WorldWideScience

Sample records for cell culture supernatants

  1. Cell culture supernatants for detection perforin ELISA

    African Journals Online (AJOL)

    Najwa

    2014-02-19

    Feb 19, 2014 ... (2001). The lymphocytes were isolated from the peripheral heap- rinized whole blood as follows: 3 ml of blood was centrifuged at. 1000 rpm for 15 min, buffy coat was collected in a 10 ml centrifuge tubes and diluted with 5 ml RPMI 1640 (cell suspension), 5 ml of the diluted cell suspension was layered on 3 ...

  2. Use of spray-dried zirconia microspheres in the separation of immunoglobulins from cell culture supernatant.

    Science.gov (United States)

    Subramanian, A; Carr, P W; McNeff, C V

    2000-08-18

    A method suitable for the isolation of monoclonal antibodies (MAbs) on novel zirconia microspheres (20-30 microm) is described. Zirconia microspheres were generated by spray drying colloidal zirconia. Spray-dried zirconia microspheres were further classified and characterized by X-ray diffraction, BET porosimetry and scanning electron microscopy. Spray-dried zirconia microspheres were modified with ethylenediamine-N,N'-tetra(methylenephosphonic) acid (EDTPA) to create a cation-exchange chromatographic support. The chromatographic behavior of a semi-preparative column packed with EDTPA-modified zirconia microspheres was evaluated and implications for scale-up are provided. EDTPA-modified zirconia microspheres were further used to purify MAbs from cell culture supernatant. Analysis by enzyme linked immunosorbent assay and gel electrophoresis demonstrate that MAbs can be recovered from a cell culture supernatant at high yield (92-98%) and high purity (>95%) in a single chromatographic step.

  3. Isolation and characterization of exosomes from cell culture supernatants and biological fluids

    OpenAIRE

    Théry, Clotilde; Amigorena, Sebastian; Raposo, Graça; Clayton, Aled

    2006-01-01

    Exosomes are small membrane vesicles found in cell culture supernatants and in different biological fluids. Exosomes form in a particular population of endosomes, called multivesicular bodies (MVBs), by inward budding into the lumen of the compartment. Upon fusion of MVBs with the plasma membrane, these internal vesicles are secreted. Exosomes possess a defined set of membrane and cytosolic proteins. The physiological function of exosomes is still a matter of debate, but increasing results in...

  4. Culture Supernatants of Lactobacillus gasseri and L. crispatus Inhibit Candida albicans Biofilm Formation and Adhesion to HeLa Cells.

    Science.gov (United States)

    Matsuda, Yuko; Cho, Otomi; Sugita, Takashi; Ogishima, Daiki; Takeda, Satoru

    2018-03-30

    Vulvovaginal candidiasis (VVC) is a common superficial infection of the vaginal mucous membranes caused by the fungus Candida albicans. The aim of this study was to assess the mechanisms underlying the inhibitory effects of the culture supernatants of Lactobacillus gasseri and L. crispatus, the predominant microbiota in Asian healthy women, on C. albicans biofilm formation. The inhibition of C. albicans adhesion to HeLa cells by Lactobacillus culture supernatant was also investigated. Candida albicans biofilm was formed on polystyrene flat-bottomed 96-well plates, and the inhibitory effects on the initial colonization and maturation phases were determined using the XTT reduction assay. The expression levels of biofilm formation-associated genes (HWP1, ECE1, ALS3, BCR1, EFG1, TEC1, and CPH1) were determined by reverse transcription quantitative polymerase chain reaction. The inhibition of C. albicans adhesion to HeLa cells by Lactobacillus culture supernatant was evaluated by enumerating viable C. albicans cells. The culture supernatants of both Lactobacillus species inhibited the initial colonization and maturation of C. albicans biofilm. The expression levels of all biofilm formation-related genes were downregulated in the presence of Lactobacillus culture supernatant. The culture supernatant also inhibited C. albicans adhesion to HeLa cells. The culture supernatants of L. gasseri and L. crispatus inhibited C. albicans biofilm formation by downregulating biofilm formation-related genes and C. albicans adhesion to HeLa cells. These findings support the notion that Lactobacillus metabolites may be useful alternatives to antifungal drugs for the management of VVC.

  5. Comparison of EBV DNA viral load in whole blood, plasma, B-cells and B-cell culture supernatant.

    Science.gov (United States)

    Ouedraogo, David Eric; Bollore, Karine; Viljoen, Johannes; Foulongne, Vincent; Reynes, Jacques; Cartron, Guillaume; Vendrell, Jean-Pierre; Van de Perre, Philippe; Tuaillon, Edouard

    2014-05-01

    Epstein-Barr virus (EBV) genome quantitation in whole blood is used widely for therapeutic monitoring of EBV-associated disorders in immunosuppressed individuals and in patients with EBV-associated lymphoma. However, the most appropriate biological material to be used for EBV DNA quantitation remains a subject of debate. This study compare the detection rate and levels of EBV DNA from whole blood, plasma, enriched B-cells, and B-cell short-term culture supernatant using quantitative real-time PCR. Samples were collected from 33 subjects with either HIV infection or B-cell lymphoma. Overall, EBV DNA was detected in 100% of enriched B-cell samples, in 82% of B-cell culture supernatants, in 57% of plasma, and 42% of whole blood samples. A significant correlation for EBV viral load was found between enriched B-cell and B-cell culture supernatant material (ρ = 0.92; P < 0.0001), but no significant correlation existed between EBV DNA levels in whole blood and enriched B-cells (ρ = -0.02; P = 0.89), whole blood and plasma (ρ = 0.24; P = 0.24), or enriched B-cells and plasma (ρ = 0.08; P = 0.77). Testing of enriched B-cells appeared to be the most sensitive method for detection of EBV DNA as well as for exploration of the cellular reservoir. Quantitation of EBV DNA in plasma and B-cell culture supernatant may be of interest to assess EBV reactivation dynamics and response to treatment as well as to decipher EBV host-pathogen interactions in various clinical scenarios. © 2013 Wiley Periodicals, Inc.

  6. Optimized exosome isolation protocol for cell culture supernatant and human plasma

    Directory of Open Access Journals (Sweden)

    Richard J. Lobb

    2015-07-01

    Full Text Available Extracellular vesicles represent a rich source of novel biomarkers in the diagnosis and prognosis of disease. However, there is currently limited information elucidating the most efficient methods for obtaining high yields of pure exosomes, a subset of extracellular vesicles, from cell culture supernatant and complex biological fluids such as plasma. To this end, we comprehensively characterize a variety of exosome isolation protocols for their efficiency, yield and purity of isolated exosomes. Repeated ultracentrifugation steps can reduce the quality of exosome preparations leading to lower exosome yield. We show that concentration of cell culture conditioned media using ultrafiltration devices results in increased vesicle isolation when compared to traditional ultracentrifugation protocols. However, our data on using conditioned media isolated from the Non-Small-Cell Lung Cancer (NSCLC SK-MES-1 cell line demonstrates that the choice of concentrating device can greatly impact the yield of isolated exosomes. We find that centrifuge-based concentrating methods are more appropriate than pressure-driven concentrating devices and allow the rapid isolation of exosomes from both NSCLC cell culture conditioned media and complex biological fluids. In fact to date, no protocol detailing exosome isolation utilizing current commercial methods from both cells and patient samples has been described. Utilizing tunable resistive pulse sensing and protein analysis, we provide a comparative analysis of 4 exosome isolation techniques, indicating their efficacy and preparation purity. Our results demonstrate that current precipitation protocols for the isolation of exosomes from cell culture conditioned media and plasma provide the least pure preparations of exosomes, whereas size exclusion isolation is comparable to density gradient purification of exosomes. We have identified current shortcomings in common extracellular vesicle isolation methods and provide a

  7. Detecting pM concentrations of prostaglandins in cell culture supernatants by capillary SCX-LC-MS/MS

    DEFF Research Database (Denmark)

    Dahl, Sandra Rinne; Kleiveland, Charlotte Ramstad; Kassem, Moustapha

    2008-01-01

    /proteins contained in the matrix were removed by the SCX column. LODs in the range of 8-44 pg/mL (25-120 pM) cell culture supernatant were obtained. Excellent linearity (R(2) > 0.99) and satisfactory recoveries and within- and between-day precisions were obtained. Human mesenchymal stem cells (hMSCs) were stimulated...

  8. Fast and simple online sample preparation coupled with capillary LC-MS/MS for determination of prostaglandins in cell culture supernatants

    DEFF Research Database (Denmark)

    Rinne, Sandra; Ramstad Kleiveland, Charlotte; Kassem, Moustapha

    2007-01-01

    )) in cell culture supernatants was developed and validated. Pretreatment of the cell culture supernatants included dilution and filtration, and the analysis time including all sample preparation steps was less than 50 min per sample. Peptides/proteins contained in the matrix were removed by the SCX column...

  9. Detection of secreted antimicrobial peptides isolated from cell-free culture supernatant of Paenibacillus alvei AN5

    OpenAIRE

    Alkotaini, Bassam; Anuar, Nurina; Kadhum, Abdul Amir Hassan; Sani, Asmahani Azira Abdu

    2013-01-01

    An antimicrobial substance produced by the Paenibacillus alvei strain AN5 was detected in fermentation broth. Subsequently, cell-free culture supernatant (CFCS) was obtained by medium centrifugation and filtration, and its antimicrobial activity was tested. This showed a broad inhibitory spectrum against both Gram-positive and -negative bacterial strains. The CFCS was then purified and subjected to SDS-PAGE and infrared spectroscopy, which indicated the proteinaceous nature of the antimicrobi...

  10. Improving the performance of a biofuel cell cathode with laccase-containing culture supernatant from Pycnoporus sanguineus.

    Science.gov (United States)

    Fokina, Oleksandra; Eipper, Jens; Winandy, Lex; Kerzenmacher, Sven; Fischer, Reinhard

    2015-01-01

    Laccases are multicopper oxidoreductases that can be used in biofuel cells to improve cathode performance by cathodic oxygen reduction. Here we present a laccase from the ligninolytic white-rot fungus Pycnoporus sanguineus that, in contrast to the Trametes versicolor laccase, can be produced in the absence of inducers in a standard culture medium. After 7days of cultivation the activity of this laccase in culture supernatant reached 2.5U/ml, which is high enough for direct application of the supernatant in biofuel cells. The highest current density of 115.0±3.5μA/cm(2) at 400mV vs. SCE was obtained at pH 5 with a buckypaper cathode with a laccase-containing culture supernatant. The enzyme also showed electrocatalytic activity at pH 6 and 7. These results not only present a new cost-efficient laccase for improving cathode performance, but also show that new laccases with different catalytic properties can be suitable for biofuel cells. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. The reduction of l-cystine to l-cysteine in the supernatant of A549 cell culture causes imipenem inactivation.

    Science.gov (United States)

    Takemura, Hiromu; Terakubo, Shigemi; Okamura, Ninyo; Nakashima, Hideki

    2018-02-26

    In the course of measuring the intracellular antibacterial activity of antibiotics using a human alveolar epithelial cell line A549, we discovered that the antimicrobial activity of several carbapenems (CPs) decreased in the supernatant of the cells cultured with fetal calf serum (FCS)-free RPMI1640 medium (RPMI). Further investigation revealed A549 culture supernatant inhibited the antibacterial activity of CPs but did not inactivate other types of antibiotics. CE-TOFMS and LC-TOFMS metabolomics analysis of the supernatant revealed the presence of l-cysteine (Cys), which is not an original component in RPMI. Cys is known to hydrolyze and inactivate CPs in a time- and concentration-dependent manner. In this study, the inactivating effects of A549 culture supernatant on the imipenem (IPM) were examined. Antimicrobial activity of 100 μg/mL IPM decreased to 25% with two-fold dilution of A549 supernatant incubated for 3 h. l-Cystine (CS), the Cys oxide, and an original component in RPMI did not inactivate IPM. However, the inactivating effects of A549 supernatant on IPM corresponds with the Cys concentration and depends on the CS content of the culture medium. Addition of FCS to the culture medium decreased the Cys concentration and reduced inactivation of IPM in a dose-dependent manner. Our data suggest that IPM were inactivated by Cys reduced from CS, and this CS-to-Cys conversion must be considered when evaluating the antimicrobial activity of CPs in cell culture. Further studies are needed to understand if the same inactivation occurs around the cells in the human body. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. Detection of secreted antimicrobial peptides isolated from cell-free culture supernatant of Paenibacillus alvei AN5.

    Science.gov (United States)

    Alkotaini, Bassam; Anuar, Nurina; Kadhum, Abdul Amir Hassan; Sani, Asmahani Azira Abdu

    2013-06-01

    An antimicrobial substance produced by the Paenibacillus alvei strain AN5 was detected in fermentation broth. Subsequently, cell-free culture supernatant (CFCS) was obtained by medium centrifugation and filtration, and its antimicrobial activity was tested. This showed a broad inhibitory spectrum against both Gram-positive and -negative bacterial strains. The CFCS was then purified and subjected to SDS-PAGE and infrared spectroscopy, which indicated the proteinaceous nature of the antimicrobial compound. Some de novo sequencing using an automatic Q-TOF premier system determined the amino acid sequence of the purified antimicrobial peptide as Y-S-K-S-L-P-L-S-V-L-N-P (1,316 Da). The novel peptide was designated as peptide AN5-1. Its mode of action was bactericidal, inducing cell lysis in E. coli ATCC 29522 and S. aureus, and non-cell lysis in both S. marcescens and B. cereus ATCC 14579. Peptide AN5-1 displayed stability at a wide range of pH values (2-12) and remained active after exposure to high temperatures (100 °C). It also maintained its antimicrobial activity after incubation with chemicals such as SDS, urea and EDTA.

  13. [Effects of combined application of culture supernatant of human umbilical cord mesenchymal stem cells and ciprofloxacin onStaphylococcus aureusin vitro].

    Science.gov (United States)

    Zhou, B; Tu, H L; Ba, T; Wang, L F; Wang, S J; Nie, S Y

    2017-06-20

    Objective: To explore the effects of combined application of culture supernatant of human umbilical cord mesenchymal stem cells (hUCMSCs) and ciprofloxacin on Staphylococcus aureus (SA) in vitro. Methods: hUCMSCs were isolated from umbilical cord tissue of full-term healthy fetus after cesarean section and cultured. Cells in the third passage were used in the experiments after identification. SA strains isolated from wounds of burn patients in our burn wards were used in the experiments. Cells were divided into 0, 10, 100, and 1 000 ng/mL lipopolysaccharide (LPS) groups according to the random number table (the same dividing method below). Cells were cultured with culture medium of mesenchymal stem cells (MSCs) after being treated with medium containing the corresponding mass concentrations of LPS for 12 h. At post culture hour (PCH) 6, 12, and 24, 6 wells of culture supernatant of cells in each group were obtained to measure the content of LL-37 with enzyme-linked immunosorbent assay. Ninety blood agar plates were divided into ciprofloxacin control group (CC), ciprofloxacin+ supernatant group (CS), and ciprofloxacin+ supernatant+ LL-37 antibody group (CSL), with 30 blood agar plates in each group. Blood agar plates in group CC were coated with 1.5×10(8) colony forming unit (CFU)/mL bacteria solution prepared with normal saline. Blood agar plates in group CS were coated with 1.5×10(8) CFU/mL bacteria solution prepared with normal saline and culture supernatant of hUCMSCs (cultured by culture medium of MSCs, the same below) in double volume of normal saline. Blood agar plates in group CSL were coated with 1.5×10(8) CFU/mL bacteria solution prepared with normal saline, culture supernatant of hUCMSCs in double volume of normal saline, and 2.6 μL LL-37 antibody in the concentration of 2 μg/mL. At PCH 12, 24, and 48, 10 blood agar plates of each group were harvested to observe the distribution of SA colony on blood agar plate and to measure the diameter of

  14. Purification of monoclonal antibodies, IgG1, from cell culture supernatant by use of metal chelate convective interaction media monolithic columns.

    Science.gov (United States)

    Rajak, Poonam; Vijayalakshmi, M A; Jayaprakash, N S

    2012-12-01

    Monoclonal antibodies (MAbs) have diverse applications in diagnostics and therapeutics. The recent advancement in hybridoma technology for large-scale production of MAbs in bioreactors demands rapid and efficient purification methods. Conventional affinity purification systems have drawbacks of low flow rates and denaturation of antibodies owing to harsh elution conditions. Here, we attempted purification of MAbs by use of a high-throughput metal-chelate methacrylate monolithic system. Monolithic macroporous convective interaction media-iminodiacetate (CIM-IDA) disks immobilized with four different metal ions (Cu²⁺, Ni²⁺, Zn²⁺ and Co²⁺) were used and evaluated for purification of anti-human serum albumin IgG1 mouse MAbs from cell culture supernatant after precipitation with 50% ammonium sulfate. Elution with 10 mM imidazole in the equilibration buffer (25 mM MMA = MOPS (Morpholino propane sulfonic acid) + MES (Morpholino ethane sulfonic acid) + Acetate + 0.5 M NaCl, pH 7.4) resulted in a purification of 25.7 ± 2.9-fold and 32.5 ± 2.6-fold in experiments done using Zn²⁺ and Co²⁺ metal ions, respectively. The highest recovery of 85.4 ± 1.0% was obtained with a CIM-IDA-Zn(II) column. SDS-PAGE, ELISA and immuno-blot showed that the antibodies recovered were pure, with high antigen-binding efficiency. Thus, metal chelate CIM monoliths could be a potential alternative to conventional systems for fast and efficient purification of MAbs from the complex cell culture supernatant. Copyright © 2012 John Wiley & Sons, Ltd.

  15. The effects of three types of macrophages culture supernatant on CFU-GM in irradiated mice

    International Nuclear Information System (INIS)

    Quan Hongxun; Fu Li; Zhao Fengchen; Han Fen

    2008-01-01

    Objective: To study the effects of peritional macrophyge(PM), alveolar macrophage (AM), and Kupffer cell (KC) on colony forming unite granulacyte/macrophage (CFU -GM) in irradiated mice. Methods: Using techniques of hemopoietic progenitors in vitro, the authors studied the effects of three types of macrophages culture supernatant on CFU - GM. Results: It is shown that three types of macrophages culture supernatant may stimulate proliferation and differentiation of CFU-GM in irradiated mice, and KC is the best one in comparison to others. Conclusion: three types of macrophages culture supernatant may protect CFU-GM irradiated mice with KC being the best method. (authors)

  16. Human T-cell leukemia virus type-I (HTLV-I) tax is not the only one factor to enhance human immunodeficiency virus type-I (HIV-1) infection in culture-supernatants.

    Science.gov (United States)

    Tempaku, A; Maeda, Y; Song, W; Harada, S

    2001-01-01

    It is hypothesized that supernatants from cell cultures contain several factors to modify the human immunodeficiency virus type-1 (HIV-1) infection. Single round infection with pseudotyped viruses with envelope from HIV-1, amphotropic murine leukemia virus (A-MLV) and vesicular stomatitis virus G-protein (VSV-G) carrying luciferase reporter gene detected that not only human T-cell leukemia/lymphoma virus type-I (HTLV-1) transformed cells but also HTLV-I-unrelated T-cells and BJA-B cells released factors enhancing the infection with all pseudotyped viruses in their culture-supernatants. No supernatants upregulated the level of transcription from transfected DNA probe. suggesting that the action of supernatants is different from that of tumor necrosis factor (TNF) and Tax of HTLV-I. These results indicated that factors not always related to HTLV-I were ubiquitously produced and promoted viral infections, probably due to non-specific enhancement of early phase of the infection.

  17. The culture of Chlorella vulgaris in a recycled supernatant: effects on biomass production and medium quality.

    Science.gov (United States)

    Hadj-Romdhane, F; Zheng, X; Jaouen, P; Pruvost, J; Grizeau, D; Croué, J P; Bourseau, P

    2013-03-01

    Reusing supernatant of microalgae culture medium can have inhibitory or toxic effects on the biomass production because of the release of organic metabolites by cells in the culture medium during their growth. This work investigated the impact of Chlorella vulgaris medium recycling on culture productivity, cells quality and accumulation of excreted metabolites in the culture medium. No significant impact on the C. vulgaris growth was observed after 63days of recycling, the productivity remained stable at around 0.55kgm(-3)day(-1). Organic matters accumulated in supernatant were identified as biopolymers (BP) poor in nitrogen and with a size above 40kDa (probably polysaccharides), and small organic molecules (SOM) richer in nitrogen with a molecular size ranging from 1 to 3kDa. The concentration of biopolymers in the supernatant increased till to a maximum and then decreased, possibly consumed by bacteria, whereas small organic compounds accumulated in the medium. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. The culture of Chlorella vulgaris in a recycled supernatant: Effects on biomass production and medium quality

    KAUST Repository

    Hadj-Romdhane, F.

    2013-03-01

    Reusing supernatant of microalgae culture medium can have inhibitory or toxic effects on the biomass production because of the release of organic metabolites by cells in the culture medium during their growth. This work investigated the impact of Chlorella vulgaris medium recycling on culture productivity, cells quality and accumulation of excreted metabolites in the culture medium. No significant impact on the C. vulgaris growth was observed after 63days of recycling, the productivity remained stable at around 0.55kgm-3day-1. Organic matters accumulated in supernatant were identified as biopolymers (BP) poor in nitrogen and with a size above 40kDa (probably polysaccharides), and small organic molecules (SOM) richer in nitrogen with a molecular size ranging from 1 to 3kDa. The concentration of biopolymers in the supernatant increased till to a maximum and then decreased, possibly consumed by bacteria, whereas small organic compounds accumulated in the medium. © 2013 Elsevier Ltd.

  19. Characterization of and human serologic response to proteins in Helicobacter pylori broth culture supernatants with vacuolizing cytotoxin activity.

    Science.gov (United States)

    Cover, T L; Dooley, C P; Blaser, M J

    1990-03-01

    Helicobacter pylori infection is strongly associated with histologic gastritis and peptic ulcer disease. Broth culture supernatants from a subset of H. pylori strains induce vacuolization in cultured cells, a phenomenon that has been attributed to cytotoxin activity. Concentrated culture supernatants from 15 of 28 (53.6%) H. pylori strains tested induced vacuolization in HeLa cells in titers ranging from 1:10 to 1:180. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining of supernatants from these 28 strains and 2 control strains demonstrated an 82-kilodalton (kDa) protein band in 3 of 16 supernatants with vacuolizing activity, but in none of 14 supernatants without vacuolizing activity. By immunoblotting with human sera, a 128-kDa band was recognized in all 16 supernatants with vacuolizing activity, compared with 9 of 14 (64%) supernatants without vacuolizing activity (P = 0.014). Serologic recognition of the 128-kDa band in H. pylori culture supernatants was more prevalent among persons infected with vacuolizing H. pylori strains than among persons infected with nonvacuolizing strains, but the difference was not statistically significant (80 versus 45%; P = 0.079); human serologic recognition of the 82-kDa band was less common. The 128-kDa band was recognized by 100% of 31 serum samples from H. pylori-infected patients with duodenal ulcer disease, compared with 60.8% of 74 serum samples from H. pylori-infected persons without peptic ulcer disease (P = 0.0001). These data indicate that antigenic 128- and 82-kDa proteins are present in H. pylori broth culture supernatants with vacuolizing activity and that serologic responses to the 128-kDa protein are more prevalent among H. pylori-infected persons with duodenal ulceration than among infected persons without peptic ulceration.

  20. Cell vacuolation induced by Haemophilus influenzae supernatants in HEp-2 cells

    Directory of Open Access Journals (Sweden)

    Maria del Rosario Espinoza-Mellado

    2013-12-01

    Full Text Available Haemophilus influenzae belongs to respiratory tract microbiota. We observed vacuoles formation in previous studies with H. influenzae culture supernatants, so in this work we characterised that cytotoxic effect. We observed an abundant production of acidic cytoplasmic vacuoles due to the presence of a “vacuolating factor” in H. influenzae supernatants which was characterised as thermolabile. Greatest vacuolating activity was observed when utilizing the fraction > 50 kDa. The presence of a large number of vacuoles in HEp-2 cells was verified by transmission electron microscopy and some vacuoles were identified with a double membrane and/or being surrounded by ribosomes. These results suggest similar behaviour to that of vacuolating effects described by autotransporter proteins an undescribed cytotoxic effect induced by H. influenzae .

  1. Tetracycline and Glutathione Inhibit Matrix Metalloproteinase Activity: An In Vitro Study Using Culture Supernatants of L929 and Dalton Lymphoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Gajanan Kendre

    2013-01-01

    Full Text Available Tetracycline and glutathione inhibited the protease activities of matrix metalloproteinase-2 and matrix metalloproteinase-9 expressed by mouse fibrosarcoma cells (L929 and Dalton lymphoma cells, respectively. The inhibitory activity of the tetracycline may be due to its ability to chelate metal ions such as calcium and zinc. Gelatin-zymography technique was used to demonstrate the inhibitory activity of both tetracycline and glutathione. The intensity of the bands corresponding to metalloproteinase activity in zymography gel was reduced in the presence of 50–100 μg/mL of tetracycline. The presence of 10–100 μg/mL of tetracycline in the medium increased the adherence of L929 cancer cells. These results clearly indicate the antimetastatic property of tetracycline. Reduced glutathione, a compound which is produced endogenously by the cells to maintain the redox status, was shown to inhibit the matrix metalloproteinase activity (in vitro. Therefore, it is assumed that decreased glutathione levels in synovial fluids or plasma might increase the activity of MMP. Reduced glutathione at 100 μg/mL inhibited the metalloproteinase activity in gelatin-zymographic gel. As both tetracycline and glutathione exhibited an inhibitory effect on matrix metalloproteinase activity, it was of great interest to check their clinical effects on various MMP associated pathological conditions such as cancer metastasis and arthritis. Here we report that tetracycline and reduced glutathione inhibited the activity of MMP2 completely and activity of MMP9 partly.

  2. Characterization of culture supernatant proteins from Brucella abortus and its protection effects against murine brucellosis.

    Science.gov (United States)

    Lee, Jin Ju; Lim, Jeong Ju; Kim, Dae Geun; Simborio, Hannah Leah; Kim, Dong Hyeok; Reyes, Alisha Wehdnesday Bernardo; Min, WonGi; Lee, Hu Jang; Kim, Dong Hee; Chang, Hong Hee; Kim, Suk

    2014-09-01

    In this study, we characterized the secreted proteins of Brucella abortus into the enriched media under the bacterial laboratory growth condition and investigated the pathogenic importance of culture supernatant (CS) proteins to B. abortus infection. CS proteins from stationary phase were concentrated and analyzed using 2D electrophoresis. In MALDI TOF/TOF analysis, more than 27 proteins including CuZn SOD, Dps, Tat, OMPs, Adh, LivF, Tuf, SucC, GroEL and DnaK were identified. Cytotoxic effects of CS proteins were found to increase in a dose-dependent manner in RAW 264.7 cells. Upon B. abortus challenge into phagocytes, however, CS proteins pre-treated cells exhibited lower bacterial uptake and intracellular replication compared to untreated cells. Immunization with CS proteins induced a strong humoral and cell mediated immune responses and exhibited significant higher degree of protection against virulence of B. abortus infection compared to mice immunized with Brucella broth protein (BBP). Taken together, these results indicate that B. abortus secreted a number of soluble immunogenic proteins under laboratory culture condition, which can promote antibody production resulted in enhancing host defense against to subsequently bacterial infection. Moreover, further analysis of CS proteins may help to understand the pathogenic mechanism of B. abortus infection and host-pathogen interaction. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Proteomic analysis of host cell protein dynamics in the supernatant of Fc-fusion protein-producing CHO DG44 and DUKX-B11 cell lines in batch and fed-batch cultures.

    Science.gov (United States)

    Park, Jin Hyoung; Jin, Jong Hwa; Ji, In Jung; An, Hyun Joo; Kim, Jong Won; Lee, Gyun Min

    2017-10-01

    Chinese hamster ovary (CHO) cells are the most widely used host cell lines for the commercial production of therapeutic proteins including Fc-fusion proteins. During the culture of recombinant CHO (rCHO) cells, host cell proteins (HCPs), secreted from viable cells and released from dead cells, accumulate extracellularly, potentially impairing product quality. In this study, the HCPs that accumulated extracellularly in batch and fed-batch cultures of Fc-fusion protein-producing rCHO cell lines (DG-Fc and DUKX-Fc) were identified and quantified using nanoflow liquid chromatography-tandem mass spectrometry (LC-MS/MS), followed by gene ontology and functional analysis. When the proteome database of Cricetulus griseus was used as a reference to identify the HCPs, more HCPs were identified for DG-Fc (1632 HCPs in batch culture and 1733 HCPs in fed-batch culture) than for DUKX-Fc (1114 HCPs in batch culture and 1002 HCPs in fed-batch culture). Clustering analysis of HCPs, which were classified into four clusters according to their concentration profiles during culture, showed that the concentration profiles of HCPs affecting the quality of Fc-fusion proteins correlated with changes in Fc-fusion protein quality. Taken together, the dataset of HCPs obtained in this study using the two different rCHO cell lines provides insights into the determination of appropriate target proteins to be removed during the culture and purification steps so as to ensure good Fc-fusion protein quality. Biotechnol. Bioeng. 2017;114: 2267-2278. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  4. Antifungal performance of extracellular chitinases and culture supernatants of Streptomyces galilaeus CFFSUR-B12 against Mycosphaerella fijiensis Morelet.

    Science.gov (United States)

    Castillo, Benjamín Moreno; Dunn, Michael F; Navarro, Karina Guillén; Meléndez, Francisco Holguín; Ortiz, Magdalena Hernández; Guevara, Sergio Encarnación; Palacios, Graciela Huerta

    2016-03-01

    The tropical and mycoparasite strain Streptomyces galilaeus CFFSUR-B12 was evaluated as an antagonist of Mycosphaerella fijiensis Morelet, causal agent of the Black Sigatoka Disease (BSD) of banana. On zymograms of CFFSUR-B12 culture supernatants, we detected four chitinases of approximately 32 kDa (Chi32), 20 kDa (Chi20), and two with masses well over 170 kDa (ChiU) that showed little migration during denaturing electrophoresis at different concentrations of polyacrylamide. The thymol-sulphuric acid assay showed that the ChiU were glycosylated chitinases. Moreover, matrix assisted laser desorption ionization time-of-flight MS analysis revealed that the ChiU are the same protein and identical to a family 18 chitinase from Streptomyces sp. S4 (gi|498328075). Chi32 was similar to an extracellular protein from Streptomyces albus J1074 (gi|478687481) and Chi20 was non-significantly similar to chitinases from five different strains of Streptomyces (P > 0.05). Subsequently, Chi32 and Chi20 were partially purified by anion exchange and hydrophobic interaction chromatography and tested against M. fijiensis. Chitinases failed to inhibit ascospore germination, but inhibited up to 35 and 62% of germ tube elongation and mycelial growth, respectively. We found that crude culture supernatant and living cells of S. galilaeus CFFSUR-B12 were the most effective in inhibiting M. fijiensis and are potential biocontrol agents of BSD.

  5. Effect of Culture Supernatant Derived from Trichophyton Rubrum Grown in the Nail Medium on the Innate Immunity-related Molecules of HaCaT

    Directory of Open Access Journals (Sweden)

    Xin-Zhu Huang

    2015-01-01

    Full Text Available Background: Trichophyton rubrum is superficial fungi characteristically confined to dead keratinized tissues. These observations suggest that the soluble components released by the fungus could influence the host immune response in a cell in contact-free manner. Therefore, this research aimed to analyze whether the culture supernatant derived from T. rubrum grown in the nail medium could elicit the immune response of keratinocyte effectively. Methods: The culture supernatants of two strains (T1a, T XHB were compared for the β-glucan concentrations and their capacity to impact the innate immunity of keratinocytes. The β-glucan concentrations in the supernatants were determined with the fungal G-test kit and protein concentrations with bicinchoninic acid protein quantitative method, then HaCaT was stimulated with different concentrations of culture supernatants by adopting morphological method to select a suitable dosage. Expressions of host defense genes were assessed by quantitative polymerase chain reaction after the HaCaT was stimulated with the culture supernatants. Data were analyzed with one-way analysis of variance, followed by the least significant difference test. Results: The T. rubrum strains (T1a and T XHB released β-glucan of 87.530 ± 37.581 pg/ml and 15.747 ± 6.453 pg/ml, respectively into the media. The messenger RNA (mRNA expressions of toll-like receptor-2 (TLR2, TLR4, and CARD9 were moderately up-regulated in HaCaT within 6-h applications of both supernatants. HaCaT cells were more responsive to T1a than T XHB . The slight increase of dendritic cells-specific intercellular adhesion molecule 3-grabbing nonintegrin expression was faster and stronger, induced by T1a supernatant than T XHB . The moderate decreases of RNase 7, the slight up-regulations of Dectin-1 and interleukin-8 at the mRNA level were detected only in response to T1a rather than T XHB . After a long-time contact, all the elevated defense genes decreased after

  6. Effect of bacterial cell-free supernatants on infectivity of norovirus surrogates.

    Science.gov (United States)

    Shearer, Adrienne E H; Hoover, Dallas G; Kniel, Kalmia E

    2014-01-01

    Bacterial metabolic products were evaluated for inhibitory effects on viral propagation in cell culture. Cell-free supernatants (CFS) were prepared from growth of Enterococcus faecalis ATCC 19433, Pseudomonas fluorescens ATCC 13525, Escherichia coli 08, Staphylococcus epidermidis ATCC 12228, Bacillus subtilis 168, Bacillus coagulans 185A, B. coagulans 7050, Clostridium sporogenes PA3679, and a commercial probiotic mixture of Lactobacillus acidophilus, Lactobacillus rhamnosus, Bifidobacterium bifidum, Lactobacillus salivarius, and Streptococcus thermophilus in microbiological medium or milk. The inhibitory effects of CFS on the propagation of murine norovirus 1 and Tulane virus in RAW 264.7 and LLCMK2 cells, respectively, were evaluated in the continuous presence of CFS or after exposure of host cells to CFS. Slight inhibition of viral propagation was observed for murine norovirus and Tulane virus in the continuous presence of CFS of B. subtilis 168 and E. faecalis 19433, respectively. CFS cytotoxicity was also determined by microscopic examination. Virus persisted in the CFS that demonstrated cytotoxic effects, suggesting a lack of direct effect of CFS on virions. The viral propagation indicates a general lack of competitive inhibition by bacterial extracellular products and bears significance in understanding the persistence of virus in food and human systems shared by bacteria that are recognized for their colonization and competitive capabilities.

  7. Purification and characterization of a novel fibrinolytic enzyme from culture supernatant of Pleurotus ostreatus.

    Science.gov (United States)

    Liu, Xiao-Lan; Zheng, Xi-Qun; Qian, Peng-Zhi; Kopparapu, Narasimha-Kumar; Deng, Yong-Ping; Nonaka, Masanori; Harada, Naoki

    2014-02-28

    A fibrinolytic enzyme was produced by an edible mushroom of Pleurotus ostreatus using submerged culture fermentation. The enzyme was purified from the culture supernatant by applying a combination of freeze-thaw treatment, ammonium sulfate precipitation, hydrophobic interaction, and gel filtration chromatographies. The enzyme was purified by a 147-fold, with a yield of 7.54%. The molecular masses of the enzyme an determined by gel filtration and SDSPAGE were 13.6 and 18.2 kDa, respectively. The isoelectric point of the enzyme was 8.52. It hydrolyzed fibrinogen by cleaving the α and β chains of fibrinogen followed by the γ chains, and also activated plasminogen into plasmin. The enzyme was optimally active at 45°C and pH 7.4. The enzyme activity was completely inhibited by EDTA, whereas protease inhibitors of TPCK, SBTI, PMSF, aprotinin and pepstatin showed no inhibition on its activity. The partial amino acid sequences of the enzyme as determined by Q-TOF2 were ATFVGCSATR, GGTLIHESSHFTR, and YTTWFGTFVTSR. These sequences showed a high degree of homology with those of metallo-endopeptidases from P. ostreatus and Armillaria mellea. The purified enzyme can also be applied as a natural agent for oral fibrinolytic therapy or prevention of thrombosis.

  8. Recovery of a monoclonal antibody from hybridoma culture supernatant by affinity precipitation with Eudragit S-100.

    Science.gov (United States)

    Taipa, M A; Kaul, R H; Mattiasson, B; Cabral, J M

    2000-01-01

    An IgG1 monoclonal antibody (MAB) was isolated from hybridoma culture supernatant by affinity precipitation with an Eudragit S-100-based heterobifunctional ligand. Affinity binding was performed in a homogeneous aqueous phase at pH 7.5 followed by precipitation of the bound affinity complex by lowering the pH to 4.8. After two washing steps, elution of specifically bound MAB was achieved by incubating the precipitate with 0.1 M glycine.HCl pH 2.5. The influence of elution volume and time on the recovery of active MAB and the overall purification factor were studied. The best conditions enabled the recovery of 50.2% of active MAB with a purification factor of 6.2. A further dialysis against 50 mM Tris.HCl pH 8.0 increased the activity yield and the purification factor to 68.4% and 8.3, respectively. This result showed that part of the antibody activity loss during affinity precipitation was due to a reversible inactivation process, being easily recovered after a refining dialysis step.

  9. Laccase concentration by foam fractionation of Cerrena unicolor and Pleurotus sapidus culture supernatants

    Directory of Open Access Journals (Sweden)

    Blatkiewicz Michał

    2017-09-01

    Full Text Available Foam fractionation process for concentration of laccases from two Basidiomycete strains under different process conditions was investigated. Culture supernatants of Cerrena unicolor and Pleurotus sapidus containing active laccase were used with and without surfactant additives. Two surfactants: cationic cetrimonium bromide (CTAB and non-ionic Polysorbate 80 were applied in the range from 0.2 mM to 1.5 mM. The pH levels ranging from 3 to 10 were examined with particular attention to pH=4, which is close to the pI of the enzymes. Results show that the source of the enzyme is significant in terms of partitioning efficiency in a foam fractionation process. Laccase from Cerrena unicolor showed the best activity partitioning coefficients between foamate and retentate of almost 200 with yields reaching 50% for pH 7.5 and concentration of CTAB cCTAB = 0.5 mM, whereas laccase from Pleurotus sapidus showed partitioning coefficients of up to 8 with 25% yield for pH 4 and cCTAB = 0.5 mM.

  10. Cell-free supernatants from probiotic Lactobacillus casei and Lactobacillus rhamnosus GG decrease colon cancer cell invasion in vitro.

    Science.gov (United States)

    Escamilla, Juanita; Lane, Michelle A; Maitin, Vatsala

    2012-08-01

    Probiotics have been shown to have a preventative role in colorectal carcinogenesis but research concerning their prophylactic potential in the later stages of colorectal cancer, specifically metastasis is limited. This study explored the potential of cell-free supernatants (CFS) from 2 probiotic Lactobacillus sp., Lactobacillus casei and Lactobacillus rhamnosus GG, to inhibit colon cancer cell invasion by influencing matrix metalloproteinase-9 (MMP-9) activity and levels of the tight junction protein zona occludens-1 (ZO-1) in cultured metastatic human colorectal carcinoma cells. HCT-116 cells were treated with CFS from L. casei, L. rhamnosus, or Bacteroides thetaiotaomicron (a gut commensal); or with uninoculated bacterial growth media. Treatment with CFS from both Lactobacillus sp. decreased colorectal cell invasion but treatment with CFS from B. thetaiotaomicron did not. CFS from both Lactobacillus sp. decreased MMP-9 and increased ZO-1 protein levels. L. rhamnosus CFS also lowered MMP-9 activity. To begin elucidating the secreted bacterial factor conveying these responses, Lactobacillus sp. CFS were fractionated into defined molecular weight ranges and cell invasion assessed. Fractionation revealed that the inhibitory activity was contained primarily in the >100 kDa and 50-100 kDa fractions, suggesting the inhibitory compound may be a macromolecule such as a protein, nucleic acid, or a polysaccharide.

  11. Cell mediated lympholysis: CML. A microplate technique requiring few target cells and employing a new method of supernatant collection

    International Nuclear Information System (INIS)

    Hirschberg, A.; Thorsby, E.

    1977-01-01

    A micromethod for the 51 Cr release assay is described. Allogeneically induced cytotoxic lymphocytes are generated in mixed lymphocyte microcultures in the wells of microplates. Their cytotoxic capacity is assayed by adding 51 Cr-labelled PHA derived lymphoblasts directly into the microcultures with no pooling or transfer of the cytotoxic effector cells being required. The 51 Cr isotope released into the cell supernatants is collected by inserting a cellulose acetate absorption cartridge into each well. A glass fiber filter attached to the cartridge effectively separates the supernatant from the cellular elemets. This system allows the simultaneous collection of the supernatant from 96 wells, and can be used with either adherent or non-adherent target cells

  12. In vitro reactivity of Cymbidium hybridum L. protocorms, on bistratified culture media, using various supernatant sucroses solution

    Directory of Open Access Journals (Sweden)

    Lucia MIHALESCU

    2009-05-01

    Full Text Available Knowing the fact that the protocorms’ multiplication processes are accelerated in their submersion conditions in liquid medium, against the situation that, these protocorms are vitrocultivated on solid (agarized medium cultures (which prevails in organogenesis processes, we propose to study the influence exerted by the cultures, practiced in bistratified regime, to Cymbidium protocorms in vitro cultures. In this interest, as supernatant we used bidistilled water, either on sucrose, glucose or fructose solutions, in different concentrations, which were applied over the inoculated protocorms on agarized medium cultures. The basic medium culture used by us in these experiments was Murashige – Skoog (1962 [13]. To this, we added different growth regulators, like: 2,4-D (2 mg/l, or mixtures of BA (2 mg/l with NAA (1 mg/l, or only BA (2 mg/l, or only NAA (1 mg/l. The witness lot consisted of vitrocultivated protocorms on agarized medium culture, without growth regulators, cultivated in monolayer.After 90 days from the initiation of the double-layered medium cultures, we ascertained that, the application of the second layer (the liquid one over the agarized medium cultures strongly stimulated the multiplication of Cymbidium protocorms, and mostly if the second layer was bidistilled water; the usage of a 5% glucose solution as supernatant, was the most inefficient procedure, matter the micropropagation of Cymbidium protocorms, regardless the content of growth regulators existing in agarized layer of medium cultures.

  13. Putative new heat-stable cytotoxic and enterotoxic factors in culture supernatant of Escherichia coli isolated from drinking water

    Directory of Open Access Journals (Sweden)

    DA Ribeiro

    2011-01-01

    Full Text Available Enteric infections caused by the ingestion of contaminated water, especially by Escherichia coli, are important to define the virulence properties of these bacteria. Due to frequent infantile diarrhea in the city of Ouro Preto, Minas Gerais state, Brazil, the phenotypic and genotypic diarrheagenic properties of E. coli isolated from drinking water were studied. The culture supernatants of 39 (40% among a total of 97 E. coli isolates from drinking water were positive by suckling mouse assay and induced cytotoxic effects on Vero cells. The enterotoxic and cytotoxic activities were present in the fraction with less than 10 kDa and were not lost when heated up to 60°C and 100°C for 30 minutes. PCR assays showed that among these 39 Vero cytotoxigenic E. coli, four (10.2% were positive for ST II (estB and two (5% positive for αHly (hlyA. Gene amplification of SLT (stx 1, stx 2, ST I (estA, LT (eltI, eltII, EAST1 (astA, EHly (enhly and plasmid-encoded enterotoxin (pet were not observed. This heat-stable cytotoxic enterotoxin of E. coli is probably a new putative diarrheagenic virulence factor, as a toxin presenting these characteristics has not yet been described.

  14. Prodigiosin from the supernatant of Serratia marcescens induces apoptosis in haematopoietic cancer cell lines.

    Science.gov (United States)

    Montaner, B; Navarro, S; Piqué, M; Vilaseca, M; Martinell, M; Giralt, E; Gil, J; Pérez-Tomás, R

    2000-10-01

    The effects of supernatant from the bacterial strain Serratia marcescens 2170 (CS-2170) on the viability of different haematopoietic cancer cell lines (Jurkat, NSO, HL-60 and Ramos) and nonmalignant cells (NIH-3T3 and MDCK) was studied. We examined whether this cytotoxic effect was due to apoptosis, and we purified the molecule responsible for this effect and determined its chemical structure. Using an MTT assay we showed a rapid (4 h) decrease in the number of viable cells. This cytotoxic effect was due to apoptosis, according to the fragmentation pattern of DNA, Hoechst 33342 staining and FACS analysis of the phosphatidylserine externalization. This apoptosis was blocked by using the caspase inhibitor Z-VAD.fmk, indicating the involvement of caspases. Prodigiosin is a red pigment produced by various bacteria including S. marcescens. Using mutants of S. marcescens (OF, WF and 933) that do not synthesize prodigiosin, we further showed that prodigiosin is involved in this apoptosis. This evidence was corroborated by spectroscopic analysis of prodigiosin isolated from S. marcescens. These results indicate that prodigiosin, an immunosuppressor, induces apoptosis in haematopoietic cancer cells with no marked toxicity in nonmalignant cells, raising the possibility of its therapeutic use as an antineoplastic drug.

  15. The effect of NaCl substitution with KCl on proteinase activities of cell-free extract and cell-free supernatant at different pH levels and salt concentrations: Lactobacillus acidophilus and Lactobacillus casei.

    Science.gov (United States)

    Ayyash, M M; Sherkat, F; Shah, N P

    2013-01-01

    The aim of this study was to investigate the effect of substitution of NaCl with KCl at different pH levels and salt concentrations on proteinase activity of cell-free extract and cell-free supernatant of the probiotics Lactobacillus acidophilus and Lactobacillus casei. de Man, Rogosa, and Sharpe broth aliquots were mixed with 2 pure salts (NaCl and KCl) and 2 salt concentrations at 2 concentration levels (5 and 10%), inoculated with Lactobacillus acidophilus or Lactobacillus casei, and incubated aerobically at 37°C for 22 h. The cultures were then centrifuged at 4,000×g for 30 min, and the collected cell pellets were used to prepare cell-wall proteinases and the supernatants used as a source of supernatant (extracellular) proteinases. The proteolytic activity and protein content of both portions were determined. After incubation of both portions with 3 milk caseins (α-, β-, κ-casein), the supernatants were individually subjected to analysis of angiotensin-converting enzyme (ACE)-inhibitory activity and proteolytic activity using the o-phthalaldehyde method. Significant differences were observed in ACE-inhibitory and proteolytic activities between salt substitution treatments of cell-free extract and cell-free supernatant from both probiotic strains at the same salt concentration and pH level. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Epidermal growth factor receptor mutation status in cell-free DNA supernatant of bronchial washings and brushings.

    Science.gov (United States)

    Kawahara, Akihiko; Fukumitsu, Chihiro; Taira, Tomoki; Abe, Hideyuki; Takase, Yorihiko; Murata, Kazuya; Yamaguchi, Tomohiko; Azuma, Koichi; Ishii, Hidenobu; Takamori, Shinzo; Akiba, Jun; Hoshino, Tomoaki; Kage, Masayoshi

    2015-10-01

    The aim of the current study was to examine whether it would be possible to detect epidermal growth factor receptor (EGFR) mutations in cytology cell-free DNA (ccfDNA) from the supernatant fluids of bronchial cytology samples. This study investigated cell damage via immunostaining with a cleaved caspase 3 antibody and the quantity of cell-free DNA in supernatant fluid from 2 cancer cell lines, and the EGFR mutation status was evaluated via polymerase chain reaction (PCR) analysis. EGFR mutations were also evaluated via PCR analysis in 74 clinical samples of ccfDNA from bronchial washing samples with physiological saline or from bronchial brushing liquid-based cytology samples with CytoRich Red. The quantity and fragmentation of cell-free DNA in the supernatant fluid and the cell damage and cleaved caspase 3 expression in the sediment gradually increased in a time-dependent manner in the cell lines. In the 74 clinical samples, the quantity of ccfDNA extracted from the supernatant was adequate to perform the PCR assay, whereas the quality of ccfDNA in physiological saline was often decreased. The detection of EGFR mutations with ccfDNA showed a sensitivity of 88.0%, a specificity of 100%, a positive predictive value of 100%, a negative predictive value of 89.7%, and an accuracy of 94.1% in samples with malignant or atypical cells. These results suggest that activating EGFR mutations can be detected with ccfDNA extracted from the supernatant fluid of liquid-based samples via a PCR assay. This could be a rapid and sensitive method for achieving a parallel diagnosis by both morphology and DNA analysis in non-small cell lung cancer patients. © 2015 American Cancer Society.

  17. Differential composition of culture supernatants from wild-type Brucella abortus and its isogenic virB mutants.

    Science.gov (United States)

    Delpino, M Victoria; Comerci, Diego J; Wagner, Mary Ann; Eschenbrenner, Michel; Mujer, Cesar V; Ugalde, Rodolfo A; Fossati, Carlos A; Baldi, Pablo C; Delvecchio, Vito G

    2009-07-01

    The virB genes coding type IV secretion system are necessary for the intracellular survival and replication of Brucella spp. In this study, extracellular proteins from B. abortus 2308 (wild type, WT) and its isogenic virB10 polar mutant were compared. Culture supernatants harvested in the early stationary phase were concentrated and subjected to 2D electrophoresis. Spots present in the WT strain but absent in the virB10 mutant (differential spots) were considered extracellular proteins released in a virB-related manner, and were identified by MALDI-TOF analysis and matching with Brucella genomes. Among the 11 differential proteins identified, DnaK chaperone (Hsp70), choloylglycine hydrolase (CGH) and a peptidyl-prolyl cis-trans isomerase (PPIase) were chosen for further investigation because of their homology with extracellular and/or virulence factors from other bacteria. The three proteins were obtained in recombinant form and specific monoclonal antibodies (mAbs) were prepared. By Western blot with these mAbs, the three proteins were detected in supernatants from the WT but not in those from the virB10 polar mutant or from strains carrying non-polar mutations in virB10 or virB11 genes. These results suggest that the expression of virB genes affects the extracellular release of DnaK, PPIase and CGH, and possibly other proteins from B. abortus.

  18. Lactobacillus rhamnosus GG supernatant upregulates serotonin transporter expression in intestinal epithelial cells and mice intestinal tissues.

    Science.gov (United States)

    Wang, Y M; Ge, X Z; Wang, W Q; Wang, T; Cao, H L; Wang, B L; Wang, B M

    2015-09-01

    The role that probiotics play in relieving irritable bowel syndrome (IBS) has been demonstrated; however, the mechanism by which IBS is affected remains unclear. In this study, serotonin transporter (SERT) mRNA and serotonin transporter protein (SERT-P) levels in HT-29, Caco-2 cells, and mice intestinal tissues were examined after treatment with Lactobacillus rhamnosus GG supernatant (LGG-s). HT-29 and Caco-2 cells were treated with different concentrations of LGG-s for 12 and 24 h and C57BL/6 mice received supplements of different concentrations for 4 weeks. SERT mRNA and SERT-P levels were detected by real-time PCR and Western blotting. SERT mRNA and SERT-P levels in HT-29 and Caco-2 cells were higher than those in the control 24 h after treatment. Undiluted LGG-s upregulated SERT mRNA levels by 9.4-fold in the first week, which dropped in the second week. The double-diluted LGG-s upregulated SERT mRNA by 2.07-fold in the first week; levels dropped to 1.75-fold within the second week and under base expression levels by the third week, while they again climbed to 1.56-fold in the fourth week. The triple-diluted LGG-s could not upregulate SERT mRNA expression until the end of the fourth week. The SERT-P levels in the double-diluted LGG-s group were higher than that in the control but fluctuated with time. SERT-P levels in the triple-diluted LGG-s were higher than that in the control in the last 2 weeks and increased with time. LGG-s can upregulate SERT mRNA and SERT-P levels in intestinal epithelial cells and mice intestinal tissues. © 2015 John Wiley & Sons Ltd.

  19. Antimicrobial Activity of Cell Free Supernatant of Irradiated Lactic Acid Bacteria Isolates

    International Nuclear Information System (INIS)

    Abdelaleem, M.A.; AL-Hagar, O.E.Aa.

    2015-01-01

    Attempts were made to isolate bio preservatives using food wastes with no value and low cost. Whey is the raw material achieved that value. Whey and many other food wastes are used in our study to isolate Lactic acid bacteria (LAB). Cell free supernatants (CFS) of isolates are used to evaluate their antimicrobial activity against indicator pathogenic bacterial strains. CFS-9 isolate from whey has the highest inhibitory activity compared to all other isolates. The inhibitory activity of CFS-9, Nisin (400 IU / ml) and the standard Lactococcus Lactis Subsp. Lactis ATCC 11454 (Lacto) were determined. Furthermore, isolate-9 and Lacto strains were exposed to irradiation at different doses. The inhibition zones of; control isolate-9 (non-irradiated) showed the highest values against all indicator strains, CFS of irradiated Lacto at dose 250 Gy was the highest value against Bacillus cereus and Escherichia coli compared to other irradiation treatments, CFS of irradiated Lacto at dose 100 Gy was the highest value against Staph aureus, while the inhibition zone was in the highest value in CFS of irradiated Lacto at dose 500 Gy against Salmonella typhimurium. Nisin (400 IU / ml) was significantly higher than all CFS of irradiated isolate-9 while, the inhibition zones of all CFS-Lacto (irradiated and nonirradiated) are better and higher than nisin-400

  20. Platelet-released supernatant induces osteoblastic differentiation of human mesenchymal stem cells: potential role of BMP-2

    Directory of Open Access Journals (Sweden)

    M Alini

    2010-12-01

    Full Text Available Platelet-rich preparations have recently gained popularity in maxillofacial and dental surgery, but their beneficial effect is still under debate. Furthermore, very little is known about the effect of platelet preparations at the cellular level, and the underlying mechanisms. In this study, we tested the effect of platelet-released supernatant (PRS on human mesenchymal stem cell (MSC differentiation towards an osteoblastic phenotype in vitro. Cultures of MSC were supplemented with PRS and typical osteoblastic markers were assessed at up to 28 days post-confluence. PRS showed an osteoinductive effect on MSC, as shown by an increased expression of typical osteoblastic marker genes such as collagen Ialpha1, bone sialoprotein II, BMP-2 and MMP-13, as well as by increased 45Ca2+ incorporation. Our results suggest that the effect of PRS on human MSC could be at least partially mediated by BMP-2.Activated autologous PRS could therefore provide an alternative to agents like recombinant bone growth factors by increasing osteoblastic differentiation of bone precursor cells at bone repair sites, although further studies are needed to fully support our observations.

  1. Peroxynitrite decomposition catalyst prevents apoptotic cell death in a human astrocytoma cell line incubated with supernatants of HIV-infected macrophages

    Directory of Open Access Journals (Sweden)

    Perno Carlo

    2002-09-01

    Full Text Available Abstract Background Oxidative stress has shown to contribute in the mechanisms underlying apoptotic cell death occuring in AIDS-dementia complex. Here we investigated the role of peroxynitrite in apoptosis occurring in astroglial cells incubated with supernatants of HIV-infected human primary macrophages (M/M. Results Flow cytometric analysis (FACS of human cultured astrocytes shortly incubated with HIV-1-infected M/M supernatants showed apoptotic cell death, an effect accompanied by pronounced staining for nitrotyrosine (footprint of peroxynitrite and by abnormal formation of malondialdehyde (MDA. Pretreatment of astrocytes with the peroxynitrite decomposition catalyst FeTMPS antagonized HIV-related astrocytic apoptosis, MDA formation and nitrotyrosine staining. Conclusions Taken together, our results suggest that inibition of peroxynitrite leads to protection against peroxidative stress accompanying HIV-related apoptosis of astrocytes. Overall results support the role of peroxynitrite in HIV-related programmed death of astrocytes and suggest the use of peroxynitrite decomposition catalyst to counteract HIV-1-related neurological disorders.

  2. Rapid Biosynthesis of Silver Nanoparticles Using Culture Supernatant of Bacteria with Microwave Irradiation

    Directory of Open Access Journals (Sweden)

    N. Saifuddin

    2009-01-01

    Full Text Available The development of rapid and reliable processes for the synthesis of nanosized materials is of great importance in the field of nanotechnology. Synthesis of silver nanoparticles using microorganism have been reported, but the process is rather slow. In this paper, we describe a novel combinatorial synthesis approach which is rapid, simple and “green” for the synthesis of metallic nanostructures of noble metals such as silver (Ag, by using a combination of culture supernatanant of Bacillus subtilis and microwave (MW irradiation in water in absence of a surfactant or soft template. It was found that exposure of culture supernatanant of Bacillus subtilis and microwave irradiation to silver ion lead to the formation of silver nanoparticles. The silver nanoparticles were in the range of 5-60 nm in dimension. The nanoparticles were examined using UV-Visible Spectroscopy, and Transmission Electron Microscopy (TEM analyses. The formation of nanoparticles by this method is extremely rapid, requires no toxic chemicals and the nanoparticles are stable for several months. The main conclusion is that the bio-reduction method to produce nanoparticles is a good alternative to the electrochemical methods.

  3. Array-CGH analysis of cell-free fetal DNA in 10 mL of amniotic fluid supernatant.

    Science.gov (United States)

    Lapaire, Olav; Lu, Xin-Yan; Johnson, Kirby L; Jarrah, Zina; Stroh, Helene; Cowan, Janet M; Tantravahi, Umadevi; Bianchi, Diana W

    2007-07-01

    Previously, we showed that analysis of amniotic fluid (AF) supernatant cell-free fetal (cff) DNA using DNA microarrays (array-CGH) allows for detection of whole chromosome differences between test and reference DNA. Subsequent technical advances have increased both the yield and quality of extracted cffDNA. Here we determined whether array-CGH using smaller volumes of both fresh and frozen AF cffDNA could identify fetal aneuploidy. CffDNA was extracted from 10 mL of residual AF supernatant. The test AF samples (n = 10) included one with a normal karyotype, and nine with the following fetal aneuploidies: trisomies 13 (n = 1), 18 (n = 3), 21 (n = 2), trisomy 9 mosaicism (47,XX,+ 9[18]/46,XX[2]), triploidy (69,XXY) and Turner syndrome (45,X). Array-CGH using AF cffDNA from aneuploid fetuses, compared to euploid reference AF cffDNA, detected whole chromosome aneuploidy in 8 of 9 cases tested, including the case of trisomy 9 mosaicism. The case of triploidy was not detected. CffDNA extracted from 10 mL AF supernatant can be analyzed using array-CGH to correctly identify human chromosome abnormalities. This technology allows for rapid screening of AF samples for whole chromosomal changes by using routinely discarded supernatant, and may augment standard prenatal karyotyping techniques by providing additional molecular information.

  4. Purification and biochemical characterization of a novel fibrinolytic enzyme from culture supernatant of Cordyceps militaris.

    Science.gov (United States)

    Liu, Xiaolan; Kopparapu, Narasimha-kumar; Shi, Xi; Deng, Yongping; Zheng, Xiqun; Wu, Jianping

    2015-03-04

    A novel fibrinolytic enzyme from Cordyceps militaris was produced by submerged culture fermentation, purified, and biochemically characterized. The enzyme was purified to homogeneity, with an overall yield of 4.0% and a specific activity of 1682 U/mg. The molecular weight and pI of the enzyme were 32 kDa and 9.3 ± 0.2, respectively. The optimal pH and temperature of the enzyme were 7.4 and 37 °C, respectively. The enzyme activity was inhibited by Fe(2+), phenylmethane sulfonyl fluoride (PMSF), aprotinin, and pepstatin but not by N-tosyl-L-phenylalanine chloromethyl ketone (TPCK) and ethylenediamine tetracetic acid (EDTA). Three internal peptides of the enzyme, APQALTVAAVGATWAR, EKNVGSTVNLLSYDGNK, and TDATSVLLDGYNVSAVNDLVAK, were obtained. The enzyme could hydrolyze fibrin(ogen) directly and cleave the α-chains more efficiently than β- and γ-chains, suggesting that it is a plasmin like protein. It degraded thrombin, which indicated that it can act as an anticoagulant and prevent thrombosis. Intravascular thrombosis is one of the major reasons of cardiovascular diseases. On the basis of these results, the purified enzyme can be developed as a natural agent for oral fibrinolytic therapy or prevention of thrombosis.

  5. Performance of hemicellulolytic enzymes in culture supernatants from a wide range of fungi on insoluble wheat straw and corn fiber fractions

    NARCIS (Netherlands)

    Gool, van M.P.; Toth, K.; Schols, H.A.; Szakacs, G.; Gruppen, H.

    2012-01-01

    Filamentous fungi are a good source of hemicellulolytic enzymes for biomass degradation. Enzyme preparations were obtained as culture supernatants from 78 fungal isolates grown on wheat straw as carbon source. These enzyme preparations were utilized in the hydrolysis of insoluble wheat straw and

  6. Actinomycetes mediated synthesis of gold nanoparticles from the culture supernatant ofStreptomyces griseoruberwith special reference to catalytic activity.

    Science.gov (United States)

    Ranjitha, V R; Rai, V Ravishankar

    2017-10-01

    Biogenic synthesis of nanoparticles has received a tremendous attention from the past few decades. The significant progress in the field of nanotechnology has resulted in a cost-effective and eco-friendly process for nanoparticle synthesis. In the present study, the extracellular synthesis of gold nanoparticles was carried out using culture supernatant of Streptomyces griseoruber , actinomycetes isolated from the soil. Bioreduction of gold nanoparticles was confirmed by UV-visible spectrophotometer that showed the peak between 520 and 550 nm. The crystalline nature and mean size of the GNPs were confirmed using XRD. FTIR revealed the possible functional group that could be useful in immobilisation and stabilisation of GNPs. Size and distribution of the biosynthesized GNPs were analysed by HR-TEM that showed the formation of GNPs in the range of 5-50 nm. The synthesised GNPs showed good catalytic activity for the degradation of methylene blue. The study shows the rapid and eco-friendly synthesis of GNPs from Streptomyces griseoruber , and this is the first report on the catalytic activity of GNPs from actinomycetes so far.

  7. Anti-adherence potential of Enterococcus durans cells and its cell-free supernatant on plastic and stainless steel against foodborne pathogens.

    Science.gov (United States)

    Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun

    2015-07-01

    It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.

  8. Culture supernatants from V. cholerae O1 ElTor strains isolated from different geographic areas induce cell vacuolation and cytotoxicity Cepas de V. cholerae O1 biotipo ElTor aisladas de diferente origen geográfico inducen vacuolización celular y citotoxicidad

    Directory of Open Access Journals (Sweden)

    Jorge E Vidal

    2009-02-01

    Full Text Available OBJECTIVE: To investigate whether the HlyA-induced vacuolating effect is produced by V. cholerae O1 ElTor strains isolated from different geographic origins, including Mexico. MATERIAL AND METHODS: Supernatant-induced haemolysis, vacuolating activity and cytotoxicity in Vero cells were recorded. PCR, RFLP analysis and molecular cloning were performed. RESULTS: All ElTor strains analyzed induced cellular vacuolation. Ribotype 2 strains isolates from the U.S. gulf coast yielded the highest titer of vacuolating activity. Eight of nine strains were haemolytic, while all strains were PCR positive for the hlyA gene. We cloned the hlyA gene from two ElTor strains, a toxigenic (2514-88, ctxAB+ and a non-toxigenic Mexican strain (CM 91-3, ctxAB-. Supernatant from those recombinant E. coli strains induced haemolysis, cell vacuolation and cytotoxicity. RFLP-PCR analysis revealed similarities in the hlyA gene from all strains tested. CONCLUSION: The HlyA-induced vacuolating effect is a widespread phenotype of epidemic V. cholerae O1 ElTor strains.OBJETIVO: Analizar el efecto vacuolizante de cepas de V. cholerae O1 ElTor aisladas de diferente origen geográfico, incluyendo México. MATERIAL Y MÉTODOS: Se realizaron pruebas de hemolisis, vacuolización y citotoxicidad en células Vero, así como PCR, análisis por RFLP y clonación molecular. RESULTADOS: Todas las cepas indujeron el efecto vacuolizante. Las cepas del ribotipo 2, aisladas de las costas del Golfo en Estados Unidos, presentaron títulos altos de vacuolización. El gen hlyA fue amplificado en las nueve cepas mediante PCR, aunque sólo ocho fueron hemolíticas. Se clonó el gen hlyA de una cepa toxigénica (2514-88, ctxAB+ y de una cepa no toxigénica aislada en México (CM 91-3, ctxAB-. El sobrenadante de las clonas recombinantes indujo hemólisis, efecto vacuolizante y citotoxicidad. El RFLP mostró alta similitud del gen hlyA de las cepas estudiadas. CONCLUSIÓN: El efecto vacuolizante es un

  9. Performance of multiplex commercial kits to quantify cytokine and chemokine responses in culture supernatants from Plasmodium falciparum stimulations.

    Directory of Open Access Journals (Sweden)

    Gemma Moncunill

    Full Text Available Cytokines and chemokines are relevant biomarkers of pathology and immunity to infectious diseases such as malaria. Several commercially available kits based on quantitative suspension array technologies allow the profiling of multiple cytokines and chemokines in small volumes of sample. However, kits are being continuously improved and information on their performance is lacking.Different cytokine/chemokine kits, two flow cytometry-based (eBioscience® FlowCytomix™ and BD™ Cytometric Bead Array Human Enhanced Sensitivity and four Luminex®-based (Invitrogen™ Human Cytokine 25-Plex Panel, Invitrogen™ Human Cytokine Magnetic 30-Plex Panel, Bio-Rad® Bio-Plex Pro™ Human Cytokine Plex Assay and Millipore™ MILLIPLEX® MAP Plex Kit were compared. Samples tested were supernatants of peripheral blood mononuclear cells of malaria-exposed children stimulated with Plasmodium falciparum parasite lysates. Number of responses in range that could be detected was determined and reproducibility of duplicates was evaluated by the Bland-Altman test. Luminex® kits performed better than flow cytometry kits in number of responses in range and reproducibility. Luminex® kits were more reproducible when magnetic beads were used. However, within each methodology overall performance depended on the analyte tested in each kit. Within the Luminex® kits, the Invitrogen™ with polystyrene beads had the poorer performance, whereas Invitrogen™ with magnetic beads had the higher percentage of cytokines/chemokines with both readings in range (40%, followed by Bio-Rad® with magnetic beads (35%. Regarding reproducibility, the Millipore™ kit had the highest percentage (60% of cytokines/chemokines with acceptable limits of agreement (<30%, followed by the Invitrogen™ with magnetic beads (40% that had tighter limits of agreement.Currently available kits for cytokine and chemokine quantification differ in reproducibility and concentration range of accurate

  10. The impact of NaCl substitution with KCl on proteinase activities cell-free extract and cell-free supernatant at different pH levels and salt concentrations: Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus thermophilus.

    Science.gov (United States)

    Ayyash, M M; Sherkat, F; Shah, N P

    2012-08-01

    The effect of NaCl substitution with KCl at different pH levels (6.0, 5.5, and 5.0) and salt concentrations on proteinase activities of cell-free and supernatant of Lactobacillus delbrueckii ssp. bulgaricus 11824 (L. bulgaricus) and Streptococcus thermophilus MS (ST) was investigated. MRS broths were separately mixed with 4 salt treatments (NaCl only, 1NaCl:1KCl, 1NaCl:3KCl, and KCl only) at 2 different concentrations (5% and 10%) and incubated at 37 °C for 22 h. The cell pellets were used to prepare proteinase of cell-free extract and the cell-free supernatants were used as source of extracellular proteinases. The proteolytic activities and protein contents of both fractions were determined. The supernatants after incubation of both fractions with 3 milk caseins (α-, β-, κ-casein) were subjected to angiotensin-converting-enzyme inhibitory (ACE-inhibitory) activity and proteolytic activity by ortho-phthalaldehyde (OPA) method. Significant differences were observed in ACE-inhibitory activities and proteolytic (OPA) between salt treatments of cell-free extract and cell-free supernatant of L. bulgaricus and S. thermophilus at same salt concentration and same pH level. There was a significant effect of pH level and salt treatments interaction on ACE-inhibitory activity, OPA activity and azocasein activity. To reduce sodium concentration in cheese by substituting of NaCl with KCl, it was important to study the effect on starter culture proteinases which play a vital role in ripening and texture profile of cheese. © 2012 Institute of Food Technologists®

  11. Mycoplasma removal: simple curative methods for viral supernatants.

    Science.gov (United States)

    Baronti, C; Pastorino, B; Charrel, R; de Lamballerie, X

    2013-02-01

    As a partner of the European Virus Archive (EVA) FP7 infrastructure, our research group is maintaining and developing a large virus collection. To meet the standards of the quality management system adopted by all European Virus Archive partners, the detection and eradication of mycoplasma in cell culture supernatants (stored at -80°C or freeze-dried) has to be improved. Although the methods for mycoplasma elimination from infected cell lines were largely described, the decontamination procedures of precious cell culture supernatants was poorly documented. In this study, a large panel of mycoplasma-contaminated virus stocks (enveloped and non enveloped, RNA and DNA viruses) was tested successfully for mycoplasma removal using two simple optimized methods. These easy-to-perform protocols, using respectively Plasmocin™ (InvivoGen, Cayla, France) and chloroform, were shown to remove mycoplasma completely from cell supernatant without incidence in viral infectivity. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Food preservative potential of gassericin A-containing concentrate prepared from a cheese whey culture supernatant from Lactobacillus gasseri LA39.

    Science.gov (United States)

    Nakamura, Kiyoshi; Arakawa, Kensuke; Kawai, Yasushi; Yasuta, Narimi; Chujo, Takahiro; Watanabe, Masamichi; Iioka, Hiroyuki; Tanioka, Masashi; Nishimura, Junko; Kitazawa, Haruki; Tsurumi, Koichi; Saito, Tadao

    2013-02-01

    Gassericin A (GA) is a circular bacteriocin produced by Lactobacillus gasseri LA39. In this study, GA-containing concentrate was prepared using a cross-flow membrane filtration device (30 kDa cut-off) from the culture supernatant of Lb. gasseri LA39 cultivated in a cheese whey-based food-grade medium. The bacteriocin activity titer in the concentrate was 16 times as high as that of the culture supernatant and was completely maintained through each incubation at 4°C for 3 months, 37°C for 2 months, 60°C for 5 h, and 100°C for 30 min. The GA-containing concentrate was used with glycine powder to make custard creams, and then four representative strains of custard cream spoilage bacteria (Bacillus cereus, Lactococcus lactis subsp. lactis, Achromobacter denitrificans and Pseudomonas fluorescens) were individually inoculated at c. 10(3) colony forming units/g in the custard creams. Throughout 30 days of incubation at 30°C, all of the inoculated bacteria were completely inhibited by the combination of 5% (w/w) of the GA-containing concentrate and 0.5% (w/w) glycine. This is the first highly practical application of GA to foods as a biopreservative, and the concentration method and the bacteriocin concentrate would contribute to biopreservation of several foods. © 2012 The Authors. Animal Science Journal © 2012 Japanese Society of Animal Science.

  13. Determining antioxidant activities of lactobacilli cell-free supernatants by cellular antioxidant assay: a comparison with traditional methods.

    Directory of Open Access Journals (Sweden)

    Jiali Xing

    Full Text Available Antioxidant activity of lactic acid bacteria is associated with multiple health-protective effects. Traditional indexes of chemical antioxidant activities poorly reflect the antioxidant effects of these bacteria in vivo. Cellular antioxidant activity (CAA assay was used in this study to determine the antioxidant activity of cell-free supernatants (CFSs of 10 Lactobacillus strains. The performance of the CAA assay was compared with that of four chemical antioxidant activity assays, namely, DPPH radical scavenging, hydroxyl radical scavenging (HRS, reducing power (RP, and inhibition of linoleic acid peroxidation (ILAP. Results of the CAA assay were associated with those of DPPH and ILAP assays, but not with those of RP and HRS assays. The inter- and intra-specific antioxidant activities of CFS were characterized by chemical and CAA assays. L. rhamnosus CCFM 1107 displayed a high antioxidative effect similar to positive control L. rhamnosus GG ATCC 53103 in all of the assays. The CAA assay is a potential method for the detection of antioxidant activities of lactobacilli CFSs.

  14. Evaluation of entomopathogenic nematodes and the supernatants of the in vitro culture medium of their mutualistic bacteria for the control of the root-knot nematodes Meloidogyne incognita and M. arenaria.

    Science.gov (United States)

    Kepenekci, Ilker; Hazir, Selcuk; Lewis, Edwin E

    2016-02-01

    The suppressive effects of various formulations of four entomopathogenic nematode (EPN) species and the supernatants of their mutualistic bacteria on the root-knot nematodes (RKNs) Meloidogyne incognita and M. arenaria in tomato roots were evaluated. The EPNs Steinernema carpocapsae, S. feltiae, S. glaseri and Heterorhabditis bacteriophora were applied as either live infective juveniles (IJs) or infected insect cadavers. Spent medium from culturing the bacterial symbionts Xenorhabdus bovienii and Photorhabdus luminescens kayaii with the cells removed was also applied without their nematode partners. The aqueous suspensions of IJs, infected cadaver applications of EPNs and especially treatments of X. bovienii supernatant suppressed the negative impact of RKNs on tomatoes. Specific responses to treatment were reduced RKN egg masses, increased plant height and increased fresh and dry weights compared with the control where only RKNs were applied. Among the treatments tested, the plant-dipping method of X. bovienii into bacterial culture fluid may be the most practical and effective method for M. incognita and M. arenaria control. © 2015 Society of Chemical Industry.

  15. Performance of hemicellulolytic enzymes in culture supernatants from a wide range of fungi on insoluble wheat straw and corn fiber fractions.

    Science.gov (United States)

    van Gool, M P; Toth, K; Schols, H A; Szakacs, G; Gruppen, H

    2012-06-01

    Filamentous fungi are a good source of hemicellulolytic enzymes for biomass degradation. Enzyme preparations were obtained as culture supernatants from 78 fungal isolates grown on wheat straw as carbon source. These enzyme preparations were utilized in the hydrolysis of insoluble wheat straw and corn fiber xylan rich fractions. Up to 14% of the carbohydrates in wheat straw and 34% of those in corn fiber were hydrolyzed. The degree of hydrolysis by the enzymes depended on the origin of the fungal isolate and on the complexity of the substrate to be degraded. Penicillium, Trichoderma or Aspergillus species, and some non-identified fungi proved to be the best producers of hemicellulolytic enzymes for degradation of xylan rich materials. This study proves that the choice for an enzyme preparation to efficiently degrade a natural xylan rich substrate, is dependent on the xylan characteristics and could not be estimated by using model substrates. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. A fast and simple dot-immunobinding assay for quantifiction of mouse immunoglobulins in hybridoma culture supernatants

    Czech Academy of Sciences Publication Activity Database

    Sulimenko, Tetyana; Dráber, Pavel

    2004-01-01

    Roč. 289, - (2004), s. 89-95 ISSN 0022-1759 R&D Projects: GA AV ČR IBS5052301; GA MŠk LN00A026; GA MŠk 1P04OE158 Keywords : dot-immunobinding assay * hybridoma culture superntatants * mouse immunoglobulins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.464, year: 2004

  17. Supernatants and lipids from stored red blood cells activate pulmonary microvascular endothelium through the BLT2 receptor and protein kinase C activation.

    Science.gov (United States)

    Silliman, Christopher C; Kelher, Marguerite R; Khan, Samina Y; West, F Bernadette; McLaughlin, Nathan J D; Elzi, David J; England, Kelly; Bjornsen, Jason; Kuldanek, Susan A; Banerjee, Anirban

    2017-11-01

    Although transfusion is a lifesaving intervention, it may be associated with significant morbidity in injured patients. We hypothesize that stored red blood cells (RBCs) induce proinflammatory activation of human pulmonary microvascular endothelial cells (HMVECs) resulting in neutrophil (PMN) adhesion and predisposition to acute lung injury (ALI). Ten units of RBCs were collected; 50% (by weight) were leukoreduced (LR-RBCs) and the remainder was unmodified and stored in additive solution-5 (AS-5). An additional 10 units of RBCs were collected, leukoreduced, and stored in AS-3. HMVECs were incubated with [10%-40%] FINAL of the supernatants on Day (D)1 to D42 of storage, lipid extracts, and purified lipids. Endothelial surface expression of intercellular adhesion molecule-1 (ICAM-1), interleukin (IL)-8 release, and PMN adhesion to HMVECs were measured. HMVEC signaling via the BLT2 receptor was evaluated. Supernatants and lipids were also employed as the first event in a two-event model of ALI. The supernatants [10%-40%] FINAL from D21 LR-RBCs and D42 RBCs and LR-RBCs and the lipids from D42 stored in AS-5 induced increased ICAM-1 surface expression on endothelium, IL-8 release, and PMN adhesion. In addition, the supernatants [20%-40%] FINAL from D21 and D42 RBCs in AS-5 also increased endothelial surface expression of ICAM-1. D42 supernatants and lipids also caused coprecipitation of β-arrestin-1 with BLT2, protein kinase C (PKC)β I , and PKCδ and served as the first event in a two-event rodent model of ALI. Lipids that accumulate during RBC storage activate endothelium and predispose to ALI, which may explain some of the adverse events associated with the transfusion of critically injured patients. © 2017 AABB.

  18. Discovery of Novel Secreted Virulence Factors from Salmonella enterica Serovar Typhimurium by Proteomic Analysis of Culture Supernatants

    Energy Technology Data Exchange (ETDEWEB)

    Niemann, George; Brown, Roslyn N.; Gustin, Jean K.; Stufkens, Afke; Shaikh-Kidwai, Afshan S.; Li, Jie; McDermott, Jason E.; Brewer, Heather M.; Schepmoes, Athena A.; Smith, Richard D.; Adkins, Joshua N.; Heffron, Fred

    2011-01-01

    The intracellular pathogen Salmonella enterica serovar Typhimurium is a leading cause of acute gastroenteritis in the world. This pathogen has two type-III secretion systems (TTSS) necessary for virulence that are encoded in Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2) and are expressed during extracellular or intracellular infectious states, respectively, to deliver virulence factors (effectors) to the host cell cytoplasm. While many have been identified and at least partially characterized, the full repertoire of effectors has not been catalogued. In this mass spectrometry-based proteomics study, we identified effector proteins secreted under minimal acidic medium growth conditions that induced the SPI-2 TTSS and its effectors, and compared the secretome from the parent strain to the secretome from strains missing either essential (SsaK) or regulatory components (SsaL) of the SPI-2 secretion apparatus. We identified 75% of the known TTSS effector repertoire. Excluding translocon components, 95% of the known effectors were biased for identification in the ssaL mutant background, which demonstrated that SsaL regulates SPI-2 type III secretion. To confirm secretion to animal cells, we made translational fusions of several of the best candidates to the calmodulin-dependent adenylate cyclase of Bordetella pertussis and assayed cAMP levels of infected J774 macrophage-like cells. From these infected cells we identified six new TTSS effectors and two others that are secreted independent of TTSS. Our results substantiate reports of additional secretion systems encoded by Salmonella other than TTSS.

  19. Mycoplasma removal : simple curative methods for viral supernatants

    OpenAIRE

    Baronti, Cécile; Pastorino, B.; Charrel, R.; De Lamballerie, Xavier

    2013-01-01

    As a partner of the European Virus Archive (EVA) FP7 infrastructure, our research group is maintaining and developing a large virus collection. To meet the standards of the quality management system adopted by all European Virus Archive partners, the detection and eradication of mycoplasma in cell culture supernatants (stored at -80 degrees C or freeze-dried) has to be improved. Although the methods for mycoplasma elimination from infected cell lines were largely described, the decontaminatio...

  20. Soluble suppressor supernatants elaborated by concanavalin A-activated human mononuclear cells. Characterization of a soluble suppressor of B cell immunoglobulin production

    International Nuclear Information System (INIS)

    Fleisher, T.A.; Greene, W.C.; Blaese, R.M.; Waldmann, T.A.

    1981-01-01

    Human peripheral blood mononuclear cells (PBMC) activated with the mitogenic lectin concanavalin A (Con A) elaborate a soluble immune suppressor supernatant (SISS) that contains at least 2 distinct suppressor factors. One of these, SISS-B, inhibits polyclonal B cell immunoglobulin production, whereas the other, SISS-T, suppresses T cell proliferation to both mitogens and antigens. The latter mediator is discussed in the companion paper. Characteristics of the human soluble suppressor of B cell immunoglobulin production (SISS-B) include: 1) inhibition by a noncytotoxic mechanism, 2) loss of activity in the presence of the monosaccharide L-rhamnose, 3) appearance within 8 to 16 hr after the addition of Con A, 4) elaboration by cells irradiated with 500 or 2000 rads, 5) production by highly purified T cells, 6) stability at pH 2.5 but instability at 56/sup o/C, and 7) m.w. of 60 to 80,000. These data indicate that after Con A activation, selected T cells not only become potent suppressor cells, but also generate a soluble saccharide-specific factor(s) that inhibits polyclonal immunoglobulin production by human B cells

  1. Inhibition of miR122a by Lactobacillus rhamnosus GG culture supernatant increases intestinal occludin expression and protects mice from alcoholic liver disease.

    Science.gov (United States)

    Zhao, Haiyang; Zhao, Cuiqing; Dong, Yuanyuan; Zhang, Min; Wang, Yuhua; Li, Fengyuan; Li, Xiaokun; McClain, Craig; Yang, Shulin; Feng, Wenke

    2015-05-05

    Alcoholic liver disease (ALD) has a high morbidity and mortality. Chronic alcohol consumption causes disruption of intestinal microflora homeostasis, intestinal tight junction barrier dysfunction, increased endotoxemia, and eventually liver steatosis/steatohepatitis. Probiotic Lactobacillus rhamnosus GG (LGG) and the bacteria-free LGG culture supernatant (LGGs) have been shown to promote intestinal epithelial integrity and protect intestinal barrier function in ALD. However, little is known about how LGGs mechanistically works to increase intestinal tight junction proteins. Here we show that chronic ethanol exposure increased intestinal miR122a expression, which decreased occludin expression leading to increased intestinal permeability. Moreover, LGGs supplementation decreased ethanol-elevated miR122a level and attenuated ethanol-induced liver injury in mice. Similar to the effect of ethanol exposure, overexpression of miR122a in Caco-2 monolayers markedly decreased occludin protein levels. In contrast, inhibition of miR122a increased occludin expression. We conclude that LGGs supplementation functions in intestinal integrity by inhibition of miR122a, leading to occludin restoration in mice exposed to chronic ethanol. Copyright © 2015. Published by Elsevier Ireland Ltd.

  2. Immunomodulatory effect of linezolid on methicillin-resistant Staphylococcus aureus supernatant-induced MUC5AC overexpression in human airway epithelial cells.

    Science.gov (United States)

    Kaku, Norihito; Yanagihara, Katsunori; Morinaga, Yoshitomo; Yamada, Koichi; Harada, Yosuke; Migiyama, Yohei; Nagaoka, Kentaro; Nakamura, Shigeki; Izumikawa, Koichi; Kohno, Shigeru

    2014-07-01

    Linezolid is the first member of the oxazolidinones and is active against drug-resistant Gram-positive pathogens, such as methicillin-resistant Staphylococcus aureus (MRSA). Additionally, linezolid shows an immunomodulatory effect, such as inhibition of inflammatory cytokine production. In this study, we examined the effect of linezolid on MRSA-induced MUC5AC overexpression in airway epithelial cells. In this study, an MRSA supernatant was used to avoid the direct effect of linezolid on MRSA. MUC5AC protein production was significantly increased with a 40-fold dilution of MRSA supernatant. At the mRNA level, MUC5AC gene expression was significantly increased 6 and 9 h after stimulation. In an inhibition study, linezolid significantly reduced MRSA-induced MUC5AC protein and mRNA overexpression at concentrations of 5 and 20 μg/ml, which were the same as the trough and peak concentrations in human epithelial lining fluid. In an analysis of cell signaling, among the mitogen-activated protein kinase inhibitors, only the extracellular signal-regulated protein kinase 1/2 (ERK1/2) inhibitor reduced the MUC5AC protein production to the same level as that of the control; on Western blot analysis, only ERK1/2 was phosphorylated by the MRSA supernatant. In addition, the ERK1/2 phosphorylation was inhibited by linezolid. MUC5AC and MUC5B are the major barrier that traps inhaled microbial organisms, particulates, and foreign irritants. However, in patients with chronic respiratory diseases, pathogen-induced MUC5AC overexpression causes many problems, and control of the overexpression is important. Thus, this study revealed that linezolid showed a direct immunomodulatory effect in airway epithelial cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  3. Use of an adaptable cell culture kit for performing lymphocyte and monocyte cell cultures in microgravity

    Science.gov (United States)

    Hatton, J. P.; Lewis, M. L.; Roquefeuil, S. B.; Chaput, D.; Cazenave, J. P.; Schmitt, D. A.

    1998-01-01

    The results of experiments performed in recent years on board facilities such as the Space Shuttle/Spacelab have demonstrated that many cell systems, ranging from simple bacteria to mammalian cells, are sensitive to the microgravity environment, suggesting gravity affects fundamental cellular processes. However, performing well-controlled experiments aboard spacecraft offers unique challenges to the cell biologist. Although systems such as the European 'Biorack' provide generic experiment facilities including an incubator, on-board 1-g reference centrifuge, and contained area for manipulations, the experimenter must still establish a system for performing cell culture experiments that is compatible with the constraints of spaceflight. Two different cell culture kits developed by the French Space Agency, CNES, were recently used to perform a series of experiments during four flights of the 'Biorack' facility aboard the Space Shuttle. The first unit, Generic Cell Activation Kit 1 (GCAK-1), contains six separate culture units per cassette, each consisting of a culture chamber, activator chamber, filtration system (permitting separation of cells from supernatant in-flight), injection port, and supernatant collection chamber. The second unit (GCAK-2) also contains six separate culture units, including a culture, activator, and fixation chambers. Both hardware units permit relatively complex cell culture manipulations without extensive use of spacecraft resources (crew time, volume, mass, power), or the need for excessive safety measures. Possible operations include stimulation of cultures with activators, separation of cells from supernatant, fixation/lysis, manipulation of radiolabelled reagents, and medium exchange. Investigations performed aboard the Space Shuttle in six different experiments used Jurkat, purified T-cells or U937 cells, the results of which are reported separately. We report here the behaviour of Jurkat and U937 cells in the GCAK hardware in ground

  4. Impact of Cell-free Supernatant of Lactic Acid Bacteria on Putrescine and Other Polyamine Formation by Foodborne Pathogens in Ornithine Decarboxylase Broth.

    Science.gov (United States)

    Ozogul, Fatih; Tabanelli, Giulia; Toy, Nurten; Gardini, Fausto

    2015-06-24

    Conversion of ornithine to putrescine by Salmonella Paratyphi A, Listeria monocytogenes, Staphylococcus aureus, and Escherichia coli was investigated in ornithine decarboxylase broth (ODB) using cell-free supernatants (CFSs) obtained from Leuconostoc mesenterodies subsp. cremoris, Pediococcus acidilactici, Lactococcus lactis subsp. lactis, Streptococcus thermophilus. Two groups of cell-free supernatants (25 or 50%) and control (only ODB) were prepared to investigate putrescine (PUT) and other polyamine formation by foodborne pathogens (FBPs). Significant differences (p < 0.05) were observed among the species for each amine. All of the CFSs reduced the formation of PUT by ≥65%. The production of cadaverine (CAD) was scarcely affected by the presence of CFSs, with the exception of the samples inoculated with L. monocytogenes. The variation in polyamine was found with respect to the control samples. Spermidine (SPD) was produced in lower amount in many samples, especially in Gram-negative FBPs, whereas spermine (SPN) increased drastically in the major part of the samples concerning the control. Histamine (HIS) was characterized by a marked concentration decrease in all of the samples, and tyramine (TYR) was accumulated in very low concentrations in the controls. Therefore, the ability of bacteria to produce certain biogenic amines such as HIS, TYR, PUT, and CAD has been studied to assess their risk and prevent their formation in food products. The results obtained from this study concluded that the lactic acid bacteria (LAB) strains with non-decarboxylase activity are capable of avoiding or limiting biogenic amine formation by FBP.

  5. Growth Inhibition of Cronobacter sakazakii in Experimentally Contaminated Powdered Infant Formula by Kefir Supernatant.

    Science.gov (United States)

    Kim, Dong-Hyeon; Chon, Jung-Whan; Kang, Il-Byeong; Kim, Hyunsook; Kim, Hong-Seok; Song, Kwang-Young; Seo, Kun-Ho

    2015-09-01

    Kefir is a type of fermented milk containing lactic and acetic acid bacteria and yeast. In this study, we evaluated the antimicrobial activity of kefir supernatant against Cronobacter sakazakii in powdered infant formula (PIF). In a spot-on-lawn test, the growth of 20 C. sakazakii strains, including 10 clinical and 10 food isolates, was completely inhibited in the presence of kefir supernatant. Significant differences in the diameters of inhibition zones were observed upon treatment with kefir compared with the results for Lactobacillus kefiri and Candida kefyr culture supernatants or solutions of lactic and acetic acid and ethyl alcohol in the agar well diffusion test (P kefir supernatant to 1 ml of nutrient broth completely inhibited the growth of C. sakazakii, as evaluated by spectrophotometry. The antimicrobial activity of kefir supernatant in experimentally contaminated PIF was also tested; we found no viable C. sakazakii cells remaining in PIF rehydrated with 30% kefir supernatant solution for 1 h, demonstrating that the antimicrobial activity of kefir supernatant against C. sakazakii could be applied in real food samples.

  6. Effect of different stress factors on IL-6 and leptin expression in HELA cell cultures

    International Nuclear Information System (INIS)

    Chu Zhenwei; Yang Tao; Wang Luhuan; Hao Xiuhua; Yan Guangtao

    2009-01-01

    Objective: To study the effect of three stress factors high glucose (HG), lipopolysaccharide (LPS) and hydrogen peroxide (H 2 O 2 ) on the expression of culture supernatant IL-6 (IL-6) and leptin contents of HELA cell line. Methods: HELA cell culture models of severe inflammatory response syndrome were prepared with cultures treated with 50 mmol/L glucose (HG), 4 μg/ ml LPS and 100 μmol/L H 2 O 2 respectively and supernatant contents of IL-6 and leptin were measured with RIA at 1h, 6h and 24h. Results: Generally speaking, the culture supernatant contents of IL-6 gradually increased and leptin contents gradually decreased with significant differences from those in cultures not treated with either stress factor at 6h and 12h (P<0.05). Conclusion: Leptin as a possible anti-inflammatory cytokine might plays an important protective role in severe inflammatory response. (authors)

  7. Analysis of the Anti-Cancer Effects of Cincau Extract (Premna oblongifolia Merr) and Other Types of Non-Digestible Fibre Using Faecal Fermentation Supernatants and Caco-2 Cells as a Model of the Human Colon

    Science.gov (United States)

    Nurdin, Samsu U.; Le Leu, Richard K.; Young, Graeme P.; Stangoulis, James C. R.; Christophersen, Claus T.; Abbott, Catherine A.

    2017-01-01

    Green cincau (Premna oblongifolia Merr) is an Indonesian food plant with a high dietary fibre content. Research has shown that dietary fibre mixtures may be more beneficial for colorectal cancer prevention than a single dietary fibre type. The aim of this study was to investigate the effects of green cincau extract on short chain fatty acid (SCFA) production in anaerobic batch cultures inoculated with human faecal slurries and to compare these to results obtained using different dietary fibre types (pectin, inulin, and cellulose), singly and in combination. Furthermore, fermentation supernatants (FSs) were evaluated in Caco-2 cells for their effect on cell viability, differentiation, and apoptosis. Cincau increased total SCFA concentration by increasing acetate and propionate, but not butyrate concentration. FSs from all dietary fibre sources, including cincau, reduced Caco-2 cell viability. However, the effects of all FSs on cell viability, cell differentiation, and apoptosis were not simply explainable by their butyrate content. In conclusion, products of fermentation of cincau extracts induced cell death, but further work is required to understand the mechanism of action. This study demonstrates for the first time that this Indonesian traditional source of dietary fibre may be protective against colorectal cancer. PMID:28368356

  8. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Özcan

    2011-01-01

    Standard cell culture plastic was surface modified by passive adsorption or covalent attachment of interleukin (IL)-4 and investigated for its ability to induce differentiation of human monocytes into mature dendritic cells, a process dose-dependently regulated by IL-4. Covalent attachment of IL-4...... in water instead of phosphate-buffered saline. Passively adsorbed IL-4 was observed to induce differentiation to dendritic cells, but analysis of cell culture supernatants revealed that leakage of IL-4 into solution could account for the differentiation observed. Covalent attachment resulted in bound IL-4...

  9. Bacterial cell culture

    OpenAIRE

    sprotocols

    2014-01-01

    ### Materials 1. Glass culture tubes with metal caps and labels - Growth medium, from media room or customized - Glass pipette tubes - Parafilm ### Equipment 1. Vortexer - Fireboy or Bunsen burner - Motorized pipette - Micropipettes and sterile tips ### Procedure For a typical liquid culture, use 5 ml of appropriate medium. The amount in each tube does not have to be exact if you are just trying to culture cells for their precious DNA. 1. Streak an a...

  10. Assessment of real-time PCR method for detection of EGFR mutation using both supernatant and cell pellet of malignant pleural effusion samples from non-small-cell lung cancer patients.

    Science.gov (United States)

    Shin, Saeam; Kim, Juwon; Kim, Yoonjung; Cho, Sun-Mi; Lee, Kyung-A

    2017-10-26

    EGFR mutation is an emerging biomarker for treatment selection in non-small-cell lung cancer (NSCLC) patients. However, optimal mutation detection is hindered by complications associated with the biopsy procedure, tumor heterogeneity and limited sensitivity of test methodology. In this study, we evaluated the diagnostic utility of real-time PCR using malignant pleural effusion samples. A total of 77 pleural fluid samples from 77 NSCLC patients were tested using the cobas EGFR mutation test (Roche Molecular Systems). Pleural fluid was centrifuged, and separated cell pellets and supernatants were tested in parallel. Results were compared with Sanger sequencing and/or peptide nucleic acid (PNA)-mediated PCR clamping of matched tumor tissue or pleural fluid samples. All samples showed valid real-time PCR results in one or more DNA samples extracted from cell pellets and supernatants. Compared with other molecular methods, the sensitivity of real-time PCR method was 100%. Concordance rate of real-time PCR and Sanger sequencing plus PNA-mediated PCR clamping was 98.7%. We have confirmed that real-time PCR using pleural fluid had a high concordance rate compared to conventional methods, with no failed samples. Our data demonstrated that the parallel real-time PCR testing using supernatant and cell pellet could offer reliable and robust surrogate strategy when tissue is not available.

  11. Vegetative Bacillus amyloliquefaciens cells do not confer protection against necrotic enteritis in broilers despite high antibacterial activity of its supernatant against Clostridium perfringens in vitro.

    Science.gov (United States)

    Geeraerts, S; Delezie, E; Ducatelle, R; Haesebrouck, F; Devreese, B; Van Immerseel, F

    2016-06-01

    In this study, the effect of Bacillus amyloliquefaciens on Clostridium perfringens was tested in vitro and in vivo. Using an agar well diffusion assay, the inhibitory activity of B. amyloliquefaciens supernatant was analysed against a large collection of netB-positive and netB-negative C. perfringens strains. Although strong growth inhibiting activity was detected against all C. perfringens isolates, it was significantly higher against virulent netB-positive C. perfringens strains compared with avirulent netB-negative isolates. Subsequently, the efficacy of in-feed administration of lyophilised vegetative cells of B. amyloliquefaciens to prevent necrotic enteritis was tested in vivo using an established experimental infection model in broilers. Ross 308 broilers received either B. amyloliquefaciens supplemented or unsupplemented feed throughout the experiment. No significant differences could be detected between the untreated positive control group and the B. amyloliquefaciens treated group in body weight, the number of chickens that developed necrotic lesions and in pathological lesion scores. These results demonstrate that despite its substantial inhibitory activity in vitro, lyophilised vegetative B. amyloliquefaciens cells had no beneficial effect against necrotic enteritis in the in vivo model used here.

  12. Supernatant treatment system design through testing

    International Nuclear Information System (INIS)

    Ploetz, D.K.; Leonard, I.M.

    1988-12-01

    The main purpose of the Supernatant Treatment System (STS) is to remove more than 99.9 percent of the radioactive cesium (Cs-137) from the high-level waste stored in tank 8D-2. Cesium removal is accomplished in the STS by processing the supernatant (liquid) portion of the high-level waste through three or four ion exchange columns filled with zeolite. After treatment in the STS, the decontaminated supernatant is processed as low-level waste and finally encapsulated in cement for eventual disposal. The Cs-137 removed from the waste and absorbed onto zeolite ion exchange material is temporarily stored in tank 8D-1 until it can be encapsulated in glass and disposed of as high-level waste. This report discusses construction and testing of the STS. Design of the STS was started in 1982 in parallel with the selection of the ion exchange material. The construction of this system was accomplished in five phase in parallel with completion of design to allow for faster completion of the project. The existing high-level waste storage tanks -- 8D-1, 8D-2, and 8D-3 -- required major renovations to permit transfer of the high-level waste from tank 8D-2 to tank 8D-1, to house the components that comprise the STS in tank 8D-1, and to store decontaminated wastes in tank 8D-3. Testing in the STS started before construction was complete and was accomplished by first testing components individually. Then the system was retested using simulated supernatant. Integrated testing of the whole Integrated Radwaste Treatment System (IRTS), which includes the STS, Liquid Waste Treatment System (LWTS), Cement Solidification System (CSS), and the Drum Cell, was also performed using simulated supernatant. Finally, slightly radioactive condensate water from tank 8D-1 was processed. After successfully completing this testing, the STS started operations with radioactive supernatant on May 23, 1988. 21 refs., 33 figs., 21 tabs

  13. Basic cell culture.

    Science.gov (United States)

    Pollard, J W

    1990-01-01

    This article will describe the basic techniques required for successful cell culture. It will also act to introduce some of the other chapters in this volume. It is not intended, as this volume is not, to describe the establishment of a tissue culture laboratory, nor to provide a historical or theoretical survey of cell culture. There are several books that adequately cover these areas, including the now somewhat dated but still valuable volume by Paul (1), the multi-authored Methods in Enzymology volume edited by Jakoby and Pastan (2), and the new edition of Freshney (3). Instead, this chapter's focus will be on the techniques for establishing primary rodent cell cultures from embryos and adult skin, maintaining and subculturing these fibro-blasts and their transformed derivatives, and the isolation of genetically pure strains. The cells described are all derived from Chinese hamsters since, to date, these cells, have proved to be the most useful for somatic cell genetics (4,5). The techniques, however, are generally applicable to most fibroblastic cell types.

  14. Tumor necrosis factor-alpha (TNF-alpha) concentrations from whole blood cultures correlate with isolated peripheral blood mononuclear cell cultures

    Science.gov (United States)

    Many cellular immune assays are impractical because they require labor-intensive isolation of cells from their natural environment. The objectives of this study were to determine the relationship between cell culture supernatant TNF-alpha from isolated peripheral blood mononuclear cells (PBMC) and w...

  15. Lactobacillus rhamnosus GG supernatant promotes intestinal barrier function, balances Treg and TH17 cells and ameliorates hepatic injury in a mouse model of chronic-binge alcohol feeding.

    Science.gov (United States)

    Chen, Rui-Cong; Xu, Lan-Man; Du, Shan-Jie; Huang, Si-Si; Wu, He; Dong, Jia-Jia; Huang, Jian-Rong; Wang, Xiao-Dong; Feng, Wen-Ke; Chen, Yong-Ping

    2016-01-22

    Impaired intestinal barrier function plays a critical role in alcohol-induced hepatic injury, and the subsequent excessive absorbed endotoxin and bacterial translocation activate the immune response that aggravates the liver injury. Lactobacillus rhamnosus GG supernatant (LGG-s) has been suggested to improve intestinal barrier function and alleviate the liver injury induced by chronic and binge alcohol consumption, but the underlying mechanisms are still not clear. In this study, chronic-binge alcohol fed model was used to determine the effects of LGG-s on the prevention of alcoholic liver disease in C57BL/6 mice and investigate underlying mechanisms. Mice were fed Lieber-DeCarli diet containing 5% alcohol for 10 days, and one dose of alcohol was gavaged on Day 11. In one group, LGG-s was supplemented along with alcohol. Control mice were fed isocaloric diet. Nine hours later the mice were sacrificed for analysis. Chronic-binge alcohol exposure induced an elevation in liver enzymes, steatosis and morphology changes, while LGG-s supplementation attenuated these changes. Treatment with LGG-s significantly improved intestinal barrier function reflected by increased mRNA expression of tight junction (TJ) proteins and villus-crypt histology in ileum, and decreased Escherichia coli (E. coli) protein level in liver. Importantly, flow cytometry analysis showed that alcohol reduced Treg cell population while increased TH17 cell population as well as IL-17 secretion, which was reversed by LGG-s administration. In conclusion, our findings indicate that LGG-s is effective in preventing chronic-binge alcohol exposure-induced liver injury and shed a light on the importance of the balance of Treg and TH17 cells in the role of LGG-s application. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Cell Culturing of Cytoskeleton

    Science.gov (United States)

    2004-01-01

    Biomedical research offers hope for a variety of medical problems, from diabetes to the replacement of damaged bone and tissues. Bioreactors, which are used to grow cells and tissue cultures, play a major role in such research and production efforts. Cell culturing, such as this bone cell culture, is an important part of biomedical research. The BioDyn payload includes a tissue engineering investigation. The commercial affiliate, Millenium Biologix, Inc., has been conducting bone implant experiments to better understand how synthetic bone can be used to treat bone-related illnesses and bone damaged in accidents. On STS-95, the BioDyn payload will include a bone cell culture aimed to help develop this commercial synthetic bone product. Millenium Biologix, Inc., is exploring the potential for making human bone implantable materials by seeding its proprietary artificial scaffold material with human bone cells. The product of this tissue engineering experiment using the Bioprocessing Modules (BPMs) on STS-95 is space-grown bone implants, which could have potential for dental implants, long bone grafts, and coating for orthopedic implants such as hip replacements.

  17. Oscillating Cell Culture Bioreactor

    Science.gov (United States)

    Freed, Lisa E.; Cheng, Mingyu; Moretti, Matteo G.

    2010-01-01

    To better exploit the principles of gas transport and mass transport during the processes of cell seeding of 3D scaffolds and in vitro culture of 3D tissue engineered constructs, the oscillatory cell culture bioreactor provides a flow of cell suspensions and culture media directly through a porous 3D scaffold (during cell seeding) and a 3D construct (during subsequent cultivation) within a highly gas-permeable closed-loop tube. This design is simple, modular, and flexible, and its component parts are easy to assemble and operate, and are inexpensive. Chamber volume can be very low, but can be easily scaled up. This innovation is well suited to work with different biological specimens, particularly with cells having high oxygen requirements and/or shear sensitivity, and different scaffold structures and dimensions. The closed-loop changer is highly gas permeable to allow efficient gas exchange during the cell seeding/culturing process. A porous scaffold, which may be seeded with cells, is fixed by means of a scaffold holder to the chamber wall with scaffold/construct orientation with respect to the chamber determined by the geometry of the scaffold holder. A fluid, with/without biological specimens, is added to the chamber such that all, or most, of the air is displaced (i.e., with or without an enclosed air bubble). Motion is applied to the chamber within a controlled environment (e.g., oscillatory motion within a humidified 37 C incubator). Movement of the chamber induces relative motion of the scaffold/construct with respect to the fluid. In case the fluid is a cell suspension, cells will come into contact with the scaffold and eventually adhere to it. Alternatively, cells can be seeded on scaffolds by gel entrapment prior to bioreactor cultivation. Subsequently, the oscillatory cell culture bioreactor will provide efficient gas exchange (i.e., of oxygen and carbon dioxide, as required for viability of metabolically active cells) and controlled levels of fluid

  18. Protease-Sensitive Inhibitory Activity of Cell-free Supernatant of Lactobacillus crispatus 156 Synergizes with Ciprofloxacin, Moxifloxacin and Streptomycin Against Pseudomonas aeruginosa: An In Vitro Study.

    Science.gov (United States)

    Kaur, Sukhraj; Sharma, Preeti

    2015-06-01

    Ciprofloxacin and streptomycin are frequently prescribed for the treatment of medical conditions originating due to infection by Pseudomonas aeruginosa. However, fluoroquinolone administration has been linked to the outgrowth of Clostridium difficile pathogen, especially in immunocompromised patients. Secondly, frequent administration of antibiotics may lead to development of resistance in the pathogens. Thus, there is a need to explore innovative adjunct therapies to lower the therapeutic doses of the antibiotics. Herein, we evaluated the synergism, if any, between conventional antibiotics and the cell-free supernatant (CFS) of vaginal Lactobacillus crispatus 156 against P. aeruginosa MTCC 741. L. crispatus 156 was isolated from the human vaginal tract, and its CFS had broad-spectrum antimicrobial activity against various Gram-positive and Gram-negative pathogens, including P. aeruginosa. The inhibitory substance present in the CFS completely lost its activity after treatment with proteinases and was resistant to temperatures up to 80 °C and pH ranging from 2 to 6. The cumulative production of the inhibitory substance in CFS was studied, and it showed that the secretion of the inhibitory substance was initiated in middle log phase of growth and peaked in late log phase. Further, CFS synergized the activities of ciprofloxacin, moxifloxacin, and streptomycin as evaluated in terms of checkerboard titrations. It lowered the minimum inhibitory concentration (MIC) of ciprofloxacin by almost 30 times and MIC of both moxifloxacin and streptomycin by 8 times. Interestingly, pepsin treatment of CFS caused the complete abrogation of its synergistic effect with all the three antibiotics. Thus, from the study, it can be concluded that probiotic-based alternative therapeutic regimen can be designed for the treatment of P. aeruginosa infections.

  19. Epithelial Cell Cultures

    Directory of Open Access Journals (Sweden)

    Imran S. Chaudhry

    2011-01-01

    Full Text Available The biological effects of only a finite number of tobacco toxins have been studied. Here, we describe exposure of cultures of human bronchial epithelial cells to low concentrations of tobacco carcinogens: nickel sulphate, benzo(bfluoranthene, N-nitrosodiethylamine, and 4-(methylnitrosamino-1-(3-pyridyl-1-butanone (NNK. After a 24-hour exposure, EGFR was expressed in cell membrane and cytoplasm, BCL-2 was expressed only in the irregular nuclei of large atypical cells, MKI67 was expressed in nuclei with no staining in larger cells, cytoplasmic BIRC5 with stronger nuclear staining was seen in large atypical cells, and nuclear TP53 was strongly expressed in all cells. After only a 24-hour exposure, cells exhibited atypical nuclear and cytoplasmic features. After a 48-hour exposure, EGFR staining was localized to the nucleus, BCL-2 was slightly decreased in intensity, BIRC5 was localized to the cytoplasm, and TP53 staining was increased in small and large cells. BCL2L1 was expressed in both the cytoplasm and nuclei of cells at 24- and 48-hour exposures. We illustrate that short-termexposure of a bronchial epithelial cell line to smoking-equivalent concentrations of tobacco carcinogens alters the expression of key proliferation regulatory genes, EGFR, BCL-2, BCL2L1, BIRC5, TP53, and MKI67, similar to that reported in biopsy specimens of pulmonary epithelium described to be preneoplastic lesions.

  20. Microfluidic Cell Culture Device

    Science.gov (United States)

    Takayama, Shuichi (Inventor); Cabrera, Lourdes Marcella (Inventor); Heo, Yun Seok (Inventor); Smith, Gary Daniel (Inventor)

    2014-01-01

    Microfluidic devices for cell culturing and methods for using the same are disclosed. One device includes a substrate and membrane. The substrate includes a reservoir in fluid communication with a passage. A bio-compatible fluid may be added to the reservoir and passage. The reservoir is configured to receive and retain at least a portion of a cell mass. The membrane acts as a barrier to evaporation of the bio-compatible fluid from the passage. A cover fluid may be added to cover the bio-compatible fluid to prevent evaporation of the bio-compatible fluid.

  1. Perfusion based cell culture chips

    DEFF Research Database (Denmark)

    Heiskanen, Arto; Emnéus, Jenny; Dufva, Martin

    2010-01-01

    Performing cell culture in miniaturized perfusion chambers gives possibilities to experiment with cells under near in vivo like conditions. In contrast to traditional batch cultures, miniaturized perfusion systems provide precise control of medium composition, long term unattended cultures...... and tissue like structuring of the cultures. However, as this chapter illustrates, many issues remain to be identified regarding perfusion cell culture such as design, material choice and how to use these systems before they will be widespread amongst biomedical researchers....

  2. Purification and characterization of erythrogenic toxins of Streptococcus pyogenes. VI. Mitogenic activity of isoelectrically focused erythrogenic toxin preparations and culture supernatants of group A streptococci.

    Science.gov (United States)

    Knöll, H; Gerlach, D; Ozegowski, J H; Hribalová, V; Köhler, W

    1983-11-01

    Isoelectric focusing (IF) was used to separate erythrogenic toxins (ET) type A, B and C from concentrated culture filtrates of Streptococcus pyogenes strains. The ET's were identified by their mitogenic activity on human lymphocytes in the lymphocyte transformation test: purified ET type A appeared at pH 5.3, ET type C at pH 6.8 and ET type B at pH 7.5 to 8.5; the ET type B was only biologically active when PAGE IF was used. IF on Sephadex G 100 failed to yield active B toxin. The application of as little as 0.1 micrograms ET type A to an isoelectric focusing gel was still sufficient to detect a mitogenic peak in the eluates. ET type A was identified in nine out of 10 culture filtrates, ET type C in 4 out of 10. Detection of ET type B (identical with streptococcal proteinase proenzyme) in culture filtrates after IF proved to be difficult. Here the pH of cultivation media and the autocatalytic conversion of streptococcal proteinase proenzyme to activated proteinase have to be considered.

  3. Development of an indirect ELISA to detect Corynebacterium pseudotuberculosis specific antibodies in sheep employing T1 strain culture supernatant as antigen

    Directory of Open Access Journals (Sweden)

    Miriam F. Rebouças

    2013-11-01

    Full Text Available Corynebacterium pseudotuberculosis is the etiologic agent of caseous lymphadenitis (CLA, a chronic disease that affects goats and sheep, characterized by granuloma formation in subcutaneous and internal lymph nodes. CLA causes significant economic losses to commercial goat herds. In this study, we aimed to test secreted antigens secreted from T1 strain bacteria grown in brain heart infusion (BHI broth in an indirect ELISA system to determine the presence of specific immunoglobulins against C. pseudotuberculosis. We analyzed the BHI antigen electrophoretic profile and the recognition pattern by infected sheep sera samples. The ELISA results were compared with multiplex PCR assay and IFN-gamma production. The ELISA was able to discriminate between negative and positive animals, with a sensitivity of 89% and a specificity of 99%, using microbiological isolation as gold standard. When this assay was compared with multiplex PCR and specific IFN-gamma quantification, six discrepant results were found among thirty-two samples. We concluded that the ELISA using antigens secreted from C. pseudotuberculosis T1 strain growth in BHI broth culture can be used for the serodiagnosis of CLA in sheep.

  4. Ureaplasma infection of cell cultures.

    Science.gov (United States)

    Kotani, H; McGarrity, G J

    1986-05-01

    Studies were performed to characterize the effects of ureaplasmas in HeLa, 3T6, and CV-1 cell cultures. The ureaplasmas studied were human Ureaplasma urealyticum T960 (serotype VIII), bovine U. diversum T95, simian strain T167-2, ovine strain 1202, canine strain D1M-C, and feline strains 382 and FT2-B. FT2-B was the only ureaplasma to grow in the cell free culture medium, Dulbecco modified Eagle-Earle medium containing 10% fetal bovine serum. The growth pattern of the ureaplasmas varied in the different cell cultures, but each strain grew in at least two of the cell cultures, suggesting a requirement for a product of the cell culture and for low concentrations of urea. When growth occurred, organisms grew to concentrations that approached, but did not equal, those observed in 10B broth. Most, but not all, ureaplasmas grew quickly, reaching peak titers 2 days after infection. Canine strain D1M-C did not grow in 3T6, but showed rapid growth in HeLa and CV-1 cells, killing both cultures, In some systems, e.g., U. urealyticum T960 and simian strain T167-2, the infection persisted, and ureaplasmas could be recovered from cell cultures four passages after infection, when studies were terminated. The cell culture ureaplasmas grew on T agar, but not on mycoplasma agar medium.

  5. Thymic factors and T cell maturation in vitro : A comparison of the effects of thymic epithelial cultures with thymic extracts and thymus dependent serum factors

    NARCIS (Netherlands)

    Kruisbeek, A.M.

    1979-01-01

    In the present review the results obtained so far with thymic epithelial culture supernatants (TES) or cocultivation of potential precursor T cells with TE cells will be discussed and compared with the effects reported for other thymic factors in studies on T cell differentiation in vitro. These

  6. Dual Effects of Cell Free Supernatants from Lactobacillus acidophilus and Lactobacillus rhamnosus GG in Regulation of MMP-9 by Up-Regulating TIMP-1 and Down-Regulating CD147 in PMA- Differentiated THP-1 Cells

    Science.gov (United States)

    Maghsood, Faezeh; Mirshafiey, Abbas; Farahani, Mohadese M.; Modarressi, Mohammad Hossein; Jafari, Parvaneh; Motevaseli, Elahe

    2018-01-01

    Objective Recent studies have reported dysregulated expression of matrix metalloproteinases (MMPs), especially MMP-2, MMP-9, tissue inhibitor of metalloproteinase-1, -2 (TIMP-1, TIMP-2), and extracellular matrix metalloproteinase inducer (EMMPRIN/CD147) in activated macrophages of patients with inflammatory diseases. Therefore, MMP-2, MMP-9, and their regulators may represent a new target for treatment of inflammatory diseases. Probiotics, which are comprised of lactic acid bacteria, have the potential to modulate inflammatory responses. In this experimental study, we investigated the anti-inflammatory effects of cell-free supernatants (CFS) from Lactobacillus acidophilus (L. acidophilus) and L. rhamnosus GG (LGG) in phorbol myristate acetate (PMA)-differentiated THP-1 cells. Materials and Methods In this experimental study, PMA-differentiated THP-1 cells were treated with CFS from L. acidophilus, LGG and uninoculated bacterial growth media (as a control). The expression of MMP-2, MMP-9, TIMP-1, and TIMP-2 mRNAs were determined using real-time quantitative reverse transcription polymerase chain reaction (RT- PCR). The levels of cellular surface expression of CD147 were assessed by flow cytometry, and the gelatinolytic activity of MMP-2 and MMP-9 were determined by zymography. Results Our results showed that CFS from both L. acidophilus and LGG significantly inhibited the gene expression of MMP-9 (P=0.0011 and P=0.0005, respectively), increased the expression of TIMP-1 (P<0.0001), decreased the cell surface expression of CD147 (P=0.0307 and P=0.0054, respectively), and inhibited the gelatinolytic activity of MMP-9 (P=0.0003 and P<0.0001, respectively) in PMA-differentiated THP-1 cells. Although, MMP-2 expression and activity and TIMP-2 expression remained unchanged. Conclusion Our results indicate that CFS from L. acidophilus and LGG possess anti-inflammatory properties and can modulate the inflammatory response. PMID:29105390

  7. Challenges of culturing human norovirus in three-dimensional organoid intestinal cell culture models.

    Directory of Open Access Journals (Sweden)

    Efstathia Papafragkou

    Full Text Available Human noroviruses are the most common cause of acute gastroenteritis worldwide. Recently, cell culture systems have been described using either human embryonic intestinal epithelial cells (Int-407 or human epithelial colorectal adenocarcinoma cells (Caco-2 growing on collagen-I porous micro carrier beads in a rotating bioreactor under conditions of physiological fluid shear. Here, we describe the efforts from two independent laboratories to implement this three dimensional (3D cell culture system for the replication of norovirus. Int-407 and Caco-2 were grown in a rotating bioreactor for up to 28 days. Prior to infection, cells were screened for the presence of microvilli by electron microscopy and stained for junction proteins (zonula occludens-1, claudin-1, and β-catenin. Differentiated 3D cells were transferred to 24-well plates and infected with bacteria-free filtrates of various norovirus genotypes (GI.1, GI.3, GI.8, GII.2, GII.4, GII.7, and GII.8. At 12 h, 24 h, and 48 h post inoculation, viral RNA from both cells and supernatants were collected and analyzed for norovirus RNA by real-time reverse transcription PCR. Despite observations of high expression of junction proteins and microvilli development in stained thin sections, our data suggest no significant increase in viral titer based on norovirus RNA copy number during the first 48 h after inoculation for the different samples and virus culture conditions tested. Our combined efforts demonstrate that 3D cell culture models using Int-407 or Caco-2 cells do not support norovirus replication and highlight the complexity and difficulty of developing a reproducible in vitro cell culture system for human norovirus.

  8. Mutation in cultured mammalian cells

    International Nuclear Information System (INIS)

    Nakamura, N.; Okada, S.

    1982-01-01

    Mammalian cell cultures were exposed to gamma-rays at various dose rates. Dose-rate effects were observed in cultured somatic cells of the mouse for cell killing and mutations resistant to 6-thioguanine (TGsup(r)) and to methotrexate (MTXsup(r)). Linear quadratic model may be applied to cell killing and TGsup(r) mutations in some cases but can not explain the whole data. Results at low doses with far low dose-rate were not predictable from data at high doses with acute or chronic irradiation. Radioprotective effects of dimethyl sulfoxide were seen only after acute exposure but not after chronic one, suggesting that damages by indirect action of radiations may be potentially reparable by cells. TGsup(r) mutations seem to contain gross structural changes whereas MTXsup(r) ones may have smaller alterations. (Namekawa, K.)

  9. Cell culture compositions

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

    2014-03-18

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  10. Cytopathogenicity of Naegleria for cultured neuroblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Fulford, D.E.

    1985-01-01

    The cytopathic activity of live Naegleria amoebae and cell-free lysates of Naegleria for B-103 rat neuroblastoma cells was investigated using a /sup 51/Cr release assay. Live amoebae and cell-free lysates of N. fowleri, N. australiensis, N. lovaniensis, and N. gruberi all induced sufficient damage to radiolabeled B-103 cells to cause a significant release of chromium. The cytotoxic activity present in the cell-free lysates of N. fowleri can be recovered in the supernatant fluid following centrifugation at 100,000xg and precipitation of the 100,000xg supernatant fluid with ammonium sulfate. Initial characterization of the cytotoxic factor indicates that it is a heat labile, pH sensitive, soluble protein. The cytotoxic activity is abolished by either extraction, unaffected by repeated freeze-thawing, and is not sensitive to inhibitors of proteolytic enzymes. Phospholipase A activity was detected in the cytotoxic ammonium sulfate precipitable material, suggesting that this enzyme activity may have a role in the cytotoxic activity of the cell-free lysates.

  11. Youth Culture and Cell Phone

    Directory of Open Access Journals (Sweden)

    mohammad saeed zokaei

    2009-11-01

    Full Text Available Iranian youth’s leisure culture has been immediately affected by the digital media culture. As a communicative media, cell phone has crossed borders of youth norms and identity; and in addition to facilitating their communication, has changed its patterns. Applying Bourdieu’s concepts of habitus and field, and relied on the qualitative and quantitative data gathered from the mobile youth users, the present study argues that mobile has produced a new field in which youth’s opportunities for leisure, entertainment, communication, and independence have extended. In addition, cell phone has facilitated and compensated for some defects in public sphere, and therefore empowered youth agency, individuality, and power. Despite this strengthening, cell phone does not cross borders of gender and class differences, or the levels of social capital.

  12. Evaluation of the Antibody in Lymphocyte Supernatant Assay to Detect Active Tuberculosis.

    Directory of Open Access Journals (Sweden)

    Margaretha Sariko

    Full Text Available We aimed to evaluate the antibody in lymphocyte supernatant (ALS assay as a biomarker to diagnose tuberculosis among adults from Tanzania with and without HIV.Adults admitted with suspicion for tuberculosis had sputa obtained for GeneXpert MTB/RIF, acid-fast bacilli smear and mycobacterial culture; blood was obtained prior to treatment initiation and after 4 weeks. Adults hospitalized with non-infectious conditions served as controls. Peripheral blood mononuclear cells were cultured unstimulated for 72 hours. Anti-mycobacterial antibodies were measured from culture supernatants by ELISA, using BCG vaccine as the coating antigen. Median ALS responses were compared between cases and controls at baseline and between cases over time.Of 97 TB cases, 85 were microbiologically confirmed and 12 were clinically diagnosed. Median ALS responses from TB cases (0.366 OD from confirmed cases and 0.285 from clinical cases were higher compared to controls (0.085, p<0.001. ALS responses did not differ based on HIV status, CD4 count or sputum smear status. Over time, the median ALS values declined significantly (0.357 at baseline; 0.198 after 4-weeks, p<0.001.Robust ALS responses were mounted by patients with TB regardless of HIV status, CD4 count, or low sputum bacillary burden, potentially conferring a unique niche for this immunologic biomarker for TB.

  13. Fluorescence Spectrum and Decay Measurement for Hsil VS Normal Cytology Differentiation in Liquid Pap Smear Supernatant

    Science.gov (United States)

    Vaitkuviene, A.; Gegzna, V.; Juodkazis, S.; Jursenas, S.; Miasojedovas, S.; Kurtinaitiene, R.; Rimiene, J.; Vaitkus, J.

    2009-06-01

    Cervical smear material contains endo and exocervical cells, mucus and inflammative, immune cells in cases of pathology. Just not destroyed keratinocytes lay on the glass for microscopy. Liquid cytology supernatant apart other diagnostics could be used for photodiagnostic. The spectroscopic parameters suitable for Normal and HSIL cytology groups supernatant differentiation are demonstrated. The dried liquid PAP supernatant fractions—sediment and liquid were investigated. Excitation and emission matrices (EEM), supernatant fluorescence decay measured under 280 nm diode short pulse excitation and fluorescence spectroscopy by excitation with 355 nm laser light were analyzed. The differences between Normal and HSIL groups were statistically proven in the certain spectral regions. Fluorescence decay peculiarities show spectral regions consisting of few fluorophores. Obtained results on fluorescence differences in Normal and HSIL groups' supernatant shows the potency of photodiagnosis application in cervical screening.

  14. Neutralization sensitivity of cell culture-passaged simian immunodeficiency virus.

    Science.gov (United States)

    Means, R E; Greenough, T; Desrosiers, R C

    1997-10-01

    CEMx174- and C8166-45-based cell lines which contain a secreted alkaline phosphatase (SEAP) reporter gene under the control of a tat-responsive promoter derived from either SIVmac239 or HIV-1(NL4-3) were constructed. Basal levels of SEAP activity from these cell lines were low but were greatly stimulated upon transfection of tat expression plasmids. Infection of these cell lines with simian immunodeficiency virus (SIV) or human immunodeficiency virus type 1 (HIV-1) resulted in a dramatic increase in SEAP production within 48 to 72 h that directly correlated with the amount of infecting virus. When combined with chemiluminescent measurement of SEAP activity in the cell-free supernatant, these cells formed the basis of a rapid, sensitive, and quantitative assay for SIV and HIV infectivity and neutralization. Eight of eight primary isolates of HIV-1 that were tested induced readily measurable SEAP activity in this system. While serum neutralization of cloned SIVmac239 was difficult to detect with other assays, neutralization of SIVmac239 was readily detected at low titers with this new assay system. The neutralization sensitivities of two stocks of SIVmac251 with different cell culture passage histories were tested by using sera from SIV-infected monkeys. The primary stock of SIVmac251 had been passaged only twice through primary cultures of rhesus monkey peripheral blood mononuclear cells, while the laboratory-adapted stock had been extensively passaged through the MT4 immortalized T-cell line. The primary stock of SIVmac251 was much more resistant to neutralization by a battery of polyclonal sera from SIV-infected monkeys than was the laboratory-adapted virus. Thus, SIVmac appears to be similar to HIV-1 in that extensive laboratory passage through T-cell lines resulted in a virus that is much more sensitive to serum neutralization.

  15. Basic Techniques in Mammalian Cell Tissue Culture.

    Science.gov (United States)

    Phelan, Katy; May, Kristin M

    2016-11-01

    Cultured mammalian cells are used extensively in cell biology studies. It requires a number of special skills in order to be able to preserve the structure, function, behavior, and biology of the cells in culture. This unit describes the basic skills required to maintain and preserve cell cultures: maintaining aseptic technique, preparing media with the appropriate characteristics, passaging, freezing and storage, recovering frozen stocks, and counting viable cells. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  16. Evaluation of Antigen-Specific IgM and IgG Production during an In Vitro Peripheral Blood Mononuclear Cell Culture Assay

    Directory of Open Access Journals (Sweden)

    Yoshiko Matsuda

    2017-07-01

    Full Text Available The recent attention given to diseases associated with memory B-cell (mBC-produced antibodies (Abs suggests the need for a similar in vitro assay to evaluate the functions of mBCs. Here, we cultured peripheral blood mononuclear cells (PBMCs with the intent to collect mBC-derived Abs in vitro and maintain their cell–cell contact-dependent interactions with helper T-cells. PBMCs were cultured with interleukin (IL-21, CpG-oligodeoxynucleotides (ODN, phorbol myristate acetate (PMA, and phytohemagglutinin/leucoagglutinin (PHA-L in 24-well flat-bottom plates (5 × 105 cells/well. A culture supernatant analysis of PBMCs from healthy donors (n = 10 indicated that antigen-specific IgM Ab levels in a PBMC culture supernatant might be better able to demonstrate the antigen sensitization status in a smaller peripheral blood sample, compared to IgG because Epstein–Barr virus-specific IgM mBCs circulate peripherally at a significantly higher frequency once antiviral humoral immunity has stabilized. Thus, our in vitro assay demonstrated the potential significance of antigen-specific IgM Ab production in the culture supernatants. Furthermore, an analysis of cultured PBMCs from allograft kidney recipients (n = 16 sensitized with de novo donor-specific human leukocyte antigen (HLA-specific Abs (DSAs showed that IgM-type HLA-specific Abs were detected mainly from the culture supernatants from PBMCs of patients with stable graft function, whereas IgG isotype HLA Abs were detectable only from patients with biopsy-proven antibody-mediated rejection. In other words, these IgG isotype Abs also represented an activated humoral immune response in vivo. Additionally, IgM- and IgG-expressing mBCs from healthy donors (n = 5 were cultured with IL-21, CpG-ODN, and a supernatant produced by stimulating CD19+ B-cell-depleted PBMCs with PHA-L and PMA in 24-well flat-bottom plates (1 × 105 cells/well, and the resulting in vitro analysis provided some

  17. Modulation of the nicotinic alpha-bungarotoxin site in chromaffin cells in culture by a factor(s) endogenous to neuronal tissue.

    Science.gov (United States)

    Quik, M; Fournier, S; Trifaró, J M

    1986-04-30

    An endogenous factor(s) which affects the in vitro binding of (alpha-BGT) to rat brain membranes has previously been found in brain supernatant. This fraction, as well as a partially purified preparation of this material from bovine brain, is here shown to affect the binding of alpha-BGT to chromaffin cell membranes. To study possible long term effects, the supernatant extract was added to adrenal medullary chromaffin cells in culture. The cells were incubated for several days and at the end of this time, the medium bathing the cells, which contained the endogenous factor(s), was removed and alpha-BGT binding to the cells measured. Binding to control cultures had shown that alpha-BGT bound to the chromaffin cells in a saturable manner, with high affinity (Kd = 1.5 nM) and the specificity of a nicotinic receptor ligand. After incubation of the cells with supernatant factor, a marked decline in the number of alpha-BGT binding sites was observed with no change in affinity. This does not appear to be due to a detrimental effect on the cells as cell number did not appear to be decreased in the cultures preincubated with the supernatant extract and the DNA and protein content were similar in the control and treated cultures. The possibility that there was some non-specific detrimental effect to the chromaffin cell membrane was considered; however, the stimulated release of noradrenaline from the cells was not affected by treatment of the cultures in the presence of the supernatant fractions. In addition, tyrosine hydroxylase activity was significantly increased in the treated cultures. D-Tubo-curarine, an antagonist at the acetylcholine receptor, caused an increase in alpha-BGT binding after 7 days of treatment, while the agonist nicotine and choline had no effect. These results suggest that in brain supernatant there may exist an endogenous factor(s), which may function in the regulation of the nicotinic-like alpha-BGT receptors in neuronal cell.

  18. Characterization of cysteinyl-leukotriene formation in primary astroglial cell cultures.

    Science.gov (United States)

    Seregi, A; Simmet, T; Schobert, A; Hertting, G

    1990-03-01

    The formation and composition of cysteinyl-leukotrienes (LT) in primary astroglial cell cultures prepared from newborn rat brain has been studied. Small amounts of cysteinyl-LT determined in terms of LTC4-like material in the supernatants of the cultures, became detectable after stimulation of the cells with 10(-5) M ionophore A23187. Cysteinyl-LT formation increased with time, reaching about 600 pg (mg protein)-1 after 60 min incubation. In contrast, considerable thromboxane (TX) B2 synthesis was found at 5 min following A23187-stimulation (about 30 ng TXB2 (mg protein)-1). The synthesis of cysteinyl-LT was abolished by 5 x 10(-5) M nordihydroguaiaretic acid (NDGA). Irrespective of the duration of incubation, blockage of prostanoid synthesis by 10(-6) M indomethacin did not result in increased cysteinyl-LT production. Reversed phase HPLC combined with radioimmunological detection showed that, after 60 min incubation in the presence of A23187, LTC4 and LTD4 accounted for practically all the LTC4-like immunoreactive material in the supernatants of cell cultures. No significant amounts of LTE4 could be detected. The results show that astrocytes may contribute to brain LTC4 and LTD4 synthesis. However, the cellular site of cerebral LTE4 formation seems to be other than the astroglia.

  19. 9 CFR 101.6 - Cell cultures.

    Science.gov (United States)

    2010-01-01

    ... used in conjunction with or in reference to cell cultures, which may be referred to as tissue cultures... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Cell cultures. 101.6 Section 101.6 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES...

  20. DEVELOPMENT OF PRIMARY CELL CULTURE FROM TAIL EPIDERMAL TISSUE OF KOI CARP (Cyprinus carpio koi

    Directory of Open Access Journals (Sweden)

    Lila Gardenia

    2014-06-01

    Full Text Available Primary cell culture from tail epidermal tissue of koi carp (Cyprinus carpio koi was developed. Cells were grown in Leibovits-15 medium supplemented with 20% fetal bovine serum and antibiotics (Penicillin/Streptomycin and Kanamycin. Cell growth was observed in a range of incubation temperature (17oC±2oC, 22oC±2oC, 27oC±2oC, and 32oC±2oC in order to determine the optimum temperature. The cells were able to grow at a range of temperature between 17oC to 32oC with optimal growth at 22oC. Primary cells infected with koi herpes virus produced typical cytopathic effects characterized by severe vacuolation and deformation of nuclei, which is consistent with those of previous reports. Artificial injection experiment by using supernatant koi herpes virus SKBM-1 isolate revealed that it could cause 90% mortality in infected fish within two weeks. PCR test with Sph I-5 specific primers carried out with DNA template from supernatant virus, pellet cell, and gills of infected fish showed positive results in all samples (molecular weight of DNA target 290 bp. The cells were found to be susceptible to koi herpes virus and can be used for virus propagation.

  1. Gamma interferon and interleukin 2, but not interleukin 4, are detectable in gamma/delta T-cell cultures after activation with bacteria.

    OpenAIRE

    Follows, G A; Munk, M E; Gatrill, A J; Conradt, P; Kaufmann, S H

    1992-01-01

    Mycobacterium tuberculosis- or group A streptococcus-activated gamma/delta T cells from normal healthy individuals were negatively sorted and restimulated in vitro from 48 h. Significant amounts of gamma interferon were detected after restimulation with M. tuberculosis, group A streptococci, or Listeria monocytogenes. In contrast, interleukin 4 was undetectable in the culture supernatants. Our findings provide indirect evidence for the involvement of gamma/delta T cells in immunity against tu...

  2. Mass production of aphicidal Beauveria bassiana SFB-205 supernatant with the parameter of chitinase.

    Science.gov (United States)

    Kim, Jae Su; Je, Yeon Ho; Yu, Yong-Man

    2011-06-01

    Beauveria bassiana SFB-205 supernatant can effectively control cotton aphid populations, which is closely associated with its chitinase activity. The present work extends to optimizing a culture medium to produce more efficacious supernatant in flask conditions, followed by scale-up in 7 L, 300 L and 1.2 KL fermentors with the parameter of chitinase. In flask conditions, a combination of soluble starch and yeast extract produced the greatest amount of chitinase (5.1 units/ml) and its supernatant had the highest aphicidal activity. An optimal quantitative combination of the two substrates, estimated by a response surface method, enabled the supernatant to have 15.7 units/ml of chitinase activity and 3.7 ml/l of median lethal concentration (LC50) of toxicity against cotton aphid adults in laboratory conditions. In the scale-up conditions, overall supernatant had 25-28 units/ml of chitinase activity. Decrease in pH and limitation of dissolved oxygen (DO) during cultures were significantly related to the yield of chitinase. These results suggest that the substrate-dependent chitinase production can be background information for optimizing a culture medium, and pH and DO are critical factors in maximizing the production in scale-up conditions.

  3. Characterization of a Cell-Culturing System for the Study of Contact-Independent Extracellular Vesicle Communication

    Directory of Open Access Journals (Sweden)

    Anne Louise Schacht Revenfeld

    2016-02-01

    Full Text Available Appropriate and well-documented in vitro cell-culturing systems are necessary to study the activity and biological function of extracellular vesicles (EVs. The aim of this study was to describe an experimental system, in which dynamic, vesicle-based cell communication can be investigated. A commercially available cell-culturing system was applied to study contact-independent cell communication, which separated two cell populations using a membrane with a pore size of 0.4 μm. The EV exchange characteristics between the two compartments in the culture set-up was preliminarily investigated in a cell-free set-up, and analysed using the Extracellular Vesicle (EV Array and Nanoparticle Tracking Analysis. The application of the cell-culturing set-up was demonstrated using co-cultures of human primary cells. The effects of the relative placement of the two cell populations on the phenotype of EVs found in the cell supernatant were investigated. The results indicate that this placement can be important for the biological hypothesis that is being investigated. These observations are relevant for short (<24h as well as long (several days studies of vesicle-based cell communication. Moreover, the introduced cell-culturing set-up and analytical strategy can be used to study contact-independent vesicle communication in a reproducible manner.

  4. Screening of Cytotoxic B. cereus on Differentiated Caco-2 Cells and in Co-Culture with Mucus-Secreting (HT29-MTX) Cells

    Science.gov (United States)

    Castiaux, Virginie; Laloux, Laurie; Schneider, Yves-Jacques; Mahillon, Jacques

    2016-01-01

    B. cereus is an opportunistic foodborne pathogen able to cause diarrhoea. However, the diarrhoeal potential of a B. cereus strain remains difficult to predict, because no simple correlation has yet been identified between the symptoms and a unique or a specific combination of virulence factors. In this study, 70 B. cereus strains with different origins (food poisonings, foods and environment) have been selected to assess their enterotoxicity. The B. cereus cell-free supernatants have been tested for their toxicity in vitro, on differentiated (21 day-old) Caco-2 cells, using their ATP content, LDH release and NR accumulation. The genetic determinants of the main potential enterotoxins and virulence factors (ces, cytK, entFM, entS, hbl, nhe, nprA, piplC and sph) have also been screened by PCR. This analysis showed that none of these genes was able to fully explain the enterotoxicity of B. cereus strains. Additionally, in order to assess a possible effect of the mucus layer in vitro, a cytotoxicity comparison between a monoculture (Caco-2 cells) and a co-culture (Caco-2 and HT29-MTX mucus-secreting cells) model has been performed with selected B. cereus supernatants. It appeared that, in these conditions, the mucus layer had no notable influence on the cytotoxicity of B. cereus supernatants. PMID:27827957

  5. 3D Cell Culture in Alginate Hydrogels

    Directory of Open Access Journals (Sweden)

    Therese Andersen

    2015-03-01

    Full Text Available This review compiles information regarding the use of alginate, and in particular alginate hydrogels, in culturing cells in 3D. Knowledge of alginate chemical structure and functionality are shown to be important parameters in design of alginate-based matrices for cell culture. Gel elasticity as well as hydrogel stability can be impacted by the type of alginate used, its concentration, the choice of gelation technique (ionic or covalent, and divalent cation chosen as the gel inducing ion. The use of peptide-coupled alginate can control cell–matrix interactions. Gelation of alginate with concomitant immobilization of cells can take various forms. Droplets or beads have been utilized since the 1980s for immobilizing cells. Newer matrices such as macroporous scaffolds are now entering the 3D cell culture product market. Finally, delayed gelling, injectable, alginate systems show utility in the translation of in vitro cell culture to in vivo tissue engineering applications. Alginate has a history and a future in 3D cell culture. Historically, cells were encapsulated in alginate droplets cross-linked with calcium for the development of artificial organs. Now, several commercial products based on alginate are being used as 3D cell culture systems that also demonstrate the possibility of replacing or regenerating tissue.

  6. Isolation and culture of pulmonary endothelial cells.

    OpenAIRE

    Ryan, U S

    1984-01-01

    Methods for isolation, identification and culture of pulmonary endothelial cells are now routine. In the past, methods of isolation have used proteolytic enzymes to detach cells; thereafter, traditional methods for cell passaging have used trypsin/EDTA mixtures. Cells isolated and passaged using proteolytic enzymes have been useful in establishing the field and in verifying certain endothelial properties. However, there is a growing awareness of the role of endothelial cells in processing vas...

  7. In vivo activity of a nonspecific T cell-replacing factor.

    Science.gov (United States)

    Kindred, B; Bösing-Schneider, R; Corley, R B

    1979-01-01

    Nonspecific T cell-replacing factors prepared as supernatants from mixed lymphocyte cultures or concanavalin A-stimulated spleen cells are active in vivo iv injected into nude mice at least 3 days before antigen. The supernatants appear to act by enhancing the week IgM responses that occur in untreated nudes. Secondary responses and IgG antibody were not found.

  8. Effect of Passage Number and Culture Time on the Expression and Activity of Insulin-Degrading Enzyme in Caco-2 Cells

    Science.gov (United States)

    Mohammadi Farsani, Taiebeh; Motevaseli, Elahe; Neyazi, Nadia; Khorramizadeh, Mohammad Reza; Zafarvahedian, Elaheh; Ghahremani, Mohammad Hossein

    2018-01-01

    Insulin-degrading enzyme (IDE) is a conserved zinc metallopeptidase. Here, we have evaluated the effect of passage number and culture time on IDE expression and activity in colorectal adenocarcinoma cell line (Caco-2). Caco-2 cells were cultured with different passage ranges of 5-15, 25-35, 52-63 for 48, 72, and 120 hours. Subsequently, IDE expression and enzyme activity were assessed by Western blot analysis and fluorescent assay, respectively. Our results confirmed that the amount of IDE was higher in cell extract compared to supernatant, and different passage numbers and culture times had small effect on IDE expression. However, when cells were cultured in the passage number range of 5-15 for 72 hours, the IDE activity was 35% higher compared to other passage numbers (p Caco-2 cells at passage number range of 5-15 and culture time of 72 hours provides proper conditions for IDE-related studies.

  9. Advances in 3D neuronal cell culture

    NARCIS (Netherlands)

    Frimat, Jean Philippe; Xie, Sijia; Bastiaens, Alex; Schurink, Bart; Wolbers, Floor; Den Toonder, Jaap; Luttge, Regina

    2015-01-01

    In this contribution, the authors present our advances in three-dimensional (3D) neuronal cell culture platform technology contributing to controlled environments for microtissue engineering and analysis of cellular physiological and pathological responses. First, a micromachined silicon sieving

  10. Culture of Mouse Neural Stem Cell Precursors

    OpenAIRE

    Currle, D. Spencer; Hu, Jia Sheng; Kolski-Andreaco, Aaron; Monuki, Edwin S.

    2007-01-01

    Primary neural stem cell cultures are useful for studying the mechanisms underlying central nervous system development. Stem cell research will increase our understanding of the nervous system and may allow us to develop treatments for currently incurable brain diseases and injuries. In addition, stem cells should be used for stem cell research aimed at the detailed study of mechanisms of neural differentiation and transdifferentiation and the genetic and environmental signals that direct the...

  11. Boildown Study on Supernatant Liquid Retrieved from AW-106 in December 2012

    Energy Technology Data Exchange (ETDEWEB)

    Page, Jason S. [Washington River Protection Solutions LLC, Richland, WA (United States)

    2013-05-01

    This document reports the results of a boildown study using a composite created from supernatant liquid grab samples retrieved from tank 241-AW-106 in December of 2012. The composite was made using predetermined volumes of the grab samples which accounted for layering of the supernatant liquid in the tank. The finished composite was a clear, yellow liquid containing no visible solids at hot cell ambient temperatures (24 - 27 °C). The density of the test composite was measured in the hot cell immediately before the boildown study and was 1.266 g/mL at 27.1 °C.

  12. Isolation and culture of pulmonary endothelial cells.

    Science.gov (United States)

    Ryan, U S

    1984-06-01

    Methods for isolation, identification and culture of pulmonary endothelial cells are now routine. In the past, methods of isolation have used proteolytic enzymes to detach cells; thereafter, traditional methods for cell passaging have used trypsin/EDTA mixtures. Cells isolated and passaged using proteolytic enzymes have been useful in establishing the field and in verifying certain endothelial properties. However, there is a growing awareness of the role of endothelial cells in processing vasoactive substances, in responding to hormones and other agonists and in cell-cell interactions with other cell types of the vascular wall, with blood cells and with cellular products. Consequently, a new requirement has arisen for cells in vitro that maintain the differentiated properties of their counterparts in vivo. The deleterious effects of trypsin and other proteolytic enzymes commonly used in cell culture on surface structures of endothelial cells such as enzymes, receptors and junctional proteins, as well as on extracellular layers such as the glycocalyx or "endothelial fuzz," have led to the development of methods that avoid use of proteolytic enzymes at both the isolation step and during subsequent subculture. This chapter describes traditional methods for isolating pulmonary endothelial cells but emphasizes newer approaches using mechanical harvest and scale-up using microcarriers. The new methods allow maintenance of long-term, large-scale cultures of cells that retain the full complement of surface properties and that maintain the cobblestone monolayer morphology and differentiated functional properties. Methods for identification of isolated cells are therefore also considered as methods for validation of cultures during their in vitro lifespan.

  13. Treatment of supernatant from sewage sludge by elctron beam irradiation

    International Nuclear Information System (INIS)

    Arai, Hidehiko; Sugiyama, Masashi; Shimizu, Ken.

    1988-01-01

    Part of the results was presented on the investigation of treatment of supernatant from sewage sludge by combination of electron beam irradiation and microbiological treatment. Supernatant is electron-beam irradiated after microbiologically treated, and then treated microbiologically again. Based this method, by irradiation of 10 kGy, chemical oxygen demand (COD) in supernatant can be decreased lower than 30 ppm. Moreover, electron-beam irradiation induces remarkable decolorization and deodorization. (author)

  14. Melphalan metabolism in cultured cells

    International Nuclear Information System (INIS)

    Seagrave, J.C.; Valdez, J.G.; Tobey, R.A.; Gurley, L.R.

    1985-06-01

    Procedures are presented for the adaptation of reversed-phase-HPLC methods to accomplish separation and isolation of the cancer therapeutic drug melphalan (L-phenylalanine mustard) and its metabolic products from whole cells. Five major degradation products of melphalan were observed following its hydrolysis in phosphate buffer in vitro. The two most polar of these products (or modifications of them) were also found in the cytosol of Chinese hamster CHO cells. The amounts of these two polar products (shown not to be mono- or dihydroxymelphalan) were significantly changed by the pretreatment of cells with ZnC1 2 , one being increased in amount while the other was reduced to an insignificant level. In ZnC1 2 -treated cells, there was also an increased binding of melphalan (or its derivatives) to one protein fraction resolved by gel filtration-HPLC. These observations suggest that changes in polar melphalan products, and perhaps their interaction with a protein, may by involved in the reduction of melphalan cytotoxicity observed in ZnC1 2 -treated cells. While ZnC1 2 is also known to increase the level of glutathione in cells, no significant amounts of glutathione-melphalan derivatives of the type formed non-enzymatically in vitro could be detected in ZnC1 2 -treated or untreated cells. Formation of derivatives of melphalan with glutathione catabolic products in ZnC1 2 -treated cells has not yet been eliminated, however. 17 refs., 5 figs., 1 tab

  15. Henrietta Lacks, HeLa cells, and cell culture contamination.

    Science.gov (United States)

    Lucey, Brendan P; Nelson-Rees, Walter A; Hutchins, Grover M

    2009-09-01

    Henrietta Lacks died in 1951 of an aggressive adenocarcinoma of the cervix. A tissue biopsy obtained for diagnostic evaluation yielded additional tissue for Dr George O. Gey's tissue culture laboratory at Johns Hopkins (Baltimore, Maryland). The cancer cells, now called HeLa cells, grew rapidly in cell culture and became the first human cell line. HeLa cells were used by researchers around the world. However, 20 years after Henrietta Lacks' death, mounting evidence suggested that HeLa cells contaminated and overgrew other cell lines. Cultures, supposedly of tissues such as breast cancer or mouse, proved to be HeLa cells. We describe the history behind the development of HeLa cells, including the first published description of Ms Lacks' autopsy, and the cell culture contamination that resulted. The debate over cell culture contamination began in the 1970s and was not harmonious. Ultimately, the problem was not resolved and it continues today. Finally, we discuss the philosophical implications of the immortal HeLa cell line.

  16. Flux analysis of mammalian cell culture

    NARCIS (Netherlands)

    Martens, D.E.; Tramper, J.

    2010-01-01

    Animal cells are used for the production of vaccines and pharmaceutical proteins. The increase in demand for these products requires an increase in volumetric productivity of animal cell culture processes, which can be attained through an increase in biomass concentration and/or specific

  17. Human cell culture in a space bioreactor

    Science.gov (United States)

    Morrison, Dennis R.

    1988-01-01

    Microgravity offers new ways of handling fluids, gases, and growing mammalian cells in efficient suspension cultures. In 1976 bioreactor engineers designed a system using a cylindrical reactor vessel in which the cells and medium are slowly mixed. The reaction chamber is interchangeable and can be used for several types of cell cultures. NASA has methodically developed unique suspension type cell and recovery apparatus culture systems for bioprocess technology experiments and production of biological products in microgravity. The first Space Bioreactor was designed for microprocessor control, no gaseous headspace, circulation and resupply of culture medium, and slow mixing in very low shear regimes. Various ground based bioreactors are being used to test reactor vessel design, on-line sensors, effects of shear, nutrient supply, and waste removal from continuous culture of human cells attached to microcarriers. The small Bioreactor is being constructed for flight experiments in the Shuttle Middeck to verify systems operation under microgravity conditions and to measure the efficiencies of mass transport, gas transfer, oxygen consumption and control of low shear stress on cells.

  18. A significant proportion of normal resting B cells are induced to secrete immunoglobulin through contact with anti-receptor antibody-activated helper T cells in clonal cultures

    DEFF Research Database (Denmark)

    Riedel, C; Owens, T; Nossal, G J

    1988-01-01

    cell line E9.D4 was stimulated with the anti-V beta 8 antibody F23.1 bound to the plastic of Terasaki 10-ul culture wells. When an excess of T helper lymphocytes was used (1,000 X-irradiated or 600 unirradiated, stimulated E9.D4 cells), 10-25% of B cells responded by antibody formation as judged...... by an enzyme-linked immunosorbent assay performed after 5 days of culture. When one of a very small number of B cells were present, the rate-limiting step to antibody-forming cell formation was the number of T cells present. Far fewer T cells sufficed for stimulation when culture trays were tilted to force T...... and B cells into proximity at the sulcus formed at the bottom edge of the culture wells. When T cell numbers were limiting, unirradiated T cells out-performed irradiated T cells. Some cell clones held for 7 days switched to IgG antibody production. E9.D4 supernatants were virtually ineffective...

  19. Increasing cell culture population doublings for long-term growth of finite life span human cell cultures

    Science.gov (United States)

    Stampfer, Martha R; Garbe, James C

    2015-02-24

    Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.

  20. A novel cell growth-promoting factor identified in a B cell leukemia cell line, BALL-1

    International Nuclear Information System (INIS)

    Dao, T.; Holan, V.; Minowada, J.

    1993-01-01

    A novel leukemia cell growth-promoting activity has been identified in the culture supernatant from a human B cell leukemia cell line, BALL-1. The supernatant from unstimulated cultures of the BALL-1 cells significantly promoted the growth of 16 out of 24 leukemia/lymphoma cell lines of different lineages (T, B and non-lymphoid) in a minimal concentration of fetal bovine serum (FBS), and 5 out of 12 cases of fresh leukemia cells in FBS-free medium. The growth-promoting sieve filtration and dialysis. The MW of the factor was less than 10 kDa. The growth-promoting activity was heat and acid stable and resistant to trypsin treatment. The factor isolated from the BALL-1 supernatant was distinct from known polypeptide growth factors with MW below 10 kDa, such as epidermal growth factor, transforming growth factor α, insulin-like growth factor I (IGF-I), IGF-II and insulin, as determine by specific antibodies and by cell-growth-promoting tests. The factor is the BALL-1 supernatant did not promote the proliferation of normal human fresh peripheral blood lymphocytes or mouse fibroblast cell line, BALB/C 3T3. In addition to the BALL-1 supernatant, a similar growth-promoting activity was found in the culture supernatant from 13 of 17 leukemia/lymphoma cell lines tested. The activity in these culture supernatant promoted the growth of leukemia/lymphoma cell lines in autocrine and/or paracrine fashions. These observations suggest that the low MW cell growth-promoting activity found in the BALL-1 culture supernatant is mediated by a novel factor which may be responsible for the clonal expansion of particular leukemic clones. (author)

  1. 21 CFR 864.2280 - Cultured animal and human cells.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cultured animal and human cells. 864.2280 Section... (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Cell And Tissue Culture Products § 864.2280 Cultured animal and human cells. (a) Identification. Cultured animal and human cells are in vitro...

  2. Cell Culture on MEMS Platforms: A Review

    Science.gov (United States)

    Ni, Ming; Tong, Wen Hao; Choudhury, Deepak; Rahim, Nur Aida Abdul; Iliescu, Ciprian; Yu, Hanry

    2009-01-01

    Microfabricated systems provide an excellent platform for the culture of cells, and are an extremely useful tool for the investigation of cellular responses to various stimuli. Advantages offered over traditional methods include cost-effectiveness, controllability, low volume, high resolution, and sensitivity. Both biocompatible and bio-incompatible materials have been developed for use in these applications. Biocompatible materials such as PMMA or PLGA can be used directly for cell culture. However, for bio-incompatible materials such as silicon or PDMS, additional steps need to be taken to render these materials more suitable for cell adhesion and maintenance. This review describes multiple surface modification strategies to improve the biocompatibility of MEMS materials. Basic concepts of cell-biomaterial interactions, such as protein adsorption and cell adhesion are covered. Finally, the applications of these MEMS materials in Tissue Engineering are presented. PMID:20054478

  3. Response to Dengue virus infections altered by cytokine-like substances from mosquito cell cultures

    Directory of Open Access Journals (Sweden)

    Laosutthipong Chaowanee

    2010-11-01

    Full Text Available Abstract Background With both shrimp and commercial insects such as honey bees, it is known that stable, persistent viral infections characterized by absence of disease can sometimes shift to overt disease states as a result of various stress triggers and that this can result in serious economic losses. The main research interest of our group is to understand the dynamics of stable viral infections in shrimp and how they can be destabilized by stress. Since there are no continuous cell lines for crustaceans, we have used a C6/36 mosquito cell line infected with Dengue virus to test hypotheses regarding these interactions. As a result, we accidentally discovered two new cytokine-like substances in 5 kDa extracts from supernatant solutions of acutely and persistently infected mosquito cells. Results Naïve C6/36 cells were exposed for 48 h to 5 kDa membrane filtrates prepared from the supernatant medium of stable C6/36 mosquito cell cultures persistently-infected with Dengue virus. Subsequent challenge of naïve cells with a virulent stock of Dengue virus 2 (DEN-2 and analysis by confocal immunofluorescence microscopy using anti-DEN-2 antibody revealed a dramatic reduction in the percentage of DEN-2 infected cells when compared to control cells. Similar filtrates prepared from C6/36 cells with acute DEN-2 infections were used to treat stable C6/36 mosquito cell cultures persistently-infected with Dengue virus. Confocal immunofluorescence microscopy revealed destabilization in the form of an apoptosis-like response. Proteinase K treatment removed the cell-altering activities indicating that they were caused by small polypeptides similar to those previously reported from insects. Conclusions This is the first report of cytokine-like substances that can alter the responses of mosquito cells to Dengue virus. This simple model system allows detailed molecular studies on insect cytokine production and on cytokine activity in a standard insect cell line.

  4. Effects of radiation on cultured fish cells

    International Nuclear Information System (INIS)

    Etoh, Hisami; Suyama, Ippei

    1980-01-01

    A new fibroblastic cell line was established in our laboratory from the caudal fin of the goldfish, C. auratus. The cells, designated CAF, have been subcultured over 80 passages since initiation in August, 1977. A brief description of cell cultivation and colony formation is presented. The plating efficiency obtained was considerably higher than those reported for other fish cell lines. CAF cells were irradiated with 250, 500, 1,000, 2,000, and 3,000 R of x-rays at a dose rate of 80 R/min in air. The survival parameters changed when the number of passages of culture increased. Values for D 0 , D sub(q), and n obtained from cells irradiated at the 70th passage were calculated to be 650 R, 700 R, and 2.7 respectively. Thus CAF cells would be several times as resistant in general as cultured mammalian cells. The cells irradiated with 1,000 R of x-rays received a second dose from 250 to 2,000 R at intervals of 3, 6, and 24 hr. The cells kept at 26 0 C showed a pronounced recovery from sublethal damage during the intervals between two doses. Magnitude of recovery was larger if the interval was longer under the present experimental conditions. These results may indicate that the recovery observed at an individual level accounts partly for that in vitro. (author)

  5. Embryo forming cells in carrot suspension cultures

    NARCIS (Netherlands)

    Toonen, M.A.J.

    1997-01-01


    Somatic cells of many plant species can be cultured in vitro and induced to form embryos that are able to develop into mature plants. This process, termed somatic embryogenesis, was originally described in carrot (Daucus carota L.). Somatic embryos develop through the same characteristic

  6. Nanotechnology, Cell Culture and Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Kazutoshi Haraguchi

    2011-01-01

    Full Text Available We have fabricated new types of polymer hydrogels and polymer nanocomposites, i.e., nanocomposite gels (NC gels and soft, polymer nanocomposites (M-NCs: solid, with novel organic/inorganic network structures. Both NC gels and M-NCs were synthesized by in-situ free-radical polymerization in the presence of exfoliated clay platelets in aqueous systems and were obtained in various forms such as film, sheet, tube, coating, etc. and sizes with a wide range of clay contents. Here, disk-like inorganic clay nanoparticles act as multi-functional crosslinkers to form new types of network systems. Both NC gels and M-NCs have extraordinary optical and mechanical properties including ultra-high reversible extensibility, as well as a number of new characteristics relating to optical anisotropy, polymer/clay morphology, biocompatibility, stimuli-sensitive surfaces, micro-patterning, etc. For examples, the biological testing of medical devices, comprised of a sensitization test, an irritation test, an intracutaneous test and an in vitro cytotoxicity test,was carried out for NC gels and M-NCs. The safety of NC gels and M-NCs was confirmed in all tests. Also, the interaction of living tissue with NC gel was investigated in vivo by implantation in live goats; neither inflammation nor concrescence occurred around the NC gels. Furthermore, it was found that both N-NC gels consisting of poly(N-isopropylacrylamide(PNIPA/clay network and M-NCs consisting of poly(2-methoxyethyacrylate(PMEA/clay network show characteristic cell culture and subsequent cell detachment on their surfaces, although it was almost impossible to culture cells on conventional, chemically-crosslinked PNIPA hydrogels and chemically crossslinked PMEA, regardless of their crosslinker concentration. Various kinds of cells, such ashumanhepatoma cells (HepG2, normal human dermal fibroblast (NHDF, and human umbilical vein endothelial cells (HUVEC, could be cultured to be confluent on the surfaces of N

  7. The function of TLR4 in interferon gamma or interleukin-13 exposed and lipopolysaccharide stimulated gingival epithelial cell cultures.

    Science.gov (United States)

    Beklen, A; Sarp, A S; Uckan, D; Tsaous Memet, G

    2014-10-01

    Gingival epithelial cells are part of the first line of host defense against infection. Toll-like receptors (TLRs) serve important immune and nonimmune functions. We investigated how interferon gamma (INF-γ) and interleukin 13 (IL-13) are involved in the TLR4 ligand-induced regulation of interleukin-8 (IL-8) effects on gingival epithelial cells. We used immunohistochemistry to localize TLR4 in ten healthy and ten periodontitis tissue specimens. Gingival epithelial cells then were primed with Th1 cytokine (INF-γ) or Th2 cytokine (IL-13) before stimulation with Escherichia coli-derived lipopolysaccharide (LPS) and enzyme-linked immunosorbent assay (ELISA) was performed to detect the level of IL-8 secretion in cell culture supernatants. Although both healthy and periodontitis gingival tissue samples expressed TLR4, the periodontitis samples showed more intense expression on gingival epithelial cells. Gingival epithelial cell cultures were primed with either INF-γ or IL-13 before stimulation with TLR4 ligand. Supernatants from co-stimulated epithelial cells exhibited IL-8 production in opposite directions, i.e., as one stimulates the release, the other reduces the release. INF-γ significantly increased TLR4 function, whereas IL-13 significantly decreased TLR4 function, i.e., production of IL-8. Pathogen associated molecular pattern-LPS, shared by many different periodonto-pathogenic bacteria, activates the gingival epithelial cells in a TLR-dependent manner. Diminished or increased TLR function in gingival epithelial cells under the influence of different Th cell types may protect or be harmful due to the altered TLR signaling.

  8. Cell Culture Assay for Human Noroviruses [response

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Honer Zu Bentrup, Kerstin; Orosz Coghlan, Patricia; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza A.; Nickerson, Cheryl A.

    2007-07-01

    We appreciate the comments provided by Leung et al., in response to our recently published article “In Vitro Cell Culture Infectivity Assay for Human Noroviruses” by Straub et al. (1). The specific aim of our project was to develop an in vitro cell culture infectivity assay for human noroviruses (hNoV) to enhance risk assessments when they are detected in water supplies. Reverse transcription (RT) qualitative or quantitative PCR are the primary assays for waterborne NoV monitoring. However, these assays cannot distinguish between infectious vs. non-infectious virions. When hNoV is detected in water supplies, information provided by our infectivity assay will significantly improve risk assessment models and protect human health, regardless of whether we are propagating NoV. Indeed, in vitro cell culture infectivity assays for the waterborne pathogen Cryptosporidium parvum that supplement approved fluorescent microscopy assays, do not result in amplification of the environmentally resistant hard-walled oocysts (2). However, identification of life cycle stages in cell culture provides evidence of infectious oocysts in a water supply. Nonetheless, Leung et al.’s assertion regarding the suitability of our method for the in vitro propagation of high titers of NoV is valid for the medical research community. In this case, well-characterized challenge pools of virus would be useful for developing and testing diagnostics, therapeutics, and vaccines. As further validation of our published findings, we have now optimized RT quantitative PCR to assess the level of viral production in cell culture, where we are indeed finding significant increases in viral titer. The magnitude and time course of these increases is dependent on both virus strain and multiplicity of infection. We are currently preparing a manuscript that will discuss these findings in greater detail, and the implications this may have for creating viral challenge pools

  9. Metabolic effects of influenza virus infection in cultured animal cells: Intra- and extracellular metabolite profiling

    Directory of Open Access Journals (Sweden)

    Genzel Yvonne

    2010-05-01

    Full Text Available Abstract Background Many details in cell culture-derived influenza vaccine production are still poorly understood and approaches for process optimization mainly remain empirical. More insights on mammalian cell metabolism after a viral infection could give hints on limitations and cell-specific virus production capacities. A detailed metabolic characterization of an influenza infected adherent cell line (MDCK was carried out based on extracellular and intracellular measurements of metabolite concentrations. Results For most metabolites the comparison of infected (human influenza A/PR/8/34 and mock-infected cells showed a very similar behavior during the first 10-12 h post infection (pi. Significant changes were observed after about 12 h pi: (1 uptake of extracellular glucose and lactate release into the cell culture supernatant were clearly increased in infected cells compared to mock-infected cells. At the same time (12 h pi intracellular metabolite concentrations of the upper part of glycolysis were significantly increased. On the contrary, nucleoside triphosphate concentrations of infected cells dropped clearly after 12 h pi. This behaviour was observed for two different human influenza A/PR/8/34 strains at slightly different time points. Conclusions Comparing these results with literature values for the time course of infection with same influenza strains, underline the hypothesis that influenza infection only represents a minor additional burden for host cell metabolism. The metabolic changes observed after12 h pi are most probably caused by the onset of apoptosis in infected cells. The comparison of experimental data from two variants of the A/PR/8/34 virus strain (RKI versus NIBSC with different productivities and infection dynamics showed comparable metabolic patterns but a clearly different timely behavior. Thus, infection dynamics are obviously reflected in host cell metabolism.

  10. Lipoprotein receptors in cultured bovine endothelial cells

    International Nuclear Information System (INIS)

    Struempfer, A.E.M.

    1983-07-01

    In this study, receptors that may be involved in the uptake of low density lipoproteins (LDL) and low density lipoproteins which have been modified by acetylation (AcLDL), were characterized. Aortic epithelial cells were used and a cell culture system which closely resembled the in vivo monolayer was established. Endothelial cell and lipoprotein interactions were examined by incubating the cells with 125 l-labelled lipoproteins under various conditions. The receptor affinity of bovine aortic endothelial cells was higher for AcLDL than that for LDL. Competition studies demonstrated that there were two distinct receptors for LDL and AcLDL on the endothelial cells. AcLDL did not compete with LDL for the LDL receptor, and conversely LDL did not compete with AcLDL for the AcLDL receptor. The receptor activities for LDL and AcLDL were examined as a function of culture age. Whereas the LDL receptor could be regulated, the AcLDL receptor was not as susceptible to regulation. Upon exposing endothelial cells for 72 h to either LDL or AcLDL, it was found that the total amount of cellular cholesterol increased by about 50%. However, the increase of total cholesterol was largely in the form of free cholesterol. This is in contrast to macrophages, where the increase in total cholesterol upon exposure to AcLDL is largely in the form cholesteryl esters

  11. Dynamic cell culture system (7-IML-1)

    Science.gov (United States)

    Cogoli, Augusto

    1992-01-01

    This experiment is one of the Biorack experiments being flown on the International Microgravity Laboratory 1 (MIL-1) mission as part of an investigation studying cell proliferation and performance in space. One of the objectives of this investigation is to assess the potential benefits of bioprocessing in space with the ultimate goal of developing a bioreactor for continuous cell cultures in space. This experiment will test the operation of an automated culture chamber that was designed for use in a Bioreactor in space. The device to be tested is called the Dynamic Cell Culture System (DCCS). It is a simple device in which media are renewed or chemicals are injected automatically, by means of osmotic pumps. This experiment uses four Type I/O experiment containers. One DCCS unit, which contains a culture chamber with renewal of medium and a second chamber without a medium supply fits in each container. Two DCCS units are maintained under zero gravity conditions during the on-orbit period. The other two units are maintained under 1 gh conditions in a 1 g centrifuge. The schedule for incubator transfer is given.

  12. A biocompatible micro cell culture chamber (mu CCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, Anders Michael

    2006-01-01

    on cell survival. Low grade light exposure was however compatible with optical recordings as well as cell viability. These results strongly indicate that a cell culture chip could be constructed that allowed for on-line optical recording of cellular events without affecting the cell culturing condition...... culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...

  13. Acetaldehyde and hexanaldehyde from cultured white cells

    Directory of Open Access Journals (Sweden)

    Zaldivar Frank

    2009-04-01

    Full Text Available Abstract Background Noninvasive detection of innate immune function such as the accumulation of neutrophils remains a challenge in many areas of clinical medicine. We hypothesized that granulocytes could generate volatile organic compounds. Methods To begin to test this, we developed a bioreactor and analytical GC-MS system to accurately identify and quantify gases in trace concentrations (parts per billion emitted solely from cell/media culture. A human promyelocytic leukemia cell line, HL60, frequently used to assess neutrophil function, was grown in serum-free medium. Results HL60 cells released acetaldehyde and hexanaldehyde in a time-dependent manner. The mean ± SD concentration of acetaldehyde in the headspace above the cultured cells following 4-, 24- and 48-h incubation was 157 ± 13 ppbv, 490 ± 99 ppbv, 698 ± 87 ppbv. For hexanaldehyde these values were 1 ± 0.3 ppbv, 8 ± 2 ppbv, and 11 ± 2 ppbv. In addition, our experimental system permitted us to identify confounding trace gas contaminants such as styrene. Conclusion This study demonstrates that human immune cells known to mimic the function of innate immune cells, like neutrophils, produce volatile gases that can be measured in vitro in trace amounts.

  14. Mouse cell culture - Methods and protocols

    Directory of Open Access Journals (Sweden)

    CarloAlberto Redi

    2010-12-01

    Full Text Available The mouse is, out of any doubt, the experimental animal par excellence for many many colleagues within the scientific community, notably for those working in mammalian biology (in a broad sense, from basic genetic to modeling human diseases, starting at least from 1664 Robert Hooke experiments on air’s propertyn. Not surprising then that mouse cell cultures is a well established field of research itself and that there are several handbooks devoted to this discipline. Here, Andrew Ward and David Tosh provide a necessary update of the protocols currently needed. In fact, nearly half of the book is devoted to stem cells culture protocols, mainly embryonic, from a list of several organs (kidney, lung, oesophagus and intestine, pancreas and liver to mention some........

  15. Callus and cell suspension cultures of carnation

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1972-01-01

    of growth regulators were observed to be 3 × 10−6M indoleacetic acid (JAA) combined with 3 × 10−6M benzylaminopurin (BAP) or 10−6M 2,4-dichlorophenoxy acetic acid (2,4-D) alone. IAA + BAP caused a 100 fold increase in fresh weight over 4 weeks at 25°C. Addition of casein hydrolysate increased growth further....... Cell suspension cultures worked best in media containing 2,4-D in which they had a doubling time of about 2 days. Filtered suspensions were successfully plated on agar in petri dishes, but division was never observed in single cells. The cultures initiated roots at higher concentrations of IAA or NAA...

  16. Conversion of primordial germ cells to pluripotent stem cells: methods for cell tracking and culture conditions.

    Science.gov (United States)

    Nagamatsu, Go; Suda, Toshio

    2013-01-01

    Primordial germ cells (PGCs) are unipotent cells committed to germ lineage: PGCs can only differentiate into gametes in vivo. However, upon fertilization, germ cells acquire the capacity to differentiate into all cell types in the body, including germ cells. Therefore, germ cells are thought to have the potential for pluripotency. PGCs can convert to pluripotent stem cells in vitro when cultured under specific conditions that include bFGF, LIF, and the membrane-bound form of SCF (mSCF). Here, the culture conditions which efficiently convert PGCs to pluripotent embryonic germ (EG) cells are described, as well as methods used for identifying pluripotent candidate cells during culture.

  17. Indirect immunofluorescence staining of cultured neural cells.

    Science.gov (United States)

    Barbierato, Massimo; Argentini, Carla; Skaper, Stephen D

    2012-01-01

    Immunofluorescence is a technique allowing the visualization of a specific protein or antigen in cells or tissue sections by binding a specific antibody chemically conjugated with a fluorescent dye such as fluorescein isothiocyanate. There are two major types of immunofluorescence staining methods: (1) direct immunofluorescence staining in which the primary antibody is labeled with fluorescence dye and (2) indirect immunofluorescence staining in which a secondary antibody labeled with fluorochrome is used to recognize a primary antibody. This chapter describes procedures for the application of indirect immunofluorescence staining to neural cells in culture.

  18. Cultured epidermal stem cells in regenerative medicine.

    Science.gov (United States)

    Jackson, Catherine J; Tønseth, Kim Alexander; Utheim, Tor Paaske

    2017-07-04

    Transplantation of cultured epidermal cell sheets (CES) has long been used to treat patients with burns, chronic wounds, and stable vitiligo. In patients with large area burns this can be a life-saving procedure. The ultimate goal, however, is to restore all normal functions of the skin and prevent scar formation. Increased focus on the incorporation of epidermal stem cells (EpiSCs) within CES transplants may ultimately prove to be key to achieving this. Transplanted EpiSCs contribute to restoring the complete epidermis and provide long-term renewal.Maintenance of the regenerative potential of EpiSCs is anchorage-dependent. The extracellular matrix (ECM) provides physical cues that are interpreted by EpiSCs and reciprocal signaling between cells and ECM are integrated to determine cell fate. Thus, the carrier scaffold chosen for culture and transplant influences maintenance of EpiSC phenotype and may enhance or detract from regenerative healing following transfer.Long-term effectiveness and safety of genetically modified EpiSCs to correct the severe skin blistering disease epidermolysis bullosa has been shown clinically. Furthermore, skin is gaining interest as an easily accessible source of adult epithelial stem cells potentially useful for restoration of other types of epithelia. This review highlights the role of EpiSCs in the current treatment of skin injury and disease, as well as their potential in novel regenerative medicine applications involving other epithelia.

  19. Ascorbic acid transport into cultured pituitary cells

    International Nuclear Information System (INIS)

    Cullen, E.I.; May, V.; Eipper, R.A.

    1986-01-01

    An amidating enzyme designated peptidyl-glycine α-amidating monooxygenase (PAM) has been studied in a variety of tissues and is dependent on molecular oxygen and stimulated by copper and ascorbic acid. To continue investigating the relationship among cellular ascorbic acid concentrations, amidating ability, and PAM activity, the authors studied ascorbic acid transport in three cell preparations that contain PAM and produce amidated peptides: primary cultures of rat anterior and intermediate pituitary and mouse AtT-20 tumor cells. When incubated in 50 μM [ 14 C]ascorbic acid all three cell preparations concentrated ascorbic acid 20- to 40-fold, producing intracellular ascorbate concentrations of 1 to 2 mM, based on experimentally determined cell volumes. All three cell preparations displayed saturable ascorbic acid uptake with half-maximal initial rates occurring between 9 and 18 μM ascorbate. Replacing NaCl in the uptake buffer with choline chloride significantly diminished ascorbate uptake in all three preparations. Ascorbic acid efflux from these cells was slow, displaying half-lives of 7 hours. Unlike systems that transport dehydroascorbic acid, the transport system for ascorbic acid in these cells was not inhibited by glucose. Thus, ascorbate is transported into pituitary cells by a sodium-dependent, active transport system

  20. A significant proportion of normal resting B cells are induced to secrete immunoglobulin through contact with anti-receptor antibody-activated helper T cells in clonal cultures

    DEFF Research Database (Denmark)

    Riedel, C; Owens, T; Nossal, G J

    1988-01-01

    This report describes single-cell techniques to address the nature of a cellular interaction in which activated T lymphocytes stimulate small resting B cells to develop into antibody-forming cell clones in the absence of any surface immunoglobulin ligand or an antigen bridge. The cloned T helper...... cell line E9.D4 was stimulated with the anti-V beta 8 antibody F23.1 bound to the plastic of Terasaki 10-ul culture wells. When an excess of T helper lymphocytes was used (1,000 X-irradiated or 600 unirradiated, stimulated E9.D4 cells), 10-25% of B cells responded by antibody formation as judged...... and B cells into proximity at the sulcus formed at the bottom edge of the culture wells. When T cell numbers were limiting, unirradiated T cells out-performed irradiated T cells. Some cell clones held for 7 days switched to IgG antibody production. E9.D4 supernatants were virtually ineffective...

  1. Obtaining phenolic acids from cell cultures of various Artemisia ...

    African Journals Online (AJOL)

    Plant cell cultures represent a high valuable source for the production of bioactive secondary metabolites which can be used in food industry, medicine and cosmetic industry. In our study, we focused on obtaining phenolic acids from plant cell cultures. We compared cell cultures obtained from nine plant species of two ...

  2. An Introductory Undergraduate Course Covering Animal Cell Culture Techniques

    Science.gov (United States)

    Mozdziak, Paul E.; Petitte, James N.; Carson, Susan D.

    2004-01-01

    Animal cell culture is a core laboratory technique in many molecular biology, developmental biology, and biotechnology laboratories. Cell culture is a relatively old technique that has been sparingly taught at the undergraduate level. The traditional methodology for acquiring cell culture training has been through trial and error, instruction when…

  3. Differentiation of human mesenchymal stromal cells cultured on collagen sponges for cartilage repair.

    Science.gov (United States)

    Sanjurjo-Rodríguez, Clara; Martínez-Sánchez, Adela Helvia; Hermida-Gómez, Tamara; Fuentes-Boquete, Isaac; Díaz-Prado, Silvia; Blanco, Francisco J

    2016-11-01

    The aim of this study was to evaluate proliferation and chondrogenic differentiation of human bone-marrow mesenchymal stromal cells (hBMSCs) cultured on collagen biomaterials. hBMSCs were seeded on five different collagen (Col) sponges: C1C2 (types I and II Col), C1C2HS (types I and II Col plus heparan sulphate (HS)), C1C2CHS (types I and II Col plus chondroitin sulphate (CHS)), C1-OLH3 (type I Col plus low molecular weight heparin) and C1CHS (type I Col plus CHS). The resulting constructs were analyzed by histological and immunohistochemical staining, molecular biology and electron microscopy. Col released into culture media was measured by a dye-binding method Results: hBMSCs on biomaterials C1C2, C1C2HS and C1C2CHS had more capacity to attach, proliferate and synthesize Col II and proteoglycans in the extracellular matrix (ECM) than on C1-OLH3 and C1CHS. The presence of aggrecan was detected only at the gene level. Total Col liberated by the cells in the supernatants in all scaffold cultures was detected. The level of Col I in the ECM was lower in C1-OLH3 and that of Col II was highest in C1C2 and C1C2HS. Electron microscopy showed differently shaped cells, from rounded to flattened, in all constructs. Col fibers in bundles were observed in C1C2CHS by transmission electron microscopy. The results show that Col I and Col II (C1C2, C1C2HS and C1C2CHS) biomaterials allowed cell proliferation and chondrogenic-like differentiation of hBMSCs at an early stage. Constructs cultured on C1C2HS and C1C2CHS showed better cartilage-like phenotype than the other ones.

  4. Reversible gelling culture media for in-vitro cell culture in three-dimensional matrices

    Science.gov (United States)

    An, Yuehuei H.; Mironov, Vladimir A.; Gutowska, Anna

    2000-01-01

    A gelling cell culture medium useful for forming a three dimensional matrix for cell culture in vitro is prepared by copolymerizing an acrylamide derivative with a hydrophilic comonomer to form a reversible (preferably thermally reversible) gelling linear random copolymer in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum gelling molecular weight cutoff, mixing the copolymer with an aqueous solvent to form a reversible gelling solution and adding a cell culture medium to the gelling solution to form the gelling cell culture medium. Cells such as chondrocytes or hepatocytes are added to the culture medium to form a seeded culture medium, and temperature of the medium is raised to gel the seeded culture medium and form a three dimensional matrix containing the cells. After propagating the cells in the matrix, the cells may be recovered by lowering the temperature to dissolve the matrix and centrifuging.

  5. [Comparison of two types of cell cultures for preparation of sTNFRII-gAD fusion protein].

    Science.gov (United States)

    Huang, Shigao; Yin, Yuting; Xiong, Chunhui; Wang, Caihong; Lü, Jianxin; Gao, Jimin

    2013-01-01

    In this study we used two types of cell cultures, i.e., anchorage-dependent basket and full suspension batch cultures of sTNFRII-gAD-expressing CHO cells in the CelliGen 310 bioreactor (7.5 L) to compare their yields in order to optimize the culturing conditions for efficient expression of sTNFRII-gAD fusion protein consisting of soluble tumor necrosis factor receptor II and globular domain of adiponectin. The anchorage-dependent basket culture was performed in 4L 10% serum-containing medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 3 days, and then switched to 4 L serum-free LK021 medium to continue the culture for 4 days. The full suspension batch culture was carried out in the 4 L serum-free LK021 medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 7 days. The culturing conditions were monitored in real-time to maintain pH and dissolved oxygen stability through the whole process. The supernatants were collected by centrifuge, and the protein was concentrated through Pellicon flow ultrafiltration system and then purified by DEAE anion exchange. The results showed that the yields of sTNFRII-gAD fusion protein were 8.0 mg/L with 95% purity and 7.5 mg/L with 98% purity in the anchorage-dependent basket and the full suspension batch cultures, respectively. The study provided the framework for the pilot production of sTNFRII-gAD fusion protein.

  6. Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge

    Energy Technology Data Exchange (ETDEWEB)

    Pestana, Carlos J.; Reeve, Petra J.; Sawade, Emma [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); Voldoire, Camille F. [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); École Européenne de Chimie, Polymères et Matériaux (ECPM), Strasbourg 67087 (France); Newton, Kelly; Praptiwi, Radisti [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); Collingnon, Lea [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); École Européenne de Chimie, Polymères et Matériaux (ECPM), Strasbourg 67087 (France); Dreyfus, Jennifer [Allwater, Adelaide Services Alliance, Wakefield St, Adelaide, SA 5001 (Australia); Hobson, Peter [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); Gaget, Virginie [University of Adelaide, Ecology and Environmental Sciences, School of Biological Sciences, Adelaide, SA 5005 (Australia); Newcombe, Gayle, E-mail: gayle.newcombe@sawater.com.au [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia)

    2016-09-15

    In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10 days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. - Highlights: • Cyanobacteria in water treatment sludge significantly impact supernatant quality • Cyanobacteria can survive, and thrive, in sludge lagoon supernatant and in treatment sludge • Metabolite concentrations in cyanobacteria in sludge can increase up to 500% • The risk associated with supernatant recycling was assessed relative to available treatment barriers.

  7. Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge

    International Nuclear Information System (INIS)

    Pestana, Carlos J.; Reeve, Petra J.; Sawade, Emma; Voldoire, Camille F.; Newton, Kelly; Praptiwi, Radisti; Collingnon, Lea; Dreyfus, Jennifer; Hobson, Peter; Gaget, Virginie; Newcombe, Gayle

    2016-01-01

    In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10 days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. - Highlights: • Cyanobacteria in water treatment sludge significantly impact supernatant quality • Cyanobacteria can survive, and thrive, in sludge lagoon supernatant and in treatment sludge • Metabolite concentrations in cyanobacteria in sludge can increase up to 500% • The risk associated with supernatant recycling was assessed relative to available treatment barriers

  8. PHYTOCHEMICAL STUDY OF CELL CULTURE JATROPHA CURCAS

    Directory of Open Access Journals (Sweden)

    KOMAR RUSLAN

    2011-01-01

    Full Text Available Jatropha curcas belongs to the Euphorbiaceae family which has potential economically. This plant has been reported to contain toxic compounds such as curcin and phorbol ester and its derivatives. These compounds may become a problem if J. curcas will be explored as a source of biofuel. In order to provide safety plants, the research on the study of phytochemical and initiation of cell and organ culture have been carried out. J curcas which has been collected from different regions in Indonesia showed to contain relatively the same profile of chemical contents. Dominant compounds that were detected by GCMS are hidrocarbon such as 2-heptenal, decadienal, hexsadecane, pentadecane, cyclooctane etc, fatty acid such as oktadecanoate acid, etthyl linoleate, ethyl stearate, heksadecanoate acid and steroid such as stigmasterol, fucosterol, sitosterol. No phorbol ester and its derivatives have been detected yet by the GCMS method. Callus and suspension cultures of J. curcas have been established to be used for further investigation.

  9. A biocompatible micro cell culture chamber (mu CCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, Anders Michael

    2006-01-01

    We have previously shown that a polymeric (PMMA) chip with medium perfusion and integrated heat regulation provides sufficiently precise heat regulation, pH-control and medium exchange to support cell growth for weeks. However, it was unclear how closely the cells cultured in the chip resembled c...... compared to cell cultured in culture flasks incubated in a dark and CO2 conditioned incubator....

  10. Good cell culture practices &in vitro toxicology.

    Science.gov (United States)

    Eskes, Chantra; Boström, Ann-Charlotte; Bowe, Gerhard; Coecke, Sandra; Hartung, Thomas; Hendriks, Giel; Pamies, David; Piton, Alain; Rovida, Costanza

    2017-12-01

    Good Cell Culture Practices (GCCP) is of high relevance to in vitro toxicology. The European Society of Toxicology In Vitro (ESTIV), the Center for Alternatives for Animal Testing (CAAT) and the In Vitro Toxicology Industrial Platform (IVTIP) joined forces to address by means of an ESTIV 2016 pre-congress session the different aspects and applications of GCCP. The covered aspects comprised the current status of the OECD guidance document on Good In Vitro Method Practices, the importance of quality assurance for new technological advances in in vitro toxicology including stem cells, and the optimized implementation of Good Manufacturing Practices and Good Laboratory Practices for regulatory testing purposes. General discussions raised the duality related to the difficulties in implementing GCCP in an academic innovative research framework on one hand, and on the other hand, the need for such GCCP principles in order to ensure reproducibility and robustness of in vitro test methods for toxicity testing. Indeed, if good cell culture principles are critical to take into consideration for all uses of in vitro test methods for toxicity testing, the level of application of such principles may depend on the stage of development of the test method as well as on the applications of the test methods, i.e., academic innovative research vs. regulatory standardized test method. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Ghrelin-Induced Enhancement of Vasopressin and Oxytocin Secretion in Rat Neurohypophyseal Cell Cultures.

    Science.gov (United States)

    Gálfi, M; Radács, M; Molnár, Zs; Budai, I; Tóth, G; Pósa, A; Kupai, K; Szalai, Z; Szabó, R; Molnár, H A; Gardi, J; László, Ferenc A; Varga, Cs

    2016-12-01

    The effects of ghrelin on vasopressin and oxytocin secretion were studied in 13-14-day cell cultures of isolated rat neurohypophyseal tissue. The vasopressin and oxytocin contents of the supernatant were determined by radioimmunoassay after a 1- or 2-h incubation. Significantly increased levels of vasopressin and oxytocin production were detected in the cell culture media following ghrelin administration, depending on the ghrelin doses. The oxytocin level proved to be more elevated than that of vasopressin. The increase of vasopressin and oxytocin secretion could be totally blocked by previous administration of the ghrelin receptor antagonist ([D-Lys 3 ]-growth hormone-releasing peptide-6). Application of the ghrelin receptor antagonist after ghrelin administration proved ineffective. The results indicate that vasopressin and oxytocin release is influenced directly by the ghrelin system, and the effects of ghrelin on vasopressin and oxytocin secretion from the neurohypophyseal tissue in rats can occur at the level of the posterior pituitary. Our observations lend support to the view that neurohypophysis contains ghrelin receptors.

  12. Enhanced infectivity of bluetongue virus in cell culture by centrifugation.

    OpenAIRE

    Sundin, D R; Mecham, J O

    1989-01-01

    The effects of centrifugation of the infection of cell culture with bluetongue virus (BTV) were investigated. Baby hamster kidney cells were infected with BTV with or without centrifugation. Viral antigen was detected by immunofluorescence at 24 h in both centrifuged and noncentrifuged cultures. However, after 24 h of infection, the production of PFU in centrifuged cell cultures was 10- to 20-fold greater than that seen in cultures not centrifuged. In addition, centrifugation enhanced the dir...

  13. Growth of cultured porcine retinal pigment epithelial cells

    DEFF Research Database (Denmark)

    Wiencke, A.K.; Kiilgaard, Jens Folke; Nicolini, Jair

    2003-01-01

    To establish and characterize cultures of porcine retinal pigment epithelial (pRPE) cells in order to produce confluent monolayers of cells for transplantation.......To establish and characterize cultures of porcine retinal pigment epithelial (pRPE) cells in order to produce confluent monolayers of cells for transplantation....

  14. Cardiac Cells Beating in Culture: A Laboratory Exercise

    Science.gov (United States)

    Weaver, Debora

    2007-01-01

    This article describes how to establish a primary tissue culture, where cells are taken directly from an organ of a living animal. Cardiac cells are taken from chick embryos and transferred to culture dishes. These cells are not transformed and therefore have a limited life span. However, the unique characteristics of cardiac cells are maintained…

  15. Equipment for large-scale mammalian cell culture.

    Science.gov (United States)

    Ozturk, Sadettin S

    2014-01-01

    This chapter provides information on commonly used equipment in industrial mammalian cell culture, with an emphasis on bioreactors. The actual equipment used in the cell culture process can vary from one company to another, but the main steps remain the same. The process involves expansion of cells in seed train and inoculation train processes followed by cultivation of cells in a production bioreactor. Process and equipment options for each stage of the cell culture process are introduced and examples are provided. Finally, the use of disposables during seed train and cell culture production is discussed.

  16. [Research progress of cell co-culture method].

    Science.gov (United States)

    Qin, Yanqin; Chen, Yulong; Li, Jiansheng

    2016-08-01

    Cell culture technology is the most commonly used method in the in vitro experiments at present. However, monolayer cell culture technology has been unable to meet the demand of the researchers. This is because that monolayer cell culture cannot mimic the cellular environment in which multiple cells interact with each other in the body. We cannot discuss the relationship of many cells, because we do not know the relationship between cells through a single kind of cell. So cell co-culture medicine arises at the historic moment for the demand. With the development of research method in recent years, cell co-culture method also has been improved in practice: from direct contact co-cultures to indirect contact co-cultures, from two-dimensional co-cultures to three-dimensional co-cultures. Cell co-culture method is closer to the human body. It is also more advantageous to study the interaction among cells. Nowadays, there are more researchers tend to select this method to study the physiological and pathological in vitro model, tissue engineering, and cell differentiation research. At the same time, it has become the focus of drug research and development, drug analysis, mechanism of drug action, and drug targets. This article will review the studies of cell co-culture method, summarize advantages and disadvantages of various methods, so as to promote improvement of cell culture methods, to build cells co-culture system that more close to human body, and build the in vitro model that simulate internal circulation of human body further.

  17. Protection of cultured mammalian cells by rebamipide

    Energy Technology Data Exchange (ETDEWEB)

    Antoku, Shigetoshi; Aramaki, Ryoji [Kyushu Univ., Fukuoka (Japan). Faculty of Medicine; Tanaka, Hisashi; Kusumoto, Naotoshi

    1997-06-01

    Rebamipide which is used as a drug for gastritis and stomach ulcer has large capability for OH radical scavenging. It is expected that rebamipide has protective effect against ionizing radiations. The present paper deals with protective effect of rebamipide for cultured mammalian cells exposed to ionizing radiations. As rebamipide is insoluble in water, three solvents were used to dissolve. Rebamipide dissolved in dimethyl sulfoxide (DMSO), dimethyl formamide (DMFA) and 0.02 N NaOH was added to the cells in Eagle`s minimum essential medium (MEM) supplemented with 10% fetal calf serum and the cells were irradiated with X-rays. After irradiation, the cells were trypsinized, plated in MEM with 10% fetal calf serum and incubated for 7 days in a CO{sub 2} incubator to form colonies. Rebamipide dissolved in 0.02 N NaOH exhibited the protective effect expected its OH radical scavenging capability. However, the protective effect of rebamipide dissolved in DMSO was about half of that expected by its radical scavenging capability and that of rebamipide dissolved in DMFA was not observed. Uptake of rebamipide labeled with {sup 14}C increased with increasing contact time with rebamipide. These rebamipide mainly distributed in nucleus rather than cytoplasm. (author)

  18. Recombinant Protein Production and Insect Cell Culture and Process

    Science.gov (United States)

    Spaulding, Glenn F. (Inventor); Goodwin, Thomas J. (Inventor); OConnor, Kim C. (Inventor); Francis, Karen M. (Inventor); Andrews, Angela D. (Inventor); Prewett, Tracey L. (Inventor)

    1997-01-01

    A process has been developed for recombinant production of selected polypeptides using transformed insect cells cultured in a horizontally rotating culture vessel modulated to create low shear conditions. A metabolically transformed insect cell line is produced using the culture procedure regardless of genetic transformation. The recombinant polypeptide can be produced by an alternative process using virtually infected or stably transformed insect cells containing a gene encoding the described polypeptide. The insect cells can also be a host for viral production.

  19. An In-Vitro Investigation of the Antibacterial Effects of the Acetone and Ethanol Extracts and the Supernatant of the Algae Chlorella vulgaris CCATM- 210-1 on Some of the Gram-Negative Bacterial Foodborne Pathogens

    OpenAIRE

    Yasaman Asadi; Monir Doudi; Behrouz Zarei Darki

    2016-01-01

    Algae are rich sources of amino acids, terpenoids, florentines, alkanes, halogenated ketones, steroidal compounds, fatty acids, and phenols that can be used in the pharmaceutical industry. The acetone and ethanol extracts, and the supernatant of the algae Chlorella vulgaris CCATM- 210-1, were used in this study. After culturing the Algae, and preparing the supernatant and extracts, the antibacterial effects of the extracts and supernatant of this algae against some of the gram-negative bacter...

  20. An In-Vitro Investigation of the Antibacterial Effects of the Methanol and Aqueous Extracts and the Supernatant of the Algae Chlorella vulgaris CCATM 210-1 on Multiantibiotic-Resistant Staphylococcus aureus Isolates Causing Urinary Tract Infections

    OpenAIRE

    Senobar Asadi; Monir Doudi; Behrouz Zarei Darki

    2016-01-01

    Algae contain compounds, some of which have antibacterial properties. For example, the antibiotic Chlorellin can be mentioned, which is extracted from Chlorella species. The methanol and aqueous extracts, and the supernatant of the algae Chlorella vulgaris CCATM- 210-1 were used in this study. After culturing the Algae and preparing the supernatant and extracts, the antibacterial effects of the extracts and supernatant of this algae against multidrugresistant (MDR) Staphylococcus ...

  1. [Elimination of haloperidol from erythrocytes surfaces supernatant and blood plasma].

    Science.gov (United States)

    Shanidze, L A

    2005-01-01

    The aim of the study was to investigate the adsorption rate of haloperidol on erythrocytes surfaces. The pharmacokinetic and pharmacodynamic parameters of haloperidol were monitored in the experiment. The neuroleptic was administered to 12 adult dogs and the blood samples were collected for further analysis following 20, 30, 60, 180, 240, 360, 420 and 480 minutes after the injection. The groups of samples (blood plasma and supernatant) were monitored during this period. The differences between haloperidol concentration in the supernatant and blood plasma were compared. Our data have shown that dynamics of the elimination of intact and acidified forms of haloperidol from the supernatant and the blood serum are not the same. Intact and acidified forms are differently regulated by plasma. albumines and globulines. The process of redistribution of haloperidol between the both substrates takes place, while the supernatant has a donor function for the free form of haloperidol and represents the acceptor of the haloperidol's metabolites. This provides the possibility to develop multidiscipline approach to the optimization to the prescription of haloperidol.

  2. Half-liter supernatant sampler system engineering work plan

    International Nuclear Information System (INIS)

    Ritter, G.A.

    1995-01-01

    The Tank Waste Remediation System (TWRS) pretreatment facility project W-236B, known as the Initial Pretreatment Module (IPM), requires samples of supernatants and sludges from 200 Area tank farms for planned hot testing work in support of IPM design. The IPM project has proposed the development of several new sampler systems. These systems include a 0.5-l supernatant sampler, 3-l and 25-l supernatant and sludge samplers, and a 4,000-l sampler system. The 0.5-l sampler will support IPM sampling needs in the 1 to 3 l range starting in late fiscal year 1995. This sampler is intended to be used in conjunction with the existing 100 ml bottle-on-a-string. The 3-l and 25-l systems will be based on the Savannah River Site's sampler system and will support IPM sampling needs in the 3 to 100 liter range. Most of the hot testing required for design of the IPM must be accomplished in the next 3 years. This work plan defines the tasks associated with the development of a 0.5-l sampler system. This system will be referred to as the Half-Liter Supernatant Sampler System (HLSSS). Specifically, this work plan will define the scope of work, identify organizational responsibilities, identify major technical requirements, describe configuration control and verification requirements, and provide estimated costs and schedule. The sampler system will be fully operational, including trained staff and operating procedures, upon completion of this task

  3. Preanalytics of urine sediment examination: effect of relative centrifugal force, tube type, volume of sample and supernatant removal.

    Science.gov (United States)

    Bunjevac, Amalija; Gabaj, Nora Nikolac; Miler, Marijana; Horvat, Anita

    2018-02-15

    Laboratories often modify procedures recommended by the European Urinalysis Guidelines for urine sediment analysis. The aim of this study was to compare the recommended protocol with our routine laboratory procedure and to evaluate the possible impact of modifications in the relative centrifugal force, type of tube, method of supernatant aspiration and urine volume on patient's results. Firstly, relative centrifugal force was investigated using 20 pairs of samples examined after centrifugation at 400xg and 1358xg. In phase two, 110 samples were examined, paired as: round bottom vs conical tube (N = 46), decanting vs suction of supernatant (N = 100) and 10 mL vs 5 mL of urine sample (N = 101). The number of erythrocytes, leukocytes and squamous epithelial cells was significantly lower after centrifugation at 400xg (P = 0.001, 0.002 and 0.004, respectively). The number of leukocytes was significantly lower in conical tubes (P = 0.010), after the suction of supernatant (P = 0.045) and in 5 mL urine (P urine (P urine. Lower results of leukocytes, erythrocytes, squamous cells and non-hyaline casts were recorded in recommended procedures (centrifugation at 400xg, suction of supernatant, conical tube, 5 mL of sample) than in routine procedure (centrifugation at 1358xg, decanting of supernatant, round bottom tube, 10 mL) used in our laboratory.

  4. Gravity, chromosomes, and organized development in aseptically cultured plant cells

    Science.gov (United States)

    Krikorian, Abraham D.

    1993-01-01

    The objectives of the PCR experiment are: to test the hypothesis that microgravity will in fact affect the pattern and developmental progression of embryogenically competent plant cells from one well-defined, critical stage to another; to determine the effects of microgravity in growth and differentiation of embryogenic carrot cells grown in cell culture; to determine whether microgravity or the space environment fosters an instability of the differentiated state; and to determine whether mitosis and chromosome behavior are adversely affected by microgravity. The methods employed will consist of the following: special embryogenically competent carrot cell cultures will be grown in cell culture chambers provided by NASDA; four cell culture chambers will be used to grow cells in liquid medium; two dishes (plant cell culture dishes) will be used to grow cells on a semi-solid agar support; progression to later embryonic stages will be induced in space via crew intervention and by media manipulation in the case of liquid grown cell cultures; progression to later stages in case of semi-solid cultures will not need crew intervention; embryo stages will be fixed at a specific interval (day 6) in flight only in the case of liquid-grown cultures; and some living cells and somatic embryos will be returned for continued post-flight development and 'grown-out.' These will derive from the semi-solid grown cultures.

  5. X-ray microanalysis of single and cultured cells

    International Nuclear Information System (INIS)

    Wroblewski, J.; Roomans, G.M.

    1984-01-01

    X-ray microanalysis of single or cultured cells is often a useful alternative or complement to the analysis of the corresponding tissue. It also allows the analysis of individual cells in a cell population. Preparation for X-ray microanalysis poses a number of typical problems. Suspensions of single cells can be prepared by either of two pathways: (1) washing - mounting - drying, or (2) centrifugation - freezing or fixation - sectioning. The washing step in the preparation of single or cultured cells presents the most severe problems. Cultured cells are generally grown on a substrate that is compatible with both the analysis and the culture, washed and dried. In some cases, sectioning of cultured cell monolayers has been performed. Special problems in quantitative analysis occur in those cases where the cells are analyzed on a thick substrate, since the substrate contributes to the spectral background

  6. Cholera toxin stimulation of human mammary epithelial cells in culture

    Energy Technology Data Exchange (ETDEWEB)

    Stampfer, M.R.

    1982-06-01

    Addition of cholera toxin to human mammary epithelial cultures derived from reduction mammoplasties and primary carcinomas greatly stimulated cell growth and increased the number of times the cells could be successfully subcultured. Other agents known to increase intracellular cAMP levels were also growth stimulatory. The increased growth potential conferred by cholera toxin enhances the usefulness of this cell culture system.

  7. Establishment and characterization of American elm cell suspension cultures

    Science.gov (United States)

    Steven M. Eshita; Joseph C. Kamalay; Vicki M. Gingas; Daniel A. Yaussy

    2000-01-01

    Cell suspension cultures of Dutch elm disease (DED)-tolerant and DED-susceptible American elms clones have been established and characterized as prerequisites for contrasts of cellular responses to pathogen-derived elicitors. Characteristics of cultured elm cell growth were monitored by A700 and media conductivity. Combined cell growth data for all experiments within a...

  8. Electrospinning of microbial polyester for cell culture

    International Nuclear Information System (INIS)

    Kwon, Oh Hyeong; Lee, Ik Sang; Ko, Young-Gwang; Meng, Wan; Jung, Kyung-Hye; Kang, Inn-Kyu; Ito, Yoshihiro

    2007-01-01

    Biodegradable and biocompatible poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), a copolymer of microbial polyester, was fabricated as a nanofibrous mat by electrospinning. The specific surface area and the porosity of electrospun PHBV nanofibrous mat were determined. When the mechanical properties of flat film and electrospun PHBV nanofibrous mats were investigated, both the tensile modulus and strength of electrospun PHBV were less than those of cast PHBV film. However, the elongation ratio of nanofiber mat was higher than that of the cast film. The structure of electrospun nanofibers using PHBV-trifluoroethanol solutions depended on the solution concentrations. When x-ray diffraction patterns of bulk PHBV before and after electrospinning were compared, the crystallinity of PHBV was not significantly affected by the electrospinning process. Chondrocytes adhered and grew on the electrospun PHBV nanofibrous mat better than on the cast PHBV film. Therefore, the electrospun PHBV was considered to be suitable for cell culture

  9. Usability and Applicability of Microfluidic Cell Culture Systems

    DEFF Research Database (Denmark)

    Hemmingsen, Mette

    of the microfluidic perfusion cell culture system is shown by investigation of adipose-derived stem cell (ASC) differentiation into adipocytes, where we have revealed that paracrine/autocrine signaling is involved in differentiation of a population of ASCs into adipocytes. We have thereby demonstrated......Microfluidic cell culture has been a research area with great attention the last decade due to its potential to mimic the in vivo cellular environment more closely compared to what is possible by conventional cell culture methods. Many exciting and complex devices have been presented providing...... possibilities for, for example, precise control of the chemical environment, 3D cultures, controlled co-culture of different cell types or automated, individual control of up to 96 cell culture chambers in one integrated system. Despite the great new opportunities to perform novel experimental designs...

  10. Can established cultured papilloma cells harbor bovine papillomavirus?

    Science.gov (United States)

    Campos, S R C; Trindade, C; Ferraz, O P; Giovanni, D N S; Lima, A A; Caetano, H V A; Carvalho, R F; Birgel, E H; Dagli, M L Z; Mori, E; Brandão, P E; Richtzenhain, L J; Beçak, W; Stocco, R C

    2008-10-21

    Papillomaviruses have been reported to be very difficult to grow in cell culture. Also, there are no descriptions of cell cultures from lesions of bovine cutaneous papillomatosis, with identification of different bovine papilloma virus (BPV) DNA sequences. In the present report, we describe primary cell cultures from samples of cutaneous lesions (warts). We investigated the simultaneous presence of different BPV DNA sequences, comparing the original lesion to different passages of the cell cultures and to peripheral blood. BPV 1, 2 and 4 DNA sequences were found in lesion samples, and respective cell cultures and peripheral blood, supporting our previous hypothesis of the possible activity of these sequences in different samples and now also showing how they can be maintained in different passages of cell cultures.

  11. [Effects on proliferation ability of vascular smooth muscle cells by static and/or dynamic cell culture: utility of pre-seeding technique for dynamic cell culture].

    Science.gov (United States)

    Yokomuro, Hiroki; Ozawa, Tsukasa; Fujii, Takeshiro; Shiono, Noritsugu; Watanabe, Yoshinori; Yoshihara, Katsunori; Koyama, Nobuya; Okada, Mitsumasa

    2007-11-01

    Conventional biomaterials are not viable, do not grow, and do not provide contractile effects in cardiac tissue. Foreign synthetic material may become thrombogenic or infected. The most recent cardiac constructs consist of biodegradable material which has the potential to solve these problems. However, dynamic three-dimensional cell culture is necessary because conventional culture is limited to construct tough biografts. Vascular smooth muscle cells derived from rat aorta were seeded to poly-L-lactide-epsilon-capro-lactone copolymer in three groups; static culture group (static cell seeding + static cell culture), dynamic culture group (dynamic cell seeding + dynamic cell culture), and pre-seeding group [static cell seeding and culture for 1 week (pre-seeding) + dynamic cell culture]. The dynamic cell culture system used an original spinner flask. The pre-seeding technique used static cell seeding and culture before dynamic culture. The three groups were evaluated by cell proliferation and histologic studies. Vascular smooth muscle cells could be proliferated in/on the biodegradable materials. The pre-seeding group cells grew much more efficiently than the other groups. Very few cells were found in the biodegradable materials with the dynamic groups. However, there were many cells in the materials with the static culture group and pre-seeding group, especially the pre-seeding group. Dynamic culture is useful for constructing tough biografts by the pre-seeding technique.

  12. Sildenafil Effect on Nitric Oxide Secretion by Normal Human Endometrial Epithelial Cells Cultured In vitro

    Directory of Open Access Journals (Sweden)

    Farzaneh Chobsaz

    2011-01-01

    Full Text Available Background: Sildenafil is a selective inhibitor of cyclic-guanosine monphosphat-specificphosphodiesterase type 5. It increases intracellular nitric oxide (NO production in some cells.There are reports on its positive effect on uterine circulation, endometrial thickness, and infertilityimprovement. Endometrial epithelial cells (EEC play an important role in embryo attachment andimplantation. The present work investigates the effect of sildenafil on human EEC and their NOsecretion in vitro.Materials and Methods: In this experimental in vitro study, endometrial biopsies (n=10 werewashed in a phosphate buffered solution (PBS and digested with collagenase I (2 mg/ml in DMEM/F12 medium at 37°C for 90 minutes. Epithelial glands were collected by sequential filtrationthrough nylon meshes (70 and 40 μm pores, respectively. Epithelial glands were then treated withtrypsin to obtain individual cells. The cells were counted and divided into four groups: control and1, 10, and 20 μM sildenafil concentrations. Cells were cultured for 15 days at 37ºC and 5% CO2; themedia were changed every 3 days, and their supernatants were collected for the NO assay. NO wasmeasured by standard Greiss methods. Data were analyzed by one way ANOVA.Results: There was no significant difference between groups in cell count and NO secretion, but thelevel of NO increased slightly in the experimental groups. The 10 μM dose showed the highest cellcount. EEC morphology changed into long spindle cells in the case groups.Conclusion: Sildenafil (1, 10, and 20 μM showed a mild proliferative effect on human EECnumbers, but no significant change was seen in NO production.

  13. Evaluation of the effects of different culture media on the myogenic differentiation potential of adipose tissue- or bone marrow-derived human mesenchymal stem cells.

    Science.gov (United States)

    Stern-Straeter, Jens; Bonaterra, Gabriel Alejandro; Juritz, Stephanie; Birk, Richard; Goessler, Ulrich Reinhart; Bieback, Karen; Bugert, Peter; Schultz, Johannes; Hörmann, Karl; Kinscherf, Ralf; Faber, Anne

    2014-01-01

    The creation of functional muscles/muscle tissue from human stem cells is a major goal of skeletal muscle tissue engineering. Mesenchymal stem cells (MSCs) from fat/adipose tissue (AT-MSCs), as well as bone marrow (BM-MSCs) have been shown to bear myogenic potential, which makes them candidate stem cells for skeletal muscle tissue engineering applications. The aim of this study was to analyse the myogenic differentiation potential of human AT-MSCs and BM-MSCs cultured in six different cell culture media containing different mixtures of growth factors. The following cell culture media were used in our experiments: mesenchymal stem cell growth medium (MSCGM)™ as growth medium, MSCGM + 5-azacytidine (5-Aza), skeletal muscle myoblast cell growth medium (SkGM)-2 BulletKit™, and 5, 30 and 50% conditioned cell culture media, i.e., supernatant of human satellite cell cultures after three days in cell culture mixed with MSCGM. Following the incubation of human AT-MSCs or BM-MSCs for 0, 4, 8, 11, 16 or 21 days with each of the cell culture media, cell proliferation was measured using the alamarBlue® assay. Myogenic differentiation was evaluated by quantitative gene expression analyses, using quantitative RT-PCR (qRT-PCR) and immunocytochemical staining (ICC), using well-defined skeletal markers, such as desmin (DES), myogenic factor 5 (MYF5), myosin, heavy chain 8, skeletal muscle, perinatal (MYH8), myosin, heavy chain 1, skeletal muscle, adult (MYH1) and skeletal muscle actin-α1 (ACTA1). The highest proliferation rates were observed in the AT-MSCs and BM-MSCs cultured with SkGM-2 BulletKit medium. The average proliferation rate was higher in the AT-MSCs than in the BM-MSCs, taking all six culture media into account. qRT-PCR revealed the expression levels of the myogenic markers, ACTA1, MYH1 and MYH8, in the AT-MSC cell cultures, but not in the BM-MSC cultures. The muscle-specific intermediate filament, DES, was only detected (by ICC) in the AT-MSCs, but not in the BM

  14. Isolation and culture of larval cells from C. elegans.

    Directory of Open Access Journals (Sweden)

    Sihui Zhang

    Full Text Available Cell culture is an essential tool to study cell function. In C. elegans the ability to isolate and culture cells has been limited to embryonically derived cells. However, cells or blastomeres isolated from mixed stage embryos terminally differentiate within 24 hours of culture, thus precluding post-embryonic stage cell culture. We have developed an efficient and technically simple method for large-scale isolation and primary culture of larval-stage cells. We have optimized the treatment to maximize cell number and minimize cell death for each of the four larval stages. We obtained up to 7.8×10(4 cells per microliter of packed larvae, and up to 97% of adherent cells isolated by this method were viable for at least 16 hours. Cultured larval cells showed stage-specific increases in both cell size and multinuclearity and expressed lineage- and cell type-specific reporters. The majority (81% of larval cells isolated by our method were muscle cells that exhibited stage-specific phenotypes. L1 muscle cells developed 1 to 2 wide cytoplasmic processes, while L4 muscle cells developed 4 to 14 processes of various thicknesses. L4 muscle cells developed bands of myosin heavy chain A thick filaments at the cell center and spontaneously contracted ex vivo. Neurons constituted less than 10% of the isolated cells and the majority of neurons developed one or more long, microtubule-rich protrusions that terminated in actin-rich growth cones. In addition to cells such as muscle and neuron that are high abundance in vivo, we were also able to isolate M-lineage cells that constitute less than 0.2% of cells in vivo. Our novel method of cell isolation extends C. elegans cell culture to larval developmental stages, and allows use of the wealth of cell culture tools, such as cell sorting, electrophysiology, co-culture, and high-resolution imaging of subcellular dynamics, in investigation of post-embryonic development and physiology.

  15. Systems Biology for Organotypic Cell Cultures

    Energy Technology Data Exchange (ETDEWEB)

    Grego, Sonia [RTI International, Research Triangle Park, NC (United States); Dougherty, Edward R. [Texas A & M Univ., College Station, TX (United States); Alexander, Francis J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Auerbach, Scott S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Berridge, Brian R. [GlaxoSmithKline, Research Triangle Park, NC (United States); Bittner, Michael L. [Translational Genomics Research Inst., Phoenix, AZ (United States); Casey, Warren [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Cooley, Philip C. [RTI International, Research Triangle Park, NC (United States); Dash, Ajit [HemoShear Therapeutics, Charlottesville, VA (United States); Ferguson, Stephen S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Fennell, Timothy R. [RTI International, Research Triangle Park, NC (United States); Hawkins, Brian T. [RTI International, Research Triangle Park, NC (United States); Hickey, Anthony J. [RTI International, Research Triangle Park, NC (United States); Kleensang, Andre [Johns Hopkins Univ., Baltimore, MD (United States). Center for Alternatives to Animal Testing; Liebman, Michael N. [IPQ Analytics, Kennett Square, PA (United States); Martin, Florian [Phillip Morris International, Neuchatel (Switzerland); Maull, Elizabeth A. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Paragas, Jason [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Qiao, Guilin [Defense Threat Reduction Agency, Ft. Belvoir, VA (United States); Ramaiahgari, Sreenivasa [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Sumner, Susan J. [RTI International, Research Triangle Park, NC (United States); Yoon, Miyoung [The Hamner Inst. for Health Sciences, Research Triangle Park, NC (United States); ScitoVation, Research Triangle Park, NC (United States)

    2016-08-04

    Translating in vitro biological data into actionable information related to human health holds the potential to improve disease treatment and risk assessment of chemical exposures. While genomics has identified regulatory pathways at the cellular level, translation to the organism level requires a multiscale approach accounting for intra-cellular regulation, inter-cellular interaction, and tissue/organ-level effects. Tissue-level effects can now be probed in vitro thanks to recently developed systems of three-dimensional (3D), multicellular, “organotypic” cell cultures, which mimic functional responses of living tissue. However, there remains a knowledge gap regarding interactions across different biological scales, complicating accurate prediction of health outcomes from molecular/genomic data and tissue responses. Systems biology aims at mathematical modeling of complex, non-linear biological systems. We propose to apply a systems biology approach to achieve a computational representation of tissue-level physiological responses by integrating empirical data derived from organotypic culture systems with computational models of intracellular pathways to better predict human responses. Successful implementation of this integrated approach will provide a powerful tool for faster, more accurate and cost-effective screening of potential toxicants and therapeutics. On September 11, 2015, an interdisciplinary group of scientists, engineers, and clinicians gathered for a workshop in Research Triangle Park, North Carolina, to discuss this ambitious goal. Participants represented laboratory-based and computational modeling approaches to pharmacology and toxicology, as well as the pharmaceutical industry, government, non-profits, and academia. Discussions focused on identifying critical system perturbations to model, the computational tools required, and the experimental approaches best suited to generating key data. This consensus report summarizes the discussions held.

  16. Using Tissue Culture To Investigate Plant Cell Differentiation and Dedifferentiation.

    Science.gov (United States)

    Bozzone, Donna M.

    1997-01-01

    Describes an experimental project that uses plant tissue culture techniques to examine cell differentiation in the carrot. Allows students to gain experience in some important techniques and to explore fundamental questions about cell differentiation. (DDR)

  17. Synthesis of polymer materials for use as cell culture substrates

    Energy Technology Data Exchange (ETDEWEB)

    Lakard, Sophie [Laboratoire de Chimie des Materiaux et Interfaces, University of Franche-Comte, IUT, 30 Avenue de l' Observatoire, 25009 Besancon (France)], E-mail: sophie.lakard@univ-fcomte.fr; Morrand-Villeneuve, Nadege [Laboratoire de Neurosciences, University of Franche-Comte, Place Leclerc, 25030 Besancon (France); Lesniewska, Eric [Laboratoire de Physique de l' Universite de Bourgogne, University of Bourgogne, 9 Avenue Savary, 21078 Dijon (France); Lakard, Boris [Laboratoire de Chimie des Materiaux et Interfaces, University of Franche-Comte, 16 Route de Gray, 25030 Besancon (France); Michel, Germaine [Laboratoire de Neurosciences, University of Franche-Comte, Place Leclerc, 25030 Besancon (France); Herlem, Guillaume [Laboratoire de Chimie des Materiaux et Interfaces, University of Franche-Comte, 16 Route de Gray, 25030 Besancon (France); Gharbi, Tijani [Laboratoire d' Optique P.M. Duffieux, University of Franche-Comte, 16 Route de Gray, 25030 Besancon (France); Fahys, Bernard [Laboratoire de Chimie des Materiaux et Interfaces, University of Franche-Comte, 16 Route de Gray, 25030 Besancon (France)

    2007-12-20

    Up to today, several techniques have been used to maintain cells in culture for studying many aspects of cell biology and physiology. More often, cell culture is dependent on proper anchorage of cells to the growth surface. Thus, poly-L-lysine, fibronectin or laminin are the most commonly used substrates. In this study, electrosynthesized biocompatible polymer films are proposed as an alternative to these standard substrates. The electrosynthesized polymers tested were polyethylenimine, polypropylenimine and polypyrrole. Then, the adhesion, proliferation and morphology of rat neuronal cell lines were investigated on these polymer substrates in an attempt to develop new and efficient polymer materials for cell culture. During their growth on the polymers, the evolution of the cell morphology was monitored using both confocal microscopy and immunohistochemistry, leading to the conclusion of a normal development. An estimation of the adhesion and proliferation rates of rat neuronal cell cultures indicated that polyethylenimine and polypropylenimine were the best substrates for culturing olfactory neuronal cells. A method to favour the differentiation of the neuronal cells was also developed since the final aim of this work is to develop a biosensor for odour detection using differentiated neuronal cells as transducers. Consequently, a biosensor was microfabricated using silicon technology. This microsystem allowed us to culture the cells on a silicon wafer and to position the cells on certain parts of the silicon wafer.

  18. Development of a microfluidic perfusion 3D cell culture system

    Science.gov (United States)

    Park, D. H.; Jeon, H. J.; Kim, M. J.; Nguyen, X. D.; Morten, K.; Go, J. S.

    2018-04-01

    Recently, 3-dimensional in vitro cell cultures have gained much attention in biomedical sciences because of the closer relevance between in vitro cell cultures and in vivo environments. This paper presents a microfluidic perfusion 3D cell culture system with consistent control of long-term culture conditions to mimic an in vivo microenvironment. It consists of two sudden expansion reservoirs to trap incoming air bubbles, gradient generators to provide a linear concentration, and microchannel mixers. Specifically, the air bubbles disturb a flow in the microfluidic channel resulting in the instability of the perfusion cell culture conditions. For long-term stable operation, the sudden expansion reservoir is designed to trap air bubbles by using buoyancy before they enter the culture system. The performance of the developed microfluidic perfusion 3D cell culture system was examined experimentally and compared with analytical results. Finally, it was applied to test the cytotoxicity of cells infected with Ewing’s sarcoma. Cell death was observed for different concentrations of H2O2. For future work, the developed microfluidic perfusion 3D cell culture system can be used to examine the behavior of cells treated with various drugs and concentrations for high-throughput drug screening.

  19. Effect of Cadmium on Macrophage U937 Cell Proliferation and ...

    African Journals Online (AJOL)

    Later, U937 cells were also pre-treated with phorbol 12- myristate, 13-acetate to transform the cells from the monocyte-like morphology to the macrophage form. The macrophage U937 cells were then incubated with different concentrations of cadmium and the supernatants of the cell cultures were analyzed for the ...

  20. Aeroponics for the culture of organisms, tissues and cells.

    Science.gov (United States)

    Weathers, P J; Zobel, R W

    1992-01-01

    Characteristics of aeroponics are discussed. Contrast is made, where appropriate, with hydroponics and aero-hydroponics as applies to research and commercial applications of nutrient mist technology. Topics include whole plants, plant tissue cultures, cell and microbial cultures, and animal tissue cultures with regard to operational considerations (moisture, temperature, minerals, gaseous atmosphere) and design of apparati.

  1. A method for culturing human hair follicle cells.

    Science.gov (United States)

    Weterings, P J; Vermorken, A J; Bloemendal, H

    1981-01-01

    For the first time a method for culturing human hair follicle cells is described. The bovine eye lens capsule, a basement membrane-like structure, is used as the substrate for the cultures. In a culture medium supplemented with hydrocortisone and insulin about 70% of the original follicles will form growing colonies of diploid keratinocytes.

  2. Rabbit uterine epithelial cells: Co-culture with spermatozoa

    International Nuclear Information System (INIS)

    Boice, M.L.

    1988-01-01

    A primary culture of rabbit uterine epithelial cells was established and their effects on sperm function were examined in vitro. Epithelial cells were isolated from uteri of estrous rabbits and cultured on floating collagen gels in phenol red-free medium supplemented with 5% fetal bovine serum. Light microscopy and keratin staining showed that the epithelial cell population established in culture had morphological characteristics similar to that seen in the intact endometrium. Cells were cultured with 3 H-leucine and uptake of label by cells and its incorporation into cellular and secretory proteins determined. When compared to cells cultured for 24-48 h, incorporation of label into cellular protein was lower at 72-96 h, but secretion increased. Estradiol 17-β did not affect label uptake or incorporation, but did enhance proliferation of cells as judged by total DNA content of the cell population. Analysis of proteins in media by sodium dodecyl sulfate polyacrylamide gel electrophoresis and fluorography suggested that epithelial and stromal cells synthesis proteins that may be secretory in nature during 72-96 h culture. Twenty-nine to thirty-one h after initiation of epithelial cultures, 1-2 x 10 6 sperm were co-incubated with cells and sperm viability, motility, loss of acrosome and fertilizing ability determined

  3. Growth and Plating of Cell Suspension Cultures of Datura Innoxia

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1974-01-01

    malate) or on NO3−-N alone. Dry weight yield was proportional to the amount of nitrate-N added (47 mg/mg N). Filtered suspension cultures containing single cells (plating cultures) could be grown in agar in petri dishes when NAA or 2,4-D were used as growth substances. Cells grew at densities above 500...

  4. Rapid method for culturing embryonic neuron-glial cell cocultures

    DEFF Research Database (Denmark)

    Svenningsen, Åsa Fex; Shan, Wei-Song; Colman, David R

    2003-01-01

    A streamlined, simple technique for primary cell culture from E17 rat tissue is presented. In an attempt to standardize culturing methods for all neuronal cell types in the embryo, we evaluated a commercial medium without serum and used similar times for trypsinization and tested different surfaces...

  5. Induction of interdigitating cell processes in podocyte culture.

    Science.gov (United States)

    Yaoita, Eishin; Yoshida, Yutaka; Nameta, Masaaki; Takimoto, Hiroki; Fujinaka, Hidehiko

    2018-02-01

    Highly organized cell processes characterize glomerular podocytes in vivo. However, podocytes in culture have a simple morphology lacking cell processes, especially upon reaching confluence. Here, we aimed to establish culture conditions under which cultured podocytes extend cell processes at confluence. Among various culture conditions that could possibly cause phenotypic changes in podocytes, we examined the effects of heparin, all-trans retinoic acid, fetal bovine serum, and extracellular matrices on the morphology of podocytes in rat primary culture. Consequently, long arborized cell processes were observed to radiate extensively from the cell body only when cells were cultured in the presence of heparin and all-trans retinoic acid on laminin-coated dishes with decreasing concentrations of fetal bovine serum. Primary processes branching repeatedly into terminal processes and cell process insertion under adjacent cell bodies were evident by electron microscopy-based analysis. Immunostaining for podocin showed conspicuous elongations of intercellular junctions. Under these conditions, the expression levels of podocyte-specific proteins and genes were markedly upregulated. Thus, we succeeded in establishing culture conditions in which the cultured podocytes exhibit phenotypes similar to those under in vivo conditions. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  6. Viable Cell Culture Banking for Biodiversity Characterization and Conservation.

    Science.gov (United States)

    Ryder, Oliver A; Onuma, Manabu

    2018-02-15

    Because living cells can be saved for indefinite periods, unprecedented opportunities for characterizing, cataloging, and conserving biological diversity have emerged as advanced cellular and genetic technologies portend new options for preventing species extinction. Crucial to realizing the potential impacts of stem cells and assisted reproductive technologies on biodiversity conservation is the cryobanking of viable cell cultures from diverse species, especially those identified as vulnerable to extinction in the near future. The advent of in vitro cell culture and cryobanking is reviewed here in the context of biodiversity collections of viable cell cultures that represent the progress and limitations of current efforts. The prospects for incorporating collections of frozen viable cell cultures into efforts to characterize the genetic changes that have produced the diversity of species on Earth and contribute to new initiatives in conservation argue strongly for a global network of facilities for establishing and cryobanking collections of viable cells.

  7. Horizontally rotated cell culture system with a coaxial tubular oxygenator

    Science.gov (United States)

    Wolf, David A. (Inventor); Schwarz, Ray P. (Inventor); Trinh, Tinh T. (Inventor)

    1991-01-01

    The present invention relates to a horizontally rotating bioreactor useful for carrying out cell and tissue culture. For processing of mammalian cells, the system is sterilized and fresh fluid medium, microcarrier beads, and cells are admitted to completely fill the cell culture vessel. An oxygen containing gas is admitted to the interior of the permeable membrane which prevents air bubbles from being introduced into the medium. The cylinder is rotated at a low speed within an incubator so that the circular motion of the fluid medium uniformly suspends the microbeads throughout the cylinder during the cell growth period. The unique design of this cell and tissue culture device was initially driven by two requirements imposed by its intended use for feasibility studies for three dimensional culture of living cells and tissues in space by JSC. They were compatible with microgravity and simulation of microgravity in one G. The vessels are designed to approximate the extremely quiescent low shear environment obtainable in space.

  8. The release of iron by Sertoli cells in culture

    NARCIS (Netherlands)

    Wauben-Penris, P. J.; Veldscholte, J.; van der Ende, A.; van der Donk, H. A.

    1988-01-01

    In seminiferous tubules, iron transport from the blood to the abluminal germinal cells must occur through the Sertoli cell cytoplasm. We investigated the release of previously accumulated iron by cultured Sertoli cells. We found that Sertoli cells contain easily releasable and less easily releasable

  9. PECULIARITIES OF SECONDARY METABOLITES BIOSYNTHESIS IN PLANT CELL CULTURES

    Directory of Open Access Journals (Sweden)

    A.M. NOSOV

    2014-06-01

    Full Text Available metabolites formation in plant cell cultures of Panax spp., (ginsenosides; Dioscorea deltoidea (steroid glycosides; Ajuga reptans, Serratula coronata, Rhaponticum carthamoides (ecdisteroids; Polyscias spp., (triterpene glycosides, Taxus spp. (taxoids, Stevia rebaudiana (diterpene steviol-glycosides, Stephania glabra (alkaloids. They are some regular trends of secondary metabolites synthesis in the plant cell culture:It can be noted the stable synthesis of the compound promoting cell proliferation. Indeed, cell cultures of Dioscorea deltoidea were demonstrated to accumulate only furostanol glycosides, which promoted cell division. Furostanol glycoside content of Dioscorea strain DM-0.5 was up to 6 - 12% by dry biomass.Panax ginseng and P. japonicus plant cell cultures synthesize as minimum seven triterpene glycosides (ginsenosides, the productivity of these compounds was up to 6.0 - 8.0% on dry biomass.By contrast, the detectable synthesis of diterpene steviol-glycosides in cultivated cells of Stevia rebaudiana initiated in the mixotrophic cultures during chloroplast formation only.Despite these differences, or mainly due to them, plant cell cultures have become an attractive source of phytochemicals in alternative to collecting wild plants. It provides a guideline to bioreactor-based production of isoprenoids using undifferentiated plant cell cultures

  10. Caprine nictitating membrane cell culture for production of small ruminants lentivirus antigen

    Directory of Open Access Journals (Sweden)

    Dalva Alana Aragão de Azevedo

    2015-12-01

    Full Text Available ABSTRACT. Azevedo D.A.A., Araújo J.F., Sousa A.L.M. de, Dias R.P., Souza T.S. de, Andrioli A. & Pinheiro R.R. [Caprine nictitating membrane cell culture for production of small ruminants lentivirus antigen.] Produção de antí- geno de lentivírus de pequenos ruminantes através da cultura celular de membrana nictitante caprina. Revista Brasileira de Medicina Veterinária, 37(4:316-320, 2015. Empresa Brasileira de Pesquisa Agropecuária (Embrapa Caprinos e Ovinos, Fazenda Três Lagoas, Estrada Sobral/Jordão Km 4, Sobral, CE 62010-970, Brasil. E-mail: dalvaazevedo@outlook.com Small Ruminants lentivirus (SRLV belong to the Retroviridae family and is the etiologic agent of caprine arthritis encephalitis in goats and maedi-visna in sheep. Cells of the monocytic-phagocytic lineage are the main viral targets and infected hosts cannot develop a curative immune response. We evaluated whether nictitating membrane (NM cells can be cultivated in vitro and also whether it is a feasible system for SRLV antigen production for immunodiagnosis purposes. MN cells were collected from a SRLV negative animal and cultivated in minimal essential media supplemented with bovine fetal serum. Subcultures were inoculated with caprine arthritis encephalitis virus (CAEV Cork strain, the supernatant was collected, clarified by centrifugation (3.400 g for 20 minutes, concentrated using the AMICON® system. Samples were subjected to agar gel immunodiffusion (AGID tests. MN cells presented satisfactory performance, were amenable to several subcultivation.

  11. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  12. Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR.

    Science.gov (United States)

    Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier

    2017-11-01

    Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.

  13. Tryptophan oxidation catabolite, N-formylkynurenine, in photo degraded cell culture medium results in reduced cell culture performance.

    Science.gov (United States)

    McElearney, Kyle; Ali, Amr; Gilbert, Alan; Kshirsagar, Rashmi; Zang, Li

    2016-01-01

    Chemically defined media have been widely used in the biopharmaceutical industry to enhance cell culture productivities and ensure process robustness. These media, which are quite complex, often contain a mixture of many components such as vitamins, amino acids, metals and other chemicals. Some of these components are known to be sensitive to various stress factors including photodegradation. Previous work has shown that small changes in impurity concentrations induced by these potential stresses can have a large impact on the cell culture process including growth and product quality attributes. Furthermore, it has been shown to be difficult to detect these modifications analytically due to the complexity of the cell culture media and the trace level of the degradant products. Here, we describe work performed to identify the specific chemical(s) in photodegraded medium that affect cell culture performance. First, we developed a model system capable of detecting changes in cell culture performance. Second, we used these data and applied an LC-MS analytical technique to characterize the cell culture media and identify degradant products which affect cell culture performance. Riboflavin limitation and N-formylkynurenine (NFK), a tryptophan oxidation catabolite, were identified as chemicals which results in a reduction in cell culture performance. © 2015 American Institute of Chemical Engineers.

  14. Cytokine profiles of tumor supernatants in invasive ductal cancer and fibroadenoma of the breast and its relationship with VEGF-A expression in the tumors.

    Science.gov (United States)

    Autenshlyus, Alexander I; Arkhipov, Sergey A; Kunts, Tatiana A; Marinkin, Igor O; Mikhailova, Elena S; Karpukhina, Xenia V; Varaksin, Nikolay A

    2017-03-01

    Interrelations between cytokines, produced by invasive ductal carcinoma (IDC) and fibroadenoma (FA) of the breast, and angiogenic growth factor VEGF-A, expressed in IDC and FA, were investigated. The analysis of the cytokine profiles of IDC and FA was performed by cultivation of tumor biopsy specimens in vitro. Testing of the cytokine-producing reserve of the tumors for production of VEGF-A was conducted by culturing samples of IDC and FA in a medium containing polyclonal activator (a complex of phytohemagglutinin, concanavalin A, and lipopolysaccharide). Levels of cytokines and growth factors (IL-2, IL-6, IL-8, IL-10, IL-17, IL-18, IL-1β, IL-1Ra, TNF-α, IFN-γ, G-CSF, GM-CSF, VEGF-A) and MCP-1 (monocyte chemoattractant protein-1) in tumor supernatants were determined by an ELISA. Expression of VEGF-A was analyzed in tumor biopsy specimens by immunohistochemical analysis. In the IDC supernatants, the concentrations of IL-17, IL-18, and IFN-γ were higher and the concentrations of IL-10 and MCP-1 were lower in comparison with the FA supernatants. We observed negative correlations between the macrophage infiltration and VEGF-A concentration in the IDC supernatants (r = -0.508; P = 0.011) and between VEGF-A expression and the IDC vascularization degree (r = -0.423, P = 0.039). Spontaneous expression of VEGF-A in samples of IDC significantly exceeded the VEGF-A expression in FA. There was no difference between IDC and FA in VEGF-A expression after treatment with the polyclonal activators. Our results indicate that greater malignancy may have a paradoxical effect that is controlled by cytokines and characterized by weakening of tumor angiogenesis during overproduction of VEGF-A. These findings point to complex mechanisms of positive and negative regulation of tumor angiogenesis by cytokines that are produced by the tumor and by cells in its microenvironment, whose cytokine profiles may change at different stages of tumor progression.

  15. A kinetic model for flavonoid production in tea cell culture.

    Science.gov (United States)

    Shibasaki-Kitakawa, Naomi; Iizuka, Yasuhiro; Takahashi, Atsushi; Yonemoto, Toshikuni

    2017-02-01

    As one of the strategies for efficient production of a metabolite from cell cultures, a kinetic model is very useful tool to predict productivity under various culture conditions. In this study, we propose a kinetic model for flavonoid production in tea cell culture based on the cell life cycle and expression of PAL, the gene encoding phenylalanine ammonia-lyase (PAL)-the key enzyme in flavonoid biosynthesis. The flavonoid production rate was considered to be related to the amount of active PAL. Synthesis of PAL was modelled based on a general gene expression/translation mechanism, including the transcription of DNA encoding PAL into mRNA and the translation of PAL mRNA into the PAL protein. The transcription of DNA was assumed to be promoted at high light intensity and suppressed by a feedback regulatory mechanism at high flavonoid concentrations. In the model, mRNA and PAL were considered to self-decompose and to be lost by cell rupture. The model constants were estimated by fitting the experimental results obtained from tea cell cultures under various light intensities. The model accurately described the kinetic behaviors of dry and fresh cell concentrations, glucose concentration, cell viability, PAL specific activity, and flavonoid content under a wide range of light intensities. The model simulated flavonoid productivity per medium under various culture conditions. Therefore, this model will be useful to predict optimum culture conditions for maximum flavonoid productivity in cultured tea cells.

  16. [Application of cell co-culture techniques in medical studies].

    Science.gov (United States)

    Luo, Yun; Sun, Gui-Bo; Qin, Meng; Yao, Fan; Sun, Xiao-Bo

    2012-11-01

    As the cell co-culture techniques can better imitate an in vivo environment, it is helpful in observing the interactions among cells and between cells and the culture environment, exploring the effect mechanisms of drugs and their possible targets and filling the gaps between the mono-layer cell culture and the whole animal experiments. In recently years, they has attracted much more attention from the medical sector, and thus becoming one of research hotspots in drug research and development and bio-pharmaceutical fields. The cell co-culture techniques, including direct and indirect methods, are mainly used for studying pathological basis, new-type treatment methods and drug activity screening. Existing cell co-culture techniques are used for more pharmacological studies on single drug and less studies on interaction of combined drugs, such as collaborative compatibility and attenuation and synergistic effect among traditional Chinese medicines (TCMs). In line with the action characteristics of multi-component and multi-target, the cell co-culture techniques provide certain reference value for future studies on the effect and mechanism of combined TCMs on organisms as well as new methods for studies on TCMs and their compounds. This essay summarizes cell co-culture methods and their application and look into the future of their application in studies on TCMs and compounds.

  17. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tissue culture media for human ex vivo tissue and... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture processing applications. (a) Identification. Tissue culture media for human ex vivo tissue and cell culture...

  18. Effects of scorched food leachates with or without activated charcoal pretreatment on AhR activation in cultured cells.

    Science.gov (United States)

    Takahashi, Satoshi; Morita, Koji; Kinoshita, Makoto; Fujimori, Shin; Ishikawa, Toshio

    2015-12-01

    Aryl hydrocarbon receptor (AhR) is a transcription factor activated by xenobiotics, including dioxins and polycyclic aromatic hydrocarbons (PAHs). Although AhR is also activated by some dietary constituents, it has not been completely clarified in what circumstances AhR ligands are ingested in our daily life. Because PAHs are formed by the incomplete combustion of organic materials, we hypothesized that scorched foods might contain and leach out AhR ligands sufficient to stimulate AhR in vitro. To test this hypothesis, scorched foods (bread, cheese, etc.) were mixed vigorously with water, and the supernatants were retrieved as samples. The samples were added to HepG2 cells stably expressing an AhR-responsive reporter gene. Also, expression of CYP1A1, an endogenous AhR-responsive gene, was analyzed by RT-PCR in different cell lines treated with the samples. We further tested whether pretreatment of the samples with activated charcoal would alter their AhR-stimulating activity. All the supernatant samples tested induced AhR-dependent reporter gene activity and CYP1A1 mRNA expression. In some samples, these inductions were inhibited by pretreatment with activated charcoal. Our findings indicate that scorched food leachates stimulate AhR in cultured cells and that activated charcoal adsorbs the AhR-stimulating substances in some leachates. Thus, people who habitually eat scorched foods are exposed to AhR ligands on a regular basis. Further studies are needed to elucidate whether burnt foods actually exert biological effects on our health.

  19. Novel culturing platform for brain slices and neuronal cells

    DEFF Research Database (Denmark)

    Svendsen, Winnie Edith; Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya

    2015-01-01

    In this paper we demonstrate a novel culturing system for brain slices and neuronal cells, which can control the concentration of nutrients and the waste removal from the culture by adjusting the fluid flow within the device. The entire system can be placed in an incubator. The system has been te...... tested successfully with brain slices and PC12 cells. The culture substrate can be modified using metal electrodes and/or nanostructures for conducting electrical measurements while culturing and for better mimicking the in vivo conditions.......In this paper we demonstrate a novel culturing system for brain slices and neuronal cells, which can control the concentration of nutrients and the waste removal from the culture by adjusting the fluid flow within the device. The entire system can be placed in an incubator. The system has been...

  20. Radiosensitivity of primary cultured fish cells with different ploidy

    International Nuclear Information System (INIS)

    Mitani, Hiroshi; Egami, Nobuo; Kobayashi, Hiromu.

    1986-01-01

    The radiosensitivity of primary cultured goldfish cells (Carassius auratus) was investigated by colony formation assay. The radiosensitivity of cells from two varieties of goldfish, which show different sensitivity to lethal effect of ionizing radiation in vivo, was almost identical. Primary cultured cells from diploid, triploid and tetraploid fish retained their DNA content as measured by microfluorometry, and the nuclear size increases as ploidy increases. However, radiosensitivity was not related to ploidy. (author)

  1. Treatment of Mycoplasma Contamination in Cell Cultures with Plasmocin

    OpenAIRE

    Uphoff, Cord C.; Denkmann, Sabine-A.; Drexler, Hans G.

    2012-01-01

    A high percentage of cell lines are chronically infected with various mycoplasma species. The addition of antibiotics that are particularly effective against these contaminants to the culture medium during a limited period of time is a simple, inexpensive, and very practical approach for decontaminating cell cultures. Here, we examined the effectiveness of the new antimycoplasma compound Plasmocin that has been employed routinely to cleanse chronically infected cell lines. In a first round of...

  2. Multizone Paper Platform for 3D Cell Cultures

    Science.gov (United States)

    Derda, Ratmir; Hong, Estrella; Mwangi, Martin; Mammoto, Akiko; Ingber, Donald E.; Whitesides, George M.

    2011-01-01

    In vitro 3D culture is an important model for tissues in vivo. Cells in different locations of 3D tissues are physiologically different, because they are exposed to different concentrations of oxygen, nutrients, and signaling molecules, and to other environmental factors (temperature, mechanical stress, etc). The majority of high-throughput assays based on 3D cultures, however, can only detect the average behavior of cells in the whole 3D construct. Isolation of cells from specific regions of 3D cultures is possible, but relies on low-throughput techniques such as tissue sectioning and micromanipulation. Based on a procedure reported previously (“cells-in-gels-in-paper” or CiGiP), this paper describes a simple method for culture of arrays of thin planar sections of tissues, either alone or stacked to create more complex 3D tissue structures. This procedure starts with sheets of paper patterned with hydrophobic regions that form 96 hydrophilic zones. Serial spotting of cells suspended in extracellular matrix (ECM) gel onto the patterned paper creates an array of 200 micron-thick slabs of ECM gel (supported mechanically by cellulose fibers) containing cells. Stacking the sheets with zones aligned on top of one another assembles 96 3D multilayer constructs. De-stacking the layers of the 3D culture, by peeling apart the sheets of paper, “sections” all 96 cultures at once. It is, thus, simple to isolate 200-micron-thick cell-containing slabs from each 3D culture in the 96-zone array. Because the 3D cultures are assembled from multiple layers, the number of cells plated initially in each layer determines the spatial distribution of cells in the stacked 3D cultures. This capability made it possible to compare the growth of 3D tumor models of different spatial composition, and to examine the migration of cells in these structures. PMID:21573103

  3. Feeding Frequency Affects Cultured Rat Pituitary Cells in Low Gravity

    Science.gov (United States)

    Hymer, W. C.; Grindeland, R. E.; Salada, T.; Cenci, R.; Krishnan, K.; Mukai, C.; Nagaoka, S.

    1996-01-01

    In this report, we describe the results of a rat pituitary cell culture experiment done on STS-65 in which the effect of cell feeding on the release of the six anterior pituitary hormones was studied. We found complex microgravity related interactions between the frequency of cell feeding and the quantity and quality (i.e. biological activity) of some of the six hormones released in flight. Analyses of growth hormone (GH) released from cells into culture media on different mission days using gel filtration and ion exchange chromatography yielded qualitatively similar results between ground and flight samples. Lack of cell feeding resulted in extensive cell clumping in flight (but not ground) cultures. Vigorous fibroblast growth occurred in both ground and flight cultures fed 4 times. These results are interpreted within the context of autocrine and or paracrine feedback interactions. Finally the payload specialist successfully prepared a fresh trypsin solution in microgravity, detached the cells from their surface and reinserted them back into the culture chamber. These cells reattached and continued to release hormone in microgravity. In summary, this experiment shows that pituitary cells are microgravity sensitive and that coupled operations routinely associated with laboratory cel1 culture can also be accomplished in low gravity.

  4. Radiation adaptive response for the growth of cultured glial cells

    International Nuclear Information System (INIS)

    Suzuki, S.; Miura, Y.; Kano, M.; Toda, T.; Urano, S.

    2003-01-01

    Full text: To examine the molecular mechanism of radiation adaptive response (RAR) for the growth of cultured glial cells and to investigate the influence of aging on the response, glial cells were cultured from young and aged rats (1 month and 24 months old). RAR for the growth of glial cells conditioned with a low dose of X-rays and subsequently exposed to a high dose of X-rays was examined for cell number and BrdU incorporation. Involvement of the subcellular signaling pathway factors in RAR was investigated using their inhibitors, activators and mutated glial cells. RAR was observed in cells cultured from young rats, but was not in cells from aged rats. The inhibitors of protein kinase C (PKC) and DNA-dependent protein kinase (DNA-PK) or phosphatidylinositol 3-kinase (PI3K) suppressed RAR. The activators of PKC instead of low dose irradiation also caused RAR. Moreover, glial cells cultured from severe combined immunodeficiency (scid) mice (CB-17 scid) and ataxia-telangiectasia (AT) cells from AT patients showed no RAR. These results indicated that PKC, ATM, DNAPK and/or PI3K were involved in RAR for growth and BrdU incorporation of cultured glial cells and RAR decreased with aging. Proteomics data of glial cells exposed to severe stress of H 2 O 2 or X-rays also will be presented in the conference since little or no difference has not been observed with slight stress yet

  5. Urokinase production by electrophoretically separated cultured human embryonic kidney cells

    Science.gov (United States)

    Kunze, M. E.; Plank, L. D.; Giranda, V.; Sedor, K.; Todd, P. W.

    1985-01-01

    Urokinase is a plasminogen activator found in urine. Relatively pure preparations have been tested in Europe, Japan and the United States for the treatment of deep vein thrombosis and other dangerous blood clots. Human embryonic kidney cell cultures have been found to produce urokinase at much higher concentrations, but less than 5% of the cells in typical cultures are producers. Since human diploid cells become senescent in culture the selection of clones derived from single cells will not provide enough material to be useful, so a bulk purification method is needed for the isolation of urokinase producing cell populations. Preparative cell electrophoresis was chosen as the method, since evidence exists that human embryonic cell cultures are richly heterogeneous with respect to electrophoretic mobility, and preliminary electrophoretic separations on the Apollo-Soyuz space flight produced cell populations that were rich in urokinase production. Similarly, erythropoietin is useful in the treatment of certain anemias and is a kidney cell duct, and electrophoretically enriched cell populations producing this product have been reported. Thus, there is a clear need for diploid human cells that produce these products, and there is evidence that such cells should be separable by free-flow cell electrophoresis.

  6. Controlling the diversity of cell populations in a stem cell culture

    NARCIS (Netherlands)

    Heo, Inha; Clevers, Hans

    2015-01-01

    Culturing intestinal stem cells into 3D organoids results in heterogeneous cell populations, reflecting the in vivo cell type diversity. In a recent paper published in Nature, Wang et al. established a culture condition for a highly homogeneous population of intestinal stem cells.

  7. The ultrastructure of separated and cultured cell of Porphyra yezoensis

    Science.gov (United States)

    Mei, Jun-Xue; Fei, Xiu-Geng

    2001-03-01

    There are many reports that cells (protoplasts) separated from the thallus of Porphyra by enzyme can develop to normal leafy thalli in the same way as monospores. But there are few investigations on the subcellular structure of the isolated vegetative cell for comparison with the subcellular structure of monospores. To clarify whether the separated and cultured cells undergo the same or similar ultrastructure changes during culture and germination as monospores undergo in their formation and germination, we observed their ultrastructure, compared them with those of the monospore and found that the ultrastructure of separated and cultured cells did not have the characteristic feature as that of monospore formation, such as production of small and large fibrous vesicles, but was accompanied by vacuolation and starch mobilization like that in monospore germination. The paper also discusses the relations between monospores and separated and cultured cells.

  8. Monitoring of cell cultures with LTCC microelectrode array.

    Science.gov (United States)

    Ciosek, P; Zawadzki, K; Łopacińska, J; Skolimowski, M; Bembnowicz, P; Golonka, L J; Brzózka, Z; Wróblewski, W

    2009-04-01

    Monitoring of cell cultures in microbioreactors is a crucial task in cell bioassays and toxicological tests. In this work a novel tool based on a miniaturized sensor array fabricated using low-temperature cofired ceramics (LTCC) technology is presented. The developed device is applied to the monitoring of cell-culture media change, detection of the growth of various species, and in toxicological studies performed with the use of cells. Noninvasive monitoring performed with the LTCC microelectrode array can be applied for future cell-engineering purposes.

  9. Nylon-3 polymers that enable selective culture of endothelial cells.

    Science.gov (United States)

    Liu, Runhui; Chen, Xinyu; Gellman, Samuel H; Masters, Kristyn S

    2013-11-06

    Substrates that selectively encourage the growth of specific cell types are valuable for the engineering of complex tissues. Some cell-selective peptides have been identified from extracellular matrix proteins; these peptides have proven useful for biomaterials-based approaches to tissue repair or regeneration. However, there are very few examples of synthetic materials that display selectivity in supporting cell growth. We describe nylon-3 polymers that support in vitro culture of endothelial cells but do not support the culture of smooth muscle cells or fibroblasts. These materials may be promising for vascular biomaterials applications.

  10. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  11. Surface modified alginate microcapsules for 3D cell culture

    Science.gov (United States)

    Chen, Yi-Wen; Kuo, Chiung Wen; Chueh, Di-Yen; Chen, Peilin

    2016-06-01

    Culture as three dimensional cell aggregates or spheroids can offer an ideal platform for tissue engineering applications and for pharmaceutical screening. Such 3D culture models, however, may suffer from the problems such as immune response and ineffective and cumbersome culture. This paper describes a simple method for producing microcapsules with alginate cores and a thin shell of poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG) to encapsulate mouse induced pluripotent stem (miPS) cells, generating a non-fouling surface as an effective immunoisolation barrier. We demonstrated the trapping of the alginate microcapsules in a microwell array for the continuous observation and culture of a large number of encapsulated miPS cells in parallel. miPS cells cultured in the microcapsules survived well and proliferated to form a single cell aggregate. Droplet formation of monodisperse microcapsules with controlled size combined with flow cytometry provided an efficient way to quantitatively analyze the growth of encapsulated cells in a high-throughput manner. The simple and cost-effective coating technique employed to produce the core-shell microcapsules could be used in the emerging field of cell therapy. The microwell array would provide a convenient, user friendly and high-throughput platform for long-term cell culture and monitoring.

  12. Stimulation and support of haemopoietic stem cell proliferation by irradiated stroma cell colonies in bone marrow cell culture in vitro

    International Nuclear Information System (INIS)

    Mori, K.J.; Izumi, Hiroko; Seto, Akira

    1981-01-01

    A culture system was established in which haemopoietic stem cells can undergo a recovery proliferation after a depletion of the stem cells, completely in vitro. To elucidate the source of the stimulatory factors, normal bone marrow cells were overlayed on top of the irradiated adherent 'stromal' cell colonies in the bone marrow cell culture. This stimulated the proliferation of haemopoietic stem cells in the cultured cells in suspension. The present results indicate that the stromal cells produce factors which stimulate stem cell proliferation. Whether the stimulation is evoked by direct cell-cell interactions or by humoral factors is as yet to be studied. (author)

  13. Pulsed electromagnetic fields decrease proinflammatory cytokine secretion (IL-1β and TNF-α) on human fibroblast-like cell culture.

    Science.gov (United States)

    Gómez-Ochoa, Ignacio; Gómez-Ochoa, Pablo; Gómez-Casal, Francisco; Cativiela, Encarna; Larrad-Mur, Luis

    2011-10-01

    The clinical use of pulsed electromagnetic fields (PEMF) in osteoarticular pathology is widely extended, although the mechanisms involved are unknown. The aim of this study was to evaluate the action of a new protocol of treatment with PEMF on liquid medium cultures of fibroblast-like cells derivates of mononuclear peripheral blood cells. Fibroblast-like cells growth was obtained in liquid medium culture from mononuclear cells (MNC) of human peripheral blood. The PEMF irradiation protocol included an intensity of 2.25 mT, a frequency of 50 Hz and an application time of 15 min on days 7, 8 and 9 of cell culture. Immunophenotype was performed with specific heterologous monoclonal antibodies for each cell receptor (Vimentin, Cytokeratin, CD34, CD41, CD61 and CD68). The cytokines' production was determined in the supernatant of the culture medium by means of the Luminex technology. The immunophenotype did not show any statistical difference on comparing treated against non-treated cell cultures on any of the days. In the treatment cell population, the proinflammatory cytokines, IL-1β and TNF-α showed a significant decrease on days 14 and 21 of the culture, whilst IL-10 increased significantly on day 21. It is concluded that PEMF irradiation does not alter the cell immunophenotype of the fibroblast-like cell population, but does provoke a decrease in the production of inflammatory-type cytokines (IL-1β, TNF-α) and an increase in cytokines of lymphocytic origin (IL-10). These facts coincide with the chronology of the clinical effect undergone by patients with osteoarticular pathology after PEMF irradiation.

  14. Immunodissection and culture of rabbit cortical collecting tubule cells

    International Nuclear Information System (INIS)

    Spielman, W.S.; Sonnenburg, W.K.; Allen, M.L.; Arend, L.J.; Gerozissis, K.; Smith, W.L.

    1986-01-01

    A mouse monoclonal antibody designated IgG 3 (rct-30) has been prepared that reacts specifically with an antigen on the surface of all cells comprising the cortical and medullary rabbit renal collecting tubule including the arcades. Plastic culture dishes coated with IgG 3 (rct-30) were used to isolate collecting tubule cells from collagenase dispersions of rabbit renal cortical cells by immunoadsorption. Typically, 10 6 rabbit cortical collecting tubule (RCCT) cells were obtained from 5 g of renal cortex (2 kidneys). Between 20 and 30% of the RCCT cells were reactive with peanut lectin suggesting that RCCT cells are a mixture of principal and intercalated cells. Approximately 10 7 RCCT cells were obtained after 4 to 5 days in primary culture. Moreover, RCCT cells continued to proliferate after passaging with a doubling time of ∼32 h. RCCT cells passaged once and then cultured 4-5 days were found 1) to synthesize cAMP in response to arginine vasopressin (AVP), prostaglandin E 2 (PGE 2 ), isoproterenol, and parathyroid hormone, but not calcitonin, prostaglandin D 2 , or prostaglandin I, and 2) to release PGE 2 in response to bradykinin but not arginine vasopressin or isoproterenol. The results indicate that cultured RCCT cells retain many of the hormonal, histochemical, and morphological properties expected for a mixture of principal and intercalated rabbit cortical collecting tubule epithelia. RCCT cells should prove useful both for studying hormonal interactions in the cortical collecting tubule and as a starting population for isolating intercalated collecting tubule epithelia

  15. In vitro production of azadirachtin from cell suspension cultures of ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    to affect the growth and metabolism of cultured cells, and have been studied extensively in different species in .... Specific growth rate of neem cell suspensions in altered nitrate: ammonium ratio. MS, Murashige and Skoog medium; MS medium with .... Stimulated caffeine production has been reported in Coffea arabica cell ...

  16. Protein biosynthesis in cultured human hair follicle cells.

    Science.gov (United States)

    Weterings, P J; Vermorken, A J; Bloemendal, H

    1980-10-31

    A new technique has been used for culturing human keratinocytes. The cells grow on the basement membrane-like capsules of bovine lenses. Lens cells were removed from the capsules by rigid trypsinization. In order to exclude any contamination with remaining living cells the isolated capsules were irradiated with X-rays at a dose of 10,000 rad. In this way human epithelial cells can be brought in culture from individual hair follicles. Since feeder cells are not used in this culture technique, the biosynthesis of keratinocyte proteins can be studied in these cultures. The newly synthesized proteins can be separated into a water-soluble, a urea-soluble, and a urea-insoluble fraction. Product analysis has been performed on the first two fractions revealing protein patterns identical to those of intact hair follicles. Product analysis of the urea-soluble fractions of microdissected hair follicles shows that the protein pattern of the cultured keratinocytes resembles the protein pattern of the hair follicle sheath. Studies on the metabolism of benzo(a)pyrene revealed that the enzyme aryl hydrocarbon hydroxylase (AHH) is present in cultured hair follicle cells. A possible use of our culture system for eventual detection of inherited predisposition for smoking-dependent lung cancer is discussed.

  17. Control of fibronectin synthesis by rat granulosa cells in culture

    International Nuclear Information System (INIS)

    Skinner, M.K.; Dorrington, J.H.

    1984-01-01

    The secreted and cellular [ 35 S]methionine-radiolabeled proteins of cultured rat granulosa cells were separated by electrophoresis on sodium dodecylsulfate (SDS) polyacrylamide gradient slab gels. From 24 to 72 h of culture FSH increased the intensity of labeling of most of the secreted proteins. A 220,000-dalton protein, however, increased in intensity only in control cultures and became the major secreted protein after 72 h, comprising 20% of the total radiolabeled proteins. This protein was identified as fibronectin by immunoprecipitation. There was no increase in the secreted or cellular fibronectin in FSH- or testosterone- and insulin-treated cultures. These studies indicate that a component of extracellular matrix is a major secretory product of unstimulated immature granulosa cells. As hormones induce the differentiated functions of granulosa cells in culture, the secretion of fibronectin is inhibited

  18. Characterization of a novel miniature cell culture device

    Science.gov (United States)

    Moore, Sandra K.; Kleis, Stanley J.

    2008-05-01

    Recent advancements in the field of microfluidics have generated much interest in the advent of a miniaturized cell culture device. In this study, we developed a novel miniature culture system (cells, either prokaryotic or eukaryotic in type, for both 1 g and microgravity applications. The miniature culture system may advance the development of microanalytical remote monitoring tools such as biological sentinels, biosensors, and lab-on-a-chip. Integrating the autonomous miniature culture system with a microanalytical device makes a powerful biological tool. Cells can be cultured long-term, harvested, and released directly into an analytical tool without the need for human interaction through fluid dynamic manipulations. This work characterizes the miniature bioreactor system through numerical and experimental proof of concept studies.

  19. Radiosensitivity of cultured insect cells: II. Diptera

    Energy Technology Data Exchange (ETDEWEB)

    Koval, T.M.

    1983-10-01

    The radiosensitivity of five dipteran cell lines representing three mosquito genera and one fruit fly genus were examined. These lines are: (1) ATC-10, Aedes aegypti; (2) RU-TAE-14, Toxorhynchites amboinensis; (3) RU-ASE-2A, Anopheles stephensi; (4) WR69-DM-1, Drosophila melanogaster; and (5) WR69-DM-2, Drosophila melanogaster. Population doubling times for these lines range from approximately 16 to 48 hr. Diploid chromosome numbers are six for the mosquito cells and eight for the fruit fly cells D/sub 0/ values are 5.1 and 6.5 Gy for the Drosophila cell lines and 3.6, 6.2, and 10.2 Gy for the mosquito cell lines. The results of this study demonstrate that dipteran insect cells are a few times more resistant to radiation than mammalian cells, but not nearly as radioresistant as lepidopteran cells.

  20. Radiosensitivity of cultured insect cells: II. Diptera

    International Nuclear Information System (INIS)

    Koval, T.M.

    1983-01-01

    The radiosensitivity of five dipteran cell lines representing three mosquito genera and one fruit fly genus were examined. These lines are: (1) ATC-10, Aedes aegypti; (2) RU-TAE-14, Toxorhynchites amboinensis; (3) RU-ASE-2A, Anopheles stephensi; (4) WR69-DM-1, Drosophila melanogaster; and (5) WR69-DM-2, Drosophila melanogaster. Population doubling times for these lines range from approximately 16 to 48 hr. Diploid chromosome numbers are six for the mosquito cells and eight for the fruit fly cells D 0 values are 5.1 and 6.5 Gy for the Drosophila cell lines and 3.6, 6.2, and 10.2 Gy for the mosquito cell lines. The results of this study demonstrate that dipteran insect cells are a few times more resistant to radiation than mammalian cells, but not nearly as radioresistant as lepidopteran cells

  1. Quantitative volumetric Raman imaging of three dimensional cell cultures

    KAUST Repository

    Kallepitis, Charalambos

    2017-03-22

    The ability to simultaneously image multiple biomolecules in biologically relevant three-dimensional (3D) cell culture environments would contribute greatly to the understanding of complex cellular mechanisms and cell–material interactions. Here, we present a computational framework for label-free quantitative volumetric Raman imaging (qVRI). We apply qVRI to a selection of biological systems: human pluripotent stem cells with their cardiac derivatives, monocytes and monocyte-derived macrophages in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies and cytoskeletal structures in 3D with unprecedented biomolecular specificity for vibrational microspectroscopy.

  2. Generation of a patterned co-culture system composed of adherent cells and immobilized nonadherent cells.

    Science.gov (United States)

    Yamazoe, Hironori; Ichikawa, Takashi; Hagihara, Yoshihisa; Iwasaki, Yasuhiko

    2016-02-01

    Patterned co-culture is a promising technique used for fundamental investigation of cell-cell communication and tissue engineering approaches. However, conventional methods are inapplicable to nonadherent cells. In this study, we aimed to establish a patterned co-culture system composed of adherent and nonadherent cells. Nonadherent cells were immobilized on a substrate using a cell membrane anchoring reagent conjugated to a protein, in order to incorporate them into the co-culture system. Cross-linked albumin film, which has unique surface properties capable of regulating protein adsorption, was used to control their spatial localization. The utility of our approach was demonstrated through the fabrication of a patterned co-culture consisting of micropatterned neuroblastoma cells surrounded by immobilized myeloid cells. Furthermore, we also created a co-culture system composed of cancer cells and immobilized monocytes. We observed that monocytes enhanced the drug sensitivity of cancer cells and its influence was limited to cancer cells located near the monocytes. Therefore, the incorporation of nonadherent cells into a patterned co-culture system is useful for creating culture systems containing immune cells, as well as investigating the influence of these immune cells on cancer drug sensitivity. Various methods have been proposed for creating patterned co-culture systems, in which multiple cell types are attached to a substrate with a desired pattern. However, conventional methods, including our previous report published in Acta Biomaterialia (2010, 6, 526-533), are unsuitable for nonadherent cells. Here, we developed a novel method that incorporates nonadherent cells into the co-culture system, which allows us to precisely manipulate and study microenvironments containing nonadherent and adherent cells. Using this technique, we demonstrated that monocytes (nonadherent cells) could enhance the drug sensitivity of cancer cells and that their influence had a

  3. Human hematopoietic cell culture, transduction, and analyses

    DEFF Research Database (Denmark)

    Bonde, Jesper; Wirthlin, Louisa; Kohn, Donald B

    2008-01-01

    This unit provides methods for introducing genes into human hematopoietic progenitor cells. The Basic Protocol describes isolation of CD34(+) cells, transduction of these cells with a retroviral vector on fibronectin-coated plates, assaying the efficiency of transduction, and establishing long-te...

  4. Exposure to Music Alters Cell Viability and Cell Motility of Human Nonauditory Cells in Culture.

    Science.gov (United States)

    Lestard, Nathalia R; Capella, Marcia A M

    2016-01-01

    Although music is part of virtually all cultures in the world, little is known about how it affects us. Since the beginning of this century several studies suggested that the response to music, and to sound in general, is complex and might not be exclusively due to emotion, given that cell types other than auditory hair cells can also directly react to audible sound. The present study was designed to better understand the direct effects of acoustic vibrations, in the form of music, in human cells in culture. Our results suggest that the mechanisms of cell growth arrest and/or cell death induced by acoustic vibrations are similar for auditory and nonauditory cells.

  5. Establishment of sorghum cell suspension culture system for ...

    African Journals Online (AJOL)

    Total soluble proteins (TSP) and culture filtrate (CF) proteins were extracted from the cell culture system and solubilised in urea buffer (9 M urea, 2 M thiourea and 4% CHAPS). Both onedimensional (1D) and two-dimensional (2D) gel analysis of these two proteomes show that the TSP and CF proteomes have different ...

  6. Free-energy carriers in human cultured muscle cells

    NARCIS (Netherlands)

    Bolhuis, P. A.; de Zwart, H. J.; Ponne, N. J.; de Jong, J. M.

    1985-01-01

    Creatine phosphate (CrP), adenosine triphosphate (ATP), creatine kinase (CK), adenylate kinase (AK), protein, and DNA were quantified in human muscle cell cultures undergoing transition from dividing myoblasts to multinucleate myotubes. CrP is negligible in cultures grown in commonly applied media

  7. Enhancement of Diosgenin Production in Plantlet and Cell Cultures ...

    African Journals Online (AJOL)

    Enhancement of Diosgenin Production in Plantlet and Cell Cultures of Dioscorea zingiberensis by Palmarumycin C13 from the Endophytic fungus, Berkleasmium sp. Dzf12. Y Mou, K Zhou, D Xu, R Yu, J Li, C Yin, L Zhou ...

  8. Impact of cell culture on recombinant monoclonal antibody product heterogeneity.

    Science.gov (United States)

    Liu, Hongcheng; Nowak, Christine; Shao, Mei; Ponniah, Gomathinayagam; Neill, Alyssa

    2016-09-01

    Recombinant monoclonal antibodies are commonly expressed in mammalian cell culture and purified by several steps of filtration and chromatography. The resulting high purity bulk drug substance still contains product variants differing in properties such as charge and size. Posttranslational modifications and degradations occurring during cell culture are the major sources of heterogeneity in bulk drug substance of recombinant monoclonal antibodies. The focus of the current review is the impact of cell culture conditions on the types and levels of various modifications and degradations of recombinant monoclonal antibodies. Understanding the relationship between cell culture and product variants can help to make consistently safe and efficacious products. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1103-1112, 2016. © 2016 American Institute of Chemical Engineers.

  9. Viral risk mitigation for Mammalian cell culture media.

    Science.gov (United States)

    Weaver, Bob; Rosenthal, Scott

    2010-01-01

    Adventitious viral contamination in mammalian cell culture manufacturing facilities can lead to loss of product due to regulatory concerns regarding potential health risks. These events can also result in manufacturing shutdowns for extended periods of time. Numerous measures are currently taken to minimize these risks. Nonetheless, raw materials remain a high-risk entry point for viral contamination of mammalian cell cultures. Two virucidal technologies, ultraviolet radiation in the C band and high-temperature short-time pasteurization, were tested for the treatment of mammalian cell culture media. The results demonstrated no impact to the cell culture process or the quality of the products produced at the chosen dosage while providing robust viral protection.

  10. Elicitation of Diacetylenic Compounds in Suspension Cultured Cells of Eggplant

    Science.gov (United States)

    Imoto, Setsuko; Ohta, Yoshimoto

    1988-01-01

    Induction of stress metabolites in the suspension cultured cells of eggplant (Solanum melongena L.) was examined. When autoclaved RNase A or nigeran, both of which are nonspecific phytoalexin elicitors in bean cells, were added to the cell culture of eggplant, greatly enhanced levels of three compounds were observed. One of them was cis-pentadeca-6-ene-1,3-diyne-5,15-diol, a novel diacetylenic compound. This compound has considerable fungitoxic activity. Also identified was falcarindiol, another fungitoxic diacetylenic compound previously reported as one of the phytoalexins in infected tomato fruits and leaves. Elicited compounds preferentially accumulated in the culture medium rather than in the cells and decreased to original levels during prolonged culturing. The elicitation of these compounds was closely correlated with cellular damage in terms of the decrease of growth rate and was inhibited by 10 micromolar cycloheximide. PMID:16665862

  11. Cell/Tissue Culture Radiation Exposure Facility, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop a Cell/Tissue Culture Radiation Exposure Facility (CTC-REF) to enable radiobiologists to investigate the real-time radiation effects on...

  12. Production and release of infectious hepatitis C virus from human liver cell cultures in the three-dimensional radial-flow bioreactor

    International Nuclear Information System (INIS)

    Aizaki, Hideki; Nagamori, Seishi; Matsuda, Mami; Kawakami, Hayato; Hashimoto, Osamu; Ishiko, Hiroaki; Kawada, Masaaki; Matsuura, Tomokazu; Hasumura, Satoshi; Matsuura, Yoshiharu; Suzuki, Tetsuro; Miyamura, Tatsuo

    2003-01-01

    Lack of efficient culture systems for hepatitis C virus (HCV) has been a major obstacle in HCV research. Human liver cells grown in a three-dimensional radial-flow bioreactor were successfully infected following inoculation with plasma from an HCV carrier. Subsequent detection of increased HCV RNA suggested viral replication. Furthermore, transfection of HCV RNA transcribed from full-length cDNA also resulted in the production and release of HCV virions into supernatant. Infectivity was shown by successful secondary passage to a new culture. Introduction of mutations in RNA helicase and polymerase regions of HCV cDNA abolished virus replication, indicating that reverse genetics of this system is possible. The ability to replicate and detect the extracellular release of HCV might provide clues with regard to the persistent nature of HCV infection. It will also accelerate research into the pathogenicity of HCV, as well as the development of prophylactic agents and new therapy

  13. Cadmium binding components in the supernatant fraction of the small intestinal mucosa of rats administered cadmium

    International Nuclear Information System (INIS)

    Taguchi, Tetsuya; Suzuki, Shosuke

    1978-01-01

    Cadmium binding protein was isolated by gel filtration from the supernatant fraction of the small intestines of rats continuously administered cadmium for 1, 3, 6, 9, 32 and 96 days. About two-thirds of the total amount of absorbed cadmium was associated with the cytosol of mucosal tissues scraped from the small intestines. Cadmium was almost always bound to proteins, molecular weights of which ranged from 5,400 to 9,800. Cadmium in livers and that in intestinal mucosa were in the same binding state, but as there was some lag period between the induction of the Cd-binding proteins of both tissues, the protein of the small intestinal mucosal cells must have been induced at the mucosa itself by contact with cadmium. The Cd-binding protein of the mucosal cells may play an important role in absorbing cadmium, because no other form of this metal was found in the mucosal cells of the small intestines. (Kobatake, H.)

  14. Characterization of Tight Junction Proteins in Cultured Human Urothelial Cells

    Science.gov (United States)

    Rickard, Alice; Dorokhov, Nikolay; Ryerse, Jan; Klumpp, David J.; McHowat, Jane

    2010-01-01

    Tight junctions (TJs) are essential for normal function of epithelia, restricting paracellular diffusion and contributing to the maintainance of cell surface polarity. Superficial cells of the urothelium develop TJs, the basis for the paracellular permeability barrier of the bladder against diffusion of urinary solutes. Focusing on the superficial cell layer of stratified cell cultures of an immortalized human ureteral cell line, TEU-2 cells, we have examined the presence of TJ and TJ-associated proteins. TEU-2 cells were treated with calcium chloride and fetal bovine serum culture conditions used to induce stratification that resembles the normal transitional epithelial phenotype. Cultures were examined for TJ and TJ-associated proteins by confocal immuno-fluorescence microscopy and evaluated for TJ mRNA by reverse transcriptase-polymerase chain reaction (RT- PCR). TEU-2 cultures exhibited immunoreactivity at intercellular margins for claudins 1, 4, 5, 7, 14 and 16 whereas claudins 2, 8 and 12 were intracellular. RT-PCR corroborated the presence of these claudins at the mRNA level. The TJ-associated proteins occludin, JAM-1, and zonula occludens (ZO-1, ZO-2 and ZO-3) were localized at cell margins. We have found that numerous TJs and TJ-associated proteins are expressed in stratified TEU-2 cultures. Further, we propose TEU-2s provide a useful ureteral model for future studies on the involvement of TJs proteins in the normal and pathological physiology of the human urinary system. PMID:18553212

  15. CULTURE OF EMBRYONIC CELLS OF DROSOPHILA MELANOGASTER IN VITRO.

    Science.gov (United States)

    HORIKAWA, M; FOX, A S

    1964-09-25

    Embryonic cells isolated from eggs ofDrosophila melanogasterhave been cultured continuously in a new medium. Generation time for cell division is 30 hours. Chromosome number remains constant for at least 10 days. Cells from embryos of the mutant maroon-like grow at the same rate as those from wild-type embryos, but cells from rosy-2 grow slower and at a lower optimum temperature.

  16. Topological defects control collective dynamics in neural progenitor cell cultures

    Science.gov (United States)

    Kawaguchi, Kyogo; Kageyama, Ryoichiro; Sano, Masaki

    2017-04-01

    Cultured stem cells have become a standard platform not only for regenerative medicine and developmental biology but also for biophysical studies. Yet, the characterization of cultured stem cells at the level of morphology and of the macroscopic patterns resulting from cell-to-cell interactions remains largely qualitative. Here we report on the collective dynamics of cultured murine neural progenitor cells (NPCs), which are multipotent stem cells that give rise to cells in the central nervous system. At low densities, NPCs moved randomly in an amoeba-like fashion. However, NPCs at high density elongated and aligned their shapes with one another, gliding at relatively high velocities. Although the direction of motion of individual cells reversed stochastically along the axes of alignment, the cells were capable of forming an aligned pattern up to length scales similar to that of the migratory stream observed in the adult brain. The two-dimensional order of alignment within the culture showed a liquid-crystalline pattern containing interspersed topological defects with winding numbers of +1/2 and -1/2 (half-integer due to the nematic feature that arises from the head-tail symmetry of cell-to-cell interaction). We identified rapid cell accumulation at +1/2 defects and the formation of three-dimensional mounds. Imaging at the single-cell level around the defects allowed us to quantify the velocity field and the evolving cell density; cells not only concentrate at +1/2 defects, but also escape from -1/2 defects. We propose a generic mechanism for the instability in cell density around the defects that arises from the interplay between the anisotropic friction and the active force field.

  17. Cell proliferation and radiosensitivity of cow lymphocytes in culture

    International Nuclear Information System (INIS)

    Modave, C.; Fabry, L.; Leonard, A.

    1982-01-01

    The harlequin-staining technique has been used to study, after PHA-stimulation, the cell proliferation of cow lymphocytes in culture and to assess the radiosensitivity in first mitosis cells. At the 48 h fixation time, only 34% of the cells are in first mitosis whereas 55% are already in second and 11% in third mitosis. The exposure of cow lymphocytes to 200 rad X-rays result in the production of 16% dicentric chromosomes in first mitosis cells [fr

  18. Phosphate removal from digested sludge supernatant using modified fly ash.

    Science.gov (United States)

    Xu, Ke; Deng, Tong; Liu, Juntan; Peng, Weigong

    2012-05-01

    The removal of phosphate in digested sludge supernatant by modified coal fly ash was investigated in this study. Modification of the fly ash by the addition of sulfuric acid could significantly enhance its immobilization ability. The experimental results also showed that adsorption of phosphate by the modified fly ash was rapid with the removal percentage of phosphate reaching an equilibrium of 98.62% in less than 5 minutes. The optimum pH for phosphate removal was 9 and the removal percentage increased with increasing adsorbent dosage. The effect of temperature on phosphate removal efficiency was not significant from 20 to 40 degrees C. X-ray diffraction and scanning electron microscope analyses showed that phosphate formed an amorphous precipitate with water-soluble calcium, aluminum, and iron ions in the modified fly ash.

  19. Introducing Mammalian Cell Culture and Cell Viability Techniques in the Undergraduate Biology Laboratory.

    Science.gov (United States)

    Bowey-Dellinger, Kristen; Dixon, Luke; Ackerman, Kristin; Vigueira, Cynthia; Suh, Yewseok K; Lyda, Todd; Sapp, Kelli; Grider, Michael; Crater, Dinene; Russell, Travis; Elias, Michael; Coffield, V McNeil; Segarra, Verónica A

    2017-01-01

    Undergraduate students learn about mammalian cell culture applications in introductory biology courses. However, laboratory modules are rarely designed to provide hands-on experience with mammalian cells or teach cell culture techniques, such as trypsinization and cell counting. Students are more likely to learn about cell culture using bacteria or yeast, as they are typically easier to grow, culture, and manipulate given the equipment, tools, and environment of most undergraduate biology laboratories. In contrast, the utilization of mammalian cells requires a dedicated biological safety cabinet and rigorous antiseptic techniques. For this reason, we have devised a laboratory module and method herein that familiarizes students with common cell culture procedures, without the use of a sterile hood or large cell culture facility. Students design and perform a time-efficient inquiry-based cell viability experiment using HeLa cells and tools that are readily available in an undergraduate biology laboratory. Students will become familiar with common techniques such as trypsinizing cells, cell counting with a hemocytometer, performing serial dilutions, and determining cell viability using trypan blue dye. Additionally, students will work with graphing software to analyze their data and think critically about the mechanism of death on a cellular level. Two different adaptations of this inquiry-based lab are presented-one for non-biology majors and one for biology majors. Overall, these laboratories aim to expose students to mammalian cell culture and basic techniques and help them to conceptualize their application in scientific research.

  20. Culturing intestinal stem cells: applications for colorectal cancer research

    Directory of Open Access Journals (Sweden)

    Masayuki eFujii

    2014-06-01

    Full Text Available Recent advance of sequencing technology has revealed genetic alterations in colorectal cancer. The biological function of recurrently mutated genes has been intensively investigated through mouse genetic models and colorectal cancer cell lines. Although these experimental models may not fully reflect biological traits of human intestinal epithelium, they provided insights into the understanding of intestinal stem cell self-renewal, leading to the development of novel human intestinal organoid culture system. Intestinal organoid culture enabled to expand normal or tumor epithelial cells in vitro retaining their stem cell self-renewal and multiple differentiation. Gene manipulation of these cultured cells may provide an attractive tool for investigating genetic events involved in colorectal carcinogenesis.

  1. Production of recombinant proteins in suspension-cultured plant cells.

    Science.gov (United States)

    Plasson, Carole; Michel, Rémy; Lienard, David; Saint-Jore-Dupas, Claude; Sourrouille, Christophe; de March, Ghislaine Grenier; Gomord, Véronique

    2009-01-01

    Plants have emerged in the past decade as a suitable alternative to the current production systems for recombinant pharmaceutical proteins and, today their potential for low-cost production of high quality, much safer and biologically active mammalian proteins is largely documented. Among various plant expression systems being explored, genetically modified suspension-cultured plant cells offer a promising system for production of biopharmaceuticals. Indeed, when compared to other plant-based production platforms that have been explored, suspension-cultured plant cells have the advantage of being totally devoid of problems associated with the vagaries of weather, pest, soil and gene flow in the environment. Because of short growth cycles, the timescale needed for the production of recombinant proteins in plant cell culture can be counted in days or weeks after transformation compared to months needed for the production in transgenic plants. Moreover, recovery and purification of recombinant proteins from plant biomass is an expensive and technically challenging business that may amount to 80-94% of the final product cost. One additional advantage of plant cell culture is that the recombinant protein fused with a signal sequence can be expressed and secreted into the culture medium, and therefore recovered and purified in the absence of large quantities of contaminating proteins. Consequently, the downstream processing of proteins extracted from plant cell culture medium is less expensive, which may/does balance the higher costs of fermentation. When needed for clinical use, recombinant proteins are easily produced in suspension-cultured plant cells under certified, controllable and sterile conditions that offer improved safety and provide advantages for good manufacturing practices and regulatory compliance. In this chapter, we present basic protocols for rapid generation of transgenic suspension-cultured cells of Nicotiana tabacum, Oriza sativa and Arabidopis

  2. Determination of thymidine in serum used for cell culture media

    International Nuclear Information System (INIS)

    Schaer, J.C.; Maurer, U.; Schindler, R.

    1978-01-01

    Thymidine concentrations in serum used for cell culture media were determined with an assay based on isotope dilution. In this assay, incorporation of (3H)-thymidine into DNA of cultured cells was measured in the presence of 5 and 20% serum as a function of the concentration of unlabeled thymidine added to the medium. Thymidine concentrations were measured using horse serum as well as fetal calf serum in the culture media. Dialysis of serum resulted in a reduction of thymidine levels by factors of at least 10

  3. Contributions of 3D Cell Cultures for Cancer Research.

    Science.gov (United States)

    Ravi, Maddaly; Ramesh, Aarthi; Pattabhi, Aishwarya

    2017-10-01

    Cancer cell lines have contributed immensely in understanding the complex physiology of cancers. They are excellent material for studies as they offer homogenous samples without individual variations and can be utilised with ease and flexibility. Also, the number of assays and end-points one can study is almost limitless; with the advantage of improvising, modifying or altering several variables and methods. Literally, a new dimension to cancer research has been achieved by the advent of 3Dimensional (3D) cell culture techniques. This approach increased many folds the ways in which cancer cell lines can be utilised for understanding complex cancer biology. 3D cell culture techniques are now the preferred way of using cancer cell lines to bridge the gap between the 'absolute in vitro' and 'true in vivo'. The aspects of cancer biology that 3D cell culture systems have contributed include morphology, microenvironment, gene and protein expression, invasion/migration/metastasis, angiogenesis, tumour metabolism and drug discovery, testing chemotherapeutic agents, adaptive responses and cancer stem cells. We present here, a comprehensive review on the applications of 3D cell culture systems for these aspects of cancers. J. Cell. Physiol. 232: 2679-2697, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. Advances in culture and manipulation of human pluripotent stem cells.

    Science.gov (United States)

    Qian, X; Villa-Diaz, L G; Krebsbach, P H

    2013-11-01

    Recent advances in the understanding of pluripotent stem cell biology and emerging technologies to reprogram somatic cells to a stem cell-like state are helping bring stem cell therapies for a range of human disorders closer to clinical reality. Human pluripotent stem cells (hPSCs) have become a promising resource for regenerative medicine and research into early development because these cells are able to self-renew indefinitely and are capable of differentiation into specialized cell types of all 3 germ layers and trophoectoderm. Human PSCs include embryonic stem cells (hESCs) derived from the inner cell mass of blastocyst-stage embryos and induced pluripotent stem cells (hiPSCs) generated via the reprogramming of somatic cells by the overexpression of key transcription factors. The application of hiPSCs and the finding that somatic cells can be directly reprogrammed into different cell types will likely have a significant impact on regenerative medicine. However, a major limitation for successful therapeutic application of hPSCs and their derivatives is the potential xenogeneic contamination and instability of current culture conditions. This review summarizes recent advances in hPSC culture and methods to induce controlled lineage differentiation through regulation of cell-signaling pathways and manipulation of gene expression as well as new trends in direct reprogramming of somatic cells.

  5. Growth and phenotypic characteristics of human nevus cells in culture.

    Science.gov (United States)

    Mancianti, M L; Herlyn, M; Weil, D; Jambrosic, J; Rodeck, U; Becker, D; Diamond, L; Clark, W H; Koprowski, H

    1988-02-01

    Nevus cells were isolated from the three cutaneous components, epidermis, basal layer, and dermis, of nonmalignant pigmented lesions and were cultured separately in the presence or absence of the phorbol ester 12-0-tetradecanoyl phorbol-13-acetate in medium that supports the rapid proliferation of melanocytic cells. The separation procedure used provided cultures that were essentially free from normal melanocytes (dermis) or fibroblasts (epidermis). In short term culture, nevus cells of all skin compartments expressed markers associated with differentiated melanocytes, such as presence of premelanosomes and melanosomes and elevated tyrosinase levels. Nevus cells also expressed melanoma-associated antigens, such as NGF-receptor, transferrin-related p97, proteoglycan, and HLA-DR as detected with monoclonal antibodies. After several subpassages, cells showed a decreased expression of melanoma-associated antigens, decreased tyrrosinase levels, and melanosomes could no longer be detected. Morphologically, these cells were similar to fibroblasts. The disappearance of melanoma-associated cell surface antigens was concomitant with the appearance of a melanocyte-associated 145 kd protein that might serve as a marker of fibroblast-like differentiation in nevus cells and normal melanocytes. Nevus cell cultures grown in the presence of 12-0-tetradecanoyl phorbol-13-acetate maintained a stable differentiated phenotype throughout their lifespan. As reported earlier, nevus cells in culture, irrespective of the presence or absence of 12-0-tetradecanoyl phorbol-13-acetate, have a finite lifespan in vitro, grow anchorage-independent in soft agar, but do not form tumors when xenografted to nude mice. These studies demonstrate that nevus cells isolated from the epidermal, basal layer, and dermal components of lesional skin can serve as models to characterize the initial steps of tumor progression in a human cell system.

  6. Stability of resazurin in buffers and mammalian cell culture media

    DEFF Research Database (Denmark)

    Rasmussen, Eva; Nicolaisen, G.M.

    1999-01-01

    The utility of a ferricyanide/ferrocyanide system used in the AlamarBlue(TM) (Serotec, Oxford, UK) vital. dye to inhibit the reduction of resazurin by mammalian cell culture media is questioned. Resazurin was found to be relatively stable when dissolved in phosphate-buffered saline (PBS). The use...... of HEPES resulted in a huge immediate dye reduction, which was significantly enhanced by exposure to diffuse light from fluorescent tubes in the laboratory 8 h per day. The reduction of resazurin by various cell culture media was time and temperature dependent, and it was significantly enhanced......'s nutrient mixture F-10 and F-12. Fetal calf serum (5-20%) slightly decreased resazurin reduction during the first 2 days of incubation. The reduction of resazurin by mammalian cell culture media do not appear to be problematic under normal culture conditions, and it is primarily dependent upon the presence...

  7. Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge.

    Science.gov (United States)

    Pestana, Carlos J; Reeve, Petra J; Sawade, Emma; Voldoire, Camille F; Newton, Kelly; Praptiwi, Radisti; Collingnon, Lea; Dreyfus, Jennifer; Hobson, Peter; Gaget, Virginie; Newcombe, Gayle

    2016-09-15

    In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Fabrication of a thermoresponsive cell culture dish: a key technology for cell sheet tissue engineering

    Directory of Open Access Journals (Sweden)

    Jun Kobayashi and Teruo Okano

    2010-01-01

    Full Text Available This article reviews the properties and characterization of an intelligent thermoresponsive surface, which is a key technology for cell sheet-based tissue engineering. Intelligent thermoresponsive surfaces grafted with poly(N-isopropylacrylamide exhibit hydrophilic/hydrophobic alteration in response to temperature change. Cultured cells are harvested on thermoresponsive cell culture dishes by decreasing the temperature without the use of digestive enzymes or chelating agents. Our group has developed cell sheet-based tissue engineering for therapeutic uses with single layer or multilayered cell sheets, which were recovered from the thermoresponsive cell culture dish. Using surface derivation techniques, we developed a new generation of thermoresponsive cell culture dishes to improve culture conditions. We also designed a new methodology for constructing well-defined organs using microfabrication techniques.

  9. Characterisation and germline transmission of cultured avian primordial germ cells.

    Science.gov (United States)

    Macdonald, Joni; Glover, James D; Taylor, Lorna; Sang, Helen M; McGrew, Michael J

    2010-11-29

    Avian primordial germ cells (PGCs) have significant potential to be used as a cell-based system for the study and preservation of avian germplasm, and the genetic modification of the avian genome. It was previously reported that PGCs from chicken embryos can be propagated in culture and contribute to the germ cell lineage of host birds. We confirm these results by demonstrating that PGCs from a different layer breed of chickens can be propagated for extended periods in vitro. We demonstrate that intracellular signalling through PI3K and MEK is necessary for PGC growth. We carried out an initial characterisation of these cells. We find that cultured PGCs contain large lipid vacuoles, are glycogen rich, and express the stem cell marker, SSEA-1. These cells also express the germ cell-specific proteins CVH and CDH. Unexpectedly, using RT-PCR we show that cultured PGCs express the pluripotency genes c-Myc, cKlf4, cPouV, cSox2, and cNanog. Finally, we demonstrate that the cultured PGCs will migrate to and colonise the forming gonad of host embryos. Male PGCs will colonise the female gonad and enter meiosis, but are lost from the gonad during sexual development. In male hosts, cultured PGCs form functional gametes as demonstrated by the generation of viable offspring. The establishment of in vitro cultures of germline competent avian PGCs offers a unique system for the study of early germ cell differentiation and also a comparative system for mammalian germ cell development. Primary PGC lines will form the basis of an alternative technique for the preservation of avian germplasm and will be a valuable tool for transgenic technology, with both research and industrial applications.

  10. Characterisation and germline transmission of cultured avian primordial germ cells.

    Directory of Open Access Journals (Sweden)

    Joni Macdonald

    Full Text Available BACKGROUND: Avian primordial germ cells (PGCs have significant potential to be used as a cell-based system for the study and preservation of avian germplasm, and the genetic modification of the avian genome. It was previously reported that PGCs from chicken embryos can be propagated in culture and contribute to the germ cell lineage of host birds. PRINCIPAL FINDINGS: We confirm these results by demonstrating that PGCs from a different layer breed of chickens can be propagated for extended periods in vitro. We demonstrate that intracellular signalling through PI3K and MEK is necessary for PGC growth. We carried out an initial characterisation of these cells. We find that cultured PGCs contain large lipid vacuoles, are glycogen rich, and express the stem cell marker, SSEA-1. These cells also express the germ cell-specific proteins CVH and CDH. Unexpectedly, using RT-PCR we show that cultured PGCs express the pluripotency genes c-Myc, cKlf4, cPouV, cSox2, and cNanog. Finally, we demonstrate that the cultured PGCs will migrate to and colonise the forming gonad of host embryos. Male PGCs will colonise the female gonad and enter meiosis, but are lost from the gonad during sexual development. In male hosts, cultured PGCs form functional gametes as demonstrated by the generation of viable offspring. CONCLUSIONS: The establishment of in vitro cultures of germline competent avian PGCs offers a unique system for the study of early germ cell differentiation and also a comparative system for mammalian germ cell development. Primary PGC lines will form the basis of an alternative technique for the preservation of avian germplasm and will be a valuable tool for transgenic technology, with both research and industrial applications.

  11. Integration of embryonic stem cells in metanephric kidney organ culture.

    Science.gov (United States)

    Steenhard, Brooke M; Isom, Kathryn S; Cazcarro, Patricia; Dunmore, Judy H; Godwin, Alan R; St John, Patricia L; Abrahamson, Dale R

    2005-06-01

    Many stages of nephrogenesis can be studied using cultured embryonic kidneys, but there is no efficient technique available to readily knockdown or overexpress transgenes for rapid evaluation of resulting phenotypes. Embryonic stem (ES) cells have unlimited developmental potential and can be manipulated at the molecular genetic level by a variety of methods. The aim of this study was to determine if ES cells could respond to developmental signals within the mouse embryonic day 12 to embryonic day 13 (E12 to E13) kidney microenvironment and incorporate into kidney structures. ROSA26 ES cells were shown to express beta-galactosidase ubiquitously when cultured in the presence of leukemia inhibitory factor to suppress differentiation. When these cells were microinjected into E12 to E13 metanephroi and then placed in transwell organ culture, ES cell-derived, beta-galactosidase-positive cells were identified in epithelial structures resembling tubules. On rare occasions, individual ES cells were observed in structures resembling glomerular tufts. Electron microscopy showed that the ES cell-derived tubules were surrounded by basement membrane and had apical microvilli and junctional complexes. Marker analysis revealed that a subset of these epithelial tubules bound Lotus tetragonolobus and expressed alpha(1) Na(+)/K(+) ATPase. ES cells were infected before injection with a cytomegalovirus promoter-green fluorescence protein (GFP) adenovirus and GFP expression was found as early as 18 h, persisting for up to 48 h in cultured kidneys. This ES cell technology may achieve the objective of obtaining a versatile cell culture system in which molecular interventions can be used in vitro and consequences of these perturbations on the normal kidney development program in vivo can be studied.

  12. Transcriptome analysis of primary bovine extra-embryonic cultured cells

    Directory of Open Access Journals (Sweden)

    Séverine A. Degrelle

    2015-12-01

    Full Text Available The dataset described in this article pertains to the article by Hue et al. (2015 entitled “Primary bovine extra-embryonic cultured cells: A new resource for the study of in vivo peri-implanting phenotypes and mesoderm formation” [1]. In mammals, extra-embryonic tissues are essential to support not only embryo patterning but also embryo survival, especially in late implanting species. These tissues are composed of three cell types: trophoblast (bTCs, endoderm (bXECs and mesoderm (bXMCs. Until now, it is unclear how these cells interact. In this study, we have established primary cell cultures of extra-embryonic tissues from bovine embryos collected at day-18 after artificial insemination. We used our homemade bovine 10K array (GPL7417 to analyze the gene expression profiles of these primary extra-embryonic cultured cells compared to the corresponding cells from in vivo micro-dissected embryos. Here, we described the experimental design, the isolation of bovine extra-embryonic cell types as well as the microarray expression analysis. The dataset has been deposited in Gene Expression Omnibus (GEO (accession number GSE52967. Finally, these primary cell cultures were a powerful tool to start studying their cellular properties, and will further allow in vitro studies on cellular interactions among extra-embryonic tissues, and potentially between extra-embryonic vs embryonic tissues.

  13. Animal-cell culture in aqueous two-phase systems

    NARCIS (Netherlands)

    Zijlstra, G.M.

    1998-01-01

    In current industrial biotechnology, animal-cell culture is an important source of therapeutic protein products. The conventional animal-cell production processes, however, include many unit operations as part of the fermentation and downstream processing strategy. The research described in

  14. Endothelial cell cultures as a tool in biomaterial research

    NARCIS (Netherlands)

    Kirkpatrick, CJ; Otto, M; van Kooten, T; Krump, [No Value; Kriegsmann, J; Bittinger, F

    1999-01-01

    Progress in biocompatibility and tissue engineering would today be inconceivable without the aid of in vitro techniques. Endothelial cell cultures represent a valuable tool not just in haemocompatibility testing, but also in the concept of designing hybrid organs. In the past endothelial cells (EC)

  15. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Ozcan

    2011-01-01

    Standard cell culture plastic was surface modified by passive adsorption or covalent attachment of interleukin (IL)-4 and investigated for its ability to induce differentiation of human monocytes into mature dendritic cells, a process dose-dependently regulated by IL-4. Covalent attachment of IL-...

  16. Time evolution of cell size distributions in dense cell cultures

    Science.gov (United States)

    Khain, Evgeniy

    2015-03-01

    Living cells in a dense system are all in contact with each other. The common assumption is that such cells stop dividing due to a lack of space. Recent experimental observations have shown, however, that cells continue dividing for a while, but other cells in the system must shrink, to allow the newborn cells to grow to a normal size. Due to these ``pressure'' effects, the average cell size dramatically decreases with time, and the dispersion in cell sizes decreases, too. The collective cell behavior becomes even more complex when the system is expanding: cells near the edges are larger and migrate faster, while cells deep inside the colony are smaller and move slower. This exciting experimental data still needs to be described theoretically, incorporating the distribution of cell sizes in the system. We propose a mathematical model for time evolution of cell size distribution both in a closed and open system. The model incorporates cell proliferation, cell growth after division, cell shrinking due to ``pressure'' from other cells, and possible cell detachment from the interface of a growing colony. This research sheds light on physical and biological mechanisms of cell response to a dense environment and on the role of mechanical stresses in determining the distribution of cell sizes in the system.

  17. Duchenne muscular dystrophy: normal ATP turnover in cultured cells

    International Nuclear Information System (INIS)

    Fox, I.H.; Bertorini, T.; Palmieri, G.M.A.; Shefner, R.

    1986-01-01

    This paper examines ATP metabolism in cultured muscle cells and fibroblasts from patients with Duchenne dystrophy. ATP and ADP levels were the same in cultured cells from normal subjects and patients and there was no difference in ATP synthesis or degradation. The ATP synthesis was measured by the incorporation of C 14-U-adenine into aTP and ADP. although there was a significant decrease in radioactively labelled ATP after incubation with deoxyglucose in Duchenne muscle cells, there was no difference in ATP concentration of ADP metabolism

  18. Correlation of the aphicidal activity of Beauveria bassiana SFB-205 supernatant with enzymes.

    Science.gov (United States)

    Kim, Jae Su; Roh, Jong Yul; Choi, Jae Young; Wang, Yong; Shim, Hee Jin; Je, Yeon Ho

    2010-01-01

    The supernatant of Beauveria bassiana SFB-205 reduced the population of cotton aphid, Aphis gossypii Glover, with a dosage-dependent manner, which allowed a quality control (QC) factor to be determined for the evaluation of the supernatant as the first step of a development. Enzymes were assumed as possible QC factors based on 1) the comparable aphicidal activity of the supernatant protein pellet to the raw supernatant, 2) the supernatant-induced degradation of the insect cuticles, observed by transmission electron microscopy, and 3) the confirmation of enzymes related to the fungal penetration - chitinase, and the Pr1- and Pr2 proteases - in the supernatant. Finally, from the bioassay with the enzyme-inhibited supernatants processed by substrate inhibition one by one, decreased aphicidal activities were observed for all three enzyme-inhibited treatments. This phenomenon, furthermore, was more remarkable in the chitinase-inhibited supernatant. This finding provides that those enzymes (and most particularly the chitinase) in the supernatant were strongly involved in the aphicidal activity. Consequently, the amount of the chitinase may be used as one of the QC factors to determine the insecticidal activity of the supernatant of B. bassiana SFB-205 in the optimization of mass production. Copyright © 2009 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  19. Establishing a stem cell culture laboratory for clinical trials

    Science.gov (United States)

    Sekiya, Elíseo Joji; Forte, Andresa; Kühn, Telma Ingrid Borges de Bellis; Janz, Felipe; Bydlowski, Sérgio Paulo; Alves, Adelson

    2012-01-01

    Adult stem/progenitor cells are found in different human tissues. An in vitro cell culture is needed for their isolation or for their expansion when they are not available in a sufficient quantity to regenerate damaged organs and tissues. The level of complexity of these new technologies requires adequate facilities, qualified personnel with experience in cell culture techniques, assessment of quality and clear protocols for cell production. The rules for the implementation of cell therapy centers involve national and international standards of good manufacturing practices. However, such standards are not uniform, reflecting the diversity of technical and scientific development. Here standards from the United States, the European Union and Brazil are analyzed. Moreover, practical solutions encountered for the implementation of a cell therapy center appropriate for the preparation and supply of cultured cells for clinical studies are described. Development stages involved the planning and preparation of the project, the construction of the facility, standardization of laboratory procedures and development of systems to prevent cross contamination. Combining the theoretical knowledge of research centers involved in the study of cells with the practical experience of blood therapy services that manage structures for cell transplantation is presented as the best potential for synergy to meet the demands to implement cell therapy centers. PMID:23049427

  20. Biophysical characteristics of cells cultured on cholesteryl ester liquid crystals.

    Science.gov (United States)

    Soon, Chin Fhong; Omar, Wan Ibtisam Wan; Berends, Rebecca F; Nayan, Nafarizal; Basri, Hatijah; Tee, Kian Sek; Youseffi, Mansour; Blagden, Nick; Denyer, Morgan Clive Thomas

    2014-01-01

    This study aimed at examining the biophysical characteristics of human derived keratinocytes (HaCaT) cultured on cholesteryl ester liquid crystals (CELC). CELC was previously shown to improve sensitivity in sensing cell contractions. Characteristics of the cell integrin expressions and presence of extracellular matrix (ECM) proteins on the liquid crystals were interrogated using various immunocytochemical techniques. The investigation was followed by characterization of the chemical properties of the liquid crystals (LC) after immersion in cell culture media using Fourier transform infrared spectroscopy (FTIR). The surface morphology of cells adhered to the LC was studied using atomic force microscopy (AFM). Consistent with the expressions of the integrins α2, α3 and β1, extracellular matrix proteins (laminin, collagen type IV and fibronectin) were found secreted by the HaCaT onto CELC and these proteins were also secreted by cells cultured on the glass substrates. FTIR analysis of the LC revealed the existence of spectrum assigned to cholesterol and ester moieties that are essential compounds for the metabolizing activities of keratinocytes. The immunostainings indicated that cell adhesion on the LC is mediated by self-secreted ECM proteins. As revealed by the AFM imaging, the constraint in cell membrane spread on the LC leads to the increase in cell surface roughness and thickness of cell membrane. The biophysical expressions of cells on biocompatible CELC suggested that CELC could be a new class of biological relevant material. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Microfluidic bioreactors for culture of non-adherent cells

    DEFF Research Database (Denmark)

    Shah, Pranjul Jaykumar; Vedarethinam, Indumathi; Kwasny, Dorota

    2011-01-01

    Microfluidic bioreactors (μBR) are becoming increasingly popular for cell culture, sample preparation and analysis in case of routine genetic and clinical diagnostics. We present a novel μBR for non-adherent cells designed to mimic in vivo perfusion of cells based on diffusion of media through...... a sandwiched membrane. The culture chamber and perfusion chamber are separated by a sandwiched membrane and each chamber has separate inlet/outlets for easy loading/unloading of cells and perfusion of the media. The perfusion of media and exchange of nutrients occur through the sandwiched membrane, which...... was also verified with simulations. Finally, we present the application of this device for cytogenetic sample preparation, whereby we culture and arrest peripheral T-lymphocytes in metaphase and later fix them in the μBR. The expansion of T-lymphocytes from an unknown patient sample was quantified by means...

  2. Hydrodynamic effects on cells in agitated tissue culture reactors

    Science.gov (United States)

    Cherry, R. S.; Papoutsakis, E. T.

    1986-01-01

    The mechanisms by which hydrodynamic forces can affect cells grown on microcarrier beads in agitated cell culture reactors were investigated by analyzing the motion of microcarriers relative to the surrounding fluid, to each other, and to moving or stationary solid surfaces. It was found that harmful effects on cell cultures that have been previously attributed to shear can be better explained as the effects of turbulence (of a size scale comparable to the microcarriers or the spacing between them) or collisions. The primary mechanisms of cell damage involve direct interaction between microcarriers and turbulent eddies, collisions between microcarriers in turbulent flow, and collisions against the impeller or other solid surfaces. The implications of these analytical results for the design of tissue culture reactors are discussed.

  3. Miniature Bioreactor System for Long-Term Cell Culture

    Science.gov (United States)

    Gonda, Steve R.; Kleis, Stanley J.; Geffert, Sandara K.

    2010-01-01

    A prototype miniature bioreactor system is designed to serve as a laboratory benchtop cell-culturing system that minimizes the need for relatively expensive equipment and reagents and can be operated under computer control, thereby reducing the time and effort required of human investigators and reducing uncertainty in results. The system includes a bioreactor, a fluid-handling subsystem, a chamber wherein the bioreactor is maintained in a controlled atmosphere at a controlled temperature, and associated control subsystems. The system can be used to culture both anchorage-dependent and suspension cells, which can be either prokaryotic or eukaryotic. Cells can be cultured for extended periods of time in this system, and samples of cells can be extracted and analyzed at specified intervals. By integrating this system with one or more microanalytical instrument(s), one can construct a complete automated analytical system that can be tailored to perform one or more of a large variety of assays.

  4. A novel closed cell culture device for fabrication of corneal epithelial cell sheets.

    Science.gov (United States)

    Nakajima, Ryota; Kobayashi, Toyoshige; Moriya, Noboru; Mizutani, Manabu; Kan, Kazutoshi; Nozaki, Takayuki; Saitoh, Kazuo; Yamato, Masayuki; Okano, Teruo; Takeda, Shizu

    2015-11-01

    Automation technology for cell sheet-based tissue engineering would need to optimize the cell sheet fabrication process, stabilize cell sheet quality and reduce biological contamination risks. Biological contamination must be avoided in clinical settings. A closed culture system provides a solution for this. In the present study, we developed a closed culture device called a cell cartridge, to be used in a closed cell culture system for fabricating corneal epithelial cell sheets. Rabbit limbal epithelial cells were cultured on the surface of a porous membrane with 3T3 feeder cells, which are separate from the epithelial cells in the cell cartridges and in the cell-culture inserts as a control. To fabricate the stratified cell sheets, five different thicknesses of the membranes which were welded to the cell cartridge, were examined. Multilayered corneal epithelial cell sheets were fabricated in cell cartridges that were welded to a 25 µm-thick gas-permeable membrane, which was similar to the results with the cell-culture inserts. However, stratification of corneal epithelial cell sheets did not occur with cell cartridges that were welded to 100-300 µm-thick gas-permeable membranes. The fabricated cell sheets were evaluated by histological analyses to examine the expression of corneal epithelial-specific markers. Immunohistochemical analyses showed that a putative stem cell marker, p63, a corneal epithelial differentiation maker, CK3, and a barrier function marker, Claudin-1, were expressed in the appropriate position in the cell sheets. These results suggest that the cell cartridge is effective for fabricating corneal epithelial cell sheets. Copyright © 2012 John Wiley & Sons, Ltd.

  5. The replacement of serum by hormones in cell culture media.

    Science.gov (United States)

    Sato, G; Hayashi, I

    1976-12-01

    The replacement of serum by hormones in cell culture media. (Reemplazo del suero por hormonas en el medio de cultivo de células). Arch. Biol. Med. Exper. 10: 120-121, 1976. The serum used in cell culture media can be replaced by a mixture of hormones and some accesory blood factors. The pituitary cell line GH3 can be grown in a medium in which serum is replaced by triiodothyronine, transferrin, parathormone, tyrotrophin releasing hormone and somatomedins. Hela and BHK cell strains can also be grown in serum free medium supplemented with hormones. Each cell type appears to have different hormonal requirements yet it may found that some hormones are required for most cell types.

  6. Therapeutic touch stimulates the proliferation of human cells in culture.

    Science.gov (United States)

    Gronowicz, Gloria A; Jhaveri, Ankur; Clarke, Libbe W; Aronow, Michael S; Smith, Theresa H

    2008-04-01

    Our objective was to assess the effect of Therapeutic Touch (TT) on the proliferation of normal human cells in culture compared to sham and no treatment. Several proliferation techniques were used to confirm the results, and the effect of multiple 10-minute TT treatments was studied. Fibroblasts, tendon cells (tenocytes), and bone cells (osteoblasts) were treated with TT, sham, or untreated for 2 weeks, and then assessed for [(3)H]-thymidine incorporation into the DNA, and immunocytochemical staining for proliferating cell nuclear antigen (PCNA). The number of PCNA-stained cells was also quantified. For 1 and 2 weeks, varying numbers of 10-minute TT treatments were administered to each cell type to determine whether there was a dose-dependent effect. TT administered twice a week for 2 weeks significantly stimulated proliferation of fibroblasts, tenocytes, and osteoblasts in culture (p = 0.04, 0.01, and 0.01, respectively) compared to untreated control. These data were confirmed by PCNA immunocytochemistry. In the same experiments, sham healer treatment was not significantly different from the untreated cultures in any group, and was significantly less than TT treatment in fibroblast and tenocyte cultures. In 1-week studies involving the administration of multiple 10-minute TT treatments, four and five applications significantly increased [(3)H]-thymidine incorporation in fibroblasts and tenocytes, respectively, but not in osteoblasts. With different doses of TT for 2 weeks, two 10-minute TT treatments per week significantly stimulated proliferation in all cell types. Osteoblasts also responded to four treatments per week with a significant increase in proliferation. Additional TT treatments (five per week for 2 weeks) were not effective in eliciting increased proliferation compared to control in any cell type. A specific pattern of TT treatment produced a significant increase in proliferation of fibro-blasts, osteoblasts, and tenocytes in culture. Therefore, TT may

  7. Hypoxic contraction of cultured pulmonary vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Murray, T.R.; Chen, L.; Marshall, B.E.; Macarak, E.J.

    1990-01-01

    The cellular events involved in generating the hypoxic pulmonary vasoconstriction response are not clearly understood, in part because of the multitude of factors that alter pulmonary vascular tone. The goal of the present studies was to determine if a cell culture preparation containing vascular smooth muscle (VSM) cells could be made to contract when exposed to a hypoxic atmosphere. Cultures containing only fetal bovine pulmonary artery VSM cells were assessed for contractile responses to hypoxic stimuli by two methods. In the first, tension forces generated by cells grown on a flexible growth surface (polymerized polydimethyl siloxane) were manifested as wrinkles and distortions of the surface under the cells. Wrinkling of the surface was noted to progressively increase with time as the culture medium bathing the cells was made hypoxic (PO2 approximately 25 mmHg). The changes were sometimes reversible upon return to normoxic conditions and appeared to be enhanced in cells already exhibiting evidence of some baseline tone. Repeated passage in culture did not diminish the hypoxic response. Evidence for contractile responses to hypoxia was also obtained from measurements of myosin light chain (MLC) phosphorylation. Conversion of MLC to the phosphorylated species is an early step in the activation of smooth muscle contraction. Lowering the PO2 in the culture medium to 59 mmHg caused a 45% increase in the proportion of MLC in the phosphorylated form as determined by two-dimensional gel electrophoresis. Similarly, cultures preincubated for 4 h with 32P and then exposed to normoxia or hypoxia for a 5-min experimental period showed more than twice as much of the label in MLCs of the hypoxic cells

  8. Animal-cell culture media: History, characteristics, and current issues.

    Science.gov (United States)

    Yao, Tatsuma; Asayama, Yuta

    2017-04-01

    Cell culture technology has spread prolifically within a century, a variety of culture media has been designed. This review goes through the history, characteristics and current issues of animal-cell culture media. A literature search was performed on PubMed and Google Scholar between 1880 and May 2016 using appropriate keywords. At the dawn of cell culture technology, the major components of media were naturally derived products such as serum. The field then gradually shifted to the use of chemical-based synthetic media because naturally derived ingredients have their disadvantages such as large batch-to-batch variation. Today, industrially important cells can be cultured in synthetic media. Nevertheless, the combinations and concentrations of the components in these media remain to be optimized. In addition, serum-containing media are still in general use in the field of basic research. In the fields of assisted reproductive technologies and regenerative medicine, some of the medium components are naturally derived in nearly all instances. Further improvements of culture media are desirable, which will certainly contribute to a reduction in the experimental variation, enhance productivity among biopharmaceuticals, improve treatment outcomes of assisted reproductive technologies, and facilitate implementation and popularization of regenerative medicine.

  9. Dose verification by OSLDs in the irradiation of cell cultures

    International Nuclear Information System (INIS)

    Meca C, E. A.; Bourel, V.; Notcovich, C.; Duran, H.

    2015-10-01

    The determination of value of irradiation dose presents difficulties when targets are irradiated located in regions where electronic equilibrium of charged particle is not reached, as in the case of irradiation -in vitro- of cell lines monolayer-cultured, in culture dishes or flasks covered with culture medium. The present study aimed to implement a methodology for dose verification in irradiation of cells in culture media by optically stimulated luminescence dosimetry (OSLD). For the determination of the absorbed dose in terms of cell proliferation OSL dosimeters of aluminum oxide doped with carbon (Al 2 O 3 :C) were used, which were calibrated to the irradiation conditions of culture medium and at doses that ranged from 0.1 to 15 Gy obtained with a linear accelerator of 6 MV photons. Intercomparison measurements were performed with an ionization chamber of 6 cm 3 . Different geometries were evaluated by varying the thicknesses of solid water, air and cell culture medium. The results showed deviations below 2.2% when compared with the obtained doses of OSLDs and planning system used. Also deviations were observed below 3.4% by eccentric points of the irradiation plane, finding homogeneous dose distribution. Uncertainty in the readings was less than 2%. The proposed methodology contributes a contribution in the dose verification in this type of irradiations, eliminating from the calculation uncertainties, potential errors in settling irradiation or possible equipment failure with which is radiating. It also provides certainty about the survival curves to be plotted with the experimental data. (Author)

  10. Isolation and Culture of Postnatal Stem Cells from Deciduous Teeth

    OpenAIRE

    Olávez, Daniela; Facultad de Odontología Universidad de Los Andes; Salmen, Siham; Instituto de Inmunología Clínica, Universidad de Los Andes.; Padrón, Karla; Facultad de Odontología. Univerisdad de Los Andes.; Lobo, Carmine; Facultad de Odontología. Univerisdad de Los Andes.; Díaz, Nancy; Facultad de Odontología, Universidad de Los Andes.; Berrueta, Lisbeth; Doctora en Inmunología por Instituto Venezolano de Investigaciones Científicas (IVIC). Instituto de Inmunología Clínica, Facultad de Medicina, Universidad de Los Andes, Venezuela.; Solorzanio, Eduvigis; Facultad de Odontología, Universidad de Los Andes.

    2014-01-01

    Background: Currently, degenerative diseases represent a public health problem; therefore, the development and implementation of strategies to fully or partially recover of damaged tissues has a special interest in the biomedical field. Therapeutic strategies based on mesenchymal stem cells transplantation from dental pulp have been proposed as an alternative. Purpose: To develop a mesenchymal stem cells culture isolated from dental pulp of deciduous teeth. Methods: The mesenchymal stem cells...

  11. Pluronic polyols in human lymphocyte cell line cultures.

    Science.gov (United States)

    Mizrahi, A

    1975-01-01

    Pluronic polyols markedly improved the growth of two human lymphocyte cell lines when added to the growth medium in concentrations of 0.05 to 0.1%. The results of the current studies suggest that, in addition to the protective effect of polyols against mechanical damage of mammalian cells in submerged cultures, the pluronic compounds may also, by lowering surface tension, facilitate transport of metabolites into cells and thus increase the growth rate. PMID:1063740

  12. Formation and action of oxygen activated species in cell cultures

    International Nuclear Information System (INIS)

    Hoffmann, M.E.; Meneghini, R.

    1982-01-01

    The differences of hydrogen peroxide sensibility of mammal cell lineages (man, mouse, chinese hamster) in culture are studied. The cellular survival and the frequency of DNA induced breaks by hydrogen peroxide are analysed. The efficiency of elimination of DNA breaks by cells is determined. The possible relation between the cell capacity of repair and its survival to hydrogen peroxide action is also discussed. (M.A.) [pt

  13. A microwell cell culture platform for the aggregation of pancreatic β-cells.

    Science.gov (United States)

    Bernard, Abigail B; Lin, Chien-Chi; Anseth, Kristi S

    2012-08-01

    Cell-cell contact between pancreatic β-cells is important for maintaining survival and normal insulin secretion. Various techniques have been developed to promote cell-cell contact between β-cells, but a simple yet robust method that affords precise control over three-dimensional (3D) β-cell cluster size has not been demonstrated. To address this need, we developed a poly(ethylene glycol) (PEG) hydrogel microwell platform using photolithography. This microwell cell-culture platform promotes the formation of 3D β-cell aggregates of defined sizes from 25 to 210 μm in diameter. Using this platform, mouse insulinoma 6 (MIN6) β-cells formed aggregates with cell-cell adherin junctions. These naturally formed cell aggregates with controllable sizes can be removed from the microwells for macroencapsulation, implantation, or other biological assays. When removed and subsequently encapsulated in PEG hydrogels, the aggregated cell clusters demonstrated improved cellular viability (>90%) over 7 days in culture, while the β-cells encapsulated as single cells maintained only 20% viability. Aggregated MIN6 cells also exhibited more than fourfold higher insulin secretion in response to a glucose challenge compared with encapsulated single β-cells. Further, the cell aggregates stained positively for E-cadherin, indicative of the formation of cell junctions. Using this hydrogel microwell cell-culture method, viable and functional β-cell aggregates of specific sizes were created, providing a platform from which other biologically relevant questions may be answered.

  14. The impact of simulated microgravity on purinergic signaling in an endothelial and smooth muscle cell co-culture model

    Science.gov (United States)

    Zhang, Yu; Hemmersbach, Ruth; Lau, Patrick; Pansky, Andreas; Kassack, Matthias; Tobiasch, Edda

    Astronauts suffer from cardiovascular deconditioning when they are exposed to microgravity conditions during space missions. Thus, current research focuses on the identification of the underlying mechanism also with respect to therapy and countermeasures. Endothelial cells (ECs) and smooth muscle cells (SMCs) play a key role in a variety of vascular functions. Gene expression, cytoskeleton morphology and apoptosis in both, ECs and SMCs, have shown alterations under simulated and real microgravity condition. However, all these data were observed during single culturing of either ECs or SMCs under microgravity conditions, which is different from the in vivo situation. Purinergic 2 (P2) receptors bind extracellular nucleotides and can regulate the vascular tone and vascular cell proliferation, migration and apoptosis. In this study primary ECs and SMCs were obtained from bovine aorta and characterized using specific markers. Here we show for the first time that the P2-receptor expressions pattern in ECs and in SMCs is altered after 24h in simulated microgravity. Specific receptors are down- or up-regulated on the gene and protein level. In addition the supernatant of ECs during culture was used as conditioned medium for SMCs and vice visa to investigate the influence of either cell type on the other. ECs and SMCs secret cytokines which induce pathogenic proliferation and an altered migration behavior under simulated microgravity conditions. Interestingly, co-culturing with condition medium could compensate this change. In detail, P2X7 was down-regulated in ECs after 24h clinorotation but recovered to the 1 g level when cultured with conditioned medium from SMCs collected under normal gravity. In conclusion, our data indicate that the paracrine effect between ECs and SMCs is an important regulator of cell behavior, also under altered gravity conditions. P2-receptor gene and protein expression were altered during microgravity. Since several P2-receptor artificial

  15. Multidimensional fractionation is a requirement for quantitation of Golgi-resident glycosylation enzymes from cultured human cells.

    Science.gov (United States)

    Lin, Chi-Hung; Chik, Jenny H L; Packer, Nicolle H; Molloy, Mark P

    2015-02-06

    Glycosylation results from the concerted action of glycosylation enzymes in the secretory pathway. In general, gene expression serves as the primary control mechanism, but post-translational fine-tuning of glycosylation enzyme functions is often necessary for efficient synthesis of specific glycan epitopes. While the field of glycomics has rapidly advanced, there lacks routine proteomic methods to measure expression of specific glycosylation enzymes needed to fill the gap between mRNA expression and the glycomic profile in a "reverse genomics" workflow. Toward developing this workflow we enriched Golgi membranes from two human colon cancer cell lines by sucrose density centrifugation and further mass-based fractionation by SDS-PAGE. We then applied mass spectrometry to demonstrate a doubling in the number of Golgi resident proteins identified, compared to the unenriched, low speed centrifuged supernatant of lysed cells. A total of 35 Golgi-resident glycosylation enzymes, of which 23 were glycosyltransferases, were identified making this the largest protein database so far of Golgi resident glycosylation enzymes experimentally identified in cultured human cells. We developed targeted mass spectrometry assays for specific quantitation of many of these glycosylation enzymes. Our results show that alterations in abundance of glycosylation enzymes at the protein level were generally consistent with the resultant glycomic profiles, but not necessarily with the corresponding glycosyltransferase mRNA expression as exemplified by the case of O-glycan core 1 T synthase.

  16. HUMAN CELLS IN CULTURE: REVISlTED*

    African Journals Online (AJOL)

    advantages, e.g. the generation time is reduced to about. 1/10000 that of the ... or less reflects the cellular biology of the donor tissut:'Y .... X-linked. Autosomal recessive. Autosomal recessive. Autosomal recessive mothers of affected males, however, show that only 50% of the cell population is defective, which furnishes an.

  17. Altered eicosanoid production and phospholipid remodeling during cell culture.

    Science.gov (United States)

    Okuno, Toshiaki; Gijón, Miguel A; Zarini, Simona; Martin, Sarah A; Barkley, Robert M; Johnson, Christopher A; Ohba, Mai; Yokomizo, Takehiko; Murphy, Robert C

    2018-03-01

    The remodeling of PUFAs by the Lands cycle is responsible for the diversity of phospholipid molecular species found in cells. There have not been detailed studies of the alteration of phospholipid molecular species as a result of serum starvation or depletion of PUFAs that typically occurs during tissue culture. The time-dependent effect of cell culture on phospholipid molecular species in RAW 264.7 cells cultured for 24, 48, or 72 h was examined by lipidomic strategies. These cells were then stimulated to produce arachidonate metabolites derived from the cyclooxygenase pathway, thromboxane B 2 , PGE 2 , and PGD 2 , and the 5-lipoxygenase pathway, leukotriene (LT)B 4 , LTC 4 , and 5-HETE, which decreased with increasing time in culture. However, the 5-lipoxygenase metabolites of a 20:3 fatty acid, LTB 3 , all trans -LTB 3 , LTC 3 , and 5-hydroxyeicosatrienoic acid, time-dependently increased. Molecular species of arachidonate containing phospholipids were drastically remodeled during cell culture, with a new 20:3 acyl group being populated into phospholipids to replace increasingly scarce arachidonate. In addition, the amount of TNFα induced by lipopolysaccharide stimulation was significantly increased in the cells cultured for 72 h compared with 24 h, suggesting that the remodeling of PUFAs enhanced inflammatory response. These studies supported the rapid operation of the Lands cycle to maintain cell growth and viability by populating PUFA species; however, without sufficient n-6 fatty acids, 20:3 n-9 accumulated, resulting in altered lipid mediator biosynthesis and inflammatory response. Copyright © 2018 by the American Society for Biochemistry and Molecular Biology, Inc.

  18. Mammary Gland Cell Culture of Macaca fascicularis as a Reservoir for Stem Cells

    Directory of Open Access Journals (Sweden)

    Silmi Mariya

    2017-07-01

    Full Text Available The mammary gland contains adult stem cells that are capable of self-renewal and are likely target for neoplastic transformation leading to breast cancer. In this study, we developed a cell culture derived from the mammary glands of cynomolgus monkeys (Macaca fascicularis (MfMC and furthermore identified the expression of markers for stemness and estrogen receptor-associated activities. We found that the primary culture can be successfully subcultured to at least 3 passages, primarily epithelial-like in morphology, the cultured cells remained heterogenous in phenotype as they expressed epithelial cell markers CD24, CK18, and marker for fibroblast S1004A. Importantly, the cell population also consistently expressed the markers of mammary stem cells (ITGB1 or CD29 and ITGA6 or CD49f, mesenchymal stem cells (CD73 and CD105 and pluripotency (NANOG, OCT4, SOX2. In addition to this, the cells were also positive for Estrogen Receptor (ER, and ER-activated marker Trefoil Factor 1, suggesting an estrogen responsiveness of the culture model. These results indicate that our cell culture model is a reliable model for acquiring a population of cells with mammary stem cell properties and that these cultures may also serve as a reservoir from which more purified populations of stem cell populations can be isolated in the future.

  19. Induction of Regulatory T Cells and Its Regulation with Insulin-like Growth Factor/Insulin-like Growth Factor Binding Protein-4 by Human Mesenchymal Stem Cells.

    Science.gov (United States)

    Miyagawa, Ippei; Nakayamada, Shingo; Nakano, Kazuhisa; Yamagata, Kaoru; Sakata, Kei; Yamaoka, Kunihiro; Tanaka, Yoshiya

    2017-09-01

    Human mesenchymal stem cells (MSCs) are multipotent and exert anti-inflammatory effects, but the underlying mechanism remains to be elucidated. In the current study, we investigated the regulatory mechanism of regulatory T cell (Treg) induction through the growth factors released by human MSCs. Human naive CD4 + T cells were stimulated with anti-CD3/28 Abs and cocultured with human MSC culture supernatant for 48 h. The proliferation and cytokine production of CD4 + T cells and surface molecule expression on CD4 + T cells were evaluated. The proliferation of anti-CD3/28 Abs-stimulated CD4 + T cells was suppressed by the addition of human MSC culture supernatant; in addition, the production of IL-10 and IL-4 increased. The human MSC culture supernatant induced CD4 + FOXP3 + Tregs that expressed CD25, CTLA-4, glucocorticoid-induced TNFR-related protein, insulin-like growth factor (IGF)-1R, and IGF-2R, showing antiproliferative activity against CD4 + T cells. In addition, the induction of Tregs by human MSC culture supernatant was enhanced by the addition of IGF and suppressed by the inhibition of IGF-1R. In contrast, a significant amount of IGF binding protein (IGFBP)-4, an inhibitor of IGF action, was detected in the human MSC culture supernatant. After neutralization of IGFBP-4 in the human MSC culture supernatant by anti-IGFBP-4 Ab, Treg numbers increased significantly. Thus, our results raise the possibility that human MSC actions also involve a negative-regulatory mechanism that suppresses Treg proliferation by releasing IGFBP-4. The results of this study suggest that regulation of IGF may be important for treatments using human MSCs. Copyright © 2017 by The American Association of Immunologists, Inc.

  20. Diffusion chamber culture of human peripheral mononuclear cells in mice

    International Nuclear Information System (INIS)

    Kawakami, Masahito; Shigeta, Chiharu; Enzan, Hideaki; Takahashi, Hiroshi; Ohkita, Takeshi

    1977-01-01

    The mononuclear cells isolated by Isopaque-Ficoll method from blood of three healthy men were cultured in diffusion chambers implanted to peritoneal cavity of mice pretreated by cyclophosphamide 300 mg/kg b. w. or 800 rad of 60 Co γ ray or 500 rad. For two of three men the cell growth was slightly higher in hosts pretreated by cyclophosphamide or 800 rad than in hosts pretreated by 500 rad, but, for another one it was slow in all hosts. Under these conditions the growth potential of mononuclear cells might be different from person to person. A few granulocytes as well as plasma cells, very few megakaryocytes and rare erythroblasts were found in diffusion chamber cultured cells. (auth.)

  1. Microfluidic cell culture chip with multiplexed medium delivery and efficient cell/scaffold loading mechanisms for high-throughput perfusion 3-dimensional cell culture-based assays.

    Science.gov (United States)

    Huang, Song-Bin; Wu, Min-Hsien; Wang, Shih-Siou; Lee, Gwo-Bin

    2011-06-01

    This study reports a microfluidic cell culture chip consisting of 48 microbioreactors for high-throughput perfusion 3-dimensional (3-D) cell culture-based assays. Its advantages include the capability for multiplexed and backflow-free medium delivery, and both efficient and high-throughput micro-scale, 3-D cell culture construct loading. In this work, the microfluidic cell culture chip is fabricated using two major processes, specifically, a computer-numerical-controlled (CNC) mold machining process and a polydimethylsiloxane (PDMS) replication process. The chip is composed of micropumps, microbioreactors, connecting microchannels and a cell/agarose scaffold loading mechanism. The performance of the new pneumatic micropumps and the cell/agarose scaffold loading mechanism has been experimentally evaluated. The experimental results show that this proposed multiplexed medium-pumping design is able to provide a uniform pumping rate ranging from 1.5 to 298.3 μl hr(-1) without any fluid backflow and the resultant medium contamination. In addition, the simple cell/agarose loading method has been proven to be able to load the 3-D cell culture construct uniformly and efficiently in all 48 microbioreactors investigated. Furthermore, a micro-scale, perfusion, 3-D cell culture-based assay has been successfully demonstrated using this proposed cell culture chip. The experimental results are also compared to a similar evaluation using a conventional static 3-D cell culture with a larger scale culture. It is concluded that the choice of a cell culture format can influence assay results. As a whole, because of the inherent advantages of a miniaturized perfusion 3-D cell culture assay, the cell culture chip not only can provide a stable, well-defined and more biologically-meaningful culture environment, but it also features a low consumption of research resources. Moreover, due to the integrated medium pumping mechanism and the simple cell/agarose loading method, this chip is

  2. Lingual Epithelial Stem Cells and Organoid Culture of Them

    Directory of Open Access Journals (Sweden)

    Hiroko Hisha

    2016-01-01

    Full Text Available As tongue cancer is one of the major malignant cancers in the world, understanding the mechanism of maintenance of lingual epithelial tissue, which is known to be the origin of tongue cancer, is unquestionably important. However, the actual stem cells that are responsible for the long-term maintenance of the lingual epithelium have not been identified. Moreover, a simple and convenient culture method for lingual epithelial stem cells has not yet been established. Recently, we have shown that Bmi1-positive cells, residing at the second or third layer of the epithelial cell layer at the base of the interpapillary pit (IPP, were slow-cycling and could supply keratinized epithelial cells for over one year, indicating that Bmi1-positive cells are long-term lingual epithelial stem cells. In addition, we have developed a novel lingual epithelium organoid culture system using a three-dimensional matrix and growth factors. Here, we discuss current progress in the identification of lingual stem cells and future applications of the lingual culture system for studying the regulatory mechanisms of the lingual epithelium and for regenerative medicine.

  3. Crude subcellular fractionation of cultured mammalian cell lines

    Directory of Open Access Journals (Sweden)

    Holden Paul

    2009-12-01

    Full Text Available Abstract Background The expression and study of recombinant proteins in mammalian culture systems can be complicated during the cell lysis procedure by contaminating proteins from cellular compartments distinct from those within which the protein of interest resides and also by solubility issues that may arise from the use of a single lysis buffer. Partial subcellular fractionation using buffers of increasing stringency, rather than whole cell lysis is one way in which to avoid or reduce this contamination and ensure complete recovery of the target protein. Currently published protocols involve time consuming centrifugation steps which may require expensive equipment and commercially available kits can be prohibitively expensive when handling large or multiple samples. Findings We have established a protocol to sequentially extract proteins from cultured mammalian cells in fractions enriched for cytosolic, membrane bound organellar, nuclear and insoluble proteins. All of the buffers used can be made inexpensively and easily and the protocol requires no costly equipment. While the method was optimized for a specific cell type, we demonstrate that the protocol can be applied to a variety of commonly used cell lines and anticipate that it can be applied to any cell line via simple optimization of the primary extraction step. Conclusion We describe a protocol for the crude subcellular fractionation of cultured mammalian cells that is both straightforward and cost effective and may facilitate the more accurate study of recombinant proteins and the generation of purer preparations of said proteins from cell extracts.

  4. Treatment of mycoplasma contamination in cell cultures with Plasmocin.

    Science.gov (United States)

    Uphoff, Cord C; Denkmann, Sabine-A; Drexler, Hans G

    2012-01-01

    A high percentage of cell lines are chronically infected with various mycoplasma species. The addition of antibiotics that are particularly effective against these contaminants to the culture medium during a limited period of time is a simple, inexpensive, and very practical approach for decontaminating cell cultures. Here, we examined the effectiveness of the new antimycoplasma compound Plasmocin that has been employed routinely to cleanse chronically infected cell lines. In a first round of treatment 45 out of 58 (78%) mycoplasma-positive cell lines could be cured. In a second attempt using back-up cryopreserved original cells, four additional cell lines were cured; thus, the overall cure rate was 84%. Even if the mycoplasma contamination was not eradicated by Plasmocin, the parallel treatment with several other antibiotics (Baytril, BM-Cyclin, Ciprobay, MRA, or MycoZap) led to the cure of all 58 cell lines. The successful decontamination was permanent as mycoplasmas were no longer detected at day +14 posttreatment and at later time points as examined by PCR which is the most sensitive and specific mycoplasma detection method. Collectively, our results highlight certain antibiotics as effective antimycoplasma reagents and support the therapeutic rationale for their use in the eradication of this notorious cell culture contaminant.

  5. Treatment of Mycoplasma Contamination in Cell Cultures with Plasmocin

    Directory of Open Access Journals (Sweden)

    Cord C. Uphoff

    2012-01-01

    Full Text Available A high percentage of cell lines are chronically infected with various mycoplasma species. The addition of antibiotics that are particularly effective against these contaminants to the culture medium during a limited period of time is a simple, inexpensive, and very practical approach for decontaminating cell cultures. Here, we examined the effectiveness of the new antimycoplasma compound Plasmocin that has been employed routinely to cleanse chronically infected cell lines. In a first round of treatment 45 out of 58 (78% mycoplasma-positive cell lines could be cured. In a second attempt using back-up cryopreserved original cells, four additional cell lines were cured; thus, the overall cure rate was 84%. Even if the mycoplasma contamination was not eradicated by Plasmocin, the parallel treatment with several other antibiotics (Baytril, BM-Cyclin, Ciprobay, MRA, or MycoZap led to the cure of all 58 cell lines. The successful decontamination was permanent as mycoplasmas were no longer detected at day +14 posttreatment and at later time points as examined by PCR which is the most sensitive and specific mycoplasma detection method. Collectively, our results highlight certain antibiotics as effective antimycoplasma reagents and support the therapeutic rationale for their use in the eradication of this notorious cell culture contaminant.

  6. Bridging the gap between cell culture and live tissue

    Directory of Open Access Journals (Sweden)

    Stefan Przyborski

    2017-11-01

    Full Text Available Traditional in vitro two-dimensional (2-D culture systems only partly imitate the physiological and biochemical features of cells in their original tissue. In vivo, in organs and tissues, cells are surrounded by a three-dimensional (3-D organization of supporting matrix and neighbouring cells, and a gradient of chemical and mechanical signals. Furthermore, the presence of blood flow and mechanical movement provides a dynamic environment (Jong et al., 2011. In contrast, traditional in vitro culture, carried out on 2-D plastic or glass substrates, typically provides a static environment, which, however is the base of the present understanding of many biological processes, tissue homeostasis as well as disease. It is clear that this is not an exact representation of what is happening in vivo and the microenvironment provided by in vitro cell culture models are significantly different and can cause deviations in cell response and behaviour from those distinctive of in vivo tissues. In order to translate the present basic knowledge in cell control, cell repair and regeneration from the laboratory bench to the clinical application, we need a better understanding of the cell and tissue interactions. This implies a detailed comprehension of the natural tissue environment, with its organization and local signals, in order to more closely mimic what happens in vivo, developing more physiological models for efficient in vitro systems. In particular, it is imperative to understand the role of the environmental cues which can be mainly divided into those of a chemical and mechanical nature.

  7. [In vitro cell culture technology in cosmetology research].

    Science.gov (United States)

    Gojniczek, Katarzyna; Garncarczyk, Agnieszka; Pytel, Agata

    2005-01-01

    For ages the humanity has been looking for all kind of active substances, which could be used in improving the health and the appearance of our skin. People try to find out how to protect the skin from harmful, environmental factors. Every year a lot of new natural and synthetic, chemical substances are discovered. All of them potentially could be used as a cosmetic ingredient. In cosmetology research most of new xenobiotics were tested in vivo on animals. Alternative methods to in vivo tests are in vitro tests with skin cell culture system. The aim of this work was to describe two-dimensional and tree-dimensional skin cell cultures. Additionally, in this work we wanted to prove the usefulness of in vitro skin cell cultures in cosmetology research.

  8. Isolation, culture and genetic manipulation of mouse pancreatic ductal cells.

    Science.gov (United States)

    Reichert, Maximilian; Takano, Shigetsugu; Heeg, Steffen; Bakir, Basil; Botta, Gregory P; Rustgi, Anil K

    2013-01-01

    The most common subtype of pancreatic cancer is pancreatic ductal adenocarcinoma (PDAC). PDAC resembles duct cells morphologically and, to some extent, at a molecular level. Recently, genetic-lineage labeling has become popular in the field of tumor biology in order to study cell-fate decisions or to trace cancer cells in the mouse. However, certain biological questions require a nongenetic labeling approach to purify a distinct cell population in the pancreas. Here we describe a protocol for isolating mouse pancreatic ductal epithelial cells and ductlike cells directly in vivo using ductal-specific Dolichos biflorus agglutinin (DBA) lectin labeling followed by magnetic bead separation. Isolated cells can be cultured (in two or three dimensions), manipulated by lentiviral transduction to modulate gene expression and directly used for molecular studies. This approach is fast (~4 h), affordable, results in cells with high viability, can be performed on the bench and is applicable to virtually all genetic and nongenetic disease models of the pancreas.

  9. Extracellular protectants produced by Clostridium perfringens cells at elevated temperatures.

    Science.gov (United States)

    Heredia, N; Ybarra, P; Hernández, C; García, S

    2009-01-01

    The mechanisms of adaptation of Clostridium perfringens to high temperatures are not well understood. In this work, the involvement of extracellular compounds in protection to heat was determined. Cells were grown in fluid thioglycollate medium or chicken broth. When mid-log phase was reached, they were heat-shocked at 50 degrees C for 30 min. Then cultures were centrifuged and supernatants were transferred to nonshocked cells. Heat tolerance of these cells was performed at 55 degrees C. Viable cells were determined. In some cases, supernatants were heated at 65 degrees C or 100 degrees C or treated with trypsin. Supernatants were fractionated and PAGE was made of fractions showing heat-protective activity. When C. perfringens was exposed to a heat shock at 50 degrees C, extracellular factors were found in the culture supernatant that provided protection to cells not exposed to a heat shock. The extracellular factors were sensitive to heat and trypsin treatment suggesting a protein component. SDS-PAGE analysis of supernatant fractions from heat-treated cells revealed two induced proteins (56 and 125 kDa) that could be involved in heat tolerance. In this work, the presence and thermoprotective activity of extracellular factors produced by C. perfringens under a heat shock was demonstrated. The detection of thermoprotective extracellular factors of C. perfringens will aid in our understanding of the physiology of survival of C. perfringens in foods.

  10. Aragonite precipitation by "proto-polyps" in coral cell cultures.

    Science.gov (United States)

    Mass, Tali; Drake, Jeana L; Haramaty, Liti; Rosenthal, Yair; Schofield, Oscar M E; Sherrell, Robert M; Falkowski, Paul G

    2012-01-01

    The mechanisms of coral calcification at the molecular, cellular and tissue levels are poorly understood. In this study, we examine calcium carbonate precipitation using novel coral tissue cultures that aggregate to form "proto-polyps". Our goal is to establish an experimental system in which calcification is facilitated at the cellular level, while simultaneously allowing in vitro manipulations of the calcifying fluid. This novel coral culturing technique enables us to study the mechanisms of biomineralization and their implications for geochemical proxies. Viable cell cultures of the hermatypic, zooxanthellate coral, Stylophora pistillata, have been maintained for 6 to 8 weeks. Using an enriched seawater medium with aragonite saturation state similar to open ocean surface waters (Ω(arag)~4), the primary cell cultures assemble into "proto-polyps" which form an extracellular organic matrix (ECM) and precipitate aragonite crystals. These extracellular aragonite crystals, about 10 µm in length, are formed on the external face of the proto-polyps and are identified by their distinctive elongated crystallography and X-ray diffraction pattern. The precipitation of aragonite is independent of photosynthesis by the zooxanthellae, and does not occur in control experiments lacking coral cells or when the coral cells are poisoned with sodium azide. Our results demonstrate that proto-polyps, aggregated from primary coral tissue culture, function (from a biomineralization perspective) similarly to whole corals. This approach provides a novel tool for investigating the biophysical mechanism of calcification in these organisms.

  11. Aragonite precipitation by "proto-polyps" in coral cell cultures.

    Directory of Open Access Journals (Sweden)

    Tali Mass

    Full Text Available The mechanisms of coral calcification at the molecular, cellular and tissue levels are poorly understood. In this study, we examine calcium carbonate precipitation using novel coral tissue cultures that aggregate to form "proto-polyps". Our goal is to establish an experimental system in which calcification is facilitated at the cellular level, while simultaneously allowing in vitro manipulations of the calcifying fluid. This novel coral culturing technique enables us to study the mechanisms of biomineralization and their implications for geochemical proxies. Viable cell cultures of the hermatypic, zooxanthellate coral, Stylophora pistillata, have been maintained for 6 to 8 weeks. Using an enriched seawater medium with aragonite saturation state similar to open ocean surface waters (Ω(arag~4, the primary cell cultures assemble into "proto-polyps" which form an extracellular organic matrix (ECM and precipitate aragonite crystals. These extracellular aragonite crystals, about 10 µm in length, are formed on the external face of the proto-polyps and are identified by their distinctive elongated crystallography and X-ray diffraction pattern. The precipitation of aragonite is independent of photosynthesis by the zooxanthellae, and does not occur in control experiments lacking coral cells or when the coral cells are poisoned with sodium azide. Our results demonstrate that proto-polyps, aggregated from primary coral tissue culture, function (from a biomineralization perspective similarly to whole corals. This approach provides a novel tool for investigating the biophysical mechanism of calcification in these organisms.

  12. Proinflammatory and Anabolic Gene Expression Effects of Platelet-Rich Gel Supernatants on Equine Synovial Membrane Explants Challenged with Lipopolysaccharide

    Directory of Open Access Journals (Sweden)

    Jorge U. Carmona

    2017-01-01

    Full Text Available Platelet-rich plasma (PRP preparations are used in horses with osteoarthritis (OA. However, some controversies remain regarding the ideal concentration of platelets and leukocytes to produce an adequate anti-inflammatory and anabolic response in the synovial membrane. The aims of this study were to study the influence of leukoconcentrated platelet-rich gel (Lc-PRG and leukoreduced platelet-rich gel (Lr-PRG supernatants on the quantitative expression of some proinflammatory and anabolic genes in equine synovial membrane explants (SMEs challenged with lipopolysaccharide (LPS. SMEs from six horses were cultured over 96 h. Then, SMEs were harvested for RNA extraction and quantitative gene expression analysis by RT-qPCR for nuclear factor kappa B (NFκB, matrix metalloproteinase 13 (MMP-13, a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS-4, collagen type I alpha 1 (COL1A1, collagen type II alpha 1 (COL2A1, and cartilage oligomeric matrix protein (COMP. The 25% and 50% Lc-PRG supernatants led to downregulation of NFκB, MMP-13, ADAMTS-4, COL1A1, COL2A1, and COMP in SMEs. Lr-PRG supernatants (particularly at the 50% concentration induced downregulation of NFκB, MMP-13, ADAMTS-4, and COL1A1 and upregulation of COL2A1 and COMP. Lr-PRG supernatants should be used for the treatment of inflammatory arthropathies in horses because they have anti-inflammatory and anabolic effects in the synovial membrane.

  13. Extension of the celiac intestinal antibody (CIA) pattern through eight antibody assessments in fecal supernatants from patients with celiac disease.

    Science.gov (United States)

    Di Tola, Marco; Marino, Mariacatia; Casale, Rossella; Di Battista, Valeria; Borghini, Raffaele; Picarelli, Antonio

    2016-01-01

    Detection of anti-transglutaminase, anti-endomysium and anti-gliadin antibodies is commonly used to screen celiac disease patients. Besides that in serum, these antibodies are detectable in culture supernatants of oral, duodenal and colonic biopsy samples, saliva, gut lavage fluid samples, and fecal supernatants. Our aim was to extend the intestinal antibody pattern in fecal supernatants from patients with celiac disease. The fecal supernatants obtained from 25 celiac disease patients and 12 healthy volunteers were used to determine IgA and IgG1 anti-endomysium by immunofluorescence analysis, IgA and IgG anti-transglutaminase, IgA and IgG anti-deamidated gliadin peptides, IgA/IgG anti-transglutaminase/deamidated gliadin peptides and IgA anti-actin by enzyme-linked immunosorbent assay. IgA anti-endomysium were found in 11 of 25 (44.0%) celiac disease patients and in none of healthy volunteers (p=0.0066). The levels of IgA anti-transglutaminase, IgA anti-deamidated gliadin peptides, IgA/IgG anti-transglutaminase/deamidated gliadin peptides and IgA anti-actin determined in celiac disease patients were significantly higher (p=0.0005, p=0.0018, p=0.0061 and p=0.0477, respectively) than those measured in healthy volunteers. The ROC curve analysis showed a diagnostic significance in IgA anti-transglutaminase (AUC=0.862, pceliac disease. Further studies are needed to better evaluate the role of fecal antibody tests in identifying celiac disease patients. Copyright © 2015 Elsevier GmbH. All rights reserved.

  14. Karyotype changes in cultured human corneal endothelial cells

    OpenAIRE

    Miyai, Takashi; Maruyama, Yoko; Osakabe, Yasuhiro; Nejima, Ryohei; Miyata, Kazunori; Amano, Shiro

    2008-01-01

    Purpose To examine karyotype changes in cultured human corneal endothelial cells (HCECs). Methods HCECs with Descemet’s membrane were removed from 20 donors of various ages (range, 2–77 years; average, 43.7±26.4 years) and cultured on dishes coated with extracellular matrix produced by bovine corneal endothelial cells (BCECs). Karyotype changes were examined by G-band karyotyping of HCECs at the third passage from 12 donors and the fifth passage from 16 donors. The number of chromosomes was a...

  15. Testicular Sertoli cells influence the proliferation and immunogenicity of co-cultured endothelial cells

    International Nuclear Information System (INIS)

    Fan, Ping; He, Lan; Pu, Dan; Lv, Xiaohong; Zhou, Wenxu; Sun, Yining; Hu, Nan

    2011-01-01

    Research highlights: → The proliferation of dramatic increased by co-cultured with Sertoli cells. → VEGF receptor-2 expression of ECs was up-regulated by co-cultured with Sertoli cells. → The MHC expression of ECs induced by INF-γ and IL-6, IL-8 and sICAM induced by TNF-α decreased respectively after co-cultured with Sertoli cells. → ECs co-cultured with Sertoli cells also didn't increase the stimulation index of spleen lymphocytes. -- Abstract: The major problem of the application of endothelial cells (ECs) in transplantation is the lack of proliferation and their immunogenicity. In this study, we co-cultured ECs with Sertoli cells to monitor whether Sertoli cells can influence the proliferation and immunogenicity of co-cultured ECs. Sertoli cells were isolated from adult testicular tissue. ECs were divided into the control group and the experimental group, which included three sub-groups co-cultured with 1 x 10 3 , 1 x 10 4 or 1 x 10 5 cell/ml of Sertoli cells. The growth and proliferation of ECs were observed microscopically, and the expression of vascular endothelial growth factor (VEGF) receptor-2 (KDR) was examined by Western blotting. In another experiment, ECs were divided into the control group, the single culture group and the co-culture group with the optimal concentration of Sertoli cells. After INF-γ and TNF-α were added to the culture medium, MHC II antigen expression was detected by immunofluorescence staining and western blotting; interleukin (IL)-6, IL-8 and soluble intercellular adhesion molecule (sICAM) were measured in the culture medium by ELISA. We demonstrated that 1 x 10 4 cell/ml Sertoli cells promoted the proliferation of co-cultured ECs more dramatically than that in other groups (P 4 cell/ml of the Sertoli cells was most effective in the up-regulation of KDR expression in the co-cultured ECs (P < 0.05). Sertoli cells can effectively suppress INF-γ-induced MHC II antigen expression in co-cultured ECs compared with single

  16. Testicular Sertoli cells influence the proliferation and immunogenicity of co-cultured endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Ping, E-mail: fanpinggoodluck@163.com [Department of Rheumatism and Immunity, The First Affiliated Hospital Xi' an Jiaotong University School of Medicine, Xi' an, Shaanxi 710061 (China); He, Lan; Pu, Dan; Lv, Xiaohong; Zhou, Wenxu; Sun, Yining; Hu, Nan [Department of Rheumatism and Immunity, The First Affiliated Hospital Xi' an Jiaotong University School of Medicine, Xi' an, Shaanxi 710061 (China)

    2011-01-21

    Research highlights: {yields} The proliferation of dramatic increased by co-cultured with Sertoli cells. {yields} VEGF receptor-2 expression of ECs was up-regulated by co-cultured with Sertoli cells. {yields} The MHC expression of ECs induced by INF-{gamma} and IL-6, IL-8 and sICAM induced by TNF-{alpha} decreased respectively after co-cultured with Sertoli cells. {yields} ECs co-cultured with Sertoli cells also didn't increase the stimulation index of spleen lymphocytes. -- Abstract: The major problem of the application of endothelial cells (ECs) in transplantation is the lack of proliferation and their immunogenicity. In this study, we co-cultured ECs with Sertoli cells to monitor whether Sertoli cells can influence the proliferation and immunogenicity of co-cultured ECs. Sertoli cells were isolated from adult testicular tissue. ECs were divided into the control group and the experimental group, which included three sub-groups co-cultured with 1 x 10{sup 3}, 1 x 10{sup 4} or 1 x 10{sup 5} cell/ml of Sertoli cells. The growth and proliferation of ECs were observed microscopically, and the expression of vascular endothelial growth factor (VEGF) receptor-2 (KDR) was examined by Western blotting. In another experiment, ECs were divided into the control group, the single culture group and the co-culture group with the optimal concentration of Sertoli cells. After INF-{gamma} and TNF-{alpha} were added to the culture medium, MHC II antigen expression was detected by immunofluorescence staining and western blotting; interleukin (IL)-6, IL-8 and soluble intercellular adhesion molecule (sICAM) were measured in the culture medium by ELISA. We demonstrated that 1 x 10{sup 4} cell/ml Sertoli cells promoted the proliferation of co-cultured ECs more dramatically than that in other groups (P < 0.05). Western blotting showed that 1 x 10{sup 4} cell/ml of the Sertoli cells was most effective in the up-regulation of KDR expression in the co-cultured ECs (P < 0.05). Sertoli

  17. A study of chromosomal aberrations in amniotic fluid cell cultures.

    Science.gov (United States)

    Wolstenholme, J; Crocker, M; Jonasson, J

    1988-06-01

    This paper represents the analysis of 1916 routine amniotic fluid specimens harvested by an in situ fixation technique in a prospective study with regard to cultural chromosome anomalies. Excluding constitutional abnormalities, 2.9 per cent of 19,432 cells analysed showed some form of chromosome anomaly, terminal deletions (57 per cent) and chromatid/chromosome breaks and gaps (18 per cent) being the most frequent, followed by interchange aberrations (13 per cent) and trisomy (5 per cent). No case was found of more than one colony from the same culture showing the same anomaly without it being present in other cultures from the same fluid. The wholly abnormal colonies had a surplus of trisomies and from the mathematical considerations presented one may infer that these are likely to reflect the presence of abnormal cells in the amniotic fluid. Partly abnormal colonies appeared at a frequency that would correspond to virtual absence of selection against chromosomally abnormal cells when cultured in vitro. The aberrations found were similar to those seen as single cell anomalies, except for chromatid breaks and exchanges. The data suggest a basic preferential induction of trisomy for chromosomes 2, 18, 21, and the Y-chromosome. Structural aberrations showed a marked clustering of breakpoints around the centromeres. The frequency of mutant cells was low (1.4 X 10(-3)) before culture was initiated. At harvest, the frequency of abnormal cells was much higher (3 X 10(-2)) corresponding to 3 X 10(-3) mutations per cell per generation accumulating over approximately ten generations in vitro.

  18. Cell culture media impact on drug product solution stability.

    Science.gov (United States)

    Purdie, Jennifer L; Kowle, Ronald L; Langland, Amie L; Patel, Chetan N; Ouyang, Anli; Olson, Donald J

    2016-07-08

    To enable subcutaneous administration of monoclonal antibodies, drug product solutions are often needed at high concentrations. A significant risk associated with high drug product concentrations is an increase in aggregate level over the shelf-life dating period. While much work has been done to understand the impact of drug product formulation on aggregation, there is limited understanding of the link between cell culture process conditions and soluble aggregate growth in drug product. During cell culture process development, soluble aggregates are often measured at harvest using cell-free material purified by Protein A chromatography. In the work reported here, cell culture media components were evaluated with respect to their impact on aggregate levels in high concentration solution drug product during accelerated stability studies. Two components, cysteine and ferric ammonium citrate, were found to impact aggregate growth rates in our current media (version 1) leading to the development of new chemically defined media and concentrated feed formulations. The new version of media and associated concentrated feeds (version 2) were evaluated across four cell lines producing recombinant IgG4 monoclonal antibodies and a bispecific antibody. In all four cell lines, the version 2 media reduced aggregate growth over the course of a 12 week accelerated stability study compared with the version 1 media, although the degree to which aggregate growth decreased was cell line dependent. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:998-1008, 2016. © 2016 American Institute of Chemical Engineers.

  19. Testing of serum atherogenicity in cell cultures: questionable data published

    Directory of Open Access Journals (Sweden)

    Sergei V. Jargin

    2012-01-01

    Full Text Available In a large series of studies was reported that culturing of smooth muscle cells with serum from atherosclerosis patients caused intracellular lipid accumulation, while serum from healthy controls had no such effect. Cultures were used for evaluation of antiatherogenic drugs. Numerous substances were reported to lower serum atherogenicity: statins, trapidil, calcium antagonists, garlic derivatives etc. On the contrary, beta-blockers, phenothiazines and oral hypoglycemics were reported to be pro-atherogenic. Known antiatherogenic agents can influence lipid metabolism and cholesterol synthesis, intestinal absorption or endothelium-related mechanisms. All these targets are absent in cell monocultures. Inflammatory factors, addressed by some antiatherogenic drugs, are also not reproduced. In vivo, relationship between cholesterol uptake by cells and atherogenesis must be inverse rather than direct: in familial hypercholesterolemia, inefficient clearance of LDL-cholesterol by cells predisposes to atherosclerosis. Accordingly, if a pharmacological agent reduces cholesterol uptake by cells in vitro, it should be expected to elevate cholesterol in vivo. Validity of clinical recommendations, based on serum atherogenicity testing in cell monocultures, is therefore questionable. These considerations pertain also to the drugs developed on the basis of the cell culture experiments.

  20. Arsenic exposure induces the Warburg effect in cultured human cells

    International Nuclear Information System (INIS)

    Zhao, Fei; Severson, Paul; Pacheco, Samantha; Futscher, Bernard W.; Klimecki, Walter T.

    2013-01-01

    Understanding how arsenic exacts its diverse, global disease burden is hampered by a limited understanding of the particular biological pathways that are disrupted by arsenic and underlie pathogenesis. A reductionist view would predict that a small number of basic pathways are generally perturbed by arsenic, and manifest as diverse diseases. Following an initial observation that arsenite-exposed cells in culture acidify their media more rapidly than control cells, the report here shows that low level exposure to arsenite (75 ppb) is sufficient to induce aerobic glycolysis (the Warburg effect) as a generalized phenomenon in cultured human primary cells and cell lines. Expanded studies in one such cell line, the non-malignant pulmonary epithelial line, BEAS-2B, established that the arsenite-induced Warburg effect was associated with increased accumulation of intracellular and extracellular lactate, an increased rate of extracellular acidification, and inhibition by the non-metabolized glucose analog, 2-deoxy-D-glucose. Associated with the induction of aerobic glycolysis was a pathway-wide induction of glycolysis gene expression, as well as protein accumulation of an established glycolysis master-regulator, hypoxia-inducible factor 1A. Arsenite-induced alteration of energy production in human cells represents the type of fundamental perturbation that could extend to many tissue targets and diseases. - Highlights: • Chronic arsenite exposure induces aerobic glycolysis, dubbed the “Warburg effect”. • Arsenite-induced Warburg effect is a general phenomenon in cultured human cells. • HIF-1A may mediate arsenite induced Warburg effect

  1. Scanning electroporation of selected areas of adherent cell cultures.

    Science.gov (United States)

    Olofsson, Jessica; Levin, Mikael; Strömberg, Anette; Weber, Stephen G; Ryttsén, Frida; Orwar, Owe

    2007-06-15

    We present a computer-controlled scanning electroporation method. Adherent cells are electroporated using an electrolyte-filled capillary in contact with an electrode. The capillary can be scanned over a cell culture and locally deliver both an electric field and an electroporation agent to the target area without affecting surrounding cells. The instantaneous size of the targeted area is determined by the dimensions of the capillary. The size and shape of the total electroporated area are defined by these dimensions in combination with the scanning pattern. For example, striped and serpentine patterns of electroporated cells in confluent cultures can be formed. As it is easy to switch between different electroporation agents, the method is suitable for design of cell cultures with complex composition. Finite element method simulations were used to study the spatial distributions of the electric field and the concentration of an electroporation agent, as well as the fluid dynamics related to scanning and flow of electroporation agent from the capillary. The method was validated for transfection by introduction of a 9-base-pair-long randomized oligonucleotide into PC12 cells and a pmaxGFP plasmid coding for green fluorescent protein into CHO and WSS cells.

  2. Schwann Cells Can Be Reprogrammed to Multipotency by Culture

    Science.gov (United States)

    Widera, Darius; Heimann, Peter; Zander, Christin; Imielski, Yvonne; Heidbreder, Meike; Heilemann, Mike; Kaltschmidt, Christian

    2011-01-01

    Adult neural crest related-stem cells persist in adulthood, making them an ideal and easily accessible source of multipotent cells for potential clinical use. Recently, we reported the presence of neural crest-related stem cells within adult palatal ridges, thus raising the question of their localization in their endogenous niche. Using immunocytochemistry, reverse transcription–polymerase chain reaction, and correlative fluorescence and transmission electron microscopy, we identified myelinating Schwann cells within palatal ridges as a putative neural crest stem cell source. Palatal Schwann cells expressed nestin, p75NTR, and S100. Correlative fluorescence and transmission electron microscopy revealed the exclusive nestin expression within myelinating Schwann cells. Palatal neural crest stem cells and nestin-positive Schwann cells isolated from adult sciatic nerves were able to grow under serum-free conditions as neurospheres in presence of FGF-2 and EGF. Spheres of palatal and sciatic origin showed overlapping expression pattern of neural crest stem cell and Schwann cell markers. Expression of the pluripotency factors Sox2, Klf4, c-Myc, Oct4, the NF-κB subunits p65, p50, and the NF-κB-inhibitor IκB-β were up-regulated in conventionally cultivated sciatic nerve Schwann cells and in neurosphere cultures. Finally, neurospheres of palatal and sciatic origin were able to differentiate into ectodermal, mesodermal, and endodermal cell types emphasizing their multipotency. Taken together, we show that nestin-positive myelinating Schwann cells can be reprogrammed into multipotent adult neural crest stem cells under appropriate culture conditions. PMID:21466279

  3. Cannabinoids induce incomplete maturation of cultured human leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Murison, G.; Chubb, C.B.H.; Maeda, S.; Gemmell, M.A.; Huberman, E.

    1987-08-01

    Monocyte maturation markers were induced in cultured human myeloblastic ML-2 leukemia cells after treatment for 1-6 days with 0.03-30 ..mu..M ..delta../sup 9/-tetrahydrocannabinol (THC), the major psychoactive component of marijuana. After a 2-day or longer treatment, 2- to 5-fold increases were found in the percentages of cells exhibiting reactivity with either the murine OKM1 monoclonal antibody of the Leu-M5 monoclonal antibody, staining positively for nonspecific esterase activity, and displaying a promonocyte morphology. The increases in these differentiation markers after treatment with 0.03-1 ..mu..M THC were dose dependent. At this dose range, THC did not cause an inhibition of cell growth. The THC-induced cell maturation was also characterized by specific changes in the patterns of newly synthesized proteins. The THC-induced differentiation did not, however, result in cells with a highly developed mature monocyte phenotype. However, treatment of these incompletely matured cells with either phorbol 12-myristate 13-acetate of 1..cap alpha..,25-dihydroxycholecalciferol, which are inducers of differentiation in myeloid leukemia cells (including ML-2 cells), produced cells with a mature monocyte morphology. The ML-2 cell system described here may be a useful tool for deciphering critical biochemical events that lead to the cannabinoid-induced incomplete cell differentiation of ML-2 cells and other related cell types. Findings obtained from this system may have important implications for studies of cannabinoid effects on normal human bone-marrow progenitor cells.

  4. Culturing of PC12 Cells, Neuronal Cells, Astrocytes Cultures and Brain Slices in an Open Microfluidic System

    DEFF Research Database (Denmark)

    Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya; Rømer Sørensen, Ane

    and electrochemical sensor system that enables real time detection of metabolites, e.g. dopamine from cell cultures and brain slices. In summary we present results on culturing of brain slices and cells in the microfluidic system as well as on the incorporation of an electrochemical sensor system for characterization......The brain is the center of the nervous system, where serious neurodegenerative diseases such as Parkinson’s, Alzheimer’s and Huntington’s are products of functional loss in the neural cells (1). Typical techniques used to investigate these diseases lack precise control of the cellular surroundings......, in addition to isolating the neural tissue from nutrient delivery and to creating unwanted gradients (2). This means that typical techniques used to investigate neurodegenerative diseases cannot mimic in vivo conditions, as closely as desired. We have developed a novel microfluidic system for culturing PC12...

  5. System-level modeling and simulation of the cell culture microfluidic biochip ProCell

    DEFF Research Database (Denmark)

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan

    2010-01-01

    Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory. There are two technologies for the microfluidic biochips: droplet-based and flow-based. In this paper we are interested in flow-based microfluidic biochips, where the liquid flows continuously through pre......-defined micro-channels using valves and pumps. We present an approach to the system-level modeling and simulation of a cell culture microfluidic biochip called ProCell, Programmable Cell Culture Chip. ProCell contains a cell culture chamber, which is envisioned to run 256 simultaneous experiments (viewed...... and a comprehensive fault model that captures permanent faults occurring during chip operation. Using the proposed modeling and simulation framework, we perform an architectural level evaluation of two cell culture chamber implementations. A qualitative success metric is also proposed to evaluate chip performance...

  6. Chikungunya virus isolation using simplified cell culture technique in Mauritius.

    Science.gov (United States)

    Pyndiah, M N; Pursem, V; Meetoo, G; Daby, S; Ramuth, V; Bhinkah, P; Chuttoo, R; Paratian, U

    2012-03-01

    During the chikungunya outbreak of 2005 - 2006, the only laboratory facilities available in Mauritius were virus isolation in cell culture tubes and serology. The laboratory was submerged with large numbers of blood samples. Comparative isolation was made in human embryonic lung (HEL) and VERO cells grown in 96-well plate. Culture on HEL cells was found to be more sensitive and presence of cytopathic effect (CPE) was observed earlier than in VERO cells. Out of the 18 300 blood samples inoculated on HEL, 11 165 were positive. This virus isolation method was of great help for the surveillance and control of the vectors. In cases of an outbreak a cheap, rapid and simple method of isolating chikungunya virus is described.

  7. Bystander Host Cell Killing Effects of Clostridium perfringens Enterotoxin

    Directory of Open Access Journals (Sweden)

    Archana Shrestha

    2016-12-01

    Full Text Available Clostridium perfringens enterotoxin (CPE binds to claudin receptors, e.g., claudin-4, and then forms a pore that triggers cell death. Pure cultures of host cells that do not express claudin receptors, e.g., fibroblasts, are unaffected by pathophysiologically relevant CPE concentrations in vitro. However, both CPE-insensitive and CPE-sensitive host cells are present in vivo. Therefore, this study tested whether CPE treatment might affect fibroblasts when cocultured with CPE-sensitive claudin-4 fibroblast transfectants or Caco-2 cells. Under these conditions, immunofluorescence microscopy detected increased death of fibroblasts. This cytotoxic effect involved release of a toxic factor from the dying CPE-sensitive cells, since it could be reproduced using culture supernatants from CPE-treated sensitive cells. Supernatants from CPE-treated sensitive cells, particularly Caco-2 cells, were found to contain high levels of membrane vesicles, often containing a CPE species. However, most cytotoxic activity remained in those supernatants even after membrane vesicle depletion, and CPE was not detected in fibroblasts treated with supernatants from CPE-treated sensitive cells. Instead, characterization studies suggest that a major cytotoxic factor present in supernatants from CPE-treated sensitive cells may be a 10- to 30-kDa host serine protease or require the action of that host serine protease. Induction of caspase-3-mediated apoptosis was found to be important for triggering release of the cytotoxic factor(s from CPE-treated sensitive host cells. Furthermore, the cytotoxic factor(s in these supernatants was shown to induce a caspase-3-mediated killing of fibroblasts. This bystander killing effect due to release of cytotoxic factors from CPE-treated sensitive cells could contribute to CPE-mediated disease.

  8. Enhancement effect of shikonin in cell suspension culture and transfermanant culture by radiation application

    International Nuclear Information System (INIS)

    Kim, Jae Sung; Lee, Young Keun; Chung, Byung Yeoup; Lee, Young Bok; Hwang Hye Yeon

    2004-10-01

    The cell lines 679, 679-29 and 622-46 of L. erythrorhizon could be selected on LS agar medium for the production shikonin in cell suspension culture. The shikonin was increased moderately in suspension culture of cell line 622-46 in LS liquid medium containing BA 2 mg·L -1 and IAA 0.2 mg·L -1 in the dark, and was increased by adding 1 μM Cu 2+ and 100 μM methyl jasmonate The accumulation of shikonin in the liquid medium was increased significantly by 2 Gy irradiation to callus of cell line 622-46 and culture in LS liquid medium containing BA 2 mg·L -1 and IAA 0.2 mg·L -1 in the dark and shikonin in cell debris was higher by 16 Gy irradiation. The activity of p-hydroxybenzoate geranyltransferase was increased by irradiation of 2 Gy and 16 Gy of γ radiation. Seedling hypocotyles of L. erythrorhizon were infected with Agrogacterium rhizogenes strain 15834 harboring a binary vector with an intron bearing the GUS (β-glucuronidase) gene driven by cauliflower mosaic virus (CaMV) 35S promotor as well as the HPT (hygromycin phosphotransferase) gene as the selection marker. Hairy roots isolated were hygromycin resistant and had integrated GUS gene in DNA. The root tip grown on M-9 medium showed normal pigment production pattern in border cells and root hairs

  9. Radiation Response of Cultured Human Cells Is Unaffected by Johrei

    OpenAIRE

    Hall, Zach; Luu, Tri; Moore, Dan; Yount, Garret

    2007-01-01

    Johrei has been credited with healing thousands from radiation wounds after the Hiroshima and Nagasaki bombs in 1945. This alternative medical therapy is becoming increasingly popular in the United States, as are other Energy Medicine modalities that purport to influence a universal healing energy. Human brain cells were cultured and exposed to increasing doses of ionizing radiation. Experienced Johrei practitioners directed healing intentionality toward the cells for 30 min from a distance o...

  10. Cultured meat from stem cells: challenges and prospects.

    Science.gov (United States)

    Post, Mark J

    2012-11-01

    As one of the alternatives for livestock meat production, in vitro culturing of meat is currently studied. The generation of bio-artificial muscles from satellite cells has been ongoing for about 15 years, but has never been used for generation of meat, while it already is a great source of animal protein. In order to serve as a credible alternative to livestock meat, lab or factory grown meat should be efficiently produced and should mimic meat in all of its physical sensations, such as visual appearance, smell, texture and of course, taste. This is a formidable challenge even though all the technologies to create skeletal muscle and fat tissue have been developed and tested. The efficient culture of meat will primarily depend on culture conditions such as the source of medium and its composition. Protein synthesis by cultured skeletal muscle cells should further be maximized by finding the optimal combination of biochemical and physical conditions for the cells. Many of these variables are known, but their interactions are numerous and need to be mapped. This involves a systematic, if not systems, approach. Given the urgency of the problems that the meat industry is facing, this endeavor is worth undertaking. As an additional benefit, culturing meat may provide opportunities for production of novel and healthier products. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Oxidative Stress Induces Senescence in Cultured RPE Cells.

    Science.gov (United States)

    Aryan, Nona; Betts-Obregon, Brandi S; Perry, George; Tsin, Andrew T

    2016-01-01

    The aim of this research is to determine whether oxidative stress induces cellular senescence in human retinal pigment epithelial cells. Cultured ARPE19 cells were subjected to different concentrations of hydrogen peroxide to induce oxidative stress. Cells were seeded into 24-well plates with hydrogen peroxide added to cell medium and incubated at 37°C + 5% CO2 for a 90-minute period [at 0, 300, 400 and 800 micromolar (MCM) hydrogen peroxide]. The number of viable ARPE19 cells were recorded using the Trypan Blue Dye Exclusion Method and cell senescence was measured by positive staining for senescence-associated beta-galactosidase (SA-beta-Gal) protein. Without hydrogen peroxide treatment, the number of viable ARPE19 cells increased significantly from 50,000 cells/well to 197,000 within 72 hours. Treatment with hydrogen peroxide reduced this level of cell proliferation significantly (to 52,167 cells at 400 MCM; to 49,263 cells at 800 MCM). Meanwhile, cells with a high level of positive senescence-indicator SA-Beta-Gal-positive staining was induced by hydrogen peroxide treatment (from a baseline level of 12% to 80% at 400 MCM and at 800 MCM). Our data suggests that oxidative stress from hydrogen peroxide treatment inhibited ARPE19 cell proliferation and induced cellular senescence.

  12. CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures.

    Science.gov (United States)

    Kisselbach, Lynn; Merges, Michael; Bossie, Alexis; Boyd, Ann

    2009-01-01

    Cluster Differentiation 90 (CD90) is a cell surface glycoprotein originally identified on mouse thymocytes. Although CD90 has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells, the knowledge about the levels of CD90 expression on different cell types, including human primary cells, is limited. The goal of this study was to identify CD90 as a human primary cell biomarker and to develop an efficient and reliable method for eliminating unwanted or contaminating fibroblasts from human primary cell cultures suitable for research pursuant to cell based therapy technologies.

  13. Human disc cells in monolayer vs 3D culture: cell shape, division and matrix formation

    Directory of Open Access Journals (Sweden)

    Hanley Edward N

    2000-10-01

    Full Text Available Abstract Background The relationship between cell shape, proliferation, and extracellular matrix (ECM production, important aspects of cell behavior, is examined in a little-studied cell type, the human annulus cell from the intervertebral disc, during monolayer vs three-dimensional (3D culture. Results Three experimental studies showed that cells respond specifically to culture microenvironments by changes in cell shape, mitosis and ECM production: 1 Cell passages showed extensive immunohistochemical evidence of Type I and II collagens only in 3D culture. Chondroitin sulfate and keratan sulfate were abundant in both monolayer and 3D cultures. 2 Cells showed significantly greater proliferation in monolayer in the presence of platelet-derived growth factor compared to cells in 3D. 3 Cells on Matrigel™-coated monolayer substrates became rounded and formed nodular colonies, a finding absent during monolayer growth. Conclusions The cell's in vivo interactions with the ECM can regulate shape, gene expression and other cell functions. The shape of the annulus cell changes markedly during life: the young, healthy disc contains spindle shaped cells and abundant collagen. With aging and degeneration, many cells assume a strikingly different appearance, become rounded and are surrounded by unusual accumulations of ECM products. In vitro manipulation of disc cells provides an experimental window for testing how disc cells from given individuals respond when they are grown in environments which direct cells to have either spindle- or rounded-shapes. In vitro assessment of the response of such cells to platelet-derived growth factor and to Matrigel™ showed a continued influence of cell shape even in the presence of a growth factor stimulus. These findings contribute new information to the important issue of the influence of cell shape on cell behavior.

  14. Apple derived cellulose scaffolds for 3D mammalian cell culture.

    Directory of Open Access Journals (Sweden)

    Daniel J Modulevsky

    Full Text Available There are numerous approaches for producing natural and synthetic 3D scaffolds that support the proliferation of mammalian cells. 3D scaffolds better represent the natural cellular microenvironment and have many potential applications in vitro and in vivo. Here, we demonstrate that 3D cellulose scaffolds produced by decellularizing apple hypanthium tissue can be employed for in vitro 3D culture of NIH3T3 fibroblasts, mouse C2C12 muscle myoblasts and human HeLa epithelial cells. We show that these cells can adhere, invade and proliferate in the cellulose scaffolds. In addition, biochemical functionalization or chemical cross-linking can be employed to control the surface biochemistry and/or mechanical properties of the scaffold. The cells retain high viability even after 12 continuous weeks of culture and can achieve cell densities comparable with other natural and synthetic scaffold materials. Apple derived cellulose scaffolds are easily produced, inexpensive and originate from a renewable source. Taken together, these results demonstrate that naturally derived cellulose scaffolds offer a complementary approach to existing techniques for the in vitro culture of mammalian cells in a 3D environment.

  15. T cell resistance to activation by dendritic cells requires long-term culture in simulated microgravity

    Science.gov (United States)

    Bradley, Jillian H.; Stein, Rachel; Randolph, Brad; Molina, Emily; Arnold, Jennifer P.; Gregg, Randal K.

    2017-11-01

    Immune impairment mediated by microgravity threatens the success of space exploration requiring long-duration spaceflight. The cells of most concern, T lymphocytes, coordinate the host response against microbial and cancerous challenges leading to elimination and long-term protection. T cells are activated upon recognition of specific microbial peptides bound on the surface of antigen presenting cells, such as dendritic cells (DC). Subsequently, this engagement results in T cell proliferation and differentiation into effector T cells driven by autocrine interleukin-2 (IL-2) and other cytokines. Finally, the effector T cells acquire the weaponry needed to destroy microbial invaders and tumors. Studies conducted on T cells during spaceflight, or using Earth-based culture systems, have shown reduced production of cytokines, proliferation and effector functions as compared to controls. This may account for the cases of viral reactivation events and opportunistic infections associated with astronauts of numerous missions. This work has largely been based upon the outcome of T cell activation by stimulatory factors that target select T cell signaling pathways rather than the complex, signaling events related to the natural process of antigen presentation by DC. This study tested the response of an ovalbumin peptide-specific T cell line, OT-II TCH, to activation by DC when the T cells were cultured 24-120 h in a simulated microgravity (SMG) environment generated by a rotary cell culture system. Following 72 h culture of T cells in SMG (SMG-T) or control static (Static-T) conditions, IL-2 production by the T cells was reduced in SMG-T cells compared to Static-T cells upon stimulation by phorbol 12-myristate 13-acetate (PMA) and ionomycin. However, when the SMG-T cells were stimulated with DC and peptide, IL-2 was significantly increased compared to Static-T cells. Such enhanced IL-2 production by SMG-T cells peaked at 72 h SMG culture time and decreased thereafter. When

  16. T cell resistance to activation by dendritic cells requires long-term culture in simulated microgravity.

    Science.gov (United States)

    Bradley, Jillian H; Stein, Rachel; Randolph, Brad; Molina, Emily; Arnold, Jennifer P; Gregg, Randal K

    2017-11-01

    Immune impairment mediated by microgravity threatens the success of space exploration requiring long-duration spaceflight. The cells of most concern, T lymphocytes, coordinate the host response against microbial and cancerous challenges leading to elimination and long-term protection. T cells are activated upon recognition of specific microbial peptides bound on the surface of antigen presenting cells, such as dendritic cells (DC). Subsequently, this engagement results in T cell proliferation and differentiation into effector T cells driven by autocrine interleukin-2 (IL-2) and other cytokines. Finally, the effector T cells acquire the weaponry needed to destroy microbial invaders and tumors. Studies conducted on T cells during spaceflight, or using Earth-based culture systems, have shown reduced production of cytokines, proliferation and effector functions as compared to controls. This may account for the cases of viral reactivation events and opportunistic infections associated with astronauts of numerous missions. This work has largely been based upon the outcome of T cell activation by stimulatory factors that target select T cell signaling pathways rather than the complex, signaling events related to the natural process of antigen presentation by DC. This study tested the response of an ovalbumin peptide-specific T cell line, OT-II TCH, to activation by DC when the T cells were cultured 24-120 h in a simulated microgravity (SMG) environment generated by a rotary cell culture system. Following 72 h culture of T cells in SMG (SMG-T) or control static (Static-T) conditions, IL-2 production by the T cells was reduced in SMG-T cells compared to Static-T cells upon stimulation by phorbol 12-myristate 13-acetate (PMA) and ionomycin. However, when the SMG-T cells were stimulated with DC and peptide, IL-2 was significantly increased compared to Static-T cells. Such enhanced IL-2 production by SMG-T cells peaked at 72 h SMG culture time and decreased thereafter

  17. Mesenchymal stem cells enhance the metastasis of 3D-cultured hepatocellular carcinoma cells

    International Nuclear Information System (INIS)

    Liu, Chang; Liu, Yang; Xu, Xiao-xi; Guo, Xin; Sun, Guang-wei; Ma, Xiao-jun

    2016-01-01

    Accumulating evidences have demonstrated that mesenchymal stem cells (MSC) could be recruited to the tumor microenvironment. Umbilical cord mesenchymal stem cells (UCMSC) were attractive vehicles for delivering therapeutic agents against cancer. Nevertheless, the safety of UCMSC in the treatment of tumors including hepatocellular carcinoma (HCC) was still undetermined. In this study, an in vitro co-culture system was established to evaluate the effect of UCMSC on the cell growth, cancer stem cell (CSC) characteristics, drug resistance, metastasis of 3D-cultured HCC cells, and the underlying mechanism was also investigated. It was found that after co-cultured with UCMSC, the metastatic ability of 3D-cultured HCC cells was significantly enhanced as indicated by up-regulation of matrix metalloproteinase (MMP), epithelial-mesenchymal transition (EMT)-related genes, and migration ability. However, cell growth, drug resistance and CSC-related gene expression of HCC cells were not affected by UCMSC. Moreover, EMT was reversed, MMP-2 expression was down-regulated, and migration ability of HCC cell was significantly inhibited when TGF-β receptor inhibitor SB431542 was added into the co-culture system. Therefore, these data indicated that UCMSC could significantly enhance the tumor cell metastasis, which was due to the EMT of HCC cells induced by TGF-β. The online version of this article (doi:10.1186/s12885-016-2595-4) contains supplementary material, which is available to authorized users

  18. In vitro plant regeneration from embryogenic cell suspension culture ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... plasts in A. adsurgens (Luo and Jia, 1998a, b). There are only few reports available on plant regeneration systems via somatic embryogenesis (Luo et al., 1999; Hou and. Jia, 2004). Here, we report a protocol for plant regenera- tion from embryogenic cell suspension culture of endemic. A. chrysochlorus.

  19. Spontaneous calcium waves in granule cells in cerebellar slice cultures

    DEFF Research Database (Denmark)

    Apuschkin, Mia; Ougaard, Maria; Rekling, Jens C

    2013-01-01

    with MK-801. Whole-cell recordings during wave formation showed cyclic EPSP barrages with an amplitude of 10-20 mV concurrent with wave activity. Local non-propagating putative transglial waves were also present in the cultures, and could be reproduced by pressure application of ATP. We hypothesize...

  20. Plant Cell Cultures as Source of Cosmetic Active Ingredients

    Directory of Open Access Journals (Sweden)

    Ani Barbulova

    2014-04-01

    Full Text Available The last decades witnessed a great demand of natural remedies. As a result, medicinal plants have been increasingly cultivated on a commercial scale, but the yield, the productive quality and the safety have not always been satisfactory. Plant cell cultures provide useful alternatives for the production of active ingredients for biomedical and cosmetic uses, since they represent standardized, contaminant-free and biosustainable systems, which allow the production of desired compounds on an industrial scale. Moreover, thanks to their totipotency, plant cells grown as liquid suspension cultures can be used as “biofactories” for the production of commercially interesting secondary metabolites, which are in many cases synthesized in low amounts in plant tissues and differentially distributed in the plant organs, such as roots, leaves, flowers or fruits. Although it is very widespread in the pharmaceutical industry, plant cell culture technology is not yet very common in the cosmetic field. The aim of the present review is to focus on the successful research accomplishments in the development of plant cell cultures for the production of active ingredients for cosmetic applications.

  1. Establishment of the callus and cell suspension culture of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-05

    Oct 5, 2009 ... The objective of this work was the optimization of the conditions of callus and cell suspension culture of Elaeagnus angustifolia for the production of condensed tannins. The effects of different conditions on the callus growth and the production of condensed tannins were researched. The leaf tissue part of.

  2. Establishment of sorghum cell suspension culture system for ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-03-18

    Mar 18, 2008 ... Key words: Sorghum, proteomics, callus, cell suspension cultures, total soluble protein, secretome. INTRODUCTION. Sorghum, a cereal crop native to Africa, is drought- tolerant, surviving periods of water deficit (Rosenow et al., 1983). The crop is grown in the semi-arid regions of. Africa and Asia primarily ...

  3. Test chambers for cell culture in static magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Glinka, Marek, E-mail: mag@iq.pl [Research and Development Centre of Electrical Machines. 188 Rozdzienskiego Street, 40-203 Katowice (Poland); Gawron, Stanisław, E-mail: s.gawron@komel.katowice.pl [Research and Development Centre of Electrical Machines. 188 Rozdzienskiego Street, 40-203 Katowice (Poland); Sieroń, Aleksander, E-mail: sieron1@tlen.pl [Department of Internal Diseases, Angiology and Physical Medicine in Bytom. Medical University of Silesia in Katowice. 15 Batorego Street, 41-902 Bytom (Poland); Pawłowska–Góral, Katarzyna, E-mail: kgoral@sum.edu.pl [Department of Food and Nutrition in Sosnowiec. Medical University of Silesia in Katowice. 8 Jednosci Street, 41-200 Sosnowiec (Poland); Cieślar, Grzegorz, E-mail: cieslar1@tlen.pl [Department of Internal Diseases, Angiology and Physical Medicine in Bytom. Medical University of Silesia in Katowice. 15 Batorego Street, 41-902 Bytom (Poland); Sieroń–Stołtny, Karolina [Department of Internal Diseases, Angiology and Physical Medicine in Bytom. Medical University of Silesia in Katowice. 15 Batorego Street, 41-902 Bytom (Poland)

    2013-04-15

    Article presents a test chamber intended to be used for in vitro cell culture in homogenous constant magnetic field with parametrically variable magnitude. We constructed test chambers with constant parameters of control homeostasis of cell culture for the different parameters of static magnetic field. The next step was the computer calculation of 2D and 3D simulation of the static magnetic field distribution in the chamber. The analysis of 2D and 3D calculations of magnetic induction in the cells' exposition plane reveals, in comparison to the detection results, the greater accuracy of 2D calculations (Figs. 9 and 10). The divergence in 2D method was 2–4% and 8 to 10% in 3D method (reaching 10% only out of the cells′ cultures margins). -- Highlights: ► We present test chamber to be used for in vitro cell culture in static magnetic field. ► The technical data of the chamber construction was presented. ► 2D versus 3D simulation of static magnetic field distribution in chamber was reported. ► We report the accuracy of 2D calculation than 3D.

  4. Establishment of the callus and cell suspension culture of ...

    African Journals Online (AJOL)

    The objective of this work was the optimization of the conditions of callus and cell suspension culture of Elaeagnus angustifolia for the production of condensed tannins. The effects of different conditions on the callus growth and the production of condensed tannins were researched. The leaf tissue part of E. angustifolia was ...

  5. Chloride secretion by cultures of pig tracheal gland cells

    Science.gov (United States)

    Borthwell, Rachel M.; Hajighasemi-Ossareh, Mohammad; Lachowicz-Scroggins, Marrah E.; Finkbeiner, W. E.; Stevens, Jeremy E.; Modlin, Sara

    2012-01-01

    Malfunction of airway submucosal glands contributes to the pathology of cystic fibrosis (CF), and cell cultures of CF human airway glands show defects in Cl− and water transport. Recently, a transgenic pig model of CF (the CF pig) has been developed. Accordingly, we have developed cell cultures of pig airway gland epithelium for use in investigating alterations in gland function in CF. Our cultures form tight junctions (as evidenced by high transepithelial electrical resistance) and show high levels of active anion secretion (measured as amiloride-insensitive short-circuit current). In agreement with recent results on human airway glands, neurohumoral agents that elevate intracellular Ca2+ potently stimulated anion secretion, while elevation of cAMP was comparatively ineffective. Our cultures express lactoferrin and lysozyme (serous gland cell markers) and MUC5B (the main mucin of airway glands). They are, therefore, potentially useful in determining if CF-related alterations in anion transport result in altered secretion of serous cell antimicrobial agents or mucus. PMID:22367783

  6. [Colorectal cancer: tissutal explantation and primary cell culture].

    Science.gov (United States)

    Spisni, Roberto; Failli, Alessandra; Orsini, Giulia; Kastsiuchenka, Olga; Natale, Gianfranco; Castagna, Maura; Legitimo, Annalisa; Aghasbabyan, Alekandr; Ambrosini, Carlo Enrico; Consolini, Rita; Miccoli, Paolo

    2009-01-01

    Setting of cellular cultures extracted from colorectal cancer tissue represents a valid model for in vitro study of biological and molecular characteristics of each single tumor finalized to obtain a tailored chemiotherapy. The end point of this study is to create primary cellular cultures from "fresh" cancer tissue in different stages of evolution. Cancer tissue samples are obtained by means of surgical excisional biopsy or by means of semi-automatic biopsy instrument (Sprig-Cut). After having compared different approaches, two experimental protocols have been selected to have the highest number or intact cells: enzimatic digestion with trypsin and explantation. Primary cell culture free of microbic contamination, obtained mainly by means of Spring-Cut methods, underwent immunohistochemical analysis to evaluate what kind of cell have been grown in vitro by measuring the expression of CK20 and GFAP both resulted positive. The possibility of setting a primary cell culture which represents the cancer of each patient allows a pharmacologic and biomolecular study which can contribute to the development of a tailored adjuvant therapy with many advantages for the patient in terms of positive answer to the treatment and reduced toxicity.

  7. Disposable Bioreactors for Plant Micropropagation and Mass Plant Cell Culture

    Science.gov (United States)

    Ducos, Jean-Paul; Terrier, Bénédicte; Courtois, Didier

    Different types of bioreactors are used at Nestlé R&D Centre - Tours for mass propagation of selected plant varieties by somatic embryogenesis and for large scale culture of plants cells to produce metabolites or recombinant proteins. Recent studies have been directed to cut down the production costs of these two processes by developing disposable cell culture systems. Vegetative propagation of elite plant varieties is achieved through somatic embryogenesis in liquid medium. A pilot scale process has recently been set up for the industrial propagation of Coffea canephora (Robusta coffee). The current production capacity is 3.0 million embryos per year. The pre-germination of the embryos was previously conducted by temporary immersion in liquid medium in 10-L glass bioreactors. An improved process has been developed using a 10-L disposable bioreactor consisting of a bag containing a rigid plastic box ('Box-in-Bag' bioreactor), insuring, amongst other advantages, a higher light transmittance to the biomass due to its horizontal design. For large scale cell culture, two novel flexible plastic-based disposable bioreactors have been developed from 10 to 100 L working volumes, validated with several plant species ('Wave and Undertow' and 'Slug Bubble' bioreactors). The advantages and the limits of these new types of bioreactor are discussed, based mainly on our own experience on coffee somatic embryogenesis and mass cell culture of soya and tobacco.

  8. CYTOTOXICITY TESTING OF WOUND DRESSINGS USING METHYLCELLULOSE CELL-CULTURE

    NARCIS (Netherlands)

    VANLUYN, MJA; VANWACHEM, PB; NIEUWENHUIS, P; JONKMAN, MF

    1992-01-01

    Wound dressings may induce cytotoxic effects. In this study, we check several, mostly commercially available, wound dressings for cytotoxicity. We used our previously described, newly developed and highly sensitive 7 d methylcellulose cell culture with fibroblasts as the test system. Cytotoxicity is

  9. Lethal impacts of cigarette smoke in cultured tobacco cells

    Directory of Open Access Journals (Sweden)

    Kawano Tomonori

    2011-07-01

    Full Text Available Abstract Background In order to understand and generalize the toxic mechanism of cigarette smoke in living cells, comparison of the data between animal systems and other biological system such as microbial and plant systems is highly beneficial. Objective By employing the tobacco cells as model materials for cigarette smoke toxicity assay, the impacts of the combustion by-products such as nitrogen oxides could be highlighted as the toxic impacts of the plant-derived endogenous chemicals could be excluded in the plant cells. Methods Cigarette smoke-induced cell death was assessed in tobacco cell suspension cultures in the presence and absence of pharmacological inhibitors. Results Cigarette smoke was effective in induction of cell death. The smoke-induced cell death could be partially prevented by addition of nitric oxide (NO scavenger, suggesting the role for NO as the cell death mediator. Addition of NO donor to tobacco cells also resulted in development of partial cell death further confirming the role of NO as cell death mediator. Members of reactive oxygen species and calcium ion were shown to be protecting the cells from the toxic action of smoke-derived NO.

  10. Mefloquine damage vestibular hair cells in organotypic cultures.

    Science.gov (United States)

    Yu, Dongzhen; Ding, Dalian; Jiang, Haiyan; Stolzberg, Daniel; Salvi, Richard

    2011-07-01

    Mefloquine is an effective and widely used anti-malarial drug; however, some clinical reports suggest that it can cause dizziness, balance, and vestibular disturbances. To determine if mefloquine might be toxic to the vestibular system, we applied mefloquine to organotypic cultures of the macula of the utricle from postnatal day 3 rats. The macula of the utricle was micro-dissected out as a flat surface preparation and cultured with 10, 50, 100, or 200 μM mefloquine for 24 h. Specimens were stained with TRITC-conjugated phalloidin to label the actin in hair cell stereocilia and TO-PRO-3 to visualize cell nuclei. Some utricles were also labeled with fluorogenic caspase-3, -8, or -9 indicators to evaluate the mechanism of programmed cell death. Mefloquine treatment caused a dose-dependent loss of utricular hair cells. Treatment with 10 μM caused a slight reduction, 50 μM caused a significant reduction, and 200 μM destroyed nearly all the hair cells. Hair cell nuclei in mefloquine-treated utricles were condensed and fragmented, morphological features of apoptosis. Mefloquine-treated utricles were positive for the extrinsic initiator caspase-8 and intrinsic initiator caspase-9 and downstream executioner caspase-3. These results indicate that mefloquine can induce significant hair cell degeneration in the postnatal rat utricle and that mefloquine-induced hair cell death is initiated by both caspase-8 and caspase-9.

  11. Ultrastructure of cells of Ulmus americana cultured in vitro and exposed to the culture filtrate of Ceratocystis ulmi

    Science.gov (United States)

    Paula M. Pijut; R. Daniel Lineberger; Subhash C. Domir; Jann M. Ichida; Charles R. Krause

    1990-01-01

    Calli of American elm susceptible and resistant to Dutch elm disease were exposed to a culture filtrate of a pathogenic isolate of Ceratocystis ulmi. Cells from untreated tissue exhibited typical internal composition associated with healthy, actively growing cells. All cells exposed to culture filtrate showed appreciable ultrastructural changes....

  12. Differential heat shock response of primary human cell cultures and established cell lines

    DEFF Research Database (Denmark)

    Richter, W W; Issinger, O G

    1986-01-01

    degrees C treatment, whereas in immortalized cell lines usually 90% of the cells were found in suspension. Enhanced expression of the major heat shock protein (hsp 70) was found in all heat-treated cells. In contrast to the primary cell cultures, established and transformed cell lines synthesized...... a protein with an apparent molecular mass of 70 kDa and an isoelectric pH of 7.0 as early as 3 h after the initial hyperthermal treatment....

  13. Morphological differences between circulating tumor cells from prostate cancer patients and cultured prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Sunyoung Park

    Full Text Available Circulating tumor cell (CTC enumeration promises to be an important predictor of clinical outcome for a range of cancers. Established CTC enumeration methods primarily rely on affinity capture of cell surface antigens, and have been criticized for underestimation of CTC numbers due to antigenic bias. Emerging CTC capture strategies typically distinguish these cells based on their assumed biomechanical characteristics, which are often validated using cultured cancer cells. In this study, we developed a software tool to investigate the morphological properties of CTCs from patients with castrate resistant prostate cancer and cultured prostate cancer cells in order to establish whether the latter is an appropriate model for the former. We isolated both CTCs and cultured cancer cells from whole blood using the CellSearch® system and examined various cytomorphological characteristics. In contrast with cultured cancer cells, CTCs enriched by CellSearch® system were found to have significantly smaller size, larger nuclear-cytoplasmic ratio, and more elongated shape. These CTCs were also found to exhibit significantly more variability than cultured cancer cells in nuclear-cytoplasmic ratio and shape profile.

  14. The presence of pMRC01 promotes greater cell permeability and autolysis in lactococcal starter cultures.

    Science.gov (United States)

    Fallico, Vincenzo; McAuliffe, Olivia; Fitzgerald, Gerald F; Hill, Colin; Ross, R Paul

    2009-08-15

    Conjugative transfer of plasmid-associated properties is routinely used to generate food-grade derivatives of lactococcal starter strains with improved technological traits. However, the introduction of one or more plasmids in a single strain is likely to impose a burden on regular cell metabolism and may affect the growth characteristics of the transconjugant culture. The aim of this study was to evaluate the impact of the 60.2-kb plasmid pMRC01 (encoding for an abortive infection bacteriophage resistance system and production of the anti-microbial, lacticin 3147) on starter performance. Five lactococcal strains (L. lactis HP, 255A, SK1, 712 and IL1403) and their pMRC01-containing derivatives were compared in terms of technological properties, including analysis of growth, acidification and autolysis rates. The transconjugants exhibited lower specific growth rates and higher generation times compared to the parental strains when grown at 30 degrees C in glucose-M17, but the presence of pMRC01 did not significantly affect the acidification capacity of strains in 11% reconstituted skimmed milk and synthetic media. Levels of lactate dehydrogenase were two-fold higher in supernatants of transconjugants than in those of parental strains, after 24 and 72 h of growth at 30 degrees C in glucose-M17, suggesting that the presence of pMRC01 somehow accelerates and promotes cellular autolysis. Analysis by flow cytometry following live/dead staining confirmed this result by showing larger populations of injured and dead cells in pMRC01-carrying cultures compared to the parental strains. The results of this study reveal that the plasmid pMRC01 places a burden on lactococcal host metabolism, which is associated with an increased cell permeability and autolysis, without significantly affecting the acidification capacity of the starter. While the magnitude of these effects appears to be strain dependent, the production of the bacteriocin lacticin 3147 may not be involved.

  15. Rapid Detection of Apoptosis in Cultured Mammalian Cells.

    Science.gov (United States)

    Kudryavtsev, Igor; Serebryakova, Maria; Solovjeva, Liudmila; Svetlova, Maria; Firsanov, Denis

    2017-01-01

    Flow cytometry is a powerful tool for the analysis of apoptosis, the process that directly determines cell fate after the action of different stresses. Here, we describe a flow cytometry method for the assessment of early and late stages of apoptosis in non-fixed cultured cells using SYTO16, DRAQ7, and PO-PRO1 dyes simultaneously. This multicolor flow cytometry procedure requires 45 min for completion and provides a quantitative assessment of cell viability. It can be useful in evaluating the cytotoxic properties of new drugs, and antitumor interventions.

  16. 76 FR 51374 - Direct Discovery of HLA Associated Influenza Epitopes Isolated From Human Cells for Vaccine and...

    Science.gov (United States)

    2011-08-18

    ..., MD 20892, Telephone: 301-827-0793; E-mail: [email protected] . For Financial and... requires extensive infrastructure for growing cells, purifying HLA from culture supernatants, and for mass... allow FDA to acquire the proteomic expertise, training, and tissue culture support to establish a...

  17. Identifying developmental toxicity pathways for a subset of ToxCast chemicals using human embryonic stem cells and metabolomics

    Science.gov (United States)

    Metabolomics analysis was performed on the supernatant of human embryonic stem (hES) cell cultures exposed to a blinded subset of 11 chemicals selected from the chemical library of EPA's ToxCast™ chemical screening and prioritization research project. Metabolites from hES cultur...

  18. Effect of Micro Ridges on Orientation of Cultured Cell

    Directory of Open Access Journals (Sweden)

    Haruka Hino

    2014-06-01

    Full Text Available The effect of micro ridges on orientation of cultured cells has been studied in vitro. Several patterns of micro ridges have been fabricated on a transparent polydimethylsiloxane disk with the photo lithography technique. The ridges consist of several lines of rectangular column: the width of 0.003 mm, the interval of 0.007 mm. Variation has been made on the height of the ridge between 0.0003 mm and 0.0035 mm. C2C12 (mouse myoblast cell line originated with cross-striated muscle of C3H mouse was cultured on the disk with the micro ridges for one week and was observed with an inverted phase contrast microscope. The experimental results show that cells adhere on the top of the ridge and align to the longitudinal direction of the micro ridges with the height between 0.0015 mm and 0.0025 mm.

  19. Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models

    Science.gov (United States)

    Marquette, Michele L.; Sognier, Marguerite A.

    2013-01-01

    An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.

  20. Plant cell tissue culture: A potential source of chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Scott, C.D.; Dougall, D.K.

    1987-08-01

    Higher plants produce many industrially important products. Among these are drugs and medicinal chemicals, essential oils and flavors, vegetable oils and fats, fine and specialty chemicals, and even some commodity chemicals. Although, currently, whole-plant extraction is the primary means of harvesting these materials, the advent of plant cell tissue culture could be a much more effective method of producing many types of phytochemicals. The use of immobilized plant cells in an advanced bioreactor configuration with excretion of the product into the reactor medium may represent the most straightforward way of commercializing such techniques for lower-value chemicals. Important research and development opportunities in this area include screening for plant cultures for nonmedical, lower-value chemicals; understanding and controlling plant cell physiology and biochemistry; optimizing effective immobilization methods; developing more efficient bioreactor concepts; and perfecting product extraction and purification techniques. 62 refs., 2 figs.

  1. PDMS/glass microfluidic cell culture system for cytotoxicity tests and cells passage

    DEFF Research Database (Denmark)

    Ziolkowska, K.; Jedrych, E.; Kwapiszewski, R.

    2010-01-01

    In this paper, hybrid (PDMS/glass) microfluidic cell culture system (MCCS) integrated with the concentration gradient generator (CGG) is presented. PDMS gas permeability enabled cells' respiration in the fabricated microdevices and excellent glass hydrophilicity allowed successful cells' seeding......' bioactivity, defining the lowest toxic level of tested substances etc....

  2. Adenosine formation in contracting primary rat skeletal muscle cells and endothelial cells in culture

    DEFF Research Database (Denmark)

    Hellsten, Ylva; Frandsen, Ulrik

    1997-01-01

    1. The present study examined the capacity for adenosine formation, uptake and metabolism in contracting primary rat muscle cells and in microvascular endothelial cells in culture. 2. Strong and moderate electrical simulation of skeletal muscle cells led to a significantly greater increase...

  3. Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions.

    Science.gov (United States)

    Kaji, Hirokazu; Camci-Unal, Gulden; Langer, Robert; Khademhosseini, Ali

    2011-03-01

    Inside the body, cells lie in direct contact or in close proximity to other cell types in a tightly controlled architecture that often regulates the resulting tissue function. Therefore, tissue engineering constructs that aim to reproduce the architecture and the geometry of tissues will benefit from methods of controlling cell-cell interactions with microscale resolution. We discuss the use of microfabrication technologies for generating patterned co-cultures. In addition, we categorize patterned co-culture systems by cell type and discuss the implications of regulating cell-cell interactions in the resulting biological function of the tissues. Patterned co-cultures are a useful tool for fabricating tissue engineered constructs and for studying cell-cell interactions in vitro, because they can be used to control the degree of homotypic and heterotypic cell-cell contact. In addition, this approach can be manipulated to elucidate important factors involved in cell-matrix interactions. Patterned co-culture strategies hold significant potential to develop biomimetic structures for tissue engineering. It is expected that they would create opportunities to develop artificial tissues in the future. This article is part of a Special Issue entitled Nanotechnologies - Emerging Applications in Biomedicine. 2010 Elsevier B.V. All rights reserved.

  4. MEMS-based dynamic cell-to-cell culture platforms using electrochemical surface modifications

    International Nuclear Information System (INIS)

    Chang, Jiyoung; Lin, Liwei; Yoon, Sang-Hee; Mofrad, Mohammad R K

    2011-01-01

    MEMS-based biological platforms with the capability of both spatial placements and time releases of living cells for cell-to-cell culture experiments have been designed and demonstrated utilizing electrochemical surface modification effects. The spatial placement is accomplished by electrochemical surface modification of substrate surfaces to be either adhesive or non-adhesive for living cells. The time control is achieved by the electrical activation of the selective indium tin oxide co-culture electrode to allow the migration of living cells onto the electrode to start the cell-to-cell culture studies. Prototype devices have a three-electrode design with an electrode size of 50 × 50 µm 2 and the separation gaps of 2 µm between them. An electrical voltage of −1.5 V has been used to activate the electrodes independently and sequentially to demonstrate the dynamic cell-to-cell culture experiments of NIH 3T3 fibroblast and Madin Darby canine kidney cells. As such, this MEMS platform could be a basic yet versatile tool to characterize transient cell-to-cell interactions

  5. Cell Migration in Tissues: Explant Culture and Live Imaging.

    Science.gov (United States)

    Staneva, Ralitza; Barbazan, Jorge; Simon, Anthony; Vignjevic, Danijela Matic; Krndija, Denis

    2018-01-01

    Cell migration is a process that ensures correct cell localization and function in development and homeostasis. In disease such as cancer, cells acquire an upregulated migratory capacity that leads to their dissemination throughout the body. Live imaging of cell migration allows for better understanding of cell behaviors in development, adult tissue homeostasis and disease. We have optimized live imaging procedures to track cell migration in adult murine tissue explants derived from: (1) healthy gut; (2) primary intestinal carcinoma; and (3) the liver, a common metastatic site. To track epithelial cell migration in the gut, we generated an inducible fluorescent reporter mouse, enabling us to visualize and track individual cells in unperturbed gut epithelium. To image intratumoral cancer cells, we use a spontaneous intestinal cancer model based on the activation of Notch1 and deletion of p53 in the mouse intestinal epithelium, which gives rise to aggressive carcinoma. Interaction of cancer cells with a metastatic niche, the mouse liver, is addressed using a liver colonization model. In summary, we describe a method for long-term 3D imaging of tissue explants by two-photon excitation microscopy. Explant culturing and imaging can help understand dynamic behavior of cells in homeostasis and disease, and would be applicable to various tissues.

  6. Maxisorp RAST. A sensitive method for detection of antigen-specific human IgE in culture fluids

    DEFF Research Database (Denmark)

    Poulsen, L K; Pedersen, M F; Malling, H J

    1989-01-01

    For determination of allergen-specific IgE in cell culture supernatants and other highly diluted IgE preparations a radioallergosorbent test (RAST) based on high adsorption polystyrene test tubes has been developed ("Maxisorp RAST"). Cladosporium herbarum extract was used as a model allergen...

  7. Three-dimensional cell culture model utilization in cancer stem cell research.

    Science.gov (United States)

    Bielecka, Zofia F; Maliszewska-Olejniczak, Kamila; Safir, Ilan J; Szczylik, Cezary; Czarnecka, Anna M

    2017-08-01

    Three-dimensional (3D) cell culture models are becoming increasingly popular in contemporary cancer research and drug resistance studies. Recently, scientists have begun incorporating cancer stem cells (CSCs) into 3D models and modifying culture components in order to mimic in vivo conditions better. Currently, the global cell culture market is primarily focused on either 3D cancer cell cultures or stem cell cultures, with less focus on CSCs. This is evident in the low product availability officially indicated for 3D CSC model research. This review discusses the currently available commercial products for CSC 3D culture model research. Additionally, we discuss different culture media and components that result in higher levels of stem cell subpopulations while better recreating the tumor microenvironment. In summary, although progress has been made applying 3D technology to CSC research, this technology could be further utilized and a greater number of 3D kits dedicated specifically to CSCs should be implemented. © 2016 The Authors. Biological Reviews published by John Wiley & Sons Ltd on behalf of Cambridge Philosophical Society.

  8. [The effect of Solcoseryl on in-vitro cultured cells].

    Science.gov (United States)

    Lindner, G; Grosse, G; Lehmann, A

    1977-01-01

    Explants of peripherical nervous system (PNS), skin and ventriculus cordis from chick embryo were cultivated in Maximow chambers and the effect of Solcoseryl, Fa. Solco Basel AG, on some morphological parameters was tested. 1. The growth of tissue cultures is influenced by Solcoseryl in relation to concentration and time of application. The index of area in cultures of PNS and cor increased within the first days. By long time application up to 6 days in vitro the index of area decreased and the index was the same than in controls. Explants of skin showed no essential stimulation of growth. 2. The number of cells per unit of culture in the outgrowth of PNS, cor and skin was different influenced. The density of cells in cultures of PNS and skin decreased (signif. difference). In explants of heart we could not observe a difference between the inside and outside of the outgrowth. An influence of Solcoseryl on the degree of migration is discussed. 3. The area of cell nuclei from heartcells was observed. The area decreased under the influence of Solcoseryl. The difference is significant. 4. The mitotic index of heart cells increased by application of Solcoseryl within the first 2 and 3 days in vitro. 5. The number of nucleoli per nucleus of heart cells under experimental conditions increased significant. It is discussed, Solcoseryl influenced in vitro metabolic processes in suitable systems; stimulation of cell proliferation and migration and rns-synthesis was observed within the first days of cultivation. In-vitro-systems are important objects and they are suitable for tests of pharmaca in vitro.

  9. Viral antigen production in cell cultures on microcarriers Bovine parainfluenza 3 virus and MDBK cells.

    Science.gov (United States)

    Conceição, M M; Tonso, A; Freitas, C B; Pereira, C A

    2007-11-07

    Viral antigens can be obtained from infected mammalian cells cultivated on microcarriers. We have worked out parameters for the production of bovine parainfluenza 3 (PI-3) virus by Mandin-Darby Bovine Kidney (MDBK) cells cultivated on Cytodex 1 microcarriers (MCs) in spinners flasks and bioreactor using fetal bovine serum (FBS) supplemented Eagle minimal essential medium (Eagle-MEM). Medium renewal during the cell culture was shown to be crucial for optimal MCs loading (>90% MCs with confluent cell monolayers) and cell growth (2.5 x 10(6)cells/mL and a micro(x) (h(-1)) 0.05). Since cell cultures performed with lower amount of MCs (1g/L), showed good performances in terms of cell loading, we designed batch experiments with a lower concentration of MCs in view of optimizing the cell growth and virus production. Studies of cell growth with lower concentrations of MCs (0.85 g/L) showed that an increase in the initial cell seeding (from 7 to 40 cells/MC) led to a different kinetic of initial cell growth but to comparable final cell concentrations ((8-10)x10(5)cells/mL at 120 h) and cell loading (210-270 cells/MC). Upon infection with PI-3 virus, cultures showed a decrease in cell growth and MC loading directly related to the multiplicity of infection (moi) used for virus infection. Infected cultures showed also a higher consumption of glucose and production of lactate. The PI-3 virus and PI-3 antigen production among the cultures was not significantly different and attained values ranging from, respectively, 7-9 log(10) TCID(50)/mL and 1.5-2.2 OD. The kinetics of PI-3 virus production showed a sharp increase during the first 24h and those of PI-3 antigen increased after 24h. The differential kinetics of PI-3 virus and PI-3 antigen can be explained by the virus sensitivity to temperature. In view of establishing a protocol of virus production and based on the previous experiments, MDBK cell cultures performed under medium perfusion in a bioreactor of 1.2L were infected

  10. Characterizing parameters of Jatropha curcas cell cultures for microgravity studies

    Science.gov (United States)

    Vendrame, Wagner A.; Pinares, Ania

    2013-06-01

    Jatropha (Jatropha curcas) is a tropical perennial species identified as a potential biofuel crop. The oil is of excellent quality and it has been successfully tested as biodiesel and in jet fuel mixes. However, studies on breeding and genetic improvement of jatropha are limited. Space offers a unique environment for experiments aiming at the assessment of mutations and differential gene expression of crops and in vitro cultures of plants are convenient for studies of genetic variation as affected by microgravity. However, before microgravity studies can be successfully performed, pre-flight experiments are necessary to characterize plant material and validate flight hardware environmental conditions. Such preliminary studies set the ground for subsequent spaceflight experiments. The objectives of this study were to compare the in vitro growth of cultures from three explant sources (cotyledon, leaf, and stem sections) of three jatropha accessions (Brazil, India, and Tanzania) outside and inside the petriGAP, a modified group activation pack (GAP) flight hardware to fit petri dishes. In vitro jatropha cell cultures were established in petri dishes containing a modified MS medium and maintained in a plant growth chamber at 25 ± 2 °C in the dark. Parameters evaluated were surface area of the explant tissue (A), fresh weight (FW), and dry weight (DW) for a period of 12 weeks. Growth was observed for cultures from all accessions at week 12, including subsequent plantlet regeneration. For all accessions differences in A, FW and DW were observed for inside vs. outside the PetriGAPs. Growth parameters were affected by accession (genotype), explant type, and environment. The type of explant influenced the type of cell growth and subsequent plantlet regeneration capacity. However, overall cell growth showed no abnormalities. The present study demonstrated that jatropha in vitro cell cultures are suitable for growth inside PetriGAPs for a period of 12 weeks. The parameters

  11. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  12. Co-culture with Sertoli cells promotes proliferation and migration of umbilical cord mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Fenxi, E-mail: fxzhang0824@gmail.com [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Hong, Yan; Liang, Wenmei [Department of Histology and Embryology, Guiyang Medical University, Guizhou 550004, People' s Republic of China (China); Ren, Tongming [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Jing, Suhua [ICU Center, The Third Hospital of Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Lin, Juntang [Stem Cell Center, Xinxiang Medical University, Henan 453003, People' s Republic of China (China)

    2012-10-12

    Highlights: Black-Right-Pointing-Pointer Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). Black-Right-Pointing-Pointer Presence of SCs dramatically increased proliferation and migration of UCMSCs. Black-Right-Pointing-Pointer Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of 'nurse' cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.

  13. Co-culture with Sertoli cells promotes proliferation and migration of umbilical cord mesenchymal stem cells

    International Nuclear Information System (INIS)

    Zhang, Fenxi; Hong, Yan; Liang, Wenmei; Ren, Tongming; Jing, Suhua; Lin, Juntang

    2012-01-01

    Highlights: ► Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). ► Presence of SCs dramatically increased proliferation and migration of UCMSCs. ► Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of “nurse” cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.

  14. Endothelial cells stimulate growth of normal and cancerous breast epithelial cells in 3D culture

    Directory of Open Access Journals (Sweden)

    Magnusson Magnus K

    2010-07-01

    Full Text Available Abstract Background Epithelial-stromal interaction provides regulatory signals that maintain correct histoarchitecture and homeostasis in the normal breast and facilitates tumor progression in breast cancer. However, research on the regulatory role of the endothelial component in the normal and malignant breast gland has largely been neglected. The aim of the study was to investigate the effects of endothelial cells on growth and differentiation of human breast epithelial cells in a three-dimensional (3D co-culture assay. Methods Breast luminal and myoepithelial cells and endothelial cells were isolated from reduction mammoplasties. Primary cells and established normal and malignant breast cell lines were embedded in reconstituted basement membrane in direct co-culture with endothelial cells and by separation of Transwell filters. Morphogenic and phenotypic profiles of co-cultures was evaluated by phase contrast microscopy, immunostaining and confocal microscopy. Results In co-culture, endothelial cells stimulate proliferation of both luminal- and myoepithelial cells. Furthermore, endothelial cells induce a subpopulation of luminal epithelial cells to form large acini/ducts with a large and clear lumen. Endothelial cells also stimulate growth and cloning efficiency of normal and malignant breast epithelial cell lines. Transwell and gradient co-culture studies show that endothelial derived effects are mediated - at least partially - by soluble factors. Conclusion Breast endothelial cells - beside their role in transporting nutrients and oxygen to tissues - are vital component of the epithelial microenvironment in the breast and provide proliferative signals to the normal and malignant breast epithelium. These growth promoting effects of endothelial cells should be taken into consideration in breast cancer biology.

  15. The assessment of cytokines in Quantiferon supernatants for the diagnosis of latent TB infection in a tribal population of Melghat, India.

    Science.gov (United States)

    Bapat, Prachi R; Husain, Aliabbas A; Daginawala, Hatim F; Agrawal, Neha P; Panchbhai, Milind S; Satav, Ashish R; Taori, Girdhar M; Kashyap, Rajpal S

    2015-01-01

    The tuberculin skin test (TST) and interferon-gamma release assays (IGRA), namely, the QuantiFERON-TB Gold test (QFT), remain the standard immunological diagnostic tools for latent tuberculosis (TB) infection (LTBI). However, the sub-optimal detection rates of both of these tests are major impediments in recognizing the population at risk. This study was aimed at evaluating additional cytokines besides interferon-gamma (IFN-γ) as biomarkers for improving LTBI diagnosis in the tribal population of Melghat, India. Seventy-four close TB contacts were stratified by QFT and TST results into: (i) QFT+/TST+ (n = 26), (ii) QFT+/TST- (n = 12), (iii) QFT-/TST- (n = 35) and (iv) QFT-/TST+ (n = 1) groups. A panel of cytokines (IL-6, IL-10, TNF-α and IL-2R) was then evaluated in antigen-stimulated QFT cell-free culture supernatants using IMMULITE-1000, an automated immunoassay analyzer. Cytokine estimation showed significantly higher levels of IL-6 in the QFT+/TST+ group, while significantly higher levels of IL-10 were found in the QFT-/TST- group. Correlation analysis identified a positive correlation between IL-6 and the QFT response (r = 0.6723, P < 0.0001), while a negative correlation was seen between QFT and IL-10 expression (r = -0.3271, P = 0.0044). Similarly, IL-6 was positively correlated with TST levels (r = 0.6631, P <0 .0001), and conversely, a negative correlation was found between TST and IL-10 expression (r = -0.5698, P < 0.0001). The positive and negative predictive values of IL-6 were found to be 92.59 and 93.33%, respectively, and the positive and negative predictive values of IL-10 were 96.55 and 91.18%, respectively. No significant impact of the demographic characteristics on cytokine positivity was observed. Our preliminary results suggest that the evaluation of additional cytokines in QFT cell-free culture supernatants may be valuable for the identification of LTBI. Combining IL-6 and IL-10 with QFT and/or TST could markedly improve the detection

  16. A co-culture system with an organotypic lung slice and an immortal alveolar macrophage cell line to quantify silica-induced inflammation.

    Directory of Open Access Journals (Sweden)

    Falk Hofmann

    Full Text Available There is growing evidence that amorphous silica nanoparticles cause toxic effects on lung cells in vivo as well as in vitro and induce inflammatory processes. The phagocytosis of silica by alveolar macrophages potentiates these effects. To understand the underlying molecular mechanisms of silica toxicity, we applied a co-culture system including the immortal alveolar epithelial mouse cell line E10 and the macrophage cell line AMJ2-C11. In parallel we exposed precision-cut lung slices (lacking any blood cells as well as residual alveolar macrophages of wild type and P2rx7-/- mice with or without AMJ2-C11 cells to silica nanoparticles. Exposure of E10 cells as well as slices of wild type mice resulted in an increase of typical alveolar epithelial type 1 cell proteins like T1α, caveolin-1 and -2 and PKC-β1, whereas the co-culture with AMJ2-C11 showed mostly a slightly lesser increase of these proteins. In P2rx7-/- mice most of these proteins were slightly decreased. ELISA analysis of the supernatant of wild type and P2rx7-/- mice precision-cut lung slices showed decreased amounts of IL-6 and TNF-α when incubated with nano-silica. Our findings indicate that alveolar macrophages influence the early inflammation of the lung and also that cell damaging reagents e.g. silica have a smaller impact on P2rx7-/- mice than on wild type mice. The co-culture system with an organotypic lung slice is a useful tool to study the role of alveolar macrophages during lung injury at the organoid level.

  17. Radiation response of cultured human cells is unaffected by Johrei.

    Science.gov (United States)

    Hall, Zach; Luu, Tri; Moore, Dan; Yount, Garret

    2007-06-01

    Johrei has been credited with healing thousands from radiation wounds after the Hiroshima and Nagasaki bombs in 1945. This alternative medical therapy is becoming increasingly popular in the United States, as are other Energy Medicine modalities that purport to influence a universal healing energy. Human brain cells were cultured and exposed to increasing doses of ionizing radiation. Experienced Johrei practitioners directed healing intentionality toward the cells for 30 min from a distance of 20 cm and the fate of the cells was observed by computerized time-lapse microscopy. Cell death and cell divisions were tallied every 30 min before, during and after Johrei treatment for a total of 22.5 h. An equal number of control experiments were conducted in which cells were irradiated but did not receive Johrei treatment. Samples were assigned to treatment conditions randomly and data analysis was conducted in a blinded fashion. Radiation exposure decreased the rate of cell division (cell cycle arrest) in a dose-dependent manner. Division rates were estimated for each 30 min and averaged over 8 independent experiments (4 control and 4 with Johrei treatment) for each of 4 doses of X-rays (0, 2, 4 and 8 Gy). Because few cell deaths were observed, pooled data from the entire observation period were used to estimate death rates. Analysis of variance did not reveal any significant differences on division rate or death rate between treatment groups. Only radiation dose was statistically significant. We found no indication that the radiation response of cultured cells is affected by Johrei treatment.

  18. Radiation Response of Cultured Human Cells Is Unaffected by Johrei

    Directory of Open Access Journals (Sweden)

    Zach Hall

    2007-01-01

    Full Text Available Johrei has been credited with healing thousands from radiation wounds after the Hiroshima and Nagasaki bombs in 1945. This alternative medical therapy is becoming increasingly popular in the United States, as are other Energy Medicine modalities that purport to influence a universal healing energy. Human brain cells were cultured and exposed to increasing doses of ionizing radiation. Experienced Johrei practitioners directed healing intentionality toward the cells for 30 min from a distance of 20 cm and the fate of the cells was observed by computerized time-lapse microscopy. Cell death and cell divisions were tallied every 30 min before, during and after Johrei treatment for a total of 22.5 h. An equal number of control experiments were conducted in which cells were irradiated but did not receive Johrei treatment. Samples were assigned to treatment conditions randomly and data analysis was conducted in a blinded fashion. Radiation exposure decreased the rate of cell division (cell cycle arrest in a dose-dependent manner. Division rates were estimated for each 30 min and averaged over 8 independent experiments (4 control and 4 with Johrei treatment for each of 4 doses of X-rays (0, 2, 4 and 8 Gy. Because few cell deaths were observed, pooled data from the entire observation period were used to estimate death rates. Analysis of variance did not reveal any significant differences on division rate or death rate between treatment groups. Only radiation dose was statistically significant. We found no indication that the radiation response of cultured cells is affected by Johrei treatment.

  19. Effect of low dose laser on the chorioallantoic culture of retinal pigment cells

    International Nuclear Information System (INIS)

    Yew, D.T.; Lam, S.T.L.; Chan, Y.W.

    1982-01-01

    Low dose laser effects were analysed in chorioallantoic cultures of retinal pigment cells. Decrease in cell sizes and increase in number of mitosis were observed in the experimental cultures. On the other hand, pyknosis did not change significantly following irradiation. Most cells in the control and experimental cultures formed groups. However, 2 types of detached cells were evident. The percentage of detached cells was higher in the experimental culture. (Auth.)

  20. Scale-up of cell culture bioreactors using biomechatronic design.

    Science.gov (United States)

    Mandenius, Carl-Fredrik; Björkman, Mats

    2012-08-01

    Scale-up of cell culture bioreactors is a challenging engineering work that requires wide competence in cell biology, mechanical engineering and bioprocess design. In this article, a new approach for cell culture bioreactor scale-up is suggested that is based on biomechatronic design methodology. The approach differs from traditional biochemical engineering methodology by applying a sequential design procedure where the needs of the users and alternative design solutions are systematically analysed. The procedure is based on the biological and technical functions of the scaled-up bioreactor that are derived in functional maps, concept generation charts and scoring and interaction matrices. Basic reactor engineering properties, such as mass and heat transfer and kinetics are integrated in the procedure. The methodology results in the generation of alternative design solutions that are thoroughly ranked with help of the user needs. Examples from monoclonal antibodies and recombinant protein production illuminate the steps of the procedure. The methodology provides engineering teams with additional tools that can significantly facilitate the design of new production methods for cell culture processes. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. 3D Cell Culture Imaging with Digital Holographic Microscopy

    Science.gov (United States)

    Dimiduk, Thomas; Nyberg, Kendra; Almeda, Dariela; Koshelva, Ekaterina; McGorty, Ryan; Kaz, David; Gardel, Emily; Auguste, Debra; Manoharan, Vinothan

    2011-03-01

    Cells in higher organisms naturally exist in a three dimensional (3D) structure, a fact sometimes ignored by in vitro biological research. Confinement to a two dimensional culture imposes significant deviations from the native 3D state. One of the biggest obstacles to wider use of 3D cultures is the difficulty of 3D imaging. The confocal microscope, the dominant 3D imaging instrument, is expensive, bulky, and light-intensive; live cells can be observed for only a short time before they suffer photodamage. We present an alternative 3D imaging techinque, digital holographic microscopy, which can capture 3D information with axial resolution better than 2 μm in a 100 μm deep volume. Capturing a 3D image requires only a single camera exposure with a sub-millisecond laser pulse, allowing us to image cell cultures using five orders of magnitude less light energy than with confocal. This can be done with hardware costing ~ 1000. We use the instrument to image growth of MCF7 breast cancer cells and p. pastoras yeast. We acknowledge support from NSF GRFP.

  2. Individualized medicine for renal cell carcinoma: establishment of primary cell line culture from surgical specimens.

    Science.gov (United States)

    Kim, Fernando J; Campagna, Adriano; Khandrika, Lakshmipathi; Koul, Sweaty; Byun, Seok-Soo; vanBokhoven, Adrie; Moore, Ernest E; Koul, Hari

    2008-10-01

    The lack of effective "in vivo" and "in vitro" models to predict success of pharmacological therapy for patients with renal cell carcinoma, as well as, the variety of cancer cell types demands the development of better experimental models to understand the pathophysiology of the disease and evaluate drug sensitivity in vitro. To develop primary renal cancer cell culture irrespective of tumor grade and tumor type, harvested from the patient's pathological specimen immediately after the laparoscopic radical nephrectomy to study potential "in vivo" pharmacological sensitivity. A total of 24 patients (17 males and 7 females). Mean age of 63.1+/-3.1 y.o. The mean size of the renal masses was 7.56+/-3.1 cm. Normal and pathological renal tissue was collected immediately after the specimen was extracted and submitted to enzymatic digestion for 16-24 hours. Clear cell carcinoma cells were selected through multiple passages in DMEM medium supplemented with glucose and antibiotics. Establishment of cell line culture from all the patients' specimens irrespective of tumor grade and tumor type was achieved successfully. In addition to the tumor cell line culture, normal parenchyma tissue yielded primary cell lines to allow testing the response of tumor types to various pharmacological therapeutic agents and toxicity of such treatments to healthy tissue. From the initial collection of the specimens obtained after the removal of the kidney to the development of cell lines took occurred in average 32+6 hrs. The cells in culture showed characteristics of epithelial cells; like expression on cytokeratin and were maintained in culture for more than 20 passages. The development of renal cancer cell cultures in vitro is labor intense but may yield a more realistic model to tailor pharmacological therapies and predict therapeutic success prior to "in vivo" application-a step in the direction of individualized medicine for RCC.

  3. Cell division in Escherichia coli cultures monitored at single cell resolution

    Directory of Open Access Journals (Sweden)

    Luidalepp Hannes

    2008-04-01

    Full Text Available Abstract Background A fundamental characteristic of cells is the ability to divide. To date, most parameters of bacterial cultures, including cell division, have been measured as cell population averages, assuming that all bacteria divide at a uniform rate. Results We monitored the division of individual cells in Escherichia coli cultures during different growth phases. Our experiments are based on the dilution of green fluorescent protein (GFP upon cell division, monitored by flow cytometry. The results show that the vast majority of E. coli cells in exponentially growing cultures divided uniformly. In cultures that had been in stationary phase up to four days, no cell division was observed. However, upon dilution of stationary phase culture into fresh medium, two subpopulations of cells emerged: one that started dividing and another that did not. These populations were detectable by GFP dilution and displayed different side scatter parameters in flow cytometry. Further analysis showed that bacteria in the non-growing subpopulation were not dead, neither was the difference in growth capacity reducible to differences in stationary phase-specific gene expression since we observed uniform expression of several stress-related promoters. The presence of non-growing persisters, temporarily dormant bacteria that are tolerant to antibiotics, has previously been described within growing bacterial populations. Using the GFP dilution method combined with cell sorting, we showed that ampicillin lyses growing bacteria while non-growing bacteria retain viability and that some of them restart growth after the ampicillin is removed. Thus, our method enables persisters to be monitored even in liquid cultures of wild type strains in which persister formation has low frequency. Conclusion In principle, the approaches developed here could be used to detect differences in cell division in response to different environmental conditions and in cultures of unicellular

  4. Calcium exchange, structure, and function in cultured adult myocardial cells

    International Nuclear Information System (INIS)

    Langer, G.A.; Frank, J.S.; Rich, T.L.; Orner, F.B.

    1987-01-01

    Cells digested from adult rat heart and cultured for 14 days demonstrate all the structural elements, in mature form, associated with the process of excitation-contraction (EC) coupling. The transverse tubular (TT) system is well developed with an extensive junctional sarcoplasmic reticulum (JSR). In nonphosphate-containing buffer contraction of the cells is lost as rapidly as zero extracellular Ca concentration ([Ca] 0 ) solution is applied and a negative contraction staircase is produced on increase of stimulation frequency. Structurally and functionally the cells have the characteristics of adult cells in situ. 45 Ca exchange and total 45 Ca measurement in N-2-hydroxyethylpiperazine N'-2-ethanesulfonic acid (HEPES)-buffered perfusate define three components of cellular Ca: 1) a rapidly exchangeable component accounting for 36% of total Ca, 2) a slowly exchangeable component (t/sub 1/2/ 53 min) accounting for 7% total Ca, and 3) the remaining 57% cellular Ca is inexchangeable (demonstrates no significant exchange within 60 min). The slowly exchangeable component can be increased 10-fold within 60 min by addition of phosphate to the perfusate. The Ca distribution and exchange characteristics are little different from those of 3-day cultures of neonatal rat heart previously studied. The results suggest that the cells are representative of adult cells in situ and that both sarcolemmal-bound and sarcoplasmic reticular Ca contribute to the component of Ca that is rapidly exchangeable

  5. Biofunctionalized Plants as Diverse Biomaterials for Human Cell Culture.

    Science.gov (United States)

    Fontana, Gianluca; Gershlak, Joshua; Adamski, Michal; Lee, Jae-Sung; Matsumoto, Shion; Le, Hau D; Binder, Bernard; Wirth, John; Gaudette, Glenn; Murphy, William L

    2017-04-01

    The commercial success of tissue engineering products requires efficacy, cost effectiveness, and the possibility of scaleup. Advances in tissue engineering require increased sophistication in the design of biomaterials, often challenging the current manufacturing techniques. Interestingly, several of the properties that are desirable for biomaterial design are embodied in the structure and function of plants. This study demonstrates that decellularized plant tissues can be used as adaptable scaffolds for culture of human cells. With simple biofunctionalization technique, it is possible to enable adhesion of human cells on a diverse set of plant tissues. The elevated hydrophilicity and excellent water transport abilities of plant tissues allow cell expansion over prolonged periods of culture. Moreover, cells are able to conform to the microstructure of the plant frameworks, resulting in cell alignment and pattern registration. In conclusion, the current study shows that it is feasible to use plant tissues as an alternative feedstock of scaffolds for mammalian cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Single molecule microscopy in 3D cell cultures and tissues.

    Science.gov (United States)

    Lauer, Florian M; Kaemmerer, Elke; Meckel, Tobias

    2014-12-15

    From the onset of the first microscopic visualization of single fluorescent molecules in living cells at the beginning of this century, to the present, almost routine application of single molecule microscopy, the method has well-proven its ability to contribute unmatched detailed insight into the heterogeneous and dynamic molecular world life is composed of. Except for investigations on bacteria and yeast, almost the entire story of success is based on studies on adherent mammalian 2D cell cultures. However, despite this continuous progress, the technique was not able to keep pace with the move of the cell biology community to adapt 3D cell culture models for basic research, regenerative medicine, or drug development and screening. In this review, we will summarize the progress, which only recently allowed for the application of single molecule microscopy to 3D cell systems and give an overview of the technical advances that led to it. While initially posing a challenge, we finally conclude that relevant 3D cell models will become an integral part of the on-going success of single molecule microscopy. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Diffusion chamber culture of mouse bone marrow cells, (1)

    International Nuclear Information System (INIS)

    Sigeta, Chiharu; Tanaka, Kimio; Kawakami, Masahito; Takahashi, Hiroshi; Ohkita, Takeshi

    1980-01-01

    Mouse bone marrow cells were cultured in diffusion chambers (DC) implanted in the peritoneal cavity of host mice. Host mice were subjected to (1) irradiation ( 60 Co 800 rad) and/or (2) phenylhydrazine induced anemia and then receiving irradiation ( 60 Co 600 rad). After culture periods of 3-7 days, the total number of cells in DC was increased. A marked increase in DC is due to the proliferation of granulocyte series. When host mice were subjected to anemia and irradiation, the start of cell proliferation in DC was delay about two days. On the whole, anemia and irradiation host reduced a little cell growth in DC. The number of immature granulocytes grown in DC in irradiated hosts or anemia and irradiated hosts increased and reached a plateu at day 5. During the plateu period, the proportions between immature and mature granulocytes in DC were kept constantly. The number of macrophages showed a two-phase increasing. Erythroid cells and lymphocytes rapidly disappeared from the chambers during 3 days. The number of erythroid cells was not significantly influenced even in anemia and irradiation hosts. (author)

  8. Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis

    International Nuclear Information System (INIS)

    Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.

    1988-01-01

    Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)

  9. Platelet lysate as a novel serum-free media supplement for the culture of equine bone marrow-derived mesenchymal stem cells.

    Science.gov (United States)

    Naskou, Maria C; Sumner, Scarlett M; Chocallo, Anna; Kemelmakher, Hannah; Thoresen, Merrilee; Copland, Ian; Galipeau, Jacques; Peroni, John F

    2018-03-22

    Mesenchymal stem cells (MSCs) produced for clinical purposes rely on culture media containing fetal bovine serum (FBS) which is xenogeneic and has the potential to significantly alter the MSC phenotype, rendering these cells immunogenic. As a result of bovine-derived exogenous proteins expressed on the cell surface, MSCs may be recognized by the host immune system as non-self and be rejected. Platelet lysate (PL) may obviate some of these concerns and shows promising results in human medicine as a possible alternative to FBS. Our goal was to evaluate the use of equine platelet lysate (ePL) pooled from donor horses in place of FBS to culture equine MSCs. We hypothesized that ePL, produced following apheresis, will function as the sole media supplement to accelerate the expansion of equine bone marrow-derived MSCs without altering their phenotype and their immunomodulatory capacity. Platelet concentrate was obtained via plateletpheresis and ePL were produced via freeze-thaw and centrifugation cycles. Population doublings (PD) and doubling time (DT) of bone marrow-derived MSCs (n = 3) cultured with FBS or ePL media were calculated. Cell viability, immunophenotypic analysis, and trilineage differentiation capacity of MSCs were assessed accordingly. To assess the ability of MSCs to modulate inflammatory responses, E. coli lipopolysaccharide (LPS)-stimulated monocytes were cocultured with MSCs cultured in the two different media formulations, and cell culture supernatants were assayed for the production of tumor necrosis factor (TNF)-α. Our results showed that MSCs cultured in ePL media exhibited similar proliferation rates (PD and DT) compared with those cultured in FBS at individual time points. MSCs cultured in ePL showed a statistically significant increased viability following a single washing step, expressed similar levels of MSC markers compared to FBS, and were able to differentiate towards the three lineages. Finally, MSCs cultured in ePL efficiently suppressed

  10. Radiation-induced bystander effects in cultured human stem cells.

    Directory of Open Access Journals (Sweden)

    Mykyta V Sokolov

    2010-12-01

    Full Text Available The radiation-induced "bystander effect" (RIBE was shown to occur in a number of experimental systems both in vitro and in vivo as a result of exposure to ionizing radiation (IR. RIBE manifests itself by intercellular communication from irradiated cells to non-irradiated cells which may cause DNA damage and eventual death in these bystander cells. It is known that human stem cells (hSC are ultimately involved in numerous crucial biological processes such as embryologic development; maintenance of normal homeostasis; aging; and aging-related pathologies such as cancerogenesis and other diseases. However, very little is known about radiation-induced bystander effect in hSC. To mechanistically interrogate RIBE responses and to gain novel insights into RIBE specifically in hSC compartment, both medium transfer and cell co-culture bystander protocols were employed.Human bone-marrow mesenchymal stem cells (hMSC and embryonic stem cells (hESC were irradiated with doses 0.2 Gy, 2 Gy and 10 Gy of X-rays, allowed to recover either for 1 hr or 24 hr. Then conditioned medium was collected and transferred to non-irradiated hSC for time course studies. In addition, irradiated hMSC were labeled with a vital CMRA dye and co-cultured with non-irradiated bystander hMSC. The medium transfer data showed no evidence for RIBE either in hMSC and hESC by the criteria of induction of DNA damage and for apoptotic cell death compared to non-irradiated cells (p>0.05. A lack of robust RIBE was also demonstrated in hMSC co-cultured with irradiated cells (p>0.05.These data indicate that hSC might not be susceptible to damaging effects of RIBE signaling compared to differentiated adult human somatic cells as shown previously. This finding could have profound implications in a field of radiation biology/oncology, in evaluating radiation risk of IR exposures, and for the safety and efficacy of hSC regenerative-based therapies.

  11. Isolation and culture of Celosia cristata L cell suspension protoplasts

    Directory of Open Access Journals (Sweden)

    Retno Mastuti

    2003-06-01

    Full Text Available Developmental competence of Celosia cristata L. cell suspension-derived protoplasts was investigated. The protoplasts were isolatedfrom 3- to 9-d old cultures in enzyme solution containing 2% (w/v Cellulase YC and 0.5% (w/v Macerozyme R-10 which was dissolvedin washing solution (0.4 M mannitol and 10 mM CaCl2 at pH 5.6 for 3 hours. The highest number of viable protoplasts was releasedfrom 5-d old culture of a homogenous cell suspension. Subsequently, three kinds of protoplast culture media were simultaneously examinedwith four kinds of concentration of gelling agent. Culturing the protoplasts on KM8p medium solidified with 1.2% agarose significantlyenhanced plating efficiency as well as microcolony formation. Afterwards, the microcalli actively proliferated into friable watery calluswhen they were subcultured on MS medium supplemented with 0.3 mg/l 2,4-D and 1.0 mg/l kinetin. Although the plant regenerationfrom the protoplasts-derived calli has not yet been obtained, the reproducible developmental step from protoplasts to callus in thisstudy may facilitate the establishment of somatic hybridization using C. cristata as one parent.

  12. An introduction to plant cell culture: the future ahead.

    Science.gov (United States)

    Loyola-Vargas, Víctor M; Ochoa-Alejo, Neftalí

    2012-01-01

    Plant cell, tissue, and organ culture (PTC) techniques were developed and established as an experimental necessity for solving important fundamental questions in plant biology, but they currently represent very useful biotechnological tools for a series of important applications such as commercial micropropagation of different plant species, generation of disease-free plant materials, production of haploid and doublehaploid plants, induction of epigenetic or genetic variation for the isolation of variant plants, obtention of novel hybrid plants through the rescue of hybrid embryos or somatic cell fusion from intra- or intergeneric sources, conservation of valuable plant germplasm, and is the keystone for genetic engineering of plants to produce disease and pest resistant varieties, to engineer metabolic pathways with the aim of producing specific secondary metabolites or as an alternative for biopharming. Some other miscellaneous applications involve the utilization of in vitro cultures to test toxic compounds and the possibilities of removing them (bioremediation), interaction of root cultures with nematodes or mycorrhiza, or the use of shoot cultures to maintain plant viruses. With the increased worldwide demand for biofuels, it seems that PTC will certainly be fundamental for engineering different plants species in order to increase the diversity of biofuel options, lower the price marketing, and enhance the production efficiency. Several aspects and applications of PTC such as those mentioned above are the focus of this edition.

  13. Genotoxic activity of caramel on Salmonella and cultured mammalian cells.

    Science.gov (United States)

    Yu, Y N; Chen, X R; Ding, C; Cai, Z N; Li, Q G

    1984-04-01

    The genetic activity of 2 commercial caramel preparations, manufactured either by heating the malt sugar solution directly (non-ammoniated caramel) or by heating it with ammonia (ammoniated caramel) was studied in the Salmonella mutagenicity test and UDS assay in cultured mammalian cells. The non-ammoniated caramel was found to be mutagenic to S. typhimurium TA100, while the ammoniated one was genetically active in all the tester strains used, namely TA100, TA97 and TA98. It was also demonstrated that non-ammoniated caramel was capable of inducing UDS in cultured human amnion FL cells, but for the ammoniated one, no such activity was observed. Furthermore, based on the results obtained in the DNA synthesis inhibition assay, it was suggested that the DNA synthesis inhibition seen in our experiments with the ammoniated caramel was probably not of DNA damage in origin. These data indicate that the mutagenic fractions formed during ammoniated and non-ammoniated caramelization were quite different.

  14. Batch variation between branchial cell cultures: An analysis of variance

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Grosell, M.; Kristensen, L.

    2003-01-01

    We present in detail how a statistical analysis of variance (ANOVA) is used to sort out the effect of an unexpected batch-to-batch variation between cell cultures. Two separate cultures of rainbow trout branchial cells were grown on permeable filtersupports ("inserts"). They were supposed...... to be simple duplicates for testing the effect of two induced factors-apical or basolateral addition of radioactive precursors and different apical media-on the incorporation of 14C-acetate and 32Pphosphate intotissue lipids. Unfortunately, they did not altogether give the same result. By accepting this fact...... and introducing the observed difference between batches as one of the factors in an expanded three-dimensional ANOVA, we were able to overcome an otherwisecrucial lack of sufficiently reproducible duplicate values. We could thereby show that the effect of changing the apical medium was much more marked when...

  15. Boildown Study on Supernatant Liquid Retrieved from AW-106 in December 2012

    Energy Technology Data Exchange (ETDEWEB)

    Page, Jason S. [Washington River Protection Solutions, LLC, Richland, WA (United States)

    2013-06-04

    This document reports the results of a boil down study using a composite created from supernatant liquid grab samples retrieved from tank 241-AW-I06 in December of 2012. The composite was made using predetermined volumes of the grab samples which accounted for layering of the supernatant liquid in the tank. The finished composite was a clear, yellow liquid containing no visible solids at hot cell ambient temperatures (24 - 27°C). The density of the test composite was measured in the hot cell immediately before the boildown study and was 1.266 g/mL at 27.1 °C. The boiling temperature of the composite was measured at three different pressures (40, 60, and 80 Torr) throughout the volume reduction, and the results show steadily increasing boiling temperatures with increasing volume reduction and no significant discontinuities. Moderate foaming was observed at the onset of the boildown. The foaming disappeared during the first reduction step, and minimal foaming was observed throughout the rest of the study. The bulk densities at 18.0 °C (D{sub Bulk}{sup 18 °C}) and quantities of settled and centrifuged solids were measured on samples of the boildown concentrates. Estimated values of the bulk densities at the 60-Torr boiling temperatures (D{sub Bulk}{sup 60 Torr}) were also calculated. Solids were first observed at boildown temperatures when the % VWR reached 39.3%. The quantity of solids in the composite quickly increased after this initial formation; the amount of centrifuged solids increased by 22% as the %WVR increased from 39.3 to 44.1 %. A small amount of solids did appear in the samples collected prior to the initial formation during the boildown. These solids precipitated while they sat at hot cell ambient temperature and in the 18. 0 °C water bath. Analysis of boil down test samples indicated that natrophosphate (Na7{sub 3}F(PO{sub 4}){sub 2}{centerdot} 19 H{sub 2}O) and kogarkoite (Na3FS04) accounted for a majority of the initial solids (~80% of the

  16. Cytokine profiles of HeLa and human diploid cells induced by different fractions of Vibrio parahaemolyticus cultures exposed to stress conditions.

    Science.gov (United States)

    Chifiriuc, Mariana Carmen; Bleotu, Coralia; Pîrcălăbioru, Gratiela; Israil, Anca Michaela; Dinu, Sorin; Rută, Simona Maria; Grancea, Camelia; Lazăr, Veronica

    2010-01-01

    Vibrio (V.) parahaemolyticus is an aquatic halophilic bacteria which produces gastroenteritis and in rare cases septicaemia after the consumption of raw or under-cooked contaminated seafood.The severity of diarrheal illness caused by this bacterium is closely related to the presence of two types of hemolysins (the thermostable direct hemolysin-TDH and TDH related hemolysin-TRH) and also of type III secretion system (TTSS) proteins. The TTSS type 1 induces a wide array of effects on infected HeLa cells such as autophagy, oncosis, cell rounding and lysis. Previous studies have shown that heat shock proteins have the ability to stimulate the production of interleukins in different cellular cultures. In our studies we have stimulated two cellular lines (HeLa and human diploid cells) with different V. parahaemolyticus culture fractions in order to observe the effect on cytokines production. Thus, the purpose of this study was to analyze the expression of IL-1, IL-2, IL-4, IL-6, IL-10 and TNF-alpha induced by the cell treatment with total cellular lysate, periplasmic fractions and culture supernatants extracted from V. parahaemolyticus exposed to normal and also to stress conditions. The ELISA assay of the cytokine profile of the HeLa and HDC cell lines stimulated with different bacterial fractions revealed that in the V. parahemolyticus cultures submitted to osmotic and heat shock stress are accumulating factors (probably heat shock proteins) which are exhibiting immunomodulatory activity, responsible for the induction of a pro-inflammatory response associated with increased levels of IL-6 and TNF-alpha expression, however balanced by the stimulation of the anti-inflammatory cytokine IL-4 synthesis.

  17. Tumor necrosis factor (cachetin) decreases adipose cell differentiation in primary cell culture

    International Nuclear Information System (INIS)

    Martin, R.J.; Jones, D.D.; Jewell, D.E.; Hausman, G.J.

    1986-01-01

    Cachetin has been shown to effect gene product expression in the established adipose cell line 3T3-L1. Expression of messenger RNA for lipoprotein lipase is suppressed in cultured adipocytes. The purpose of this study was to determine the effect of Cachetin on adipose cell differentiation in primary cell culture. Stromalvascular cells obtained from the inguinal fat pad of 4-5 week old Sprague-Dawley rats were grown in culture for two weeks. During the proliferative growth phase all cells were grown on the same medium and labelled with 3 H-thymidine. Cachetin treatment (10 -6 to 10 -10 M) was initiated on day 5, the initial phase of preadipocyte differentiation. Adipocytes and stromal cells were separated using density gradient, and 3 H-thymidine was determined for both cell types. Thymidine incorporation into adipose cells was decreased maximally (∼ 50%) at 10 -10 M. Stromalvascular cells were not influenced at any of the doses tested. Adipose cell lipid content as indicated by oil red-O staining was decreased by Cachetin. Esterase staining by adipose cells treated with Cachetin was increased indicating an increase in intracellular lipase. These studies show that Cachetin has specific effects on primary adipose cell differentiation

  18. Isolation and culture of porcine neural progenitor cells from embryos and pluripotent stem cells

    DEFF Research Database (Denmark)

    Rasmussen, Mikkel Aabech; Hall, Vanessa Jane; Hyttel, Poul

    2013-01-01

    therapy. The pig has become recognized as an important large animal model and establishment of in vitro-derived porcine NPCs would allow for preclinical safety testing by transplantation in a porcine biomedical model. In this chapter, a detailed method for isolation and in vitro culture of porcine NPCs......The isolation and culture of neural progenitor cells (NPCs) from pluripotent stem cells has facilitated in vitro mechanistic studies of diseases related to the nervous system, as well as discovery of new medicine. In addition, NPCs are envisioned to play a crucial role in future cell replacement....... The cells have the potential of long-term culture and the ability to differentiate into neural and glial cells....

  19. Mesenchymal stem cells cultured on magnetic nanowire substrates

    Science.gov (United States)

    Perez, Jose E.; Ravasi, Timothy; Kosel, Jürgen

    2017-02-01

    Stem cells have been shown to respond to extracellular mechanical stimuli by regulating their fate through the activation of specific signaling pathways. In this work, an array of iron nanowires (NWs) aligned perpendicularly to the surface was fabricated by pulsed electrodepositon in porous alumina templates followed by a partial removal of the alumina to reveal 2-3 μm of the NWs. This resulted in alumina substrates with densely arranged NWs of 33 nm in diameter separated by 100 nm. The substrates were characterized by scanning electron microscopy (SEM) energy dispersive x-ray analysis and vibrating sample magnetometer. The NW array was then used as a platform for the culture of human mesenchymal stem cells (hMSCs). The cells were stained for the cell nucleus and actin filaments, as well as immuno-stained for the focal adhesion protein vinculin, and then observed by fluorescence microscopy in order to characterize their spreading behavior. Calcein AM/ethidium homodimer-1 staining allowed the determination of cell viability. The interface between the cells and the NWs was studied using SEM. Results showed that hMSCs underwent a re-organization of actin filaments that translated into a change from an elongated to a spherical cell shape. Actin filaments and vinculin accumulated in bundles, suggesting the attachment and formation of focal adhesion points of the cells on the NWs. Though the overall number of cells attached on the NWs was lower compared to the control, the attached cells maintained a high viability (>90%) for up to 6 d. Analysis of the interface between the NWs and the cells confirmed the re-organization of F-actin and revealed the adhesion points of the cells on the NWs. Additionally, a net of filopodia surrounded each cell, suggesting the probing of the array to find additional adhesion points. The cells maintained their round shape for up to 6 d of culture. Overall, the NW array is a promising nanostructured platform for studying and influencing h

  20. Mesenchymal stem cells cultured on magnetic nanowire substrates

    KAUST Repository

    Perez, Jose E.

    2016-12-28

    Stem cells have been shown to respond to extracellular mechanical stimuli by regulating their fate through the activation of specific signaling pathways. In this work, an array of iron nanowires (NWs) aligned perpendicularly to the surface was fabricated by pulsed electrodepositon in porous alumina templates followed by a partial removal of the alumina to reveal 2-3 μm of the NWs. This resulted in alumina substrates with densely arranged NWs of 33 nm in diameter separated by 100 nm. The substrates were characterized by scanning electron microscopy (SEM) energy dispersive x-ray analysis and vibrating sample magnetometer. The NW array was then used as a platform for the culture of human mesenchymal stem cells (hMSCs). The cells were stained for the cell nucleus and actin filaments, as well as immuno-stained for the focal adhesion protein vinculin, and then observed by fluorescence microscopy in order to characterize their spreading behavior. Calcein AM/ethidium homodimer-1 staining allowed the determination of cell viability. The interface between the cells and the NWs was studied using SEM. Results showed that hMSCs underwent a re-organization of actin filaments that translated into a change from an elongated to a spherical cell shape. Actin filaments and vinculin accumulated in bundles, suggesting the attachment and formation of focal adhesion points of the cells on the NWs. Though the overall number of cells attached on the NWs was lower compared to the control, the attached cells maintained a high viability (>90%) for up to 6 d. Analysis of the interface between the NWs and the cells confirmed the re-organization of F-actin and revealed the adhesion points of the cells on the NWs. Additionally, a net of filopodia surrounded each cell, suggesting the probing of the array to find additional adhesion points. The cells maintained their round shape for up to 6 d of culture. Overall, the NW array is a promising nanostructured platform for studying and influencing h

  1. Lactate Detection in Tumor Cell Cultures Using Organic Transistor Circuits.

    Science.gov (United States)

    Braendlein, Marcel; Pappa, Anna-Maria; Ferro, Marc; Lopresti, Alexia; Acquaviva, Claire; Mamessier, Emilie; Malliaras, George G; Owens, Róisín M

    2017-04-01

    A biosensing platform based on an organic transistor circuit for metabolite detection in highly complex biological media is introduced. The sensor circuit provides inherent background subtraction allowing for highly specific, sensitive lactate detection in tumor cell cultures. The proposed sensing platform paves the way toward rapid, label-free, and cost-effective clinically relevant in vitro diagnostic tools. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. UV Inactivation of Cryptosporidium hominis as Measured in Cell Culture

    OpenAIRE

    Johnson, Anne M.; Linden, Karl; Ciociola, Kristina M.; De Leon, Ricardo; Widmer, Giovanni; Rochelle, Paul A.

    2005-01-01

    The Cryptosporidium spp. UV disinfection studies conducted to date have used Cryptosporidium parvum oocysts. However, Cryptosporidium hominis predominates in human cryptosporidiosis infections, so there is a critical need to assess the efficacy of UV disinfection of C. hominis. This study utilized cell culture-based methods to demonstrate that C. hominis oocysts displayed similar levels of infectivity and had the same sensitivity to UV light as C. parvum. Therefore, the water industry can be ...

  3. [Biological characteristics of mesenchymal stem cell and hematopoietic stem cell in the co-culture system].

    Science.gov (United States)

    Wei, Wei; Xu, Chao; Ye, Zhi-Yong; Huang, Xiao-Jun; Yuan, Jia-En; Ma, Tian-Bao; Lin, Han-Biao; Chen, Xiu-Qiong

    2016-10-25

    The aim of the present study was to obtain the qualified hematopoietic stem/progenitor cells (HSC/HPC) and human umbilical cord-mesenchymal stem cells (MSC) in vitro in the co-culture system. Cord blood mononuclear cells were separated from umbilical cord blood by Ficoll lymphocyte separation medium, and then CD34 + HSC was collected by MACS immunomagnetic beads. The selected CD34 + HSC/HPC and MSC were transferred into culture flask. IMDM culture medium with 15% AB-type cord plasma supplemented with interleukin-3 (IL-3), IL-6, thrombopoietin (TPO), stem cell factor (SCF) and FMS-like tyrosine kinase 3 ligand (Flt-3L) factors were used as the co-culture system for the amplification of HSC/HPC and MSC. The cellular growth status and proliferation on day 6 and 10 after co-culture were observed by using inverted microscope. The percentage of positive expression of CD34 in HSC/HPC, as well as the percentages of positive expressions of CD105, CD90, CD73, CD45, CD34 and HLA-DR in the 4 th generation MSC, was tested by flow cytometry. Semisolid colony culture was used to test the HSC/HPC colony forming ability. The osteogenic, chondrogenesis and adipogenic ability of the 4 th generation MSC were assessed. The karyotype analysis of MSC was conducted by colchicines. The results demonstrated that the HSC/HPC of co-culture group showed higher ability of amplification, CFU-GM and higher CD34 + percentage compared with the control group. The co-cultured MSC maintained the ability to differentiate into bone cells, fat cells and chondrocytes. And the karyotype stability of MSC remained normal. These results reveal that the appropriate co-culture system for MSC and HSC is developed, and via this co-culture system we could gain both two kinds of these cells. The MSCs under the co-culture system maintain the biological characteristics. The CFU-GM ability, cell counting and the flow cytometry results of HSC/HPC under the co-culture system are conform to the criterion, showing that

  4. Proteomic analysis of grape berry cell cultures reveals that developmentally regulated ripening related processes can be studied using cultured cells.

    Directory of Open Access Journals (Sweden)

    Ramaschandra G Sharathchandra

    Full Text Available BACKGROUND: This work describes a proteomics profiling method, optimized and applied to berry cell suspensions to evaluate organ-specific cultures as a platform to study grape berry ripening. Variations in berry ripening within a cluster(s on a vine and in a vineyard are a major impediment towards complete understanding of the functional processes that control ripening, specifically when a characterized and homogenous sample is required. Berry cell suspensions could overcome some of these problems, but their suitability as a model system for berry development and ripening needs to be established first. METHODOLOGY/PRINCIPAL FINDINGS: In this study we report on the proteomic evaluation of the cytosolic proteins obtained from synchronized cell suspension cultures that were established from callus lines originating from green, véraison and ripe Vitis vinifera berry explants. The proteins were separated using liquid phase IEF in a Microrotofor cell and SDS PAGE. This method proved superior to gel-based 2DE. Principal component analysis confirmed that biological and technical repeats grouped tightly and importantly, showed that the proteomes of berry cultures originating from the different growth/ripening stages were distinct. A total of twenty six common bands were selected after band matching between different growth stages and twenty two of these bands were positively identified. Thirty two % of the identified proteins are currently annotated as hypothetical. The differential expression profile of the identified proteins, when compared with published literature on grape berry ripening, suggested common trends in terms of relative abundance in the different developmental stages between real berries and cell suspensions. CONCLUSIONS: The advantages of having suspension cultures that accurately mimic specific developmental stages are profound and could significantly contribute to the study of the intricate regulatory and signaling networks

  5. PC-3 prostate carcinoma cells release signal substances that influence the migratory activity of cells in the tumor's microenvironment

    Directory of Open Access Journals (Sweden)

    Zänker Kurt S

    2010-07-01

    Full Text Available Abstract Background Tumor cells interact with the cells of the microenvironment not only by cell-cell-contacts but also by the release of signal substances. These substances are known to induce tumor vascularization, especially under hypoxic conditions, but are also supposed to provoke other processes such as tumor innervation and inflammatory conditions. Inflammation is mediated by two organ systems, the neuroendocrine system and the immune system. Therefore, we investigated the influence of substances released by PC-3 human prostate carcinoma cells on SH-SY5Y neuroblastoma cells as well as neutrophil granulocytes and cytotoxic T lymphocytes, especially with regard to their migratory activity. Results PC-3 cells express several cytokines and growth factors including vascular endothelial growth factors, fibroblast growth factors, interleukins and neurotrophic factors. SH-SY5Y cells are impaired in their migratory activity by PC-3 cell culture supernatant, but orientate chemotactically towards the source. Neutrophil granulocytes increase their locomotory activity only in response to cell culture supernantant of hypoxic but not of normoxic PC-3 cells. In contrast, cytotoxic T lymphocytes do not change their migratory activity in response to either culture supernatant, but increase their cytotoxicity, whereas supernatant of normoxic PC-3 cells leads to a stronger increase than that of hypoxic PC-3 cells. Conclusions PC-3 cells release several signal substances that influence the behavior of the cells in the tumor's microenvironment, whereas no clear pattern towards proinflammatory or immunosuppressive conditions can be seen.

  6. Human lung mast cells modulate the functions of airway smooth muscle cells in asthma.

    Science.gov (United States)

    Alkhouri, H; Hollins, F; Moir, L M; Brightling, C E; Armour, C L; Hughes, J M

    2011-09-01

    Activated mast cell densities are increased on the airway smooth muscle in asthma where they may modulate muscle functions and thus contribute to airway inflammation, remodelling and airflow obstruction. To determine the effects of human lung mast cells on the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Freshly isolated human lung mast cells were stimulated with IgE/anti-IgE. Culture supernatants were collected after 2 and 24 h and the mast cells lysed. The supernatants/lysates were added to serum-deprived, subconfluent airway smooth muscle cells for up to 48 h. Released chemokines and extracellular matrix were measured by ELISA, proliferation was quantified by [(3) H]-thymidine incorporation and cell counting, and intracellular signalling by phospho-arrays. Mast cell 2-h supernatants reduced CCL11 and increased CXCL8 and fibronectin production from both asthmatic and nonasthmatic muscle cells. Leupeptin reversed these effects. Mast cell 24-h supernatants and lysates reduced CCL11 release from both muscle cell types but increased CXCL8 release by nonasthmatic cells. The 24-h supernatants also reduced asthmatic, but not nonasthmatic, muscle cell DNA synthesis and asthmatic cell numbers over 5 days through inhibiting extracellular signal-regulated kinase (ERK) and phosphatidylinositol (PI3)-kinase pathways. However, prostaglandins, thromboxanes, IL-4 and IL-13 were not involved in reducing the proliferation. Mast cell proteases and newly synthesized products differentially modulated the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Thus, mast cells may modulate their own recruitment and airway smooth muscle functions locally in asthma. © 2011 John Wiley & Sons A/S.

  7. Characterization of conditioned medium of cultured bone marrow stromal cells.

    Science.gov (United States)

    Nakano, Norihiko; Nakai, Yoshiyasu; Seo, Tae-Boem; Yamada, Yoshihiro; Ohno, Takayuki; Yamanaka, Atsuo; Nagai, Yoji; Fukushima, Masanori; Suzuki, Yoshiyuki; Nakatani, Toshio; Ide, Chizuka

    2010-10-08

    It has been recognized that bone marrow stromal cell (BMSC) transplantation has beneficial effects on spinal cord injury in animal models and therapeutic trials. It is hypothesized that BMSCs provide microenvironments suitable for axonal regeneration and secrete some trophic factors to rescue affected cells from degeneration. However, the molecular and cellular mechanisms of the trophic factors involved remain unclear. In the present study, we examined the effects of trophic factors secreted by rat BMSCs using bioassays involving cultured hippocampal neurons. The conditioned medium (CM) as well as non-contact co-culture of BMSCs promoted neurite outgrowth and suppressed TUNEL-positive cells compared to serum-free D-MEM. Protein analyses of the CM by antibody-based protein array analysis and ELISA revealed that the CM contained insulin-like growth factor (IGF)-1, hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), and transforming growth factor (TGF)-beta1. DNA microarray analysis revealed that neurons highly expressed receptors of IGF-1 and TGF-beta1. However, their expression indices remained unchanged even after the CM treatment. The individual trophic factors mentioned above or their combinations were less effective at promoting neuronal survival and neurite outgrowth than the CM. The present study showed that BMSCs secreted various kinds of molecules into the culture medium including trophic factors to promote neuronal survival and neurite outgrowth. The main trophic factors responsible remain to be elucidated. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  8. In Vitro Cell Culture Infectivity Assay for Human Noroviruses

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Honer Zu Bentrup, Kerstin A.; Orosz Coghlan, Patricia A.; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza; Nickerson, Cheryl A.

    2007-01-30

    Human noroviruses (NoV) cause severe, self-limiting gastroenteritis that typically lasts 24 - 48 hours. The true nature of NoV pathogenesis remains unknown due to the lack of suitable tissue culture or animal models. Here we show, for the first time, that NoV can infect and replicate in an organoid, three-dimensional (3-D) model of human small intestinal epithelium (INT-407). Cellular differentiation for this model was achieved by growing the cells in 3-D on porous collagen I-coated microcarrier beads under conditions of physiological fluid shear in rotating wall vessel bioreactors. Microscopy, PCR, and fluorescent in-situ hybridization were employed to provide evidence of NoV infection. CPE and norovirus RNA was detected at each of the five cell passages for both genogroup I and II viruses. Our results demonstrate that the highly differentiated 3-D cell culture model can support the natural growth of human noroviruses, whereas previous attempts using differentiated monolayer cultures failed.

  9. Rotary orbital suspension culture of embryonic stem cell-derived neural stem/progenitor cells: impact of hydrodynamic culture on aggregate yield, morphology and cell phenotype.

    Science.gov (United States)

    Laundos, Tiago L; Silva, Joana; Assunção, Marisa; Quelhas, Pedro; Monteiro, Cátia; Oliveira, Carla; Oliveira, Maria J; Pêgo, Ana P; Amaral, Isabel F

    2017-08-01

    Embryonic stem (ES)-derived neural stem/progenitor cells (ES-NSPCs) constitute a promising cell source for application in cell therapies for the treatment of central nervous system disorders. In this study, a rotary orbital hydrodynamic culture system was applied to single-cell suspensions of ES-NSPCs, to obtain homogeneously-sized ES-NSPC cellular aggregates (neurospheres). Hydrodynamic culture allowed the formation of ES-NSPC neurospheres with a narrower size distribution than statically cultured neurospheres, increasing orbital speeds leading to smaller-sized neurospheres and higher neurosphere yield. Neurospheres formed under hydrodynamic conditions (72 h at 55 rpm) showed higher cell compaction and comparable percentages of viable, dead, apoptotic and proliferative cells. Further characterization of cellular aggregates provided new insights into the effect of hydrodynamic shear on ES-NSPC behaviour. Rotary neurospheres exhibited reduced protein levels of N-cadherin and β-catenin, and higher deposition of laminin (without impacting fibronectin deposition), matrix metalloproteinase-2 (MMP-2) activity and percentage of neuronal cells. In line with the increased MMP-2 activity levels found, hydrodynamically-cultured neurospheres showed higher outward migration on laminin. Moreover, when cultured in a 3D fibrin hydrogel, rotary neurospheres generated an increased percentage of neuronal cells. In conclusion, the application of a constant orbital speed to single-cell suspensions of ES-NSPCs, besides allowing the formation of homogeneously-sized neurospheres, promoted ES-NSPC differentiation and outward migration, possibly by influencing the expression of cell-cell adhesion molecules and the secretion of proteases/extracellular matrix proteins. These findings are important when establishing the culture conditions needed to obtain uniformly-sized ES-NSPC aggregates, either for use in regenerative therapies or in in vitro platforms for biomaterial development or

  10. Neural differentiation of adipose-derived stem cells by indirect co-culture with Schwann cells

    Directory of Open Access Journals (Sweden)

    Li Xiaojie

    2009-01-01

    Full Text Available To investigate whether adipose-derived stem cells (ADSCs could be subject to neural differentiation induced only by Schwann cell (SC factors, we co-cultured ADSCs and SCs in transwell culture dishes. Immunoassaying, Western blot analysis, and RT-PCR were performed (1, 3, 7, 14 d and the co-cultured ADSCs showed gene and protein expression of S-100, Nestin, and GFAP. Further, qRT-PCR disclosed relative quantitative differences in the above three gene expressions. We think ADSCs can undergo induced neural differentiation by being co-cultured with SCs, and such differentia­tions begin 1 day after co-culture, become apparent after 7 days, and thereafter remain stable till the 14th day.

  11. A co-culture device with a tunable stiffness to understand combinatorial cell-cell and cell-matrix interactions.

    Science.gov (United States)

    Rao, Nikhil; Grover, Gregory N; Vincent, Ludovic G; Evans, Samantha C; Choi, Yu Suk; Spencer, Katrina H; Hui, Elliot E; Engler, Adam J; Christman, Karen L

    2013-11-01

    Cell behavior on 2-D in vitro cultures is continually being improved to better mimic in vivo physiological conditions by combining niche cues including multiple cell types and substrate stiffness, which are well known to impact cell phenotype. However, no system exists in which a user can systematically examine cell behavior on a substrate with a specific stiffness (elastic modulus) in culture with a different cell type, while maintaining distinct cell populations. We demonstrate the modification of a silicon reconfigurable co-culture system with a covalently linked hydrogel of user-defined stiffness. This device allows the user to control whether two separate cell populations are in contact with each other or only experience paracrine interactions on substrates of controllable stiffness. To illustrate the utility of this device, we examined the role of substrate stiffness combined with myoblast co-culture on adipose derived stem cell (ASC) differentiation and found that the presence of myoblasts and a 10 kPa substrate stiffness increased ASC myogenesis versus co-culture on stiff substrates. As this example highlights, this technology better controls the in vitro microenvironment, allowing the user to develop a more thorough understanding of the combined effects of cell-cell and cell-matrix interactions.

  12. Flow field measurements in the cell culture unit

    Science.gov (United States)

    Walker, Stephen; Wilder, Mike; Dimanlig, Arsenio; Jagger, Justin; Searby, Nancy

    2002-01-01

    The cell culture unit (CCU) is being designed to support cell growth for long-duration life science experiments on the International Space Station (ISS). The CCU is a perfused loop system that provides a fluid environment for controlled cell growth experiments within cell specimen chambers (CSCs), and is intended to accommodate diverse cell specimen types. Many of the functional requirements depend on the fluid flow field within the CSC (e.g., feeding and gas management). A design goal of the CCU is to match, within experimental limits, all environmental conditions, other than the effects of gravity on the cells, whether the hardware is in microgravity ( micro g), normal Earth gravity, or up to 2g on the ISS centrifuge. In order to achieve this goal, two steps are being taken. The first step is to characterize the environmental conditions of current 1g cell biology experiments being performed in laboratories using ground-based hardware. The second step is to ensure that the design of the CCU allows the fluid flow conditions found in 1g to be replicated from microgravity up to 2g. The techniques that are being used to take these steps include flow visualization, particle image velocimetry (PIV), and computational fluid dynamics (CFD). Flow visualization using the injection of dye has been used to gain a global perspective of the characteristics of the CSC flow field. To characterize laboratory cell culture conditions, PIV is being used to determine the flow field parameters of cell suspension cultures grown in Erlenmeyer flasks on orbital shakers. These measured parameters will be compared to PIV measurements in the CSCs to ensure that the flow field that cells encounter in CSCs is within the bounds determined for typical laboratory experiments. Using CFD, a detailed simulation is being developed to predict the flow field within the CSC for a wide variety of flow conditions, including microgravity environments. Results from all these measurements and analyses of the

  13. Characterization of biomaterial-free cell sheets cultured from human oral mucosal epithelial cells.

    Science.gov (United States)

    Hyun, Dong Won; Kim, Yun Hee; Koh, Ah Young; Lee, Hyun Ju; Wee, Won Ryang; Jeon, Saewha; Kim, Mee Kum

    2017-03-01

    The purpose of this study was to report the characteristics of biomaterial-free sheets cultured from human oral mucosal epithelial cells without fibrin support, in vitro and after transplantation to limbal-deficient models. Human oral mucosal epithelial cells and limbal epithelial cells were cultured for 2 weeks, and the colony-forming efficiency (CFE) rates were compared. Markers of stem cells (p63), cell proliferation (Ki-67) and epithelial differentiation (cytokeratin; K1, K3, K4, K13) were observed in colonies and in biomaterial-free sheets. Biomaterial-free sheets which had been detached with 1% dispase or biomaterial-free sheets generated by fibrin support were transplanted to 12 limbal-deficient rabbit models. In vitro cell viability, in vivo stability and cytokeratin characteristics of biomaterial-free sheets were compared with those of sheets formed by fibrin-coated culture 1 week after transplantation. Mean CFE rate was significantly higher in human oral mucosal epithelial cells (44.8%) than in human limbal epithelial cells(17.7%). K3 and K4 were well expressed in both colonies and sheets. Biomaterial-free sheets had two to six layers of stratified cells and showed an average of 79.8% viable cells in the sheets after detachment. Cytokeratin expressions of biomaterial-free sheets were comparable to those of sheets cultured by fibrin support, in limbal-deficient models. Both p63 and Ki-67 were well expressed in colonies, isolated sheets and sheets transplanted to limbal-deficient models. Our results suggest that biomaterial-free sheets cultured from human oral mucosal epithelial cells without fibrin support can be an alternative option for cell therapy in use for the treatment of limbal-deficient diseases. Copyright © 2014 John Wiley & Sons, Ltd. Copyright © 2014 John Wiley & Sons, Ltd.

  14. Smooth muscle myosin regulation by serum and cell density in cultured rat lung connective tissue cells.

    Science.gov (United States)

    Babij, P; Zhao, J; White, S; Woodcock-Mitchell, J; Mitchell, J; Absher, M; Baldor, L; Periasamy, M; Low, R B

    1993-08-01

    RNA and protein analyses were used to detect expression of SM1 and SM2 smooth muscle myosin heavy chain (MHC) in cultured adult rat lung connective tissue cells (RL-90). Smooth muscle MHC mRNA expression in confluent cells grown in 10% serum was approximately 50% of the level in adult stomach. Similar results were obtained in cells cultured at low density (25% confluency) in 1% serum. However, in low-density cultures transferred to 10% serum for 24 h, the level of MHC mRNA decreased to approximately 20% of that in adult stomach. Smooth muscle alpha-actin showed a pattern of expression similar to that for smooth muscle MHC. Expression of nonmuscle MHC-A mRNA was higher in all culture conditions compared to stomach. MHC-A mRNA expression was less in low-density cultures in low serum and increased when low-density cultures were transferred to 10% serum for 24 h. MHC-B mRNA expression was less in low- vs. high-density cultures. In contrast to MHC-A, however, MHC-B mRNA expression in low-density cultures was higher in low serum. Immunofluorescence and immunoblotting with SM1-specific antibody demonstrated the presence of the SM1 protein isoform as well as reactivity to a protein band migrating slightly faster than SM2. These results demonstrate that cultured rat lung connective tissue cells express smooth muscle MHC and that expression is modulated by culture conditions.

  15. Thymic epithelial cells. I. Expression of strong suppressive (veto) activity in mouse thymic epithelial cell cultures

    DEFF Research Database (Denmark)

    Claesson, Mogens Helweg; Ropke, C

    1990-01-01

    We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level. It is conclu....... It is concluded that the epithelial stromal cells of the thymus, by acting as veto cells, may be responsible for the negative intrathymic selection of self-reactive thymocytes leading to elimination of the vast majority of immature thymic lymphocytes....

  16. Feeder Cell Type Affects the Growth of In Vitro Cultured Bovine Trophoblast Cells

    Directory of Open Access Journals (Sweden)

    Islam M. Saadeldin

    2017-01-01

    Full Text Available Trophectoderm cells are the foremost embryonic cells to differentiate with prospective stem-cell properties. In the current study, we aimed at improving the current approach for trophoblast culture by using granulosa cells as feeders. Porcine granulosa cells (PGCs compared to the conventional mouse embryonic fibroblasts (MEFs were used to grow trophectoderm cells from hatched bovine blastocysts. Isolated trophectoderm cells were monitored and displayed characteristic epithelial/cuboidal morphology. The isolated trophectoderm cells expressed mRNA of homeobox protein (CDX2, cytokeratin-8 (KRT8, and interferon tau (IFNT. The expression level was higher on PGCs compared to MEFs throughout the study. In addition, primary trophectoderm cell colonies grew faster on PGCs, with a doubling time of approximately 48 hrs, compared to MEFs. PGCs feeders produced a fair amount of 17β-estradiol and progesterone. We speculated that the supplementation of sex steroids and still-unknown factors during the trophoblasts coculture on PGCs have helped to have better trophectoderm cell’s growth than on MEFs. This is the first time to use PGCs as feeders to culture trophectoderm cells and it proved superior to MEFs. We propose PGCs as alternative feeders for long-term culture of bovine trophectoderm cells. This model will potentially benefit studies on the early trophoblast and embryonic development in bovines.

  17. Lactobacillus rhamnosus GG inhibits invasion of cultured human respiratory cells by prtF1-positive macrolide-resistant group A streptococci.

    Science.gov (United States)

    Princivalli, M S; Paoletti, C; Magi, G; Palmieri, C; Ferrante, L; Facinelli, B

    2009-03-01

    This study was designed to determine whether the probiotic strain Lactobacillus GG, which is extensively used in the treatment and prevention of intestinal disorders, is able to inhibit invasion of cultured human respiratory cells by macrolide-resistant group A streptococci (GAS) carrying the prtF1 gene, which encodes the fibronectin (Fn)-binding invasin F1. Eight prtF1-positive erythromycin-resistant GAS strains were used to infect A549 monolayers in competition and displacement assays with Lactobacillus GG. Live (L-LGG) and heat-killed (HK-LGG) lactobacilli and their spent culture supernatant (SCS) significantly reduced (P Lactobacillus GG against GAS was detected. Both L-LGG and HK-LGG and all prtF1-positive GAS induced a strong agglutination reaction using Fn-coated particles. Lactobacillus GG exerts an antagonistic action against GAS by inhibiting cell invasion. Competitive binding of Lactobacillus GG and GAS to Fn might be involved in the inhibition process. The finding that Lactobacillus GG can prevent in vitro invasion of respiratory cells by GAS suggests new applications for this probiotic strain and warrants further studies of its capacity to prevent GAS throat infections.

  18. Cell Culture in Microgravity: Opening the Door to Space Cell Biology

    Science.gov (United States)

    Pellis, Neal R.; Dawson, David L. (Technical Monitor)

    1999-01-01

    Adaptational response of human cell populations to microgravity is investigated using simulation, short-term Shuttle experiments, and long-term microgravity. Simulation consists of a clinostatically-rotated cell culture system. The system is a horizontally-rotated cylinder completely filled with culture medium. Low speed rotation results in continuous-fall of the cells through the fluid medium. In this setting, cells: 1) aggregate, 2) propagate in three dimensions, 3) synthesize matrix, 4) differentiate, and 5) form sinusoids that facilitate mass transfer. Space cell culture is conducted in flight bioreactors and in static incubators. Cells grown in microgravity are: bovine cartilage, promyelocytic leukemia, kidney proximal tubule cells, adrenal medulla, breast and colon cancer, and endothelium. Cells were cultured in space to test specific hypotheses. Cartilage cells were used to determine structural differences in cartilage grown in space compared to ground-based bioreactors. Results from a 130-day experiment on Mir revealed that cartilage grown in space was substantially more compressible due to insufficient glycosaminoglycan in the matrix. Interestingly, earth-grown cartilage conformed better to the dimensions of the scaffolding material, while the Mir specimens were spherical. The other cell populations are currently being analyzed for cell surface properties, gene expression, and differentiation. Results suggest that some cells spontaneously differentiate in microgravity. Additionally, vast changes in gene expression may occur in response to microgravity. In conclusion, the transition to microgravity may constitute a physical perturbation in cells resulting in unique gene expressions, the consequences of which may be useful in tissue engineering, disease modeling, and space cell biology.

  19. Effect of Lactobacillus sp. isolates supernatant on Escherichia coli O157:H7 enhances the role of organic acids production as a factor for pathogen control

    Directory of Open Access Journals (Sweden)

    Larissa B. Poppi

    2015-04-01

    Full Text Available Many attempts have been made to establish the control of foodborne pathogens through Lactobacillus isolates and their metabolism products with success being obtained in several situations. The aim of this study was to investigate the antagonistic effect of eight Lactobacillus isolates, including L. casei subsp. pseudoplantarum, L. plantarum, L. reuteri and L. delbrueckii subsp. delbrueckii, on the pathogenic Escherichia colistrain O157:H7. The inhibitory effect of pure cultures and two pooled cultures supernatants of Lactobacillus on the growth of pathogenic bacteria was evaluated by the spot agar method and by monitoring turbidity. Antimicrobial activity was confirmed for L. reuteri and L. delbrueckii subsp. delbrueckii and for a pool of lactic acid bacteria. The neutralized supernatant of the pool exerted a higher antimicrobial activity than that of the individual strains. Furthermore, D-lactic acid and acetic acid were produced during growth of the Lactobacillus isolates studied.

  20. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure.

    Science.gov (United States)

    Akahane, M; Shimizu, T; Kira, T; Onishi, T; Uchihara, Y; Imamura, T; Tanaka, Y

    2016-11-01

    To assess the structure and extracellular matrix molecule expression of osteogenic cell sheets created via culture in medium with both dexamethasone (Dex) and ascorbic acid phosphate (AscP) compared either Dex or AscP alone. Osteogenic cell sheets were prepared by culturing rat bone marrow stromal cells in a minimal essential medium (MEM), MEM with AscP, MEM with Dex, and MEM with Dex and AscP (Dex/AscP). The cell number and messenger (m)RNA expression were assessed in vitro, and the appearance of the cell sheets was observed after mechanical retrieval using a scraper. β-tricalcium phosphate (β-TCP) was then wrapped with the cell sheets from the four different groups and subcutaneously implanted into rats. After mechanical retrieval, the osteogenic cell sheets from the MEM, MEM with AscP, and MEM with Dex groups appeared to be fragmented or incomplete structures. The cell sheets cultured with Dex/AscP remained intact after mechanical retrieval, without any identifiable tears. Culture with Dex/AscP increased the mRNA and protein expression of extracellular matrix proteins and cell number compared with those of the other three groups. More bridging bone formation was observed after transplantation of the β-TCP scaffold wrapped with cell sheets cultured with Dex/AscP, than in the other groups. These results suggest that culture with Dex/AscP improves the mechanical integrity of the osteogenic cell sheets, allowing retrieval of the confluent cells in a single cell sheet structure. This method may be beneficial when applied in cases of difficult tissue reconstruction, such as nonunion, bone defects, and osteonecrosis.Cite this article: M. Akahane, T. Shimizu, T. Kira, T. Onishi, Y. Uchihara, T. Imamura, Y. Tanaka. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure. Bone Joint Res 2016;5:569-576. DOI: 10.1302/2046-3758.511.BJR-2016-0013.R1. © 2016 Akahane et al.

  1. Experimental prestorage filtration removes antibodies and decreases lipids in RBC supernatants mitigating TRALI in vivo

    Science.gov (United States)

    Kelher, Marguerite R.; Khan, Samina Y.; LaSarre, Monica; West, F. Bernadette; Land, Kevin J.; Mish, Barbara; Ceriano, Linda; Sowemimo-Coker, Samuel

    2014-01-01

    Transfusion-related acute lung injury (TRALI) remains a significant cause of transfusion-related mortality with red cell transfusion. We hypothesize that prestorage filtration may reduce proinflammatory activity in the red blood cell (RBC) supernatant and prevent TRALI. Filters were manufactured for both small volumes and RBC units. Plasma containing antibodies to human lymphocyte antigen (HLA)-A2 or human neutrophil antigen (HNA)-3a was filtered, and immunoglobulins and specific HNA-3a and HLA-2a neutrophil (PMN) priming activity were measured. Antibodies to OX27 were added to plasma, and filtration was evaluated in a 2-event animal model of TRALI. RBC units from 31 donors known to have antibodies against HLA antigens and from 16 antibody-negative controls were filtered. Furthermore, 4 RBC units were drawn and underwent standard leukoreduction. Immunoglobulins, HLA antibodies, PMN priming activity, and the ability to induce TRALI in an animal model were measured. Small-volume filtration of plasma removed >96% of IgG, antibodies to HLA-A2 and HNA-3a, and their respective priming activity, as well as mitigating antibody-mediated in vivo TRALI. In RBC units, experimental filtration removed antibodies to HLA antigens and inhibited the accumulation of lipid priming activity and lipid-mediated TRALI. We conclude that filtration removes proinflammatory activity and the ability to induce TRALI from RBCs and may represent a TRALI mitigation step. PMID:24747436

  2. Discarded human fetal tissue and cell cultures for transplantation research

    International Nuclear Information System (INIS)

    Hay, R.J.; Phillips, T.; Thompson, A.; Vilner, L.; Cleland, M.; Tchaw-ren Chen; Zabrenetzky, V.

    1999-01-01

    A feasibility study has been performed to explore the utility of various tissues from discarded human abortuses for transplantation and related research. Specifically, aborted fetuses plus parental blood samples and all relevant clinical data were obtained through a local hospital complex. Whenever possible, pancreas, skin and skeletal muscle, heart, liver, kidney, cartilage and lung tissues were removed, dissociated and subfractionated for cryopreservation, characterization and cultivation trials in vitro. Existing protocols for these manipulations were compared and improved upon as required. Clonal culture, cell aggregate maintenance techniques and use of feeder cell populations have been utilized where appropriate to develop quantitative comparative data. Histological and biochemical assays were applied both to evaluate separation/cultivation methods and to identify optimal culture conditions for maintaining functional cells. Immunochemical and molecular biological procedures were applied to study expression of Major Histocompatibility Vomplex (MHC) class 1 and 11 molecules on cell lines derived. Tissue and cell culture populations were examined for infections with bacteria, ftingi, mycoplasma, HIV, CMV, hepatitis B and other viruses. Only 1% of the abortuses tested were virally infected. Cytogenetic analyses confin-ned the normal diploid status in the vast majority (>98%) of lines tested. A total of over 250 abortuses have been obtained and processed. Only 25 were found to be contaminated with bacteria or fungi and unsuitable for further cultivation trials. A total of over 200 cell populations were isolated, characterized and cryopreserved for further study. Included were kidney, lung, liver and epidermal epithelia: cartilage-derived cells from the spine and epiphyses plus myogenic myoblasts. Selected lines have been immortalized using HPV I 6E6/E7 sequences. Epithelia from the liver and pancreas and cardiac myocytes were the most problematic in that initial

  3. Is cell culture a risky business? Risk analysis based on scientist survey data.

    Science.gov (United States)

    Shannon, Mark; Capes-Davis, Amanda; Eggington, Elaine; Georghiou, Ronnie; Huschtscha, Lily I; Moy, Elsa; Power, Melinda; Reddel, Roger R; Arthur, Jonathan W

    2016-02-01

    Cell culture is a technique that requires vigilance from the researcher. Common cell culture problems, including contamination with microorganisms or cells from other cultures, can place the reliability and reproducibility of cell culture work at risk. Here we use survey data, contributed by research scientists based in Australia and New Zealand, to assess common cell culture risks and how these risks are managed in practice. Respondents show that sharing of cell lines between laboratories continues to be widespread. Arrangements for mycoplasma and authentication testing are increasingly in place, although scientists are often uncertain how to perform authentication testing. Additional risks are identified for preparation of frozen stocks, storage and shipping. © 2015 UICC.

  4. Mutation Analysis in Cultured Cells of Transgenic Rodents

    Directory of Open Access Journals (Sweden)

    Ahmad Besaratinia

    2018-01-01

    Full Text Available To comply with guiding principles for the ethical use of animals for experimental research, the field of mutation research has witnessed a shift of interest from large-scale in vivo animal experiments to small-sized in vitro studies. Mutation assays in cultured cells of transgenic rodents constitute, in many ways, viable alternatives to in vivo mutagenicity experiments in the corresponding animals. A variety of transgenic rodent cell culture models and mutation detection systems have been developed for mutagenicity testing of carcinogens. Of these, transgenic Big Blue® (Stratagene Corp., La Jolla, CA, USA, acquired by Agilent Technologies Inc., Santa Clara, CA, USA, BioReliance/Sigma-Aldrich Corp., Darmstadt, Germany mouse embryonic fibroblasts and the λ Select cII Mutation Detection System have been used by many research groups to investigate the mutagenic effects of a wide range of chemical and/or physical carcinogens. Here, we review techniques and principles involved in preparation and culturing of Big Blue® mouse embryonic fibroblasts, treatment in vitro with chemical/physical agent(s of interest, determination of the cII mutant frequency by the λ Select cII assay and establishment of the mutation spectrum by DNA sequencing. We describe various approaches for data analysis and interpretation of the results. Furthermore, we highlight representative studies in which the Big Blue® mouse cell culture model and the λ Select cII assay have been used for mutagenicity testing of diverse carcinogens. We delineate the advantages of this approach and discuss its limitations, while underscoring auxiliary methods, where applicable.

  5. Cultured stem cells are sensitive to gravity changes

    Science.gov (United States)

    Buravkova, L. B.; Romanov, Yu. A.; Konstantinova, N. A.; Buravkov, S. V.; Gershovich, Yu. G.; Grivennikov, I. A.

    2008-09-01

    Stem and precursor cells play an important role in development and regeneration. The state of these cells is regulated by biochemical substances, mechanical stimuli and cellular interactions. To estimate gravity effects we used two types of cultured stem cells: human mesenchymal stromal cells (hMSCs) from bone marrow and mice embryonic stem (mESC) line R1. Gravity changes were simulated by long-term (4-7 days) slow clinorotation and leaded to decreased hMSC proliferation, changes of cell morphology and modified F-actin cytoskeleton. We did not find the shifts in cell phenotype except for decreased expression of HLA 1 and CD105 but excretion of IL-6 into medium increased significantly. Remodeling of cytoskeleton started after first 4 h and was similar to preapoptotic changes. This data suggested the modification in cell adhesion and possible commitment of hMSC. It was observed that expression of alkaline phosphatase by MSC in osteogenic medium was more intensive in control. On the contrary, clinorotation did not change formation of mESC colonies and increased proliferation activity in LIF+-medium. However, the number of embryonic bodies after clinorotation was less than in static control. It is suggested that ESCs kept the viability and proliferative potential but decreased the differentiation ability after changes in gravity stimulation.

  6. Assay of anticancer drugs in tissue culture: cell cultures of biopsies from human astrocytoma.

    Science.gov (United States)

    Morgan, D; Freshney, R I; Darling, J L; Thomas, D G; Celik, F

    1983-02-01

    A method has been developed for measuring the drug sensitivity of human gliomas in short-term culture, using scintillation counting or autofluorography. Cell cultures prepared from malignant astrocytomas were treated with anticancer drugs whilst in exponential growth in microtitration plates. After drug treatment and a recovery period, residual viability was measured by [3H] leucine incorporation followed by scintillation counting or by [35S] methionine incorporation and autofluorography in situ. In 5 glioma cell lines tested against 6 drugs, the microtitration method correlated well with monolayer cloning. Although replicate samples of the same tumour showed little variation in chemosensitivity, there was marked variation between the chemosensitivities of cultures derived from the tumours of different patients. However, as variability between replicates was apparent during drug exposure or shortly after, it is important to allow the assay to run as long as possible after drug removal. It is hoped that this assay may provide the basis of a method for the prediction of in vivo chemosensitivity or the screening of potential chemotherapeutic drugs.

  7. 21 CFR 864.2220 - Synthetic cell and tissue culture media and components.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Synthetic cell and tissue culture media and... Products § 864.2220 Synthetic cell and tissue culture media and components. (a) Identification. Synthetic cell and tissue culture media and components are substances that are composed entirely of defined...

  8. Comparison of chromosome analysis using cell culture by coverslip technique with flask technique.

    Science.gov (United States)

    Sajapala, Suraphan; Buranawut, Kitti; NiwatArunyakasemsuk, Md

    2014-02-01

    To determine accuracy rate ofchromosome study from amniotic cellculture by coverslip technique compared with flask technique and to compared timing ofamniotic cell culture, amount ofamniotic cell culture media and cost ofamniotic cell culture. Cross sectional study. Department of Obstetrics and Gynecology, Phramongkutklao Hospital. Subjects: 70 pregnant women who underwent amniocentesis at Phramongkutklao Hospital during November 1, 2007 to February 29, 2008. Amniotic cell culture by flask technique and coverslip technique. Accuracy of amniotic cell culture for chromosome study by coverslip technique compared with flask technique. Totally 70 pregnant women who underwent to amniocentesis and dividedamniotic fluid to cell culture by flask technique and coverslip technique. 69 samples had similar resultfrom both techniques. The only one sample had cell culture failure inboth methods due to blood contamination. Accuracy in coverslip technique was 100% compared with flask technique. In timing of amniotic cell culture, amount ofamniotic cell culture media and cost of amniotic cell culture between 2 methods that coverslip technique was lesser than flask technique. There is statistically significant of accuracy in chromosome result between coverslip technique and flask technique. Coverslip technique was lesser than flask technique in timing, amniotic cell culture media and costs ofamniotic cell culture.

  9. Feruloyl Oligosaccharides from Cell Walls of Suspension-Cultured Spinach Cells and Sugar Beet Pulp : STRUCTURE AND FUNCTION OF CELLS

    OpenAIRE

    Tadashi, ISHII; Forestry and Forest Products Research Institute

    1994-01-01

    Cell walls of suspension-cultured spinach cells and sugar beet pulp were separately hydrolyzed with Driselase. A feruloyl arabinobiose was isolated from both spinach cells and sugar beet. Four feruloyl oligosaccharides were obtained from sugar beet. The four oligosaccharides were characterized by NMR spectroscopy, methylation analysis and FAB-MS.

  10. Glycosylation-mediated phenylpropanoid partitioning in Populus tremuloides cell cultures

    Directory of Open Access Journals (Sweden)

    Babst Benjamin A

    2009-12-01

    Full Text Available Abstract Background Phenylpropanoid-derived phenolic glycosides (PGs and condensed tannins (CTs comprise large, multi-purpose non-structural carbon sinks in Populus. A negative correlation between PG and CT concentrations has been observed in several studies. However, the molecular mechanism underlying the relationship is not known. Results Populus cell cultures produce CTs but not PGs under normal conditions. Feeding salicyl alcohol resulted in accumulation of salicins, the simplest PG, in the cells, but not higher-order PGs. Salicin accrual reflected the stimulation of a glycosylation response which altered a number of metabolic activities. We utilized this suspension cell feeding system as a model for analyzing the possible role of glycosylation in regulating the metabolic competition between PG formation, CT synthesis and growth. Cells accumulated salicins in a dose-dependent manner following salicyl alcohol feeding. Higher feeding levels led to a decrease in cellular CT concentrations (at 5 or 10 mM, and a negative effect on cell growth (at 10 mM. The competition between salicin and CT formation was reciprocal, and depended on the metabolic status of the cells. We analyzed gene expression changes between controls and cells fed with 5 mM salicyl alcohol for 48 hr, a time point when salicin accumulation was near maximum and CT synthesis was reduced, with no effect on growth. Several stress-responsive genes were up-regulated, suggestive of a general stress response in the fed cells. Salicyl alcohol feeding also induced expression of genes associated with sucrose catabolism, glycolysis and the Krebs cycle. Transcript levels of phenylalanine ammonia lyase and most of the flavonoid pathway genes were reduced, consistent with down-regulated CT synthesis. Conclusions Exogenous salicyl alcohol was readily glycosylated in Populus cell cultures, a process that altered sugar utilization and phenolic partitioning in the cells. Using this system, we

  11. EFFECT OF MACROLIDE ANTIBIOTICS ON VARIOUS CELL CULTURES IN VITRO: 1. CELL MORPHOLOGY

    Directory of Open Access Journals (Sweden)

    Renáta Kováčová

    2012-08-01

    Full Text Available The aim of our study was to evaluate the cytotoxicity of macrolide antibiotics (tilmicosin, tylosin and spiramycin of various concentrations on different cell cultures in vitro. Cellular lines from animal tissues (VERO cells - kidney cells of Macacus rhesus, FE cells - feline embryonal cells, BHK 21 cellular line from young hamster kidneys were used. Tilmicosin effect: BHK cells are most sensitive, significant decrease in vital cells occurs already at the concentration of 50 μg.ml-1. VERO cells were most resistant, significant decrease of vital cells was observed only at the concentration of 300 μg.ml-1. Tylosin effect: BHK cells can be considered most sensitive, since at concentrations higher than 500 μg.ml-1, no vital cells were observed. At the concentration of 1000 μg.ml-1 were 3.13% of vital and 70.52% of subvital FE cells. In Vero cells, we observed a significant decrease at the concentration of 750 μg.ml-1. Spiramycin effect: Significant decrease of vital BHK cells was observed at the concentration of 150 μg.ml-1, at the concentration of 300 μg.ml-1, no vital cells and only 7.53% of subvital cells were observed. At the concentration of 500 μg.ml-1 reported 10.34% of vital FE cells. At the concentration of 500 μg.ml-1 22.48% of vital and 71.16% of subvital VERO cells were recorded.

  12. Rheological characteristics of cell suspension and cell culture of Perilla frutescens.

    Science.gov (United States)

    Zhong, J J; Seki, T; Kinoshita, S; Yoshida, T

    1992-12-05

    Physical properties such as viscosity, fluid dynamic behavior of cell suspension, and size distribution of cell aggregates of a plant, Perilla frustescens, cultured in a liquid medium were studied. As a result of investigations using cells harvester after 12 days of cultivation in a flask, it was found that the apparent viscosity of the cell suspension did not change with any variation of cell concentration below 5 g dry cell/L but markedly increased when the cell concentration increased over 12.8 g dry cell/L. The cell suspension exhibited the characteristics of a Bingham plastic fluid with a small yield stress. The size of cell aggregates in the range 74 to 500 mum did not influence the rheological characteristics of the cell suspension. The rheological characteristics of cultivation mixtures of P. frutescens cultivated in a flask and in a bioreactor were also investigated. The results showed that the flow characteristics of the cell culture could be described by a Bingham plastic model. At the later stage of cultivation, the apparent viscosity increased steadily, even though the biomass concentration (by dry weight) decreased, due to the increase of individual cell size. (c) 1992 John Wiley & Sons, Inc.

  13. Cell thickness of UV absorption by the cell: relation to UV action spectrum shift in mammalian cells in culture

    International Nuclear Information System (INIS)

    Sakharov, V.H.; Voronkova, L.N.; Blokhin, A.V.

    1985-01-01

    By means of reconstruction of series half - thin transverse sections the three - dimensional morphometry of SPEV cells for a series of their specific states in culture is performed: for exponential growth in a monolayer, in a merged monolayer, in the mitosis phase, for giant cells and suspension cells. In the monolayer the cell thickness in its central part depended mainly on the nucleus thickness and in average changed but slightly despite a wide range of changes in volumes of nuclei and cells and their density in culture. The cell thickness has noticeably increased in mitosis. For the above states of cells UV radiation absorption spectra are determined. It is shown that a certain shift of action spectrus of death of mammalian cells as compared with that for bacterial cell can be a seguence of selfshielding and not differences in the nature of active chromophores

  14. In vitro cell culture lethal dose submitted to gamma radiation

    International Nuclear Information System (INIS)

    Moreno, Carolina S.; Rogero, Sizue O.; Rogero, Jose Roberto; Ikeda, Tamiko I.; Cruz, Aurea S.

    2009-01-01

    The present study was designed to evaluate the in vitro effect of gamma radiation in cell culture of mouse connective tissue exposed to different doses of gamma radiation and under several conditions. The cell viability was analyzed by neutral red uptake methodology. This assay was developed for establish a methodology to be used in the future in the study of resveratrol radioprotection. Resveratrol (3,4',5- trihydroxystilbene), a phenolic phytoalexin that occurs naturally in some spermatophytes, such as grapevines, in response to injury as fungal infections and exposure to ultraviolet light. In the wines this compound is found at high levels and is considered one of the highest antioxidant constituents. The intense antioxidant potential of resveratrol provides many pharmacological activities including cardioprotection, chemoprevention and anti-tumor effects. Our results demonstrated that 60 Co gamma radiation lethal dose (LD50) on NCTC clone 929 cells was about 340Gy. (author)

  15. Sulphur XANES Analysis of Cultured Human Prostate Cancer Cells

    International Nuclear Information System (INIS)

    Kwiatek, W.M.; Podgorczyk, M.; Paluszkiewicz, Cz.; Balerna, A.; Kisiel, A.

    2008-01-01

    Prostate cancer is one of the most commonly diagnosed cancers in men throughout the world. It is believed that changes to the structure of protein binding sites, altering its metabolism, may play an important role in carcinogenesis. Sulphur, often present in binding sites, can influence such changes through its chemical speciation. Hence there is a need for precise investigation of coordination environment of sulphur. X-ray absorption near edge structure spectroscopy offers such possibility. Cell culture samples offer histologically well defined areas of good homogeneity, suitable for successful and reliable X-ray absorption near edge structure analysis. This paper presents sulphur speciation data collected from three different human prostate cancer cell lines (PC-3, LNCaP and DU-145). Sulphur X-ray absorption near edge structure analysis was performed on K-edge structure. The spectra of cells were compared with those of cancerous tissue and with organic substances as well as inorganic compounds. (authors)

  16. Propagation and isolation of ranaviruses in cell culture

    DEFF Research Database (Denmark)

    Ariel, Ellen; Nicolajsen, Nicole; Christophersen, Maj-Britt

    2009-01-01

    The optimal in vitro propagation procedure for a panel of ranavirus isolates and the best method for isolation of Epizootic haematopoietic necrosis virus (EHNV) from organ material in cell-culture were investigated. The panel of ranavirus isolates included: Frog virus 3 (FV3), Bohle iridovirus (BIV......), Pike-perch iridovirus (PPIV), European catfish virus (ECV), European sheatfish virus (ESV), EHNV, Doctor fish virus (DFV), Guppy virus 6 (GF6), short-finned eel virus (SERV) and Rana esculenta virus Italy 282/102 (REV 282/102). Each isolate was titrated in five cell lines: bluegill fry (BF-2...... consistently produced lower titers than the other cell lines at all temperatures. The optimal temperature for propagating the isolates collectively to high titers in vivo was 24 °C. Additionally, three established methods for re-isolation of virus from EHNV-infected organ material were compared. Challenged...

  17. Test procedures and instructions for Hanford complexant concentrate supernatant cesium removal using CST

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W.

    1997-01-08

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Complexant Concentrate supernatant liquor from tank 241-AN-107, in a bench-scale column. The cesium sorbent to be tested is crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-023, Hanford Complexant Concentrate Supernatant Cesium Removal Test Plan.

  18. Test procedures and instructions for Hanford tank waste supernatant cesium removal

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W., Westinghouse Hanford

    1996-05-31

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test using Hanford Double-Shell Slurry Feed supernatant liquor from tank 251-AW-101 in a bench-scale column.Cesium sorbents to be tested include resorcinol-formaldehyde resin and crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-022, Hanford Tank Waste Supernatant Cesium Removal Test Plan.

  19. Optimization of Storage Temperature for Cultured ARPE-19 Cells

    Directory of Open Access Journals (Sweden)

    Lara Pasovic

    2013-01-01

    Full Text Available Purpose. The establishment of future retinal pigment epithelium (RPE replacement therapy is partly dependent on the availability of tissue-engineered RPE cells, which may be enhanced by the development of suitable storage methods for RPE. This study investigates the effect of different storage temperatures on the viability, morphology, and phenotype of cultured RPE. Methods. ARPE-19 cells were cultured under standard conditions and stored in HEPES-buffered MEM at nine temperatures (4°C, 8°C, 12°C, 16°C, 20°C, 24°C, 28°C, 32°C, and 37°C for seven days. Viability and phenotype were assessed by a microplate fluorometer and epifluorescence microscopy, while morphology was analyzed by scanning electron microscopy. Results. The percentage of viable cells preserved after storage was highest in the 16°C group (48.7%±9.8%; P<0.01 compared to 4°C, 8°C, and 24°C–37°C; P<0.05 compared to 12°C. Ultrastructure was best preserved at 12°C, 16°C, and 20°C. Expression of actin, ZO-1, PCNA, caspase-3, and RPE65 was maintained after storage at 16°C compared to control cells that were not stored. Conclusion. Out of nine temperatures tested between 4°C and 37°C, storage at 12°C, 16°C, and 20°C was optimal for maintenance of RPE cell viability, morphology, and phenotype. The preservation of RPE cells is critically dependent on storage temperature.

  20. A Cell Culture Approach to Optimized Human Corneal Endothelial Cell Function

    Science.gov (United States)

    Bartakova, Alena; Kuzmenko, Olga; Alvarez-Delfin, Karen; Kunzevitzky, Noelia J.; Goldberg, Jeffrey L.

    2018-01-01

    Purpose Cell-based therapies to replace corneal endothelium depend on culture methods to optimize human corneal endothelial cell (HCEC) function and minimize endothelial-mesenchymal transition (EnMT). Here we explore contribution of low-mitogenic media on stabilization of phenotypes in vitro that mimic those of HCECs in vivo. Methods HCECs were isolated from cadaveric donor corneas and expanded in vitro, comparing continuous presence of exogenous growth factors (“proliferative media”) to media without those factors (“stabilizing media”). Identity based on canonical morphology and expression of surface marker CD56, and function based on formation of tight junction barriers measured by trans-endothelial electrical resistance assays (TEER) were assessed. Results Primary HCECs cultured in proliferative media underwent EnMT after three to four passages, becoming increasingly fibroblastic. Stabilizing the cells before each passage by switching them to a media low in mitogenic growth factors and serum preserved canonical morphology and yielded a higher number of cells. HCECs cultured in stabilizing media increased both expression of the identity marker CD56 and also tight junction monolayer integrity compared to cells cultured without stabilization. Conclusions HCECs isolated from donor corneas and expanded in vitro with a low-mitogenic media stabilizing step before each passage demonstrate more canonical structural and functional features and defer EnMT, increasing the number of passages and total canonical cell yield. This approach may facilitate development of HCEC-based cell therapies. PMID:29625488

  1. Cell in situ zymography: an in vitro cytotechnology for localization of enzyme activity in cell culture.

    Science.gov (United States)

    Chhabra, Aastha; Jaiswal, Astha; Malhotra, Umang; Kohli, Shrey; Rani, Vibha

    2012-09-01

    In situ zymography is a unique technique for detection and localization of enzyme-substrate interactions majorly in histological sections. Substrate with quenched fluorogenic molecule is incorporated in gel over which tissue sections are mounted and then incubated in buffer. The enzymatic activity is observed in the form of fluorescent signal. With the advancements in the field of biological research, use of in vitro cell culture has become very popular and holds great significance in multiple fields including inflammation, cancer, stem cell biology and the still emerging 3-D cell cultures. The information on analysis of enzymatic activity in cell lines is inadequate presently. We propose a single-step methodology that is simple, sensitive, cost-effective, and functional to perform and study the 'in position' activity of enzyme on substrate for in vitro cell cultures. Quantification of enzymatic activity to carry out comparative studies on cells has also been illustrated. This technique can be applied to a variety of enzyme classes including proteases, amylases, xylanases, and cellulases in cell cultures.

  2. Co-culture of Mouse Embryonic Stem Cells with Sertoli Cells Promote in vitro Generation of Germ Cells

    Directory of Open Access Journals (Sweden)

    Mohammad Miryounesi

    2013-06-01

    Full Text Available   Objective(s: Sertoli cells support in vivo germ cell production; but, its exact mechanism has not been well understood. The present study was designed to analyze the effect of Sertoli cells in differentiation of mouse embryonic stem cells (mESCs to germ cells.   Materials and Methods: A fusion construct composed of a Stra8 gene promoter and the coding region of enhanced green fluorescence protein was produced to select differentiated mESCs. To analyze sertoli cells’ effect in differentiation process, mESCs were separated into two groups: the first group was cultured on gelatin with retinoic acid treatment and the second group was co-cultured with sertoli cell feeder without retinoic acid induction. Expressions of pre-meiotic (Stra8, meiotic (Dazl and Sycp3 and post-meiotic (Prm1 genes were evaluated at different differentiation stages (+7, +12 and +18 days of culture. Results: In the first group, expressions of meiotic and post-meiotic genes started 12 and 18 days after induction with retinoic acid, respectively. In the second group, 7 days after co-culturing with Sertoli cells, expression of meiotic and post-meiotic genes was observed. Conclusion: These results show that differentiation process to germ cells is supported by Sertoli cells. Our findings provide a novel effective approach for generation of germ cell in vitro and studying the interaction of germ cells with their niche.

  3. Defining cell culture conditions to improve human norovirus infectivity assays

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Hutchison, Janine R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Bartholomew, Rachel A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Valdez, Catherine O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Valentine, Nancy B. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Dohnalkova, Alice [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Ozanich, Richard M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Bruckner-Lea, Cindy J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2013-01-10

    Significant difficulties remain for determining whether human noroviruses (hNoV) recovered from water, food, and environmental samples are infectious. Three-dimensional tissue culture of human intestinal cells has shown promise in developing an infectivity assay, but reproducibility, even within a single laboratory, remains problematic. From the literature and our observations, we hypothesized that the common factors that leads to more reproducible hNoV infectivity in vitro requires that the cell line be 1) of human gastrointestinal origin, 2) expresses apical microvilli, and 3) be a positive secretor cell line. The C2BBe1 cell line, which is a brush-border producing clone of Caco-2, meets these three criteria. When challenged with Genogroup II viruses, we observed a 2 Log10 increase in viral RNA titer. A passage experiment with GII viruses showed evidence of the ability to propagate hNoV by both reverse transcription quantitative PCR (qRT-PCR) and microscopy. Using 3-D C2BBe1 cells improves reproducibility of the infectivity assay for hNoV, but the assay can still be variable. Two sources of variability include the cells themselves (mixed phenotypes of small and large intestine) and initial titer measurements using quantitative reverse transcription PCR (qRT-PCR) that measures all RNA vs. plaque assays that measure infectious virus.

  4. Centering Single Cells in Microgels via Delayed Crosslinking Supports Long-Term 3D Culture by Preventing Cell Escape

    NARCIS (Netherlands)

    Kamperman, Tom; Henke, Sieger; Visser, Claas Willem; Karperien, Marcel; Leijten, Jeroen

    2017-01-01

    Single-cell-laden microgels support physiological 3D culture conditions while enabling straightforward handling and high-resolution readouts of individual cells. However, their widespread adoption for long-term cultures is limited by cell escape. In this work, it is demonstrated that cell escape is

  5. Quantitation of DNA repair in brain cell cultures: implications for autoradiographic analysis of mixed cell populations

    International Nuclear Information System (INIS)

    Dambergs, R.; Kidson, C.

    1979-01-01

    Quantitation of DNA repair in the mixed cell population of mouse embryo brain cultures has been assessed by autoradiographic analysis of unscheduled DNA synthesis following UV-irradiation. The proportion of labelled neurons and the grain density over neuronal nuclei were both less than the corresponding values for glial cells. The nuclear geometries of these two classes of cell are very different. Partial correction for the different geometries by relating grain density to nuclear area brought estimates of neuronal and glial DNA repair synthesis more closely in line. These findings have general implications for autoradiographic measurement of DNA repair in mixed cell populations and in differentiated versus dividing cells. (author)

  6. Synthesis of Th17 cytokines in the culture of peripheral blood mononuclear cells stimulated with Borrelia burgdorferi sensu lato

    Directory of Open Access Journals (Sweden)

    Sambor Grygorczuk

    2016-06-01

    Full Text Available [b]Introduction and objective. [/b]Th17 lymphocytes and their cytokines, interleukin 17A (IL-17A, IL-17F and IL-22, participate in the response to extracellular bacteria and in the autoimmunity and may be engaged in the pathogenesis of Lyme borreliosis. Concentrations were measured of IL-17A, IL-17F and IL-22 in the supernatant of the peripheral blood mononuclear cells (PBMC culture stimulated with [i]Borrelia burgdorferi sensu lato[/i] ([i]B. burgdorferi[/i]. [b]Materials and method.[/b] The study group consisted of 13 patients with early disseminated and late Lyme borreliosis and a control group of 7 healthy persons. PBMC cultures were stimulated for 48 hours with [i]B. burgdorferi [/i]spirochetes of three pathogenic species: [i]B. burgdorferi[/i] sensu stricto, B. afzelii or B. garinii, in the multiplicity of infection 10:1. Concentrations of Th17 cytokines IL-17A, IL-17F and IL-22, as well as Th2/immunoregulatory cytokine IL-10 were measured with ELISA assays. [b]Results. [/b]Expression of IL-17A, IL-17F and IL-22 increased under stimulation, simultaneously with the increased IL-10 expression. Concentration of IL-17F tended to be lower in early neuroborreliosis than in late Lyme borreliosis and than in controls. [i]B. afzelii[/i] elicited higher expression of IL-17A than the other two species. [b]Conclusions.[/b] IL-17A, IL-17F and IL-22 are synthesized simultaneously by PBMC stimulated with [i]B. burgdorferi[/i]. There is no antagonism between Th17 response and IL-10 expression. The role of Th17 cytokines seems to differ depending on the clinical stage of Lyme borreliosis and on the [i]B. burgdorferi[/i] species.

  7. EFFECT OF MACROLIDE ANTIBIOTICS ON VARIOUS CELL CULTURES IN VITRO: 2. CELL BIOCHEMISTRY

    Directory of Open Access Journals (Sweden)

    Anton Kováčik

    2012-12-01

    Full Text Available he aim of our study was to evaluate the effect of macrolide antibiotics (tilmicosin, tylosin and spiramycin on the cellular biochemistry using different cell cultures in vitro. Cellular lines from animal tissues (VERO cells - kidney cells of Macacus Rhesus, FE cells - feline embryonal cells and BHK21 - cellular line from young hamster kidneys were used. The effect was assessed after 24 hours of culture. We studied the concentration of calcium (Ca, magnesium (Mg, sodium (Na, potassium (K, chlorides (Cl, total proteins (TP and cholesterol (Chol. Biochemical analysis of BHK21 cells cultivated with tilmicosin showed a significant decrease in the concentration of Ca, Cl and TP in almost all experimental groups. No significant differences were found in the FE cells. The highest concentrations of tilmicosin led to a significant increase of all analyzed elements and TP in medium in the VERO cells. The effect of tylosin on the BHK21 cell metabolism showed a significant decrease in the concentration of Na and Cl in the all experimental groups and a significant decrease in the concentration of TP in the groups to which more than 700 µg.ml-1 was added. No significant differences were found in the FE and VERO cells. Biochemical analysis of BHK21 cells with spyramicin showed a significant decrease in the concentration of Na in the all experimental groups and a significant decrease in the concentration of Cl and TP in the cell cultures with 100 µg.ml-1, 150 µg.ml-1, 200 µg.ml-1, 300 µg.ml-1 concentrations of spyramycin. The highest concentrations of spyramycin caused a significant increase of Na and a significant decrease of Chol in the FE cells. No significant differences were found in the VERO cells except increased total proteins at the highest concentration of spyramycin.

  8. Regulation of Taurine transporter activity in cultured rat retinal ganglion cells and rat retinal Muller Cells

    International Nuclear Information System (INIS)

    Eissa, Laila A.; Smith, Sylvia B.; El-sherbeny, Amira A.

    2006-01-01

    Diabetic retinopathy is one of the most common complications of diabetes. The amino acid taurine is believed to play an antioxidant protective role in diabetic retinopathy through the scavenging of the reactive species. It is not well established whether taurine uptake is altered in retina cells during diabetic conditions. Thus, the present study was designed to investigate the changes in taurine transport in cultures of rat retinal Muller cells and rat retinal ganglion cells under conditions associated with diabetes. Taurine was abundantly taken up by retinal Muller cells and rat retinal ganglion cells under normal glycemic condition. Taurine was actively transported to rat Muller cells and rat retinal ganglion cells in a Na and Cl dependant manner. Taurine uptake further significantly elevated in both type of cells after the incubation with high glucose concentration. This effect could be attributed to the increase in osmolarity. Because Nitric Oxide (NO) is a molecule implicated in the pathogenesis of diabetes, we also determined the activity of taurine transporter in cultured rat retinal Muller cells and rat retinal ganglion cells in the presence of the NO donors, SIN-1 and SNAP. Taurine uptake was elevated above control value after 24-h incubation with low concentration of NO donors. We finally investigated the ability of neurotoxic glutamate to change taurine transporter activity in both types of cells. Uptake of taurine was significantly increased in rat retinal ganglion cells when only incubated with high concentration of glutamate. Our data provide evidence that taurine transporter is present in cultured rat retinal ganglion and Muller cells and is regulated by hyperosmolarity. The data are relevant to disease such as diabetes and neuronal degeneration where retinal cell volume may dramatically change. (author)

  9. A biocompatible micro cell culture chamber for culturing and on-line monitoring of Eukaryotic cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael

    2006-01-01

    Visualisering af cellulære processer over længere tidsperioder har været besværliggjort af cellernes krav til varme, fugtighed og et fysiologisk pH balanceret medie. Fremskridt indenfor mikro teknologi har muliggjort fabrikation af miniaturiserede celle kultur anordninger der er i stand til...... at holde celler i live over længere tidsperioder I det foreliggende arbejde præsenteres et nyt perfusions baseret mikro celle dyrknings kultur kammer med integreret termisk overvågning og regulering. Kammeret opretholdt både dyrkning og on-line overvågning af både kræft celler såvel som stam celler over...... at dyrknings betingelserne i kammeret var sammenlignelige med dem i konventionelle celle kultur dyrknings flaske, hvis lys intensiteten på mikroskopet og omgivelserne blev minimeret mest muligt. Overflade modificeringer af den strukturelle fotoresist SU-8, der ofte bliver brugt til fabrikation af mikro kanaler...

  10. ( Linum usitatissimum L. cv. Modran cell suspension culture

    Directory of Open Access Journals (Sweden)

    Aleksandra Seta-Koselska

    2018-01-01

    Full Text Available Flax ( Linum usitatissimum L. is an ancient crop that is widely cultivated as a source of oil, fiber, and bioactive compounds. Flax fiber is traditionally used in textile industry, linseed oil is processed for industrial oils, paints, varnishes and bio-petroleum. Flaxseeds are also rich in α-linolenic acid and phytochemicals such as lignans. In addition to the commercial aspects, this species has been used widely and readily in biotechnological, developmental, and plant-pathogen interaction studies. Differences in the levels of endogenous hormones in various cultivars of flax significantly affected the intensity of callogenesis and determined the type and concentration of growth regulators necessary for callus production. The aim of our investigation was to optimize the culture conditions for callus formation and cell proliferation in liquid medium of the Polish cultivar of fiber flax – Modran. In the first step, 4 combinations of phytohormones in the medium were tested to obtain established callus tissue suitable for initiation of suspension culture. Next, we investigated the effect of chosen plant growth regulators on cell divisions, fresh and dry weight, and dispersal of callus cells in liquid medium. Fast growing and friable callus was obtained in a modified MS medium supplemented with 0.5 mg/l BAP and 0.1 mg/l NAA. We determined that for the initiation of cell suspension supplementation with 0.5 mg/l BAP and 0.5 mg/l NAA is optimal. The results obtained indicated that high concentration of cytokinin (BAP in liquid medium limited cell proliferation and decreased biomass formation.

  11. Nucleoside transport in primary cultured rabbit tracheal epithelial cells.

    Science.gov (United States)

    Mathias, Neil R; Wu, Sharon K; Kim, Kwang-Jin; Lee, Vincent H L

    2005-01-01

    The present study aimed at elucidating the mechanisms of nucleoside transport in primary cultured rabbit tracheal epithelial cells (RTEC) grown on a permeable filter support. Uptake of (3)H-uridine, the model nucleoside substrate, from the apical fluid of primary cultured RTEC was examined with respect to its dependence on Na(+), substrate concentration, temperature and its sensitivity to inhibitors, other nucleosides and antiviral nucleoside analogs. Apical (3)H-uridine uptake in primary cultured RTEC was strongly dependent on an inward Na(+) gradient and temperature. Ten micromolar nitro-benzyl-mercapto-purine-ribose (NBMPR) (an inhibitor of es-type nucleoside transport in the nanomolar range) did not further inhibit this process. (3)H-uridine uptake from apical fluid was inhibited by basolateral ouabain (10 microM) and apical phloridzin (100 microM), indicating that uptake may involve a secondary active transport process. Uridine uptake was saturable with a K(m) of 3.4 +/- 1.8 microM and the V(max) of 24.3 +/- 5.2 pmoles/mg protein/30 s. Inhibition studies indicated that nucleoside analogs that have a substitution on the nucleobase competed with uridine uptake from apical fluid, but those with modifications on the ribose sugar including acyclic analogs were ineffective. The pattern of inhibition of apical (3)H-uridine, (3)H-inosine and (3)H-thymidine uptake into RTEC cells by physiological nucleosides was consistent with multiple systems: A pyrimidine-selective transport system (CNT1); a broad nucleoside substrate transport system that excludes inosine (CNT4) and an equilibrative NBMPR-insensitive nucleoside transport system (ei type). These results indicate that the presence of apically located nucleoside transporters in the epithelial cells lining the upper respiratory tract can lead to a high accumulation of nucleosides in the trachea. At least one Na(+)-dependent, secondary, active transport process may mediate the apical absorption of nucleosides or

  12. Designing media for animal cell culture: CHO cells, the industrial standard.

    Science.gov (United States)

    Landauer, Karlheinz

    2014-01-01

    The success of culturing CHO cells solely depends on functionality of the used media. Cell culture technology is more than 50 years old, and the knowledge of cell requirements increased steadily. In the beginning, animal-sourced components were the key to growth. Nowadays state-of-the-art media do not contain any animal or naturally sourced components. The compositions are based on scientific awareness of the needs of the cells. The result is high lot-to-lot consistency and high performance.In this book section, a method for the development of a synthetic, animal component-free medium is described. The composition is based on public available formulations and information based on the work of many scientists printed in numerous papers and manuscripts. The method shall help beginners to design their own medium, although some knowledge of biochemistry and animal cells is still required.

  13. Cell-transforming activity and genotoxicity of phenolphthalein in cultured Syrian hamster embryo cells.

    Science.gov (United States)

    Tsutsui, T; Tamura, Y; Yagi, E; Hasegawa, K; Tanaka, Y; Uehama, A; Someya, T; Hamaguchi, F; Yamamoto, H; Barrett, J C

    1997-11-27

    Phenolphthalein is a cathartic agent widely used in non-prescription laxatives. For the simultaneous assessment of in vitro carcinogenicity and mutagenicity of phenolphthalein, the ability of this chemical to induce cell transformation and genetic effects was examined using the Syrian hamster embryo (SHE) cell model. Cell growth was reduced by treatment with phenolphthalein at 10-40 microM in a dose-related manner. Treatment with phenolphthalein for 48 hr induced a dose-dependent increase in morphological transformation of SHE cells. Over the dose range that resulted in cell transformation ( 10-40 microM), treatment of SHE cells with phenolphthalein induced gene mutations at the hprt locus but not at the Na+/K+ ATPase locus. A statistically significant level of chromosomal aberrations was elicited in SHE cells treated with phenolphthalein at the highest dose (40 microM). Meanwhile, neither numerical chromosomal changes nor DNA adduct formation, analyzed by the nuclease P1 enhancement version of 32P-post-labeling, were induced by treatment with phenolphthalein at any concentrations examined. We thus report cell-transforming activity and mutagenicity of phenolphthalein assessed with the same mammalian cells in culture. Our results provide evidence that phenolphthalein has cell-transforming and genotoxic activity in cultured mammalian cells. The mutagenic and clastogenic activities of phenolphthalein could be a causal mechanism for carcinogenicity in rodents.

  14. Cell and Molecular Biology of Ataxia Telangiectasia Heterozygous Human Mammary Epithelial Cells Irradiated in Culture

    Science.gov (United States)

    Richmond, Robert C.

    2001-01-01

    Autologous isolates of cell types from obligate heterozygotes with the autosomal disorder ataxia-telangiectasia (A-T)were used to begin a tissue culture model for assessing pathways of radiation-induced cancer formation in this target tissue. This was done by establishing cultures of stromal fibroblasts and long-term growth human mammary epithelial cells (HMEC) in standard 2-dimensional tissue culture in order to establish expression of markers detailing early steps of carcinogenesis. The presumptive breast cancer susceptibility of A-T heterozygotes as a sequel to damage caused by ionizing radiation provided reason to study expression of markers in irradiated HMEC. Findings from our study with HMEC have included determination of differences in specific protein expression amongst growth phase (e.g., log vs stationary) and growth progression (e.g., pass 7 vs pass 9), as well as differences in morphologic markers within populations of irradiated HMEC (e.g., development of multinucleated cells).

  15. Cell Homogeneity Indispensable for Regenerative Medicine by Cultured Human Corneal Endothelial Cells.

    Science.gov (United States)

    Hamuro, Junji; Toda, Munetoyo; Asada, Kazuko; Hiraga, Asako; Schlötzer-Schrehardt, Ursula; Montoya, Monty; Sotozono, Chie; Ueno, Morio; Kinoshita, Shigeru

    2016-09-01

    To identify the subpopulation (SP) among heterogeneous cultured human corneal endothelial cells (cHCECs) devoid of cell-state transition applicable for cell-based therapy. Subpopulation presence in cHCECs was confirmed via surface CD-marker expression level by flow cytometry. CD markers effective for distinguishing distinct SPs were selected by analyzing those on established cHCECs with a small cell area and high cell density. Contrasting features among three typical cHCEC SPs was confirmed by PCR array for extracellular matrix (ECM). Combined analysis of CD markers was performed to identify the SP (effector cells) applicable for therapy. ZO-1 and Na+/K+ ATPase, CD200, and HLA expression were compared among heterogeneous SPs. Flow cytometry analysis identified the effector cell expressing CD166+CD105-CD44-∼+/-CD26-CD24-, but CD200-, and the presence of other SPs with CD166+ CD105-CD44+++ (CD26 and CD24, either + or -) was confirmed. PCR array revealed three distinct ECM expression profiles. Some SPs expressed ZO-1 and Na+/K+ ATPase at comparable levels with effector cells, while only one SP expressed CD200, but not on effector cells. Human leukocyte antigen expression was most reduced in the effector SP. The proportion of effector cells (E-ratio) inversely paralleled donor age and decreased during prolonged culture passages. The presence of Rho-associated protein kinase (ROCK) inhibitor increased the E-ratio in cHCECs. The average area of effector cells was approximately 200∼220 μm2, and the density of cHCECs exceeded 2500 cells/mm2. A specified cultured effector cell population sharing the surface phenotypes with mature HCECs in corneal tissues may serve as an alternative to donor corneas for the treatment of corneal endothelial dysfunction.

  16. Studying endosomes in cultured neurons by live-cell imaging.

    Science.gov (United States)

    Lasiecka, Zofia M; Winckler, Bettina

    2016-01-01

    Endosomes play critical roles on regulating surface receptor levels as well as signaling cascades in all cell types, including neurons. Endocytosis and endosomal trafficking is routinely studied after fixation, but live imaging is increasingly being used to capture the dynamic nature of endosomes and is allowing increasingly sophisticated glimpses into trafficking processes in live neurons. In this chapter, we describe the basics of neuronal primary cultures, methods for expressing fluorescent proteins, and live imaging of cargos and endosomal regulators. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  18. Further characterization of the adhesive-tumor-cell culture system for measuring the radiosensitivity of human tumor primary cultures

    International Nuclear Information System (INIS)

    Brock, W.A.; Bock, S.P.; Williams, M.; Baker, F.L.

    1987-01-01

    This study extends the use of the adhesive-tumor-cell culture system to include: over 100 sensitivity measurements at 2.0 Gy; tumorgenicity determinations in nude mice; and flow cytometry of the cells grown in the system. The malignant nature of the growing cells was proved by injecting cells into nude mice. Tumors resulted in 60% of the cases and the histology of each xenograft was similar to that of the human tumor. Flow cytometry was used to obtain DNA histograms of the original cell suspension and of cultures during the two week culture period in order to obtain quantitative information about the growth of aneuploid versus diploid populations. The results thus far demonstrate that 95% of aneuploid populations yield aneuploid growth; of the first 20 cases studied, only one suspension with an aneuploid peak resulted in diploid growth. Of further interest was the observation that it is not unusual for a minor aneuploid population to become the predominate growth fraction after two weeks in culture. These results demonstrate that the adhesive-tumor-cell culture system supports the growth of malignant cells, that multiple cell populations exist in cell suspensions derived from solid tumors, and that differences exist between the radiosensitivity of cells at 2.0 Gy in different histology types

  19. Cell-cycle research with synchronous cultures: an evaluation

    Science.gov (United States)

    Helmstetter, C. E.; Thornton, M.; Grover, N. B.

    2001-01-01

    The baby-machine system, which produces new-born Escherichia coli cells from cultures immobilized on a membrane, was developed many years ago in an attempt to attain optimal synchrony with minimal disturbance of steady-state growth. In the present article, we put forward a model to describe the behaviour of cells produced by this method, and provide quantitative evaluation of the parameters involved, at each of four different growth rates. Considering the high level of selection achievable with this technique and the natural dispersion in interdivision times, we believe that the output of the baby machine is probably close to optimal in terms of both quality and persistence of synchrony. We show that considerable information on events in the cell cycle can be obtained from populations with age distributions very much broader than those achieved with the baby machine and differing only modestly from steady state. The data presented here, together with the long and fruitful history of findings employing the baby-machine technique, suggest that minimisation of stress on cells is the single most important factor for successful cell-cycle analysis.

  20. Hormonal regulation of Na -K -ATPase in cultured epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, J.P.; Jones, D.; Wiesmann, W.P.

    1986-08-01

    Aldosterone and insulin stimulate Na transport through mechanisms involving protein synthesis. Na -K -ATPase has been implicated in the action of both hormones. The authors examined the effect of aldosterone and insulin on Na -K -ATPase in epithelial cells in culture derived from toad urinary bladder (TB6C) and toad kidney (A6). Aldosterone, but not insulin, increases short-circuit current (I/sub sc/) in TB6C cells. Aldosterone increases Na -K -(TSP)ATPase activity after 18 h of incubation, but no effect can be seen at 3 and 6 h. Amiloride, which inhibits aldosterone-induced increases in I/sub sc/, has no effect on either basal or aldosterone stimulated enzyme activity. Both aldosterone and insulin increase I/sub sc/ in A6 cells and when added together are synergistic. Aldosterone stimulates enzyme activity in A6 cells, but insulin alone has no effect. However, aldosterone and insulin together stimulate enzyme activity more than aldosterone alone. It appears that stimulation of Na -K -ATPase activity is involved in aldosterone action in both cell lines but does not appear to be due to increased Na entry, since enhanced enzyme activity is not inhibited by amiloride. In contrast, insulin alone has no direct effect on Na -K -ATPase, although the increased enzyme activity following both agents in combination may explain their synergism on I/sub sc/.

  1. Studies on radiation transformation of cultured mammalian cells

    International Nuclear Information System (INIS)

    Terasima, Toyozo; Sakiyama, Hisako; Yasukawa, Mieko

    1978-01-01

    In an attempt to induce in vitro transformation by radiation, several cell lines and primary cultures derived from embryonal tissues of hamster, mouse and man were tested. Under various conditions favorable for transformation, none of these were successfully transformed except for C3H mouse embryo-derived 10Tl/2 cells. Normally the cells contact-inhibited were irradiated with single graded doses and dispersed 3 hours after, followed by inoculation and 8-week cultivation with repeated medium renewals. A few types of focus were identified according to the description of Reznikoff et al. The foci characterized by (i) high cell density, (ii) increased affinity to a basic dye, and (iii) piled-up structure, were taken as an indication of transformation. The frequency of transformation was 6.5 x 10 -4 for 300 R which was 4 times higher than the frequency found in the untreated control. It increased dose-dependently until 500 R and then levelled off. Another type of experiment using TR cells derived from a leukemia-prone trisomy 21 human embryo, revealed that a single 300 R exposure to x-ray induced clones showing higher plating efficiency and plateau density than unirradiated control after 200 days of post-irradiation cultivation. However, the clones isolated did not show any particular transformational properties in vitro and tumorigenic activity on inoculation into nude mice. (author)

  2. Algorithms for pattern recognition in images of cell cultures

    Science.gov (United States)

    Mendes, Joyce M.; Peixoto, Nathalia L.; Ramirez-Fernandez, Francisco J.

    2001-06-01

    Several applications of silicon microstructures in areas such as neurobiology and electrophysiology have been stimulating the development of microsystems with the objective of mechanical support to monitor and control several parameters in cell cultures. In this work a multi-microelectrode arrays was fabricated over a glass plate to obtain the growth of neuronal cell monitoring their behavior during cell development. To identify the neuron core and axon an approach for implementation of edge detectors algorithms associated to images is described. The necessity of efficient and reliable algorithms for image processing and interpretation is justified by its large field of applications in several areas as well as medicine, robotics, cellular biology, computational vision and pattern recognition. In this work, it is investigated the adequacy of some edge detectors algorithms such as Canny, Marr-Hildreth. Some alterations in those methods are propose to improve the identification of both cell core and axonal growth measure. We compare the operator to edge detector proposed by Canny, Marr-Hildreth operator and application of Hough Transform. For evaluation of algorithms adaptations, we developed a method for automatic cell segmentation and measurement. Our goal is to find a set of parameters defining the location of the objects to compare the original and processed images.

  3. Serum-free media formulations are cell line-specific and require optimization for microcarrier culture.

    Science.gov (United States)

    Tan, Kah Yong; Teo, Kim Leng; Lim, Jessica F Y; Chen, Allen K L; Choolani, Mahesh; Reuveny, Shaul; Chan, Jerry; Oh, Steve Kw

    2015-08-01

    Mesenchymal stromal cells (MSCs) are being investigated as potential cell therapies for many different indications. Current methods of production rely on traditional monolayer culture on tissue-culture plastic, usually with the use of serum-supplemented growth media. However, the monolayer culturing system has scale-up limitations and may not meet the projected hundreds of billions to trillions batches of cells needed for therapy. Furthermore, serum-free medium offers several advantages over serum-supplemented medium, which may have supply and contaminant issues, leading to many serum-free medium formulations being developed. We cultured seven MSC lines in six different serum-free media and compared their growth between monolayer and microcarrier culture. We show that (i) expansion levels of MSCs in serum-free monolayer cultures may not correlate with expansion in serum-containing media; (ii) optimal culture conditions (serum-free media for monolayer or microcarrier culture) differ for each cell line; (iii) growth in static microcarrier culture does not correlate with growth in stirred spinner culture; (iv) and that early cell attachment and spreading onto microcarriers does not necessarily predict efficiency of cell expansion in agitated microcarrier culture. Current serum-free media developed for monolayer cultures of MSCs may not support MSC proliferation in microcarrier cultures. Further optimization in medium composition will be required for microcarrier suspension culture for each cell line. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  4. Fibroblasts Cultured on Nanowires Exhibit Low Motility, Impaired Cell Division, and DNA Damage

    DEFF Research Database (Denmark)

    Persson, H.; Købler, Carsten; Mølhave, Kristian

    2013-01-01

    Mouse fibroblasts cultured on 7-μm-long vertical nanowires are reported on page 4006 by C. N. Prinz and co-workers. Culturing cells on this kind of substrate interferes greatly with cell function, causing the cells to develop into widely different morphologies. The cells' division is impaired...

  5. The phosphatidylinositol species of suspension cultured plant cells

    International Nuclear Information System (INIS)

    Heim, S.; Wagner, K.G.

    1987-01-01

    Suspension cultured Nicotiana tabacum and Catharanthus roseus cells were labeled with [ 3 H]inositol, the phospholipid fraction extracted and separated by thin layer chromatography. Three different solvent systems and reference compounds were used to assign the different 3 H-labeled species by autoradiography. The ratio of [ 3 H]inositol incorporation into PI, PIP and PIP 2 was found to be 95:4:1; with some preparations a lyso-PI band was obtained which incorporated about a tenth of the label of the PIP band. With Catharanthus roseus cells a very faint band between PI and lyso-PI was detected which could not be assigned to a reference compound. (orig.)

  6. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  7. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  8. Freeform micropatterning of living cells into cell culture medium using direct inkjet printing.

    Science.gov (United States)

    Park, Ju An; Yoon, Sejeong; Kwon, Jimin; Now, Hesung; Kim, Young Kwon; Kim, Woo-Jong; Yoo, Joo-Yeon; Jung, Sungjune

    2017-11-06

    Microfabrication methods have widely been used to control the local cellular environment on a micron scale. However, accurately mimicking the complexity of the in vivo tissue architecture while maintaining the freedom of form and design is still a challenge when co-culturing multiple types of cells on the same substrate. For the first time, we present a drop-on-demand inkjet printing method to directly pattern living cells into a cell-friendly liquid environment. High-resolution control of cell location is achieved by precisely optimizing printing parameters with high-speed imaging of cell jetting and impacting behaviors. We demonstrated the capabilities of the direct cell printing method by co-printing different cells into various designs, including complex gradient arrangements. Finally, we applied this technique to investigate the influence of the heterogeneity and geometry of the cell population on the infectivity of seasonal H1N1 influenza virus (PR8) by generating A549 and HeLa cells printed in checkboard patterns of different sizes in a medium-filled culture dish. Direct inkjet cell patterning can be a powerful and versatile tool for both fundamental biology and applied biotechnology.

  9. Degradation of high density lipoprotein in cultured rat luteal cells

    International Nuclear Information System (INIS)

    Rajan, V.P.; Menon, K.M.J.

    1986-01-01

    In rat ovary luteal cells, degradation of high density lipoprotein (HDL) to tricholoracetic acid (TCA)-soluble products accounts for only a fraction of the HDL-derived cholesterol used for steroidogenesis. In this study the authors have investigated the fate of 125 I]HDL bound to cultured luteal cells using pulse-chase technique. Luteal cell cultures were pulse labeled with [ 125 I]HDL 3 and reincubated in the absence of HDL. By 24 h about 50% of the initallay bound radioactivity was released into the medium, of which 60-65% could be precipitated with 10% TCA. Gel filtration of the chase incubation medium on 10% agarose showed that the amount of TCA-soluble radioactivity was nearly completely accounted for by a sharp peak in the low molecular weight region which was identified as 96% monoiodotyrosine by paper chromatography. The TCA-precipitable radioactivity was nearly completely accounted for by a sharp peak in the low molecular weight region which was identified as 96% monoiodotyrosine by paper chromatography. The TCA-precipitable radioactivity eluted over a wide range of molecular weights (15,000-80,000), and there was very little intact HDL present. Electrophoresis of the chase medium showed that component of the TCA-precipitable portion had mobility similar to apo AI. Lysosomal inhibitors of receptor-mediated endocytosis had no effect on the composition or quantity of radioactivity released during chase incubation. The results show that HDL 3 binding to luteal cells is followed by complete degradation of the lipoprotein, although the TCA-soluble part does not reflect the extent of degradation

  10. Hemopoietic cell precursor responses to erythropoietin in plasma clot cultures

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, W.L.

    1979-01-01

    The time dependence of the response of mouse bone marrow cells to erythropoietin (Ep) in vitro was studied. Experiments include studies on the Ep response of marrow cells from normal, plethoric, or bled mice. Results with normal marrow reveal: (1) Not all erythroid precursors (CFU-E) are alike in their response to Ep. A significant number of the precursors develop to a mature erythroid colony after very short Ep exposures, but they account for only approx. 13% of the total colonies generated when Ep is active for 48 hrs. If Ep is active more than 6 hrs, a second population of erythroid colonies emerges at a nearly constant rate until the end of the culture. Full erythroid colony production requires prolonged exposure to erythropoietin. (2) The longer erythropoietin is actively present, the larger the number of erythroid colonies that reach 17 cells or more. Two distinct populations of immediate erythroid precursors are also present in marrow from plethoric mice. In these mice, total colony numbers are equal to or below those obtained from normal mice. However, the population of fast-responding CFU-E is consistently decreased to 10 to 20% of that found in normal marrow. The remaining colonies are formed from plethoric marrow at a rate equal to normal marrow. With increasing Ep exposures, the number of large colonies produced increases. From the marrow of bled mice, total erythroid colony production is equal to or above that of normal marrow. Two populations of colony-forming cells are again evident, with the fast-responding CFU-E being below normal levels. The lack of colonies from this group was compensated in bled mice by rapid colony production in the second population. A real increase in numbers of precursors present in this pool increased the rate of colony production in culture to twice that of normal marrow. The number of large colonies obtained from bled mice was again increased as the Ep exposure was lengthened. (ERB)

  11. Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells in irradiated bone marrow cell culture in vitro

    International Nuclear Information System (INIS)

    Fujitake, Hideki; Okamoto, Yuruko; Okubo, Hiroshi; Miyanomae, Takeshi; Kumagai, Keiko; Mori, K.J.

    1981-01-01

    Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells after irradiation were studied in the long-term culture of mouse bone marrow cells in vitro. No difference was observed in the survival of the stem cells among cultures in which 0 - 10 7 cells were re-inoculated on the adherent cell colonies in the culture flask. Stem cells showed a significant proliferation within 1 week and the number of the stem cells exceeded the control in 3 weeks after irradiation in the cultures with less than 10 6 re-inoculated cells per flask. In contrast, there was a considerable delay in the onset of stem cell proliferation after irradiation in the culture with 10 7 cells per flask. Based on these results, a possibility that a stimulator of stem cell proliferation, released from irradiated stromal cells, is cancelled by an inhibitory factor produced by irradiated or unirradiated haemopoietic cells is postulated. (author)

  12. Isolation, culture and intraportal transplantation of rat marrow stromal cell

    International Nuclear Information System (INIS)

    Wang Ping; Wang Jianhua; Yan Zhiping; Li Wentao; Lin Genlai; Hu Meiyu; Wang Yanhong

    2004-01-01

    Objective: To observe the tracing and evolution of marrow stromal cell (MSC) after intraportal transplantation into the liver of homogenous rats, and to provide experimental data for MSC differentiation to hepatocyte in vivo. Methods: The MSC was isolated from the leg bone marrow of adult SD rats, and purified by culture-expanded in vitro. Before transplantation, MSC was labeled with DAPI. Then 10 5 MSC were intraportally transplanted into the homogenous rat liver. Rats were killed at 2 hours and 1, 2, 3 and 4 weeks after transplantation. The cryosection samples of liver and lung were observed under fluorescence microscopy. Results: MSC in vitro culture had high ability of proliferation. Except 4 rats were dead because of abdominal bleeding or infection, other recipients were healthy until sacrificed. The implantation cells were detected by identifying the DAPI labeled MSC in the host livers, but not in the host lungs. Conclusion: Intraportal transplanted MSC could immigrate and survive in the host livers at least for 4 weeks. They could immigrate from the small branches of portal veins to hepatic parenchyma

  13. Defining process design space for monoclonal antibody cell culture.

    Science.gov (United States)

    Abu-Absi, Susan Fugett; Yang, LiYing; Thompson, Patrick; Jiang, Canping; Kandula, Sunitha; Schilling, Bernhard; Shukla, Abhinav A

    2010-08-15

    The concept of design space has been taking root as a foundation of in-process control strategies for biopharmaceutical manufacturing processes. During mapping of the process design space, the multidimensional combination of operational variables is studied to quantify the impact on process performance in terms of productivity and product quality. An efficient methodology to map the design space for a monoclonal antibody cell culture process is described. A failure modes and effects analysis (FMEA) was used as the basis for the process characterization exercise. This was followed by an integrated study of the inoculum stage of the process which includes progressive shake flask and seed bioreactor steps. The operating conditions for the seed bioreactor were studied in an integrated fashion with the production bioreactor using a two stage design of experiments (DOE) methodology to enable optimization of operating conditions. A two level Resolution IV design was followed by a central composite design (CCD). These experiments enabled identification of the edge of failure and classification of the operational parameters as non-key, key or critical. In addition, the models generated from the data provide further insight into balancing productivity of the cell culture process with product quality considerations. Finally, process and product-related impurity clearance was evaluated by studies linking the upstream process with downstream purification. Production bioreactor parameters that directly influence antibody charge variants and glycosylation in CHO systems were identified.

  14. Control of galactosylated glycoforms distribution in cell culture system.

    Science.gov (United States)

    McCracken, Neil A; Kowle, Ronald; Ouyang, Anli

    2014-01-01

    Cell culture process conditions including media components and bioreactor operation conditions have a profound impact on recombinant protein quality attributes. Considerable changes in the distribution of galactosylated glycoforms (G0F, G1F, and G2F) were observed across multiple CHO derived recombinant proteins in development at Eli Lilly and Company when switching to a new chemically defined (CD) media platform condition. In the new CD platform, significantly lower G0F percentages and higher G1F and G2F were observed. These changes were of interest as glycosylation heterogeneity can impact the effectiveness of a protein. A systematic investigation was done to understand the root cause of the change and control strategy for galactosylated glycoforms distribution. It was found that changes in asparagine concentration could result in a corresponding change in G0F, G1F, and G2F distribution. A follow-up study examined a wider range of asparagine concentration and it was found that G0F, G1F, and G2F percentage could be titrated by adjusting asparagine concentration. The observed changes in heterogeneity from changing asparagine concentration are due to resulting changes in ammonium metabolism. Further study ascertained that different integrated ammonium level during the cell culture process could control G0F, G1F, and G2F percentage distribution. A mechanism hypothesis is proposed that integrated ammonium level impacts intracellular pH, which further regulates β-1, 4 galactosyltransferase activity. © 2014 American Institute of Chemical Engineers.

  15. CELL SHAPE AND HEXOSE TRANSPORT IN NORMAL AND VIRUS-TRANSFORMED CELLS IN CULTURE

    Energy Technology Data Exchange (ETDEWEB)

    Bissell, M.J.; Farson, D.; Tung, A.S.C.

    1976-07-01

    The rate of hexose transport was compared in normal and virus-transformed cells on a monolayer and in suspension. It was shown that: (1) Both trypsin-removed cells and those suspended for an additional day in methyl cellulose had decreased rates of transport and lower available water space when compared with cells on a monolayer. Thus, cell shape affects the overall rate of hexose transport, especially at higher sugar concentrations. (2) Even in suspension, the initial transport rates remained higher in transformed cells with reference to normal cells. Scanning electron micrographs of normal and transformed chick cells revealed morphological differences only in the flat state. This indicates that the increased rate of hexose transport after transformation is not due to a difference in the shape of these cells on a monolayer. The relation between the geometry of cells, transport rates, and growth regulation is undoubtedly very complex, and our knowledge of these relationships is still very elementary. In a recent review on the influence of geometry on control of cell growth, Folkman and Greenspan (1) pointed out that the permeability of cells in a flat versus a spherical state may indeed be very different. The growth properties of cells on a surface and in suspension have been compared often (1-5). However, with one exception. little is known about the changes in transport properties when cell shape is changed. Foster and Pardee (6) demonstrated that the active transport of a-aminoisobutyric acid was reduced 2.5 times in suspension cultures of Chinese hamster cells with respect to the cells grown on a coverslip. They attributed this to the smaller surface area of suspended cells. While it is not clear why active transport should be dependent on the surface area available, it is possible that once the cells assume a spherical configuration, the carrier proteins are redistributed in such a way as to make them less accessible to the substrate. What happens to

  16. Azo-polysiloxanes as new supports for cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Hurduc, Nicolae, E-mail: nhurduc@ch.tuiasi.ro [“Gheorghe Asachi” Technical University of Iasi, Department of Natural and Synthetic Polymers, Prof. Dimitrie, Mangeron Street, 73, 700050-Iasi (Romania); Macovei, Alina [Institute of Biochemistry of the Romanian Academy, Department of Viral Glycoproteins, Splaiul Independentei 296, Sector 6, 060041-Bucuresti (Romania); Paius, Cristina; Raicu, Alina [“Gheorghe Asachi” Technical University of Iasi, Department of Natural and Synthetic Polymers, Prof. Dimitrie, Mangeron Street, 73, 700050-Iasi (Romania); Moleavin, Ioana [CEA, LIST Saclay, Laboratoire Capteurs et Architectures Électroniques, F-91191 Gif-sur-Yvette, Cedex (France); Branza-Nichita, Norica, E-mail: nichita@biochim.ro [Institute of Biochemistry of the Romanian Academy, Department of Viral Glycoproteins, Splaiul Independentei 296, Sector 6, 060041-Bucuresti (Romania); Hamel, Matthieu [CEA, LIST Saclay, Laboratoire Capteurs et Architectures Électroniques, F-91191 Gif-sur-Yvette, Cedex (France); Rocha, Licinio, E-mail: Licinio.ROCHA@cea.fr [CEA, LIST Saclay, Laboratoire Capteurs et Architectures Électroniques, F-91191 Gif-sur-Yvette, Cedex (France)

    2013-05-01

    The paper introduces a new class of materials with azo-polysiloxanic structure bearing the property to generate nano-structured surfaces by laser irradiation. The ability to modulate the optical response of the film, through a modification of the polymer chemical structure, has been investigated. The azo-materials were tested for their ability to support cell adhesion and growth, with very promising results. A future use of these materials as growth support in cell cultures is of great interest, due to an easy, one step-method to generate the surface relief grating and to the possibility to introduce a large range of chemical modifications due to the presence of the chlorobenzyl groups in the polymeric side-chain. - Graphical abstract: Cell development on a nano-structured surface obtained from an azo-polysiloxanic film. Highlights: ► New azo-polysiloxanic films for biological applications were reported. ► Nanostructured surfaces with controllable geometry are obtained by laser irradiation. ► Cells are very sensitive to the chemical and physical properties of the polymeric substrate.

  17. Soft Micro-Channels for Cell Culturing and Migration Studies

    Science.gov (United States)

    Abbasirazgaleh, Sara

    Various techniques and methods have been studied and developed to aid nerve regeneration and repairing nerve injuries. Among all, nerve grafting is the gold standard for bridging the gap between the injured nerve stumps. Despite the advantages of this technique, there are also various drawbacks that have encouraged the exploration of alternative, less invasive methods for promoting nerve regeneration. In this thesis, we have fabricated soft micro-channels for cell culturing and migration studies which could act as an interface capable of long-term, reliable, and high-resolution stimulation device for nerve regeneration. Micro-channels fabrication is performed using a combination of photolithography technique and physical vapor deposition (PVD) methods. Initially, the surfaces of the micro-channels are treated with oxygen plasma to convert the surface of PDMS from hydrophobic to hydrophilic and to further provide an optimal environment for cells to adhere and grow. Next, in vitro studies were performed on the fabricated micro-channels to demonstrate feasibility of the platform to promote adherence and growth of PC12 cells (cell line derived from a pheochromocytomas of the rat adrenal medulla).

  18. Metabolism of 4-nitrobiphenyl (NBP) by cultured rat urothelial cells

    International Nuclear Information System (INIS)

    Swaminathan, S.; Lang, D.B.; Reznikoff, C.A.

    1986-01-01

    The potential of rat urothelial cells to metabolize NBP was evaluated by incubating 4.3 x 10 7 viable cells with 20 μM [ 3 H]NBP in a serum free medium for 48 hours. The culture medium was examined for metabolites of NBP by extraction with ethyl acetate and subsequent chromatographic analysis. High pressure liquid chromatography of the solvent extract using a Whatman ODS-3, C-18 column in 70% methanol-water at a flow rate of 1 ml/min revealed two major peaks at retention times of approximately 8 and 13 min. Thin layer chromatography showed two regions of radioactivity at Rf values of 0.35 and 0.83, the latter corresponding with NBP. Based on the chromatographic data the metabolite with the retention time of 8.0 min in HPLC and an Rf of 0.35 in TLC has been tentatively identified as 4-acetylaminobiphenyl. Analysis of binding to proteins and nucleic acids following exposure to [ 3 H]NBP revealed a significant amount (0.03% of initially applied radioactivity) in the protein fractions. Control samples of NBP incubated in medium, without the urothelial cells revealed only the parent compound. These data suggest that rat bladder cells possess the metabolic capability to reduce NBP and to generate reactive metabolites that bind to cellular macromolecules

  19. Studies of baby hamster kidney natural cell aggregation in suspended batch cultures.

    Science.gov (United States)

    Moreira, J L; Alves, P M; Rodrigues, J M; Cruz, P E; Aunins, J G; Carrondo, M J

    1994-11-30

    Microcarrier cultures of animal cells of industrial relevance are known to shed aggregates into the suspension phase. For a BHK cell line, which is known to be prone to aggregate naturally, microcarrier and aggregate forms of culture are compared in spinner culture. In microcarrier cultures, it is shown that increasing initial microcarrier concentration yields decreasing concentration of smaller aggregates in suspension; roughly equivalent concentrations of total cells and single cells in suspension are obtained. In the absence of Cytodex 3, aggregate final size is hydrodynamically controlled in batch and semicontinuous suspension culture. Rate of agitation is the main variable controlling aggregate size in batch cultures. The range of agitation rates studied (20 to 70 rpm in 250 mL spinner flasks) produced aggregates with maximum sizes of 200 microns. Necrotic centers were not observed; this was confirmed by Trypan blue viability measurements after mechanical dissociation of aggregates and also by the constant productivity obtained from different aggregate sizes. Comparing aggregate and microcarrier culture conditions, it is shown that at 100 rpm maximum total cell concentration is larger in the absence of microcarriers; dead cell concentrations, most of which exist in suspension, are slightly larger in microcarrier culture. Total viable cell concentrations in aggregate, hydrodynamically controlled culture, are almost one order of magnitude higher than in microcarrier cultures. These results suggest that there might be advantages in using aggregate cultures under hydrodynamic control of aggregate size in lieu of microcarrier cultures for naturally aggregating cell lines.

  20. [The application progress of three-dimensional cell culture technology in ophthalmology].

    Science.gov (United States)

    Zhao, Yun; Zhang, Lei; Zhao, Hong

    2015-11-01

    Three-dimensional cell culture technology is a kind of technology that cultures the cells in a three-dimensional cultivation by using a kind of scaffold materials in vitro. Its advantage is that the vivo microenvironment simulating degrees of the three-dimensional culture technology is higher than that of the two-dimensional planar cell culture model, and the controllability is also higher than the animal experiment. In recent years, with the development of tissue engineering technology, a varietiy of the stent of biological materials also a fast development, which provided a favorable platform for three-dimensional cell culture technology. In ophthalmology, three-dimensional cell culture has been applied to the cornea, retina and the visual system development and other optic tumor researches. The objective of this paper is to making a review the application status of the three-dimensional cell culture technology in the basic research and clinical treatment in ophthalmology.

  1. Micro fluidic System for Culturing and Monitoring of Neuronal Cells and Tissue

    DEFF Research Database (Denmark)

    Bakmand, Tanya; Waagepetersen, Helle S.

    The aim of this Ph.D. project was to combine experience within cell and tissue culturing, electrochemistry and microfabrication in order to develop an in vivo-like fluidic culturing platform, challenging the traditional culturing methods. The first goal was to develope a fluidic system for cultur...

  2. The usefulness of three-dimensional cell culture in induction of cancer stem cells from esophageal squamous cell carcinoma cell lines

    International Nuclear Information System (INIS)

    Fujiwara, Daisuke; Kato, Kazunori; Nohara, Shigeo; Iwanuma, Yoshimi; Kajiyama, Yoshiaki

    2013-01-01

    Highlights: •Spheroids were created from esophageal carcinoma cells using NanoCulture® Plates. •The proportion of strongly ALDH-positive cells increased in 3-D culture. •Expression of cancer stem cell-related genes was enhanced in 3-D culture. •CA-9 expression was enhanced, suggesting hypoxia had been induced in 3-D culture. •Drug resistance was increased. 3-D culture is useful for inducing cancer stem cells. -- Abstract: In recent years, research on resistance to chemotherapy and radiotherapy in cancer treatment has come under the spotlight, and researchers have also begun investigating the relationship between resistance and cancer stem cells. Cancer stem cells are assumed to be present in esophageal cancer, but experimental methods for identification and culture of these cells have not yet been established. To solve this problem, we created spheroids using a NanoCulture® Plate (NCP) for 3-dimensional (3-D) cell culture, which was designed as a means for experimentally reproducing the 3-D structures found in the body. We investigated the potential for induction of cancer stem cells from esophageal cancer cells. Using flow cytometry we analyzed the expression of surface antigen markers CD44, CD133, CD338 (ABCG2), CD318 (CDCP1), and CD326 (EpCAM), which are known cancer stem cell markers. None of these surface antigen markers showed enhanced expression in 3-D cultured cells. We then analyzed aldehyde dehydrogenase (ALDH) enzymatic activity using the ALDEFLUOR reagent, which can identify immature cells such as stem cells and precursor cells. 3-D-cultured cells were strongly positive for ALDH enzyme activity. We also analyzed the expression of the stem cell-related genes Sox-2, Nanog, Oct3/4, and Lin28 using RT-PCR. Expression of Sox-2, Nanog, and Lin28 was enhanced. Analysis of expression of the hypoxic surface antigen marker carbonic anhydrase-9 (CA-9), which is an indicator of cancer stem cell induction and maintenance, revealed that CA-9 expression

  3. Mammary epithelial cell transformation: insights from cell culture and mouse models

    OpenAIRE

    Dimri, Goberdhan; Band, Hamid; Band, Vimla

    2005-01-01

    Normal human mammary epithelial cells (HMECs) have a finite life span and do not undergo spontaneous immortalization in culture. Critical to oncogenic transformation is the ability of cells to overcome the senescence checkpoints that define their replicative life span and to multiply indefinitely – a phenomenon referred to as immortalization. HMECs can be immortalized by exposing them to chemicals or radiation, or by causing them to overexpress certain cellular genes or viral oncogenes. Howev...

  4. Experimental data developed to support the selection of a treatment process for West Valley alkaline supernatant

    International Nuclear Information System (INIS)

    Bray, L.A.; Holton, L.K.; Myers, T.R.; Richardson, G.M.; Wise, B.M.

    1984-01-01

    At the request of West Valley Nuclear Services Co., Inc., the Pacific Northwest Laboratory (PNL) has studied alternative treatment processes for the alkaline PUREX waste presently being stored in Tank 8D2 at West Valley, New York. Five tasks were completed during FY 1983: (1) simulation and characterization of the alkaline supernatant and sludge from the tank. The radiochemical and chemical distributions between the aqueous and solid phase were determined, and the efficiency of washing sludge with water to remove ions such as Na + and SO 4 2- was investigated; (2) evaluation of a sodium tetraphenylboron (Na-TPB) precipitation process to recover cesium (Cs) and a sodium titanate (Na-TiA) sorption process to recover strontium (Sr) and plutonium (Pu) from the West Valley Alkaline supernatant. These processes were previously developed and tested at the US Department of Energy's Savannah River Plant; (3) evaluation of an organic cation-exchange resin (Duolite CS-100) to recover Cs and Pu from the alkaline supernatant followed by an organic macroreticular cation exchange resin (Amberlite IRC-718) to recover Sr; (4) evaluation of an inorganic ion exchanger (Linde Ionsiv IE-95) to recover Cs, Sr, and Pu from the alkaline supernatant; and (5) evaluation of Dowex-1,X8 organic anion exchange resin to recover technetium (Tc) from alkaline supernatant. The findings of these tasks are reported. 21 references, 36 figures, 34 tables

  5. Residual urinary extracellular vesicles in ultracentrifugation supernatants after hydrostatic filtration dialysis enrichment.

    Science.gov (United States)

    Musante, Luca; Tataruch-Weinert, Dorota; Kerjaschki, Dontscho; Henry, Michael; Meleady, Paula; Holthofer, Harry

    2017-01-01

    Urinary extracellular vesicles (UEVs) appear an ideal source of biomarkers for kidney and urogenital diseases. The majority of protocols designed for their isolation are based on differential centrifugation steps. However, little is still known of the type and amount of vesicles left in the supernatant. Here we used an isolation protocol for UEVs which uses hydrostatic filtration dialysis as first pre-enrichment step, followed by differential centrifugation. Transmission electron microscopy (TEM), mass spectrometry (MS), western blot, ELISA assays and tuneable resistive pulse sensing (TRPS) were used to characterise and quantify UEVs in the ultracentri