WorldWideScience

Sample records for cell culture supernatants

  1. Bioactivities of Culture Supernatants from Retroviral Packaging Cells Carrying the Mouse Fas Ligand Gene

    Institute of Scientific and Technical Information of China (English)

    LIU Lingbo; ZOU Ping; GUO Rong; XIAO Juan; XU Zhiliang

    2001-01-01

    The bioactivities of culture supernatants from retroviral packaging cells carrying the mouse Fas ligand (mFasL) gene was investigated. FasLcDNA was cloned into PLXIN with an internal ribosome entry site to link two cistrons through gene recombination technology, PLXIN and the recombinant vector PLFIN were separately transfected into PA317 retrovirus packing cell line by lipofectamine 2000, and the resistant clones were selected with G418 selective medium. The integration of genome DNA was assayed by genomic DNA PCR. NIH3T3 cells were transduced by the culture supernatants from PA317 carrying the mFasLcDNA gene, and were selected with G418 selective medium, so as to select the PLFIN-PA317 clone capable of producing higher titer of supernatants. The levels of mFasL protein on NIH3T3 cells membrane were assayed by flow cytometry (FCM). The biological activity of mFasL on NIH3T3 cells membrane was investigated by the inducing apoptosis of Fas+ Yac-1 cells co-cultured with NIH3T3 cells expressing Fas ligand. To explore the direct mFasL cytotoxicity of culture supernatants from retroviral packaging cells carrying the mFasL gene, the culture supernatants from PLFIN-PA317 and PLXIN-PA317 were separately co-cultured with Yac-1cells in parallel. The recombinant PLFIN was successfully constructed. The highest titer of supernatants from twelve resistant clones was 8. 5 × 105 colony-forming-unit (CFU)/ml. The NIH3T3cells transfected by above supernatants had a higher level of mFasL (53.81±6.9 %), and significantly induced the apoptosis of Fas+ Yac-1 cells (56. 78±4.5 %), as both were cocultured for 5 h at1 : 1 ratio, whereas it is 7. 08±3.4 % in control group (P<0. 01). Supernatant from PLFINPA317 could also directly induce the apoptosis of Yac-1 within 5 h of incubation. Thus, the culture supernatants from PLFIN-PA317 possessed both infectivity and cytotoxicity of mFasL.

  2. Detection of cell wall mannoprotein Mp1p in culture supernatants of Penicillium marneffei and in sera of penicilliosis patients

    OpenAIRE

    Cao, Liang; Chan, King-Man; Chen, Daliang; Vanittanakom, Nongnuch; Lee, Cindy; Chan, Che-Man; Sirisanthana, Thira; Tsang, Dominic N. C.; Yuen, Kwok-Yung

    1999-01-01

    Mannoproteins are important and abundant structural components of fungal cell walls. The MP1 gene encodes a cell wall mannoprotein of the pathogenic fungus Penicillium marneffei. In the present study, we show that Mp1p is secreted into the cell culture supernatant at a level that can be detected by Western blotting. A sensitive enzyme-linked immunosorbent assay (ELISA) developed with antibodies against Mp1p was capable of detecting this protein from the cell culture supernatant of P. marneffe...

  3. Comparison among three anion exchange chromatographic supports to capture erythropoietin from cell culture supernatant

    Institute of Scientific and Technical Information of China (English)

    Lourdes HERNNDEZ; Diobel STEWART; Lourdes ZUMALACRREGUI; Daniel AMARO

    2015-01-01

    Affinity and ion exchange conventional chromatography have been used to capture erythropoietin ( EPO)from mammalian cell culture supernatant. Currently,chromatographic adsorbent perfusion is available, however a limited number of applications have been found in the literature. In this work,three anion exchange chromatographic supports( gel,membrane and monolithic)were evaluated in the capture step of the recombi-nant erythropoietin purification process. The influences of load and flow rate on each support performance were analyzed. Also the purity of the EPO molecules was determined. A productivity analysis,as a decision tool for larger scale implementation,was done. As a conclusion,the evaluated supports are technically suitable to cap-ture EPO with adequate recovery and good purity. However,the monolithic column admits high operating velocity,showing the highest adsorption capacity and productivity.

  4. Detecting pM concentrations of prostaglandins in cell culture supernatants by capillary SCX-LC-MS/MS

    DEFF Research Database (Denmark)

    Dahl, Sandra Rinne; Kleiveland, Charlotte Ramstad; Kassem, Moustapha;

    2008-01-01

    )PGF(1alpha), and 15-Delta(12, 14)-deoxy-PGJ(2) (15dPGJ(2)) in cell culture supernatants was developed and validated. Pretreatment of the cell culture supernatants included only dilution and filtration, and the analysis time including all sample preparation steps was 60 min per sample. Peptides....../proteins contained in the matrix were removed by the SCX column. LODs in the range of 8-44 pg/mL (25-120 pM) cell culture supernatant were obtained. Excellent linearity (R(2) > 0.99) and satisfactory recoveries and within- and between-day precisions were obtained. Human mesenchymal stem cells (hMSCs) were stimulated...

  5. Two-dimensional gel electrophoresis for controlling and comparing culture supernatants of mammalian cell culture productions systems.

    Science.gov (United States)

    Wimmer, K; Harant, H; Reiter, M; Blüml, G; Gaida, T; Katinger, H

    1994-01-01

    A recombinant Chinese hamster ovary cell line, producing human erythropoietin, was cultivated in a continuous mode in a stirred tank reactor applying different dilution rates. In order to monitor the stability of this expression system, product and non-product proteins of the cell culture supernatant were analyzed by two-dimensional electrophoresis. The consistency of the isoforms of the recombinant product was determined by western blot combined with specific staining. The same cell line was propagated in a high cell density cultivation system based on macro-cell-aggregates. The patterns of secreted proteins of the cell line cultivated in the different systems were compared in order to detect modifications in protein expression of the product and of non product proteins relevant for cell culture supernatant. Hardly any alterations in two-dimensional pattern were detectable. The isoforms of erythropoietin, as well as the overall pattern of secreted proteins, detectable with the two-dimensional electrophoresis method were remarkably stable under different cultivation conditions.

  6. Overcoming bottlenecks of enzymatic biofuel cell cathodes: crude fungal culture supernatant can help to extend lifetime and reduce cost.

    Science.gov (United States)

    Sané, Sabine; Jolivalt, Claude; Mittler, Gerhard; Nielsen, Peter J; Rubenwolf, Stefanie; Zengerle, Roland; Kerzenmacher, Sven

    2013-07-01

    Enzymatic biofuel cells (BFCs) show great potential for the direct conversion of biochemically stored energy from renewable biomass resources into electricity. However, enzyme purification is time-consuming and expensive. Furthermore, the long-term use of enzymatic BFCs is hindered by enzyme degradation, which limits their lifetime to only a few weeks. We show, for the first time, that crude culture supernatant from enzyme-secreting microorganisms (Trametes versicolor) can be used without further treatment to supply the enzyme laccase to the cathode of a mediatorless BFC. Polarization curves show that there is no significant difference in the cathode performance when using crude supernatant that contains laccase compared to purified laccase in culture medium or buffer solution. Furthermore, we demonstrate that the oxygen reduction activity of this enzymatic cathode can be sustained over a period of at least 120 days by periodic resupply of crude culture supernatant. This is more than five times longer than control cathodes without the resupply of culture supernatant. During the operation period of 120 days, no progressive loss of potential is observed, which suggests that significantly longer lifetimes than shown in this work may be possible. Our results demonstrate the possibility to establish simple, cost efficient, and mediatorless enzymatic BFC cathodes that do not require expensive enzyme purification procedures. Furthermore, they show the feasibility of an enzymatic BFC with an extended lifetime, in which self-replicating microorganisms provide the electrode with catalytically active enzymes in a continuous or periodic manner.

  7. Modulation of the Culture Supernatant of Decidual Cells with Exogenous Cytokines on Killing Activity of Natural Killer Cells in Early Pregnancy

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective To investigate the important function of cytokines in early pregnancy and to provide basic and experimental evidence for understanding the mechanism of their action. Methods Add interferon-γ (IFN-γ) , interleukin- 2(IL- 2) , interleukin- 6(IL-6) and epidermal growth factor (EGF) to the confluent culturing decidual cells with three different concentrations and harvest the culture supernatant after 12, 24 and 48 h separately. Observe the effect of the supernatant on killing activity of NK cells with radioimmunological assay of 51Cr immersion. Results The culture supernatant of decidual cells can promote the killing activity of NK cells in various degrees, and the effect is independent of the type, concentration and acting time of cytokines. Conclusion In normal pregnancy, decidual cytokine network is in a dynamic equilibri um. Exogenous cytokines would be harm to normal pregnancy by interfering the equi librium state, but the exact mechanism needs further study.

  8. Modulation of the Culture Supernatant of Decidual Cells with Exogenous Cytokines on Killing Activity of Natural Killer Cells in Early Pregnancy

    Institute of Scientific and Technical Information of China (English)

    胡冬梅; 王丽莉; 何援利

    2000-01-01

    Objective To investigate the important function of cytohines in early pregnancy and to provide basic and experimental evidence for understanding the mechanism of their action.Methods Add interferon-γ (IFN-γ) ,interleuhin-2(IL-2) , interleuhin-6(IL-6) andepidermal growth factor(EGF) to the confluent culturing decidual cells with three different concentrations and harvest the culture supernatant after 12, 24 and 48 h separately. Observe the effect of the supernatant on killing activity of NK cells with radioimmunological assay of 51Cr immersion.Results The culture supernatant of decidual cells can promote the killing activity of NK cells in various degrees, and the effect is independent of the type, concentration and acting time of cytokines.Conclusion In normal pregnancy, decidual cytokine network is in a dynamic equilibri-um. Exogenous cytokines would be harm to normal pregnancy by interfering the equi-librium state, but the exact mechanism needs further study.

  9. Effective isolation of exosomes with polyethylene glycol from cell culture supernatant for in-depth proteome profiling.

    Science.gov (United States)

    Weng, Yejing; Sui, Zhigang; Shan, Yichu; Hu, Yechen; Chen, Yuanbo; Zhang, Lihua; Zhang, Yukui

    2016-08-01

    Exosomes are secreted nanovesicles shed by almost all kinds of cells. Recently, increased interest has been focused on these extracellular vesicles as natural carriers transporting biological contents for intercellular communication. However, current isolation techniques, such as ultracentrifugation, are not convenient and often require specialized equipment. Herein, we describe a polyethylene glycol (PEG)-based approach, which could permit facile, low-cost and effective isolation of exosomes from cell culture supernatant. High-resolution electron microscopes clearly visualized the size and morphology of isolated exosome aggregates, implying the mechanism of PEG-based precipitation. Combined with tandem mass spectrometry analysis, 6299 protein groups encoded by 5120 genes were successfully characterized from HeLa cell culture supernatant, including numerous exosome proteins which could overlap 97% of the Top 100 exosome marker proteins recorded in the ExoCarta database, as well as a series of low-abundance cytokines and biomarkers. Furthermore, we found a higher ratio of neo-cleavage sites in proteins identified from exosomes compared with cellular proteins, revealing the potential roles of exosomes in accumulation and transportation of protein degradation intermediates. PMID:27229443

  10. THE EFFECT OF ANTISENSE OLIGONUCLEOTIDE ON THE INTERLEUKIN-5 IN THE SUPERNATANTS OF SPLEEN CELL CULTURES OF ASTHMATIC MICE

    Institute of Scientific and Technical Information of China (English)

    王美琴; 白春学; 钮善福; 方晓惠; 陈常庆; 陈波

    2001-01-01

    To explore the effect of antisense oligonucleotide on the production of IL-5 by mouse spleen T lymphocytes.Methods Based on the IL-5 cDNA sequence of mouse, a segment of antisense oligonucleotide was designed and synthesized. 5’-labeling of antisense oligonucleotide was signed by T4 PNK in order that the efficiency of stearylamine liposome in transfecting antisense oligonucleotide can be evaluated. Asthma model was duplicated with ovalbumin(OVA) absorbed to aluminum hydroxide. T lymphocytes of mice were separated by nylon fiber method, then T lymphocytes transfected with different concentration of antisense oligonucleotide with cation stearylamine liposme were incubated respectively in order to observe the effect of antisense oligonucleotide on Il-5 production by T lymphocytes. IL-5 levels in the supernatants of T lymphocyte cultures were determined by ELISA.Results Stearylamine liposome could markedly increase the efficiency of antisense oligonucleotide transfection. The transfection efficiency of antisense oligouncleotide increased approximately 12 times at a ratio of 1: 15m/m (antisense oligonucleotide to SA liposome). In healthy and asthma Balb/c mice, IL-5 was not detectable in the supernatants of T lymphocyte cultures without stimulated with OVA; however, IL-5 was increased markedly in the supernatants of T lymphocyte cultures stimulated with OVA. After transfection with different concentrations of antisense oligonucleotide, IL-5 levels in the supernatants of T lymphocyte cultures were significantly lower than those in control cultured without antisense oligonucleotide transfection. IL-5 levels decreased from 44.60±6.23 pg/ml to 30.70±7.362 pg/ml, 17.20±6.181 pg/ml and 8.16±2.34 pg/ml respectively. And IL-5 synthesis was inhibited by 31.17%, 61.43% and 81.7% respectively.Conclusion IL-5 synthesis could be obviously inhibited by antisense oligonucleotide and showed a markedly correlation between dose and effectiveness. It suggests the production

  11. Cell-free culture supernatant of Bifidobacterium breve CNCM I-4035 decreases pro-inflammatory cytokines in human dendritic cells challenged with Salmonella typhi through TLR activation.

    Directory of Open Access Journals (Sweden)

    Miriam Bermudez-Brito

    Full Text Available Dendritic cells (DCs constitute the first point of contact between gut commensals and our immune system. Despite growing evidence of the immunomodulatory effects of probiotics, the interactions between the cells of the intestinal immune system and bacteria remain largely unknown. Indeed,, the aim of this work was to determine whether the probiotic Bifidobacterium breve CNCM I-4035 and its cell-free culture supernatant (CFS have immunomodulatory effects in human intestinal-like dendritic cells (DCs and how they respond to the pathogenic bacterium Salmonella enterica serovar Typhi, and also to elucidate the molecular mechanisms involved in these interactions. Human DCs were directly challenged with B. breve/CFS, S. typhi or a combination of these stimuli for 4 h. The expression pattern of genes involved in Toll-like receptor (TLR signaling pathway and cytokine secretion was analyzed. CFS decreased pro-inflammatory cytokines and chemokines in human intestinal DCs challenged with S. typhi. In contrast, the B. breve CNCM I-4035 probiotic strain was a potent inducer of the pro-inflammatory cytokines and chemokines tested, i.e., TNF-α, IL-8 and RANTES, as well as anti-inflammatory cytokines including IL-10. CFS restored TGF-β levels in the presence of Salmonella. Live B.breve and its supernatant enhanced innate immune responses by the activation of TLR signaling pathway. These treatments upregulated TLR9 gene transcription. In addition, CFS was a more potent inducer of TLR9 expression than the probiotic bacteria in the presence of S. typhi. Expression levels of CASP8 and IRAK4 were also increased by CFS, and both treatments induced TOLLIP gene expression. Our results indicate that the probiotic strain B. breve CNCM I-4035 affects the intestinal immune response, whereas its supernatant exerts anti-inflammatory effects mediated by DCs. This supernatant may protect immune system from highly infectious agents such as Salmonella typhi and can down

  12. Culture supernatants of breast cancer cell line MDA-MB-231 treated with parthenolide inhibit the proliferation, migration, and lumen formation capacity of human umbilical vein endothelial cells

    Institute of Scientific and Technical Information of China (English)

    LI Cai-juan; GUO Su-fen; SHI Tie-mei

    2012-01-01

    Background Parthenolide has been tested for anti-tumor activities,such as anti-proliferation and pro-apoptosis in recent studies.However,little is known about its role in the process of tumor angiogenesis.This study aims to investigate the effects and potential mechanisms of parthenolide on the proliferation,migration and lumen formation capacity of human umbilical vein endothelial cells.Methods Different concentrations of parthenolide were applied to the human breast cancer cell line MDA-MB-231 cells.After 24-hour incubation,the culture supematants were harvested and used to treat human umbilical vein endothelial cells for 24 hours.Then an inverted fluorescence phase contrast microscope was used to evaluate the human umbilical vein endothelial cells.The secretion of vascular endothelial growth factor (VEGF),interleukin (IL)-8 and matrix metalloproteinases (MMP)-9 in the culture supernatant of the MDA-MB-231 cells was then measured with enzyme-linked immunosorbent assay (ELISA) assays.Results Suppression of proliferation,migration,and the lumen formation capacity of human umbilical vein endothelial cells was observed in the presence of the culture supernatants from the breast cancer cell line treated with different concentrations of parthenolide.Parthenolide decreased the levels of the angiogenic factors MMP-9,VEGF,and IL-8secreted by the MDA-MB-231 cells.Conclusions Parthenolide may suppress angiogenesis through decreasing angiogenic factors secreted by breast cancer cells to interfere with the proliferation,migration and lumen-like structure formation of endothelial cells,thereby inhibiting tumor growth.It is a promising potential anti-angiogenic drug.

  13. Early stationary phase culture supernatant accelerates growth of sputum cultures collected after initiation of anti-tuberculosis treatment.

    Science.gov (United States)

    Kolwijck, E; Friedrich, S O; Karinja, M N; van Ingen, J; Warren, R M; Diacon, A H

    2014-07-01

    We investigated the effect of Mycobacterium tuberculosis culture supernatant added to sputum cultures collected during the first 8 weeks of anti-tuberculosis treatment. With ongoing treatment duration, time to culture positivity decreased significantly in supernatant-enriched cultures, possibly due to stimulation of dormant or slowly metabolizing M. tuberculosis cells.

  14. Identification and Immunogenicity of Group A Streptococcus Culture Supernatant Proteins

    OpenAIRE

    Lei, Benfang; Mackie, Stacy; Lukomski, Slawomir; Musser, James M.

    2000-01-01

    Extracellular proteins made by group A Streptococcus (GAS) play critical roles in the pathogenesis of human infections caused by this bacterium. Although many extracellular GAS proteins have been identified and characterized, there has been no systematic analysis of culture supernatant proteins. Proteins present in the culture supernatant of strains of serotype M1 (MGAS 5005) and M3 (MGAS 315) mutants lacking production of the major extracellular cysteine protease were separated by two-dimens...

  15. Purification of monoclonal antibodies, IgG1, from cell culture supernatant by use of metal chelate convective interaction media monolithic columns.

    Science.gov (United States)

    Rajak, Poonam; Vijayalakshmi, M A; Jayaprakash, N S

    2012-12-01

    Monoclonal antibodies (MAbs) have diverse applications in diagnostics and therapeutics. The recent advancement in hybridoma technology for large-scale production of MAbs in bioreactors demands rapid and efficient purification methods. Conventional affinity purification systems have drawbacks of low flow rates and denaturation of antibodies owing to harsh elution conditions. Here, we attempted purification of MAbs by use of a high-throughput metal-chelate methacrylate monolithic system. Monolithic macroporous convective interaction media-iminodiacetate (CIM-IDA) disks immobilized with four different metal ions (Cu²⁺, Ni²⁺, Zn²⁺ and Co²⁺) were used and evaluated for purification of anti-human serum albumin IgG1 mouse MAbs from cell culture supernatant after precipitation with 50% ammonium sulfate. Elution with 10 mM imidazole in the equilibration buffer (25 mM MMA = MOPS (Morpholino propane sulfonic acid) + MES (Morpholino ethane sulfonic acid) + Acetate + 0.5 M NaCl, pH 7.4) resulted in a purification of 25.7 ± 2.9-fold and 32.5 ± 2.6-fold in experiments done using Zn²⁺ and Co²⁺ metal ions, respectively. The highest recovery of 85.4 ± 1.0% was obtained with a CIM-IDA-Zn(II) column. SDS-PAGE, ELISA and immuno-blot showed that the antibodies recovered were pure, with high antigen-binding efficiency. Thus, metal chelate CIM monoliths could be a potential alternative to conventional systems for fast and efficient purification of MAbs from the complex cell culture supernatant.

  16. Application of an enzyme-linked immunoassay for the measurement of pregnancy zone protein (PZP) in cell culture supernatants and sera.

    Science.gov (United States)

    Povlsen, J V; Ingerslev, J; Petersen, C M

    1987-05-01

    A simple and sensitive enzyme-linked immunosorbent assay (ELISA) measuring specifically the pregnancy zone protein (PZP) was constructed. The assay range was 2.0-500 micrograms/l. The intra-assay coefficient of variation (CV%) was 5.9% at the level of 100 micrograms/l and 3.5% at 10 micrograms/l. The imprecision between runs was 4.5% at 100 micrograms/l and 7.6% at 10 micrograms/l. Recovery of the native PZP standard added to serum-free cell culture medium was 98.1 +/- 3.7% (mean +/- SD), and recovery from serum of women in late pregnancy was 96.0 +/- 9.3%. Recovery from PZP-chymotrypsin (PZP-CT) complexes added to serum-free medium was 141 +/- 4.3%. There was no detectable cross-reactivity between the anti-human PZP antibody and human alpha 2-macroglobulin (alpha 2-M). The dose-response of two PZP standards and the PZP serum concentrations of 100 blood donors were determined. Furthermore, the serum level of PZP from 11 patients suffering from IgA myeloma was quantitated and found within the normal range when compared to serum levels of healthy blood donors of the same age and sex. Finally, supernatants from serum-free cultures of different human peripheral blood mononuclear cell (PBM) subpopulations were assayed. Neither of them were found to exhibit any detectable increase in PZP concentration during culture, but cultures of monocytes were found to produce alpha 2-M.

  17. The culture of Chlorella vulgaris in a recycled supernatant: Effects on biomass production and medium quality

    KAUST Repository

    Hadj-Romdhane, F.

    2013-03-01

    Reusing supernatant of microalgae culture medium can have inhibitory or toxic effects on the biomass production because of the release of organic metabolites by cells in the culture medium during their growth. This work investigated the impact of Chlorella vulgaris medium recycling on culture productivity, cells quality and accumulation of excreted metabolites in the culture medium. No significant impact on the C. vulgaris growth was observed after 63days of recycling, the productivity remained stable at around 0.55kgm-3day-1. Organic matters accumulated in supernatant were identified as biopolymers (BP) poor in nitrogen and with a size above 40kDa (probably polysaccharides), and small organic molecules (SOM) richer in nitrogen with a molecular size ranging from 1 to 3kDa. The concentration of biopolymers in the supernatant increased till to a maximum and then decreased, possibly consumed by bacteria, whereas small organic compounds accumulated in the medium. © 2013 Elsevier Ltd.

  18. Fast and simple online sample preparation coupled with capillary LC-MS/MS for determination of prostaglandins in cell culture supernatants

    DEFF Research Database (Denmark)

    Rinne, Sandra; Ramstad Kleiveland, Charlotte; Kassem, Moustapha;

    2007-01-01

    An online 2-D strong cation exchange (SCX)-RP capillary liquid chromatographic (cLC) method with IT mass spectrometric (IT-MS/MS) detection for the simultaneous determination of prostaglandin (PG) A(1), PGD(2), PGE(1), PGE(2), PGF(2a), 6-keto-(6k)PGF(1a), and 15-Delta(12,14)-deoxy-PGJ(2) (15dPGJ(2...... production was analyzed using the developed method. PGE(2 )was found in cultures from both untreated and stimulated hMSCs, while PGE(1) was present above the detection limit only in stimulated cells...

  19. Analysis of IL-2-like factor in lymphocyte culture supernatant of olive flounder, Paralichthys oliveaceus

    Science.gov (United States)

    Wu, Riqin; Zhang, Peijun; Li, Jun; Xu, Yongli

    2005-03-01

    To study immune mechanism of fish lymphocyte we performed a proliferation assay and ELISA using monoclonal antibody against human IL-2. The result showed that an interleukin-2 (IL-2)-like factor was detected in the supernatant of plant haemoglutinin (PHA)-stimulated lymphocyte culture from peripheral blood, spleen and head kidney of olive flounder, Paralichthys olivaceus. The quantities of IL-2-like factor in the supernatant from different lymphoid tissues were quite different. The IL-2 like factor in the supernatant from cultured head kidney lymphocytes was much higher than those of peripheral blood lymphocytes and spleen lymphocytes ( Precombinant human IL-2, (rhIL-2) was able to stimulate flounder thymocyte proliferation and used to detect the IL-2 receptor (IL-2R) on the surface of flounder lymphocyte. The cross-reaction between the lymphocytes of flounder peripheral blood and CD25(IL-2R) was detected with flow cytometry and shown that the percentage of CD25-positive cell in peripheral blood was 7.74±0.67%.

  20. Quantitative analysis of the supernatant from host and transfected CHO cells using iTRAQ 8-plex technique.

    Science.gov (United States)

    Zhu, Guijie; Sun, Liangliang; Albanetti, Thomas; Linkous, Travis; Larkin, Christopher; Schoner, Ronald; McGivney, James B; Dovichi, Norman J

    2016-10-01

    We employed UPLC-MS/MS with iTRAQ 8-plex labeling to quantitatively analyze the supernatant produced by two Chinese hamster ovary (CHO) cell lines (CHO K1SV and CHO CAT-S). In each case, the supernatant from the host and three transfected clones were analyzed at days 5, 7, and 10 of culture. A total of eight iTRAQ 8-plex experiments were performed. For each cell line, the overlap of supernatant protein identifications between transfected clones is over 60%. Over 70% of the supernatant proteins in the CHO K1SV host cell line are present in the CHO CAT-S cell line. For the CHO K1SV cell line, the overlap in supernatant protein identifications between the host cell line and the transfected clones is >59%. For the CHO CAT-S cell line, the overlap between supernatant protein identifications for the transfected clone and host cell is >45%. These differences in the supernatant protein identifications between transfected clones in each cell line and between the two host cell lines are not significant. We used cluster analysis to characterize the change in supernatant protein expression as a function of cell culture time. Roughly 1.3 or clones at each time point. Greater than 65% of the common proteins in the CHO K1SV cell line supernatant and over 54% in the CHO CAT-S cell line supernatant show no significant expression difference between host and the three transfected clones. Data are available via ProteomeXchange with identifier PXD003462. Biotechnol. Bioeng. 2016;113: 2140-2148. © 2016 Wiley Periodicals, Inc. PMID:27070921

  1. Purification and characterization of an inhibitor of thymidine uptake from culture supernatants of human tonsil lymphocytes

    International Nuclear Information System (INIS)

    Lymphocytes from human tonsils were cultured in the absence of serum for 3 days. In the presence of the concentrated culture supernatant the proliferative response of PBL, to con A, as measured by the uptake of 3H-tdr, was significantly reduced. The suppressor substance was referred to as SMAL (suppressor of mitogen activated lymphocytes). The estimated molecular weight of SMAL under nondenaturing conditions was 100,000-300,000. SMAL also suppressed the incorporation of 3H-tdr by a variety of mouse and human tumor cell lines. The activity of SMAL was sensitive to pronase and heating at 1000C for 30 minutes but insensitive to RNase. Treatment with DNase, however, enhanced the activity of SMAL. SMAL was not produced by heat-killed tonsil lymphocytes or lymphocytes-treated with cycloheximide. Maximal production occurred in the first 24 hours of culture, and progressively less was produced in subsequent 24-hour intervals. Both T- and B lymphocyte-enriched culture supernatants contained SMAL. Two active components, one corresponding to a large and/or less negatively charged molecule and another corresponding to small and/or highly acidic molecule, were recovered. HPLC-purified SMAL at relatively low doses inhibited the uptake and phosphorylation of 3H-tdr, without significant effect on cell proliferation. The inhibition of 3H-tdr uptake was favored over that of 3H-udr or 3H-adr, and this effect was reversible

  2. Cell vacuolation induced by Haemophilus influenzae supernatants in HEp-2 cells

    Directory of Open Access Journals (Sweden)

    Maria del Rosario Espinoza-Mellado

    2013-12-01

    Full Text Available Haemophilus influenzae belongs to respiratory tract microbiota. We observed vacuoles formation in previous studies with H. influenzae culture supernatants, so in this work we characterised that cytotoxic effect. We observed an abundant production of acidic cytoplasmic vacuoles due to the presence of a “vacuolating factor” in H. influenzae supernatants which was characterised as thermolabile. Greatest vacuolating activity was observed when utilizing the fraction > 50 kDa. The presence of a large number of vacuoles in HEp-2 cells was verified by transmission electron microscopy and some vacuoles were identified with a double membrane and/or being surrounded by ribosomes. These results suggest similar behaviour to that of vacuolating effects described by autotransporter proteins an undescribed cytotoxic effect induced by H. influenzae .

  3. Analysis of IL-2-like factor in lymphocyte culture supernatant of olive flounder, Paralichthys oliveaceus

    Institute of Scientific and Technical Information of China (English)

    WU Riqin; ZHANG Peijun; LI Jun; XU Yongli

    2005-01-01

    To study immune mechanism of fish lymphocyte we performed a proliferation assay and ELISA using monoclonal antibody against human IL-2. The result showed that an interleukin-2 (IL-2)-like factor was detected in the supernatant of plant haemoglutinin (PHA)-stimulated lymphocyte culture from peripheral blood,spleen and head kidney of olive flounder, Paralichthys olivaceus. The quantities of IL-2-1ike factor in the supematant from different lymphoid tissues were quite different. The IL-2 like factor in the supernatant from cultured head kidney lymphocytes was much higher than those of peripheral blood lymphocytes and spleen lymphocytes (P<0.01). The IL-2 activity was found in either mouse thymocyte proliferation assay or flounder head kidney lymphocyte proliferation assay and shown to have obvious enhancing effect on proliferation of the above two types of cell. The recombinant human IL-2 (rhIL-2) was able to stimulate flounder thymocyte proliferation and used to detect the IL-2 receptor (IL-2R) on the surface of flounder lymphocyte. The cross-reaction between the lymphocytes of flounder peripheral blood and CD25(IL-2R) was detected with flow cytometry and shown that the percentage of CD25-positive cell in peripheral blood was 7.74± 0.67%.

  4. Inhibition of Crotalidae venom hemorrhagic activities by Didelphis marsupialis liver spheroids culture supernatants.

    Science.gov (United States)

    Salgueiro, L M; Rodríguez-Acosta, A; Rivas-Vetencourt, P; Zerpa, M; Carillo, G; Aguilar, I; Girón, M E; Acevedo, C E; Gendzekhadze, K

    2001-05-01

    The main aim of this work was the development of a primary hepatocyte culture from Didelphis marsupialis, to determine the possible use of culture medium supernatants as a source of inhibitors of the Bothrops lanceolatus venom hemorrhagic activity. The cellular culture was carried out from isolated hepatocytes by the double perfusion technique, and digestion of the liver with collagenase and culturing the hepatocytes in a liquid media under continuous agitation at 37 degrees C in 5% CO2. The hemorrhagic activity inhibition assays were performed inoculating intradermically, a mixture of Bothrops lanceolatus venom plus a pool of liver spheroids culture supernatants, in mice. These liver Didelphis marsupialis spheroid cultures were adequate to obtain large supernatant volumes with inhibitors of hemorrhagic activity. PMID:11405280

  5. Tetracycline and Glutathione Inhibit Matrix Metalloproteinase Activity: An In Vitro Study Using Culture Supernatants of L929 and Dalton Lymphoma Cell Lines

    OpenAIRE

    Gajanan Kendre; Rahul Raghavan; Sanith Cheriyamundath; Joseph Madassery

    2013-01-01

    Tetracycline and glutathione inhibited the protease activities of matrix metalloproteinase-2 and matrix metalloproteinase-9 expressed by mouse fibrosarcoma cells (L929) and Dalton lymphoma cells, respectively. The inhibitory activity of the tetracycline may be due to its ability to chelate metal ions such as calcium and zinc. Gelatin-zymography technique was used to demonstrate the inhibitory activity of both tetracycline and glutathione. The intensity of the bands corresponding to metallopro...

  6. Tetracycline and Glutathione Inhibit Matrix Metalloproteinase Activity: An In Vitro Study Using Culture Supernatants of L929 and Dalton Lymphoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Gajanan Kendre

    2013-01-01

    Full Text Available Tetracycline and glutathione inhibited the protease activities of matrix metalloproteinase-2 and matrix metalloproteinase-9 expressed by mouse fibrosarcoma cells (L929 and Dalton lymphoma cells, respectively. The inhibitory activity of the tetracycline may be due to its ability to chelate metal ions such as calcium and zinc. Gelatin-zymography technique was used to demonstrate the inhibitory activity of both tetracycline and glutathione. The intensity of the bands corresponding to metalloproteinase activity in zymography gel was reduced in the presence of 50–100 μg/mL of tetracycline. The presence of 10–100 μg/mL of tetracycline in the medium increased the adherence of L929 cancer cells. These results clearly indicate the antimetastatic property of tetracycline. Reduced glutathione, a compound which is produced endogenously by the cells to maintain the redox status, was shown to inhibit the matrix metalloproteinase activity (in vitro. Therefore, it is assumed that decreased glutathione levels in synovial fluids or plasma might increase the activity of MMP. Reduced glutathione at 100 μg/mL inhibited the metalloproteinase activity in gelatin-zymographic gel. As both tetracycline and glutathione exhibited an inhibitory effect on matrix metalloproteinase activity, it was of great interest to check their clinical effects on various MMP associated pathological conditions such as cancer metastasis and arthritis. Here we report that tetracycline and reduced glutathione inhibited the activity of MMP2 completely and activity of MMP9 partly.

  7. Acaricidal activities of whole cell suspension, cell-free supernatant,and crude cell extract of Xenorhabdus stokiae against mushroom mite (Luciaphorus sp.)

    Institute of Scientific and Technical Information of China (English)

    Prapassom BUSSAMAN; Chirayu SA-UTH; Paweena RATTANAS ENA; Angsumarn CHANDRAPATYA

    2012-01-01

    Xenorhabdus bacterium has been used as a biological control agent against Luciaphorus sp.,a mushroom mite endemic in Thailand.To develop an effective formulation of Xenorhabdus stokiae,treatments using different parts of X.stokiae isolate PB09 culture,including whole cell suspension,cell-free supernatant,and crude cell extract,were performed.The results show that different parts ofX.stokiae isolate PB09 culture could induce variable effects on mite mortality and fecundity.Application with cell-free supernatant of X.stokiae culture resulted in both the highest mite mortality rate [(89.00+3.60)%] and the lowest mite fecundity [(41.33+23.69) eggs/gravid female].Whole cell suspension of X.stokiae isolate PB09 culture was found to be slightly less effective than its cell-free supernatant,suggesting that X.stokiae was more likely to release its metabolites with acaricidal activities to the surrounding culture media.Crude cell extract of X.stokiae was not effective against mites.Cell-free supernatant of X.stokiae isolate PB09 was the most effective biological control agent and it could be conveniently used in future formulations instead of live bacteria.

  8. Identification of specific metabolites in culture supernatant of Mycobacterium tuberculosis using metabolomics: exploration of potential biomarkers

    OpenAIRE

    Lau, Susanna KP; Lam, Ching-Wan; Curreem, Shirly OT; Lee, Kim-Chung; Lau, Candy CY; Chow, Wang-Ngai; Ngan, Antonio HY; To, Kelvin KW; Chan, Jasper FW; Hung, Ivan FN; Yam, Wing-Cheong; Yuen, Kwok-Yung; Woo, Patrick CY

    2015-01-01

    Although previous studies have reported the use of metabolomics for Mycobacterium species differentiation, little is known about the potential of extracellular metabolites of Mycobacterium tuberculosis (MTB) as specific biomarkers. Using an optimized ultrahigh performance liquid chromatography–electrospray ionization–quadruple time of flight–mass spectrometry (UHPLC–ESI–Q–TOF–MS) platform, we characterized the extracellular metabolomes of culture supernatant of nine MTB strains and nine non-t...

  9. Supernatant of Bone Marrow Mesenchymal Stromal Cells Induces Peripheral Blood Mononuclear Cells Possessing Mesenchymal Features

    OpenAIRE

    Hu, Gang; Xu, Jun-jun; Deng, Zhi-Hong; Feng, Jie; Jin, Yan

    2011-01-01

    Increasing evidence shows that some cells from peripheral blood fibroblast-like mononuclear cells have the capacity to differentiate into mesenchymal lineages. However, the insufficiency of these cells in the circulation challenges the cell isolation and subsequently limits the clinical application of these cells. In the present study, the peripheral blood mononuclear cells (pbMNCs) were isolated from wound animals and treated with the supernatant of bone marrow mesenchymal stromal cells (bmM...

  10. An efficient process of generating bispecific antibodies via controlled Fab-arm exchange using culture supernatants.

    Science.gov (United States)

    Paul, Suparna; Connor, Judy; Nesspor, Tom; Haytko, Peter; Boakye, Ken; Chiu, Mark L; Jiang, Haiyan

    2016-05-01

    Bispecific antibody generation is actively pursued for therapeutic and research antibody development. Although there are multiple strategies for generating bispecific antibodies (bsAbs); the common challenge is to develop a scalable method to prepare bsAbs with high purity and yield. The controlled Fab-arm exchange (cFAE) method combines two parental monoclonal antibodies (mAbs), each with a matched point mutation, F405L and K409R in the respective CH3 domains. The conventional process employs two steps: the purification of two parental mAbs from culture supernatants followed by cFAE. Following a reduction/oxidation reaction, the bispecific mAb is formed with greater than 95% heterodimerization efficiency. In this study, cFAE was initiated in culture supernatants expressing the two parental mAbs, thereby eliminating the need to first purify the parental mAbs. The bsAbs formed in culture supernatant was then purified using a Protein A affinity chromatography. The BsAbs generated in this manner had efficiency comparable to the conventional method using purified parental mAbs. BsAbs prepared by two different routes showed indistinguishable characteristics by SDS capillary electrophoresis, analytical size exclusion, and cation exchange chromatography. This alternative method significantly shortened timelines and reduced resources required for bsAb generation, providing an improved process with potential benefits in large-scale bsAb preparation, as well as for HTP small-scale bsAb matrix selection.

  11. [Regulation of endothelial cells functions by ultrasonic supernatant of Streptococcus pyogenes].

    Science.gov (United States)

    Starikova, É A; Lebedeva, A M; Burova, L A; Freĭdlin, I S

    2012-01-01

    Angiogenesis and vascular remodeling are vital components of inflammation. As an inflammation evolves, vessels expand to supply nutrients and inflammatory mediators, sustaining the accumulation of activated immune cells in the affected tissues. This study demonstrates that ultrasonic supernatant of Streptoccocus pyogenes has anti-angiogenic properties: inhibit EA.hy 926 human endothelial cells metabolism, adhesion, migration, proliferation. At the same time Streptococcal components inhibit signaling pathways that involve FAK and ERK1/2. These effects are not associated with necrosis or apoptosis in cell culture. Taking together, our results suggest that impairing angiogenic function of endothelial cells might contribute to the reduced tissue perfusion, hypoxia, and subsequent regional tissue necrosis caused by Streptococci group A. PMID:22567900

  12. Cell-free fetal DNA in amniotic fluid supernatant for prenatal diagnosis.

    Science.gov (United States)

    Soltani, M; Nemati, M; Maralani, M; Estiar, M A; Andalib, S; Fardiazar, Z; Sakhinia, E

    2016-01-01

    In widespread conviction, amniotic fluid is utilized for prenatal diagnosis. Amniotic fluid supernatant is usually discarded, notwithstanding being a good source of fetal DNA. The aim of the present study was to assess cell-free fetal DNA extracted from amniotic fluid supernatant for application in prenatal diagnosis such as gender determination and early diagnosis of β-thalassemia. Samples of amniotic fluid of 70 pregnant women were collected and went through routine tests along with tests for cell-free fetal DNA from amniotic fluid supernatant. The DNA in the amniotic fluid supernatant was extracted and analyzed for gender determination by PCR and Real-time PCR. ARMS-PCR was applied to test early diagnosis of IVS II-I mutation (common β-thalassemia mutation) and E7V mutation for sickle cell anemia using DNA extracted from the amniotic fluid supernatant. Using the cell-free fetal DNA extracted from the amniotic fluid supernatant, the sensitivity of PCR and Real-time PCR for gender detection was compared with the routine cytogenetic method. The fetus tested for sickle cell anemia and β-thalassemia was observed to be healthy but heterozygous for IVS II-I mutation. The findings indicated that cell-free fetal DNA from amniotic fluid supernatant can be a good source of fetal DNA and be used in early prenatal diagnosis since because of its fast and accurate application. Therefore, it would be suggested that the amniotic fluid supernatant's disposal is prevented because if the tests needs to be repeated, cell-free fetal DNA extracted from the amniotic fluid supernatant can be used as an alternative source for prenatal diagnosis.

  13. Cell-free fetal DNA in amniotic fluid supernatant for prenatal diagnosis.

    Science.gov (United States)

    Soltani, M; Nemati, M; Maralani, M; Estiar, M A; Andalib, S; Fardiazar, Z; Sakhinia, E

    2016-01-01

    In widespread conviction, amniotic fluid is utilized for prenatal diagnosis. Amniotic fluid supernatant is usually discarded, notwithstanding being a good source of fetal DNA. The aim of the present study was to assess cell-free fetal DNA extracted from amniotic fluid supernatant for application in prenatal diagnosis such as gender determination and early diagnosis of β-thalassemia. Samples of amniotic fluid of 70 pregnant women were collected and went through routine tests along with tests for cell-free fetal DNA from amniotic fluid supernatant. The DNA in the amniotic fluid supernatant was extracted and analyzed for gender determination by PCR and Real-time PCR. ARMS-PCR was applied to test early diagnosis of IVS II-I mutation (common β-thalassemia mutation) and E7V mutation for sickle cell anemia using DNA extracted from the amniotic fluid supernatant. Using the cell-free fetal DNA extracted from the amniotic fluid supernatant, the sensitivity of PCR and Real-time PCR for gender detection was compared with the routine cytogenetic method. The fetus tested for sickle cell anemia and β-thalassemia was observed to be healthy but heterozygous for IVS II-I mutation. The findings indicated that cell-free fetal DNA from amniotic fluid supernatant can be a good source of fetal DNA and be used in early prenatal diagnosis since because of its fast and accurate application. Therefore, it would be suggested that the amniotic fluid supernatant's disposal is prevented because if the tests needs to be repeated, cell-free fetal DNA extracted from the amniotic fluid supernatant can be used as an alternative source for prenatal diagnosis. PMID:27188728

  14. Bioleaching of metals from steel slag by Acidithiobacillus thiooxidans culture supernatant.

    Science.gov (United States)

    Hocheng, Hong; Su, Cheer; Jadhav, Umesh U

    2014-12-01

    The generation of 300–500 kg of slag per ton of the steel produced is a formidable amount of solid waste available for treatment. They usually contain considerable quantities of valuable metals. In this sense, they may become either important secondary resource if processed in eco-friendly manner for secured supply of contained metals or potential pollutants, if not treated properly. It is possible to recover metals from steel slag by applying bioleaching process. Electric arc furnace (EAF) slag sample was used for bioleaching of metals. In the present study, before bioleaching experiment water washing of an EAF slag was carried out. This reduced slag pH from 11.2 to 8.3. Culture supernatants of Acidithiobacillus thiooxidans (At. thiooxidans), Acidithiobacillus ferrooxidans (At. ferrooxidans), and Aspergillus niger (A. niger) were used for metal solubilization. At. thiooxidans culture supernatant containing 0.016 M sulfuric acid was found most effective for bioleaching of metals from an EAF slag. Maximum metal extraction was found for Mg (28%), while it was least for Mo (0.1%) in six days. Repeated bioleaching cycles increased metal recovery from 28% to 75%, from 14% to 60% and from 11% to 27%, for Mg, Zn and Cu respectively.

  15. Effect of Culture Supernatant Derived from Trichophyton Rubrum Grown in the Nail Medium on the Innate Immunity-related Molecules of HaCaT

    Directory of Open Access Journals (Sweden)

    Xin-Zhu Huang

    2015-01-01

    Full Text Available Background: Trichophyton rubrum is superficial fungi characteristically confined to dead keratinized tissues. These observations suggest that the soluble components released by the fungus could influence the host immune response in a cell in contact-free manner. Therefore, this research aimed to analyze whether the culture supernatant derived from T. rubrum grown in the nail medium could elicit the immune response of keratinocyte effectively. Methods: The culture supernatants of two strains (T1a, T XHB were compared for the β-glucan concentrations and their capacity to impact the innate immunity of keratinocytes. The β-glucan concentrations in the supernatants were determined with the fungal G-test kit and protein concentrations with bicinchoninic acid protein quantitative method, then HaCaT was stimulated with different concentrations of culture supernatants by adopting morphological method to select a suitable dosage. Expressions of host defense genes were assessed by quantitative polymerase chain reaction after the HaCaT was stimulated with the culture supernatants. Data were analyzed with one-way analysis of variance, followed by the least significant difference test. Results: The T. rubrum strains (T1a and T XHB released β-glucan of 87.530 ± 37.581 pg/ml and 15.747 ± 6.453 pg/ml, respectively into the media. The messenger RNA (mRNA expressions of toll-like receptor-2 (TLR2, TLR4, and CARD9 were moderately up-regulated in HaCaT within 6-h applications of both supernatants. HaCaT cells were more responsive to T1a than T XHB . The slight increase of dendritic cells-specific intercellular adhesion molecule 3-grabbing nonintegrin expression was faster and stronger, induced by T1a supernatant than T XHB . The moderate decreases of RNase 7, the slight up-regulations of Dectin-1 and interleukin-8 at the mRNA level were detected only in response to T1a rather than T XHB . After a long-time contact, all the elevated defense genes decreased after

  16. 大肠癌细胞及其上清液体外培养泡球蚴的实验研究%Experimental studies on the in vitro culture of Echinococcus multilocularis metacestodes with Caco-2 cells and its supernatant fluid

    Institute of Scientific and Technical Information of China (English)

    马海龙; 郭倩; 孙世安; 李兆勇

    2012-01-01

    [目的]利用大肠癌细胞(Caco-2)及其培养上述细胞的上清液,在体外对泡球蚴进行培养,建立稳定的体外培养模型,观察泡球蚴的在体外的生长、发育过程.[方法]培养大肠癌细胞(Caco-2),留取细胞上清液.取泡球蚴组织,分别与大肠癌细胞及其细胞培养上清的DMEM完全培养基于37℃5% CO2培养箱中培养38 d.实验期间对囊泡进行计数,观察囊泡生长情况,记录囊泡最大、最小直径,绘制生长曲线.培养结束后,取培养囊泡囊液进行蛋白定量.[结果]泡球蚴与大肠癌细胞及其上清液中均能共同生长,呈出芽生殖方式,囊泡直径0.5~5.0mm;囊液蛋白含量分别为:大肠癌细胞,3.2mg/ml;大肠癌细胞上清液,1.2mg/ml.泡球蚴在体外培养初期呈较快速性生长(1~ 15 d);生长中期可见一平台期(15 ~ 26 d);后期表现为逐渐减少.[结论]多房棘球蚴体外生长因素不依赖培养细胞本身,利用大肠癌细胞上清液建立多房棘球蚴体外培养模型具有一定的可行性,由于大肠癌细胞(Caco-2)与其培养细胞的上清液所含成分可能不同,可能引起囊泡内囊液的蛋白定量有所差异.%[Objective] To establish a model for the in vitro culture of Echinococcus multilocularis metacestodes, and observe the process of growth. [Methods] After recovery Caco-2 cell, and its supernatant fluid, metacestode tissue was placed in DMEM medium containing the cells and its supernatant fluid and cultured in an incubator containing 5% CO2 at 37℃ for a period of 38 days. Number of vesicles was counted, condition of growth was recorded maximum and minimum diameter of vesicle was measured growth curve of secondary vesicles was drawed. Protien level of hydatid fluid of secondary vesicles was determined. [Results] Echinococcus multilocularis metacestodes could develop in DMEM medium containing Caco-2 cell, and its supernatant fluid in vitro. Budding of new cysts were observed and the vesicles

  17. Long acting β2-agonist and corticosteroid restore airway glandular cell function altered by bacterial supernatant

    Directory of Open Access Journals (Sweden)

    Nawrocki-Raby Béatrice

    2010-01-01

    Full Text Available Abstract Background Staphylococcus aureus releases virulence factors (VF that may impair the innate protective functions of airway cells. The aim of this study was to determine whether a long-acting β2 adrenergic receptor agonist (salmeterol hydroxynaphthoate, Sal combined with a corticosteroid (fluticasone propionate, FP was able to regulate ion content and cytokine expression by airway glandular cells after exposure to S. aureus supernatant. Methods A human airway glandular cell line was incubated with S. aureus supernatant for 1 h and then treated with the combination Sal/FP for 4 h. The expression of actin and CFTR proteins was analyzed by immunofluorescence. Videomicroscopy was used to evaluate chloride secretion and X-ray microanalysis to measure the intracellular ion and water content. The pro-inflammatory cytokine expression was assessed by RT-PCR and ELISA. Results When the cells were incubated with S. aureus supernatant and then with Sal/FP, the cellular localisation of CFTR was apical compared to the cytoplasmic localisation in cells incubated with S. aureus supernatant alone. The incubation of airway epithelial cells with S. aureus supernatant reduced by 66% the chloride efflux that was fully restored by Sal/FP treatment. We also observed that Sal/FP treatment induced the restoration of ion (Cl and S and water content within the intracellular secretory granules of airway glandular cells and reduced the bacterial supernatant-dependent increase of pro-inflammatory cytokines IL8 and TNFα. Conclusions Our results demonstrate that treatment with the combination of a corticosteroid and a long-acting β2 adrenergic receptor agonist after bacterial infection restores the airway glandular cell function. Abnormal mucus induced by defective ion transport during pulmonary infection could benefit from treatment with a combination of β2 adrenergic receptor agonist and glucocorticoid.

  18. Beneficial effects of BV2 cell on proliferation and neuron-differentiating of mesenchymal stem cells in the circumstance of injured PC12 cell supernatant

    Institute of Scientific and Technical Information of China (English)

    Xiao-Guang LUO; Hong WANG; Jin ZHOU; Rong YAN; Zhe WU; Chao-Dong ZHANG; Qiu-Shuang WANG

    2006-01-01

    Objective The microglias is the representative of immune cells in the brain. It plays dual roles of both repairing and damaging in injured nervous system, and works as an inevitable component of the circumstance of injured neurons. This study was aiming at the effects of the microglias on the biological activities of mesenchymal stem cells (MSCs) inthe circumstance of injured neurons. Methods MSCs were obtained by primary culture. We adopted PC12 cells (PC12) and BV2 cells (BV2) to substitute for neurons and microglias, respectively. PC12 were injured by aged Aβ1-40 and the supernatant of the injured PC12 was used to set up the circumstance of injured neurons. Transwells were used for co-culture of BV2 and MSCs, which allowed the independent detection of cells after co-culture. Immunofluorescence was used to identify MSCs and neuron-differentiating cells with CD44 and neuron specific enolase (NSE) staining, respectively. MTT assay was adopted to measure the proliferation. Results In the circumstance of both BV2 presence and injured PC12 supernatant incubation, either the proliferation or the differentiation of MSCs reached the highest, which seemed to be contradictory, but we gave our explanations. With the BV2 co-culture, the proliferation of MSCs tend to be higher, but the neuron-differentiating MSCs were similar to those incubated without BV2 co-culture either in normal or injured in PC12 supernatant. With the incubation of injured PC12 supernatant, the neuron-differentiating cells were significantly higher than that of control (P < 0.05). Conclusion In the circumstance of injured neurons, microlgias tend to promote the MSCs proliferation. Although not helpful in neuron-differentiating, microglias did not exert any negative effect either.

  19. Applications of Lactobacillus rhamnosus Spent Culture Supernatant in Cosmetic Antioxidation, Whitening and Moisture Retention Applications

    Directory of Open Access Journals (Sweden)

    Cheng-Chih Tsai

    2013-11-01

    Full Text Available This study was aimed at investigating the antioxidant, whitening, and moisture-retention properties of Lactobacillus rhamnosus spent culture supernatant (Lr-SCS in cosmetic applications. Results reveal that Lr-SCS effectively and gradually scavenges 1,1-diphenyl-2-picrylhydrazyl as well as 2,2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid radical cations, and increases reducing power in a dose-dependent manner. Additionally, Lr-SCS can also suppress tyrosinase activity in vitro and effectively promote moisture retention. Heat treatment at 100 °C for 30 min does not influence the functions of Lr-SCS. We conclude that Lr-SCS can be used effectively in skin care cosmetics.

  20. Experimental studies on the in vitro culture of Echinococcus multilocularis metacestodes with Bel-7404 cells and its supernatant fluid%肝癌细胞及其上清液体外培养多房棘球蚴的实验研究

    Institute of Scientific and Technical Information of China (English)

    马海龙; 李兆勇; 孙世安; 郭倩

    2012-01-01

    [Objective] To cultivate Echinococcus with Bel7404 cell and its supernatant fluid in vitro and observe the process of growth. [ Methods ] After recovery Bel-7404 cells and its supernatant fluid, metacestode vesicle suspension which was aseptically removed from the peritoneal cavity of infected mice and cultured in the presence or absence of Bel-7404 cells for 38 days. Number of vesicles was counted, condition of growth was recorded matimum and minimum diameter of vesicle was meaured growth curve was drawed. Protien level of hydatid fluid of secondary vesicle was determined. [Results] Echinococcus multilocularis metacestodes could develop in Bel-7404 cells or its supernatant in vitro. The vesicles diameter was from 1 to 5 mm. Detection of secondary vesicles' hydatid fluid protein level in vitro and in vivo were 3.8 mg/ml 和 1.1 mg/ml respectively and amplification of DNA showed the same specific 200bp band as Echinococcus multilocularis. [Conclusion]Echinococcus multilocularis metacestodes growth in vitro not rely only on Bel-7404 cells completely. Improvement in vitro culture model of Echinococcus multilocularis metacestodes was feasible by utilizing host cells' supernatant fluid. Different composition of Bel-7404 cells and its supernatant resulted in different of protein level secondary vesicles' hydatid fluid.%[目的]利用肝癌细胞(Bel-7404)及其培养细胞的上清液,在体外对多房棘球蚴进行培养,观察其在体外的生长、发育过程.[方法]培养肝癌细胞(Bel7404),留取细胞上清液,分别取培养细胞及其上清液与多房棘球蚴囊液进行共培养38d.实验期间对囊泡进行计数,观察囊泡生长情况,记录囊泡最大、最小直径,绘制生长曲线,培养结束后,取所培养囊泡壁及其囊液分别进行DNA鉴定和蛋白定量.[结果]多房棘球蚴在肝癌细胞(Bel-7404)及其上清液中均能生长,呈出芽生殖方式,囊泡直径1.0~ 5.0 mm;囊液蛋白含量分别为:肝癌细胞,3.8 mg

  1. Effects of LPS-stimulated monocyte culture supernatant on the osteogenic function of osteoblastic cells in vitro%脂多糖刺激单核巨噬细胞培养上清液对成骨细胞成骨特性的影响

    Institute of Scientific and Technical Information of China (English)

    王海燕; 邓辉; 徐春燕; 叶洁; 胡荣党

    2011-01-01

    目的 探讨建立牙周炎症的体外实验模型的可行性,为后续进行牙周炎症状态下应力对牙槽骨改建的研究奠定基础.方法 以牙龈卟啉单胞菌(Porphyromonas gingivalis,P.g)脂多糖(lipopolysaccharide,LPS)Pg-LPS刺激小鼠单核巨噬细胞(RAW264.7)的培养上清液作用于体外培养的小鼠成骨细胞(MC3T3-E1)24 h和48 h后,分别通过噻唑蓝(MTT)法和碱性磷酸酶(ALP)试剂盒检测MC3T3-E1的增殖活性和碱性磷酸酶活性,观察脂多糖刺激的小鼠单核巨噬细胞培养上清液对小鼠成骨细胞成骨功能的影响.结果 Pg-LPS刺激RAW264.7后其上清液含L-1β、IL-6 和TNF-α等炎症因子,且与LPS的浓度和刺激时间呈依赖性.此上清液对MC3T3-E1的增殖和ALP活性均有抑制作用,亦与上清液中以上炎症因子的浓度呈依赖性,与体内牙周炎症状态相似.结论 Pg-LPS体外刺激RAW264.7的培养上清液可以应用于建立体外牙周炎症模型,这将为后续研究牙周炎症状态下应力对牙槽骨改建的影响奠定初步的基础.%Objective To investigate the influence of Pg-LPS stimulated monocyte (RAW264.7) culture supernatant on the proliferation and alkaline phosphatase (ALP) activity of osteoblastic cells (MC3T3-E1) in vitro. Methods The culture supernatant of monocytes stimulated with Pg-LPS was applied to osteoblasts MC3T3-E1 with different diluted concentrations(10%、20%、30%、40% and 50%) simultaneously for 24 h and 48 h in vitro.The cellular proliferation was assessed by MTT assay, Cellular ALP activity was examined using ALP measurement kit, and the results were statistically analyzed using SPSS 12.0 software package. Results LPS stimulated RAW264.7 to release inflammatory cytokines including IL-1β, IL-6 and TNF-α, whose secretion was in a time and dose dependent manner with the concentration of LPS. After the stimulation of different concentrations of inflammatory supernatant, the proliferation and ALP activity of MC3T3-El

  2. Effect of Culture Supernatant Derived from Trichophyton Rubrum Grown in the Nail Medium on the Innate Immunity-related Molecules of HaCaT

    Institute of Scientific and Technical Information of China (English)

    Xin-Zhu Huang; Pan-Pan Liang; Han Ma; Jin-Ling Yi; Song-Chao Yin; Zhi-Rui Chen; Mei-Rong Li

    2015-01-01

    Background: Trichophyton rubrum is superficial fungi characteristically confined to dead keratinized tissues.These observations suggest that the soluble components released by the fungus could influence the host immune response in a cell in contact-free manner.Therefore,this research aimed to analyze whether the culture supematant derived from T.rubrum grown in the nail medium could elicit the immune response of keratinocyte effectively.Methods: The culture supematants of two strains (T1a, TXHB) were compared for the β-glucan concentrations and their capacity to impact the innate immunity of keratinocytes.The β-glucan concentrations in the supernatants were determined with the fungal G-test kit and protein concentrations with bicinchoninic acid protein quantitative method, then HaCaT was stimulated with different concentrations of culture supernatants by adopting morphological method to select a suitable dosage.Expressions of host defense genes were assessed by quantitative polymerase chain reaction after the HaCaT was stimulated with the culture supernatants.Data were analyzed with one-way analysis of variance, followed by the least significant difference test.Results: The T.rubrum strains (T1 a and TXHB) released β-glucan of 87.530 ± 37.581 pg/ml and 15.747 ± 6.453 pg/ml, respectively into the media.The messenger RNA (mRNA) expressions of toll-like receptor-2 (TLR2), TLR4, and CARD9 were moderately up-regulated in HaCaT within 6-h applications of both supernatants.HaCaT cells were more responsive to T1 a than TXHB.The slight increase of dendritic cells-specific intercellular adhesion molecule 3-grabbing nonintegrin expression was faster and stronger, induced by T1 a supernatant than TXHB.The moderate decreases of RNase 7, the slight up-regulations of Dectin-1 and interleukin-8 at the mRNA level were detected only in response to T1a rather than TXHB.After a long-time contact, all the elevated defense genes decreased after 24 h.Conclusion: The culture

  3. Supernatant of Bone Marrow Mesenchymal Stromal Cells Induces Peripheral Blood Mononuclear Cells Possessing Mesenchymal Features

    Directory of Open Access Journals (Sweden)

    Gang Hu, Jun-jun Xu, Zhi-hong Deng, Jie Feng, Yan Jin

    2011-01-01

    Full Text Available Increasing evidence shows that some cells from peripheral blood fibroblast-like mononuclear cells have the capacity to differentiate into mesenchymal lineages. However, the insufficiency of these cells in the circulation challenges the cell isolation and subsequently limits the clinical application of these cells. In the present study, the peripheral blood mononuclear cells (pbMNCs were isolated from wound animals and treated with the supernatant of bone marrow mesenchymal stromal cells (bmMSCs. Results showed these pbMNCs were fibroblast-like, had stromal morphology, were negative for CD34 and CD45, but positive for Vimentin and Collagen I, and had the multipotency to differentiate into adipocytes and osteoblasts. We named these induced peripheral blood-derived mesenchymal stromal cells (ipbMSCs. Skin grafts in combination with ipbMSCs and collagen I were applied for wound healing, and results revealed ipbMSC exhibited similar potency and effectiveness in the promotion of wound healing to the bmMSCs. Hereafter, we speculate that the mixture of growth factors and chemokines secreted by bmMSCs may play an important roles in the induction of the proliferation and mesenchymal differentiation of mononuclear cells. Our results are clinically relevant because it provide a new method for the acquisition of MSCs which can be used as a candidate for the wound repair.

  4. The Immunostimulation of F4ac ETEC-Culture Supernatant to Porcine Small Intestinal Epithelial Cells%F4ac型产肠毒素大肠杆菌菌液上清对仔猪小肠上皮细胞的免疫刺激作用

    Institute of Scientific and Technical Information of China (English)

    周传丽; 刘铮铸; 俞英; 张勤

    2014-01-01

    [Objective]Porcine enterotoxigenic Escherichia coli (ETEC) is a worldwide cause of bacteria induced diarrhoea in piglets. In the veterinary practices of pig production, serological identification of ETEC shows that F4ac is the most common serological type expressed in ETEC strains isolated from diarrheic piglets. So far, the mechanism by which ETEC produces diarrhoea in piglets has been clearly elucidated. However, the immunostimulation of ETEC-culture to host target cells has not been studied or described. In the present study, the immunostimulation of the supernatant of F4ac ETEC-culture to IPEC-J2 cells was studied.[Method]The culture of F4ac ETEC strain 200 was collected and centrifuged (4℃, 4 000 r/min for 15 min) after 12 hours in culture, and the supernatant was sterilized by passing it through a 0.22μm filter. The solution combined the sterilized supernatant with equivalent DMEM/F12 medium was used to challenge IPEC-J2 cells for 3 hours. The IPEC-J2 cells co-cultured with fresh LB medium and equivalent DMEM/F12 medium were as the control group. For both treatments, each experiment was repeated three times. Total RNAs of the stimulated and control IPEC-J2 cells were extracted using TRIZOL Reagent following the manufacturer’s instructions. According to the manufacturer’s instructions, complementary DNA (cDNA) was synthesized from RNA using the Prime Script® RT reagent Kit with gDNA Eraser (Perfect Real Time). The cDNA samples were then analyzed with real time RT-PCR using a LightCycler® 480 Real-Time PCR System. The real time RT-PCR reactions were performed in a final volume of 20μL with the Roche SYBR Green PCR Kit according to the manufacturer’s instructions. The pig house-keeping gene β-actin was used as the internal standards to correct the input of cDNA. Triplicate qRT-PCRs were performed on each cDNA and the average Ct was used for further analysis. The relative quantification values were calculated using the 2-ΔΔCt. Differential m

  5. Identification of specific metabolites in culture supernatant of Mycobacterium tuberculosis using metabolomics: exploration of potential biomarkers.

    Science.gov (United States)

    Lau, Susanna K P; Lam, Ching-Wan; Curreem, Shirly O T; Lee, Kim-Chung; Lau, Candy C Y; Chow, Wang-Ngai; Ngan, Antonio H Y; To, Kelvin K W; Chan, Jasper F W; Hung, Ivan F N; Yam, Wing-Cheong; Yuen, Kwok-Yung; Woo, Patrick C Y

    2015-01-01

    Although previous studies have reported the use of metabolomics for Mycobacterium species differentiation, little is known about the potential of extracellular metabolites of Mycobacterium tuberculosis (MTB) as specific biomarkers. Using an optimized ultrahigh performance liquid chromatography-electrospray ionization-quadruple time of flight-mass spectrometry (UHPLC-ESI-Q-TOF-MS) platform, we characterized the extracellular metabolomes of culture supernatant of nine MTB strains and nine non-tuberculous Mycobacterium (NTM) strains (four M. avium complex, one M. bovis Bacillus Calmette-Guérin (BCG), one M. chelonae, one M. fortuitum and two M. kansasii). Principal component analysis readily distinguished the metabolomes between MTB and NTM. Using multivariate and univariate analysis, 24 metabolites with significantly higher levels in MTB were identified. While seven metabolites were identified by tandem mass spectrometry (MS/MS), the other 17 metabolites were unidentified by MS/MS against database matching, suggesting that they may be potentially novel compounds. One metabolite was identified as dexpanthenol, the alcohol analog of pantothenic acid (vitamin B5), which was not known to be produced by bacteria previously. Four metabolites were identified as 1-tuberculosinyladenosine (1-TbAd), a product of the virulence-associated enzyme Rv3378c, and three previously undescribed derivatives of 1-TbAd. Two derivatives differ from 1-TbAd by the ribose group of the nucleoside while the other likely differs by the base. The remaining two metabolites were identified as a tetrapeptide, Val-His-Glu-His, and a monoacylglycerophosphoglycerol, phosphatidylglycerol (PG) (16∶0/0∶0), respectively. Further studies on the chemical structure and biosynthetic pathway of these MTB-specific metabolites would help understand their biological functions. Studies on clinical samples from tuberculosis patients are required to explore for their potential role as diagnostic biomarkers. PMID

  6. Cell-free supernatants from probiotic Lactobacillus casei and Lactobacillus rhamnosus GG decrease colon cancer cell invasion in vitro.

    Science.gov (United States)

    Escamilla, Juanita; Lane, Michelle A; Maitin, Vatsala

    2012-08-01

    Probiotics have been shown to have a preventative role in colorectal carcinogenesis but research concerning their prophylactic potential in the later stages of colorectal cancer, specifically metastasis is limited. This study explored the potential of cell-free supernatants (CFS) from 2 probiotic Lactobacillus sp., Lactobacillus casei and Lactobacillus rhamnosus GG, to inhibit colon cancer cell invasion by influencing matrix metalloproteinase-9 (MMP-9) activity and levels of the tight junction protein zona occludens-1 (ZO-1) in cultured metastatic human colorectal carcinoma cells. HCT-116 cells were treated with CFS from L. casei, L. rhamnosus, or Bacteroides thetaiotaomicron (a gut commensal); or with uninoculated bacterial growth media. Treatment with CFS from both Lactobacillus sp. decreased colorectal cell invasion but treatment with CFS from B. thetaiotaomicron did not. CFS from both Lactobacillus sp. decreased MMP-9 and increased ZO-1 protein levels. L. rhamnosus CFS also lowered MMP-9 activity. To begin elucidating the secreted bacterial factor conveying these responses, Lactobacillus sp. CFS were fractionated into defined molecular weight ranges and cell invasion assessed. Fractionation revealed that the inhibitory activity was contained primarily in the >100 kDa and 50-100 kDa fractions, suggesting the inhibitory compound may be a macromolecule such as a protein, nucleic acid, or a polysaccharide. PMID:22830611

  7. In vitro reactivity of Cymbidium hybridum L. protocorms, on bistratified culture media, using various supernatant sucroses solution

    Directory of Open Access Journals (Sweden)

    Lucia MIHALESCU

    2009-05-01

    Full Text Available Knowing the fact that the protocorms’ multiplication processes are accelerated in their submersion conditions in liquid medium, against the situation that, these protocorms are vitrocultivated on solid (agarized medium cultures (which prevails in organogenesis processes, we propose to study the influence exerted by the cultures, practiced in bistratified regime, to Cymbidium protocorms in vitro cultures. In this interest, as supernatant we used bidistilled water, either on sucrose, glucose or fructose solutions, in different concentrations, which were applied over the inoculated protocorms on agarized medium cultures. The basic medium culture used by us in these experiments was Murashige – Skoog (1962 [13]. To this, we added different growth regulators, like: 2,4-D (2 mg/l, or mixtures of BA (2 mg/l with NAA (1 mg/l, or only BA (2 mg/l, or only NAA (1 mg/l. The witness lot consisted of vitrocultivated protocorms on agarized medium culture, without growth regulators, cultivated in monolayer.After 90 days from the initiation of the double-layered medium cultures, we ascertained that, the application of the second layer (the liquid one over the agarized medium cultures strongly stimulated the multiplication of Cymbidium protocorms, and mostly if the second layer was bidistilled water; the usage of a 5% glucose solution as supernatant, was the most inefficient procedure, matter the micropropagation of Cymbidium protocorms, regardless the content of growth regulators existing in agarized layer of medium cultures.

  8. Putative new heat-stable cytotoxic and enterotoxic factors in culture supernatant of Escherichia coli isolated from drinking water

    Directory of Open Access Journals (Sweden)

    DA Ribeiro

    2011-01-01

    Full Text Available Enteric infections caused by the ingestion of contaminated water, especially by Escherichia coli, are important to define the virulence properties of these bacteria. Due to frequent infantile diarrhea in the city of Ouro Preto, Minas Gerais state, Brazil, the phenotypic and genotypic diarrheagenic properties of E. coli isolated from drinking water were studied. The culture supernatants of 39 (40% among a total of 97 E. coli isolates from drinking water were positive by suckling mouse assay and induced cytotoxic effects on Vero cells. The enterotoxic and cytotoxic activities were present in the fraction with less than 10 kDa and were not lost when heated up to 60°C and 100°C for 30 minutes. PCR assays showed that among these 39 Vero cytotoxigenic E. coli, four (10.2% were positive for ST II (estB and two (5% positive for αHly (hlyA. Gene amplification of SLT (stx 1, stx 2, ST I (estA, LT (eltI, eltII, EAST1 (astA, EHly (enhly and plasmid-encoded enterotoxin (pet were not observed. This heat-stable cytotoxic enterotoxin of E. coli is probably a new putative diarrheagenic virulence factor, as a toxin presenting these characteristics has not yet been described.

  9. Lipopolysaccharide-Induced Profiles of Cytokine, Chemokine, and Growth Factors Produced by Human Decidual Cells Are Altered by Lactobacillus rhamnosus GR-1 Supernatant

    OpenAIRE

    Li, Wei; Yang, Siwen; Kim, Sung O.; Reid, Gregor; Challis, John R. G.; Bocking, Alan D.

    2014-01-01

    The aim of this study was to assess the effects of bacterial lipopolysaccharide (LPS) and Lactobacillus rhamnosus GR-1 supernatant (GR-1SN) on secretion profiles of cytokines, chemokines, and growth factors from primary cultures of human decidual cells. Lipopolysaccharide significantly increased the output of proinflammatory cytokines (interleukin [IL]-1B, IL-2, IL-6, IL-12p70, IL-15, IL-17A, interferon gamma [IFN-γ], and tumor necrosis factor [TNF]); anti-inflammatory cytokines (IL-1RN, IL-4...

  10. Detection of interleukin-10 and transforming growth factor-β1 in the culture supernatant of CD4+CD25+ T cells from patients with alopecia areata%斑秃患者外周血CD4+CD25+T细胞培养上清液白介素10和转化生长因子β1检测

    Institute of Scientific and Technical Information of China (English)

    马新华; 邵文俊; 金宛宛; 高宇

    2014-01-01

    Objective To evaluate the potential association of CD4+CD25+ T cells with alopecia areata.Methods Totally,this study enrolled 23 patients with progressive alopecia areata,25 patients with stable alopecia areata,and 25 healthy controls.Peripheral blood was isolated from these subjects followed by isolation of CD4+ CD25+ regulatory T cells,which were then cuhured with the presence of anti-CD3 and-CD28 monoclonal antibodies for four days.Subsequently,enzyme-linked immunosorbent assay was performed to measure the levels of interleukin (IL)-10 and transforming growth factor (TGF)-β1 in the culture supematant of these T cells.Results The levels of IL-10 and TGF-β1 were (31.68 ± 6.78) pg/ml and (32.29 ± 6.8) pg/ml respectively in the culture supernatant of CD4+CD25+ regulatory T cells from patients with progressive alopecia areata,significantly lower than those from the healthy controls ((57.34 ± 14.15) pg/ml and (57.43 ± 15.16) pg/ml,both P < 0.05) and patients with stable alopecia areata ((52.56 ± 13.02) pg/ml and (61.75 ± 14.10) pg/ml,both P < 0.05).However,no significant difference was observed in the supernatant levels of IL-10 or TGF-β1 between the healthy controls and patients with stable alopecia areata.Conclusions The secretion of IL-10 and TGF-β1 by CD4+CD25+ T cells is decreased in patients with progressive alopecia areata,which may contribute to the pathogenesis of alopecia areata.%目的 探讨CD4+CD25+T细胞与斑秃发病之间的关系.方法 收集了3组研究对象,其中健康对照组25例、稳定期斑秃患者25例、进展期斑秃患者23例.抽取所有对象外周血,提取CD4+CD25+T细胞,培养4d,收集培养上清液,ELISA法检测上清液IL-10和TGF-β1水平.结果 进展期斑秃患者外周血CD4+CD25+T细胞培养的IL-10和TGF-β1分别为(31.68±6.78) pg/ml和(32.29±6.80) pg/ml,明显低于健康对照组(57.34±14.15) pg/ml、(57.43±15.16) pg/ml和稳定期斑秃患者(52.56±13.02) pg/ml和(61.75±14.10) pg

  11. The Immunostimulation of F4ac ETEC-Culture Supernatant to Porcine Small Intestinal Epithelial Cells%F4ac型产肠毒素大肠杆菌菌液上清对仔猪小肠上皮细胞的免疫刺激作用

    Institute of Scientific and Technical Information of China (English)

    周传丽; 刘铮铸; 俞英; 张勤

    2014-01-01

    [Objective]Porcine enterotoxigenic Escherichia coli (ETEC) is a worldwide cause of bacteria induced diarrhoea in piglets. In the veterinary practices of pig production, serological identification of ETEC shows that F4ac is the most common serological type expressed in ETEC strains isolated from diarrheic piglets. So far, the mechanism by which ETEC produces diarrhoea in piglets has been clearly elucidated. However, the immunostimulation of ETEC-culture to host target cells has not been studied or described. In the present study, the immunostimulation of the supernatant of F4ac ETEC-culture to IPEC-J2 cells was studied.[Method]The culture of F4ac ETEC strain 200 was collected and centrifuged (4℃, 4 000 r/min for 15 min) after 12 hours in culture, and the supernatant was sterilized by passing it through a 0.22μm filter. The solution combined the sterilized supernatant with equivalent DMEM/F12 medium was used to challenge IPEC-J2 cells for 3 hours. The IPEC-J2 cells co-cultured with fresh LB medium and equivalent DMEM/F12 medium were as the control group. For both treatments, each experiment was repeated three times. Total RNAs of the stimulated and control IPEC-J2 cells were extracted using TRIZOL Reagent following the manufacturer’s instructions. According to the manufacturer’s instructions, complementary DNA (cDNA) was synthesized from RNA using the Prime Script® RT reagent Kit with gDNA Eraser (Perfect Real Time). The cDNA samples were then analyzed with real time RT-PCR using a LightCycler® 480 Real-Time PCR System. The real time RT-PCR reactions were performed in a final volume of 20μL with the Roche SYBR Green PCR Kit according to the manufacturer’s instructions. The pig house-keeping gene β-actin was used as the internal standards to correct the input of cDNA. Triplicate qRT-PCRs were performed on each cDNA and the average Ct was used for further analysis. The relative quantification values were calculated using the 2-ΔΔCt. Differential m

  12. Comprehensive supernatant treatment

    Energy Technology Data Exchange (ETDEWEB)

    Egan, Z. [Oak Ridge National Lab., TN (United States)

    1996-10-01

    This task involves testing of sorbent materials for removing cesium, strontium, and technetium from the saline solutions in DOE storage tank supernatant at Oak Ridge and other sites. Staff at Oak Ridge National Laboratory (ORNL) are recovering and treating the liquid (supernatant) portions of Melton Valley Storage Tank (MVST) waste in a hot cell to separate and remove the radionuclides. Batch tests will be used to evaluate and select the most promising materials for supernatant treatment to reduce the amount of waste for final disposal. Small column tests will be made on selected sorbents to verify the batch data and to obtain additional data for process design. Efforts will be made to obtain samples of tank supernatant from Hanford for comparison.

  13. Antimicrobial Activity of Cell Free Supernatant of Irradiated Lactic Acid Bacteria Isolates

    International Nuclear Information System (INIS)

    Attempts were made to isolate bio preservatives using food wastes with no value and low cost. Whey is the raw material achieved that value. Whey and many other food wastes are used in our study to isolate Lactic acid bacteria (LAB). Cell free supernatants (CFS) of isolates are used to evaluate their antimicrobial activity against indicator pathogenic bacterial strains. CFS-9 isolate from whey has the highest inhibitory activity compared to all other isolates. The inhibitory activity of CFS-9, Nisin (400 IU / ml) and the standard Lactococcus Lactis Subsp. Lactis ATCC 11454 (Lacto) were determined. Furthermore, isolate-9 and Lacto strains were exposed to irradiation at different doses. The inhibition zones of; control isolate-9 (non-irradiated) showed the highest values against all indicator strains, CFS of irradiated Lacto at dose 250 Gy was the highest value against Bacillus cereus and Escherichia coli compared to other irradiation treatments, CFS of irradiated Lacto at dose 100 Gy was the highest value against Staph aureus, while the inhibition zone was in the highest value in CFS of irradiated Lacto at dose 500 Gy against Salmonella typhimurium. Nisin (400 IU / ml) was significantly higher than all CFS of irradiated isolate-9 while, the inhibition zones of all CFS-Lacto (irradiated and nonirradiated) are better and higher than nisin-400

  14. Biological synthesis of very small silver nanoparticles by culture supernatant of Klebsiella pneumonia: The effects of visible-light irradiation and the liquid mixing process

    International Nuclear Information System (INIS)

    This study has investigated different visible-light irradiation's effect on the formation of silver nanoparticles from silver nitrate using the culture supernatant of Klebsiella pneumonia. Our study shows that visible-light emission can significantly prompt the synthesis of silver nanoparticles. Also, the study experimentally investigated the liquid mixing process effect on silver nanoparticle synthesis by visible-light irradiation. This study successfully synthesized uniformly dispersed silver nanoparticles with a uniform size and shape in the range of 1-6 nm with an average size of 3 nm. Furthermore, the study investigated the mechanism of the reduction of silver ions by culture supernatant of K. pneumonia, and used X-ray diffraction to characterize silver chloride as an intermediate compound. Silver chloride was prepared synthetically and used as a substrate for the synthesis of silver nanoparticles by culture supernatant of K. pneumonia. The silver nanoparticles have been prepared from silver chloride during this investigation for the first time.

  15. Peroxynitrite decomposition catalyst prevents apoptotic cell death in a human astrocytoma cell line incubated with supernatants of HIV-infected macrophages

    Directory of Open Access Journals (Sweden)

    Perno Carlo

    2002-09-01

    Full Text Available Abstract Background Oxidative stress has shown to contribute in the mechanisms underlying apoptotic cell death occuring in AIDS-dementia complex. Here we investigated the role of peroxynitrite in apoptosis occurring in astroglial cells incubated with supernatants of HIV-infected human primary macrophages (M/M. Results Flow cytometric analysis (FACS of human cultured astrocytes shortly incubated with HIV-1-infected M/M supernatants showed apoptotic cell death, an effect accompanied by pronounced staining for nitrotyrosine (footprint of peroxynitrite and by abnormal formation of malondialdehyde (MDA. Pretreatment of astrocytes with the peroxynitrite decomposition catalyst FeTMPS antagonized HIV-related astrocytic apoptosis, MDA formation and nitrotyrosine staining. Conclusions Taken together, our results suggest that inibition of peroxynitrite leads to protection against peroxidative stress accompanying HIV-related apoptosis of astrocytes. Overall results support the role of peroxynitrite in HIV-related programmed death of astrocytes and suggest the use of peroxynitrite decomposition catalyst to counteract HIV-1-related neurological disorders.

  16. Supernatant of Bifidobacterium breve induces dendritic cell maturation, activation, and survival through a Toll-like receptor 2 pathway

    OpenAIRE

    Hoarau, Cyrille; Lagaraine, Christine; Martin, Laurence; Velge-Roussel, Florence; Lebranchu, Yvon

    2006-01-01

    International audience Background: Commensal gut bacteria are essential for the development and maintenance of the gut's immune system. Some bacteria strains, such as Lactobacillus and Bifidobacterium species, have been reported to provide protection from allergic and inflammatory bowel diseases. However, the interactions between these commensal bacteria and the immune system are largely unknown. Objective: We studied the effects of a supernatant from the culture of B breve C50 (BbC50) on ...

  17. Quantitative Determination of Lethal Toxin Proteins in Culture Supernatant of Human Live Anthrax Vaccine Bacillus anthracis A16R.

    Science.gov (United States)

    Zai, Xiaodong; Zhang, Jun; Liu, Ju; Liu, Jie; Li, Liangliang; Yin, Ying; Fu, Ling; Xu, Junjie; Chen, Wei

    2016-03-01

    Bacillus anthracis (B. anthracis) is the etiological agent of anthrax affecting both humans and animals. Anthrax toxin (AT) plays a major role in pathogenesis. It includes lethal toxin (LT) and edema toxin (ET), which are formed by the combination of protective antigen (PA) and lethal factor (LF) or edema factor (EF), respectively. The currently used human anthrax vaccine in China utilizes live-attenuated B. anthracis spores (A16R; pXO1+, pXO2-) that produce anthrax toxin but cannot produce the capsule. Anthrax toxins, especially LT, have key effects on both the immunogenicity and toxicity of human anthrax vaccines. Thus, determining quantities and biological activities of LT proteins expressed by the A16R strain is meaningful. Here, we explored LT expression patterns of the A16R strain in culture conditions using another vaccine strain Sterne as a control. We developed a sandwich ELISA and cytotoxicity-based method for quantitative detection of PA and LF. Expression and degradation of LT proteins were observed in culture supernatants over time. Additionally, LT proteins expressed by the A16R and Sterne strains were found to be monomeric and showed cytotoxic activity, which may be the main reason for side effects of live anthrax vaccines. Our work facilitates the characterization of anthrax vaccines components and establishment of a quality control standard for vaccine production which may ultimately help to ensure the efficacy and safety of the human anthrax vaccine A16R. PMID:26927174

  18. Activated platelet supernatant can augment the angiogenic potential of human peripheral blood stem cells mobilized from bone marrow by G-CSF.

    Science.gov (United States)

    Kang, Jeehoon; Hur, Jin; Kang, Jin-A; Yun, Ji-Yeon; Choi, Jae-Il; Ko, Seung Bum; Lee, Choon-Soo; Lee, Jaewon; Han, Jung-Kyu; Kim, Hyun Kyung; Kim, Hyo-Soo

    2014-10-01

    Platelets not only play a role in hemostasis, but they also promote angiogenesis and tissue recovery by releasing various cytokines and making an angiogenic milieu. Here, we examined autologous 'activated platelet supernatant (APS)' as a priming agent for stem cells; thereby enhance their pro-angiogenic potential and efficacy of stem cell-based therapy for ischemic diseases. The mobilized peripheral blood stem cells ((mob)PBSCs) were isolated from healthy volunteers after subcutaneous injection of granulocyte-colony stimulating factor. APS was collected separately from the platelet rich plasma after activation by thrombin. (mob)PBSCs were primed for 6h before analysis. Compared to naive platelet supernatants, APS had a higher level of various cytokines, such as IL8, IL17, PDGF and VEGF. APS-priming for 6h induced (mob)PBSCs to express key angiogenic factors, surface markers (i.e. CD34, CD31, and CXCR4) and integrins (integrins α5, β1 and β2). Also (mob)PBSCs were polarized toward CD14(++)/CD16(+) pro-angiogenic monocytes. The priming effect was reproduced by an in vitro reconstruction of APS. Through this phenotype, APS-priming increased cell-cell adhesion and cell-extracellular matrix adhesion. The culture supernatant of APS-primed (mob)PBSCs contained high levels of IL8, IL10, IL17 and TNFα, and augmented proliferation and capillary network formation of human umbilical vein endothelial cells. In vivo transplantation of APS-primed (mob)PBSCs into athymic mice ischemic hindlimbs and Matrigel plugs elicited vessel differentiation and tissue repair. In safety analysis, platelet activity increased after mixing with (mob)PBSCs regardless of priming, which was normalized by aspirin treatment. Collectively, our data identify that APS-priming can enhance the angiogenic potential of (mob)PBSCs, which can be used as an adjunctive strategy to improve the efficacy of cell therapy for ischemic diseases. PMID:25016235

  19. Repression of the locus of the enterocyte effacement-encoded regulator of gene transcription of Escherichia coli O157:H7 by Lactobacillus reuteri culture supernatants is LuxS and strain dependent.

    Science.gov (United States)

    Jelcić, Ivan; Hüfner, Eric; Schmidt, Herbert; Hertel, Christian

    2008-05-01

    Culture supernatants of Lactobacillus reuteri ATCC 55730 repressed ler expression in Escherichia coli O157:H7 cells, but neither the strain's isogenic luxS mutant nor the L. reuteri 100-23C wild-type strain and its luxS mutant elicited a comparable effect. Furthermore, the epinephrine-mediated induction of ler expression was repressed by secreted substance(s) of L. reuteri ATCC 55730. PMID:18378666

  20. Repression of the Locus of the Enterocyte Effacement-Encoded Regulator of Gene Transcription of Escherichia coli O157:H7 by Lactobacillus reuteri Culture Supernatants Is LuxS and Strain Dependent▿

    OpenAIRE

    Jelčić, Ivan; Hüfner, Eric; Schmidt, Herbert; Hertel, Christian

    2008-01-01

    Culture supernatants of Lactobacillus reuteri ATCC 55730 repressed ler expression in Escherichia coli O157:H7 cells, but neither the strain's isogenic luxS mutant nor the L. reuteri 100-23C wild-type strain and its luxS mutant elicited a comparable effect. Furthermore, the epinephrine-mediated induction of ler expression was repressed by secreted substance(s) of L. reuteri ATCC 55730.

  1. Comparison of DOT-ELISA and Standard-ELISA for Detection of the Vibrio cholerae Toxin in Culture Supernatants of Bacteria Isolated from Human and Environmental Samples.

    Science.gov (United States)

    Meza-Lucas, Antonio; Pérez-Villagómez, María-Fernanda; Martínez-López, José-Patricio; García-Rodea, Ricardo; Martínez-Castelán, María-Guadalupe; Escobar-Gutiérrez, Alejandro; de-la-Rosa-Arana, Jorge-Luis; Villanueva-Zamudio, Altagracia

    2016-09-01

    A comparison of DOT-ELISA and Standard-ELISA was made for detection of Vibrio cholerae toxin in culture supernatants of bacteria isolated from human and environmental samples. A total of 293 supernatants were tested in a double blind assay. A correlation of 100 % was obtained between both techniques. The cholera toxin was found in 20 Inaba and 3 Ogawa strains. Positive samples were from seafood (17 samples), potable water (1 sample) and sewage (5 samples). The DOT-ELISA was useful as the standard-ELISA to confirm the presence of cholera toxin in the environmental samples. PMID:27407304

  2. 人羊膜间充质干细胞培养上清液对人成纤维细胞生物学功能的影响%Effects of culture supernatant of human amnion mesenchymal stem cells on biological characteristics of human fibroblasts

    Institute of Scientific and Technical Information of China (English)

    吴骐而; 吕璐; 辛海明; 罗亮; 童亚林; 莫永亮; 岳毅刚

    2016-01-01

    Objective To investigate the effects of culture supernatant of human amnion mesenchymal stem cells (hAMSCs-CS) on biological characteristics of human fibroblasts.Methods (1) hAMSCs were isolated from deprecated human fresh amnion tissue of placenta and then sub-cultured.The morphology of hAMSCs on culture day 3 and hAMSCs of the third passage were observed with inverted phase contrast microscope.(2) Two batches of hAMSCs of the third passage were obtained,then the expression of vimentin of cells was observed with immunofluorescence method,and the expression of cell surface marker CD90,CD73,CD105,and CD45 was detected by flow cytometer.(3) hAMSCs-CS of the third passage at culture hour 72 were collected,and the content of insulin-like growth factor Ⅰ (IGF-Ⅰ),vascular endothelial growth factor (VEGF),epidermal growth factor (EGF),and basic fibroblast growth factor (bFGF) were detected by enzyme-linked immunosorbent assay.(4) Hunan fibroblasts were isolated from deprecated human fresh prepuce tissue of circumcision and then sub-cultured.Human fibroblasts of the third passage were used in the following experiments.Cells were divided into blank control group and 10%,30%,50%,and 70% hAMSCs-CS groups according to the random number table (the same grouping method below),with 48 wells in each group.Cells in blank control group were cultured with DMEM/F12 medium containing 2% fetal bovine serum (FBS),while cells in the latter 4 groups were cultured with DMEM/F12 medium containing corresponding volume fraction of hAMSCs-CS and 2% FBS.The proliferation activity of cells was detected by cell counting kit 8 and microplate reader at culture hour 12,24,48,and 72,respectively,and corresponding volume fraction of hAMSCs-CS which causing the best proliferation activity of human fibroblasts was used in the following experiments.(5) Human fibroblasts were divided into blank control group and 50% hAMSCs-CS group and treated as in (4),with 4 wells in each group,at post

  3. Genetic susceptibility to S. aureus mastitis in sheep: differential expression of mammary epithelial cells in response to live bacteria or supernatant.

    Science.gov (United States)

    Bonnefont, Cécile M D; Rainard, Pascal; Cunha, Patricia; Gilbert, Florence B; Toufeer, Mehdi; Aurel, Marie-Rose; Rupp, Rachel; Foucras, Gilles

    2012-04-01

    Staphylococcus aureus is a prevalent pathogen for mastitis in dairy ruminants and is responsible for both clinical and subclinical mastitis. Mammary epithelial cells (MEC) represent not only a physical barrier against bacterial invasion but are also active players of the innate immune response permitting infection clearance. To decipher their functions in general and in animals showing different levels of genetic predisposition to Staphylococcus in particular, MEC from ewes undergoing a divergent selection on milk somatic cell count were stimulated by S. aureus. MEC response was also studied according to the stimulation condition with live bacteria or culture supernatant. The early MEC response was studied during a 5 h time course by microarray to identify differentially expressed genes with regard to the host genetic background and as a function of the conditions of stimulation. In both conditions of stimulation, metabolic processes were altered, the apoptosis-associated pathways were considerably modified, and inflammatory and immune responses were enhanced with the upregulation of il1a, il1b, and tnfa and several chemokines known to enhance neutrophil (cxcl8) or mononuclear leukocyte (ccl20) recruitment. Genes associated with oxidative stress were increased after live bacteria stimulation, whereas immune response-related genes were higher after supernatant stimulation in the early phase. Only 20 genes were differentially expressed between Staphylococcus spp-mastitis resistant and susceptible animals without any clearly defined role on the control of infection. To conclude, this suggests that MEC may not represent the cell type at the origin of the difference of mastitis susceptibility, at least as demonstrated in our genetic model. Supernatant or heat-killed S. aureus produce biological effects that are essentially different from those induced by live bacteria. PMID:22337903

  4. [Cell cultures].

    Science.gov (United States)

    Cipro, Simon; Groh, Tomáš

    2014-01-01

    Cell or tissue cultures (both terms are interchangeable) represent a complex process by which eukaryotic cells are maintained in vitro outside their natural environment. They have a broad usage covering not only scientific field but also diagnostic one since they represent the most important way of monoclonal antibodies production which are used for both diagnostic and therapeutic purposes. Cell cultures are also used as a "cultivation medium" in virology and for establishing proliferating cells in cytodiagnostics. They are well-established and easy-to-handle models in the area of research, e.g. as a precious source of nucleic acids or proteins. This paper briefly summarizes their importance and methods as well as the pitfalls of the cultivation and new trends in this field. PMID:24624984

  5. Anti-adherence potential of Enterococcus durans cells and its cell-free supernatant on plastic and stainless steel against foodborne pathogens.

    Science.gov (United States)

    Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun

    2015-07-01

    It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P < 0.05) inhibition potential of the pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.

  6. Understanding ForteBio's Sensors for High-Throughput Kinetic and Epitope Screening for Purified Antibodies and Yeast Culture Supernatant.

    Science.gov (United States)

    Yu, Yao; Mitchell, Scott; Lynaugh, Heather; Brown, Michael; Nobrega, R Paul; Zhi, Xiaoyong; Sun, Tingwan; Caffry, Isabelle; Cao, Yuan; Yang, Rong; Burnina, Irina; Xu, Yingda; Estep, Patricia

    2016-01-01

    Real-time and label-free antibody screening systems are becoming more popular because of the increasing output of purified antibodies and antibody supernatant from many antibody discovery platforms. However, the properties of the biosensor can greatly affect the kinetic and epitope binning results generated by these label-free screening systems. ForteBio human-specific ProA, anti-human IgG quantitation (AHQ), anti-human Fc capture (AHC) sensors, and custom biotinylated-anti-human Fc capture (b-AHFc) sensors were evaluated in terms of loading ability, regeneration, kinetic characterization, and epitope binning with both purified IgG and IgG supernatant. AHC sensors proved unreliable for kinetic or binning assays at times, whereas AHQ sensors showed poor loading and regeneration abilities. ProA sensors worked well with both purified IgG and IgG supernatant. However, the interaction between ProA sensors and the Fab region of the IgG with VH3 germline limited the application of ProA sensors, especially in the epitope binning experiment. In an attempt to generate a biosensor type that would be compatible with a variety of germlines and sample types, we found that the custom b-AHFc sensors appeared to be robust working with both purified IgG and IgG supernatant, with little evidence of sensor-related artifacts.

  7. Culture supernatants from V. cholerae O1 ElTor strains isolated from different geographic areas induce cell vacuolation and cytotoxicity Cepas de V. cholerae O1 biotipo ElTor aisladas de diferente origen geográfico inducen vacuolización celular y citotoxicidad

    Directory of Open Access Journals (Sweden)

    Jorge E Vidal

    2009-02-01

    Full Text Available OBJECTIVE: To investigate whether the HlyA-induced vacuolating effect is produced by V. cholerae O1 ElTor strains isolated from different geographic origins, including Mexico. MATERIAL AND METHODS: Supernatant-induced haemolysis, vacuolating activity and cytotoxicity in Vero cells were recorded. PCR, RFLP analysis and molecular cloning were performed. RESULTS: All ElTor strains analyzed induced cellular vacuolation. Ribotype 2 strains isolates from the U.S. gulf coast yielded the highest titer of vacuolating activity. Eight of nine strains were haemolytic, while all strains were PCR positive for the hlyA gene. We cloned the hlyA gene from two ElTor strains, a toxigenic (2514-88, ctxAB+ and a non-toxigenic Mexican strain (CM 91-3, ctxAB-. Supernatant from those recombinant E. coli strains induced haemolysis, cell vacuolation and cytotoxicity. RFLP-PCR analysis revealed similarities in the hlyA gene from all strains tested. CONCLUSION: The HlyA-induced vacuolating effect is a widespread phenotype of epidemic V. cholerae O1 ElTor strains.OBJETIVO: Analizar el efecto vacuolizante de cepas de V. cholerae O1 ElTor aisladas de diferente origen geográfico, incluyendo México. MATERIAL Y MÉTODOS: Se realizaron pruebas de hemolisis, vacuolización y citotoxicidad en células Vero, así como PCR, análisis por RFLP y clonación molecular. RESULTADOS: Todas las cepas indujeron el efecto vacuolizante. Las cepas del ribotipo 2, aisladas de las costas del Golfo en Estados Unidos, presentaron títulos altos de vacuolización. El gen hlyA fue amplificado en las nueve cepas mediante PCR, aunque sólo ocho fueron hemolíticas. Se clonó el gen hlyA de una cepa toxigénica (2514-88, ctxAB+ y de una cepa no toxigénica aislada en México (CM 91-3, ctxAB-. El sobrenadante de las clonas recombinantes indujo hemólisis, efecto vacuolizante y citotoxicidad. El RFLP mostró alta similitud del gen hlyA de las cepas estudiadas. CONCLUSIÓN: El efecto vacuolizante es un

  8. Performance of multiplex commercial kits to quantify cytokine and chemokine responses in culture supernatants from Plasmodium falciparum stimulations.

    Directory of Open Access Journals (Sweden)

    Gemma Moncunill

    Full Text Available BACKGROUND: Cytokines and chemokines are relevant biomarkers of pathology and immunity to infectious diseases such as malaria. Several commercially available kits based on quantitative suspension array technologies allow the profiling of multiple cytokines and chemokines in small volumes of sample. However, kits are being continuously improved and information on their performance is lacking. METHODOLOGY/PRINCIPAL FINDINGS: Different cytokine/chemokine kits, two flow cytometry-based (eBioscience® FlowCytomix™ and BD™ Cytometric Bead Array Human Enhanced Sensitivity and four Luminex®-based (Invitrogen™ Human Cytokine 25-Plex Panel, Invitrogen™ Human Cytokine Magnetic 30-Plex Panel, Bio-Rad® Bio-Plex Pro™ Human Cytokine Plex Assay and Millipore™ MILLIPLEX® MAP Plex Kit were compared. Samples tested were supernatants of peripheral blood mononuclear cells of malaria-exposed children stimulated with Plasmodium falciparum parasite lysates. Number of responses in range that could be detected was determined and reproducibility of duplicates was evaluated by the Bland-Altman test. Luminex® kits performed better than flow cytometry kits in number of responses in range and reproducibility. Luminex® kits were more reproducible when magnetic beads were used. However, within each methodology overall performance depended on the analyte tested in each kit. Within the Luminex® kits, the Invitrogen™ with polystyrene beads had the poorer performance, whereas Invitrogen™ with magnetic beads had the higher percentage of cytokines/chemokines with both readings in range (40%, followed by Bio-Rad® with magnetic beads (35%. Regarding reproducibility, the Millipore™ kit had the highest percentage (60% of cytokines/chemokines with acceptable limits of agreement (<30%, followed by the Invitrogen™ with magnetic beads (40% that had tighter limits of agreement. CONCLUSIONS/SIGNIFICANCE: Currently available kits for cytokine and chemokine

  9. Human hematopoietic cell culture, transduction, and analyses

    DEFF Research Database (Denmark)

    Bonde, Jesper; Wirthlin, Louisa; Kohn, Donald B;

    2008-01-01

    This unit provides methods for introducing genes into human hematopoietic progenitor cells. The Basic Protocol describes isolation of CD34(+) cells, transduction of these cells with a retroviral vector on fibronectin-coated plates, assaying the efficiency of transduction, and establishing long......-term cultures. Support protocols describe methods for maintenance of vector-producing fibroblasts (VPF) and supernatant collection from these cells, screening medium components for the ability to support hematopoietic cell growth, and establishing colonies from long-term cultures. Other protocols provide PCR...

  10. 骨髓间充质干细胞培养上清液治疗支气管哮喘及对肺部炎症的影响%Culture supernatant of bone marrow mesenchymal stem cells for treatment of bronchial asthma and its influence on lung inflammation

    Institute of Scientific and Technical Information of China (English)

    雷琰; 刘长卿

    2015-01-01

    BACKGROUND:Bronchial asthma is considered general y to have an association with Th2 immune response disease, but there is no ideal treatment. Bone marrow mesenchymal stem cel s as a kind of adult stem cel s not only have the multipotent differentiation and proliferation capacity, but also have low immunogenicity and immunoregulation ability. OBJECTIVE:To investigate the effect of culture supernatant of bone marrow mesenchymal stem cel s on lung inflammation of bronchial asthma mice. METHODS:Twenty experimental mice were randomly divided into control and experimental groups, 10 mice in each group. At 0 and 14 days, intraperitoneal injection of ovalbumin induced sensitization in mice, and at 24-26 days, aerosolized ovalbumin solution was used for excitation. From the 24th day, in the experimental group, bone marrow mesenchymal stem cel supernatant was intraperitoneal y injected at 2 hours before excitation;meanwhile, normal saline was injected in the control group. At the last of excitation, the mice were sacrificed under anesthesia to take serum samples, bronchoalveolar lavage fluid and lung tissues. RESULTS AND CONCLUSION:(1) Mice in the control group appeared to have abnormal lung tissue structure, and there were a large amount of eosinophils and monocytes in the submucosa and muscularis. However, lung inflammation was relieved in the experimental group after bone marrow mesenchymal stem cel treatment. (2) The levels of interleukin-17 in the bronchoalveolar lavage fluid and serum were significantly lower in the experimental group than the control group (P0.05). These findings indicate that the intraperitoneal injection of bone marrow mesenchymal stem cel s can ease lung inflammation and reduce levels of inflammatory markers in the bronchoalveolar lavage fluid and serum of bronchial asthma mice.%背景:医学界普遍认为支气管哮喘是一种与Th2相关的免疫反应疾病,目前尚缺乏理想的治疗方法。骨髓间充质干细胞作为一种成

  11. Food preservative potential of gassericin A-containing concentrate prepared from a cheese whey culture supernatant from Lactobacillus gasseri LA39.

    Science.gov (United States)

    Nakamura, Kiyoshi; Arakawa, Kensuke; Kawai, Yasushi; Yasuta, Narimi; Chujo, Takahiro; Watanabe, Masamichi; Iioka, Hiroyuki; Tanioka, Masashi; Nishimura, Junko; Kitazawa, Haruki; Tsurumi, Koichi; Saito, Tadao

    2013-02-01

    Gassericin A (GA) is a circular bacteriocin produced by Lactobacillus gasseri LA39. In this study, GA-containing concentrate was prepared using a cross-flow membrane filtration device (30 kDa cut-off) from the culture supernatant of Lb. gasseri LA39 cultivated in a cheese whey-based food-grade medium. The bacteriocin activity titer in the concentrate was 16 times as high as that of the culture supernatant and was completely maintained through each incubation at 4°C for 3 months, 37°C for 2 months, 60°C for 5 h, and 100°C for 30 min. The GA-containing concentrate was used with glycine powder to make custard creams, and then four representative strains of custard cream spoilage bacteria (Bacillus cereus, Lactococcus lactis subsp. lactis, Achromobacter denitrificans and Pseudomonas fluorescens) were individually inoculated at c. 10(3) colony forming units/g in the custard creams. Throughout 30 days of incubation at 30°C, all of the inoculated bacteria were completely inhibited by the combination of 5% (w/w) of the GA-containing concentrate and 0.5% (w/w) glycine. This is the first highly practical application of GA to foods as a biopreservative, and the concentration method and the bacteriocin concentrate would contribute to biopreservation of several foods.

  12. Determining antioxidant activities of lactobacilli cell-free supernatants by cellular antioxidant assay: a comparison with traditional methods.

    Directory of Open Access Journals (Sweden)

    Jiali Xing

    Full Text Available Antioxidant activity of lactic acid bacteria is associated with multiple health-protective effects. Traditional indexes of chemical antioxidant activities poorly reflect the antioxidant effects of these bacteria in vivo. Cellular antioxidant activity (CAA assay was used in this study to determine the antioxidant activity of cell-free supernatants (CFSs of 10 Lactobacillus strains. The performance of the CAA assay was compared with that of four chemical antioxidant activity assays, namely, DPPH radical scavenging, hydroxyl radical scavenging (HRS, reducing power (RP, and inhibition of linoleic acid peroxidation (ILAP. Results of the CAA assay were associated with those of DPPH and ILAP assays, but not with those of RP and HRS assays. The inter- and intra-specific antioxidant activities of CFS were characterized by chemical and CAA assays. L. rhamnosus CCFM 1107 displayed a high antioxidative effect similar to positive control L. rhamnosus GG ATCC 53103 in all of the assays. The CAA assay is a potential method for the detection of antioxidant activities of lactobacilli CFSs.

  13. Inhibition of biofilm development and spoilage potential of Shewanella baltica by quorum sensing signal in cell-free supernatant from Pseudomonas fluorescens.

    Science.gov (United States)

    Zhao, Aifei; Zhu, Junli; Ye, Xiaofeng; Ge, Yangyang; Li, Jianrong

    2016-08-01

    The objective of this study was to in vitro evaluate the effect of a cell-free supernatant (CFS) containing quorum sensing (QS) signal of Pseudomonas fluorescens on the growth, biofilm development and spoilage potential of Shewanella baltica, and preliminarily assess the interactive influences of various chemically synthesized autoinducers on spoilage phenotypes of S. baltica. PF01 strain isolated from spoiled Pseudosciaen crocea was identified P. fluorescens. The addition of 25% and 50% CFS to S. baltica culture had no effect on the growth rate during the lag and exponential phase, however, caused cell decline during the stationary phase. The presence of CFS from P. fluorescens significantly inhibited biofilm development, and greatly decreased the production of trimethylamine (TMA) and biogenic amino in S. baltica. Various signal molecules of QS in the CFS of P. fluorescens culture were detected, including seven N-acyl-l-homoserine lactones (AHLs), autoinducer-2 (AI-2) and two diketopiperazines (DKPs). Exogenous supplement of synthesized seven AHLs containing in the CFS decreased biofilm formation and TMA production in S. baltica, while exposure to exogenous cyclo-(l-Pro-l-Leu) was showed to promote spoilage potential, which revealed that S. baltica also sense the two QS molecules. Furthermore, the stimulating effect of cyclo-(l-Pro-l-Leu) was affected when AHL was simultaneously added, suggesting that the inhibitory activity of spoilage phenotypes in S. baltica might be attributed to a competitive effect of these QS compounds in the CFS of P. fluorescens. The present studies provide a good basis for future research on the role of QS in the regulation of spoilage microbial flora. PMID:27149651

  14. Cell-free translation systems prepared from starfish oocytes faithfully reflect in vivo activity; mRNA and initiation factors stimulate supernatants from immature oocytes.

    OpenAIRE

    Xu, Z.; Hille, M B

    1990-01-01

    Meiotic maturation stimulates a change in the translation of stored mRNAs: mRNAs encoding proteins needed for growth of oocytes are translated before meiotic maturation, whereas those encoding proteins required for cleavage are translated after meiotic maturation. Studies of translational regulation during meiotic maturation have been limited by the lack of translationally active cell-free supernatants. Starfish oocytes are ideal for preparing cell-free translation systems because experimenta...

  15. Discovery of Novel Secreted Virulence Factors from Salmonella enterica Serovar Typhimurium by Proteomic Analysis of Culture Supernatants

    Energy Technology Data Exchange (ETDEWEB)

    Niemann, George; Brown, Roslyn N.; Gustin, Jean K.; Stufkens, Afke; Shaikh-Kidwai, Afshan S.; Li, Jie; McDermott, Jason E.; Brewer, Heather M.; Schepmoes, Athena A.; Smith, Richard D.; Adkins, Joshua N.; Heffron, Fred

    2011-01-01

    The intracellular pathogen Salmonella enterica serovar Typhimurium is a leading cause of acute gastroenteritis in the world. This pathogen has two type-III secretion systems (TTSS) necessary for virulence that are encoded in Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2) and are expressed during extracellular or intracellular infectious states, respectively, to deliver virulence factors (effectors) to the host cell cytoplasm. While many have been identified and at least partially characterized, the full repertoire of effectors has not been catalogued. In this mass spectrometry-based proteomics study, we identified effector proteins secreted under minimal acidic medium growth conditions that induced the SPI-2 TTSS and its effectors, and compared the secretome from the parent strain to the secretome from strains missing either essential (SsaK) or regulatory components (SsaL) of the SPI-2 secretion apparatus. We identified 75% of the known TTSS effector repertoire. Excluding translocon components, 95% of the known effectors were biased for identification in the ssaL mutant background, which demonstrated that SsaL regulates SPI-2 type III secretion. To confirm secretion to animal cells, we made translational fusions of several of the best candidates to the calmodulin-dependent adenylate cyclase of Bordetella pertussis and assayed cAMP levels of infected J774 macrophage-like cells. From these infected cells we identified six new TTSS effectors and two others that are secreted independent of TTSS. Our results substantiate reports of additional secretion systems encoded by Salmonella other than TTSS.

  16. Lipopolysaccharide-Induced Profiles of Cytokine, Chemokine, and Growth Factors Produced by Human Decidual Cells Are Altered by Lactobacillus rhamnosus GR-1 Supernatant.

    Science.gov (United States)

    Li, Wei; Yang, Siwen; Kim, Sung O; Reid, Gregor; Challis, John R G; Bocking, Alan D

    2014-01-15

    The aim of this study was to assess the effects of bacterial lipopolysaccharide (LPS) and Lactobacillus rhamnosus GR-1 supernatant (GR-1SN) on secretion profiles of cytokines, chemokines, and growth factors from primary cultures of human decidual cells. Lipopolysaccharide significantly increased the output of proinflammatory cytokines (interleukin [IL]-1B, IL-2, IL-6, IL-12p70, IL-15, IL-17A, interferon gamma [IFN-γ], and tumor necrosis factor [TNF]); anti-inflammatory cytokines (IL-1RN, IL-4, IL-9, and IL-10); chemokines (IL-8, eotaxin, IFN-inducible protein 10 [IP-10], monocyte chemoattractant protein 1 [MCP-1], macrophage inflammatory protein-1α [MIP-1α], macrophage inflammatory protein-1β [MIP-1β], and regulated on activation normal T cell expressed and secreted [RANTES]); and growth factors (granulocyte colony-stimulating factor [CSF] 3, CSF-2, and vascular endothelial growth factor A [VEGFA]). Lactobacillus rhamnosus GR-1SN alone significantly increased CSF-3, MIP-1α MIP-1β, and RANTES but decreased IL-15 and IP-10 output. The GR-1SN also significantly or partially reduced LPS-induced proinflammatory cytokines TNF, IFN-γ, IL-1β, IL-2 IL-6, IL-12p70, IL-15, IL-17, and IP-10; partially reduced LPS-induced anti-inflammatory cytokines IL-1RN, IL-4 and IL-10, and LPS-induced VEGFA output but did not affect CSF-3, MIP-1α, MIP-1β, MCP-1, IL-8, and IL-9. Our results demonstrate that GR-1SN attenuates the inflammatory responses to LPS by human decidual cells, suggesting its potential role in ameliorating intrauterine infection. PMID:24429676

  17. Reverse transcriptase activity in chicken embryo fibroblast culture supernatants is associated with particles containing endogenous avian retrovirus EAV-0 RNA.

    OpenAIRE

    Weissmahr, R N; Schüpbach, J; Böni, J

    1997-01-01

    We have recently shown that live attenuated virus vaccines produced on chicken-derived cells contain low levels of particle-associated reverse transcriptase (RT). In both virus and corresponding control harvests produced on chicken embryo fibroblasts, these activities were present at significantly higher concentrations than in the vaccines. In order to identify the putative retrovirus sequence responsible for this activity, a novel method for the selective PCR amplification of particle-associ...

  18. Discovery of novel secreted virulence factors from Salmonella enterica serovar Typhimurium by proteomic analysis of culture supernatants.

    Science.gov (United States)

    Niemann, George S; Brown, Roslyn N; Gustin, Jean K; Stufkens, Afke; Shaikh-Kidwai, Afshan S; Li, Jie; McDermott, Jason E; Brewer, Heather M; Schepmoes, Athena; Smith, Richard D; Adkins, Joshua N; Heffron, Fred

    2011-01-01

    Salmonella enterica serovar Typhimurium is a leading cause of acute gastroenteritis throughout the world. This pathogen has two type III secretion systems (TTSS) encoded in Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2) that deliver virulence factors (effectors) to the host cell cytoplasm and are required for virulence. While many effectors have been identified and at least partially characterized, the full repertoire of effectors has not been catalogued. In this proteomic study, we identified effector proteins secreted into defined minimal medium designed to induce expression of the SPI-2 TTSS and its effectors. We compared the secretomes of the parent strain to those of strains missing essential (ssaK::cat) or regulatory (ΔssaL) components of the SPI-2 TTSS. We identified 20 known SPI-2 effectors. Excluding the translocon components SseBCD, all SPI-2 effectors were biased for identification in the ΔssaL mutant, substantiating the regulatory role of SsaL in TTS. To identify novel effector proteins, we coupled our secretome data with a machine learning algorithm (SIEVE, SVM-based identification and evaluation of virulence effectors) and selected 12 candidate proteins for further characterization. Using CyaA' reporter fusions, we identified six novel type III effectors and two additional proteins that were secreted into J774 macrophages independently of a TTSS. To assess their roles in virulence, we constructed nonpolar deletions and performed a competitive index analysis from intraperitoneally infected 129/SvJ mice. Six mutants were significantly attenuated for spleen colonization. Our results also suggest that non-type III secretion mechanisms are required for full Salmonella virulence.

  19. Fish Stem Cell Cultures

    OpenAIRE

    Ni Hong, Zhendong Li, Yunhan Hong

    2011-01-01

    Stem cells have the potential for self-renewal and differentiation. First stem cell cultures were derived 30 years ago from early developing mouse embryos. These are pluripotent embryonic stem (ES) cells. Efforts towards ES cell derivation have been attempted in other mammalian and non-mammalian species. Work with stem cell culture in fish started 20 years ago. Laboratory fish species, in particular zebrafish and medaka, have been the focus of research towards stem cell cultures. Medaka is th...

  20. Optimizing stem cell culture.

    Science.gov (United States)

    van der Sanden, Boudewijn; Dhobb, Mehdi; Berger, François; Wion, Didier

    2010-11-01

    Stem cells always balance between self-renewal and differentiation. Hence, stem cell culture parameters are critical and need to be continuously refined according to progress in our stem cell biology understanding and the latest technological developments. In the past few years, major efforts have been made to define more precisely the medium composition in which stem cells grow or differentiate. This led to the progressive replacement of ill-defined additives such as serum or feeder cell layers by recombinant cytokines or growth factors. Another example is the control of the oxygen pressure. For many years cell cultures have been done under atmospheric oxygen pressure which is much higher than the one experienced by stem cells in vivo. A consequence of cell metabolism is that cell culture conditions are constantly changing. Therefore, the development of high sensitive monitoring processes and control algorithms is required for ensuring cell culture medium homeostasis. Stem cells also sense the physical constraints of their microenvironment. Rigidity, stiffness, and geometry of the culture substrate influence stem cell fate. Hence, nanotopography is probably as important as medium formulation in the optimization of stem cell culture conditions. Recent advances include the development of synthetic bioinformative substrates designed at the micro- and nanoscale level. On going research in many different fields including stem cell biology, nanotechnology, and bioengineering suggest that our current way to culture cells in Petri dish or flasks will soon be outdated as flying across the Atlantic Ocean in the Lindbergh's plane. PMID:20803548

  1. Effects of neuroglia cultured supernatants with LPS-priming on neurons%LPS预激神经胶质细胞培养上清对神经元的影响

    Institute of Scientific and Technical Information of China (English)

    谢泽锋; 苏芸; 蒋治武; 许燕璇; 辛岗; 李康生

    2012-01-01

    and microglia)were cultured in vitro and identified by immunofluorescence. Thereafter,these glial cells were divided into 4 groups:LPS-primed group, 0.01μg/ml of LPS treated group, 1 μg/ml of LPS treated group and non-treated group. The LPS-primed group was preconditioned with 0.01μg/ml of LPS for 18 hours and re-retreated with a higher dose of LPS (1μg/ml LPS)for 24 hours. Then all cultured supernatants of 4 groups were collected and were used to treat the neurons for 24 hours in vitro. The cytotoxicity and secretion ability of proinflammatory cytokines were determined by CCK-8 kit and ELISA respectively. Results The cytotocixity of neurons was decreased by the treatment with the astrocyte supernatant of LPS-primed group,there was significant difference statistically if compared with 0.01μg/ml and lug/ml of LPS groups (P0.05). As for TNF-α levels, it was increased by the treatment with the astrocyte supernatant of LPS-primed group, 0.0 1μg/ml of LPS treated group, 1μg/ml of LPS treated group,particularly in 1ug/ml of LPS treated group,statistical difference was found when compared with 0.01μg/ml of LPS treated group and non-treated group (P0.05). Conclusion There were diverse effects (ncluding protection or injury) of cultured supernatants from astrocytes and microglia on the cytotoxicity and secretion ability in the neurons,because of the readjustment of bioacitve molecules with LPS preconditioning in target cells.

  2. Astrocytes Enhance Streptococcus suis-Glial Cell Interaction in Primary Astrocyte-Microglial Cell Co-Cultures.

    Science.gov (United States)

    Seele, Jana; Nau, Roland; Prajeeth, Chittappen K; Stangel, Martin; Valentin-Weigand, Peter; Seitz, Maren

    2016-06-13

    Streptococcus (S.) suis infections are the most common cause of meningitis in pigs. Moreover, S. suis is a zoonotic pathogen, which can lead to meningitis in humans, mainly in adults. We assume that glial cells may play a crucial role in host-pathogen interactions during S. suis infection of the central nervous system. Glial cells are considered to possess important functions during inflammation and injury of the brain in bacterial meningitis. In the present study, we established primary astrocyte-microglial cell co-cultures to investigate interactions of S. suis with glial cells. For this purpose, microglial cells and astrocytes were isolated from new-born mouse brains and characterized by flow cytometry, followed by the establishment of astrocyte and microglial cell mono-cultures as well as astrocyte-microglial cell co-cultures. In addition, we prepared microglial cell mono-cultures co-incubated with uninfected astrocyte mono-culture supernatants and astrocyte mono-cultures co-incubated with uninfected microglial cell mono-culture supernatants. After infection of the different cell cultures with S. suis, bacteria-cell association was mainly observed with microglial cells and most prominently with a non-encapsulated mutant of S. suis. A time-dependent induction of NO release was found only in the co-cultures and after co-incubation of microglial cells with uninfected supernatants of astrocyte mono-cultures mainly after infection with the capsular mutant. Only moderate cytotoxic effects were found in co-cultured glial cells after infection with S. suis. Taken together, astrocytes and astrocyte supernatants increased interaction of microglial cells with S. suis. Astrocyte-microglial cell co-cultures are suitable to study S. suis infections and bacteria-cell association as well as NO release by microglial cells was enhanced in the presence of astrocytes.

  3. Growth Inhibition of Cronobacter sakazakii in Experimentally Contaminated Powdered Infant Formula by Kefir Supernatant.

    Science.gov (United States)

    Kim, Dong-Hyeon; Chon, Jung-Whan; Kang, Il-Byeong; Kim, Hyunsook; Kim, Hong-Seok; Song, Kwang-Young; Seo, Kun-Ho

    2015-09-01

    Kefir is a type of fermented milk containing lactic and acetic acid bacteria and yeast. In this study, we evaluated the antimicrobial activity of kefir supernatant against Cronobacter sakazakii in powdered infant formula (PIF). In a spot-on-lawn test, the growth of 20 C. sakazakii strains, including 10 clinical and 10 food isolates, was completely inhibited in the presence of kefir supernatant. Significant differences in the diameters of inhibition zones were observed upon treatment with kefir compared with the results for Lactobacillus kefiri and Candida kefyr culture supernatants or solutions of lactic and acetic acid and ethyl alcohol in the agar well diffusion test (P < 0.05). The addition of 100 μl of kefir supernatant to 1 ml of nutrient broth completely inhibited the growth of C. sakazakii, as evaluated by spectrophotometry. The antimicrobial activity of kefir supernatant in experimentally contaminated PIF was also tested; we found no viable C. sakazakii cells remaining in PIF rehydrated with 30% kefir supernatant solution for 1 h, demonstrating that the antimicrobial activity of kefir supernatant against C. sakazakii could be applied in real food samples.

  4. Bacterial cell culture

    OpenAIRE

    sprotocols

    2014-01-01

    ### Materials 1. Glass culture tubes with metal caps and labels - Growth medium, from media room or customized - Glass pipette tubes - Parafilm ### Equipment 1. Vortexer - Fireboy or Bunsen burner - Motorized pipette - Micropipettes and sterile tips ### Procedure For a typical liquid culture, use 5 ml of appropriate medium. The amount in each tube does not have to be exact if you are just trying to culture cells for their precious DNA. 1. Streak an a...

  5. Fish Stem Cell Cultures

    Directory of Open Access Journals (Sweden)

    Ni Hong, Zhendong Li, Yunhan Hong

    2011-01-01

    Full Text Available Stem cells have the potential for self-renewal and differentiation. First stem cell cultures were derived 30 years ago from early developing mouse embryos. These are pluripotent embryonic stem (ES cells. Efforts towards ES cell derivation have been attempted in other mammalian and non-mammalian species. Work with stem cell culture in fish started 20 years ago. Laboratory fish species, in particular zebrafish and medaka, have been the focus of research towards stem cell cultures. Medaka is the second organism that generated ES cells and the first that gave rise to a spermatogonial stem cell line capable of test-tube sperm production. Most recently, the first haploid stem cells capable of producing whole animals have also been generated from medaka. ES-like cells have been reported also in zebrafish and several marine species. Attempts for germline transmission of ES cell cultures and gene targeting have been reported in zebrafish. Recent years have witnessed the progress in markers and procedures for ES cell characterization. These include the identification of fish homologs/paralogs of mammalian pluripotency genes and parameters for optimal chimera formation. In addition, fish germ cell cultures and transplantation have attracted considerable interest for germline transmission and surrogate production. Haploid ES cell nuclear transfer has proven in medaka the feasibility of semi-cloning as a novel assisted reproductive technology. In this special issue on “Fish Stem Cells and Nuclear Transfer”, we will focus our review on medaka to illustrate the current status and perspective of fish stem cells in research and application. We will also mention semi-cloning as a new development to conventional nuclear transfer.

  6. Fish stem cell cultures.

    Science.gov (United States)

    Hong, Ni; Li, Zhendong; Hong, Yunhan

    2011-04-13

    Stem cells have the potential for self-renewal and differentiation. First stem cell cultures were derived 30 years ago from early developing mouse embryos. These are pluripotent embryonic stem (ES) cells. Efforts towards ES cell derivation have been attempted in other mammalian and non-mammalian species. Work with stem cell culture in fish started 20 years ago. Laboratory fish species, in particular zebrafish and medaka, have been the focus of research towards stem cell cultures. Medaka is the second organism that generated ES cells and the first that gave rise to a spermatogonial stem cell line capable of test-tube sperm production. Most recently, the first haploid stem cells capable of producing whole animals have also been generated from medaka. ES-like cells have been reported also in zebrafish and several marine species. Attempts for germline transmission of ES cell cultures and gene targeting have been reported in zebrafish. Recent years have witnessed the progress in markers and procedures for ES cell characterization. These include the identification of fish homologs/paralogs of mammalian pluripotency genes and parameters for optimal chimera formation. In addition, fish germ cell cultures and transplantation have attracted considerable interest for germline transmission and surrogate production. Haploid ES cell nuclear transfer has proven in medaka the feasibility of semi-cloning as a novel assisted reproductive technology. In this special issue on "Fish Stem Cells and Nuclear Transfer", we will focus our review on medaka to illustrate the current status and perspective of fish stem cells in research and application. We will also mention semi-cloning as a new development to conventional nuclear transfer.

  7. Optimizing stem cell culture.

    OpenAIRE

    van der Sanden, Boudewijn; Dhobb, Mehdi; Berger, François; Wion, Didier

    2010-01-01

    International audience Stem cells always balance between self-renewal and differentiation. Hence, stem cell culture parameters are critical and need to be continuously refined according to progress in our stem cell biology understanding and the latest technological developments. In the past few years, major efforts have been made to define more precisely the medium composition in which stem cells grow or differentiate. This led to the progressive replacement of ill-defined additives such a...

  8. Digital Microfluidic Cell Culture.

    Science.gov (United States)

    Ng, Alphonsus H C; Li, Bingyu Betty; Chamberlain, M Dean; Wheeler, Aaron R

    2015-01-01

    Digital microfluidics (DMF) is a droplet-based liquid-handling technology that has recently become popular for cell culture and analysis. In DMF, picoliter- to microliter-sized droplets are manipulated on a planar surface using electric fields, thus enabling software-reconfigurable operations on individual droplets, such as move, merge, split, and dispense from reservoirs. Using this technique, multistep cell-based processes can be carried out using simple and compact instrumentation, making DMF an attractive platform for eventual integration into routine biology workflows. In this review, we summarize the state-of-the-art in DMF cell culture, and describe design considerations, types of DMF cell culture, and cell-based applications of DMF. PMID:26643019

  9. DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

    International Nuclear Information System (INIS)

    A Lyt-2+, trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3H counts from target cells prelabeled with [3H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1+, ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

  10. [Continuous perfusion culture hybridoma cells for production of monoclonal antibody].

    Science.gov (United States)

    Mi, Li; Li, Ling; Feng, Qiang; Yu, Xiao-Ling; Chen, Zhi-Nan

    2002-05-01

    Hybridoma cells were cultured by continuous perfusion in Fibra-Cel of 5L packed-bed bioreactor for 22 days in low serum or serum-free media. The corresponded amino acids were fed and serum concentration was decreased by analyzing glucose concentration, oxygen uptake rate, secretary antibody amount and amino acids concentration in culture supernatant. Comparing with continuous perfusion culture that amino acids were not fed, antibody amount of production was increased about 2-3 times. The inoculated cell density was 2.5 x 10(5) cells/mL, while the final cell density was 8.79 x 10(8) cells/mL. Antibody production was reached 295 mg/L/d at average level, and the highest level was reached 532 mg/L/d. These results provided a primary mode of enlarge culture for monoclonal antibody industralization. PMID:12192875

  11. A significant proportion of normal resting B cells are induced to secrete immunoglobulin through contact with anti-receptor antibody-activated helper T cells in clonal cultures

    DEFF Research Database (Denmark)

    Riedel, C; Owens, T; Nossal, G J

    1988-01-01

    and B cells into proximity at the sulcus formed at the bottom edge of the culture wells. When T cell numbers were limiting, unirradiated T cells out-performed irradiated T cells. Some cell clones held for 7 days switched to IgG antibody production. E9.D4 supernatants were virtually ineffective...

  12. Cell Culturing of Cytoskeleton

    Science.gov (United States)

    2004-01-01

    Biomedical research offers hope for a variety of medical problems, from diabetes to the replacement of damaged bone and tissues. Bioreactors, which are used to grow cells and tissue cultures, play a major role in such research and production efforts. Cell culturing, such as this bone cell culture, is an important part of biomedical research. The BioDyn payload includes a tissue engineering investigation. The commercial affiliate, Millenium Biologix, Inc. has been conducting bone implant experiments to better understand how synthetic bone can be used to treat bone-related illnesses and bone damaged in accidents. On STS-95, the BioDyn payload will include a bone cell culture aimed to help develop this commercial synthetic bone product. Millenium Biologix, Inc. is exploring the potential for making human bone implantable materials by seeding its proprietary artificial scaffold material with human bone cells. The product of this tissue engineering experiment using the Bioprocessing Modules (BPMs) on STS-95 is space-grown bone implants, which could have potential for dental implants, long bone grafts, and coating for orthopedic implants such as hip replacements.

  13. Oscillating Cell Culture Bioreactor

    Science.gov (United States)

    Freed, Lisa E.; Cheng, Mingyu; Moretti, Matteo G.

    2010-01-01

    To better exploit the principles of gas transport and mass transport during the processes of cell seeding of 3D scaffolds and in vitro culture of 3D tissue engineered constructs, the oscillatory cell culture bioreactor provides a flow of cell suspensions and culture media directly through a porous 3D scaffold (during cell seeding) and a 3D construct (during subsequent cultivation) within a highly gas-permeable closed-loop tube. This design is simple, modular, and flexible, and its component parts are easy to assemble and operate, and are inexpensive. Chamber volume can be very low, but can be easily scaled up. This innovation is well suited to work with different biological specimens, particularly with cells having high oxygen requirements and/or shear sensitivity, and different scaffold structures and dimensions. The closed-loop changer is highly gas permeable to allow efficient gas exchange during the cell seeding/culturing process. A porous scaffold, which may be seeded with cells, is fixed by means of a scaffold holder to the chamber wall with scaffold/construct orientation with respect to the chamber determined by the geometry of the scaffold holder. A fluid, with/without biological specimens, is added to the chamber such that all, or most, of the air is displaced (i.e., with or without an enclosed air bubble). Motion is applied to the chamber within a controlled environment (e.g., oscillatory motion within a humidified 37 C incubator). Movement of the chamber induces relative motion of the scaffold/construct with respect to the fluid. In case the fluid is a cell suspension, cells will come into contact with the scaffold and eventually adhere to it. Alternatively, cells can be seeded on scaffolds by gel entrapment prior to bioreactor cultivation. Subsequently, the oscillatory cell culture bioreactor will provide efficient gas exchange (i.e., of oxygen and carbon dioxide, as required for viability of metabolically active cells) and controlled levels of fluid

  14. Supernatants of activated natural killer cells enhance the capability of CTL cells for killing hepatoma cells%NK 细胞上清液提高CTL 细胞对肝癌细胞杀伤力的研究

    Institute of Scientific and Technical Information of China (English)

    李旭宏; 王晓波; 余少鸿; 隆洪木; 范德庆; 曾江潮; 刘刚; 陈先锋

    2016-01-01

    Objective To investigate whether supernatants of natural killer (NK)cells activated with IL‐12 ,IL‐18 ,and both with IL‐2 ,can endows AFP specific CTL cells on hepatoma cells function .Methods NK cells were cultured and activated with IL‐12 ,IL‐18 ,and both with IL‐2 ,3 days later extract supernatants of NK cells ,and together culture with hepa1‐6 tumor cells overnight .Then M HC class I expression of hepa1‐6 tumor cells were assayed with flow cytometry ,and as targets for AFP specific CTL cells for cy‐totoxic assay .Results The IFNγ concentrations of NK cells in the supernatants activated with IL‐12 ,IL‐18 ,and both with IL‐2 , were significantly more than NK cells activated with IL‐2(P< 0 .05) ,and which could effectively increase the expression of M HC class I on hepa1‐6 tumor cells to further enhance the capability of CTL cells for killing target cells (P< 0 .05) .However ,blocking the secretion of IFNγdoes the opposite .Conclusion Supernatants from NK cells will induce increased M HC class I expression on target cells and will enhance the fuctionality of killing hepatoma cells on AFP specific CTL cells .%目的:研究用白细胞介素2(IL‐2)联合IL‐12、IL‐18以及三者共同活化NK细胞所提取的上清液与肝癌细胞共培养是否能提高AFP特异性的细胞毒性T细胞(CTL)对小鼠肝癌细胞的杀伤性。方法提取NK 细胞,分别用IL‐26000 IU/mL、IL‐26000 IU/mL+ IL‐1210 ng/mL、IL‐26000 IU/mL+IL‐l8100 ng/mL、IL‐26000 IU/mL+IL‐1210 ng/mL+IL‐18100 ng/mL活化NK细胞,3 d后提取上清液,ELISA检测上清液IFNγ表达量,然后将上清液与Hepa1‐6细胞培养过夜,流式细胞仪检测肿瘤细胞表面I类组织相容性抗原(M HC I)表达,以其为靶细胞检测AFP特异性的CTL细胞对 Hepa1‐6细胞杀伤率。结果NK+IL‐2+IL‐12、NK+IL‐2+IL‐18、NK+IL‐2+IL‐12+IL‐18上

  15. Perfusion based cell culture chips

    DEFF Research Database (Denmark)

    Heiskanen, Arto; Emnéus, Jenny; Dufva, Martin

    2010-01-01

    Performing cell culture in miniaturized perfusion chambers gives possibilities to experiment with cells under near in vivo like conditions. In contrast to traditional batch cultures, miniaturized perfusion systems provide precise control of medium composition, long term unattended cultures...... and tissue like structuring of the cultures. However, as this chapter illustrates, many issues remain to be identified regarding perfusion cell culture such as design, material choice and how to use these systems before they will be widespread amongst biomedical researchers....

  16. Cervical Cancer Cell Supernatants Induce a Phenotypic Switch from U937-Derived Macrophage-Activated M1 State into M2-Like Suppressor Phenotype with Change in Toll-Like Receptor Profile

    Science.gov (United States)

    Sánchez-Reyes, Karina; Bravo-Cuellar, Alejandro; Hernández-Flores, Georgina; Lerma-Díaz, José Manuel; Jave-Suárez, Luis Felipe; Gómez-Lomelí, Paulina; de Celis, Ruth; Aguilar-Lemarroy, Adriana; Domínguez-Rodríguez, Jorge Ramiro; Ortiz-Lazareno, Pablo Cesar

    2014-01-01

    Cervical cancer (CC) is the second most common cancer among women worldwide. Infection with human papillomavirus (HPV) is the main risk factor for developing CC. Macrophages are important immune effector cells; they can be differentiated into two phenotypes, identified as M1 (classically activated) and M2 (alternatively activated). Macrophage polarization exerts profound effects on the Toll-like receptor (TLR) profile. In this study, we evaluated whether the supernatant of human CC cells HeLa, SiHa, and C-33A induces a shift of M1 macrophage toward M2 macrophage in U937-derived macrophages. Results. The results showed that soluble factors secreted by CC cells induce a change in the immunophenotype of macrophages from macrophage M1 into macrophage M2. U937-derived macrophages M1 released proinflammatory cytokines and nitric oxide; however, when these cells were treated with the supernatant of CC cell lines, we observed a turnover of M1 toward M2. These cells increased CD163 and IL-10 expression. The expression of TLR-3, -7, and -9 is increased when the macrophages were treated with the supernatant of CC cells. Conclusions. Our result strongly suggests that CC cells may, through the secretion of soluble factors, induce a change of immunophenotype M1 into M2 macrophages. PMID:25309919

  17. Cervical Cancer Cell Supernatants Induce a Phenotypic Switch from U937-Derived Macrophage-Activated M1 State into M2-Like Suppressor Phenotype with Change in Toll-Like Receptor Profile

    Directory of Open Access Journals (Sweden)

    Karina Sánchez-Reyes

    2014-01-01

    Full Text Available Cervical cancer (CC is the second most common cancer among women worldwide. Infection with human papillomavirus (HPV is the main risk factor for developing CC. Macrophages are important immune effector cells; they can be differentiated into two phenotypes, identified as M1 (classically activated and M2 (alternatively activated. Macrophage polarization exerts profound effects on the Toll-like receptor (TLR profile. In this study, we evaluated whether the supernatant of human CC cells HeLa, SiHa, and C-33A induces a shift of M1 macrophage toward M2 macrophage in U937-derived macrophages. Results. The results showed that soluble factors secreted by CC cells induce a change in the immunophenotype of macrophages from macrophage M1 into macrophage M2. U937-derived macrophages M1 released proinflammatory cytokines and nitric oxide; however, when these cells were treated with the supernatant of CC cell lines, we observed a turnover of M1 toward M2. These cells increased CD163 and IL-10 expression. The expression of TLR-3, -7, and -9 is increased when the macrophages were treated with the supernatant of CC cells. Conclusions. Our result strongly suggests that CC cells may, through the secretion of soluble factors, induce a change of immunophenotype M1 into M2 macrophages.

  18. Microfluidic Cell Culture Device

    Science.gov (United States)

    Takayama, Shuichi (Inventor); Cabrera, Lourdes Marcella (Inventor); Heo, Yun Seok (Inventor); Smith, Gary Daniel (Inventor)

    2014-01-01

    Microfluidic devices for cell culturing and methods for using the same are disclosed. One device includes a substrate and membrane. The substrate includes a reservoir in fluid communication with a passage. A bio-compatible fluid may be added to the reservoir and passage. The reservoir is configured to receive and retain at least a portion of a cell mass. The membrane acts as a barrier to evaporation of the bio-compatible fluid from the passage. A cover fluid may be added to cover the bio-compatible fluid to prevent evaporation of the bio-compatible fluid.

  19. Cell culture's spider silk road.

    Science.gov (United States)

    Perkel, Jeffrey

    2014-06-01

    A number of synthetic and natural materials have been tried in cell culture and tissue engineering applications in recent years. Now Jeffrey Perkel takes a look at one new culture component that might surprise you-spider silk.

  20. Development of an indirect ELISA to detect Corynebacterium pseudotuberculosis specific antibodies in sheep employing T1 strain culture supernatant as antigen

    Directory of Open Access Journals (Sweden)

    Miriam F. Rebouças

    2013-11-01

    Full Text Available Corynebacterium pseudotuberculosis is the etiologic agent of caseous lymphadenitis (CLA, a chronic disease that affects goats and sheep, characterized by granuloma formation in subcutaneous and internal lymph nodes. CLA causes significant economic losses to commercial goat herds. In this study, we aimed to test secreted antigens secreted from T1 strain bacteria grown in brain heart infusion (BHI broth in an indirect ELISA system to determine the presence of specific immunoglobulins against C. pseudotuberculosis. We analyzed the BHI antigen electrophoretic profile and the recognition pattern by infected sheep sera samples. The ELISA results were compared with multiplex PCR assay and IFN-gamma production. The ELISA was able to discriminate between negative and positive animals, with a sensitivity of 89% and a specificity of 99%, using microbiological isolation as gold standard. When this assay was compared with multiplex PCR and specific IFN-gamma quantification, six discrepant results were found among thirty-two samples. We concluded that the ELISA using antigens secreted from C. pseudotuberculosis T1 strain growth in BHI broth culture can be used for the serodiagnosis of CLA in sheep.

  1. Systemic suppression of delayed-type hypersensitivity by supernatants from UV-irradiated keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Rivas, J.M.; Ullrich, S.E. (Univ. of Texas, Houston (United States))

    1992-12-15

    Exposing murine keratinocyte cultures to UV radiation causes the release of a suppressive cytokine that mimics the immunosuppressive effects of total-body UV exposure. Injecting supernatants from UV-irradiated keratinocyte cultures into mice inhibits their ability to generate a delayed-type hypersensitivity reaction against allogeneic histocompatibility Ag, and spleen cells from mice injected with supernatant do not respond to alloantigen in the in vitro MLR. A unique feature of the immunosuppression induced by either total-body UV-exposure or injecting the suppressive cytokine from UV-irradiated keratinocytes is the selectivity of suppression. Although cellular immune reactions such as delayed-type hypersensitivity are suppressed antibody production is unaffected. Because the selective nature to the UV-induced immunosuppression is similar to the biologic activity of IL-10, the authors examined the hypothesis that UV exposure of keratinocytes causes the release of IL-10. Keratinocyte monolayers were exposed to UV radiation and at specific times after exposure mRNA was isolated or the culture supernatant from the cells was collected. These data indicate that activated keratinocytes are capable of secreting IL-10 and suggest that the release of IL-10 by UV-irradiated keratinocytes plays an essential role in the induction of systemic immunosuppression after total-body UV exposure. 44 refs., 3 figs., 2 tabs.

  2. High rate manure supernatant digestion

    OpenAIRE

    Bergland, Wenche Hennie; Dinamarca, Carlos; Toradzadegan, Mehrdad; Nordgård, Anne Synnøve Røstad; Bakke, Ingrid; Bakke, Rune

    2015-01-01

    The study shows that high rate anaerobic digestion may be an efficient way to obtain sustainable energy recovery from slurries such as pig manure. High process capacity and robustness to 5% daily load increases are observed in the 370mL sludge bed AD reactors investigated. The supernatant from partly settled, stored pig manure was fed at rates giving hydraulic retention times, HRT, gradually decreased from 42 to 1.7h imposing a maximum organic load of 400g COD L-1 reactor d-1. The reactors re...

  3. Tacrolimus Inhibits the Enhancing Effects of Peripheral Blood Mononuclear Cell Supernatant on Proliferation and Collagen Expression in Keloid Fibroblasts: Implication for New Therapeutic Approach%他克莫司抑制外周血单个核细胞培养上清对瘢痕疙瘩成纤维细胞的作用

    Institute of Scientific and Technical Information of China (English)

    王大雷; 闫伦; 李辉超; 楚菲菲; 夏炜

    2013-01-01

    目的:研究他克莫司(FK506)抑制外周血单个核细胞(PBMC)培养上清对瘢痕疙瘩成纤维细胞的作用,探讨FK506在瘢痕疙瘩治疗中可能的的作用和机制.方法:用消化法原代培养人瘢痕疙瘩来源的成纤维细胞,梯度密度离心法分离培养人PBMC.将瘢痕疙瘩来源的成纤维细胞随机分组,给予PBMC培养上清处理,实验组同时给与不同浓度FK506处理.四甲基偶氮唑蓝法(MTT)检测瘢痕疙瘩成纤维细胞增殖活性,荧光实时定量PCR法检测Ⅰ型胶原表达.结果:单纯给予PBMC培养上清处理后,成纤维细胞的增殖活性与对照组相比明显增高(P<0.01),同时给予PBMC上清和FK506时发现FK506在20 ng/ml和100 ng/ml时能够抑制PBMC上清的促增殖作用(P<0.01),荧光实时定量PCR结果显示:单纯给予PBMC培养上清处理后,Ⅰ型胶原的表达与对照组相比明显增高(P<0.05),给予PBMC上清和FK506后,在FK506浓度为20 ng/ml和100 ng/ml时Ⅰ型胶原表达降低(P<0.01).结论:FK506能够抑制PBMC培养上清对瘢痕疙瘩成纤维细胞的作用,因此,FK506可能通过抑制PBMC的作用来达到预防和治疗瘢痕疙瘩的作用.%Objective: To study the inhibition of tacrolimus upon the enhancing effects of peripheral blood mononuclear cell (PBMC) supernatant on keloid fibroblasts, and to investigate the role of tacrolimus in keloid thearapy and its mechanism. Methods: Keloid fibroblasts were harvested by digestion method. PBMCs were separated with density gradient centrifogation. Culture supernatant derived from the PBMC was added to keloid fibroblasts. The experimental group was treated with PBMC supernatant and different concentration tacrolimus at the same time. Proliferation of keloid fibroblasts activity was detected with [3- (4,5-dimethylthiazol -2-yl)-2, 5-diphenyltetrazolium bromide (MTT) method. Type I collagen expression was detected with Real-time PCR. Results: PBMC culture supernatant treatment increased

  4. Polyamines in relation to growth in carrot cell cultures.

    Science.gov (United States)

    Fallon, K M; Phillips, R

    1988-09-01

    Changes in polyamine metabolism were investigated in relation to growth of cell suspension cultures of carrot (Daucus carota, cv Chantenay). Changes in levels of the major amines putrescine and spermidine throughout the culture period correlated poorly with changes in fresh weight, but a closer correlation with the minor component spermine was observed. The arginine decarboxylase (ADC) inhibitor difluoromethylarginine (DFMA) strongly and specifically inhibited ADC activity in the supernatant, reduced the major amine (putrescine) by 95% and the total amine content by 80%. It had no effect on cell number and stimulated fresh weight by over 25% through increased cell expansion. Spermine content, in contrast, increased with DFMA concentration in parallel with fresh weight increases. Difluoromethylornithine strongly inhibited ornithine decarboxylase activity in the pellet, but had little effect on either polyamine levels or culture growth. It was concluded that little evidence for a correlation between free polyamines and cell number in carrot cultures could be detected, but that a possible correlation between spermine content and cell expansion was observed.

  5. Polyamines in Relation to Growth in Carrot Cell Cultures 1

    Science.gov (United States)

    Fallon, Kevin M.; Phillips, Richard

    1988-01-01

    Changes in polyamine metabolism were investigated in relation to growth of cell suspension cultures of carrot (Daucus carota, cv Chantenay). Changes in levels of the major amines putrescine and spermidine throughout the culture period correlated poorly with changes in fresh weight, but a closer correlation with the minor component spermine was observed. The arginine decarboxylase (ADC) inhibitor difluoromethylarginine (DFMA) strongly and specifically inhibited ADC activity in the supernatant, reduced the major amine (putrescine) by 95% and the total amine content by 80%. It had no effect on cell number and stimulated fresh weight by over 25% through increased cell expansion. Spermine content, in contrast, increased with DFMA concentration in parallel with fresh weight increases. Difluoromethylornithine strongly inhibited ornithine decarboxylase activity in the pellet, but had little effect on either polyamine levels or culture growth. It was concluded that little evidence for a correlation between free polyamines and cell number in carrot cultures could be detected, but that a possible correlation between spermine content and cell expansion was observed. PMID:16666271

  6. Challenges of culturing human norovirus in three-dimensional organoid intestinal cell culture models.

    Directory of Open Access Journals (Sweden)

    Efstathia Papafragkou

    Full Text Available Human noroviruses are the most common cause of acute gastroenteritis worldwide. Recently, cell culture systems have been described using either human embryonic intestinal epithelial cells (Int-407 or human epithelial colorectal adenocarcinoma cells (Caco-2 growing on collagen-I porous micro carrier beads in a rotating bioreactor under conditions of physiological fluid shear. Here, we describe the efforts from two independent laboratories to implement this three dimensional (3D cell culture system for the replication of norovirus. Int-407 and Caco-2 were grown in a rotating bioreactor for up to 28 days. Prior to infection, cells were screened for the presence of microvilli by electron microscopy and stained for junction proteins (zonula occludens-1, claudin-1, and β-catenin. Differentiated 3D cells were transferred to 24-well plates and infected with bacteria-free filtrates of various norovirus genotypes (GI.1, GI.3, GI.8, GII.2, GII.4, GII.7, and GII.8. At 12 h, 24 h, and 48 h post inoculation, viral RNA from both cells and supernatants were collected and analyzed for norovirus RNA by real-time reverse transcription PCR. Despite observations of high expression of junction proteins and microvilli development in stained thin sections, our data suggest no significant increase in viral titer based on norovirus RNA copy number during the first 48 h after inoculation for the different samples and virus culture conditions tested. Our combined efforts demonstrate that 3D cell culture models using Int-407 or Caco-2 cells do not support norovirus replication and highlight the complexity and difficulty of developing a reproducible in vitro cell culture system for human norovirus.

  7. Inflammatory cytokine detection in adenotonsill and peripheral blood mononuclear cells- culture in adenotonsillectomy patients: a comparative study

    Directory of Open Access Journals (Sweden)

    Farhadi M

    2013-04-01

    Full Text Available Background: Tonsils and adenoid hypertrophy is a major respiratory symptom in children which is partly due to recruitment of inflammatory cells in upper airway lymph nodes as a result of the effects of synthesis and release of different inflammatory cytokines. It seems that infections play role in concert with these cytokines leading to tonsilar hypertrophy and other pathologic consequences. It is proposed that cellular infiltrate of tonsils and adenoids may secrete different quantities of these cytokines compared with peripheral blood mononuclear cells (PBMC cultures.Methods: Among patients who were admitted for adenotonsillectomy to the ENT ward, 37 patients, under 1-12 years old patients with fulfill criteria selected to include the study. Excised adenoid and tonsils cultured and inflammatory cytokines Interferon-γ (INF-γ, Interlukine-1 (IL-1, IL-6, IL-8 and tumor necrosis factor-α (TNF-α measured in cellular culture supernatant. The same cytokines measured in PBMC cultures.Results: The data shows that there is a significant difference between IFN-γ and IL-8 amounts in adenoid tissue culture supernatant and PBMC culture of our patients. Furth-ermore, the amounts of IFN-γ, IL-1 and IL-8 showed considerable difference between tonsilar tissue culture supernatant and PBMC culture of these patients. Although there is a significant correlation between IL-6 amounts in tissue culture supernatant and PBMC culture (P=0.02, the respective data for TNF is only almost significant.Conclusion: Inflammatory cytokines may have significant role in the early provoke of inflammation occurred in hypertrophied tonsils and adenoid. The majority of these cyt-okines increase the expression of adhesion molecules on epithelial cells and influence the recruitment of leucocytes and inflamed tonsils. On the other hand lack of sufficient cytokine release may lead to persistent infections and may cause chronic inflammation and hypertrophied tissue.

  8. Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells

    Directory of Open Access Journals (Sweden)

    del Angel Rosa M

    2008-04-01

    Full Text Available Abstract Current methods for dengue virus quantitation are either time consuming, technically demanding or costly. As an alternative, the commercial enzyme immunoassay Platelia™ Dengue NS1 AG (Bio-Rad Laboratories was used to monitor semiquantitatively dengue virus replication in cultured cells. The presence of NS1 protein was evaluated in supernatants from Vero and C6/36 HT cells infected with dengue virus. The amount of NS1 detected in the supernatants of infected cells was proportional to the initial MOI used and to the time of post infection harvest. This immunoassay was also able to detect the presence of NS1 in the supernatants of infected human macrophages. Inhibition of dengue virus replication in C6/36 HT cells treated with lysosomotropic drugs was readily monitored with the use of this assay. These results suggest that the Platelia™ Dengue NS1 AG kit can be used as a fast and reliable surrogate method for the relative quantitation of dengue virus replication in cultured cells.

  9. Aseptic technique for cell culture.

    Science.gov (United States)

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here. PMID:18228291

  10. Cell culture compositions

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

    2014-03-18

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  11. Microarray-based MALDI-TOF mass spectrometry enables monitoring of monoclonal antibody production in batch and perfusion cell cultures.

    Science.gov (United States)

    Steinhoff, Robert F; Karst, Daniel J; Steinebach, Fabian; Kopp, Marie R G; Schmidt, Gregor W; Stettler, Alexander; Krismer, Jasmin; Soos, Miroslav; Pabst, Martin; Hierlemann, Andreas; Morbidelli, Massimo; Zenobi, Renato

    2016-07-15

    Cell culture process monitoring in monoclonal antibody (mAb) production is essential for efficient process development and process optimization. Currently employed online, at line and offline methods for monitoring productivity as well as process reproducibility have their individual strengths and limitations. Here, we describe a matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS)-based on a microarray for mass spectrometry (MAMS) technology to rapidly monitor a broad panel of analytes, including metabolites and proteins directly from the unpurified cell supernatant or from host cell culture lysates. The antibody titer is determined from the intact antibody mass spectra signal intensity relative to an internal protein standard spiked into the supernatant. The method allows a semi-quantitative determination of light and heavy chains. Intracellular mass profiles for metabolites and proteins can be used to track cellular growth and cell productivity. PMID:26707204

  12. Hepatitis E Virus Produced from Cell Culture Has a Lipid Envelope.

    Directory of Open Access Journals (Sweden)

    Ying Qi

    Full Text Available The absence of a productive cell culture system hampered detailed analysis of the structure and protein composition of the hepatitis E virion. In this study, hepatitis E virus from a robust HEV cell culture system and from the feces of infected monkeys at the peak of virus excretion was purified by ultra-centrifugation. The common feature of the two samples after ultracentrifugation was that the ORF2 protein mainly remained in the top fractions. The ORF2 protein from cell culture system was glycosylated, with an apparent molecular weight of 88 kDa, and was not infectious in PLC/PRF/5 cells. The ORF2 protein in this fraction can bind to and protect HEV RNA from digestion by RNase A. The RNA-ORF2 product has a similar sedimentation coefficient to the virus from feces. The viral RNA in the cell culture supernatant was mainly in the fraction of 1.15 g/cm3 but that from the feces was mainly in the fraction of 1.21 g/cm3. Both were infectious in PLC/PRF/5 cells. And the fraction in the middle of the gradient (1.06 g/cm3 from the cell culture supernatant,but not that from the feces, also has ORF2 protein and HEV RNA but was not infectious in PLC/PRF/5.The infectious RNA-rich fraction from the cell culture contained ORF3 protein and lipid but the corresponding fraction from feces had no lipid and little ORF3 protein. The lipid on the surface of the virus has no effect on its binding to cells but the ORF3 protein interferes with binding. The result suggests that most of the secreted ORF2 protein is not associated with HEV RNA and that hepatitis E virus produced in cell culture differs in structure from the virus found in feces in that it has a lipid envelope.

  13. Insect Cell Culture and Biotechnology

    Institute of Scientific and Technical Information of China (English)

    Robert R.Granados; Guoxun Li; G.W.Blissard

    2007-01-01

    The continued development of new cell culture technology is essential for the future growth and application of insect cell and baculovirus biotechnology. The use of cell lines for academic research and for commercial applications is currently dominated by two cell lines; the Spodoptera frugiperda line, SF21 (and its clonal isolate, SF9), and the Trichoplusia ni line, BTI 5B1-4, commercially known as High Five cells. The long perceived prediction that the immense potential application of the baculovirus-insect cell system, as a tool in cell and molecular biology, agriculture, and animal health, has been achieved. The versatility and recent applications of this popular expression system has been demonstrated by both academia and industry and it is clear that this cell-based system has been widely accepted for biotechnological applications. Numerous small to midsize startup biotechnology companies in North America and the Europe are currently using the baculovirus-insect cell technology to produce custom recombinant proteins for research and commercial applications. The recent breakthroughs using the baculovirus-insect cell-based system for the development of several commercial products that will impact animal and human health will further enhance interest in this technology by pharma. Clearly, future progress in novel cell and engineering advances will lead to fundamental scientific discoveries and serve to enhance the utility and applications of this baculovirus-insect cell system.

  14. IL-10 release by bovine epithelial cells cultured with Trichomonas vaginalis and Tritrichomonas foetus

    Directory of Open Access Journals (Sweden)

    Ricardo Chaves Vilela

    2013-02-01

    Full Text Available Trichomonas vaginalis and Tritrichomonas foetus are parasitic protists of the human and bovine urogenital tracts, respectively. Several studies have described the cytotoxic effects of trichomonads on urogenital tract epithelial cells. However, little is known about the host cell response against trichomonads. The aim of this study was to determine whether T. foetus and T. vaginalis stimulated the release of the cytokine interleukin (IL-10 from cultured bovine epithelial cells. To characterise the inflammatory response induced by these parasites, primary cultures of bovine oviduct epithelial cells were exposed to either T. vaginalis or T. foetus. Within 12 h after parasite challenge, supernatants were collected and cytokine production was analysed. Large amounts of IL-10 were detected in the supernatants of cultures that had been stimulated with T. foetus. Interestingly, T. vaginalis induced only a small increase in the release of IL-10 upon exposure to the same bovine cells. Thus, the inflammatory response of the host cell is species-specific. Only T. foetus and not T. vaginalis induced the release of IL-10 by bovine oviduct epithelial cells.

  15. Cytopathogenicity of Naegleria for cultured neuroblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Fulford, D.E.

    1985-01-01

    The cytopathic activity of live Naegleria amoebae and cell-free lysates of Naegleria for B-103 rat neuroblastoma cells was investigated using a /sup 51/Cr release assay. Live amoebae and cell-free lysates of N. fowleri, N. australiensis, N. lovaniensis, and N. gruberi all induced sufficient damage to radiolabeled B-103 cells to cause a significant release of chromium. The cytotoxic activity present in the cell-free lysates of N. fowleri can be recovered in the supernatant fluid following centrifugation at 100,000xg and precipitation of the 100,000xg supernatant fluid with ammonium sulfate. Initial characterization of the cytotoxic factor indicates that it is a heat labile, pH sensitive, soluble protein. The cytotoxic activity is abolished by either extraction, unaffected by repeated freeze-thawing, and is not sensitive to inhibitors of proteolytic enzymes. Phospholipase A activity was detected in the cytotoxic ammonium sulfate precipitable material, suggesting that this enzyme activity may have a role in the cytotoxic activity of the cell-free lysates.

  16. Effects of external radiation in a co-culture model of endothelial cells and adipose-derived stem cells

    International Nuclear Information System (INIS)

    The inflammatory response clinically observed after radiation has been described to correlate with elevated expression of cytokines and adhesion molecules by endothelial cells. Therapeutic compensation for this microvascular compromise could be an important approach in the treatment of irradiated wounds. Clinical reports describe the potential of adipose-derived stem cells to enhance wound healing, but the underlying cellular mechanisms remain largely unclear. Human dermal microvascular endothelial cells (HDMEC) and human adipose-derived stem cells (ASC) were cultured in a co-culture setting and irradiated with sequential doses of 2 to 12 Gy. Cell count was determined 48 h after radiation using a semi-automated cell counting system. Levels of interleukin-6 (IL-6), basic fibroblast growth factor (FGF), intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) were determined in the supernatants using enzyme-linked immunosorbent assay (ELISA). Irradiated HDMEC and ASC as well as non-irradiated co-cultures, HDMEC or ASC respectively were used as controls. Cell count was significantly reduced in irradiated co-cultures of HDMEC and ASC compared to non-irradiated controls. Levels of IL-6, FGF, ICAM-1 and VCAM-1 in the supernatants of the co-cultures were significantly less affected by external radiation in comparison to HDMEC. The increased expression of cytokines and adhesion molecules by HDMEC after external radiation is mitigated in the co-culture setting with ASC. These in vitro changes seem to support the clinical observation that ASC may have a stabilizing effect when injected into irradiated wounds

  17. Cell Culture, Technology: Enhancing the Culture of Diagnosing Human Diseases.

    Science.gov (United States)

    Hudu, Shuaibu Abdullahi; Alshrari, Ahmed Subeh; Syahida, Ahmad; Sekawi, Zamberi

    2016-03-01

    Cell culture involves a complex of processes of cell isolation from their natural environment (in vivo) and subsequent growth in a controlled environmental artificial condition (in vitro). Cells from specific tissues or organs are cultured as short term or established cell lines which are widely used for research and diagnosis, most specially in the aspect of viral infection, because pathogenic viral isolation depends on the availability of permissible cell cultures. Cell culture provides the required setting for the detection and identification of numerous pathogens of humans, which is achieved via virus isolation in the cell culture as the "gold standard" for virus discovery. In this review, we summarized the views of researchers on the current role of cell culture technology in the diagnosis of human diseases. The technological advancement of recent years, starting with monoclonal antibody development to molecular techniques, provides an important approach for detecting presence of viral infection. They are also used as a baseline for establishing rapid tests for newly discovered pathogens. A combination of virus isolation in cell culture and molecular methods is still critical in identifying viruses that were previously unrecognized. Therefore, cell culture should be considered as a fundamental procedure in identifying suspected infectious viral agent.

  18. Techniques for mammalian cell tissue culture.

    Science.gov (United States)

    Phelan, Mary C

    2006-05-01

    This unit opens with detailed discussions on the latest principles of sterile technique and preparation of culture media. Step-by-step protocols describe trypsinizing and subculturing monolayer cultures, passaging suspension cultures, freezing and thawing cells, counting cells using a hemacytometer, and preparing cells for transport. PMID:18770828

  19. Cell-free supernatants obtained from fermentation of cheese whey hydrolyzates and phenylpyruvic acid by Lactobacillus plantarum as a source of antimicrobial compounds, bacteriocins, and natural aromas.

    Science.gov (United States)

    Rodríguez-Pazo, Noelia; Vázquez-Araújo, Laura; Pérez-Rodríguez, Noelia; Cortés-Diéguez, Sandra; Domínguez, José Manuel

    2013-10-01

    Cheese whey hydrolyzates supplemented with phenylpyruvic acid (PPA) and commercial nutrients can be efficiently metabolized by Lactobacillus plantarum CECT-221 to biosynthesize some compounds with attractive applications in the food market. The main metabolites of cell-free extracts were antimicrobial compounds such as phenyllactic acid (PLA) and lactic acid (LA). The production of PLA by L. plantarum CECT-221 was evaluated in the Man-Rogosa-Sharpe broth supplemented with two biosynthetic precursors: phenylalanine or PPA. Using 30.5 mM PPA, the microorganism increased sevenfold the concentration of PLA producing 16.4 mM PLA in 46 h. A concentration of 40 mM PPA was a threshold to avoid substrate inhibition. The biosynthesis of whey hydrolyzates as a carbon source was enhanced by fed-batch fermentation of PPA; the average productivity of PLA increased up to 45.4 ± 3.02 mM after 120 h with a product yield of 0.244 mM mM(-1); meanwhile, LA reached 26.1 ± 1.3 g L(-1) with a product yield of 0.72 g g(-1). Cell-free fed-batch extracts charged in wells showed bacteriocin activity with halos of 7.49 ± 1.44 mm in plates inoculated with Carnobacterium piscicola and antimicrobial activity against Staphylococcus aureus (11.54 ± 1.14 mm), Pseudomonas aeruginosa (10.17 ± 2.46 mm), Listeria monocytogenes (7.75 ± 1.31 mm), and Salmonella enterica (3.60 ± 1.52 mm). Additionally, the analysis of the volatile composition of the headspace of this cell-free extract revealed that L. plantarum is a potential producer for natural aromas, such as acetophenone, with high price in the market. This is the first report of PLA production from cheese whey and PPA. The extracts showed bacteriocin activity and potential to be applied as an antimicrobial in the elaboration of safer foods. PMID:23934083

  20. Interferon Response in Hepatitis C Virus (HCV) Infection: Lessons from Cell Culture Systems of HCV Infection.

    Science.gov (United States)

    Sung, Pil Soo; Shin, Eui-Cheol; Yoon, Seung Kew

    2015-01-01

    Hepatitis C virus (HCV) is a positive-stranded RNA virus that infects approximately 130-170 million people worldwide. In 2005, the first HCV infection system in cell culture was established using clone JFH-1, which was isolated from a Japanese patient with fulminant HCV infection. JFH-1 replicates efficiently in hepatoma cells and infectious virion particles are released into the culture supernatant. The development of cell culture-derived HCV (HCVcc) systems has allowed us to understand how hosts respond to HCV infection and how HCV evades host responses. Although the mechanisms underlying the different outcomes of HCV infection are not fully understood, innate immune responses seem to have a critical impact on the outcome of HCV infection, as demonstrated by the prognostic value of IFN-λ gene polymorphisms among patients with chronic HCV infection. Herein, we review recent research on interferon response in HCV infection, particularly studies using HCVcc infection systems.

  1. Dynamized Preparations in Cell Culture

    Directory of Open Access Journals (Sweden)

    Ellanzhiyil Surendran Sunila

    2009-01-01

    Full Text Available Although reports on the efficacy of homeopathic medicines in animal models are limited, there are even fewer reports on the in vitro action of these dynamized preparations. We have evaluated the cytotoxic activity of 30C and 200C potencies of ten dynamized medicines against Dalton's Lymphoma Ascites, Ehrlich's Ascites Carcinoma, lung fibroblast (L929 and Chinese Hamster Ovary (CHO cell lines and compared activity with their mother tinctures during short-term and long-term cell culture. The effect of dynamized medicines to induce apoptosis was also evaluated and we studied how dynamized medicines affected genes expressed during apoptosis. Mother tinctures as well as some dynamized medicines showed significant cytotoxicity to cells during short and long-term incubation. Potentiated alcohol control did not produce any cytotoxicity at concentrations studied. The dynamized medicines were found to inhibit CHO cell colony formation and thymidine uptake in L929 cells and those of Thuja, Hydrastis and Carcinosinum were found to induce apoptosis in DLA cells. Moreover, dynamized Carcinosinum was found to induce the expression of p53 while dynamized Thuja produced characteristic laddering pattern in agarose gel electrophoresis of DNA. These results indicate that dynamized medicines possess cytotoxic as well as apoptosis-inducing properties.

  2. Dynamized preparations in cell culture.

    Science.gov (United States)

    Sunila, Ellanzhiyil Surendran; Kuttan, Ramadasan; Preethi, Korengath Chandran; Kuttan, Girija

    2009-06-01

    Although reports on the efficacy of homeopathic medicines in animal models are limited, there are even fewer reports on the in vitro action of these dynamized preparations. We have evaluated the cytotoxic activity of 30C and 200C potencies of ten dynamized medicines against Dalton's Lymphoma Ascites, Ehrlich's Ascites Carcinoma, lung fibroblast (L929) and Chinese Hamster Ovary (CHO) cell lines and compared activity with their mother tinctures during short-term and long-term cell culture. The effect of dynamized medicines to induce apoptosis was also evaluated and we studied how dynamized medicines affected genes expressed during apoptosis. Mother tinctures as well as some dynamized medicines showed significant cytotoxicity to cells during short and long-term incubation. Potentiated alcohol control did not produce any cytotoxicity at concentrations studied. The dynamized medicines were found to inhibit CHO cell colony formation and thymidine uptake in L929 cells and those of Thuja, Hydrastis and Carcinosinum were found to induce apoptosis in DLA cells. Moreover, dynamized Carcinosinum was found to induce the expression of p53 while dynamized Thuja produced characteristic laddering pattern in agarose gel electrophoresis of DNA. These results indicate that dynamized medicines possess cytotoxic as well as apoptosis-inducing properties. PMID:18955237

  3. In vitro Culture of Bone Marrow Mesenchymal Stem Cells in Rats and Differentiation into Retinal Neural-like Cells

    Institute of Scientific and Technical Information of China (English)

    SUN Xufang; JIANG Huanrong; YANG Hong

    2007-01-01

    In order to study the in vitro culture and expansion of bone marrow mesenchymal stem cells in rats (rMSCs) and the possibility of rMSCs differentiation into retinal neural cells, the bone marrow-derived cells in SD rats were isolated and cultured in vitro. The retinal neural cells in SD rats were cultured and the supernatants were collected to prepare conditioned medium. The cultured rMSCs were induced to differentiate by two steps. Imrnunofluorescence method and anti-nestin, anti-NeuN, anti-GFAP and anti-Thy1.1 antibodies were used to identify the cells derived from the rMSCs. The results showed that the in vitro cultured rMSCs grew well and expanded quickly. After induction with two conditioned media, rMSCs was induced to differentiate into neural progenitor cells, then into retinal neural-like cells which were positive for nestin, NeuN, GFAP and Thy1.1 de-tected by fluorescence method. The findings suggested that rMSCs could be culture and expanded in vitro, and induced to differentiate into retinal neural-like cells.

  4. Expanding intestinal stem cells in culture

    NARCIS (Netherlands)

    Heo, Inha; Clevers, Hans

    2015-01-01

    Culturing intestinal stem cells into 3D organoids results in heterogeneous cell populations, reflecting the in vivo cell type diversity. In a recent paper published in Nature, Wang et al. established a culture condition for a highly homogeneous population of intestinal stem cells.

  5. Effects of Supernatant of CLEC2B Gene Overexpression in Jurkat Cells on the B16 Melanoma cell%CLEC2B基因过表达的Jurkat细胞培养上清液对黑素瘤细胞B16的影响

    Institute of Scientific and Technical Information of China (English)

    张峻岭; 徐士福; 柳君如; 程琳; ZHOU Youwen

    2012-01-01

    目的 将CLEC2B基因过表达的Jurkat细胞培养上清液作用于黑素瘤细胞,观察其上清液对黑素瘤细胞增殖、酪氨酸酶活性、黑素合成的影响,探讨CLEC2B基因在白癜风发病中的作用.方法 培养人淋巴瘤细胞Jurkat细胞和小鼠黑素瘤细胞B16,采用脂质体介导的方法瞬时转染CLEC2B重组质粒入Jurkat细胞,半定量RT-PCR法鉴定CLEC2B基因过表达;将其细胞培养上清液作用于黑素瘤细胞48h后,MTT法检测黑素瘤细胞的增殖情况,多巴氧化法检测酪氨酸酶活性,氢氧化钠裂解法检测黑素含量.结果 CLEC2B基因过表达的Jurkat细胞培养上清液作用后的黑素瘤细胞增殖比空载体组、正常对照组降低,差异有统计学意义(均P<0.05),CLEC2B过表达组黑素含量比空载体组、正常对照组减少,差异有统计学意义(均P<0.05),CLEC2B过表达组、空载体组、正常对照组之间的酪氨酸酶活性比较差异无统计学意义(均P>0.05),空载体组与正常对照组比较差异均无统计学意义(均P>0.05).结论 CLEC2B基因过表达的Jurkat细胞培养上清液对黑素细胞的增殖和黑素合成有一定的抑制作用,对酪氨酸酶活性影响不明显.提示CLEC2B可能通过调节淋巴细胞功能间接影响黑素细胞增殖和黑素合成,从而参与白癜风发病.%Objective The melanoma cells were treated with culture supernatant of CLEC2B gene overexpression in Jurkat cells, to observe the impact of melanoma proliferation, the activity of tyrosinase and melanin synthesis, for searching CLEC2B gene participated in the vitiligo. Methods In this study, Jurkat cells were transfected with recombinant plasmid pGCMV/EGFP/Neo-CLEC2B by DMRIE-C Reagent. RT-PCR identified CLEC2B gene overexpression. After 48 h transfection, the melanoma cells were treated with their culture supernatant for 48 h, then the proliferation of melanoma cells were detected by MTT, the activity of tyrosinase was detected by

  6. Suitability of human Tenon's fibroblasts as feeder cells for culturing human limbal epithelial stem cells.

    Science.gov (United States)

    Scafetta, Gaia; Tricoli, Eleonora; Siciliano, Camilla; Napoletano, Chiara; Puca, Rosa; Vingolo, Enzo Maria; Cavallaro, Giuseppe; Polistena, Andrea; Frati, Giacomo; De Falco, Elena

    2013-12-01

    Corneal epithelial regeneration through ex vivo expansion of limbal stem cells (LSCs) on 3T3-J2 fibroblasts has revealed some limitations mainly due to the corneal microenvironment not being properly replicated, thus affecting long term results. Insights into the feeder cells that are used to expand LSCs and the mechanisms underlying the effects of human feeder cells have yet to be fully elucidated. We recently developed a standardized methodology to expand human Tenon's fibroblasts (TFs). Here we aimed to investigate whether TFs can be employed as feeder cells for LSCs, characterizing the phenotype of the co-cultures and assessing what human soluble factors are secreted. The hypothesis that TFs could be employed as alternative human feeder layer has not been explored yet. LSCs were isolated from superior limbus biopsies, co-cultured on TFs, 3T3-J2 or dermal fibroblasts (DFs), then analyzed by immunofluorescence (p63α), colony-forming efficiency (CFE) assay and qPCR for a panel of putative stem cell and epithelial corneal differentiation markers (KRT3). Co-cultures supernatants were screened for a set of soluble factors. Results showed that the percentage of p63α(+)LSCs co-cultured onto TFs was significantly higher than those on DFs (p = 0.032) and 3T3-J2 (p = 0.047). Interestingly, LSCs co-cultures on TFs exhibited both significantly higher CFE and mRNA expression levels of ΔNp63α than on 3T3-J2 and DFs (p < 0.0001), showing also significantly greater levels of soluble factors (IL-6, HGF, b-FGF, G-CSF, TGF-β3) than LSCs on DFs. Therefore, TFs could represent an alternative feeder layer to both 3T3-J2 and DFs, potentially providing a suitable microenvironment for LSCs culture. PMID:23832306

  7. Mechanism of the clinical effects of uv-irradiated blood: stimulation of dna synthesis by human cells in culture

    International Nuclear Information System (INIS)

    This paper studies the DNA-synthetic activity of hyman embryonic cells (EC) cultured in the presence of supernatants from intact and irradiated cell fractions of blood or plasma. Human EC obtained from abortion material were incubated; after incubation, tritium-thymidine was added to the growth medium for 30 min. It is shown that stimulation of DNA synthesis in EC growing in the presence of supernatants from irradiated whole blood is not connected with photoactivation of growth factors in the blood plasma, but takes place as a result of their release from the cells. Donated blood, irradiated with UV light of the same wavelength and within the same dose range as are used under clinical conditions (up to 1200 J/m2), possesses growth-stimulating properties

  8. Tick cell culture isolation and growth of Rickettsia raoultii from Dutch Dermacentor reticulatus ticks.

    Science.gov (United States)

    Alberdi, M Pilar; Nijhof, Ard M; Jongejan, Frans; Bell-Sakyi, Lesley

    2012-12-01

    Tick cell lines play an important role in research on ticks and tick-borne pathogenic and symbiotic microorganisms. In an attempt to derive continuous Dermacentor reticulatus cell lines, embryo-derived primary cell cultures were set up from eggs laid by field ticks originally collected as unfed adults in The Netherlands and maintained for up to 16 months. After several months, it became evident that cells in the primary cultures were infected with a Rickettsia-like intracellular organism. Supernatant medium containing some D. reticulatus cells was inoculated into cultures of 2 Rhipicephalus (Boophilus) microplus cell lines, BME/CTVM2 and BME/CTVM23, where abundant growth of the bacteria occurred intracellularly on transfer to both cell lines. Bacterial growth was monitored by light (live, inverted microscope, Giemsa-stained cytocentrifuge smears) and transmission electron microscopy revealing heavy infection with typical intracytoplasmic Rickettsia-like bacteria, not present in uninfected cultures. DNA was extracted from bacteria-infected and uninfected control cultures, and primers specific for Rickettsia 16S rRNA, ompB, and sca4 genes were used to generate PCR products that were subsequently sequenced. D. reticulatus primary cultures and both infected tick cell lines were positive for all 3 Rickettsia genes. Sequencing of PCR products revealed 99-100% identity with published Rickettsia raoultii sequences. The R. raoultii also grew abundantly in the D. nitens cell line ANE58, poorly in the D. albipictus cell line DALBE3, and not at all in the D. andersoni cell line DAE15. In conclusion, primary tick cell cultures and cell lines are useful systems for isolation and propagation of fastidious tick-borne microorganisms. In vitro isolation of R. raoultii from Dutch D. reticulatus confirms previous PCR-based detection in field ticks, and presence of the bacteria in the tick eggs used to initiate the primary cultures confirms that transovarial transmission of this

  9. Cell Culture as an Alternative in Education.

    Science.gov (United States)

    Nardone, Roland M.

    1990-01-01

    Programs that are intended to inform and provide "hands-on" experience for students and to facilitate the introduction of cell culture-based laboratory exercises into the high school and college laboratory are examined. The components of the CellServ Program and the Cell Culture Toxicology Training Programs are described. (KR)

  10. In vitro culture of human thyroid cells

    International Nuclear Information System (INIS)

    Procedures for establishing primary cultures of human thyroid tissue are described. Tissues removed surgically from patients with papillary carcinoma (PC), follicular adenoma (FA), or hyperthyroidism were grown in culture. In addition, normal cells were separated from the margins of excised tumors and were also cultured. For each gram of thyroid tissue cultured, more than 1 x 105 cells attached to culture dishes. A mixture of 2.5 % fetal bovine serum supplemented with insulin, hydrocortisone, transferrin, glycl-1-histidyl-L-lysine acetate, somatostatin and epidermal growth factor was added to nutrient media containing equal parts of Ham's F-12 and minimum essential medium (αMEM). Complete medium selectively supported epithelial cell growth while restricting fibroblast cell growth, especially during the first two weeks of the primary culture. Cells were stimulated with thyroid stimulating hormone (TSH) and produced raised levels of cAMP and thyroid hormone (T3). Culture conditions that affected the response of cells to X-rays were identified. During the culture period, first and second passage cells were compared for differences in their radiosensitivities. In all cases, cells showed differences in their responses to radiation depending on the cell passage number. However, results of replicate experiments of first passage cells that were exposed to X-rays showed good agreement between experiments. This technique makes it possible to quantitate the effects of chemical and physical cytotoxic agents on proliferating human thyroid epithelial cells. (author)

  11. Culture of Cells from Amphibian Embryos.

    Science.gov (United States)

    Stanisstreet, Martin

    1983-01-01

    Describes a method for in vitro culturing of cells from amphibian early embryos. Such cells can be used to demonstrate such properties of eukaryote cells as cell motility, adhesion, differentiation, and cell sorting into tissues. The technique may be extended to investigate other factors. (Author/JN)

  12. Cell Suspension Culture of Neem Tree

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The establishment of suspension culture system for neem (Azadirachta indica A. Juss) cells and the suspension culture condition was studied. It shows that the neem cell suspension culture system was best in B5 liquid medium, 2.0~4.0mg/L NAA with direct spill method. Based on the integrated analysis of cell biomass, Azadirachtin content and productivity, the optimum culture conditions were B5 liquid medium, 2.0-4.0 mg/L NAA, 3% sucrose at 25 ℃. The optimum rotating speed of the shaker and broth content d...

  13. Callus and cell suspension cultures of carnation

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1972-01-01

    . Cell suspension cultures worked best in media containing 2,4-D in which they had a doubling time of about 2 days. Filtered suspensions were successfully plated on agar in petri dishes, but division was never observed in single cells. The cultures initiated roots at higher concentrations of IAA or NAA...

  14. [Effects of beryllium chloride on cultured cells].

    Science.gov (United States)

    Sakaguchi, T; Sakaguchi, S; Nakamura, I; Kagami, M

    1984-05-01

    The effects of beryllium on cultured cells were investigated. Three cell-lines (HeLa-S3, Vero, HEL-R66) were used in these experiments and they were cultured in Eagle's MEM plus 5 or 10% FBS (Fetal Bovine Serum) containing beryllium in various concentrations. HeLa cells or Vero cells were able to grow in the medium with 10 micrograms Be/ml (1.1 mM). On the other hand, the growth of HEL cells were strongly inhibited, even when cultured in the medium with 1 microgram Be/ml (1.1 X 10(-1) mM) and the number of living cells showed markedly low level as compared to that of the control samples cultured in the medium without beryllium. The cytotoxic effects of beryllium on these cells, which were cultured for three days in the medium with beryllium, were observed. None of cytotoxic effects were found on HeLa cells cultured with 0.5 micrograms/ml (5.5 X 10(-2) mM) and on Vero cells cultured with 0.05 micrograms Be/ml (5.5 X 10(-3) mM), while HEL cells received cytotoxic effects even when cultured in the medium containing 0.05 micrograms Be/ml (5.5 X 10(-3) mM), and these effects on the cells appeared strong when cultured in the medium without FBS. It was revealed from these experiments that HEL cells are very sensitive in terms of toxic effects of beryllium. Therefore, there cells can be used for the toxicological study on low level concentrations of the metal.

  15. Dynamic culture improves cell reprogramming efficiency.

    Science.gov (United States)

    Sia, Junren; Sun, Raymond; Chu, Julia; Li, Song

    2016-06-01

    Cell reprogramming to pluripotency is an inefficient process and various approaches have been devised to improve the yield of induced pluripotent stem cells. However, the effect of biophysical factors on cell reprogramming is not well understood. Here we showed that, for the first time, dynamic culture with orbital shaking significantly improved the reprogramming efficiency in adherent cells. Manipulating the viscosity of the culture medium suggested that the improved efficiency is mainly attributed to convective mixing rather than hydrodynamic shear stress. Temporal studies demonstrated that the enhancement of reprogramming efficiency required the dynamic culture in the middle but not early phase. In the early phase, fibroblasts had a high proliferation rate, but as the culture became over-confluent in the middle phase, expression of p57 was upregulated to inhibit cell proliferation and consequently, cell reprogramming. Subjecting the over confluent culture to orbital shaking prevented the upregulation of p57, thus improving reprogramming efficiency. Seeding cells at low densities to avoid over-confluency resulted in a lower efficiency, and optimal reprogramming efficiency was attained at a high seeding density with dynamic culture. Our findings provide insight into the underlying mechanisms of how dynamic culture condition regulate cell reprogramming, and will have broad impact on cell engineering for regenerative medicine and disease modeling.

  16. Autofluorescence of viable cultured mammalian cells.

    Science.gov (United States)

    Aubin, J E

    1979-01-01

    The autofluorescence other than intrinsic protein emission of viable cultured mammalian cells has been investigated. The fluorescence was found to originate in discrete cytoplasmic vesicle-like regions and to be absent from the nucleus. Excitation and emission spectra of viable cells revealed at least two distinct fluorescent species. Comparison of cell spectra with spectra of known cellular metabolites suggested that most, if not all, of the fluorescence arises from intracellular nicotinamide adenine dinucleotide (NADH) and riboflavin and flavin coenzymes. Various changes in culture conditions did not affect the observed autofluorescence intensity. A multiparameter flow system (MACCS) was used to compare the fluorescence intensities of numerous cultured mammalian cells.

  17. Cell Culture for Production of Insecticidal Viruses.

    Science.gov (United States)

    Reid, Steven; Chan, Leslie C L; Matindoost, Leila; Pushparajan, Charlotte; Visnovsky, Gabriel

    2016-01-01

    While large-scale culture of insect cells will need to be conducted using bioreactors up to 10,000 l scale, many of the main challenges for cell culture-based production of insecticidal viruses can be studied using small-scale (20-500 ml) shaker/spinner flasks, either in free suspension or using microcarrier-based systems. These challenges still relate to the development of appropriate cell lines, stability of virus strains in culture, enhancing virus yields per cell, and the development of serum-free media and feeds for the desired production systems. Hence this chapter presents mainly the methods required to work with and analyze effectively insect cell systems using small-scale cultures. Outlined are procedures for quantifying cells and virus and for establishing frozen cells and virus stocks. The approach for maintaining cell cultures and the multiplicity of infection (MOI) and time of infection (TOI) parameters that should be considered for conducting infections are discussed.The methods described relate, in particular, to the suspension culture of Helicoverpa zea and Spodoptera frugiperda cell lines to produce the baculoviruses Helicoverpa armigera nucleopolyhedrovirus, HearNPV, and Anticarsia gemmatalis multicapsid nucleopolyhedrovirus, AgMNPV, respectively, and the production of the nonoccluded Oryctes nudivirus, OrNV, using an adherent coleopteran cell line. PMID:27565495

  18. Methods for Maintaining Insect Cell Cultures

    OpenAIRE

    Lynn, Dwight E.

    2002-01-01

    Insect cell cultures are now commonly used in insect physiology, developmental biology, pathology, and molecular biology. As the field has advanced from methods development to a standard procedure, so has the diversity of scientists using the technique. This paper describes methods that are effective for maintaining various insect cell lines. The procedures are differentiated between loosely or non-attached cell strains, attached cell strains, and strongly adherent cell strains.

  19. In vitro differentiation of MSCs into retina-like cells by the supernatant fluid of light-injured neurosensory retina%光损伤鼠视网膜片培养上清液诱导 MSCs 分化为视网膜样细胞的研究

    Institute of Scientific and Technical Information of China (English)

    白月; 徐国兴

    2014-01-01

    AIM: To explore the possibility of inducing rat mesenchymal stem cells ( MSCs) into retina-like cells by the supernatant fluid of light-injured neurosensory retina in vitro. METHODS: MSCs were isolated and attached to the wall of culture dishes by their specific adherent ability. Then the cells were characterized by flow cytometry.The neurosensory retina was isolated from retina of SD rat and it was tested by hematoxylin-eosin ( HE ) staining.The pathological changes of light-injured neurosensory retina was observed under transmission electron microscope. Three kinds of supernatant fluid of light -injured neurosensory retina of SD rats were prepared.The third passage of MSCs were cultured with these mixed medium for 7-8d, we used RT-PCR to see whether they could express rhodopsin, neuron-specific enolase (NSE), and glial fibrillary acidic protein ( GFAP ) , and positive cells were counted and analyzed. RESULTS: HE staining showed the retinal sheets included full-thickness neural retina.Neurosensory retina developed ultrastructural destructions by light injury.RT-PCR showed that the medium of mixed I expressed higher positive rate of rhodopsin (0.3915±0.00644), NSE (0.2019± 0.00682), GFAP (0.1972 ±0.00211) than the medium of mixed Ⅱ rhodopsin (0.0983 ±0.00319), NSE (0.1048 ± 0.00323), GFAP (0.1040±0.00254) and medium of mixedⅢrhodopsin(0.0044±0.00126), NSE (0.0498±0.00149), GFAP (0.0467±0.00333).The difference of intergroup has statistical significance. CONCLUTION:The supernatant fluid of light-injured neurosensory retina of SD rats can induce MSCs to differentiate into retina-like cells and provide new insights of stem cell therapy for retinopathy.%目的:应用大鼠视网膜片光损伤后的培养上清液,在体外诱导大鼠骨髓间充质干细胞( mesenchymal stem cells , MSCs)成为视网膜样细胞的可能性。  方法:贴壁筛选法分离、培养大鼠MSCs ,流式细胞仪对其细胞纯度鉴定。取材大鼠视网

  20. Ambroxol inhibits rhinovirus infection in primary cultures of human tracheal epithelial cells.

    Science.gov (United States)

    Yamaya, Mutsuo; Nishimura, Hidekazu; Nadine, Lusamba Kalonji; Ota, Chiharu; Kubo, Hiroshi; Nagatomi, Ryoichi

    2014-04-01

    The mucolytic drug ambroxol hydrochloride reduces the production of pro-inflammatory cytokines and the frequency of exacerbation in patients with chronic obstructive pulmonary disease (COPD). However, the inhibitory effects of ambroxol on rhinovirus infection, the major cause of COPD exacerbations, have not been studied. We examined the effects of ambroxol on type 14 rhinovirus (RV14) infection, a major RV group, in primary cultures of human tracheal epithelial cells. RV14 infection increased virus titers and cytokine content in the supernatants and RV14 RNA in the cells. Ambroxol (100 nM) reduced RV14 titers and cytokine concentrations of interleukin (IL)-1β, IL-6 and IL-8 in the supernatants and RV14 RNA in the cells after RV14 infection, in addition to reducing susceptibility to RV14 infection. Ambroxol also reduced the expression of intercellular adhesion molecule-1 (ICAM-1), the receptor for RV14, and the number of acidic endosomes from which RV14 RNA enters the cytoplasm. In addition, ambroxol reduced the activation of the transcription factor nuclear factor kappa B (NF-κB) in the nucleus. These results suggest that ambroxol inhibits RV14 infection partly by reducing ICAM-1 and acidic endosomes via the inhibition of NF-κB activation. Ambroxol may modulate airway inflammation by reducing the production of cytokines in rhinovirus infection.

  1. Ambroxol inhibits rhinovirus infection in primary cultures of human tracheal epithelial cells.

    Science.gov (United States)

    Yamaya, Mutsuo; Nishimura, Hidekazu; Nadine, Lusamba Kalonji; Ota, Chiharu; Kubo, Hiroshi; Nagatomi, Ryoichi

    2014-04-01

    The mucolytic drug ambroxol hydrochloride reduces the production of pro-inflammatory cytokines and the frequency of exacerbation in patients with chronic obstructive pulmonary disease (COPD). However, the inhibitory effects of ambroxol on rhinovirus infection, the major cause of COPD exacerbations, have not been studied. We examined the effects of ambroxol on type 14 rhinovirus (RV14) infection, a major RV group, in primary cultures of human tracheal epithelial cells. RV14 infection increased virus titers and cytokine content in the supernatants and RV14 RNA in the cells. Ambroxol (100 nM) reduced RV14 titers and cytokine concentrations of interleukin (IL)-1β, IL-6 and IL-8 in the supernatants and RV14 RNA in the cells after RV14 infection, in addition to reducing susceptibility to RV14 infection. Ambroxol also reduced the expression of intercellular adhesion molecule-1 (ICAM-1), the receptor for RV14, and the number of acidic endosomes from which RV14 RNA enters the cytoplasm. In addition, ambroxol reduced the activation of the transcription factor nuclear factor kappa B (NF-κB) in the nucleus. These results suggest that ambroxol inhibits RV14 infection partly by reducing ICAM-1 and acidic endosomes via the inhibition of NF-κB activation. Ambroxol may modulate airway inflammation by reducing the production of cytokines in rhinovirus infection. PMID:23856970

  2. Culture and transfection of axolotl cells.

    Science.gov (United States)

    Denis, Jean-François; Sader, Fadi; Ferretti, Patrizia; Roy, Stéphane

    2015-01-01

    The use of cells grown in vitro has been instrumental for multiple aspects of biomedical research and especially molecular and cellular biology. The ability to grow cells from multicellular organisms like humans, squids, or salamanders is important to simplify the analyses and experimental designs to help understand the biology of these organisms. The advent of the first cell culture has allowed scientists to tease apart the cellular functions, and in many situations these experiments help understand what is happening in the whole organism. In this chapter, we describe techniques for the culture and genetic manipulation of an established cell line from axolotl, a species widely used for studying epimorphic regeneration.

  3. Sponge cell culture? A molecular identification method for sponge cells

    NARCIS (Netherlands)

    Sipkema, D.; Heilig, G.H.J.; Akkermans, A.D.L.; Osinga, R.; Tramper, J.; Wijffels, R.H.

    2003-01-01

    Dissociated sponge cells are easily confused with unicellular organisms. This has been an obstacle in the development of sponge-cell lines. We developed a molecular detection method to identify cells of the sponge Dysidea avara in dissociated cell cultures. The 18S ribosomal RNA gene from a Dysidea

  4. Cell culture models for study of differentiated adipose cells

    OpenAIRE

    Clynes, Martin

    2014-01-01

    Adipose cells are an important source of mesenchymal stem cells and are important for direct use in research on lipid metabolism and obesity. In addition to use of primary cultures, there is increasing interest in other sources of larger numbers of cells, using approaches including induced pluripotent stem cell differentiation and viral immortalisation.

  5. Melphalan metabolism in cultured cells

    International Nuclear Information System (INIS)

    Procedures are presented for the adaptation of reversed-phase-HPLC methods to accomplish separation and isolation of the cancer therapeutic drug melphalan (L-phenylalanine mustard) and its metabolic products from whole cells. Five major degradation products of melphalan were observed following its hydrolysis in phosphate buffer in vitro. The two most polar of these products (or modifications of them) were also found in the cytosol of Chinese hamster CHO cells. The amounts of these two polar products (shown not to be mono- or dihydroxymelphalan) were significantly changed by the pretreatment of cells with ZnC12, one being increased in amount while the other was reduced to an insignificant level. In ZnC12-treated cells, there was also an increased binding of melphalan (or its derivatives) to one protein fraction resolved by gel filtration-HPLC. These observations suggest that changes in polar melphalan products, and perhaps their interaction with a protein, may by involved in the reduction of melphalan cytotoxicity observed in ZnC12-treated cells. While ZnC12 is also known to increase the level of glutathione in cells, no significant amounts of glutathione-melphalan derivatives of the type formed non-enzymatically in vitro could be detected in ZnC12-treated or untreated cells. Formation of derivatives of melphalan with glutathione catabolic products in ZnC12-treated cells has not yet been eliminated, however. 17 refs., 5 figs., 1 tab

  6. Flux analysis of mammalian cell culture

    NARCIS (Netherlands)

    Martens, D.E.; Tramper, J.

    2010-01-01

    Animal cells are used for the production of vaccines and pharmaceutical proteins. The increase in demand for these products requires an increase in volumetric productivity of animal cell culture processes, which can be attained through an increase in biomass concentration and/or specific productivit

  7. [CO-CULTURE OF BOAR SPERMATOGONIAL CELLS WITH SERTOLI CELLS].

    Science.gov (United States)

    Savchenkova, I P; Vasil'eva, S A

    2016-01-01

    In the present study, we developed in vitro culture conditions using co-culture of boar spermatogonial cells with Sertoli cells. Testes from 60-day-old crossbred boar were used. A spermatogonia-enriched culture was achieved by enzymatic digestion method and purification by density gradient centrifugation using a discontinuous Percoll gradient and differentiated adherence technique. Lipid drops were detected in isolated Sertoli cells by Oil Red O staining. We have found that the cultivation of boar spermatogonia in the presence of Sertoli cells (up to 35 days) leads to their differentiation as well as in vivo in testis. Association of cells in groups, formation of chains and suspension clusters of the spermatogenic cells were observed on the 10th day. Spermatogonial cellular colonies were noted at the same time. These cellular colonies were analyzed for the expression of genes: Nanog and Plzf in RT PCR. The expression of the Nanog gene in the experimental cellular clones obtained by short-term culture of spermatogonial cells in the presence of Sertoli cells was 200 times higher than the expression of this gene in the freshly isolated spermatogonial cells expression was found in freshly isolated germ cells and in cellular clones derived in vitro. We have found that, in the case of longer cultivation of these cells on Sertoli cells, in vitro process of differentiation of germ cells and formation of single mobile boar spermatozoa occurs at 30-33 days. Cellular population is heterogeneous at this stage. Spermatogenic differentiation in vitro without Sertoli cells stays on the 7th day of cultivation. The results show that co-culture of boar spermatogonia-enriched cells with Sertoli cells can induce their differentiation into spermatozoa in vitro and facilitate obtaining of porcine germ cell culture. PMID:27228660

  8. Genipin inhibits endothelial exocytosis via nitric oxide in cultured human umbilical vein endothelial cells

    Institute of Scientific and Technical Information of China (English)

    Guang-fa WANG; Shao-yu WU; Jin-jun RAO; Lin L(U); Wei XU; Jian-xin PANG; Zhong-qiu LIU; Shu-guang WU; Jia-jie ZHANG

    2009-01-01

    Aim: Exocytosis of endothelial Weibel-Palade bodies, which contain von Willebrand factor (VWF), P-selectin and other modulators, plays an important role in both inflammation and thrombosis. The present study investigates whether genipin,an aglycon of geniposide, inhibits endothelial exocytosis.Methods: Human umbilical vein endothelial cells (HUVECs) were isolated from umbilical cords and cultured. The concentration of VWF in cell supernatants was measured using an ELISA Kit. P-selectin translocation on the cell surface was analyzed by cell surface ELISA. Cell viability was measured using a Cell Counting Kit-8. Mouse bleeding times were measured by amputating the tail tip. Western blot analysis was used to determine the amount of endothelial nitric oxide synthase (eNOS) and phospho-eNOS present. Nitric oxide (NO) was measured in the cell supernatants as nitrite using an NO Colorimetric Assay.Results: Genipin inhibited thrombin-induced VWF release and P-selectin translocation in HUVECs in a dose- and time-dependent manner. The drug had no cytotoxic effect on the cells at the same doses that were able to inhibit exocytosis. The functional study that demonstrated that genipin inhibited exocytosis in vivo also showed that genipin prolonged the mouse bleeding time. Furthermore, genipin activated eNOS phosphorylation, promoted enzyme activation and increased NO production. L-NAME, an inhibitor of NOS, reversed the inhibitory effects of genipin on endothelial exocytosis.Conclusion: Genipin inhibits endothelial exocytosis in HUVECs. The mechanism by which this compound inhibits exocytosis may be related to its ability to stimulate eNOS activation and NO production. Our findings suggest a novel antiinflammatory mechanism for genipin. This compound may represent a new treatment for inflammation and/or thrombosis in which excess endothelial exocytosis plays a pathophysiological role.

  9. Increasing cell culture population doublings for long-term growth of finite life span human cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Stampfer, Martha R.; Garbe, James C.

    2016-06-28

    Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.

  10. Increasing cell culture population doublings for long-term growth of finite life span human cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Stampfer, Martha R; Garbe, James C

    2015-02-24

    Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.

  11. 21 CFR 864.2280 - Cultured animal and human cells.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cultured animal and human cells. 864.2280 Section... (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Cell And Tissue Culture Products § 864.2280 Cultured animal and human cells. (a) Identification. Cultured animal and human cells are in...

  12. Pinoresinol from Ipomoea cairica cell cultures.

    Science.gov (United States)

    Páska, Csilla; Innocenti, Gabbriella; Ferlin, Mariagrazia; Kunvári, Mónika; László, Miklós

    2002-10-01

    Ipomoea cairica cell cultures produced a tetrahydrofuran lignan, (+)-pinoresinol, identified by UV, IR, MS and NMR methods, not yet found in the intact plant, and new in the Convolvulaceae family. Pinoresinol was found to have antioxidant and Ca2+ antagonist properties. As it could be requested for its biological activity, we examined the possibility to raise the pinoresinol yield of I. cairica cultures, as well as we continued investigations on lignans' response to optimization.

  13. Probiotic modulation of dendritic cells co-cultured with intestinal epithelial cells

    Institute of Scientific and Technical Information of China (English)

    Ji Yeun Kim; Myeong Soo Park; Geun Eog Ji

    2012-01-01

    AIM:TO investigate cytokine production and cell surface phenotypes of dendritic cells (DC) in the presence of epithelial cells stimulated by probiotics.METHODS:Mouse DC were cultured alone or together with mouse epithelial cell monolayers in normal or inverted systems and were stimulated with heat-killed probiotic bacteria,Bifidobacteriumlactis AD011 (BL),Bifidobacterium bifidum BGN4 (BB),Lactobacillus casei IBS041 (LC),and Lactobacillus acidophilus AD031 (LA),for 12 h.Cytokine levels in the culture supernatants were determined by enzyme-linked immunosorbent assay and phenotypic analysis of DC was investigated by flow cytometry.RESULTS:BB and LC in single-cultured DC increased the expression of I-Ad,CD86 and CD40 (I-Ad,18.51 vs 30.88,46.11; CD86,62.74 vs 92.7,104.12; CD40,0.67vs 6.39,3.37,P < 0.05).All of the experimental probiotics increased the production of inflammatory cytokines,interleukin (IL)-6 and tumor necrosis factor (TNF)-α.However,in the normal co-culture systems,LC and LA decreased the expression of I-Ad (39.46 vs 30.32,33.26,P < 0.05),and none of the experimental probiotics increased the levels of IL-6 or TNF-α.In the inverted coculture systems,LC decreased the expression of CD40 (1.36 vs-2.27,P < 0.05),and all of the experimental probiotics decreased the levels of IL-6.In addition,BL increased the production of IL-10 (103.8 vs 166.0,P< 0.05) and LC and LA increased transforming growth factor-3 secretion (235.9 vs 618.9,607.6,P < 0.05).CONCLUSION:These results suggest that specific probiotic strains exert differential immune modulation mediated by the interaction of dendritic cells and epithelial cells in the homeostasis of gastrointestinal tract.

  14. Boildown Study on Supernatant Liquid Retrieved from AW-106 in December 2012

    Energy Technology Data Exchange (ETDEWEB)

    Page, Jason S.

    2013-06-04

    This document reports the results of a boildown study using a composite created from supernatant liquid grab samples retrieved from tank 241-AW-106 in December of 2012. The composite was made using predetermined volumes of the grab samples which accounted for layering of the supernatant liquid in the tank. The finished composite was a clear, yellow liquid containing no visible solids at hot cell ambient temperatures (24 - 27 °C). The density of the test composite was measured in the hot cell immediately before the boildown study and was 1.266 g/mL at 27.1 °C.

  15. Growth regulation of cultured human nevus cells.

    Science.gov (United States)

    Mancianti, M L; Györfi, T; Shih, I M; Valyi-Nagy, I; Levengood, G; Menssen, H D; Halpern, A C; Elder, D E; Herlyn, M

    1993-03-01

    Cells isolated from congenital melanocytic nevi and cultured in vitro have growth characteristics that resemble their premalignant stage in situ. A serum-free, chemically defined medium has been developed that allows continuous growth of established nevus cultures for up to several months. Like primary melanoma cells, nevus cells in high-calcium-containing W489 medium require insulin for growth. In contrast to melanoma cells, nevus cells in serum-free medium require the presence of alpha-melanocyte-stimulating hormone, which enhanced intracellular levels of cyclic adenosine monophosphate. In contrast to the requirements of normal human melanocytes from newborn foreskin, congenital nevus cells grow with less dependency on basic fibroblast growth factor (bFGF). Nevus cultures contain bFGF-like activity, and they express bFGF mRNA. Nevic cells of compound nevi also express bFGF mRNA in situ but only in the junctional areas. These results indicate that bFGF plays an important growth regulatory role for nevus cells in vitro and in vivo. PMID:8440904

  16. General overview of neuronal cell culture.

    Science.gov (United States)

    Gordon, Jennifer; Amini, Shohreh; White, Martyn K

    2013-01-01

    In this introductory chapter, we provide a general overview of neuronal cell culture. This is a rapidly evolving area of research and we provide an outline and contextual framework for the different chapters of this book. These chapters were all contributed by scientists actively working in the field who are currently using state-of-the-art techniques to advance our understanding of the molecular and cellular biology of the central nervous system. Each chapter provides detailed descriptions and experimental protocols for a variety of techniques ranging in scope from basic neuronal cell line culturing to advanced and specialized methods.

  17. Wnt-Dependent Control of Cell Polarity in Cultured Cells.

    Science.gov (United States)

    Runkle, Kristin B; Witze, Eric S

    2016-01-01

    The secreted ligand Wnt5a regulates cell polarity and polarized cell movement during development by signaling through the poorly defined noncanonical Wnt pathway. Cell polarity regulates most aspects of cell behavior including the organization of apical/basolateral membrane domains of epithelial cells, polarized cell divisions along a directional plane, and front rear polarity during cell migration. These characteristics of cell polarity allow coordinated cell movements required for tissue formation and organogenesis during embryonic development. Genetic model organisms have been used to identify multiple signaling pathways including Wnt5a that are required to establish cell polarity and regulate polarized cell behavior. However, the downstream signaling events that regulate these complex cellular processes are still poorly understood. The methods below describe assays to study Wnt5a-induced cell polarity in cultured cells, which may facilitate our understanding of these complex signaling pathways. PMID:27590152

  18. A novel cell growth-promoting factor identified in a B cell leukemia cell line, BALL-1

    International Nuclear Information System (INIS)

    A novel leukemia cell growth-promoting activity has been identified in the culture supernatant from a human B cell leukemia cell line, BALL-1. The supernatant from unstimulated cultures of the BALL-1 cells significantly promoted the growth of 16 out of 24 leukemia/lymphoma cell lines of different lineages (T, B and non-lymphoid) in a minimal concentration of fetal bovine serum (FBS), and 5 out of 12 cases of fresh leukemia cells in FBS-free medium. The growth-promoting sieve filtration and dialysis. The MW of the factor was less than 10 kDa. The growth-promoting activity was heat and acid stable and resistant to trypsin treatment. The factor isolated from the BALL-1 supernatant was distinct from known polypeptide growth factors with MW below 10 kDa, such as epidermal growth factor, transforming growth factor α, insulin-like growth factor I (IGF-I), IGF-II and insulin, as determine by specific antibodies and by cell-growth-promoting tests. The factor is the BALL-1 supernatant did not promote the proliferation of normal human fresh peripheral blood lymphocytes or mouse fibroblast cell line, BALB/C 3T3. In addition to the BALL-1 supernatant, a similar growth-promoting activity was found in the culture supernatant from 13 of 17 leukemia/lymphoma cell lines tested. The activity in these culture supernatant promoted the growth of leukemia/lymphoma cell lines in autocrine and/or paracrine fashions. These observations suggest that the low MW cell growth-promoting activity found in the BALL-1 culture supernatant is mediated by a novel factor which may be responsible for the clonal expansion of particular leukemic clones. (author)

  19. Cell Cycle Progression of Human Cells Cultured in Rotating Bioreactor

    Science.gov (United States)

    Parks, Kelsey

    2009-01-01

    Space flight has been shown to alter the astronauts immune systems. Because immune performance is complex and reflects the influence of multiple organ systems within the host, scientists sought to understand the potential impact of microgravity alone on the cellular mechanisms critical to immunity. Lymphocytes and their differentiated immature form, lymphoblasts, play an important and integral role in the body's defense system. T cells, one of the three major types of lymphocytes, play a central role in cell-mediated immunity. They can be distinguished from other lymphocyte types, such as B cells and natural killer cells by the presence of a special receptor on their cell surface called T cell receptors. Reported studies have shown that spaceflight can affect the expression of cell surface markers. Cell surface markers play an important role in the ability of cells to interact and to pass signals between different cells of the same phenotype and cells of different phenotypes. Recent evidence suggests that cell-cycle regulators are essential for T-cell function. To trigger an effective immune response, lymphocytes must proliferate. The objective of this project is to investigate the changes in growth of human cells cultured in rotating bioreactors and to measure the growth rate and the cell cycle distribution for different human cell types. Human lymphocytes and lymphoblasts will be cultured in a bioreactor to simulate aspects of microgravity. The bioreactor is a cylindrical culture vessel that incorporates the aspects of clinostatic rotation of a solid fluid body around a horizontal axis at a constant speed, and compensates gravity by rotation and places cells within the fluid body into a sustained free-fall. Cell cycle progression and cell proliferation of the lymphocytes will be measured for a number of days. In addition, RNA from the cells will be isolated for expression of genes related in cell cycle regulations.

  20. Integrated biosensors for cell culture monitoring

    OpenAIRE

    De Micheli, Giovanni; Boero, Cristina; Olivo, Jacopo; Carrara, Sandro

    2014-01-01

    Biosensors for endogenous compounds, such as glucose and lactate, are applied to monitor cell cultures. Cells can be cultivated for several purposes, such as understanding and modeling some biological mechanisms, the development of new drugs and therapies, and in the field of regenerative medicine. We have realized a self-contained monitoring system with remote readout. Metabolite detection is based on oxidases immobilized onto carbon nanotubes. We calibrate the system for glucose and lactate...

  1. Cell culture from sponges: pluripotency and immortality

    NARCIS (Netherlands)

    Caralt Bosch, de S.; Uriz, M.J.; Wijffels, R.H.

    2007-01-01

    Sponges are a source of compounds with potential pharmaceutical applications. In this article, methods of sponge cell culture for production of these bioactive compounds are reviewed, and new approaches for overcoming the problem of metabolite supply are examined. The use of embryos is proposed as a

  2. 3D culture for cardiac cells.

    Science.gov (United States)

    Zuppinger, Christian

    2016-07-01

    This review discusses historical milestones, recent developments and challenges in the area of 3D culture models with cardiovascular cell types. Expectations in this area have been raised in recent years, but more relevant in vitro research, more accurate drug testing results, reliable disease models and insights leading to bioartificial organs are expected from the transition to 3D cell culture. However, the construction of organ-like cardiac 3D models currently remains a difficult challenge. The heart consists of highly differentiated cells in an intricate arrangement.Furthermore, electrical “wiring”, a vascular system and multiple cell types act in concert to respond to the rapidly changing demands of the body. Although cardiovascular 3D culture models have been predominantly developed for regenerative medicine in the past, their use in drug screening and for disease models has become more popular recently. Many sophisticated 3D culture models are currently being developed in this dynamic area of life science. This article is part of a Special Issue entitled: Cardiomyocyte Biology: Integration of Developmental and Environmental Cues in the Heart edited by Marcus Schaub and Hughes Abriel.

  3. Nanotechnology, Cell Culture and Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Kazutoshi Haraguchi

    2011-01-01

    Full Text Available We have fabricated new types of polymer hydrogels and polymer nanocomposites, i.e., nanocomposite gels (NC gels and soft, polymer nanocomposites (M-NCs: solid, with novel organic/inorganic network structures. Both NC gels and M-NCs were synthesized by in-situ free-radical polymerization in the presence of exfoliated clay platelets in aqueous systems and were obtained in various forms such as film, sheet, tube, coating, etc. and sizes with a wide range of clay contents. Here, disk-like inorganic clay nanoparticles act as multi-functional crosslinkers to form new types of network systems. Both NC gels and M-NCs have extraordinary optical and mechanical properties including ultra-high reversible extensibility, as well as a number of new characteristics relating to optical anisotropy, polymer/clay morphology, biocompatibility, stimuli-sensitive surfaces, micro-patterning, etc. For examples, the biological testing of medical devices, comprised of a sensitization test, an irritation test, an intracutaneous test and an in vitro cytotoxicity test,was carried out for NC gels and M-NCs. The safety of NC gels and M-NCs was confirmed in all tests. Also, the interaction of living tissue with NC gel was investigated in vivo by implantation in live goats; neither inflammation nor concrescence occurred around the NC gels. Furthermore, it was found that both N-NC gels consisting of poly(N-isopropylacrylamide(PNIPA/clay network and M-NCs consisting of poly(2-methoxyethyacrylate(PMEA/clay network show characteristic cell culture and subsequent cell detachment on their surfaces, although it was almost impossible to culture cells on conventional, chemically-crosslinked PNIPA hydrogels and chemically crossslinked PMEA, regardless of their crosslinker concentration. Various kinds of cells, such ashumanhepatoma cells (HepG2, normal human dermal fibroblast (NHDF, and human umbilical vein endothelial cells (HUVEC, could be cultured to be confluent on the surfaces of N

  4. Cell culture models using rat primary alveolar type I cells.

    Science.gov (United States)

    Downs, Charles A; Montgomery, David W; Merkle, Carrie J

    2011-10-01

    There is a lack of cell culture models using primary alveolar type I (AT I) cells. The purpose of this study was to develop cell culture models using rat AT I cells and microvascular endothelial cells from the lung (MVECL). Two types of model systems were developed: single and co-culture systems; additionally a 3-dimensional model system was developed. Pure AT I cell (96.3 ± 2.7%) and MVECL (97.9 ± 1.1%) preparations were used. AT I cell morphology, mitochondrial number and distribution, actin filament arrangement and number of apoptotic cells at confluence, and telomere attrition were characterized. AT I cells maintained their morphometric characteristics through at least population doubling (PD) 35, while demonstrating telomere attrition through at least PD 100. Furthermore, AT I cells maintained the expression of their specific markers, T1α and AQ-5, through PD 42. For the co-cultures, AT I cells were grown on the top and MVECL were grown on the bottom of fibronectin-coated 24-well Transwell Fluroblok™ filter inserts. Neither cell type transmigrated the 1 μm pores. Additionally, AT I cells were grown in a thick layer of Matrigel(®) to create a 3-dimensional model in which primary AT I cells form ring-like structures that resemble an alveolus. The development of these model systems offers the opportunities to investigate AT I cells and their interactions with MVECL in response to pharmacological interventions and in the processes of disease, repair and regeneration. PMID:21624488

  5. A biocompatible micro cell culture chamber (microCCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, A M;

    2006-01-01

    culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...

  6. Cell Culture Assay for Human Noroviruses [response

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Honer Zu Bentrup, Kerstin; Orosz Coghlan, Patricia; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza A.; Nickerson, Cheryl A.

    2007-07-01

    We appreciate the comments provided by Leung et al., in response to our recently published article “In Vitro Cell Culture Infectivity Assay for Human Noroviruses” by Straub et al. (1). The specific aim of our project was to develop an in vitro cell culture infectivity assay for human noroviruses (hNoV) to enhance risk assessments when they are detected in water supplies. Reverse transcription (RT) qualitative or quantitative PCR are the primary assays for waterborne NoV monitoring. However, these assays cannot distinguish between infectious vs. non-infectious virions. When hNoV is detected in water supplies, information provided by our infectivity assay will significantly improve risk assessment models and protect human health, regardless of whether we are propagating NoV. Indeed, in vitro cell culture infectivity assays for the waterborne pathogen Cryptosporidium parvum that supplement approved fluorescent microscopy assays, do not result in amplification of the environmentally resistant hard-walled oocysts (2). However, identification of life cycle stages in cell culture provides evidence of infectious oocysts in a water supply. Nonetheless, Leung et al.’s assertion regarding the suitability of our method for the in vitro propagation of high titers of NoV is valid for the medical research community. In this case, well-characterized challenge pools of virus would be useful for developing and testing diagnostics, therapeutics, and vaccines. As further validation of our published findings, we have now optimized RT quantitative PCR to assess the level of viral production in cell culture, where we are indeed finding significant increases in viral titer. The magnitude and time course of these increases is dependent on both virus strain and multiplicity of infection. We are currently preparing a manuscript that will discuss these findings in greater detail, and the implications this may have for creating viral challenge pools

  7. ¹H NMR spectroscopy profiling of metabolic reprogramming of Chinese hamster ovary cells upon a temperature shift during culture.

    Directory of Open Access Journals (Sweden)

    Jane L Wagstaff

    Full Text Available We report an NMR based approach to determine the metabolic reprogramming of Chinese hamster ovary cells upon a temperature shift during culture by investigating the extracellular cell culture media and intracellular metabolome of CHOK1 and CHO-S cells during culture and in response to cold-shock and subsequent recovery from hypothermic culturing. A total of 24 components were identified for CHOK1 and 29 components identified for CHO-S cell systems including the observation that CHO-S media contains 5.6 times the level of glucose of CHOK1 media at time zero. We confirm that an NMR metabolic approach provides quantitative analysis of components such as glucose and alanine with both cell lines responding in a similar manner and comparable to previously reported data. However, analysis of lactate confirms a differentiation between CHOK1 and CHO-S and that reprogramming of metabolism in response to temperature was cell line specific. The significance of our results is presented using principal component analysis (PCA that confirms changes in metabolite profile in response to temperature and recovery. Ultimately, our approach demonstrates the capability of NMR providing real-time analysis to detect reprogramming of metabolism upon cellular perception of cold-shock/sub-physiological temperatures. This has the potential to allow manipulation of metabolites in culture supernatant to improve growth or productivity.

  8. Cell Culture Microfluidic Biochips: Experimental Throughput Maximization

    DEFF Research Database (Denmark)

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan;

    2011-01-01

    Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory, integrating all necessary functionalities on-chip in order to perform biochemical applications. Researchers have started to propose computer-aided design tools for the synthesis of such biochips. Our foc...... metaheuristic for experimental design generation for the cell culture microfluidic biochips, and we have evaluated our approach using multiple experimental setups....... in this paper is on the optimization of how a biochemical application is performed on a biochip. In this paper, we consider cell culture biochips, where several cell colonies are exposed to soluble compounds and monitored in real-time to determine the right combination of factors that leads to the desired...

  9. The function of TLR4 in interferon gamma or interleukin-13 exposed and lipopolysaccharide stimulated gingival epithelial cell cultures.

    Science.gov (United States)

    Beklen, A; Sarp, A S; Uckan, D; Tsaous Memet, G

    2014-10-01

    Gingival epithelial cells are part of the first line of host defense against infection. Toll-like receptors (TLRs) serve important immune and nonimmune functions. We investigated how interferon gamma (INF-γ) and interleukin 13 (IL-13) are involved in the TLR4 ligand-induced regulation of interleukin-8 (IL-8) effects on gingival epithelial cells. We used immunohistochemistry to localize TLR4 in ten healthy and ten periodontitis tissue specimens. Gingival epithelial cells then were primed with Th1 cytokine (INF-γ) or Th2 cytokine (IL-13) before stimulation with Escherichia coli-derived lipopolysaccharide (LPS) and enzyme-linked immunosorbent assay (ELISA) was performed to detect the level of IL-8 secretion in cell culture supernatants. Although both healthy and periodontitis gingival tissue samples expressed TLR4, the periodontitis samples showed more intense expression on gingival epithelial cells. Gingival epithelial cell cultures were primed with either INF-γ or IL-13 before stimulation with TLR4 ligand. Supernatants from co-stimulated epithelial cells exhibited IL-8 production in opposite directions, i.e., as one stimulates the release, the other reduces the release. INF-γ significantly increased TLR4 function, whereas IL-13 significantly decreased TLR4 function, i.e., production of IL-8. Pathogen associated molecular pattern-LPS, shared by many different periodonto-pathogenic bacteria, activates the gingival epithelial cells in a TLR-dependent manner. Diminished or increased TLR function in gingival epithelial cells under the influence of different Th cell types may protect or be harmful due to the altered TLR signaling.

  10. Metabolic effects of influenza virus infection in cultured animal cells: Intra- and extracellular metabolite profiling

    Directory of Open Access Journals (Sweden)

    Genzel Yvonne

    2010-05-01

    Full Text Available Abstract Background Many details in cell culture-derived influenza vaccine production are still poorly understood and approaches for process optimization mainly remain empirical. More insights on mammalian cell metabolism after a viral infection could give hints on limitations and cell-specific virus production capacities. A detailed metabolic characterization of an influenza infected adherent cell line (MDCK was carried out based on extracellular and intracellular measurements of metabolite concentrations. Results For most metabolites the comparison of infected (human influenza A/PR/8/34 and mock-infected cells showed a very similar behavior during the first 10-12 h post infection (pi. Significant changes were observed after about 12 h pi: (1 uptake of extracellular glucose and lactate release into the cell culture supernatant were clearly increased in infected cells compared to mock-infected cells. At the same time (12 h pi intracellular metabolite concentrations of the upper part of glycolysis were significantly increased. On the contrary, nucleoside triphosphate concentrations of infected cells dropped clearly after 12 h pi. This behaviour was observed for two different human influenza A/PR/8/34 strains at slightly different time points. Conclusions Comparing these results with literature values for the time course of infection with same influenza strains, underline the hypothesis that influenza infection only represents a minor additional burden for host cell metabolism. The metabolic changes observed after12 h pi are most probably caused by the onset of apoptosis in infected cells. The comparison of experimental data from two variants of the A/PR/8/34 virus strain (RKI versus NIBSC with different productivities and infection dynamics showed comparable metabolic patterns but a clearly different timely behavior. Thus, infection dynamics are obviously reflected in host cell metabolism.

  11. The allogeneic umbilical cord mesenchymal stem cells regulate the function of T helper 17 cells from patients with rheumatoid arthritis in an in vitro co-culture system

    Directory of Open Access Journals (Sweden)

    Wang Qin

    2012-12-01

    Full Text Available Abstract Background Previous in vivo studies have shown that mesenchymal stem cell (MSC transplantation significantly improves the condition of a number of autoimmune diseases including autoimmune cerebrospinal meningitis, multiple sclerosis, glomerulonephritis and systemic lupus erythematosus. Methods To investigate the immunoregulatory effect of stem cell transplantation, human umbilical cord MSCs were co-cultured with peripheral blood mononuclear cells (PBMCs from patients with rheumatoid arthritis (RA. Orphan nuclear receptor gamma (ROR-γ mRNA and protein expression was detected with real-time PCR and Western blotting. Interleukin (IL-17, IL-6 and tumor necrosis factor (TNF-α in the cell culture supernatant were measured using a flow cytometric bead capture method. Results After 72 hours of co-culture, the mRNA and protein expression levels of ROR-γ in co-cultured PBMCs were decreased compared with that in PBMC of RA patients cultured alone (p  Conclusions In vitro co-culture with MSCs down-regulated the inflammatory response of PBMCs from RA patients with severe disease activity, but had no significant effect on PBMCs from healthy controls or patients with mild disease activity, suggesting that the immunoregulatory role of MSCs may associate with the occurrence of inflammatory mediators.

  12. Prevention and Detection of Mycoplasma Contamination in Cell Culture

    Directory of Open Access Journals (Sweden)

    Parvaneh Farzaneh

    2012-01-01

    Full Text Available One of the main problems in cell culture is mycoplasma infection. It can extensively affectcell physiology and metabolism. As the applications of cell culture increase in research,industrial production and cell therapy, more concerns about mycoplasma contaminationand detection will arise. This review will provide valuable information about: 1. the waysin which cells are contaminated and the frequency and source of mycoplasma species incell culture; 2. the ways to prevent mycoplasma contamination in cell culture; 3. the importanceof mycoplasma tests in cell culture; 4. different methods to identify mycoplasmacontamination; 5. the consequences of mycoplasma contamination in cell culture and 6.available methods to eliminate mycoplasma contamination. Awareness about the sourcesof mycoplasma and pursuing aseptic techniques in cell culture along with reliable detectionmethods of mycoplasma contamination can provide an appropriate situation to preventmycoplasma contamination in cell culture.

  13. Mouse cell culture - Methods and protocols

    Directory of Open Access Journals (Sweden)

    CarloAlberto Redi

    2010-12-01

    Full Text Available The mouse is, out of any doubt, the experimental animal par excellence for many many colleagues within the scientific community, notably for those working in mammalian biology (in a broad sense, from basic genetic to modeling human diseases, starting at least from 1664 Robert Hooke experiments on air’s propertyn. Not surprising then that mouse cell cultures is a well established field of research itself and that there are several handbooks devoted to this discipline. Here, Andrew Ward and David Tosh provide a necessary update of the protocols currently needed. In fact, nearly half of the book is devoted to stem cells culture protocols, mainly embryonic, from a list of several organs (kidney, lung, oesophagus and intestine, pancreas and liver to mention some........

  14. Darwinian Evolution of Prions in Cell Culture*

    OpenAIRE

    Li, Jiali; Browning, Shawn; Mahal, Sukhvir P.; Oelschlegel, Anja M.; Weissmann, Charles

    2009-01-01

    Prions are infectious proteins consisting mainly of PrPSc, a β sheet-rich conformer of the normal host protein PrPC, and occur in different strains. Strain identity is thought to be encoded by PrPSc conformation. We found that biologically cloned prion populations gradually became heterogeneous by accumulating “mutants”, and selective pressures resulted in the emergence of different mutants as major constituents of the evolving population. Thus, when transferred from brain to cultured cells, ...

  15. Mediation of endogenous peroxynitrite in the injury of cultured pulmonary artery endothelial cells induced by lipopolysaccharide

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    This experiment, using cultured bovine pulmonary artery endothelial cells (BPAEC), was undertaken to investigate roles of endogenous ONOO- in lipopolysaccharide (LPS)-caused injury to endothelial cells. The fluorescent intensity of nitrotyrosine (NT), a marker of ONOO- generation, in BPAEC represented content of endogenous ONOO- generation. The fluorescent intensity of NT and number of NT positive cells were detected with flow cytometry, and the percentage of NT positive cells was calculated. Results were as follows. (1) LPS (1 mg/L, 5 mg/L and 10 mg/L) caused marked increase in fluorescent intensity of NT in a dose dependent manner. The number and percentage of NT positive cells were markedly increased (P<0.05). Aminoguanidine (AG), a selective inhibitor of inducible nitric oxide synthase, inhibited the increase in fluorescent intensity of NT in BPAEC induced by LPS. However, the number and percentage of NT positive cells had tendency to reduce. (2) LPS caused the enhancement of MDA content and activity of LDH in cultured supernatant (P<0.01). AG reversed the enhancement of MDA content induced by LPS (P<0.01). In contrast, AG had marginal effect on activity of LDH. (3) LPS induced the increase in apoptotic rate in BPAEC in a dose dependent manner. Some BPAEC stained with fluorescent probe ethidium bromide showed morphological features of apoptosis with chromatin condensation and nuclear fragmentation. AG reduced the apoptotic rate and number of apoptotic cells, both of which were still higher than those of vehicle group (P<0.05). (4) LPS inhibited mitochondrial respiration. Effect of LPS on mitochondrial membrane potential (ΔΨ) depended on the doses of LPS. 1 mg/L LPS led to a little increase in ΔΨ, while 5 mg/L and 10 mg/L LPS significantly reduced ΔΨ. In conclusion, LPS caused injury to cultured BPAEC and increased production of ONOO-. Cytotoxicity of LPS may be mediated by endogenous ONOO-.

  16. 单宁酸对糖尿病大鼠肾组织和肾小球系膜细胞培养上清中8-OHdG及3-NT含量的影响%Influence of tannic acid on contents of 8-OHdG and 3-NT in nephridial tissue of diabetic rats and supernatant of glomerular mesangial cells

    Institute of Scientific and Technical Information of China (English)

    魏海峰; 刘磊; 芦小单; 米旭光; 李首庆; 谭岩; 方艳秋

    2014-01-01

    from 68 6-week-old male Wistar rats as normal control group and the remaining 60 rats accepted high-sugar and high-fat diet for 4 weeks, then were injected streptozotocin ( STZ, 52 mg/kg ) intraperitoneally in order to manufacture a diabetic rat model.Further the diabetic rats were randomly divided into model group ,aminoguanidine group ,low-dose of tannic acid group and high dose of tannic acid group.The rats in aminoguanidine group were injected aminoguanidine [AG,40 mg/(kg· d)] intraperitoneally, those in low-dose of tannic acid group were injected tannic acid [TA,20 mg/(kg· d)] and those in high-dose of tannic acid group were injected tannic acid [TA,30 mg/(kg· d)].The rats in normal control group and model group were injected normal saline [NS, 30 mg/(kg· d)] and all rats were sacrificed and tissues were derived at the end of the week 10.Morphologic changes of kidney in diabetic rats were observed by HE staining and correlative biochemical indices of renal function were detected by biochemical analyzer.8-hydroxy deoxyguanosine (8-OHdG) and 3-nitrotyrosine (3-NT) content of renal tissue in rats in different groups were detected by ELISA method.Mesangial cells cultured in vitro were treated with high concentration of glucose (30 mmol/L) and AGEs (250 mg/L) and at the same time with different concentration of tannic acid (10,20,40 and 80μmol/L) on the basis of setting corre-sponding control group.The contents of 8-OHdG and 3-NT in the culture supernatant were measured by ELISA method after 48 hours.Results:Tannic acid can effectively improve the renal pathological changes and improve renal function of diabetic rats .The contents of 8-OHdG and 3-NT in kidney tissue homogenate of diabetic rats and in the supernatant of GMC cultured with high glucose or AGEs were all significantly increased and can be reduced by tannic acid.Conclusion:Tannic acid improving the structure and function damage of kidney in diabetic rats might be achieved by oxidative stress and

  17. Prevention and Detection of Mycoplasma Contamination in Cell Culture

    OpenAIRE

    Parvaneh Farzaneh; Laleh Nikfarjam

    2011-01-01

    One of the main problems in cell culture is mycoplasma infection. It can extensively affect cell physiology and metabolism. As the applications of cell culture increase in research, industrial production and cell therapy, more concerns about mycoplasma contamination and detection will arise. This review will provide valuable information about: 1. the ways in which cells are contaminated and the frequency and source of mycoplasma species in cell culture; 2. the ways to prevent mycoplasma conta...

  18. 利用产黄青霉培养液的上清液生物合成纳米银影响因素的研究%Effects of Experimental Conditions on Silver Nanoparticles' s Biosynthesis by Culture Supernatant of Penicillium chrysogenum

    Institute of Scientific and Technical Information of China (English)

    杨素玲; 孟佑婷; 刘桂君; 王平; 尚宏忠

    2013-01-01

    [目的]对利用产黄青霉培养液的上清液生物合成纳米银的影响因素进行研究.[方法]利用紫外-可见光谱和投射电镜研究硝酸银起始浓度、pH值、光照和微波辐照等条件对合成反应速率及合成纳米银粒径的影响.[结果]硝酸银的最佳起始浓度为2 mmol/L;随着反应体系pH值的升高,反应速率随之加快,合成纳米银粒子的粒径变小;光照和微波辐照均能有效促进纳米银的合成.[结论]该研究为实现纳米银的可控合成提供了试验基础.%[Objective] The aim was to study the effects of experimental conditions on silver nanoparticles's biosynthesis by culture supernatant of Penicillium chrysogenum. [ Method] The effects of initial silver nitrate concentration,pH value, visible-light emission and microwave irradiation on the reaction rate and size of synthetic: silver nanoparticles were studied by using UV-vis spectra and transmission electron microscopy. [Result] The optimal initial silver nitrate concentration was 2 mmol/L; the reaction rate was increased with the increase of pH value in the reaction system , but the particle size was decreased; both visible-light emission and microwave irradiation could promote the synthesis of silver nanoparticles effectively. [Conclusion] This research provided a test basis for the realization of controllable synthesis of silver nanoparticles.

  19. A Versatile Bioreactor for Dynamic Suspension Cell Culture. Application to the Culture of Cancer Cell Spheroids.

    Science.gov (United States)

    Massai, Diana; Isu, Giuseppe; Madeddu, Denise; Cerino, Giulia; Falco, Angela; Frati, Caterina; Gallo, Diego; Deriu, Marco A; Falvo D'Urso Labate, Giuseppe; Quaini, Federico; Audenino, Alberto; Morbiducci, Umberto

    2016-01-01

    A versatile bioreactor suitable for dynamic suspension cell culture under tunable shear stress conditions has been developed and preliminarily tested culturing cancer cell spheroids. By adopting simple technological solutions and avoiding rotating components, the bioreactor exploits the laminar hydrodynamics establishing within the culture chamber enabling dynamic cell suspension in an environment favourable to mass transport, under a wide range of tunable shear stress conditions. The design phase of the device has been supported by multiphysics modelling and has provided a comprehensive analysis of the operating principles of the bioreactor. Moreover, an explanatory example is herein presented with multiphysics simulations used to set the proper bioreactor operating conditions for preliminary in vitro biological tests on a human lung carcinoma cell line. The biological results demonstrate that the ultralow shear dynamic suspension provided by the device is beneficial for culturing cancer cell spheroids. In comparison to the static suspension control, dynamic cell suspension preserves morphological features, promotes intercellular connection, increases spheroid size (2.4-fold increase) and number of cycling cells (1.58-fold increase), and reduces double strand DNA damage (1.5-fold reduction). It is envisioned that the versatility of this bioreactor could allow investigation and expansion of different cell types in the future. PMID:27144306

  20. Reversible gelling culture media for in-vitro cell culture in three-dimensional matrices

    Science.gov (United States)

    An, Yuehuei H.; Mironov, Vladimir A.; Gutowska, Anna

    2000-01-01

    A gelling cell culture medium useful for forming a three dimensional matrix for cell culture in vitro is prepared by copolymerizing an acrylamide derivative with a hydrophilic comonomer to form a reversible (preferably thermally reversible) gelling linear random copolymer in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum gelling molecular weight cutoff, mixing the copolymer with an aqueous solvent to form a reversible gelling solution and adding a cell culture medium to the gelling solution to form the gelling cell culture medium. Cells such as chondrocytes or hepatocytes are added to the culture medium to form a seeded culture medium, and temperature of the medium is raised to gel the seeded culture medium and form a three dimensional matrix containing the cells. After propagating the cells in the matrix, the cells may be recovered by lowering the temperature to dissolve the matrix and centrifuging.

  1. Cell response of Chlamydomonas actinochloris culture to repeated microwave irradiation

    Directory of Open Access Journals (Sweden)

    OLESIA O. GRYGORIEVA

    2015-05-01

    Full Text Available Abstract. Grygorieva OO, Berezovsjka MA, Dacenko OI. 2015. Cell response of Chlamydomonas actinochloris culture to repeated microwave irradiation. Nusantara Bioscience 7: 38-42. Two cultures of Chlamydomonas actinochloris Deason et Bold in the lag-phase were exposed to the microwave irradiation. One of them (culture 1 was not treated beforehand, whereas the other (culture 2 was irradiated by microwaves 2 years earlier. The measurement of cell quantity as well as measurement of change of intensities and spectra of cultures photoluminescence (PL in the range of chlorophyll a emission was regularly conducted during the cell cultures development. Cell concentration of culture 1 exposed to the microwave irradiation for the first time has quickly restored while cell concentration of culture 2 which was irradiated repeatedly has fallen significantly. The following increasing of cell concentration of culture 2 is negligible. Cell concentration reaches the steady-state level that is about a half of the cell concentration of control culture. Initially the PL efficiency of cells of both cultures decreases noticeable as a result of irradiation. Then there is the monotonic increase to the values which are significantly higher than the corresponding values in the control cultures. The ratio of the intensities at the maxima of the main emission bands of chlorophyll for control samples of both cultures remained approximately at the same level. At the same time effect of irradiation on the cell PL spectrum appears as a temporary reduction of this magnitude.

  2. Insect cell culture in research: Indian scenario.

    Science.gov (United States)

    Sudeep, A B; Mourya, D T; Mishra, A C

    2005-06-01

    Insect cell cultures are widely used in viral diagnosis and biotechnology, for the production of recombinant proteins, viral pesticides and vaccines as well as in basic research in genetics, molecular biology, biochemistry, endocrinology and virology. Following KRP Singh's pioneering research in 1967, a large number of cell lines from diptera, hemiptera, and lepidopteran insects were established and characterized in India. With the availability of the modern tools in molecular biology and the advancements made in biotechnology, the indigenous cell lines may prove useful in creating a future without biohazardous chemical pesticides as well as producing life saving pharmaceuticals and vaccines for many diseases. This review summarizes information gathered regarding the insect cell lines established so far in India. It also covers the familiarization of the well characterized continuous cell lines and their potential applications. Special attention is given to virus susceptibility of the cell lines, the yield of virus with a comparative analysis with other conventional systems. The potential applications of dipteran and lepidopteran cell lines in agriculture and biotechnology are also briefly discussed for prospective studies.

  3. Cytotoxicity effects of amiodarone on cultured cells.

    Science.gov (United States)

    Golli-Bennour, Emna El; Bouslimi, Amel; Zouaoui, Olfa; Nouira, Safa; Achour, Abdellatif; Bacha, Hassen

    2012-07-01

    Amiodarone is a potent anti-arrhythmic drug used for the treatment of cardiac arrhythmias. Although, the effects of amiodarone are well characterized on post-ischemic heart and cardiomyocytes, its toxicity on extra-cardiac tissues is still poorly understood. To this aim, we have monitored the cytotoxicity effects of this drug on three cultured cell lines including hepatocytes (HepG2), epithelial cells (EAhy 926) and renal cells (Vero). We have investigated the effects of amiodarone on (i) cell viabilities, (ii) heat shock protein expressions (Hsp 70) as a parameter of protective and adaptive response and (iii) oxidative damage.Our results clearly showed that amiodarone inhibits cell proliferation, induces an over-expression of Hsp 70 and generates significant amount of reactive oxygen species as measured by lipid peroxidation occurrence. However, toxicity of amiodarone was significantly higher in renal and epithelial cells than in hepatocytes. Vitamin E supplement restores the major part of cell mortalities induced by amiodarone showing that oxidative damage is the predominant toxic effect of the drug.Except its toxicity for the cardiac system, our findings demonstrated that amiodarone can target other tissues. Therefore, kidneys present a high sensibility to this drug which may limit its use with subjects suffering from renal disorders.

  4. Rapid method for culturing embryonic neuron-glial cell cocultures

    DEFF Research Database (Denmark)

    Svenningsen, Åsa Fex; Shan, Wei-Song; Colman, David R;

    2003-01-01

    A streamlined, simple technique for primary cell culture from E17 rat tissue is presented. In an attempt to standardize culturing methods for all neuronal cell types in the embryo, we evaluated a commercial medium without serum and used similar times for trypsinization and tested different surfaces...... for plating. In 1 day, using one method and a single medium, it is possible to produce robust E17 cultures of dorsal root ganglia (DRG), cerebellum, and enteric plexi. Allowing the endogenous glial cells to repopulate the cultures saves time compared with existing techniques, in which glial cells are added...... to cultures first treated with antimitotic agents. It also ensures that all the cells present in vivo will be present in the culture. Myelination commences after approximately 2 weeks in culture for dissociated DRG and 3-4 weeks in cerebellar cultures. In enteric cultures, glial wrapping of the enteric...

  5. Development of Scalable Culture Systems for Human Embryonic Stem Cells

    OpenAIRE

    Azarin, Samira M.; Palecek, Sean P.

    2010-01-01

    The use of human pluripotent stem cells, including embryonic and induced pluripotent stem cells, in therapeutic applications will require the development of robust, scalable culture technologies for undifferentiated cells. Advances made in large-scale cultures of other mammalian cells will facilitate expansion of undifferentiated human embryonic stem cells (hESCs), but challenges specific to hESCs will also have to be addressed, including development of defined, humanized culture media and su...

  6. PHYTOCHEMICAL STUDY OF CELL CULTURE JATROPHA CURCAS

    Directory of Open Access Journals (Sweden)

    KOMAR RUSLAN

    2011-01-01

    Full Text Available Jatropha curcas belongs to the Euphorbiaceae family which has potential economically. This plant has been reported to contain toxic compounds such as curcin and phorbol ester and its derivatives. These compounds may become a problem if J. curcas will be explored as a source of biofuel. In order to provide safety plants, the research on the study of phytochemical and initiation of cell and organ culture have been carried out. J curcas which has been collected from different regions in Indonesia showed to contain relatively the same profile of chemical contents. Dominant compounds that were detected by GCMS are hidrocarbon such as 2-heptenal, decadienal, hexsadecane, pentadecane, cyclooctane etc, fatty acid such as oktadecanoate acid, etthyl linoleate, ethyl stearate, heksadecanoate acid and steroid such as stigmasterol, fucosterol, sitosterol. No phorbol ester and its derivatives have been detected yet by the GCMS method. Callus and suspension cultures of J. curcas have been established to be used for further investigation.

  7. How do culture media influence in vitro perivascular cell behavior?

    Science.gov (United States)

    Huber, Birgit; Volz, Ann-Cathrin; Kluger, Petra Juliane

    2015-12-01

    Perivascular cells are multilineage cells located around the vessel wall and important for wall stabilization. In this study, we evaluated a stem cell media and a perivascular cell-specific media for the culture of primary perivascular cells regarding their cell morphology, doubling time, stem cell properties, and expression of cell type-specific markers. When the two cell culture media were compared to each other, perivascular cells cultured in the stem cell medium had a more elongated morphology and a faster doubling rate and cells cultured in the pericyte medium had a more typical morphology, with several filopodia, and a slower doubling rate. To evaluate stem cell properties, perivascular cells, CD146(-) cells, and mesenchymal stem cells (MSCs) were differentiated into the adipogenic, osteogenic, and chondrogenic lineages. It was seen that perivascular cells, as well as CD146(-) cells and MSCs, cultured in stem cell medium showed greater differentiation than cells cultured in pericyte-specific medium. The expression of pericyte-specific markers CD146, neural/glial antigen 2 (NG2), platelet-derived growth factor receptor-β (PDGFR-β), myosin, and α-smooth muscle actin (α-SMA) could be found in both pericyte cultures, as well as to varying amounts in CD146(-) cells, MSCs, and endothelial cells. The here presented work shows that perivascular cells can adapt to their in vitro environment and cell culture conditions influence cell functionality, such as doubling rate or differentiation behavior. Pericyte-specific markers were shown to be expressed also from cells other than perivascular cells. We can further conclude that CD146(+) perivascular cells are inhomogeneous cell population probably containing stem cell subpopulations, which are located perivascular around capillaries.

  8. Secretome of Peripheral Blood Mononuclear Cells Enhances Wound Healing

    OpenAIRE

    Mildner, Michael; Hacker, Stefan; Haider, Thomas; Gschwandtner, Maria; Werba, Gregor; Barresi, Caterina; Zimmermann, Matthias; Golabi, Bahar; Tschachler, Erwin; Ankersmit, Hendrik Jan

    2013-01-01

    Non-healing skin ulcers are often resistant to most common therapies. Treatment with growth factors has been demonstrated to improve closure of chronic wounds. Here we investigate whether lyophilized culture supernatant of freshly isolated peripheral blood mononuclear cells (PBMC) is able to enhance wound healing. PBMC from healthy human individuals were prepared and cultured for 24 hours. Supernatants were collected, dialyzed and lyophilized (SECPBMC). Six mm punch biopsy wounds were set on ...

  9. DNA MUTAGENESIS IN PANAX GINSENG CELL CULTURES

    Directory of Open Access Journals (Sweden)

    Kiselev K.V.

    2012-08-01

    Full Text Available At the present time, it is well documented that plant tissue culture induces a number of mutations and chromosome rearrangements termed “somaclonal variations”. However, little is known about the nature and the molecular mechanisms of the tissue culture-induced mutagenesis and the effects of long-term subculturing on the rate and specific features of the mutagenesis. The aim of the present study was to investigate and compare DNA mutagenesis in different genes of Panax ginseng callus cultures of different age. It has previously been shown that the nucleotide sequences of the Agrobacterium rhizogenes rolC locus and the selective marker nptII developed mutations during long-term cultivation of transgenic cell cultures of P. ginseng. In the present work, we analyzed nucleotide sequences of selected plant gene families in a 2-year-old and 20-year-old P. ginseng 1c cell culture and in leaves of cultivated P. ginseng plants. We analysed sequence variability between the Actin genes, which are a family of house-keeping genes; the phenylalanine ammonia-lyase (PAL and dammarenediol synthase (DDS genes, which actively participate in the biosynthesis of ginsenosides; and the somatic embryogenesis receptor kinase (SERK genes, which control plant development. The frequency of point mutations in the Actin, PAL, DDS, and SERK genes in the 2-year-old callus culture was markedly higher than that in cultivated plants but lower than that in the 20-year-old callus culture of P. ginseng. Most of the mutations in the 2- and 20-year-old P. ginseng calli were A↔G and T↔C transitions. The number of nonsynonymous mutations was higher in the 2- and 20-year-old callus cultures than the number of nonsynonymous mutations in the cultivated plants of P. ginseng. Interestingly, the total number of N→G or N→C substitutions in the analyzed genes was 1.6 times higher than the total number of N→A or N→T substitutions. Using methylation-sensitive DNA fragmentation

  10. Cardiac Cells Beating in Culture: A Laboratory Exercise

    Science.gov (United States)

    Weaver, Debora

    2007-01-01

    This article describes how to establish a primary tissue culture, where cells are taken directly from an organ of a living animal. Cardiac cells are taken from chick embryos and transferred to culture dishes. These cells are not transformed and therefore have a limited life span. However, the unique characteristics of cardiac cells are maintained…

  11. Growth of cultured porcine retinal pigment epithelial cells

    DEFF Research Database (Denmark)

    Wiencke, A.K.; Kiilgaard, Jens Folke; Nicolini, Jair;

    2003-01-01

    To establish and characterize cultures of porcine retinal pigment epithelial (pRPE) cells in order to produce confluent monolayers of cells for transplantation.......To establish and characterize cultures of porcine retinal pigment epithelial (pRPE) cells in order to produce confluent monolayers of cells for transplantation....

  12. Development of primary cell culture from Scylla serrata: Primary cell cultures from Scylla serrata

    OpenAIRE

    Sashikumar, Anu; Desai, P. V.

    2008-01-01

    This paper reports for the first time, the Primary cell culture of hepatopancreas from edible crab Scylla serrata using crab saline, L-15 (Leibovitz), 1 × L-15 + crab saline, 2 × L-15 + crab saline, 3 × L-15 and citrate buffer without any serum. We could isolate and maintain E (Embryonalzellen), F (Fibrenzellen), B (Blasenzellen), R (Restzellen) and G (Granular cells). Upon seeding the hepatopancreatic E, F, B, and R cells showed different survival pattern over time than granular cells. A mod...

  13. TR146 cells grown on filters as a model of human buccal epithelium

    DEFF Research Database (Denmark)

    Mørck Nielsen, H; Rømer Rassing, M; Nielsen, Hanne Mørck

    2000-01-01

    The objective of the present study was to characterise the TR146 cell culture model as an in vitro model of human buccal mucosa with respect to the enzyme activity in the tissues. For this purpose, the contents of aminopeptidase, carboxypeptidase and esterase in homogenate supernatants of the TR146...... of the three enzymes in the TR146 homogenate supernatants was in the same range as the activity in homogenate supernatants of human buccal epithelium. In the TR146 cell culture model, the activity of aminopeptidase (13.70+/-2.10 nmol/min per mg protein) was approx. four times the activity of carboxypeptidase...

  14. Metabolic flux rewiring in mammalian cell cultures.

    Science.gov (United States)

    Young, Jamey D

    2013-12-01

    Continuous cell lines (CCLs) engage in 'wasteful' glucose and glutamine metabolism that leads to accumulation of inhibitory byproducts, primarily lactate and ammonium. Advances in techniques for mapping intracellular carbon fluxes and profiling global changes in enzyme expression have led to a deeper understanding of the molecular drivers underlying these metabolic alterations. However, recent studies have revealed that CCLs are not necessarily entrenched in a glycolytic or glutaminolytic phenotype, but instead can shift their metabolism toward increased oxidative metabolism as nutrients become depleted and/or growth rate slows. Progress to understand dynamic flux regulation in CCLs has enabled the development of novel strategies to force cultures into desirable metabolic phenotypes, by combining fed-batch feeding strategies with direct metabolic engineering of host cells. PMID:23726154

  15. Phosphatidylinositol species of suspension cultured plant cells

    Energy Technology Data Exchange (ETDEWEB)

    Heim, S.; Wagner, K.G.

    Suspension cultured Nicotiana tabacum and Catharanthus roseus cells were labeled with (/sup 3/H)inositol, the phospholipid fraction extracted and separated by thin layer chromatography. Three different solvent systems and reference compounds were used to assign the different /sup 3/H-labeled species by autoradiography. The ratio of (/sup 3/H)inositol incorporation into PI, PIP and PIP/sub 2/ was found to be 95:4:1; with some preparations a lyso-PI band was obtained which incorporated about a tenth of the label of the PIP band. With Catharanthus roseus cells a very faint band between PI and lyso-PI was detected which could not be assigned to a reference compound.

  16. Secretion of nerve growth factor, brain-derived neurotrophic factor, and glial cell-line derived neurotrophic factor in co-culture of four cell types in cerebrospinal fluid-containing medium

    Institute of Scientific and Technical Information of China (English)

    Sanjiang Feng; Minghua Zhuang; Rui Wu

    2012-01-01

    The present study co-cultured human embryonic olfactory ensheathing cells, human Schwann cells, human amniotic epithelial cells and human vascular endothelial cells in complete culture medium- containing cerebrospinal fluid. Enzyme linked immunosorbent assay was used to detect nerve growth factor, brain-derived neurotrophic factor, and glial cell line-derived neurotrophic factor secretion in the supernatant of co-cultured cells. Results showed that the number of all cell types reached a peak at 7–10 days, and the expression of nerve growth factor, brain-derived neurotrophic factor, and glial cell line-derived neurotrophic factor peaked at 9 days. Levels of secreted nerve growth factor were four-fold higher than brain-derived neurotrophic factor, which was three-fold higher than glial cell line-derived neurotrophic factor. Increasing concentrations of cerebrospinal fluid (10%, 20% and 30%) in the growth medium caused a decrease of neurotrophic factor secretion. Results indicated co-culture of human embryonic olfactory ensheathing cells, human Schwann cells, human amniotic epithelial cells and human vascular endothelial cells improved the expression of nerve growth factor, brain-derived neurotrophic factor, and glial cell line-derived neurotrophic factor. The reduction of cerebrospinal fluid extravasation at the transplant site after spinal cord injury is beneficial for the survival and secretion of neurotrophic factors from transplanted cells.

  17. Recombinant Protein Production and Insect Cell Culture and Process

    Science.gov (United States)

    Spaulding, Glenn F. (Inventor); Goodwin, Thomas J. (Inventor); OConnor, Kim C. (Inventor); Francis, Karen M. (Inventor); Andrews, Angela D. (Inventor); Prewett, Tracey L. (Inventor)

    1997-01-01

    A process has been developed for recombinant production of selected polypeptides using transformed insect cells cultured in a horizontally rotating culture vessel modulated to create low shear conditions. A metabolically transformed insect cell line is produced using the culture procedure regardless of genetic transformation. The recombinant polypeptide can be produced by an alternative process using virtually infected or stably transformed insect cells containing a gene encoding the described polypeptide. The insect cells can also be a host for viral production.

  18. Protection of cultured mammalian cells by rebamipide

    Energy Technology Data Exchange (ETDEWEB)

    Antoku, Shigetoshi; Aramaki, Ryoji [Kyushu Univ., Fukuoka (Japan). Faculty of Medicine; Tanaka, Hisashi; Kusumoto, Naotoshi

    1997-06-01

    Rebamipide which is used as a drug for gastritis and stomach ulcer has large capability for OH radical scavenging. It is expected that rebamipide has protective effect against ionizing radiations. The present paper deals with protective effect of rebamipide for cultured mammalian cells exposed to ionizing radiations. As rebamipide is insoluble in water, three solvents were used to dissolve. Rebamipide dissolved in dimethyl sulfoxide (DMSO), dimethyl formamide (DMFA) and 0.02 N NaOH was added to the cells in Eagle`s minimum essential medium (MEM) supplemented with 10% fetal calf serum and the cells were irradiated with X-rays. After irradiation, the cells were trypsinized, plated in MEM with 10% fetal calf serum and incubated for 7 days in a CO{sub 2} incubator to form colonies. Rebamipide dissolved in 0.02 N NaOH exhibited the protective effect expected its OH radical scavenging capability. However, the protective effect of rebamipide dissolved in DMSO was about half of that expected by its radical scavenging capability and that of rebamipide dissolved in DMFA was not observed. Uptake of rebamipide labeled with {sup 14}C increased with increasing contact time with rebamipide. These rebamipide mainly distributed in nucleus rather than cytoplasm. (author)

  19. Three-dimensional cell culturing by magnetic levitation.

    Science.gov (United States)

    Haisler, William L; Timm, David M; Gage, Jacob A; Tseng, Hubert; Killian, T C; Souza, Glauco R

    2013-10-01

    Recently, biomedical research has moved toward cell culture in three dimensions to better recapitulate native cellular environments. This protocol describes one method for 3D culture, the magnetic levitation method (MLM), in which cells bind with a magnetic nanoparticle assembly overnight to render them magnetic. When resuspended in medium, an external magnetic field levitates and concentrates cells at the air-liquid interface, where they aggregate to form larger 3D cultures. The resulting cultures are dense, can synthesize extracellular matrix (ECM) and can be analyzed similarly to the other culture systems using techniques such as immunohistochemical analysis (IHC), western blotting and other biochemical assays. This protocol details the MLM and other associated techniques (cell culture, imaging and IHC) adapted for the MLM. The MLM requires 45 min of working time over 2 d to create 3D cultures that can be cultured in the long term (>7 d). PMID:24030442

  20. Three-Dimensional Cell Culture: A Breakthrough in Vivo

    Directory of Open Access Journals (Sweden)

    Delphine Antoni

    2015-03-01

    Full Text Available Cell culture is an important tool for biological research. Two-dimensional cell culture has been used for some time now, but growing cells in flat layers on plastic surfaces does not accurately model the in vivo state. As compared to the two-dimensional case, the three-dimensional (3D cell culture allows biological cells to grow or interact with their surroundings in all three dimensions thanks to an artificial environment. Cells grown in a 3D model have proven to be more physiologically relevant and showed improvements in several studies of biological mechanisms like: cell number monitoring, viability, morphology, proliferation, differentiation, response to stimuli, migration and invasion of tumor cells into surrounding tissues, angiogenesis stimulation and immune system evasion, drug metabolism, gene expression and protein synthesis, general cell function and in vivo relevance. 3D culture models succeed thanks to technological advances, including materials science, cell biology and bioreactor design.

  1. Electrospinning of microbial polyester for cell culture

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Oh Hyeong [Department of Polymer Science and Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Lee, Ik Sang [Department of Polymer Science and Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Ko, Young-Gwang [Department of Polymer Science and Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Meng, Wan [Department of Polymer Science, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Jung, Kyung-Hye [Department of Polymer Science, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Kang, Inn-Kyu [Department of Polymer Science, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Ito, Yoshihiro [Kanagawa Academy of Science and Technology, KSP East 309, Sakado 3-2-1, Takatsu-ku, Kawasaki 213-0012 (Japan)

    2007-03-01

    Biodegradable and biocompatible poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), a copolymer of microbial polyester, was fabricated as a nanofibrous mat by electrospinning. The specific surface area and the porosity of electrospun PHBV nanofibrous mat were determined. When the mechanical properties of flat film and electrospun PHBV nanofibrous mats were investigated, both the tensile modulus and strength of electrospun PHBV were less than those of cast PHBV film. However, the elongation ratio of nanofiber mat was higher than that of the cast film. The structure of electrospun nanofibers using PHBV-trifluoroethanol solutions depended on the solution concentrations. When x-ray diffraction patterns of bulk PHBV before and after electrospinning were compared, the crystallinity of PHBV was not significantly affected by the electrospinning process. Chondrocytes adhered and grew on the electrospun PHBV nanofibrous mat better than on the cast PHBV film. Therefore, the electrospun PHBV was considered to be suitable for cell culture.

  2. Organ culture-cell culture system for studying multistage carcinogenesis in respiratory epithelium. [Mice

    Energy Technology Data Exchange (ETDEWEB)

    Steele, Vernon E.; Marchok, Ann C.; Nettesheim, Paul

    1977-01-01

    An organ culture-cell culture system was used to demonstrate carcinogen dose-dependent transformation of tracheal epithelial cells in vitro. Tracheal explants were exposed to MNNG (N-methyl-N/sup 1/-nitro-N-nitrosoguanidine) in organ culture. Outgrowths from these explants provided epithelial cell cultures. The numbers of long term epithelial cell cultures and cell lines that were established per explant increased as MNNG exposure concentration increased. At the present time, more cell lines derived from explants exposed to the highest MNNG concentration have produced palpable tumors than cell lines derived from explants exposed to lower MNNG concentrations. No cell lines were established from primaries derived from control explants. TPA (12-0-tetradecanoyl-phorbol-13-acetate), stimulates DNA synthesis in tracheal epithelium in organ culture in a manner simular to that described for mouse skin. Short exposures to TPA not only stimulated DNA synthesis earlier, but the stimulation was greater than that obtained with continuous exposure. At the present time, exposure of tracheal organ cultures to MNNG followed by TPA has resulted in an enhanced production of morphologically altered cells in primary epithelial cell cultures, than exposure to either agent alone.

  3. HAIR CELL-LIKE CELL GENERATION INDUCED BY NATURE CULTURE OF ADULT RAT AUDITORY EPITHELIUM

    Institute of Scientific and Technical Information of China (English)

    Liu Hui; Zhu Hongliang; Li Shengli; Yao Xiaobao; Wang Xiaoxia

    2006-01-01

    Objective To establish adult rat auditory epithelial cell culture and try to find precursor cells of auditory hair cells in vitro. Methods With refinement of culture media and techniques, cochlear sensory epithelial cells of adult rat were cultured. Immunocytochemistry and Bromodeoxyuridine (BrdU)labeling were used to detect properties and mitotic status of cultured cells. Results The cultured auditory epithelial cells showed a large, flat epithelial morphotype and expressed F-actin and cytokeratin, a subset of cells generated from auditory epithelium were labeled by calretinin, a specific marker of early hair cell. Conclusion Adult rat auditory epithelium can be induced to generate hair cell-like cells by nature culture, this phenomenon suggests that progenitor cells may exist in rat cochlea and they may give birth to new hair cells. Whether these progenitor cells are tissue specific stem cells is still need more study.

  4. Particle Trajectories in Rotating Wall Cell Culture Devices

    Science.gov (United States)

    Ramachandran N.; Downey, J. P.

    1999-01-01

    Cell cultures are extremely important to the medical community since such cultures provide an opportunity to perform research on human tissue without the concerns inherent in experiments on individual humans. Development of cells in cultures has been found to be greatly influenced by the conditions of the culture. Much work has focused on the effect of the motions of cells in the culture relative to the solution. Recently rotating wall vessels have been used with success in achieving improved cellular cultures. Speculation and limited research have focused on the low shear environment and the ability of rotating vessels to keep cells suspended in solution rather than floating or sedimenting as the primary reasons for the improved cellular cultures using these devices. It is widely believed that the cultures obtained using a rotating wall vessel simulates to some degree the effect of microgravity on cultures. It has also been speculated that the microgravity environment may provide the ideal acceleration environment for culturing of cellular tissues due to the nearly negligible levels of sedimentation and shear possible. This work predicts particle trajectories of cells in rotating wall vessels of cylindrical and annular design consistent with the estimated properties of typical cellular cultures. Estimates of the shear encountered by cells in solution and the interactions with walls are studied. Comparisons of potential experiments in ground and microgravity environments are performed.

  5. Usability and Applicability of Microfluidic Cell Culture Systems

    DEFF Research Database (Denmark)

    Hemmingsen, Mette

    , these devices still lack general implementation into biological research laboratories. In this project, the usability and applicability of microfluidic cell culture systems have been investigated. The tested systems display good properties regarding optics and compatibility with standard laboratory equipment......Microfluidic cell culture has been a research area with great attention the last decade due to its potential to mimic the in vivo cellular environment more closely compared to what is possible by conventional cell culture methods. Many exciting and complex devices have been presented providing...... possibilities for, for example, precise control of the chemical environment, 3D cultures, controlled co-culture of different cell types or automated, individual control of up to 96 cell culture chambers in one integrated system. Despite the great new opportunities to perform novel experimental designs...

  6. Sildenafil Effect on Nitric Oxide Secretion by Normal Human Endometrial Epithelial Cells Cultured In vitro

    Directory of Open Access Journals (Sweden)

    Farzaneh Chobsaz

    2011-01-01

    Full Text Available Background: Sildenafil is a selective inhibitor of cyclic-guanosine monphosphat-specificphosphodiesterase type 5. It increases intracellular nitric oxide (NO production in some cells.There are reports on its positive effect on uterine circulation, endometrial thickness, and infertilityimprovement. Endometrial epithelial cells (EEC play an important role in embryo attachment andimplantation. The present work investigates the effect of sildenafil on human EEC and their NOsecretion in vitro.Materials and Methods: In this experimental in vitro study, endometrial biopsies (n=10 werewashed in a phosphate buffered solution (PBS and digested with collagenase I (2 mg/ml in DMEM/F12 medium at 37°C for 90 minutes. Epithelial glands were collected by sequential filtrationthrough nylon meshes (70 and 40 μm pores, respectively. Epithelial glands were then treated withtrypsin to obtain individual cells. The cells were counted and divided into four groups: control and1, 10, and 20 μM sildenafil concentrations. Cells were cultured for 15 days at 37ºC and 5% CO2; themedia were changed every 3 days, and their supernatants were collected for the NO assay. NO wasmeasured by standard Greiss methods. Data were analyzed by one way ANOVA.Results: There was no significant difference between groups in cell count and NO secretion, but thelevel of NO increased slightly in the experimental groups. The 10 μM dose showed the highest cellcount. EEC morphology changed into long spindle cells in the case groups.Conclusion: Sildenafil (1, 10, and 20 μM showed a mild proliferative effect on human EECnumbers, but no significant change was seen in NO production.

  7. THE ALKALOID CYTISINE IN THE CELL CULTURE

    Directory of Open Access Journals (Sweden)

    Gazaliev A.M.

    2012-08-01

    Full Text Available Alkaloids are vegetative establishments of complex and original structure with nitrous heterocycles in the basis. For a long time they drew researchers’ attention because of their unique and specific physiological effect on alive organisms. Not all the representatives of the globe’s flora contain these unique substances. Alkaloid cytisine is to be found mainly in the plants of the fabaceous family - Fabaceae. For the cytisine production the seeds of Thermopsis lanceolata R.Br (T. lanceolata R.Br and Cytisus laburnum (C. laburnum are used as a raw material. The object of the research is T. lanceolata cell culture. Sterile sprouts are used at the first stage of the experiment. Callus genesis is accompanied with dedifferentiation. It leads to the cellular organization simplification. Based on an important property of a plant cell, such as totipotency, there appears the formation of the “de novo” biosynthetic device. The cultivation algorithm consists of two basic stages: (i the cultivation conditions optimization of callus with a high level of the primary metabolites biosynthesis (Aspartat – lysine; (ii the research of cultivation chemical and physical factors influence on the secondary metabolite (cytisine biosynthesis and accumulation. During the cultivation the Murashige and Skoog classical recipe of nutrient medium will be used. Optimization of the cultivation conditions will concern the phytohormones, macro- and micronutrients content, as the purpose of optimization is the production of the determined high-level competence embriogenical callus. The main problem is genetic heterogeneity of a cellular population and instability of morpho-physiological processes. The correct management of higher plants cells population is possible at the synchronization of a cellular cycle phases. The references analysis has shown that it is almost impossible to synchronize cellular cycles in the culture of plant tissue. The application of chemical

  8. Isolation and culture of larval cells from C. elegans.

    Directory of Open Access Journals (Sweden)

    Sihui Zhang

    Full Text Available Cell culture is an essential tool to study cell function. In C. elegans the ability to isolate and culture cells has been limited to embryonically derived cells. However, cells or blastomeres isolated from mixed stage embryos terminally differentiate within 24 hours of culture, thus precluding post-embryonic stage cell culture. We have developed an efficient and technically simple method for large-scale isolation and primary culture of larval-stage cells. We have optimized the treatment to maximize cell number and minimize cell death for each of the four larval stages. We obtained up to 7.8×10(4 cells per microliter of packed larvae, and up to 97% of adherent cells isolated by this method were viable for at least 16 hours. Cultured larval cells showed stage-specific increases in both cell size and multinuclearity and expressed lineage- and cell type-specific reporters. The majority (81% of larval cells isolated by our method were muscle cells that exhibited stage-specific phenotypes. L1 muscle cells developed 1 to 2 wide cytoplasmic processes, while L4 muscle cells developed 4 to 14 processes of various thicknesses. L4 muscle cells developed bands of myosin heavy chain A thick filaments at the cell center and spontaneously contracted ex vivo. Neurons constituted less than 10% of the isolated cells and the majority of neurons developed one or more long, microtubule-rich protrusions that terminated in actin-rich growth cones. In addition to cells such as muscle and neuron that are high abundance in vivo, we were also able to isolate M-lineage cells that constitute less than 0.2% of cells in vivo. Our novel method of cell isolation extends C. elegans cell culture to larval developmental stages, and allows use of the wealth of cell culture tools, such as cell sorting, electrophysiology, co-culture, and high-resolution imaging of subcellular dynamics, in investigation of post-embryonic development and physiology.

  9. Using Tissue Culture To Investigate Plant Cell Differentiation and Dedifferentiation.

    Science.gov (United States)

    Bozzone, Donna M.

    1997-01-01

    Describes an experimental project that uses plant tissue culture techniques to examine cell differentiation in the carrot. Allows students to gain experience in some important techniques and to explore fundamental questions about cell differentiation. (DDR)

  10. Systems Biology for Organotypic Cell Cultures

    Energy Technology Data Exchange (ETDEWEB)

    Grego, Sonia [RTI International, Research Triangle Park, NC (United States); Dougherty, Edward R. [Texas A & M Univ., College Station, TX (United States); Alexander, Francis J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Auerbach, Scott S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Berridge, Brian R. [GlaxoSmithKline, Research Triangle Park, NC (United States); Bittner, Michael L. [Translational Genomics Research Inst., Phoenix, AZ (United States); Casey, Warren [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Cooley, Philip C. [RTI International, Research Triangle Park, NC (United States); Dash, Ajit [HemoShear Therapeutics, Charlottesville, VA (United States); Ferguson, Stephen S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Fennell, Timothy R. [RTI International, Research Triangle Park, NC (United States); Hawkins, Brian T. [RTI International, Research Triangle Park, NC (United States); Hickey, Anthony J. [RTI International, Research Triangle Park, NC (United States); Kleensang, Andre [Johns Hopkins Univ., Baltimore, MD (United States). Center for Alternatives to Animal Testing; Liebman, Michael N. [IPQ Analytics, Kennett Square, PA (United States); Martin, Florian [Phillip Morris International, Neuchatel (Switzerland); Maull, Elizabeth A. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Paragas, Jason [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Qiao, Guilin [Defense Threat Reduction Agency, Ft. Belvoir, VA (United States); Ramaiahgari, Sreenivasa [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Sumner, Susan J. [RTI International, Research Triangle Park, NC (United States); Yoon, Miyoung [The Hamner Inst. for Health Sciences, Research Triangle Park, NC (United States); ScitoVation, Research Triangle Park, NC (United States)

    2016-08-04

    Translating in vitro biological data into actionable information related to human health holds the potential to improve disease treatment and risk assessment of chemical exposures. While genomics has identified regulatory pathways at the cellular level, translation to the organism level requires a multiscale approach accounting for intra-cellular regulation, inter-cellular interaction, and tissue/organ-level effects. Tissue-level effects can now be probed in vitro thanks to recently developed systems of three-dimensional (3D), multicellular, “organotypic” cell cultures, which mimic functional responses of living tissue. However, there remains a knowledge gap regarding interactions across different biological scales, complicating accurate prediction of health outcomes from molecular/genomic data and tissue responses. Systems biology aims at mathematical modeling of complex, non-linear biological systems. We propose to apply a systems biology approach to achieve a computational representation of tissue-level physiological responses by integrating empirical data derived from organotypic culture systems with computational models of intracellular pathways to better predict human responses. Successful implementation of this integrated approach will provide a powerful tool for faster, more accurate and cost-effective screening of potential toxicants and therapeutics. On September 11, 2015, an interdisciplinary group of scientists, engineers, and clinicians gathered for a workshop in Research Triangle Park, North Carolina, to discuss this ambitious goal. Participants represented laboratory-based and computational modeling approaches to pharmacology and toxicology, as well as the pharmaceutical industry, government, non-profits, and academia. Discussions focused on identifying critical system perturbations to model, the computational tools required, and the experimental approaches best suited to generating key data. This consensus report summarizes the discussions held.

  11. Induced engulfment of Neisseria gonorrhoeae by tissue culture cells.

    OpenAIRE

    Richardson, W P; Sadoff, J C

    1988-01-01

    Engulfment of gonococci by mammalian tissue culture cells was examined as a model of the penetration of host cells in gonorrhea. Engulfment required viable organisms; killing the gonococci with heat or refrigeration abolished the process. Engulfment also required tissue culture cell microtubule- and microfilament-dependent movement; treating the cells with cytochalasin B (0.5 micrograms/ml) or demecolcine (Colcemid; Ciba-Geigy AG, Basel, Switzerland) (10 micrograms/ml) also prevented his proc...

  12. Acetylsalicylic acid induces programmed cell death in Arabidopsis cell cultures.

    Science.gov (United States)

    García-Heredia, José M; Hervás, Manuel; De la Rosa, Miguel A; Navarro, José A

    2008-06-01

    Acetylsalicylic acid (ASA), a derivative from the plant hormone salicylic acid (SA), is a commonly used drug that has a dual role in animal organisms as an anti-inflammatory and anticancer agent. It acts as an inhibitor of cyclooxygenases (COXs), which catalyze prostaglandins production. It is known that ASA serves as an apoptotic agent on cancer cells through the inhibition of the COX-2 enzyme. Here, we provide evidences that ASA also behaves as an agent inducing programmed cell death (PCD) in cell cultures of the model plant Arabidopsis thaliana, in a similar way than the well-established PCD-inducing agent H(2)O(2), although the induction of PCD by ASA requires much lower inducer concentrations. Moreover, ASA is herein shown to be a more efficient PCD-inducing agent than salicylic acid. ASA treatment of Arabidopsis cells induces typical PCD-linked morphological and biochemical changes, namely cell shrinkage, nuclear DNA degradation, loss of mitochondrial membrane potential, cytochrome c release from mitochondria and induction of caspase-like activity. However, the ASA effect can be partially reverted by jasmonic acid. Taking together, these results reveal the existence of common features in ASA-induced animal apoptosis and plant PCD, and also suggest that there are similarities between the pathways of synthesis and function of prostanoid-like lipid mediators in animal and plant organisms.

  13. Pancreatic stellate cells promote proliferation and invasiveness of human pancreatic cancer cells via galectin-3

    Institute of Scientific and Technical Information of China (English)

    Hai-Biao Jiang; Ming Xu; Xing-Peng Wang

    2008-01-01

    AIM: To investigate the role of pancreatic stellate cells (PSCs) and galectin-3 (GAL-3) in the proliferation and infiltration of pancreatic cancer cell line SW1990.METHODS: Human pancreatic cancer cell line SW1990 and PSCs were cultured in vitro. Supernatant fluid of cultured PSCs and SW1990 cells was collected. Expression of GAL-3 in SW1990 cells and PSCs was detected by ELISA, RT-PCR and Western blotting. Proliferation of cultured PSCs and SW1990 cells was measured by 3-(4, 5-methylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay and flow cytometry. Infiltration of SW1990 cells was detected by a cell infiltration kit.RESULTS: SW1990 cells expressed GAL-3 and this was up-regulated by the supernatant fluid of cultured PSCs. PSCs did not express GAL-3. SW1990 cells stimulated proliferation of PSCs via GAL-3. GAL-3 antibody inhibited SW1990 cell proliferation, while the supernatant fluid of PSCs stimulated proliferation of SW1990 cells through interaction with GAL-3 protein. The supernatant fluid of PSCs enhanced the invasiveness of SW1990 cells through interaction with GAL-3.CONCLUSION: GAL-3 and PSCs were involved in the proliferation and infiltration process of pancreatic cancer cells.

  14. Comparison of defined culture systems for feeder cell free propagation of human embryonic stem cells

    OpenAIRE

    Akopian, Veronika; Andrews, Peter W.; Beil, Stephen; Benvenisty, Nissim; Brehm, Jennifer; Christie, Megan; Ford, Angela; Fox, Victoria; Gokhale, Paul J; Healy, Lyn; Holm, Frida; Hovatta, Outi; Knowles, Barbara B; Ludwig, Tenneille E; Ronald D G McKay

    2010-01-01

    There are many reports of defined culture systems for the propagation of human embryonic stem cells in the absence of feeder cell support, but no previous study has undertaken a multi-laboratory comparison of these diverse methodologies. In this study, five separate laboratories, each with experience in human embryonic stem cell culture, used a panel of ten embryonic stem cell lines (including WA09 as an index cell line common to all laboratories) to assess eight cell culture methods, with pr...

  15. Lactobacillus plantarum LB95 impairs the virulence potential of Gram-positive and Gram-negative food-borne pathogens in HT-29 and Vero cell cultures.

    Science.gov (United States)

    Dutra, Virna; Silva, Ana Carla; Cabrita, Paula; Peres, Cidália; Malcata, Xavier; Brito, Luisa

    2016-01-01

    Listeria monocytogenes, Salmonella enterica and verocytotoxigenic Escherichia coli (VTEC) are amongst the most important agents responsible for food outbreaks occurring worldwide. In this work, two Lactobacillus spp. strains (LABs), Lactobacillus plantarum (LB95) and Lactobacillus paraplantarum (LB13), previously isolated from spontaneously fermenting olive brines, and two reference probiotic strains, Lactobacillus casei Shirota and Lactobacillus rhamnosus GG, were investigated for their ability to attenuate the virulence of the aforementioned pathogens using animal cell culture assays. In competitive exclusion assays, the relative percentages of adhesion and invasion of S. enterica subsp. enterica serovar Enteritidis were significantly reduced when the human HT-29 cell line was previously exposed to LB95. The relative percentage of invasion by Listeria monocytogenes was significantly reduced when HT-29 cells were previously exposed to LB95. In the cytotoxicity assays, the cell-free supernatant of the co-culture (CFSC)of VTEC with LB95 accounted for the lowest value obtained amongst the co-cultures of VTEC with LABs, and was significantly lower than the value obtained with the co-culture of VTEC with the two probiotic reference strains. The cytotoxicity of CFSC of VTEC with both LB95 and LB13 exhibited values not significantly different from the cell-free supernatant of the nonpathogenic E. coli B strain. Our results suggested that LB95 may be able to attenuate the virulence of Gram-positive and Gram-negative food-borne pathogens; together with other reported features of these strains, our data reveal their possible use in probiotic foods due to their interesting potential in preventing enteric infections in humans.

  16. PECULIARITIES OF SECONDARY METABOLITES BIOSYNTHESIS IN PLANT CELL CULTURES

    Directory of Open Access Journals (Sweden)

    A.M. NOSOV

    2014-06-01

    Full Text Available metabolites formation in plant cell cultures of Panax spp., (ginsenosides; Dioscorea deltoidea (steroid glycosides; Ajuga reptans, Serratula coronata, Rhaponticum carthamoides (ecdisteroids; Polyscias spp., (triterpene glycosides, Taxus spp. (taxoids, Stevia rebaudiana (diterpene steviol-glycosides, Stephania glabra (alkaloids. They are some regular trends of secondary metabolites synthesis in the plant cell culture:It can be noted the stable synthesis of the compound promoting cell proliferation. Indeed, cell cultures of Dioscorea deltoidea were demonstrated to accumulate only furostanol glycosides, which promoted cell division. Furostanol glycoside content of Dioscorea strain DM-0.5 was up to 6 - 12% by dry biomass.Panax ginseng and P. japonicus plant cell cultures synthesize as minimum seven triterpene glycosides (ginsenosides, the productivity of these compounds was up to 6.0 - 8.0% on dry biomass.By contrast, the detectable synthesis of diterpene steviol-glycosides in cultivated cells of Stevia rebaudiana initiated in the mixotrophic cultures during chloroplast formation only.Despite these differences, or mainly due to them, plant cell cultures have become an attractive source of phytochemicals in alternative to collecting wild plants. It provides a guideline to bioreactor-based production of isoprenoids using undifferentiated plant cell cultures

  17. Biologic characteristics of fibroblast cells cultured from the knee ligaments

    Institute of Scientific and Technical Information of China (English)

    陈鸿辉; 唐毅; 李斯明; 沈雁; 刘向荣; 钟灿灿

    2002-01-01

    Objective: To culture fibroblast cells from the kneeligaments and to study the biological characteristics of thesecells.Methods: Cells of the anterior cruciate ligament(ACL) and the medial collateral ligament (MCL) fromNew Zealand white rabbit were cultured in vitro. Cellulargrowth and expression of the collagen were analyzed.Moreover, an in vitro wound closure model was establishedand the healing of the ACL and the MCL cells wascompared.Results: Maximal growth for all these cells wereobtained with Dulbecco's modified Eagle's mediumsupplemented with 10% fetal bovine serum, but RPMI 1640and Ham's F12 media were not suitable to maintain thesecells. Morphology of both ACL and MCL cells from NewZealand white rabbit was alike in vitro, but the MCL cellsgrew faster than the ACL cells. Both cell types producedsimilar amount of collagen in culture, but the ratio ofcollage type I to type III produced by ACL cells was higherthan that produced by MCL cells. Wound closure assayshowed that at 36 hours after injury, cell-free zones createdin the ACL cultures were occupied partially by the ACLcells; in contrast, the wounded zone in the MCL cultureswas almost completely covered by the cells.Conclusions: Although the ACL cells and the MCLcells from New Zealand white rabbit show similarappearance in morphology in culture, the cellular growthand the biochemical synthesis of collagen as well as thehealing in vitro were significantly different. Thesedifferences in intrinsic properties of the two types of cells invitro might contribute to the differential healing potentialsof these ligaments in vivo.

  18. LIF-free embryonic stem cell culture in simulated microgravity.

    Directory of Open Access Journals (Sweden)

    Yumi Kawahara

    Full Text Available BACKGROUND: Leukemia inhibitory factor (LIF is an indispensable factor for maintaining mouse embryonic stem (ES cell pluripotency. A feeder layer and serum are also needed to maintain an undifferentiated state, however, such animal derived materials need to be eliminated for clinical applications. Therefore, a more reliable ES cell culture technique is required. METHODOLOGY/PRINCIPAL FINDINGS: We cultured mouse ES cells in simulated microgravity using a 3D-clinostat. We used feeder-free and serum-free media without LIF. CONCLUSIONS/SIGNIFICANCE: Here we show that simulated microgravity allows novel LIF-free and animal derived material-free culture methods for mouse ES cells.

  19. The activity and stability of cell associated activity of bovicin HC5, a bacteriocin from Streptococcus bovis HC5

    Science.gov (United States)

    Streptococcus bovis HC5 cultures released a broad spectrum lantibiotic, bovicin HC5, into the cell-fee culture supernatant after they reached stationary phase, but most of the antibacterial activity remained cell-associated. Cell-associated bovicin HC5 was more resistant to degradation by Pronase E ...

  20. Mesenchymal Progenitor Cells: Tissue Origin, Isolation and Culture.

    Science.gov (United States)

    Bourin, Philippe; Gadelorge, Mélanie; Peyrafitte, Julie-Anne; Fleury-Cappellesso, Sandrine; Gomez, Marilyn; Rage, Christine; Sensebé, Luc

    2008-01-01

    SUMMARY: Since the pioneering work of Alexander Friedenstein on multipotent mesenchymal stromal cells (MSCs), a tremendous amount of work has been done to isolate, characterize and culture such cells. Assay of colony forming unit-fibroblasts (CFU-Fs), the hallmark of MSCs, is used to estimate their frequency in tissue. MSCs are adherent cells, so they are easy to isolate, and they show contact inhibition. Thus, several parameters must be taken into account for culture: cell density, number of passages, culture medium, and growth factors used. The purity of the initial material is not a limiting parameter. Similar but not identical cell populations are found in almost all mammal or human tissues. MSCs seem to be very abundant in adipose tissue but at low frequency in blood from umbilical cord or in adult tissue. The culture conditions are very similar, whatever the source of cells. Because of their favorable properties, MSCs are very promising tools for regenerative medicine.

  1. Culture materials affect ex vivo expansion of hematopoietic progenitor cells.

    Science.gov (United States)

    LaIuppa, J A; McAdams, T A; Papoutsakis, E T; Miller, W M

    1997-09-01

    Ex vivo expansion of hematopoietic cells is important for applications such as cancer treatment, gene therapy, and transfusion medicine. While cell culture systems are widely used to evaluate the biocompatibility of materials for implantation, the ability of materials to support proliferation of primary human cells in cultures for reinfusion into patients has not been addressed. We screened a variety of commercially available polymer (15 types), metal (four types), and glass substrates for their ability to support expansion of hematopoietic cells when cultured under conditions that would be encountered in a clinical setting. Cultures of peripheral blood (PB) CD34+ cells and mononuclear cells (MNC) were evaluated for expansion of total cells and colony-forming unit-granulocyte monocyte (CFU-GM; progenitors committed to the granulocyte and/or monocyte lineage). Human hematopoietic cultures in serum-free medium were found to be extremely sensitive to the substrate material. The only materials tested that supported expansion at or near the levels of polystyrene were tissue culture polystyrene, Teflon perfluoroalkoxy, Teflon fluorinated ethylene propylene, cellulose acetate, titanium, new polycarbonate, and new polymethylpentene. MNC were less sensitive to the substrate materials than the primitive CD34+ progenitors, although similar trends were seen for expansion of the two cell populations on the substrates tested. CFU-GM expansion was more sensitive to substrate materials than was total cell expansion. The detrimental effects of a number of the materials on hematopoietic cultures appear to be caused by protein adsorption and/or leaching of toxins. Factors such as cleaning, sterilization, and reuse significantly affected the performance of some materials as culture substrates. We also used PB CD34+ cell cultures to examine the biocompatibility of gas-permeable cell culture and blood storage bags and several types of tubing commonly used with biomedical equipment

  2. Supernatant Sludge Treatment on the Ljubljana Wastewater Treatment Plant

    OpenAIRE

    Vrbančič, Mojca

    2013-01-01

    Supernatant, generated from mechanical compaction previously anaerobically stabilized sludge at the wastewater treatment plant, is heavily loaded with ammonium nitrogen. Usually is leaded to an inflow of wastewater treatment plant and represents approximately 30 % of the additional nitrogen load in the biological treatment stage. To avoid this problem and due to increasingly stringent regulations, which has in recent years heavily limited emissions of nitrogen in the effluent from wastewater...

  3. Culturing Schwann Cells from Neonatal Rats by Improved Enzyme Digestion Combined with Explants-culture Method.

    Science.gov (United States)

    Liu, Di; Liang, Xiao-Chun; Zhang, Hong

    2016-08-01

    Objective To develop an improved method for culturing Schwann cells(SCs) by using both enzyme digestion and explants-culture approaches and compared with traditional explants-culture method and general hemi-explants-culture method. Methods Bilaterally sciatic nerves and brachial plexus nerves were dissected from 3 to 5-day-old neonatal SD rats and explants-culture method,general hemi-explants-culture method,and improved enzyme digestion combined with explants-culture method were adopted to culture SCs,respectively. SCs were digested and passaged after 7 days in culture and counted under the microscope. The purity of SCs was identified by S-100 immunofluorescence staining. Results The SCs of improved method group grew fastest and the total number of cells obtained was(1.85±0.13)×10(6);the SCs of the hemi-explants-culture method group grew slower than the improved method group and the total number of cells obtained was (1.10±0.10)×10(6);the SCs of the explants-culture method group grew slowest and the total number of cells obtained was (0.77±0.03)×10(6).The total number of cells obtained showed significant difference among the three groups(Pculture method group,and (74.50±4.23)% in the explants-culture method group(Pculture method can obtain sufficient amount of high-purity SCs in a short time and thus may be applied in further research on peripheral nerve regeneration.

  4. Isolation, Culture, and Maintenance of Mouse Intestinal Stem Cells

    Science.gov (United States)

    O’Rourke, Kevin P.; Ackerman, Sarah; Dow, Lukas E; Lowe, Scott W

    2016-01-01

    In this protocol we describe our modifications to a method to isolate, culture and maintain mouse intestinal stem cells as crypt-villus forming organoids. These cells, isolated either from the small or large intestine, maintain self-renewal and multilineage differentiation potential over time. This provides investigators a tool to culture wild type or transformed intestinal epithelium, and a robust assay for stem cell tissue homeostasis in vitro.

  5. Chemotherapy in heterogeneous cultures of cancer cells with interconversion

    International Nuclear Information System (INIS)

    Recently, the interconversion between differentiated and stem-like cancer cells has been observed. Here, we model the in vitro growth of heterogeneous cell cultures in the presence of interconversion from differentiated cancer cells to cancer stem cells (CSCs), showing that, by targeting only CSC with cytotoxic agents, it is not always possible to eradicate cancer. We have determined the kinetic conditions under which cytotoxic agents in in vitro heterogeneous cultures of cancer cells eradicate cancer. In particular, we have shown that the chemotherapeutic elimination of in vitro cultures of heterogeneous cancer cells is effective only if it targets all cancer cell types, and if the induced death rates for the different subpopulations of cancer cell types are large enough. The quantitative results of the model are compared and validated with experimental data. (paper)

  6. Application of screen-printed microband biosensors to end-point measurements of glucose and cell numbers in HepG2 cell culture.

    Science.gov (United States)

    Pemberton, R M; Xu, J; Pittson, R; Biddle, N; Drago, G A; Jackson, S K; Hart, J P

    2009-02-15

    Microband glucose biosensors were produced by insulating and sectioning through a screen-printed, water-based carbon electrode containing cobalt phthalocyanine redox mediator and glucose oxidase enzyme. Under quiescent conditions at 37 degrees C, at an operating potential of +0.4V, they produced an amperometric response to glucose in buffer solutions with a sensitivity of 26.4 nA/mM and a linear range of 0.45 to 9.0 mM. An optimal pH value of 8.5 was obtained under these conditions, and a value for activation energy of 40.55 kJ mol(-1) was calculated. In culture medium (pH 7.3), a sensitivity of 13 nA/mM was obtained and the response was linear up to 5 mM with a detection limit of 0.5 mM. The working concentration was up to 20 mM glucose with a precision of 11.3% for replicate biosensors (n=4). The microband biosensors were applied to determine end-point glucose concentrations in culture medium by monitoring steady-state current responses 400 s after transfer of the biosensors into different sample solutions. In conjunction with cultures of HepG2 (human Caucasian hepatocyte carcinoma) cells, current responses obtained in 24-h supernatants showed an inverse correlation (R(2)=0.98) with cell number, indicating that the biosensors were applicable for monitoring glucose metabolism by cells and of quantifying cell number. Glucose concentrations determined using the biosensor assay were in good agreement, for concentrations up to 20mM, with those determined spectrophotometrically (R(2)=0.99). This method of end-point glucose determination was used to provide an estimated rate of glucose uptake for HepG2 cells of 7.9 nmol/(10(6) cells min) based on a 24-h period in culture. PMID:19027709

  7. Multizone paper platform for 3D cell cultures.

    Directory of Open Access Journals (Sweden)

    Ratmir Derda

    Full Text Available In vitro 3D culture is an important model for tissues in vivo. Cells in different locations of 3D tissues are physiologically different, because they are exposed to different concentrations of oxygen, nutrients, and signaling molecules, and to other environmental factors (temperature, mechanical stress, etc. The majority of high-throughput assays based on 3D cultures, however, can only detect the average behavior of cells in the whole 3D construct. Isolation of cells from specific regions of 3D cultures is possible, but relies on low-throughput techniques such as tissue sectioning and micromanipulation. Based on a procedure reported previously ("cells-in-gels-in-paper" or CiGiP, this paper describes a simple method for culture of arrays of thin planar sections of tissues, either alone or stacked to create more complex 3D tissue structures. This procedure starts with sheets of paper patterned with hydrophobic regions that form 96 hydrophilic zones. Serial spotting of cells suspended in extracellular matrix (ECM gel onto the patterned paper creates an array of 200 micron-thick slabs of ECM gel (supported mechanically by cellulose fibers containing cells. Stacking the sheets with zones aligned on top of one another assembles 96 3D multilayer constructs. De-stacking the layers of the 3D culture, by peeling apart the sheets of paper, "sections" all 96 cultures at once. It is, thus, simple to isolate 200-micron-thick cell-containing slabs from each 3D culture in the 96-zone array. Because the 3D cultures are assembled from multiple layers, the number of cells plated initially in each layer determines the spatial distribution of cells in the stacked 3D cultures. This capability made it possible to compare the growth of 3D tumor models of different spatial composition, and to examine the migration of cells in these structures.

  8. Tumour necrosis factor-{alpha} induction by endotoxin-containing coal mine dusts in cultures of human macrophages and its effects on pneumocyte type II cells

    Energy Technology Data Exchange (ETDEWEB)

    Griwatz, U.; Seemayer, N.H. [Heinrich-Heine University of Duesseldorf, Duesseldorf (Germany). Medical Inst. of Environmental Hygiene

    1995-08-01

    Recent results indicate that tumour necrosis factors {alpha} (TNF{alpha}) may have an important role in the pathogenesis of silicosis. Supernatants of macrophages exposed to quartz and coal mine dust were tested for the presence of TNF{alpha}. Monocytes were isolated from peripheral blood and cultured for 10-14 days. After in vitro maturation of monocytes to cells with characteristics of macrophages, they were incubated with quartz dust DQ12 and various coal mine dusts from the Ruhr Valley for 24 hr. TNF{alpha} bioactivity in the supernatant of dust-treated macrophages was measured in cytotoxicity bioassay with L929-mouse fibroblasts. Endotoxin, the lipopolysaccharide-containing cell wall component of Gram-negative bacteria, is the most important stimulator of TNF{alpha} induction in human macrophages. Suspensions of coal mine dusts from the Ruhr Valley and quartz dust DQ12 were therefore analysed for the presence of endotoxin by the very sensitive Limulus amoebocytes lysate test. Only a few suspensions of coal mine dusts from the Ruhr Valley contained endotoxin. Only endotoxin-containing dusts stimulated macrophages to produce TNF{alpha}. Incubating human pneumocytes type II (line A-549) with TNF{alpha} as the pure substance led to a transformation of these epithelial cells into spindle-shaped cells. This morphological transformation was accompanied by marked inhibition of pneumocyte type II proliferation. 39 refs., 2 figs., 4 tabs., 1 plate.

  9. Feeding Frequency Affects Cultured Rat Pituitary Cells in Low Gravity

    Science.gov (United States)

    Hymer, W. C.; Grindeland, R. E.; Salada, T.; Cenci, R.; Krishnan, K.; Mukai, C.; Nagaoka, S.

    1996-01-01

    In this report, we describe the results of a rat pituitary cell culture experiment done on STS-65 in which the effect of cell feeding on the release of the six anterior pituitary hormones was studied. We found complex microgravity related interactions between the frequency of cell feeding and the quantity and quality (i.e. biological activity) of some of the six hormones released in flight. Analyses of growth hormone (GH) released from cells into culture media on different mission days using gel filtration and ion exchange chromatography yielded qualitatively similar results between ground and flight samples. Lack of cell feeding resulted in extensive cell clumping in flight (but not ground) cultures. Vigorous fibroblast growth occurred in both ground and flight cultures fed 4 times. These results are interpreted within the context of autocrine and or paracrine feedback interactions. Finally the payload specialist successfully prepared a fresh trypsin solution in microgravity, detached the cells from their surface and reinserted them back into the culture chamber. These cells reattached and continued to release hormone in microgravity. In summary, this experiment shows that pituitary cells are microgravity sensitive and that coupled operations routinely associated with laboratory cel1 culture can also be accomplished in low gravity.

  10. Three Dimensional Culture of Human Renal Cell Carcinoma Organoids.

    Directory of Open Access Journals (Sweden)

    Cynthia A Batchelder

    Full Text Available Renal cell carcinomas arise from the nephron but are heterogeneous in disease biology, clinical behavior, prognosis, and response to systemic therapy. Development of patient-specific in vitro models that efficiently and faithfully reproduce the in vivo phenotype may provide a means to develop personalized therapies for this diverse carcinoma. Studies to maintain and model tumor phenotypes in vitro were conducted with emerging three-dimensional culture techniques and natural scaffolding materials. Human renal cell carcinomas were individually characterized by histology, immunohistochemistry, and quantitative PCR to establish the characteristics of each tumor. Isolated cells were cultured on renal extracellular matrix and compared to a novel polysaccharide scaffold to assess cell-scaffold interactions, development of organoids, and maintenance of gene expression signatures over time in culture. Renal cell carcinomas cultured on renal extracellular matrix repopulated tubules or vessel lumens in renal pyramids and medullary rays, but cells were not observed in glomeruli or outer cortical regions of the scaffold. In the polysaccharide scaffold, renal cell carcinomas formed aggregates that were loosely attached to the scaffold or free-floating within the matrix. Molecular analysis of cell-scaffold constructs including immunohistochemistry and quantitative PCR demonstrated that individual tumor phenotypes could be sustained for up to 21 days in culture on both scaffolds, and in comparison to outcomes in two-dimensional monolayer cultures. The use of three-dimensional scaffolds to engineer a personalized in vitro renal cell carcinoma model provides opportunities to advance understanding of this disease.

  11. Mammosphere culture of cancer stem cells in a microfluidic device

    Science.gov (United States)

    Saadin, Katayoon; White, Ian M.

    2012-03-01

    It is known that tumor-initiating cells with stem-like properties will form spherical colonies - termed mammospheres - when cultured in serum-free media on low-attachment substrates. Currently this assay is performed in commercially available 96-well trays with low-attachment surfaces. Here we report a novel microsystem that features on-chip mammosphere culture on low attachment surfaces. We have cultured mammospheres in this microsystem from well-studied human breast cancer cell lines. To enable the long-term culture of these unattached cells, we have integrated diffusion-based delivery columns that provide zero-convection delivery of reagents, such as fresh media, staining agents, or drugs. The multi-layer system consists of parallel cell-culture chambers on top of a low-attachment surface, connected vertically with a microfluidic reagent delivery layer. This design incorporates a reagent reservoir, which is necessary to reduce evaporation from the cell culture micro-chambers. The development of this microsystem will lead to the integration of mammosphere culture with other microfluidic functions, including circulating tumor cell recovery and high throughput drug screening. This will enable the cancer research community to achieve a much greater understanding of these tumor initiating cancer stem cells.

  12. Absence of C-type virus production in human leukemic B cell, T cell and null cell lines.

    Directory of Open Access Journals (Sweden)

    Ogura,Hajime

    1978-06-01

    Full Text Available Electron microscope observation of cultured human leukemic B cell, T cell and null cell lines and reverse transcriptase assay of the culture supernatants were all negative for the presence of C-type virus. Bat cell line, which propagates primate C-type viruses well, was cocultivated with the human leukemic cell lines, in the hope of amplification of virus if present. Three weeks after mixed culture, the culture supernatants were again examined for reverse transcriptase activity and the cells were tested for syncytia formation by cocultivation with rat XC, human KC and RSb cell lines. All these tests, except for the positive control using a simian sarcoma virus, were negative, suggesting that no C-type was produced from these human leukemic cell lines.

  13. Optimization of Buffalo (Bubalus bubalis Embryonic Stem Cell Culture System

    Directory of Open Access Journals (Sweden)

    Mohammad Zandi

    2015-07-01

    Full Text Available Objective: In order to retain an undifferentiated pluripotent state, embryonic stem (ES cells have to be cultured on feeder cell layers. However, use of feeder layers limits stem cell research, since experimental data may result from a combined ES cell and feeder cell response to various stimuli. Materials and Methods: In this experimental study, a buffalo ES cell line was established from in vitro derived blastocysts and characterized by the Alkaline phosphatase (AP and immunoflourescence staining of various pluripotency markers. We examined the effect of various factors like fibroblast growth factor 2 (FGF-2, leukemia inhibitory factor (LIF and Y-27632 to support the growth and maintenance of bubaline ES cells on gelatin coated dishes, in order to establish feeder free culture systems. We also analyzed the effect of feeder-conditioned media on stem cell growth in gelatin based cultures both in the presence as well as in the absence of the growth factors. Results: The results showed that Y-27632, in the presence of FGF-2 and LIF, resulted in higher colony growth and increased expression of Nanog gene. Feeder-Conditioned Medium resulted in a significant increase in growth of buffalo ES cells on gelatin coated plates, however, feeder layer based cultures produced better results than gelatin based cultures. Feeder layers from buffalo fetal fibroblast cells can support buffalo ES cells for more than two years. Conclusion: We developed a feeder free culture system that can maintain buffalo ES cells in the short term, as well as feeder layer based culture that can support the long term maintenance of buffalo ES cells.

  14. THE ULTRASTRUCTURE OF SEPARATED AND CULTURED CELL OF PORPHYRA YEZOENSIS

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    There are many reports that cells (protoplasts) separated from the thallus of Porphyra by enzyme can develop to normal leafy thalli in the same way as monospores. But there are few investigations on the subcellular structure of the isolated vegetative cell for comparison with the subcellular structure of monospores. To clarify whether the separated and cultured cells undergo the same or similar ultrastructure changes during culture and germination as monospores undergo in their formation and germination, we observed their ultrastructure, compared them with those of the monospore and found that the ultrastructure of separated and cultured cells did not have the characteristic feature as that of monospore formation, such as production of small and large fibrous vesicles, but was accompanied by vacuolation and starch mobilization like that in monospore germination. The paper also discusses the relations between monospores and separated and cultured cells.

  15. Controlling the diversity of cell populations in a stem cell culture

    NARCIS (Netherlands)

    Heo, Inha; Clevers, Hans

    2015-01-01

    Culturing intestinal stem cells into 3D organoids results in heterogeneous cell populations, reflecting the in vivo cell type diversity. In a recent paper published in Nature, Wang et al. established a culture condition for a highly homogeneous population of intestinal stem cells.

  16. Surface modified alginate microcapsules for 3D cell culture

    Science.gov (United States)

    Chen, Yi-Wen; Kuo, Chiung Wen; Chueh, Di-Yen; Chen, Peilin

    2016-06-01

    Culture as three dimensional cell aggregates or spheroids can offer an ideal platform for tissue engineering applications and for pharmaceutical screening. Such 3D culture models, however, may suffer from the problems such as immune response and ineffective and cumbersome culture. This paper describes a simple method for producing microcapsules with alginate cores and a thin shell of poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG) to encapsulate mouse induced pluripotent stem (miPS) cells, generating a non-fouling surface as an effective immunoisolation barrier. We demonstrated the trapping of the alginate microcapsules in a microwell array for the continuous observation and culture of a large number of encapsulated miPS cells in parallel. miPS cells cultured in the microcapsules survived well and proliferated to form a single cell aggregate. Droplet formation of monodisperse microcapsules with controlled size combined with flow cytometry provided an efficient way to quantitatively analyze the growth of encapsulated cells in a high-throughput manner. The simple and cost-effective coating technique employed to produce the core-shell microcapsules could be used in the emerging field of cell therapy. The microwell array would provide a convenient, user friendly and high-throughput platform for long-term cell culture and monitoring.

  17. Microfluidic bioreactors for culture of non-adherent cells

    DEFF Research Database (Denmark)

    Shah, Pranjul Jaykumar; Vedarethinam, Indumathi; Kwasny, Dorota;

    2011-01-01

    Microfluidic bioreactors (μBR) are becoming increasingly popular for cell culture, sample preparation and analysis in case of routine genetic and clinical diagnostics. We present a novel μBR for non-adherent cells designed to mimic in vivo perfusion of cells based on diffusion of media through...

  18. The effects of glucocorticoids on cultured human endothelial cells.

    Science.gov (United States)

    Maca, R D; Fry, G L; Hoak, J C

    1978-04-01

    The effects of hydrocortisone, dexamethasone and prednisone on the morphology, replication, DNA synthesis, cell protein content and protein synthesis of cultured, human endothelial cells were evaluated. After culturing the cells with these glucocorticoids for 24-48 h, the cells covered a greater portion of the culture surface area. The mean surface area of the individual endothelial cell treated with glucocorticoids was 1.53 times greater than that of the untreated control endothelial cell. When compared with controls, the endothelial cover provided by the cells treated with glucocorticoids was more extensive and in many instances covered the entire culture surface. The change in morphology was associated with an increase in protein synthesis and protein content of the cells without an increase in DNA synthesis or cellular replication. Dexamethasone was approximately 10-fold more effective than hydrocortisone, while prednisone was the least effective. Aldosterone, DOCA, testosterone, progesterone, oestradiol and oestriol were ineffective. These studies indicate that glucocorticoids can alter the morphology and biochemistry of cultured endothelial cells and may have implications for the effects of steroids in the treatment of thrombocytopenic states and vascular disorders in man. PMID:646949

  19. Novel culturing platform for brain slices and neuronal cells

    DEFF Research Database (Denmark)

    Svendsen, Winnie Edith; Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya;

    2015-01-01

    In this paper we demonstrate a novel culturing system for brain slices and neuronal cells, which can control the concentration of nutrients and the waste removal from the culture by adjusting the fluid flow within the device. The entire system can be placed in an incubator. The system has been te...

  20. [Results of mammalian cell culture exposure on artificial earth satellites].

    Science.gov (United States)

    Sushkov, F V; Portugalov, V V; Rudneva, S V; Bobkova, N N; Iordanishvili, E K

    1976-01-01

    The paper presents the results of an exposure of cells of the Syrian hamster strain VNK-21 to space flight effects. In contrast to the cell culture kept in a thermostat at 29 degrees C, the cell culture that was maintained in thermally uncontrolled conditions developed noticeable structural and physiological changes induced by suboptimal temperatures. It was concluded that a 6-day exposure to weightlessness exerted no adverse effect on mammalian cells in vitro and produced no stable structural or physiological changes. Some changes that were detected in the cell culture--faster ageing, stable tendency to an increase of the number of cells with enlarged nuclei, an increase of the mitotic index at an early stage of cultivation--need further investigation.

  1. Culture of graft-infiltrating cells from cryopreserved endomyocardial biopsies

    NARCIS (Netherlands)

    G.A. Patijn (G.); L.M.B. Vaessen (Leonard); W. Weimar (Willem); F.H.J. Claas (Frans); N.H.P.M. Jutte (Nicolet)

    1996-01-01

    textabstractGraft-infiltrating cells can be cultured from fresh endomyocardial biopsies (EMB) taken after heart transplantation to determine their growth patterns, phenotypic composition, and functional characteristics for clinical or scientific purposes. In this study we investigated whether graft-

  2. Cell/Tissue Culture Radiation Exposure Facility Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop a Cell/Tissue Culture Radiation Exposure Facility (CTC-REF) to enable radiobiologists to investigate the real-time radiation effects on...

  3. 9 CFR 101.6 - Cell cultures.

    Science.gov (United States)

    2010-01-01

    ... normal tissue up to and including the 10th subculture. (b) Cell line. A pool of cells which are 11 or more subcultures from the tissue of origin. (c) Subculture. Each flask to flask transfer or...

  4. Convoluted cells as a marker for maternal cell contamination in CVS cultures

    DEFF Research Database (Denmark)

    Hertz, Jens Michael; Jensen, P K; Therkelsen, A J

    1987-01-01

    In order to identify cells of maternal origin in CVS cultures, tissue from 1st trimester abortions were cultivated and the cultures stained in situ for X-chromatin. Convoluted cells and maternal fibroblasts were found to be positive. By chromosome analysis of cultures from 105 diagnostic placenta...... biopsies, obtained by the transabdominal route, metaphases of maternal origin were found in nine cases. In eight of these cases colonies of convoluted cells were observed. We conclude that convoluted cells are of maternal origin and are a reliable marker for maternal cell contamination in CVS cultures....

  5. Study on Cell Suspension Culture of Floribunda Rose

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun'ai; WANG Jingang; FAN Jinping; GONG Shufang; CHE Daidi

    2008-01-01

    Friable callus was induced when immature seeds of floribunda rose were inoculated on MS medium supplemented with 2,4-D 3.0 mg-L-1.When transfered onto subculture media,fi-iable callus developed into embryogenic callus,which was used to establish cell suspension lines.Cell suspensions had to be subcultured at a interval of 4-5 days at the first several culture cycles.The best subculturing cycle for the stable cell suspensions was 8-10 days.The best inoculum quantity was 1 mL PCV(Packed Cell Volume) per 40 mL culture fluid.

  6. 2D- and 3D-culture of cell

    Directory of Open Access Journals (Sweden)

    Khoruzhenko A. I.

    2011-02-01

    Full Text Available The cultivation of mammalian cells in three-dimensional conditions acquires a priority in a variety of biomedical applications. In the areas of toxicology and anticancer drug development it concerns a significant difference of responses to proapoptotic factors of the cells cultured in 2D versus 3D environment. Besides, the clear-cut differences have been found in cell polarity, cytoskeleton structure, distribution of receptors to wide range of hormones, growth factors, etc. in mammalian cells depending on culture conditions. It is resulted in different response of cultured cells to extracellular stimuli. Multicellular spheroids are regarded presently as the most convenient model of solid tumour growth in vitro. The cultivation of thyroid follicles, mammary acini and other structure units, maintaining initial tissue organization, allows studying the behavior, biochemical features and gene profile of differentiated cells. On the other hand, 3D cultures have some limitations in comparison with a well established monolayer culture. The advantages and disadvantages of each type of cultures and their application in biological and medical researches will be discussed in this review

  7. 人羊膜匀浆上清液对脂多糖致伤的大鼠肺微血管内皮细胞增殖及分泌炎症因子的影响%Effect of supernatant of human amnion homogenate on lipopolysaccharide induced pulmonary microvascular endotheli-al cells injury and their proliferation and expression of proinflammatory factors in rats

    Institute of Scientific and Technical Information of China (English)

    陈云鹏; 朱富军; 龚震宇; 辛海明; 王磊; 童亚林; 刘亮; 吕璐; 莫永亮; 詹球; 阳齐琼; 梁静

    2015-01-01

    长因子、细胞因子,对 LPS致伤的 RPMVECs增殖具有促进作用,并减少致伤后炎症因子分泌。%Objective:To investigate the protective effect of supernatant of human amnion homogenate (hAHS)on proliferation and expression of proinflammatory mediators by lipopolysaccharide (LPS)induced inj ured pulmonary microvascular endothelial cells of rats (RPMVECs).Methods:hAHS was prepared from fresh human amnion. The total protein content and the content of epithelial growth factor (EGF),basic fibroblast growth factor (bFGF), vascular endothelial growth factor (VEGF),interleukin-4 (IL-4),IL-10,angiogenin-1 (Ang-1),humanβ-defensin2 (HBD2)of hAHS were determined with Coomassie blue staining and ELISA. The effect of 0,10%,15%, 20%,25% hAHS on cell proliferation activity of RPMVECs was respectively determined with MTT assay,in or-der to determine the optimal concentration of hAHS on promoting RPMVECs proliferation. According to different co-culture conditions,RPMVECs were randomly divided into 4 groups:group N (cultured with 10%FBS+DMEM/F12),group A(10%FBS+DMEM/F12+15%hAHS),group B (10%FBS+DMEM/F12+LPS),and group C (10%FBS+DMEM/F12+15%hAHS+LPS). At 0,12,24,48,72 hours after culturing with the corre-sponding medium of each group,optical density values (A values)of each group were determined respectively with MTT assay to determine the proliferation activity,and the contents of IL-6,IL-8,TNF-αlevels in the culture su-pernates were also determined by ELISA at 6,8,10,12 and 24 hours. Results:The total protein concentration of hAHS was (725.125±12.625)mg/L,and levels of EGF,bFGF,VEGF,IL-4,IL-10,Ang-1,HDB2 were re-spectively(504.785±4.665)ng/L,(4.426±0.138)ng/L,(0.185±0.006)ng/L,(25.650±4.104)ng/L,(13.733 ±2.197)ng/L,(15.561±0.496)ng/L,(4.763±0.714)ng/L.10%-20% hAHS was shown to promote prolifer-ation of RPMVECs,and 15% hAHS,and the best result was observed on 7 and 9 days. The proliferation rate of RPMVECs in 25% hAHS group at 7,9 and 11 days was lower than those in the 0%hAHS group (P<0

  8. Auxin requirements of sycamore cells in suspension culture.

    Science.gov (United States)

    Moloney, M M; Hall, J F; Robinson, G M; Elliott, M C

    1983-04-01

    Sycamore (Acer pseudoplatanus L.) cell suspension cultures (strain OS) require 2,4-dichlorophenoxyacetic acid (2,4-D) in their culture medium for normal growth. If the 2,4-D is omitted, rates of cell division are dramatically reduced and cell lysis may occur. Despite this ;auxin requirement,' it has been shown by gas chromatography-mass spectrometry that the cells synthesize indol-3yl-acetic acid (IAA). Changes in free 2,4-D and IAA in the cells during a culture passage have been monitored.There is a rapid uptake of 2,4-D by the cells during the lag phase leading to a maximum concentration per cell (125 nanograms per 10(6) cells) on day 2 followed by a decline to 45 nanograms per 10(6) cells by day 9 (middle of linear phase). The initial concentration of IAA (0.08 nanograms per 10(6) cells) rises slowly to a peak of 1.4 nanograms per 10(6) cells by day 9 then decreases rapidly to 0.2 nanograms per 10(6) cells by day 15 (early declining phase) and 0.08 nanograms per 10(6) cells by day 23 (early stationary phase).

  9. Guard cell protoplasts: isolation, culture, and regeneration of plants.

    Science.gov (United States)

    Tallman, Gary

    2006-01-01

    Guard cell protoplasts have been used extensively in short-term experiments designed to elucidate the signal transduction mechanisms that regulate stomatal movements. The utility of uard cell protoplasts for other types of longer-term signal transduction experiments is just now being realized. Because highly purified, primary isolates of guard cell protoplasts are synchronous initially, they are uniform in their responses to changes in culture conditions. Such isolates have demonstrated potential to reveal mechanisms that underlie hormonal signalling for plant cell survival, cell cycle re-entry, reprogramming of genes during dedifferentiation to an embryogenic state, and plant cell thermotolerance. Plants have been regenerated from cultured guard cell protoplasts of two species: Nicotiana glauca (Graham), tree tobacco, and Beta vulgaris, sugar beet. Plants genetically engineered for herbicide tolerance have been regenerated from cultured guard cell protoplasts of B. vulgaris. The method for isolating, culturing, and regenerating plants from guard cell protoplasts of N. glauca is described here. A recently developed procedure for large-scale isolation of these cells from as many as nine leaves per experiment is described. Using this protocol, yields of 1.5-2 x 10(7) per isolate may be obtained. Such yields are sufficient for standard methods of molecular, biochemical, and proteomic analysis.

  10. Exposure to Music Alters Cell Viability and Cell Motility of Human Nonauditory Cells in Culture

    Science.gov (United States)

    Lestard, Nathalia R.

    2016-01-01

    Although music is part of virtually all cultures in the world, little is known about how it affects us. Since the beginning of this century several studies suggested that the response to music, and to sound in general, is complex and might not be exclusively due to emotion, given that cell types other than auditory hair cells can also directly react to audible sound. The present study was designed to better understand the direct effects of acoustic vibrations, in the form of music, in human cells in culture. Our results suggest that the mechanisms of cell growth arrest and/or cell death induced by acoustic vibrations are similar for auditory and nonauditory cells. PMID:27478480

  11. Exposure to Music Alters Cell Viability and Cell Motility of Human Nonauditory Cells in Culture.

    Science.gov (United States)

    Lestard, Nathalia R; Capella, Marcia A M

    2016-01-01

    Although music is part of virtually all cultures in the world, little is known about how it affects us. Since the beginning of this century several studies suggested that the response to music, and to sound in general, is complex and might not be exclusively due to emotion, given that cell types other than auditory hair cells can also directly react to audible sound. The present study was designed to better understand the direct effects of acoustic vibrations, in the form of music, in human cells in culture. Our results suggest that the mechanisms of cell growth arrest and/or cell death induced by acoustic vibrations are similar for auditory and nonauditory cells. PMID:27478480

  12. Growth and Plating of Cell Suspension Cultures of Datura Innoxia

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1974-01-01

    Suspension cultures of Datura innoxia Mill, were successfully grown on a modified Murashige and Skoog medium with 2,4–D, NAA or BAP as growth substances, provided the micronutrient levels were reduced to 1/10. Normal amounts of micronutrients were toxic. Attempts to identify the toxic elements did...... malate) or on NO3−-N alone. Dry weight yield was proportional to the amount of nitrate-N added (47 mg/mg N). Filtered suspension cultures containing single cells (plating cultures) could be grown in agar in petri dishes when NAA or 2,4-D were used as growth substances. Cells grew at densities above 500...

  13. Hypergravity signal transduction and gene expression in cultured mammalian cells

    Science.gov (United States)

    Kumei, Y.; Whitson, P. A.

    1994-01-01

    A number of studies have been conducted during space flight and with clinostats and centrifuges, suggesting that gravity effects the proliferation and differentiation of mammalian cells in vitro. However, little is known about the mechanisms by which mammalian cells respond to changes in gravitational stress. This paper summarizes studies designed to clarify the effects of hypergravity on the cultured human HeLa cells and to investigate the mechanism of hypergravity signal transduction in these cells.

  14. Qualitative study of three cell culture methods.

    Science.gov (United States)

    Wang, Aiguo; Xia, Tao; Ran, Peng; Chen, Xuemin; Nuessler, Andreas K

    2002-01-01

    Primary rat hepatocytes were cultured using different in vitro models and the enzyme leakage, albumin secretion, and cytochrome P450 1A (CYP 1A) activity were observed. The results showed that the level of LDH was decreased over time in culture. However, on day 5, LDH showed a significant increase in monolayer culture (MC) while after day 8 no LDH was detectable in sandwich culture (SC). The levels of AST and ALT did not change significantly over the investigated time. The CYP 1A activity was gradually decreased in a time-dependent manner in MC and SC. The decline of CYP 1A was faster in MC than in SC. This effect was partially reversed by using cytochrome P450 (CYP450) inducer such as Omeprazol and 3-methylcholanthrene (3-MC) and the CYP 1A induction was always higher in MC than in SC. In bioreactor basic CYP 1A activity was preserved over 2 weeks and the highest albumin production was observed in bioreactor followed by SC and MC. Taken together, it was indicated each investigated model had its advantages and disadvantages. It was also underlined that various in vitro models may address different questions. PMID:12674760

  15. [Effect evaluation of three cell culture models].

    Science.gov (United States)

    Wang, Aiguo; Xia, Tao; Yuan, Jing; Chen, Xuemin

    2003-11-01

    Primary rat hepatocytes were cultured using three kinds of models in vitro and the enzyme leakage, albumin secretion, and cytochrome P450 1A (CYP 1A) activity were observed. The results showed that the level of LDH in the medium decreased over time in the period of culture. However, on 5 days, LDH showed a significant increase in monolayer culture (MC) while after 8 days LDH was not detected in sandwich culture (SC). The levels of AST and ALT in the medium did not change significantly over the investigated time. The basic CYP 1A activity gradually decreased with time in MC and SC. The decline of CYP 1A in rat hepatocytes was faster in MC than that in SC. This effect was partially reversed by using cytochrome P450 (CYP450) inducers such as omeprazol and 3-methylcholanthrene (3-MC) and the CYP 1A induction was always higher in MC than that in SC. Basic CYP 1A activity in bioreactor was keeped over 2 weeks and the highest albumin production was observed in bioreactor, and next were SC and MC. In conclusion, our results clearly indicated that there have some advantages and disadvantages in each of models in which can address different questions in metabolism of toxicants and drugs. PMID:14963896

  16. Pattern secretion of matrix Metalloproteinases and their biological tissue inhibitors by human glomerular mesangial cells in culture

    Directory of Open Access Journals (Sweden)

    "Hosseini R

    2001-08-01

    Full Text Available The glomerular mesangial cells (GMC play a central role in the synthesis and turnover of the glomerular mesangial matrix. The breakdown of the matrix likely depends on the balance between of a variety of proteinases including matrix metalloproteinases and their biological inhibitors secreted by the GMC, and any disturbance in the balance may result in appearance of various pathological states such as glomerulosclerosis. We therefore studied pattern secretion of matrix metalloproteinases (MMPs, MMP-1, MMP-2, MMP-3, MMP-9 and their biological tissue inhibitor of matrix metalloproteinases (TIMPs, TIMP-1 and TIMP-2 by cultured human GMC. We also measured MMP-1/TIMP-1 complex level in the cell culture supernatants. For this purpose, the GMC were incubated under serum-free conditions with medium (RPMI-1640 alone or in combination with TNF-α (30 ng/ml or phorbol myristate acetate (PMA (50 ng/ml for exactly 24, 48 and 72 hours. The above parameters were assayed by established ELISA techniques. Our results showed that the lowest and largest secretions were related to MMP-9 and MMP-2, respectively. The results indicated that the MMPs and TIMPs secretion were increased by TNF-α (MMP-1, MMP-2, TIMP-1 and TIMP-2 and PMA (MMP-2, TIMP-1 and TIMP-2, significantly (P<0.05. These results suggest that the GMC can synthesis and release various MMPs and their inhibitors (TIMPs that, in part, control turnover of extracellular matrix proteins.

  17. Towards dynamic metabolic flux analysis in CHO cell cultures.

    Science.gov (United States)

    Ahn, Woo Suk; Antoniewicz, Maciek R

    2012-01-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian cell line for biopharmaceutical production, with a total global market approaching $100 billion per year. In the pharmaceutical industry CHO cells are grown in fed-batch culture, where cellular metabolism is characterized by high glucose and glutamine uptake rates combined with high rates of ammonium and lactate secretion. The metabolism of CHO cells changes dramatically during a fed-batch culture as the cells adapt to a changing environment and transition from exponential growth phase to stationary phase. Thus far, it has been challenging to study metabolic flux dynamics in CHO cell cultures using conventional metabolic flux analysis techniques that were developed for systems at metabolic steady state. In this paper we review progress on flux analysis in CHO cells and techniques for dynamic metabolic flux analysis. Application of these new tools may allow identification of intracellular metabolic bottlenecks at specific stages in CHO cell cultures and eventually lead to novel strategies for improving CHO cell metabolism and optimizing biopharmaceutical process performance. PMID:22102428

  18. Integrin VLA-3: ultrastructural localization at cell-cell contact sites of human cell cultures

    OpenAIRE

    1989-01-01

    The integrin VLA-3 is a cell surface receptor, which binds to fibronectin, laminin, collagen type I and VI (Takada, Y., E. A. Wayner, W. G. Carter, and M. E. Hemler. 1988. J. Cell. Biochem. 37:385-393) and is highly expressed in substrate adherent cultures of almost all human cell types. The ligand specificity of VLA-3 and the inhibition of cell adhesion by anti-VLA-3 monoclonal antibodies suggest its involvement in cell-substrate interaction. In normal tissues, VLA-3 is restricted to few cel...

  19. A solution density model for hanford waste treatment plant supernatants

    International Nuclear Information System (INIS)

    The density of nuclear waste solution is used as a process control parameter in the Hanford Waste Treatment Plant pretreatment process and is crucial to tank utilization evaluations. The supernatants, however, have many different dissolved sodium salts, including nitrate, nitrite, carbonate, sulfate, phosphate, hydroxide, and aluminate. The large concentrations and diversity of salts in the waste has made the predictions of solution densities difficult historically. The purpose of this study is to determine if a new model of multi-component electrolyte solution densities, recently published in the literature, is effective at predicting the density of nuclear waste supernatants. A statistically designed set of solution densities containing the most prevalent electrolytes in Hanford tank waste was used for model validation. The densities of the simulants were calculated by the model and compared to the experimentally determined densities. The average model error was just 0.1%. These results indicate that the model can be used to accurately predict the density of nuclear waste processed at the Hanford Waste Treatment Plant. (authors)

  20. Modeling of cell culture damage and recovery leads to increased antibody and biomass productivity in CHO cell cultures.

    Science.gov (United States)

    Naderi, Saeideh; Nikdel, Ali; Meshram, Mukesh; McConkey, Brendan; Ingalls, Brian; Budman, Hector; Scharer, Jeno

    2014-09-01

    The development of an efficient and productive cell-culture process requires a deep understanding of intracellular mechanisms and extracellular conditions for optimal product synthesis. Mathematical modeling provides an effective strategy to predict, control, and optimize cell performance under a range of culture conditions. In this study, a mathematical model is proposed for the investigation of cell damage of a Chinese hamster ovary cell culture secreting recombinant anti-RhD monoclonal antibody (mAb). Irreversible cell damage was found to be correlated with a reduction in pH. This irreversible damage to cellular function is described mathematically by a Tessier-based model, in which the actively growing fraction of cells is dependent on an intracellular metabolic product acting as a growth inhibitor. To further verify the model, an offline model-based optimization of mAb production in the cell culture was carried out, with the goal of minimizing cell damage and thereby enhancing productivity through intermittent refreshment of the culture medium. An experimental implementation of this model-based strategy resulted in a doubling of the yield as compared to the batch operation and the resulting biomass and productivity profiles agreed with the model predictions.

  1. Detection of multiple mycoplasma infection in cell cultures by PCR

    Directory of Open Access Journals (Sweden)

    J. Timenetsky

    2006-07-01

    Full Text Available A total of 301 cell cultures from 15 laboratories were monitored for mycoplasma (Mollicutes using PCR and culture methodology. The infection was detected in the cell culture collection of 12 laboratories. PCR for Mollicutes detected these bacteria in 93 (30.9% samples. Although the infection was confirmed by culture for 69 (22.9% samples, PCR with generic primers did not detect the infection in five (5.4%. Mycoplasma species were identified with specific primers in 91 (30.2% of the 98 samples (32.6% considered to be infected. Mycoplasma hyorhinis was detected in 63.3% of the infected samples, M. arginini in 59.2%, Acholeplasma laidlawii in 20.4%, M. fermentans in 14.3%, M. orale in 11.2%, and M. salivarium in 8.2%. Sixty (61.2% samples were co-infected with more than one mycoplasma species. M. hyorhinis and M. arginini were the microorganisms most frequently found in combination, having been detected in 30 (30.6% samples and other associations including up to four species were detected in 30 other samples. Failure of the treatments used to eliminate mycoplasmas from cell cultures might be explained by the occurrence of these multiple infections. The present results indicate that the sharing of non-certified cells among laboratories may disseminate mycoplasma in cell cultures.

  2. Carrier cultures of simian foamy virus.

    Science.gov (United States)

    Clarke, J K; Samuels, J; Dermott, E; Gay, F W

    1970-05-01

    The production of cultures of HEp-2 and BHK-21 cells persistently infected with a type 1 simian foamy virus is described. After infection, HEp-2 cells showed no structural changes, whereas BHK-21 cells lost their normal spindle shape and showed mitochondrial damage, and some cells contained many lysosomes. Thin sections also showed that a few BHK-21 cells contained virus particles in low concentration, and infectious virus could be isolated from both the cells and the supernatant fluid. No virus was seen in thin sections of HEp-2 cells, although infectious virus in low titer could be recovered intermittently from lysed cells. Both carrier cultures were immune to challenge with homologous virus and antigen could be detected in over 90% of the cells even after growth for 9 weeks in the presence of virus-neutralizing serum. The distribution of antigen in carrier cultures of both cell types is described and compared with that seen in cytocidal infections. PMID:4986851

  3. ROLE OF PANCREATIC STELLATE CELLS AND GALECTIN-3 ON PROLIFERATION AND INFILTRATION OF HUMAN PANCREATIC CANCER CELL LINE SW1990

    Institute of Scientific and Technical Information of China (English)

    JIANG Hai-biao; XU Ming; WANG Xing-peng

    2008-01-01

    Objective To investigate the role of pancreatic stellate cells (PSCs) and galectin-3 (GAL-3)on the proliferation and infiltration of pancreatic cancer cell line SW1990. Methods Human pancreatic cancercell line SW1990 and PSCs were cultured in vitro. Supernatant of cultured PSCs and SW1990 cells was collected.Expressions of GAL-3 in SW1990 cells and PSCs were detected by ELISA, RT-PCR and Western blot. Theproliferation of those cultured PSCs and SW1990 cells were measured by MTT assay and flowcytometry. Infiltrationof SW1990 cells was detected by cell infiltration kit. Results SW1990 cells expressed GAL-3 and the expressionwas up-regulated by the supernatant fluid of cultured PSCs. PSCs did not express GAL-3. SW1990 cells couldstimulate the proliferation of PSCs via GAL-3. GAL-3 antibody could inhibit SW1990 cells proliferation andinfiltration, which indicated that supernatant of PSCs might stimulate the proliferation of SW1990 cells through theinteraction with GAL-3 protein. The supernatant fluid of PSCs could enhance the invasiveness of SW1990 cellsthrough the interaction with GAL-3. Conclusion GAL-3 and PSCs was involved in the proliferation andinfiltration process of pancreatic cancer.

  4. Metabolism Kinetics of Glucose in Anchorage-dependent Cell Cultures

    Institute of Scientific and Technical Information of China (English)

    孙祥明; 张元兴

    2001-01-01

    The kinetic model of glucose metabolism was established and successfully applied to batchcultures of rCHO and rBHK cells. It was found that a large amount of glucose was utilized for cellmaintenance, and the overwhelming majority of maintenance energy from glucose was by its anaerobicmetabolism in both rBHK and rCHO cell cultures. The overall maintenance coefficients from aerobicmetabolism were 1.9×10-13 mmol/(cell.h) for rCHO cells and 7×10-13 mmol/(cell.h) for rBHK cells. Inaddition, all Go/T and Eo/T gradually increased with the same trend as the cell growth in the culture ofboth rCHO and rBHK cells. The overall molecule yield coefficients of lactate to glucose were 1.61 for rCHO cells and 1.38 for rBHK cells. The yield coefficients of cell to glucose were 4.5×108 cells/mmol for rCHO cells and 1.9 × 108 cells/mmol for rBHK cells, respectively.

  5. Advances in culture and manipulation of human pluripotent stem cells.

    Science.gov (United States)

    Qian, X; Villa-Diaz, L G; Krebsbach, P H

    2013-11-01

    Recent advances in the understanding of pluripotent stem cell biology and emerging technologies to reprogram somatic cells to a stem cell-like state are helping bring stem cell therapies for a range of human disorders closer to clinical reality. Human pluripotent stem cells (hPSCs) have become a promising resource for regenerative medicine and research into early development because these cells are able to self-renew indefinitely and are capable of differentiation into specialized cell types of all 3 germ layers and trophoectoderm. Human PSCs include embryonic stem cells (hESCs) derived from the inner cell mass of blastocyst-stage embryos and induced pluripotent stem cells (hiPSCs) generated via the reprogramming of somatic cells by the overexpression of key transcription factors. The application of hiPSCs and the finding that somatic cells can be directly reprogrammed into different cell types will likely have a significant impact on regenerative medicine. However, a major limitation for successful therapeutic application of hPSCs and their derivatives is the potential xenogeneic contamination and instability of current culture conditions. This review summarizes recent advances in hPSC culture and methods to induce controlled lineage differentiation through regulation of cell-signaling pathways and manipulation of gene expression as well as new trends in direct reprogramming of somatic cells.

  6. Characterisation and germline transmission of cultured avian primordial germ cells.

    Directory of Open Access Journals (Sweden)

    Joni Macdonald

    Full Text Available BACKGROUND: Avian primordial germ cells (PGCs have significant potential to be used as a cell-based system for the study and preservation of avian germplasm, and the genetic modification of the avian genome. It was previously reported that PGCs from chicken embryos can be propagated in culture and contribute to the germ cell lineage of host birds. PRINCIPAL FINDINGS: We confirm these results by demonstrating that PGCs from a different layer breed of chickens can be propagated for extended periods in vitro. We demonstrate that intracellular signalling through PI3K and MEK is necessary for PGC growth. We carried out an initial characterisation of these cells. We find that cultured PGCs contain large lipid vacuoles, are glycogen rich, and express the stem cell marker, SSEA-1. These cells also express the germ cell-specific proteins CVH and CDH. Unexpectedly, using RT-PCR we show that cultured PGCs express the pluripotency genes c-Myc, cKlf4, cPouV, cSox2, and cNanog. Finally, we demonstrate that the cultured PGCs will migrate to and colonise the forming gonad of host embryos. Male PGCs will colonise the female gonad and enter meiosis, but are lost from the gonad during sexual development. In male hosts, cultured PGCs form functional gametes as demonstrated by the generation of viable offspring. CONCLUSIONS: The establishment of in vitro cultures of germline competent avian PGCs offers a unique system for the study of early germ cell differentiation and also a comparative system for mammalian germ cell development. Primary PGC lines will form the basis of an alternative technique for the preservation of avian germplasm and will be a valuable tool for transgenic technology, with both research and industrial applications.

  7. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Ozcan;

    2011-01-01

    Standard cell culture plastic was surface modified by passive adsorption or covalent attachment of interleukin (IL)-4 and investigated for its ability to induce differentiation of human monocytes into mature dendritic cells, a process dose-dependently regulated by IL-4. Covalent attachment of IL-...

  8. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...

  9. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Özcan;

    2011-01-01

    Standard cell culture plastic was surface modified by passive adsorption or covalent attachment of interleukin (IL)-4 and investigated for its ability to induce differentiation of human monocytes into mature dendritic cells, a process dose-dependently regulated by IL-4. Covalent attachment of IL-4...

  10. Endothelial cell cultures as a tool in biomaterial research

    NARCIS (Netherlands)

    Kirkpatrick, CJ; Otto, M; Kooten, TV; Krump, [No Value; Kriegsmann, J; Bittinger, F

    1999-01-01

    Progress in biocompatibility and tissue engineering would today be inconceivable without the aid of in vitro techniques. Endothelial cell cultures represent a valuable tool not just in haemocompatibility testing, but also in the concept of designing hybrid organs. In the past endothelial cells (EC)

  11. Cell cultures from the symbiotic soft coral Sinularia flexibilis

    NARCIS (Netherlands)

    Khalesi, M.K.; Vera-Jimenez, N.I.; Aanen, D.K.; Beeftink, H.H.; Wijffels, R.H.

    2008-01-01

    The symbiotic octocoral Sinularia flexibilis is a producer of potential pharmaceuticals. Sustainable mass production of these corals as a source of such compounds demands innovative approaches, including coral cell culture. We studied various cell dissociation methodologies and the feasibility of cu

  12. Duchenne muscular dystrophy: normal ATP turnover in cultured cells

    International Nuclear Information System (INIS)

    This paper examines ATP metabolism in cultured muscle cells and fibroblasts from patients with Duchenne dystrophy. ATP and ADP levels were the same in cultured cells from normal subjects and patients and there was no difference in ATP synthesis or degradation. The ATP synthesis was measured by the incorporation of C 14-U-adenine into aTP and ADP. although there was a significant decrease in radioactively labelled ATP after incubation with deoxyglucose in Duchenne muscle cells, there was no difference in ATP concentration of ADP metabolism

  13. Replica-moulded polydimethylsiloxane culture vessel lids attenuate osmotic drift in long-term cell cultures

    Indian Academy of Sciences (India)

    Axel Blau; Tanja Neumann; Christiane Ziegler; Fabio Benfenati

    2009-03-01

    An imbalance in medium osmolarity is a determinant that affects cell culture longevity. Even in humidified incubators, evaporation of water leads to a gradual increase in osmolarity overtime. We present a simple replica-moulding strategy for producing self-sealing lids adaptable to standard, small-size cell-culture vessels. They are made of polydimethylsiloxane (PDMS), a flexible, transparent and biocompatible material, which is gas-permeable but largely impermeable to water. Keeping cell cultures in a humidified 5% CO2 incubator at 37°C, medium osmolarity increased by +6.86 mosmol/kg/day in standard 35 mm Petri dishes, while PDMS lids attenuated its rise by a factor of four to changes of +1.72 mosmol/kg/ day. Depending on the lid membrane thickness, pH drifts at ambient CO2 levels were attenuated by a factor of 4 to 9. Comparative evaporation studies at temperatures below 60°C yielded a 10-fold reduced water vapour flux of 1.75 g/day/dm2 through PDMS lids as compared with 18.69 g/day/dm2 with conventional Petri dishes. Using such PDMS lids, about 2/3 of the cell cultures grew longer than 30 days in vitro. Among these, the average survival time was 69 days with the longest survival being 284 days under otherwise conventional cell culture conditions.

  14. Schwann cell cultures from human fetal dorsal root ganglia

    Institute of Scientific and Technical Information of China (English)

    Yaping Feng; Hui Zhu; Jiang Hao; Xinmin Wang; Shengping Wu; Li Bai; Xiangming Li; Yun Zha

    2009-01-01

    BACKGROUND:Previous studies have used many methods for in vitro Schwann cells (SCs) cul-tures and purification,such as single cell suspension and cytosine arabinoside.However,it has been difficult to obtain sufficient cellular density,and the procedures have been quite tedious.OBJECTIVE:To investigate the feasibility of culturing high-density SCs using fetal human dorsal root ganglion tissue explants.DESIGN,TIME AND SETTING:Cell culture and immunohistochemistry were performed at the Cen-tral Laboratory of Kunming General Hospital of Chinese PLA between March 2001 and October 2008.MATERIALS:Culture media containing 10% fetal bovine serum,as well as 0.2% collagenase and 0.25% trypsin were purchased from Gibco,USA;mouse anti-human S-100 monoclonal antibody and goat anti-mouse IgG labeled with horseradish peroxidase were provided by Beijing Institute of Bi-ological Products,China.METHODS:Primarily cultured SCs were dissociated from dorsal root ganglia of human aborted fe-tuses at 4-6 months pregnancy.Following removal of the dorsal root ganglion perineurium,the gan-glia were dissected into tiny pieces and digested with 0.2% collagenase and 0.25% trypsin (volume ratio 1:1),then explanted and cultured.SC purification was performed with 5 mL 10% fetal bovine serum added to the culture media,followed by differential adhesion.MAIN OUTCOME MEASURES:SCs morphology was observed under inverted phase contrast light microscopy.SC purity was evaluated according to percentage of S-100 immunostained cells.RESULTS:SCs were primarily cultured for 5-6 days and then subcultured for 4-5 passages.The highly enriched SC population reached > 95% purity and presented with normal morphology.CONCLUSION:A high purity of SCs was obtained with culture methods using human fetal dorsal root ganglion tissue explants.

  15. Hydrodynamic effects on cells in agitated tissue culture reactors

    Science.gov (United States)

    Cherry, R. S.; Papoutsakis, E. T.

    1986-01-01

    The mechanisms by which hydrodynamic forces can affect cells grown on microcarrier beads in agitated cell culture reactors were investigated by analyzing the motion of microcarriers relative to the surrounding fluid, to each other, and to moving or stationary solid surfaces. It was found that harmful effects on cell cultures that have been previously attributed to shear can be better explained as the effects of turbulence (of a size scale comparable to the microcarriers or the spacing between them) or collisions. The primary mechanisms of cell damage involve direct interaction between microcarriers and turbulent eddies, collisions between microcarriers in turbulent flow, and collisions against the impeller or other solid surfaces. The implications of these analytical results for the design of tissue culture reactors are discussed.

  16. Culture and immortalization of pancreatic ductal epithelial cells.

    Science.gov (United States)

    Lawson, Terence; Ouellette, Michel; Kolar, Carol; Hollingsworth, Michael

    2005-01-01

    Some populations of the epithelial cells from the duct and ductular network of the mammalian pancreas have been isolated and maintained in vitro for up to 3 mo. These cells express many of the surface factors that are unique to them in vivo. They also retain significant drug- and carcinogen-metabolizing capacity in vitro. In this chapter we review the progression of the methods for the isolation, culture and maintenance in vitro for these cells from the earliest when only duct/ductular fragments were obtainable to the current ones which provide epithelial cells. The critical steps in the isolation process are identified and strategies are provided to facilitate these steps. These include the selection of tissue digestive enzymes, the importance of extensive mincing before culture and the importance of roles of some co-factors used in the culture medium. PMID:15542901

  17. Miniature Bioreactor System for Long-Term Cell Culture

    Science.gov (United States)

    Gonda, Steve R.; Kleis, Stanley J.; Geffert, Sandara K.

    2010-01-01

    A prototype miniature bioreactor system is designed to serve as a laboratory benchtop cell-culturing system that minimizes the need for relatively expensive equipment and reagents and can be operated under computer control, thereby reducing the time and effort required of human investigators and reducing uncertainty in results. The system includes a bioreactor, a fluid-handling subsystem, a chamber wherein the bioreactor is maintained in a controlled atmosphere at a controlled temperature, and associated control subsystems. The system can be used to culture both anchorage-dependent and suspension cells, which can be either prokaryotic or eukaryotic. Cells can be cultured for extended periods of time in this system, and samples of cells can be extracted and analyzed at specified intervals. By integrating this system with one or more microanalytical instrument(s), one can construct a complete automated analytical system that can be tailored to perform one or more of a large variety of assays.

  18. Radiosensitivity of cultured insect cells: I. Lepidoptera

    Energy Technology Data Exchange (ETDEWEB)

    Koval, T.M.

    1983-10-01

    The radiosensitivity of five lepidopteran insect cell lines representing five different genera has been investigated. These lines are: (1) TN-368, Trichoplusia ni; (2) IPLB-SF-1254, Spodoptera frugiperda; (3) IPLB-1075, Heliothis zea; (4) MRRL-CHl, clone GVl, Manduca sexta; and (5) IAL-PID2, Plodia interpunctella. The cell lines grew at different rates and had population doubling times that ranged from 19 to 52 hr. All of the lines are highly heteroploid and have approximate chromosome numbers near or above 100. The chromosomes are very small. All of the lines are extremely radioresistant; cell populations are able to recover from 260 kVp X-ray exposures up to and including 400 Gy, the highest dose examined. Cell survival curves were obtainable for only the TN-368 and IPLB-SF-1254 lines. The TN-368 cells displayed a biphasic survival response with D/sub 0/, d/sub q/, and n values of 65.7 and 130.2 Gy, 9.0 and -36.1 Gy, and 1.2 and 0.8, respectively, for the steep and shallow portions of the curve. The IPLB-SF-1254 cells had a D/sub 0/ of 63.9 Gy. D/sub q/ of 19.0 Gy, and n value of 1.4. These studies provide definitive evidence of the radioresistance of lepidopteran cells, and suggest that this radioresistance is a characteristic of lepidopteran insects.

  19. Dose verification by OSLDs in the irradiation of cell cultures

    International Nuclear Information System (INIS)

    The determination of value of irradiation dose presents difficulties when targets are irradiated located in regions where electronic equilibrium of charged particle is not reached, as in the case of irradiation -in vitro- of cell lines monolayer-cultured, in culture dishes or flasks covered with culture medium. The present study aimed to implement a methodology for dose verification in irradiation of cells in culture media by optically stimulated luminescence dosimetry (OSLD). For the determination of the absorbed dose in terms of cell proliferation OSL dosimeters of aluminum oxide doped with carbon (Al2O3:C) were used, which were calibrated to the irradiation conditions of culture medium and at doses that ranged from 0.1 to 15 Gy obtained with a linear accelerator of 6 MV photons. Intercomparison measurements were performed with an ionization chamber of 6 cm3. Different geometries were evaluated by varying the thicknesses of solid water, air and cell culture medium. The results showed deviations below 2.2% when compared with the obtained doses of OSLDs and planning system used. Also deviations were observed below 3.4% by eccentric points of the irradiation plane, finding homogeneous dose distribution. Uncertainty in the readings was less than 2%. The proposed methodology contributes a contribution in the dose verification in this type of irradiations, eliminating from the calculation uncertainties, potential errors in settling irradiation or possible equipment failure with which is radiating. It also provides certainty about the survival curves to be plotted with the experimental data. (Author)

  20. Highly Efficient JFH1-Based Cell-Culture System for Hepatitis C Virus Genotype 5a: Failure of Homologous Neutralizing-Antibody Treatment to Control Infection

    DEFF Research Database (Denmark)

    Jensen, Tanja B; Gottwein, Judith Margarete; Scheel, Troels Kasper Høyer;

    2008-01-01

    Background. @nbsp; Recently, a hepatitis C virus (HCV) cell-culture system was developed that employed strain JFH1 (genotype 2a), and JFH1-based intra- and intergenotypic recombinants now permit functional studies of the structural genes (Core, E1, and E2), p7, and NS2 of genotypes 1-4. The goal...... was to adapt the system to employ genotype 5. Methods. @nbsp; Huh7.5 cells infected with SA13/JFH1, containing Core-NS2 of strain SA13 (genotype 5a), were monitored for Core expression and for supernatant infectivity and HCV-RNA titers. Adaptive mutations of SA13/JFH1 were identified by sequence analysis...

  1. Establishing a stem cell culture laboratory for clinical trials

    Directory of Open Access Journals (Sweden)

    Elíseo Joji Sekiya

    2012-01-01

    Full Text Available Adult stem/progenitor cells are found in different human tissues. An in vitro cell culture is needed for their isolation or for their expansion when they are not available in a sufficient quantity to regenerate damaged organs and tissues. The level of complexity of these new technologies requires adequate facilities, qualified personnel with experience in cell culture techniques, assessment of quality and clear protocols for cell production. The rules for the implementation of cell therapy centers involve national and international standards of good manufacturing practices. However, such standards are not uniform, reflecting the diversity of technical and scientific development. Here standards from the United States, the European Union and Brazil are analyzed. Moreover, practical solutions encountered for the implementation of a cell therapy center appropriate for the preparation and supply of cultured cells for clinical studies are described. Development stages involved the planning and preparation of the project, the construction of the facility, standardization of laboratory procedures and development of systems to prevent cross contamination. Combining the theoretical knowledge of research centers involved in the study of cells with the practical experience of blood therapy services that manage structures for cell transplantation is presented as the best potential for synergy to meet the demands to implement cell therapy centers.

  2. Differential heat shock response of primary human cell cultures and established cell lines

    DEFF Research Database (Denmark)

    Richter, W W; Issinger, O G

    1986-01-01

    degrees C treatment, whereas in immortalized cell lines usually 90% of the cells were found in suspension. Enhanced expression of the major heat shock protein (hsp 70) was found in all heat-treated cells. In contrast to the primary cell cultures, established and transformed cell lines synthesized a...

  3. The replacement of serum by hormones in cell culture media.

    Science.gov (United States)

    Sato, G; Hayashi, I

    1976-12-01

    The replacement of serum by hormones in cell culture media. (Reemplazo del suero por hormonas en el medio de cultivo de células). Arch. Biol. Med. Exper. 10: 120-121, 1976. The serum used in cell culture media can be replaced by a mixture of hormones and some accesory blood factors. The pituitary cell line GH3 can be grown in a medium in which serum is replaced by triiodothyronine, transferrin, parathormone, tyrotrophin releasing hormone and somatomedins. Hela and BHK cell strains can also be grown in serum free medium supplemented with hormones. Each cell type appears to have different hormonal requirements yet it may found that some hormones are required for most cell types.

  4. The replacement of serum by hormones in cell culture media.

    Science.gov (United States)

    Sato, G; Hayashi, I

    1976-12-01

    The replacement of serum by hormones in cell culture media. (Reemplazo del suero por hormonas en el medio de cultivo de células). Arch. Biol. Med. Exper. 10: 120-121, 1976. The serum used in cell culture media can be replaced by a mixture of hormones and some accesory blood factors. The pituitary cell line GH3 can be grown in a medium in which serum is replaced by triiodothyronine, transferrin, parathormone, tyrotrophin releasing hormone and somatomedins. Hela and BHK cell strains can also be grown in serum free medium supplemented with hormones. Each cell type appears to have different hormonal requirements yet it may found that some hormones are required for most cell types. PMID:1026199

  5. Continuous culture of immobilized streptomyces cells for kasugamycin production.

    Science.gov (United States)

    Kim, C J; Chang, Y K; Chun, G T; Jeong, Y H; Lee, S J

    2001-01-01

    Continuous cultures of immobilized Streptomyces kasugaensis, a kasugamycin producer, were carried out on Celite beads. When using a prototype separator for immobilized-cell separation and recycling, the continuous operation could not be sustained for an extended period as a result of an excessive loss of immobilized cells caused by the poor performance of the separator. Accordingly, the immobilized-cell separator was revised to provide better immobilized-cell settling and thus recycling into the reactor. In a subsequent culture using the revised separator, a stable operation was maintained for over 820 h with a high kasugamycin productivity. The kasugamycin productivity ranged from 9.8 to 16.1 mg/L/h, which was about 14- to 23-fold higher than that in a batch suspended-cell culture. When the original feeding medium concentration was doubled at the end of the continuous culture, the productivity became severely impaired for several reasons, which will be discussed. An excessive formation of free cells and loss of immobilized cells through the separator were also observed. PMID:11386865

  6. Isolation, culture and characterization of primary mouse RPE cells.

    Science.gov (United States)

    Fernandez-Godino, Rosario; Garland, Donita L; Pierce, Eric A

    2016-07-01

    Mouse models are powerful tools for the study of ocular diseases. Alterations in the morphology and function of the retinal pigment epithelium (RPE) are common features shared by many ocular disorders. We report a detailed protocol to collect, seed, culture and characterize RPE cells from mice. We describe a reproducible method that we previously developed to collect and culture murine RPE cells on Transwells as functional polarized monolayers. The collection of RPE cells takes ∼3 h, and the cultures mimic in vivo RPE cell features within 1 week. This protocol also describes methods to characterize the cells on Transwells within 1-2 weeks by transmission and scanning electron microscopy (TEM and SEM, respectively), immunostaining of vibratome sections and flat mounts, and measurement of transepithelial electrical resistance. The RPE cell cultures are suitable to study the biology of the RPE from wild-type and genetically modified strains of mice between the ages of 10 d and 12 months. The RPE cells can also be manipulated to investigate molecular mechanisms underlying the RPE pathology in the numerous mouse models of ocular disorders. Furthermore, modeling the RPE pathology in vitro represents a new approach to testing drugs that will help accelerate the development of therapies for vision-threatening disorders such as macular degeneration (MD). PMID:27281648

  7. A novel closed cell culture device for fabrication of corneal epithelial cell sheets.

    Science.gov (United States)

    Nakajima, Ryota; Kobayashi, Toyoshige; Moriya, Noboru; Mizutani, Manabu; Kan, Kazutoshi; Nozaki, Takayuki; Saitoh, Kazuo; Yamato, Masayuki; Okano, Teruo; Takeda, Shizu

    2015-11-01

    Automation technology for cell sheet-based tissue engineering would need to optimize the cell sheet fabrication process, stabilize cell sheet quality and reduce biological contamination risks. Biological contamination must be avoided in clinical settings. A closed culture system provides a solution for this. In the present study, we developed a closed culture device called a cell cartridge, to be used in a closed cell culture system for fabricating corneal epithelial cell sheets. Rabbit limbal epithelial cells were cultured on the surface of a porous membrane with 3T3 feeder cells, which are separate from the epithelial cells in the cell cartridges and in the cell-culture inserts as a control. To fabricate the stratified cell sheets, five different thicknesses of the membranes which were welded to the cell cartridge, were examined. Multilayered corneal epithelial cell sheets were fabricated in cell cartridges that were welded to a 25 µm-thick gas-permeable membrane, which was similar to the results with the cell-culture inserts. However, stratification of corneal epithelial cell sheets did not occur with cell cartridges that were welded to 100-300 µm-thick gas-permeable membranes. The fabricated cell sheets were evaluated by histological analyses to examine the expression of corneal epithelial-specific markers. Immunohistochemical analyses showed that a putative stem cell marker, p63, a corneal epithelial differentiation maker, CK3, and a barrier function marker, Claudin-1, were expressed in the appropriate position in the cell sheets. These results suggest that the cell cartridge is effective for fabricating corneal epithelial cell sheets.

  8. Culture of Neural Stem Cells in Calcium-alginate Microbeads

    Institute of Scientific and Technical Information of China (English)

    Li-Song YAO; Tian-Qing LIU; Dan GE; Xue-Hu MA; Zhan-Feng CUI

    2005-01-01

    @@ 1 Introduction Recent research shows that neural stem cells may play an important role in the nerve injury reparation and nerve disease treatment. The shortage of the source and the number of NSCs, however, is the main challenge for its clinic application. In this situation, expansion of NSCs in large scale and culture in three dimensional environment are very worth of exploration. Notablely, the shear stress existed in bioreactors can cause serious cell injury especially for the shear sensitive cells like NSCs.

  9. Polyphosphoinositides are present in plant tissue culture cells

    International Nuclear Information System (INIS)

    Polyphosphoinositides have been isolated from wild carrot cells grown in suspension culture. This is the first report of polyphosphoinositides in plant cells. The phospholipids were identified by comigration with known standards on thin-layer plates. After overnight labeling of the cells with myo-[2-3H] inositol, the phosphoinositides as percent recovered inositol were 93% phosphatidylinositol., 3.7% lysophosphatidylinositol, 1.7% phosphatidylinositol monophosphate, 0.8% phosphatidylinositol bisphosphate

  10. Optimization of Seeding Density in Microencapsulated Recombinant CHO Cell Culture

    OpenAIRE

    Zhang, Ying; Zhou, Jing; Zhang, Xulang; Yu, Weiting; Guo, Xin; Wang, Wei; Ma, Xiaojun

    2008-01-01

    Microencapsulation technology is an alternative large-scale mammalian cell culture method. The semi-permeable membrane of the microcapsule allows free diffusion of nutrients, oxygen and toxic metabolites to support cell growth, and the microcapsule membrane can protect the cells from the mechanical damage of shear forces associated with agitation and aeration. Many polymers have been used to make microcapsules, such as chitosan, polyacrylates, alginate, polyamino acids, and polyamides. One of...

  11. Culture of Neural Stem Cells in Calcium-alginate Microbeads

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    1 Introduction Recent research shows that neural stem cells may play an important role in the nerve injury reparation and nerve disease treatment. The shortage of the source and the number of NSCs, however, is the main challenge for its clinic application. In this situation, expansion of NSCs in large scale and culture in three dimensional environment are very worth of exploration. Notablely, the shear stress existed in bioreactors can cause serious cell injury especially for the shear sensitive cells like ...

  12. Formation and action of oxygen activated species in cell cultures

    International Nuclear Information System (INIS)

    The differences of hydrogen peroxide sensibility of mammal cell lineages (man, mouse, chinese hamster) in culture are studied. The cellular survival and the frequency of DNA induced breaks by hydrogen peroxide are analysed. The efficiency of elimination of DNA breaks by cells is determined. The possible relation between the cell capacity of repair and its survival to hydrogen peroxide action is also discussed. (M.A.)

  13. Culturing Human Pluripotent and Neural Stem Cells in an Enclosed Cell Culture System for Basic and Preclinical Research.

    Science.gov (United States)

    Stover, Alexander E; Herculian, Siranush; Banuelos, Maria G; Navarro, Samantha L; Jenkins, Michael P; Schwartz, Philip H

    2016-01-01

    This paper describes how to use a custom manufactured, commercially available enclosed cell culture system for basic and preclinical research. Biosafety cabinets (BSCs) and incubators have long been the standard for culturing and expanding cell lines for basic and preclinical research. However, as the focus of many stem cell laboratories shifts from basic research to clinical translation, additional requirements are needed of the cell culturing system. All processes must be well documented and have exceptional requirements for sterility and reproducibility. In traditional incubators, gas concentrations and temperatures widely fluctuate anytime the cells are removed for feeding, passaging, or other manipulations. Such interruptions contribute to an environment that is not the standard for cGMP and GLP guidelines. These interruptions must be minimized especially when cells are utilized for therapeutic purposes. The motivation to move from the standard BSC and incubator system to a closed system is that such interruptions can be made negligible. Closed systems provide a work space to feed and manipulate cell cultures and maintain them in a controlled environment where temperature and gas concentrations are consistent. This way, pluripotent and multipotent stem cells can be maintained at optimum health from the moment of their derivation all the way to their eventual use in therapy. PMID:27341536

  14. Culturing Human Pluripotent and Neural Stem Cells in an Enclosed Cell Culture System for Basic and Preclinical Research

    Science.gov (United States)

    Stover, Alexander E.; Herculian, Siranush; Banuelos, Maria G.; Navarro, Samantha L.; Jenkins, Michael P.; Schwartz, Philip H.

    2016-01-01

    This paper describes how to use a custom manufactured, commercially available enclosed cell culture system for basic and preclinical research. Biosafety cabinets (BSCs) and incubators have long been the standard for culturing and expanding cell lines for basic and preclinical research. However, as the focus of many stem cell laboratories shifts from basic research to clinical translation, additional requirements are needed of the cell culturing system. All processes must be well documented and have exceptional requirements for sterility and reproducibility. In traditional incubators, gas concentrations and temperatures widely fluctuate anytime the cells are removed for feeding, passaging, or other manipulations. Such interruptions contribute to an environment that is not the standard for cGMP and GLP guidelines. These interruptions must be minimized especially when cells are utilized for therapeutic purposes. The motivation to move from the standard BSC and incubator system to a closed system is that such interruptions can be made negligible. Closed systems provide a work space to feed and manipulate cell cultures and maintain them in a controlled environment where temperature and gas concentrations are consistent. This way, pluripotent and multipotent stem cells can be maintained at optimum health from the moment of their derivation all the way to their eventual use in therapy. PMID:27341536

  15. A biocompatible micro cell culture chamber (mu CCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, Anders Michael;

    2006-01-01

    We have previously shown that a polymeric (PMMA) chip with medium perfusion and integrated heat regulation provides sufficiently precise heat regulation, pH-control and medium exchange to support cell growth for weeks. However, it was unclear how closely the cells cultured in the chip resembled c...

  16. Expression of CD44 in Cultured Human Trabecular Meshwork Cells

    Institute of Scientific and Technical Information of China (English)

    Zhongguo Li; Hong Zhang

    2004-01-01

    Purpose:To determine whether cultured human trabecular meshwork cells express CD44 and to discuss their possible relationship with primary open angle glaucoma.Methods:Human trabecular meshwork cells were cultured in DMEM/F12 media. Total RNAs from the cells were extracted with Trizol reagent. Messenger RNA expression of CD44 in human trabecular meshwork cells was examined by using reverse transcriptasepolymerase chain reaction ( RT-PCR ) analysis. Expression of CD44 was confirmed by Western-blotting and immunofiuorescent microscopy. Effect of CD44-specific antisense oligonucleotide on adhesion of trabecular meshwork cells to hyaluronate was determined by MTT assay.Results:A single RT-PCR product whose size was 471bp was obtained.A band about 80kD was stained by Western-blot. Immunofiuorescent examination of expression of CD44 on the cell surface was positive and reactions were mainly localized in cell membranes.Adhesion of trabecular meshwork cells to hyaluronate was inhibited by CD44-specific antisense oligonucleotide.Conclusions: Cultured human trabecular meshwork cells express CD44. CD44 may play a role in pathogenesis of primary open angle glaucoma. Eye Science 2004;20:52-56.

  17. Metabolic measurements in cell culture and tissue constructs

    Science.gov (United States)

    Rolfe, P.

    2008-10-01

    This paper concerns the study and use of biological cells in which there is a need for sensors and assemblies for the measurement of a diverse range of physical and chemical variables. In this field cell culture is used for basic research and for applications such as protein and drug synthesis, and in cell, tissue and organ engineering. Metabolic processes are fundamental to cell behaviour and must therefore be monitored reliably. Basic metabolic studies measure the transport of oxygen, glucose, carbon dioxide, lactic acid to, from, or within cells, whilst more advanced research requires examination of energy storage and utilisation. Assemblies are designed to incorporate bioreactor functions for cell culture together with appropriate sensing devices. Oxygen consumption by populations of cells is achieved in a flowthrough assembly that incorporates O2 micro-sensors based on either amperometry or fluorescence. Measurements in single cell are possible with intra-cellular fluorophores acting as biosensors together with optical stimulation and detection. Near infra-red spectroscopy (NIRS) is used for analysis within culture fluid, for example for estimation of glucose levels, as well as within cell populations, for example to study the respiratory enzymes.Â#

  18. Specimen Sample Preservation for Cell and Tissue Cultures

    Science.gov (United States)

    Meeker, Gabrielle; Ronzana, Karolyn; Schibner, Karen; Evans, Robert

    1996-01-01

    The era of the International Space Station with its longer duration missions will pose unique challenges to microgravity life sciences research. The Space Station Biological Research Project (SSBRP) is responsible for addressing these challenges and defining the science requirements necessary to conduct life science research on-board the International Space Station. Space Station will support a wide range of cell and tissue culture experiments for durations of 1 to 30 days. Space Shuttle flights to bring experimental samples back to Earth for analyses will only occur every 90 days. Therefore, samples may have to be retained for periods up to 60 days. This presents a new challenge in fresh specimen sample storage for cell biology. Fresh specimen samples are defined as samples that are preserved by means other than fixation and cryopreservation. The challenge of long-term storage of fresh specimen samples includes the need to suspend or inhibit proliferation and metabolism pending return to Earth-based laboratories. With this challenge being unique to space research, there have not been any ground based studies performed to address this issue. It was decided hy SSBRP that experiment support studies to address the following issues were needed: Fixative Solution Management; Media Storage Conditions; Fresh Specimen Sample Storage of Mammalian Cell/Tissue Cultures; Fresh Specimen Sample Storage of Plant Cell/Tissue Cultures; Fresh Specimen Sample Storage of Aquatic Cell/Tissue Cultures; and Fresh Specimen Sample Storage of Microbial Cell/Tissue Cultures. The objective of these studies was to derive a set of conditions and recommendations that can be used in a long duration microgravity environment such as Space Station that will permit extended storage of cell and tissue culture specimens in a state consistent with zero or minimal growth, while at the same time maintaining their stability and viability.

  19. Enhanced casein kinase II activity in human tumour cell cultures

    DEFF Research Database (Denmark)

    Prowald, K; Fischer, H; Issinger, O G

    1984-01-01

    Casein kinase II (CKII) activity is enhanced as much as 2-3 fold in established and 4-5-fold in transformed human cell lines when compared to that of fibroblasts and primary human tumour cell cultures where CKII activity never exceeded a basic level. The high activity of CKII in transformed cells...... and in established cell lines was reduced to about the same basic level after treatment with heparin, a highly specific inhibitor of CKII activity. The activity of the cAMP-dependent protein kinase was virtually the same in fibroblasts and various human tumour cell lines investigated....

  20. Multidimensional fractionation is a requirement for quantitation of Golgi-resident glycosylation enzymes from cultured human cells.

    Science.gov (United States)

    Lin, Chi-Hung; Chik, Jenny H L; Packer, Nicolle H; Molloy, Mark P

    2015-02-01

    Glycosylation results from the concerted action of glycosylation enzymes in the secretory pathway. In general, gene expression serves as the primary control mechanism, but post-translational fine-tuning of glycosylation enzyme functions is often necessary for efficient synthesis of specific glycan epitopes. While the field of glycomics has rapidly advanced, there lacks routine proteomic methods to measure expression of specific glycosylation enzymes needed to fill the gap between mRNA expression and the glycomic profile in a "reverse genomics" workflow. Toward developing this workflow we enriched Golgi membranes from two human colon cancer cell lines by sucrose density centrifugation and further mass-based fractionation by SDS-PAGE. We then applied mass spectrometry to demonstrate a doubling in the number of Golgi resident proteins identified, compared to the unenriched, low speed centrifuged supernatant of lysed cells. A total of 35 Golgi-resident glycosylation enzymes, of which 23 were glycosyltransferases, were identified making this the largest protein database so far of Golgi resident glycosylation enzymes experimentally identified in cultured human cells. We developed targeted mass spectrometry assays for specific quantitation of many of these glycosylation enzymes. Our results show that alterations in abundance of glycosylation enzymes at the protein level were generally consistent with the resultant glycomic profiles, but not necessarily with the corresponding glycosyltransferase mRNA expression as exemplified by the case of O-glycan core 1 T synthase.

  1. Cell Wall Polysaccharides of Candida albicans Induce Mast Cell Degranulation in the Gut

    OpenAIRE

    Sakurai, Atsuko; Yamaguchi, Natsu; Sonoyama, Kei

    2012-01-01

    We investigated Candida albicans-induced mast cell degranulation in vitro and in vivo. Cell wall fraction but not culture supernatant and cell membrane fraction prepared from hyphally grown C. albicans induced β-hexosaminidase release in RBL-2H3 cells. Cell wall mannan and soluble β-glucan fractions also induced β-hexosaminidase release. Histological examination of mouse forestomach showed that C. albicans gut colonization induces mast cell degranulation. However, intragastric administration ...

  2. Isolation, culture, and transplantation of muscle satellite cells.

    Science.gov (United States)

    Motohashi, Norio; Asakura, Yoko; Asakura, Atsushi

    2014-01-01

    Muscle satellite cells are a stem cell population required for postnatal skeletal muscle development and regeneration, accounting for 2-5% of sublaminal nuclei in muscle fibers. In adult muscle, satellite cells are normally mitotically quiescent. Following injury, however, satellite cells initiate cellular proliferation to produce myoblasts, their progenies, to mediate the regeneration of muscle. Transplantation of satellite cell-derived myoblasts has been widely studied as a possible therapy for several regenerative diseases including muscular dystrophy, heart failure, and urological dysfunction. Myoblast transplantation into dystrophic skeletal muscle, infarcted heart, and dysfunctioning urinary ducts has shown that engrafted myoblasts can differentiate into muscle fibers in the host tissues and display partial functional improvement in these diseases. Therefore, the development of efficient purification methods of quiescent satellite cells from skeletal muscle, as well as the establishment of satellite cell-derived myoblast cultures and transplantation methods for myoblasts, are essential for understanding the molecular mechanisms behind satellite cell self-renewal, activation, and differentiation. Additionally, the development of cell-based therapies for muscular dystrophy and other regenerative diseases are also dependent upon these factors. However, current prospective purification methods of quiescent satellite cells require the use of expensive fluorescence-activated cell sorting (FACS) machines. Here, we present a new method for the rapid, economical, and reliable purification of quiescent satellite cells from adult mouse skeletal muscle by enzymatic dissociation followed by magnetic-activated cell sorting (MACS). Following isolation of pure quiescent satellite cells, these cells can be cultured to obtain large numbers of myoblasts after several passages. These freshly isolated quiescent satellite cells or ex vivo expanded myoblasts can be transplanted

  3. A microwell cell culture platform for the aggregation of pancreatic β-cells.

    Science.gov (United States)

    Bernard, Abigail B; Lin, Chien-Chi; Anseth, Kristi S

    2012-08-01

    Cell-cell contact between pancreatic β-cells is important for maintaining survival and normal insulin secretion. Various techniques have been developed to promote cell-cell contact between β-cells, but a simple yet robust method that affords precise control over three-dimensional (3D) β-cell cluster size has not been demonstrated. To address this need, we developed a poly(ethylene glycol) (PEG) hydrogel microwell platform using photolithography. This microwell cell-culture platform promotes the formation of 3D β-cell aggregates of defined sizes from 25 to 210 μm in diameter. Using this platform, mouse insulinoma 6 (MIN6) β-cells formed aggregates with cell-cell adherin junctions. These naturally formed cell aggregates with controllable sizes can be removed from the microwells for macroencapsulation, implantation, or other biological assays. When removed and subsequently encapsulated in PEG hydrogels, the aggregated cell clusters demonstrated improved cellular viability (>90%) over 7 days in culture, while the β-cells encapsulated as single cells maintained only 20% viability. Aggregated MIN6 cells also exhibited more than fourfold higher insulin secretion in response to a glucose challenge compared with encapsulated single β-cells. Further, the cell aggregates stained positively for E-cadherin, indicative of the formation of cell junctions. Using this hydrogel microwell cell-culture method, viable and functional β-cell aggregates of specific sizes were created, providing a platform from which other biologically relevant questions may be answered. PMID:22320435

  4. Experimental study of bioartificial liver with cultured human liver cells

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    AIM To establish an extracorporeal bioartificial liver support system (EBLSS) using cultured human liver cells and to study its support effect for fulminant hepatic failure (FHF).METHODS The liver support experiment of EBLSS consisting of aggregates cultured human liver cells, hollow fiber bioreactor, and circulation unit was carried out in dizhepatic dogs.RESULTS The viability of isolated hepatocytes and nonparenchymal liver cells reached 96%. These cells were successfully cultured as multicellular spheroids with synthetic technique. The typical morphological appearance was retained up to the end of the artificial liver experiment. Compared with the control dogs treated with EBLSS without liver cells, the survival time of artificial liver support dogs was significantly prolonged. The changes of blood pressure, heart rate and ECG were slow. Both serum ammonia and lactate levels were significantly lowered at the 3rd h and 5th h. In addition, a good viability of human liver cells was noted after 5 h experiment.CONCLUSION EBLSS playing a metabolic role of cultured human hepatocytes, is capable of compensating the function of the liver, and could provide effective artificial liver support and therapy for patients with FHF.

  5. [In vitro cell culture technology in cosmetology research].

    Science.gov (United States)

    Gojniczek, Katarzyna; Garncarczyk, Agnieszka; Pytel, Agata

    2005-01-01

    For ages the humanity has been looking for all kind of active substances, which could be used in improving the health and the appearance of our skin. People try to find out how to protect the skin from harmful, environmental factors. Every year a lot of new natural and synthetic, chemical substances are discovered. All of them potentially could be used as a cosmetic ingredient. In cosmetology research most of new xenobiotics were tested in vivo on animals. Alternative methods to in vivo tests are in vitro tests with skin cell culture system. The aim of this work was to describe two-dimensional and tree-dimensional skin cell cultures. Additionally, in this work we wanted to prove the usefulness of in vitro skin cell cultures in cosmetology research.

  6. Batch variation between branchial cell cultures: An analysis of variance

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Grosell, M.; Kristensen, L.

    2003-01-01

    We present in detail how a statistical analysis of variance (ANOVA) is used to sort out the effect of an unexpected batch-to-batch variation between cell cultures. Two separate cultures of rainbow trout branchial cells were grown on permeable filtersupports ("inserts"). They were supposed...... and introducing the observed difference between batches as one of the factors in an expanded three-dimensional ANOVA, we were able to overcome an otherwisecrucial lack of sufficiently reproducible duplicate values. We could thereby show that the effect of changing the apical medium was much more marked when...... the radioactive lipid precursors were added on the apical, rather than on the basolateral, side. Theinsert cell cultures were obviously polarized. We argue that it is not reasonable to reject troublesome experimental results, when we do not know a priori that something went wrong. The ANOVA is a very useful...

  7. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tissue culture media for human ex vivo tissue and cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell...

  8. Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge.

    Science.gov (United States)

    Pestana, Carlos J; Reeve, Petra J; Sawade, Emma; Voldoire, Camille F; Newton, Kelly; Praptiwi, Radisti; Collingnon, Lea; Dreyfus, Jennifer; Hobson, Peter; Gaget, Virginie; Newcombe, Gayle

    2016-09-15

    In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. PMID:27265732

  9. A Simple Hydrophilic Treatment of SU-8 Surfaces for Cell Culturing and Cell Patterning

    DEFF Research Database (Denmark)

    Wang, Zhenyu; Stangegaard, Michael; Dufva, Hans Martin;

    2005-01-01

    SU-8, an epoxy-based photoresist, widely used in constitution different mTAS systems, is incompatible with mammalian cell adhesion and culture in its native form. Here, we demonstrate a simple, cheap and robust two-step method to render a SU-8 surface hydrophilic and compatible with cell culture...

  10. Lingual Epithelial Stem Cells and Organoid Culture of Them.

    Science.gov (United States)

    Hisha, Hiroko; Tanaka, Toshihiro; Ueno, Hiroo

    2016-01-28

    As tongue cancer is one of the major malignant cancers in the world, understanding the mechanism of maintenance of lingual epithelial tissue, which is known to be the origin of tongue cancer, is unquestionably important. However, the actual stem cells that are responsible for the long-term maintenance of the lingual epithelium have not been identified. Moreover, a simple and convenient culture method for lingual epithelial stem cells has not yet been established. Recently, we have shown that Bmi1-positive cells, residing at the second or third layer of the epithelial cell layer at the base of the interpapillary pit (IPP), were slow-cycling and could supply keratinized epithelial cells for over one year, indicating that Bmi1-positive cells are long-term lingual epithelial stem cells. In addition, we have developed a novel lingual epithelium organoid culture system using a three-dimensional matrix and growth factors. Here, we discuss current progress in the identification of lingual stem cells and future applications of the lingual culture system for studying the regulatory mechanisms of the lingual epithelium and for regenerative medicine.

  11. Treatment of Mycoplasma Contamination in Cell Cultures with Plasmocin

    Directory of Open Access Journals (Sweden)

    Cord C. Uphoff

    2012-01-01

    Full Text Available A high percentage of cell lines are chronically infected with various mycoplasma species. The addition of antibiotics that are particularly effective against these contaminants to the culture medium during a limited period of time is a simple, inexpensive, and very practical approach for decontaminating cell cultures. Here, we examined the effectiveness of the new antimycoplasma compound Plasmocin that has been employed routinely to cleanse chronically infected cell lines. In a first round of treatment 45 out of 58 (78% mycoplasma-positive cell lines could be cured. In a second attempt using back-up cryopreserved original cells, four additional cell lines were cured; thus, the overall cure rate was 84%. Even if the mycoplasma contamination was not eradicated by Plasmocin, the parallel treatment with several other antibiotics (Baytril, BM-Cyclin, Ciprobay, MRA, or MycoZap led to the cure of all 58 cell lines. The successful decontamination was permanent as mycoplasmas were no longer detected at day +14 posttreatment and at later time points as examined by PCR which is the most sensitive and specific mycoplasma detection method. Collectively, our results highlight certain antibiotics as effective antimycoplasma reagents and support the therapeutic rationale for their use in the eradication of this notorious cell culture contaminant.

  12. Biological Effects of Culture Substrates on Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Yohei Hayashi

    2016-01-01

    Full Text Available In recent years, as human pluripotent stem cells (hPSCs have been commonly cultured in feeder-free conditions, a number of cell culture substrates have been applied or developed. However, the functional roles of these substrates in maintaining hPSC self-renewal remain unclear. Here in this review, we summarize the types of these substrates and their effect on maintaining hPSC self-renewal. Endogenous extracellular matrix (ECM protein expression has been shown to be crucial in maintaining hPSC self-renewal. These ECM molecules interact with integrin cell-surface receptors and transmit their cellular signaling. We discuss the possible effect of integrin-mediated signaling pathways on maintaining hPSC self-renewal. Activation of integrin-linked kinase (ILK, which transmits ECM-integrin signaling to AKT (also known as protein kinase B, has been shown to be critical in maintaining hPSC self-renewal. Also, since naïve pluripotency has been widely recognized as an alternative pluripotent state of hPSCs, we discuss the possible effects of culture substrates and integrin signaling on naïve hPSCs based on the studies of mouse embryonic stem cells. Understanding the role of culture substrates in hPSC self-renewal and differentiation enables us to control hPSC behavior precisely and to establish scalable or microfabricated culture technologies for regenerative medicine and drug development.

  13. Isolated Cells of Porphyra yezoensis Cultured on Solid Medium

    Institute of Scientific and Technical Information of China (English)

    沈颂东; 戴继勋

    2001-01-01

    Vegetative cells of Porphyra yezoensis are isolated with sea snail enzyme and cultured on the solidified agar medium. The results of experiments show that the isolated cells can survive,divide and regenerate well on the medium solidified with agar. The first division on the solid medium starts after 7 days' culture, 4 days later than the liquid culture. The survival rate of isolated cells is 71.3% on the solid medium, lower than the 86.2% of that in seawater.Thalli, thalloids,conchocelis, spermatangia and multicellular masses are developed on the solid/medium in the first month, slowly but normally. Spermatangia sacs disappear within 4 weeks. Without adding nutrient liquid onto the surface of solid medium or injecting seawater under the agar layer in order to keep moisture, the thalli and cell groups release monospores to form new thalli instead of enlarging their areas after 5 weeks' culturing. Some monospores regenerate new thalli. Other monospores lose their pigments and minimize their volume and divide quickly to form light pink calli. After 16 weeks, numerous calli can be seen on the solid medium and after 24 weeks' culturing, almost only calli and conchocelis can be seen. If the calli are immersed in seawater, the monospores are released and may develop into young thallus.

  14. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions

    OpenAIRE

    Saha, Krishanu; Mei, Ying; Reisterer, Colin M.; Pyzocha, Neena Kenton; Yang, Jing; Muffat, Julien; Davies, Martyn C.; Alexander, Morgan R.; Langer, Robert; Anderson, Daniel G.; Jaenisch, Rudolf

    2011-01-01

    The current gold standard for the culture of human pluripotent stem cells requires the use of a feeder layer of cells. Here, we develop a spatially defined culture system based on UV/ozone radiation modification of typical cell culture plastics to define a favorable surface environment for human pluripotent stem cell culture. Chemical and geometrical optimization of the surfaces enables control of early cell aggregation from fully dissociated cells, as predicted from a numerical model of cell...

  15. Condition medium of HepG-2 cells induces the transdifferentiation of human umbilical cord mesenchymal stem cells into cancerous mesenchymal stem cells.

    Science.gov (United States)

    Yang, Juan; Miao, Yinglei; Chang, Yefei; Zhang, Fan; Wang, Yubo; Zheng, Sheng

    2016-01-01

    This study aimed to investigate the transdifferentiation of human umbilical cord mesenchymal stem cells (hUCMSCs) into cancer-associated mesenchymal stem cells (CA-MSCs) after incubation with condition medium (CM) from liver cancer HepG-2 cells, and the biobehaviors (proliferation and migration) of these CA-MSCs were further evaluated. The supernatant of HepG-2 cells was collected and mixed with equal volume of low glucose DMEM. The resultant medium was used to treat hUCMSCs for 48 h. The expression of CA-MSCs related proteins and miR-221 was detected in cells. The supernatant of induced hUCMSCs was mixed with equal volume of high glucose DMEM, and the resultant medium was used treat HepG-2 cells for 48 h and the proliferation and migration of HepG-2 cells were evaluated. Moreover, HepG-2 cells were co-cultured with hUCMSCs and then the proliferation and migration of HepG-2 cells were assessed. After incubation with the supernatant from HepG-2 cells, hUCMSCs showed significantly elevated expression of vimentin, fibroblast activation protein (FAP) and miR-221. The supernatant of induced hUCMSCs was able to significantly increase the proliferation and migration of HepG-2 cells. Following co-culture, the proliferation and migration of HepG-2 cells increased dramatically. These findings suggest that the supernatant of HepG-2 cells is able to induce the phenotype of CA-MSCs and the supernatant of CA-MSCs may promote the proliferation and migration of HepG-2 cells. These findings provide experimental evidence for the cellular remodeling in tumor microenvironment and the safety of clinical use of hUCMSCs. PMID:27648133

  16. Cell sources for in vitro human liver cell culture models.

    Science.gov (United States)

    Zeilinger, Katrin; Freyer, Nora; Damm, Georg; Seehofer, Daniel; Knöspel, Fanny

    2016-09-01

    In vitro liver cell culture models are gaining increasing importance in pharmacological and toxicological research. The source of cells used is critical for the relevance and the predictive value of such models. Primary human hepatocytes (PHH) are currently considered to be the gold standard for hepatic in vitro culture models, since they directly reflect the specific metabolism and functionality of the human liver; however, the scarcity and difficult logistics of PHH have driven researchers to explore alternative cell sources, including liver cell lines and pluripotent stem cells. Liver cell lines generated from hepatomas or by genetic manipulation are widely used due to their good availability, but they are generally altered in certain metabolic functions. For the past few years, adult and pluripotent stem cells have been attracting increasing attention, due their ability to proliferate and to differentiate into hepatocyte-like cells in vitro However, controlling the differentiation of these cells is still a challenge. This review gives an overview of the major human cell sources under investigation for in vitro liver cell culture models, including primary human liver cells, liver cell lines, and stem cells. The promises and challenges of different cell types are discussed with a focus on the complex 2D and 3D culture approaches under investigation for improving liver cell functionality in vitro Finally, the specific application options of individual cell sources in pharmacological research or disease modeling are described. PMID:27385595

  17. Metabolic flux rewiring in mammalian cell cultures

    OpenAIRE

    Young, Jamey D.

    2013-01-01

    Continuous cell lines (CCLs) engage in “wasteful” glucose and glutamine metabolism that leads to accumulation of inhibitory byproducts, primarily lactate and ammonium. Advances in techniques for mapping intracellular carbon fluxes and profiling global changes in enzyme expression have led to a deeper understanding of the molecular drivers underlying these metabolic alterations. However, recent studies have revealed that CCLs are not necessarily entrenched in a glycolytic or glutaminolytic phe...

  18. Culture and characterization of rat hair follicle stem cells.

    Science.gov (United States)

    Quan, Renfu; Zheng, Xuan; Ni, Yueming; Xie, Shangju; Li, Changming

    2016-08-01

    The purpose of this study was to establish methods for isolation, culture, expansion, and characterization of rat hair follicle stem cells (rHFSCs). Hair follicles were harvested from 1-week-old Sprague-Dawley rats and digested with dispase and collagenase IV. The bulge of the hair follicle was dissected under a microscope and cultured in Dulbecco's modified Eagle's medium/F12 supplemented with KnockOut™ Serum Replacement serum substitute, penicillin-streptomycin, L-glutamine, non-essential amino acids, epidermal growth factor, basic fibroblast growth factor, polyhydric alcohol, and hydrocortisone. The rHFSCs were purified using adhesion to collagen IV. Cells were characterized by detecting marker genes with immunofluorescent staining and real-time polymerase chain reaction (PCR). The proliferation and vitality of rHFSCs at different passages were evaluated. The cultured rHFSCs showed typical cobblestone morphology with good adhesion and colony-forming ability. Expression of keratin 15, integrin α6, and integrin β1 were shown by immunocytochemistry staining. On day 1-2, the cells were in the latent phase. On day 5-6, the cells were in the logarithmic phase. Cell vitality gradually decreased from the 7th passage. Real-time PCR showed that the purified rHFSCs had good vitality and proliferative capacity and contained no keratinocytes. Highly purified rHFSCs can be obtained using tissue culture and adhesion to collagen IV. The cultured cells had good proliferative capacity and could therefore be a useful cell source for tissue-engineered hair follicles, vessels, and skin. PMID:25407732

  19. Influence of leptin on luteinizing hormone and follicle stimulating hormone secreted from cultured rat anterior pituitary cells

    Institute of Scientific and Technical Information of China (English)

    Yuebing Qiao; Xiuyan Ma; Huixian Cui

    2008-01-01

    BACKGROUND: Leptin may regulate reproductive function via release of hypothalamic neuropeptide Y. However, it is unknown whether this regulatory effect is limited to the hypothalamus. OBJECTIVE: To detect the effect of different dosages of leptin on luteinizing hormone (LH) and follicle stimulating hormone (FSH) secretion from in vitro cultured rat anterior pituitary cells. DESIGN: Contrast study based on cells. SETTING: This study was performed in the Basic Institute of Chengde Medical College, Chengde City, Hebei Province, China from March to June 2007. MATERIALS: Eighteen female Wistar rats of three months of age, weighing 200-220 g, and of clean grade were used. Leptin was provided by Peprotech Company, DMEM culture medium by Invitrogen Company, and the radioimmunological kit by Beijing Zhongshan Jinqiao Biotechnology Co., Ltd. METHODS: Three glandular organs were regarded as one group for culture of anterior pituitary cells. In the control group, saline was added to the culture medium instead of leptin. In the leptin group, leptin was prepared into different concentrations of 1×10-12, 1×10-11, 1×10-9, 1×10-7, and 1×10-6 mol/L for stimulation of cultured cells. The culture supernatant was obtained at three hours after additional of saline/leptin. MAIN OUTCOME MEASURES: Contents of LH and FSH were detected by radioimmunology. RESULTS: Following leptin stimulation, LH release increased with increasing concentrations of leptin up to 1×10-9 mol/L, where LH release peaked. LH release then progressively decreased with increasing leptin concentrations (P<0.01). LH release in the leptin (1×10-12, 1×10-11, 1×10-7, and 1×10-6 mol/L) groups was significantly higher than that in the control group (P<0.01). FSH content in the leptin (1×10-11, 1×10-9, and 1×10-7 mol/L) groups was significantly higher than that in the control group (P<0.01). CONCLUSION: Leptin can directly affect pituitary tissue to promote the secretion of LH and FSH in a dose-dependent manner.

  20. Cell culture systems for the hepatitis C virus

    Institute of Scientific and Technical Information of China (English)

    Gilles Duverlie; Czeslaw Wychowski

    2007-01-01

    Since the discovery of HCV in 1989, the lack of a cell culture system has hampered research progress on this important human pathogen. No robust system has been obtained by empiric approaches, and HCV cell culture remained hypothetical until 2005. The construction of functional molecular clones has served as a starting point to reconstitute a consensus infectious cDNA that was able to transcribe infectious HCV RNAs as shown by intrahepatic inoculation in a chimpanzee. Other consensus clones have been selected and established in a human hepatoma cell line as replicons, i.e. self-replicating subgenomic or genomic viral RNAs. However, these replicons did not support production of infectious virus. Interestingly, some full-length replicons could be established without adaptive mutations and one of them was able to replicate at very high levels and to release virus particles that are infectious in cell culture and in vivo. This new cell culture system represents a major breakthrough in the HCV field and should enable a broad range of basic and applied studies to be achieved.

  1. PDMS/glass microfluidic cell culture system for cytotoxicity tests and cells passage

    DEFF Research Database (Denmark)

    Ziolkowska, K.; Jedrych, E.; Kwapiszewski, R.;

    2010-01-01

    In this paper, hybrid (PDMS/glass) microfluidic cell culture system (MCCS) integrated with the concentration gradient generator (CGG) is presented. PDMS gas permeability enabled cells' respiration in the fabricated microdevices and excellent glass hydrophilicity allowed successful cells' seeding....... The human lung carcinoma cells (A549) were cultured in the microdevice for several days. The growth and proliferation of cells was monitored using an inverted fluorescence microscope. After the cells' confluence was achieved in the microchambers, the novel method of cells' passaging in the designed...... microdevice was developed and successfully tested. The MCCS microdevice is fully reusable, i.e. it can be used several times for various cell culture and cytotoxic experiments. The suitability of designed MCCS for cell-based cytotoxicity assay application was verified using 1,4-dioxane as a model toxic agent...

  2. Testing of serum atherogenicity in cell cultures: questionable data published

    Directory of Open Access Journals (Sweden)

    Sergei V. Jargin

    2012-01-01

    Full Text Available In a large series of studies was reported that culturing of smooth muscle cells with serum from atherosclerosis patients caused intracellular lipid accumulation, while serum from healthy controls had no such effect. Cultures were used for evaluation of antiatherogenic drugs. Numerous substances were reported to lower serum atherogenicity: statins, trapidil, calcium antagonists, garlic derivatives etc. On the contrary, beta-blockers, phenothiazines and oral hypoglycemics were reported to be pro-atherogenic. Known antiatherogenic agents can influence lipid metabolism and cholesterol synthesis, intestinal absorption or endothelium-related mechanisms. All these targets are absent in cell monocultures. Inflammatory factors, addressed by some antiatherogenic drugs, are also not reproduced. In vivo, relationship between cholesterol uptake by cells and atherogenesis must be inverse rather than direct: in familial hypercholesterolemia, inefficient clearance of LDL-cholesterol by cells predisposes to atherosclerosis. Accordingly, if a pharmacological agent reduces cholesterol uptake by cells in vitro, it should be expected to elevate cholesterol in vivo. Validity of clinical recommendations, based on serum atherogenicity testing in cell monocultures, is therefore questionable. These considerations pertain also to the drugs developed on the basis of the cell culture experiments.

  3. Arsenic exposure induces the Warburg effect in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Fei; Severson, Paul; Pacheco, Samantha; Futscher, Bernard W.; Klimecki, Walter T., E-mail: klimecki@pharmacy.arizona.edu

    2013-08-15

    Understanding how arsenic exacts its diverse, global disease burden is hampered by a limited understanding of the particular biological pathways that are disrupted by arsenic and underlie pathogenesis. A reductionist view would predict that a small number of basic pathways are generally perturbed by arsenic, and manifest as diverse diseases. Following an initial observation that arsenite-exposed cells in culture acidify their media more rapidly than control cells, the report here shows that low level exposure to arsenite (75 ppb) is sufficient to induce aerobic glycolysis (the Warburg effect) as a generalized phenomenon in cultured human primary cells and cell lines. Expanded studies in one such cell line, the non-malignant pulmonary epithelial line, BEAS-2B, established that the arsenite-induced Warburg effect was associated with increased accumulation of intracellular and extracellular lactate, an increased rate of extracellular acidification, and inhibition by the non-metabolized glucose analog, 2-deoxy-D-glucose. Associated with the induction of aerobic glycolysis was a pathway-wide induction of glycolysis gene expression, as well as protein accumulation of an established glycolysis master-regulator, hypoxia-inducible factor 1A. Arsenite-induced alteration of energy production in human cells represents the type of fundamental perturbation that could extend to many tissue targets and diseases. - Highlights: • Chronic arsenite exposure induces aerobic glycolysis, dubbed the “Warburg effect”. • Arsenite-induced Warburg effect is a general phenomenon in cultured human cells. • HIF-1A may mediate arsenite induced Warburg effect.

  4. Arsenic exposure induces the Warburg effect in cultured human cells

    International Nuclear Information System (INIS)

    Understanding how arsenic exacts its diverse, global disease burden is hampered by a limited understanding of the particular biological pathways that are disrupted by arsenic and underlie pathogenesis. A reductionist view would predict that a small number of basic pathways are generally perturbed by arsenic, and manifest as diverse diseases. Following an initial observation that arsenite-exposed cells in culture acidify their media more rapidly than control cells, the report here shows that low level exposure to arsenite (75 ppb) is sufficient to induce aerobic glycolysis (the Warburg effect) as a generalized phenomenon in cultured human primary cells and cell lines. Expanded studies in one such cell line, the non-malignant pulmonary epithelial line, BEAS-2B, established that the arsenite-induced Warburg effect was associated with increased accumulation of intracellular and extracellular lactate, an increased rate of extracellular acidification, and inhibition by the non-metabolized glucose analog, 2-deoxy-D-glucose. Associated with the induction of aerobic glycolysis was a pathway-wide induction of glycolysis gene expression, as well as protein accumulation of an established glycolysis master-regulator, hypoxia-inducible factor 1A. Arsenite-induced alteration of energy production in human cells represents the type of fundamental perturbation that could extend to many tissue targets and diseases. - Highlights: • Chronic arsenite exposure induces aerobic glycolysis, dubbed the “Warburg effect”. • Arsenite-induced Warburg effect is a general phenomenon in cultured human cells. • HIF-1A may mediate arsenite induced Warburg effect

  5. Cell culture media impact on drug product solution stability.

    Science.gov (United States)

    Purdie, Jennifer L; Kowle, Ronald L; Langland, Amie L; Patel, Chetan N; Ouyang, Anli; Olson, Donald J

    2016-07-01

    To enable subcutaneous administration of monoclonal antibodies, drug product solutions are often needed at high concentrations. A significant risk associated with high drug product concentrations is an increase in aggregate level over the shelf-life dating period. While much work has been done to understand the impact of drug product formulation on aggregation, there is limited understanding of the link between cell culture process conditions and soluble aggregate growth in drug product. During cell culture process development, soluble aggregates are often measured at harvest using cell-free material purified by Protein A chromatography. In the work reported here, cell culture media components were evaluated with respect to their impact on aggregate levels in high concentration solution drug product during accelerated stability studies. Two components, cysteine and ferric ammonium citrate, were found to impact aggregate growth rates in our current media (version 1) leading to the development of new chemically defined media and concentrated feed formulations. The new version of media and associated concentrated feeds (version 2) were evaluated across four cell lines producing recombinant IgG4 monoclonal antibodies and a bispecific antibody. In all four cell lines, the version 2 media reduced aggregate growth over the course of a 12 week accelerated stability study compared with the version 1 media, although the degree to which aggregate growth decreased was cell line dependent. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:998-1008, 2016.

  6. Kinetics of meta-iodo-benzylguanidine in neuroblastoma cell cultures

    International Nuclear Information System (INIS)

    The continuously cultured human neuroblastoma cell line SK-N-SH possesses an active transport mechanism for uptake of meta-iodobenzylguanidine (MIBG). The uptake rate at an MIBG-concentration of 6,4x10-8 M was 0.35x10-12 mol/minx106 cells, corresponding to values as measured in human pheochromocytoma cell lines. MIBG is released from the cells with a biological half-life of 81,3 h in correspondence to half-life values as measured in vivo in neuroblastoma patients. (orig.)

  7. Effects of Visible Light on Cultured Bovine Trabecular Cells

    Institute of Scientific and Technical Information of China (English)

    姜发纲; 郝风芹; 魏厚仁; 许德胜

    2004-01-01

    To explore the biological effects of light on trabecular cells, cultured bovine trabecular cells were exposed to visible light of different wavelength with different energy. Cellular morphology, structure, proliferation, and phagocytosis were observed. The cells showed no remarkable changes when the energy was low. When the exposure energy reached 1. 12 mW/cm2 , the cytoplasm showed a rough appearance, and cell proliferation and phagocytosis decreased. This phototoxicity was strong with white light (compound chromatic light), moderate with violet light or yellow light, and mild with red light.

  8. Culture of Oral Mucosal Epithelial Cells for the Purpose of Treating Limbal Stem Cell Deficiency.

    Science.gov (United States)

    Utheim, Tor Paaske; Utheim, Øygunn Aass; Khan, Qalb-E-Saleem; Sehic, Amer

    2016-01-01

    The cornea is critical for normal vision as it allows allowing light transmission to the retina. The corneal epithelium is renewed by limbal epithelial cells (LEC), which are located in the periphery of the cornea, the limbus. Damage or disease involving LEC may lead to various clinical presentations of limbal stem cell deficiency (LSCD). Both severe pain and blindness may result. Transplantation of cultured autologous oral mucosal epithelial cell sheet (CAOMECS) represents the first use of a cultured non-limbal autologous cell type to treat this disease. Among non-limbal cell types, CAOMECS and conjunctival epithelial cells are the only laboratory cultured cell sources that have been explored in humans. Thus far, the expression of p63 is the only predictor of clinical outcome following transplantation to correct LSCD. The optimal culture method and substrate for CAOMECS is not established. The present review focuses on cell culture methods, with particular emphasis on substrates. Most culture protocols for CAOMECS used amniotic membrane as a substrate and included the xenogeneic components fetal bovine serum and murine 3T3 fibroblasts. However, it has been demonstrated that tissue-engineered epithelial cell sheet grafts can be successfully fabricated using temperature-responsive culture surfaces and autologous serum. In the studies using different substrates for culture of CAOMECS, the quantitative expression of p63 was generally poorly reported; thus, more research is warranted with quantification of phenotypic data. Further research is required to develop a culture system for CAOMECS that mimics the natural environment of oral/limbal/corneal epithelial cells without the need for undefined foreign materials such as serum and feeder cells. PMID:26938569

  9. Measurement and analysis of calcium signaling in heterogeneous cell cultures.

    Science.gov (United States)

    Richards, Gillian R; Jack, Andrew D; Platts, Amy; Simpson, Peter B

    2006-01-01

    High-content imaging platforms capable of studying kinetic responses at a single-cell level have elevated kinetic recording techniques from labor-intensive low-throughput experiments to potential high-throughput screening assays. We have applied this technology to the investigation of heterogeneous cell cultures derived from primary neural tissue. The neuronal cultures mature into a coupled network and display spontaneous oscillations in intracellular calcium, which can be modified by the addition of pharmacological agents. We have developed algorithms to perform Fourier analysis and quantify both the degree of synchronization and the effects of modulators on the oscillations. Functional and phenotypic experiments can be combined using this approach. We have used post-hoc immunolabeling to identify subpopulations of cells in cocultures and to dissect the calcium responses of these cells from the population response. The combination of these techniques represents a powerful tool for drug discovery.

  10. Hybridoma cell behaviour in continuous culture under hyperosmotic stress.

    Science.gov (United States)

    Cherlet, M; Marc, A

    1999-01-01

    In this paper, we propose an alternative strategy to the ones proposed before (Oh et al., 1993; Øyaas et al., 1994a) to get real increases of global final antibody titer and production at hyperosmotic stress, by reducing the detrimental effect of such a stress on cell growth, and conserving the stimulating effect on antibody production. It consists of cultivating the cells in continuous culture and increasing the osmolality stepwise. In this way, the cells could progressively adapt to the higher osmolality at each step and antibody titers could be nearly doubled at 370 and 400 mOsm kg-1, compared to the standard osmolality of 335 mOsm kg-1. Surprisingly, the stimulation of antibody production was not confirmed for higher osmolalities, 425 and 450 mOsm kg- 1, despite the minor negative effect on cell growth. Intracellular IgG analysis by flow cytometry revealed at these osmolalities a significant population of non-producing cells. However, even when taking into account this non-producing population, a stimulating effect on antibody production could not be shown at these highest osmolalities. It seems to us that osmolality has a significant effect on the appearance of these non-producing cells, since they were not observed in continuous cultures at standard osmolality, of comparable duration and at an even higher dilution rate. The appearance of the non-producing cells coincides furthermore with modifications of the synthesised antibody, as shown by electrophoretic techniques. It is however not really clear if these two observations reflect actually the same phenomenon. Hyperosmolality affects the cell behaviour in continuous culture in multiple ways, independently of the growth rate, counting all at least partially for the observed stimulation of antibody production: acceleration of the amino acid, and in particular the glutamine metabolism, increase of the cell volume, increase of the intracellular pH and accumulation of cells in the G1 cell cycle phase. PMID

  11. Cannabinoids induce incomplete maturation of cultured human leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Murison, G.; Chubb, C.B.H.; Maeda, S.; Gemmell, M.A.; Huberman, E.

    1987-08-01

    Monocyte maturation markers were induced in cultured human myeloblastic ML-2 leukemia cells after treatment for 1-6 days with 0.03-30 ..mu..M ..delta../sup 9/-tetrahydrocannabinol (THC), the major psychoactive component of marijuana. After a 2-day or longer treatment, 2- to 5-fold increases were found in the percentages of cells exhibiting reactivity with either the murine OKM1 monoclonal antibody of the Leu-M5 monoclonal antibody, staining positively for nonspecific esterase activity, and displaying a promonocyte morphology. The increases in these differentiation markers after treatment with 0.03-1 ..mu..M THC were dose dependent. At this dose range, THC did not cause an inhibition of cell growth. The THC-induced cell maturation was also characterized by specific changes in the patterns of newly synthesized proteins. The THC-induced differentiation did not, however, result in cells with a highly developed mature monocyte phenotype. However, treatment of these incompletely matured cells with either phorbol 12-myristate 13-acetate of 1..cap alpha..,25-dihydroxycholecalciferol, which are inducers of differentiation in myeloid leukemia cells (including ML-2 cells), produced cells with a mature monocyte morphology. The ML-2 cell system described here may be a useful tool for deciphering critical biochemical events that lead to the cannabinoid-induced incomplete cell differentiation of ML-2 cells and other related cell types. Findings obtained from this system may have important implications for studies of cannabinoid effects on normal human bone-marrow progenitor cells.

  12. Isolation and culture of umbilical vein mesenchymal stem cells

    Directory of Open Access Journals (Sweden)

    D.T. Covas

    2003-09-01

    Full Text Available Bone marrow contains a population of stem cells that can support hematopoiesis and can differentiate into different cell lines including adipocytes, osteocytes, chondrocytes, myocytes, astrocytes, and tenocytes. These cells have been denoted mesenchymal stem cells. In the present study we isolated a cell population derived from the endothelium and subendothelium of the umbilical cord vein which possesses morphological, immunophenotypical and cell differentiation characteristics similar to those of mesenchymal stem cells isolated from bone marrow. The cells were isolated from three umbilical cords after treatment of the umbilical vein lumen with collagenase. The cell population isolated consisted of adherent cells with fibroblastoid morphology which, when properly stimulated, gave origin to adipocytes and osteocytes in culture. Immunophenotypically, this cell population was found to be positive for the CD29, CD13, CD44, CD49e, CD54, CD90 and HLA-class 1 markers and negative for CD45, CD14, glycophorin A, HLA-DR, CD51/61, CD106, and CD49d. The characteristics described are the same as those presented by bone marrow mesenchymal stem cells. Taken together, these findings indicate that the umbilical cord obtained from term deliveries is an important source of mesenchymal stem cells that could be used in cell therapy protocols.

  13. A Microwell Cell Culture Platform for the Aggregation of Pancreatic β-Cells

    OpenAIRE

    Bernard, Abigail B.; Lin, Chien-Chi; Anseth, Kristi S.

    2012-01-01

    Cell–cell contact between pancreatic β-cells is important for maintaining survival and normal insulin secretion. Various techniques have been developed to promote cell–cell contact between β-cells, but a simple yet robust method that affords precise control over three-dimensional (3D) β-cell cluster size has not been demonstrated. To address this need, we developed a poly(ethylene glycol) (PEG) hydrogel microwell platform using photolithography. This microwell cell-culture platform promotes t...

  14. Radiation causes increased production and decreased utilization of IL-2 in human mononuclear cells

    International Nuclear Information System (INIS)

    The effects of radiation on the kinetics of Interleukin-2 (IL-2) production and utilization by mononuclear cells (MNCs) were studied. Mononuclear cells from normal, healthy individuals were subjected to various doses of radiation ranging from 0 to 2,000 rad and cultured in the presence of PHA. Supernatants from these cultures were harvested at various periods and their IL-2 contents determined by both the standard bioassay and ELISA. A radiation dose of 800 rad and higher had a marked effect on both IL-2 production and consumption. Although the supernatants from both the irradiated and non-irradiated MNCs contained maximal concentrations of IL-2 between 8 and 24 h of culture, the former had three times as much IL-2 as the latter. An increase in IL-2-mRNA levels was also noticed in irradiated, PHA-stimulated cells. Moreover, the supernatants from irradiated MNCs collected as late as 72 h after the initiation of culture contained more than 30% of the total IL-2 produced compared to less than 8% in supernatants from non-irradiated cells. Supernatants from non-irradiated cells incubated further with irradiated cells contained relatively higher quantities of IL-2 than those incubated continuously with non-irradiated cells. Supernatants from co-cultures of irradiated and non-irradiated MNCs contained less than expected amounts of IL-2 in two of the three subjects. Despite a difference in both the production and consumption of IL-2 between the irradiated and non-irradiated cells, there was no difference in their ability to generate IL-2 receptors. The results indicate that inactivation of radiosensitive suppressor T cells is associated with superinduction of IL-2 mRNA, increased production and decreased consumption of IL-2 by MNCs, thereby resulting in increased accumulation of IL-2

  15. Withaferin A from cell cultures of Withania somnifera

    Directory of Open Access Journals (Sweden)

    Ciddi Veeresham

    2006-01-01

    Full Text Available Suspension cultures of Withania somnifera cells were established and shown to produce withaferin A. The identification of withaferin A was done by TLC, UV absorption, HPLC and electron spray mass spectroscopy. These cultures could be strongly elicited by exposure to salacin. Addition of salacin at the concentration of 750 µM to the cultures in production medium enhanced production levels of withaferin A to 25±2.9 mg/l compared to 0.47±0.03 mg/l in unelicited controls. This report is the first to demonstrate withaferin A production in plant suspension cultures and provides prerequisites for commercial scale, controlled production of withaferin A.

  16. Influence of in vitro irradiation upon LIF production by ConA stimulated mononuclear cells

    International Nuclear Information System (INIS)

    Leukocyte migration inhibitory factor (LIF) activity of culture supernatants of in vitro irradiated Concanavalin A (ConA) stimulated lymphocytes was tested by measuring granulocyte migration from clotted plasma droplets placed in flat bottom microplates. The specificity of inhibition was assured by pretreating the assay supernatants with anti-LIF antibodies which abrogated granulocyte migration inhibition but did not impair guinea pig Peritoneal Exudate Cells (PEC) migration inhibition. In vitro irradiation (150-1200 rads) of MNC cultures either before or after ConA stimulation did not impair lymphokine production and sometimes significantly improved the supernatants' LIF activity as compared with that of unirradiated cultures. The existence of radiosensitive suppressor cells regulating LIF production by ConA stimulated mononuclear cells is suggested

  17. Influence of in vitro irradiation upon LIF production by ConA stimulated mononuclear cells

    International Nuclear Information System (INIS)

    Leukocyte migration inhibitory factor (LIF) activity of culture supernatants of in vitro irradiated Concanavalin A (ConA) stimulated lymphocytes was tested by measuring granulocyte migration from clotted plasma droplets placed in flat bottom microplates. The specificity of inhibition was assured by pretreating the assay supernatants with anti-LIF antibodies which abrogated granulocyte migration inhibition but did not impair guinea pig Peritoneal Exudate Cells (PEC) migration inhibition. In vitro irradiation (150-1200 rad) of MNC cultures either before or after ConA stimulation did not impair lymphokine production and sometimes significantly improved the supernatants' LIF activity as compared with that of unirradiated cultures. The existence of radiosensitive suppressor cells regulating LIF production by ConA stimulated mononuclear cells is suggested

  18. Culturing intestinal stem cells: applications for colorectal cancer research

    OpenAIRE

    Fujii, Masayuki; Sato, Toshiro

    2014-01-01

    Recent advance of sequencing technology has revealed genetic alterations in colorectal cancer (CRC). The biological function of recurrently mutated genes has been intensively investigated through mouse genetic models and CRC cell lines. Although these experimental models may not fully reflect biological traits of human intestinal epithelium, they provided insights into the understanding of intestinal stem cell self-renewal, leading to the development of novel human intestinal organoid culture...

  19. Extraction and identification of exosomes from drug-resistant breast cancer cells and their potential role in cell-to-cell drug-resistance transfer

    Institute of Scientific and Technical Information of China (English)

    许金金

    2014-01-01

    Objective To explore whether docetaxel-resistant cells(MCF-7/Doc)and doxorubicin-resistant cells(MCF-7/ADM)can secrete Exosomes and their potential role in cell-cell drug-resistance transfer.Methods Exosomes were extracted from the cell culture supernatants of MCF-7/Doc and MCF-7/ADM cells by fractionation ultracentrifugation,and were identified by transmission

  20. Fabrication of a thermoresponsive cell culture dish: a key technology for cell sheet tissue engineering

    OpenAIRE

    Jun Kobayashi and Teruo Okano

    2010-01-01

    This article reviews the properties and characterization of an intelligent thermoresponsive surface, which is a key technology for cell sheet-based tissue engineering. Intelligent thermoresponsive surfaces grafted with poly(N-isopropylacrylamide) exhibit hydrophilic/hydrophobic alteration in response to temperature change. Cultured cells are harvested on thermoresponsive cell culture dishes by decreasing the temperature without the use of digestive enzymes or chelating agents. Our group has d...

  1. Staurosporine induces different cell death forms in cultured rat astrocytes

    International Nuclear Information System (INIS)

    Astroglial cells are frequently involved in malignant transformation. Besides apoptosis, necroptosis, a different form of regulated cell death, seems to be related with glioblastoma genesis, proliferation, angiogenesis and invasion. In the present work we elucidated mechanisms of necroptosis in cultured astrocytes, and compared them with apoptosis, caused by staurosporine. Cultured rat cortical astrocytes were used for a cell death studies. Cell death was induced by different concentrations of staurosporine, and modified by inhibitors of apoptosis (z-vad-fmk) and necroptosis (nec-1). Different forms of a cell death were detected using flow cytometry. We showed that staurosporine, depending on concentration, induces both, apoptosis as well as necroptosis. Treatment with 10−7 M staurosporine increased apoptosis of astrocytes after the regeneration in a staurosporine free medium. When caspases were inhibited, apoptosis was attenuated, while necroptosis was slightly increased. Treatment with 10−6 M staurosporine induced necroptosis that occurred after the regeneration of astrocytes in a staurosporine free medium, as well as without regeneration period. Necroptosis was significantly attenuated by nec-1 which inhibits RIP1 kinase. On the other hand, the inhibition of caspases had no effect on necroptosis. Furthermore, staurosporine activated RIP1 kinase increased the production of reactive oxygen species, while an antioxidant BHA significantly attenuated necroptosis. Staurosporine can induce apoptosis and/or necroptosis in cultured astrocytes via different signalling pathways. Distinction between different forms of cell death is crucial in the studies of therapy-induced necroptosis

  2. Salt tolerance in cultured cells of Spartina pectinata.

    Science.gov (United States)

    Warren, R S; Baird, L M; Thompson, A K

    1985-04-01

    Suspension cultures with cell doubling times of ca. 2 days were developed from the halophytic grass Spartina pectinata. Maximum rates of exponential growth measured by direct cell counts and by total culture packed-cell-volume were not significantly reduced by NaCl up to 200 mM but dropped beyond this point. In contrast, total cell production over a one week culture cycle, by both measures, was reduced in a roughly linear fashion between 0 and 500 mM NaCl. The pattern of growth in relation to NaCl is very similar to that of previously described cell suspensions derived from another halophyte, Distichlis spicata. In the field the latter is much more salt tolerant. The basis for the whole plant differences is not clear. They do not appear to reflect effectiveness of cell based salt tolerance or the presence of salt glands, which are reported here for the first time in S. pectinata and are found on the leaves of both species.

  3. Stability of resazurin in buffers and mammalian cell culture media

    DEFF Research Database (Denmark)

    Rasmussen, Eva; Nicolaisen, G.M.

    1999-01-01

    The utility of a ferricyanide/ferrocyanide system used in the AlamarBlue(TM) (Serotec, Oxford, UK) vital. dye to inhibit the reduction of resazurin by mammalian cell culture media is questioned. Resazurin was found to be relatively stable when dissolved in phosphate-buffered saline (PBS). The use...

  4. Disposable Bioreactors for Plant Micropropagation and Mass Plant Cell Culture

    Science.gov (United States)

    Ducos, Jean-Paul; Terrier, Bénédicte; Courtois, Didier

    Different types of bioreactors are used at Nestlé R&D Centre - Tours for mass propagation of selected plant varieties by somatic embryogenesis and for large scale culture of plants cells to produce metabolites or recombinant proteins. Recent studies have been directed to cut down the production costs of these two processes by developing disposable cell culture systems. Vegetative propagation of elite plant varieties is achieved through somatic embryogenesis in liquid medium. A pilot scale process has recently been set up for the industrial propagation of Coffea canephora (Robusta coffee). The current production capacity is 3.0 million embryos per year. The pre-germination of the embryos was previously conducted by temporary immersion in liquid medium in 10-L glass bioreactors. An improved process has been developed using a 10-L disposable bioreactor consisting of a bag containing a rigid plastic box ('Box-in-Bag' bioreactor), insuring, amongst other advantages, a higher light transmittance to the biomass due to its horizontal design. For large scale cell culture, two novel flexible plastic-based disposable bioreactors have been developed from 10 to 100 L working volumes, validated with several plant species ('Wave and Undertow' and 'Slug Bubble' bioreactors). The advantages and the limits of these new types of bioreactor are discussed, based mainly on our own experience on coffee somatic embryogenesis and mass cell culture of soya and tobacco.

  5. Plant Cell Cultures as Source of Cosmetic Active Ingredients

    Directory of Open Access Journals (Sweden)

    Ani Barbulova

    2014-04-01

    Full Text Available The last decades witnessed a great demand of natural remedies. As a result, medicinal plants have been increasingly cultivated on a commercial scale, but the yield, the productive quality and the safety have not always been satisfactory. Plant cell cultures provide useful alternatives for the production of active ingredients for biomedical and cosmetic uses, since they represent standardized, contaminant-free and biosustainable systems, which allow the production of desired compounds on an industrial scale. Moreover, thanks to their totipotency, plant cells grown as liquid suspension cultures can be used as “biofactories” for the production of commercially interesting secondary metabolites, which are in many cases synthesized in low amounts in plant tissues and differentially distributed in the plant organs, such as roots, leaves, flowers or fruits. Although it is very widespread in the pharmaceutical industry, plant cell culture technology is not yet very common in the cosmetic field. The aim of the present review is to focus on the successful research accomplishments in the development of plant cell cultures for the production of active ingredients for cosmetic applications.

  6. Biodegradable Mg corrosion and osteoblast cell culture studies

    International Nuclear Information System (INIS)

    Magnesium (Mg) is a biodegradable metal that has significant potential advantages as an implant material. In this paper, corrosion and cell culture experiments were performed to evaluate the biocompatibility of Mg. The corrosion current and potential of a Mg disk were measured in different physiological solutions including deionized (DI) water, phosphate-buffered saline (PBS), and McCoy's 5A culture medium. The corrosion currents in the PBS and in the McCoy's 5A-5% FBS media were found to be higher than in DI water, which is expected because corrosion of Mg occurs faster in a chloride solution. Weight loss, open-circuit potential, and electrochemical impedance spectroscopy measurements were also performed. The Mg specimens were also characterized using an environmental scanning electron microscope and energy-dispersive X-ray analysis (EDAX). The X-ray analysis showed that in the cell culture media a passive interfacial layer containing oxygen, chloride, phosphate, and potassium formed on the samples. U2OS cells were then co-cultured with a Mg specimen for up to one week. Cytotoxicity results of magnesium using MTT assay and visual observation through cell staining were not significantly altered by the presence of the corroding Mg sample. Further, bone tissue formation study using von Kossa and alkaline phosphatase staining indicates that Mg may be suitable as a biodegradable implant material.

  7. Test chambers for cell culture in static magnetic field

    International Nuclear Information System (INIS)

    Article presents a test chamber intended to be used for in vitro cell culture in homogenous constant magnetic field with parametrically variable magnitude. We constructed test chambers with constant parameters of control homeostasis of cell culture for the different parameters of static magnetic field. The next step was the computer calculation of 2D and 3D simulation of the static magnetic field distribution in the chamber. The analysis of 2D and 3D calculations of magnetic induction in the cells' exposition plane reveals, in comparison to the detection results, the greater accuracy of 2D calculations (Figs. 9 and 10). The divergence in 2D method was 2–4% and 8 to 10% in 3D method (reaching 10% only out of the cells′ cultures margins). -- Highlights: ► We present test chamber to be used for in vitro cell culture in static magnetic field. ► The technical data of the chamber construction was presented. ► 2D versus 3D simulation of static magnetic field distribution in chamber was reported. ► We report the accuracy of 2D calculation than 3D

  8. DIVERSITY OF ARSENIC METABOLISM IN CULTURED HUMAN CANCER CELL LINES

    Science.gov (United States)

    Diversity of arsenic metabolism in cultured human cancer cell lines. Arsenic has been known to cause a variety of malignancies in human. Pentavalent As (As 5+) is reduced to trivalent As (As3+) which is further methylated by arsenic methyltransferase(s) to monomethylarson...

  9. Oxidative Stress Induces Senescence in Cultured RPE Cells.

    Science.gov (United States)

    Aryan, Nona; Betts-Obregon, Brandi S; Perry, George; Tsin, Andrew T

    2016-01-01

    The aim of this research is to determine whether oxidative stress induces cellular senescence in human retinal pigment epithelial cells. Cultured ARPE19 cells were subjected to different concentrations of hydrogen peroxide to induce oxidative stress. Cells were seeded into 24-well plates with hydrogen peroxide added to cell medium and incubated at 37°C + 5% CO2 for a 90-minute period [at 0, 300, 400 and 800 micromolar (MCM) hydrogen peroxide]. The number of viable ARPE19 cells were recorded using the Trypan Blue Dye Exclusion Method and cell senescence was measured by positive staining for senescence-associated beta-galactosidase (SA-beta-Gal) protein. Without hydrogen peroxide treatment, the number of viable ARPE19 cells increased significantly from 50,000 cells/well to 197,000 within 72 hours. Treatment with hydrogen peroxide reduced this level of cell proliferation significantly (to 52,167 cells at 400 MCM; to 49,263 cells at 800 MCM). Meanwhile, cells with a high level of positive senescence-indicator SA-Beta-Gal-positive staining was induced by hydrogen peroxide treatment (from a baseline level of 12% to 80% at 400 MCM and at 800 MCM). Our data suggests that oxidative stress from hydrogen peroxide treatment inhibited ARPE19 cell proliferation and induced cellular senescence. PMID:27651846

  10. Cell Stratification, Spheroid Formation and Bioscaffolds Used to Grow Cells in Three Dimensional Cultures

    Directory of Open Access Journals (Sweden)

    Hana Hrebíková

    2015-12-01

    Full Text Available The cell culture became an invaluable tool for studying cell behaviour, development, function, gene expression, toxicity of compounds and efficacy of novel drugs. Although most results were obtained from cell cultivation in two-dimensional (2D systems, in which cells are grown in a monolayer, three-dimensional (3D cultures are more promising as they correspond closely to the native arrangement of cells in living tissues. In our study, we focused on three types of 3D in vitro systems used for cultivation of one cell type. Cell morphology, their spatial distribution inside of resulting multicellular structures and changes in time were analysed with histological examination of samples harvested at different time periods. In multilayered cultures of WRL 68 hepatocytes grown on semipermeable membranes and non-passaged neurospheres generated by proliferation of neural progenitor cells, the cells were tightly apposed, showed features of cell differentiation but also cell death that was observable in short-term cultures. Biogenic scaffolds composed of extracellular matrix of the murine tibial anterior muscle were colonized with C2C12 myoblasts in vitro. The recellularized scaffolds did not reach high cell densities comparable with the former systems but supported well cell anchorage and migration without any signs of cell regression.

  11. Neural differentiation of human placenta-derived mesenchymal stem cells following neural cell co-culture

    Institute of Scientific and Technical Information of China (English)

    Nailong Yang; Hongyan Zhang; Xiaojuan Sun; Lili Xu

    2011-01-01

    We induced human placenta-derived mesenchymal stem cells (hPMSCs) to differentiate into neural cells by adding chemical reagents,despite the fact that toxic chemicals induce cell shrinkage or cytoskeletal formation,which does not represent a proper cell differentiation process.The present study established a co-culture system with hPMSCs and neural cells and analyzed the influence of neural cells on hPMSC differentiation in a co-culture system.hPMSCs were isolated and purified from human full-term placenta using collagenase digestion.Fetal neural cells were co-cultured with hPMSCs for 48 hours using the Transwell co-culture system.hPMSCs co-cultured with neural cells exhibited a slender morphology with a filament.After 96 hours,hPMSCs expressed neuron-specific enolase,which suggested that co-culture of hPMSCs and neural cells induced neural differentiation of hPMSCs.

  12. The molecularly crowded cytoplasm of bacterialcCells : Dividing cells contrasted with viable but non-culturable (VBNC) bacterial cells

    NARCIS (Netherlands)

    Trevors, J. T.; van Elsas, J. D.; Bej, A. K.

    2013-01-01

    In this perspective, we discuss the cytoplasm in actively growing bacterial cells contrasted with viable but non-culturable (VBNC) cells. Actively growing bacterial cells contain a more molecularly crowded and organized cytoplasm, and are capable of completing their cell cycle resulting in cell divi

  13. Ultrafiltration and Characterization of AW-101 Supernatant and Entrained Solids

    International Nuclear Information System (INIS)

    The River Protection Project Waste Treatment Plant (RPP-WTP) (1996) flow sheet uses cross-flow filtration as the solid/liquid separation technique. Unlike traditional dead-end filtration, which has a declining rate caused by the growth of a filter cake on the surface of the filter medium, in cross-flow filtration, the filter cake is swept away by the fluid flowing across it. This filtration method is especially beneficial when there are very fine particles and when system simplicity is required. The objective of this work was to test cross-flow filtration using actual Envelope A Hanford tank waste. Similar to the Phase 1A study, they evaluated the permeability of an Envelope A feed through a single element filter as a function of transmembrane pressure, axial velocity, solids concentration, and time. In addition, the efficiency of back pulse and chemical cleaning on the filter performance was evaluated. The chemical and radiochemical composition of the filtrate and solids was measured to determine efficiency of the filtration process. This report describes the test apparatus, the experimental approach, the results of the tests, and the chemical and radiochemical analysis for supernatants taken from Hanford Tank AW-101. This report also provides a means of transmitting to British Nuclear Fuels, Limited (BNFL) the completed test instruction and raw filtration and analytical data

  14. A microdroplet cell culture based high frequency somatic embryogenesis system for pigeonpea, Cajanus cajan (L.) Millsp.

    Science.gov (United States)

    Kumar, Nagan Udhaya; Gnanaraj, Muniraj; Sindhujaa, Vajravel; Viji, Maluventhen; Manoharan, Kumariah

    2015-09-01

    A protocol for high frequency production of somatic embryos was worked out in pigeonpea, Cajanus cajan (L.) Millsp. The protocol involved sequential employment of embryogenic callus cultures, low density cell suspension cultures and a novel microdroplet cell culture system. The microdroplet cell cultures involved culture of a single cell in 10 μI of Murashige and Skoog's medium supplemented with phytohormones, growth factors and phospholipid precursors. By employing the microdroplet cell cultures, single cells in isolation were grown into cell clones which developed somatic embryos. Further, 2,4-dichlorophenoxyacetic acid, kinetin, polyethylene glycol, putrescine, spermine, spermidine, choline chloride, ethanolamine and LiCl were supplemented to the low density cell suspension cultures and microdroplet cell cultures to screen for their cell division and somatic embryogenesis activity. Incubation of callus or the inoculum employed for low density cell suspension cultures and microdroplet cell cultures with polyethylene glycol was found critical for induction of somatic embryogenesis. Somatic embryogenesis at a frequency of 1.19, 3.16 and 6.51 per 10(6) cells was achieved in the callus, low density cell suspension cultures and microdroplet cell cultures, respectively. Advantages of employing microdroplet cell cultures for high frequency production of somatic embryos and its application in genetic transformation protocols are discussed. PMID:26548080

  15. Human disc cells in monolayer vs 3D culture: cell shape, division and matrix formation

    Directory of Open Access Journals (Sweden)

    Hanley Edward N

    2000-10-01

    Full Text Available Abstract Background The relationship between cell shape, proliferation, and extracellular matrix (ECM production, important aspects of cell behavior, is examined in a little-studied cell type, the human annulus cell from the intervertebral disc, during monolayer vs three-dimensional (3D culture. Results Three experimental studies showed that cells respond specifically to culture microenvironments by changes in cell shape, mitosis and ECM production: 1 Cell passages showed extensive immunohistochemical evidence of Type I and II collagens only in 3D culture. Chondroitin sulfate and keratan sulfate were abundant in both monolayer and 3D cultures. 2 Cells showed significantly greater proliferation in monolayer in the presence of platelet-derived growth factor compared to cells in 3D. 3 Cells on Matrigel™-coated monolayer substrates became rounded and formed nodular colonies, a finding absent during monolayer growth. Conclusions The cell's in vivo interactions with the ECM can regulate shape, gene expression and other cell functions. The shape of the annulus cell changes markedly during life: the young, healthy disc contains spindle shaped cells and abundant collagen. With aging and degeneration, many cells assume a strikingly different appearance, become rounded and are surrounded by unusual accumulations of ECM products. In vitro manipulation of disc cells provides an experimental window for testing how disc cells from given individuals respond when they are grown in environments which direct cells to have either spindle- or rounded-shapes. In vitro assessment of the response of such cells to platelet-derived growth factor and to Matrigel™ showed a continued influence of cell shape even in the presence of a growth factor stimulus. These findings contribute new information to the important issue of the influence of cell shape on cell behavior.

  16. Unique cell culture systems for ground based research

    Science.gov (United States)

    Lewis, Marian L.

    1990-01-01

    The horizontally rotating fluid-filled, membrane oxygenated bioreactors developed at NASA Johnson for spacecraft applications provide a powerful tool for ground-based research. Three-dimensional aggregates formed by cells cultured on microcarrier beads are useful for study of cell-cell interactions and tissue development. By comparing electron micrographs of plant seedlings germinated during Shuttle flight 61-C and in an earth-based rotating bioreactor it is shown that some effects of microgravity are mimicked. Bioreactors used in the UAH Bioreactor Laboratory will make it possible to determine some of the effects of altered gravity at the cellular level. Bioreactors can be valuable for performing critical, preliminary-to-spaceflight experiments as well as medical investigations such as in vitro tumor cell growth and chemotherapeutic drug response; the enrichment of stem cells from bone marrow; and the effect of altered gravity on bone and muscle cell growth and function and immune response depression.

  17. Lethal impacts of cigarette smoke in cultured tobacco cells

    Directory of Open Access Journals (Sweden)

    Kawano Tomonori

    2011-07-01

    Full Text Available Abstract Background In order to understand and generalize the toxic mechanism of cigarette smoke in living cells, comparison of the data between animal systems and other biological system such as microbial and plant systems is highly beneficial. Objective By employing the tobacco cells as model materials for cigarette smoke toxicity assay, the impacts of the combustion by-products such as nitrogen oxides could be highlighted as the toxic impacts of the plant-derived endogenous chemicals could be excluded in the plant cells. Methods Cigarette smoke-induced cell death was assessed in tobacco cell suspension cultures in the presence and absence of pharmacological inhibitors. Results Cigarette smoke was effective in induction of cell death. The smoke-induced cell death could be partially prevented by addition of nitric oxide (NO scavenger, suggesting the role for NO as the cell death mediator. Addition of NO donor to tobacco cells also resulted in development of partial cell death further confirming the role of NO as cell death mediator. Members of reactive oxygen species and calcium ion were shown to be protecting the cells from the toxic action of smoke-derived NO.

  18. Induced Pluripotent Stem (iPS) Cell Culture Methods and Induction of Differentiation into Endothelial Cells

    Science.gov (United States)

    Chatterjee, Ishita; Li, Fei; Kohler, Erin E.; Rehman, Jalees; Malik, Asrar B.; Wary, Kishore K.

    2015-01-01

    Summary The studies of stem cell behavior and differentiation in a developmental context is complex, time-consuming and expensive, and for this reason, cell culture remains a method of choice for developmental and regenerative biology and mechanistic studies. Similar to ES cells, iPS cells have the ability to differentiate into endothelial cells (ECs), and the route for differentiation appears to mimic the developmental process that occurs during the formation of an embryo. Traditional EC induction methods from embryonic stem (ES) cells rely mostly on the formation the embryoid body (EB), which employs feeder or feeder-free conditions in the presence or absence of supporting cells. Similar to ES cells, iPS cells can be cultured in feeder-layer or feeder-free conditions. Here, we describe the iPS cell culture methods and induction differentiation of these cells into ECs. We use anti-mouse Flk1 and anti-mouse VE-cadherin to isolate and characterize mouse ECs, because these antibodies are commercially available and their use has been described in the literature, including by our group. The ECs produced by this method have been used by our laboratory, and we have demonstrated their in vivo potential. We also discuss how iPS cells differ in their ability to differentiate into endothelial cells in culture. PMID:25687301

  19. Induced Pluripotent Stem (iPS) Cell Culture Methods and Induction of Differentiation into Endothelial Cells.

    Science.gov (United States)

    Chatterjee, Ishita; Li, Fei; Kohler, Erin E; Rehman, Jalees; Malik, Asrar B; Wary, Kishore K

    2016-01-01

    The study of stem cell behavior and differentiation in a developmental context is complex, time-consuming, and expensive, and for this reason, cell culture remains a method of choice for developmental and regenerative biology and mechanistic studies. Similar to ES cells, iPS cells have the ability to differentiate into endothelial cells (ECs), and the route for differentiation appears to mimic the developmental process that occurs during the formation of an embryo. Traditional EC induction methods from embryonic stem (ES) cells rely mostly on the formation of embryoid body (EB), which employs feeder or feeder-free conditions in the presence or absence of supporting cells. Similar to ES cells, iPS cells can be cultured in feeder layer or feeder-free conditions. Here, we describe the iPS cell culture methods and induction differentiation of these cells into ECs. We use anti-mouse Flk1 and anti-mouse VE-cadherin to isolate and characterize mouse ECs, because these antibodies are commercially available and their use has been described in the literature, including by our group. The ECs produced by this method have been used by our laboratory, and we have demonstrated their in vivo potential. We also discuss how iPS cells differ in their ability to differentiate into endothelial cells in culture.

  20. Vegetal cell cultures under the effect of low intensity microwaves

    International Nuclear Information System (INIS)

    In order to study the microwave effect on the chlorophyll biosynthesis in Papaver rhoes in vitro cultures microwave radiation characterized by a power density of 0.9 mW/cm2 in a frequency range of 9. 75 - 10.75 GHz was used. P. rhoes in vitro cultures, were obtained from explants of leaves and flowers provided by adult individuals, grown in the Botanical garden of AL. I. Cuza University from Iasi. Murashige Skoog agarized medium with a suitable hormone balance was used to conduct cell culture development before as well as after exposure to microwaves. Assimilatory pigment levels (chlorophyll a, chlorophyll b and carotene pigments) have been evaluated by standard spectrophotometric technique. Student t-test (two tailed, pair) gave significant p-values for the modification of chlorophyll a and chlorophyll b levels after microwave treatment (p0.05). Microwave treatment seems to be able to stimulate assimilatory pigment biosynthesis in the vegetal cell cultures. An inhibitory effect may be associated to the phenotypic modifications noticed in the callus growth from 2 exposed vials - probably related to a non-thermal effect of microwaves in living tissues. Further study of sub-cultures derived from exposed vials is needed to clarify if microwaves of low power density are adequate for the stimulation of assimilatory pigment from chloroplast membranes. (authors)

  1. Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models

    Science.gov (United States)

    Marquette, Michele L.; Sognier, Marguerite A.

    2013-01-01

    An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.

  2. Benzaldehyde dehydrogenase from chitosan-treated Sorbus aucuparia cell cultures.

    Science.gov (United States)

    Gaid, Mariam M; Sircar, Debabrata; Beuerle, Till; Mitra, Adinpunya; Beerhues, Ludger

    2009-09-01

    Cell cultures of Sorbus aucuparia respond to the addition of chitosan with the accumulation of the biphenyl phytoalexin aucuparin. The carbon skeleton of this inducible defense compound is formed by biphenyl synthase (BIS) from benzoyl-CoA and three molecules of malonyl-CoA. The formation of benzoyl-CoA proceeds via benzaldehyde as an intermediate. Benzaldehyde dehydrogenase (BD), which converts benzaldehyde into benzoic acid, was detected in cell-free extracts from S. aucuparia cell cultures. BD and BIS were induced by chitosan treatment. The preferred substrate for BD was benzaldehyde (K(m)=49 microM). Cinnamaldehyde and various hydroxybenzaldehydes were relatively poor substrates. BD activity was strictly dependent on the presence of NAD(+) as a cofactor (K(m)=67 microM).

  3. Mechanism for multiplicity of steady states with distinct cell concentration in continuous culture of mammalian cells.

    Science.gov (United States)

    Yongky, Andrew; Lee, Jongchan; Le, Tung; Mulukutla, Bhanu Chandra; Daoutidis, Prodromos; Hu, Wei-Shou

    2015-07-01

    Continuous culture for the production of biopharmaceutical proteins offers the possibility of steady state operations and thus more consistent product quality and increased productivity. Under some conditions, multiplicity of steady states has been observed in continuous cultures of mammalian cells, wherein with the same dilution rate and feed nutrient composition, steady states with very different cell and product concentrations may be reached. At those different steady states, cells may exhibit a high glycolysis flux with high lactate production and low cell concentration, or a low glycolysis flux with low lactate and high cell concentration. These different steady states, with different cell concentration, also have different productivity. Developing a mechanistic understanding of the occurrence of steady state multiplicity and devising a strategy to steer the culture toward the desired steady state is critical. We establish a multi-scale kinetic model that integrates a mechanistic intracellular metabolic model and cell growth model in a continuous bioreactor. We show that steady state multiplicity exists in a range of dilution rate in continuous culture as a result of the bistable behavior in glycolysis. The insights from the model were used to devise strategies to guide the culture to the desired steady state in the multiple steady state region. The model provides a guideline principle in the design of continuous culture processes of mammalian cells.

  4. Morphological differences between circulating tumor cells from prostate cancer patients and cultured prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Sunyoung Park

    Full Text Available Circulating tumor cell (CTC enumeration promises to be an important predictor of clinical outcome for a range of cancers. Established CTC enumeration methods primarily rely on affinity capture of cell surface antigens, and have been criticized for underestimation of CTC numbers due to antigenic bias. Emerging CTC capture strategies typically distinguish these cells based on their assumed biomechanical characteristics, which are often validated using cultured cancer cells. In this study, we developed a software tool to investigate the morphological properties of CTCs from patients with castrate resistant prostate cancer and cultured prostate cancer cells in order to establish whether the latter is an appropriate model for the former. We isolated both CTCs and cultured cancer cells from whole blood using the CellSearch® system and examined various cytomorphological characteristics. In contrast with cultured cancer cells, CTCs enriched by CellSearch® system were found to have significantly smaller size, larger nuclear-cytoplasmic ratio, and more elongated shape. These CTCs were also found to exhibit significantly more variability than cultured cancer cells in nuclear-cytoplasmic ratio and shape profile.

  5. Maintenance of mesenchymal stem cells culture due to the cells with reduced attachment rate

    Directory of Open Access Journals (Sweden)

    Shuvalova N. S.

    2013-01-01

    Full Text Available Aim. The classic detachment techniques lead to changes in cells properties. We offer a simple method of cultivating the population of cells that avoided an influence on the surface structures. Methods. Mesenchymal stem cells (MSC from human umbilical cord matrix were obtained and cultivated in standard conditions. While substituting the culture media by a fresh portion, the conditioned culture medium, where the cells were maintained for three days, was transferred to other culture flacks with addition of serum and growth factors. Results. In the flacks, one day after medium transfer, we observed attached cells with typical MSC morphology. The cultures originated from these cells had the same rate of surface markers expression and clonogenic potential as those replated by standard methods. Conclusions. MSC culture, derived by preserving the cells with reduced attachment ability, actually has the properties of «parent» passage. Using this method with accepted techniques of cells reseeding would allow maintaining the cells that avoided an impact on the cell surface proteins.

  6. Astragalus extract inhibits destruction of gastric cancer cells to mesothelial cells by anti-apoptosis

    Institute of Scientific and Technical Information of China (English)

    Di Na; Fu-Nan Liu; Zhi-Feng Miao; Zong-Min Du; Hui-Mian Xu

    2009-01-01

    AIM: To determine the inhibitory effect of Astragalus memebranaceushas on gastric cancer cell supernatantinduced apoptosis of human peritoneal mesothelial cells. METHODS: Human peritoneal mesothelial cell (HPMC) line HMrSV5 was co-incubated with gastric cancer cell supernatant (MKN45) and/or Astragalus memebranaceushas. Morphological changes in gastric cancer cells were observed under phase-contrast microscope. Quantitative cell damage was determined by MTT assay. Apoptosis was determined under transmission electron microscope and quantified by detecting acridine orange/ethidium bromide-stained (AO/EB) condensed nuclei under fluorescent microscope or by flow cytometry. Expressions of Bcl-2 and Bax were evaluated with immunostaining. RESULTS: Morphological changes and exfoliation occurred and naked areas appeared in cultured HMrSV5 cells 24 h after they were treated with gastric cancer cell supernatant. Cell supernatant from MKN45 gastric cancer cells induced apoptosis of HMrSV5 cells in a time-dependent manner. Obvious morphological changes were observed in cell apoptosis, such as condensation of chromatin, nuclear fragmentations and apoptotic bodies. Astragalus memebranaceus could partly suppress these changes and regulate the expressions of Bcl-2 and Bax in HMrSV5 cells. CONCLUSION: Gastric cancer cells induce apoptosis of HPMCs through the supernatant. Astragalus memebranaceushas inhibits this phenomenon and can be used an adjuvant chemothera-peutic agent in gastric cancer therapy.

  7. Contextualizing Hepatocyte Functionality of Cryopreserved HepaRG Cell Cultures.

    Science.gov (United States)

    Jackson, Jonathan P; Li, Linhou; Chamberlain, Erica D; Wang, Hongbing; Ferguson, Stephen S

    2016-09-01

    Over the last decade HepaRG cells have emerged as a promising alternative to primary human hepatocytes (PHH) and have been featured in over 300 research publications. Most of these reports employed freshly differentiated HepaRG cells that require time-consuming culture (∼28 days) for full differentiation. Recently, a cryopreserved, predifferentiated format of HepaRG cells (termed here "cryo-HepaRG") has emerged as a new model that improves global availability and experimental flexibility; however, it is largely unknown whether HepaRG cells in this format fully retain their hepatic characteristics. Therefore, we systematically investigated the hepatocyte functionality of cryo-HepaRG cultures in context with the range of interindividual variation observed with PHH in both sandwich-culture and suspension formats. These evaluations uncovered a novel adaptation period for the cryo-HepaRG format and demonstrated the impact of extracellular matrix on cryo-HepaRG functionality. Pharmacologically important drug-metabolizing alleles were genotyped in HepaRG cells and poor metabolizer alleles for CYP2D6, CYP2C9, and CYP3A5 were identified and consistent with higher frequency alleles found in individuals of Caucasian decent. We observed liver enzyme inducibility with aryl hydrocarbon receptor, constitutive androstane receptor (CAR), and pregnane X receptor activators comparable to that of sandwich-cultured PHH. Finally, we show for the first time that cryo-HepaRG supports proper CAR cytosolic sequestration and translocation to hepatocyte nuclei in response to phenobarbital treatment. Taken together, these data reveal important considerations for the use of this cell model and demonstrate that cryo-HepaRG are suitable for metabolism and toxicology screening.

  8. Identifying developmental toxicity pathways for a subset of ToxCast chemicals using human embryonic stem cells and metabolomics

    Science.gov (United States)

    Metabolomics analysis was performed on the supernatant of human embryonic stem (hES) cell cultures exposed to a blinded subset of 11 chemicals selected from the chemical library of EPA's ToxCast™ chemical screening and prioritization research project. Metabolites from hES cultur...

  9. Helicobacter pylori damages human gallbladder epithelial cells in vitro

    Institute of Scientific and Technical Information of China (English)

    Dong-Feng Chen; Lu Hu; Ping Yi; Wei-Wen Liu; Dian-Chun Fang; Hong Cao

    2008-01-01

    AIM: To study the mechanism by which Helicobacter pylori (Hpy/orO damages human gallbladder epithelial cells (HGBEC).METHODS: H pylori isolated from gallbladder were cultured in a liquid medium. Different concentration supernatants and sonicated extracts of H pylori cells were then added to HGBEC in a primary culture. The morphological changes in HGBEC as well as changes in the levels of alkaline phosphatase (ALP), lactate dehydrogenase (LDH) and glutamyltransferase (GGT)were measured.RESULTS: According to the culture curve of HGBEC,it was convenient to study the changes in HGBEC by adding H pylori sonicated extracts and H pylori culture supernatants. Both H pylori sonicated extracts and H pylori culture supernatants had a significant influence on HGBEC morphology, i.e. HGBEC grew more slowly, their viability decreased and their detachment increased. Furthermore, HGBEC ruptured and died. The levels of ALP (33.84 ± 6.00 vs 27.01± 4.67, P < 0.05), LDH (168.37 ± 20.84 vs 55.51 ±17.17, P < 0.01) and GGT (42.01 ± 6.18 vs 25.34 ±4.33, P < 0.01) significantly increased in the HGBEC culture supernatant in a time- and concentrationdependent. The damage to HGBEC in Hpylori culture liquid was more significant than that in H pylori sonicated extracts.CONCLUSION: H pylori induces no obvious damage to HGBEC.

  10. Cell culture density affects the proliferation activity of human adipose tissue stem cells.

    Science.gov (United States)

    Kim, Dae Seong; Lee, Myoung Woo; Ko, Young Jong; Chun, Yong Hoon; Kim, Hyung Joon; Sung, Ki Woong; Koo, Hong Hoe; Yoo, Keon Hee

    2016-01-01

    In this study, we investigated the effect of cell density on the proliferation activity of human mesenchymal stem cells (MSCs) derived from adipose tissue (AT-MSCs) over time in culture. Passage #4 (P4) and #12 (P12) AT-MSCs from two donors were plated at a density of 200 (culture condition 1, CC1) or 5000 (culture condition 2, CC2) cells cm(-2) . After 7 days of incubation, P4 and P12 AT-MSCs cultured in CC1 were thin and spindle-shaped, whereas those cultured in CC2 had extensive cell-to-cell contacts and an expanded cell volume. In addition, P4 and P12 AT-MSCs in CC1 divided more than three times, while those in CC2 divided less than once on average. Flow cytometric analysis using 5(6)-carboxyfluorescein diacetate N-succinimidyl ester dye showed that the fluorescence intensity of AT-MSCs was lower in CC1 than in CC2. Furthermore, expression of proliferation-associated genes, such as CDC45L, CDC20A and KIF20A, in P4 AT-MSCs was higher in CC1 than in CC2, and this difference was also observed in P12 AT-MSCs. These data demonstrated that cell culture density affects the proliferation activity of MSCs, suggesting that it is feasible to design a strategy to prepare suitable MSCs using specific culture conditions.

  11. Long term maintenance of myeloid leukemic stem cells cultured with unrelated human mesenchymal stromal cells

    Directory of Open Access Journals (Sweden)

    Sawa Ito

    2015-01-01

    Full Text Available Mesenchymal stromal cells (MSCs support the growth and differentiation of normal hematopoietic stem cells (HSCs. Here we studied the ability of MSCs to support the growth and survival of leukemic stem cells (LSCs in vitro. Primary leukemic blasts isolated from the peripheral blood of 8 patients with acute myeloid leukemia (AML were co-cultured with equal numbers of irradiated MSCs derived from unrelated donor bone marrow, with or without cytokines for up to 6 weeks. Four samples showed CD34+CD38− predominance, and four were predominantly CD34+CD38+. CD34+ CD38− predominant leukemia cells maintained the CD34+ CD38− phenotype and were viable for 6 weeks when co-cultured with MSCs compared to co-cultures with cytokines or medium only, which showed rapid differentiation and loss of the LSC phenotype. In contrast, CD34+ CD38+ predominant leukemic cells maintained the CD34+CD38+ phenotype when co-cultured with MSCs alone, but no culture conditions supported survival beyond 4 weeks. Cell cycle analysis showed that MSCs maintained a higher proportion of CD34+ blasts in G0 than leukemic cells cultured with cytokines. AML blasts maintained in culture with MSCs for up to 6 weeks engrafted NSG mice with the same efficiency as their non-cultured counterparts, and the original karyotype persisted after co-culture. Chemosensitivity and transwell assays suggest that MSCs provide pro-survival benefits to leukemic blasts through cell–cell contact. We conclude that MSCs support long-term maintenance of LSCs in vitro. This simple and inexpensive approach will facilitate basic investigation of LSCs and enable screening of novel therapeutic agents targeting LSCs.

  12. Human neuronal cells in culture: from concepts to basic methodology.

    Science.gov (United States)

    Silani, V; Pizzuti, A; Donato, M F; Falini, A; Bassani, R; Strada, O; Causarano, R I; Mariani, D; Villani, R M; Scarlato, G

    1990-01-01

    The paper reviews some conceptual and methodological aspects of the tissue culture models which, during the past three decades, demonstrated a remarkable mimicry of many important structures and functions of the mammalian Central Nervous System (CNS) and related peripheral sensory and motor elements. Emphasis is placed on an original human neuronal tissue culture model obtained from selective CNS areas. The different cell types were identified and the neurotrophic interactions preliminary characterized. Neuropathological findings suggest hypothesis that can be fully tested using in vitro human models of affected cerebral specific areas. PMID:2102114

  13. Over-pressurized bioreactors: application to microbial cell cultures.

    Science.gov (United States)

    Lopes, Marlene; Belo, Isabel; Mota, Manuel

    2014-01-01

    In industrial biotechnology, microbial cultures are exposed to different local pressures inside bioreactors. Depending on the microbial species and strains, the increased pressure may have detrimental or beneficial effects on cellular growth and product formation. In this review, the effects of increased air pressure on various microbial cultures growing in bioreactors under moderate total pressure conditions (maximum, 15 bar) will be discussed. Recent data illustrating the diversity of increased air pressure effects at different levels in microbial cells cultivation will be presented, with particular attention to the effects of oxygen and carbon dioxide partial pressures on cellular growth and product formation, and the concomitant effect of oxygen pressure on antioxidant cellular defense mechanisms.

  14. The major bovine mastitis pathogens have different cell tropisms in cultures of bovine mammary gland cells

    NARCIS (Netherlands)

    Lammers, A.; Vorstenbosch, van C.J.; Erkens, J.H.F.; Smith, H.E.

    2001-01-01

    We previously showed that Staphylococcus aureus cells adhered mainly to an elongated cell type, present in cultures of bovine mammary gland cells. Moreover. we showed that this adhesion was mediated by binding to fibronectin. The same in vitro model was used here, to study adhesion of other importan

  15. MEMS-based dynamic cell-to-cell culture platforms using electrochemical surface modifications

    International Nuclear Information System (INIS)

    MEMS-based biological platforms with the capability of both spatial placements and time releases of living cells for cell-to-cell culture experiments have been designed and demonstrated utilizing electrochemical surface modification effects. The spatial placement is accomplished by electrochemical surface modification of substrate surfaces to be either adhesive or non-adhesive for living cells. The time control is achieved by the electrical activation of the selective indium tin oxide co-culture electrode to allow the migration of living cells onto the electrode to start the cell-to-cell culture studies. Prototype devices have a three-electrode design with an electrode size of 50 × 50 µm2 and the separation gaps of 2 µm between them. An electrical voltage of −1.5 V has been used to activate the electrodes independently and sequentially to demonstrate the dynamic cell-to-cell culture experiments of NIH 3T3 fibroblast and Madin Darby canine kidney cells. As such, this MEMS platform could be a basic yet versatile tool to characterize transient cell-to-cell interactions

  16. Keratocytes Derived from Spheroid Culture of Corneal Stromal Cells Resemble Tissue Resident Keratocytes

    OpenAIRE

    Byun, Yong-Soo; Tibrewal, Sapna; Kim, Eunjae; Yco, Lisette; Sarkar, Joy; Ivanir, Yair; Liu, Chia-Yang; Sano, Cecile M.; Jain, Sandeep

    2014-01-01

    Purpose Corneal stromal cells transform to precursor cells in spheroid culture. We determined whether keratocytes derived from spheroid culture of murine corneal stromal cells resemble tissue resident keratocytes. Methods Spheroid culture was performed by seeding dissociated stromal cells onto ultra-low attachment plates containing serum-free mesenchymal stem cell culture medium. Spheroids were characterized with phenotype specific markers and stemness transcription factor genes. Spheroids an...

  17. Characterizing parameters of Jatropha curcas cell cultures for microgravity studies

    Science.gov (United States)

    Vendrame, Wagner A.; Pinares, Ania

    2013-06-01

    Jatropha (Jatropha curcas) is a tropical perennial species identified as a potential biofuel crop. The oil is of excellent quality and it has been successfully tested as biodiesel and in jet fuel mixes. However, studies on breeding and genetic improvement of jatropha are limited. Space offers a unique environment for experiments aiming at the assessment of mutations and differential gene expression of crops and in vitro cultures of plants are convenient for studies of genetic variation as affected by microgravity. However, before microgravity studies can be successfully performed, pre-flight experiments are necessary to characterize plant material and validate flight hardware environmental conditions. Such preliminary studies set the ground for subsequent spaceflight experiments. The objectives of this study were to compare the in vitro growth of cultures from three explant sources (cotyledon, leaf, and stem sections) of three jatropha accessions (Brazil, India, and Tanzania) outside and inside the petriGAP, a modified group activation pack (GAP) flight hardware to fit petri dishes. In vitro jatropha cell cultures were established in petri dishes containing a modified MS medium and maintained in a plant growth chamber at 25 ± 2 °C in the dark. Parameters evaluated were surface area of the explant tissue (A), fresh weight (FW), and dry weight (DW) for a period of 12 weeks. Growth was observed for cultures from all accessions at week 12, including subsequent plantlet regeneration. For all accessions differences in A, FW and DW were observed for inside vs. outside the PetriGAPs. Growth parameters were affected by accession (genotype), explant type, and environment. The type of explant influenced the type of cell growth and subsequent plantlet regeneration capacity. However, overall cell growth showed no abnormalities. The present study demonstrated that jatropha in vitro cell cultures are suitable for growth inside PetriGAPs for a period of 12 weeks. The parameters

  18. Isolation and culture of protoplasts of Ma-phut (Garcinia dulcis derived from cell suspension culture

    Directory of Open Access Journals (Sweden)

    Sompong Te-chato

    2008-09-01

    Full Text Available Friable callus induced from young leaves of Ma-phut on Murashige and Skoog (MS medium containing 3% sucrose,1 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D, 0.5 mg/l benzyladenine (BA and 500 mg/l polyvinylpyrrolidone (PVP, was cultured in liquid medium with the same components. Various ages of cell suspension at weekly intervals were then incubated in various kinds and concentrations of cell wall digestion enzymes combined with 1% macerozyme R-10 on a rotary shaker at 100 rpm under 1500 lux illumination at 26±4oC. Purified protoplasts were cultured at various densities in MS medium (adjusted osmoticum to 0.4 M by mannitol supplemented with 3% sucrose and two types of auxin, 2,4-D and NAA at four concentrations (1, 2, 3 and 4 mg/l together with 1 mg/l BA. The results revealed that a four-day old cell suspension culture incubated in 2% cellulase Onozuka R-10 (CR10 in combination with 1% macerozyme R-10 gave an optimum result in both yield and viability of protoplasts at 5.7x106/1 ml PCV and 80%, respectively. Embedding protoplasts at a density of 2.5x105/ml in 0.2% phytagel containing MS medium supplemented with 3 mg/l NAA and 1 mg/l BA promoted the most effective division of the protoplasts (20%. The first division of the protoplasts was obtained after 2 days of culture and further divisions to form micro- and macro-colonies could be observed after 7-10 days of culture. However, callusformation and plantlet regeneration was not obtained.

  19. Improved culture-based isolation of differentiating endothelial progenitor cells from mouse bone marrow mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Haruki Sekiguchi

    Full Text Available Numerous endothelial progenitor cell (EPC-related investigations have been performed in mouse experiments. However, defined characteristics of mouse cultured EPC have not been examined. We focused on fast versus slow adherent cell population in bone marrow mononuclear cells (BMMNCs in culture and examined their characteristics. After 24 h-culture of BMMNCs, attached (AT cells and floating (FL cells were further cultured in endothelial differentiation medium separately. Immunological and molecular analyses exhibited more endothelial-like and less monocyte/macrophage-like characteristics in FL cells compared with AT cells. FL cells formed thick/stable tube and hypoxia or shear stress overload further enhanced these endothelial-like features with increased angiogenic cytokine/growth factor mRNA expressions. Finally, FL cells exhibited therapeutic potential in a mouse myocardial infarction model showing the specific local recruitment to ischemic border zone and tissue preservation. These findings suggest that slow adherent (FL but not fast attached (AT BMMNCs in culture are EPC-rich population in mouse.

  20. Propagation and isolation of ranaviruses in cell culture

    DEFF Research Database (Denmark)

    Ariel, Ellen; Nicolajsen, Nicole; Christophersen, Maj-Britt;

    2009-01-01

    The optimal in vitro propagation procedure for a panel of ranavirus isolates and the best method for isolation of Epizootic haematopoietic necrosis virus (EHNV) from organ material in cell-culture were investigated. The panel of ranavirus isolates included: Frog virus 3 (FV3), Bohle iridovirus (BIV......), epithelioma papulosum cyprini (EPC), chinook salmon embryo (CHSE-214) rainbow trout gonad (RTG-2) and fathead minnow (FHM), and incubated at 10, 15, 20, 24 and 28 °C for two weeks. BF-2, EPC and CHSE-214 cells performed well and titers obtained in the three cell lines were similar, whereas FHM and RTG-2 cells...... consistently produced lower titers than the other cell lines at all temperatures. The optimal temperature for propagating the isolates collectively to high titers in vivo was 24 °C. Additionally, three established methods for re-isolation of virus from EHNV-infected organ material were compared. Challenged...

  1. Dexamethasone Modulation on Cultured Human Retinal Pigment Epithelial Cell

    Institute of Scientific and Technical Information of China (English)

    Bing Liu; Yannian; Hui Yusheng Wang; Hong Wei

    2001-01-01

    Purpose: Dexamethasone(DEX) was tested for its ability to modulate human retinal pigment epithelium (hRPE) cell proliferation in cell culture. Methods: DEX in different concentrations was added to cultured hRPE cells. The effects were measured with MTT method, 3H-thymidine(3H-TdR) incorporation and flow cytometw. Results: DEX increased survival rate and DNA synthesis from 32 mg/L to 320 mg/L under hRPE culture conditions, but paradoxically reduced them at 1 000 mg/L and 3 200 mg/L in dose and time dependent fashion by both MTT assay and 3 H-TdR incorporation. The cell numbers in S phase and G2/M phase increased 28.32 % at DEX concentration 320 mg/L, in contrast, reduced 41.84 % at 1 000 mg/L. Conclusion: DEX increased proliferation from 32 mg/L to 320 mg/L, and inhibited proliferation at concentrations greater than 320 mg/L. The inhibiting effect of DEX may happen in s phase and G2/M phase. Eye Sciernce 2001; 17:27 ~ 30.

  2. Culture and purification of human fetal olfactory bulb ensheathing cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective: To obtain high purity of human fetal olfactory bulb ensheathing cells (OB-hOECs) in vitro and to develop a simple and effective method for primary culture of OB-hOECs. Methods: OB-hOECs were cultured based on the differential rates of attachment of the various harvested cell types. Then the method was combined with arabinoside cytosine (Ara-C)inhibition, serum-free starvation or intermittent neurotrophin 3 (NT3) nutrition method to observe cell states in different cultural environments. The purity of OB-hOECs was assessed with immunocytochemical analysis. Results: OB-hOECs appeared bipolar and tripolar shape, with slender processes forming network. The purity of OECs reached 88% with the selective attachment method on day 6, and then fibroblast proliferated quickly and reduced the purity. When combined with the starvation method, the purity of OECs was 91% on day 6 and 86% on day 9, however, OECs were in a poor state. While combined with the NT3 method, the purity reached 95% on day 9 and 83% on day 12, respectively. The cells still remained in a good state. Conclusion: A combination of selective attachment and intermittent NT3 nutrition is an effective method to obtain OECs with higher purity and quality.

  3. Co-stimulation of cultured peripheral blood mononuclear cells from intrinsic asthmatics with exogenous recombinant IL-6 produce high levels of IL-4-dependent IgE.

    Science.gov (United States)

    Sánchez-Guerrero, I M; Herrero, N; Muro, M; Vegara, R P; Campos, M; García-Alonso, A M; Alvarez, M R

    1997-09-01

    Asthma is an inflammatory airway disorder, traditionally subdivided into extrinsic, immunoglobulin E (IgE)-mediated, and intrinsic asthma of unknown aetiology. IgE synthesis requires contact between T- and B-cells and a signal provided by interleukin (IL)-4, which can be modulated by IL-6. The objective of this study was to evaluate the effects of IL-4 and IL-6 on total IgE synthesis by peripheral blood mononuclear cells from intrinsic and extrinsic asthmatics. Peripheral blood mononuclear cells from intrinsic and extrinsic asthmatic patients and from healthy subjects were cultured and stimulated with pokeweed mitogen, recombinant IL-4 and IL-6. The IgE level in serum and supernatants was measured by an enzyme-linked immunoassay. Serum IgE was significantly lower in intrinsic asthma than in extrinsic asthma, but significantly higher than in control subjects. IgE production by cultured mononuclear cells from extrinsic asthmatics was not modified after exogenous IL-4 and IL-6 addition. However, intrinsic asthmatics showed enhancement of IgE synthesis in response to IL-4 stimulation, reaching a threefold increase of the spontaneous IgE values, when simultaneous recombinant IL-4 plus IL-6 stimulus was used. Our results indicate that exogenous recombinant interleukin-6 can significantly upregulate the interleukin-4-dependent immunoglobulin E synthesis in intrinsic asthma. This suggests that immunoglobulin E could also play a role in the pathogenesis of intrinsic asthma, in which an interleukin-6 threshold would be critical.

  4. Endothelial cells stimulate growth of normal and cancerous breast epithelial cells in 3D culture

    Directory of Open Access Journals (Sweden)

    Magnusson Magnus K

    2010-07-01

    Full Text Available Abstract Background Epithelial-stromal interaction provides regulatory signals that maintain correct histoarchitecture and homeostasis in the normal breast and facilitates tumor progression in breast cancer. However, research on the regulatory role of the endothelial component in the normal and malignant breast gland has largely been neglected. The aim of the study was to investigate the effects of endothelial cells on growth and differentiation of human breast epithelial cells in a three-dimensional (3D co-culture assay. Methods Breast luminal and myoepithelial cells and endothelial cells were isolated from reduction mammoplasties. Primary cells and established normal and malignant breast cell lines were embedded in reconstituted basement membrane in direct co-culture with endothelial cells and by separation of Transwell filters. Morphogenic and phenotypic profiles of co-cultures was evaluated by phase contrast microscopy, immunostaining and confocal microscopy. Results In co-culture, endothelial cells stimulate proliferation of both luminal- and myoepithelial cells. Furthermore, endothelial cells induce a subpopulation of luminal epithelial cells to form large acini/ducts with a large and clear lumen. Endothelial cells also stimulate growth and cloning efficiency of normal and malignant breast epithelial cell lines. Transwell and gradient co-culture studies show that endothelial derived effects are mediated - at least partially - by soluble factors. Conclusion Breast endothelial cells - beside their role in transporting nutrients and oxygen to tissues - are vital component of the epithelial microenvironment in the breast and provide proliferative signals to the normal and malignant breast epithelium. These growth promoting effects of endothelial cells should be taken into consideration in breast cancer biology.

  5. Heat-transfer-method-based cell culture quality assay through cell detection by surface imprinted polymers.

    Science.gov (United States)

    Eersels, Kasper; van Grinsven, Bart; Khorshid, Mehran; Somers, Veerle; Püttmann, Christiane; Stein, Christoph; Barth, Stefan; Diliën, Hanne; Bos, Gerard M J; Germeraad, Wilfred T V; Cleij, Thomas J; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

    2015-02-17

    Previous work has indicated that surface imprinted polymers (SIPs) allow for highly specific cell detection through macromolecular cell imprints. The combination of SIPs with a heat-transfer-based read-out technique has led to the development of a selective, label-free, low-cost, and user-friendly cell detection assay. In this study, the breast cancer cell line ZR-75-1 is used to assess the potential of the platform for monitoring the quality of a cell culture in time. For this purpose, we show that the proposed methodology is able to discriminate between the original cell line (adherent growth, ZR-75-1a) and a descendant cell line (suspension growth, ZR-75-1s). Moreover, ZR-75-1a cells were cultured for a prolonged period of time and analyzed using the heat-transfer method (HTM) at regular time intervals. The results of these experiments demonstrate that the thermal resistance (Rth) signal decays after a certain number of cell culture passages. This can likely be attributed to a compromised quality of the cell culture due to cross-contamination with the ZR-75-1s cell line, a finding that was confirmed by classical STR DNA profiling. The cells do not express the same functional groups on their membrane, resulting in a weaker bond between cell and imprint, enabling cell removal by mechanical friction, provided by flushing the measuring chamber with buffer solution. These findings were further confirmed by HTM and illustrate that the biomimetic sensor platform can be used as an assay for monitoring the quality of cell cultures in time.

  6. Co-culture with Sertoli cells promotes proliferation and migration of umbilical cord mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Fenxi, E-mail: fxzhang0824@gmail.com [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Hong, Yan; Liang, Wenmei [Department of Histology and Embryology, Guiyang Medical University, Guizhou 550004, People' s Republic of China (China); Ren, Tongming [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Jing, Suhua [ICU Center, The Third Hospital of Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Lin, Juntang [Stem Cell Center, Xinxiang Medical University, Henan 453003, People' s Republic of China (China)

    2012-10-12

    Highlights: Black-Right-Pointing-Pointer Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). Black-Right-Pointing-Pointer Presence of SCs dramatically increased proliferation and migration of UCMSCs. Black-Right-Pointing-Pointer Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of 'nurse' cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.

  7. A Place to Call Home: Bioengineering Pluripotential Stem Cell Cultures

    Directory of Open Access Journals (Sweden)

    Mark Weingarten

    2015-03-01

    Full Text Available Pluripotent stem cells (PSCs have the power to revolutionize the future of cell-based therapies and regenerative medicine. However, stem/progenitor cell use in the clinical arsenal has been hampered by discrepancies resulting from stem cell engineering and expansion, as well as in their (mass differentiation in culture. Moreover, the manner in which external conditions affect PSC and induced-pluripotent stem cell lineage establishment as well as maturation remains controversial. In this review, we examine novel methods of cell engineering and the role of reprogramming transcription factors in PSC development. In addition, we explore the effect of external environmental signals on PSC cultivation and differentiation by elucidating key components of the primordial stem cell microenvironment, the blastocyst. Furthermore, we assess the effects of hypoxic conditions on DNA editing, gene expression, and protein function in PSC self-renewal and growth. Finally, we speculate on the principal use of gap junction subunit expression as relevant biomarkers of PSC fate. Improving bioreactor design and pertinent cell biomarker classification could vastly enhance manufactured stem cell yield and quality, thereby increasing the potency and safety of therapeutic cells to be used in regenerative medicine.

  8. Enhancement effect of shikonin in cell suspension culture and transfermanant culture by radiation application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jae Sung; Lee, Young Keun; Chung, Byung Yeoup; Lee, Young Bok; Hwang Hye Yeon

    2004-10-01

    The cell lines 679, 679-29 and 622-46 of L. erythrorhizon could be selected on LS agar medium for the production shikonin in cell suspension culture. The shikonin was increased moderately in suspension culture of cell line 622-46 in LS liquid medium containing BA 2 mg{center_dot}L{sup -1} and IAA 0.2 mg{center_dot}L{sup -1} in the dark, and was increased by adding 1 {mu}M Cu{sup 2+} and 100 {mu}M methyl jasmonate The accumulation of shikonin in the liquid medium was increased significantly by 2 Gy irradiation to callus of cell line 622-46 and culture in LS liquid medium containing BA 2 mg{center_dot}L{sup -1} and IAA 0.2 mg{center_dot}L{sup -1} in the dark and shikonin in cell debris was higher by 16 Gy irradiation. The activity of p-hydroxybenzoate geranyltransferase was increased by irradiation of 2 Gy and 16 Gy of {gamma} radiation. Seedling hypocotyles of L. erythrorhizon were infected with Agrogacterium rhizogenes strain 15834 harboring a binary vector with an intron bearing the GUS ({beta}-glucuronidase) gene driven by cauliflower mosaic virus (CaMV) 35S promotor as well as the HPT (hygromycin phosphotransferase) gene as the selection marker. Hairy roots isolated were hygromycin resistant and had integrated GUS gene in DNA. The root tip grown on M-9 medium showed normal pigment production pattern in border cells and root hairs.

  9. Radiation Response of Cultured Human Cells Is Unaffected by Johrei

    Directory of Open Access Journals (Sweden)

    Zach Hall

    2007-01-01

    Full Text Available Johrei has been credited with healing thousands from radiation wounds after the Hiroshima and Nagasaki bombs in 1945. This alternative medical therapy is becoming increasingly popular in the United States, as are other Energy Medicine modalities that purport to influence a universal healing energy. Human brain cells were cultured and exposed to increasing doses of ionizing radiation. Experienced Johrei practitioners directed healing intentionality toward the cells for 30 min from a distance of 20 cm and the fate of the cells was observed by computerized time-lapse microscopy. Cell death and cell divisions were tallied every 30 min before, during and after Johrei treatment for a total of 22.5 h. An equal number of control experiments were conducted in which cells were irradiated but did not receive Johrei treatment. Samples were assigned to treatment conditions randomly and data analysis was conducted in a blinded fashion. Radiation exposure decreased the rate of cell division (cell cycle arrest in a dose-dependent manner. Division rates were estimated for each 30 min and averaged over 8 independent experiments (4 control and 4 with Johrei treatment for each of 4 doses of X-rays (0, 2, 4 and 8 Gy. Because few cell deaths were observed, pooled data from the entire observation period were used to estimate death rates. Analysis of variance did not reveal any significant differences on division rate or death rate between treatment groups. Only radiation dose was statistically significant. We found no indication that the radiation response of cultured cells is affected by Johrei treatment.

  10. Radiation response of cultured human cells is unaffected by Johrei.

    Science.gov (United States)

    Hall, Zach; Luu, Tri; Moore, Dan; Yount, Garret

    2007-06-01

    Johrei has been credited with healing thousands from radiation wounds after the Hiroshima and Nagasaki bombs in 1945. This alternative medical therapy is becoming increasingly popular in the United States, as are other Energy Medicine modalities that purport to influence a universal healing energy. Human brain cells were cultured and exposed to increasing doses of ionizing radiation. Experienced Johrei practitioners directed healing intentionality toward the cells for 30 min from a distance of 20 cm and the fate of the cells was observed by computerized time-lapse microscopy. Cell death and cell divisions were tallied every 30 min before, during and after Johrei treatment for a total of 22.5 h. An equal number of control experiments were conducted in which cells were irradiated but did not receive Johrei treatment. Samples were assigned to treatment conditions randomly and data analysis was conducted in a blinded fashion. Radiation exposure decreased the rate of cell division (cell cycle arrest) in a dose-dependent manner. Division rates were estimated for each 30 min and averaged over 8 independent experiments (4 control and 4 with Johrei treatment) for each of 4 doses of X-rays (0, 2, 4 and 8 Gy). Because few cell deaths were observed, pooled data from the entire observation period were used to estimate death rates. Analysis of variance did not reveal any significant differences on division rate or death rate between treatment groups. Only radiation dose was statistically significant. We found no indication that the radiation response of cultured cells is affected by Johrei treatment. PMID:17549235

  11. Calcium exchange, structure, and function in cultured adult myocardial cells

    International Nuclear Information System (INIS)

    Cells digested from adult rat heart and cultured for 14 days demonstrate all the structural elements, in mature form, associated with the process of excitation-contraction (EC) coupling. The transverse tubular (TT) system is well developed with an extensive junctional sarcoplasmic reticulum (JSR). In nonphosphate-containing buffer contraction of the cells is lost as rapidly as zero extracellular Ca concentration ([Ca]0) solution is applied and a negative contraction staircase is produced on increase of stimulation frequency. Structurally and functionally the cells have the characteristics of adult cells in situ. 45Ca exchange and total 45Ca measurement in N-2-hydroxyethylpiperazine N'-2-ethanesulfonic acid (HEPES)-buffered perfusate define three components of cellular Ca: 1) a rapidly exchangeable component accounting for 36% of total Ca, 2) a slowly exchangeable component (t/sub 1/2/ 53 min) accounting for 7% total Ca, and 3) the remaining 57% cellular Ca is inexchangeable (demonstrates no significant exchange within 60 min). The slowly exchangeable component can be increased 10-fold within 60 min by addition of phosphate to the perfusate. The Ca distribution and exchange characteristics are little different from those of 3-day cultures of neonatal rat heart previously studied. The results suggest that the cells are representative of adult cells in situ and that both sarcolemmal-bound and sarcoplasmic reticular Ca contribute to the component of Ca that is rapidly exchangeable

  12. Effect of radiofrequency radiation in cultured mammalian cells: A review.

    Science.gov (United States)

    Manna, Debashri; Ghosh, Rita

    2016-01-01

    The use of mobile phone related technologies will continue to increase in the foreseeable future worldwide. This has drawn attention to the probable interaction of radiofrequency electromagnetic radiation with different biological targets. Studies have been conducted on various organisms to evaluate the alleged ill-effect on health. We have therefore attempted to review those work limited to in vitro cultured cells where irradiation conditions were well controlled. Different investigators have studied varied endpoints like DNA damage, cell cycle arrest, reactive oxygen species (ROS) formation, cellular morphology and viability to weigh the genotoxic effect of such radiation by utilizing different frequencies and dose rates under various irradiation conditions that include continuous or pulsed exposures and also amplitude- or frequency-modulated waves. Cells adapt to change in their intra and extracellular environment from different chemical and physical stimuli through organized alterations in gene or protein expression that result in the induction of stress responses. Many studies have focused on such effects for risk estimations. Though the effects of microwave radiation on cells are often not pronounced, some investigators have therefore combined radiofrequency radiation with other physical or chemical agents to observe whether the effects of such agents were augmented or not. Such reports in cultured cellular systems have also included in this review. The findings from different workers have revealed that, effects were dependent on cell type and the endpoint selection. However, contradictory findings were also observed in same cell types with same assay, in such cases the specific absorption rate (SAR) values were significant.

  13. Aquaporin-1 Expressed in Cultured Human Trabecular Meshwork Cells

    Institute of Scientific and Technical Information of China (English)

    Mingkai Lin; Jian Ge; Yehong Zhuo; Yuqing Lan; Keming Yu; Jianliang Zheng

    2002-01-01

    Objective:To determine if aquaporin-1 could be detected in cultures of human trabecularshwork cells. Methods: Using primers specific for aquaporin-1, reverse transcription combined withpolymerase chain reaction (RT-PCR) yielded a product and its size with total RNAprepared from the human trabecular meshwork cells. SDS-PAGE and immunoblottingwere also used in this study to detect the specific water channel.Results: The presence of this product and its size (298 base pairs) are consistent withthat of an aquaporin-1 message in these cells. A band of 28 kD in agreement with themolecular size of aquaporin-1 was showed in a film by immunoblotting.Conclusion: The presence of aquaporin-1 in human trabecular meshwork cells, thepredominant cell-type of the primary outflow region of the human eye, suggests that waterchannels may be involved in the movement of aqueous fluid out of the eye. In addition,the existence of aquaporin-1 on cultures of human trabecular meshwork cells provides anin vitro model to study the endogenous expression of aquaporin-1 and its possible role inthe regulation of aqueous outflow.

  14. Methyl Jasmonate Represses Growth and Affects Cell Cycle Progression in Cultured Taxus Cells

    OpenAIRE

    Patil, Rohan A.; Lenka, Sangram K.; Normanly, Jennifer; Walker, Elsbeth L.; Roberts, Susan C.

    2014-01-01

    Methyl jasmonate (MeJA) elicitation is an effective strategy to induce and enhance synthesis of the anticancer agent paclitaxel (Taxol®) in Taxus cell suspension cultures; however, concurrent decreases in growth are often observed, which is problematic for large scale bioprocessing. Here, increased accumulation of paclitaxel in Taxus cuspidata suspension cultures with MeJA elicitation was accompanied by a concomitant decrease in cell growth, evident within the first three days post-elicitatio...

  15. A modular suite of hardware enabling spaceflight cell culture research

    Science.gov (United States)

    Hoehn, Alexander; Klaus, David M.; Stodieck, Louis S.

    2004-01-01

    BioServe Space Technologies, a NASA Research Partnership Center (RPC), has developed and operated various middeck payloads launched on 23 shuttle missions since 1991 in support of commercial space biotechnology projects. Modular cell culture systems are contained within the Commercial Generic Bioprocessing Apparatus (CGBA) suite of flight-qualified hardware, compatible with Space Shuttle, SPACEHAB, Spacelab and International Space Station (ISS) EXPRESS Rack interfaces. As part of the CGBA family, the Isothermal Containment Module (ICM) incubator provides thermal control, data acquisition and experiment manipulation capabilities, including accelerometer launch detection for automated activation and thermal profiling for culture incubation and sample preservation. The ICM can accommodate up to 8 individually controlled temperature zones. Command and telemetry capabilities allow real-time downlink of data and video permitting remote payload operation and ground control synchronization. Individual cell culture experiments can be accommodated in a variety of devices ranging from 'microgravity test tubes' or standard 100 mm Petri dishes, to complex, fed-batch bioreactors with automated culture feeding, waste removal and multiple sample draws. Up to 3 levels of containment can be achieved for chemical fixative addition, and passive gas exchange can be provided through hydrophobic membranes. Many additional options exist for designing customized hardware depending on specific science requirements.

  16. Handbook of plant cell culture. Volume 2. Crop species

    Energy Technology Data Exchange (ETDEWEB)

    Sharp, W.R.; Evans, D.A.; Ammirato, P.V.; Yamada, Y. (eds.)

    1984-01-01

    In this volume the state-of-the-art plant cell culture techniques described in the first volume are applied to several agricultural and horticultural crops. In 21 chapters, they include maize, oats, wheat, beans, red clover and other forage legumes, asparagus, celery, cassava, sweet potato, banana, pawpaw, apple, grapes, conifers, date palm, rubber, sugarcane and tobacco. Each chapter contains (1) detailed protocols to serve as the foundation for current research, (2) a critical review of the literature, and (3) in-depth evaluations of the potential shown by plant cell culture for crop improvement. The history and economic importance of each crop are discussed. This volume also includes an essay, ''Oil from plants'', by M. Calvin.

  17. Gill cell culture systems as models for aquatic environmental monitoring.

    Science.gov (United States)

    Bury, Nic R; Schnell, Sabine; Hogstrand, Christer

    2014-03-01

    A vast number of chemicals require environmental safety assessments for market authorisation. To ensure acceptable water quality, effluents and natural waters are monitored for their potential harmful effects. Tests for market authorisation and environmental monitoring usually involve the use of large numbers of organisms and, for ethical, cost and logistic reasons, there is a drive to develop alternative methods that can predict toxicity to fish without the need to expose any animals. There is therefore a great interest in the potential to use cultured fish cells in chemical toxicity testing. This review summarises the advances made in the area and focuses in particular on a system of cultured fish gill cells grown into an epithelium that permits direct treatment with water samples.

  18. Gill cell culture systems as models for aquatic environmental monitoring.

    Science.gov (United States)

    Bury, Nic R; Schnell, Sabine; Hogstrand, Christer

    2014-03-01

    A vast number of chemicals require environmental safety assessments for market authorisation. To ensure acceptable water quality, effluents and natural waters are monitored for their potential harmful effects. Tests for market authorisation and environmental monitoring usually involve the use of large numbers of organisms and, for ethical, cost and logistic reasons, there is a drive to develop alternative methods that can predict toxicity to fish without the need to expose any animals. There is therefore a great interest in the potential to use cultured fish cells in chemical toxicity testing. This review summarises the advances made in the area and focuses in particular on a system of cultured fish gill cells grown into an epithelium that permits direct treatment with water samples. PMID:24574380

  19. Transparent, biocompatible nanostructured surfaces for cancer cell capture and culture

    Directory of Open Access Journals (Sweden)

    Cheng BR

    2014-05-01

    Full Text Available Boran Cheng,1,* Zhaobo He,2,* Libo Zhao,2,* Yuan Fang,1 Yuanyuan Chen,1 Rongxiang He,2 Fangfang Chen,1 Haibin Song,1 Yuliang Deng,2 Xingzhong Zhao,2 Bin Xiong1 1Department of Oncology, Zhongnan Hospital of Wuhan University, Hubei Key Laboratory of Tumor Biological Behaviors, Hubei Cancer Clinical Study Center, Wuhan, Hubei, People’s Republic of China; 2Key Laboratory of Artificial Micro- and Nano-Structures of Ministry of Education, School of Physics and Technology, Wuhan University, Wuhan, Hubei, People’s Republic of China *These authors contributed equally to this work Abstract: Circulating tumor cells (CTCs in the blood which have detached from both the primary tumor and any metastases may be considered as a “liquid biopsy” and are expected to replace tumor biopsies in the monitoring of treatment response and determining patient prognosis. Here, we introduce a facile and efficient CTC detection material made of hydroxyapatite/chitosan (HA/CTS, which is beneficial because of its transparency and excellent biological compatibility. Atomic force microscopy images show that the roughness of the HA/CTS nanofilm (HA/CTSNF substrates can be controlled by changing the HA:CTS ratio. Enhanced local topographic interactions between nano-components on cancer cell membranes, and the antibody coated nanostructured substrate lead to improved CTC capture and separation. This remarkable nanostructured substrate has the potential for CTC culture in situ and merits further analysis. CTCs captured from artificial blood samples were observed in culture on HA/CTSNF substrates over a period of 14 days by using conventional staining methods (hematoxylin eosin and Wright’s stain. We conclude that these substrates are multifunctional materials capable of isolating and culturing CTCs for subsequent studies. Keywords: cell capture, cell culture, nanofilms, hydroxyapatite/chitosan

  20. Ion-selective microelectrode arrays for cell culture monitoring

    OpenAIRE

    Generelli, Silvia; De Rooij, Nicolas-F.

    2008-01-01

    The design, microfabrication and characterization of a platform comprising an array of ion-selective microelectrodes (µISE) aimed at in vitro cellular physiology and toxicology is described. This study focusses on K+ and Ca2+ monitoring in cell culture environments. A potential promising application of such a platform is based on recent findings in molecular biology, revealing connections between certain diseases, as for example some types of cancer or parkinsonism, and a malfunction in cellu...

  1. Preparation of Cell Cultures and Vaccinia Virus Stocks.

    Science.gov (United States)

    Cotter, Catherine A; Earl, Patricia L; Wyatt, Linda S; Moss, Bernard

    2015-01-01

    The culturing of cell lines used with vaccinia virus, both as monolayer and in suspension, is described. The preparation of chick embryo fibroblasts (CEF) is presented for use in the production of the highly attenuated and host range-restricted modified vaccinia virus Ankara (MVA) strain of vaccinia virus. Protocols for the preparation, titration, and trypsinization of vaccinia virus stocks, as well as viral DNA preparation and virus purification methods are also included.

  2. A Three-Dimensional Cell Culture Model To Study Enterovirus Infection of Polarized Intestinal Epithelial Cells.

    Science.gov (United States)

    Drummond, Coyne G; Nickerson, Cheryl A; Coyne, Carolyn B

    2016-01-01

    Despite serving as the primary entry portal for coxsackievirus B (CVB), little is known about CVB infection of the intestinal epithelium, owing at least in part to the lack of suitable in vivo models and the inability of cultured cells to recapitulate the complexity and structure associated with the gastrointestinal (GI) tract. Here, we report on the development of a three-dimensional (3-D) organotypic cell culture model of Caco-2 cells to model CVB infection of the gastrointestinal epithelium. We show that Caco-2 cells grown in 3-D using the rotating wall vessel (RWV) bioreactor recapitulate many of the properties of the intestinal epithelium, including the formation of well-developed tight junctions, apical-basolateral polarity, brush borders, and multicellular complexity. In addition, transcriptome analyses using transcriptome sequencing (RNA-Seq) revealed the induction of a number of genes associated with intestinal epithelial differentiation and/or intestinal processes in vivo when Caco-2 cells were cultured in 3-D. Applying this model to CVB infection, we found that although the levels of intracellular virus production were similar in two-dimensional (2-D) and 3-D Caco-2 cell cultures, the release of infectious CVB was enhanced in 3-D cultures at early stages of infection. Unlike CVB, the replication of poliovirus (PV) was significantly reduced in 3-D Caco-2 cell cultures. Collectively, our studies show that Caco-2 cells grown in 3-D using the RWV bioreactor provide a cell culture model that structurally and transcriptionally represents key aspects of cells in the human GI tract and can thus be used to expand our understanding of enterovirus-host interactions in intestinal epithelial cells. IMPORTANCE Coxsackievirus B (CVB), a member of the enterovirus family of RNA viruses, is associated with meningitis, pericarditis, diabetes, dilated cardiomyopathy, and myocarditis, among other pathologies. CVB is transmitted via the fecal-oral route and encounters the

  3. Ethanolamine metabolism in cultured bovine aortic endothelial cells

    International Nuclear Information System (INIS)

    The role of extracellular ethanolamine in phospholipid synthesis was examined in cultured bovine aortic endothelial cells. Serine and ethanolamine were both readily accumulated by these cells and incorporated into phospholipid. Exposing cells to extracellular ethanolamine for 4-6 weeks had no effect on cell growth, yet increased the phosphatidylethanolamine content of these cells by 31% as compared to control cells. The intracellular content of ethanolamine was measured by high performance liquid chromatography, and results showed that the ethanolamine-treated cells contained a significantly greater amount of free ethanolamine compared to control cells. Ethanolamine-treated cells also had decreased accumulation and incorporation into lipid of [3H]ethanolamine throughout a 48-h incubation and increased K'm and V'max parameters of ethanolamine transport as compared to control cells. Studies were also done to examine the effect of ethanolamine on the generation of free ethanolamine from phosphatidylserine. In pulse-chase experiments with [3H]serine, a physiological concentration of ethanolamine decreased the amount of 3H-labeled phosphatidylethanolamine produced from 3H-labeled phosphatidylserine by 12 h as compared to the amount of 3H-labeled phosphatidyl-ethanolamine produced in the absence of ethanolamine in the chase incubation. Furthermore, ethanolamine-treated cells accumulated 20% less labeled ethanolamine in the aqueous pool from [3H]serine after 24 h of incubation than did control cells. These results can be explained by isotope dilution with the ethanolamine pool that accumulates in these cells with time when exposed to media supplemented with a physiological concentration of ethanolamine and by an effect of ethanolamine on ethanolamine generation from phosphatidylserine

  4. In Vitro Cell Culture Infectivity Assay for Human Noroviruses

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Honer Zu Bentrup, Kerstin A.; Orosz Coghlan, Patricia A.; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza; Nickerson, Cheryl A.

    2007-01-30

    Human noroviruses (NoV) cause severe, self-limiting gastroenteritis that typically lasts 24 - 48 hours. The true nature of NoV pathogenesis remains unknown due to the lack of suitable tissue culture or animal models. Here we show, for the first time, that NoV can infect and replicate in an organoid, three-dimensional (3-D) model of human small intestinal epithelium (INT-407). Cellular differentiation for this model was achieved by growing the cells in 3-D on porous collagen I-coated microcarrier beads under conditions of physiological fluid shear in rotating wall vessel bioreactors. Microscopy, PCR, and fluorescent in-situ hybridization were employed to provide evidence of NoV infection. CPE and norovirus RNA was detected at each of the five cell passages for both genogroup I and II viruses. Our results demonstrate that the highly differentiated 3-D cell culture model can support the natural growth of human noroviruses, whereas previous attempts using differentiated monolayer cultures failed.

  5. Somatic Embryogenesis from Cell Suspension Cultures of Aspen Clone

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Suspension cultures initiated from callus derived from petiole explants of aspen hybrid (Populus tremuloides × P.tremula) produced somatic embryos. Callus was induced on a MS medium supplemented with 5 mg·L-1 2,4-D and 0.05 mg·L-1 zeatin under light conditions. Embryogenic calli were obtained when a subsequent subculture of calli was suspended in the same basal medium with 10 mg·L-1 2,4-D. The highest number of globular embryos were induced from embryogenic calli by cell suspension culture in a MS liquid medium supplemented with 10 mg·L-1 2,4-D. Genotype and 2,4-D concentration were vital to the induction of embryogenic calli producing competent cells. Embryogenic calli for each genotype were heterogeneous. Green calli with gel-like consistency could yield more competent cells than light yellow embryogenic calli. However, some globular embryos broke into slices and some developed abnormally after one month of culture under the same or other hormonal conditions.

  6. The culture of human embryonic stem cells in microchannel perfusion bioreactors

    Science.gov (United States)

    Korin, Natanel; Bransky, Avishay; Dinnar, Uri; Levenberg, Shulamit

    2007-12-01

    The culture of human Embryonic Stem (ES) cells in microchannel bioreactors can be highly beneficial for ES cell biology studies and ES tissue engineering applications. In the present study we examine the use of Human Foreskin Fibroblasts (HFF) cells as feeder cells for human ES culture in a microchannel perfusion bioreactor. PDMS microchannels (depth:130 micron) were fabricated using conventional soft-lithography techniques. The channels were sterilized, coated with a human fibronectin solution and seeded with cells. Following a period of static incubation, culture medium was perfused through the channels at various flow rates and cell growth was monitored throughout the culture process. Mass transport and fluid mechanics models were used to evaluate the culture conditions (shear stress, oxygen levels within the micro-bioreactor as a function of the medium flow rate. The conditions for successful long-term culture (>7 days) of HFF under flow were established. Experiments with human embryonic stem cells cultured in microchannels show that the conditions essential to co-culture human ES cell on HFF cells under perfusion differ from the conditions necessary for HFF cell culture. Human ES cells were found to be highly sensitive to flow and culture conditions and did not grow under flow rates which were suitable for HFF long-term culture. Successful culture of undifferentiated human ES cell colonies in a perfusion micro-bioreactor is a basic step towards utilizing microfluidic techniques to explore stem cell biology.

  7. Immunoprecipitation of membrane proteins of cultured human sarcoma cells.

    Science.gov (United States)

    Grófová, M; Forchhammer, J; Lizonová, A; Popovic, M

    1981-01-01

    Human sarcoma associated antigens (HSAA) have previously been identified by indirect immune fluorescence in human sarcoma cells in culture using sera from patients bearing different types of sarcoma. To further characterize these HSAA, surface proteins of cultured cells were labeled with 125Iodine, [3H]-glucosamine and [35S]-methionine and solubilized. After immunoprecipitation labeled proteins were detected in immune complexes by SDS polyacrylamide gel electrophoresis and autoradiography, which allowed comparison with antigens described by other groups. A surface protein (Mr 96 000) was precipitated with sera from sarcoma bearing patients, and two glycoproteins (Mr 115 000 and 85 000) were preferentially precipitated with antisera from rabbits immunized with membranes from two human sarcoma cell lines. At least two of these proteins were found in each of five human sarcoma cell lines studied (U-4SS, U-3930S, U-20S, B-5GT and B-6FS). None of the proteins were precipitated with three human control sera, and only occasionally a faint band was observed in immunoprecipitates from control cells (B-25F, B-41B, B-42FC, U-2S, and U-393S with the immune sera. These proteins are probably some of the antigens responsible for the immune fluorescence observed in determination of HSAA. However, purification of the proteins and competition experiments are needed before this can be finally established.

  8. Isolation and culture of porcine neural progenitor cells from embryos and pluripotent stem cells

    DEFF Research Database (Denmark)

    Rasmussen, Mikkel Aabech; Hall, Vanessa Jane; Hyttel, Poul

    2013-01-01

    therapy. The pig has become recognized as an important large animal model and establishment of in vitro-derived porcine NPCs would allow for preclinical safety testing by transplantation in a porcine biomedical model. In this chapter, a detailed method for isolation and in vitro culture of porcine NPCs......The isolation and culture of neural progenitor cells (NPCs) from pluripotent stem cells has facilitated in vitro mechanistic studies of diseases related to the nervous system, as well as discovery of new medicine. In addition, NPCs are envisioned to play a crucial role in future cell replacement....... The cells have the potential of long-term culture and the ability to differentiate into neural and glial cells....

  9. Cryopreservation of primary cell cultures of marine invertebrates.

    Science.gov (United States)

    Odintsova, N; Kiselev, K; Sanina, N; Kostetsky, E

    2001-01-01

    Primary cell cultures obtained from somatic and larval tissues of bivalve molluscs and from embryos of sea urchins were frozen to -196 degrees C by two-step freezing using 10% dimethyl sulfoxide (DMSO) or/and trehalose (3-30 mg/ml) as cryoprotectants. We estimated both cell viability and the RNA synthetic activity after freeze-thaw. Total lipid extracts from the tissues of echinoderms examined as possible cryoprotective agents demonstrated a weak cryoprotective capacity. Mussel lipid extract was found to possess a considerable cryoprotective activity. Cryoprotective capacity of tested lipids correlated with their thermotropic behaviour. DMSO + trehalose combination was shown to be a favourable cryoprotectant and sea urchin blastula cells the most freezing-tolerant cells. PMID:11788872

  10. An Assessment of Cell Culture Plate Surface Chemistry for in Vitro Studies of Tissue Engineering Scaffolds

    OpenAIRE

    Alexander Röder; Elena García-Gareta; Christina Theodoropoulos; Nikola Ristovski; Keith A. Blackwood; Woodruff, Maria A.

    2015-01-01

    The use of biopolymers as a three dimensional (3D) support structure for cell growth is a leading tissue engineering approach in regenerative medicine. Achieving consistent cell seeding and uniform cell distribution throughout 3D scaffold culture in vitro is an ongoing challenge. Traditionally, 3D scaffolds are cultured within tissue culture plates to enable reproducible cell seeding and ease of culture media change. In this study, we compared two different well-plates with different surface ...

  11. Benchmarking of commercially available CHO cell culture media for antibody production

    OpenAIRE

    Reinhart, David; Damjanovic, Lukas; Kaisermayer, Christian; Kunert, Renate

    2015-01-01

    In this study, eight commercially available, chemically defined Chinese hamster ovary (CHO) cell culture media from different vendors were evaluated in batch culture using an IgG-producing CHO DG44 cell line as a model. Medium adaptation revealed that the occurrence of even small aggregates might be a good indicator of cell growth performance in subsequent high cell density cultures. Batch experiments confirmed that the culture medium has a significant impact on bioprocess performance, but hi...

  12. Renal mesangial cell cultures as a model for study of erythropoietin production.

    OpenAIRE

    Kurtz, Armin; Jelkmann, W; Sinowatz, F.; Bauer, Christian

    1983-01-01

    Mesangial cells derived from isolated glomeruli of rat kidney were grown as homogeneous cell lines in culture. They released, into the culture medium, erythropoietin that had free terminal galactosyl residues and was therefore not active in vivo. The production of erythropoietin by these cells was significantly enhanced by either lowering the PO2 in the incubation atmosphere or by adding cobalt chloride to the culture medium. Therefore, mesangial cells in culture may be considered as an in vi...

  13. Smooth muscle myosin regulation by serum and cell density in cultured rat lung connective tissue cells.

    Science.gov (United States)

    Babij, P; Zhao, J; White, S; Woodcock-Mitchell, J; Mitchell, J; Absher, M; Baldor, L; Periasamy, M; Low, R B

    1993-08-01

    RNA and protein analyses were used to detect expression of SM1 and SM2 smooth muscle myosin heavy chain (MHC) in cultured adult rat lung connective tissue cells (RL-90). Smooth muscle MHC mRNA expression in confluent cells grown in 10% serum was approximately 50% of the level in adult stomach. Similar results were obtained in cells cultured at low density (25% confluency) in 1% serum. However, in low-density cultures transferred to 10% serum for 24 h, the level of MHC mRNA decreased to approximately 20% of that in adult stomach. Smooth muscle alpha-actin showed a pattern of expression similar to that for smooth muscle MHC. Expression of nonmuscle MHC-A mRNA was higher in all culture conditions compared to stomach. MHC-A mRNA expression was less in low-density cultures in low serum and increased when low-density cultures were transferred to 10% serum for 24 h. MHC-B mRNA expression was less in low- vs. high-density cultures. In contrast to MHC-A, however, MHC-B mRNA expression in low-density cultures was higher in low serum. Immunofluorescence and immunoblotting with SM1-specific antibody demonstrated the presence of the SM1 protein isoform as well as reactivity to a protein band migrating slightly faster than SM2. These results demonstrate that cultured rat lung connective tissue cells express smooth muscle MHC and that expression is modulated by culture conditions.

  14. Engineering cell-compatible paper chips for cell culturing, drug screening, and mass spectrometric sensing.

    Science.gov (United States)

    Chen, Qiushui; He, Ziyi; Liu, Wu; Lin, Xuexia; Wu, Jing; Li, Haifang; Lin, Jin-Ming

    2015-10-28

    Paper-supported cell culture is an unprecedented development for advanced bioassays. This study reports a strategy for in vitro engineering of cell-compatible paper chips that allow for adherent cell culture, quantitative assessment of drug efficiency, and label-free sensing of intracellular molecules via paper spray mass spectrometry. The polycarbonate paper is employed as an excellent alternative bioscaffold for cell distribution, adhesion, and growth, as well as allowing for fluorescence imaging without light scattering. The cell-cultured paper chips are thus amenable to fabricate 3D tissue construction and cocultures by flexible deformation, stacks and assembly by layers of cells. As a result, the successful development of cell-compatible paper chips subsequently offers a uniquely flexible approach for in situ sensing of live cell components by paper spray mass spectrometry, allowing profiling the cellular lipids and quantitative measurement of drug metabolism with minimum sample pretreatment. Consequently, the developed paper chips for adherent cell culture are inexpensive for one-time use, compatible with high throughputs, and amenable to label-free and rapid analysis.

  15. Human alveolar epithelial type II cells in primary culture.

    Science.gov (United States)

    Mao, Pu; Wu, Songling; Li, Jianchun; Fu, Wei; He, Weiqun; Liu, Xiaoqing; Slutsky, Arthur S; Zhang, Haibo; Li, Yimin

    2015-02-01

    Alveolar epithelial type II (AEII) cells are a key structure and defender in the lung but also are the targets in many lung diseases, including acute respiratory distress syndrome, ventilator-induced lung injury, and pulmonary fibrosis. We sought to establish an optimized method for high yielding and long maintenance of characteristics of primary human AEII cells to facilitate the investigation of the mechanisms of lung diseases at the cellular and molecular levels. Adult human peripheral normal lung tissues of oncologic patients undergoing lung resection were collected. The AEII cells were isolated and identified by the expression of pro-surfactant protein (SP)C, epithelial sodium channel (αENaC) and cytokeratin (CK)-8, the lamellar bodies specific for AEII cells, and confirmed by the histology using electron microscopy. The phenotype of AEII cells was characterized by the expression of surfactant proteins (SP-A, SP-B, SP-C, SP-D), CK-8, KL-6, αENaC, and aquaporin (AQP)-3, which was maintained over 20 days. The biological activity of the primary human AEII cells producing SP-C, cytokines, and intercellular adhesion molecule-1 was vigorous in response to stimulation with tumor necrosis factor-α. We have modified previous methods and optimized a method for isolation of high purity and long maintenance of the human AEII cell phenotype in primary culture. This method provides an important tool for studies aiming at elucidating the molecular mechanisms of lung diseases exclusively in AEII cells. PMID:25677546

  16. Is cell culture a risky business? Risk analysis based on scientist survey data.

    Science.gov (United States)

    Shannon, Mark; Capes-Davis, Amanda; Eggington, Elaine; Georghiou, Ronnie; Huschtscha, Lily I; Moy, Elsa; Power, Melinda; Reddel, Roger R; Arthur, Jonathan W

    2016-02-01

    Cell culture is a technique that requires vigilance from the researcher. Common cell culture problems, including contamination with microorganisms or cells from other cultures, can place the reliability and reproducibility of cell culture work at risk. Here we use survey data, contributed by research scientists based in Australia and New Zealand, to assess common cell culture risks and how these risks are managed in practice. Respondents show that sharing of cell lines between laboratories continues to be widespread. Arrangements for mycoplasma and authentication testing are increasingly in place, although scientists are often uncertain how to perform authentication testing. Additional risks are identified for preparation of frozen stocks, storage and shipping.

  17. General protocol for the culture of cells on plasma-coated electrospun scaffolds.

    Science.gov (United States)

    Guex, A Géraldine; Fortunato, Giuseppino; Hegemann, Dirk; Tevaearai, Hendrik T; Giraud, Marie-Noëlle

    2013-01-01

    As opposed to culture on standard tissue-treated plastic, cell culture on three-dimensional scaffolds impedes additional challenges with respect to substrate preparation, cell seeding, culture maintenance, and analysis. We herewith present a general route for the culture of primary cells, differentiated cells, or stem cells on plasma-coated, electrospun scaffolds. We describe a method to prepare and fix the scaffolds in culture wells and discuss a convenient method for cell seeding and subsequent analysis by scanning electron microscopy or immunohistology.

  18. A co-culture device with a tunable stiffness to understand combinatorial cell-cell and cell-matrix interactions

    Science.gov (United States)

    Rao, Nikhil; Grover, Gregory N.; Vincent, Ludovic G.; Evans, Samantha C.; Choi, Yu Suk; Vincent, Ludovic G.; Spencer, Katrina H.; Hui, Elliot E.; Engler, Adam J.; Christman, Karen L.

    2013-01-01

    Cell behavior on 2-D in vitro cultures is continually being improved to better mimic in vivo physiological conditions by combining niche cues including multiple cell types and substrate stiffness, which are well known to impact cell phenotype. However, no system exists in which a user can systematically examine cell behavior on a substrate with a specific stiffness (elastic modulus) in culture with a different cell type, while maintaining distinct cell populations. We demonstrate the modification of a silicon reconfigurable co-culture system with a covalently linked hydrogel of user-defined stiffness. This device allows the user to control whether two separate cell populations are in contact with each other or only experience paracrine interactions on substrates of controllable stiffness. To illustrate the utility of this device, we examined the role of substrate stiffness combined with myoblast co-culture on adipose derived stem cell (ASC) differentiation and found that the presence of myoblasts and a 10 kPa substrate stiffness increased ASC myogenesis versus co-culture on stiff substrates. As this example highlights, this technology better controls the in vitro microenvironment, allowing the user to develop a more thorough understanding of the combined effects of cell-cell and cell-matrix interactions. PMID:24061208

  19. Discarded human fetal tissue and cell cultures for transplantation research

    International Nuclear Information System (INIS)

    A feasibility study has been performed to explore the utility of various tissues from discarded human abortuses for transplantation and related research. Specifically, aborted fetuses plus parental blood samples and all relevant clinical data were obtained through a local hospital complex. Whenever possible, pancreas, skin and skeletal muscle, heart, liver, kidney, cartilage and lung tissues were removed, dissociated and subfractionated for cryopreservation, characterization and cultivation trials in vitro. Existing protocols for these manipulations were compared and improved upon as required. Clonal culture, cell aggregate maintenance techniques and use of feeder cell populations have been utilized where appropriate to develop quantitative comparative data. Histological and biochemical assays were applied both to evaluate separation/cultivation methods and to identify optimal culture conditions for maintaining functional cells. Immunochemical and molecular biological procedures were applied to study expression of Major Histocompatibility Vomplex (MHC) class 1 and 11 molecules on cell lines derived. Tissue and cell culture populations were examined for infections with bacteria, ftingi, mycoplasma, HIV, CMV, hepatitis B and other viruses. Only 1% of the abortuses tested were virally infected. Cytogenetic analyses confin-ned the normal diploid status in the vast majority (>98%) of lines tested. A total of over 250 abortuses have been obtained and processed. Only 25 were found to be contaminated with bacteria or fungi and unsuitable for further cultivation trials. A total of over 200 cell populations were isolated, characterized and cryopreserved for further study. Included were kidney, lung, liver and epidermal epithelia: cartilage-derived cells from the spine and epiphyses plus myogenic myoblasts. Selected lines have been immortalized using HPV I 6E6/E7 sequences. Epithelia from the liver and pancreas and cardiac myocytes were the most problematic in that initial

  20. Cell Culture in Microgravity: Opening the Door to Space Cell Biology

    Science.gov (United States)

    Pellis, Neal R.; Dawson, David L. (Technical Monitor)

    1999-01-01

    Adaptational response of human cell populations to microgravity is investigated using simulation, short-term Shuttle experiments, and long-term microgravity. Simulation consists of a clinostatically-rotated cell culture system. The system is a horizontally-rotated cylinder completely filled with culture medium. Low speed rotation results in continuous-fall of the cells through the fluid medium. In this setting, cells: 1) aggregate, 2) propagate in three dimensions, 3) synthesize matrix, 4) differentiate, and 5) form sinusoids that facilitate mass transfer. Space cell culture is conducted in flight bioreactors and in static incubators. Cells grown in microgravity are: bovine cartilage, promyelocytic leukemia, kidney proximal tubule cells, adrenal medulla, breast and colon cancer, and endothelium. Cells were cultured in space to test specific hypotheses. Cartilage cells were used to determine structural differences in cartilage grown in space compared to ground-based bioreactors. Results from a 130-day experiment on Mir revealed that cartilage grown in space was substantially more compressible due to insufficient glycosaminoglycan in the matrix. Interestingly, earth-grown cartilage conformed better to the dimensions of the scaffolding material, while the Mir specimens were spherical. The other cell populations are currently being analyzed for cell surface properties, gene expression, and differentiation. Results suggest that some cells spontaneously differentiate in microgravity. Additionally, vast changes in gene expression may occur in response to microgravity. In conclusion, the transition to microgravity may constitute a physical perturbation in cells resulting in unique gene expressions, the consequences of which may be useful in tissue engineering, disease modeling, and space cell biology.

  1. Thymic epithelial cells. I. Expression of strong suppressive (veto) activity in mouse thymic epithelial cell cultures

    DEFF Research Database (Denmark)

    Claesson, Mogens Helweg; Ropke, C

    1990-01-01

    We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level. It is conclu....... It is concluded that the epithelial stromal cells of the thymus, by acting as veto cells, may be responsible for the negative intrathymic selection of self-reactive thymocytes leading to elimination of the vast majority of immature thymic lymphocytes....

  2. Dual polarization of microglia isolated from mixed glial cell cultures.

    Science.gov (United States)

    Ju, Lili; Zeng, Hui; Chen, Yun; Wu, Yanhong; Wang, Beibei; Xu, Qunyuan

    2015-09-01

    Microglia are versatile immune effector cells of the CNS and are sensitive to various stimuli. The different methods used to isolate microglia may affect some of their characteristics, such as their polarization state. The influence of cell sorting methods on the polarization state of microglia has never been studied. Mixed glial culture system (MGCS) and magnetic activated cell sorting (MACS) are two methods that are commonly used to purify microglia. This study compares the immunological states between microglia isolated by MGCS and microglia isolated by MACS. We show that microglia isolated by MGCS exhibit a stronger immune-activated state than microglia isolated by MACS. They present an elevated phagocytic ability and high levels of markers associated with classical activation (M1) and alternative activation (M2). In addition, high levels of M1-type and M2-type chemokine (C-C motif) ligand 2 and transforming growth factor-β1 were detected in the culture medium of mixed glial cells. Our results show that microglia isolated by MGCS are in an immune-activated state, whereas microglia isolated by MACS appear to be closer to their primary in vivo state. Therefore, the immune status of microglia, depending on the protocol used to purify them, should be carefully considered in neuropathology research.

  3. Digital microfluidics for automated hanging drop cell spheroid culture.

    Science.gov (United States)

    Aijian, Andrew P; Garrell, Robin L

    2015-06-01

    Cell spheroids are multicellular aggregates, grown in vitro, that mimic the three-dimensional morphology of physiological tissues. Although there are numerous benefits to using spheroids in cell-based assays, the adoption of spheroids in routine biomedical research has been limited, in part, by the tedious workflow associated with spheroid formation and analysis. Here we describe a digital microfluidic platform that has been developed to automate liquid-handling protocols for the formation, maintenance, and analysis of multicellular spheroids in hanging drop culture. We show that droplets of liquid can be added to and extracted from through-holes, or "wells," and fabricated in the bottom plate of a digital microfluidic device, enabling the formation and assaying of hanging drops. Using this digital microfluidic platform, spheroids of mouse mesenchymal stem cells were formed and maintained in situ for 72 h, exhibiting good viability (>90%) and size uniformity (% coefficient of variation digital microfluidic platform provides a viable tool for automating cell spheroid culture and analysis. PMID:25510471

  4. Spheroid culture for enhanced differentiation of human embryonic stem cells to hepatocyte-like cells.

    Science.gov (United States)

    Subramanian, Kartik; Owens, Derek Jason; Raju, Ravali; Firpo, Meri; O'Brien, Timothy D; Verfaillie, Catherine M; Hu, Wei-Shou

    2014-01-15

    Stem cell-derived hepatocyte-like cells hold great potential for the treatment of liver disease and for drug toxicity screening. The success of these applications hinges on the generation of differentiated cells with high liver specific activities. Many protocols have been developed to guide human embryonic stem cells (hESCs) to differentiate to the hepatic lineage. Here we report cultivation of hESCs as three-dimensional aggregates that enhances their differentiation to hepatocyte-like cells. Differentiation was first carried out in monolayer culture for 20 days. Subsequently cells were allowed to self-aggregate into spheroids. Significantly higher expression of liver-specific transcripts and proteins, including Albumin, phosphoenolpyruvate carboxykinase, and asialoglycoprotein receptor 1 was observed. The differentiated phenotype was sustained for more than 2 weeks in the three-dimensional spheroid culture system, significantly longer than in monolayer culture. Cells in spheroids exhibit morphological and ultrastructural characteristics of primary hepatocytes by scanning and transmission electron microscopy in addition to mature functions, such as biliary excretion of metabolic products and cytochrome P450 activities. This three-dimensional spheroid culture system may be appropriate for generating high quality, functional hepatocyte-like cells from ESCs.

  5. Cultured stem cells are sensitive to gravity changes

    Science.gov (United States)

    Buravkova, L. B.; Romanov, Yu. A.; Konstantinova, N. A.; Buravkov, S. V.; Gershovich, Yu. G.; Grivennikov, I. A.

    2008-09-01

    Stem and precursor cells play an important role in development and regeneration. The state of these cells is regulated by biochemical substances, mechanical stimuli and cellular interactions. To estimate gravity effects we used two types of cultured stem cells: human mesenchymal stromal cells (hMSCs) from bone marrow and mice embryonic stem (mESC) line R1. Gravity changes were simulated by long-term (4-7 days) slow clinorotation and leaded to decreased hMSC proliferation, changes of cell morphology and modified F-actin cytoskeleton. We did not find the shifts in cell phenotype except for decreased expression of HLA 1 and CD105 but excretion of IL-6 into medium increased significantly. Remodeling of cytoskeleton started after first 4 h and was similar to preapoptotic changes. This data suggested the modification in cell adhesion and possible commitment of hMSC. It was observed that expression of alkaline phosphatase by MSC in osteogenic medium was more intensive in control. On the contrary, clinorotation did not change formation of mESC colonies and increased proliferation activity in LIF+-medium. However, the number of embryonic bodies after clinorotation was less than in static control. It is suggested that ESCs kept the viability and proliferative potential but decreased the differentiation ability after changes in gravity stimulation.

  6. Bladder cancer cell in co-culture induces human stem cell differentiation to urothelial cells through paracrine FGF10 signaling

    OpenAIRE

    Chung, Seyung S.; Koh, Chester J.

    2013-01-01

    FGF10 is required for embryonic epidermal morphogenesis including brain development, lung morphogenesis, and initiation of limb bud formation. In this study, we investigated the role of FGF10 as a lead induction factor for stem cell differentiation toward urothelial cell. To this end, human multi-potent stem cell in vitro system was employed. Human amniotic fluid stem cells were co-cultured with immortalized bladder cancer lines to induce directed differentiation into urothelial cells. Urothe...

  7. Glycosylation-mediated phenylpropanoid partitioning in Populus tremuloides cell cultures

    Directory of Open Access Journals (Sweden)

    Babst Benjamin A

    2009-12-01

    Full Text Available Abstract Background Phenylpropanoid-derived phenolic glycosides (PGs and condensed tannins (CTs comprise large, multi-purpose non-structural carbon sinks in Populus. A negative correlation between PG and CT concentrations has been observed in several studies. However, the molecular mechanism underlying the relationship is not known. Results Populus cell cultures produce CTs but not PGs under normal conditions. Feeding salicyl alcohol resulted in accumulation of salicins, the simplest PG, in the cells, but not higher-order PGs. Salicin accrual reflected the stimulation of a glycosylation response which altered a number of metabolic activities. We utilized this suspension cell feeding system as a model for analyzing the possible role of glycosylation in regulating the metabolic competition between PG formation, CT synthesis and growth. Cells accumulated salicins in a dose-dependent manner following salicyl alcohol feeding. Higher feeding levels led to a decrease in cellular CT concentrations (at 5 or 10 mM, and a negative effect on cell growth (at 10 mM. The competition between salicin and CT formation was reciprocal, and depended on the metabolic status of the cells. We analyzed gene expression changes between controls and cells fed with 5 mM salicyl alcohol for 48 hr, a time point when salicin accumulation was near maximum and CT synthesis was reduced, with no effect on growth. Several stress-responsive genes were up-regulated, suggestive of a general stress response in the fed cells. Salicyl alcohol feeding also induced expression of genes associated with sucrose catabolism, glycolysis and the Krebs cycle. Transcript levels of phenylalanine ammonia lyase and most of the flavonoid pathway genes were reduced, consistent with down-regulated CT synthesis. Conclusions Exogenous salicyl alcohol was readily glycosylated in Populus cell cultures, a process that altered sugar utilization and phenolic partitioning in the cells. Using this system, we

  8. In vitro cell culture lethal dose submitted to gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Moreno, Carolina S.; Rogero, Sizue O.; Rogero, Jose Roberto [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)], e-mail: carolina_sm@hotmail.com; Ikeda, Tamiko I.; Cruz, Aurea S. [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil)

    2009-07-01

    The present study was designed to evaluate the in vitro effect of gamma radiation in cell culture of mouse connective tissue exposed to different doses of gamma radiation and under several conditions. The cell viability was analyzed by neutral red uptake methodology. This assay was developed for establish a methodology to be used in the future in the study of resveratrol radioprotection. Resveratrol (3,4',5- trihydroxystilbene), a phenolic phytoalexin that occurs naturally in some spermatophytes, such as grapevines, in response to injury as fungal infections and exposure to ultraviolet light. In the wines this compound is found at high levels and is considered one of the highest antioxidant constituents. The intense antioxidant potential of resveratrol provides many pharmacological activities including cardioprotection, chemoprevention and anti-tumor effects. Our results demonstrated that {sup 60}Co gamma radiation lethal dose (LD50) on NCTC clone 929 cells was about 340Gy. (author)

  9. In vitro cell culture lethal dose submitted to gamma radiation

    International Nuclear Information System (INIS)

    The present study was designed to evaluate the in vitro effect of gamma radiation in cell culture of mouse connective tissue exposed to different doses of gamma radiation and under several conditions. The cell viability was analyzed by neutral red uptake methodology. This assay was developed for establish a methodology to be used in the future in the study of resveratrol radioprotection. Resveratrol (3,4',5- trihydroxystilbene), a phenolic phytoalexin that occurs naturally in some spermatophytes, such as grapevines, in response to injury as fungal infections and exposure to ultraviolet light. In the wines this compound is found at high levels and is considered one of the highest antioxidant constituents. The intense antioxidant potential of resveratrol provides many pharmacological activities including cardioprotection, chemoprevention and anti-tumor effects. Our results demonstrated that 60Co gamma radiation lethal dose (LD50) on NCTC clone 929 cells was about 340Gy. (author)

  10. Comparison of polypeptides from cultured human fibroblasts and sarcoma cells.

    Science.gov (United States)

    Vartio, T; Kaelin, H; Vaheri, A

    1978-10-23

    The proteins in cell layers of cultured normal diploid human skin (ES, ER) and lung (WI-38) fibroblasts were compared to those of SV40-transformed human fibroblasts (WI-38/VA-13), human rhabdomyosarcoma (RD) and fibrosarcoma (HT-1080) cells using metabolic amino acid and sugar labeling and surface labeling with tritiated sodium borohydride after oxidation with galactose oxidase. The labeled proteins were analysed by sodium dodecyl sulfate polyacrylamide gel electrophoresis and autoradiography (fluorography). A transformation-associated decrease in the pericellular glycoprotein fibronectin (subunit molecular weight, 220 000) and in the synthesis of a set of polypeptides in the 130 000--180 000 dalton region was seen. Synthesis of a glycosylated 160 000 dalton polypeptide was markedly reduced. In transformed cells distinct increases of several specific polypeptides was detected in both [35S]methionine and [3H] mannose incorporation experiments but not using the surface labeling method.

  11. Ribavirin Inhibits Parrot Bornavirus 4 Replication in Cell Culture.

    Science.gov (United States)

    Musser, Jeffrey M B; Heatley, J Jill; Koinis, Anastasia V; Suchodolski, Paulette F; Guo, Jianhua; Escandon, Paulina; Tizard, Ian R

    2015-01-01

    Parrot bornavirus 4 is an etiological agent of proventricular dilatation disease, a fatal neurologic and gastrointestinal disease of psittacines and other birds. We tested the ability of ribavirin, an antiviral nucleoside analog with antiviral activity against a range of RNA and DNA viruses, to inhibit parrot bornavirus 4 replication in duck embryonic fibroblast cells. Two analytical methods that evaluate different products of viral replication, indirect immunocytochemistry for viral specific nucleoprotein and qRT-PCR for viral specific phosphoprotein gene mRNA, were used. Ribavirin at concentrations between 2.5 and 25 μg/mL inhibited parrot bornavirus 4 replication, decreasing viral mRNA and viral protein load, in infected duck embryonic fibroblast cells. The addition of guanosine diminished the antiviral activity of ribavirin suggesting that one possible mechanism of action against parrot bornavirus 4 may likely be through inosine monophosphate dehydrogenase inhibition. This study demonstrates parrot bornavirus 4 susceptibility to ribavirin in cell culture. PMID:26222794

  12. Dissecting mitosis by RNAi in Drosophila tissue culture cells

    Directory of Open Access Journals (Sweden)

    Maiato Helder

    2003-01-01

    Full Text Available Here we describe a detailed methodology to study the function of genes whose products function during mitosis by dsRNA-mediated interference (RNAi in cultured cells of Drosophila melanogaster. This procedure is particularly useful for the analysis of genes for which genetic mutations are not available or for the dissection of complicated phenotypes derived from the analysis of such mutants. With the advent of whole genome sequencing it is expected that RNAi-based screenings will be one method of choice for the identification and study of novel genes involved in particular cellular processes. In this paper we focused particularly on the procedures for the proper phenotypic analysis of cells after RNAi-mediated depletion of proteins required for mitosis, the process by which the genetic information is segregated equally between daughter cells. We use RNAi of the microtubule-associated protein MAST/Orbit as an example for the usefulness of the technique.

  13. Effect of Lactobacillus sp. isolates supernatant on Escherichia coli O157:H7 enhances the role of organic acids production as a factor for pathogen control

    Directory of Open Access Journals (Sweden)

    Larissa B. Poppi

    2015-04-01

    Full Text Available Many attempts have been made to establish the control of foodborne pathogens through Lactobacillus isolates and their metabolism products with success being obtained in several situations. The aim of this study was to investigate the antagonistic effect of eight Lactobacillus isolates, including L. casei subsp. pseudoplantarum, L. plantarum, L. reuteri and L. delbrueckii subsp. delbrueckii, on the pathogenic Escherichia colistrain O157:H7. The inhibitory effect of pure cultures and two pooled cultures supernatants of Lactobacillus on the growth of pathogenic bacteria was evaluated by the spot agar method and by monitoring turbidity. Antimicrobial activity was confirmed for L. reuteri and L. delbrueckii subsp. delbrueckii and for a pool of lactic acid bacteria. The neutralized supernatant of the pool exerted a higher antimicrobial activity than that of the individual strains. Furthermore, D-lactic acid and acetic acid were produced during growth of the Lactobacillus isolates studied.

  14. Optimization of Storage Temperature for Cultured ARPE-19 Cells

    Directory of Open Access Journals (Sweden)

    Lara Pasovic

    2013-01-01

    Full Text Available Purpose. The establishment of future retinal pigment epithelium (RPE replacement therapy is partly dependent on the availability of tissue-engineered RPE cells, which may be enhanced by the development of suitable storage methods for RPE. This study investigates the effect of different storage temperatures on the viability, morphology, and phenotype of cultured RPE. Methods. ARPE-19 cells were cultured under standard conditions and stored in HEPES-buffered MEM at nine temperatures (4°C, 8°C, 12°C, 16°C, 20°C, 24°C, 28°C, 32°C, and 37°C for seven days. Viability and phenotype were assessed by a microplate fluorometer and epifluorescence microscopy, while morphology was analyzed by scanning electron microscopy. Results. The percentage of viable cells preserved after storage was highest in the 16°C group (48.7%±9.8%; P<0.01 compared to 4°C, 8°C, and 24°C–37°C; P<0.05 compared to 12°C. Ultrastructure was best preserved at 12°C, 16°C, and 20°C. Expression of actin, ZO-1, PCNA, caspase-3, and RPE65 was maintained after storage at 16°C compared to control cells that were not stored. Conclusion. Out of nine temperatures tested between 4°C and 37°C, storage at 12°C, 16°C, and 20°C was optimal for maintenance of RPE cell viability, morphology, and phenotype. The preservation of RPE cells is critically dependent on storage temperature.

  15. The Biological Study of the Cultured Human Lens Epithelial Cells in Vitro

    Institute of Scientific and Technical Information of China (English)

    1994-01-01

    The human lens epithelial cells (HLE) cultured in vitro was established in normal and cataractous lenses. The biological feature, histological characteristics and the ultrastructure of the cultured HLE cells were investigated. The results reveal that the proliferative capacity of the culutured HLE cells is reversely proportional to the donour age; the cultured HLE cells has the limited proliferative capacity in vitro. The relieve of the contact inhibition is the effective trigger of the HLE cell prolife...

  16. Boildown Study on Supernatant Liquid Retrieved from AW-106 in December 2012

    Energy Technology Data Exchange (ETDEWEB)

    Page, Jason S. [Washington River Protection Solutions, LLC, Richland, WA (United States)

    2013-06-04

    This document reports the results of a boil down study using a composite created from supernatant liquid grab samples retrieved from tank 241-AW-I06 in December of 2012. The composite was made using predetermined volumes of the grab samples which accounted for layering of the supernatant liquid in the tank. The finished composite was a clear, yellow liquid containing no visible solids at hot cell ambient temperatures (24 - 27°C). The density of the test composite was measured in the hot cell immediately before the boildown study and was 1.266 g/mL at 27.1 °C. The boiling temperature of the composite was measured at three different pressures (40, 60, and 80 Torr) throughout the volume reduction, and the results show steadily increasing boiling temperatures with increasing volume reduction and no significant discontinuities. Moderate foaming was observed at the onset of the boildown. The foaming disappeared during the first reduction step, and minimal foaming was observed throughout the rest of the study. The bulk densities at 18.0 °C (D{sub Bulk}{sup 18 °C}) and quantities of settled and centrifuged solids were measured on samples of the boildown concentrates. Estimated values of the bulk densities at the 60-Torr boiling temperatures (D{sub Bulk}{sup 60 Torr}) were also calculated. Solids were first observed at boildown temperatures when the % VWR reached 39.3%. The quantity of solids in the composite quickly increased after this initial formation; the amount of centrifuged solids increased by 22% as the %WVR increased from 39.3 to 44.1 %. A small amount of solids did appear in the samples collected prior to the initial formation during the boildown. These solids precipitated while they sat at hot cell ambient temperature and in the 18. 0 °C water bath. Analysis of boil down test samples indicated that natrophosphate (Na7{sub 3}F(PO{sub 4}){sub 2}{centerdot} 19 H{sub 2}O) and kogarkoite (Na3FS04) accounted for a majority of the initial solids (~80% of the

  17. Boildown Study on Supernatant Liquid Retrieved from AW-106 in December 2012

    International Nuclear Information System (INIS)

    This document reports the results of a boil down study using a composite created from supernatant liquid grab samples retrieved from tank 241-AW-I06 in December of 2012. The composite was made using predetermined volumes of the grab samples which accounted for layering of the supernatant liquid in the tank. The finished composite was a clear, yellow liquid containing no visible solids at hot cell ambient temperatures (24 - 27°C). The density of the test composite was measured in the hot cell immediately before the boildown study and was 1.266 g/mL at 27.1 °C. The boiling temperature of the composite was measured at three different pressures (40, 60, and 80 Torr) throughout the volume reduction, and the results show steadily increasing boiling temperatures with increasing volume reduction and no significant discontinuities. Moderate foaming was observed at the onset of the boildown. The foaming disappeared during the first reduction step, and minimal foaming was observed throughout the rest of the study. The bulk densities at 18.0 °C (Dbulk18°C) and quantities of settled and centrifuged solids were measured on samples of the boildown concentrates. Estimated values of the bulk densities at the 60-Torr boiling temperatures (Dbulk60Torr) were also calculated. Solids were first observed at boildown temperatures when the % VWR reached 39.3%. The quantity of solids in the composite quickly increased after this initial formation; the amount of centrifuged solids increased by 22% as the %WVR increased from 39.3 to 44.1 %. A small amount of solids did appear in the samples collected prior to the initial formation during the boildown. These solids precipitated while they sat at hot cell ambient temperature and in the 18. 0 °C water bath. Analysis of boil down test samples indicated that natrophosphate (Na7F(PO4)2 · 19 H2O) and kogarkoite (Na3FS04) accounted for a majority of the initial solids (∼80% of the dissolved sulfate and phosphate precipitated from the

  18. Pre-incubation of cell-free HIV-1 group M isolates with non-nucleoside reverse transcriptase inhibitors blocks subsequent viral replication in co-cultures of dendritic cells and T cells.

    Science.gov (United States)

    Njai, Harr F; Lewi, Paul J; Janssen, Cornelus G M; Garcia, Sergio; Fransen, Katrien; Kestens, Luc; Vanham, Guido; Janssen, Paul A J

    2005-01-01

    In order to study the inhibitory effect of various reverse transcriptase inhibitors (RTIs) on cell-free HIV, we adapted a recently described in vitro system, based on co-cultures of dendritic cells and resting CD4 T cells, modelling early target cells during sexual transmission. The compounds tested included the second-generation non-nucleoside RTI (NNRTI) TMC-120 (R147681, dapivirine) and TMC-125 (R165335, travertine), as well as the reference nucleoside RTI AZT (zidovudine), the nucleotide RTI PMPA (tenofovir) and the NNRTI UC-781. The virus strains included the reference strain HIV-1Ba-L and six primary isolates, representative of the HIV-1 group M pandemic. They all display the non-syncytium-inducing and CCR5 receptor-using (NSI/R5) phenotype, important in transmission. Cell-free virus was immobilized on a poly-L-lysine (PLL)-treated microwell plate and incubated with compound for 1 h. Afterwards, the compound was thoroughly washed away; target cells were added and cultured for 2 weeks, followed by an extended culture with highly susceptible mitogen-activated T cells. Viral production in the cultures was measured on supernatant with HIV antigen ELISA. Negative results were confirmed by showing absence of proviral DNA in the cells. TMC-120 and TMC-125 inhibited replication of HIV-1Ba-L with average EC50 values of 38 nM and 117 nM, respectively, whereas the EC50 of UC-781 was 517 nM. Complete suppression of virus and provirus was observed at compound concentrations of 100, 300 and 1000 nM, respectively. Inhibition of all primary isolates followed the same pattern as HIV-1Ba-L. In contrast, pre-treating the virus with the nucleotide RTI PMPA and AZT failed to inhibit infection even at a concentration of 100000 nM. These data clearly suggest that NNRTIs inactivate RT enzymatic activity of different viral clades (predominant in the epidemic) and might be proposed for further testing as a sterilizing microbicide worldwide. PMID:15865220

  19. Rheological characteristics of cell suspension and cell culture of Perilla frutescens.

    Science.gov (United States)

    Zhong, J J; Seki, T; Kinoshita, S; Yoshida, T

    1992-12-01

    Physical properties such as viscosity, fluid dynamic behavior of cell suspension, and size distribution of cell aggregates of a plant, Perilla frustescens, cultured in a liquid medium were studied. As a result of investigations using cells harvester after 12 days of cultivation in a flask, it was found that the apparent viscosity of the cell suspension did not change with any variation of cell concentration below 5 g dry cell/L but markedly increased when the cell concentration increased over 12.8 g dry cell/L. The cell suspension exhibited the characteristics of a Bingham plastic fluid with a small yield stress. The size of cell aggregates in the range 74 to 500 mum did not influence the rheological characteristics of the cell suspension. The rheological characteristics of cultivation mixtures of P. frutescens cultivated in a flask and in a bioreactor were also investigated. The results showed that the flow characteristics of the cell culture could be described by a Bingham plastic model. At the later stage of cultivation, the apparent viscosity increased steadily, even though the biomass concentration (by dry weight) decreased, due to the increase of individual cell size.

  20. Epithelial Cell Culture from Human Adenoids: A Functional Study Model for Ciliated and Secretory Cells

    Directory of Open Access Journals (Sweden)

    Claudia González

    2013-01-01

    Full Text Available Background. Mucociliary transport (MCT is a defense mechanism of the airway. To study the underlying mechanisms of MCT, we have both developed an experimental model of cultures, from human adenoid tissue of ciliated and secretory cells, and characterized the response to local chemical signals that control ciliary activity and the secretion of respiratory mucins in vitro. Materials and Methods. In ciliated cell cultures, ciliary beat frequency (CBF and intracellular Ca2+ levels were measured in response to ATP, UTP, and adenosine. In secretory cultures, mucin synthesis and secretion were identified by using immunodetection. Mucin content was taken from conditioned medium and analyzed in the presence or absence of UTP. Results. Enriched ciliated cell monolayers and secretory cells were obtained. Ciliated cells showed a basal CBF of 10.7 Hz that increased significantly after exposure to ATP, UTP, or adenosine. Mature secretory cells showed active secretion of granules containing different glycoproteins, including MUC5AC. Conclusion. Culture of ciliated and secretory cells grown from adenoid epithelium is a reproducible and feasible experimental model, in which it is possible to observe ciliary and secretory activities, with a potential use as a model to understand mucociliary transport control mechanisms.

  1. Monoclonal antibody to human endothelial cell surface internalization and liposome delivery in cell culture.

    Science.gov (United States)

    Trubetskaya, O V; Trubetskoy, V S; Domogatsky, S P; Rudin, A V; Popov, N V; Danilov, S M; Nikolayeva, M N; Klibanov, A L; Torchilin, V P

    1988-02-01

    A monoclonal antibody (mAb), E25, is described that binds to the surface of cultured human endothelial cells. Upon binding E25 is rapidly internalized and digested intracellularly. Selective liposome targeting to the surface of the cells is performed using a biotinylated E25 antibody and an avidin-biotin system. Up to 30% of the cell-adherent liposomal lipid is internalized.

  2. Single-Cell-State Culture of Human Pluripotent Stem Cells Increases Transfection Efficiency

    OpenAIRE

    Nii, Takenobu; Kohara, Hiroshi; Marumoto, Tomotoshi; Sakuma, Tetsushi; Yamamoto, Takashi; Tani, Kenzaburo

    2016-01-01

    Abstract Efficient gene transfer into human pluripotent stem cells (hPSCs) holds great promise for regenerative medicine and pharmaceutical development. In the past decade, various methods were developed for gene transfer into hPSCs; however, hPSCs form tightly packed colonies, making gene transfer difficult. In this study, we established a stable culture method of hPSCs at a single-cell state to reduce cell density and investigated gene transfection efficiency followed by gene editing effici...

  3. THE CHARACTERISTICS OF ENDOGENOUS OUABAIN SECRETIONFROM CULTURED BOVINE ADRENOCORTICAL CELLS

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objective To compare the characteristics of endogenous ouabain(EO) secretion with the other adrenocortical hormones and determine the effects of angiotensin Ⅰ (Ang Ⅰ ), and adrenocorticotrophin(ACTH) on the secretion of EO. Methods EO was measured by radioimmunoassay from primary cultured bovine adrenocotical cells (BAC). Results ①Ouabain was determined in the media of cultured BAC. Both EO and aldosterone secretion were decreased from the outer to inner layer of the cultured adrenal cortex, and the responses to Ang Ⅰ and ACTH were higher than that in the mid layer (P <0. 05) and inner layer (P <0. 01). Cortisol secretion was activated by Ang Ⅱ or ACTH was significantly higher in the mid layer and in the inner layer than that in the outer layer. ②The time-course experiment showed that the gradually rising amounts of aldosterone and cortisol could be determined dur ing the continuous incubation to 48h with or without Ang Ⅰ or ACTH. However, EO did not increase continuously af ter 24h of incubation in the basal secreting situation and after 12h of incubation in the stimulating situation by Ang Ⅱ or ACTH. ③There were obvious drops in aldosterone and cortisol secretion from 3rd day during a 21 day-period cell culture, but the peak secretion of ouabain was in 7th day. Conclusion It suggests that the secretory mechanism might be different between EO and aldosterone or cortisol. Also, Ang Ⅱ and ACTH might be involved in the regulation of EO secretion.

  4. EFFECT OF MACROLIDE ANTIBIOTICS ON VARIOUS CELL CULTURES IN VITRO: 1. CELL MORPHOLOGY

    Directory of Open Access Journals (Sweden)

    Renáta Kováčová

    2012-08-01

    Full Text Available The aim of our study was to evaluate the cytotoxicity of macrolide antibiotics (tilmicosin, tylosin and spiramycin of various concentrations on different cell cultures in vitro. Cellular lines from animal tissues (VERO cells - kidney cells of Macacus rhesus, FE cells - feline embryonal cells, BHK 21 cellular line from young hamster kidneys were used. Tilmicosin effect: BHK cells are most sensitive, significant decrease in vital cells occurs already at the concentration of 50 μg.ml-1. VERO cells were most resistant, significant decrease of vital cells was observed only at the concentration of 300 μg.ml-1. Tylosin effect: BHK cells can be considered most sensitive, since at concentrations higher than 500 μg.ml-1, no vital cells were observed. At the concentration of 1000 μg.ml-1 were 3.13% of vital and 70.52% of subvital FE cells. In Vero cells, we observed a significant decrease at the concentration of 750 μg.ml-1. Spiramycin effect: Significant decrease of vital BHK cells was observed at the concentration of 150 μg.ml-1, at the concentration of 300 μg.ml-1, no vital cells and only 7.53% of subvital cells were observed. At the concentration of 500 μg.ml-1 reported 10.34% of vital FE cells. At the concentration of 500 μg.ml-1 22.48% of vital and 71.16% of subvital VERO cells were recorded.

  5. Sphingomonas sp. is a novel cell culture contaminant.

    Science.gov (United States)

    Asghar, Muhammad Tahir; Al-Ghanim, K; Mahboob, Shahid; Sharif, Muhammad; Nazir, Jawad; Shakoori, Abdul Rauf

    2015-06-01

    A novel contaminant was isolated from Madin Darby Bovine Kidney (MDBK) cells. The organism was unable to grow on standard microbiological media by conventional techniques, but grew well in Dulbecco's Modified Eagle's Medium (DMEM) containing high glucose concentration. The organism formed a white biofilm on the bottom without any signs of turbidity. Upon genome sequence analysis of 16 S rDNA, the contaminant was identified as Sphingomonas sp. Shah, a member of the group α-Proteobacteria. Neutral red dye uptake method confirmed clear cytotoxic potential of the bacterium on A-549 cells. The organism was capable of invading and infecting different mammalian cell lines: MDBK, ZZ-R, 293-T, A549, and HeLa cells. Infected cells showed a variety of cytopathic effects including vacuolation at perinuclear area, cytoplasmic granulation and membrane blebbing. Microscopic analysis of the infected cells revealed the presence of cytoplasmic vacuoles harboring motile organisms. Apparently local serum preparations seem to be the source of this contamination, which is imperceptibly passed on from one culture passage to the other and ultimately leading to serious cytopathic manifestations.

  6. Synthesis of Th17 cytokines in the culture of peripheral blood mononuclear cells stimulated with Borrelia burgdorferi sensu lato

    Directory of Open Access Journals (Sweden)

    Sambor Grygorczuk

    2016-06-01

    Full Text Available [b]Introduction and objective. [/b]Th17 lymphocytes and their cytokines, interleukin 17A (IL-17A, IL-17F and IL-22, participate in the response to extracellular bacteria and in the autoimmunity and may be engaged in the pathogenesis of Lyme borreliosis. Concentrations were measured of IL-17A, IL-17F and IL-22 in the supernatant of the peripheral blood mononuclear cells (PBMC culture stimulated with [i]Borrelia burgdorferi sensu lato[/i] ([i]B. burgdorferi[/i]. [b]Materials and method.[/b] The study group consisted of 13 patients with early disseminated and late Lyme borreliosis and a control group of 7 healthy persons. PBMC cultures were stimulated for 48 hours with [i]B. burgdorferi [/i]spirochetes of three pathogenic species: [i]B. burgdorferi[/i] sensu stricto, B. afzelii or B. garinii, in the multiplicity of infection 10:1. Concentrations of Th17 cytokines IL-17A, IL-17F and IL-22, as well as Th2/immunoregulatory cytokine IL-10 were measured with ELISA assays. [b]Results. [/b]Expression of IL-17A, IL-17F and IL-22 increased under stimulation, simultaneously with the increased IL-10 expression. Concentration of IL-17F tended to be lower in early neuroborreliosis than in late Lyme borreliosis and than in controls. [i]B. afzelii[/i] elicited higher expression of IL-17A than the other two species. [b]Conclusions.[/b] IL-17A, IL-17F and IL-22 are synthesized simultaneously by PBMC stimulated with [i]B. burgdorferi[/i]. There is no antagonism between Th17 response and IL-10 expression. The role of Th17 cytokines seems to differ depending on the clinical stage of Lyme borreliosis and on the [i]B. burgdorferi[/i] species.

  7. Assessment of pancreatic carcinoma cell chemosensitivity using a three-dimensional culture system

    Institute of Scientific and Technical Information of China (English)

    LIAO Quan; HU Ya; ZHAO Yu-pei; ZHOU Tao; ZHANG Qiang

    2010-01-01

    Background Monolayer cell culture models are the traditional culture models used for in vitro research of pancreatic carcinoma chemosensitivity. However, these models neglect the interactions between tumor cells and the impact of the tumor microenvironment. Such tumor cell monolayers poorly mimic the solid tumor microenvironment. The present study aimed to investigate the chemosensitivity characteristics of pancreatic cancer cells in a three-dimensional culture system by analyzing the differences in drug sensitivity between a scattered cell culture model and a multicellular spheroid culture model.Methods Three pancreatic cancer cell lines (SW1990, ASPC-1 and PCT-3) were cultured in three-dimensional collagen gels as well as in traditional two-dimensional monolayers. The chemosensitivities of the pancreatic carcinoma cells to 5-fluorouracil (5-FU), gemcitabine, and oxaliplatin in vitro were detected by both the Cell Counting Kit-8 test and the collagen gel droplet-embedded culture drug-sensitivity test.Results In the two-dimensional culture model, differences in the chemosensitivities of the cloned pancreatic carcinoma cells and scattered cells existed for some concentrations of 5-FU, gemcitabine and oxaliplatin. In the three-dimensional culture model, there were significant differences in the chemosensitivities of the pancreatic cancer cells between the scattered cells and multicellular spheroids (P <0.05).Conclusion Pancreatic carcinoma cells exhibit multicellular resistance in three-dimensional cultures.

  8. Identification of a population of cells with hematopoietic stem cell properties in mouse aorta-gonad-mesonephros cultures

    International Nuclear Information System (INIS)

    The aorta-gonad-mesonephros (AGM) region is a primary source of definitive hematopoietic cells in the midgestation mouse embryo. In cultures of dispersed AGM regions, adherent cells containing endothelial cells are observed first, and then non-adherent hematopoietic cells are produced. Here we report on the characterization of hematopoietic cells that emerge in the AGM culture. Based on the expression profiles of CD45 and c-Kit, we defined three cell populations: CD45low c-Kit+ cells that had the ability to form hematopoietic cell colonies in methylcellulose media and in co-cultures with stromal cells; CD45low c-Kit- cells that showed a granulocyte morphology; CD45high c-Kitlow/- that exhibited a macrophage morphology. In co-cultures of OP9 stromal cells and freshly prepared AGM cultures, CD45low c-Kit+ cells from the AGM culture had the abilities to reproduce CD45low c-Kit+ cells and differentiate into CD45low c-Kit- and CD45high c-Kitlow/- cells, whereas CD45low c-Kit- and CD45high c-Kitlow/- did not produce CD45low c-Kit+ cells. Furthermore, CD45low c-Kit+ cells displayed a long-term repopulating activity in adult hematopoietic tissue when transplanted into the liver of irradiated newborn mice. These results indicate that CD45low c-Kit+ cells from the AGM culture have the potential to reconstitute multi-lineage hematopoietic cells

  9. Manufacture of biopharmaceutical proteins by mammalian cell culture systems.

    Science.gov (United States)

    Tolbert, W R

    1990-01-01

    In the last several years, dramatic advances have been in the development of new biopharmaceuticals including monoclonal antibodies for diagnosis and treatment and such genetically engineered proteins as tPA, Factor VIIIc, erythropoietin and soluble CD4, an anti-AIDS protein. Currently, there are several hundred such candidate drugs in human clinical trials. In most cases, these protein-based drugs will require manufacture by mammalian cell culture due to the inability of lower organisms to properly glycosylate, fold, make correct disulfide bonds and secrete active biomolecular forms. The need for large scale production from cell culture will greatly increase as more of the products in clinical trials are approved for commercial production. This will require significant reduction in manufacturing costs per gram, concomitant with increased capacity to hundreds or perhaps even thousands of kilograms annually. As an example, Invitron's multi-reactor manufacturing facility has operated at greater than one-half million liters per year and has experience with more than 250 mammalian cell lines for producing protein drug products.

  10. Efficient flotation of yeast cells grown in batch culture.

    Science.gov (United States)

    Palmieri, M C; Greenhalf, W; Laluce, C

    1996-05-01

    A fast flotation assay was used to select new floating yeast strains. The flotation ability did not seem to be directly correlated to total extracellular protein concentration of the culture. However, the hydrophobicity of the cell was definitely correlated to the flotation capacity. The Saccharomyces strains (FLT strains) were highly hydrophobic and showed an excellent flotation performance in batch cultures without additives (flotation agents) and with no need for a special flotation chamber or flotation column. A stable and well-organized structure was evident in the dried foam as shown by scanning electron microscopy which revealed its unique structure showing mummified cells (dehydrated) attached to each other. The attachment among the cells and the high protein concentration of the foams indicated that proteins might be involved in the foam formation. The floating strains (strains FLT) which were not flocculent and showed no tendency to aggregate, were capable of growing and producing ethanol in a synthetic medium containing high glucose concentration as a carbon source. The phenomenon responsible for flotation seems to be quite different from the flocculation phenomenon. PMID:18626952

  11. From Three-Dimensional Cell Culture to Organs-on-Chips

    OpenAIRE

    Huh, Dongeun; Hamilton, Geraldine A.; Ingber, Donald E.

    2011-01-01

    Three-dimensional (3D) cell culture models have recently garnered great attention because they often promote levels of cell differentiation and tissue organization not possible in conventional two-dimensional (2D) culture systems. Here, we review new advances in 3D culture that leverage microfabrication technologies from the microchip industry and microfluidics approaches to create cell culture microenvironments that both support tissue differentiation and recapitulate the tissue-tissue inter...

  12. Further analyses of human kidney cell populations separated on the space shuttle

    Science.gov (United States)

    Stewart, Robin M.; Todd, Paul; Cole, Kenneth D.; Morrison, Dennis R.

    Cultured human embryonic kidney cells were separated into electrophoretic subpopulations in laboratory experiments and in two separation experiments on the STS-8 (Challenger) Space Shuttle flight using the mid-deck Continuous Flow Electrophoretic Separator (CFES). Populations of cells from each fraction were cultured for the lifetime of the cells, and supernatant medium was withdrawn and replaced at 4-day intervals. Withdrawn medium was frozen at -120°C for subsequent analysis. Enzyme assays, antibodies and gel electrophoresis were used as analytical tools for the detection and quantitation of plasminogen activators in these samples. These assays of frozen culture supernatant fluids confirmed the electrophoretic separation of plasminogen-activator producing cells from non-producing cells, the isolation of cells capable of sustained production, and the separation of cells that produce different plasminogen activators from one another.

  13. Regulation of Taurine transporter activity in cultured rat retinal ganglion cells and rat retinal Muller Cells

    International Nuclear Information System (INIS)

    Diabetic retinopathy is one of the most common complications of diabetes. The amino acid taurine is believed to play an antioxidant protective role in diabetic retinopathy through the scavenging of the reactive species. It is not well established whether taurine uptake is altered in retina cells during diabetic conditions. Thus, the present study was designed to investigate the changes in taurine transport in cultures of rat retinal Muller cells and rat retinal ganglion cells under conditions associated with diabetes. Taurine was abundantly taken up by retinal Muller cells and rat retinal ganglion cells under normal glycemic condition. Taurine was actively transported to rat Muller cells and rat retinal ganglion cells in a Na and Cl dependant manner. Taurine uptake further significantly elevated in both type of cells after the incubation with high glucose concentration. This effect could be attributed to the increase in osmolarity. Because Nitric Oxide (NO) is a molecule implicated in the pathogenesis of diabetes, we also determined the activity of taurine transporter in cultured rat retinal Muller cells and rat retinal ganglion cells in the presence of the NO donors, SIN-1 and SNAP. Taurine uptake was elevated above control value after 24-h incubation with low concentration of NO donors. We finally investigated the ability of neurotoxic glutamate to change taurine transporter activity in both types of cells. Uptake of taurine was significantly increased in rat retinal ganglion cells when only incubated with high concentration of glutamate. Our data provide evidence that taurine transporter is present in cultured rat retinal ganglion and Muller cells and is regulated by hyperosmolarity. The data are relevant to disease such as diabetes and neuronal degeneration where retinal cell volume may dramatically change. (author)

  14. Self-Assembled Peptide Gels for 3D Cell Culture

    OpenAIRE

    Tang, Claire

    2010-01-01

    Under specific conditions short peptides modified with an N-terminal fluorenyl-9-methoxycarbonyl (Fmoc) group can self-assemble into hydrogel scaffolds similar in properties to the natural extracellular matrix. Fmoc-diphenylalanine (Fmoc-FF) for instance, has been shown to form hydrogels at physiological pH that have the ability to support 2D and 3D cell culture. The aim of this investigation is to provide further understanding of the self-assembly mechanism of such systems in order to progre...

  15. Immunologically active polysaccharides of Arnica montana cell cultures.

    Science.gov (United States)

    Puhlmann, J; Zenk, M H; Wagner, H

    1991-01-01

    From the nutrition medium of Arnica montana cell cultures two homogeneous polysaccharides, an acidic arabino-3,6-galactan-protein with mean Mr of 100,000 and a neutral fucogalactoxyloglucan with mean Mr of 22,500 have been isolated by DEAE-Sepharose CL-6B and Sephacryl S-400 column chromatography. Their structures were elucidated mainly by methylation analysis, partial acidic and enzymatic hydrolysis and 13C NMR spectroscopy. The fucogalactoxyloglucan shows a pronounced enhancement of phagocytosis in vivo. The arabino-3,6-galactan-protein displays a strong anticomplementary effect and stimulates macrophages to excrete the tumour necrosis factor (TNF alpha).

  16. Cell and Molecular Biology of Ataxia Telangiectasia Heterozygous Human Mammary Epithelial Cells Irradiated in Culture

    Science.gov (United States)

    Richmond, Robert C.

    2001-01-01

    Autologous isolates of cell types from obligate heterozygotes with the autosomal disorder ataxia-telangiectasia (A-T)were used to begin a tissue culture model for assessing pathways of radiation-induced cancer formation in this target tissue. This was done by establishing cultures of stromal fibroblasts and long-term growth human mammary epithelial cells (HMEC) in standard 2-dimensional tissue culture in order to establish expression of markers detailing early steps of carcinogenesis. The presumptive breast cancer susceptibility of A-T heterozygotes as a sequel to damage caused by ionizing radiation provided reason to study expression of markers in irradiated HMEC. Findings from our study with HMEC have included determination of differences in specific protein expression amongst growth phase (e.g., log vs stationary) and growth progression (e.g., pass 7 vs pass 9), as well as differences in morphologic markers within populations of irradiated HMEC (e.g., development of multinucleated cells).

  17. Fibroblasts Cultured on Nanowires Exhibit Low Motility, Impaired Cell Division, and DNA Damage

    DEFF Research Database (Denmark)

    Persson, H.; Købler, Carsten; Mølhave, Kristian;

    2013-01-01

    Mouse fibroblasts cultured on 7-μm-long vertical nanowires are reported on page 4006 by C. N. Prinz and co-workers. Culturing cells on this kind of substrate interferes greatly with cell function, causing the cells to develop into widely different morphologies. The cells' division is impaired...

  18. Cloned calves produced by nuclear transfer from cultured cumulus cells

    Institute of Scientific and Technical Information of China (English)

    AN; Xiaorong(安晓荣); GOU; Kemian(苟克勉); ZHU; Shien(朱士恩); GUAN; Hong(关宏); HOU; Jian(侯健); LIN; Aixing(林爱星); ZENG; Shenming(曾申明); TIAN; Jianhui(田见辉); CHEN; Yongfu(陈永福)

    2002-01-01

    Short-term cultured cumulus cell lines (1-5BCC) derived from 5 individual cows were used in nuclear transfer (NT) and 1188 enucleated bovine oocytes matured in vitro were used as nuclear recipients. A total of 931 (78.4%) cloned embryos were reconstructed, of which 763 (82%) cleaved, 627 (67.3%) developed to 8-cell stage, and 275 (29.5%) reached blastocyst stage. The average cell number of blastocysts was 124±24.5 (n=20). In this study, the effects of donor cell sources, serum starvation of donor cells, time interval from fusion to activation (IFA) were also tested on cloning efficiency. These results showed that blastocyst rates of embryos reconstructed from 5 different individuals cells were significantly different among them (14.1%, 45.2%, 27.3%, 34.3%, vs 1.5%, P0.05); and that blastocyst rate (20.3%) of the group with fusion/activation interval of 2-3 h, was significantly lower than that of the 3-6 h groups (31.0%), while not significantly different among 3-4 h (P < 0.05), 4-5 h, and 5-6 h groups (P ≥ 0.05). Sixty-three thawed NT blastocysts were transferred to 31 recipient cows, of which 4 pregnancies were established and two cloned calves were given birth. These results indicate that serum starvation of cumulus cells is not a key factor for successful bovine cloning, while IFA treatment and sources of donor cells have effects on cloning efficiency.

  19. Fibroblast and epidermal cell-type I collagen interactions: cell culture and human studies.

    Science.gov (United States)

    Doillon, C J; Silver, F H; Olson, R M; Kamath, C Y; Berg, R A

    1988-06-01

    Fibroblast and epidermal cell-type I collagen sponge interactions were studied in cell culture as well as in humans. In cell culture, fibroblasts were observed to migrate and proliferate throughout a type I collagen sponge containing either hyaluronic acid (HA) or fibronectin (FN). Fibroblasts accumulated in the center of the pores in sponges containing HA and appeared to surround themselves with newly synthesized extracellular matrix. In sponges containing FN, fibroblasts attached to and elongated along the collagen fibers of the sponge. In the absence of FN or HA protein synthesis of fibroblasts appeared to be inhibited by the presence of the type I collagen sponge. Epidermal cells grown on plastic or on type I collagen, formed sheets. Epidermal cells grown on a collagen sponge morphologically appeared different than cells grown on plastic. The type I collagen matrix studied in cell culture was applied to dermal wounds of patients with pressure ulcers in order to evaluate its effect on dermal wound healing. The areas of ulcers treated for 6 weeks with a type I collagen sponge decreased by about 40% compared with no change in the areas of untreated controls. Preliminary results suggest that a type I collagen sponge is a biocompatible substrate with fibroblasts and epidermal cells and may be effective in enhancing healing of chronic skin ulcers. PMID:3399861

  20. From cells to organisms: Can we learn about aging from cells in culture?

    Energy Technology Data Exchange (ETDEWEB)

    Campisi, Judith

    2000-12-21

    Can studying cultured cells inform us about the biology of aging? The idea that this may be was stimulated by the first formal description of replicative senescence. Replicative senescence limits the proliferation of normal human cells in culture, causing them to irreversibly arrest growth and adopt striking changes in cell function. We now know that telomere shortening, which occurs in most somatic cells as a consequence of DNA replication, drives replicative senescence in human cells. However, rodent cells also undergo replicative senescence, despite very long telomeres, and DNA damage,the action of certain oncogenes and changes in chromatin induce a phenotype similar to that of replicatively senescent cells. Thus,replicative senescence is an example of the more general process of cellular senescence, indicating that the telomere hypothesis of aging is a misnomer. Cellular senescence appears to be a response to potentially oncogenic insults, including oxidative stress. The growth arrest almost certainly suppresses tumorigenesis, at least in young organisms, whereas the functional changes may contribute to aging,although this has yet to be critically tested. Thus, cellular senescence may be an example of antagonistic pleiotropy.Cross-species comparisons suggest there is a relationship between the senescence of cells in culture and organismal life span, but the relationship is neither quantitative nor direct.

  1. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  2. Antioxidant Capacity of Cultured Mammalian Cells Estimated by ESR Method

    Directory of Open Access Journals (Sweden)

    Tamar Kartvelishvili

    2004-01-01

    Full Text Available In the present study, the antioxidant capacity against hydrogen peroxide (H2O2, one of the stress-inducing agents, was investigated in two distinct cell lines: L-41 (human epithelial-like cells and HLF (human diploid lung fibroblasts, which differ in tissue origin, life span in culture, proliferate activity, and special enzyme system activity. The cell antioxidant capacity against H2O2 was estimated by the electron spin resonance (ESR spin-trapping technique in the Fenton reaction system via Fe+2 ion action with H2O2 resulting in hydroxyl radical generation. The effects of catalase inhibitors, such as sodium azide and 3-amino-1,2,4-triazole, on the antioxidant capacity of cells were tested. Based on our observation, it can be concluded that the defensive capacity of cells against H2O2 depends on the ratio between catalase/GPx/SOD and H2O2, especially at high-stress situations, and the intracellular balance of these enzymes are more important than the influence of the single component.

  3. A biocompatible micro cell culture chamber for culturing and on-line monitoring of Eukaryotic cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael

    2006-01-01

    Visualisering af cellulære processer over længere tidsperioder har været besværliggjort af cellernes krav til varme, fugtighed og et fysiologisk pH balanceret medie. Fremskridt indenfor mikro teknologi har muliggjort fabrikation af miniaturiserede celle kultur anordninger der er i stand til at ho...... øgede den nye random priming metode antallet af detekterede gener på transkriptom DNA mikroarrays med 55% i Cy-3 kanalen og 72% i Cy-5 kanalen, hvilket indikerer en bedre dækning af transkriptomet....

  4. Cell Monitoring and Manipulation Systems (CMMSs based on Glass Cell-Culture Chips (GC3s

    Directory of Open Access Journals (Sweden)

    Sebastian M. Buehler

    2016-06-01

    Full Text Available We developed different types of glass cell-culture chips (GC3s for culturing cells for microscopic observation in open media-containing troughs or in microfluidic structures. Platinum sensor and manipulation structures were used to monitor physiological parameters and to allocate and permeabilize cells. Electro-thermal micro pumps distributed chemical compounds in the microfluidic systems. The integrated temperature sensors showed a linear, Pt1000-like behavior. Cell adhesion and proliferation were monitored using interdigitated electrode structures (IDESs. The cell-doubling times of primary murine embryonic neuronal cells (PNCs were determined based on the IDES capacitance-peak shifts. The electrical activity of PNC networks was detected using multi-electrode arrays (MEAs. During seeding, the cells were dielectrophoretically allocated to individual MEAs to improve network structures. MEA pads with diameters of 15, 20, 25, and 35 µm were tested. After 3 weeks, the magnitudes of the determined action potentials were highest for pads of 25 µm in diameter and did not differ when the inter-pad distances were 100 or 170 µm. Using 25-µm diameter circular oxygen electrodes, the signal currents in the cell-culture media were found to range from approximately −0.08 nA (0% O2 to −2.35 nA (21% O2. It was observed that 60-nm thick silicon nitride-sensor layers were stable potentiometric pH sensors under cell-culture conditions for periods of days. Their sensitivity between pH 5 and 9 was as high as 45 mV per pH step. We concluded that sensorized GC3s are potential animal replacement systems for purposes such as toxicity pre-screening. For example, the effect of mefloquine, a medication used to treat malaria, on the electrical activity of neuronal cells was determined in this study using a GC3 system.

  5. CD34+ cells cultured in stem cell factor and interleukin-2 generate CD56+ cells with antiproliferative effects on tumor cell lines

    Directory of Open Access Journals (Sweden)

    Hensel Nancy

    2005-04-01

    Full Text Available Abstract In vitro stimulation of CD34+ cells with IL-2 induces NK cell differentiation. In order to define the stages of NK cell development, which influence their generation from CD34 cells, we cultured G-CSF mobilized peripheral blood CD34+ cells in the presence of stem cell factor and IL-2. After three weeks culture we found a diversity of CD56+ subsets which possessed granzyme A, but lacked the cytotoxic apparatus required for classical NK-like cytotoxicity. However, these CD56+ cells had the unusual property of inhibiting proliferation of K562 and P815 cell lines in a cell-contact dependent fashion.

  6. Flux characteristics of cell culture medium in rectangular microchannels.

    Science.gov (United States)

    Feng, Zhonggang; Fukuda, Shuhei; Yokoyama, Michio; Kitajima, Tatsuo; Nakamura, Takao; Umezu, Mitsuo

    2011-09-01

    Rectangular microchannels 50 μm high and 30, 40, 50, 60, or 70 μm wide were fabricated by adjusting the width of a gap cut in a polyethylene sheet 50 μm thick and sandwiching the sheet between an acrylic plate and a glass plate. Flux in the microchannels was measured under three different inner surface conditions: uncoated, albumin-coated, and confluent growth of rat fibroblasts on the bottom of the microchannels. The normalized flux in microchannels with cultured fibroblasts or albumin coating was significantly larger than that in the uncoated channels. The experimental data for all microchannels deviated from that predicted by classical hydrodynamic theory. At small aspect ratio the flux in the microchannels was larger than that predicted theoretically, whereas it became smaller at large aspect ratio. The aspect ratio rather than Reynolds number is the correct property for predicting the variation of the normalized friction factor. We postulate that two counteracting effects, rotation of large molecules and slip velocity at the corners of the microchannels, are responsible for the deviation. From these results we conclude that albumin coating should be carried out in the same way as when fabricating our integrating cell-culture system. The outcomes of this study are not only important for the design of our culture system, but also quite informative for general microfluidics.

  7. Cell-to-Cell Diversity in a Synchronized Chlamydomonas Culture As Revealed by Single-Cell Analyses

    OpenAIRE

    Garz, Andreas; Sandmann, Michael; Rading, Michael; Ramm, Sascha; Menzel, Ralf; Steup, Martin

    2012-01-01

    In a synchronized photoautotrophic culture of Chlamydomonas reinhardtii, cell size, cell number, and the averaged starch content were determined throughout the light-dark cycle. For single-cell analyses, the relative cellular starch was quantified by measuring the second harmonic generation (SHG). In destained cells, amylopectin essentially represents the only biophotonic structure. As revealed by various validation procedures, SHG signal intensities are a reliable relative measure of the cel...

  8. Cell-Culture Reactor Having a Porous Organic Polymer Membrane

    Science.gov (United States)

    Koontz, Steven L. (Inventor)

    2000-01-01

    A method for making a biocompatible polymer article using a uniform atomic oxygen treatment is disclosed. The substrate may be subsequently optionally grated with a compatibilizing compound. Compatibilizing compounds may include proteins, phosphory1choline groups, platelet adhesion preventing polymers, albumin adhesion promoters, and the like. The compatibilized substrate may also have a living cell layer adhered thereto. The atomic oxygen is preferably produced by a flowing afterglow microwave discharge, wherein the substrate resides in a sidearm out of the plasma. Also, methods for culturing cells for various purposes using the various membranes are disclosed as well. Also disclosed are porous organic polymers having a distributed pore chemistry (DPC) comprising hydrophilic and hydrophobic regions, and a method for making the DPC by exposing the polymer to atomic oxygen wherein the rate of hydrophilization is greater than the rate of mass loss.

  9. A proteome map of primary cultured rat Schwann cells

    Directory of Open Access Journals (Sweden)

    Shen Mi

    2012-03-01

    Full Text Available Abstract Background Schwann cells (SCs are the principal glial cells of the peripheral nervous system with a wide range of biological functions. SCs play a key role in peripheral nerve regeneration and are involved in several hereditary peripheral neuropathies. The objective of this study was to gain new insight into the whole protein composition of SCs. Results Two-dimensional liquid chromatography coupled with tandem mass spectrometry (2D LC-MS/MS was performed to identify the protein expressions in primary cultured SCs of rats. We identified a total of 1,232 proteins, which were categorized into 20 functional classes. We also used quantitative real time RT-PCR and Western blot analysis to validate some of proteomics-identified proteins. Conclusion We showed for the first time the proteome map of SCs. Our data could serve as a reference library to provide basic information for understanding SC biology.

  10. Phase-segregated model for plant cell culture: The effect of cell volume fraction

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, W. [Univ. of Adelaide, Adelaide (Australia). Dept. of Chemical Engineering]|[Tokyo Univ. (Japan)hinese Academy of Sciences, Dalian (China). Dalian Inst. of Chemical Physics; Furusaki, S. [Tokyo Univ. (Japan)] Middelberg, A. [Univ. of Adelaide, Adelaide (Australia). Dept. of Chemical Engineering

    1998-06-01

    Plant cells are characterized by low water content, so the fraction of cell volume (volume fraction) in a vessel is large compared with other cell systems, even if the cell concentrations are the same. Therefore, concentration of plant cells should preferably be expressed by the liquid volume basis rather than by the total vessel volume basis. In this paper, a new model is proposed to analyze behavior of a plant cell culture by dividing the cell suspension into the biotic- and abiotic-phases. Using this model, we analyzed the cell-growth and the alkaloid production by Catharanthus roseus. Large errors in the simulated results were observed if the phase-segregation was not considered. 12 refs., 3 figs.

  11. Hemopoietic cell precursor responses to erythropoietin in plasma clot cultures

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, W.L.

    1979-01-01

    The time dependence of the response of mouse bone marrow cells to erythropoietin (Ep) in vitro was studied. Experiments include studies on the Ep response of marrow cells from normal, plethoric, or bled mice. Results with normal marrow reveal: (1) Not all erythroid precursors (CFU-E) are alike in their response to Ep. A significant number of the precursors develop to a mature erythroid colony after very short Ep exposures, but they account for only approx. 13% of the total colonies generated when Ep is active for 48 hrs. If Ep is active more than 6 hrs, a second population of erythroid colonies emerges at a nearly constant rate until the end of the culture. Full erythroid colony production requires prolonged exposure to erythropoietin. (2) The longer erythropoietin is actively present, the larger the number of erythroid colonies that reach 17 cells or more. Two distinct populations of immediate erythroid precursors are also present in marrow from plethoric mice. In these mice, total colony numbers are equal to or below those obtained from normal mice. However, the population of fast-responding CFU-E is consistently decreased to 10 to 20% of that found in normal marrow. The remaining colonies are formed from plethoric marrow at a rate equal to normal marrow. With increasing Ep exposures, the number of large colonies produced increases. From the marrow of bled mice, total erythroid colony production is equal to or above that of normal marrow. Two populations of colony-forming cells are again evident, with the fast-responding CFU-E being below normal levels. The lack of colonies from this group was compensated in bled mice by rapid colony production in the second population. A real increase in numbers of precursors present in this pool increased the rate of colony production in culture to twice that of normal marrow. The number of large colonies obtained from bled mice was again increased as the Ep exposure was lengthened. (ERB)

  12. Test procedures and instructions for Hanford complexant concentrate supernatant cesium removal using CST

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W.

    1997-01-08

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Complexant Concentrate supernatant liquor from tank 241-AN-107, in a bench-scale column. The cesium sorbent to be tested is crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-023, Hanford Complexant Concentrate Supernatant Cesium Removal Test Plan.

  13. Test procedures and instructions for Hanford tank waste supernatant cesium removal

    Energy Technology Data Exchange (ETDEWEB)

    Hendrickson, D.W., Westinghouse Hanford

    1996-05-31

    This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test using Hanford Double-Shell Slurry Feed supernatant liquor from tank 251-AW-101 in a bench-scale column.Cesium sorbents to be tested include resorcinol-formaldehyde resin and crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-022, Hanford Tank Waste Supernatant Cesium Removal Test Plan.

  14. Comparative study on the stem cell phenotypes of C6 cells under different culture conditions

    Institute of Scientific and Technical Information of China (English)

    ZHANG Suo-jun; YE Fei; XIE Rui-fan; HU Feng; WANG Bao-feng; WAN Feng; GUO Dong-sheng; LEI Ting

    2011-01-01

    Background Glioma stem cell (GSC) hypothesis posits that a subpopulation of cells within gliomas have true clonogenic and tumorigenic potential. Significantly, a more controversial correlate to GSC is that cells in different culture conditions might display distinct stem cell properties. Considering these possibilities, we applied an approach comparing stem cell characteristics of C6 glioma cells under different culture conditions.Methods C6 cells were cultured under three different growth conditions, i.e., adherent growth in conventional 10% serum medium, non-adherent spheres growth in serum-free medium, as well as adherent growth on laminin-coated flask in serum-free medium. Growth characteristics were detected contrastively through neurosphere formation assay and cell cycle analysis. Markers were determined by immunofluorescence, relative-quantitative reverse transcription (RT)-PCR,Western blotting and flow cytometry. Side population cells were analyzed via flow cytometry. Tumor models were detected by magnetic resonance imaging and hematoxylin & eosin staining. Data analyses were performed with SPSS software (17.0).Results C6 cells (C6-Adh, C6-SC-Sph and C6-SC-Adh) showed distinctive growth patterns and proliferation capacity.Compared to suspending C6-SC-Sph, adherent C6-Adh and C6-SC-Adh displayed higher growth ratio. C6-SC-Sph and C6-SC-Adh showed enhanced capability of neurosphere formation and self-renewal. High side population ratio was detected in C6-SC-Sph and C6-SC-Adh. CD133 was not detected in all three kinds of cells. Conversely, Nestin and β-Ⅲ-tubulin were demonstrated positive, nonetheless with no statistical significance (P >0.05). Interestingly, lower expression of glial fibrillary acidic protein was demonstrated in C6-SC-Sph and C6-SC-Adh. C6-Adh, C6-SC-Sph and C6-SC-Adh were all displayed in situ oncogenicity, while statistical difference of survival time was not confirmed.Conclusions C6 glioma cell line is endowed with some GSC

  15. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  16. Development of 3-D Hydrogel Culture Systems With On-Demand Cell Separation

    OpenAIRE

    Hamilton, Sharon K.; Bloodworth, Nathaniel C.; Massad, Christopher S.; Hammoudi, Taymour M.; Suri, Shalu; Yang, Peter J.; Lu, Hang; Temenoff, Johnna S

    2013-01-01

    Recently there has been an increased interest in the effects of paracrine signaling between groups of cells, particularly in the context of better understanding how stem cells contribute to tissue repair. Most current 3-D co-culture methods lack the ability to effectively separate 2 cell populations after the culture period, which is important for simultaneously analyzing the reciprocal effects of each cell type on the other. Here, we detail the development of a 3-D hydrogel co-culture system...

  17. Receptor-mediated endocytosis of diphtheria toxin by cells in culture.

    OpenAIRE

    Keen, J H; Maxfield, F R; Hardegree, M C; Habig, W H

    1982-01-01

    The binding and uptake of fluorescently labeled diphtheria toxin by cells in culture has been examined by using epifluorescence video intensification microscopy. Rhodamine-labeled diphtheria toxin retained significant toxicity on bioassay and in cell culture and was tested for uptake by human WI-38 and mouse 3T3 fibroblasts grown in culture. When added to cells at 37 degrees C, toxin was observed to become concentrated and internalized in discrete vesicles in both cell lines. The appearance o...

  18. A primary culture of guinea pig gallbladder epithelial cells that is responsive to secretagogues

    OpenAIRE

    Gunter-Smith, Pamela J.; Abdulkadir, Oluwakemi; Hammonds-Odie, Latanya; Scanlon, Mary; Terrell, Raquel

    2000-01-01

    We have developed a cell culture of guinea pig gallbladder epithelial cells with which to study ion transport. When grown on permeable supports, the cultured epithelia developed a transepithelial resistance (Rt) of ∼500 Ω·cm2. The epithelial cell origin of the cell culture was further confirmed by immunocytochemical localization of cytokeratin. Ionomycin and forskolin increased transepithelial voltage and short-circuit current (Isc) and decreased Rt. The response to ionomycin was transient, w...

  19. Replication of parvovirus B19 in hematopoietic progenitor cells generated in vitro from normal human peripheral blood.

    OpenAIRE

    Schwarz, T F; Serke, S; Hottenträger, B; von Brunn, A; Baurmann, H; Kirsch, A.; Stolz, W.; Huhn, D; Deinhardt, F.; Roggendorf, M

    1992-01-01

    Erythroid progenitor cells generated in vitro from peripheral human blood in the presence of interleukin-3 and erythropoietin were infected with human parvovirus B19. B19 virus DNA replication was highest 48 to 72 h after infection, and maximum levels of B19 virus proteins were detected in culture supernatants at 72 to 96 h after infection. B19 virus propagated in vitro was infectious. This cell culture system with peripheral blood cells facilitates studies in vitro of B19 virus replication.

  20. Comparison of ultracentrifugation and density gradient separation methods for isolating Tca8113 human tongue cancer cell line-derived exosomes

    OpenAIRE

    Zhang, Zhuoyuan; Wang, Chenxing; Li, Tang; LIU, ZHE; LI, LONGJIANG

    2014-01-01

    The aim of the present study was to compare the method of ultracentrifugation and density gradient separation for isolating Tca8113 human tongue squamous cell carcinoma cell line-derived exosomes. The exosomes were obtained from the culture supernatant of cultured Tca8113 cells, respectively, followed by identification with transmission electron microscopy observation and western blot analysis. The two different methods were then compared by the morphology, the distribution range of the parti...

  1. Efficacy of decoquinate against Sarcocystis neurona in cell cultures.

    Science.gov (United States)

    Lindsay, David S; Nazir, M Mudasser; Maqbool, Azhar; Ellison, Siobhan P; Strobl, Jeannine S

    2013-09-01

    Decoquinate is a quinolone anticoccidial approved for use in the prevention of intestinal coccidiosis in farm animals. This compound has good activity against Toxoplasma gondii and Neospora caninum in cell cultures. The drug acts on the parasites' mitochondria. The activity of decoquinate against developing merozoites of 2 isolates of Sarcocystis neurona was examined in cell culture. Merozoite production at 10 days was completely inhibited when decoquinate was used at 20 or 240 nM. The IC50 of decoquinate was 0.5 ± 0.09nM for the Sn6 isolate of S. neurona from a horse and 1.1 ± 0.6 nM for the SnOP15 isolate of S. neurona from an opossum. Levamisole was toxic at 5 μg/ml and no synergism was observed when decoquinate was combined with levamisole and tested against the Sn3YFP isolate of S. neurona. Decoquinate was cidal for developing schizonts of S. neurona at 240 nM. PMID:23523012

  2. Enhanced cell attachment using a novel cell culture surface presenting functional domains from extracellular matrix proteins

    OpenAIRE

    Cooke, M. J.; Phillips, S R; Shah, D. S. H.; Athey, D.; Lakey, J H; Przyborski, S A

    2008-01-01

    Many factors contribute to the creation and maintenance of a realistic environment for cell growth in vitro, e.g. the consistency of the growth medium, the addition of supplements, and the surface on which the cells grow. The nature of the surface on which cells are cultured plays an important role in their ability to attach, proliferate, migrate and function. Components of the extracellular matrix (ECM) are often used to coat glass or plastic surfaces to enhance cell attachment in vitro. Fra...

  3. Influence of co-culture on osteogenesis and angiogenesis of bone marrow mesenchymal stem cells and aortic endothelial cells.

    Science.gov (United States)

    Gurel Pekozer, Gorke; Torun Kose, Gamze; Hasirci, Vasif

    2016-11-01

    Co-culture of bone forming cells and endothelial cells to induce pre-vascularization is one of the strategies used to solve the insufficient vascularization problem in bone tissue engineering attempts. In the study, primary cells isolated from 2 different tissues of the same animal, rat bone marrow stem cells (RBMSCs) and rat aortic endothelial cells (RAECs) were co-cultured to study the effects of co-culturing on both osteogenesis and angiogenesis. The formation of tube like structure in 2D culture was observed for the first time in the literature by the co-culture of primary cells from the same animal and also osteogenesis and angiogenesis were investigated at the same time by using this co-culture system. Co-cultured cells mineralized and formed microvasculature beginning from 14days of incubation. After 28days of incubation in the osteogenic medium, expression of osteogenic genes in co-cultures was significantly upregulated compared to RBMSCs cultured alone. These results suggest that the co-culture of endothelial cells with mesenchymal stem cells induces both osteogenesis and angiogenesis.

  4. Azo-polysiloxanes as new supports for cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Hurduc, Nicolae, E-mail: nhurduc@ch.tuiasi.ro [“Gheorghe Asachi” Technical University of Iasi, Department of Natural and Synthetic Polymers, Prof. Dimitrie, Mangeron Street, 73, 700050-Iasi (Romania); Macovei, Alina [Institute of Biochemistry of the Romanian Academy, Department of Viral Glycoproteins, Splaiul Independentei 296, Sector 6, 060041-Bucuresti (Romania); Paius, Cristina; Raicu, Alina [“Gheorghe Asachi” Technical University of Iasi, Department of Natural and Synthetic Polymers, Prof. Dimitrie, Mangeron Street, 73, 700050-Iasi (Romania); Moleavin, Ioana [CEA, LIST Saclay, Laboratoire Capteurs et Architectures Électroniques, F-91191 Gif-sur-Yvette, Cedex (France); Branza-Nichita, Norica, E-mail: nichita@biochim.ro [Institute of Biochemistry of the Romanian Academy, Department of Viral Glycoproteins, Splaiul Independentei 296, Sector 6, 060041-Bucuresti (Romania); Hamel, Matthieu [CEA, LIST Saclay, Laboratoire Capteurs et Architectures Électroniques, F-91191 Gif-sur-Yvette, Cedex (France); Rocha, Licinio, E-mail: Licinio.ROCHA@cea.fr [CEA, LIST Saclay, Laboratoire Capteurs et Architectures Électroniques, F-91191 Gif-sur-Yvette, Cedex (France)

    2013-05-01

    The paper introduces a new class of materials with azo-polysiloxanic structure bearing the property to generate nano-structured surfaces by laser irradiation. The ability to modulate the optical response of the film, through a modification of the polymer chemical structure, has been investigated. The azo-materials were tested for their ability to support cell adhesion and growth, with very promising results. A future use of these materials as growth support in cell cultures is of great interest, due to an easy, one step-method to generate the surface relief grating and to the possibility to introduce a large range of chemical modifications due to the presence of the chlorobenzyl groups in the polymeric side-chain. - Graphical abstract: Cell development on a nano-structured surface obtained from an azo-polysiloxanic film. Highlights: ► New azo-polysiloxanic films for biological applications were reported. ► Nanostructured surfaces with controllable geometry are obtained by laser irradiation. ► Cells are very sensitive to the chemical and physical properties of the polymeric substrate.

  5. Azo-polysiloxanes as new supports for cell cultures

    International Nuclear Information System (INIS)

    The paper introduces a new class of materials with azo-polysiloxanic structure bearing the property to generate nano-structured surfaces by laser irradiation. The ability to modulate the optical response of the film, through a modification of the polymer chemical structure, has been investigated. The azo-materials were tested for their ability to support cell adhesion and growth, with very promising results. A future use of these materials as growth support in cell cultures is of great interest, due to an easy, one step-method to generate the surface relief grating and to the possibility to introduce a large range of chemical modifications due to the presence of the chlorobenzyl groups in the polymeric side-chain. - Graphical abstract: Cell development on a nano-structured surface obtained from an azo-polysiloxanic film. Highlights: ► New azo-polysiloxanic films for biological applications were reported. ► Nanostructured surfaces with controllable geometry are obtained by laser irradiation. ► Cells are very sensitive to the chemical and physical properties of the polymeric substrate

  6. Open-Porous Hydroxyapatite Scaffolds for Three-Dimensional Culture of Human Adult Liver Cells.

    Science.gov (United States)

    Finoli, Anthony; Schmelzer, Eva; Over, Patrick; Nettleship, Ian; Gerlach, Joerg C

    2016-01-01

    Liver cell culture within three-dimensional structures provides an improved culture system for various applications in basic research, pharmacological screening, and implantable or extracorporeal liver support. Biodegradable calcium-based scaffolds in such systems could enhance liver cell functionality by providing endothelial and hepatic cell support through locally elevated calcium levels, increased surface area for cell attachment, and allowing three-dimensional tissue restructuring. Open-porous hydroxyapatite scaffolds were fabricated and seeded with primary adult human liver cells, which were embedded within or without gels of extracellular matrix protein collagen-1 or hyaluronan. Metabolic functions were assessed after 5, 15, and 28 days. Longer-term cultures exhibited highest cell numbers and liver specific gene expression when cultured on hydroxyapatite scaffolds in collagen-1. Endothelial gene expression was induced in cells cultured on scaffolds without extracellular matrix proteins. Hydroxyapatite induced gene expression for cytokeratin-19 when cells were cultured in collagen-1 gel while culture in hyaluronan increased cytokeratin-19 gene expression independent of the use of scaffold in long-term culture. The implementation of hydroxyapatite composites with extracellular matrices affected liver cell cultures and cell differentiation depending on the type of matrix protein and the presence of a scaffold. The hydroxyapatite scaffolds enable scale-up of hepatic three-dimensional culture models for regenerative medicine applications.

  7. Open-Porous Hydroxyapatite Scaffolds for Three-Dimensional Culture of Human Adult Liver Cells

    Directory of Open Access Journals (Sweden)

    Anthony Finoli

    2016-01-01

    Full Text Available Liver cell culture within three-dimensional structures provides an improved culture system for various applications in basic research, pharmacological screening, and implantable or extracorporeal liver support. Biodegradable calcium-based scaffolds in such systems could enhance liver cell functionality by providing endothelial and hepatic cell support through locally elevated calcium levels, increased surface area for cell attachment, and allowing three-dimensional tissue restructuring. Open-porous hydroxyapatite scaffolds were fabricated and seeded with primary adult human liver cells, which were embedded within or without gels of extracellular matrix protein collagen-1 or hyaluronan. Metabolic functions were assessed after 5, 15, and 28 days. Longer-term cultures exhibited highest cell numbers and liver specific gene expression when cultured on hydroxyapatite scaffolds in collagen-1. Endothelial gene expression was induced in cells cultured on scaffolds without extracellular matrix proteins. Hydroxyapatite induced gene expression for cytokeratin-19 when cells were cultured in collagen-1 gel while culture in hyaluronan increased cytokeratin-19 gene expression independent of the use of scaffold in long-term culture. The implementation of hydroxyapatite composites with extracellular matrices affected liver cell cultures and cell differentiation depending on the type of matrix protein and the presence of a scaffold. The hydroxyapatite scaffolds enable scale-up of hepatic three-dimensional culture models for regenerative medicine applications.

  8. Open-Porous Hydroxyapatite Scaffolds for Three-Dimensional Culture of Human Adult Liver Cells

    Science.gov (United States)

    Schmelzer, Eva; Over, Patrick; Nettleship, Ian; Gerlach, Joerg C.

    2016-01-01

    Liver cell culture within three-dimensional structures provides an improved culture system for various applications in basic research, pharmacological screening, and implantable or extracorporeal liver support. Biodegradable calcium-based scaffolds in such systems could enhance liver cell functionality by providing endothelial and hepatic cell support through locally elevated calcium levels, increased surface area for cell attachment, and allowing three-dimensional tissue restructuring. Open-porous hydroxyapatite scaffolds were fabricated and seeded with primary adult human liver cells, which were embedded within or without gels of extracellular matrix protein collagen-1 or hyaluronan. Metabolic functions were assessed after 5, 15, and 28 days. Longer-term cultures exhibited highest cell numbers and liver specific gene expression when cultured on hydroxyapatite scaffolds in collagen-1. Endothelial gene expression was induced in cells cultured on scaffolds without extracellular matrix proteins. Hydroxyapatite induced gene expression for cytokeratin-19 when cells were cultured in collagen-1 gel while culture in hyaluronan increased cytokeratin-19 gene expression independent of the use of scaffold in long-term culture. The implementation of hydroxyapatite composites with extracellular matrices affected liver cell cultures and cell differentiation depending on the type of matrix protein and the presence of a scaffold. The hydroxyapatite scaffolds enable scale-up of hepatic three-dimensional culture models for regenerative medicine applications.

  9. Technology for cell cycle research with unstressed steady-state cultures

    OpenAIRE

    Lebleu, Valerie S.; Thornton, Maureen; Gonda, Steven R.; Helmstetter, Charles E.

    2006-01-01

    A culture system for performing cell cycle analyses on cells in undisturbed steady-state populations was designed and tested. In this system, newborn cells are shed continuously from an immobilized, perfused culture rotating about the horizontal axis. As a result of this arrangement, the number of newborn cells released into the effluent medium each generation is identical to the number of cells residing in the immobilized population, indicating that one of the two new daughter cells is shed ...

  10. Ghrelin regulates cell cycle-related gene expression in cultured hippocampal neural stem cells.

    Science.gov (United States)

    Chung, Hyunju; Park, Seungjoon

    2016-08-01

    We have previously demonstrated that ghrelin stimulates the cellular proliferation of cultured adult rat hippocampal neural stem cells (NSCs). However, little is known about the molecular mechanisms by which ghrelin regulates cell cycle progression. The purpose of this study was to investigate the potential effects of ghrelin on cell cycle regulatory molecules in cultured hippocampal NSCs. Ghrelin treatment increased proliferation assessed by CCK-8 proliferation assay. The expression levels of proliferating cell nuclear antigen and cell division control 2, well-known cell-proliferating markers, were also increased by ghrelin. Fluorescence-activated cell sorting analysis revealed that ghrelin promoted progression of cell cycle from G0/G1 to S phase, whereas this progression was attenuated by the pretreatment with specific inhibitors of MEK/extracellular signal-regulated kinase 1/2, phosphoinositide 3-kinase/Akt, mammalian target of rapamycin, and janus kinase 2/signal transducer and activator of transcription 3. Ghrelin-induced proliferative effect was associated with increased expression of E2F1 transcription factor in the nucleus, as determined by Western blotting and immunofluorescence. We also found that ghrelin caused an increase in protein levels of positive regulators of cell cycle, such as cyclin A and cyclin-dependent kinase (CDK) 2. Moreover, p27(KIP1) and p57(KIP2) protein levels were reduced when cell were exposed to ghrelin, suggesting downregulation of CDK inhibitors may contribute to proliferative effect of ghrelin. Our data suggest that ghrelin targets both cell cycle positive and negative regulators to stimulate proliferation of cultured hippocampal NSCs. PMID:27325242

  11. Simple and sensitive method for monitoring drug-induced cell injury in cultured cells

    Energy Technology Data Exchange (ETDEWEB)