrophils with supernatant of MSCs significantly increased the healthy cells percentage and significantly decreased the amount of necrosis (P˂0.05, but no significant decrease was observed in regard with apoptosis compared to the controls (P˃0.05. The 24-hour incubation of neutrophils with cell supernatant significantly increased the percentage of healthy cells and apoptosis was significantly reduced compared to the control group (P˂0.05. Moreover, a reduction in cell necrosis was not significant in the treated groups compared to the control (P˃0.05. Conclusions: In addition to the clinical importance of MSCs, their biological aspects are of great potential for cell therapy, such as self-renewal, proliferation and immune modulatory effects.

  17. Is cell culture a risky business? Risk analysis based on scientist survey data.

    Science.gov (United States)

    Shannon, Mark; Capes-Davis, Amanda; Eggington, Elaine; Georghiou, Ronnie; Huschtscha, Lily I; Moy, Elsa; Power, Melinda; Reddel, Roger R; Arthur, Jonathan W

    2016-02-01

    Cell culture is a technique that requires vigilance from the researcher. Common cell culture problems, including contamination with microorganisms or cells from other cultures, can place the reliability and reproducibility of cell culture work at risk. Here we use survey data, contributed by research scientists based in Australia and New Zealand, to assess common cell culture risks and how these risks are managed in practice. Respondents show that sharing of cell lines between laboratories continues to be widespread. Arrangements for mycoplasma and authentication testing are increasingly in place, although scientists are often uncertain how to perform authentication testing. Additional risks are identified for preparation of frozen stocks, storage and shipping. © 2015 UICC.

  18. Discarded human fetal tissue and cell cultures for transplantation research

    International Nuclear Information System (INIS)

    Hay, R.J.; Phillips, T.; Thompson, A.; Vilner, L.; Cleland, M.; Tchaw-ren Chen; Zabrenetzky, V.

    1999-01-01

    A feasibility study has been performed to explore the utility of various tissues from discarded human abortuses for transplantation and related research. Specifically, aborted fetuses plus parental blood samples and all relevant clinical data were obtained through a local hospital complex. Whenever possible, pancreas, skin and skeletal muscle, heart, liver, kidney, cartilage and lung tissues were removed, dissociated and subfractionated for cryopreservation, characterization and cultivation trials in vitro. Existing protocols for these manipulations were compared and improved upon as required. Clonal culture, cell aggregate maintenance techniques and use of feeder cell populations have been utilized where appropriate to develop quantitative comparative data. Histological and biochemical assays were applied both to evaluate separation/cultivation methods and to identify optimal culture conditions for maintaining functional cells. Immunochemical and molecular biological procedures were applied to study expression of Major Histocompatibility Vomplex (MHC) class 1 and 11 molecules on cell lines derived. Tissue and cell culture populations were examined for infections with bacteria, ftingi, mycoplasma, HIV, CMV, hepatitis B and other viruses. Only 1% of the abortuses tested were virally infected. Cytogenetic analyses confin-ned the normal diploid status in the vast majority (>98%) of lines tested. A total of over 250 abortuses have been obtained and processed. Only 25 were found to be contaminated with bacteria or fungi and unsuitable for further cultivation trials. A total of over 200 cell populations were isolated, characterized and cryopreserved for further study. Included were kidney, lung, liver and epidermal epithelia: cartilage-derived cells from the spine and epiphyses plus myogenic myoblasts. Selected lines have been immortalized using HPV I 6E6/E7 sequences. Epithelia from the liver and pancreas and cardiac myocytes were the most problematic in that initial

  19. Bags versus flasks: a comparison of cell culture systems for the production of dendritic cell-based immunotherapies.

    Science.gov (United States)

    Fekete, Natalie; Béland, Ariane V; Campbell, Katie; Clark, Sarah L; Hoesli, Corinne A

    2018-04-19

    In recent years, cell-based therapies targeting the immune system have emerged as promising strategies for cancer treatment. This review summarizes manufacturing challenges related to production of antigen presenting cells as a patient-tailored cancer therapy. Understanding cell-material interactions is essential because in vitro cell culture manipulations to obtain mature antigen-producing cells can significantly alter their in vivo performance. Traditional antigen-producing cell culture protocols often rely on cell adhesion to surface-treated hydrophilic polystyrene flasks. More recent commercial and investigational cancer immunotherapy products were manufactured using suspension cell culture in closed hydrophobic fluoropolymer bags. The shift to closed cell culture systems can decrease risks of contamination by individual operators, as well as facilitate scale-up and automation. Selecting closed cell culture bags over traditional open culture systems entails different handling procedures and processing controls, which can affect product quality. Changes in culture vessels also entail changes in vessel materials and geometry, which may alter the cell microenvironment and resulting cell fate decisions. Strategically designed culture systems will pave the way for the generation of more sophisticated and highly potent cell-based cancer vaccines. As an increasing number of cell-based therapies enter the clinic, the selection of appropriate cell culture vessels and materials becomes a critical consideration that can impact the therapeutic efficacy of the product, and hence clinical outcomes and patient quality of life. © 2018 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

  20. Effects of 2,3-iminosqualene in cultured cells

    International Nuclear Information System (INIS)

    Popjak, G.; Meenan, A.; Nes, W.D.

    1987-01-01

    2,3-Iminosqualene added to culture media 10 ug/ml) of rat hepatoma (H4-II-E-C3) or Chinese hamster ovary (CHO) cells irreversibly inactivates the squalene-oxide: lanosterol cyclase, but it does not inhibit general polyprenyl synthesis either from [ 14 C]acetate or [ 14 C]mevalonate. Isq added to lipoprotein-containing media of H4 cells causes in 24 hr an over twofold rise in HMG-CoA reductase and abolishes the repressive effect of mevalonate (MVA) on the reductase. H4 cells synthesize from [2- 14 C]-MVA labelled squalene, squalene-2,3-oxide, squalene-2,3-22,23-dioxide, but very little sterol. The conversion of MVA to these polyprenyls in the presence of Isq is as efficient as its conversion to squalene and cholesterol in control cells. They conclude that the repressor of HMG-CoA reductase derived from MVA is a sterol - whatever might be the nature of that sterol - and not a nonsteroidal derivative of MVA metabolism. H4 cells exposed to Isq in lipid-depleted media die in 48-72 hr, but can be rescued by LDL, but not by free cholesterol or MVA. CHO cells are more resistant than H4 cells and succumb only after 8-9 days' exposure to Isq

  1. Establishment of automated culture system for murine induced pluripotent stem cells

    Directory of Open Access Journals (Sweden)

    Koike Hiroyuki

    2012-11-01

    Full Text Available Abstract Background Induced pluripotent stem (iPS cells can differentiate into any cell type, which makes them an attractive resource in fields such as regenerative medicine, drug screening, or in vitro toxicology. The most important prerequisite for these industrial applications is stable supply and uniform quality of iPS cells. Variation in quality largely results from differences in handling skills between operators in laboratories. To minimize these differences, establishment of an automated iPS cell culture system is necessary. Results We developed a standardized mouse iPS cell maintenance culture, using an automated cell culture system housed in a CO2 incubator commonly used in many laboratories. The iPS cells propagated in a chamber uniquely designed for automated culture and showed specific colony morphology, as for manual culture. A cell detachment device in the system passaged iPS cells automatically by dispersing colonies to single cells. In addition, iPS cells were passaged without any change in colony morphology or expression of undifferentiated stem cell markers during the 4 weeks of automated culture. Conclusions Our results show that use of this compact, automated cell culture system facilitates stable iPS cell culture without obvious effects on iPS cell pluripotency or colony-forming ability. The feasibility of iPS cell culture automation may greatly facilitate the use of this versatile cell source for a variety of biomedical applications.

  2. Digital microfluidics for automated hanging drop cell spheroid culture.

    Science.gov (United States)

    Aijian, Andrew P; Garrell, Robin L

    2015-06-01

    Cell spheroids are multicellular aggregates, grown in vitro, that mimic the three-dimensional morphology of physiological tissues. Although there are numerous benefits to using spheroids in cell-based assays, the adoption of spheroids in routine biomedical research has been limited, in part, by the tedious workflow associated with spheroid formation and analysis. Here we describe a digital microfluidic platform that has been developed to automate liquid-handling protocols for the formation, maintenance, and analysis of multicellular spheroids in hanging drop culture. We show that droplets of liquid can be added to and extracted from through-holes, or "wells," and fabricated in the bottom plate of a digital microfluidic device, enabling the formation and assaying of hanging drops. Using this digital microfluidic platform, spheroids of mouse mesenchymal stem cells were formed and maintained in situ for 72 h, exhibiting good viability (>90%) and size uniformity (% coefficient of variation <10% intraexperiment, <20% interexperiment). A proof-of-principle drug screen was performed on human colorectal adenocarcinoma spheroids to demonstrate the ability to recapitulate physiologically relevant phenomena such as insulin-induced drug resistance. With automatable and flexible liquid handling, and a wide range of in situ sample preparation and analysis capabilities, the digital microfluidic platform provides a viable tool for automating cell spheroid culture and analysis. © 2014 Society for Laboratory Automation and Screening.

  3. Cell thickness of UV absorption by the cell: relation to UV action spectrum shift in mammalian cells in culture

    International Nuclear Information System (INIS)

    Sakharov, V.H.; Voronkova, L.N.; Blokhin, A.V.

    1985-01-01

    By means of reconstruction of series half - thin transverse sections the three - dimensional morphometry of SPEV cells for a series of their specific states in culture is performed: for exponential growth in a monolayer, in a merged monolayer, in the mitosis phase, for giant cells and suspension cells. In the monolayer the cell thickness in its central part depended mainly on the nucleus thickness and in average changed but slightly despite a wide range of changes in volumes of nuclei and cells and their density in culture. The cell thickness has noticeably increased in mitosis. For the above states of cells UV radiation absorption spectra are determined. It is shown that a certain shift of action spectrus of death of mammalian cells as compared with that for bacterial cell can be a seguence of selfshielding and not differences in the nature of active chromophores

  4. Rheological characteristics of cell suspension and cell culture of Perilla frutescens.

    Science.gov (United States)

    Zhong, J J; Seki, T; Kinoshita, S; Yoshida, T

    1992-12-05

    Physical properties such as viscosity, fluid dynamic behavior of cell suspension, and size distribution of cell aggregates of a plant, Perilla frustescens, cultured in a liquid medium were studied. As a result of investigations using cells harvester after 12 days of cultivation in a flask, it was found that the apparent viscosity of the cell suspension did not change with any variation of cell concentration below 5 g dry cell/L but markedly increased when the cell concentration increased over 12.8 g dry cell/L. The cell suspension exhibited the characteristics of a Bingham plastic fluid with a small yield stress. The size of cell aggregates in the range 74 to 500 mum did not influence the rheological characteristics of the cell suspension. The rheological characteristics of cultivation mixtures of P. frutescens cultivated in a flask and in a bioreactor were also investigated. The results showed that the flow characteristics of the cell culture could be described by a Bingham plastic model. At the later stage of cultivation, the apparent viscosity increased steadily, even though the biomass concentration (by dry weight) decreased, due to the increase of individual cell size. (c) 1992 John Wiley & Sons, Inc.

  5. Glycosylation-mediated phenylpropanoid partitioning in Populus tremuloides cell cultures

    Directory of Open Access Journals (Sweden)

    Babst Benjamin A

    2009-12-01

    Full Text Available Abstract Background Phenylpropanoid-derived phenolic glycosides (PGs and condensed tannins (CTs comprise large, multi-purpose non-structural carbon sinks in Populus. A negative correlation between PG and CT concentrations has been observed in several studies. However, the molecular mechanism underlying the relationship is not known. Results Populus cell cultures produce CTs but not PGs under normal conditions. Feeding salicyl alcohol resulted in accumulation of salicins, the simplest PG, in the cells, but not higher-order PGs. Salicin accrual reflected the stimulation of a glycosylation response which altered a number of metabolic activities. We utilized this suspension cell feeding system as a model for analyzing the possible role of glycosylation in regulating the metabolic competition between PG formation, CT synthesis and growth. Cells accumulated salicins in a dose-dependent manner following salicyl alcohol feeding. Higher feeding levels led to a decrease in cellular CT concentrations (at 5 or 10 mM, and a negative effect on cell growth (at 10 mM. The competition between salicin and CT formation was reciprocal, and depended on the metabolic status of the cells. We analyzed gene expression changes between controls and cells fed with 5 mM salicyl alcohol for 48 hr, a time point when salicin accumulation was near maximum and CT synthesis was reduced, with no effect on growth. Several stress-responsive genes were up-regulated, suggestive of a general stress response in the fed cells. Salicyl alcohol feeding also induced expression of genes associated with sucrose catabolism, glycolysis and the Krebs cycle. Transcript levels of phenylalanine ammonia lyase and most of the flavonoid pathway genes were reduced, consistent with down-regulated CT synthesis. Conclusions Exogenous salicyl alcohol was readily glycosylated in Populus cell cultures, a process that altered sugar utilization and phenolic partitioning in the cells. Using this system, we

  6. Improved endothelial cell seeding with cultured cells and fibronectin-coated grafts

    International Nuclear Information System (INIS)

    Seeger, J.M.; Klingman, N.

    1985-01-01

    A possible approach to the low seeding efficiency of endothelial cells into prosthetic grafts is to increase the number of cells to be seeded in cell culture and improve seeding efficiency by graft precoating with fibronectin. The effect of cell culture on cell adhesion is unknown, however, and fibronectin also binds fibrin, which may increase the thrombogenicity of the graft luminal surface. To investigate these questions, freshly harvested canine jugular vein endothelial cells from six animals and similar cells harvested from six primary and eight secondary cell cultures were labeled with 111 Indium and seeded into 5 cm, 4 mm PTFE grafts coated with fibronectin, using similar uncoated PTFE grafts as controls. Platelet accumulation and distribution on six similar coated and uncoated grafts placed in canine carotid, external jugular arterial venous shunts for 2 hr were also determined using autogenous 111 Indium-labeled platelets. Significant differences between group means were determined using the paired Student's t test. Results reveal that seeding efficiency is significantly better in all groups of coated grafts compared to uncoated grafts (P less than 0.01). Cells derived from cell culture also had significantly higher seeding efficiencies than freshly harvested cells when seeded into coated grafts (P less than 0.05) and tended to have higher seeding efficiencies than harvested cells when seeded into uncoated grafts (P = 0.53). Fibronectin coating increased mean platelet accumulation on the entire graft luminal surface, but not to a statistically significant degree (P greater than 0.1). Whether this increased seeding efficiency will improve graft endothelialization remains to be investigated

  7. Cell in situ zymography: an in vitro cytotechnology for localization of enzyme activity in cell culture.

    Science.gov (United States)

    Chhabra, Aastha; Jaiswal, Astha; Malhotra, Umang; Kohli, Shrey; Rani, Vibha

    2012-09-01

    In situ zymography is a unique technique for detection and localization of enzyme-substrate interactions majorly in histological sections. Substrate with quenched fluorogenic molecule is incorporated in gel over which tissue sections are mounted and then incubated in buffer. The enzymatic activity is observed in the form of fluorescent signal. With the advancements in the field of biological research, use of in vitro cell culture has become very popular and holds great significance in multiple fields including inflammation, cancer, stem cell biology and the still emerging 3-D cell cultures. The information on analysis of enzymatic activity in cell lines is inadequate presently. We propose a single-step methodology that is simple, sensitive, cost-effective, and functional to perform and study the 'in position' activity of enzyme on substrate for in vitro cell cultures. Quantification of enzymatic activity to carry out comparative studies on cells has also been illustrated. This technique can be applied to a variety of enzyme classes including proteases, amylases, xylanases, and cellulases in cell cultures.

  8. A Cell Culture Approach to Optimized Human Corneal Endothelial Cell Function

    Science.gov (United States)

    Bartakova, Alena; Kuzmenko, Olga; Alvarez-Delfin, Karen; Kunzevitzky, Noelia J.; Goldberg, Jeffrey L.

    2018-01-01

    Purpose Cell-based therapies to replace corneal endothelium depend on culture methods to optimize human corneal endothelial cell (HCEC) function and minimize endothelial-mesenchymal transition (EnMT). Here we explore contribution of low-mitogenic media on stabilization of phenotypes in vitro that mimic those of HCECs in vivo. Methods HCECs were isolated from cadaveric donor corneas and expanded in vitro, comparing continuous presence of exogenous growth factors (“proliferative media”) to media without those factors (“stabilizing media”). Identity based on canonical morphology and expression of surface marker CD56, and function based on formation of tight junction barriers measured by trans-endothelial electrical resistance assays (TEER) were assessed. Results Primary HCECs cultured in proliferative media underwent EnMT after three to four passages, becoming increasingly fibroblastic. Stabilizing the cells before each passage by switching them to a media low in mitogenic growth factors and serum preserved canonical morphology and yielded a higher number of cells. HCECs cultured in stabilizing media increased both expression of the identity marker CD56 and also tight junction monolayer integrity compared to cells cultured without stabilization. Conclusions HCECs isolated from donor corneas and expanded in vitro with a low-mitogenic media stabilizing step before each passage demonstrate more canonical structural and functional features and defer EnMT, increasing the number of passages and total canonical cell yield. This approach may facilitate development of HCEC-based cell therapies. PMID:29625488

  9. In vitro cell culture lethal dose submitted to gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Moreno, Carolina S.; Rogero, Sizue O.; Rogero, Jose Roberto [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)], e-mail: carolina_sm@hotmail.com; Ikeda, Tamiko I.; Cruz, Aurea S. [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil)

    2009-07-01

    The present study was designed to evaluate the in vitro effect of gamma radiation in cell culture of mouse connective tissue exposed to different doses of gamma radiation and under several conditions. The cell viability was analyzed by neutral red uptake methodology. This assay was developed for establish a methodology to be used in the future in the study of resveratrol radioprotection. Resveratrol (3,4',5- trihydroxystilbene), a phenolic phytoalexin that occurs naturally in some spermatophytes, such as grapevines, in response to injury as fungal infections and exposure to ultraviolet light. In the wines this compound is found at high levels and is considered one of the highest antioxidant constituents. The intense antioxidant potential of resveratrol provides many pharmacological activities including cardioprotection, chemoprevention and anti-tumor effects. Our results demonstrated that {sup 60}Co gamma radiation lethal dose (LD50) on NCTC clone 929 cells was about 340Gy. (author)

  10. In vitro cell culture lethal dose submitted to gamma radiation

    International Nuclear Information System (INIS)

    Moreno, Carolina S.; Rogero, Sizue O.; Rogero, Jose Roberto; Ikeda, Tamiko I.; Cruz, Aurea S.

    2009-01-01

    The present study was designed to evaluate the in vitro effect of gamma radiation in cell culture of mouse connective tissue exposed to different doses of gamma radiation and under several conditions. The cell viability was analyzed by neutral red uptake methodology. This assay was developed for establish a methodology to be used in the future in the study of resveratrol radioprotection. Resveratrol (3,4',5- trihydroxystilbene), a phenolic phytoalexin that occurs naturally in some spermatophytes, such as grapevines, in response to injury as fungal infections and exposure to ultraviolet light. In the wines this compound is found at high levels and is considered one of the highest antioxidant constituents. The intense antioxidant potential of resveratrol provides many pharmacological activities including cardioprotection, chemoprevention and anti-tumor effects. Our results demonstrated that 60 Co gamma radiation lethal dose (LD50) on NCTC clone 929 cells was about 340Gy. (author)

  11. Sulphur XANES Analysis of Cultured Human Prostate Cancer Cells

    International Nuclear Information System (INIS)

    Kwiatek, W.M.; Podgorczyk, M.; Paluszkiewicz, Cz.; Balerna, A.; Kisiel, A.

    2008-01-01

    Prostate cancer is one of the most commonly diagnosed cancers in men throughout the world. It is believed that changes to the structure of protein binding sites, altering its metabolism, may play an important role in carcinogenesis. Sulphur, often present in binding sites, can influence such changes through its chemical speciation. Hence there is a need for precise investigation of coordination environment of sulphur. X-ray absorption near edge structure spectroscopy offers such possibility. Cell culture samples offer histologically well defined areas of good homogeneity, suitable for successful and reliable X-ray absorption near edge structure analysis. This paper presents sulphur speciation data collected from three different human prostate cancer cell lines (PC-3, LNCaP and DU-145). Sulphur X-ray absorption near edge structure analysis was performed on K-edge structure. The spectra of cells were compared with those of cancerous tissue and with organic substances as well as inorganic compounds. (authors)

  12. Centering Single Cells in Microgels via Delayed Crosslinking Supports Long-Term 3D Culture by Preventing Cell Escape

    NARCIS (Netherlands)

    Kamperman, Tom; Henke, Sieger; Visser, Claas Willem; Karperien, Marcel; Leijten, Jeroen

    2017-01-01

    Single-cell-laden microgels support physiological 3D culture conditions while enabling straightforward handling and high-resolution readouts of individual cells. However, their widespread adoption for long-term cultures is limited by cell escape. In this work, it is demonstrated that cell escape is

  13. Optimization of Storage Temperature for Cultured ARPE-19 Cells

    Directory of Open Access Journals (Sweden)

    Lara Pasovic

    2013-01-01

    Full Text Available Purpose. The establishment of future retinal pigment epithelium (RPE replacement therapy is partly dependent on the availability of tissue-engineered RPE cells, which may be enhanced by the development of suitable storage methods for RPE. This study investigates the effect of different storage temperatures on the viability, morphology, and phenotype of cultured RPE. Methods. ARPE-19 cells were cultured under standard conditions and stored in HEPES-buffered MEM at nine temperatures (4°C, 8°C, 12°C, 16°C, 20°C, 24°C, 28°C, 32°C, and 37°C for seven days. Viability and phenotype were assessed by a microplate fluorometer and epifluorescence microscopy, while morphology was analyzed by scanning electron microscopy. Results. The percentage of viable cells preserved after storage was highest in the 16°C group (48.7%±9.8%; P<0.01 compared to 4°C, 8°C, and 24°C–37°C; P<0.05 compared to 12°C. Ultrastructure was best preserved at 12°C, 16°C, and 20°C. Expression of actin, ZO-1, PCNA, caspase-3, and RPE65 was maintained after storage at 16°C compared to control cells that were not stored. Conclusion. Out of nine temperatures tested between 4°C and 37°C, storage at 12°C, 16°C, and 20°C was optimal for maintenance of RPE cell viability, morphology, and phenotype. The preservation of RPE cells is critically dependent on storage temperature.

  14. Evaluation of a dental pulp-derived cell sheet cultured on amniotic membrane substrate.

    Science.gov (United States)

    Honjo, Ken-ichi; Yamamoto, Toshiro; Adachi, Tetsuya; Amemiya, Takeshi; Mazda, Osam; Kanamura, Narisato; Kita, Masakazu

    2015-01-01

    Mesenchymal stem cells (MSC) are transplanted for periodontal tissue regeneration, and the periodontal ligament (PDL) is regenerated using a cultured cell sheet. This cultured cell sheet is prepared using PDL-derived cells, growth factors, and amniotic membrane (AM). Dental pulp (DP)-derived cells can be easily obtained from extracted wisdom teeth, proliferate rapidly, and are less susceptible to bacterial infection than PDL-derived cells. Thus, to prepare a novel cell sheet, DP-derived cells were cultured on AM as a culture substrate for immunohistochemical examination. Wisdom teeth extracted from three adults were cut along the cement-enamel border. DP tissue was collected, minced, and primarily cultured. After three or four passage cultures, DP-derived cells were cultured on AM, followed by hematoxylin-eosin (H-E) and immunofluorescence staining. DP-derived cells cultured on AM formed a layered structure. Cells positive for vimentin, Ki-67, ZO-1, desmoplakin, CD29, 44, 105 or 146, STRO-1, collagen IV or VII or laminin 5 or α5 chain were localized. DP-derived cells proliferated on AM, while retaining the properties of DP, which allowed the cultured cell sheet to be prepared. In addition, the cultured cell sheet contained MSC, which suggests its potential application in periodontal tissue regeneration.

  15. Quantitation of DNA repair in brain cell cultures: implications for autoradiographic analysis of mixed cell populations

    International Nuclear Information System (INIS)

    Dambergs, R.; Kidson, C.

    1979-01-01

    Quantitation of DNA repair in the mixed cell population of mouse embryo brain cultures has been assessed by autoradiographic analysis of unscheduled DNA synthesis following UV-irradiation. The proportion of labelled neurons and the grain density over neuronal nuclei were both less than the corresponding values for glial cells. The nuclear geometries of these two classes of cell are very different. Partial correction for the different geometries by relating grain density to nuclear area brought estimates of neuronal and glial DNA repair synthesis more closely in line. These findings have general implications for autoradiographic measurement of DNA repair in mixed cell populations and in differentiated versus dividing cells. (author)

  16. Test procedures and instructions for Hanford tank waste supernatant cesium removal

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W., Westinghouse Hanford

    1996-05-31

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test using Hanford Double-Shell Slurry Feed supernatant liquor from tank 251-AW-101 in a bench-scale column.Cesium sorbents to be tested include resorcinol-formaldehyde resin and crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-022, Hanford Tank Waste Supernatant Cesium Removal Test Plan.

  17. Test procedures and instructions for Hanford complexant concentrate supernatant cesium removal using CST

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W.

    1997-01-08

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Complexant Concentrate supernatant liquor from tank 241-AN-107, in a bench-scale column. The cesium sorbent to be tested is crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-023, Hanford Complexant Concentrate Supernatant Cesium Removal Test Plan.

  18. The effects of energy beverages on cultured cells.

    Science.gov (United States)

    Doyle, Wayne; Shide, Eric; Thapa, Slesha; Chandrasekaran, Vidya

    2012-10-01

    The popularity and prevalence of energy beverages makes it essential to examine the interactions between the ingredients and their effects on the safety of these beverages. In this study, we used in vitro assays to examine the effects of two energy beverages on mesenchymal, epithelial and neuronal cells. Our results showed that treatment of epithelial and mesenchymal cells with either energy beverage resulted in a dose dependent delay in wound closure, in a scratch wound healing assay. In rat embryonic fibroblasts, treatment with the energy beverages led to decreased lamellipodia formation and decreased proliferation/viability; whereas in MDCK cells, energy beverage treatment resulted in actin disorganization without any effects on cell proliferation. This suggests that the mechanisms underlying delayed wound healing might be different in the two cell types. Interestingly, the delays in both cell types could not be mimicked by treatment of caffeine, taurine and glucose alone or in combinations. Furthermore, treatment of chick forebrain neuronal cultures with energy beverages resulted in a dose dependent inhibition of neurite outgrowth. The cellular assays used in this study provide a consistent, qualitative and quantitative system for examining the combinatorial effects of the various ingredients used in energy beverages. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Regulation of Taurine transporter activity in cultured rat retinal ganglion cells and rat retinal Muller Cells

    International Nuclear Information System (INIS)

    Eissa, Laila A.; Smith, Sylvia B.; El-sherbeny, Amira A.

    2006-01-01

    Diabetic retinopathy is one of the most common complications of diabetes. The amino acid taurine is believed to play an antioxidant protective role in diabetic retinopathy through the scavenging of the reactive species. It is not well established whether taurine uptake is altered in retina cells during diabetic conditions. Thus, the present study was designed to investigate the changes in taurine transport in cultures of rat retinal Muller cells and rat retinal ganglion cells under conditions associated with diabetes. Taurine was abundantly taken up by retinal Muller cells and rat retinal ganglion cells under normal glycemic condition. Taurine was actively transported to rat Muller cells and rat retinal ganglion cells in a Na and Cl dependant manner. Taurine uptake further significantly elevated in both type of cells after the incubation with high glucose concentration. This effect could be attributed to the increase in osmolarity. Because Nitric Oxide (NO) is a molecule implicated in the pathogenesis of diabetes, we also determined the activity of taurine transporter in cultured rat retinal Muller cells and rat retinal ganglion cells in the presence of the NO donors, SIN-1 and SNAP. Taurine uptake was elevated above control value after 24-h incubation with low concentration of NO donors. We finally investigated the ability of neurotoxic glutamate to change taurine transporter activity in both types of cells. Uptake of taurine was significantly increased in rat retinal ganglion cells when only incubated with high concentration of glutamate. Our data provide evidence that taurine transporter is present in cultured rat retinal ganglion and Muller cells and is regulated by hyperosmolarity. The data are relevant to disease such as diabetes and neuronal degeneration where retinal cell volume may dramatically change. (author)

  20. Preparing nuclei from cells in monolayer cultures suitable for counting and for following synchronized cells through the cell cycle.

    Science.gov (United States)

    Butler, W B

    1984-08-15

    A procedure is described for preparing nuclei from cells in monolayer culture so that they may be counted using an electronic particle counter. It takes only 10 to 15 min, and consists of swelling the cells in hypotonic buffer and then lysing them with the quaternary ammonium salt, ethylhexadecyldimethylammonium bromide. The cells are completely lysed, yielding a suspension of clean single nuclei which is stable, free of debris, and easily counted. The method was developed for a cell line of epithelial origin (MCF-7), which is often difficult to trypsinize to single cells. It works equally well at all cell densities up to and beyond confluence, and has been used with a variety of cells in culture, including 3T3 cells, bovine macrophages, rat mammary epithelial cells, mouse mammary tumor cell lines, and human fibroblasts. The size of the nuclei produced by this procedure is related to their DNA content, and the method is thus suitable for following cultures of synchronized cells through the cell cycle, and for performing differential counts of cells with substantial differences in DNA content.

  1. Antitumor Activity of Rat Mesenchymal Stem Cells during Direct or Indirect Co-Culturing with C6 Glioma Cells.

    Science.gov (United States)

    Gabashvili, A N; Baklaushev, V P; Grinenko, N F; Mel'nikov, P A; Cherepanov, S A; Levinsky, A B; Chehonin, V P

    2016-02-01

    The tumor-suppressive effect of rat mesenchymal stem cells against low-differentiated rat C6 glioma cells during their direct and indirect co-culturing and during culturing of C6 glioma cells in the medium conditioned by mesenchymal stem cells was studied in an in vitro experiment. The most pronounced antitumor activity of mesenchymal stem cells was observed during direct co-culturing with C6 glioma cells. The number of live C6 glioma cells during indirect co-culturing and during culturing in conditioned medium was slightly higher than during direct co-culturing, but significantly differed from the control (C6 glioma cells cultured in medium conditioned by C6 glioma cells). The cytotoxic effect of medium conditioned by mesenchymal stem cells was not related to medium depletion by glioma cells during their growth. The medium conditioned by other "non-stem" cells (rat astrocytes and fibroblasts) produced no tumor-suppressive effect. Rat mesenchymal stem cells, similar to rat C6 glioma cells express connexin 43, the main astroglial gap junction protein. During co-culturing, mesenchymal stem cells and glioma C6 cells formed functionally active gap junctions. Gap junction blockade with connexon inhibitor carbenoxolone attenuated the antitumor effect observed during direct co-culturing of C6 glioma cells and mesenchymal stem cells to the level produced by conditioned medium. Cell-cell signaling mediated by gap junctions can be a mechanism of the tumor-suppressive effect of mesenchymal stem cells against C6 glioma cells. This phenomenon can be used for the development of new methods of cell therapy for high-grade malignant gliomas.

  2. CD34+ cells cultured in stem cell factor and interleukin-2 generate CD56+ cells with antiproliferative effects on tumor cell lines

    Directory of Open Access Journals (Sweden)

    Hensel Nancy

    2005-04-01

    Full Text Available Abstract In vitro stimulation of CD34+ cells with IL-2 induces NK cell differentiation. In order to define the stages of NK cell development, which influence their generation from CD34 cells, we cultured G-CSF mobilized peripheral blood CD34+ cells in the presence of stem cell factor and IL-2. After three weeks culture we found a diversity of CD56+ subsets which possessed granzyme A, but lacked the cytotoxic apparatus required for classical NK-like cytotoxicity. However, these CD56+ cells had the unusual property of inhibiting proliferation of K562 and P815 cell lines in a cell-contact dependent fashion.

  3. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  4. Transparent polymeric cell culture chip with integrated temperature control and uniform media perfusion

    DEFF Research Database (Denmark)

    Petronis, Sarunas; Stangegaard, Michael; Christensen, C.

    2006-01-01

    Modern microfabrication and microfluidic technologies offer new opportunities in the design and fabrication of miniaturized cell culture systems for online monitoring of living cells. We used laser micromachining and thermal bonding to fabricate an optically transparent, low-cost polymeric chip...... for long-term online cell culture observation under controlled conditions. The chip incorporated a microfluidic flow equalization system, assuring uniform perfusion of the cell culture media throughout the cell culture chamber. The integrated indium-tin-oxide heater and miniature temperature probe linked....... HeLa cells were cultured for up to 2 weeks within the cell culture chip and monitored using a time-lapse video recording microscopy setup. Cell attachment and spreading was observed during the first 10-20 h (lag phase). After approximately 20 h, cell growth gained exponential character...

  5. Chromosomal instability and telomere shortening in long-term culture of hematopoietic stem cells: insights from a cell culture model of RPS14 haploinsufficiency.

    Science.gov (United States)

    Thomay, K; Schienke, A; Vajen, B; Modlich, U; Schambach, A; Hofmann, W; Schlegelberger, B; Göhring, G

    2014-01-01

    The fate of cultivated primary hematopoietic stem cells (HSCs) with respect to genetic instability and telomere attrition has not yet been described in great detail. Thus, knowledge of the genetic constitution of HSCs is important when interpreting results of HSCs in culture. While establishing a cell culture model for myelodysplastic syndrome with a deletion in 5q by performing RPS14 knockdown, we found surprising data that may be of importance for any CD34+ cell culture experiments. We performed cytogenetic analyses and telomere length measurement on transduced CD34+ cells and untransduced control cells to observe the effects of long-term culturing. Initially, CD34+ cells had a normal median telomere length of about 12 kb and showed no signs of chromosomal instability. During follow-up, the median telomere length seemed to decrease and, simultaneously, increased chromosomal instability could be observed - in modified and control cells. One culture showed a clonal monosomy 7 - independent of prior RPS14 knockdown. During further culturing, it seemed that the telomeres re-elongated, and chromosomes stabilized, while TERT expression was not elevated. In summary, irrespective of our results of RPS14 knockdown in the long-term culture of CD34+ cells, it becomes clear that cell culture artefacts inducing telomere shortening and chromosomal instability have to be taken into account and regular cytogenetic analyses should always be performed. © 2013 S. Karger AG, Basel.

  6. Cell Homogeneity Indispensable for Regenerative Medicine by Cultured Human Corneal Endothelial Cells.

    Science.gov (United States)

    Hamuro, Junji; Toda, Munetoyo; Asada, Kazuko; Hiraga, Asako; Schlötzer-Schrehardt, Ursula; Montoya, Monty; Sotozono, Chie; Ueno, Morio; Kinoshita, Shigeru

    2016-09-01

    To identify the subpopulation (SP) among heterogeneous cultured human corneal endothelial cells (cHCECs) devoid of cell-state transition applicable for cell-based therapy. Subpopulation presence in cHCECs was confirmed via surface CD-marker expression level by flow cytometry. CD markers effective for distinguishing distinct SPs were selected by analyzing those on established cHCECs with a small cell area and high cell density. Contrasting features among three typical cHCEC SPs was confirmed by PCR array for extracellular matrix (ECM). Combined analysis of CD markers was performed to identify the SP (effector cells) applicable for therapy. ZO-1 and Na+/K+ ATPase, CD200, and HLA expression were compared among heterogeneous SPs. Flow cytometry analysis identified the effector cell expressing CD166+CD105-CD44-∼+/-CD26-CD24-, but CD200-, and the presence of other SPs with CD166+ CD105-CD44+++ (CD26 and CD24, either + or -) was confirmed. PCR array revealed three distinct ECM expression profiles. Some SPs expressed ZO-1 and Na+/K+ ATPase at comparable levels with effector cells, while only one SP expressed CD200, but not on effector cells. Human leukocyte antigen expression was most reduced in the effector SP. The proportion of effector cells (E-ratio) inversely paralleled donor age and decreased during prolonged culture passages. The presence of Rho-associated protein kinase (ROCK) inhibitor increased the E-ratio in cHCECs. The average area of effector cells was approximately 200∼220 μm2, and the density of cHCECs exceeded 2500 cells/mm2. A specified cultured effector cell population sharing the surface phenotypes with mature HCECs in corneal tissues may serve as an alternative to donor corneas for the treatment of corneal endothelial dysfunction.

  7. A biocompatible micro cell culture chamber for culturing and on-line monitoring of Eukaryotic cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael

    2006-01-01

    Visualisering af cellulære processer over længere tidsperioder har været besværliggjort af cellernes krav til varme, fugtighed og et fysiologisk pH balanceret medie. Fremskridt indenfor mikro teknologi har muliggjort fabrikation af miniaturiserede celle kultur anordninger der er i stand til...... at holde celler i live over længere tidsperioder I det foreliggende arbejde præsenteres et nyt perfusions baseret mikro celle dyrknings kultur kammer med integreret termisk overvågning og regulering. Kammeret opretholdt både dyrkning og on-line overvågning af både kræft celler såvel som stam celler over...... at dyrknings betingelserne i kammeret var sammenlignelige med dem i konventionelle celle kultur dyrknings flaske, hvis lys intensiteten på mikroskopet og omgivelserne blev minimeret mest muligt. Overflade modificeringer af den strukturelle fotoresist SU-8, der ofte bliver brugt til fabrikation af mikro kanaler...

  8. Cell and Molecular Biology of Ataxia Telangiectasia Heterozygous Human Mammary Epithelial Cells Irradiated in Culture

    Science.gov (United States)

    Richmond, Robert C.

    2001-01-01

    Autologous isolates of cell types from obligate heterozygotes with the autosomal disorder ataxia-telangiectasia (A-T)were used to begin a tissue culture model for assessing pathways of radiation-induced cancer formation in this target tissue. This was done by establishing cultures of stromal fibroblasts and long-term growth human mammary epithelial cells (HMEC) in standard 2-dimensional tissue culture in order to establish expression of markers detailing early steps of carcinogenesis. The presumptive breast cancer susceptibility of A-T heterozygotes as a sequel to damage caused by ionizing radiation provided reason to study expression of markers in irradiated HMEC. Findings from our study with HMEC have included determination of differences in specific protein expression amongst growth phase (e.g., log vs stationary) and growth progression (e.g., pass 7 vs pass 9), as well as differences in morphologic markers within populations of irradiated HMEC (e.g., development of multinucleated cells).

  9. ( Linum usitatissimum L. cv. Modran cell suspension culture

    Directory of Open Access Journals (Sweden)

    Aleksandra Seta-Koselska

    2018-01-01

    Full Text Available Flax ( Linum usitatissimum L. is an ancient crop that is widely cultivated as a source of oil, fiber, and bioactive compounds. Flax fiber is traditionally used in textile industry, linseed oil is processed for industrial oils, paints, varnishes and bio-petroleum. Flaxseeds are also rich in α-linolenic acid and phytochemicals such as lignans. In addition to the commercial aspects, this species has been used widely and readily in biotechnological, developmental, and plant-pathogen interaction studies. Differences in the levels of endogenous hormones in various cultivars of flax significantly affected the intensity of callogenesis and determined the type and concentration of growth regulators necessary for callus production. The aim of our investigation was to optimize the culture conditions for callus formation and cell proliferation in liquid medium of the Polish cultivar of fiber flax – Modran. In the first step, 4 combinations of phytohormones in the medium were tested to obtain established callus tissue suitable for initiation of suspension culture. Next, we investigated the effect of chosen plant growth regulators on cell divisions, fresh and dry weight, and dispersal of callus cells in liquid medium. Fast growing and friable callus was obtained in a modified MS medium supplemented with 0.5 mg/l BAP and 0.1 mg/l NAA. We determined that for the initiation of cell suspension supplementation with 0.5 mg/l BAP and 0.5 mg/l NAA is optimal. The results obtained indicated that high concentration of cytokinin (BAP in liquid medium limited cell proliferation and decreased biomass formation.

  10. Pros and cons of fish skin cells in culture: long-term full skin and short-term scale cell culture from rainbow trout, Oncorhynchus mykiss.

    Science.gov (United States)

    Rakers, Sebastian; Klinger, Matthias; Kruse, Charli; Gebert, Marina

    2011-12-01

    Here, we report the establishment of a permanent skin cell culture from rainbow trout (Oncorhynchus mykiss). The cells of the fish skin cell culture could be propagated over 60 passages so far. Furthermore, we show for the first time that it is possible to integrate freshly harvested rainbow trout scales into this new fish skin cell culture. We further demonstrated that epithelial cells derived from the scales survived in the artificial micro-environment of surrounding fibroblast-like cells. Also, antibody staining indicated that both cell types proliferated and started to build connections with the other cell type. It seems that it is possible to generate an 'artificial skin' with two different cell types. This could lead to the development of a three-dimensional test system, which might be a better in vitro representative of fish skin in vivo than individual skin cell lines. Copyright © 2011 Elsevier GmbH. All rights reserved.

  11. Cell Monitoring and Manipulation Systems (CMMSs based on Glass Cell-Culture Chips (GC3s

    Directory of Open Access Journals (Sweden)

    Sebastian M. Buehler

    2016-06-01

    Full Text Available We developed different types of glass cell-culture chips (GC3s for culturing cells for microscopic observation in open media-containing troughs or in microfluidic structures. Platinum sensor and manipulation structures were used to monitor physiological parameters and to allocate and permeabilize cells. Electro-thermal micro pumps distributed chemical compounds in the microfluidic systems. The integrated temperature sensors showed a linear, Pt1000-like behavior. Cell adhesion and proliferation were monitored using interdigitated electrode structures (IDESs. The cell-doubling times of primary murine embryonic neuronal cells (PNCs were determined based on the IDES capacitance-peak shifts. The electrical activity of PNC networks was detected using multi-electrode arrays (MEAs. During seeding, the cells were dielectrophoretically allocated to individual MEAs to improve network structures. MEA pads with diameters of 15, 20, 25, and 35 µm were tested. After 3 weeks, the magnitudes of the determined action potentials were highest for pads of 25 µm in diameter and did not differ when the inter-pad distances were 100 or 170 µm. Using 25-µm diameter circular oxygen electrodes, the signal currents in the cell-culture media were found to range from approximately −0.08 nA (0% O2 to −2.35 nA (21% O2. It was observed that 60-nm thick silicon nitride-sensor layers were stable potentiometric pH sensors under cell-culture conditions for periods of days. Their sensitivity between pH 5 and 9 was as high as 45 mV per pH step. We concluded that sensorized GC3s are potential animal replacement systems for purposes such as toxicity pre-screening. For example, the effect of mefloquine, a medication used to treat malaria, on the electrical activity of neuronal cells was determined in this study using a GC3 system.

  12. Serum-free media formulations are cell line-specific and require optimization for microcarrier culture.

    Science.gov (United States)

    Tan, Kah Yong; Teo, Kim Leng; Lim, Jessica F Y; Chen, Allen K L; Choolani, Mahesh; Reuveny, Shaul; Chan, Jerry; Oh, Steve Kw

    2015-08-01

    Mesenchymal stromal cells (MSCs) are being investigated as potential cell therapies for many different indications. Current methods of production rely on traditional monolayer culture on tissue-culture plastic, usually with the use of serum-supplemented growth media. However, the monolayer culturing system has scale-up limitations and may not meet the projected hundreds of billions to trillions batches of cells needed for therapy. Furthermore, serum-free medium offers several advantages over serum-supplemented medium, which may have supply and contaminant issues, leading to many serum-free medium formulations being developed. We cultured seven MSC lines in six different serum-free media and compared their growth between monolayer and microcarrier culture. We show that (i) expansion levels of MSCs in serum-free monolayer cultures may not correlate with expansion in serum-containing media; (ii) optimal culture conditions (serum-free media for monolayer or microcarrier culture) differ for each cell line; (iii) growth in static microcarrier culture does not correlate with growth in stirred spinner culture; (iv) and that early cell attachment and spreading onto microcarriers does not necessarily predict efficiency of cell expansion in agitated microcarrier culture. Current serum-free media developed for monolayer cultures of MSCs may not support MSC proliferation in microcarrier cultures. Further optimization in medium composition will be required for microcarrier suspension culture for each cell line. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  13. Further characterization of the adhesive-tumor-cell culture system for measuring the radiosensitivity of human tumor primary cultures

    International Nuclear Information System (INIS)

    Brock, W.A.; Bock, S.P.; Williams, M.; Baker, F.L.

    1987-01-01

    This study extends the use of the adhesive-tumor-cell culture system to include: over 100 sensitivity measurements at 2.0 Gy; tumorgenicity determinations in nude mice; and flow cytometry of the cells grown in the system. The malignant nature of the growing cells was proved by injecting cells into nude mice. Tumors resulted in 60% of the cases and the histology of each xenograft was similar to that of the human tumor. Flow cytometry was used to obtain DNA histograms of the original cell suspension and of cultures during the two week culture period in order to obtain quantitative information about the growth of aneuploid versus diploid populations. The results thus far demonstrate that 95% of aneuploid populations yield aneuploid growth; of the first 20 cases studied, only one suspension with an aneuploid peak resulted in diploid growth. Of further interest was the observation that it is not unusual for a minor aneuploid population to become the predominate growth fraction after two weeks in culture. These results demonstrate that the adhesive-tumor-cell culture system supports the growth of malignant cells, that multiple cell populations exist in cell suspensions derived from solid tumors, and that differences exist between the radiosensitivity of cells at 2.0 Gy in different histology types

  14. Radiosensitivity and TP 53, EGFR amplification and LOH10 analysis of primary glioma cell cultures

    NARCIS (Netherlands)

    Gerlach, Bärbel; Harder, Anna H.; Hulsebos, Theo J. M.; Leenstra, Sieger; Slotman, Berend J.; Vandertop, W. Peter; Hartmann, Karl-Axel; Sminia, Peter

    2002-01-01

    Aim: Determination of in-vitro radiosensitivity and genetic alterations of cell cultures derived from human glioma biopsy tissue and established glioma cell lines. Material and Methods: Fresh brain tumor specimens of six patients were processed to early passage cell cultures. In addition the cell

  15. Fibroblasts Cultured on Nanowires Exhibit Low Motility, Impaired Cell Division, and DNA Damage

    DEFF Research Database (Denmark)

    Persson, H.; Købler, Carsten; Mølhave, Kristian

    2013-01-01

    Mouse fibroblasts cultured on 7-μm-long vertical nanowires are reported on page 4006 by C. N. Prinz and co-workers. Culturing cells on this kind of substrate interferes greatly with cell function, causing the cells to develop into widely different morphologies. The cells' division is impaired...

  16. [Mesenchymal stem cells: definitions, culture and potential applications].

    Science.gov (United States)

    Ceron, Willy; Lozada-Requena, Iván; Ventocilla, Kiomi; Jara, Sandra; Pinto, Milagros; Cabello, Marco; Aguilar, José L

    2016-01-01

    In recent years, mesenchymal stem cells (MSC) have become very important due to their high plasticity and their ability to release paracrine factors able to interact with various cell types, tissues and organs. The use of MSC in regenerative medicine became of vital importance, since they do not express histocompatibility MHC molecules class II nor costimulant molecules, and low expression of MHC class I, will not be rejected by individuals of same species, they could be used in an autologous, and eventually, allogeneic manner. However, it is important to scientifically demonstrate many properties, including immunomodulatory ones. Having several sources of obtaining, it should be standardized the best one to ensure the purity and quality of these cells. Finally, it is important when working with these cells, that characteristics of cell culture, immunophenotyping and differentiation capacity are fully demonstrated. MSC have been applied in several clinical uses. Among them, their ability to improve, and even heal chronic ulcers, as diabetic, has attracted attention for its potential therapeutic impact.

  17. Hormonal regulation of Na -K -ATPase in cultured epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, J.P.; Jones, D.; Wiesmann, W.P.

    1986-08-01

    Aldosterone and insulin stimulate Na transport through mechanisms involving protein synthesis. Na -K -ATPase has been implicated in the action of both hormones. The authors examined the effect of aldosterone and insulin on Na -K -ATPase in epithelial cells in culture derived from toad urinary bladder (TB6C) and toad kidney (A6). Aldosterone, but not insulin, increases short-circuit current (I/sub sc/) in TB6C cells. Aldosterone increases Na -K -(TSP)ATPase activity after 18 h of incubation, but no effect can be seen at 3 and 6 h. Amiloride, which inhibits aldosterone-induced increases in I/sub sc/, has no effect on either basal or aldosterone stimulated enzyme activity. Both aldosterone and insulin increase I/sub sc/ in A6 cells and when added together are synergistic. Aldosterone stimulates enzyme activity in A6 cells, but insulin alone has no effect. However, aldosterone and insulin together stimulate enzyme activity more than aldosterone alone. It appears that stimulation of Na -K -ATPase activity is involved in aldosterone action in both cell lines but does not appear to be due to increased Na entry, since enhanced enzyme activity is not inhibited by amiloride. In contrast, insulin alone has no direct effect on Na -K -ATPase, although the increased enzyme activity following both agents in combination may explain their synergism on I/sub sc/.

  18. Cell-cycle research with synchronous cultures: an evaluation

    Science.gov (United States)

    Helmstetter, C. E.; Thornton, M.; Grover, N. B.

    2001-01-01

    The baby-machine system, which produces new-born Escherichia coli cells from cultures immobilized on a membrane, was developed many years ago in an attempt to attain optimal synchrony with minimal disturbance of steady-state growth. In the present article, we put forward a model to describe the behaviour of cells produced by this method, and provide quantitative evaluation of the parameters involved, at each of four different growth rates. Considering the high level of selection achievable with this technique and the natural dispersion in interdivision times, we believe that the output of the baby machine is probably close to optimal in terms of both quality and persistence of synchrony. We show that considerable information on events in the cell cycle can be obtained from populations with age distributions very much broader than those achieved with the baby machine and differing only modestly from steady state. The data presented here, together with the long and fruitful history of findings employing the baby-machine technique, suggest that minimisation of stress on cells is the single most important factor for successful cell-cycle analysis.

  19. UP-REGULATION OF ANTITHROMBOTIC ECTONUCLEOTIDASES BY ASPIRIN IN HUMAN ENDOTHELIAL-CELLS IN-VITRO

    NARCIS (Netherlands)

    CHEUNG, PK; VISSER, J; BAKKER, WW

    1994-01-01

    Ecto ATP-diphosphohydrolase (apyrase) activity of human endothelial cells following aspirin treatment has been studied in-vitro. It was shown by HPLC analysis of supernatant samples that pre-incubation of the cultures with aspirin resulted in a significantly increased turnover of supplemented ATP

  20. Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells in irradiated bone marrow cell culture in vitro

    International Nuclear Information System (INIS)

    Fujitake, Hideki; Okamoto, Yuruko; Okubo, Hiroshi; Miyanomae, Takeshi; Kumagai, Keiko; Mori, K.J.

    1981-01-01

    Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells after irradiation were studied in the long-term culture of mouse bone marrow cells in vitro. No difference was observed in the survival of the stem cells among cultures in which 0 - 10 7 cells were re-inoculated on the adherent cell colonies in the culture flask. Stem cells showed a significant proliferation within 1 week and the number of the stem cells exceeded the control in 3 weeks after irradiation in the cultures with less than 10 6 re-inoculated cells per flask. In contrast, there was a considerable delay in the onset of stem cell proliferation after irradiation in the culture with 10 7 cells per flask. Based on these results, a possibility that a stimulator of stem cell proliferation, released from irradiated stromal cells, is cancelled by an inhibitory factor produced by irradiated or unirradiated haemopoietic cells is postulated. (author)

  1. Micromass co-culture of human articular chondrocytes and human bone marrow mesenchymal stem cells to investigate stable neocartilage tissue formation in vitro

    Directory of Open Access Journals (Sweden)

    S Giovannini

    2010-10-01

    Full Text Available Cell therapies for articular cartilage defects rely on expanded chondrocytes. Mesenchymal stem cells (MSC represent an alternative cell source should their hypertrophic differentiation pathway be prevented. Possible cellular instruction between human articular chondrocytes (HAC and human bone marrow MSC was investigated in micromass pellets. HAC and MSC were mixed in different percentages or incubated individually in pellets for 3 or 6 weeks with and without TGF-beta1 and dexamethasone (±T±D as chondrogenic factors. Collagen II, collagen X and S100 protein expression were assessed using immunohistochemistry. Proteoglycan synthesis was evaluated applying the Bern score and quantified using dimethylmethylene blue dye binding assay. Alkaline phosphatase activity (ALP was detected on cryosections and soluble ALP measured in pellet supernatants. HAC alone generated hyaline-like discs, while MSC formed spheroid pellets in ±T±D. Co-cultured pellets changed from disc to spheroid shape with decreasing number of HAC, and displayed random cell distribution. In -T-D, HAC expressed S100, produced GAG and collagen II, and formed lacunae, while MSC did not produce any cartilage-specific proteins. Based on GAG, collagen type II and S100 expression chondrogenic differentiation occurred in -T-D MSC co-cultures. However, quantitative experimental GAG and DNA values did not differ from predicted values, suggesting only HAC contribution to GAG production. MSC produced cartilage-specific matrix only in +T+D but underwent hypertrophy in all pellet cultures. In summary, influence of HAC on MSC was restricted to early signs of neochondrogenesis. However, MSC did not contribute to the proteoglycan deposition, and HAC could not prevent hypertrophy of MSC induced by chondrogenic stimuli.

  2. Cell-Culture Reactor Having a Porous Organic Polymer Membrane

    Science.gov (United States)

    Koontz, Steven L. (Inventor)

    2000-01-01

    A method for making a biocompatible polymer article using a uniform atomic oxygen treatment is disclosed. The substrate may be subsequently optionally grated with a compatibilizing compound. Compatibilizing compounds may include proteins, phosphory1choline groups, platelet adhesion preventing polymers, albumin adhesion promoters, and the like. The compatibilized substrate may also have a living cell layer adhered thereto. The atomic oxygen is preferably produced by a flowing afterglow microwave discharge, wherein the substrate resides in a sidearm out of the plasma. Also, methods for culturing cells for various purposes using the various membranes are disclosed as well. Also disclosed are porous organic polymers having a distributed pore chemistry (DPC) comprising hydrophilic and hydrophobic regions, and a method for making the DPC by exposing the polymer to atomic oxygen wherein the rate of hydrophilization is greater than the rate of mass loss.

  3. Efficient infectious cell culture systems of the hepatitis C virus (HCV) prototype strains HCV-1 and H77.

    Science.gov (United States)

    Li, Yi-Ping; Ramirez, Santseharay; Mikkelsen, Lotte; Bukh, Jens

    2015-01-01

    The first discovered and sequenced hepatitis C virus (HCV) genome and the first in vivo infectious HCV clones originated from the HCV prototype strains HCV-1 and H77, respectively, both widely used in research of this important human pathogen. In the present study, we developed efficient infectious cell culture systems for these genotype 1a strains by using the HCV-1/SF9_A and H77C in vivo infectious clones. We initially adapted a genome with the HCV-1 5'UTR-NS5A (where UTR stands for untranslated region) and the JFH1 NS5B-3'UTR (5-5A recombinant), including the genotype 2a-derived mutations F1464L/A1672S/D2979G (LSG), to grow efficiently in Huh7.5 cells, thus identifying the E2 mutation S399F. The combination of LSG/S399F and reported TNcc(1a)-adaptive mutations A1226G/Q1773H/N1927T/Y2981F/F2994S promoted adaptation of the full-length HCV-1 clone. An HCV-1 recombinant with 17 mutations (HCV1cc) replicated efficiently in Huh7.5 cells and produced supernatant infectivity titers of 10(4.0) focus-forming units (FFU)/ml. Eight of these mutations were identified from passaged HCV-1 viruses, and the A970T/I1312V/C2419R/A2919T mutations were essential for infectious particle production. Using CD81-deficient Huh7 cells, we further demonstrated the importance of A970T/I1312V/A2919T or A970T/C2419R/A2919T for virus assembly and that the I1312V/C2419R combination played a major role in virus release. Using a similar approach, we found that NS5B mutation F2994R, identified here from culture-adapted full-length TN viruses and a common NS3 helicase mutation (S1368P) derived from viable H77C and HCV-1 5-5A recombinants, initiated replication and culture adaptation of H77C containing LSG and TNcc(1a)-adaptive mutations. An H77C recombinant harboring 19 mutations (H77Ccc) replicated and spread efficiently after transfection and subsequent infection of naive Huh7.5 cells, reaching titers of 10(3.5) and 10(4.4) FFU/ml, respectively. Hepatitis C virus (HCV) was discovered in 1989 with

  4. Metabolite profiling of microfluidic cell culture conditions for droplet based screening

    DEFF Research Database (Denmark)

    Björk, Sara M.; Sjoström, Staffan L.; Svahn, Helene Andersson

    2015-01-01

    We investigate the impact of droplet culture conditions on cell metabolic state by determining key metabolite concentrations in S. cerevisiae cultures in different microfluidic droplet culture formats. Control of culture conditions is critical for single cell/clone screening in droplets......, such as directed evolution of yeast, as cell metabolic state directly affects production yields from cell factories. Here, we analyze glucose, pyruvate, ethanol, and glycerol, central metabolites in yeast glucose dissimilation to establish culture formats for screening of respiring as well as fermenting yeast...... limited cultures, whereas the metabolite profiles of cells cultured in the alternative wide tube droplet incubation format resemble those from aerobic culture. Furthermore, we demonstrate retained droplet stability and size in the new better oxygenated droplet incubation format....

  5. Degradation of high density lipoprotein in cultured rat luteal cells

    International Nuclear Information System (INIS)

    Rajan, V.P.; Menon, K.M.J.

    1986-01-01

    In rat ovary luteal cells, degradation of high density lipoprotein (HDL) to tricholoracetic acid (TCA)-soluble products accounts for only a fraction of the HDL-derived cholesterol used for steroidogenesis. In this study the authors have investigated the fate of 125 I]HDL bound to cultured luteal cells using pulse-chase technique. Luteal cell cultures were pulse labeled with [ 125 I]HDL 3 and reincubated in the absence of HDL. By 24 h about 50% of the initallay bound radioactivity was released into the medium, of which 60-65% could be precipitated with 10% TCA. Gel filtration of the chase incubation medium on 10% agarose showed that the amount of TCA-soluble radioactivity was nearly completely accounted for by a sharp peak in the low molecular weight region which was identified as 96% monoiodotyrosine by paper chromatography. The TCA-precipitable radioactivity was nearly completely accounted for by a sharp peak in the low molecular weight region which was identified as 96% monoiodotyrosine by paper chromatography. The TCA-precipitable radioactivity eluted over a wide range of molecular weights (15,000-80,000), and there was very little intact HDL present. Electrophoresis of the chase medium showed that component of the TCA-precipitable portion had mobility similar to apo AI. Lysosomal inhibitors of receptor-mediated endocytosis had no effect on the composition or quantity of radioactivity released during chase incubation. The results show that HDL 3 binding to luteal cells is followed by complete degradation of the