WorldWideScience

Sample records for cell culture supernatants

  1. Bioactivities of Culture Supernatants from Retroviral Packaging Cells Carrying the Mouse Fas Ligand Gene

    Institute of Scientific and Technical Information of China (English)

    LIU Lingbo; ZOU Ping; GUO Rong; XIAO Juan; XU Zhiliang

    2001-01-01

    The bioactivities of culture supernatants from retroviral packaging cells carrying the mouse Fas ligand (mFasL) gene was investigated. FasLcDNA was cloned into PLXIN with an internal ribosome entry site to link two cistrons through gene recombination technology, PLXIN and the recombinant vector PLFIN were separately transfected into PA317 retrovirus packing cell line by lipofectamine 2000, and the resistant clones were selected with G418 selective medium. The integration of genome DNA was assayed by genomic DNA PCR. NIH3T3 cells were transduced by the culture supernatants from PA317 carrying the mFasLcDNA gene, and were selected with G418 selective medium, so as to select the PLFIN-PA317 clone capable of producing higher titer of supernatants. The levels of mFasL protein on NIH3T3 cells membrane were assayed by flow cytometry (FCM). The biological activity of mFasL on NIH3T3 cells membrane was investigated by the inducing apoptosis of Fas+ Yac-1 cells co-cultured with NIH3T3 cells expressing Fas ligand. To explore the direct mFasL cytotoxicity of culture supernatants from retroviral packaging cells carrying the mFasL gene, the culture supernatants from PLFIN-PA317 and PLXIN-PA317 were separately co-cultured with Yac-1cells in parallel. The recombinant PLFIN was successfully constructed. The highest titer of supernatants from twelve resistant clones was 8. 5 × 105 colony-forming-unit (CFU)/ml. The NIH3T3cells transfected by above supernatants had a higher level of mFasL (53.81±6.9 %), and significantly induced the apoptosis of Fas+ Yac-1 cells (56. 78±4.5 %), as both were cocultured for 5 h at1 : 1 ratio, whereas it is 7. 08±3.4 % in control group (P<0. 01). Supernatant from PLFINPA317 could also directly induce the apoptosis of Yac-1 within 5 h of incubation. Thus, the culture supernatants from PLFIN-PA317 possessed both infectivity and cytotoxicity of mFasL.

  2. The Supernatant Obtained from Cultured Anip973 Cells Enhances the Biological Activities of HUVEC

    Directory of Open Access Journals (Sweden)

    Cuicui ZHANG

    2015-11-01

    Full Text Available Background and objective Unlike normal tissue-derived microvascular endothelial cells, tumor microvessel endothelial cells are highly reactive to growth factors and exhibit more adhesion molecules. Thus, vascular tumors are highly permeable and grow vigorously; this occurrence results in rapid growth and metastasis cancer cells. Therefore, understanding the characteristics of endothelial cells in the tumor microenvironment guides anti-angiogenic therapy. To this end, we explore the effect of the supernatant obtained from cultured Anip973 cells (high-metastatic human lung adenocarcinoma cells on the biological behavior and on the cell surface markers of the human umbilical vein endothelial cell (HUVEC. Methods The HUVEC that was cultured in a medium (RPMI-1640 + 10% fetal bovine serum containing various concentrations of Anip973 supernatants was categorized into experimental groups. The HUVEC cultured in a medium without Anip973 supernatants served as the control group. Proliferation was determined with CCK-8; blood vessel formation was investigated with three-dimensional culture techniques in vitro; and HUVEC migration was observed via transwell assay. At the same time, the expressions of CD105, CD31, and the apoptotic marker of Annexin V were detected through flow cytometry for analyzing the relationship between the expression of cell surface markers and biological behavior. Results Following incubation with the supernatant obtained from cultured Anip973 cells, HUVEC proliferated more than the control group did, and the proliferation rate was maximized when incubated in a supernatant concentration of 250 μL/mL for 24 h (P=0.002. In addition, the experimental groups exhibited varying degrees of migration and forms of vascular lumen sample structure, especially at supernatant concentrations of 125 µL/mL (P<0.001 and 250 µL/mL (P=0.002, respectively. CD105 expression was optimized at 250 μL/mL (P=0.028, and CD31 expression also increased with

  3. Detection of cell wall mannoprotein Mp1p in culture supernatants of Penicillium marneffei and in sera of penicilliosis patients

    OpenAIRE

    Cao, Liang; Chan, King-Man; Chen, Daliang; Vanittanakom, Nongnuch; Lee, Cindy; Chan, Che-Man; Sirisanthana, Thira; Tsang, Dominic N. C.; Yuen, Kwok-Yung

    1999-01-01

    Mannoproteins are important and abundant structural components of fungal cell walls. The MP1 gene encodes a cell wall mannoprotein of the pathogenic fungus Penicillium marneffei. In the present study, we show that Mp1p is secreted into the cell culture supernatant at a level that can be detected by Western blotting. A sensitive enzyme-linked immunosorbent assay (ELISA) developed with antibodies against Mp1p was capable of detecting this protein from the cell culture supernatant of P. marneffe...

  4. Continuous precipitation of IgG from CHO cell culture supernatant in a tubular reactor.

    Science.gov (United States)

    Hammerschmidt, Nikolaus; Hintersteiner, Beate; Lingg, Nico; Jungbauer, Alois

    2015-08-01

    We successfully transferred a two-stage batch precipitation-based antibody capture step to continuous mode using continuous tubular reactors. The precipitation process solely employs a cheap mineral salt (CaCl2 ) and an organic solvent (ethanol) and could replace the costly protein A capture step in the purification of recombinant antibodies from cell culture supernatant. The time from startup untill attaining steady state conditions was reached in less than 15 minutes and both reactors were operated for several hours at steady state without manual intervention, delivering antibody at a constant yield and purity. An overall yield of > 90 percent, with a host cell protein reduction from 42 777 to 9000 ppm and a DNA reduction from 359 ppm to 7 ppm, could be achieved for the antibody investigated. The precipitated antibody can be dissolved at very high concentrations (> 40 g/L) in numerous buffer systems of various pH and high and low ionic strength, thereby rendering a subsequent concentration or buffer exchange step redundant. This system enables cell culture supernatants with low or high antibody titer to be processed with constant reactor size and without changing any parameters or increasing precipitant consumption. Aggregate levels were below 1% under all conditions tested. Purification by precipitation did not affect binding to CD16a or the isoform distribution of the antibody. PMID:25781580

  5. Comparison among three anion exchange chromatographic supports to capture erythropoietin from cell culture supernatant

    Institute of Scientific and Technical Information of China (English)

    Lourdes HERNNDEZ; Diobel STEWART; Lourdes ZUMALACRREGUI; Daniel AMARO

    2015-01-01

    Affinity and ion exchange conventional chromatography have been used to capture erythropoietin ( EPO)from mammalian cell culture supernatant. Currently,chromatographic adsorbent perfusion is available, however a limited number of applications have been found in the literature. In this work,three anion exchange chromatographic supports( gel,membrane and monolithic)were evaluated in the capture step of the recombi-nant erythropoietin purification process. The influences of load and flow rate on each support performance were analyzed. Also the purity of the EPO molecules was determined. A productivity analysis,as a decision tool for larger scale implementation,was done. As a conclusion,the evaluated supports are technically suitable to cap-ture EPO with adequate recovery and good purity. However,the monolithic column admits high operating velocity,showing the highest adsorption capacity and productivity.

  6. Optimized exosome isolation protocol for cell culture supernatant and human plasma

    Directory of Open Access Journals (Sweden)

    Richard J. Lobb

    2015-07-01

    Full Text Available Extracellular vesicles represent a rich source of novel biomarkers in the diagnosis and prognosis of disease. However, there is currently limited information elucidating the most efficient methods for obtaining high yields of pure exosomes, a subset of extracellular vesicles, from cell culture supernatant and complex biological fluids such as plasma. To this end, we comprehensively characterize a variety of exosome isolation protocols for their efficiency, yield and purity of isolated exosomes. Repeated ultracentrifugation steps can reduce the quality of exosome preparations leading to lower exosome yield. We show that concentration of cell culture conditioned media using ultrafiltration devices results in increased vesicle isolation when compared to traditional ultracentrifugation protocols. However, our data on using conditioned media isolated from the Non-Small-Cell Lung Cancer (NSCLC SK-MES-1 cell line demonstrates that the choice of concentrating device can greatly impact the yield of isolated exosomes. We find that centrifuge-based concentrating methods are more appropriate than pressure-driven concentrating devices and allow the rapid isolation of exosomes from both NSCLC cell culture conditioned media and complex biological fluids. In fact to date, no protocol detailing exosome isolation utilizing current commercial methods from both cells and patient samples has been described. Utilizing tunable resistive pulse sensing and protein analysis, we provide a comparative analysis of 4 exosome isolation techniques, indicating their efficacy and preparation purity. Our results demonstrate that current precipitation protocols for the isolation of exosomes from cell culture conditioned media and plasma provide the least pure preparations of exosomes, whereas size exclusion isolation is comparable to density gradient purification of exosomes. We have identified current shortcomings in common extracellular vesicle isolation methods and provide a

  7. Quantitative analysis of particles, genomes and infectious particles in supernatants of haemorrhagic fever virus cell cultures

    Directory of Open Access Journals (Sweden)

    Hedlund Kjell-Olof

    2011-02-01

    Full Text Available Abstract Information on the replication of viral haemorrhagic fever viruses is not readily available and has never been analysed in a comparative approach. Here, we compared the cell culture growth characteristics of haemorrhagic fever viruses (HFV, of the Arenaviridae, Filoviridae, Bunyaviridae, and Flavivridae virus families by performing quantitative analysis of cell culture supernatants by (i electron microscopy for the quantification of virus particles, (ii quantitative real time PCR for the quantification of genomes, and (iii determination of focus forming units by coating fluorescent antibodies to infected cell monolayers for the quantification of virus infectivity. The comparative analysis revealed that filovirus and RVFV replication results in a surplus of genomes but varying degrees of packaging efficiency and infectious particles. More efficient replication and packaging was observed for Lassa virus, and Dengue virus resulting in a better yield of infectious particles while, YFV turned out to be most efficient with only 4 particles inducing one FFU. For Crimean-Congo haemorrhagic fever virus (CCHFV a surplus of empty shells was observed with only one in 24 particles equipped with a genome. The complete particles turned out to be extraordinarily infectious.

  8. Fast and simple online sample preparation coupled with capillary LC-MS/MS for determination of prostaglandins in cell culture supernatants

    DEFF Research Database (Denmark)

    Rinne, Sandra; Ramstad Kleiveland, Charlotte; Kassem, Moustapha; Lea, Tor; Lundanes, Elsa; Greibrokk, Tyge

    2007-01-01

    )) in cell culture supernatants was developed and validated. Pretreatment of the cell culture supernatants included dilution and filtration, and the analysis time including all sample preparation steps was less than 50 min per sample. Peptides/proteins contained in the matrix were removed by the SCX...

  9. Detecting pM concentrations of prostaglandins in cell culture supernatants by capillary SCX-LC-MS/MS

    DEFF Research Database (Denmark)

    Dahl, Sandra Rinne; Kleiveland, Charlotte Ramstad; Kassem, Moustapha;

    2008-01-01

    A highly sensitive, improved online strong cation exchange (SCX)--RP capillary liquid chromatographic (cLC) method with IT mass spectrometric (IT-MS/MS) detection for the simultaneous determination of prostaglandin (PG)A(1), PGD(2), PGE(1), PGE(2), PGF(2alpha), 8-iso-(8i)PGF(2alpha), 6-keto-(6k......)PGF(1alpha), and 15-Delta(12, 14)-deoxy-PGJ(2) (15dPGJ(2)) in cell culture supernatants was developed and validated. Pretreatment of the cell culture supernatants included only dilution and filtration, and the analysis time including all sample preparation steps was 60 min per sample. Peptides....../proteins contained in the matrix were removed by the SCX column. LODs in the range of 8-44 pg/mL (25-120 pM) cell culture supernatant were obtained. Excellent linearity (R(2) > 0.99) and satisfactory recoveries and within- and between-day precisions were obtained. Human mesenchymal stem cells (hMSCs) were stimulated...

  10. Effective isolation of exosomes with polyethylene glycol from cell culture supernatant for in-depth proteome profiling.

    Science.gov (United States)

    Weng, Yejing; Sui, Zhigang; Shan, Yichu; Hu, Yechen; Chen, Yuanbo; Zhang, Lihua; Zhang, Yukui

    2016-08-01

    Exosomes are secreted nanovesicles shed by almost all kinds of cells. Recently, increased interest has been focused on these extracellular vesicles as natural carriers transporting biological contents for intercellular communication. However, current isolation techniques, such as ultracentrifugation, are not convenient and often require specialized equipment. Herein, we describe a polyethylene glycol (PEG)-based approach, which could permit facile, low-cost and effective isolation of exosomes from cell culture supernatant. High-resolution electron microscopes clearly visualized the size and morphology of isolated exosome aggregates, implying the mechanism of PEG-based precipitation. Combined with tandem mass spectrometry analysis, 6299 protein groups encoded by 5120 genes were successfully characterized from HeLa cell culture supernatant, including numerous exosome proteins which could overlap 97% of the Top 100 exosome marker proteins recorded in the ExoCarta database, as well as a series of low-abundance cytokines and biomarkers. Furthermore, we found a higher ratio of neo-cleavage sites in proteins identified from exosomes compared with cellular proteins, revealing the potential roles of exosomes in accumulation and transportation of protein degradation intermediates. PMID:27229443

  11. THE EFFECT OF ANTISENSE OLIGONUCLEOTIDE ON THE INTERLEUKIN-5 IN THE SUPERNATANTS OF SPLEEN CELL CULTURES OF ASTHMATIC MICE

    Institute of Scientific and Technical Information of China (English)

    王美琴; 白春学; 钮善福; 方晓惠; 陈常庆; 陈波

    2001-01-01

    To explore the effect of antisense oligonucleotide on the production of IL-5 by mouse spleen T lymphocytes.Methods Based on the IL-5 cDNA sequence of mouse, a segment of antisense oligonucleotide was designed and synthesized. 5’-labeling of antisense oligonucleotide was signed by T4 PNK in order that the efficiency of stearylamine liposome in transfecting antisense oligonucleotide can be evaluated. Asthma model was duplicated with ovalbumin(OVA) absorbed to aluminum hydroxide. T lymphocytes of mice were separated by nylon fiber method, then T lymphocytes transfected with different concentration of antisense oligonucleotide with cation stearylamine liposme were incubated respectively in order to observe the effect of antisense oligonucleotide on Il-5 production by T lymphocytes. IL-5 levels in the supernatants of T lymphocyte cultures were determined by ELISA.Results Stearylamine liposome could markedly increase the efficiency of antisense oligonucleotide transfection. The transfection efficiency of antisense oligouncleotide increased approximately 12 times at a ratio of 1: 15m/m (antisense oligonucleotide to SA liposome). In healthy and asthma Balb/c mice, IL-5 was not detectable in the supernatants of T lymphocyte cultures without stimulated with OVA; however, IL-5 was increased markedly in the supernatants of T lymphocyte cultures stimulated with OVA. After transfection with different concentrations of antisense oligonucleotide, IL-5 levels in the supernatants of T lymphocyte cultures were significantly lower than those in control cultured without antisense oligonucleotide transfection. IL-5 levels decreased from 44.60±6.23 pg/ml to 30.70±7.362 pg/ml, 17.20±6.181 pg/ml and 8.16±2.34 pg/ml respectively. And IL-5 synthesis was inhibited by 31.17%, 61.43% and 81.7% respectively.Conclusion IL-5 synthesis could be obviously inhibited by antisense oligonucleotide and showed a markedly correlation between dose and effectiveness. It suggests the production

  12. Cell-free culture supernatant of Bifidobacterium breve CNCM I-4035 decreases pro-inflammatory cytokines in human dendritic cells challenged with Salmonella typhi through TLR activation.

    Directory of Open Access Journals (Sweden)

    Miriam Bermudez-Brito

    Full Text Available Dendritic cells (DCs constitute the first point of contact between gut commensals and our immune system. Despite growing evidence of the immunomodulatory effects of probiotics, the interactions between the cells of the intestinal immune system and bacteria remain largely unknown. Indeed,, the aim of this work was to determine whether the probiotic Bifidobacterium breve CNCM I-4035 and its cell-free culture supernatant (CFS have immunomodulatory effects in human intestinal-like dendritic cells (DCs and how they respond to the pathogenic bacterium Salmonella enterica serovar Typhi, and also to elucidate the molecular mechanisms involved in these interactions. Human DCs were directly challenged with B. breve/CFS, S. typhi or a combination of these stimuli for 4 h. The expression pattern of genes involved in Toll-like receptor (TLR signaling pathway and cytokine secretion was analyzed. CFS decreased pro-inflammatory cytokines and chemokines in human intestinal DCs challenged with S. typhi. In contrast, the B. breve CNCM I-4035 probiotic strain was a potent inducer of the pro-inflammatory cytokines and chemokines tested, i.e., TNF-α, IL-8 and RANTES, as well as anti-inflammatory cytokines including IL-10. CFS restored TGF-β levels in the presence of Salmonella. Live B.breve and its supernatant enhanced innate immune responses by the activation of TLR signaling pathway. These treatments upregulated TLR9 gene transcription. In addition, CFS was a more potent inducer of TLR9 expression than the probiotic bacteria in the presence of S. typhi. Expression levels of CASP8 and IRAK4 were also increased by CFS, and both treatments induced TOLLIP gene expression. Our results indicate that the probiotic strain B. breve CNCM I-4035 affects the intestinal immune response, whereas its supernatant exerts anti-inflammatory effects mediated by DCs. This supernatant may protect immune system from highly infectious agents such as Salmonella typhi and can down

  13. Culture supernatants of breast cancer cell line MDA-MB-231 treated with parthenolide inhibit the proliferation, migration, and lumen formation capacity of human umbilical vein endothelial cells

    Institute of Scientific and Technical Information of China (English)

    LI Cai-juan; GUO Su-fen; SHI Tie-mei

    2012-01-01

    Background Parthenolide has been tested for anti-tumor activities,such as anti-proliferation and pro-apoptosis in recent studies.However,little is known about its role in the process of tumor angiogenesis.This study aims to investigate the effects and potential mechanisms of parthenolide on the proliferation,migration and lumen formation capacity of human umbilical vein endothelial cells.Methods Different concentrations of parthenolide were applied to the human breast cancer cell line MDA-MB-231 cells.After 24-hour incubation,the culture supematants were harvested and used to treat human umbilical vein endothelial cells for 24 hours.Then an inverted fluorescence phase contrast microscope was used to evaluate the human umbilical vein endothelial cells.The secretion of vascular endothelial growth factor (VEGF),interleukin (IL)-8 and matrix metalloproteinases (MMP)-9 in the culture supernatant of the MDA-MB-231 cells was then measured with enzyme-linked immunosorbent assay (ELISA) assays.Results Suppression of proliferation,migration,and the lumen formation capacity of human umbilical vein endothelial cells was observed in the presence of the culture supernatants from the breast cancer cell line treated with different concentrations of parthenolide.Parthenolide decreased the levels of the angiogenic factors MMP-9,VEGF,and IL-8secreted by the MDA-MB-231 cells.Conclusions Parthenolide may suppress angiogenesis through decreasing angiogenic factors secreted by breast cancer cells to interfere with the proliferation,migration and lumen-like structure formation of endothelial cells,thereby inhibiting tumor growth.It is a promising potential anti-angiogenic drug.

  14. Identification and Immunogenicity of Group A Streptococcus Culture Supernatant Proteins

    OpenAIRE

    Lei, Benfang; Mackie, Stacy; Lukomski, Slawomir; Musser, James M.

    2000-01-01

    Extracellular proteins made by group A Streptococcus (GAS) play critical roles in the pathogenesis of human infections caused by this bacterium. Although many extracellular GAS proteins have been identified and characterized, there has been no systematic analysis of culture supernatant proteins. Proteins present in the culture supernatant of strains of serotype M1 (MGAS 5005) and M3 (MGAS 315) mutants lacking production of the major extracellular cysteine protease were separated by two-dimens...

  15. The culture of Chlorella vulgaris in a recycled supernatant: Effects on biomass production and medium quality

    KAUST Repository

    Hadj-Romdhane, F.

    2013-03-01

    Reusing supernatant of microalgae culture medium can have inhibitory or toxic effects on the biomass production because of the release of organic metabolites by cells in the culture medium during their growth. This work investigated the impact of Chlorella vulgaris medium recycling on culture productivity, cells quality and accumulation of excreted metabolites in the culture medium. No significant impact on the C. vulgaris growth was observed after 63days of recycling, the productivity remained stable at around 0.55kgm-3day-1. Organic matters accumulated in supernatant were identified as biopolymers (BP) poor in nitrogen and with a size above 40kDa (probably polysaccharides), and small organic molecules (SOM) richer in nitrogen with a molecular size ranging from 1 to 3kDa. The concentration of biopolymers in the supernatant increased till to a maximum and then decreased, possibly consumed by bacteria, whereas small organic compounds accumulated in the medium. © 2013 Elsevier Ltd.

  16. Analysis of IL-2-like factor in lymphocyte culture supernatant of olive flounder, Paralichthys oliveaceus

    Science.gov (United States)

    Wu, Riqin; Zhang, Peijun; Li, Jun; Xu, Yongli

    2005-03-01

    To study immune mechanism of fish lymphocyte we performed a proliferation assay and ELISA using monoclonal antibody against human IL-2. The result showed that an interleukin-2 (IL-2)-like factor was detected in the supernatant of plant haemoglutinin (PHA)-stimulated lymphocyte culture from peripheral blood, spleen and head kidney of olive flounder, Paralichthys olivaceus. The quantities of IL-2-like factor in the supernatant from different lymphoid tissues were quite different. The IL-2 like factor in the supernatant from cultured head kidney lymphocytes was much higher than those of peripheral blood lymphocytes and spleen lymphocytes ( Precombinant human IL-2, (rhIL-2) was able to stimulate flounder thymocyte proliferation and used to detect the IL-2 receptor (IL-2R) on the surface of flounder lymphocyte. The cross-reaction between the lymphocytes of flounder peripheral blood and CD25(IL-2R) was detected with flow cytometry and shown that the percentage of CD25-positive cell in peripheral blood was 7.74±0.67%.

  17. Quantitative analysis of the supernatant from host and transfected CHO cells using iTRAQ 8-plex technique.

    Science.gov (United States)

    Zhu, Guijie; Sun, Liangliang; Albanetti, Thomas; Linkous, Travis; Larkin, Christopher; Schoner, Ronald; McGivney, James B; Dovichi, Norman J

    2016-10-01

    We employed UPLC-MS/MS with iTRAQ 8-plex labeling to quantitatively analyze the supernatant produced by two Chinese hamster ovary (CHO) cell lines (CHO K1SV and CHO CAT-S). In each case, the supernatant from the host and three transfected clones were analyzed at days 5, 7, and 10 of culture. A total of eight iTRAQ 8-plex experiments were performed. For each cell line, the overlap of supernatant protein identifications between transfected clones is over 60%. Over 70% of the supernatant proteins in the CHO K1SV host cell line are present in the CHO CAT-S cell line. For the CHO K1SV cell line, the overlap in supernatant protein identifications between the host cell line and the transfected clones is >59%. For the CHO CAT-S cell line, the overlap between supernatant protein identifications for the transfected clone and host cell is >45%. These differences in the supernatant protein identifications between transfected clones in each cell line and between the two host cell lines are not significant. We used cluster analysis to characterize the change in supernatant protein expression as a function of cell culture time. Roughly 1.3 or clones at each time point. Greater than 65% of the common proteins in the CHO K1SV cell line supernatant and over 54% in the CHO CAT-S cell line supernatant show no significant expression difference between host and the three transfected clones. Data are available via ProteomeXchange with identifier PXD003462. Biotechnol. Bioeng. 2016;113: 2140-2148. © 2016 Wiley Periodicals, Inc. PMID:27070921

  18. Purification and characterization of an inhibitor of thymidine uptake from culture supernatants of human tonsil lymphocytes

    International Nuclear Information System (INIS)

    Lymphocytes from human tonsils were cultured in the absence of serum for 3 days. In the presence of the concentrated culture supernatant the proliferative response of PBL, to con A, as measured by the uptake of 3H-tdr, was significantly reduced. The suppressor substance was referred to as SMAL (suppressor of mitogen activated lymphocytes). The estimated molecular weight of SMAL under nondenaturing conditions was 100,000-300,000. SMAL also suppressed the incorporation of 3H-tdr by a variety of mouse and human tumor cell lines. The activity of SMAL was sensitive to pronase and heating at 1000C for 30 minutes but insensitive to RNase. Treatment with DNase, however, enhanced the activity of SMAL. SMAL was not produced by heat-killed tonsil lymphocytes or lymphocytes-treated with cycloheximide. Maximal production occurred in the first 24 hours of culture, and progressively less was produced in subsequent 24-hour intervals. Both T- and B lymphocyte-enriched culture supernatants contained SMAL. Two active components, one corresponding to a large and/or less negatively charged molecule and another corresponding to small and/or highly acidic molecule, were recovered. HPLC-purified SMAL at relatively low doses inhibited the uptake and phosphorylation of 3H-tdr, without significant effect on cell proliferation. The inhibition of 3H-tdr uptake was favored over that of 3H-udr or 3H-adr, and this effect was reversible

  19. Analysis of IL-2-like factor in lymphocyte culture supernatant of olive flounder, Paralichthys oliveaceus

    Institute of Scientific and Technical Information of China (English)

    WU Riqin; ZHANG Peijun; LI Jun; XU Yongli

    2005-01-01

    To study immune mechanism of fish lymphocyte we performed a proliferation assay and ELISA using monoclonal antibody against human IL-2. The result showed that an interleukin-2 (IL-2)-like factor was detected in the supernatant of plant haemoglutinin (PHA)-stimulated lymphocyte culture from peripheral blood,spleen and head kidney of olive flounder, Paralichthys olivaceus. The quantities of IL-2-1ike factor in the supematant from different lymphoid tissues were quite different. The IL-2 like factor in the supernatant from cultured head kidney lymphocytes was much higher than those of peripheral blood lymphocytes and spleen lymphocytes (P<0.01). The IL-2 activity was found in either mouse thymocyte proliferation assay or flounder head kidney lymphocyte proliferation assay and shown to have obvious enhancing effect on proliferation of the above two types of cell. The recombinant human IL-2 (rhIL-2) was able to stimulate flounder thymocyte proliferation and used to detect the IL-2 receptor (IL-2R) on the surface of flounder lymphocyte. The cross-reaction between the lymphocytes of flounder peripheral blood and CD25(IL-2R) was detected with flow cytometry and shown that the percentage of CD25-positive cell in peripheral blood was 7.74± 0.67%.

  20. Inhibition of Crotalidae venom hemorrhagic activities by Didelphis marsupialis liver spheroids culture supernatants.

    Science.gov (United States)

    Salgueiro, L M; Rodríguez-Acosta, A; Rivas-Vetencourt, P; Zerpa, M; Carillo, G; Aguilar, I; Girón, M E; Acevedo, C E; Gendzekhadze, K

    2001-05-01

    The main aim of this work was the development of a primary hepatocyte culture from Didelphis marsupialis, to determine the possible use of culture medium supernatants as a source of inhibitors of the Bothrops lanceolatus venom hemorrhagic activity. The cellular culture was carried out from isolated hepatocytes by the double perfusion technique, and digestion of the liver with collagenase and culturing the hepatocytes in a liquid media under continuous agitation at 37 degrees C in 5% CO2. The hemorrhagic activity inhibition assays were performed inoculating intradermically, a mixture of Bothrops lanceolatus venom plus a pool of liver spheroids culture supernatants, in mice. These liver Didelphis marsupialis spheroid cultures were adequate to obtain large supernatant volumes with inhibitors of hemorrhagic activity. PMID:11405280

  1. Tetracycline and Glutathione Inhibit Matrix Metalloproteinase Activity: An In Vitro Study Using Culture Supernatants of L929 and Dalton Lymphoma Cell Lines

    OpenAIRE

    Gajanan Kendre; Rahul Raghavan; Sanith Cheriyamundath; Joseph Madassery

    2013-01-01

    Tetracycline and glutathione inhibited the protease activities of matrix metalloproteinase-2 and matrix metalloproteinase-9 expressed by mouse fibrosarcoma cells (L929) and Dalton lymphoma cells, respectively. The inhibitory activity of the tetracycline may be due to its ability to chelate metal ions such as calcium and zinc. Gelatin-zymography technique was used to demonstrate the inhibitory activity of both tetracycline and glutathione. The intensity of the bands corresponding to metallopro...

  2. Tetracycline and Glutathione Inhibit Matrix Metalloproteinase Activity: An In Vitro Study Using Culture Supernatants of L929 and Dalton Lymphoma Cell Lines

    Directory of Open Access Journals (Sweden)

    Gajanan Kendre

    2013-01-01

    Full Text Available Tetracycline and glutathione inhibited the protease activities of matrix metalloproteinase-2 and matrix metalloproteinase-9 expressed by mouse fibrosarcoma cells (L929 and Dalton lymphoma cells, respectively. The inhibitory activity of the tetracycline may be due to its ability to chelate metal ions such as calcium and zinc. Gelatin-zymography technique was used to demonstrate the inhibitory activity of both tetracycline and glutathione. The intensity of the bands corresponding to metalloproteinase activity in zymography gel was reduced in the presence of 50–100 μg/mL of tetracycline. The presence of 10–100 μg/mL of tetracycline in the medium increased the adherence of L929 cancer cells. These results clearly indicate the antimetastatic property of tetracycline. Reduced glutathione, a compound which is produced endogenously by the cells to maintain the redox status, was shown to inhibit the matrix metalloproteinase activity (in vitro. Therefore, it is assumed that decreased glutathione levels in synovial fluids or plasma might increase the activity of MMP. Reduced glutathione at 100 μg/mL inhibited the metalloproteinase activity in gelatin-zymographic gel. As both tetracycline and glutathione exhibited an inhibitory effect on matrix metalloproteinase activity, it was of great interest to check their clinical effects on various MMP associated pathological conditions such as cancer metastasis and arthritis. Here we report that tetracycline and reduced glutathione inhibited the activity of MMP2 completely and activity of MMP9 partly.

  3. Identification of specific metabolites in culture supernatant of Mycobacterium tuberculosis using metabolomics: exploration of potential biomarkers

    OpenAIRE

    Lau, Susanna KP; Lam, Ching-Wan; Curreem, Shirly OT; Lee, Kim-Chung; Lau, Candy CY; Chow, Wang-Ngai; Ngan, Antonio HY; To, Kelvin KW; Chan, Jasper FW; Hung, Ivan FN; Yam, Wing-Cheong; Yuen, Kwok-Yung; Woo, Patrick CY

    2015-01-01

    Although previous studies have reported the use of metabolomics for Mycobacterium species differentiation, little is known about the potential of extracellular metabolites of Mycobacterium tuberculosis (MTB) as specific biomarkers. Using an optimized ultrahigh performance liquid chromatography–electrospray ionization–quadruple time of flight–mass spectrometry (UHPLC–ESI–Q–TOF–MS) platform, we characterized the extracellular metabolomes of culture supernatant of nine MTB strains and nine non-t...

  4. An efficient process of generating bispecific antibodies via controlled Fab-arm exchange using culture supernatants.

    Science.gov (United States)

    Paul, Suparna; Connor, Judy; Nesspor, Tom; Haytko, Peter; Boakye, Ken; Chiu, Mark L; Jiang, Haiyan

    2016-05-01

    Bispecific antibody generation is actively pursued for therapeutic and research antibody development. Although there are multiple strategies for generating bispecific antibodies (bsAbs); the common challenge is to develop a scalable method to prepare bsAbs with high purity and yield. The controlled Fab-arm exchange (cFAE) method combines two parental monoclonal antibodies (mAbs), each with a matched point mutation, F405L and K409R in the respective CH3 domains. The conventional process employs two steps: the purification of two parental mAbs from culture supernatants followed by cFAE. Following a reduction/oxidation reaction, the bispecific mAb is formed with greater than 95% heterodimerization efficiency. In this study, cFAE was initiated in culture supernatants expressing the two parental mAbs, thereby eliminating the need to first purify the parental mAbs. The bsAbs formed in culture supernatant was then purified using a Protein A affinity chromatography. The BsAbs generated in this manner had efficiency comparable to the conventional method using purified parental mAbs. BsAbs prepared by two different routes showed indistinguishable characteristics by SDS capillary electrophoresis, analytical size exclusion, and cation exchange chromatography. This alternative method significantly shortened timelines and reduced resources required for bsAb generation, providing an improved process with potential benefits in large-scale bsAb preparation, as well as for HTP small-scale bsAb matrix selection. PMID:26826313

  5. Supernatant of Bone Marrow Mesenchymal Stromal Cells Induces Peripheral Blood Mononuclear Cells Possessing Mesenchymal Features

    OpenAIRE

    Hu, Gang; Xu, Jun-jun; Deng, Zhi-Hong; Feng, Jie; Jin, Yan

    2011-01-01

    Increasing evidence shows that some cells from peripheral blood fibroblast-like mononuclear cells have the capacity to differentiate into mesenchymal lineages. However, the insufficiency of these cells in the circulation challenges the cell isolation and subsequently limits the clinical application of these cells. In the present study, the peripheral blood mononuclear cells (pbMNCs) were isolated from wound animals and treated with the supernatant of bone marrow mesenchymal stromal cells (bmM...

  6. [Regulation of endothelial cells functions by ultrasonic supernatant of Streptococcus pyogenes].

    Science.gov (United States)

    Starikova, É A; Lebedeva, A M; Burova, L A; Freĭdlin, I S

    2012-01-01

    Angiogenesis and vascular remodeling are vital components of inflammation. As an inflammation evolves, vessels expand to supply nutrients and inflammatory mediators, sustaining the accumulation of activated immune cells in the affected tissues. This study demonstrates that ultrasonic supernatant of Streptoccocus pyogenes has anti-angiogenic properties: inhibit EA.hy 926 human endothelial cells metabolism, adhesion, migration, proliferation. At the same time Streptococcal components inhibit signaling pathways that involve FAK and ERK1/2. These effects are not associated with necrosis or apoptosis in cell culture. Taking together, our results suggest that impairing angiogenic function of endothelial cells might contribute to the reduced tissue perfusion, hypoxia, and subsequent regional tissue necrosis caused by Streptococci group A. PMID:22567900

  7. Cell-free fetal DNA in amniotic fluid supernatant for prenatal diagnosis.

    Science.gov (United States)

    Soltani, M; Nemati, M; Maralani, M; Estiar, M A; Andalib, S; Fardiazar, Z; Sakhinia, E

    2016-01-01

    In widespread conviction, amniotic fluid is utilized for prenatal diagnosis. Amniotic fluid supernatant is usually discarded, notwithstanding being a good source of fetal DNA. The aim of the present study was to assess cell-free fetal DNA extracted from amniotic fluid supernatant for application in prenatal diagnosis such as gender determination and early diagnosis of β-thalassemia. Samples of amniotic fluid of 70 pregnant women were collected and went through routine tests along with tests for cell-free fetal DNA from amniotic fluid supernatant. The DNA in the amniotic fluid supernatant was extracted and analyzed for gender determination by PCR and Real-time PCR. ARMS-PCR was applied to test early diagnosis of IVS II-I mutation (common β-thalassemia mutation) and E7V mutation for sickle cell anemia using DNA extracted from the amniotic fluid supernatant. Using the cell-free fetal DNA extracted from the amniotic fluid supernatant, the sensitivity of PCR and Real-time PCR for gender detection was compared with the routine cytogenetic method. The fetus tested for sickle cell anemia and β-thalassemia was observed to be healthy but heterozygous for IVS II-I mutation. The findings indicated that cell-free fetal DNA from amniotic fluid supernatant can be a good source of fetal DNA and be used in early prenatal diagnosis since because of its fast and accurate application. Therefore, it would be suggested that the amniotic fluid supernatant's disposal is prevented because if the tests needs to be repeated, cell-free fetal DNA extracted from the amniotic fluid supernatant can be used as an alternative source for prenatal diagnosis. PMID:27188728

  8. Antifungal performance of extracellular chitinases and culture supernatants of Streptomyces galilaeus CFFSUR-B12 against Mycosphaerella fijiensis Morelet.

    Science.gov (United States)

    Castillo, Benjamín Moreno; Dunn, Michael F; Navarro, Karina Guillén; Meléndez, Francisco Holguín; Ortiz, Magdalena Hernández; Guevara, Sergio Encarnación; Palacios, Graciela Huerta

    2016-03-01

    The tropical and mycoparasite strain Streptomyces galilaeus CFFSUR-B12 was evaluated as an antagonist of Mycosphaerella fijiensis Morelet, causal agent of the Black Sigatoka Disease (BSD) of banana. On zymograms of CFFSUR-B12 culture supernatants, we detected four chitinases of approximately 32 kDa (Chi32), 20 kDa (Chi20), and two with masses well over 170 kDa (ChiU) that showed little migration during denaturing electrophoresis at different concentrations of polyacrylamide. The thymol-sulphuric acid assay showed that the ChiU were glycosylated chitinases. Moreover, matrix assisted laser desorption ionization time-of-flight MS analysis revealed that the ChiU are the same protein and identical to a family 18 chitinase from Streptomyces sp. S4 (gi|498328075). Chi32 was similar to an extracellular protein from Streptomyces albus J1074 (gi|478687481) and Chi20 was non-significantly similar to chitinases from five different strains of Streptomyces (P > 0.05). Subsequently, Chi32 and Chi20 were partially purified by anion exchange and hydrophobic interaction chromatography and tested against M. fijiensis. Chitinases failed to inhibit ascospore germination, but inhibited up to 35 and 62 % of germ tube elongation and mycelial growth, respectively. We found that crude culture supernatant and living cells of S. galilaeus CFFSUR-B12 were the most effective in inhibiting M. fijiensis and are potential biocontrol agents of BSD. PMID:26873555

  9. Effect of Culture Supernatant Derived from Trichophyton Rubrum Grown in the Nail Medium on the Innate Immunity-related Molecules of HaCaT

    Directory of Open Access Journals (Sweden)

    Xin-Zhu Huang

    2015-01-01

    Full Text Available Background: Trichophyton rubrum is superficial fungi characteristically confined to dead keratinized tissues. These observations suggest that the soluble components released by the fungus could influence the host immune response in a cell in contact-free manner. Therefore, this research aimed to analyze whether the culture supernatant derived from T. rubrum grown in the nail medium could elicit the immune response of keratinocyte effectively. Methods: The culture supernatants of two strains (T1a, T XHB were compared for the β-glucan concentrations and their capacity to impact the innate immunity of keratinocytes. The β-glucan concentrations in the supernatants were determined with the fungal G-test kit and protein concentrations with bicinchoninic acid protein quantitative method, then HaCaT was stimulated with different concentrations of culture supernatants by adopting morphological method to select a suitable dosage. Expressions of host defense genes were assessed by quantitative polymerase chain reaction after the HaCaT was stimulated with the culture supernatants. Data were analyzed with one-way analysis of variance, followed by the least significant difference test. Results: The T. rubrum strains (T1a and T XHB released β-glucan of 87.530 ± 37.581 pg/ml and 15.747 ± 6.453 pg/ml, respectively into the media. The messenger RNA (mRNA expressions of toll-like receptor-2 (TLR2, TLR4, and CARD9 were moderately up-regulated in HaCaT within 6-h applications of both supernatants. HaCaT cells were more responsive to T1a than T XHB . The slight increase of dendritic cells-specific intercellular adhesion molecule 3-grabbing nonintegrin expression was faster and stronger, induced by T1a supernatant than T XHB . The moderate decreases of RNase 7, the slight up-regulations of Dectin-1 and interleukin-8 at the mRNA level were detected only in response to T1a rather than T XHB . After a long-time contact, all the elevated defense genes decreased after

  10. Beneficial effects of BV2 cell on proliferation and neuron-differentiating of mesenchymal stem cells in the circumstance of injured PC12 cell supernatant

    Institute of Scientific and Technical Information of China (English)

    Xiao-Guang LUO; Hong WANG; Jin ZHOU; Rong YAN; Zhe WU; Chao-Dong ZHANG; Qiu-Shuang WANG

    2006-01-01

    Objective The microglias is the representative of immune cells in the brain. It plays dual roles of both repairing and damaging in injured nervous system, and works as an inevitable component of the circumstance of injured neurons. This study was aiming at the effects of the microglias on the biological activities of mesenchymal stem cells (MSCs) inthe circumstance of injured neurons. Methods MSCs were obtained by primary culture. We adopted PC12 cells (PC12) and BV2 cells (BV2) to substitute for neurons and microglias, respectively. PC12 were injured by aged Aβ1-40 and the supernatant of the injured PC12 was used to set up the circumstance of injured neurons. Transwells were used for co-culture of BV2 and MSCs, which allowed the independent detection of cells after co-culture. Immunofluorescence was used to identify MSCs and neuron-differentiating cells with CD44 and neuron specific enolase (NSE) staining, respectively. MTT assay was adopted to measure the proliferation. Results In the circumstance of both BV2 presence and injured PC12 supernatant incubation, either the proliferation or the differentiation of MSCs reached the highest, which seemed to be contradictory, but we gave our explanations. With the BV2 co-culture, the proliferation of MSCs tend to be higher, but the neuron-differentiating MSCs were similar to those incubated without BV2 co-culture either in normal or injured in PC12 supernatant. With the incubation of injured PC12 supernatant, the neuron-differentiating cells were significantly higher than that of control (P < 0.05). Conclusion In the circumstance of injured neurons, microlgias tend to promote the MSCs proliferation. Although not helpful in neuron-differentiating, microglias did not exert any negative effect either.

  11. Genome wide transcriptomic analysis identifies pathways affected by the infusion of Clostridium perfringens culture supernatant in the duodenum of broilers in situ.

    Science.gov (United States)

    Athanasiadou, S; Russell, K M; Kaiser, P; Kanellos, T; Burgess, S T G; Mitchell, M; Clutton, E; Naylor, S W; Low, C J; Hutchings, M R; Sparks, N

    2015-06-01

    Clostridium perfringens type A is the main etiological factor for necrotic enteritis, a multifactorial enteric disease that penalizes performance, health, and welfare of poultry. Lack of knowledge of host responses and disease pathogenesis is slowing down progress on developing therapies for disease control. A combined genomewide and targeted gene approach was used to investigate pathways and biological functions affected by the infusion of C. perfringens culture supernatant in the duodenum of broilers in 2 experiments. An in situ isolated loop of duodenum was prepared in anesthetized broilers of 3 wk of age (Exp. 1) and was infused either with crude C. perfringens culture supernatant (n = 7; treated), positive for necrotic enteritis B-like toxin (NetB) as determined by a cytotoxicity assay, or with a control preparation (n = 6; control). Birds were maintained alive for 1 h and then euthanized for tissue recovery. The use of the Affymetrix chicken genome array on RNA samples from loop tissue showed top biological functions affected by culture supernatant infusion included cell morphology, immune cell trafficking, and cell death; pathways affected included death receptor signaling, inflammatory response, and nuclear factor (NF)-κB signaling. In a second in situ study (Exp. 2), broilers were maintained alive for 4 h to monitor temporal expression patterns of targeted genes. Duodenal tissue was removed at 0.5, 1, 2, and 4 h post-infusion with culture supernatant (n = 9) or a control preparation (n = 5) for histology and gene expression analysis. Genes encoding proinflammatory cytokines, such as interferon γ (IFNγ), cell trafficking, such as neuroblastoma 1 (NBL1) and B cell CLL/Lymphoma 6 (BCL6), and cell death, such as Fas cell surface death receptor (FAS) and GTPase IMAP family member 8 (GIMAP8), were differentially expressed in the duodenum of treated and control broilers (P perfringens culture supernatant (NetB positive) infusion resulted in histological and

  12. Long acting β2-agonist and corticosteroid restore airway glandular cell function altered by bacterial supernatant

    Directory of Open Access Journals (Sweden)

    Nawrocki-Raby Béatrice

    2010-01-01

    Full Text Available Abstract Background Staphylococcus aureus releases virulence factors (VF that may impair the innate protective functions of airway cells. The aim of this study was to determine whether a long-acting β2 adrenergic receptor agonist (salmeterol hydroxynaphthoate, Sal combined with a corticosteroid (fluticasone propionate, FP was able to regulate ion content and cytokine expression by airway glandular cells after exposure to S. aureus supernatant. Methods A human airway glandular cell line was incubated with S. aureus supernatant for 1 h and then treated with the combination Sal/FP for 4 h. The expression of actin and CFTR proteins was analyzed by immunofluorescence. Videomicroscopy was used to evaluate chloride secretion and X-ray microanalysis to measure the intracellular ion and water content. The pro-inflammatory cytokine expression was assessed by RT-PCR and ELISA. Results When the cells were incubated with S. aureus supernatant and then with Sal/FP, the cellular localisation of CFTR was apical compared to the cytoplasmic localisation in cells incubated with S. aureus supernatant alone. The incubation of airway epithelial cells with S. aureus supernatant reduced by 66% the chloride efflux that was fully restored by Sal/FP treatment. We also observed that Sal/FP treatment induced the restoration of ion (Cl and S and water content within the intracellular secretory granules of airway glandular cells and reduced the bacterial supernatant-dependent increase of pro-inflammatory cytokines IL8 and TNFα. Conclusions Our results demonstrate that treatment with the combination of a corticosteroid and a long-acting β2 adrenergic receptor agonist after bacterial infection restores the airway glandular cell function. Abnormal mucus induced by defective ion transport during pulmonary infection could benefit from treatment with a combination of β2 adrenergic receptor agonist and glucocorticoid.

  13. Applications of Lactobacillus rhamnosus Spent Culture Supernatant in Cosmetic Antioxidation, Whitening and Moisture Retention Applications

    Directory of Open Access Journals (Sweden)

    Cheng-Chih Tsai

    2013-11-01

    Full Text Available This study was aimed at investigating the antioxidant, whitening, and moisture-retention properties of Lactobacillus rhamnosus spent culture supernatant (Lr-SCS in cosmetic applications. Results reveal that Lr-SCS effectively and gradually scavenges 1,1-diphenyl-2-picrylhydrazyl as well as 2,2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid radical cations, and increases reducing power in a dose-dependent manner. Additionally, Lr-SCS can also suppress tyrosinase activity in vitro and effectively promote moisture retention. Heat treatment at 100 °C for 30 min does not influence the functions of Lr-SCS. We conclude that Lr-SCS can be used effectively in skin care cosmetics.

  14. Effect of Culture Supernatant Derived from Trichophyton Rubrum Grown in the Nail Medium on the Innate Immunity-related Molecules of HaCaT

    Institute of Scientific and Technical Information of China (English)

    Xin-Zhu Huang; Pan-Pan Liang; Han Ma; Jin-Ling Yi; Song-Chao Yin; Zhi-Rui Chen; Mei-Rong Li

    2015-01-01

    Background: Trichophyton rubrum is superficial fungi characteristically confined to dead keratinized tissues.These observations suggest that the soluble components released by the fungus could influence the host immune response in a cell in contact-free manner.Therefore,this research aimed to analyze whether the culture supematant derived from T.rubrum grown in the nail medium could elicit the immune response of keratinocyte effectively.Methods: The culture supematants of two strains (T1a, TXHB) were compared for the β-glucan concentrations and their capacity to impact the innate immunity of keratinocytes.The β-glucan concentrations in the supernatants were determined with the fungal G-test kit and protein concentrations with bicinchoninic acid protein quantitative method, then HaCaT was stimulated with different concentrations of culture supernatants by adopting morphological method to select a suitable dosage.Expressions of host defense genes were assessed by quantitative polymerase chain reaction after the HaCaT was stimulated with the culture supernatants.Data were analyzed with one-way analysis of variance, followed by the least significant difference test.Results: The T.rubrum strains (T1 a and TXHB) released β-glucan of 87.530 ± 37.581 pg/ml and 15.747 ± 6.453 pg/ml, respectively into the media.The messenger RNA (mRNA) expressions of toll-like receptor-2 (TLR2), TLR4, and CARD9 were moderately up-regulated in HaCaT within 6-h applications of both supernatants.HaCaT cells were more responsive to T1 a than TXHB.The slight increase of dendritic cells-specific intercellular adhesion molecule 3-grabbing nonintegrin expression was faster and stronger, induced by T1 a supernatant than TXHB.The moderate decreases of RNase 7, the slight up-regulations of Dectin-1 and interleukin-8 at the mRNA level were detected only in response to T1a rather than TXHB.After a long-time contact, all the elevated defense genes decreased after 24 h.Conclusion: The culture

  15. Supernatant of Bone Marrow Mesenchymal Stromal Cells Induces Peripheral Blood Mononuclear Cells Possessing Mesenchymal Features

    Directory of Open Access Journals (Sweden)

    Gang Hu, Jun-jun Xu, Zhi-hong Deng, Jie Feng, Yan Jin

    2011-01-01

    Full Text Available Increasing evidence shows that some cells from peripheral blood fibroblast-like mononuclear cells have the capacity to differentiate into mesenchymal lineages. However, the insufficiency of these cells in the circulation challenges the cell isolation and subsequently limits the clinical application of these cells. In the present study, the peripheral blood mononuclear cells (pbMNCs were isolated from wound animals and treated with the supernatant of bone marrow mesenchymal stromal cells (bmMSCs. Results showed these pbMNCs were fibroblast-like, had stromal morphology, were negative for CD34 and CD45, but positive for Vimentin and Collagen I, and had the multipotency to differentiate into adipocytes and osteoblasts. We named these induced peripheral blood-derived mesenchymal stromal cells (ipbMSCs. Skin grafts in combination with ipbMSCs and collagen I were applied for wound healing, and results revealed ipbMSC exhibited similar potency and effectiveness in the promotion of wound healing to the bmMSCs. Hereafter, we speculate that the mixture of growth factors and chemokines secreted by bmMSCs may play an important roles in the induction of the proliferation and mesenchymal differentiation of mononuclear cells. Our results are clinically relevant because it provide a new method for the acquisition of MSCs which can be used as a candidate for the wound repair.

  16. Identification of specific metabolites in culture supernatant of Mycobacterium tuberculosis using metabolomics: exploration of potential biomarkers.

    Science.gov (United States)

    Lau, Susanna K P; Lam, Ching-Wan; Curreem, Shirly O T; Lee, Kim-Chung; Lau, Candy C Y; Chow, Wang-Ngai; Ngan, Antonio H Y; To, Kelvin K W; Chan, Jasper F W; Hung, Ivan F N; Yam, Wing-Cheong; Yuen, Kwok-Yung; Woo, Patrick C Y

    2015-01-01

    Although previous studies have reported the use of metabolomics for Mycobacterium species differentiation, little is known about the potential of extracellular metabolites of Mycobacterium tuberculosis (MTB) as specific biomarkers. Using an optimized ultrahigh performance liquid chromatography-electrospray ionization-quadruple time of flight-mass spectrometry (UHPLC-ESI-Q-TOF-MS) platform, we characterized the extracellular metabolomes of culture supernatant of nine MTB strains and nine non-tuberculous Mycobacterium (NTM) strains (four M. avium complex, one M. bovis Bacillus Calmette-Guérin (BCG), one M. chelonae, one M. fortuitum and two M. kansasii). Principal component analysis readily distinguished the metabolomes between MTB and NTM. Using multivariate and univariate analysis, 24 metabolites with significantly higher levels in MTB were identified. While seven metabolites were identified by tandem mass spectrometry (MS/MS), the other 17 metabolites were unidentified by MS/MS against database matching, suggesting that they may be potentially novel compounds. One metabolite was identified as dexpanthenol, the alcohol analog of pantothenic acid (vitamin B5), which was not known to be produced by bacteria previously. Four metabolites were identified as 1-tuberculosinyladenosine (1-TbAd), a product of the virulence-associated enzyme Rv3378c, and three previously undescribed derivatives of 1-TbAd. Two derivatives differ from 1-TbAd by the ribose group of the nucleoside while the other likely differs by the base. The remaining two metabolites were identified as a tetrapeptide, Val-His-Glu-His, and a monoacylglycerophosphoglycerol, phosphatidylglycerol (PG) (16∶0/0∶0), respectively. Further studies on the chemical structure and biosynthetic pathway of these MTB-specific metabolites would help understand their biological functions. Studies on clinical samples from tuberculosis patients are required to explore for their potential role as diagnostic biomarkers. PMID

  17. In vitro reactivity of Cymbidium hybridum L. protocorms, on bistratified culture media, using various supernatant sucroses solution

    Directory of Open Access Journals (Sweden)

    Lucia MIHALESCU

    2009-05-01

    Full Text Available Knowing the fact that the protocorms’ multiplication processes are accelerated in their submersion conditions in liquid medium, against the situation that, these protocorms are vitrocultivated on solid (agarized medium cultures (which prevails in organogenesis processes, we propose to study the influence exerted by the cultures, practiced in bistratified regime, to Cymbidium protocorms in vitro cultures. In this interest, as supernatant we used bidistilled water, either on sucrose, glucose or fructose solutions, in different concentrations, which were applied over the inoculated protocorms on agarized medium cultures. The basic medium culture used by us in these experiments was Murashige – Skoog (1962 [13]. To this, we added different growth regulators, like: 2,4-D (2 mg/l, or mixtures of BA (2 mg/l with NAA (1 mg/l, or only BA (2 mg/l, or only NAA (1 mg/l. The witness lot consisted of vitrocultivated protocorms on agarized medium culture, without growth regulators, cultivated in monolayer.After 90 days from the initiation of the double-layered medium cultures, we ascertained that, the application of the second layer (the liquid one over the agarized medium cultures strongly stimulated the multiplication of Cymbidium protocorms, and mostly if the second layer was bidistilled water; the usage of a 5% glucose solution as supernatant, was the most inefficient procedure, matter the micropropagation of Cymbidium protocorms, regardless the content of growth regulators existing in agarized layer of medium cultures.

  18. Putative new heat-stable cytotoxic and enterotoxic factors in culture supernatant of Escherichia coli isolated from drinking water

    Directory of Open Access Journals (Sweden)

    DA Ribeiro

    2011-01-01

    Full Text Available Enteric infections caused by the ingestion of contaminated water, especially by Escherichia coli, are important to define the virulence properties of these bacteria. Due to frequent infantile diarrhea in the city of Ouro Preto, Minas Gerais state, Brazil, the phenotypic and genotypic diarrheagenic properties of E. coli isolated from drinking water were studied. The culture supernatants of 39 (40% among a total of 97 E. coli isolates from drinking water were positive by suckling mouse assay and induced cytotoxic effects on Vero cells. The enterotoxic and cytotoxic activities were present in the fraction with less than 10 kDa and were not lost when heated up to 60°C and 100°C for 30 minutes. PCR assays showed that among these 39 Vero cytotoxigenic E. coli, four (10.2% were positive for ST II (estB and two (5% positive for αHly (hlyA. Gene amplification of SLT (stx 1, stx 2, ST I (estA, LT (eltI, eltII, EAST1 (astA, EHly (enhly and plasmid-encoded enterotoxin (pet were not observed. This heat-stable cytotoxic enterotoxin of E. coli is probably a new putative diarrheagenic virulence factor, as a toxin presenting these characteristics has not yet been described.

  19. Inhibition of Candida albicans biofilm formation and modulation of gene expression by probiotic cells and supernatant.

    Science.gov (United States)

    James, K M; MacDonald, K W; Chanyi, R M; Cadieux, P A; Burton, J P

    2016-04-01

    Oral candidiasis is a disease caused by opportunistic species of Candida that normally reside on human mucosal surfaces. The transition of Candida from budding yeast to filamentous hyphae allows for covalent attachment to oral epithelial cells, followed by biofilm formation, invasion and tissue damage. In this study, combinations of Lactobacillus plantarum SD5870, Lactobacillus helveticus CBS N116411 and Streptococcus salivarius DSM 14685 were assessed for their ability to inhibit the formation of and disrupt Candida albicans biofilms. Co-incubation with probiotic supernatants under hyphae-inducing conditions reduced C. albicans biofilm formation by >75 % in all treatment groups. Likewise, combinations of live probiotics reduced biofilm formation of C. albicans by >67 %. When live probiotics or their supernatants were overlaid on preformed C. albicans biofilms, biofilm size was reduced by >63 and >65 % respectively. Quantitative real-time PCR results indicated that the combined supernatants of SD5870 and CBS N116411 significantly reduced the expression of several C. albicans genes involved in the yeast-hyphae transition: ALS3 (adhesin/invasin) by 70 % (P biofilm formation) by >99 % (P removing preformed C. albicans biofilms. Our novel results point to the downregulation of several Candida genes critical to the yeast-hyphae transition, biofilm formation, tissue invasion and cellular damage. PMID:26847045

  20. Thermal treatment enhances the stability and biological activity of a truncated tilapia somatotropin contained in Pichia pastoris culture supernatant.

    Science.gov (United States)

    Acosta, Jannel; Ruiz, Odalys; Carpio, Yamila; Morales, Reynold; Aguila, Julio C; Valdés, Jorge; Martínez, Eduardo; Estrada, Mario P

    2011-01-20

    The importance of somatotropin as a growth promoting agent and immune-stimulator has long been recognized and its potential application in the fish farming industry has been an active research area. In the work reported here, we sought to improve the stability of a previously obtained truncated somatotropin by applying a 60 °C heat shock to the culture supernatant containing this molecule, and then compared its effects with and without heat shock on larval growth and immune functions. We observed that the treatment with heat shock at 60 °C enhanced protein stability, growth and innate immune functions in tilapia larvae. PMID:21112358

  1. Lipopolysaccharide-Induced Profiles of Cytokine, Chemokine, and Growth Factors Produced by Human Decidual Cells Are Altered by Lactobacillus rhamnosus GR-1 Supernatant

    OpenAIRE

    Li, Wei; Yang, Siwen; Kim, Sung O.; Reid, Gregor; Challis, John R. G.; Bocking, Alan D.

    2014-01-01

    The aim of this study was to assess the effects of bacterial lipopolysaccharide (LPS) and Lactobacillus rhamnosus GR-1 supernatant (GR-1SN) on secretion profiles of cytokines, chemokines, and growth factors from primary cultures of human decidual cells. Lipopolysaccharide significantly increased the output of proinflammatory cytokines (interleukin [IL]-1B, IL-2, IL-6, IL-12p70, IL-15, IL-17A, interferon gamma [IFN-γ], and tumor necrosis factor [TNF]); anti-inflammatory cytokines (IL-1RN, IL-4...

  2. Detection of interleukin-10 and transforming growth factor-β1 in the culture supernatant of CD4+CD25+ T cells from patients with alopecia areata%斑秃患者外周血CD4+CD25+T细胞培养上清液白介素10和转化生长因子β1检测

    Institute of Scientific and Technical Information of China (English)

    马新华; 邵文俊; 金宛宛; 高宇

    2014-01-01

    Objective To evaluate the potential association of CD4+CD25+ T cells with alopecia areata.Methods Totally,this study enrolled 23 patients with progressive alopecia areata,25 patients with stable alopecia areata,and 25 healthy controls.Peripheral blood was isolated from these subjects followed by isolation of CD4+ CD25+ regulatory T cells,which were then cuhured with the presence of anti-CD3 and-CD28 monoclonal antibodies for four days.Subsequently,enzyme-linked immunosorbent assay was performed to measure the levels of interleukin (IL)-10 and transforming growth factor (TGF)-β1 in the culture supematant of these T cells.Results The levels of IL-10 and TGF-β1 were (31.68 ± 6.78) pg/ml and (32.29 ± 6.8) pg/ml respectively in the culture supernatant of CD4+CD25+ regulatory T cells from patients with progressive alopecia areata,significantly lower than those from the healthy controls ((57.34 ± 14.15) pg/ml and (57.43 ± 15.16) pg/ml,both P < 0.05) and patients with stable alopecia areata ((52.56 ± 13.02) pg/ml and (61.75 ± 14.10) pg/ml,both P < 0.05).However,no significant difference was observed in the supernatant levels of IL-10 or TGF-β1 between the healthy controls and patients with stable alopecia areata.Conclusions The secretion of IL-10 and TGF-β1 by CD4+CD25+ T cells is decreased in patients with progressive alopecia areata,which may contribute to the pathogenesis of alopecia areata.%目的 探讨CD4+CD25+T细胞与斑秃发病之间的关系.方法 收集了3组研究对象,其中健康对照组25例、稳定期斑秃患者25例、进展期斑秃患者23例.抽取所有对象外周血,提取CD4+CD25+T细胞,培养4d,收集培养上清液,ELISA法检测上清液IL-10和TGF-β1水平.结果 进展期斑秃患者外周血CD4+CD25+T细胞培养的IL-10和TGF-β1分别为(31.68±6.78) pg/ml和(32.29±6.80) pg/ml,明显低于健康对照组(57.34±14.15) pg/ml、(57.43±15.16) pg/ml和稳定期斑秃患者(52.56±13.02) pg/ml和(61.75±14.10) pg

  3. The Immunostimulation of F4ac ETEC-Culture Supernatant to Porcine Small Intestinal Epithelial Cells%F4ac型产肠毒素大肠杆菌菌液上清对仔猪小肠上皮细胞的免疫刺激作用

    Institute of Scientific and Technical Information of China (English)

    周传丽; 刘铮铸; 俞英; 张勤

    2014-01-01

    [Objective]Porcine enterotoxigenic Escherichia coli (ETEC) is a worldwide cause of bacteria induced diarrhoea in piglets. In the veterinary practices of pig production, serological identification of ETEC shows that F4ac is the most common serological type expressed in ETEC strains isolated from diarrheic piglets. So far, the mechanism by which ETEC produces diarrhoea in piglets has been clearly elucidated. However, the immunostimulation of ETEC-culture to host target cells has not been studied or described. In the present study, the immunostimulation of the supernatant of F4ac ETEC-culture to IPEC-J2 cells was studied.[Method]The culture of F4ac ETEC strain 200 was collected and centrifuged (4℃, 4 000 r/min for 15 min) after 12 hours in culture, and the supernatant was sterilized by passing it through a 0.22μm filter. The solution combined the sterilized supernatant with equivalent DMEM/F12 medium was used to challenge IPEC-J2 cells for 3 hours. The IPEC-J2 cells co-cultured with fresh LB medium and equivalent DMEM/F12 medium were as the control group. For both treatments, each experiment was repeated three times. Total RNAs of the stimulated and control IPEC-J2 cells were extracted using TRIZOL Reagent following the manufacturer’s instructions. According to the manufacturer’s instructions, complementary DNA (cDNA) was synthesized from RNA using the Prime Script® RT reagent Kit with gDNA Eraser (Perfect Real Time). The cDNA samples were then analyzed with real time RT-PCR using a LightCycler® 480 Real-Time PCR System. The real time RT-PCR reactions were performed in a final volume of 20μL with the Roche SYBR Green PCR Kit according to the manufacturer’s instructions. The pig house-keeping gene β-actin was used as the internal standards to correct the input of cDNA. Triplicate qRT-PCRs were performed on each cDNA and the average Ct was used for further analysis. The relative quantification values were calculated using the 2-ΔΔCt. Differential m

  4. Comprehensive supernatant treatment

    Energy Technology Data Exchange (ETDEWEB)

    Egan, Z. [Oak Ridge National Lab., TN (United States)

    1996-10-01

    This task involves testing of sorbent materials for removing cesium, strontium, and technetium from the saline solutions in DOE storage tank supernatant at Oak Ridge and other sites. Staff at Oak Ridge National Laboratory (ORNL) are recovering and treating the liquid (supernatant) portions of Melton Valley Storage Tank (MVST) waste in a hot cell to separate and remove the radionuclides. Batch tests will be used to evaluate and select the most promising materials for supernatant treatment to reduce the amount of waste for final disposal. Small column tests will be made on selected sorbents to verify the batch data and to obtain additional data for process design. Efforts will be made to obtain samples of tank supernatant from Hanford for comparison.

  5. Biological synthesis of very small silver nanoparticles by culture supernatant of Klebsiella pneumonia: The effects of visible-light irradiation and the liquid mixing process

    International Nuclear Information System (INIS)

    This study has investigated different visible-light irradiation's effect on the formation of silver nanoparticles from silver nitrate using the culture supernatant of Klebsiella pneumonia. Our study shows that visible-light emission can significantly prompt the synthesis of silver nanoparticles. Also, the study experimentally investigated the liquid mixing process effect on silver nanoparticle synthesis by visible-light irradiation. This study successfully synthesized uniformly dispersed silver nanoparticles with a uniform size and shape in the range of 1-6 nm with an average size of 3 nm. Furthermore, the study investigated the mechanism of the reduction of silver ions by culture supernatant of K. pneumonia, and used X-ray diffraction to characterize silver chloride as an intermediate compound. Silver chloride was prepared synthetically and used as a substrate for the synthesis of silver nanoparticles by culture supernatant of K. pneumonia. The silver nanoparticles have been prepared from silver chloride during this investigation for the first time.

  6. Antimicrobial Activity of Cell Free Supernatant of Irradiated Lactic Acid Bacteria Isolates

    International Nuclear Information System (INIS)

    Attempts were made to isolate bio preservatives using food wastes with no value and low cost. Whey is the raw material achieved that value. Whey and many other food wastes are used in our study to isolate Lactic acid bacteria (LAB). Cell free supernatants (CFS) of isolates are used to evaluate their antimicrobial activity against indicator pathogenic bacterial strains. CFS-9 isolate from whey has the highest inhibitory activity compared to all other isolates. The inhibitory activity of CFS-9, Nisin (400 IU / ml) and the standard Lactococcus Lactis Subsp. Lactis ATCC 11454 (Lacto) were determined. Furthermore, isolate-9 and Lacto strains were exposed to irradiation at different doses. The inhibition zones of; control isolate-9 (non-irradiated) showed the highest values against all indicator strains, CFS of irradiated Lacto at dose 250 Gy was the highest value against Bacillus cereus and Escherichia coli compared to other irradiation treatments, CFS of irradiated Lacto at dose 100 Gy was the highest value against Staph aureus, while the inhibition zone was in the highest value in CFS of irradiated Lacto at dose 500 Gy against Salmonella typhimurium. Nisin (400 IU / ml) was significantly higher than all CFS of irradiated isolate-9 while, the inhibition zones of all CFS-Lacto (irradiated and nonirradiated) are better and higher than nisin-400

  7. Peroxynitrite decomposition catalyst prevents apoptotic cell death in a human astrocytoma cell line incubated with supernatants of HIV-infected macrophages

    Directory of Open Access Journals (Sweden)

    Perno Carlo

    2002-09-01

    Full Text Available Abstract Background Oxidative stress has shown to contribute in the mechanisms underlying apoptotic cell death occuring in AIDS-dementia complex. Here we investigated the role of peroxynitrite in apoptosis occurring in astroglial cells incubated with supernatants of HIV-infected human primary macrophages (M/M. Results Flow cytometric analysis (FACS of human cultured astrocytes shortly incubated with HIV-1-infected M/M supernatants showed apoptotic cell death, an effect accompanied by pronounced staining for nitrotyrosine (footprint of peroxynitrite and by abnormal formation of malondialdehyde (MDA. Pretreatment of astrocytes with the peroxynitrite decomposition catalyst FeTMPS antagonized HIV-related astrocytic apoptosis, MDA formation and nitrotyrosine staining. Conclusions Taken together, our results suggest that inibition of peroxynitrite leads to protection against peroxidative stress accompanying HIV-related apoptosis of astrocytes. Overall results support the role of peroxynitrite in HIV-related programmed death of astrocytes and suggest the use of peroxynitrite decomposition catalyst to counteract HIV-1-related neurological disorders.

  8. Supernatant of Bifidobacterium breve induces dendritic cell maturation, activation, and survival through a Toll-like receptor 2 pathway

    OpenAIRE

    Hoarau, Cyrille; Lagaraine, Christine; Martin, Laurence; Velge-Roussel, Florence; Lebranchu, Yvon

    2006-01-01

    International audience Background: Commensal gut bacteria are essential for the development and maintenance of the gut's immune system. Some bacteria strains, such as Lactobacillus and Bifidobacterium species, have been reported to provide protection from allergic and inflammatory bowel diseases. However, the interactions between these commensal bacteria and the immune system are largely unknown. Objective: We studied the effects of a supernatant from the culture of B breve C50 (BbC50) on ...

  9. Quantitative Determination of Lethal Toxin Proteins in Culture Supernatant of Human Live Anthrax Vaccine Bacillus anthracis A16R.

    Science.gov (United States)

    Zai, Xiaodong; Zhang, Jun; Liu, Ju; Liu, Jie; Li, Liangliang; Yin, Ying; Fu, Ling; Xu, Junjie; Chen, Wei

    2016-03-01

    Bacillus anthracis (B. anthracis) is the etiological agent of anthrax affecting both humans and animals. Anthrax toxin (AT) plays a major role in pathogenesis. It includes lethal toxin (LT) and edema toxin (ET), which are formed by the combination of protective antigen (PA) and lethal factor (LF) or edema factor (EF), respectively. The currently used human anthrax vaccine in China utilizes live-attenuated B. anthracis spores (A16R; pXO1+, pXO2-) that produce anthrax toxin but cannot produce the capsule. Anthrax toxins, especially LT, have key effects on both the immunogenicity and toxicity of human anthrax vaccines. Thus, determining quantities and biological activities of LT proteins expressed by the A16R strain is meaningful. Here, we explored LT expression patterns of the A16R strain in culture conditions using another vaccine strain Sterne as a control. We developed a sandwich ELISA and cytotoxicity-based method for quantitative detection of PA and LF. Expression and degradation of LT proteins were observed in culture supernatants over time. Additionally, LT proteins expressed by the A16R and Sterne strains were found to be monomeric and showed cytotoxic activity, which may be the main reason for side effects of live anthrax vaccines. Our work facilitates the characterization of anthrax vaccines components and establishment of a quality control standard for vaccine production which may ultimately help to ensure the efficacy and safety of the human anthrax vaccine A16R. PMID:26927174

  10. Activated platelet supernatant can augment the angiogenic potential of human peripheral blood stem cells mobilized from bone marrow by G-CSF.

    Science.gov (United States)

    Kang, Jeehoon; Hur, Jin; Kang, Jin-A; Yun, Ji-Yeon; Choi, Jae-Il; Ko, Seung Bum; Lee, Choon-Soo; Lee, Jaewon; Han, Jung-Kyu; Kim, Hyun Kyung; Kim, Hyo-Soo

    2014-10-01

    Platelets not only play a role in hemostasis, but they also promote angiogenesis and tissue recovery by releasing various cytokines and making an angiogenic milieu. Here, we examined autologous 'activated platelet supernatant (APS)' as a priming agent for stem cells; thereby enhance their pro-angiogenic potential and efficacy of stem cell-based therapy for ischemic diseases. The mobilized peripheral blood stem cells ((mob)PBSCs) were isolated from healthy volunteers after subcutaneous injection of granulocyte-colony stimulating factor. APS was collected separately from the platelet rich plasma after activation by thrombin. (mob)PBSCs were primed for 6h before analysis. Compared to naive platelet supernatants, APS had a higher level of various cytokines, such as IL8, IL17, PDGF and VEGF. APS-priming for 6h induced (mob)PBSCs to express key angiogenic factors, surface markers (i.e. CD34, CD31, and CXCR4) and integrins (integrins α5, β1 and β2). Also (mob)PBSCs were polarized toward CD14(++)/CD16(+) pro-angiogenic monocytes. The priming effect was reproduced by an in vitro reconstruction of APS. Through this phenotype, APS-priming increased cell-cell adhesion and cell-extracellular matrix adhesion. The culture supernatant of APS-primed (mob)PBSCs contained high levels of IL8, IL10, IL17 and TNFα, and augmented proliferation and capillary network formation of human umbilical vein endothelial cells. In vivo transplantation of APS-primed (mob)PBSCs into athymic mice ischemic hindlimbs and Matrigel plugs elicited vessel differentiation and tissue repair. In safety analysis, platelet activity increased after mixing with (mob)PBSCs regardless of priming, which was normalized by aspirin treatment. Collectively, our data identify that APS-priming can enhance the angiogenic potential of (mob)PBSCs, which can be used as an adjunctive strategy to improve the efficacy of cell therapy for ischemic diseases. PMID:25016235

  11. Repression of the locus of the enterocyte effacement-encoded regulator of gene transcription of Escherichia coli O157:H7 by Lactobacillus reuteri culture supernatants is LuxS and strain dependent.

    Science.gov (United States)

    Jelcić, Ivan; Hüfner, Eric; Schmidt, Herbert; Hertel, Christian

    2008-05-01

    Culture supernatants of Lactobacillus reuteri ATCC 55730 repressed ler expression in Escherichia coli O157:H7 cells, but neither the strain's isogenic luxS mutant nor the L. reuteri 100-23C wild-type strain and its luxS mutant elicited a comparable effect. Furthermore, the epinephrine-mediated induction of ler expression was repressed by secreted substance(s) of L. reuteri ATCC 55730. PMID:18378666

  12. Repression of the Locus of the Enterocyte Effacement-Encoded Regulator of Gene Transcription of Escherichia coli O157:H7 by Lactobacillus reuteri Culture Supernatants Is LuxS and Strain Dependent▿

    OpenAIRE

    Jelčić, Ivan; Hüfner, Eric; Schmidt, Herbert; Hertel, Christian

    2008-01-01

    Culture supernatants of Lactobacillus reuteri ATCC 55730 repressed ler expression in Escherichia coli O157:H7 cells, but neither the strain's isogenic luxS mutant nor the L. reuteri 100-23C wild-type strain and its luxS mutant elicited a comparable effect. Furthermore, the epinephrine-mediated induction of ler expression was repressed by secreted substance(s) of L. reuteri ATCC 55730.

  13. Comparison of DOT-ELISA and Standard-ELISA for Detection of the Vibrio cholerae Toxin in Culture Supernatants of Bacteria Isolated from Human and Environmental Samples.

    Science.gov (United States)

    Meza-Lucas, Antonio; Pérez-Villagómez, María-Fernanda; Martínez-López, José-Patricio; García-Rodea, Ricardo; Martínez-Castelán, María-Guadalupe; Escobar-Gutiérrez, Alejandro; de-la-Rosa-Arana, Jorge-Luis; Villanueva-Zamudio, Altagracia

    2016-09-01

    A comparison of DOT-ELISA and Standard-ELISA was made for detection of Vibrio cholerae toxin in culture supernatants of bacteria isolated from human and environmental samples. A total of 293 supernatants were tested in a double blind assay. A correlation of 100 % was obtained between both techniques. The cholera toxin was found in 20 Inaba and 3 Ogawa strains. Positive samples were from seafood (17 samples), potable water (1 sample) and sewage (5 samples). The DOT-ELISA was useful as the standard-ELISA to confirm the presence of cholera toxin in the environmental samples. PMID:27407304

  14. Genetic susceptibility to S. aureus mastitis in sheep: differential expression of mammary epithelial cells in response to live bacteria or supernatant.

    Science.gov (United States)

    Bonnefont, Cécile M D; Rainard, Pascal; Cunha, Patricia; Gilbert, Florence B; Toufeer, Mehdi; Aurel, Marie-Rose; Rupp, Rachel; Foucras, Gilles

    2012-04-01

    Staphylococcus aureus is a prevalent pathogen for mastitis in dairy ruminants and is responsible for both clinical and subclinical mastitis. Mammary epithelial cells (MEC) represent not only a physical barrier against bacterial invasion but are also active players of the innate immune response permitting infection clearance. To decipher their functions in general and in animals showing different levels of genetic predisposition to Staphylococcus in particular, MEC from ewes undergoing a divergent selection on milk somatic cell count were stimulated by S. aureus. MEC response was also studied according to the stimulation condition with live bacteria or culture supernatant. The early MEC response was studied during a 5 h time course by microarray to identify differentially expressed genes with regard to the host genetic background and as a function of the conditions of stimulation. In both conditions of stimulation, metabolic processes were altered, the apoptosis-associated pathways were considerably modified, and inflammatory and immune responses were enhanced with the upregulation of il1a, il1b, and tnfa and several chemokines known to enhance neutrophil (cxcl8) or mononuclear leukocyte (ccl20) recruitment. Genes associated with oxidative stress were increased after live bacteria stimulation, whereas immune response-related genes were higher after supernatant stimulation in the early phase. Only 20 genes were differentially expressed between Staphylococcus spp-mastitis resistant and susceptible animals without any clearly defined role on the control of infection. To conclude, this suggests that MEC may not represent the cell type at the origin of the difference of mastitis susceptibility, at least as demonstrated in our genetic model. Supernatant or heat-killed S. aureus produce biological effects that are essentially different from those induced by live bacteria. PMID:22337903

  15. A rapid solution-phase screening technique for hybridoma culture supernatants using radiolabeled antigen and a solid-phase immunoadsorbent

    International Nuclear Information System (INIS)

    The solid-phase immunoassay commonly used to screen hybridoma supernatants at times gave falsely positive results. A solution-phase screening technique, which uses radiolabeled antigen and a solid-phase immunoadsorbent, is described. This technique overcomes the problem of false positives and can be easily adopted for other soluble antigens. (Auth.)

  16. Culture supernatants from V. cholerae O1 ElTor strains isolated from different geographic areas induce cell vacuolation and cytotoxicity Cepas de V. cholerae O1 biotipo ElTor aisladas de diferente origen geográfico inducen vacuolización celular y citotoxicidad

    Directory of Open Access Journals (Sweden)

    Jorge E Vidal

    2009-02-01

    Full Text Available OBJECTIVE: To investigate whether the HlyA-induced vacuolating effect is produced by V. cholerae O1 ElTor strains isolated from different geographic origins, including Mexico. MATERIAL AND METHODS: Supernatant-induced haemolysis, vacuolating activity and cytotoxicity in Vero cells were recorded. PCR, RFLP analysis and molecular cloning were performed. RESULTS: All ElTor strains analyzed induced cellular vacuolation. Ribotype 2 strains isolates from the U.S. gulf coast yielded the highest titer of vacuolating activity. Eight of nine strains were haemolytic, while all strains were PCR positive for the hlyA gene. We cloned the hlyA gene from two ElTor strains, a toxigenic (2514-88, ctxAB+ and a non-toxigenic Mexican strain (CM 91-3, ctxAB-. Supernatant from those recombinant E. coli strains induced haemolysis, cell vacuolation and cytotoxicity. RFLP-PCR analysis revealed similarities in the hlyA gene from all strains tested. CONCLUSION: The HlyA-induced vacuolating effect is a widespread phenotype of epidemic V. cholerae O1 ElTor strains.OBJETIVO: Analizar el efecto vacuolizante de cepas de V. cholerae O1 ElTor aisladas de diferente origen geográfico, incluyendo México. MATERIAL Y MÉTODOS: Se realizaron pruebas de hemolisis, vacuolización y citotoxicidad en células Vero, así como PCR, análisis por RFLP y clonación molecular. RESULTADOS: Todas las cepas indujeron el efecto vacuolizante. Las cepas del ribotipo 2, aisladas de las costas del Golfo en Estados Unidos, presentaron títulos altos de vacuolización. El gen hlyA fue amplificado en las nueve cepas mediante PCR, aunque sólo ocho fueron hemolíticas. Se clonó el gen hlyA de una cepa toxigénica (2514-88, ctxAB+ y de una cepa no toxigénica aislada en México (CM 91-3, ctxAB-. El sobrenadante de las clonas recombinantes indujo hemólisis, efecto vacuolizante y citotoxicidad. El RFLP mostró alta similitud del gen hlyA de las cepas estudiadas. CONCLUSIÓN: El efecto vacuolizante es un

  17. Performance of multiplex commercial kits to quantify cytokine and chemokine responses in culture supernatants from Plasmodium falciparum stimulations.

    Directory of Open Access Journals (Sweden)

    Gemma Moncunill

    Full Text Available BACKGROUND: Cytokines and chemokines are relevant biomarkers of pathology and immunity to infectious diseases such as malaria. Several commercially available kits based on quantitative suspension array technologies allow the profiling of multiple cytokines and chemokines in small volumes of sample. However, kits are being continuously improved and information on their performance is lacking. METHODOLOGY/PRINCIPAL FINDINGS: Different cytokine/chemokine kits, two flow cytometry-based (eBioscience® FlowCytomix™ and BD™ Cytometric Bead Array Human Enhanced Sensitivity and four Luminex®-based (Invitrogen™ Human Cytokine 25-Plex Panel, Invitrogen™ Human Cytokine Magnetic 30-Plex Panel, Bio-Rad® Bio-Plex Pro™ Human Cytokine Plex Assay and Millipore™ MILLIPLEX® MAP Plex Kit were compared. Samples tested were supernatants of peripheral blood mononuclear cells of malaria-exposed children stimulated with Plasmodium falciparum parasite lysates. Number of responses in range that could be detected was determined and reproducibility of duplicates was evaluated by the Bland-Altman test. Luminex® kits performed better than flow cytometry kits in number of responses in range and reproducibility. Luminex® kits were more reproducible when magnetic beads were used. However, within each methodology overall performance depended on the analyte tested in each kit. Within the Luminex® kits, the Invitrogen™ with polystyrene beads had the poorer performance, whereas Invitrogen™ with magnetic beads had the higher percentage of cytokines/chemokines with both readings in range (40%, followed by Bio-Rad® with magnetic beads (35%. Regarding reproducibility, the Millipore™ kit had the highest percentage (60% of cytokines/chemokines with acceptable limits of agreement (<30%, followed by the Invitrogen™ with magnetic beads (40% that had tighter limits of agreement. CONCLUSIONS/SIGNIFICANCE: Currently available kits for cytokine and chemokine

  18. Human hematopoietic cell culture, transduction, and analyses

    DEFF Research Database (Denmark)

    Bonde, Jesper; Wirthlin, Louisa; Kohn, Donald B;

    2008-01-01

    This unit provides methods for introducing genes into human hematopoietic progenitor cells. The Basic Protocol describes isolation of CD34(+) cells, transduction of these cells with a retroviral vector on fibronectin-coated plates, assaying the efficiency of transduction, and establishing long......-term cultures. Support protocols describe methods for maintenance of vector-producing fibroblasts (VPF) and supernatant collection from these cells, screening medium components for the ability to support hematopoietic cell growth, and establishing colonies from long-term cultures. Other protocols provide PCR...

  19. 骨髓间充质干细胞培养上清液治疗支气管哮喘及对肺部炎症的影响%Culture supernatant of bone marrow mesenchymal stem cells for treatment of bronchial asthma and its influence on lung inflammation

    Institute of Scientific and Technical Information of China (English)

    雷琰; 刘长卿

    2015-01-01

    BACKGROUND:Bronchial asthma is considered general y to have an association with Th2 immune response disease, but there is no ideal treatment. Bone marrow mesenchymal stem cel s as a kind of adult stem cel s not only have the multipotent differentiation and proliferation capacity, but also have low immunogenicity and immunoregulation ability. OBJECTIVE:To investigate the effect of culture supernatant of bone marrow mesenchymal stem cel s on lung inflammation of bronchial asthma mice. METHODS:Twenty experimental mice were randomly divided into control and experimental groups, 10 mice in each group. At 0 and 14 days, intraperitoneal injection of ovalbumin induced sensitization in mice, and at 24-26 days, aerosolized ovalbumin solution was used for excitation. From the 24th day, in the experimental group, bone marrow mesenchymal stem cel supernatant was intraperitoneal y injected at 2 hours before excitation;meanwhile, normal saline was injected in the control group. At the last of excitation, the mice were sacrificed under anesthesia to take serum samples, bronchoalveolar lavage fluid and lung tissues. RESULTS AND CONCLUSION:(1) Mice in the control group appeared to have abnormal lung tissue structure, and there were a large amount of eosinophils and monocytes in the submucosa and muscularis. However, lung inflammation was relieved in the experimental group after bone marrow mesenchymal stem cel treatment. (2) The levels of interleukin-17 in the bronchoalveolar lavage fluid and serum were significantly lower in the experimental group than the control group (P0.05). These findings indicate that the intraperitoneal injection of bone marrow mesenchymal stem cel s can ease lung inflammation and reduce levels of inflammatory markers in the bronchoalveolar lavage fluid and serum of bronchial asthma mice.%背景:医学界普遍认为支气管哮喘是一种与Th2相关的免疫反应疾病,目前尚缺乏理想的治疗方法。骨髓间充质干细胞作为一种成

  20. A novel approach to enhance biological nutrient removal using a culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (Rpf) in SBR process.

    Science.gov (United States)

    Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng

    2016-03-01

    A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations. PMID:26514565

  1. Determining antioxidant activities of lactobacilli cell-free supernatants by cellular antioxidant assay: a comparison with traditional methods.

    Directory of Open Access Journals (Sweden)

    Jiali Xing

    Full Text Available Antioxidant activity of lactic acid bacteria is associated with multiple health-protective effects. Traditional indexes of chemical antioxidant activities poorly reflect the antioxidant effects of these bacteria in vivo. Cellular antioxidant activity (CAA assay was used in this study to determine the antioxidant activity of cell-free supernatants (CFSs of 10 Lactobacillus strains. The performance of the CAA assay was compared with that of four chemical antioxidant activity assays, namely, DPPH radical scavenging, hydroxyl radical scavenging (HRS, reducing power (RP, and inhibition of linoleic acid peroxidation (ILAP. Results of the CAA assay were associated with those of DPPH and ILAP assays, but not with those of RP and HRS assays. The inter- and intra-specific antioxidant activities of CFS were characterized by chemical and CAA assays. L. rhamnosus CCFM 1107 displayed a high antioxidative effect similar to positive control L. rhamnosus GG ATCC 53103 in all of the assays. The CAA assay is a potential method for the detection of antioxidant activities of lactobacilli CFSs.

  2. Inhibition of biofilm development and spoilage potential of Shewanella baltica by quorum sensing signal in cell-free supernatant from Pseudomonas fluorescens.

    Science.gov (United States)

    Zhao, Aifei; Zhu, Junli; Ye, Xiaofeng; Ge, Yangyang; Li, Jianrong

    2016-08-01

    The objective of this study was to in vitro evaluate the effect of a cell-free supernatant (CFS) containing quorum sensing (QS) signal of Pseudomonas fluorescens on the growth, biofilm development and spoilage potential of Shewanella baltica, and preliminarily assess the interactive influences of various chemically synthesized autoinducers on spoilage phenotypes of S. baltica. PF01 strain isolated from spoiled Pseudosciaen crocea was identified P. fluorescens. The addition of 25% and 50% CFS to S. baltica culture had no effect on the growth rate during the lag and exponential phase, however, caused cell decline during the stationary phase. The presence of CFS from P. fluorescens significantly inhibited biofilm development, and greatly decreased the production of trimethylamine (TMA) and biogenic amino in S. baltica. Various signal molecules of QS in the CFS of P. fluorescens culture were detected, including seven N-acyl-l-homoserine lactones (AHLs), autoinducer-2 (AI-2) and two diketopiperazines (DKPs). Exogenous supplement of synthesized seven AHLs containing in the CFS decreased biofilm formation and TMA production in S. baltica, while exposure to exogenous cyclo-(l-Pro-l-Leu) was showed to promote spoilage potential, which revealed that S. baltica also sense the two QS molecules. Furthermore, the stimulating effect of cyclo-(l-Pro-l-Leu) was affected when AHL was simultaneously added, suggesting that the inhibitory activity of spoilage phenotypes in S. baltica might be attributed to a competitive effect of these QS compounds in the CFS of P. fluorescens. The present studies provide a good basis for future research on the role of QS in the regulation of spoilage microbial flora. PMID:27149651

  3. Cell-free translation systems prepared from starfish oocytes faithfully reflect in vivo activity; mRNA and initiation factors stimulate supernatants from immature oocytes.

    OpenAIRE

    Xu, Z.; Hille, M B

    1990-01-01

    Meiotic maturation stimulates a change in the translation of stored mRNAs: mRNAs encoding proteins needed for growth of oocytes are translated before meiotic maturation, whereas those encoding proteins required for cleavage are translated after meiotic maturation. Studies of translational regulation during meiotic maturation have been limited by the lack of translationally active cell-free supernatants. Starfish oocytes are ideal for preparing cell-free translation systems because experimenta...

  4. Discovery of Novel Secreted Virulence Factors from Salmonella enterica Serovar Typhimurium by Proteomic Analysis of Culture Supernatants

    Energy Technology Data Exchange (ETDEWEB)

    Niemann, George; Brown, Roslyn N.; Gustin, Jean K.; Stufkens, Afke; Shaikh-Kidwai, Afshan S.; Li, Jie; McDermott, Jason E.; Brewer, Heather M.; Schepmoes, Athena A.; Smith, Richard D.; Adkins, Joshua N.; Heffron, Fred

    2011-01-01

    The intracellular pathogen Salmonella enterica serovar Typhimurium is a leading cause of acute gastroenteritis in the world. This pathogen has two type-III secretion systems (TTSS) necessary for virulence that are encoded in Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2) and are expressed during extracellular or intracellular infectious states, respectively, to deliver virulence factors (effectors) to the host cell cytoplasm. While many have been identified and at least partially characterized, the full repertoire of effectors has not been catalogued. In this mass spectrometry-based proteomics study, we identified effector proteins secreted under minimal acidic medium growth conditions that induced the SPI-2 TTSS and its effectors, and compared the secretome from the parent strain to the secretome from strains missing either essential (SsaK) or regulatory components (SsaL) of the SPI-2 secretion apparatus. We identified 75% of the known TTSS effector repertoire. Excluding translocon components, 95% of the known effectors were biased for identification in the ssaL mutant background, which demonstrated that SsaL regulates SPI-2 type III secretion. To confirm secretion to animal cells, we made translational fusions of several of the best candidates to the calmodulin-dependent adenylate cyclase of Bordetella pertussis and assayed cAMP levels of infected J774 macrophage-like cells. From these infected cells we identified six new TTSS effectors and two others that are secreted independent of TTSS. Our results substantiate reports of additional secretion systems encoded by Salmonella other than TTSS.

  5. Lipopolysaccharide-Induced Profiles of Cytokine, Chemokine, and Growth Factors Produced by Human Decidual Cells Are Altered by Lactobacillus rhamnosus GR-1 Supernatant.

    Science.gov (United States)

    Li, Wei; Yang, Siwen; Kim, Sung O; Reid, Gregor; Challis, John R G; Bocking, Alan D

    2014-01-15

    The aim of this study was to assess the effects of bacterial lipopolysaccharide (LPS) and Lactobacillus rhamnosus GR-1 supernatant (GR-1SN) on secretion profiles of cytokines, chemokines, and growth factors from primary cultures of human decidual cells. Lipopolysaccharide significantly increased the output of proinflammatory cytokines (interleukin [IL]-1B, IL-2, IL-6, IL-12p70, IL-15, IL-17A, interferon gamma [IFN-γ], and tumor necrosis factor [TNF]); anti-inflammatory cytokines (IL-1RN, IL-4, IL-9, and IL-10); chemokines (IL-8, eotaxin, IFN-inducible protein 10 [IP-10], monocyte chemoattractant protein 1 [MCP-1], macrophage inflammatory protein-1α [MIP-1α], macrophage inflammatory protein-1β [MIP-1β], and regulated on activation normal T cell expressed and secreted [RANTES]); and growth factors (granulocyte colony-stimulating factor [CSF] 3, CSF-2, and vascular endothelial growth factor A [VEGFA]). Lactobacillus rhamnosus GR-1SN alone significantly increased CSF-3, MIP-1α MIP-1β, and RANTES but decreased IL-15 and IP-10 output. The GR-1SN also significantly or partially reduced LPS-induced proinflammatory cytokines TNF, IFN-γ, IL-1β, IL-2 IL-6, IL-12p70, IL-15, IL-17, and IP-10; partially reduced LPS-induced anti-inflammatory cytokines IL-1RN, IL-4 and IL-10, and LPS-induced VEGFA output but did not affect CSF-3, MIP-1α, MIP-1β, MCP-1, IL-8, and IL-9. Our results demonstrate that GR-1SN attenuates the inflammatory responses to LPS by human decidual cells, suggesting its potential role in ameliorating intrauterine infection. PMID:24429676

  6. Fish Stem Cell Cultures

    OpenAIRE

    Ni Hong, Zhendong Li, Yunhan Hong

    2011-01-01

    Stem cells have the potential for self-renewal and differentiation. First stem cell cultures were derived 30 years ago from early developing mouse embryos. These are pluripotent embryonic stem (ES) cells. Efforts towards ES cell derivation have been attempted in other mammalian and non-mammalian species. Work with stem cell culture in fish started 20 years ago. Laboratory fish species, in particular zebrafish and medaka, have been the focus of research towards stem cell cultures. Medaka is th...

  7. Use of an adaptable cell culture kit for performing lymphocyte and monocyte cell cultures in microgravity

    Science.gov (United States)

    Hatton, J. P.; Lewis, M. L.; Roquefeuil, S. B.; Chaput, D.; Cazenave, J. P.; Schmitt, D. A.

    1998-01-01

    The results of experiments performed in recent years on board facilities such as the Space Shuttle/Spacelab have demonstrated that many cell systems, ranging from simple bacteria to mammalian cells, are sensitive to the microgravity environment, suggesting gravity affects fundamental cellular processes. However, performing well-controlled experiments aboard spacecraft offers unique challenges to the cell biologist. Although systems such as the European 'Biorack' provide generic experiment facilities including an incubator, on-board 1-g reference centrifuge, and contained area for manipulations, the experimenter must still establish a system for performing cell culture experiments that is compatible with the constraints of spaceflight. Two different cell culture kits developed by the French Space Agency, CNES, were recently used to perform a series of experiments during four flights of the 'Biorack' facility aboard the Space Shuttle. The first unit, Generic Cell Activation Kit 1 (GCAK-1), contains six separate culture units per cassette, each consisting of a culture chamber, activator chamber, filtration system (permitting separation of cells from supernatant in-flight), injection port, and supernatant collection chamber. The second unit (GCAK-2) also contains six separate culture units, including a culture, activator, and fixation chambers. Both hardware units permit relatively complex cell culture manipulations without extensive use of spacecraft resources (crew time, volume, mass, power), or the need for excessive safety measures. Possible operations include stimulation of cultures with activators, separation of cells from supernatant, fixation/lysis, manipulation of radiolabelled reagents, and medium exchange. Investigations performed aboard the Space Shuttle in six different experiments used Jurkat, purified T-cells or U937 cells, the results of which are reported separately. We report here the behaviour of Jurkat and U937 cells in the GCAK hardware in ground

  8. Inhibition of miR122a by Lactobacillus rhamnosus GG culture supernatant increases intestinal occludin expression and protects mice from alcoholic liver disease.

    Science.gov (United States)

    Zhao, Haiyang; Zhao, Cuiqing; Dong, Yuanyuan; Zhang, Min; Wang, Yuhua; Li, Fengyuan; Li, Xiaokun; McClain, Craig; Yang, Shulin; Feng, Wenke

    2015-05-01

    Alcoholic liver disease (ALD) has a high morbidity and mortality. Chronic alcohol consumption causes disruption of intestinal microflora homeostasis, intestinal tight junction barrier dysfunction, increased endotoxemia, and eventually liver steatosis/steatohepatitis. Probiotic Lactobacillus rhamnosus GG (LGG) and the bacteria-free LGG culture supernatant (LGGs) have been shown to promote intestinal epithelial integrity and protect intestinal barrier function in ALD. However, little is known about how LGGs mechanistically works to increase intestinal tight junction proteins. Here we show that chronic ethanol exposure increased intestinal miR122a expression, which decreased occludin expression leading to increased intestinal permeability. Moreover, LGGs supplementation decreased ethanol-elevated miR122a level and attenuated ethanol-induced liver injury in mice. Similar to the effect of ethanol exposure, overexpression of miR122a in Caco-2 monolayers markedly decreased occludin protein levels. In contrast, inhibition of miR122a increased occludin expression. We conclude that LGGs supplementation functions in intestinal integrity by inhibition of miR122a, leading to occludin restoration in mice exposed to chronic ethanol. PMID:25746479

  9. Soluble suppressor supernatants elaborated by concanavalin A-activated human mononuclear cells. Characterization of a soluble suppressor of B cell immunoglobulin production

    International Nuclear Information System (INIS)

    Human peripheral blood mononuclear cells (PBMC) activated with the mitogenic lectin concanavalin A (Con A) elaborate a soluble immune suppressor supernatant (SISS) that contains at least 2 distinct suppressor factors. One of these, SISS-B, inhibits polyclonal B cell immunoglobulin production, whereas the other, SISS-T, suppresses T cell proliferation to both mitogens and antigens. The latter mediator is discussed in the companion paper. Characteristics of the human soluble suppressor of B cell immunoglobulin production (SISS-B) include: 1) inhibition by a noncytotoxic mechanism, 2) loss of activity in the presence of the monosaccharide L-rhamnose, 3) appearance within 8 to 16 hr after the addition of Con A, 4) elaboration by cells irradiated with 500 or 2000 rads, 5) production by highly purified T cells, 6) stability at pH 2.5 but instability at 56/sup o/C, and 7) m.w. of 60 to 80,000. These data indicate that after Con A activation, selected T cells not only become potent suppressor cells, but also generate a soluble saccharide-specific factor(s) that inhibits polyclonal immunoglobulin production by human B cells

  10. Optimizing stem cell culture.

    Science.gov (United States)

    van der Sanden, Boudewijn; Dhobb, Mehdi; Berger, François; Wion, Didier

    2010-11-01

    Stem cells always balance between self-renewal and differentiation. Hence, stem cell culture parameters are critical and need to be continuously refined according to progress in our stem cell biology understanding and the latest technological developments. In the past few years, major efforts have been made to define more precisely the medium composition in which stem cells grow or differentiate. This led to the progressive replacement of ill-defined additives such as serum or feeder cell layers by recombinant cytokines or growth factors. Another example is the control of the oxygen pressure. For many years cell cultures have been done under atmospheric oxygen pressure which is much higher than the one experienced by stem cells in vivo. A consequence of cell metabolism is that cell culture conditions are constantly changing. Therefore, the development of high sensitive monitoring processes and control algorithms is required for ensuring cell culture medium homeostasis. Stem cells also sense the physical constraints of their microenvironment. Rigidity, stiffness, and geometry of the culture substrate influence stem cell fate. Hence, nanotopography is probably as important as medium formulation in the optimization of stem cell culture conditions. Recent advances include the development of synthetic bioinformative substrates designed at the micro- and nanoscale level. On going research in many different fields including stem cell biology, nanotechnology, and bioengineering suggest that our current way to culture cells in Petri dish or flasks will soon be outdated as flying across the Atlantic Ocean in the Lindbergh's plane. PMID:20803548

  11. Cell Culture Made Easy.

    Science.gov (United States)

    Dye, Frank J.

    1985-01-01

    Outlines steps to generate cell samples for observation and experimentation. The procedures (which use ordinary laboratory equipment) will establish a short-term primary culture of normal mammalian cells. Information on culture vessels and cell division and a list of questions to generate student interest and involvement in the topics are…

  12. Effects of neuroglia cultured supernatants with LPS-priming on neurons%LPS预激神经胶质细胞培养上清对神经元的影响

    Institute of Scientific and Technical Information of China (English)

    谢泽锋; 苏芸; 蒋治武; 许燕璇; 辛岗; 李康生

    2012-01-01

    and microglia)were cultured in vitro and identified by immunofluorescence. Thereafter,these glial cells were divided into 4 groups:LPS-primed group, 0.01μg/ml of LPS treated group, 1 μg/ml of LPS treated group and non-treated group. The LPS-primed group was preconditioned with 0.01μg/ml of LPS for 18 hours and re-retreated with a higher dose of LPS (1μg/ml LPS)for 24 hours. Then all cultured supernatants of 4 groups were collected and were used to treat the neurons for 24 hours in vitro. The cytotoxicity and secretion ability of proinflammatory cytokines were determined by CCK-8 kit and ELISA respectively. Results The cytotocixity of neurons was decreased by the treatment with the astrocyte supernatant of LPS-primed group,there was significant difference statistically if compared with 0.01μg/ml and lug/ml of LPS groups (P0.05). As for TNF-α levels, it was increased by the treatment with the astrocyte supernatant of LPS-primed group, 0.0 1μg/ml of LPS treated group, 1μg/ml of LPS treated group,particularly in 1ug/ml of LPS treated group,statistical difference was found when compared with 0.01μg/ml of LPS treated group and non-treated group (P0.05). Conclusion There were diverse effects (ncluding protection or injury) of cultured supernatants from astrocytes and microglia on the cytotoxicity and secretion ability in the neurons,because of the readjustment of bioacitve molecules with LPS preconditioning in target cells.

  13. Growth Inhibition of Cronobacter sakazakii in Experimentally Contaminated Powdered Infant Formula by Kefir Supernatant.

    Science.gov (United States)

    Kim, Dong-Hyeon; Chon, Jung-Whan; Kang, Il-Byeong; Kim, Hyunsook; Kim, Hong-Seok; Song, Kwang-Young; Seo, Kun-Ho

    2015-09-01

    Kefir is a type of fermented milk containing lactic and acetic acid bacteria and yeast. In this study, we evaluated the antimicrobial activity of kefir supernatant against Cronobacter sakazakii in powdered infant formula (PIF). In a spot-on-lawn test, the growth of 20 C. sakazakii strains, including 10 clinical and 10 food isolates, was completely inhibited in the presence of kefir supernatant. Significant differences in the diameters of inhibition zones were observed upon treatment with kefir compared with the results for Lactobacillus kefiri and Candida kefyr culture supernatants or solutions of lactic and acetic acid and ethyl alcohol in the agar well diffusion test (P < 0.05). The addition of 100 μl of kefir supernatant to 1 ml of nutrient broth completely inhibited the growth of C. sakazakii, as evaluated by spectrophotometry. The antimicrobial activity of kefir supernatant in experimentally contaminated PIF was also tested; we found no viable C. sakazakii cells remaining in PIF rehydrated with 30% kefir supernatant solution for 1 h, demonstrating that the antimicrobial activity of kefir supernatant against C. sakazakii could be applied in real food samples. PMID:26319718

  14. Bacterial cell culture

    OpenAIRE

    sprotocols

    2014-01-01

    ### Materials 1. Glass culture tubes with metal caps and labels - Growth medium, from media room or customized - Glass pipette tubes - Parafilm ### Equipment 1. Vortexer - Fireboy or Bunsen burner - Motorized pipette - Micropipettes and sterile tips ### Procedure For a typical liquid culture, use 5 ml of appropriate medium. The amount in each tube does not have to be exact if you are just trying to culture cells for their precious DNA. 1. Streak an a...

  15. Mammalian Cell Culture Simplified.

    Science.gov (United States)

    Moss, Robert; Solomon, Sondra

    1991-01-01

    A tissue culture experiment that does not require elaborate equipment and that can be used to teach sterile technique, the principles of animal cell line maintenance, and the concept of cell growth curves is described. The differences between cancerous and normal cells can be highlighted. The procedure is included. (KR)

  16. Fish Stem Cell Cultures

    Directory of Open Access Journals (Sweden)

    Ni Hong, Zhendong Li, Yunhan Hong

    2011-01-01

    Full Text Available Stem cells have the potential for self-renewal and differentiation. First stem cell cultures were derived 30 years ago from early developing mouse embryos. These are pluripotent embryonic stem (ES cells. Efforts towards ES cell derivation have been attempted in other mammalian and non-mammalian species. Work with stem cell culture in fish started 20 years ago. Laboratory fish species, in particular zebrafish and medaka, have been the focus of research towards stem cell cultures. Medaka is the second organism that generated ES cells and the first that gave rise to a spermatogonial stem cell line capable of test-tube sperm production. Most recently, the first haploid stem cells capable of producing whole animals have also been generated from medaka. ES-like cells have been reported also in zebrafish and several marine species. Attempts for germline transmission of ES cell cultures and gene targeting have been reported in zebrafish. Recent years have witnessed the progress in markers and procedures for ES cell characterization. These include the identification of fish homologs/paralogs of mammalian pluripotency genes and parameters for optimal chimera formation. In addition, fish germ cell cultures and transplantation have attracted considerable interest for germline transmission and surrogate production. Haploid ES cell nuclear transfer has proven in medaka the feasibility of semi-cloning as a novel assisted reproductive technology. In this special issue on “Fish Stem Cells and Nuclear Transfer”, we will focus our review on medaka to illustrate the current status and perspective of fish stem cells in research and application. We will also mention semi-cloning as a new development to conventional nuclear transfer.

  17. Optimizing stem cell culture.

    OpenAIRE

    van der Sanden, Boudewijn; Dhobb, Mehdi; Berger, François; Wion, Didier

    2010-01-01

    International audience Stem cells always balance between self-renewal and differentiation. Hence, stem cell culture parameters are critical and need to be continuously refined according to progress in our stem cell biology understanding and the latest technological developments. In the past few years, major efforts have been made to define more precisely the medium composition in which stem cells grow or differentiate. This led to the progressive replacement of ill-defined additives such a...

  18. Digital Microfluidic Cell Culture.

    Science.gov (United States)

    Ng, Alphonsus H C; Li, Bingyu Betty; Chamberlain, M Dean; Wheeler, Aaron R

    2015-01-01

    Digital microfluidics (DMF) is a droplet-based liquid-handling technology that has recently become popular for cell culture and analysis. In DMF, picoliter- to microliter-sized droplets are manipulated on a planar surface using electric fields, thus enabling software-reconfigurable operations on individual droplets, such as move, merge, split, and dispense from reservoirs. Using this technique, multistep cell-based processes can be carried out using simple and compact instrumentation, making DMF an attractive platform for eventual integration into routine biology workflows. In this review, we summarize the state-of-the-art in DMF cell culture, and describe design considerations, types of DMF cell culture, and cell-based applications of DMF. PMID:26643019

  19. Mycoplasmas detection in cells cultures

    OpenAIRE

    Rivera-Tapia José Antonio; Castillo-Viveros Linda Valeria; Sánchez-Hernández José Antonio

    2010-01-01

    INTRODUCTION. Cells cultures are widely used in both biomedical and biotechnological research centers and industry, as well as for diagnostic test in hospitals. Contaminations of cells cultures with microbial organisms as well as with virus or other eukaryotic cell lines are a major problem in cell culture related research.OBJECTIVE. Mycoplasmas detection in cells cultures came from biomedical laboratories.MATERIAL AND METHODS. The cells cultures screened for mycoplasmas by using of microbiol...

  20. Perfusion based cell culture chips

    DEFF Research Database (Denmark)

    Heiskanen, Arto; Emnéus, Jenny; Dufva, Martin

    2010-01-01

    Performing cell culture in miniaturized perfusion chambers gives possibilities to experiment with cells under near in vivo like conditions. In contrast to traditional batch cultures, miniaturized perfusion systems provide precise control of medium composition, long term unattended cultures and ti...

  1. [Continuous perfusion culture hybridoma cells for production of monoclonal antibody].

    Science.gov (United States)

    Mi, Li; Li, Ling; Feng, Qiang; Yu, Xiao-Ling; Chen, Zhi-Nan

    2002-05-01

    Hybridoma cells were cultured by continuous perfusion in Fibra-Cel of 5L packed-bed bioreactor for 22 days in low serum or serum-free media. The corresponded amino acids were fed and serum concentration was decreased by analyzing glucose concentration, oxygen uptake rate, secretary antibody amount and amino acids concentration in culture supernatant. Comparing with continuous perfusion culture that amino acids were not fed, antibody amount of production was increased about 2-3 times. The inoculated cell density was 2.5 x 10(5) cells/mL, while the final cell density was 8.79 x 10(8) cells/mL. Antibody production was reached 295 mg/L/d at average level, and the highest level was reached 532 mg/L/d. These results provided a primary mode of enlarge culture for monoclonal antibody industralization. PMID:12192875

  2. Peripheral blood mononuclear cell supernatants from asymptomatic dogs immunized and experimentally challenged with Leishmania chagasi can stimulate canine macrophages to reduce infection in vitro.

    Science.gov (United States)

    Rodrigues, Cleusa Alves Theodoro; Batista, Luís Fábio da Silva; Teixeira, Márcia Cristina Aquino; Pereira, Andréa Mendes; Santos, Patrícia Oliveira Meira; de Sá Oliveira, Geraldo Gileno; de Freitas, Luiz Antônio Rodrigues; Veras, Patrícia Sampaio Tavares

    2007-02-28

    Leishmania chagasi is the causative agent of visceral leishmaniasis in both humans and dogs in the New World. The dog is the main domestic reservoir and its infection displays different clinical presentations, from asymptomatic to severe disease. Macrophages play an important role in the control of Leishmania infection. Although it is not an area of intense study, some data suggest a role for canine macrophages in parasite killing by a NO-dependent mechanism. It has been proposed that control of human disease could be possible with the development of an effective vaccine against canine visceral leishmaniasis. Development of a rapid in vitro test to predict animal responses to Leishmania infection or vaccination should be helpful. In this study, an in vitro model was established to test whether peripheral blood mononuclear cell (PBMC) supernatants from dogs immunized with promastigote lysates and infected with L. chagasi promastigotes could stimulate macrophages from healthy dogs in order to control parasite infection. PBMC from a majority of the immunized and experimentally infected dogs expressed IFN-gamma mRNA and secreted IFN-gamma when stimulated with soluble L. chagasi antigen (SLA) in vitro. Additionally, the supernatants from stimulated PBMC were able to reduce the percentage of infected donor macrophages. The results also indicate that parasite killing in this system is dependent on NO, since aminoguanidine (AMG) reversed this effect. This in vitro test appears to be useful for screening animal responses to parasite inoculation as well as studying the lymphocyte effector mechanisms involved in pathogen killing by canine macrophages. PMID:17045743

  3. Oscillating Cell Culture Bioreactor

    Science.gov (United States)

    Freed, Lisa E.; Cheng, Mingyu; Moretti, Matteo G.

    2010-01-01

    To better exploit the principles of gas transport and mass transport during the processes of cell seeding of 3D scaffolds and in vitro culture of 3D tissue engineered constructs, the oscillatory cell culture bioreactor provides a flow of cell suspensions and culture media directly through a porous 3D scaffold (during cell seeding) and a 3D construct (during subsequent cultivation) within a highly gas-permeable closed-loop tube. This design is simple, modular, and flexible, and its component parts are easy to assemble and operate, and are inexpensive. Chamber volume can be very low, but can be easily scaled up. This innovation is well suited to work with different biological specimens, particularly with cells having high oxygen requirements and/or shear sensitivity, and different scaffold structures and dimensions. The closed-loop changer is highly gas permeable to allow efficient gas exchange during the cell seeding/culturing process. A porous scaffold, which may be seeded with cells, is fixed by means of a scaffold holder to the chamber wall with scaffold/construct orientation with respect to the chamber determined by the geometry of the scaffold holder. A fluid, with/without biological specimens, is added to the chamber such that all, or most, of the air is displaced (i.e., with or without an enclosed air bubble). Motion is applied to the chamber within a controlled environment (e.g., oscillatory motion within a humidified 37 C incubator). Movement of the chamber induces relative motion of the scaffold/construct with respect to the fluid. In case the fluid is a cell suspension, cells will come into contact with the scaffold and eventually adhere to it. Alternatively, cells can be seeded on scaffolds by gel entrapment prior to bioreactor cultivation. Subsequently, the oscillatory cell culture bioreactor will provide efficient gas exchange (i.e., of oxygen and carbon dioxide, as required for viability of metabolically active cells) and controlled levels of fluid

  4. DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

    International Nuclear Information System (INIS)

    A Lyt-2+, trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3H counts from target cells prelabeled with [3H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1+, ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

  5. Microfluidic Cell Culture Device

    Science.gov (United States)

    Takayama, Shuichi (Inventor); Cabrera, Lourdes Marcella (Inventor); Heo, Yun Seok (Inventor); Smith, Gary Daniel (Inventor)

    2014-01-01

    Microfluidic devices for cell culturing and methods for using the same are disclosed. One device includes a substrate and membrane. The substrate includes a reservoir in fluid communication with a passage. A bio-compatible fluid may be added to the reservoir and passage. The reservoir is configured to receive and retain at least a portion of a cell mass. The membrane acts as a barrier to evaporation of the bio-compatible fluid from the passage. A cover fluid may be added to cover the bio-compatible fluid to prevent evaporation of the bio-compatible fluid.

  6. Lactobacillus rhamnosus GG supernatant promotes intestinal barrier function, balances Treg and TH17 cells and ameliorates hepatic injury in a mouse model of chronic-binge alcohol feeding.

    Science.gov (United States)

    Chen, Rui-Cong; Xu, Lan-Man; Du, Shan-Jie; Huang, Si-Si; Wu, He; Dong, Jia-Jia; Huang, Jian-Rong; Wang, Xiao-Dong; Feng, Wen-Ke; Chen, Yong-Ping

    2016-01-22

    Impaired intestinal barrier function plays a critical role in alcohol-induced hepatic injury, and the subsequent excessive absorbed endotoxin and bacterial translocation activate the immune response that aggravates the liver injury. Lactobacillus rhamnosus GG supernatant (LGG-s) has been suggested to improve intestinal barrier function and alleviate the liver injury induced by chronic and binge alcohol consumption, but the underlying mechanisms are still not clear. In this study, chronic-binge alcohol fed model was used to determine the effects of LGG-s on the prevention of alcoholic liver disease in C57BL/6 mice and investigate underlying mechanisms. Mice were fed Lieber-DeCarli diet containing 5% alcohol for 10 days, and one dose of alcohol was gavaged on Day 11. In one group, LGG-s was supplemented along with alcohol. Control mice were fed isocaloric diet. Nine hours later the mice were sacrificed for analysis. Chronic-binge alcohol exposure induced an elevation in liver enzymes, steatosis and morphology changes, while LGG-s supplementation attenuated these changes. Treatment with LGG-s significantly improved intestinal barrier function reflected by increased mRNA expression of tight junction (TJ) proteins and villus-crypt histology in ileum, and decreased Escherichia coli (E. coli) protein level in liver. Importantly, flow cytometry analysis showed that alcohol reduced Treg cell population while increased TH17 cell population as well as IL-17 secretion, which was reversed by LGG-s administration. In conclusion, our findings indicate that LGG-s is effective in preventing chronic-binge alcohol exposure-induced liver injury and shed a light on the importance of the balance of Treg and TH17 cells in the role of LGG-s application. PMID:26617183

  7. Development of an indirect ELISA to detect Corynebacterium pseudotuberculosis specific antibodies in sheep employing T1 strain culture supernatant as antigen

    Directory of Open Access Journals (Sweden)

    Miriam F. Rebouças

    2013-11-01

    Full Text Available Corynebacterium pseudotuberculosis is the etiologic agent of caseous lymphadenitis (CLA, a chronic disease that affects goats and sheep, characterized by granuloma formation in subcutaneous and internal lymph nodes. CLA causes significant economic losses to commercial goat herds. In this study, we aimed to test secreted antigens secreted from T1 strain bacteria grown in brain heart infusion (BHI broth in an indirect ELISA system to determine the presence of specific immunoglobulins against C. pseudotuberculosis. We analyzed the BHI antigen electrophoretic profile and the recognition pattern by infected sheep sera samples. The ELISA results were compared with multiplex PCR assay and IFN-gamma production. The ELISA was able to discriminate between negative and positive animals, with a sensitivity of 89% and a specificity of 99%, using microbiological isolation as gold standard. When this assay was compared with multiplex PCR and specific IFN-gamma quantification, six discrepant results were found among thirty-two samples. We concluded that the ELISA using antigens secreted from C. pseudotuberculosis T1 strain growth in BHI broth culture can be used for the serodiagnosis of CLA in sheep.

  8. Huanglongbing and psyllid cell cultures

    Science.gov (United States)

    We successfully established cell cultures of the Asian citrus psyllid, Diaphorina citri (Psyllidae: Hemiptera), DcHH-1. The cell culture also supported growth of Candidatus Liberibacter asiaticus. This bacterial pathogen is associated with Huanglongbing, known as citrus greening disease. Research on...

  9. Systemic suppression of delayed-type hypersensitivity by supernatants from UV-irradiated keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Rivas, J.M.; Ullrich, S.E. (Univ. of Texas, Houston (United States))

    1992-12-15

    Exposing murine keratinocyte cultures to UV radiation causes the release of a suppressive cytokine that mimics the immunosuppressive effects of total-body UV exposure. Injecting supernatants from UV-irradiated keratinocyte cultures into mice inhibits their ability to generate a delayed-type hypersensitivity reaction against allogeneic histocompatibility Ag, and spleen cells from mice injected with supernatant do not respond to alloantigen in the in vitro MLR. A unique feature of the immunosuppression induced by either total-body UV-exposure or injecting the suppressive cytokine from UV-irradiated keratinocytes is the selectivity of suppression. Although cellular immune reactions such as delayed-type hypersensitivity are suppressed antibody production is unaffected. Because the selective nature to the UV-induced immunosuppression is similar to the biologic activity of IL-10, the authors examined the hypothesis that UV exposure of keratinocytes causes the release of IL-10. Keratinocyte monolayers were exposed to UV radiation and at specific times after exposure mRNA was isolated or the culture supernatant from the cells was collected. These data indicate that activated keratinocytes are capable of secreting IL-10 and suggest that the release of IL-10 by UV-irradiated keratinocytes plays an essential role in the induction of systemic immunosuppression after total-body UV exposure. 44 refs., 3 figs., 2 tabs.

  10. High density cell culture system

    Science.gov (United States)

    Spaulding, Glenn F. (Inventor)

    1994-01-01

    An annular culture vessel for growing mammalian cells is constructed in a one piece integral and annular configuration with an open end which is closed by an endcap. The culture vessel is rotatable about a horizontal axis by use of conventional roller systems commonly used in culture laboratories. The end wall of the endcap has tapered access ports to frictionally and sealingly receive the ends of hypodermic syringes. The syringes permit the introduction of fresh nutrient and withdrawal of spent nutrients. The walls are made of conventional polymeric cell culture material and are subjected to neutron bombardment to form minute gas permeable perforations in the walls.

  11. Tacrolimus Inhibits the Enhancing Effects of Peripheral Blood Mononuclear Cell Supernatant on Proliferation and Collagen Expression in Keloid Fibroblasts: Implication for New Therapeutic Approach%他克莫司抑制外周血单个核细胞培养上清对瘢痕疙瘩成纤维细胞的作用

    Institute of Scientific and Technical Information of China (English)

    王大雷; 闫伦; 李辉超; 楚菲菲; 夏炜

    2013-01-01

    目的:研究他克莫司(FK506)抑制外周血单个核细胞(PBMC)培养上清对瘢痕疙瘩成纤维细胞的作用,探讨FK506在瘢痕疙瘩治疗中可能的的作用和机制.方法:用消化法原代培养人瘢痕疙瘩来源的成纤维细胞,梯度密度离心法分离培养人PBMC.将瘢痕疙瘩来源的成纤维细胞随机分组,给予PBMC培养上清处理,实验组同时给与不同浓度FK506处理.四甲基偶氮唑蓝法(MTT)检测瘢痕疙瘩成纤维细胞增殖活性,荧光实时定量PCR法检测Ⅰ型胶原表达.结果:单纯给予PBMC培养上清处理后,成纤维细胞的增殖活性与对照组相比明显增高(P<0.01),同时给予PBMC上清和FK506时发现FK506在20 ng/ml和100 ng/ml时能够抑制PBMC上清的促增殖作用(P<0.01),荧光实时定量PCR结果显示:单纯给予PBMC培养上清处理后,Ⅰ型胶原的表达与对照组相比明显增高(P<0.05),给予PBMC上清和FK506后,在FK506浓度为20 ng/ml和100 ng/ml时Ⅰ型胶原表达降低(P<0.01).结论:FK506能够抑制PBMC培养上清对瘢痕疙瘩成纤维细胞的作用,因此,FK506可能通过抑制PBMC的作用来达到预防和治疗瘢痕疙瘩的作用.%Objective: To study the inhibition of tacrolimus upon the enhancing effects of peripheral blood mononuclear cell (PBMC) supernatant on keloid fibroblasts, and to investigate the role of tacrolimus in keloid thearapy and its mechanism. Methods: Keloid fibroblasts were harvested by digestion method. PBMCs were separated with density gradient centrifogation. Culture supernatant derived from the PBMC was added to keloid fibroblasts. The experimental group was treated with PBMC supernatant and different concentration tacrolimus at the same time. Proliferation of keloid fibroblasts activity was detected with [3- (4,5-dimethylthiazol -2-yl)-2, 5-diphenyltetrazolium bromide (MTT) method. Type I collagen expression was detected with Real-time PCR. Results: PBMC culture supernatant treatment increased

  12. High rate manure supernatant digestion

    OpenAIRE

    Bergland, Wenche Hennie; Dinamarca, Carlos; Toradzadegan, Mehrdad; Nordgård, Anne Synnøve Røstad; Bakke, Ingrid; Bakke, Rune

    2015-01-01

    The study shows that high rate anaerobic digestion may be an efficient way to obtain sustainable energy recovery from slurries such as pig manure. High process capacity and robustness to 5% daily load increases are observed in the 370mL sludge bed AD reactors investigated. The supernatant from partly settled, stored pig manure was fed at rates giving hydraulic retention times, HRT, gradually decreased from 42 to 1.7h imposing a maximum organic load of 400g COD L-1 reactor d-1. The reactors re...

  13. Challenges of culturing human norovirus in three-dimensional organoid intestinal cell culture models.

    Directory of Open Access Journals (Sweden)

    Efstathia Papafragkou

    Full Text Available Human noroviruses are the most common cause of acute gastroenteritis worldwide. Recently, cell culture systems have been described using either human embryonic intestinal epithelial cells (Int-407 or human epithelial colorectal adenocarcinoma cells (Caco-2 growing on collagen-I porous micro carrier beads in a rotating bioreactor under conditions of physiological fluid shear. Here, we describe the efforts from two independent laboratories to implement this three dimensional (3D cell culture system for the replication of norovirus. Int-407 and Caco-2 were grown in a rotating bioreactor for up to 28 days. Prior to infection, cells were screened for the presence of microvilli by electron microscopy and stained for junction proteins (zonula occludens-1, claudin-1, and β-catenin. Differentiated 3D cells were transferred to 24-well plates and infected with bacteria-free filtrates of various norovirus genotypes (GI.1, GI.3, GI.8, GII.2, GII.4, GII.7, and GII.8. At 12 h, 24 h, and 48 h post inoculation, viral RNA from both cells and supernatants were collected and analyzed for norovirus RNA by real-time reverse transcription PCR. Despite observations of high expression of junction proteins and microvilli development in stained thin sections, our data suggest no significant increase in viral titer based on norovirus RNA copy number during the first 48 h after inoculation for the different samples and virus culture conditions tested. Our combined efforts demonstrate that 3D cell culture models using Int-407 or Caco-2 cells do not support norovirus replication and highlight the complexity and difficulty of developing a reproducible in vitro cell culture system for human norovirus.

  14. Cell culture purity issues and DFAT cells

    International Nuclear Information System (INIS)

    Highlights: •DFAT cells are progeny cells derived from dedifferentiated mature adipocytes. •Common problems in this research is potential cell contamination of initial cultures. •The initial cell culture purity is crucial in DFAT cell research field. -- Abstract: Dedifferentiation of mature adipocytes, in vitro, has been pursued/documented for over forty years. The subsequent progeny cells are named dedifferentiated adipocyte-derived progeny cells (DFAT cells). DFAT cells are proliferative and likely to possess mutilineage potential. As a consequence, DFAT cells and their progeny/daughter cells may be useful as a potential tool for various aspects of tissue engineering and as potential vectors for the alleviation of several disease states. Publications in this area have been increasing annually, but the purity of the initial culture of mature adipocytes has seldom been documented. Consequently, it is not always clear whether DFAT cells are derived from dedifferentiated mature (lipid filled) adipocytes or from contaminating cells that reside in an impure culture

  15. Absence of siderophore-like activity in Legionella pneumophila supernatants.

    OpenAIRE

    Liles, M R; Cianciotto, N P

    1996-01-01

    Conflicting reports have been given as to the existence of a Legionella pneumophila siderophore. Hence, we rigorously examined the reported siderophore-like activity using the chrome azurol S indicator. Although chrome azurol S reactivity was detected in supernatants, control experiments indicate that it was due to cysteine in the media. When bacteria were cultured in media without cysteine, no siderophores were detected.

  16. Inflammatory cytokine detection in adenotonsill and peripheral blood mononuclear cells- culture in adenotonsillectomy patients: a comparative study

    Directory of Open Access Journals (Sweden)

    Farhadi M

    2013-04-01

    Full Text Available Background: Tonsils and adenoid hypertrophy is a major respiratory symptom in children which is partly due to recruitment of inflammatory cells in upper airway lymph nodes as a result of the effects of synthesis and release of different inflammatory cytokines. It seems that infections play role in concert with these cytokines leading to tonsilar hypertrophy and other pathologic consequences. It is proposed that cellular infiltrate of tonsils and adenoids may secrete different quantities of these cytokines compared with peripheral blood mononuclear cells (PBMC cultures.Methods: Among patients who were admitted for adenotonsillectomy to the ENT ward, 37 patients, under 1-12 years old patients with fulfill criteria selected to include the study. Excised adenoid and tonsils cultured and inflammatory cytokines Interferon-γ (INF-γ, Interlukine-1 (IL-1, IL-6, IL-8 and tumor necrosis factor-α (TNF-α measured in cellular culture supernatant. The same cytokines measured in PBMC cultures.Results: The data shows that there is a significant difference between IFN-γ and IL-8 amounts in adenoid tissue culture supernatant and PBMC culture of our patients. Furth-ermore, the amounts of IFN-γ, IL-1 and IL-8 showed considerable difference between tonsilar tissue culture supernatant and PBMC culture of these patients. Although there is a significant correlation between IL-6 amounts in tissue culture supernatant and PBMC culture (P=0.02, the respective data for TNF is only almost significant.Conclusion: Inflammatory cytokines may have significant role in the early provoke of inflammation occurred in hypertrophied tonsils and adenoid. The majority of these cyt-okines increase the expression of adhesion molecules on epithelial cells and influence the recruitment of leucocytes and inflamed tonsils. On the other hand lack of sufficient cytokine release may lead to persistent infections and may cause chronic inflammation and hypertrophied tissue.

  17. Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells

    Directory of Open Access Journals (Sweden)

    del Angel Rosa M

    2008-04-01

    Full Text Available Abstract Current methods for dengue virus quantitation are either time consuming, technically demanding or costly. As an alternative, the commercial enzyme immunoassay Platelia™ Dengue NS1 AG (Bio-Rad Laboratories was used to monitor semiquantitatively dengue virus replication in cultured cells. The presence of NS1 protein was evaluated in supernatants from Vero and C6/36 HT cells infected with dengue virus. The amount of NS1 detected in the supernatants of infected cells was proportional to the initial MOI used and to the time of post infection harvest. This immunoassay was also able to detect the presence of NS1 in the supernatants of infected human macrophages. Inhibition of dengue virus replication in C6/36 HT cells treated with lysosomotropic drugs was readily monitored with the use of this assay. These results suggest that the Platelia™ Dengue NS1 AG kit can be used as a fast and reliable surrogate method for the relative quantitation of dengue virus replication in cultured cells.

  18. Copper-induced production of copper-binding supernatant proteins by the marine bacterium Vibrio alginolyticus.

    OpenAIRE

    Harwood-Sears, V; Gordon, A S

    1990-01-01

    Growth of the marine bacterium Vibrio alginolyticus is temporarily inhibited by micromolar levels of copper. During the copper-induced lag phase, supernatant compounds which complex and detoxify copper are produced. In this study two copper-inducible supernatant proteins having molecular masses of ca. 21 and 19 kilodaltons (CuBP1 and CuBP2) were identified; these proteins were, respectively, 25 and 46 times amplified in supernatants of copper-challenged cultures compared with controls. Experi...

  19. Aseptic technique for cell culture.

    Science.gov (United States)

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here. PMID:18228291

  20. Cell culture compositions

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

    2014-03-18

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  1. Dynamized Preparations in Cell Culture

    OpenAIRE

    Girija Kuttan; Korengath Chandran Preethi; Ramadasan Kuttan; Ellanzhiyil Surendran Sunila

    2009-01-01

    Although reports on the efficacy of homeopathic medicines in animal models are limited, there are even fewer reports on the in vitro action of these dynamized preparations. We have evaluated the cytotoxic activity of 30C and 200C potencies of ten dynamized medicines against Dalton's Lymphoma Ascites, Ehrlich's Ascites Carcinoma, lung fibroblast (L929) and Chinese Hamster Ovary (CHO) cell lines and compared activity with their mother tinctures during short-term and long-term cell culture. The ...

  2. Microarray-based MALDI-TOF mass spectrometry enables monitoring of monoclonal antibody production in batch and perfusion cell cultures.

    Science.gov (United States)

    Steinhoff, Robert F; Karst, Daniel J; Steinebach, Fabian; Kopp, Marie R G; Schmidt, Gregor W; Stettler, Alexander; Krismer, Jasmin; Soos, Miroslav; Pabst, Martin; Hierlemann, Andreas; Morbidelli, Massimo; Zenobi, Renato

    2016-07-15

    Cell culture process monitoring in monoclonal antibody (mAb) production is essential for efficient process development and process optimization. Currently employed online, at line and offline methods for monitoring productivity as well as process reproducibility have their individual strengths and limitations. Here, we describe a matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS)-based on a microarray for mass spectrometry (MAMS) technology to rapidly monitor a broad panel of analytes, including metabolites and proteins directly from the unpurified cell supernatant or from host cell culture lysates. The antibody titer is determined from the intact antibody mass spectra signal intensity relative to an internal protein standard spiked into the supernatant. The method allows a semi-quantitative determination of light and heavy chains. Intracellular mass profiles for metabolites and proteins can be used to track cellular growth and cell productivity. PMID:26707204

  3. Insect Cell Culture and Biotechnology

    Institute of Scientific and Technical Information of China (English)

    Robert R.Granados; Guoxun Li; G.W.Blissard

    2007-01-01

    The continued development of new cell culture technology is essential for the future growth and application of insect cell and baculovirus biotechnology. The use of cell lines for academic research and for commercial applications is currently dominated by two cell lines; the Spodoptera frugiperda line, SF21 (and its clonal isolate, SF9), and the Trichoplusia ni line, BTI 5B1-4, commercially known as High Five cells. The long perceived prediction that the immense potential application of the baculovirus-insect cell system, as a tool in cell and molecular biology, agriculture, and animal health, has been achieved. The versatility and recent applications of this popular expression system has been demonstrated by both academia and industry and it is clear that this cell-based system has been widely accepted for biotechnological applications. Numerous small to midsize startup biotechnology companies in North America and the Europe are currently using the baculovirus-insect cell technology to produce custom recombinant proteins for research and commercial applications. The recent breakthroughs using the baculovirus-insect cell-based system for the development of several commercial products that will impact animal and human health will further enhance interest in this technology by pharma. Clearly, future progress in novel cell and engineering advances will lead to fundamental scientific discoveries and serve to enhance the utility and applications of this baculovirus-insect cell system.

  4. The cytotoxicity of corrosion products of nitinol stent wire on cultured smooth muscle cells.

    Science.gov (United States)

    Shih, C C; Lin, S J; Chen, Y L; Su, Y Y; Lai, S T; Wu, G J; Kwok, C F; Chung, K H

    2000-11-01

    Although nitinol is one of most popular materials of intravascular stents, there are still few confirmative biocompatibility data available, especially in vascular smooth muscle cells. In this report, the nitinol wires were corroded in Dulbecco's modified Eagle's medium with constant electrochemical breakdown voltage and the supernatant and precipitates of corrosion products were prepared as culture media. The dose and time effects of different concentrations of corrosion products on the growth and morphology of smooth muscle cells were evaluated with [(3)H]-thymidine uptake ratio and cell cycle sorter. Both the supernatant and precipitate of the corrosive products of nitinol wire were toxic to the primary cultured rat aortic smooth muscle cells. The growth inhibition was correlated well with the increased concentrations of the corrosion products. Although small stimulation was found with released nickel concentration of 0.95 +/- 0.23 ppm, the growth inhibition became significant when the nickel concentration was above 9 ppm. The corrosion products also altered cell morphology, induced cell necrosis, and decreased cell numbers. The cell replication was inhibited at the G0-G1 to S transition phase. This was the first study to demonstrate the cytotoxicity of corrosion products of current nitinol stent wire on smooth muscle cells, which might affect the postimplantation neointimal hyperplasia and the patency rate of cardiovascular stents. PMID:10951381

  5. Effects of external radiation in a co-culture model of endothelial cells and adipose-derived stem cells

    International Nuclear Information System (INIS)

    The inflammatory response clinically observed after radiation has been described to correlate with elevated expression of cytokines and adhesion molecules by endothelial cells. Therapeutic compensation for this microvascular compromise could be an important approach in the treatment of irradiated wounds. Clinical reports describe the potential of adipose-derived stem cells to enhance wound healing, but the underlying cellular mechanisms remain largely unclear. Human dermal microvascular endothelial cells (HDMEC) and human adipose-derived stem cells (ASC) were cultured in a co-culture setting and irradiated with sequential doses of 2 to 12 Gy. Cell count was determined 48 h after radiation using a semi-automated cell counting system. Levels of interleukin-6 (IL-6), basic fibroblast growth factor (FGF), intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) were determined in the supernatants using enzyme-linked immunosorbent assay (ELISA). Irradiated HDMEC and ASC as well as non-irradiated co-cultures, HDMEC or ASC respectively were used as controls. Cell count was significantly reduced in irradiated co-cultures of HDMEC and ASC compared to non-irradiated controls. Levels of IL-6, FGF, ICAM-1 and VCAM-1 in the supernatants of the co-cultures were significantly less affected by external radiation in comparison to HDMEC. The increased expression of cytokines and adhesion molecules by HDMEC after external radiation is mitigated in the co-culture setting with ASC. These in vitro changes seem to support the clinical observation that ASC may have a stabilizing effect when injected into irradiated wounds

  6. Growth inhibition of cultured smooth muscle cells by corrosion products of 316 L stainless steel wire.

    Science.gov (United States)

    Shih, C C; Shih, C M; Chen, Y L; Su, Y Y; Shih, J S; Kwok, C F; Lin, S J

    2001-11-01

    The potential cytotoxicity on vascular smooth muscle cells of corrosion products from 316 L stainless steel, one of most popular biomaterials of intravascular stents, has not been highlighted. In this investigation, 316 L stainless steel wires were corroded in Dulbecco's modified eagle's medium with applied constant electrochemical breakdown voltage, and the supernatant and precipitates of corrosion products were prepared as culture media. The effects of different concentrations of corrosion products on the growth of rat aortic smooth muscle cells were conducted with the [3H]-thymidine uptake test and cell cycle sorter. Both the supernatant and precipitates of corrosion products were toxic to the primary culture of smooth muscle cells. The growth inhibition was correlated well with the increased nickel ions in the corrosion products when nickel concentration was above 11.7 ppm. The corrosion products also changed cell morphology and induced cell necrosis. The cell growth inhibition occurred at the G0/G1 to S transition phase. Similar to our recent study of nitinol stent wire, the present investigation also demonstrated the cytotoxicity of corrosion products of 316 L stainless steel stent wire on smooth muscle cells, which might affect the poststenting vascular response. PMID:11484182

  7. Techniques for mammalian cell tissue culture.

    Science.gov (United States)

    Phelan, Mary C

    2006-05-01

    This unit opens with detailed discussions on the latest principles of sterile technique and preparation of culture media. Step-by-step protocols describe trypsinizing and subculturing monolayer cultures, passaging suspension cultures, freezing and thawing cells, counting cells using a hemacytometer, and preparing cells for transport. PMID:18770828

  8. Dynamized Preparations in Cell Culture

    Directory of Open Access Journals (Sweden)

    Ellanzhiyil Surendran Sunila

    2009-01-01

    Full Text Available Although reports on the efficacy of homeopathic medicines in animal models are limited, there are even fewer reports on the in vitro action of these dynamized preparations. We have evaluated the cytotoxic activity of 30C and 200C potencies of ten dynamized medicines against Dalton's Lymphoma Ascites, Ehrlich's Ascites Carcinoma, lung fibroblast (L929 and Chinese Hamster Ovary (CHO cell lines and compared activity with their mother tinctures during short-term and long-term cell culture. The effect of dynamized medicines to induce apoptosis was also evaluated and we studied how dynamized medicines affected genes expressed during apoptosis. Mother tinctures as well as some dynamized medicines showed significant cytotoxicity to cells during short and long-term incubation. Potentiated alcohol control did not produce any cytotoxicity at concentrations studied. The dynamized medicines were found to inhibit CHO cell colony formation and thymidine uptake in L929 cells and those of Thuja, Hydrastis and Carcinosinum were found to induce apoptosis in DLA cells. Moreover, dynamized Carcinosinum was found to induce the expression of p53 while dynamized Thuja produced characteristic laddering pattern in agarose gel electrophoresis of DNA. These results indicate that dynamized medicines possess cytotoxic as well as apoptosis-inducing properties.

  9. Pasteurella haemolytica leukotoxin induces histamine release from bovine pulmonary mast cells.

    OpenAIRE

    Adusu, T E; Conlon, P D; Shewen, P.E.; Black, W D

    1994-01-01

    Pasteurella haemolytica A1 leukotoxic culture supernatant was evaluated for its ability to induce histamine release from bovine pulmonary mast cells isolated by enzymatic dispersion of lung tissue. Histamine was measured by a radioimmunoassay technique. Leukotoxic culture supernatant of P. haemolytica significantly released histamine in a time and concentration-related manner. This effect was lost when culture supernatant was heat-inactivated or preincubated with leukotoxin neutralizing rabbi...

  10. Expanding intestinal stem cells in culture

    NARCIS (Netherlands)

    Heo, Inha; Clevers, Hans

    2015-01-01

    Culturing intestinal stem cells into 3D organoids results in heterogeneous cell populations, reflecting the in vivo cell type diversity. In a recent paper published in Nature, Wang et al. established a culture condition for a highly homogeneous population of intestinal stem cells.

  11. Cell-free supernatants obtained from fermentation of cheese whey hydrolyzates and phenylpyruvic acid by Lactobacillus plantarum as a source of antimicrobial compounds, bacteriocins, and natural aromas.

    Science.gov (United States)

    Rodríguez-Pazo, Noelia; Vázquez-Araújo, Laura; Pérez-Rodríguez, Noelia; Cortés-Diéguez, Sandra; Domínguez, José Manuel

    2013-10-01

    Cheese whey hydrolyzates supplemented with phenylpyruvic acid (PPA) and commercial nutrients can be efficiently metabolized by Lactobacillus plantarum CECT-221 to biosynthesize some compounds with attractive applications in the food market. The main metabolites of cell-free extracts were antimicrobial compounds such as phenyllactic acid (PLA) and lactic acid (LA). The production of PLA by L. plantarum CECT-221 was evaluated in the Man-Rogosa-Sharpe broth supplemented with two biosynthetic precursors: phenylalanine or PPA. Using 30.5 mM PPA, the microorganism increased sevenfold the concentration of PLA producing 16.4 mM PLA in 46 h. A concentration of 40 mM PPA was a threshold to avoid substrate inhibition. The biosynthesis of whey hydrolyzates as a carbon source was enhanced by fed-batch fermentation of PPA; the average productivity of PLA increased up to 45.4 ± 3.02 mM after 120 h with a product yield of 0.244 mM mM(-1); meanwhile, LA reached 26.1 ± 1.3 g L(-1) with a product yield of 0.72 g g(-1). Cell-free fed-batch extracts charged in wells showed bacteriocin activity with halos of 7.49 ± 1.44 mm in plates inoculated with Carnobacterium piscicola and antimicrobial activity against Staphylococcus aureus (11.54 ± 1.14 mm), Pseudomonas aeruginosa (10.17 ± 2.46 mm), Listeria monocytogenes (7.75 ± 1.31 mm), and Salmonella enterica (3.60 ± 1.52 mm). Additionally, the analysis of the volatile composition of the headspace of this cell-free extract revealed that L. plantarum is a potential producer for natural aromas, such as acetophenone, with high price in the market. This is the first report of PLA production from cheese whey and PPA. The extracts showed bacteriocin activity and potential to be applied as an antimicrobial in the elaboration of safer foods. PMID:23934083

  12. Fluorescence Spectrum and Decay Measurement for Hsil VS Normal Cytology Differentiation in Liquid Pap Smear Supernatant

    Science.gov (United States)

    Vaitkuviene, A.; Gegzna, V.; Juodkazis, S.; Jursenas, S.; Miasojedovas, S.; Kurtinaitiene, R.; Rimiene, J.; Vaitkus, J.

    2009-06-01

    Cervical smear material contains endo and exocervical cells, mucus and inflammative, immune cells in cases of pathology. Just not destroyed keratinocytes lay on the glass for microscopy. Liquid cytology supernatant apart other diagnostics could be used for photodiagnostic. The spectroscopic parameters suitable for Normal and HSIL cytology groups supernatant differentiation are demonstrated. The dried liquid PAP supernatant fractions—sediment and liquid were investigated. Excitation and emission matrices (EEM), supernatant fluorescence decay measured under 280 nm diode short pulse excitation and fluorescence spectroscopy by excitation with 355 nm laser light were analyzed. The differences between Normal and HSIL groups were statistically proven in the certain spectral regions. Fluorescence decay peculiarities show spectral regions consisting of few fluorophores. Obtained results on fluorescence differences in Normal and HSIL groups' supernatant shows the potency of photodiagnosis application in cervical screening.

  13. Endogenous lectins from cultured soybean cells: isolation of a protein immunologically cross-reactive with seed soybean agglutinin and analysis of its role in binding of Rhizobium japonicum

    OpenAIRE

    1986-01-01

    Incubation of Rhizobium japonicum with the cultured soybean cell line SB-1, originally derived from the roots of Glycine max, resulted in specific adhesion of the bacteria to the plant cells. This binding interaction appears to be mediated via carbohydrate recognition, since galactose can inhibit the heterotypic adhesion but glucose cannot. Affinity chromatography, on a Sepharose column derivatized with N- caproyl-galactosamine, of the supernatant fraction of a SB-1 cell suspension after enzy...

  14. Mechanism of the clinical effects of uv-irradiated blood: stimulation of dna synthesis by human cells in culture

    International Nuclear Information System (INIS)

    This paper studies the DNA-synthetic activity of hyman embryonic cells (EC) cultured in the presence of supernatants from intact and irradiated cell fractions of blood or plasma. Human EC obtained from abortion material were incubated; after incubation, tritium-thymidine was added to the growth medium for 30 min. It is shown that stimulation of DNA synthesis in EC growing in the presence of supernatants from irradiated whole blood is not connected with photoactivation of growth factors in the blood plasma, but takes place as a result of their release from the cells. Donated blood, irradiated with UV light of the same wavelength and within the same dose range as are used under clinical conditions (up to 1200 J/m2), possesses growth-stimulating properties

  15. Effects of Supernatant of CLEC2B Gene Overexpression in Jurkat Cells on the B16 Melanoma cell%CLEC2B基因过表达的Jurkat细胞培养上清液对黑素瘤细胞B16的影响

    Institute of Scientific and Technical Information of China (English)

    张峻岭; 徐士福; 柳君如; 程琳; ZHOU Youwen

    2012-01-01

    目的 将CLEC2B基因过表达的Jurkat细胞培养上清液作用于黑素瘤细胞,观察其上清液对黑素瘤细胞增殖、酪氨酸酶活性、黑素合成的影响,探讨CLEC2B基因在白癜风发病中的作用.方法 培养人淋巴瘤细胞Jurkat细胞和小鼠黑素瘤细胞B16,采用脂质体介导的方法瞬时转染CLEC2B重组质粒入Jurkat细胞,半定量RT-PCR法鉴定CLEC2B基因过表达;将其细胞培养上清液作用于黑素瘤细胞48h后,MTT法检测黑素瘤细胞的增殖情况,多巴氧化法检测酪氨酸酶活性,氢氧化钠裂解法检测黑素含量.结果 CLEC2B基因过表达的Jurkat细胞培养上清液作用后的黑素瘤细胞增殖比空载体组、正常对照组降低,差异有统计学意义(均P<0.05),CLEC2B过表达组黑素含量比空载体组、正常对照组减少,差异有统计学意义(均P<0.05),CLEC2B过表达组、空载体组、正常对照组之间的酪氨酸酶活性比较差异无统计学意义(均P>0.05),空载体组与正常对照组比较差异均无统计学意义(均P>0.05).结论 CLEC2B基因过表达的Jurkat细胞培养上清液对黑素细胞的增殖和黑素合成有一定的抑制作用,对酪氨酸酶活性影响不明显.提示CLEC2B可能通过调节淋巴细胞功能间接影响黑素细胞增殖和黑素合成,从而参与白癜风发病.%Objective The melanoma cells were treated with culture supernatant of CLEC2B gene overexpression in Jurkat cells, to observe the impact of melanoma proliferation, the activity of tyrosinase and melanin synthesis, for searching CLEC2B gene participated in the vitiligo. Methods In this study, Jurkat cells were transfected with recombinant plasmid pGCMV/EGFP/Neo-CLEC2B by DMRIE-C Reagent. RT-PCR identified CLEC2B gene overexpression. After 48 h transfection, the melanoma cells were treated with their culture supernatant for 48 h, then the proliferation of melanoma cells were detected by MTT, the activity of tyrosinase was detected by

  16. Cell Culture as an Alternative in Education.

    Science.gov (United States)

    Nardone, Roland M.

    1990-01-01

    Programs that are intended to inform and provide "hands-on" experience for students and to facilitate the introduction of cell culture-based laboratory exercises into the high school and college laboratory are examined. The components of the CellServ Program and the Cell Culture Toxicology Training Programs are described. (KR)

  17. In vitro culture of human thyroid cells

    International Nuclear Information System (INIS)

    Procedures for establishing primary cultures of human thyroid tissue are described. Tissues removed surgically from patients with papillary carcinoma (PC), follicular adenoma (FA), or hyperthyroidism were grown in culture. In addition, normal cells were separated from the margins of excised tumors and were also cultured. For each gram of thyroid tissue cultured, more than 1 x 105 cells attached to culture dishes. A mixture of 2.5 % fetal bovine serum supplemented with insulin, hydrocortisone, transferrin, glycl-1-histidyl-L-lysine acetate, somatostatin and epidermal growth factor was added to nutrient media containing equal parts of Ham's F-12 and minimum essential medium (αMEM). Complete medium selectively supported epithelial cell growth while restricting fibroblast cell growth, especially during the first two weeks of the primary culture. Cells were stimulated with thyroid stimulating hormone (TSH) and produced raised levels of cAMP and thyroid hormone (T3). Culture conditions that affected the response of cells to X-rays were identified. During the culture period, first and second passage cells were compared for differences in their radiosensitivities. In all cases, cells showed differences in their responses to radiation depending on the cell passage number. However, results of replicate experiments of first passage cells that were exposed to X-rays showed good agreement between experiments. This technique makes it possible to quantitate the effects of chemical and physical cytotoxic agents on proliferating human thyroid epithelial cells. (author)

  18. Culture of Cells from Amphibian Embryos.

    Science.gov (United States)

    Stanisstreet, Martin

    1983-01-01

    Describes a method for in vitro culturing of cells from amphibian early embryos. Such cells can be used to demonstrate such properties of eukaryote cells as cell motility, adhesion, differentiation, and cell sorting into tissues. The technique may be extended to investigate other factors. (Author/JN)

  19. Advantages of embryogenic cell cultures of Gramineae

    International Nuclear Information System (INIS)

    Immature embryos and/or explants from very young leaves and inflorescences of 13 species and over 75 cultivars of Gramineae - including wheat, maize, rye, pearl millet, sugar-cane, Napier grass, Guinea grass, etc. - were used to initiate callus cultures. The cultures are white to yellowish white in colour, compact and contain small and thin-walled meristematic cells which are richly cytoplasmic, non-vacuolated and contain prominent starch grains. These embryogenic tissue cultures provide a long-term, highly reliable and efficient means of rapid mass clonal propagation by the formation of somatic embryos that arise from single cells. The cultures consist largely of cytologically normal diploid cells. During the process of plant regeneration via somatic embryogenesis, there is strong selection in favour of normal cells, so that plants recovered from such cultures neither exhibit any morphological abnormalities nor show any evidence of cytological changes in the number or structure of chromosomes. Embryogenic callus cultures have been used successfully to establish highly dispersed and friable cell-suspension cultures. These fast-growing cultures comprise groups of 2-6 embryogenic cells, which adhere together to form larger unorganized aggregates of up to about 75 cells, but do not contain any organized meristems or callus tissues. Plants were regenerated by somatic embryogenesis from embryogenic cell-suspension cultures of pearl millet, Guinea grass, sugar-cane and maize. Finally, embryogenic cell-suspension cultures are the only current source of totipotent protoplasts in Gramineae. Protoplasts isolated from such cultures have been successfully cultured to produce somatic embryos and plants in pearl millet, Guinea grass, Napier grass and sugar-cane. (author)

  20. Cell Suspension Culture of Neem Tree

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The establishment of suspension culture system for neem (Azadirachta indica A. Juss) cells and the suspension culture condition was studied. It shows that the neem cell suspension culture system was best in B5 liquid medium, 2.0~4.0mg/L NAA with direct spill method. Based on the integrated analysis of cell biomass, Azadirachtin content and productivity, the optimum culture conditions were B5 liquid medium, 2.0-4.0 mg/L NAA, 3% sucrose at 25 ℃. The optimum rotating speed of the shaker and broth content d...

  1. 9 CFR 101.6 - Cell cultures.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Cell cultures. 101.6 Section 101.6 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS DEFINITIONS § 101.6 Cell cultures. When used in conjunction with or in reference...

  2. Callus and cell suspension cultures of carnation

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1972-01-01

    . Cell suspension cultures worked best in media containing 2,4-D in which they had a doubling time of about 2 days. Filtered suspensions were successfully plated on agar in petri dishes, but division was never observed in single cells. The cultures initiated roots at higher concentrations of IAA or NAA...

  3. Plant cell cultures and their biotechnological potential

    Energy Technology Data Exchange (ETDEWEB)

    Barz, W.; Ellis, B.E.

    1981-01-01

    The potential of plant cell suspension cultures for the biotechnological production of high-cost, plant-specific compounds is critically evaluated. The basic roles of nutrient media and phytohormones are described followed by a description of the recent progress in mass cultivation of plant cell cultures as measured by biomass and doubling time. The accumulation of secondary constituents in cell cultures is reviewed and methods for the selection of high-producing strains are described. The essential features of the selection strategy are the establishment of cell cultures from high-producing plants and a sensitive assay (e.g. radio-immunoassay) for the screening of microcolonies grown on petri dishes. The accumulation of biosynthetic intermediates of secondary constituents in cell culture strains will possibly lead to the isolation of novel compounds.

  4. Studying cell-cell communication in co-culture

    OpenAIRE

    Bogdanowicz, Danielle R.; Lu, Helen H.

    2013-01-01

    Heterotypic and homotypic cellular interactions are essential for biological function, and co-culture models are versatile tools for investigating these cellular interactions in vitro. Physiologically relevant co-culture models have been used to elucidate the effects of cell-cell physical contact and/or secreted factors, as well as the influence of substrate geometry and interaction scale on cell response. Identifying the relative contribution of each cell population to co-culture is often ex...

  5. Cell Culture for Production of Insecticidal Viruses.

    Science.gov (United States)

    Reid, Steven; Chan, Leslie C L; Matindoost, Leila; Pushparajan, Charlotte; Visnovsky, Gabriel

    2016-01-01

    While large-scale culture of insect cells will need to be conducted using bioreactors up to 10,000 l scale, many of the main challenges for cell culture-based production of insecticidal viruses can be studied using small-scale (20-500 ml) shaker/spinner flasks, either in free suspension or using microcarrier-based systems. These challenges still relate to the development of appropriate cell lines, stability of virus strains in culture, enhancing virus yields per cell, and the development of serum-free media and feeds for the desired production systems. Hence this chapter presents mainly the methods required to work with and analyze effectively insect cell systems using small-scale cultures. Outlined are procedures for quantifying cells and virus and for establishing frozen cells and virus stocks. The approach for maintaining cell cultures and the multiplicity of infection (MOI) and time of infection (TOI) parameters that should be considered for conducting infections are discussed.The methods described relate, in particular, to the suspension culture of Helicoverpa zea and Spodoptera frugiperda cell lines to produce the baculoviruses Helicoverpa armigera nucleopolyhedrovirus, HearNPV, and Anticarsia gemmatalis multicapsid nucleopolyhedrovirus, AgMNPV, respectively, and the production of the nonoccluded Oryctes nudivirus, OrNV, using an adherent coleopteran cell line. PMID:27565495

  6. Emulsions Containing Perfluorocarbon Support Cell Cultures

    Science.gov (United States)

    Ju, Lu-Kwang; Lee, Jaw Fang; Armiger, William B.

    1990-01-01

    Addition of emulsion containing perfluorocarbon liquid to aqueous cell-culture medium increases capacity of medium to support mammalian cells. FC-40 Fluorinert (or equivalent) - increases average density of medium so approximately equal to that of cells. Cells stay suspended in medium without mechanical stirring, which damages them. Increases density enough to prevent cells from setting, and increases viscosity of medium so oxygen bubbled through it and nutrients stirred in with less damage to delicate cells.

  7. Constructing a High Density Cell Culture System

    Science.gov (United States)

    Spaulding, Glenn F. (Inventor)

    1996-01-01

    An annular culture vessel for growing mammalian cells is constructed in a one piece integral and annular configuration with an open end which is closed by an endcap. The culture vessel is rotatable about a horizontal axis by use of conventional roller systems commonly used in culture laboratories. The end wall of the endcap has tapered access ports to frictionally and sealingly receive the ends of hypodermic syringes. The syringes permit the introduction of fresh nutrient and withdrawal of spent nutrients. The walls are made of conventional polymeric cell culture material and are subjected to neutron bombardment to form minute gas permeable perforations in the walls.

  8. 3D Cell Culture in Alginate Hydrogels

    Directory of Open Access Journals (Sweden)

    Therese Andersen

    2015-03-01

    Full Text Available This review compiles information regarding the use of alginate, and in particular alginate hydrogels, in culturing cells in 3D. Knowledge of alginate chemical structure and functionality are shown to be important parameters in design of alginate-based matrices for cell culture. Gel elasticity as well as hydrogel stability can be impacted by the type of alginate used, its concentration, the choice of gelation technique (ionic or covalent, and divalent cation chosen as the gel inducing ion. The use of peptide-coupled alginate can control cell–matrix interactions. Gelation of alginate with concomitant immobilization of cells can take various forms. Droplets or beads have been utilized since the 1980s for immobilizing cells. Newer matrices such as macroporous scaffolds are now entering the 3D cell culture product market. Finally, delayed gelling, injectable, alginate systems show utility in the translation of in vitro cell culture to in vivo tissue engineering applications. Alginate has a history and a future in 3D cell culture. Historically, cells were encapsulated in alginate droplets cross-linked with calcium for the development of artificial organs. Now, several commercial products based on alginate are being used as 3D cell culture systems that also demonstrate the possibility of replacing or regenerating tissue.

  9. Methods for Maintaining Insect Cell Cultures

    OpenAIRE

    Dwight E. Lynn

    2002-01-01

    Insect cell cultures are now commonly used in insect physiology, developmental biology, pathology, and molecular biology. As the field has advanced from methods development to a standard procedure, so has the diversity of scientists using the technique. This paper describes methods that are effective for maintaining various insect cell lines. The procedures are differentiated between loosely or non-attached cell strains, attached cell strains, and strongly adherent cell strains.

  10. Ambroxol inhibits rhinovirus infection in primary cultures of human tracheal epithelial cells.

    Science.gov (United States)

    Yamaya, Mutsuo; Nishimura, Hidekazu; Nadine, Lusamba Kalonji; Ota, Chiharu; Kubo, Hiroshi; Nagatomi, Ryoichi

    2014-04-01

    The mucolytic drug ambroxol hydrochloride reduces the production of pro-inflammatory cytokines and the frequency of exacerbation in patients with chronic obstructive pulmonary disease (COPD). However, the inhibitory effects of ambroxol on rhinovirus infection, the major cause of COPD exacerbations, have not been studied. We examined the effects of ambroxol on type 14 rhinovirus (RV14) infection, a major RV group, in primary cultures of human tracheal epithelial cells. RV14 infection increased virus titers and cytokine content in the supernatants and RV14 RNA in the cells. Ambroxol (100 nM) reduced RV14 titers and cytokine concentrations of interleukin (IL)-1β, IL-6 and IL-8 in the supernatants and RV14 RNA in the cells after RV14 infection, in addition to reducing susceptibility to RV14 infection. Ambroxol also reduced the expression of intercellular adhesion molecule-1 (ICAM-1), the receptor for RV14, and the number of acidic endosomes from which RV14 RNA enters the cytoplasm. In addition, ambroxol reduced the activation of the transcription factor nuclear factor kappa B (NF-κB) in the nucleus. These results suggest that ambroxol inhibits RV14 infection partly by reducing ICAM-1 and acidic endosomes via the inhibition of NF-κB activation. Ambroxol may modulate airway inflammation by reducing the production of cytokines in rhinovirus infection. PMID:23856970

  11. Callus and cell suspension cultures of carnation

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1972-01-01

    Callus cultures of carnation, Dianthus caryophyllus L. ev. G. J. Sim, were grown on a synthetic medium of half strength Murashige and Skoog salts, 3 % sucrose, 100 mg/l of myo-inositol, 0.5 mg/l each of thiamin, HCl, pyridoxin, HCl and nicotinic acid and 10 g/l agar. Optimal concentrations of....... Cell suspension cultures worked best in media containing 2,4-D in which they had a doubling time of about 2 days. Filtered suspensions were successfully plated on agar in petri dishes, but division was never observed in single cells. The cultures initiated roots at higher concentrations of IAA or NAA...

  12. Cell culture models for study of differentiated adipose cells

    OpenAIRE

    Clynes, Martin

    2014-01-01

    Adipose cells are an important source of mesenchymal stem cells and are important for direct use in research on lipid metabolism and obesity. In addition to use of primary cultures, there is increasing interest in other sources of larger numbers of cells, using approaches including induced pluripotent stem cell differentiation and viral immortalisation.

  13. In vitro differentiation of MSCs into retina-like cells by the supernatant fluid of light-injured neurosensory retina%光损伤鼠视网膜片培养上清液诱导 MSCs 分化为视网膜样细胞的研究

    Institute of Scientific and Technical Information of China (English)

    白月; 徐国兴

    2014-01-01

    AIM: To explore the possibility of inducing rat mesenchymal stem cells ( MSCs) into retina-like cells by the supernatant fluid of light-injured neurosensory retina in vitro. METHODS: MSCs were isolated and attached to the wall of culture dishes by their specific adherent ability. Then the cells were characterized by flow cytometry.The neurosensory retina was isolated from retina of SD rat and it was tested by hematoxylin-eosin ( HE ) staining.The pathological changes of light-injured neurosensory retina was observed under transmission electron microscope. Three kinds of supernatant fluid of light -injured neurosensory retina of SD rats were prepared.The third passage of MSCs were cultured with these mixed medium for 7-8d, we used RT-PCR to see whether they could express rhodopsin, neuron-specific enolase (NSE), and glial fibrillary acidic protein ( GFAP ) , and positive cells were counted and analyzed. RESULTS: HE staining showed the retinal sheets included full-thickness neural retina.Neurosensory retina developed ultrastructural destructions by light injury.RT-PCR showed that the medium of mixed I expressed higher positive rate of rhodopsin (0.3915±0.00644), NSE (0.2019± 0.00682), GFAP (0.1972 ±0.00211) than the medium of mixed Ⅱ rhodopsin (0.0983 ±0.00319), NSE (0.1048 ± 0.00323), GFAP (0.1040±0.00254) and medium of mixedⅢrhodopsin(0.0044±0.00126), NSE (0.0498±0.00149), GFAP (0.0467±0.00333).The difference of intergroup has statistical significance. CONCLUTION:The supernatant fluid of light-injured neurosensory retina of SD rats can induce MSCs to differentiate into retina-like cells and provide new insights of stem cell therapy for retinopathy.%目的:应用大鼠视网膜片光损伤后的培养上清液,在体外诱导大鼠骨髓间充质干细胞( mesenchymal stem cells , MSCs)成为视网膜样细胞的可能性。  方法:贴壁筛选法分离、培养大鼠MSCs ,流式细胞仪对其细胞纯度鉴定。取材大鼠视网

  14. Human cell culture in a space bioreactor

    Science.gov (United States)

    Morrison, Dennis R.

    1988-01-01

    Microgravity offers new ways of handling fluids, gases, and growing mammalian cells in efficient suspension cultures. In 1976 bioreactor engineers designed a system using a cylindrical reactor vessel in which the cells and medium are slowly mixed. The reaction chamber is interchangeable and can be used for several types of cell cultures. NASA has methodically developed unique suspension type cell and recovery apparatus culture systems for bioprocess technology experiments and production of biological products in microgravity. The first Space Bioreactor was designed for microprocessor control, no gaseous headspace, circulation and resupply of culture medium, and slow mixing in very low shear regimes. Various ground based bioreactors are being used to test reactor vessel design, on-line sensors, effects of shear, nutrient supply, and waste removal from continuous culture of human cells attached to microcarriers. The small Bioreactor is being constructed for flight experiments in the Shuttle Middeck to verify systems operation under microgravity conditions and to measure the efficiencies of mass transport, gas transfer, oxygen consumption and control of low shear stress on cells.

  15. Melphalan metabolism in cultured cells

    International Nuclear Information System (INIS)

    Procedures are presented for the adaptation of reversed-phase-HPLC methods to accomplish separation and isolation of the cancer therapeutic drug melphalan (L-phenylalanine mustard) and its metabolic products from whole cells. Five major degradation products of melphalan were observed following its hydrolysis in phosphate buffer in vitro. The two most polar of these products (or modifications of them) were also found in the cytosol of Chinese hamster CHO cells. The amounts of these two polar products (shown not to be mono- or dihydroxymelphalan) were significantly changed by the pretreatment of cells with ZnC12, one being increased in amount while the other was reduced to an insignificant level. In ZnC12-treated cells, there was also an increased binding of melphalan (or its derivatives) to one protein fraction resolved by gel filtration-HPLC. These observations suggest that changes in polar melphalan products, and perhaps their interaction with a protein, may by involved in the reduction of melphalan cytotoxicity observed in ZnC12-treated cells. While ZnC12 is also known to increase the level of glutathione in cells, no significant amounts of glutathione-melphalan derivatives of the type formed non-enzymatically in vitro could be detected in ZnC12-treated or untreated cells. Formation of derivatives of melphalan with glutathione catabolic products in ZnC12-treated cells has not yet been eliminated, however. 17 refs., 5 figs., 1 tab

  16. Increasing cell culture population doublings for long-term growth of finite life span human cell cultures

    Science.gov (United States)

    Stampfer, Martha R; Garbe, James C

    2015-02-24

    Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.

  17. Increasing cell culture population doublings for long-term growth of finite life span human cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Stampfer, Martha R.; Garbe, James C.

    2016-06-28

    Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.

  18. [CO-CULTURE OF BOAR SPERMATOGONIAL CELLS WITH SERTOLI CELLS].

    Science.gov (United States)

    Savchenkova, I P; Vasil'eva, S A

    2016-01-01

    In the present study, we developed in vitro culture conditions using co-culture of boar spermatogonial cells with Sertoli cells. Testes from 60-day-old crossbred boar were used. A spermatogonia-enriched culture was achieved by enzymatic digestion method and purification by density gradient centrifugation using a discontinuous Percoll gradient and differentiated adherence technique. Lipid drops were detected in isolated Sertoli cells by Oil Red O staining. We have found that the cultivation of boar spermatogonia in the presence of Sertoli cells (up to 35 days) leads to their differentiation as well as in vivo in testis. Association of cells in groups, formation of chains and suspension clusters of the spermatogenic cells were observed on the 10th day. Spermatogonial cellular colonies were noted at the same time. These cellular colonies were analyzed for the expression of genes: Nanog and Plzf in RT PCR. The expression of the Nanog gene in the experimental cellular clones obtained by short-term culture of spermatogonial cells in the presence of Sertoli cells was 200 times higher than the expression of this gene in the freshly isolated spermatogonial cells expression was found in freshly isolated germ cells and in cellular clones derived in vitro. We have found that, in the case of longer cultivation of these cells on Sertoli cells, in vitro process of differentiation of germ cells and formation of single mobile boar spermatozoa occurs at 30-33 days. Cellular population is heterogeneous at this stage. Spermatogenic differentiation in vitro without Sertoli cells stays on the 7th day of cultivation. The results show that co-culture of boar spermatogonia-enriched cells with Sertoli cells can induce their differentiation into spermatozoa in vitro and facilitate obtaining of porcine germ cell culture. PMID:27228660

  19. Genipin inhibits endothelial exocytosis via nitric oxide in cultured human umbilical vein endothelial cells

    Institute of Scientific and Technical Information of China (English)

    Guang-fa WANG; Shao-yu WU; Jin-jun RAO; Lin L(U); Wei XU; Jian-xin PANG; Zhong-qiu LIU; Shu-guang WU; Jia-jie ZHANG

    2009-01-01

    Aim: Exocytosis of endothelial Weibel-Palade bodies, which contain von Willebrand factor (VWF), P-selectin and other modulators, plays an important role in both inflammation and thrombosis. The present study investigates whether genipin,an aglycon of geniposide, inhibits endothelial exocytosis.Methods: Human umbilical vein endothelial cells (HUVECs) were isolated from umbilical cords and cultured. The concentration of VWF in cell supernatants was measured using an ELISA Kit. P-selectin translocation on the cell surface was analyzed by cell surface ELISA. Cell viability was measured using a Cell Counting Kit-8. Mouse bleeding times were measured by amputating the tail tip. Western blot analysis was used to determine the amount of endothelial nitric oxide synthase (eNOS) and phospho-eNOS present. Nitric oxide (NO) was measured in the cell supernatants as nitrite using an NO Colorimetric Assay.Results: Genipin inhibited thrombin-induced VWF release and P-selectin translocation in HUVECs in a dose- and time-dependent manner. The drug had no cytotoxic effect on the cells at the same doses that were able to inhibit exocytosis. The functional study that demonstrated that genipin inhibited exocytosis in vivo also showed that genipin prolonged the mouse bleeding time. Furthermore, genipin activated eNOS phosphorylation, promoted enzyme activation and increased NO production. L-NAME, an inhibitor of NOS, reversed the inhibitory effects of genipin on endothelial exocytosis.Conclusion: Genipin inhibits endothelial exocytosis in HUVECs. The mechanism by which this compound inhibits exocytosis may be related to its ability to stimulate eNOS activation and NO production. Our findings suggest a novel antiinflammatory mechanism for genipin. This compound may represent a new treatment for inflammation and/or thrombosis in which excess endothelial exocytosis plays a pathophysiological role.

  20. Cell culture experiments planned for the space bioreactor

    Science.gov (United States)

    Morrison, Dennis R.; Cross, John H.

    1987-01-01

    Culturing of cells in a pilot-scale bioreactor remains to be done in microgravity. An approach is presented based on several studies of cell culture systems. Previous and current cell culture research in microgravity which is specifically directed towards development of a space bioprocess is described. Cell culture experiments planned for a microgravity sciences mission are described in abstract form.

  1. Colorimetric growth assay for epidermal cell cultures by their crystal violet binding capacity.

    Science.gov (United States)

    Bonnekoh, B; Wevers, A; Jugert, F; Merk, H; Mahrle, G

    1989-01-01

    The application of a simple, rapid, and inexpensive colorimetric growth assay was tested for human epidermal cells subcultured in uncoated plastic dishes. Cell layers were incubated with a crystal violet (CV) solution (0.2% with ethanol 2% in 0.5 M Tris-Cl buffer, pH 7.8) for 10 min at room temperature. After rinsing with 0.5 M Tris-Cl (pH 7.8) the cell layer was dried and decolorized with a sodium-dodecylsulfate solution (0.5% with ethanol 50% in 0.5 M Tris-Cl, pH 7.8) for 60 min at 37 degrees C. The extinction of the supernatant was read at the absorption maximum of 586 nm. The protein content of attached cells as classical parameter for quantifying cell growth was strongly related to CV extinction with a correlation coefficient of r = 0.98. Furthermore, the subcellular protein binding qualities of CV were analyzed. The water-soluble protein fraction of cultured epidermal cells was separated by sodium-dodecylsulfate polyacrylamide gel electrophoresis and stained with CV. We found a staining pattern which was qualitatively very similar to that of Coomassie blue, however less intense. Keratin electrophoresis revealed an affinity of CV to the 48, 50, and 56 kD cytokeratins. In conclusion, this CV assay is a reliable and simple method for the monitoring of epidermal cell growth in cultures. PMID:2482013

  2. Probiotic modulation of dendritic cells co-cultured with intestinal epithelial cells

    Institute of Scientific and Technical Information of China (English)

    Ji Yeun Kim; Myeong Soo Park; Geun Eog Ji

    2012-01-01

    AIM:TO investigate cytokine production and cell surface phenotypes of dendritic cells (DC) in the presence of epithelial cells stimulated by probiotics.METHODS:Mouse DC were cultured alone or together with mouse epithelial cell monolayers in normal or inverted systems and were stimulated with heat-killed probiotic bacteria,Bifidobacteriumlactis AD011 (BL),Bifidobacterium bifidum BGN4 (BB),Lactobacillus casei IBS041 (LC),and Lactobacillus acidophilus AD031 (LA),for 12 h.Cytokine levels in the culture supernatants were determined by enzyme-linked immunosorbent assay and phenotypic analysis of DC was investigated by flow cytometry.RESULTS:BB and LC in single-cultured DC increased the expression of I-Ad,CD86 and CD40 (I-Ad,18.51 vs 30.88,46.11; CD86,62.74 vs 92.7,104.12; CD40,0.67vs 6.39,3.37,P < 0.05).All of the experimental probiotics increased the production of inflammatory cytokines,interleukin (IL)-6 and tumor necrosis factor (TNF)-α.However,in the normal co-culture systems,LC and LA decreased the expression of I-Ad (39.46 vs 30.32,33.26,P < 0.05),and none of the experimental probiotics increased the levels of IL-6 or TNF-α.In the inverted coculture systems,LC decreased the expression of CD40 (1.36 vs-2.27,P < 0.05),and all of the experimental probiotics decreased the levels of IL-6.In addition,BL increased the production of IL-10 (103.8 vs 166.0,P< 0.05) and LC and LA increased transforming growth factor-3 secretion (235.9 vs 618.9,607.6,P < 0.05).CONCLUSION:These results suggest that specific probiotic strains exert differential immune modulation mediated by the interaction of dendritic cells and epithelial cells in the homeostasis of gastrointestinal tract.

  3. A biocompatible micro cell culture chamber (mu CCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, Anders Michael;

    2006-01-01

    We have previously shown that a polymeric (PMMA) chip with medium perfusion and integrated heat regulation provides sufficiently precise heat regulation, pH-control and medium exchange to support cell growth for weeks. However, it was unclear how closely the cells cultured in the chip resembled...... cells cultured in the culture flask. In the current study, gene expression profiles of cells cultured in the chip were compared with gene expression profiles of cells cultured in culture flasks. The results showed that there were only two genes that were differently expressed in cells grown in the cell...... culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...

  4. A biocompatible micro cell culture chamber (microCCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, A M;

    2006-01-01

    We have previously shown that a polymeric (PMMA) chip with medium perfusion and integrated heat regulation provides sufficiently precise heat regulation, pH-control and medium exchange to support cell growth for weeks. However, it was unclear how closely the cells cultured in the chip resembled...... cells cultured in the culture flask. In the current study, gene expression profiles of cells cultured in the chip were compared with gene expression profiles of cells cultured in culture flasks. The results showed that there were only two genes that were differently expressed in cells grown in the cell...... culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...

  5. An animal cell culture: Advance technology for modern research

    OpenAIRE

    Sarita Khare; Rajeev Nema

    2012-01-01

    At the present time animal cell culture is more significant and multifarious application tool for current research streams. A lot of field assorted from animal cell culture such: stem cell biology, IVF technology, cancer cell biology, monoclonal antibody production, recombinant protein production, gene therapy, vaccine manufacturing, novel drug selection and improvement. In this review conclude animal cell culture as well as its requirements

  6. BOVINE SPLENIC NK CELLS SYNTHESIZE IFN-GAMMA IN RESPONSE TO IL-12-CONTAINING SUPERNATANTS FROM BABESIA BOVIS-EXPOSED MONOCYTE CULTURES

    Science.gov (United States)

    The spleen is a critical effector organ functioning in hemoparasitic diseases like babesiosis, to destroy the pathogen and clear the host of infected erythrocytes. It has an important role in both innate and adaptive immune responses. Young calves demonstrate a strong spleen-dependent innate respons...

  7. Wnt-Dependent Control of Cell Polarity in Cultured Cells.

    Science.gov (United States)

    Runkle, Kristin B; Witze, Eric S

    2016-01-01

    The secreted ligand Wnt5a regulates cell polarity and polarized cell movement during development by signaling through the poorly defined noncanonical Wnt pathway. Cell polarity regulates most aspects of cell behavior including the organization of apical/basolateral membrane domains of epithelial cells, polarized cell divisions along a directional plane, and front rear polarity during cell migration. These characteristics of cell polarity allow coordinated cell movements required for tissue formation and organogenesis during embryonic development. Genetic model organisms have been used to identify multiple signaling pathways including Wnt5a that are required to establish cell polarity and regulate polarized cell behavior. However, the downstream signaling events that regulate these complex cellular processes are still poorly understood. The methods below describe assays to study Wnt5a-induced cell polarity in cultured cells, which may facilitate our understanding of these complex signaling pathways. PMID:27590152

  8. Cell Cycle Progression of Human Cells Cultured in Rotating Bioreactor

    Science.gov (United States)

    Parks, Kelsey

    2009-01-01

    Space flight has been shown to alter the astronauts immune systems. Because immune performance is complex and reflects the influence of multiple organ systems within the host, scientists sought to understand the potential impact of microgravity alone on the cellular mechanisms critical to immunity. Lymphocytes and their differentiated immature form, lymphoblasts, play an important and integral role in the body's defense system. T cells, one of the three major types of lymphocytes, play a central role in cell-mediated immunity. They can be distinguished from other lymphocyte types, such as B cells and natural killer cells by the presence of a special receptor on their cell surface called T cell receptors. Reported studies have shown that spaceflight can affect the expression of cell surface markers. Cell surface markers play an important role in the ability of cells to interact and to pass signals between different cells of the same phenotype and cells of different phenotypes. Recent evidence suggests that cell-cycle regulators are essential for T-cell function. To trigger an effective immune response, lymphocytes must proliferate. The objective of this project is to investigate the changes in growth of human cells cultured in rotating bioreactors and to measure the growth rate and the cell cycle distribution for different human cell types. Human lymphocytes and lymphoblasts will be cultured in a bioreactor to simulate aspects of microgravity. The bioreactor is a cylindrical culture vessel that incorporates the aspects of clinostatic rotation of a solid fluid body around a horizontal axis at a constant speed, and compensates gravity by rotation and places cells within the fluid body into a sustained free-fall. Cell cycle progression and cell proliferation of the lymphocytes will be measured for a number of days. In addition, RNA from the cells will be isolated for expression of genes related in cell cycle regulations.

  9. Integrated biosensors for cell culture monitoring

    OpenAIRE

    De Micheli, Giovanni; Boero, Cristina; Olivo, Jacopo; Carrara, Sandro

    2014-01-01

    Biosensors for endogenous compounds, such as glucose and lactate, are applied to monitor cell cultures. Cells can be cultivated for several purposes, such as understanding and modeling some biological mechanisms, the development of new drugs and therapies, and in the field of regenerative medicine. We have realized a self-contained monitoring system with remote readout. Metabolite detection is based on oxidases immobilized onto carbon nanotubes. We calibrate the system for glucose and lactate...

  10. A novel cell growth-promoting factor identified in a B cell leukemia cell line, BALL-1

    International Nuclear Information System (INIS)

    A novel leukemia cell growth-promoting activity has been identified in the culture supernatant from a human B cell leukemia cell line, BALL-1. The supernatant from unstimulated cultures of the BALL-1 cells significantly promoted the growth of 16 out of 24 leukemia/lymphoma cell lines of different lineages (T, B and non-lymphoid) in a minimal concentration of fetal bovine serum (FBS), and 5 out of 12 cases of fresh leukemia cells in FBS-free medium. The growth-promoting sieve filtration and dialysis. The MW of the factor was less than 10 kDa. The growth-promoting activity was heat and acid stable and resistant to trypsin treatment. The factor isolated from the BALL-1 supernatant was distinct from known polypeptide growth factors with MW below 10 kDa, such as epidermal growth factor, transforming growth factor α, insulin-like growth factor I (IGF-I), IGF-II and insulin, as determine by specific antibodies and by cell-growth-promoting tests. The factor is the BALL-1 supernatant did not promote the proliferation of normal human fresh peripheral blood lymphocytes or mouse fibroblast cell line, BALB/C 3T3. In addition to the BALL-1 supernatant, a similar growth-promoting activity was found in the culture supernatant from 13 of 17 leukemia/lymphoma cell lines tested. The activity in these culture supernatant promoted the growth of leukemia/lymphoma cell lines in autocrine and/or paracrine fashions. These observations suggest that the low MW cell growth-promoting activity found in the BALL-1 culture supernatant is mediated by a novel factor which may be responsible for the clonal expansion of particular leukemic clones. (author)

  11. Boildown Study on Supernatant Liquid Retrieved from AW-106 in December 2012

    Energy Technology Data Exchange (ETDEWEB)

    Page, Jason S.

    2013-06-04

    This document reports the results of a boildown study using a composite created from supernatant liquid grab samples retrieved from tank 241-AW-106 in December of 2012. The composite was made using predetermined volumes of the grab samples which accounted for layering of the supernatant liquid in the tank. The finished composite was a clear, yellow liquid containing no visible solids at hot cell ambient temperatures (24 - 27 °C). The density of the test composite was measured in the hot cell immediately before the boildown study and was 1.266 g/mL at 27.1 °C.

  12. Cell culture from sponges: pluripotency and immortality

    NARCIS (Netherlands)

    Caralt Bosch, de S.; Uriz, M.J.; Wijffels, R.H.

    2007-01-01

    Sponges are a source of compounds with potential pharmaceutical applications. In this article, methods of sponge cell culture for production of these bioactive compounds are reviewed, and new approaches for overcoming the problem of metabolite supply are examined. The use of embryos is proposed as a

  13. THE METHODS FOR MAINTAINING INSECT CELL CULTURES

    Science.gov (United States)

    Insect cell cultures are now commonly used in insect physiology, developmental biology, pathology, and molecular biology. As the field has advanced from a methods development to a standard procedure, so has the diversity of scientists using the technique. This paper describes techniques that are e...

  14. ANTHOCYANIN (ACN) STABILITY IN CELL CULTURE MEDIA

    Science.gov (United States)

    Anthocyanins (ACNs) are potential oxygen radical scavengers that have coronary vasoactive and vasoprotective properties. Cell or tissue culture systems have been used to examine the bioactivity and mechanisms of action of ACNs on the vascular system. However, due to their unique chemical structure, ...

  15. Cell Culture Microfluidic Biochips: Experimental Throughput Maximization

    DEFF Research Database (Denmark)

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan;

    2011-01-01

    Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory, integrating all necessary functionalities on-chip in order to perform biochemical applications. Researchers have started to propose computer-aided design tools for the synthesis of such biochips. Our focus...... Annealing metaheuristic for experimental design generation for the cell culture microfluidic biochips, and we have evaluated our approach using multiple experimental setups....

  16. Nanotechnology, Cell Culture and Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Kazutoshi Haraguchi

    2011-01-01

    Full Text Available We have fabricated new types of polymer hydrogels and polymer nanocomposites, i.e., nanocomposite gels (NC gels and soft, polymer nanocomposites (M-NCs: solid, with novel organic/inorganic network structures. Both NC gels and M-NCs were synthesized by in-situ free-radical polymerization in the presence of exfoliated clay platelets in aqueous systems and were obtained in various forms such as film, sheet, tube, coating, etc. and sizes with a wide range of clay contents. Here, disk-like inorganic clay nanoparticles act as multi-functional crosslinkers to form new types of network systems. Both NC gels and M-NCs have extraordinary optical and mechanical properties including ultra-high reversible extensibility, as well as a number of new characteristics relating to optical anisotropy, polymer/clay morphology, biocompatibility, stimuli-sensitive surfaces, micro-patterning, etc. For examples, the biological testing of medical devices, comprised of a sensitization test, an irritation test, an intracutaneous test and an in vitro cytotoxicity test,was carried out for NC gels and M-NCs. The safety of NC gels and M-NCs was confirmed in all tests. Also, the interaction of living tissue with NC gel was investigated in vivo by implantation in live goats; neither inflammation nor concrescence occurred around the NC gels. Furthermore, it was found that both N-NC gels consisting of poly(N-isopropylacrylamide(PNIPA/clay network and M-NCs consisting of poly(2-methoxyethyacrylate(PMEA/clay network show characteristic cell culture and subsequent cell detachment on their surfaces, although it was almost impossible to culture cells on conventional, chemically-crosslinked PNIPA hydrogels and chemically crossslinked PMEA, regardless of their crosslinker concentration. Various kinds of cells, such ashumanhepatoma cells (HepG2, normal human dermal fibroblast (NHDF, and human umbilical vein endothelial cells (HUVEC, could be cultured to be confluent on the surfaces of N

  17. Does VEGF concentration in pre-eclamptic serum induce sVCAM-1 production in endothelial cell culture?

    Directory of Open Access Journals (Sweden)

    Sri B. Subakir

    2005-03-01

    Full Text Available Serum concentrations of VEGF (Vascular Endothelial Growth Factor are elevated in preeclampsia. In addition to inducing mitosis and increase permeability of endothelial cells, VEGF was reported to activate endothelial cells to produce cell adhesion molecules. Cell adhesion molecules play an important role in the inflammation process by inducing adherence of leukocytes in blood stream to the endothelial cells. The aim of this study is to investigate the effect of VEGF in serum from preeclamptic patients on sVCAM-1 (soluble vascular adhesion molecules-1 production in endothelial cell culture. Twelve sera from women with preeclampsia and 11 from women with normal pregnancy (controls in 20% concentration were added to human umbilical vein endothelial cell culture (HUVEC and incubated for 24 hours. All subjects have agreed to participate in this study and signed the informed consent form. sVCAM-1 concentration in the supernatant was measured by ELISA. VEGF concentration tends to be higher in preeclamptic serum than control, but the difference is not stastitically significant. The production of sVCAM-1 by endothelial cells exposed to preeclamptic serum was significantly higher than the production by endothelial cells exposed to serum from control (p<0.05. No correlation was found between the difference in VEGF concentrations in preeclamptic and control sera, and sVCAM-1 production by endothelial cell culture. (Med J Indones 2005; 14: 3-6Keywords: endothelial cell, preeclampsia, VCAM, VEGF

  18. Cell culture models using rat primary alveolar type I cells.

    Science.gov (United States)

    Downs, Charles A; Montgomery, David W; Merkle, Carrie J

    2011-10-01

    There is a lack of cell culture models using primary alveolar type I (AT I) cells. The purpose of this study was to develop cell culture models using rat AT I cells and microvascular endothelial cells from the lung (MVECL). Two types of model systems were developed: single and co-culture systems; additionally a 3-dimensional model system was developed. Pure AT I cell (96.3 ± 2.7%) and MVECL (97.9 ± 1.1%) preparations were used. AT I cell morphology, mitochondrial number and distribution, actin filament arrangement and number of apoptotic cells at confluence, and telomere attrition were characterized. AT I cells maintained their morphometric characteristics through at least population doubling (PD) 35, while demonstrating telomere attrition through at least PD 100. Furthermore, AT I cells maintained the expression of their specific markers, T1α and AQ-5, through PD 42. For the co-cultures, AT I cells were grown on the top and MVECL were grown on the bottom of fibronectin-coated 24-well Transwell Fluroblok™ filter inserts. Neither cell type transmigrated the 1 μm pores. Additionally, AT I cells were grown in a thick layer of Matrigel(®) to create a 3-dimensional model in which primary AT I cells form ring-like structures that resemble an alveolus. The development of these model systems offers the opportunities to investigate AT I cells and their interactions with MVECL in response to pharmacological interventions and in the processes of disease, repair and regeneration. PMID:21624488

  19. Beneficial paracrine effects of adipocytes from obese rats on cultured endothelial cells

    Directory of Open Access Journals (Sweden)

    Nathan T. Jenkins

    2014-03-01

    Full Text Available The purpose was to test the hypothesis that adipocytes from obese rats would exert pro-atherogenic paracrine effects on cultured endothelial cells compared to adipocytes from lean rats, and that the adverse obesity-associated paracrine effects of adipocytes would be more pronounced in visceral than subcutaneous adipose tissue. Epididymal and subcutaneous adipose tissues were harvested from 32-wk old obese Otsuka Long Evans Tokushima Fatty (OLETF and lean Long Evans Tokushima Otsuka (LETO rats. Cultured rat aortic endothelial cells were treated for 24 h with media conditioned with LETO subcutaneous adipocytes (LSA, OLETF subcutaneous adipocytes (OSA, LETO epididymal adipocytes (LEA, and OLETF epididymal adipocytes (OEA. The amount of key adipokines secreted by ATs was measured in the supernatant fluid with ELISA and mRNA levels of a number of pro- and anti-atherogenic genes were assessed in treated endothelial cells via quantitative real-time PCR. Compared to adipocytes from other depots, secretion of leptin and TNFα was highest and vaspin secretion was lowest from OEA. However, endothelial cells treated with OEA conditioned media exhibited lower expression of several pro-atherogenic genes. These data suggest that adipocytes isolated from obese visceral adipose tissue secrete some as-yet unidentified factor(s that confers a beneficial effect on transcription of pro- and anti-atherogenic genes of endothelial cells.

  20. Investigation of mechanisms of indometophen on haemopoietic precursors cells in mouse long-term bone marrow cultures

    International Nuclear Information System (INIS)

    Influence of indometophen radioprotector (an analog of tamoxiphen) on the dynamic content and proliferative activity of colony-forming units and granulocyto-macrophages precursors and the level of colony-simulating factor in mouse long-term bone marrow cultures were studied for 4 weeks after administration. Five days after indometophen injection the long-term cultures were exposed to irradiation at a dose of 2.0 Gy and on the time course of postirradiation recovery haemopoietic precursor cells and dynamic release of granulocyto-macrophages colony-simulating factor in the culture supernatants were examined. Data of this report suggest that the mechanisms responsible for radioprotective action of indometophen may be associated both with its direct effects on the proliferation and differentiation of hemopoietic cellular precursors and with stimulation of release of growth-differential factors by hemopoietic microenvironmental elements

  1. Dynamic cell culture system (7-IML-1)

    Science.gov (United States)

    Cogoli, Augusto

    1992-01-01

    This experiment is one of the Biorack experiments being flown on the International Microgravity Laboratory 1 (MIL-1) mission as part of an investigation studying cell proliferation and performance in space. One of the objectives of this investigation is to assess the potential benefits of bioprocessing in space with the ultimate goal of developing a bioreactor for continuous cell cultures in space. This experiment will test the operation of an automated culture chamber that was designed for use in a Bioreactor in space. The device to be tested is called the Dynamic Cell Culture System (DCCS). It is a simple device in which media are renewed or chemicals are injected automatically, by means of osmotic pumps. This experiment uses four Type I/O experiment containers. One DCCS unit, which contains a culture chamber with renewal of medium and a second chamber without a medium supply fits in each container. Two DCCS units are maintained under zero gravity conditions during the on-orbit period. The other two units are maintained under 1 gh conditions in a 1 g centrifuge. The schedule for incubator transfer is given.

  2. Advantages and challenges of microfluidic cell culture in polydimethylsiloxane devices

    OpenAIRE

    Halldórsson, Skarphédinn; Lucumi Moreno, Edinson; Gómez-Sjöberg, Rafael; Fleming, Ronan MT

    2015-01-01

    Culture of cells using various microfluidic devices is becoming more common within experimental cell biology. At the same time, a technological radiation of microfluidic cell culture device designs is currently in progress. Ultimately, the utility of microfluidic cell culture will be determined by its capacity to permit new insights into cellular function. Especially insights that would otherwise be difficult or impossible to obtain with macroscopic cell culture in traditional polystyrene dis...

  3. Metabolic effects of influenza virus infection in cultured animal cells: Intra- and extracellular metabolite profiling

    Directory of Open Access Journals (Sweden)

    Genzel Yvonne

    2010-05-01

    Full Text Available Abstract Background Many details in cell culture-derived influenza vaccine production are still poorly understood and approaches for process optimization mainly remain empirical. More insights on mammalian cell metabolism after a viral infection could give hints on limitations and cell-specific virus production capacities. A detailed metabolic characterization of an influenza infected adherent cell line (MDCK was carried out based on extracellular and intracellular measurements of metabolite concentrations. Results For most metabolites the comparison of infected (human influenza A/PR/8/34 and mock-infected cells showed a very similar behavior during the first 10-12 h post infection (pi. Significant changes were observed after about 12 h pi: (1 uptake of extracellular glucose and lactate release into the cell culture supernatant were clearly increased in infected cells compared to mock-infected cells. At the same time (12 h pi intracellular metabolite concentrations of the upper part of glycolysis were significantly increased. On the contrary, nucleoside triphosphate concentrations of infected cells dropped clearly after 12 h pi. This behaviour was observed for two different human influenza A/PR/8/34 strains at slightly different time points. Conclusions Comparing these results with literature values for the time course of infection with same influenza strains, underline the hypothesis that influenza infection only represents a minor additional burden for host cell metabolism. The metabolic changes observed after12 h pi are most probably caused by the onset of apoptosis in infected cells. The comparison of experimental data from two variants of the A/PR/8/34 virus strain (RKI versus NIBSC with different productivities and infection dynamics showed comparable metabolic patterns but a clearly different timely behavior. Thus, infection dynamics are obviously reflected in host cell metabolism.

  4. Prevention and Detection of Mycoplasma Contamination in Cell Culture

    Directory of Open Access Journals (Sweden)

    Parvaneh Farzaneh

    2012-01-01

    Full Text Available One of the main problems in cell culture is mycoplasma infection. It can extensively affectcell physiology and metabolism. As the applications of cell culture increase in research,industrial production and cell therapy, more concerns about mycoplasma contaminationand detection will arise. This review will provide valuable information about: 1. the waysin which cells are contaminated and the frequency and source of mycoplasma species incell culture; 2. the ways to prevent mycoplasma contamination in cell culture; 3. the importanceof mycoplasma tests in cell culture; 4. different methods to identify mycoplasmacontamination; 5. the consequences of mycoplasma contamination in cell culture and 6.available methods to eliminate mycoplasma contamination. Awareness about the sourcesof mycoplasma and pursuing aseptic techniques in cell culture along with reliable detectionmethods of mycoplasma contamination can provide an appropriate situation to preventmycoplasma contamination in cell culture.

  5. Cell culture: Progenitor cells from human brain after death

    Science.gov (United States)

    Palmer, Theo D.; Schwartz, Philip H.; Taupin, Philippe; Kaspar, Brian; Stein, Stuart A.; Gage, Fred H.

    2001-05-01

    Culturing neural progenitor cells from the adult rodent brain has become routine and is also possible from human fetal tissue, but expansion of these cells from postnatal and adult human tissue, although preferred for ethical reasons, has encountered problems. Here we describe the isolation and successful propagation of neural progenitor cells from human postmortem tissues and surgical specimens. Although the relative therapeutic merits of adult and fetal progenitor cells still need to be assessed, our results may extend the application of these progenitor cells in the treatment of neurodegenerative diseases.

  6. Mouse cell culture - Methods and protocols

    Directory of Open Access Journals (Sweden)

    CarloAlberto Redi

    2010-12-01

    Full Text Available The mouse is, out of any doubt, the experimental animal par excellence for many many colleagues within the scientific community, notably for those working in mammalian biology (in a broad sense, from basic genetic to modeling human diseases, starting at least from 1664 Robert Hooke experiments on air’s propertyn. Not surprising then that mouse cell cultures is a well established field of research itself and that there are several handbooks devoted to this discipline. Here, Andrew Ward and David Tosh provide a necessary update of the protocols currently needed. In fact, nearly half of the book is devoted to stem cells culture protocols, mainly embryonic, from a list of several organs (kidney, lung, oesophagus and intestine, pancreas and liver to mention some........

  7. Differentiation of mammalian skeletal muscle cells cultured on microcarrier beads in a rotating cell culture system

    Science.gov (United States)

    Torgan, C. E.; Burge, S. S.; Collinsworth, A. M.; Truskey, G. A.; Kraus, W. E.

    2000-01-01

    The growth and repair of adult skeletal muscle are due in part to activation of muscle precursor cells, commonly known as satellite cells or myoblasts. These cells are responsive to a variety of environmental cues, including mechanical stimuli. The overall goal of the research is to examine the role of mechanical signalling mechanisms in muscle growth and plasticity through utilisation of cell culture systems where other potential signalling pathways (i.e. chemical and electrical stimuli) are controlled. To explore the effects of decreased mechanical loading on muscle differentiation, mammalian myoblasts are cultured in a bioreactor (rotating cell culture system), a model that has been utilised to simulate microgravity. C2C12 murine myoblasts are cultured on microcarrier beads in a bioreactor and followed throughout differentiation as they form a network of multinucleated myotubes. In comparison with three-dimensional control cultures that consist of myoblasts cultured on microcarrier beads in teflon bags, myoblasts cultured in the bioreactor exhibit an attenuation in differentiation. This is demonstrated by reduced immunohistochemical staining for myogenin and alpha-actinin. Western analysis shows a decrease, in bioreactor cultures compared with control cultures, in levels of the contractile proteins myosin (47% decrease, p < 0.01) and tropomyosin (63% decrease, p < 0.01). Hydrodynamic measurements indicate that the decrease in differentiation may be due, at least in part, to fluid stresses acting on the myotubes. In addition, constraints on aggregate size imposed by the action of fluid forces in the bioreactor affect differentiation. These results may have implications for muscle growth and repair during spaceflight.

  8. Darwinian Evolution of Prions in Cell Culture*

    OpenAIRE

    Li, Jiali; Browning, Shawn; Mahal, Sukhvir P.; Oelschlegel, Anja M.; Weissmann, Charles

    2009-01-01

    Prions are infectious proteins consisting mainly of PrPSc, a β sheet-rich conformer of the normal host protein PrPC, and occur in different strains. Strain identity is thought to be encoded by PrPSc conformation. We found that biologically cloned prion populations gradually became heterogeneous by accumulating “mutants”, and selective pressures resulted in the emergence of different mutants as major constituents of the evolving population. Thus, when transferred from brain to cultured cells, ...

  9. Bioactive sugar surfaces for hepatocyte cell culture

    OpenAIRE

    Ambury, Rachael

    2010-01-01

    The primary objective of this study was to identify, develop and characterise a novel bioactive surface capable of binding hepatocytes and enabling the retention of hepatocyte-specific cell function during in-vitro culture. The materials were designed to exploit a unique characteristic of hepatocyte biology, with β-galactose moieties displayed to allow cellular adhesion via the specific asialoglycoprotein receptors (ASGP-R) found on hepatocytes. Hydrogels were created by modifying a commercia...

  10. Degradation of TNT by plant cell cultures

    Czech Academy of Sciences Publication Activity Database

    Podlipná, Radka; Nepovím, Aleš; Zeman, S.; Vágner, Martin; Vaněk, Tomáš

    Smolenice, 2003, s. 78-79. [Xenobiochemické sympózium /22./. Smolenice (SK), 09.06.2003-11.06.2003] R&D Projects: GA ČR GP206/02/P065; GA MŠk OC 837.10 Institutional research plan: CEZ:AV0Z5038910; CEZ:AV0Z4055905 Keywords : degradation * plant cell cultures Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides

  11. Prevention and Detection of Mycoplasma Contamination in Cell Culture

    OpenAIRE

    Parvaneh Farzaneh; Laleh Nikfarjam

    2011-01-01

    One of the main problems in cell culture is mycoplasma infection. It can extensively affect cell physiology and metabolism. As the applications of cell culture increase in research, industrial production and cell therapy, more concerns about mycoplasma contamination and detection will arise. This review will provide valuable information about: 1. the ways in which cells are contaminated and the frequency and source of mycoplasma species in cell culture; 2. the ways to prevent mycoplasma conta...

  12. Application of "Hirt supernatant" DNA to the molecular epidemiology of cytomegalovirus infections.

    OpenAIRE

    Eizuru, Y; Inagawa, S.; Minamishima, Y.

    1984-01-01

    Human cytomegalovirus DNA was isolated from infected cells by the Hirt method (B. Hirt, J. Mol. Biol. 26:365-369, 1967). The restriction endonuclease cleavage patterns of DNA obtained in this manner were comparable with those of DNA extracted from purified virions. The "Hirt supernatants" were satisfactory for identifying individual cytomegalovirus strains by their DNA fingerprinting.

  13. Mediation of endogenous peroxynitrite in the injury of cultured pulmonary artery endothelial cells induced by lipopolysaccharide

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    This experiment, using cultured bovine pulmonary artery endothelial cells (BPAEC), was undertaken to investigate roles of endogenous ONOO- in lipopolysaccharide (LPS)-caused injury to endothelial cells. The fluorescent intensity of nitrotyrosine (NT), a marker of ONOO- generation, in BPAEC represented content of endogenous ONOO- generation. The fluorescent intensity of NT and number of NT positive cells were detected with flow cytometry, and the percentage of NT positive cells was calculated. Results were as follows. (1) LPS (1 mg/L, 5 mg/L and 10 mg/L) caused marked increase in fluorescent intensity of NT in a dose dependent manner. The number and percentage of NT positive cells were markedly increased (P<0.05). Aminoguanidine (AG), a selective inhibitor of inducible nitric oxide synthase, inhibited the increase in fluorescent intensity of NT in BPAEC induced by LPS. However, the number and percentage of NT positive cells had tendency to reduce. (2) LPS caused the enhancement of MDA content and activity of LDH in cultured supernatant (P<0.01). AG reversed the enhancement of MDA content induced by LPS (P<0.01). In contrast, AG had marginal effect on activity of LDH. (3) LPS induced the increase in apoptotic rate in BPAEC in a dose dependent manner. Some BPAEC stained with fluorescent probe ethidium bromide showed morphological features of apoptosis with chromatin condensation and nuclear fragmentation. AG reduced the apoptotic rate and number of apoptotic cells, both of which were still higher than those of vehicle group (P<0.05). (4) LPS inhibited mitochondrial respiration. Effect of LPS on mitochondrial membrane potential (ΔΨ) depended on the doses of LPS. 1 mg/L LPS led to a little increase in ΔΨ, while 5 mg/L and 10 mg/L LPS significantly reduced ΔΨ. In conclusion, LPS caused injury to cultured BPAEC and increased production of ONOO-. Cytotoxicity of LPS may be mediated by endogenous ONOO-.

  14. A Versatile Bioreactor for Dynamic Suspension Cell Culture. Application to the Culture of Cancer Cell Spheroids

    Science.gov (United States)

    Madeddu, Denise; Cerino, Giulia; Falco, Angela; Frati, Caterina; Gallo, Diego; Deriu, Marco A.; Falvo D’Urso Labate, Giuseppe; Quaini, Federico; Audenino, Alberto; Morbiducci, Umberto

    2016-01-01

    A versatile bioreactor suitable for dynamic suspension cell culture under tunable shear stress conditions has been developed and preliminarily tested culturing cancer cell spheroids. By adopting simple technological solutions and avoiding rotating components, the bioreactor exploits the laminar hydrodynamics establishing within the culture chamber enabling dynamic cell suspension in an environment favourable to mass transport, under a wide range of tunable shear stress conditions. The design phase of the device has been supported by multiphysics modelling and has provided a comprehensive analysis of the operating principles of the bioreactor. Moreover, an explanatory example is herein presented with multiphysics simulations used to set the proper bioreactor operating conditions for preliminary in vitro biological tests on a human lung carcinoma cell line. The biological results demonstrate that the ultralow shear dynamic suspension provided by the device is beneficial for culturing cancer cell spheroids. In comparison to the static suspension control, dynamic cell suspension preserves morphological features, promotes intercellular connection, increases spheroid size (2.4-fold increase) and number of cycling cells (1.58-fold increase), and reduces double strand DNA damage (1.5-fold reduction). It is envisioned that the versatility of this bioreactor could allow investigation and expansion of different cell types in the future. PMID:27144306

  15. A Versatile Bioreactor for Dynamic Suspension Cell Culture. Application to the Culture of Cancer Cell Spheroids.

    Science.gov (United States)

    Massai, Diana; Isu, Giuseppe; Madeddu, Denise; Cerino, Giulia; Falco, Angela; Frati, Caterina; Gallo, Diego; Deriu, Marco A; Falvo D'Urso Labate, Giuseppe; Quaini, Federico; Audenino, Alberto; Morbiducci, Umberto

    2016-01-01

    A versatile bioreactor suitable for dynamic suspension cell culture under tunable shear stress conditions has been developed and preliminarily tested culturing cancer cell spheroids. By adopting simple technological solutions and avoiding rotating components, the bioreactor exploits the laminar hydrodynamics establishing within the culture chamber enabling dynamic cell suspension in an environment favourable to mass transport, under a wide range of tunable shear stress conditions. The design phase of the device has been supported by multiphysics modelling and has provided a comprehensive analysis of the operating principles of the bioreactor. Moreover, an explanatory example is herein presented with multiphysics simulations used to set the proper bioreactor operating conditions for preliminary in vitro biological tests on a human lung carcinoma cell line. The biological results demonstrate that the ultralow shear dynamic suspension provided by the device is beneficial for culturing cancer cell spheroids. In comparison to the static suspension control, dynamic cell suspension preserves morphological features, promotes intercellular connection, increases spheroid size (2.4-fold increase) and number of cycling cells (1.58-fold increase), and reduces double strand DNA damage (1.5-fold reduction). It is envisioned that the versatility of this bioreactor could allow investigation and expansion of different cell types in the future. PMID:27144306

  16. Reversible gelling culture media for in-vitro cell culture in three-dimensional matrices

    Science.gov (United States)

    An, Yuehuei H.; Mironov, Vladimir A.; Gutowska, Anna

    2000-01-01

    A gelling cell culture medium useful for forming a three dimensional matrix for cell culture in vitro is prepared by copolymerizing an acrylamide derivative with a hydrophilic comonomer to form a reversible (preferably thermally reversible) gelling linear random copolymer in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum gelling molecular weight cutoff, mixing the copolymer with an aqueous solvent to form a reversible gelling solution and adding a cell culture medium to the gelling solution to form the gelling cell culture medium. Cells such as chondrocytes or hepatocytes are added to the culture medium to form a seeded culture medium, and temperature of the medium is raised to gel the seeded culture medium and form a three dimensional matrix containing the cells. After propagating the cells in the matrix, the cells may be recovered by lowering the temperature to dissolve the matrix and centrifuging.

  17. An Introductory Undergraduate Course Covering Animal Cell Culture Techniques

    Science.gov (United States)

    Mozdziak, Paul E.; Petitte, James N.; Carson, Susan D.

    2004-01-01

    Animal cell culture is a core laboratory technique in many molecular biology, developmental biology, and biotechnology laboratories. Cell culture is a relatively old technique that has been sparingly taught at the undergraduate level. The traditional methodology for acquiring cell culture training has been through trial and error, instruction when…

  18. Sodium 22+ washout from cultured rat cells

    International Nuclear Information System (INIS)

    The washout of Na+ isotopes from tissues and cells is quite complex and not well defined. To further gain insight into this process, we have studied 22Na+ washout from cultured Wistar rat skin fibroblasts and vascular smooth muscle cells (VSMCs). In these preparations, 22Na+ washout is described by a general three-exponential function. The exponential factor of the fastest component (k1) and the initial exchange rate constant (kie) of cultured fibroblasts decrease in magnitude in response to incubation in K+-deficient medium or in the presence of ouabain and increase in magnitude when the cells are incubated in a Ca++-deficient medium. As the magnitude of the kie declines (in the presence of ouabain) to the level of the exponential factor of the middle component (k2), 22Na+ washout is adequately described by a two-exponential function. When the kie is further diminished (in the presence of both ouabain and phloretin) to the range of the exponential factor of the slowest component (k3), the washout of 22Na+ is apparently monoexponential. Calculations of the cellular Na+ concentrations, based on the 22Na+ activity in the cells at the initiation of the washout experiments, and the medium specific activity agree with atomic absorption spectrometry measurements of the cellular concentration of this ion. Thus, all three components of 22Na+ washout from cultured rat cells are of cellular origin. Using the exponential parameters, compartmental analyses of two models (in parallel and in series) with three cellular Na+ pools were performed. The results indicate that, independent of the model chosen, the relative size of the largest Na+ pool is 92-93% in fibroblasts and approximately 96% in VSMCs. This pool is most likely to represent the cytosol

  19. Cell response of Chlamydomonas actinochloris culture to repeated microwave irradiation

    Directory of Open Access Journals (Sweden)

    OLESIA O. GRYGORIEVA

    2015-05-01

    Full Text Available Abstract. Grygorieva OO, Berezovsjka MA, Dacenko OI. 2015. Cell response of Chlamydomonas actinochloris culture to repeated microwave irradiation. Nusantara Bioscience 7: 38-42. Two cultures of Chlamydomonas actinochloris Deason et Bold in the lag-phase were exposed to the microwave irradiation. One of them (culture 1 was not treated beforehand, whereas the other (culture 2 was irradiated by microwaves 2 years earlier. The measurement of cell quantity as well as measurement of change of intensities and spectra of cultures photoluminescence (PL in the range of chlorophyll a emission was regularly conducted during the cell cultures development. Cell concentration of culture 1 exposed to the microwave irradiation for the first time has quickly restored while cell concentration of culture 2 which was irradiated repeatedly has fallen significantly. The following increasing of cell concentration of culture 2 is negligible. Cell concentration reaches the steady-state level that is about a half of the cell concentration of control culture. Initially the PL efficiency of cells of both cultures decreases noticeable as a result of irradiation. Then there is the monotonic increase to the values which are significantly higher than the corresponding values in the control cultures. The ratio of the intensities at the maxima of the main emission bands of chlorophyll for control samples of both cultures remained approximately at the same level. At the same time effect of irradiation on the cell PL spectrum appears as a temporary reduction of this magnitude.

  20. The cell-surface proteome of cultured adipose stromal cells.

    Science.gov (United States)

    Donnenberg, Albert D; Meyer, E Michael; Rubin, J Peter; Donnenberg, Vera S

    2015-07-01

    In this technical note we describe a method to evaluate the cell surface proteome of human primary cell cultures and cell lines. The method utilizes the BD Biosciences lyoplate, a system covering 242 surface proteins, glycoproteins, and glycosphingolipids plus relevant isotype controls, automated plate-based flow cytometry, conventional file-level analysis and unsupervised K-means clustering of markers on the basis of percent of positive events and mean fluorescence intensity of positive and total clean events. As an example, we determined the cell surface proteome of cultured adipose stromal cells (ASC) derived from 5 independent clinical isolates. Between-sample agreement of very strongly expressed (n = 32) and strongly expressed (n =16) markers was excellent, constituting a reliable profile for ASC identification and determination of functional properties. Known mesenchymal markers (CD29, CD44, CD73, CD90, CD105) were among the identified strongly expressed determinants. Among other strongly expressed markers are several that are potentially immunomodulatory including three proteins that protect from complement mediated effects (CD46, CD55, and CD59), two that regulate apoptosis (CD77 and CD95) and several with ectoenzymatic (CD10, CD26, CD13, CD73, and CD143) or receptor tyrosine kinase (CD140b (PDGFR), CD340 (Her-2), EGFR) activity, suggesting mechanisms for the anti-inflammatory and tissue remodeling properties of ASC. Because variables are standardized for K-means clustering, results generated using this methodology should be comparable between instrumentation platforms. It is widely generalizable to human primary explant cultures and cells lines and will prove useful to determine how cell passage, culture interventions, and gene expression and silencing affect the cell-surface proteome. PMID:25929697

  1. Development of Scalable Culture Systems for Human Embryonic Stem Cells

    OpenAIRE

    Azarin, Samira M.; Palecek, Sean P.

    2010-01-01

    The use of human pluripotent stem cells, including embryonic and induced pluripotent stem cells, in therapeutic applications will require the development of robust, scalable culture technologies for undifferentiated cells. Advances made in large-scale cultures of other mammalian cells will facilitate expansion of undifferentiated human embryonic stem cells (hESCs), but challenges specific to hESCs will also have to be addressed, including development of defined, humanized culture media and su...

  2. 利用产黄青霉培养液的上清液生物合成纳米银影响因素的研究%Effects of Experimental Conditions on Silver Nanoparticles' s Biosynthesis by Culture Supernatant of Penicillium chrysogenum

    Institute of Scientific and Technical Information of China (English)

    杨素玲; 孟佑婷; 刘桂君; 王平; 尚宏忠

    2013-01-01

    [目的]对利用产黄青霉培养液的上清液生物合成纳米银的影响因素进行研究.[方法]利用紫外-可见光谱和投射电镜研究硝酸银起始浓度、pH值、光照和微波辐照等条件对合成反应速率及合成纳米银粒径的影响.[结果]硝酸银的最佳起始浓度为2 mmol/L;随着反应体系pH值的升高,反应速率随之加快,合成纳米银粒子的粒径变小;光照和微波辐照均能有效促进纳米银的合成.[结论]该研究为实现纳米银的可控合成提供了试验基础.%[Objective] The aim was to study the effects of experimental conditions on silver nanoparticles's biosynthesis by culture supernatant of Penicillium chrysogenum. [ Method] The effects of initial silver nitrate concentration,pH value, visible-light emission and microwave irradiation on the reaction rate and size of synthetic: silver nanoparticles were studied by using UV-vis spectra and transmission electron microscopy. [Result] The optimal initial silver nitrate concentration was 2 mmol/L; the reaction rate was increased with the increase of pH value in the reaction system , but the particle size was decreased; both visible-light emission and microwave irradiation could promote the synthesis of silver nanoparticles effectively. [Conclusion] This research provided a test basis for the realization of controllable synthesis of silver nanoparticles.

  3. Rotating bio-reactor cell culture apparatus

    Science.gov (United States)

    Schwarz, Ray P. (Inventor); Wolf, David A. (Inventor)

    1991-01-01

    A bioreactor system is described in which a tubular housing contains an internal circularly disposed set of blade members and a central tubular filter all mounted for rotation about a common horizontal axis and each having independent rotational support and rotational drive mechanisms. The housing, blade members and filter preferably are driven at a constant slow speed for placing a fluid culture medium with discrete microbeads and cell cultures in a discrete spatial suspension in the housing. Replacement fluid medium is symmetrically input and fluid medium is symmetrically output from the housing where the input and the output are part of a loop providing a constant or intermittent flow of fluid medium in a closed loop.

  4. PHYTOCHEMICAL STUDY OF CELL CULTURE JATROPHA CURCAS

    Directory of Open Access Journals (Sweden)

    KOMAR RUSLAN

    2011-01-01

    Full Text Available Jatropha curcas belongs to the Euphorbiaceae family which has potential economically. This plant has been reported to contain toxic compounds such as curcin and phorbol ester and its derivatives. These compounds may become a problem if J. curcas will be explored as a source of biofuel. In order to provide safety plants, the research on the study of phytochemical and initiation of cell and organ culture have been carried out. J curcas which has been collected from different regions in Indonesia showed to contain relatively the same profile of chemical contents. Dominant compounds that were detected by GCMS are hidrocarbon such as 2-heptenal, decadienal, hexsadecane, pentadecane, cyclooctane etc, fatty acid such as oktadecanoate acid, etthyl linoleate, ethyl stearate, heksadecanoate acid and steroid such as stigmasterol, fucosterol, sitosterol. No phorbol ester and its derivatives have been detected yet by the GCMS method. Callus and suspension cultures of J. curcas have been established to be used for further investigation.

  5. 单宁酸对糖尿病大鼠肾组织和肾小球系膜细胞培养上清中8-OHdG及3-NT含量的影响%Influence of tannic acid on contents of 8-OHdG and 3-NT in nephridial tissue of diabetic rats and supernatant of glomerular mesangial cells

    Institute of Scientific and Technical Information of China (English)

    魏海峰; 刘磊; 芦小单; 米旭光; 李首庆; 谭岩; 方艳秋

    2014-01-01

    from 68 6-week-old male Wistar rats as normal control group and the remaining 60 rats accepted high-sugar and high-fat diet for 4 weeks, then were injected streptozotocin ( STZ, 52 mg/kg ) intraperitoneally in order to manufacture a diabetic rat model.Further the diabetic rats were randomly divided into model group ,aminoguanidine group ,low-dose of tannic acid group and high dose of tannic acid group.The rats in aminoguanidine group were injected aminoguanidine [AG,40 mg/(kg· d)] intraperitoneally, those in low-dose of tannic acid group were injected tannic acid [TA,20 mg/(kg· d)] and those in high-dose of tannic acid group were injected tannic acid [TA,30 mg/(kg· d)].The rats in normal control group and model group were injected normal saline [NS, 30 mg/(kg· d)] and all rats were sacrificed and tissues were derived at the end of the week 10.Morphologic changes of kidney in diabetic rats were observed by HE staining and correlative biochemical indices of renal function were detected by biochemical analyzer.8-hydroxy deoxyguanosine (8-OHdG) and 3-nitrotyrosine (3-NT) content of renal tissue in rats in different groups were detected by ELISA method.Mesangial cells cultured in vitro were treated with high concentration of glucose (30 mmol/L) and AGEs (250 mg/L) and at the same time with different concentration of tannic acid (10,20,40 and 80μmol/L) on the basis of setting corre-sponding control group.The contents of 8-OHdG and 3-NT in the culture supernatant were measured by ELISA method after 48 hours.Results:Tannic acid can effectively improve the renal pathological changes and improve renal function of diabetic rats .The contents of 8-OHdG and 3-NT in kidney tissue homogenate of diabetic rats and in the supernatant of GMC cultured with high glucose or AGEs were all significantly increased and can be reduced by tannic acid.Conclusion:Tannic acid improving the structure and function damage of kidney in diabetic rats might be achieved by oxidative stress and

  6. Renotropic stimulation in rat kidney cell culture

    International Nuclear Information System (INIS)

    A circulating renotropic factor specific for renal cells has been described in rats. The addition of sera obtained from unilaterally nephrectomized (uni) rats 24h after operation compared to sham-operated (sham) rats augments 3H-thymidine incorporation into the DNA of incubating kidney slices approximately 10% - 30%. Attempting to amplify the sensitivity of the assay for this renotropic agent, the authors replaced slices with primary rat kidney cultures. The assay system was based on one previously used for rabbits. The cultured cells were synchronized in their growth phase by a period of protein-free starvation. Compared to sera from sham rats, sera from uni rats showed significant stimulation of thymidine incorporation into DNA, 35.5% +/- 9.3 (SEM), p < .0001, at 16 h; 63.3% +/- 10.0 (SEM), p < .001, at 24 h; and 19.5% +/- 6.5 (SEM), p < .01, at 48 h post operation. Accordingly, the maximal stimulation at 24 h was greater than that previously found using the kidney slice assay. Measurable renotropic activity occurred earlier and over a shorter duration than in rabbits. Stimulation was similar when a D-valine medium, relatively specific for renal epithelial cells, replaced DME medium

  7. Optical Oxygen Sensors for Applications in Microfluidic Cell Culture

    OpenAIRE

    Grist, Samantha M.; Lukas Chrostowski; Cheung, Karen C.

    2010-01-01

    The presence and concentration of oxygen in biological systems has a large impact on the behavior and viability of many types of cells, including the differentiation of stem cells or the growth of tumor cells. As a result, the integration of oxygen sensors within cell culture environments presents a powerful tool for quantifying the effects of oxygen concentrations on cell behavior, cell viability, and drug effectiveness. Because microfluidic cell culture environments are a promising alternat...

  8. Secretome of Peripheral Blood Mononuclear Cells Enhances Wound Healing

    OpenAIRE

    Mildner, Michael; Hacker, Stefan; Haider, Thomas; Gschwandtner, Maria; Werba, Gregor; Barresi, Caterina; Zimmermann, Matthias; Golabi, Bahar; Tschachler, Erwin; Ankersmit, Hendrik Jan

    2013-01-01

    Non-healing skin ulcers are often resistant to most common therapies. Treatment with growth factors has been demonstrated to improve closure of chronic wounds. Here we investigate whether lyophilized culture supernatant of freshly isolated peripheral blood mononuclear cells (PBMC) is able to enhance wound healing. PBMC from healthy human individuals were prepared and cultured for 24 hours. Supernatants were collected, dialyzed and lyophilized (SECPBMC). Six mm punch biopsy wounds were set on ...

  9. Cardiac Cells Beating in Culture: A Laboratory Exercise

    Science.gov (United States)

    Weaver, Debora

    2007-01-01

    This article describes how to establish a primary tissue culture, where cells are taken directly from an organ of a living animal. Cardiac cells are taken from chick embryos and transferred to culture dishes. These cells are not transformed and therefore have a limited life span. However, the unique characteristics of cardiac cells are maintained…

  10. Growth of cultured porcine retinal pigment epithelial cells

    DEFF Research Database (Denmark)

    Wiencke, A.K.; Kiilgaard, Jens Folke; Nicolini, Jair;

    2003-01-01

    To establish and characterize cultures of porcine retinal pigment epithelial (pRPE) cells in order to produce confluent monolayers of cells for transplantation.......To establish and characterize cultures of porcine retinal pigment epithelial (pRPE) cells in order to produce confluent monolayers of cells for transplantation....

  11. Equipment for large-scale mammalian cell culture.

    Science.gov (United States)

    Ozturk, Sadettin S

    2014-01-01

    This chapter provides information on commonly used equipment in industrial mammalian cell culture, with an emphasis on bioreactors. The actual equipment used in the cell culture process can vary from one company to another, but the main steps remain the same. The process involves expansion of cells in seed train and inoculation train processes followed by cultivation of cells in a production bioreactor. Process and equipment options for each stage of the cell culture process are introduced and examples are provided. Finally, the use of disposables during seed train and cell culture production is discussed. PMID:24429549

  12. Development of primary cell culture from Scylla serrata: Primary cell cultures from Scylla serrata

    OpenAIRE

    Sashikumar, Anu; Desai, P. V.

    2008-01-01

    This paper reports for the first time, the Primary cell culture of hepatopancreas from edible crab Scylla serrata using crab saline, L-15 (Leibovitz), 1 × L-15 + crab saline, 2 × L-15 + crab saline, 3 × L-15 and citrate buffer without any serum. We could isolate and maintain E (Embryonalzellen), F (Fibrenzellen), B (Blasenzellen), R (Restzellen) and G (Granular cells). Upon seeding the hepatopancreatic E, F, B, and R cells showed different survival pattern over time than granular cells. A mod...

  13. Phosphatidylinositol species of suspension cultured plant cells

    Energy Technology Data Exchange (ETDEWEB)

    Heim, S.; Wagner, K.G.

    Suspension cultured Nicotiana tabacum and Catharanthus roseus cells were labeled with (/sup 3/H)inositol, the phospholipid fraction extracted and separated by thin layer chromatography. Three different solvent systems and reference compounds were used to assign the different /sup 3/H-labeled species by autoradiography. The ratio of (/sup 3/H)inositol incorporation into PI, PIP and PIP/sub 2/ was found to be 95:4:1; with some preparations a lyso-PI band was obtained which incorporated about a tenth of the label of the PIP band. With Catharanthus roseus cells a very faint band between PI and lyso-PI was detected which could not be assigned to a reference compound.

  14. Metabolic flux rewiring in mammalian cell cultures.

    Science.gov (United States)

    Young, Jamey D

    2013-12-01

    Continuous cell lines (CCLs) engage in 'wasteful' glucose and glutamine metabolism that leads to accumulation of inhibitory byproducts, primarily lactate and ammonium. Advances in techniques for mapping intracellular carbon fluxes and profiling global changes in enzyme expression have led to a deeper understanding of the molecular drivers underlying these metabolic alterations. However, recent studies have revealed that CCLs are not necessarily entrenched in a glycolytic or glutaminolytic phenotype, but instead can shift their metabolism toward increased oxidative metabolism as nutrients become depleted and/or growth rate slows. Progress to understand dynamic flux regulation in CCLs has enabled the development of novel strategies to force cultures into desirable metabolic phenotypes, by combining fed-batch feeding strategies with direct metabolic engineering of host cells. PMID:23726154

  15. Evaluation of osteogenic cell culture and osteogenic/peripheral blood mononuclear human cell co-culture on modified titanium surfaces

    International Nuclear Information System (INIS)

    This study aimed to determine the effect of a bioactive ceramic coating on titanium in the nanothickness range on human osteogenic cells, peripheral blood mononuclear cells (PBMC) and on osteogenic cells co-cultured with PBMC without exogenous stimuli. Cell viability, proliferation, adhesion, cytokine release (IL1β, TGFβ1, IL10 and IL17) and intracellular stain for osteopontin and alkaline phosphatase were assessed. Morphologic evaluation showed smaller and less spread cell aspects in co-culture relative to osteogenic cell culture. Cell viability, proliferation and adhesion kinetics were differently influenced by surface texture/chemistry in culture versus co-culture. Cytokine release was also influenced by the interaction between mononuclear and osteogenic cells (mediators released by mononuclear cells acted on osteogenic cells and vice versa). In general, ‘multi-cell type’ interactions played a more remarkable role than the surface roughness or chemistry utilized on the in vitro cellular events related to initial stages of bone formation. (paper)

  16. Recombinant Protein Production and Insect Cell Culture and Process

    Science.gov (United States)

    Spaulding, Glenn F. (Inventor); Goodwin, Thomas J. (Inventor); OConnor, Kim C. (Inventor); Francis, Karen M. (Inventor); Andrews, Angela D. (Inventor); Prewett, Tracey L. (Inventor)

    1997-01-01

    A process has been developed for recombinant production of selected polypeptides using transformed insect cells cultured in a horizontally rotating culture vessel modulated to create low shear conditions. A metabolically transformed insect cell line is produced using the culture procedure regardless of genetic transformation. The recombinant polypeptide can be produced by an alternative process using virtually infected or stably transformed insect cells containing a gene encoding the described polypeptide. The insect cells can also be a host for viral production.

  17. Secretion of nerve growth factor, brain-derived neurotrophic factor, and glial cell-line derived neurotrophic factor in co-culture of four cell types in cerebrospinal fluid-containing medium

    Institute of Scientific and Technical Information of China (English)

    Sanjiang Feng; Minghua Zhuang; Rui Wu

    2012-01-01

    The present study co-cultured human embryonic olfactory ensheathing cells, human Schwann cells, human amniotic epithelial cells and human vascular endothelial cells in complete culture medium- containing cerebrospinal fluid. Enzyme linked immunosorbent assay was used to detect nerve growth factor, brain-derived neurotrophic factor, and glial cell line-derived neurotrophic factor secretion in the supernatant of co-cultured cells. Results showed that the number of all cell types reached a peak at 7–10 days, and the expression of nerve growth factor, brain-derived neurotrophic factor, and glial cell line-derived neurotrophic factor peaked at 9 days. Levels of secreted nerve growth factor were four-fold higher than brain-derived neurotrophic factor, which was three-fold higher than glial cell line-derived neurotrophic factor. Increasing concentrations of cerebrospinal fluid (10%, 20% and 30%) in the growth medium caused a decrease of neurotrophic factor secretion. Results indicated co-culture of human embryonic olfactory ensheathing cells, human Schwann cells, human amniotic epithelial cells and human vascular endothelial cells improved the expression of nerve growth factor, brain-derived neurotrophic factor, and glial cell line-derived neurotrophic factor. The reduction of cerebrospinal fluid extravasation at the transplant site after spinal cord injury is beneficial for the survival and secretion of neurotrophic factors from transplanted cells.

  18. The Importance of Caveolin-1 as Key-Regulator of Three-Dimensional Growth in Thyroid Cancer Cells Cultured under Real and Simulated Microgravity Conditions.

    Science.gov (United States)

    Riwaldt, Stefan; Bauer, Johann; Pietsch, Jessica; Braun, Markus; Segerer, Jürgen; Schwarzwälder, Achim; Corydon, Thomas J; Infanger, Manfred; Grimm, Daniela

    2015-01-01

    We recently demonstrated that the CAV1 gene was down-regulated, when poorly differentiated thyroid FTC-133 cancer cells formed spheroids under simulated microgravity conditions. Here, we present evidence that the caveolin-1 protein is involved in the inhibition of spheroid formation, when confluent monolayers are exposed to microgravity. The evidence is based on proteins detected in cells and their supernatants of the recent spaceflight experiment: "NanoRacks-CellBox-Thyroid Cancer". The culture supernatant had been collected in a special container adjacent to the flight hardware incubation chamber and stored at low temperature until it was analyzed by Multi-Analyte Profiling (MAP) technology, while the cells remaining in the incubation chamber were fixed by RNAlater and examined by mass spectrometry. The soluble proteins identified by MAP were investigated in regard to their mutual interactions and their influence on proteins, which were associated with the cells secreting the soluble proteins and had been identified in a preceding study. A Pathway Studio v.11 analysis of the soluble and cell-associated proteins together with protein kinase C alpha (PRKCA) suggests that caveolin-1 is involved, when plasminogen enriched in the extracellular space is not activated and the vascular cellular adhesion molecule (VCAM-1) mediated cell-cell adhesion is simultaneously strengthened and activated PRKCA is recruited in caveolae, while the thyroid cancer cells do not form spheroids. PMID:26633361

  19. System-level modeling and simulation of the cell culture microfluidic biochip ProCell

    DEFF Research Database (Denmark)

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan;

    2010-01-01

    -defined micro-channels using valves and pumps. We present an approach to the system-level modeling and simulation of a cell culture microfluidic biochip called ProCell, Programmable Cell Culture Chip. ProCell contains a cell culture chamber, which is envisioned to run 256 simultaneous experiments (viewed as a...

  20. Protection of cultured mammalian cells by rebamipide

    Energy Technology Data Exchange (ETDEWEB)

    Antoku, Shigetoshi; Aramaki, Ryoji [Kyushu Univ., Fukuoka (Japan). Faculty of Medicine; Tanaka, Hisashi; Kusumoto, Naotoshi

    1997-06-01

    Rebamipide which is used as a drug for gastritis and stomach ulcer has large capability for OH radical scavenging. It is expected that rebamipide has protective effect against ionizing radiations. The present paper deals with protective effect of rebamipide for cultured mammalian cells exposed to ionizing radiations. As rebamipide is insoluble in water, three solvents were used to dissolve. Rebamipide dissolved in dimethyl sulfoxide (DMSO), dimethyl formamide (DMFA) and 0.02 N NaOH was added to the cells in Eagle`s minimum essential medium (MEM) supplemented with 10% fetal calf serum and the cells were irradiated with X-rays. After irradiation, the cells were trypsinized, plated in MEM with 10% fetal calf serum and incubated for 7 days in a CO{sub 2} incubator to form colonies. Rebamipide dissolved in 0.02 N NaOH exhibited the protective effect expected its OH radical scavenging capability. However, the protective effect of rebamipide dissolved in DMSO was about half of that expected by its radical scavenging capability and that of rebamipide dissolved in DMFA was not observed. Uptake of rebamipide labeled with {sup 14}C increased with increasing contact time with rebamipide. These rebamipide mainly distributed in nucleus rather than cytoplasm. (author)

  1. Tank 26F Supernatant And 2F Evaporator Eductor Pump Sample Characterization Results

    International Nuclear Information System (INIS)

    In an effort to understand the reasons for system plugging problems in the SRS 2F evaporator, supernatant samples were retrieved from the evaporator feed tank (Tank 26F) and solids were collected from the evaporator eductor feed pump for characterization. The variable depth supernatant samples were retrieved from Tank 26F in early December of 2010 and samples were provided to SRNL and the F/H Area laboratories for analysis. Inspection and analysis of the samples at SRNL was initiated in early March of 2011. During the interim period, samples were frequently exposed to temperatures as low as 12 C with daily temperature fluctuations as high as 10 C. The temperature at the time of sample collection from the waste tank was 51 C. Upon opening the supernatant bottles at SRNL, many brown solids were observed in both of the Tank 26F supernatant samples. In contrast, no solids were observed in the supernatant samples sent to the F/H Area laboratories, where the analysis was completed within a few days after receipt. Based on these results, it is believed that the original Tank 26F supernatant samples did not contain solids, but solids formed during the interim period while samples were stored at ambient temperature in the SRNL shielded cells without direct climate control. Many insoluble solids (>11 wt. % for one sample) were observed in the Tank 26F supernatant samples after three months of storage at SRNL which would not dissolve in the supernatant solution in two days at 51 C. Characterization of these solids along with the eductor pump solids revealed the presence of sodium oxalate and clarkeite (uranyl oxyhydroxide) as major crystalline phases. Sodium nitrate was the dominant crystalline phase present in the unwashed Eductor Pump solids. Crystalline sodium nitrate may have formed during the drying of the solids after filtration or may have been formed in the Tank 26F supernatant during storage since the solution was found to be very concentrated (9-12 M Na

  2. Determining Cell Number During Cell Culture using the Scepter Cell Counter

    OpenAIRE

    Ongena, Kathleen; Das, Chandreyee; Smith, Janet L.; Gil, Sónia; Johnston, Grace

    2010-01-01

    Counting cells is often a necessary but tedious step for in vitro cell culture. Consistent cell concentrations ensure experimental reproducibility and accuracy. Cell counts are important for monitoring cell health and proliferation rate, assessing immortalization or transformation, seeding cells for subsequent experiments, transfection or infection, and preparing for cell-based assays. It is important that cell counts be accurate, consistent, and fast, particularly for quantitative measuremen...

  3. The Importance of Caveolin-1 as Key-Regulator of Three-Dimensional Growth in Thyroid Cancer Cells Cultured under Real and Simulated Microgravity Conditions

    Directory of Open Access Journals (Sweden)

    Stefan Riwaldt

    2015-11-01

    Full Text Available We recently demonstrated that the CAV1 gene was down-regulated, when poorly differentiated thyroid FTC-133 cancer cells formed spheroids under simulated microgravity conditions. Here, we present evidence that the caveolin-1 protein is involved in the inhibition of spheroid formation, when confluent monolayers are exposed to microgravity. The evidence is based on proteins detected in cells and their supernatants of the recent spaceflight experiment: “NanoRacks-CellBox-Thyroid Cancer”. The culture supernatant had been collected in a special container adjacent to the flight hardware incubation chamber and stored at low temperature until it was analyzed by Multi-Analyte Profiling (MAP technology, while the cells remaining in the incubation chamber were fixed by RNAlater and examined by mass spectrometry. The soluble proteins identified by MAP were investigated in regard to their mutual interactions and their influence on proteins, which were associated with the cells secreting the soluble proteins and had been identified in a preceding study. A Pathway Studio v.11 analysis of the soluble and cell-associated proteins together with protein kinase C alpha (PRKCA suggests that caveolin-1 is involved, when plasminogen enriched in the extracellular space is not activated and the vascular cellular adhesion molecule (VCAM-1 mediated cell–cell adhesion is simultaneously strengthened and activated PRKCA is recruited in caveolae, while the thyroid cancer cells do not form spheroids.

  4. Three-Dimensional Cell Culture: A Breakthrough in Vivo

    Directory of Open Access Journals (Sweden)

    Delphine Antoni

    2015-03-01

    Full Text Available Cell culture is an important tool for biological research. Two-dimensional cell culture has been used for some time now, but growing cells in flat layers on plastic surfaces does not accurately model the in vivo state. As compared to the two-dimensional case, the three-dimensional (3D cell culture allows biological cells to grow or interact with their surroundings in all three dimensions thanks to an artificial environment. Cells grown in a 3D model have proven to be more physiologically relevant and showed improvements in several studies of biological mechanisms like: cell number monitoring, viability, morphology, proliferation, differentiation, response to stimuli, migration and invasion of tumor cells into surrounding tissues, angiogenesis stimulation and immune system evasion, drug metabolism, gene expression and protein synthesis, general cell function and in vivo relevance. 3D culture models succeed thanks to technological advances, including materials science, cell biology and bioreactor design.

  5. Organ culture-cell culture system for studying multistage carcinogenesis in respiratory epithelium. [Mice

    Energy Technology Data Exchange (ETDEWEB)

    Steele, Vernon E.; Marchok, Ann C.; Nettesheim, Paul

    1977-01-01

    An organ culture-cell culture system was used to demonstrate carcinogen dose-dependent transformation of tracheal epithelial cells in vitro. Tracheal explants were exposed to MNNG (N-methyl-N/sup 1/-nitro-N-nitrosoguanidine) in organ culture. Outgrowths from these explants provided epithelial cell cultures. The numbers of long term epithelial cell cultures and cell lines that were established per explant increased as MNNG exposure concentration increased. At the present time, more cell lines derived from explants exposed to the highest MNNG concentration have produced palpable tumors than cell lines derived from explants exposed to lower MNNG concentrations. No cell lines were established from primaries derived from control explants. TPA (12-0-tetradecanoyl-phorbol-13-acetate), stimulates DNA synthesis in tracheal epithelium in organ culture in a manner simular to that described for mouse skin. Short exposures to TPA not only stimulated DNA synthesis earlier, but the stimulation was greater than that obtained with continuous exposure. At the present time, exposure of tracheal organ cultures to MNNG followed by TPA has resulted in an enhanced production of morphologically altered cells in primary epithelial cell cultures, than exposure to either agent alone.

  6. Electrospinning of microbial polyester for cell culture

    International Nuclear Information System (INIS)

    Biodegradable and biocompatible poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), a copolymer of microbial polyester, was fabricated as a nanofibrous mat by electrospinning. The specific surface area and the porosity of electrospun PHBV nanofibrous mat were determined. When the mechanical properties of flat film and electrospun PHBV nanofibrous mats were investigated, both the tensile modulus and strength of electrospun PHBV were less than those of cast PHBV film. However, the elongation ratio of nanofiber mat was higher than that of the cast film. The structure of electrospun nanofibers using PHBV-trifluoroethanol solutions depended on the solution concentrations. When x-ray diffraction patterns of bulk PHBV before and after electrospinning were compared, the crystallinity of PHBV was not significantly affected by the electrospinning process. Chondrocytes adhered and grew on the electrospun PHBV nanofibrous mat better than on the cast PHBV film. Therefore, the electrospun PHBV was considered to be suitable for cell culture

  7. Particle Trajectories in Rotating Wall Cell Culture Devices

    Science.gov (United States)

    Ramachandran N.; Downey, J. P.

    1999-01-01

    Cell cultures are extremely important to the medical community since such cultures provide an opportunity to perform research on human tissue without the concerns inherent in experiments on individual humans. Development of cells in cultures has been found to be greatly influenced by the conditions of the culture. Much work has focused on the effect of the motions of cells in the culture relative to the solution. Recently rotating wall vessels have been used with success in achieving improved cellular cultures. Speculation and limited research have focused on the low shear environment and the ability of rotating vessels to keep cells suspended in solution rather than floating or sedimenting as the primary reasons for the improved cellular cultures using these devices. It is widely believed that the cultures obtained using a rotating wall vessel simulates to some degree the effect of microgravity on cultures. It has also been speculated that the microgravity environment may provide the ideal acceleration environment for culturing of cellular tissues due to the nearly negligible levels of sedimentation and shear possible. This work predicts particle trajectories of cells in rotating wall vessels of cylindrical and annular design consistent with the estimated properties of typical cellular cultures. Estimates of the shear encountered by cells in solution and the interactions with walls are studied. Comparisons of potential experiments in ground and microgravity environments are performed.

  8. HAIR CELL-LIKE CELL GENERATION INDUCED BY NATURE CULTURE OF ADULT RAT AUDITORY EPITHELIUM

    Institute of Scientific and Technical Information of China (English)

    Liu Hui; Zhu Hongliang; Li Shengli; Yao Xiaobao; Wang Xiaoxia

    2006-01-01

    Objective To establish adult rat auditory epithelial cell culture and try to find precursor cells of auditory hair cells in vitro. Methods With refinement of culture media and techniques, cochlear sensory epithelial cells of adult rat were cultured. Immunocytochemistry and Bromodeoxyuridine (BrdU)labeling were used to detect properties and mitotic status of cultured cells. Results The cultured auditory epithelial cells showed a large, flat epithelial morphotype and expressed F-actin and cytokeratin, a subset of cells generated from auditory epithelium were labeled by calretinin, a specific marker of early hair cell. Conclusion Adult rat auditory epithelium can be induced to generate hair cell-like cells by nature culture, this phenomenon suggests that progenitor cells may exist in rat cochlea and they may give birth to new hair cells. Whether these progenitor cells are tissue specific stem cells is still need more study.

  9. Usability and Applicability of Microfluidic Cell Culture Systems

    DEFF Research Database (Denmark)

    Hemmingsen, Mette

    devices still lack general implementation into biological research laboratories. In this project, the usability and applicability of microfluidic cell culture systems have been investigated. The tested systems display good properties regarding optics and compatibility with standard laboratory equipment...... possibilities for, for example, precise control of the chemical environment, 3D cultures, controlled co-culture of different cell types or automated, individual control of up to 96 cell culture chambers in one integrated system. Despite the great new opportunities to perform novel experimental designs, these...... shown to be needed. This is possibly one of the reasons for the lack of implementation of microfluidic cell culture systems into biological research laboratories. Procedures to perform long-term microfluidic perfusion cell culture experiments have been established. Furthermore, successful application of...

  10. THE ALKALOID CYTISINE IN THE CELL CULTURE

    Directory of Open Access Journals (Sweden)

    Gazaliev A.M.

    2012-08-01

    Full Text Available Alkaloids are vegetative establishments of complex and original structure with nitrous heterocycles in the basis. For a long time they drew researchers’ attention because of their unique and specific physiological effect on alive organisms. Not all the representatives of the globe’s flora contain these unique substances. Alkaloid cytisine is to be found mainly in the plants of the fabaceous family - Fabaceae. For the cytisine production the seeds of Thermopsis lanceolata R.Br (T. lanceolata R.Br and Cytisus laburnum (C. laburnum are used as a raw material. The object of the research is T. lanceolata cell culture. Sterile sprouts are used at the first stage of the experiment. Callus genesis is accompanied with dedifferentiation. It leads to the cellular organization simplification. Based on an important property of a plant cell, such as totipotency, there appears the formation of the “de novo” biosynthetic device. The cultivation algorithm consists of two basic stages: (i the cultivation conditions optimization of callus with a high level of the primary metabolites biosynthesis (Aspartat – lysine; (ii the research of cultivation chemical and physical factors influence on the secondary metabolite (cytisine biosynthesis and accumulation. During the cultivation the Murashige and Skoog classical recipe of nutrient medium will be used. Optimization of the cultivation conditions will concern the phytohormones, macro- and micronutrients content, as the purpose of optimization is the production of the determined high-level competence embriogenical callus. The main problem is genetic heterogeneity of a cellular population and instability of morpho-physiological processes. The correct management of higher plants cells population is possible at the synchronization of a cellular cycle phases. The references analysis has shown that it is almost impossible to synchronize cellular cycles in the culture of plant tissue. The application of chemical

  11. Sildenafil Effect on Nitric Oxide Secretion by Normal Human Endometrial Epithelial Cells Cultured In vitro

    Directory of Open Access Journals (Sweden)

    Farzaneh Chobsaz

    2011-01-01

    Full Text Available Background: Sildenafil is a selective inhibitor of cyclic-guanosine monphosphat-specificphosphodiesterase type 5. It increases intracellular nitric oxide (NO production in some cells.There are reports on its positive effect on uterine circulation, endometrial thickness, and infertilityimprovement. Endometrial epithelial cells (EEC play an important role in embryo attachment andimplantation. The present work investigates the effect of sildenafil on human EEC and their NOsecretion in vitro.Materials and Methods: In this experimental in vitro study, endometrial biopsies (n=10 werewashed in a phosphate buffered solution (PBS and digested with collagenase I (2 mg/ml in DMEM/F12 medium at 37°C for 90 minutes. Epithelial glands were collected by sequential filtrationthrough nylon meshes (70 and 40 μm pores, respectively. Epithelial glands were then treated withtrypsin to obtain individual cells. The cells were counted and divided into four groups: control and1, 10, and 20 μM sildenafil concentrations. Cells were cultured for 15 days at 37ºC and 5% CO2; themedia were changed every 3 days, and their supernatants were collected for the NO assay. NO wasmeasured by standard Greiss methods. Data were analyzed by one way ANOVA.Results: There was no significant difference between groups in cell count and NO secretion, but thelevel of NO increased slightly in the experimental groups. The 10 μM dose showed the highest cellcount. EEC morphology changed into long spindle cells in the case groups.Conclusion: Sildenafil (1, 10, and 20 μM showed a mild proliferative effect on human EECnumbers, but no significant change was seen in NO production.

  12. Using Tissue Culture To Investigate Plant Cell Differentiation and Dedifferentiation.

    Science.gov (United States)

    Bozzone, Donna M.

    1997-01-01

    Describes an experimental project that uses plant tissue culture techniques to examine cell differentiation in the carrot. Allows students to gain experience in some important techniques and to explore fundamental questions about cell differentiation. (DDR)

  13. Growth regulation of skin cells by epidermal cell-derived factors: implications for wound healing.

    OpenAIRE

    Eisinger, M; Sadan, S; Silver, I. A.; Flick, R B

    1988-01-01

    Epidermal cell-derived factors (EDF), present in extracts and supernatant fluids of cultured epidermal cells, were found to stimulate the proliferation of keratinocytes but to inhibit fibroblasts. In vitro, the effect of EDF on epidermal cells resulted in an increased number of rapidly proliferating colonies composed mainly of basal keratinocytes. Control cultures grown in the absence of EDF had a high proportion of terminally differentiated cells. In fibroblast cultures EDF inhibited the abi...

  14. Systems Biology for Organotypic Cell Cultures

    Energy Technology Data Exchange (ETDEWEB)

    Grego, Sonia [RTI International, Research Triangle Park, NC (United States); Dougherty, Edward R. [Texas A & M Univ., College Station, TX (United States); Alexander, Francis J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Auerbach, Scott S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Berridge, Brian R. [GlaxoSmithKline, Research Triangle Park, NC (United States); Bittner, Michael L. [Translational Genomics Research Inst., Phoenix, AZ (United States); Casey, Warren [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Cooley, Philip C. [RTI International, Research Triangle Park, NC (United States); Dash, Ajit [HemoShear Therapeutics, Charlottesville, VA (United States); Ferguson, Stephen S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Fennell, Timothy R. [RTI International, Research Triangle Park, NC (United States); Hawkins, Brian T. [RTI International, Research Triangle Park, NC (United States); Hickey, Anthony J. [RTI International, Research Triangle Park, NC (United States); Kleensang, Andre [Johns Hopkins Univ., Baltimore, MD (United States). Center for Alternatives to Animal Testing; Liebman, Michael N. [IPQ Analytics, Kennett Square, PA (United States); Martin, Florian [Phillip Morris International, Neuchatel (Switzerland); Maull, Elizabeth A. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Paragas, Jason [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Qiao, Guilin [Defense Threat Reduction Agency, Ft. Belvoir, VA (United States); Ramaiahgari, Sreenivasa [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Sumner, Susan J. [RTI International, Research Triangle Park, NC (United States); Yoon, Miyoung [The Hamner Inst. for Health Sciences, Research Triangle Park, NC (United States); ScitoVation, Research Triangle Park, NC (United States)

    2016-08-04

    Translating in vitro biological data into actionable information related to human health holds the potential to improve disease treatment and risk assessment of chemical exposures. While genomics has identified regulatory pathways at the cellular level, translation to the organism level requires a multiscale approach accounting for intra-cellular regulation, inter-cellular interaction, and tissue/organ-level effects. Tissue-level effects can now be probed in vitro thanks to recently developed systems of three-dimensional (3D), multicellular, “organotypic” cell cultures, which mimic functional responses of living tissue. However, there remains a knowledge gap regarding interactions across different biological scales, complicating accurate prediction of health outcomes from molecular/genomic data and tissue responses. Systems biology aims at mathematical modeling of complex, non-linear biological systems. We propose to apply a systems biology approach to achieve a computational representation of tissue-level physiological responses by integrating empirical data derived from organotypic culture systems with computational models of intracellular pathways to better predict human responses. Successful implementation of this integrated approach will provide a powerful tool for faster, more accurate and cost-effective screening of potential toxicants and therapeutics. On September 11, 2015, an interdisciplinary group of scientists, engineers, and clinicians gathered for a workshop in Research Triangle Park, North Carolina, to discuss this ambitious goal. Participants represented laboratory-based and computational modeling approaches to pharmacology and toxicology, as well as the pharmaceutical industry, government, non-profits, and academia. Discussions focused on identifying critical system perturbations to model, the computational tools required, and the experimental approaches best suited to generating key data. This consensus report summarizes the discussions held.

  15. Induced engulfment of Neisseria gonorrhoeae by tissue culture cells.

    OpenAIRE

    Richardson, W P; Sadoff, J C

    1988-01-01

    Engulfment of gonococci by mammalian tissue culture cells was examined as a model of the penetration of host cells in gonorrhea. Engulfment required viable organisms; killing the gonococci with heat or refrigeration abolished the process. Engulfment also required tissue culture cell microtubule- and microfilament-dependent movement; treating the cells with cytochalasin B (0.5 micrograms/ml) or demecolcine (Colcemid; Ciba-Geigy AG, Basel, Switzerland) (10 micrograms/ml) also prevented his proc...

  16. Increased exosome production from tumour cell cultures using the Integra CELLine Culture System.

    Science.gov (United States)

    Mitchell, J Paul; Court, Jacqueline; Mason, Malcolm David; Tabi, Zsuzsanna; Clayton, Aled

    2008-06-01

    Exosomes are nanometer-sized vesicles, secreted from most cell types, with documented immune-modulatory functions. Exosomes can be purified from cultured cells but to do so effectively, requires maintenance of cells at high density in order to obtain sufficient accumulation of exosomes in the culture medium, prior to purification. Whilst high density cultures can be achieved with cells in suspension, this remains difficult with adherent cells, resulting in low quantity of exosomes for subsequent study. We have used the Integra CELLine culture system, originally designed for hybridoma cultures, to achieve a significant increase in obtainable exosomes from adherent and non-adherent tumour cells. Traditional cultures of mesothelioma cells (cultured in 75 cm(2) flasks) gave an average yield of 0.78 microg+/-0.14 microg exosome/ml of conditioned medium. The CELLine Adhere 1000 (CLAD1000) flask, housing the same cell line, increased exosome yield approximately 12 fold to 10.06 microg+/-0.97 microg/ml. The morphology, phenotype and immune function of these exosomes were compared, and found to be identical in all respects. Similarly an 8 fold increase in exosome production was obtained from NKL cells (a suspension cell line) using a CELLine 1000 (CL1000) flask. The CELLine system also incurred ~5.5 fold less cost and reduced labour for cell maintenance. This simple culture system is a cost effective, useful method for significantly increasing the quantity of exosomes available from cultured cells, without detrimental effects. This tool should prove advantageous in future studies of exosome-immune modulation in cancer and other settings. PMID:18423480

  17. High-Aspect-Ratio Rotating Cell-Culture Vessel

    Science.gov (United States)

    Wolf, David A.; Sams, Clarence; Schwarz, Ray P.

    1992-01-01

    Cylindrical rotating cell-culture vessel with thin culture-medium layer of large surface area provides exchange of nutrients and products of metabolism with minimal agitation. Rotation causes averaging of buoyant forces otherwise separating components of different densities. Vessel enables growth of cells in homogeneous distribution with little agitation and little shear stress.

  18. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction.

    Science.gov (United States)

    Uphoff, Cord C; Drexler, Hans G

    2011-01-01

    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  19. Growth and Plating of Cell Suspension Cultures of Datura Innoxia

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1974-01-01

    ammonium malate) or on NO3−-N alone. Dry weight yield was proportional to the amount of nitrate-N added (47 mg/mg N). Filtered suspension cultures containing single cells (plating cultures) could be grown in agar in petri dishes when NAA or 2,4-D were used as growth substances. Cells grew at densities...

  20. Batch variation between branchial cell cultures: An analysis of variance

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Grosell, M.; Kristensen, L.

    2003-01-01

    We present in detail how a statistical analysis of variance (ANOVA) is used to sort out the effect of an unexpected batch-to-batch variation between cell cultures. Two separate cultures of rainbow trout branchial cells were grown on permeable filtersupports ("inserts"). They were supposed to be...

  1. 21 CFR 864.2280 - Cultured animal and human cells.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cultured animal and human cells. 864.2280 Section 864.2280 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Cell And Tissue Culture Products §...

  2. Comparison of defined culture systems for feeder cell free propagation of human embryonic stem cells

    OpenAIRE

    Akopian, Veronika; Andrews, Peter W.; Beil, Stephen; Benvenisty, Nissim; Brehm, Jennifer; Christie, Megan; Ford, Angela; Fox, Victoria; Gokhale, Paul J; Healy, Lyn; Holm, Frida; Hovatta, Outi; Knowles, Barbara B; Ludwig, Tenneille E; Ronald D G McKay

    2010-01-01

    There are many reports of defined culture systems for the propagation of human embryonic stem cells in the absence of feeder cell support, but no previous study has undertaken a multi-laboratory comparison of these diverse methodologies. In this study, five separate laboratories, each with experience in human embryonic stem cell culture, used a panel of ten embryonic stem cell lines (including WA09 as an index cell line common to all laboratories) to assess eight cell culture methods, with pr...

  3. Autophagic response to cell culture stress in pluripotent stem cells.

    Science.gov (United States)

    Gregory, Siân; Swamy, Sushma; Hewitt, Zoe; Wood, Andrew; Weightman, Richard; Moore, Harry

    2016-05-01

    Autophagy is an important conserved cellular process, both constitutively as a recycling pathway for long lived proteins and as an upregulated stress response. Recent findings suggest a fundamental role for autophagic processes in the maintenance of pluripotent stem cell function. In human embryonic stem cells (hESCS), autophagy was investigated by transfection of LC3-GFP to visualize autophagosomes and with an antibody to LC3B protein. The presence of the primary cilium (PC) in hESCs as the site of recruitment of autophagy-related proteins was also assessed. HESCs (mShef11) in vitro displayed basal autophagy which was upregulated in response to deprivation of culture medium replacement. Significantly higher levels of autophagy were exhibited on spontaneous differentiation of hESCs in vitro. The PC was confirmed to be present in hESCs and therefore may serve to coordinate autophagy function. PMID:26385182

  4. Horizontally rotated cell culture system with a coaxial tubular oxygenator

    Science.gov (United States)

    Wolf, David A. (Inventor); Schwarz, Ray P. (Inventor); Trinh, Tinh T. (Inventor)

    1991-01-01

    The present invention relates to a horizontally rotating bioreactor useful for carrying out cell and tissue culture. For processing of mammalian cells, the system is sterilized and fresh fluid medium, microcarrier beads, and cells are admitted to completely fill the cell culture vessel. An oxygen containing gas is admitted to the interior of the permeable membrane which prevents air bubbles from being introduced into the medium. The cylinder is rotated at a low speed within an incubator so that the circular motion of the fluid medium uniformly suspends the microbeads throughout the cylinder during the cell growth period. The unique design of this cell and tissue culture device was initially driven by two requirements imposed by its intended use for feasibility studies for three dimensional culture of living cells and tissues in space by JSC. They were compatible with microgravity and simulation of microgravity in one G. The vessels are designed to approximate the extremely quiescent low shear environment obtainable in space.

  5. Biona-C Cell Culture pH Monitoring System

    Science.gov (United States)

    Friedericks, C.

    1999-01-01

    Sensors 2000! is developing a system to demonstrate the ability to perform accurate, real-time measurements of pH and CO2 in a cell culture media in Space. The BIONA-C Cell Culture pH Monitoring System consists of S2K! developed ion selective sensors and control electronics integrated with the fluidics of a cell culture system. The integrated system comprises a "rail" in the Cell Culture Module (CCM) of WRAIR (Space Biosciences of Walter Read Army Institute of Research). The CCM is a Space Shuttle mid-deck locker experiment payload. The BIONA-C is displayed along with associated graphics and text explanations. The presentation will stimulate interest in development of sensor technology for real-time cell culture measurements. The transfer of this technology to other applications will also be of interest. Additional information is contained in the original document.

  6. PECULIARITIES OF SECONDARY METABOLITES BIOSYNTHESIS IN PLANT CELL CULTURES

    Directory of Open Access Journals (Sweden)

    A.M. NOSOV

    2014-06-01

    Full Text Available metabolites formation in plant cell cultures of Panax spp., (ginsenosides; Dioscorea deltoidea (steroid glycosides; Ajuga reptans, Serratula coronata, Rhaponticum carthamoides (ecdisteroids; Polyscias spp., (triterpene glycosides, Taxus spp. (taxoids, Stevia rebaudiana (diterpene steviol-glycosides, Stephania glabra (alkaloids. They are some regular trends of secondary metabolites synthesis in the plant cell culture:It can be noted the stable synthesis of the compound promoting cell proliferation. Indeed, cell cultures of Dioscorea deltoidea were demonstrated to accumulate only furostanol glycosides, which promoted cell division. Furostanol glycoside content of Dioscorea strain DM-0.5 was up to 6 - 12% by dry biomass.Panax ginseng and P. japonicus plant cell cultures synthesize as minimum seven triterpene glycosides (ginsenosides, the productivity of these compounds was up to 6.0 - 8.0% on dry biomass.By contrast, the detectable synthesis of diterpene steviol-glycosides in cultivated cells of Stevia rebaudiana initiated in the mixotrophic cultures during chloroplast formation only.Despite these differences, or mainly due to them, plant cell cultures have become an attractive source of phytochemicals in alternative to collecting wild plants. It provides a guideline to bioreactor-based production of isoprenoids using undifferentiated plant cell cultures

  7. Pancreatic stellate cells promote proliferation and invasiveness of human pancreatic cancer cells via galectin-3

    Institute of Scientific and Technical Information of China (English)

    Hai-Biao Jiang; Ming Xu; Xing-Peng Wang

    2008-01-01

    AIM: To investigate the role of pancreatic stellate cells (PSCs) and galectin-3 (GAL-3) in the proliferation and infiltration of pancreatic cancer cell line SW1990.METHODS: Human pancreatic cancer cell line SW1990 and PSCs were cultured in vitro. Supernatant fluid of cultured PSCs and SW1990 cells was collected. Expression of GAL-3 in SW1990 cells and PSCs was detected by ELISA, RT-PCR and Western blotting. Proliferation of cultured PSCs and SW1990 cells was measured by 3-(4, 5-methylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay and flow cytometry. Infiltration of SW1990 cells was detected by a cell infiltration kit.RESULTS: SW1990 cells expressed GAL-3 and this was up-regulated by the supernatant fluid of cultured PSCs. PSCs did not express GAL-3. SW1990 cells stimulated proliferation of PSCs via GAL-3. GAL-3 antibody inhibited SW1990 cell proliferation, while the supernatant fluid of PSCs stimulated proliferation of SW1990 cells through interaction with GAL-3 protein. The supernatant fluid of PSCs enhanced the invasiveness of SW1990 cells through interaction with GAL-3.CONCLUSION: GAL-3 and PSCs were involved in the proliferation and infiltration process of pancreatic cancer cells.

  8. Morphological and Immunohistochemical Characterization of Canine Osteosarcoma Spheroid Cell Cultures.

    Science.gov (United States)

    Gebhard, C; Gabriel, C; Walter, I

    2016-06-01

    Spheroid cell culture emerges as powerful in vitro tool for experimental tumour research. In this study, we established a scaffold-free three-dimensional spheroid system built from canine osteosarcoma (OS) cells (D17). Spheroids (7, 14 and 19 days of cultivation) and monolayer cultures (2 and 7 days of cultivation) were evaluated and compared on light and electron microscopy. Monolayer and spheroid cultures were tested for vimentin, cytokeratin, alkaline phosphatase, osteocalcin and collagen I by means of immunohistochemistry. The spheroid cell culture exhibited a distinct network of collagen I in particular after 19-day cultivation, whereas in monolayer cultures, collagen I was arranged as a lamellar basal structure. Necrotic centres of large spheroids, as observed in 14- and 19-day cultures, were characterized by significant amounts of osteocalcin. Proliferative activity as determined by Ki-67 immunoreactivity showed an even distribution in two-dimensional cultures. In spheroids, proliferation was predominating in the peripheral areas. Metastasis-associated markers ezrin and S100A4 were shown to be continuously expressed in monolayer and spheroid cultures. We conclude that the scaffold-free spheroid system from canine OS cells has the ability to mimic the architecture of the in vivo tumour, in particular cell-cell and cell-matrix interactions. PMID:26287450

  9. Half-liter supernatant sampler system engineering work plan

    Energy Technology Data Exchange (ETDEWEB)

    Ritter, G.A.

    1995-06-06

    The Tank Waste Remediation System (TWRS) pretreatment facility project W-236B, known as the Initial Pretreatment Module (IPM), requires samples of supernatants and sludges from 200 Area tank farms for planned hot testing work in support of IPM design. The IPM project has proposed the development of several new sampler systems. These systems include a 0.5-l supernatant sampler, 3-l and 25-l supernatant and sludge samplers, and a 4,000-l sampler system. The 0.5-l sampler will support IPM sampling needs in the 1 to 3 l range starting in late fiscal year 1995. This sampler is intended to be used in conjunction with the existing 100 ml bottle-on-a-string. The 3-l and 25-l systems will be based on the Savannah River Site`s sampler system and will support IPM sampling needs in the 3 to 100 liter range. Most of the hot testing required for design of the IPM must be accomplished in the next 3 years. This work plan defines the tasks associated with the development of a 0.5-l sampler system. This system will be referred to as the Half-Liter Supernatant Sampler System (HLSSS). Specifically, this work plan will define the scope of work, identify organizational responsibilities, identify major technical requirements, describe configuration control and verification requirements, and provide estimated costs and schedule. The sampler system will be fully operational, including trained staff and operating procedures, upon completion of this task.

  10. Culturing of PC12 Cells, Neuronal Cells, Astrocytes Cultures and Brain Slices in an Open Microfluidic System

    DEFF Research Database (Denmark)

    Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya; Rømer Sørensen, Ane;

    culturing PC12 cells, neuronal cells, astrocytes cultures and brain slices. The microfluidic system provides efficient nutrient delivery, waste removal, access to oxygen, fine control over the neurochemical environment and access to modern microscopy. Additionally, the setup consists of an in vitro...

  11. Microglial cells in astroglial cultures: a cautionary note

    Directory of Open Access Journals (Sweden)

    Saura Josep

    2007-10-01

    Full Text Available Abstract Primary rodent astroglial-enriched cultures are the most popular model to study astroglial biology in vitro. From the original methods described in the 1970's a great number of minor modifications have been incorporated into these protocols by different laboratories. These protocols result in cultures in which the astrocyte is the predominant cell type, but astrocytes are never 100% of cells in these preparations. The aim of this review is to bring attention to the presence of microglia in astroglial cultures because, in my opinion, the proportion of and the role that microglial cells play in astroglial cultures are often underestimated. The main problem with ignoring microglia in these cultures is that relatively minor amounts of microglia can be responsible for effects observed on cultures in which the astrocyte is the most abundant cell type. If the relative contributions of astrocytes and microglia are not properly assessed an observed effect can be erroneously attributed to the astrocytes. In order to illustrate this point the case of NO production in activated astroglial-enriched cultures is examined. Lipopolysaccharide (LPS induces nitric oxide (NO production in astroglial-enriched cultures and this effect is very often attributed to astrocytes. However, a careful review of the published data suggests that LPS-induced NO production in rodent astroglial-enriched cultures is likely to be mainly microglial in origin. This review considers cell culture protocol factors that can affect the proportion of microglial cells in astroglial cultures, strategies to minimize the proportion of microglia in these cultures, and specific markers that allow the determination of such microglial proportions.

  12. The activity and stability of cell associated activity of bovicin HC5, a bacteriocin from Streptococcus bovis HC5

    Science.gov (United States)

    Streptococcus bovis HC5 cultures released a broad spectrum lantibiotic, bovicin HC5, into the cell-fee culture supernatant after they reached stationary phase, but most of the antibacterial activity remained cell-associated. Cell-associated bovicin HC5 was more resistant to degradation by Pronase E ...

  13. Isolation, Culture, and Maintenance of Mouse Intestinal Stem Cells

    Science.gov (United States)

    O’Rourke, Kevin P.; Ackerman, Sarah; Dow, Lukas E; Lowe, Scott W

    2016-01-01

    In this protocol we describe our modifications to a method to isolate, culture and maintain mouse intestinal stem cells as crypt-villus forming organoids. These cells, isolated either from the small or large intestine, maintain self-renewal and multilineage differentiation potential over time. This provides investigators a tool to culture wild type or transformed intestinal epithelium, and a robust assay for stem cell tissue homeostasis in vitro.

  14. SPONTANEOUS TRANSFORMATION OF CULTURED PORCINE BONE MARROW STROMAL CELLS

    DEFF Research Database (Denmark)

    Zou, Lijin; Zou, Xuenong; Li, Haisheng;

    -term culture are transformed into malignant cells. MATERIAL AND METHODS BMSC from 6 pigs were isolated and propagated continuously. Cell morphology was observed. Transformation properties were evaluated by means of serum dependence assay, Ki- 67 immunostaining, soft agar colony assay, karyotyping, telomerase...... was increased and TGF‚ signaling pathway was upregulated. However, telomerase activity maintained negative during culture. CONCLUSION Porcine BMSC can undergo spontaneous transformation, which provides a useful model to study the mechanisms associated with the tumorigenic potential of adult stem cells....

  15. Effects of methyl isocyanate on rat brain cells in culture.

    Science.gov (United States)

    Anderson, D; Goyle, S; Phillips, B J; Tee, A; Beech, L; Butler, W H

    1990-09-01

    Since the disaster in Bhopal, India, people exposed to methyl isocyanate (MIC) have complained of various disorders including neuromuscular dysfunction. In an attempt to get information about such dysfunction we have previously shown that MIC can affect muscle cells in culture. The present communication reports investigations into the effect of MIC on brain cells in culture. MIC was toxic to brain cells and the response was dose related. The observations were supported by light and electron microscopy. PMID:2207030

  16. Multizone paper platform for 3D cell cultures.

    Directory of Open Access Journals (Sweden)

    Ratmir Derda

    Full Text Available In vitro 3D culture is an important model for tissues in vivo. Cells in different locations of 3D tissues are physiologically different, because they are exposed to different concentrations of oxygen, nutrients, and signaling molecules, and to other environmental factors (temperature, mechanical stress, etc. The majority of high-throughput assays based on 3D cultures, however, can only detect the average behavior of cells in the whole 3D construct. Isolation of cells from specific regions of 3D cultures is possible, but relies on low-throughput techniques such as tissue sectioning and micromanipulation. Based on a procedure reported previously ("cells-in-gels-in-paper" or CiGiP, this paper describes a simple method for culture of arrays of thin planar sections of tissues, either alone or stacked to create more complex 3D tissue structures. This procedure starts with sheets of paper patterned with hydrophobic regions that form 96 hydrophilic zones. Serial spotting of cells suspended in extracellular matrix (ECM gel onto the patterned paper creates an array of 200 micron-thick slabs of ECM gel (supported mechanically by cellulose fibers containing cells. Stacking the sheets with zones aligned on top of one another assembles 96 3D multilayer constructs. De-stacking the layers of the 3D culture, by peeling apart the sheets of paper, "sections" all 96 cultures at once. It is, thus, simple to isolate 200-micron-thick cell-containing slabs from each 3D culture in the 96-zone array. Because the 3D cultures are assembled from multiple layers, the number of cells plated initially in each layer determines the spatial distribution of cells in the stacked 3D cultures. This capability made it possible to compare the growth of 3D tumor models of different spatial composition, and to examine the migration of cells in these structures.

  17. Chemotherapy in heterogeneous cultures of cancer cells with interconversion

    International Nuclear Information System (INIS)

    Recently, the interconversion between differentiated and stem-like cancer cells has been observed. Here, we model the in vitro growth of heterogeneous cell cultures in the presence of interconversion from differentiated cancer cells to cancer stem cells (CSCs), showing that, by targeting only CSC with cytotoxic agents, it is not always possible to eradicate cancer. We have determined the kinetic conditions under which cytotoxic agents in in vitro heterogeneous cultures of cancer cells eradicate cancer. In particular, we have shown that the chemotherapeutic elimination of in vitro cultures of heterogeneous cancer cells is effective only if it targets all cancer cell types, and if the induced death rates for the different subpopulations of cancer cell types are large enough. The quantitative results of the model are compared and validated with experimental data. (paper)

  18. Application of screen-printed microband biosensors to end-point measurements of glucose and cell numbers in HepG2 cell culture.

    Science.gov (United States)

    Pemberton, R M; Xu, J; Pittson, R; Biddle, N; Drago, G A; Jackson, S K; Hart, J P

    2009-02-15

    Microband glucose biosensors were produced by insulating and sectioning through a screen-printed, water-based carbon electrode containing cobalt phthalocyanine redox mediator and glucose oxidase enzyme. Under quiescent conditions at 37 degrees C, at an operating potential of +0.4V, they produced an amperometric response to glucose in buffer solutions with a sensitivity of 26.4 nA/mM and a linear range of 0.45 to 9.0 mM. An optimal pH value of 8.5 was obtained under these conditions, and a value for activation energy of 40.55 kJ mol(-1) was calculated. In culture medium (pH 7.3), a sensitivity of 13 nA/mM was obtained and the response was linear up to 5 mM with a detection limit of 0.5 mM. The working concentration was up to 20 mM glucose with a precision of 11.3% for replicate biosensors (n=4). The microband biosensors were applied to determine end-point glucose concentrations in culture medium by monitoring steady-state current responses 400 s after transfer of the biosensors into different sample solutions. In conjunction with cultures of HepG2 (human Caucasian hepatocyte carcinoma) cells, current responses obtained in 24-h supernatants showed an inverse correlation (R(2)=0.98) with cell number, indicating that the biosensors were applicable for monitoring glucose metabolism by cells and of quantifying cell number. Glucose concentrations determined using the biosensor assay were in good agreement, for concentrations up to 20mM, with those determined spectrophotometrically (R(2)=0.99). This method of end-point glucose determination was used to provide an estimated rate of glucose uptake for HepG2 cells of 7.9 nmol/(10(6) cells min) based on a 24-h period in culture. PMID:19027709

  19. Feeding Frequency Affects Cultured Rat Pituitary Cells in Low Gravity

    Science.gov (United States)

    Hymer, W. C.; Grindeland, R. E.; Salada, T.; Cenci, R.; Krishnan, K.; Mukai, C.; Nagaoka, S.

    1996-01-01

    In this report, we describe the results of a rat pituitary cell culture experiment done on STS-65 in which the effect of cell feeding on the release of the six anterior pituitary hormones was studied. We found complex microgravity related interactions between the frequency of cell feeding and the quantity and quality (i.e. biological activity) of some of the six hormones released in flight. Analyses of growth hormone (GH) released from cells into culture media on different mission days using gel filtration and ion exchange chromatography yielded qualitatively similar results between ground and flight samples. Lack of cell feeding resulted in extensive cell clumping in flight (but not ground) cultures. Vigorous fibroblast growth occurred in both ground and flight cultures fed 4 times. These results are interpreted within the context of autocrine and or paracrine feedback interactions. Finally the payload specialist successfully prepared a fresh trypsin solution in microgravity, detached the cells from their surface and reinserted them back into the culture chamber. These cells reattached and continued to release hormone in microgravity. In summary, this experiment shows that pituitary cells are microgravity sensitive and that coupled operations routinely associated with laboratory cel1 culture can also be accomplished in low gravity.

  20. Immunogenic DNA-related factors. Nucleosomes spontaneously released from normal murine lymphoid cells stimulate proliferation and immunoglobulin synthesis of normal mouse lymphocytes.

    OpenAIRE

    Bell, D. A.; Morrison, B; VandenBygaart, P

    1990-01-01

    The cell-free supernatants of normal spleen and thymus lymphocytes in short-term culture release low molecular weight (LMW) DNA protein molecules that have an immunoproliferative effect (polyclonal B cell activation) in vitro. We have determined that the protein-LMW DNA complexes responsible for these effects are nucleosomal constituents of chromatin, since the mitogenically active fractions of these cell-free supernatants contain the constituents of core histones (H3, H2A, H2B, H4) together ...

  1. Mammosphere culture of cancer stem cells in a microfluidic device

    Science.gov (United States)

    Saadin, Katayoon; White, Ian M.

    2012-03-01

    It is known that tumor-initiating cells with stem-like properties will form spherical colonies - termed mammospheres - when cultured in serum-free media on low-attachment substrates. Currently this assay is performed in commercially available 96-well trays with low-attachment surfaces. Here we report a novel microsystem that features on-chip mammosphere culture on low attachment surfaces. We have cultured mammospheres in this microsystem from well-studied human breast cancer cell lines. To enable the long-term culture of these unattached cells, we have integrated diffusion-based delivery columns that provide zero-convection delivery of reagents, such as fresh media, staining agents, or drugs. The multi-layer system consists of parallel cell-culture chambers on top of a low-attachment surface, connected vertically with a microfluidic reagent delivery layer. This design incorporates a reagent reservoir, which is necessary to reduce evaporation from the cell culture micro-chambers. The development of this microsystem will lead to the integration of mammosphere culture with other microfluidic functions, including circulating tumor cell recovery and high throughput drug screening. This will enable the cancer research community to achieve a much greater understanding of these tumor initiating cancer stem cells.

  2. Epithelial cell detachment by Porphyromonas gingivalis biofilm and planktonic cultures.

    Science.gov (United States)

    Huang, Lijia; van Loveren, Cor; Ling, Junqi; Wei, Xi; Crielaard, Wim; Deng, Dong Mei

    2016-04-01

    Porphyromonas gingivalis is present as a biofilm at the sites of periodontal infections. The detachment of gingival epithelial cells induced by P. gingivalis biofilms was examined using planktonic cultures as a comparison. Exponentially grown planktonic cultures or 40-h biofilms were co-incubated with epithelial cells in a 24-well plate for 4 h. Epithelial cell detachment was assessed using imaging. The activity of arginine-gingipain (Rgp) and gene expression profiles of P. gingivalis cultures were examined using a gingipain assay and quantitative PCR, respectively. P. gingivalis biofilms induced significantly higher cell detachment and displayed higher Rgp activity compared to the planktonic cultures. The genes involved in gingipain post-translational modification, but not rgp genes, were significantly up-regulated in P. gingivalis biofilms. The results underline the importance of including biofilms in the study of bacterial and host cell interactions. PMID:26963862

  3. A practical guide to hydrogels for cell culture.

    Science.gov (United States)

    Caliari, Steven R; Burdick, Jason A

    2016-04-28

    There is growing appreciation of the role that the extracellular environment plays in regulating cell behavior. Mechanical, structural, and compositional cues, either alone or in concert, can drastically alter cell function. Biomaterials, and particularly hydrogels, have been developed and implemented to present defined subsets of these cues for investigating countless cellular processes as a means of understanding morphogenesis, aging, and disease. Although most scientists concede that standard cell culture materials (tissue culture plastic and glass) do a poor job of recapitulating native cellular milieus, there is currently a knowledge barrier for many researchers in regard to the application of hydrogels for cell culture. Here, we introduce hydrogels to those who may be unfamiliar with procedures to culture and study cells with these systems, with a particular focus on commercially available hydrogels. PMID:27123816

  4. THE ULTRASTRUCTURE OF SEPARATED AND CULTURED CELL OF PORPHYRA YEZOENSIS

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    There are many reports that cells (protoplasts) separated from the thallus of Porphyra by enzyme can develop to normal leafy thalli in the same way as monospores. But there are few investigations on the subcellular structure of the isolated vegetative cell for comparison with the subcellular structure of monospores. To clarify whether the separated and cultured cells undergo the same or similar ultrastructure changes during culture and germination as monospores undergo in their formation and germination, we observed their ultrastructure, compared them with those of the monospore and found that the ultrastructure of separated and cultured cells did not have the characteristic feature as that of monospore formation, such as production of small and large fibrous vesicles, but was accompanied by vacuolation and starch mobilization like that in monospore germination. The paper also discusses the relations between monospores and separated and cultured cells.

  5. Surface modified alginate microcapsules for 3D cell culture

    Science.gov (United States)

    Chen, Yi-Wen; Kuo, Chiung Wen; Chueh, Di-Yen; Chen, Peilin

    2016-06-01

    Culture as three dimensional cell aggregates or spheroids can offer an ideal platform for tissue engineering applications and for pharmaceutical screening. Such 3D culture models, however, may suffer from the problems such as immune response and ineffective and cumbersome culture. This paper describes a simple method for producing microcapsules with alginate cores and a thin shell of poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG) to encapsulate mouse induced pluripotent stem (miPS) cells, generating a non-fouling surface as an effective immunoisolation barrier. We demonstrated the trapping of the alginate microcapsules in a microwell array for the continuous observation and culture of a large number of encapsulated miPS cells in parallel. miPS cells cultured in the microcapsules survived well and proliferated to form a single cell aggregate. Droplet formation of monodisperse microcapsules with controlled size combined with flow cytometry provided an efficient way to quantitatively analyze the growth of encapsulated cells in a high-throughput manner. The simple and cost-effective coating technique employed to produce the core-shell microcapsules could be used in the emerging field of cell therapy. The microwell array would provide a convenient, user friendly and high-throughput platform for long-term cell culture and monitoring.

  6. Absence of C-type virus production in human leukemic B cell, T cell and null cell lines.

    Directory of Open Access Journals (Sweden)

    Ogura,Hajime

    1978-06-01

    Full Text Available Electron microscope observation of cultured human leukemic B cell, T cell and null cell lines and reverse transcriptase assay of the culture supernatants were all negative for the presence of C-type virus. Bat cell line, which propagates primate C-type viruses well, was cocultivated with the human leukemic cell lines, in the hope of amplification of virus if present. Three weeks after mixed culture, the culture supernatants were again examined for reverse transcriptase activity and the cells were tested for syncytia formation by cocultivation with rat XC, human KC and RSb cell lines. All these tests, except for the positive control using a simian sarcoma virus, were negative, suggesting that no C-type was produced from these human leukemic cell lines.

  7. Crystal Violet Assay for Determining Viability of Cultured Cells.

    Science.gov (United States)

    Feoktistova, Maria; Geserick, Peter; Leverkus, Martin

    2016-01-01

    Adherent cells detach from cell culture plates during cell death. This characteristic can be used for the indirect quantification of cell death and to determine differences in proliferation upon stimulation with death-inducing agents. One simple method to detect maintained adherence of cells is the staining of attached cells with crystal violet dye, which binds to proteins and DNA. Cells that undergo cell death lose their adherence and are subsequently lost from the population of cells, reducing the amount of crystal violet staining in a culture. This protocol describes a quick and reliable screening method that is suitable for the examination of the impact of chemotherapeutics or other compounds on cell survival and growth inhibition. However, characterization of the cause of reduced crystal violet staining requires additional methods detailed elsewhere. PMID:27037069

  8. Controlling the diversity of cell populations in a stem cell culture

    NARCIS (Netherlands)

    Heo, Inha; Clevers, Hans

    2015-01-01

    Culturing intestinal stem cells into 3D organoids results in heterogeneous cell populations, reflecting the in vivo cell type diversity. In a recent paper published in Nature, Wang et al. established a culture condition for a highly homogeneous population of intestinal stem cells.

  9. A Place to Call Home: Bioengineering Pluripotential Stem Cell Cultures

    OpenAIRE

    Mark Weingarten; Nathan Akhavan; Joshua Hanau; Yakov Peter

    2015-01-01

    Pluripotent stem cells (PSCs) have the power to revolutionize the future of cell-based therapies and regenerative medicine. However, stem/progenitor cell use in the clinical arsenal has been hampered by discrepancies resulting from stem cell engineering and expansion, as well as in their (mass) differentiation in culture. Moreover, the manner in which external conditions affect PSC and induced-pluripotent stem cell lineage establishment as well as maturation remains controversial. In this rev...

  10. Air pollutant production by algal cell cultures

    Science.gov (United States)

    Fong, F.; Funkhouser, E. A.

    1982-01-01

    The production of phytotoxic air pollutants by cultures of Chlorella vulgaris and Euglena gracilis is considered. Algal and plant culture systems, a fumigation system, and ethylene, ethane, cyanide, and nitrogen oxides assays are discussed. Bean, tobacco, mustard green, cantaloupe and wheat plants all showed injury when fumigated with algal gases for 4 hours. Only coleus plants showed any resistance to the gases. It is found that a closed or recycled air effluent system does not produce plant injury from algal air pollutants.

  11. Insect cell culture and applications to research and pest management

    Science.gov (United States)

    Building on earlier research, insect cell culture began with the successful establishment of one cell line from pupal ovarian tissue. The field has grown to the extent that now over 500 insect cell lines have been established from many insect species representing numerous insect Orders and from seve...

  12. Detection and Treatment of Mycoplasma Contamination in Cultured Cells

    Directory of Open Access Journals (Sweden)

    Hsuan Jung

    2003-04-01

    Full Text Available Background: Mycoplasmas, the smallest and simplest prokaryotes that reside in endosomesof mammalian cells, are widespread contaminants found in cell cultures.About 30% of all cell cultures, varying from 15 to 80%, are reportedlycontaminated with mycoplasmas. Here, we present our experience in successfullydetecting and treating mycoplasmal infection in various cell lines.Methods: The nested polymerase chain reaction (PCR detection and microscopicexamination, including phase-contrast, fluorescent, as well as differentialinterference contrast, were used for detecting potential mycoplasma contaminationof cell lines used in our laboratory. As soon as mycoplasma was identified,antibiotic treatment was initiated.Results: Mycoplasmal contamination was detected in six of 15 cell lines using thenested PCR amplification of mycoplasma DNA, which was further demonstratedusing 4, 6-Diamidino-2-phenylindole (DAPI staining and fluorescentmicroscopy. Alternate treatment with two antibiotics, macrolide (tiamulinand tetracycline (minocycline, effectively eliminated mycoplasma, whichwas validated by both PCR and microscopic studies.Conclusions: The nested PCR using genomic DNA extracted from cultured cells as templatesis a rapid and sensitive method for detecting mycoplasma contamination.Treatment with combined antibiotics can completely eradicatemycoplasmal infection from cultured cells. For the ease of use, PCR and/orDAPI staining appear suitable for detecting potential mycoplasmal contaminationin laboratories that rely heavily on the cell culture system.

  13. The effects of glucocorticoids on cultured human endothelial cells.

    Science.gov (United States)

    Maca, R D; Fry, G L; Hoak, J C

    1978-04-01

    The effects of hydrocortisone, dexamethasone and prednisone on the morphology, replication, DNA synthesis, cell protein content and protein synthesis of cultured, human endothelial cells were evaluated. After culturing the cells with these glucocorticoids for 24-48 h, the cells covered a greater portion of the culture surface area. The mean surface area of the individual endothelial cell treated with glucocorticoids was 1.53 times greater than that of the untreated control endothelial cell. When compared with controls, the endothelial cover provided by the cells treated with glucocorticoids was more extensive and in many instances covered the entire culture surface. The change in morphology was associated with an increase in protein synthesis and protein content of the cells without an increase in DNA synthesis or cellular replication. Dexamethasone was approximately 10-fold more effective than hydrocortisone, while prednisone was the least effective. Aldosterone, DOCA, testosterone, progesterone, oestradiol and oestriol were ineffective. These studies indicate that glucocorticoids can alter the morphology and biochemistry of cultured endothelial cells and may have implications for the effects of steroids in the treatment of thrombocytopenic states and vascular disorders in man. PMID:646949

  14. Novel culturing platform for brain slices and neuronal cells

    DEFF Research Database (Denmark)

    Svendsen, Winnie Edith; Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya;

    2015-01-01

    In this paper we demonstrate a novel culturing system for brain slices and neuronal cells, which can control the concentration of nutrients and the waste removal from the culture by adjusting the fluid flow within the device. The entire system can be placed in an incubator. The system has been te...

  15. Analysis of Cervical Supernatant Samples Luminescence Using 355 nm Laser

    Science.gov (United States)

    Vaitkuviene, A.; Gegzna, V.; Kurtinaitiene, R.; Stanikunas, R.; Rimiene, J.; Vaitkus, J.

    2010-05-01

    The biomarker discovery for accurate detection and diagnosis of cervical carcinoma and its malignant precursors represents one of the current challenges in clinical medicine. Laser induced autofluorescence spectra in cervical smear content were fitted to predict the cervical epithelium diagnosis as a lab off "optical biopsy" method. Liquid PAP supernatant sediment dried on Quartz plate spectroscopy was performed by 355 nm Nd YAG microlaser STA-1 (Standa, Ltd). For comparison a liquid supernatant spectroscopy was formed by laboratory "Perkin Elmer LS 50B spetrometer at 290, 300, 310 nm excitations. Analysis of spectrum was performed by approximation using the multi-peaks program with Lorentz functions for the liquid samples and with Gaussian functions for the dry samples. Ratio of spectral components area to the area under whole experimental curve (SPP) was calculated. The spectral components were compared by averages of SPP using Mann-Whitney U-test in histology groups. Results. Differentiation of Normal and HSIL/CIN2+ cases in whole supernatant could be performed by stationary laboratory lamp spectroscopy at excitation 290 nm and emission >379 nm with accuracy AUC 0,69, Sens 0,72, Spec 0,65. Differentiation Normal versus HSIL/CIN2+ groups in dried enriched supernatant could be performed by 355 nm microlaser excitation at emission 405-424 nm with accuracy (AUC 0,96, Sens 0,91, Spec 1.00). Diagnostic algorithm could be created for all histology groups differentiation under 355 nm excitation. Microlaser induced "optical biopsy "looks promising method for cervical screening at the point of care.

  16. Supernatant Sludge Treatment on the Ljubljana Wastewater Treatment Plant

    OpenAIRE

    Vrbančič, Mojca

    2013-01-01

    Supernatant, generated from mechanical compaction previously anaerobically stabilized sludge at the wastewater treatment plant, is heavily loaded with ammonium nitrogen. Usually is leaded to an inflow of wastewater treatment plant and represents approximately 30 % of the additional nitrogen load in the biological treatment stage. To avoid this problem and due to increasingly stringent regulations, which has in recent years heavily limited emissions of nitrogen in the effluent from wastewater...

  17. Cell/Tissue Culture Radiation Exposure Facility Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop a Cell/Tissue Culture Radiation Exposure Facility (CTC-REF) to enable radiobiologists to investigate the real-time radiation effects on...

  18. Convoluted cells as a marker for maternal cell contamination in CVS cultures

    DEFF Research Database (Denmark)

    Hertz, Jens Michael; Jensen, P K; Therkelsen, A J

    1987-01-01

    In order to identify cells of maternal origin in CVS cultures, tissue from 1st trimester abortions were cultivated and the cultures stained in situ for X-chromatin. Convoluted cells and maternal fibroblasts were found to be positive. By chromosome analysis of cultures from 105 diagnostic placenta...... biopsies, obtained by the transabdominal route, metaphases of maternal origin were found in nine cases. In eight of these cases colonies of convoluted cells were observed. We conclude that convoluted cells are of maternal origin and are a reliable marker for maternal cell contamination in CVS cultures....

  19. Production and release of infectious hepatitis C virus from human liver cell cultures in the three-dimensional radial-flow bioreactor

    International Nuclear Information System (INIS)

    Lack of efficient culture systems for hepatitis C virus (HCV) has been a major obstacle in HCV research. Human liver cells grown in a three-dimensional radial-flow bioreactor were successfully infected following inoculation with plasma from an HCV carrier. Subsequent detection of increased HCV RNA suggested viral replication. Furthermore, transfection of HCV RNA transcribed from full-length cDNA also resulted in the production and release of HCV virions into supernatant. Infectivity was shown by successful secondary passage to a new culture. Introduction of mutations in RNA helicase and polymerase regions of HCV cDNA abolished virus replication, indicating that reverse genetics of this system is possible. The ability to replicate and detect the extracellular release of HCV might provide clues with regard to the persistent nature of HCV infection. It will also accelerate research into the pathogenicity of HCV, as well as the development of prophylactic agents and new therapy

  20. Effects of UVC-irradiation on cultured mouse embryonic cells

    International Nuclear Information System (INIS)

    Effects of UVC-irradiation on the cultured differentiating mouse embryonic cells were investigated. Embryonic mesenchymal cells, isolated from fore-and hind-limbs or mid brain of Day 11 mouse embryos, and 3T3 cells, a reference mouse fibroblast cell line, were irradiated with UVC at a dose range of 0∼30 J/m2. Dose-dependent inhibition was found for both cellular proliferation and differentiation, dose-dependent induction of DNA cyclobutane pyrimidine dimers and (6-4) photoproducts were found in the embryonic cells. Mesenchymal chondrogenesis was more sensitive to the UVC than proliferation, and the UVC-induced DNA damage and their repair kinetics in the cultured embryonic cells were similar to those in mouse 3T3 cells. No effects of treatments by the fluorescent light pre or post UVC-irradiation were found on the repair kinetics of DNA damage in all of the cells

  1. Exposure to Music Alters Cell Viability and Cell Motility of Human Nonauditory Cells in Culture

    Science.gov (United States)

    Lestard, Nathalia R.

    2016-01-01

    Although music is part of virtually all cultures in the world, little is known about how it affects us. Since the beginning of this century several studies suggested that the response to music, and to sound in general, is complex and might not be exclusively due to emotion, given that cell types other than auditory hair cells can also directly react to audible sound. The present study was designed to better understand the direct effects of acoustic vibrations, in the form of music, in human cells in culture. Our results suggest that the mechanisms of cell growth arrest and/or cell death induced by acoustic vibrations are similar for auditory and nonauditory cells. PMID:27478480

  2. Exposure to Music Alters Cell Viability and Cell Motility of Human Nonauditory Cells in Culture.

    Science.gov (United States)

    Lestard, Nathalia R; Capella, Marcia A M

    2016-01-01

    Although music is part of virtually all cultures in the world, little is known about how it affects us. Since the beginning of this century several studies suggested that the response to music, and to sound in general, is complex and might not be exclusively due to emotion, given that cell types other than auditory hair cells can also directly react to audible sound. The present study was designed to better understand the direct effects of acoustic vibrations, in the form of music, in human cells in culture. Our results suggest that the mechanisms of cell growth arrest and/or cell death induced by acoustic vibrations are similar for auditory and nonauditory cells. PMID:27478480

  3. Qualitative study of three cell culture methods.

    Science.gov (United States)

    Wang, Aiguo; Xia, Tao; Ran, Peng; Chen, Xuemin; Nuessler, Andreas K

    2002-01-01

    Primary rat hepatocytes were cultured using different in vitro models and the enzyme leakage, albumin secretion, and cytochrome P450 1A (CYP 1A) activity were observed. The results showed that the level of LDH was decreased over time in culture. However, on day 5, LDH showed a significant increase in monolayer culture (MC) while after day 8 no LDH was detectable in sandwich culture (SC). The levels of AST and ALT did not change significantly over the investigated time. The CYP 1A activity was gradually decreased in a time-dependent manner in MC and SC. The decline of CYP 1A was faster in MC than in SC. This effect was partially reversed by using cytochrome P450 (CYP450) inducer such as Omeprazol and 3-methylcholanthrene (3-MC) and the CYP 1A induction was always higher in MC than in SC. In bioreactor basic CYP 1A activity was preserved over 2 weeks and the highest albumin production was observed in bioreactor followed by SC and MC. Taken together, it was indicated each investigated model had its advantages and disadvantages. It was also underlined that various in vitro models may address different questions. PMID:12674760

  4. [Effect evaluation of three cell culture models].

    Science.gov (United States)

    Wang, Aiguo; Xia, Tao; Yuan, Jing; Chen, Xuemin

    2003-11-01

    Primary rat hepatocytes were cultured using three kinds of models in vitro and the enzyme leakage, albumin secretion, and cytochrome P450 1A (CYP 1A) activity were observed. The results showed that the level of LDH in the medium decreased over time in the period of culture. However, on 5 days, LDH showed a significant increase in monolayer culture (MC) while after 8 days LDH was not detected in sandwich culture (SC). The levels of AST and ALT in the medium did not change significantly over the investigated time. The basic CYP 1A activity gradually decreased with time in MC and SC. The decline of CYP 1A in rat hepatocytes was faster in MC than that in SC. This effect was partially reversed by using cytochrome P450 (CYP450) inducers such as omeprazol and 3-methylcholanthrene (3-MC) and the CYP 1A induction was always higher in MC than that in SC. Basic CYP 1A activity in bioreactor was keeped over 2 weeks and the highest albumin production was observed in bioreactor, and next were SC and MC. In conclusion, our results clearly indicated that there have some advantages and disadvantages in each of models in which can address different questions in metabolism of toxicants and drugs. PMID:14963896

  5. Hydrofocusing Bioreactor for Three-Dimensional Cell Culture

    Science.gov (United States)

    Gonda, Steve R.; Spaulding, Glenn F.; Tsao, Yow-Min D.; Flechsig, Scott; Jones, Leslie; Soehnge, Holly

    2003-01-01

    The hydrodynamic focusing bioreactor (HFB) is a bioreactor system designed for three-dimensional cell culture and tissue-engineering investigations on orbiting spacecraft and in laboratories on Earth. The HFB offers a unique hydrofocusing capability that enables the creation of a low-shear culture environment simultaneously with the "herding" of suspended cells, tissue assemblies, and air bubbles. Under development for use in the Biotechnology Facility on the International Space Station, the HFB has successfully grown large three-dimensional, tissuelike assemblies from anchorage-dependent cells and grown suspension hybridoma cells to high densities. The HFB, based on the principle of hydrodynamic focusing, provides the capability to control the movement of air bubbles and removes them from the bioreactor without degrading the low-shear culture environment or the suspended three-dimensional tissue assemblies. The HFB also provides unparalleled control over the locations of cells and tissues within its bioreactor vessel during operation and sampling.

  6. Learning about Cells as Dynamic Entities: An Inquiry-Driven Cell Culture Project

    Science.gov (United States)

    Palombi, Peggy Shadduck; Jagger, Kathleen Snell

    2008-01-01

    Using cultured fibroblast cells, undergraduate students explore cell division and the responses of cultured cells to a variety of environmental changes. The students learn new research techniques and carry out a self-designed experiment. Through this project, students enhance their creative approach to scientific inquiry, learn time-management and…

  7. Stability of resazurin in buffers and mammalian cell culture media

    DEFF Research Database (Denmark)

    Rasmussen, Eva; Nicolaisen, G.M.

    1999-01-01

    The utility of a ferricyanide/ferrocyanide system used in the AlamarBlue(TM) (Serotec, Oxford, UK) vital. dye to inhibit the reduction of resazurin by mammalian cell culture media is questioned. Resazurin was found to be relatively stable when dissolved in phosphate-buffered saline (PBS). The use...... of HEPES resulted in a huge immediate dye reduction, which was significantly enhanced by exposure to diffuse light from fluorescent tubes in the laboratory 8 h per day. The reduction of resazurin by various cell culture media was time and temperature dependent, and it was significantly enhanced by......'s nutrient mixture F-10 and F-12. Fetal calf serum (5-20%) slightly decreased resazurin reduction during the first 2 days of incubation. The reduction of resazurin by mammalian cell culture media do not appear to be problematic under normal culture conditions, and it is primarily dependent upon the presence...

  8. Towards dynamic metabolic flux analysis in CHO cell cultures.

    Science.gov (United States)

    Ahn, Woo Suk; Antoniewicz, Maciek R

    2012-01-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian cell line for biopharmaceutical production, with a total global market approaching $100 billion per year. In the pharmaceutical industry CHO cells are grown in fed-batch culture, where cellular metabolism is characterized by high glucose and glutamine uptake rates combined with high rates of ammonium and lactate secretion. The metabolism of CHO cells changes dramatically during a fed-batch culture as the cells adapt to a changing environment and transition from exponential growth phase to stationary phase. Thus far, it has been challenging to study metabolic flux dynamics in CHO cell cultures using conventional metabolic flux analysis techniques that were developed for systems at metabolic steady state. In this paper we review progress on flux analysis in CHO cells and techniques for dynamic metabolic flux analysis. Application of these new tools may allow identification of intracellular metabolic bottlenecks at specific stages in CHO cell cultures and eventually lead to novel strategies for improving CHO cell metabolism and optimizing biopharmaceutical process performance. PMID:22102428

  9. Detection of multiple mycoplasma infection in cell cultures by PCR

    Directory of Open Access Journals (Sweden)

    J. Timenetsky

    2006-07-01

    Full Text Available A total of 301 cell cultures from 15 laboratories were monitored for mycoplasma (Mollicutes using PCR and culture methodology. The infection was detected in the cell culture collection of 12 laboratories. PCR for Mollicutes detected these bacteria in 93 (30.9% samples. Although the infection was confirmed by culture for 69 (22.9% samples, PCR with generic primers did not detect the infection in five (5.4%. Mycoplasma species were identified with specific primers in 91 (30.2% of the 98 samples (32.6% considered to be infected. Mycoplasma hyorhinis was detected in 63.3% of the infected samples, M. arginini in 59.2%, Acholeplasma laidlawii in 20.4%, M. fermentans in 14.3%, M. orale in 11.2%, and M. salivarium in 8.2%. Sixty (61.2% samples were co-infected with more than one mycoplasma species. M. hyorhinis and M. arginini were the microorganisms most frequently found in combination, having been detected in 30 (30.6% samples and other associations including up to four species were detected in 30 other samples. Failure of the treatments used to eliminate mycoplasmas from cell cultures might be explained by the occurrence of these multiple infections. The present results indicate that the sharing of non-certified cells among laboratories may disseminate mycoplasma in cell cultures.

  10. Pattern secretion of matrix Metalloproteinases and their biological tissue inhibitors by human glomerular mesangial cells in culture

    Directory of Open Access Journals (Sweden)

    "Hosseini R

    2001-08-01

    Full Text Available The glomerular mesangial cells (GMC play a central role in the synthesis and turnover of the glomerular mesangial matrix. The breakdown of the matrix likely depends on the balance between of a variety of proteinases including matrix metalloproteinases and their biological inhibitors secreted by the GMC, and any disturbance in the balance may result in appearance of various pathological states such as glomerulosclerosis. We therefore studied pattern secretion of matrix metalloproteinases (MMPs, MMP-1, MMP-2, MMP-3, MMP-9 and their biological tissue inhibitor of matrix metalloproteinases (TIMPs, TIMP-1 and TIMP-2 by cultured human GMC. We also measured MMP-1/TIMP-1 complex level in the cell culture supernatants. For this purpose, the GMC were incubated under serum-free conditions with medium (RPMI-1640 alone or in combination with TNF-α (30 ng/ml or phorbol myristate acetate (PMA (50 ng/ml for exactly 24, 48 and 72 hours. The above parameters were assayed by established ELISA techniques. Our results showed that the lowest and largest secretions were related to MMP-9 and MMP-2, respectively. The results indicated that the MMPs and TIMPs secretion were increased by TNF-α (MMP-1, MMP-2, TIMP-1 and TIMP-2 and PMA (MMP-2, TIMP-1 and TIMP-2, significantly (P<0.05. These results suggest that the GMC can synthesis and release various MMPs and their inhibitors (TIMPs that, in part, control turnover of extracellular matrix proteins.

  11. Integrin VLA-3: ultrastructural localization at cell-cell contact sites of human cell cultures

    OpenAIRE

    1989-01-01

    The integrin VLA-3 is a cell surface receptor, which binds to fibronectin, laminin, collagen type I and VI (Takada, Y., E. A. Wayner, W. G. Carter, and M. E. Hemler. 1988. J. Cell. Biochem. 37:385-393) and is highly expressed in substrate adherent cultures of almost all human cell types. The ligand specificity of VLA-3 and the inhibition of cell adhesion by anti-VLA-3 monoclonal antibodies suggest its involvement in cell-substrate interaction. In normal tissues, VLA-3 is restricted to few cel...

  12. Metabolism Kinetics of Glucose in Anchorage-dependent Cell Cultures

    Institute of Scientific and Technical Information of China (English)

    孙祥明; 张元兴

    2001-01-01

    The kinetic model of glucose metabolism was established and successfully applied to batchcultures of rCHO and rBHK cells. It was found that a large amount of glucose was utilized for cellmaintenance, and the overwhelming majority of maintenance energy from glucose was by its anaerobicmetabolism in both rBHK and rCHO cell cultures. The overall maintenance coefficients from aerobicmetabolism were 1.9×10-13 mmol/(cell.h) for rCHO cells and 7×10-13 mmol/(cell.h) for rBHK cells. Inaddition, all Go/T and Eo/T gradually increased with the same trend as the cell growth in the culture ofboth rCHO and rBHK cells. The overall molecule yield coefficients of lactate to glucose were 1.61 for rCHO cells and 1.38 for rBHK cells. The yield coefficients of cell to glucose were 4.5×108 cells/mmol for rCHO cells and 1.9 × 108 cells/mmol for rBHK cells, respectively.

  13. A Simple Hydrophilic Treatment of SU-8 Surfaces for Cell Culturing and Cell Patterning

    DEFF Research Database (Denmark)

    Wang, Zhenyu; Stangegaard, Michael; Dufva, Hans Martin;

    2005-01-01

    SU-8, an epoxy-based photoresist, widely used in constitution different mTAS systems, is incompatible with mammalian cell adhesion and culture in its native form. Here, we demonstrate a simple, cheap and robust two-step method to render a SU-8 surface hydrophilic and compatible with cell culture....... The contact angle of SU-8 surface was significantly reduced from 90° to 25° after the surface modification. The treated SU-8 surfaces provided a cell culture environment that was comparable with cell culture flask surface in terms of generation time and morphology....

  14. Replica-moulded polydimethylsiloxane culture vessel lids attenuate osmotic drift in long-term cell cultures

    Indian Academy of Sciences (India)

    Axel Blau; Tanja Neumann; Christiane Ziegler; Fabio Benfenati

    2009-03-01

    An imbalance in medium osmolarity is a determinant that affects cell culture longevity. Even in humidified incubators, evaporation of water leads to a gradual increase in osmolarity overtime. We present a simple replica-moulding strategy for producing self-sealing lids adaptable to standard, small-size cell-culture vessels. They are made of polydimethylsiloxane (PDMS), a flexible, transparent and biocompatible material, which is gas-permeable but largely impermeable to water. Keeping cell cultures in a humidified 5% CO2 incubator at 37°C, medium osmolarity increased by +6.86 mosmol/kg/day in standard 35 mm Petri dishes, while PDMS lids attenuated its rise by a factor of four to changes of +1.72 mosmol/kg/ day. Depending on the lid membrane thickness, pH drifts at ambient CO2 levels were attenuated by a factor of 4 to 9. Comparative evaporation studies at temperatures below 60°C yielded a 10-fold reduced water vapour flux of 1.75 g/day/dm2 through PDMS lids as compared with 18.69 g/day/dm2 with conventional Petri dishes. Using such PDMS lids, about 2/3 of the cell cultures grew longer than 30 days in vitro. Among these, the average survival time was 69 days with the longest survival being 284 days under otherwise conventional cell culture conditions.

  15. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Özcan;

    2011-01-01

    Standard cell culture plastic was surface modified by passive adsorption or covalent attachment of interleukin (IL)-4 and investigated for its ability to induce differentiation of human monocytes into mature dendritic cells, a process dose-dependently regulated by IL-4. Covalent attachment of IL-4...

  16. Endothelial cell cultures as a tool in biomaterial research

    NARCIS (Netherlands)

    Kirkpatrick, CJ; Otto, M; Kooten, TV; Krump, [No Value; Kriegsmann, J; Bittinger, F

    1999-01-01

    Progress in biocompatibility and tissue engineering would today be inconceivable without the aid of in vitro techniques. Endothelial cell cultures represent a valuable tool not just in haemocompatibility testing, but also in the concept of designing hybrid organs. In the past endothelial cells (EC)

  17. Cell cultures from the symbiotic soft coral Sinularia flexibilis

    NARCIS (Netherlands)

    Khalesi, M.K.; Vera-Jimenez, N.I.; Aanen, D.K.; Beeftink, H.H.; Wijffels, R.H.

    2008-01-01

    The symbiotic octocoral Sinularia flexibilis is a producer of potential pharmaceuticals. Sustainable mass production of these corals as a source of such compounds demands innovative approaches, including coral cell culture. We studied various cell dissociation methodologies and the feasibility of cu

  18. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Ozcan;

    2011-01-01

    Standard cell culture plastic was surface modified by passive adsorption or covalent attachment of interleukin (IL)-4 and investigated for its ability to induce differentiation of human monocytes into mature dendritic cells, a process dose-dependently regulated by IL-4. Covalent attachment of IL-...

  19. ROLE OF PANCREATIC STELLATE CELLS AND GALECTIN-3 ON PROLIFERATION AND INFILTRATION OF HUMAN PANCREATIC CANCER CELL LINE SW1990

    Institute of Scientific and Technical Information of China (English)

    JIANG Hai-biao; XU Ming; WANG Xing-peng

    2008-01-01

    Objective To investigate the role of pancreatic stellate cells (PSCs) and galectin-3 (GAL-3)on the proliferation and infiltration of pancreatic cancer cell line SW1990. Methods Human pancreatic cancercell line SW1990 and PSCs were cultured in vitro. Supernatant of cultured PSCs and SW1990 cells was collected.Expressions of GAL-3 in SW1990 cells and PSCs were detected by ELISA, RT-PCR and Western blot. Theproliferation of those cultured PSCs and SW1990 cells were measured by MTT assay and flowcytometry. Infiltrationof SW1990 cells was detected by cell infiltration kit. Results SW1990 cells expressed GAL-3 and the expressionwas up-regulated by the supernatant fluid of cultured PSCs. PSCs did not express GAL-3. SW1990 cells couldstimulate the proliferation of PSCs via GAL-3. GAL-3 antibody could inhibit SW1990 cells proliferation andinfiltration, which indicated that supernatant of PSCs might stimulate the proliferation of SW1990 cells through theinteraction with GAL-3 protein. The supernatant fluid of PSCs could enhance the invasiveness of SW1990 cellsthrough the interaction with GAL-3. Conclusion GAL-3 and PSCs was involved in the proliferation andinfiltration process of pancreatic cancer.

  20. Duchenne muscular dystrophy: normal ATP turnover in cultured cells

    International Nuclear Information System (INIS)

    This paper examines ATP metabolism in cultured muscle cells and fibroblasts from patients with Duchenne dystrophy. ATP and ADP levels were the same in cultured cells from normal subjects and patients and there was no difference in ATP synthesis or degradation. The ATP synthesis was measured by the incorporation of C 14-U-adenine into aTP and ADP. although there was a significant decrease in radioactively labelled ATP after incubation with deoxyglucose in Duchenne muscle cells, there was no difference in ATP concentration of ADP metabolism

  1. Schwann cell cultures from human fetal dorsal root ganglia

    Institute of Scientific and Technical Information of China (English)

    Yaping Feng; Hui Zhu; Jiang Hao; Xinmin Wang; Shengping Wu; Li Bai; Xiangming Li; Yun Zha

    2009-01-01

    BACKGROUND:Previous studies have used many methods for in vitro Schwann cells (SCs) cul-tures and purification,such as single cell suspension and cytosine arabinoside.However,it has been difficult to obtain sufficient cellular density,and the procedures have been quite tedious.OBJECTIVE:To investigate the feasibility of culturing high-density SCs using fetal human dorsal root ganglion tissue explants.DESIGN,TIME AND SETTING:Cell culture and immunohistochemistry were performed at the Cen-tral Laboratory of Kunming General Hospital of Chinese PLA between March 2001 and October 2008.MATERIALS:Culture media containing 10% fetal bovine serum,as well as 0.2% collagenase and 0.25% trypsin were purchased from Gibco,USA;mouse anti-human S-100 monoclonal antibody and goat anti-mouse IgG labeled with horseradish peroxidase were provided by Beijing Institute of Bi-ological Products,China.METHODS:Primarily cultured SCs were dissociated from dorsal root ganglia of human aborted fe-tuses at 4-6 months pregnancy.Following removal of the dorsal root ganglion perineurium,the gan-glia were dissected into tiny pieces and digested with 0.2% collagenase and 0.25% trypsin (volume ratio 1:1),then explanted and cultured.SC purification was performed with 5 mL 10% fetal bovine serum added to the culture media,followed by differential adhesion.MAIN OUTCOME MEASURES:SCs morphology was observed under inverted phase contrast light microscopy.SC purity was evaluated according to percentage of S-100 immunostained cells.RESULTS:SCs were primarily cultured for 5-6 days and then subcultured for 4-5 passages.The highly enriched SC population reached > 95% purity and presented with normal morphology.CONCLUSION:A high purity of SCs was obtained with culture methods using human fetal dorsal root ganglion tissue explants.

  2. Miniature Bioreactor System for Long-Term Cell Culture

    Science.gov (United States)

    Gonda, Steve R.; Kleis, Stanley J.; Geffert, Sandara K.

    2010-01-01

    A prototype miniature bioreactor system is designed to serve as a laboratory benchtop cell-culturing system that minimizes the need for relatively expensive equipment and reagents and can be operated under computer control, thereby reducing the time and effort required of human investigators and reducing uncertainty in results. The system includes a bioreactor, a fluid-handling subsystem, a chamber wherein the bioreactor is maintained in a controlled atmosphere at a controlled temperature, and associated control subsystems. The system can be used to culture both anchorage-dependent and suspension cells, which can be either prokaryotic or eukaryotic. Cells can be cultured for extended periods of time in this system, and samples of cells can be extracted and analyzed at specified intervals. By integrating this system with one or more microanalytical instrument(s), one can construct a complete automated analytical system that can be tailored to perform one or more of a large variety of assays.

  3. Hydrodynamic effects on cells in agitated tissue culture reactors

    Science.gov (United States)

    Cherry, R. S.; Papoutsakis, E. T.

    1986-01-01

    The mechanisms by which hydrodynamic forces can affect cells grown on microcarrier beads in agitated cell culture reactors were investigated by analyzing the motion of microcarriers relative to the surrounding fluid, to each other, and to moving or stationary solid surfaces. It was found that harmful effects on cell cultures that have been previously attributed to shear can be better explained as the effects of turbulence (of a size scale comparable to the microcarriers or the spacing between them) or collisions. The primary mechanisms of cell damage involve direct interaction between microcarriers and turbulent eddies, collisions between microcarriers in turbulent flow, and collisions against the impeller or other solid surfaces. The implications of these analytical results for the design of tissue culture reactors are discussed.

  4. Culture and immortalization of pancreatic ductal epithelial cells.

    Science.gov (United States)

    Lawson, Terence; Ouellette, Michel; Kolar, Carol; Hollingsworth, Michael

    2005-01-01

    Some populations of the epithelial cells from the duct and ductular network of the mammalian pancreas have been isolated and maintained in vitro for up to 3 mo. These cells express many of the surface factors that are unique to them in vivo. They also retain significant drug- and carcinogen-metabolizing capacity in vitro. In this chapter we review the progression of the methods for the isolation, culture and maintenance in vitro for these cells from the earliest when only duct/ductular fragments were obtainable to the current ones which provide epithelial cells. The critical steps in the isolation process are identified and strategies are provided to facilitate these steps. These include the selection of tissue digestive enzymes, the importance of extensive mincing before culture and the importance of roles of some co-factors used in the culture medium. PMID:15542901

  5. Microfluidic bioreactors for culture of non-adherent cells

    DEFF Research Database (Denmark)

    Shah, Pranjul Jaykumar; Vedarethinam, Indumathi; Kwasny, Dorota;

    2011-01-01

    Microfluidic bioreactors (μBR) are becoming increasingly popular for cell culture, sample preparation and analysis in case of routine genetic and clinical diagnostics. We present a novel μBR for non-adherent cells designed to mimic in vivo perfusion of cells based on diffusion of media through a...... sandwiched membrane. The culture chamber and perfusion chamber are separated by a sandwiched membrane and each chamber has separate inlet/outlets for easy loading/unloading of cells and perfusion of the media. The perfusion of media and exchange of nutrients occur through the sandwiched membrane, which was...... of CFSE staining and subsequent counting in a flow cytometer. To conclude on the applicability of μBR for genetic diagnostics, we prepare chromosome spreads on glass slides from the cultured samples, which is the primary step for metaphase FISH analysis....

  6. Dose verification by OSLDs in the irradiation of cell cultures

    International Nuclear Information System (INIS)

    The determination of value of irradiation dose presents difficulties when targets are irradiated located in regions where electronic equilibrium of charged particle is not reached, as in the case of irradiation -in vitro- of cell lines monolayer-cultured, in culture dishes or flasks covered with culture medium. The present study aimed to implement a methodology for dose verification in irradiation of cells in culture media by optically stimulated luminescence dosimetry (OSLD). For the determination of the absorbed dose in terms of cell proliferation OSL dosimeters of aluminum oxide doped with carbon (Al2O3:C) were used, which were calibrated to the irradiation conditions of culture medium and at doses that ranged from 0.1 to 15 Gy obtained with a linear accelerator of 6 MV photons. Intercomparison measurements were performed with an ionization chamber of 6 cm3. Different geometries were evaluated by varying the thicknesses of solid water, air and cell culture medium. The results showed deviations below 2.2% when compared with the obtained doses of OSLDs and planning system used. Also deviations were observed below 3.4% by eccentric points of the irradiation plane, finding homogeneous dose distribution. Uncertainty in the readings was less than 2%. The proposed methodology contributes a contribution in the dose verification in this type of irradiations, eliminating from the calculation uncertainties, potential errors in settling irradiation or possible equipment failure with which is radiating. It also provides certainty about the survival curves to be plotted with the experimental data. (Author)

  7. 人羊膜匀浆上清液对脂多糖致伤的大鼠肺微血管内皮细胞增殖及分泌炎症因子的影响%Effect of supernatant of human amnion homogenate on lipopolysaccharide induced pulmonary microvascular endotheli-al cells injury and their proliferation and expression of proinflammatory factors in rats

    Institute of Scientific and Technical Information of China (English)

    陈云鹏; 朱富军; 龚震宇; 辛海明; 王磊; 童亚林; 刘亮; 吕璐; 莫永亮; 詹球; 阳齐琼; 梁静

    2015-01-01

    长因子、细胞因子,对 LPS致伤的 RPMVECs增殖具有促进作用,并减少致伤后炎症因子分泌。%Objective:To investigate the protective effect of supernatant of human amnion homogenate (hAHS)on proliferation and expression of proinflammatory mediators by lipopolysaccharide (LPS)induced inj ured pulmonary microvascular endothelial cells of rats (RPMVECs).Methods:hAHS was prepared from fresh human amnion. The total protein content and the content of epithelial growth factor (EGF),basic fibroblast growth factor (bFGF), vascular endothelial growth factor (VEGF),interleukin-4 (IL-4),IL-10,angiogenin-1 (Ang-1),humanβ-defensin2 (HBD2)of hAHS were determined with Coomassie blue staining and ELISA. The effect of 0,10%,15%, 20%,25% hAHS on cell proliferation activity of RPMVECs was respectively determined with MTT assay,in or-der to determine the optimal concentration of hAHS on promoting RPMVECs proliferation. According to different co-culture conditions,RPMVECs were randomly divided into 4 groups:group N (cultured with 10%FBS+DMEM/F12),group A(10%FBS+DMEM/F12+15%hAHS),group B (10%FBS+DMEM/F12+LPS),and group C (10%FBS+DMEM/F12+15%hAHS+LPS). At 0,12,24,48,72 hours after culturing with the corre-sponding medium of each group,optical density values (A values)of each group were determined respectively with MTT assay to determine the proliferation activity,and the contents of IL-6,IL-8,TNF-αlevels in the culture su-pernates were also determined by ELISA at 6,8,10,12 and 24 hours. Results:The total protein concentration of hAHS was (725.125±12.625)mg/L,and levels of EGF,bFGF,VEGF,IL-4,IL-10,Ang-1,HDB2 were re-spectively(504.785±4.665)ng/L,(4.426±0.138)ng/L,(0.185±0.006)ng/L,(25.650±4.104)ng/L,(13.733 ±2.197)ng/L,(15.561±0.496)ng/L,(4.763±0.714)ng/L.10%-20% hAHS was shown to promote prolifer-ation of RPMVECs,and 15% hAHS,and the best result was observed on 7 and 9 days. The proliferation rate of RPMVECs in 25% hAHS group at 7,9 and 11 days was lower than those in the 0%hAHS group (P<0

  8. Radiosensitivity of cultured insect cells: I. Lepidoptera

    International Nuclear Information System (INIS)

    The radiosensitivity of five lepidopteran insect cell lines representing five different genera has been investigated. These lines are: (1) TN-368, Trichoplusia ni; (2) IPLB-SF-1254, Spodoptera frugiperda; (3) IPLB-1075, Heliothis zea; (4) MRRL-CHl, clone GVl, Manduca sexta; and (5) IAL-PID2, Plodia interpunctella. The cell lines grew at different rates and had population doubling times that ranged from 19 to 52 hr. All of the lines are highly heteroploid and have approximate chromosome numbers near or above 100. The chromosomes are very small. All of the lines are extremely radioresistant; cell populations are able to recover from 260 kVp X-ray exposures up to and including 400 Gy, the highest dose examined. Cell survival curves were obtainable for only the TN-368 and IPLB-SF-1254 lines. The TN-368 cells displayed a biphasic survival response with D0, d/sub q/, and n values of 65.7 and 130.2 Gy, 9.0 and -36.1 Gy, and 1.2 and 0.8, respectively, for the steep and shallow portions of the curve. The IPLB-SF-1254 cells had a D0 of 63.9 Gy. D/sub q/ of 19.0 Gy, and n value of 1.4. These studies provide definitive evidence of the radioresistance of lepidopteran cells, and suggest that this radioresistance is a characteristic of lepidopteran insects

  9. Establishing a stem cell culture laboratory for clinical trials

    Directory of Open Access Journals (Sweden)

    Elíseo Joji Sekiya

    2012-01-01

    Full Text Available Adult stem/progenitor cells are found in different human tissues. An in vitro cell culture is needed for their isolation or for their expansion when they are not available in a sufficient quantity to regenerate damaged organs and tissues. The level of complexity of these new technologies requires adequate facilities, qualified personnel with experience in cell culture techniques, assessment of quality and clear protocols for cell production. The rules for the implementation of cell therapy centers involve national and international standards of good manufacturing practices. However, such standards are not uniform, reflecting the diversity of technical and scientific development. Here standards from the United States, the European Union and Brazil are analyzed. Moreover, practical solutions encountered for the implementation of a cell therapy center appropriate for the preparation and supply of cultured cells for clinical studies are described. Development stages involved the planning and preparation of the project, the construction of the facility, standardization of laboratory procedures and development of systems to prevent cross contamination. Combining the theoretical knowledge of research centers involved in the study of cells with the practical experience of blood therapy services that manage structures for cell transplantation is presented as the best potential for synergy to meet the demands to implement cell therapy centers.

  10. The replacement of serum by hormones in cell culture media.

    Science.gov (United States)

    Sato, G; Hayashi, I

    1976-12-01

    The replacement of serum by hormones in cell culture media. (Reemplazo del suero por hormonas en el medio de cultivo de células). Arch. Biol. Med. Exper. 10: 120-121, 1976. The serum used in cell culture media can be replaced by a mixture of hormones and some accesory blood factors. The pituitary cell line GH3 can be grown in a medium in which serum is replaced by triiodothyronine, transferrin, parathormone, tyrotrophin releasing hormone and somatomedins. Hela and BHK cell strains can also be grown in serum free medium supplemented with hormones. Each cell type appears to have different hormonal requirements yet it may found that some hormones are required for most cell types. PMID:1026199

  11. Continuous culture of immobilized streptomyces cells for kasugamycin production.

    Science.gov (United States)

    Kim, C J; Chang, Y K; Chun, G T; Jeong, Y H; Lee, S J

    2001-01-01

    Continuous cultures of immobilized Streptomyces kasugaensis, a kasugamycin producer, were carried out on Celite beads. When using a prototype separator for immobilized-cell separation and recycling, the continuous operation could not be sustained for an extended period as a result of an excessive loss of immobilized cells caused by the poor performance of the separator. Accordingly, the immobilized-cell separator was revised to provide better immobilized-cell settling and thus recycling into the reactor. In a subsequent culture using the revised separator, a stable operation was maintained for over 820 h with a high kasugamycin productivity. The kasugamycin productivity ranged from 9.8 to 16.1 mg/L/h, which was about 14- to 23-fold higher than that in a batch suspended-cell culture. When the original feeding medium concentration was doubled at the end of the continuous culture, the productivity became severely impaired for several reasons, which will be discussed. An excessive formation of free cells and loss of immobilized cells through the separator were also observed. PMID:11386865

  12. Isolation, culture and characterization of primary mouse RPE cells.

    Science.gov (United States)

    Fernandez-Godino, Rosario; Garland, Donita L; Pierce, Eric A

    2016-07-01

    Mouse models are powerful tools for the study of ocular diseases. Alterations in the morphology and function of the retinal pigment epithelium (RPE) are common features shared by many ocular disorders. We report a detailed protocol to collect, seed, culture and characterize RPE cells from mice. We describe a reproducible method that we previously developed to collect and culture murine RPE cells on Transwells as functional polarized monolayers. The collection of RPE cells takes ∼3 h, and the cultures mimic in vivo RPE cell features within 1 week. This protocol also describes methods to characterize the cells on Transwells within 1-2 weeks by transmission and scanning electron microscopy (TEM and SEM, respectively), immunostaining of vibratome sections and flat mounts, and measurement of transepithelial electrical resistance. The RPE cell cultures are suitable to study the biology of the RPE from wild-type and genetically modified strains of mice between the ages of 10 d and 12 months. The RPE cells can also be manipulated to investigate molecular mechanisms underlying the RPE pathology in the numerous mouse models of ocular disorders. Furthermore, modeling the RPE pathology in vitro represents a new approach to testing drugs that will help accelerate the development of therapies for vision-threatening disorders such as macular degeneration (MD). PMID:27281648

  13. Differential heat shock response of primary human cell cultures and established cell lines

    DEFF Research Database (Denmark)

    Richter, W W; Issinger, O G

    1986-01-01

    degrees C treatment, whereas in immortalized cell lines usually 90% of the cells were found in suspension. Enhanced expression of the major heat shock protein (hsp 70) was found in all heat-treated cells. In contrast to the primary cell cultures, established and transformed cell lines synthesized a...

  14. Formation and action of oxygen activated species in cell cultures

    International Nuclear Information System (INIS)

    The differences of hydrogen peroxide sensibility of mammal cell lineages (man, mouse, chinese hamster) in culture are studied. The cellular survival and the frequency of DNA induced breaks by hydrogen peroxide are analysed. The efficiency of elimination of DNA breaks by cells is determined. The possible relation between the cell capacity of repair and its survival to hydrogen peroxide action is also discussed. (M.A.)

  15. Polyphosphoinositides are present in plant tissue culture cells

    International Nuclear Information System (INIS)

    Polyphosphoinositides have been isolated from wild carrot cells grown in suspension culture. This is the first report of polyphosphoinositides in plant cells. The phospholipids were identified by comigration with known standards on thin-layer plates. After overnight labeling of the cells with myo-[2-3H] inositol, the phosphoinositides as percent recovered inositol were 93% phosphatidylinositol., 3.7% lysophosphatidylinositol, 1.7% phosphatidylinositol monophosphate, 0.8% phosphatidylinositol bisphosphate

  16. Culture of Neural Stem Cells in Calcium-alginate Microbeads

    Institute of Scientific and Technical Information of China (English)

    Li-Song YAO; Tian-Qing LIU; Dan GE; Xue-Hu MA; Zhan-Feng CUI

    2005-01-01

    @@ 1 Introduction Recent research shows that neural stem cells may play an important role in the nerve injury reparation and nerve disease treatment. The shortage of the source and the number of NSCs, however, is the main challenge for its clinic application. In this situation, expansion of NSCs in large scale and culture in three dimensional environment are very worth of exploration. Notablely, the shear stress existed in bioreactors can cause serious cell injury especially for the shear sensitive cells like NSCs.

  17. Culture of Neural Stem Cells in Calcium-alginate Microbeads

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    1 Introduction Recent research shows that neural stem cells may play an important role in the nerve injury reparation and nerve disease treatment. The shortage of the source and the number of NSCs, however, is the main challenge for its clinic application. In this situation, expansion of NSCs in large scale and culture in three dimensional environment are very worth of exploration. Notablely, the shear stress existed in bioreactors can cause serious cell injury especially for the shear sensitive cells like ...

  18. Epithelial morphogenesis in three-dimensional cell culture system

    OpenAIRE

    Liu, Mengfei; 刘梦菲

    2014-01-01

    In human body, the most common structures formed by epithelial cells are hollow cysts or tubules. The key feature of the cysts and tubules is the central lumen, which is lined by epithelial cell sheets. The central lumen allows material exchange, thus it is indispensable for the proper function of the epithelial tissue. In order to understand the way that the epithelial cells form highly specialized structure, an in vitro three-dimensional (3D) culture system was established. The Caco-2 c...

  19. Carbon Nanotubes-Based Electrochemical Sensing for Cell Culture Monitoring

    OpenAIRE

    Boero, Cristina; Carrara, Sandro; Del Vecchio, Giovanna; Albini, Giuseppe D.; Calzà, Laura; De Micheli, Giovanni

    2010-01-01

    Monitoring of metabolic compounds, such as glucose and lactate, is extensively reported in literature, especially for clinical purposes. Instead, the application of such technologies for monitoring metabolites in cell cultures has not been explored. From one side, such devices can provide information to the current state-of-the-art of cell lines, particularly those which are not fully known, as stem and embryonic cells. On the other hand, those systems can pave the way to fully automation for...

  20. Optimization of Seeding Density in Microencapsulated Recombinant CHO Cell Culture

    OpenAIRE

    Zhang, Ying; Zhou, Jing; Zhang, Xulang; Yu, Weiting; Guo, Xin; Wang, Wei; Ma, Xiaojun

    2008-01-01

    Microencapsulation technology is an alternative large-scale mammalian cell culture method. The semi-permeable membrane of the microcapsule allows free diffusion of nutrients, oxygen and toxic metabolites to support cell growth, and the microcapsule membrane can protect the cells from the mechanical damage of shear forces associated with agitation and aeration. Many polymers have been used to make microcapsules, such as chitosan, polyacrylates, alginate, polyamino acids, and polyamides. One of...

  1. Culturing Human Pluripotent and Neural Stem Cells in an Enclosed Cell Culture System for Basic and Preclinical Research

    Science.gov (United States)

    Stover, Alexander E.; Herculian, Siranush; Banuelos, Maria G.; Navarro, Samantha L.; Jenkins, Michael P.; Schwartz, Philip H.

    2016-01-01

    This paper describes how to use a custom manufactured, commercially available enclosed cell culture system for basic and preclinical research. Biosafety cabinets (BSCs) and incubators have long been the standard for culturing and expanding cell lines for basic and preclinical research. However, as the focus of many stem cell laboratories shifts from basic research to clinical translation, additional requirements are needed of the cell culturing system. All processes must be well documented and have exceptional requirements for sterility and reproducibility. In traditional incubators, gas concentrations and temperatures widely fluctuate anytime the cells are removed for feeding, passaging, or other manipulations. Such interruptions contribute to an environment that is not the standard for cGMP and GLP guidelines. These interruptions must be minimized especially when cells are utilized for therapeutic purposes. The motivation to move from the standard BSC and incubator system to a closed system is that such interruptions can be made negligible. Closed systems provide a work space to feed and manipulate cell cultures and maintain them in a controlled environment where temperature and gas concentrations are consistent. This way, pluripotent and multipotent stem cells can be maintained at optimum health from the moment of their derivation all the way to their eventual use in therapy. PMID:27341536

  2. Specimen Sample Preservation for Cell and Tissue Cultures

    Science.gov (United States)

    Meeker, Gabrielle; Ronzana, Karolyn; Schibner, Karen; Evans, Robert

    1996-01-01

    The era of the International Space Station with its longer duration missions will pose unique challenges to microgravity life sciences research. The Space Station Biological Research Project (SSBRP) is responsible for addressing these challenges and defining the science requirements necessary to conduct life science research on-board the International Space Station. Space Station will support a wide range of cell and tissue culture experiments for durations of 1 to 30 days. Space Shuttle flights to bring experimental samples back to Earth for analyses will only occur every 90 days. Therefore, samples may have to be retained for periods up to 60 days. This presents a new challenge in fresh specimen sample storage for cell biology. Fresh specimen samples are defined as samples that are preserved by means other than fixation and cryopreservation. The challenge of long-term storage of fresh specimen samples includes the need to suspend or inhibit proliferation and metabolism pending return to Earth-based laboratories. With this challenge being unique to space research, there have not been any ground based studies performed to address this issue. It was decided hy SSBRP that experiment support studies to address the following issues were needed: Fixative Solution Management; Media Storage Conditions; Fresh Specimen Sample Storage of Mammalian Cell/Tissue Cultures; Fresh Specimen Sample Storage of Plant Cell/Tissue Cultures; Fresh Specimen Sample Storage of Aquatic Cell/Tissue Cultures; and Fresh Specimen Sample Storage of Microbial Cell/Tissue Cultures. The objective of these studies was to derive a set of conditions and recommendations that can be used in a long duration microgravity environment such as Space Station that will permit extended storage of cell and tissue culture specimens in a state consistent with zero or minimal growth, while at the same time maintaining their stability and viability.

  3. Expression of CD44 in Cultured Human Trabecular Meshwork Cells

    Institute of Scientific and Technical Information of China (English)

    Zhongguo Li; Hong Zhang

    2004-01-01

    Purpose:To determine whether cultured human trabecular meshwork cells express CD44 and to discuss their possible relationship with primary open angle glaucoma.Methods:Human trabecular meshwork cells were cultured in DMEM/F12 media. Total RNAs from the cells were extracted with Trizol reagent. Messenger RNA expression of CD44 in human trabecular meshwork cells was examined by using reverse transcriptasepolymerase chain reaction ( RT-PCR ) analysis. Expression of CD44 was confirmed by Western-blotting and immunofiuorescent microscopy. Effect of CD44-specific antisense oligonucleotide on adhesion of trabecular meshwork cells to hyaluronate was determined by MTT assay.Results:A single RT-PCR product whose size was 471bp was obtained.A band about 80kD was stained by Western-blot. Immunofiuorescent examination of expression of CD44 on the cell surface was positive and reactions were mainly localized in cell membranes.Adhesion of trabecular meshwork cells to hyaluronate was inhibited by CD44-specific antisense oligonucleotide.Conclusions: Cultured human trabecular meshwork cells express CD44. CD44 may play a role in pathogenesis of primary open angle glaucoma. Eye Science 2004;20:52-56.

  4. Preparation of 14C-catechins by tea cell culture

    International Nuclear Information System (INIS)

    The preparation of 14C labelled catechins was studied by feeding 14C labelled precursor to tea cultured cells. Two labelled precursors were tested and their effects were compared. The dynamics of absorption and transformation of fed precursors were analyzed and the effects of pre-culture as well as UV light pretreatment on product labelling rate were evaluated. Product analysis was also made by HSCCC and HPLC techniques

  5. Enhanced casein kinase II activity in human tumour cell cultures

    DEFF Research Database (Denmark)

    Prowald, K; Fischer, H; Issinger, O G

    1984-01-01

    Casein kinase II (CKII) activity is enhanced as much as 2-3 fold in established and 4-5-fold in transformed human cell lines when compared to that of fibroblasts and primary human tumour cell cultures where CKII activity never exceeded a basic level. The high activity of CKII in transformed cells...... and in established cell lines was reduced to about the same basic level after treatment with heparin, a highly specific inhibitor of CKII activity. The activity of the cAMP-dependent protein kinase was virtually the same in fibroblasts and various human tumour cell lines investigated....

  6. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tissue culture media for human ex vivo tissue and cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell...

  7. Hollow fiber clinostat for simulating microgravity in cell culture

    Science.gov (United States)

    Rhodes, Percy H. (Inventor); Miller, Teresa Y. (Inventor); Snyder, Robert S. (Inventor)

    1992-01-01

    A clinostat for simulating microgravity on cell systems carried in a fiber fixedly mounted in a rotatable culture vessel is disclosed. The clinostat is rotated horizontally along its longitudinal axis to simulate microgravity or vertically as a control response. Cells are injected into the fiber and the ends of the fiber are sealed and secured to spaced end pieces of a fiber holder assembly which consists of the end pieces, a hollow fiber, a culture vessel, and a tension spring with three alignment pins. The tension spring is positioned around the culture vessel with its ends abutting the end pieces for alignment of the spring. After the fiber is secured, the spring is decompressed to maintain tension on the fiber while it is being rotated. This assures that the fiber remains aligned along the axis of rotation. The fiber assembly is placed in the culture vessel and culture medium is added. The culture vessel is then inserted into the rotatable portion of the clinostat and subjected to rotate at selected rpms. The internal diameter of the hollow fiber determines the distance the cells are from the axis of rotation.

  8. A solution density model for hanford waste treatment plant supernatants

    International Nuclear Information System (INIS)

    The density of nuclear waste solution is used as a process control parameter in the Hanford Waste Treatment Plant pretreatment process and is crucial to tank utilization evaluations. The supernatants, however, have many different dissolved sodium salts, including nitrate, nitrite, carbonate, sulfate, phosphate, hydroxide, and aluminate. The large concentrations and diversity of salts in the waste has made the predictions of solution densities difficult historically. The purpose of this study is to determine if a new model of multi-component electrolyte solution densities, recently published in the literature, is effective at predicting the density of nuclear waste supernatants. A statistically designed set of solution densities containing the most prevalent electrolytes in Hanford tank waste was used for model validation. The densities of the simulants were calculated by the model and compared to the experimentally determined densities. The average model error was just 0.1%. These results indicate that the model can be used to accurately predict the density of nuclear waste processed at the Hanford Waste Treatment Plant. (authors)

  9. A microwell cell culture platform for the aggregation of pancreatic β-cells.

    Science.gov (United States)

    Bernard, Abigail B; Lin, Chien-Chi; Anseth, Kristi S

    2012-08-01

    Cell-cell contact between pancreatic β-cells is important for maintaining survival and normal insulin secretion. Various techniques have been developed to promote cell-cell contact between β-cells, but a simple yet robust method that affords precise control over three-dimensional (3D) β-cell cluster size has not been demonstrated. To address this need, we developed a poly(ethylene glycol) (PEG) hydrogel microwell platform using photolithography. This microwell cell-culture platform promotes the formation of 3D β-cell aggregates of defined sizes from 25 to 210 μm in diameter. Using this platform, mouse insulinoma 6 (MIN6) β-cells formed aggregates with cell-cell adherin junctions. These naturally formed cell aggregates with controllable sizes can be removed from the microwells for macroencapsulation, implantation, or other biological assays. When removed and subsequently encapsulated in PEG hydrogels, the aggregated cell clusters demonstrated improved cellular viability (>90%) over 7 days in culture, while the β-cells encapsulated as single cells maintained only 20% viability. Aggregated MIN6 cells also exhibited more than fourfold higher insulin secretion in response to a glucose challenge compared with encapsulated single β-cells. Further, the cell aggregates stained positively for E-cadherin, indicative of the formation of cell junctions. Using this hydrogel microwell cell-culture method, viable and functional β-cell aggregates of specific sizes were created, providing a platform from which other biologically relevant questions may be answered. PMID:22320435

  10. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions

    OpenAIRE

    Saha, Krishanu; Mei, Ying; Reisterer, Colin M.; Pyzocha, Neena Kenton; Yang, Jing; Muffat, Julien; Davies, Martyn C.; Alexander, Morgan R.; Langer, Robert; Anderson, Daniel G.; Jaenisch, Rudolf

    2011-01-01

    The current gold standard for the culture of human pluripotent stem cells requires the use of a feeder layer of cells. Here, we develop a spatially defined culture system based on UV/ozone radiation modification of typical cell culture plastics to define a favorable surface environment for human pluripotent stem cell culture. Chemical and geometrical optimization of the surfaces enables control of early cell aggregation from fully dissociated cells, as predicted from a numerical model of cell...

  11. Lingual Epithelial Stem Cells and Organoid Culture of Them

    Directory of Open Access Journals (Sweden)

    Hiroko Hisha

    2016-01-01

    Full Text Available As tongue cancer is one of the major malignant cancers in the world, understanding the mechanism of maintenance of lingual epithelial tissue, which is known to be the origin of tongue cancer, is unquestionably important. However, the actual stem cells that are responsible for the long-term maintenance of the lingual epithelium have not been identified. Moreover, a simple and convenient culture method for lingual epithelial stem cells has not yet been established. Recently, we have shown that Bmi1-positive cells, residing at the second or third layer of the epithelial cell layer at the base of the interpapillary pit (IPP, were slow-cycling and could supply keratinized epithelial cells for over one year, indicating that Bmi1-positive cells are long-term lingual epithelial stem cells. In addition, we have developed a novel lingual epithelium organoid culture system using a three-dimensional matrix and growth factors. Here, we discuss current progress in the identification of lingual stem cells and future applications of the lingual culture system for studying the regulatory mechanisms of the lingual epithelium and for regenerative medicine.

  12. Cancer Stem Cells: Cell Culture, Markers and Targets for New Therapies

    OpenAIRE

    Gilbert, Candace A.; Ross, Alonzo H.

    2009-01-01

    A cancer stem cell is defined as an undifferentiated cell with the ability to self-renew, differentiate to multiple lineages and initiate tumors that mimic the parent tumor. In this review, we focus on glioblastomas, describing recent progress and problems in characterizing these cells. There have been advances in cancer stem cell culture, but tumor cell heterogeneity has made purification of cancer stem cells difficult. Indeed, it may be that cancer stem cells significantly vary from tumor t...

  13. Metabolism of quercetin in cell suspension culture of Nicotiana tabacum

    International Nuclear Information System (INIS)

    Quercetin was oxidized on a rotating glassy-carbon electrode in phosphate-methanol buffer. The half-wave potentials for several pH were determined. Oxidation of quercetin by one of Nicotiana tabacum cell suspension cultures was carried out in vitro and final products were characterized by means of UV spectra and mass-spectrophotometry. Each product of oxidation was assayed for oxygen consumption inhibiting activity, using a 3 days old cell suspension culture of Nicotiana tabacum. Dimers and polymers showed strong inhibiting activity in O-2 consumption

  14. Cell Wall Polysaccharides of Candida albicans Induce Mast Cell Degranulation in the Gut

    OpenAIRE

    Sakurai, Atsuko; Yamaguchi, Natsu; Sonoyama, Kei

    2012-01-01

    We investigated Candida albicans-induced mast cell degranulation in vitro and in vivo. Cell wall fraction but not culture supernatant and cell membrane fraction prepared from hyphally grown C. albicans induced β-hexosaminidase release in RBL-2H3 cells. Cell wall mannan and soluble β-glucan fractions also induced β-hexosaminidase release. Histological examination of mouse forestomach showed that C. albicans gut colonization induces mast cell degranulation. However, intragastric administration ...

  15. Dynamic cell culture system: a new cell cultivation instrument for biological experiments in space

    Science.gov (United States)

    Gmunder, F. K.; Nordau, C. G.; Tschopp, A.; Huber, B.; Cogoli, A.

    1988-01-01

    The prototype of a miniaturized cell cultivation instrument for animal cell culture experiments aboard Spacelab is presented (Dynamic cell culture system: DCCS). The cell chamber is completely filled and has a working volume of 200 microliters. Medium exchange is achieved with a self-powered osmotic pump (flowrate 1 microliter h-1). The reservoir volume of culture medium is 230 microliters. The system is neither mechanically stirred nor equipped with sensors. Hamster kidney (Hak) cells growing on Cytodex 3 microcarriers were used to test the biological performance of the DCCS. Growth characteristics in the DCCS, as judged by maximal cell density, glucose consumption, lactic acid secretion and pH, were similar to those in cell culture tubes.

  16. Cell sources for in vitro human liver cell culture models.

    Science.gov (United States)

    Zeilinger, Katrin; Freyer, Nora; Damm, Georg; Seehofer, Daniel; Knöspel, Fanny

    2016-09-01

    In vitro liver cell culture models are gaining increasing importance in pharmacological and toxicological research. The source of cells used is critical for the relevance and the predictive value of such models. Primary human hepatocytes (PHH) are currently considered to be the gold standard for hepatic in vitro culture models, since they directly reflect the specific metabolism and functionality of the human liver; however, the scarcity and difficult logistics of PHH have driven researchers to explore alternative cell sources, including liver cell lines and pluripotent stem cells. Liver cell lines generated from hepatomas or by genetic manipulation are widely used due to their good availability, but they are generally altered in certain metabolic functions. For the past few years, adult and pluripotent stem cells have been attracting increasing attention, due their ability to proliferate and to differentiate into hepatocyte-like cells in vitro However, controlling the differentiation of these cells is still a challenge. This review gives an overview of the major human cell sources under investigation for in vitro liver cell culture models, including primary human liver cells, liver cell lines, and stem cells. The promises and challenges of different cell types are discussed with a focus on the complex 2D and 3D culture approaches under investigation for improving liver cell functionality in vitro Finally, the specific application options of individual cell sources in pharmacological research or disease modeling are described. PMID:27385595

  17. Pedigree analysis of proliferation kinetics in cultured mammalian cells

    International Nuclear Information System (INIS)

    Quantitative analysis of proliferation kinetics in cultured mammalian cells was given an outline by extremely low speed photography (pedigree method). Photographing method of this analysis, camera used in this analysis, cultivation method and apparatus for cultivation, and film analysis were explained. As to changes of generation time by this analysis, relationship of each stage of cell cycle to colony formation or to proliferation capacity were explained in non-irradiated cells and irradiated cells. On abnormal cell division in time of large dose irradiation, a condition from cell fusion to cell death via multipolar division was explained. Mechanisms of proliferation death and interphase death were explained by analysis of pedigree data on radiation injuries in time of division and by mentioning division probability. Some information about inhibition of cell proliferation by radiation and lethal effect of radiation was described. (Kanao, N.)

  18. Metabolic flux rewiring in mammalian cell cultures

    OpenAIRE

    Young, Jamey D.

    2013-01-01

    Continuous cell lines (CCLs) engage in “wasteful” glucose and glutamine metabolism that leads to accumulation of inhibitory byproducts, primarily lactate and ammonium. Advances in techniques for mapping intracellular carbon fluxes and profiling global changes in enzyme expression have led to a deeper understanding of the molecular drivers underlying these metabolic alterations. However, recent studies have revealed that CCLs are not necessarily entrenched in a glycolytic or glutaminolytic phe...

  19. Differential Effect of Culture Temperature and Specific Growth Rate on CHO Cell Behavior in Chemostat Culture

    OpenAIRE

    Vergara, Mauricio; Becerra, Silvana; Berrios, Julio; Osses, Nelson; Reyes, Juan; Rodríguez-Moyá, María; Gonzalez, Ramon; Altamirano, Claudia

    2014-01-01

    Mild hypothermia condition in mammalian cell culture technology has been one of the main focuses of research for the development of breeding strategies to maximize productivity of these production systems. Despite the large number of studies that show positive effects of mild hypothermia on specific productivity of r-proteins, no experimental approach has addressed the indirect effect of lower temperatures on specific cell growth rate, nor how this condition possibly affects less specific pro...

  20. Culture and characterization of rat hair follicle stem cells.

    Science.gov (United States)

    Quan, Renfu; Zheng, Xuan; Ni, Yueming; Xie, Shangju; Li, Changming

    2016-08-01

    The purpose of this study was to establish methods for isolation, culture, expansion, and characterization of rat hair follicle stem cells (rHFSCs). Hair follicles were harvested from 1-week-old Sprague-Dawley rats and digested with dispase and collagenase IV. The bulge of the hair follicle was dissected under a microscope and cultured in Dulbecco's modified Eagle's medium/F12 supplemented with KnockOut™ Serum Replacement serum substitute, penicillin-streptomycin, L-glutamine, non-essential amino acids, epidermal growth factor, basic fibroblast growth factor, polyhydric alcohol, and hydrocortisone. The rHFSCs were purified using adhesion to collagen IV. Cells were characterized by detecting marker genes with immunofluorescent staining and real-time polymerase chain reaction (PCR). The proliferation and vitality of rHFSCs at different passages were evaluated. The cultured rHFSCs showed typical cobblestone morphology with good adhesion and colony-forming ability. Expression of keratin 15, integrin α6, and integrin β1 were shown by immunocytochemistry staining. On day 1-2, the cells were in the latent phase. On day 5-6, the cells were in the logarithmic phase. Cell vitality gradually decreased from the 7th passage. Real-time PCR showed that the purified rHFSCs had good vitality and proliferative capacity and contained no keratinocytes. Highly purified rHFSCs can be obtained using tissue culture and adhesion to collagen IV. The cultured cells had good proliferative capacity and could therefore be a useful cell source for tissue-engineered hair follicles, vessels, and skin. PMID:25407732

  1. Cell culture systems for the hepatitis C virus

    Institute of Scientific and Technical Information of China (English)

    Gilles Duverlie; Czeslaw Wychowski

    2007-01-01

    Since the discovery of HCV in 1989, the lack of a cell culture system has hampered research progress on this important human pathogen. No robust system has been obtained by empiric approaches, and HCV cell culture remained hypothetical until 2005. The construction of functional molecular clones has served as a starting point to reconstitute a consensus infectious cDNA that was able to transcribe infectious HCV RNAs as shown by intrahepatic inoculation in a chimpanzee. Other consensus clones have been selected and established in a human hepatoma cell line as replicons, i.e. self-replicating subgenomic or genomic viral RNAs. However, these replicons did not support production of infectious virus. Interestingly, some full-length replicons could be established without adaptive mutations and one of them was able to replicate at very high levels and to release virus particles that are infectious in cell culture and in vivo. This new cell culture system represents a major breakthrough in the HCV field and should enable a broad range of basic and applied studies to be achieved.

  2. Effects of Free Anthraquinones Extract from the Rhubarb on Cell Proliferation and Accumulation of Extracellular Matrix in High Glucose Cultured-Mesangial Cells.

    Science.gov (United States)

    Wang, Jianyun; Fang, Hui; Dong, Bingzheng; Wang, Dongdong; Li, Yan; Chen, Xiao; Chen, Lijuan; Wei, Tong; Wei, Qunli

    2015-11-01

    Diabetic nephropathy (DN) is the leading cause of end-stage failure of the kidney, but the efficacy of currently available strategies for the prevention of DN remains unsatisfactory. In this study, we investigated the effects of free anthraquinones (FARs) extract, which was extracted from the rhubarb and purified by macroporous resin DM130 with gradient mixtures of ethanol/water as the lelution solvents, in high glucose-cultured glomerular mesangial cells (MCs). The cell proliferation was determined by CCK-8 assay, the levels of TGF-β1, CTGF, ColIV and FN proteins in the supernatant of MCs were measured by ELISA assays, and the mRNA levels of these four genes were detected by RT-PCR. The results showed that the increased proliferation of MCs, the mRNA levels and protein expression of TGF-β1, CTGF, ColIV and FN induced by high glucose were inhibited after the treatment with the FARs extract. This indicated that FARs extract could inhibit cell proliferation and the expression of main extracellular matrix induced by high glucose in MCs. The FARs extract exhibited potential values for prophylaxis and therapy of DN. PMID:26557014

  3. Influence of leptin on luteinizing hormone and follicle stimulating hormone secreted from cultured rat anterior pituitary cells

    Institute of Scientific and Technical Information of China (English)

    Yuebing Qiao; Xiuyan Ma; Huixian Cui

    2008-01-01

    BACKGROUND: Leptin may regulate reproductive function via release of hypothalamic neuropeptide Y. However, it is unknown whether this regulatory effect is limited to the hypothalamus. OBJECTIVE: To detect the effect of different dosages of leptin on luteinizing hormone (LH) and follicle stimulating hormone (FSH) secretion from in vitro cultured rat anterior pituitary cells. DESIGN: Contrast study based on cells. SETTING: This study was performed in the Basic Institute of Chengde Medical College, Chengde City, Hebei Province, China from March to June 2007. MATERIALS: Eighteen female Wistar rats of three months of age, weighing 200-220 g, and of clean grade were used. Leptin was provided by Peprotech Company, DMEM culture medium by Invitrogen Company, and the radioimmunological kit by Beijing Zhongshan Jinqiao Biotechnology Co., Ltd. METHODS: Three glandular organs were regarded as one group for culture of anterior pituitary cells. In the control group, saline was added to the culture medium instead of leptin. In the leptin group, leptin was prepared into different concentrations of 1×10-12, 1×10-11, 1×10-9, 1×10-7, and 1×10-6 mol/L for stimulation of cultured cells. The culture supernatant was obtained at three hours after additional of saline/leptin. MAIN OUTCOME MEASURES: Contents of LH and FSH were detected by radioimmunology. RESULTS: Following leptin stimulation, LH release increased with increasing concentrations of leptin up to 1×10-9 mol/L, where LH release peaked. LH release then progressively decreased with increasing leptin concentrations (P<0.01). LH release in the leptin (1×10-12, 1×10-11, 1×10-7, and 1×10-6 mol/L) groups was significantly higher than that in the control group (P<0.01). FSH content in the leptin (1×10-11, 1×10-9, and 1×10-7 mol/L) groups was significantly higher than that in the control group (P<0.01). CONCLUSION: Leptin can directly affect pituitary tissue to promote the secretion of LH and FSH in a dose-dependent manner.

  4. Testicular Sertoli cells influence the proliferation and immunogenicity of co-cultured endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Ping, E-mail: fanpinggoodluck@163.com [Department of Rheumatism and Immunity, The First Affiliated Hospital Xi' an Jiaotong University School of Medicine, Xi' an, Shaanxi 710061 (China); He, Lan; Pu, Dan; Lv, Xiaohong; Zhou, Wenxu; Sun, Yining; Hu, Nan [Department of Rheumatism and Immunity, The First Affiliated Hospital Xi' an Jiaotong University School of Medicine, Xi' an, Shaanxi 710061 (China)

    2011-01-21

    Research highlights: {yields} The proliferation of dramatic increased by co-cultured with Sertoli cells. {yields} VEGF receptor-2 expression of ECs was up-regulated by co-cultured with Sertoli cells. {yields} The MHC expression of ECs induced by INF-{gamma} and IL-6, IL-8 and sICAM induced by TNF-{alpha} decreased respectively after co-cultured with Sertoli cells. {yields} ECs co-cultured with Sertoli cells also didn't increase the stimulation index of spleen lymphocytes. -- Abstract: The major problem of the application of endothelial cells (ECs) in transplantation is the lack of proliferation and their immunogenicity. In this study, we co-cultured ECs with Sertoli cells to monitor whether Sertoli cells can influence the proliferation and immunogenicity of co-cultured ECs. Sertoli cells were isolated from adult testicular tissue. ECs were divided into the control group and the experimental group, which included three sub-groups co-cultured with 1 x 10{sup 3}, 1 x 10{sup 4} or 1 x 10{sup 5} cell/ml of Sertoli cells. The growth and proliferation of ECs were observed microscopically, and the expression of vascular endothelial growth factor (VEGF) receptor-2 (KDR) was examined by Western blotting. In another experiment, ECs were divided into the control group, the single culture group and the co-culture group with the optimal concentration of Sertoli cells. After INF-{gamma} and TNF-{alpha} were added to the culture medium, MHC II antigen expression was detected by immunofluorescence staining and western blotting; interleukin (IL)-6, IL-8 and soluble intercellular adhesion molecule (sICAM) were measured in the culture medium by ELISA. We demonstrated that 1 x 10{sup 4} cell/ml Sertoli cells promoted the proliferation of co-cultured ECs more dramatically than that in other groups (P < 0.05). Western blotting showed that 1 x 10{sup 4} cell/ml of the Sertoli cells was most effective in the up-regulation of KDR expression in the co-cultured ECs (P < 0.05). Sertoli

  5. Testicular Sertoli cells influence the proliferation and immunogenicity of co-cultured endothelial cells

    International Nuclear Information System (INIS)

    Research highlights: → The proliferation of dramatic increased by co-cultured with Sertoli cells. → VEGF receptor-2 expression of ECs was up-regulated by co-cultured with Sertoli cells. → The MHC expression of ECs induced by INF-γ and IL-6, IL-8 and sICAM induced by TNF-α decreased respectively after co-cultured with Sertoli cells. → ECs co-cultured with Sertoli cells also didn't increase the stimulation index of spleen lymphocytes. -- Abstract: The major problem of the application of endothelial cells (ECs) in transplantation is the lack of proliferation and their immunogenicity. In this study, we co-cultured ECs with Sertoli cells to monitor whether Sertoli cells can influence the proliferation and immunogenicity of co-cultured ECs. Sertoli cells were isolated from adult testicular tissue. ECs were divided into the control group and the experimental group, which included three sub-groups co-cultured with 1 x 103, 1 x 104 or 1 x 105 cell/ml of Sertoli cells. The growth and proliferation of ECs were observed microscopically, and the expression of vascular endothelial growth factor (VEGF) receptor-2 (KDR) was examined by Western blotting. In another experiment, ECs were divided into the control group, the single culture group and the co-culture group with the optimal concentration of Sertoli cells. After INF-γ and TNF-α were added to the culture medium, MHC II antigen expression was detected by immunofluorescence staining and western blotting; interleukin (IL)-6, IL-8 and soluble intercellular adhesion molecule (sICAM) were measured in the culture medium by ELISA. We demonstrated that 1 x 104 cell/ml Sertoli cells promoted the proliferation of co-cultured ECs more dramatically than that in other groups (P 4 cell/ml of the Sertoli cells was most effective in the up-regulation of KDR expression in the co-cultured ECs (P < 0.05). Sertoli cells can effectively suppress INF-γ-induced MHC II antigen expression in co-cultured ECs compared with single culture

  6. Enhancement effect of shikonin in cell suspension culture and transfermanant culture by radiation application

    International Nuclear Information System (INIS)

    The cell lines 679, 679-29 and 622-46 of L. erythrorhizon could be selected on LS agar medium for the production shikonin in cell suspension culture. The shikonin was increased moderately in suspension culture of cell line 622-46 in LS liquid medium containing BA 2 mg·L-1 and IAA 0.2 mg·L-1 in the dark, and was increased by adding 1 μM Cu2+ and 100 μM methyl jasmonate The accumulation of shikonin in the liquid medium was increased significantly by 2 Gy irradiation to callus of cell line 622-46 and culture in LS liquid medium containing BA 2 mg·L-1 and IAA 0.2 mg·L-1 in the dark and shikonin in cell debris was higher by 16 Gy irradiation. The activity of p-hydroxybenzoate geranyltransferase was increased by irradiation of 2 Gy and 16 Gy of γ radiation. Seedling hypocotyles of L. erythrorhizon were infected with Agrogacterium rhizogenes strain 15834 harboring a binary vector with an intron bearing the GUS (β-glucuronidase) gene driven by cauliflower mosaic virus (CaMV) 35S promotor as well as the HPT (hygromycin phosphotransferase) gene as the selection marker. Hairy roots isolated were hygromycin resistant and had integrated GUS gene in DNA. The root tip grown on M-9 medium showed normal pigment production pattern in border cells and root hairs

  7. Expansion and properties of human bone marrow stromal cells cultured in different culture media

    Czech Academy of Sciences Publication Activity Database

    Syrová, Zdeňka; Glogarová, Kateřina; Jendelová, Pavla; Syková, Eva

    2006-01-01

    Roč. 8, Supplement 1 (2006), s. 238-238. ISSN 1465-3249. [ ISCT 2006. 04.05.2006-07.05.2006, Berlin] R&D Projects: GA MZd(CZ) NR8339; GA MŠk 1M0538 Institutional research plan: CEZ:AV0Z50390512 Keywords : Cells cultured Subject RIV: FH - Neurology

  8. Arsenic exposure induces the Warburg effect in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Fei; Severson, Paul; Pacheco, Samantha; Futscher, Bernard W.; Klimecki, Walter T., E-mail: klimecki@pharmacy.arizona.edu

    2013-08-15

    Understanding how arsenic exacts its diverse, global disease burden is hampered by a limited understanding of the particular biological pathways that are disrupted by arsenic and underlie pathogenesis. A reductionist view would predict that a small number of basic pathways are generally perturbed by arsenic, and manifest as diverse diseases. Following an initial observation that arsenite-exposed cells in culture acidify their media more rapidly than control cells, the report here shows that low level exposure to arsenite (75 ppb) is sufficient to induce aerobic glycolysis (the Warburg effect) as a generalized phenomenon in cultured human primary cells and cell lines. Expanded studies in one such cell line, the non-malignant pulmonary epithelial line, BEAS-2B, established that the arsenite-induced Warburg effect was associated with increased accumulation of intracellular and extracellular lactate, an increased rate of extracellular acidification, and inhibition by the non-metabolized glucose analog, 2-deoxy-D-glucose. Associated with the induction of aerobic glycolysis was a pathway-wide induction of glycolysis gene expression, as well as protein accumulation of an established glycolysis master-regulator, hypoxia-inducible factor 1A. Arsenite-induced alteration of energy production in human cells represents the type of fundamental perturbation that could extend to many tissue targets and diseases. - Highlights: • Chronic arsenite exposure induces aerobic glycolysis, dubbed the “Warburg effect”. • Arsenite-induced Warburg effect is a general phenomenon in cultured human cells. • HIF-1A may mediate arsenite induced Warburg effect.

  9. Testing of serum atherogenicity in cell cultures: questionable data published

    Directory of Open Access Journals (Sweden)

    Sergei V. Jargin

    2012-01-01

    Full Text Available In a large series of studies was reported that culturing of smooth muscle cells with serum from atherosclerosis patients caused intracellular lipid accumulation, while serum from healthy controls had no such effect. Cultures were used for evaluation of antiatherogenic drugs. Numerous substances were reported to lower serum atherogenicity: statins, trapidil, calcium antagonists, garlic derivatives etc. On the contrary, beta-blockers, phenothiazines and oral hypoglycemics were reported to be pro-atherogenic. Known antiatherogenic agents can influence lipid metabolism and cholesterol synthesis, intestinal absorption or endothelium-related mechanisms. All these targets are absent in cell monocultures. Inflammatory factors, addressed by some antiatherogenic drugs, are also not reproduced. In vivo, relationship between cholesterol uptake by cells and atherogenesis must be inverse rather than direct: in familial hypercholesterolemia, inefficient clearance of LDL-cholesterol by cells predisposes to atherosclerosis. Accordingly, if a pharmacological agent reduces cholesterol uptake by cells in vitro, it should be expected to elevate cholesterol in vivo. Validity of clinical recommendations, based on serum atherogenicity testing in cell monocultures, is therefore questionable. These considerations pertain also to the drugs developed on the basis of the cell culture experiments.

  10. Arsenic exposure induces the Warburg effect in cultured human cells

    International Nuclear Information System (INIS)

    Understanding how arsenic exacts its diverse, global disease burden is hampered by a limited understanding of the particular biological pathways that are disrupted by arsenic and underlie pathogenesis. A reductionist view would predict that a small number of basic pathways are generally perturbed by arsenic, and manifest as diverse diseases. Following an initial observation that arsenite-exposed cells in culture acidify their media more rapidly than control cells, the report here shows that low level exposure to arsenite (75 ppb) is sufficient to induce aerobic glycolysis (the Warburg effect) as a generalized phenomenon in cultured human primary cells and cell lines. Expanded studies in one such cell line, the non-malignant pulmonary epithelial line, BEAS-2B, established that the arsenite-induced Warburg effect was associated with increased accumulation of intracellular and extracellular lactate, an increased rate of extracellular acidification, and inhibition by the non-metabolized glucose analog, 2-deoxy-D-glucose. Associated with the induction of aerobic glycolysis was a pathway-wide induction of glycolysis gene expression, as well as protein accumulation of an established glycolysis master-regulator, hypoxia-inducible factor 1A. Arsenite-induced alteration of energy production in human cells represents the type of fundamental perturbation that could extend to many tissue targets and diseases. - Highlights: • Chronic arsenite exposure induces aerobic glycolysis, dubbed the “Warburg effect”. • Arsenite-induced Warburg effect is a general phenomenon in cultured human cells. • HIF-1A may mediate arsenite induced Warburg effect

  11. Adenosine formation in contracting primary rat skeletal muscle cells and endothelial cells in culture

    DEFF Research Database (Denmark)

    Hellsten, Ylva; Frandsen, Ulrik

    1997-01-01

    1. The present study examined the capacity for adenosine formation, uptake and metabolism in contracting primary rat muscle cells and in microvascular endothelial cells in culture. 2. Strong and moderate electrical simulation of skeletal muscle cells led to a significantly greater increase in the...... extracellular adenosine concentration (421 +/- 91 and 235 +/- 30 nmol (g protein)-1, respectively; P < 0.05) compared with non-stimulated muscle cells (161 +/- 20 nmol (g protein)-1). The ATP concentration was lower (18%; P < 0.05) in the intensely contracted, but not in the moderately contracted muscle cells....... 3. Addition of microvascular endothelial cells to the cultured skeletal muscle cells enhanced the contraction-induced accumulation of extracellular adenosine (P < 0.05), whereas endothelial cells in culture alone did not cause extracellular accumulation of adenosine. 4. Skeletal muscle cells were...

  12. PDMS/glass microfluidic cell culture system for cytotoxicity tests and cells passage

    DEFF Research Database (Denmark)

    Ziolkowska, K.; Jedrych, E.; Kwapiszewski, R.; Lopacinska, Joanna M.; Skolimowski, Maciej; Chudy, M.

    2010-01-01

    In this paper, hybrid (PDMS/glass) microfluidic cell culture system (MCCS) integrated with the concentration gradient generator (CGG) is presented. PDMS gas permeability enabled cells' respiration in the fabricated microdevices and excellent glass hydrophilicity allowed successful cells' seeding....... The human lung carcinoma cells (A549) were cultured in the microdevice for several days. The growth and proliferation of cells was monitored using an inverted fluorescence microscope. After the cells' confluence was achieved in the microchambers, the novel method of cells' passaging in the designed...... microdevice was developed and successfully tested. The MCCS microdevice is fully reusable, i.e. it can be used several times for various cell culture and cytotoxic experiments. The suitability of designed MCCS for cell-based cytotoxicity assay application was verified using 1,4-dioxane as a model toxic agent...

  13. Effects of Visible Light on Cultured Bovine Trabecular Cells

    Institute of Scientific and Technical Information of China (English)

    姜发纲; 郝风芹; 魏厚仁; 许德胜

    2004-01-01

    To explore the biological effects of light on trabecular cells, cultured bovine trabecular cells were exposed to visible light of different wavelength with different energy. Cellular morphology, structure, proliferation, and phagocytosis were observed. The cells showed no remarkable changes when the energy was low. When the exposure energy reached 1. 12 mW/cm2 , the cytoplasm showed a rough appearance, and cell proliferation and phagocytosis decreased. This phototoxicity was strong with white light (compound chromatic light), moderate with violet light or yellow light, and mild with red light.

  14. Kinetics of meta-iodo-benzylguanidine in neuroblastoma cell cultures

    International Nuclear Information System (INIS)

    The continuously cultured human neuroblastoma cell line SK-N-SH possesses an active transport mechanism for uptake of meta-iodobenzylguanidine (MIBG). The uptake rate at an MIBG-concentration of 6,4x10-8 M was 0.35x10-12 mol/minx106 cells, corresponding to values as measured in human pheochromocytoma cell lines. MIBG is released from the cells with a biological half-life of 81,3 h in correspondence to half-life values as measured in vivo in neuroblastoma patients. (orig.)

  15. Hybridoma cell behaviour in continuous culture under hyperosmotic stress.

    Science.gov (United States)

    Cherlet, M; Marc, A

    1999-01-01

    In this paper, we propose an alternative strategy to the ones proposed before (Oh et al., 1993; Øyaas et al., 1994a) to get real increases of global final antibody titer and production at hyperosmotic stress, by reducing the detrimental effect of such a stress on cell growth, and conserving the stimulating effect on antibody production. It consists of cultivating the cells in continuous culture and increasing the osmolality stepwise. In this way, the cells could progressively adapt to the higher osmolality at each step and antibody titers could be nearly doubled at 370 and 400 mOsm kg-1, compared to the standard osmolality of 335 mOsm kg-1. Surprisingly, the stimulation of antibody production was not confirmed for higher osmolalities, 425 and 450 mOsm kg- 1, despite the minor negative effect on cell growth. Intracellular IgG analysis by flow cytometry revealed at these osmolalities a significant population of non-producing cells. However, even when taking into account this non-producing population, a stimulating effect on antibody production could not be shown at these highest osmolalities. It seems to us that osmolality has a significant effect on the appearance of these non-producing cells, since they were not observed in continuous cultures at standard osmolality, of comparable duration and at an even higher dilution rate. The appearance of the non-producing cells coincides furthermore with modifications of the synthesised antibody, as shown by electrophoretic techniques. It is however not really clear if these two observations reflect actually the same phenomenon. Hyperosmolality affects the cell behaviour in continuous culture in multiple ways, independently of the growth rate, counting all at least partially for the observed stimulation of antibody production: acceleration of the amino acid, and in particular the glutamine metabolism, increase of the cell volume, increase of the intracellular pH and accumulation of cells in the G1 cell cycle phase. PMID

  16. Isolation and culture of umbilical vein mesenchymal stem cells

    Directory of Open Access Journals (Sweden)

    D.T. Covas

    2003-09-01

    Full Text Available Bone marrow contains a population of stem cells that can support hematopoiesis and can differentiate into different cell lines including adipocytes, osteocytes, chondrocytes, myocytes, astrocytes, and tenocytes. These cells have been denoted mesenchymal stem cells. In the present study we isolated a cell population derived from the endothelium and subendothelium of the umbilical cord vein which possesses morphological, immunophenotypical and cell differentiation characteristics similar to those of mesenchymal stem cells isolated from bone marrow. The cells were isolated from three umbilical cords after treatment of the umbilical vein lumen with collagenase. The cell population isolated consisted of adherent cells with fibroblastoid morphology which, when properly stimulated, gave origin to adipocytes and osteocytes in culture. Immunophenotypically, this cell population was found to be positive for the CD29, CD13, CD44, CD49e, CD54, CD90 and HLA-class 1 markers and negative for CD45, CD14, glycophorin A, HLA-DR, CD51/61, CD106, and CD49d. The characteristics described are the same as those presented by bone marrow mesenchymal stem cells. Taken together, these findings indicate that the umbilical cord obtained from term deliveries is an important source of mesenchymal stem cells that could be used in cell therapy protocols.

  17. Cannabinoids induce incomplete maturation of cultured human leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Murison, G.; Chubb, C.B.H.; Maeda, S.; Gemmell, M.A.; Huberman, E.

    1987-08-01

    Monocyte maturation markers were induced in cultured human myeloblastic ML-2 leukemia cells after treatment for 1-6 days with 0.03-30 ..mu..M ..delta../sup 9/-tetrahydrocannabinol (THC), the major psychoactive component of marijuana. After a 2-day or longer treatment, 2- to 5-fold increases were found in the percentages of cells exhibiting reactivity with either the murine OKM1 monoclonal antibody of the Leu-M5 monoclonal antibody, staining positively for nonspecific esterase activity, and displaying a promonocyte morphology. The increases in these differentiation markers after treatment with 0.03-1 ..mu..M THC were dose dependent. At this dose range, THC did not cause an inhibition of cell growth. The THC-induced cell maturation was also characterized by specific changes in the patterns of newly synthesized proteins. The THC-induced differentiation did not, however, result in cells with a highly developed mature monocyte phenotype. However, treatment of these incompletely matured cells with either phorbol 12-myristate 13-acetate of 1..cap alpha..,25-dihydroxycholecalciferol, which are inducers of differentiation in myeloid leukemia cells (including ML-2 cells), produced cells with a mature monocyte morphology. The ML-2 cell system described here may be a useful tool for deciphering critical biochemical events that lead to the cannabinoid-induced incomplete cell differentiation of ML-2 cells and other related cell types. Findings obtained from this system may have important implications for studies of cannabinoid effects on normal human bone-marrow progenitor cells.

  18. Culturing intestinal stem cells: applications for colorectal cancer research

    OpenAIRE

    Fujii, Masayuki; Sato, Toshiro

    2014-01-01

    Recent advance of sequencing technology has revealed genetic alterations in colorectal cancer (CRC). The biological function of recurrently mutated genes has been intensively investigated through mouse genetic models and CRC cell lines. Although these experimental models may not fully reflect biological traits of human intestinal epithelium, they provided insights into the understanding of intestinal stem cell self-renewal, leading to the development of novel human intestinal organoid culture...

  19. New Generation of Cell Culture Assay for Smallpox Vaccine Potency

    OpenAIRE

    Leparc-Goffart, Isabelle; Poirier, Bertrand; El Zaouk, Annie; Tissier, Marie-Hélène; Fuchs, Florence

    2003-01-01

    The potency of smallpox vaccines produced in the 1970s was tested by titration onto chorioallantoic membranes of fertilized hen eggs (CAM assay). The potency specification commonly approved for these vaccines was a titer above 108 pock-forming units per milliliter. We developed and validated a cell culture titration assay to have a more reliable potency test. The cell titration assay and the CAM assay were tested in parallel on 34 first-generation smallpox vaccine lots. These allowed us to de...

  20. Radiation transformation in differentiated human cells in culture

    International Nuclear Information System (INIS)

    A tissue culture technique is described for human thyroid tissue as an approach to studying mechanisms of human radiation carcinogenesis. Normal human tissue obtained from surgery is treated in one of two ways, depending upon size of specimen. Large pieces are completely digested in trypsin/ collagenase solution to a single cell suspension. Small pieces of tissue are plated as explants following partial digestion in trypsin/collagenase solution. Following irradiation of the primary differentiated monolayers (normally 10 days after plating), the development of transformed characteristics is monitored in the subsequent subcultures. A very high level of morphological and functional differentiation is apparent in the primary cultures. Over a period of approx. 6 months, the irradiated surviving cells continue to grow in culture, unlike the unirradiated controls which senesce after 2-3 subcultures. (UK)

  1. A Microwell Cell Culture Platform for the Aggregation of Pancreatic β-Cells

    OpenAIRE

    Bernard, Abigail B.; Lin, Chien-Chi; Anseth, Kristi S.

    2012-01-01

    Cell–cell contact between pancreatic β-cells is important for maintaining survival and normal insulin secretion. Various techniques have been developed to promote cell–cell contact between β-cells, but a simple yet robust method that affords precise control over three-dimensional (3D) β-cell cluster size has not been demonstrated. To address this need, we developed a poly(ethylene glycol) (PEG) hydrogel microwell platform using photolithography. This microwell cell-culture platform promotes t...

  2. Endocytic activity of Sertoli cells grown in bicameral culture chambers

    International Nuclear Information System (INIS)

    Immature rat Sertoli cells were cultured for 7 to 14 days on Millipore filters impregnated with a reconstituted basement membrane extract in dual-environment (bicameral) culture chambers. Electron microscopy of the cultured cells revealed the presence of rod-shaped mitochondria, Golgi apparatus, rough endoplasmic reticulum, and Sertoli-Sertoli tight junctions, typical of these cells in vivo. The endocytic activity of both the apical and basal surfaces of the Sertoli cells was examined by either adding alpha 2-macroglobulin (alpha 2-M) conjugated to 20 nm gold particles to the apical chamber or by adding 125I labeled alpha 2-M to the basal chamber. During endocytosis from the apical surface of Sertoli cells, the alpha 2-M-gold particles were bound initially to coated pits and then internalized into coated vesicles within 5 minutes. After 10 minutes, the alpha 2-M-gold was found in multi-vesicular bodies (MVBs) and by 30 minutes it was present in the lysosomes. The proportion of alpha 2-M-gold found within endocytic cell organelles after 1 hour of uptake was used to estimate the approximate time that this ligand spent in each type of organelle. The alpha 2-M-gold was present in coated pits, coated vesicles, multivesicular bodies, and lysosomes for approximately 3, 11, 22, and 24 minutes, respectively. This indicates that the initial stages of endocytosis are rapid, whereas MVBs and lysosomes are relatively long-lived

  3. Staurosporine induces different cell death forms in cultured rat astrocytes

    International Nuclear Information System (INIS)

    Astroglial cells are frequently involved in malignant transformation. Besides apoptosis, necroptosis, a different form of regulated cell death, seems to be related with glioblastoma genesis, proliferation, angiogenesis and invasion. In the present work we elucidated mechanisms of necroptosis in cultured astrocytes, and compared them with apoptosis, caused by staurosporine. Cultured rat cortical astrocytes were used for a cell death studies. Cell death was induced by different concentrations of staurosporine, and modified by inhibitors of apoptosis (z-vad-fmk) and necroptosis (nec-1). Different forms of a cell death were detected using flow cytometry. We showed that staurosporine, depending on concentration, induces both, apoptosis as well as necroptosis. Treatment with 10−7 M staurosporine increased apoptosis of astrocytes after the regeneration in a staurosporine free medium. When caspases were inhibited, apoptosis was attenuated, while necroptosis was slightly increased. Treatment with 10−6 M staurosporine induced necroptosis that occurred after the regeneration of astrocytes in a staurosporine free medium, as well as without regeneration period. Necroptosis was significantly attenuated by nec-1 which inhibits RIP1 kinase. On the other hand, the inhibition of caspases had no effect on necroptosis. Furthermore, staurosporine activated RIP1 kinase increased the production of reactive oxygen species, while an antioxidant BHA significantly attenuated necroptosis. Staurosporine can induce apoptosis and/or necroptosis in cultured astrocytes via different signalling pathways. Distinction between different forms of cell death is crucial in the studies of therapy-induced necroptosis

  4. Rapid method for culturing embryonic neuron-glial cell cocultures

    DEFF Research Database (Denmark)

    Svenningsen, Åsa Fex; Shan, Wei-Song; Colman, David R;

    2003-01-01

    enteric neurons is seen after 3 weeks (2 weeks in ascorbic acid), suggesting that basal lamina production is important even for glial ensheathment in the enteric nervous system. No overgrowth of fibroblasts or other nonneuronal cells was noted in any cultures, and myelination of the peripheral nervous...

  5. Plant Cell Cultures as Source of Cosmetic Active Ingredients

    Directory of Open Access Journals (Sweden)

    Ani Barbulova

    2014-04-01

    Full Text Available The last decades witnessed a great demand of natural remedies. As a result, medicinal plants have been increasingly cultivated on a commercial scale, but the yield, the productive quality and the safety have not always been satisfactory. Plant cell cultures provide useful alternatives for the production of active ingredients for biomedical and cosmetic uses, since they represent standardized, contaminant-free and biosustainable systems, which allow the production of desired compounds on an industrial scale. Moreover, thanks to their totipotency, plant cells grown as liquid suspension cultures can be used as “biofactories” for the production of commercially interesting secondary metabolites, which are in many cases synthesized in low amounts in plant tissues and differentially distributed in the plant organs, such as roots, leaves, flowers or fruits. Although it is very widespread in the pharmaceutical industry, plant cell culture technology is not yet very common in the cosmetic field. The aim of the present review is to focus on the successful research accomplishments in the development of plant cell cultures for the production of active ingredients for cosmetic applications.

  6. Biodegradable Mg corrosion and osteoblast cell culture studies

    International Nuclear Information System (INIS)

    Magnesium (Mg) is a biodegradable metal that has significant potential advantages as an implant material. In this paper, corrosion and cell culture experiments were performed to evaluate the biocompatibility of Mg. The corrosion current and potential of a Mg disk were measured in different physiological solutions including deionized (DI) water, phosphate-buffered saline (PBS), and McCoy's 5A culture medium. The corrosion currents in the PBS and in the McCoy's 5A-5% FBS media were found to be higher than in DI water, which is expected because corrosion of Mg occurs faster in a chloride solution. Weight loss, open-circuit potential, and electrochemical impedance spectroscopy measurements were also performed. The Mg specimens were also characterized using an environmental scanning electron microscope and energy-dispersive X-ray analysis (EDAX). The X-ray analysis showed that in the cell culture media a passive interfacial layer containing oxygen, chloride, phosphate, and potassium formed on the samples. U2OS cells were then co-cultured with a Mg specimen for up to one week. Cytotoxicity results of magnesium using MTT assay and visual observation through cell staining were not significantly altered by the presence of the corroding Mg sample. Further, bone tissue formation study using von Kossa and alkaline phosphatase staining indicates that Mg may be suitable as a biodegradable implant material.

  7. Test chambers for cell culture in static magnetic field

    International Nuclear Information System (INIS)

    Article presents a test chamber intended to be used for in vitro cell culture in homogenous constant magnetic field with parametrically variable magnitude. We constructed test chambers with constant parameters of control homeostasis of cell culture for the different parameters of static magnetic field. The next step was the computer calculation of 2D and 3D simulation of the static magnetic field distribution in the chamber. The analysis of 2D and 3D calculations of magnetic induction in the cells' exposition plane reveals, in comparison to the detection results, the greater accuracy of 2D calculations (Figs. 9 and 10). The divergence in 2D method was 2–4% and 8 to 10% in 3D method (reaching 10% only out of the cells′ cultures margins). -- Highlights: ► We present test chamber to be used for in vitro cell culture in static magnetic field. ► The technical data of the chamber construction was presented. ► 2D versus 3D simulation of static magnetic field distribution in chamber was reported. ► We report the accuracy of 2D calculation than 3D

  8. System-level modeling and simulation of the cell culture microfluidic biochip ProCell

    OpenAIRE

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan; Hemmingsen, Mette; Dufva, Martin

    2010-01-01

    Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory. There are two technologies for the microfluidic biochips: droplet-based and flow-based. In this paper we are interested in flow-based microfluidic biochips, where the liquid flows continuously through pre-defined micro-channels using valves and pumps. We present an approach to the system-level modeling and simulation of a cell culture microfluidic biochip called ProCell, Programmable Cell Culture Chi...

  9. Fabrication of a thermoresponsive cell culture dish: a key technology for cell sheet tissue engineering

    OpenAIRE

    Jun Kobayashi and Teruo Okano

    2010-01-01

    This article reviews the properties and characterization of an intelligent thermoresponsive surface, which is a key technology for cell sheet-based tissue engineering. Intelligent thermoresponsive surfaces grafted with poly(N-isopropylacrylamide) exhibit hydrophilic/hydrophobic alteration in response to temperature change. Cultured cells are harvested on thermoresponsive cell culture dishes by decreasing the temperature without the use of digestive enzymes or chelating agents. Our group has d...

  10. INCREASED OSMOLARITY AND CELL CLUSTERING PRESERVES CANINE NOTOCHORDAL CELL PHENOTYPE IN CULTURE

    OpenAIRE

    Spillekom, S; Smolders, L.A.; Grinwis, G.C.M.; Arkesteijn, I.; Ito, K.; Meij, B. P.; Tryfonidou, M.A.

    2013-01-01

    Abstract Degeneration of the intervertebral disc (IVD) is associated with a loss of notochordal cells (NCs) from the nucleus pulposus (NP) and their replacement by chondrocyte-like cells. NCs are known to maintain extracellular matrix quality and stimulate the chondrocyte-like NP cells, making NCs attractive for designing new tissue engineering approaches for IVD regeneration. However, optimal conditions, such as osmolarity and other characteristics of the culture media, for long-term culture...

  11. Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge.

    Science.gov (United States)

    Pestana, Carlos J; Reeve, Petra J; Sawade, Emma; Voldoire, Camille F; Newton, Kelly; Praptiwi, Radisti; Collingnon, Lea; Dreyfus, Jennifer; Hobson, Peter; Gaget, Virginie; Newcombe, Gayle

    2016-09-15

    In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. PMID:27265732

  12. Influence of in vitro irradiation upon LIF production by ConA stimulated mononuclear cells

    International Nuclear Information System (INIS)

    Leukocyte migration inhibitory factor (LIF) activity of culture supernatants of in vitro irradiated Concanavalin A (ConA) stimulated lymphocytes was tested by measuring granulocyte migration from clotted plasma droplets placed in flat bottom microplates. The specificity of inhibition was assured by pretreating the assay supernatants with anti-LIF antibodies which abrogated granulocyte migration inhibition but did not impair guinea pig Peritoneal Exudate Cells (PEC) migration inhibition. In vitro irradiation (150-1200 rads) of MNC cultures either before or after ConA stimulation did not impair lymphokine production and sometimes significantly improved the supernatants' LIF activity as compared with that of unirradiated cultures. The existence of radiosensitive suppressor cells regulating LIF production by ConA stimulated mononuclear cells is suggested

  13. Influence of in vitro irradiation upon LIF production by ConA stimulated mononuclear cells

    International Nuclear Information System (INIS)

    Leukocyte migration inhibitory factor (LIF) activity of culture supernatants of in vitro irradiated Concanavalin A (ConA) stimulated lymphocytes was tested by measuring granulocyte migration from clotted plasma droplets placed in flat bottom microplates. The specificity of inhibition was assured by pretreating the assay supernatants with anti-LIF antibodies which abrogated granulocyte migration inhibition but did not impair guinea pig Peritoneal Exudate Cells (PEC) migration inhibition. In vitro irradiation (150-1200 rad) of MNC cultures either before or after ConA stimulation did not impair lymphokine production and sometimes significantly improved the supernatants' LIF activity as compared with that of unirradiated cultures. The existence of radiosensitive suppressor cells regulating LIF production by ConA stimulated mononuclear cells is suggested

  14. Radiation causes increased production and decreased utilization of IL-2 in human mononuclear cells

    International Nuclear Information System (INIS)

    The effects of radiation on the kinetics of Interleukin-2 (IL-2) production and utilization by mononuclear cells (MNCs) were studied. Mononuclear cells from normal, healthy individuals were subjected to various doses of radiation ranging from 0 to 2,000 rad and cultured in the presence of PHA. Supernatants from these cultures were harvested at various periods and their IL-2 contents determined by both the standard bioassay and ELISA. A radiation dose of 800 rad and higher had a marked effect on both IL-2 production and consumption. Although the supernatants from both the irradiated and non-irradiated MNCs contained maximal concentrations of IL-2 between 8 and 24 h of culture, the former had three times as much IL-2 as the latter. An increase in IL-2-mRNA levels was also noticed in irradiated, PHA-stimulated cells. Moreover, the supernatants from irradiated MNCs collected as late as 72 h after the initiation of culture contained more than 30% of the total IL-2 produced compared to less than 8% in supernatants from non-irradiated cells. Supernatants from non-irradiated cells incubated further with irradiated cells contained relatively higher quantities of IL-2 than those incubated continuously with non-irradiated cells. Supernatants from co-cultures of irradiated and non-irradiated MNCs contained less than expected amounts of IL-2 in two of the three subjects. Despite a difference in both the production and consumption of IL-2 between the irradiated and non-irradiated cells, there was no difference in their ability to generate IL-2 receptors. The results indicate that inactivation of radiosensitive suppressor T cells is associated with superinduction of IL-2 mRNA, increased production and decreased consumption of IL-2 by MNCs, thereby resulting in increased accumulation of IL-2

  15. Neural differentiation of human placenta-derived mesenchymal stem cells following neural cell co-culture

    Institute of Scientific and Technical Information of China (English)

    Nailong Yang; Hongyan Zhang; Xiaojuan Sun; Lili Xu

    2011-01-01

    We induced human placenta-derived mesenchymal stem cells (hPMSCs) to differentiate into neural cells by adding chemical reagents,despite the fact that toxic chemicals induce cell shrinkage or cytoskeletal formation,which does not represent a proper cell differentiation process.The present study established a co-culture system with hPMSCs and neural cells and analyzed the influence of neural cells on hPMSC differentiation in a co-culture system.hPMSCs were isolated and purified from human full-term placenta using collagenase digestion.Fetal neural cells were co-cultured with hPMSCs for 48 hours using the Transwell co-culture system.hPMSCs co-cultured with neural cells exhibited a slender morphology with a filament.After 96 hours,hPMSCs expressed neuron-specific enolase,which suggested that co-culture of hPMSCs and neural cells induced neural differentiation of hPMSCs.

  16. Extraction and identification of exosomes from drug-resistant breast cancer cells and their potential role in cell-to-cell drug-resistance transfer

    Institute of Scientific and Technical Information of China (English)

    许金金

    2014-01-01

    Objective To explore whether docetaxel-resistant cells(MCF-7/Doc)and doxorubicin-resistant cells(MCF-7/ADM)can secrete Exosomes and their potential role in cell-cell drug-resistance transfer.Methods Exosomes were extracted from the cell culture supernatants of MCF-7/Doc and MCF-7/ADM cells by fractionation ultracentrifugation,and were identified by transmission

  17. The molecularly crowded cytoplasm of bacterialcCells : Dividing cells contrasted with viable but non-culturable (VBNC) bacterial cells

    NARCIS (Netherlands)

    Trevors, J. T.; van Elsas, J. D.; Bej, A. K.

    2013-01-01

    In this perspective, we discuss the cytoplasm in actively growing bacterial cells contrasted with viable but non-culturable (VBNC) cells. Actively growing bacterial cells contain a more molecularly crowded and organized cytoplasm, and are capable of completing their cell cycle resulting in cell divi

  18. Human disc cells in monolayer vs 3D culture: cell shape, division and matrix formation

    Directory of Open Access Journals (Sweden)

    Hanley Edward N

    2000-10-01

    Full Text Available Abstract Background The relationship between cell shape, proliferation, and extracellular matrix (ECM production, important aspects of cell behavior, is examined in a little-studied cell type, the human annulus cell from the intervertebral disc, during monolayer vs three-dimensional (3D culture. Results Three experimental studies showed that cells respond specifically to culture microenvironments by changes in cell shape, mitosis and ECM production: 1 Cell passages showed extensive immunohistochemical evidence of Type I and II collagens only in 3D culture. Chondroitin sulfate and keratan sulfate were abundant in both monolayer and 3D cultures. 2 Cells showed significantly greater proliferation in monolayer in the presence of platelet-derived growth factor compared to cells in 3D. 3 Cells on Matrigel™-coated monolayer substrates became rounded and formed nodular colonies, a finding absent during monolayer growth. Conclusions The cell's in vivo interactions with the ECM can regulate shape, gene expression and other cell functions. The shape of the annulus cell changes markedly during life: the young, healthy disc contains spindle shaped cells and abundant collagen. With aging and degeneration, many cells assume a strikingly different appearance, become rounded and are surrounded by unusual accumulations of ECM products. In vitro manipulation of disc cells provides an experimental window for testing how disc cells from given individuals respond when they are grown in environments which direct cells to have either spindle- or rounded-shapes. In vitro assessment of the response of such cells to platelet-derived growth factor and to Matrigel™ showed a continued influence of cell shape even in the presence of a growth factor stimulus. These findings contribute new information to the important issue of the influence of cell shape on cell behavior.

  19. Vegetal cell cultures under the effect of low intensity microwaves

    International Nuclear Information System (INIS)

    In order to study the microwave effect on the chlorophyll biosynthesis in Papaver rhoes in vitro cultures microwave radiation characterized by a power density of 0.9 mW/cm2 in a frequency range of 9. 75 - 10.75 GHz was used. P. rhoes in vitro cultures, were obtained from explants of leaves and flowers provided by adult individuals, grown in the Botanical garden of AL. I. Cuza University from Iasi. Murashige Skoog agarized medium with a suitable hormone balance was used to conduct cell culture development before as well as after exposure to microwaves. Assimilatory pigment levels (chlorophyll a, chlorophyll b and carotene pigments) have been evaluated by standard spectrophotometric technique. Student t-test (two tailed, pair) gave significant p-values for the modification of chlorophyll a and chlorophyll b levels after microwave treatment (p0.05). Microwave treatment seems to be able to stimulate assimilatory pigment biosynthesis in the vegetal cell cultures. An inhibitory effect may be associated to the phenotypic modifications noticed in the callus growth from 2 exposed vials - probably related to a non-thermal effect of microwaves in living tissues. Further study of sub-cultures derived from exposed vials is needed to clarify if microwaves of low power density are adequate for the stimulation of assimilatory pigment from chloroplast membranes. (authors)

  20. Unique cell culture systems for ground based research

    Science.gov (United States)

    Lewis, Marian L.

    1990-01-01

    The horizontally rotating fluid-filled, membrane oxygenated bioreactors developed at NASA Johnson for spacecraft applications provide a powerful tool for ground-based research. Three-dimensional aggregates formed by cells cultured on microcarrier beads are useful for study of cell-cell interactions and tissue development. By comparing electron micrographs of plant seedlings germinated during Shuttle flight 61-C and in an earth-based rotating bioreactor it is shown that some effects of microgravity are mimicked. Bioreactors used in the UAH Bioreactor Laboratory will make it possible to determine some of the effects of altered gravity at the cellular level. Bioreactors can be valuable for performing critical, preliminary-to-spaceflight experiments as well as medical investigations such as in vitro tumor cell growth and chemotherapeutic drug response; the enrichment of stem cells from bone marrow; and the effect of altered gravity on bone and muscle cell growth and function and immune response depression.

  1. Milk stimulates growth of prostate cancer cells in culture.

    Science.gov (United States)

    Tate, Patricia L; Bibb, Robert; Larcom, Lyndon L

    2011-11-01

    Concern has been expressed about the fact that cows' milk contains estrogens and could stimulate the growth of hormone-sensitive tumors. In this study, organic cows' milk and two commercial substitutes were digested in vitro and tested for their effects on the growth of cultures of prostate and breast cancer cells. Cows' milk stimulated the growth of LNCaP prostate cancer cells in each of 14 separate experiments, producing an average increase in growth rate of over 30%. In contrast, almond milk suppressed the growth of these cells by over 30%. Neither cows' milk nor almond milk affected the growth of MCF-7 breast cancer cells or AsPC-1 pancreatic cancer cells significantly. Soy milk increased the growth rate of the breast cancer cells. These data indicate that prostate and breast cancer patients should be cautioned about the possible promotional effects of commercial dairy products and their substitutes. PMID:22043817

  2. Lethal impacts of cigarette smoke in cultured tobacco cells

    Directory of Open Access Journals (Sweden)

    Kawano Tomonori

    2011-07-01

    Full Text Available Abstract Background In order to understand and generalize the toxic mechanism of cigarette smoke in living cells, comparison of the data between animal systems and other biological system such as microbial and plant systems is highly beneficial. Objective By employing the tobacco cells as model materials for cigarette smoke toxicity assay, the impacts of the combustion by-products such as nitrogen oxides could be highlighted as the toxic impacts of the plant-derived endogenous chemicals could be excluded in the plant cells. Methods Cigarette smoke-induced cell death was assessed in tobacco cell suspension cultures in the presence and absence of pharmacological inhibitors. Results Cigarette smoke was effective in induction of cell death. The smoke-induced cell death could be partially prevented by addition of nitric oxide (NO scavenger, suggesting the role for NO as the cell death mediator. Addition of NO donor to tobacco cells also resulted in development of partial cell death further confirming the role of NO as cell death mediator. Members of reactive oxygen species and calcium ion were shown to be protecting the cells from the toxic action of smoke-derived NO.

  3. Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models

    Science.gov (United States)

    Marquette, Michele L.; Sognier, Marguerite A.

    2013-01-01

    An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.

  4. Growing Three-Dimensional Cartilage-Cell Cultures

    Science.gov (United States)

    Spaulding, Glenn F.; Prewett, Tacey L.; Goodwin, Thomas J.

    1995-01-01

    Process for growing three-dimensional cultures of mammalian cartilage from normal mammalian cells devised. Effected using horizontal rotating bioreactor described in companion article, "Simplified Bioreactor for Growing Mammalian Cells" (MSC-22060). Bioreactor provides quiescent environment with generous supplies of nutrient and oxygen. Initiated with noncartilage cells. Artificially grown tissue resembles that in mammalian cartilage. Potential use in developing therapies for damage to cartilage by joint and back injuries and by such inflammatory diseases as arthritis and temporal-mandibular joint disease. Also used to test nonsteroid anti-inflammation medicines.

  5. The Effect of Spaceflight on Bone Cell Cultures

    Science.gov (United States)

    Landis, William J.

    1999-01-01

    Understanding the response of bone to mechanical loading (unloading) is extremely important in defining the means of adaptation of the body to a variety of environmental conditions such as during heightened physical activity or in extended explorations of space or the sea floor. The mechanisms of the adaptive response of bone are not well defined, but undoubtedly they involve changes occurring at the cellular level of bone structure. This proposal has intended to examine the hypothesis that the loading (unloading) response of bone is mediated by specific cells through modifications of their activity cytoskeletal elements, and/or elaboration of their extracellular matrices. For this purpose, this laboratory has utilized the results of a number of previous studies defining molecular biological, biochemical, morphological, and ultrastructural events of the reproducible mineralization of a primary bone cell (osteoblast) culture system under normal loading (1G gravity level). These data and the culture system then were examined following the use of the cultures in two NASA shuttle flights, STS-59 and STS-63. The cells collected from each of the flights were compared to respective synchronous ground (1G) control cells examined as the flight samples were simultaneously analyzed and to other control cells maintained at 1G until the time of shuttle launch, at which point they were terminated and studied (defined as basal cells). Each of the cell cultures was assayed in terms of metabolic markers- gene expression; synthesis and secretion of collagen and non-collagenous proteins, including certain cytoskeletal components; assembly of collagen into macrostructural arrays- formation of mineral; and interaction of collagen and mineral crystals during calcification of the cultures. The work has utilized a combination of biochemical techniques (radiolabeling, electrophoresis, fluorography, Western and Northern Blotting, and light microscopic immunofluorescence) and structural

  6. A simple technique for preparation of chicken-embryo-skin cell cultures.

    Science.gov (United States)

    Silim, A; El Azhary, M A; Roy, R S

    1982-01-01

    A simple, rapid technique was developed for preparing chicken-embryo-skin cell cultures utilizing trypsinization of the skin of intact 12-day-old chicken embryos. When cell cultures were inoculated with fowl pox virus, those that consisted of at least 80% epithelial cells yielded a higher virus titer than fibroblast cell cultures. PMID:6284112

  7. Human neuronal cells in culture: from concepts to basic methodology.

    Science.gov (United States)

    Silani, V; Pizzuti, A; Donato, M F; Falini, A; Bassani, R; Strada, O; Causarano, R I; Mariani, D; Villani, R M; Scarlato, G

    1990-01-01

    The paper reviews some conceptual and methodological aspects of the tissue culture models which, during the past three decades, demonstrated a remarkable mimicry of many important structures and functions of the mammalian Central Nervous System (CNS) and related peripheral sensory and motor elements. Emphasis is placed on an original human neuronal tissue culture model obtained from selective CNS areas. The different cell types were identified and the neurotrophic interactions preliminary characterized. Neuropathological findings suggest hypothesis that can be fully tested using in vitro human models of affected cerebral specific areas. PMID:2102114

  8. IFN-τ acts in a dose-dependent manner on prostaglandin production by buffalo endometrial stromal cells cultured in vitro.

    Science.gov (United States)

    Chethan, S G; Singh, S K; Nongsiej, J; Rakesh, H B; Singh, R P; Kumar, N; Agarwal, S K

    2014-06-01

    Interferon-τ (IFN-τ) has been recognized as the primary embryonic signal responsible for maternal recognition of pregnancy. Uterine endometrium produces both prostaglandin F2α (PGF2α ) and prostaglandin E2 (PGE2 ). PGF2α is responsible for the luteolysis; however, PGE2 favours establishment of pregnancy by its luteoprotective action. In this study, the dose-response effect of recombinant bovine IFN-τ (rbIFN-τ) on prostaglandin (PG) production by buffalo endometrial stromal cells cultured in vitro was studied. Buffalo endometrial stromal cells were isolated by double enzymatic digestion, initially with trypsin III followed by a cocktail of trypsin III, collagenase type II and DNase I and subsequently cultured till confluence. Further, cells were treated with different doses of rbIFN-τ (0.001, 0.01, 0.1, 1.0 and 10 μg/ml) and keeping a separate set of control. Culture supernatant was collected after 6, 12 and 24 h of treatment. PG levels in the culture supernatant were measured by enzyme immune assay (EIA) and total cellular protein estimated by Bradford method. Results indicated that buffalo endometrial stromal cells following rbIFN-τ treatment enhanced the secretion of both PGE2 and PGF2α , and also its ratio in a strict dose-dependent manner with a significant increase (p < 0.01) in PGE2 production at 1 μg/ml dose of rbIFN-τ and maximal stimulation for both PG was observed at 10 μg/ml. Further, both PG production and its ratio were increased significantly (p < 0.01) in a time-dependent fashion in all the groups at 6, 12 and 24 h post-treatment with highest level achieved at 24 h as compared with control. Absolute levels of PGE2 remained higher than PGF2α indicating PGE2 as the major PG produced by endometrial stromal cells. The dose-dependent response of rbIFN-τ signifies the importance of optimum concentration of IFN-τ for the embryonic development especially during the critical period to establish successful pregnancy. PMID:24612212

  9. Long term maintenance of myeloid leukemic stem cells cultured with unrelated human mesenchymal stromal cells

    Directory of Open Access Journals (Sweden)

    Sawa Ito

    2015-01-01

    Full Text Available Mesenchymal stromal cells (MSCs support the growth and differentiation of normal hematopoietic stem cells (HSCs. Here we studied the ability of MSCs to support the growth and survival of leukemic stem cells (LSCs in vitro. Primary leukemic blasts isolated from the peripheral blood of 8 patients with acute myeloid leukemia (AML were co-cultured with equal numbers of irradiated MSCs derived from unrelated donor bone marrow, with or without cytokines for up to 6 weeks. Four samples showed CD34+CD38− predominance, and four were predominantly CD34+CD38+. CD34+ CD38− predominant leukemia cells maintained the CD34+ CD38− phenotype and were viable for 6 weeks when co-cultured with MSCs compared to co-cultures with cytokines or medium only, which showed rapid differentiation and loss of the LSC phenotype. In contrast, CD34+ CD38+ predominant leukemic cells maintained the CD34+CD38+ phenotype when co-cultured with MSCs alone, but no culture conditions supported survival beyond 4 weeks. Cell cycle analysis showed that MSCs maintained a higher proportion of CD34+ blasts in G0 than leukemic cells cultured with cytokines. AML blasts maintained in culture with MSCs for up to 6 weeks engrafted NSG mice with the same efficiency as their non-cultured counterparts, and the original karyotype persisted after co-culture. Chemosensitivity and transwell assays suggest that MSCs provide pro-survival benefits to leukemic blasts through cell–cell contact. We conclude that MSCs support long-term maintenance of LSCs in vitro. This simple and inexpensive approach will facilitate basic investigation of LSCs and enable screening of novel therapeutic agents targeting LSCs.

  10. Keratocytes Derived from Spheroid Culture of Corneal Stromal Cells Resemble Tissue Resident Keratocytes

    OpenAIRE

    Byun, Yong-Soo; Tibrewal, Sapna; Kim, Eunjae; Yco, Lisette; Sarkar, Joy; Ivanir, Yair; Liu, Chia-Yang; Sano, Cecile M.; Jain, Sandeep

    2014-01-01

    Purpose Corneal stromal cells transform to precursor cells in spheroid culture. We determined whether keratocytes derived from spheroid culture of murine corneal stromal cells resemble tissue resident keratocytes. Methods Spheroid culture was performed by seeding dissociated stromal cells onto ultra-low attachment plates containing serum-free mesenchymal stem cell culture medium. Spheroids were characterized with phenotype specific markers and stemness transcription factor genes. Spheroids an...

  11. Characterizing parameters of Jatropha curcas cell cultures for microgravity studies

    Science.gov (United States)

    Vendrame, Wagner A.; Pinares, Ania

    2013-06-01

    Jatropha (Jatropha curcas) is a tropical perennial species identified as a potential biofuel crop. The oil is of excellent quality and it has been successfully tested as biodiesel and in jet fuel mixes. However, studies on breeding and genetic improvement of jatropha are limited. Space offers a unique environment for experiments aiming at the assessment of mutations and differential gene expression of crops and in vitro cultures of plants are convenient for studies of genetic variation as affected by microgravity. However, before microgravity studies can be successfully performed, pre-flight experiments are necessary to characterize plant material and validate flight hardware environmental conditions. Such preliminary studies set the ground for subsequent spaceflight experiments. The objectives of this study were to compare the in vitro growth of cultures from three explant sources (cotyledon, leaf, and stem sections) of three jatropha accessions (Brazil, India, and Tanzania) outside and inside the petriGAP, a modified group activation pack (GAP) flight hardware to fit petri dishes. In vitro jatropha cell cultures were established in petri dishes containing a modified MS medium and maintained in a plant growth chamber at 25 ± 2 °C in the dark. Parameters evaluated were surface area of the explant tissue (A), fresh weight (FW), and dry weight (DW) for a period of 12 weeks. Growth was observed for cultures from all accessions at week 12, including subsequent plantlet regeneration. For all accessions differences in A, FW and DW were observed for inside vs. outside the PetriGAPs. Growth parameters were affected by accession (genotype), explant type, and environment. The type of explant influenced the type of cell growth and subsequent plantlet regeneration capacity. However, overall cell growth showed no abnormalities. The present study demonstrated that jatropha in vitro cell cultures are suitable for growth inside PetriGAPs for a period of 12 weeks. The parameters

  12. Isolation and culture of protoplasts of Ma-phut (Garcinia dulcis derived from cell suspension culture

    Directory of Open Access Journals (Sweden)

    Sompong Te-chato

    2008-09-01

    Full Text Available Friable callus induced from young leaves of Ma-phut on Murashige and Skoog (MS medium containing 3% sucrose,1 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D, 0.5 mg/l benzyladenine (BA and 500 mg/l polyvinylpyrrolidone (PVP, was cultured in liquid medium with the same components. Various ages of cell suspension at weekly intervals were then incubated in various kinds and concentrations of cell wall digestion enzymes combined with 1% macerozyme R-10 on a rotary shaker at 100 rpm under 1500 lux illumination at 26±4oC. Purified protoplasts were cultured at various densities in MS medium (adjusted osmoticum to 0.4 M by mannitol supplemented with 3% sucrose and two types of auxin, 2,4-D and NAA at four concentrations (1, 2, 3 and 4 mg/l together with 1 mg/l BA. The results revealed that a four-day old cell suspension culture incubated in 2% cellulase Onozuka R-10 (CR10 in combination with 1% macerozyme R-10 gave an optimum result in both yield and viability of protoplasts at 5.7x106/1 ml PCV and 80%, respectively. Embedding protoplasts at a density of 2.5x105/ml in 0.2% phytagel containing MS medium supplemented with 3 mg/l NAA and 1 mg/l BA promoted the most effective division of the protoplasts (20%. The first division of the protoplasts was obtained after 2 days of culture and further divisions to form micro- and macro-colonies could be observed after 7-10 days of culture. However, callusformation and plantlet regeneration was not obtained.

  13. Identifying developmental toxicity pathways for a subset of ToxCast chemicals using human embryonic stem cells and metabolomics

    Science.gov (United States)

    Metabolomics analysis was performed on the supernatant of human embryonic stem (hES) cell cultures exposed to a blinded subset of 11 chemicals selected from the chemical library of EPA's ToxCast™ chemical screening and prioritization research project. Metabolites from hES cultur...

  14. MEMS-based dynamic cell-to-cell culture platforms using electrochemical surface modifications

    International Nuclear Information System (INIS)

    MEMS-based biological platforms with the capability of both spatial placements and time releases of living cells for cell-to-cell culture experiments have been designed and demonstrated utilizing electrochemical surface modification effects. The spatial placement is accomplished by electrochemical surface modification of substrate surfaces to be either adhesive or non-adhesive for living cells. The time control is achieved by the electrical activation of the selective indium tin oxide co-culture electrode to allow the migration of living cells onto the electrode to start the cell-to-cell culture studies. Prototype devices have a three-electrode design with an electrode size of 50 × 50 µm2 and the separation gaps of 2 µm between them. An electrical voltage of −1.5 V has been used to activate the electrodes independently and sequentially to demonstrate the dynamic cell-to-cell culture experiments of NIH 3T3 fibroblast and Madin Darby canine kidney cells. As such, this MEMS platform could be a basic yet versatile tool to characterize transient cell-to-cell interactions

  15. The major bovine mastitis pathogens have different cell tropisms in cultures of bovine mammary gland cells

    NARCIS (Netherlands)

    Lammers, A.; Vorstenbosch, van C.J.; Erkens, J.H.F.; Smith, H.E.

    2001-01-01

    We previously showed that Staphylococcus aureus cells adhered mainly to an elongated cell type, present in cultures of bovine mammary gland cells. Moreover. we showed that this adhesion was mediated by binding to fibronectin. The same in vitro model was used here, to study adhesion of other importan

  16. Isolation and culture of porcine neural progenitor cells from embryos and pluripotent stem cells

    DEFF Research Database (Denmark)

    Rasmussen, Mikkel Aabech; Hall, Vanessa Jane; Hyttel, Poul

    2013-01-01

    The isolation and culture of neural progenitor cells (NPCs) from pluripotent stem cells has facilitated in vitro mechanistic studies of diseases related to the nervous system, as well as discovery of new medicine. In addition, NPCs are envisioned to play a crucial role in future cell replacement...

  17. Helicobacter pylori damages human gallbladder epithelial cells in vitro

    Institute of Scientific and Technical Information of China (English)

    Dong-Feng Chen; Lu Hu; Ping Yi; Wei-Wen Liu; Dian-Chun Fang; Hong Cao

    2008-01-01

    AIM: To study the mechanism by which Helicobacter pylori (Hpy/orO damages human gallbladder epithelial cells (HGBEC).METHODS: H pylori isolated from gallbladder were cultured in a liquid medium. Different concentration supernatants and sonicated extracts of H pylori cells were then added to HGBEC in a primary culture. The morphological changes in HGBEC as well as changes in the levels of alkaline phosphatase (ALP), lactate dehydrogenase (LDH) and glutamyltransferase (GGT)were measured.RESULTS: According to the culture curve of HGBEC,it was convenient to study the changes in HGBEC by adding H pylori sonicated extracts and H pylori culture supernatants. Both H pylori sonicated extracts and H pylori culture supernatants had a significant influence on HGBEC morphology, i.e. HGBEC grew more slowly, their viability decreased and their detachment increased. Furthermore, HGBEC ruptured and died. The levels of ALP (33.84 ± 6.00 vs 27.01± 4.67, P < 0.05), LDH (168.37 ± 20.84 vs 55.51 ±17.17, P < 0.01) and GGT (42.01 ± 6.18 vs 25.34 ±4.33, P < 0.01) significantly increased in the HGBEC culture supernatant in a time- and concentrationdependent. The damage to HGBEC in Hpylori culture liquid was more significant than that in H pylori sonicated extracts.CONCLUSION: H pylori induces no obvious damage to HGBEC.

  18. Astragalus extract inhibits destruction of gastric cancer cells to mesothelial cells by anti-apoptosis

    Institute of Scientific and Technical Information of China (English)

    Di Na; Fu-Nan Liu; Zhi-Feng Miao; Zong-Min Du; Hui-Mian Xu

    2009-01-01

    AIM: To determine the inhibitory effect of Astragalus memebranaceushas on gastric cancer cell supernatantinduced apoptosis of human peritoneal mesothelial cells. METHODS: Human peritoneal mesothelial cell (HPMC) line HMrSV5 was co-incubated with gastric cancer cell supernatant (MKN45) and/or Astragalus memebranaceushas. Morphological changes in gastric cancer cells were observed under phase-contrast microscope. Quantitative cell damage was determined by MTT assay. Apoptosis was determined under transmission electron microscope and quantified by detecting acridine orange/ethidium bromide-stained (AO/EB) condensed nuclei under fluorescent microscope or by flow cytometry. Expressions of Bcl-2 and Bax were evaluated with immunostaining. RESULTS: Morphological changes and exfoliation occurred and naked areas appeared in cultured HMrSV5 cells 24 h after they were treated with gastric cancer cell supernatant. Cell supernatant from MKN45 gastric cancer cells induced apoptosis of HMrSV5 cells in a time-dependent manner. Obvious morphological changes were observed in cell apoptosis, such as condensation of chromatin, nuclear fragmentations and apoptotic bodies. Astragalus memebranaceus could partly suppress these changes and regulate the expressions of Bcl-2 and Bax in HMrSV5 cells. CONCLUSION: Gastric cancer cells induce apoptosis of HPMCs through the supernatant. Astragalus memebranaceushas inhibits this phenomenon and can be used an adjuvant chemothera-peutic agent in gastric cancer therapy.

  19. Arsenite maintains germinative state in cultured human epidermal cells

    International Nuclear Information System (INIS)

    Arsenic is a well-known carcinogen for human skin, but its mechanism of action and proximal macromolecular targets remain to be elucidated. In the present study, low micromolar concentrations of sodium arsenite maintained the proliferative potential of epidermal keratinocytes, decreasing their exit from the germinative compartment under conditions that promote differentiation of untreated cells. This effect was observed in suspension and in post-confluent surface cultures as measured by colony-forming ability and by proportion of rapidly adhering colony-forming cells. Arsenite-treated cultures exhibited elevated levels of β1-integrin and β-catenin, two proteins enriched in cells with high proliferative potential. Levels of phosphorylated (inactive) glycogen synthase kinase 3β were higher in the treated cultures, likely accounting for the increased levels of transcriptionally available β-catenin. These findings suggest that arsenic could have co-carcinogenic and tumor co-promoting activities in the epidermis as a result of increasing the population and persistence of germinative cells targeted by tumor initiators and promoters. These findings also identify a critical signal transduction pathway meriting further exploration in pursuit of this phenomenon

  20. Culture and purification of human fetal olfactory bulb ensheathing cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective: To obtain high purity of human fetal olfactory bulb ensheathing cells (OB-hOECs) in vitro and to develop a simple and effective method for primary culture of OB-hOECs. Methods: OB-hOECs were cultured based on the differential rates of attachment of the various harvested cell types. Then the method was combined with arabinoside cytosine (Ara-C)inhibition, serum-free starvation or intermittent neurotrophin 3 (NT3) nutrition method to observe cell states in different cultural environments. The purity of OB-hOECs was assessed with immunocytochemical analysis. Results: OB-hOECs appeared bipolar and tripolar shape, with slender processes forming network. The purity of OECs reached 88% with the selective attachment method on day 6, and then fibroblast proliferated quickly and reduced the purity. When combined with the starvation method, the purity of OECs was 91% on day 6 and 86% on day 9, however, OECs were in a poor state. While combined with the NT3 method, the purity reached 95% on day 9 and 83% on day 12, respectively. The cells still remained in a good state. Conclusion: A combination of selective attachment and intermittent NT3 nutrition is an effective method to obtain OECs with higher purity and quality.

  1. Dexamethasone Modulation on Cultured Human Retinal Pigment Epithelial Cell

    Institute of Scientific and Technical Information of China (English)

    Bing Liu; Yannian; Hui Yusheng Wang; Hong Wei

    2001-01-01

    Purpose: Dexamethasone(DEX) was tested for its ability to modulate human retinal pigment epithelium (hRPE) cell proliferation in cell culture. Methods: DEX in different concentrations was added to cultured hRPE cells. The effects were measured with MTT method, 3H-thymidine(3H-TdR) incorporation and flow cytometw. Results: DEX increased survival rate and DNA synthesis from 32 mg/L to 320 mg/L under hRPE culture conditions, but paradoxically reduced them at 1 000 mg/L and 3 200 mg/L in dose and time dependent fashion by both MTT assay and 3 H-TdR incorporation. The cell numbers in S phase and G2/M phase increased 28.32 % at DEX concentration 320 mg/L, in contrast, reduced 41.84 % at 1 000 mg/L. Conclusion: DEX increased proliferation from 32 mg/L to 320 mg/L, and inhibited proliferation at concentrations greater than 320 mg/L. The inhibiting effect of DEX may happen in s phase and G2/M phase. Eye Sciernce 2001; 17:27 ~ 30.

  2. Enhancement effect of shikonin in cell suspension culture and transfermanant culture by radiation application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jae Sung; Lee, Young Keun; Chung, Byung Yeoup; Lee, Young Bok; Hwang Hye Yeon

    2004-10-01

    The cell lines 679, 679-29 and 622-46 of L. erythrorhizon could be selected on LS agar medium for the production shikonin in cell suspension culture. The shikonin was increased moderately in suspension culture of cell line 622-46 in LS liquid medium containing BA 2 mg{center_dot}L{sup -1} and IAA 0.2 mg{center_dot}L{sup -1} in the dark, and was increased by adding 1 {mu}M Cu{sup 2+} and 100 {mu}M methyl jasmonate The accumulation of shikonin in the liquid medium was increased significantly by 2 Gy irradiation to callus of cell line 622-46 and culture in LS liquid medium containing BA 2 mg{center_dot}L{sup -1} and IAA 0.2 mg{center_dot}L{sup -1} in the dark and shikonin in cell debris was higher by 16 Gy irradiation. The activity of p-hydroxybenzoate geranyltransferase was increased by irradiation of 2 Gy and 16 Gy of {gamma} radiation. Seedling hypocotyles of L. erythrorhizon were infected with Agrogacterium rhizogenes strain 15834 harboring a binary vector with an intron bearing the GUS ({beta}-glucuronidase) gene driven by cauliflower mosaic virus (CaMV) 35S promotor as well as the HPT (hygromycin phosphotransferase) gene as the selection marker. Hairy roots isolated were hygromycin resistant and had integrated GUS gene in DNA. The root tip grown on M-9 medium showed normal pigment production pattern in border cells and root hairs.

  3. [Wound treatment with autogenous epidermal cell expansion culture].

    Science.gov (United States)

    Bonnekoh, B; Müller, R P; Mahrle, G; Steigleder, G K

    1988-11-11

    Sheets of autologous epidermal cells grown by expansion culture were used to cover small skin defects in seven patients with postoperative necroses, necroses due to temporal arteritis, varicose ulcers or after tangential excision of tattoos. Several transplantation techniques were used: backing of the cultured epithelia with vaseline gauze, Surfasoft, Adaptic, Silastic foil, culturing directly from Petriperm-foil. Meshed Silastic-foil proved to give the best support. Optimal take of the in-vitro epithelia (more than 80% of their surface area) was achieved only for fresh dermal wound-beds. The take was only moderate on chronic granulation tissue, but the transplants reduced the formation of fibrinous-necrotic material and favoured the formation of fresh granulation tissue. PMID:3181024

  4. Radiation Response of Cultured Human Cells Is Unaffected by Johrei

    Directory of Open Access Journals (Sweden)

    Zach Hall

    2007-01-01

    Full Text Available Johrei has been credited with healing thousands from radiation wounds after the Hiroshima and Nagasaki bombs in 1945. This alternative medical therapy is becoming increasingly popular in the United States, as are other Energy Medicine modalities that purport to influence a universal healing energy. Human brain cells were cultured and exposed to increasing doses of ionizing radiation. Experienced Johrei practitioners directed healing intentionality toward the cells for 30 min from a distance of 20 cm and the fate of the cells was observed by computerized time-lapse microscopy. Cell death and cell divisions were tallied every 30 min before, during and after Johrei treatment for a total of 22.5 h. An equal number of control experiments were conducted in which cells were irradiated but did not receive Johrei treatment. Samples were assigned to treatment conditions randomly and data analysis was conducted in a blinded fashion. Radiation exposure decreased the rate of cell division (cell cycle arrest in a dose-dependent manner. Division rates were estimated for each 30 min and averaged over 8 independent experiments (4 control and 4 with Johrei treatment for each of 4 doses of X-rays (0, 2, 4 and 8 Gy. Because few cell deaths were observed, pooled data from the entire observation period were used to estimate death rates. Analysis of variance did not reveal any significant differences on division rate or death rate between treatment groups. Only radiation dose was statistically significant. We found no indication that the radiation response of cultured cells is affected by Johrei treatment.

  5. Radiation response of cultured human cells is unaffected by Johrei.

    Science.gov (United States)

    Hall, Zach; Luu, Tri; Moore, Dan; Yount, Garret

    2007-06-01

    Johrei has been credited with healing thousands from radiation wounds after the Hiroshima and Nagasaki bombs in 1945. This alternative medical therapy is becoming increasingly popular in the United States, as are other Energy Medicine modalities that purport to influence a universal healing energy. Human brain cells were cultured and exposed to increasing doses of ionizing radiation. Experienced Johrei practitioners directed healing intentionality toward the cells for 30 min from a distance of 20 cm and the fate of the cells was observed by computerized time-lapse microscopy. Cell death and cell divisions were tallied every 30 min before, during and after Johrei treatment for a total of 22.5 h. An equal number of control experiments were conducted in which cells were irradiated but did not receive Johrei treatment. Samples were assigned to treatment conditions randomly and data analysis was conducted in a blinded fashion. Radiation exposure decreased the rate of cell division (cell cycle arrest) in a dose-dependent manner. Division rates were estimated for each 30 min and averaged over 8 independent experiments (4 control and 4 with Johrei treatment) for each of 4 doses of X-rays (0, 2, 4 and 8 Gy). Because few cell deaths were observed, pooled data from the entire observation period were used to estimate death rates. Analysis of variance did not reveal any significant differences on division rate or death rate between treatment groups. Only radiation dose was statistically significant. We found no indication that the radiation response of cultured cells is affected by Johrei treatment. PMID:17549235

  6. A Place to Call Home: Bioengineering Pluripotential Stem Cell Cultures

    Directory of Open Access Journals (Sweden)

    Mark Weingarten

    2015-03-01

    Full Text Available Pluripotent stem cells (PSCs have the power to revolutionize the future of cell-based therapies and regenerative medicine. However, stem/progenitor cell use in the clinical arsenal has been hampered by discrepancies resulting from stem cell engineering and expansion, as well as in their (mass differentiation in culture. Moreover, the manner in which external conditions affect PSC and induced-pluripotent stem cell lineage establishment as well as maturation remains controversial. In this review, we examine novel methods of cell engineering and the role of reprogramming transcription factors in PSC development. In addition, we explore the effect of external environmental signals on PSC cultivation and differentiation by elucidating key components of the primordial stem cell microenvironment, the blastocyst. Furthermore, we assess the effects of hypoxic conditions on DNA editing, gene expression, and protein function in PSC self-renewal and growth. Finally, we speculate on the principal use of gap junction subunit expression as relevant biomarkers of PSC fate. Improving bioreactor design and pertinent cell biomarker classification could vastly enhance manufactured stem cell yield and quality, thereby increasing the potency and safety of therapeutic cells to be used in regenerative medicine.

  7. Sunlight-induced killing of nondividing human cells in culture

    International Nuclear Information System (INIS)

    Nondividing populations of human diploid fibroblasts that are DNA excision repair proficient and repair deficient were exposed to mid-day summer sunlight and their survival determined based on their ability to remain attached to a culture vessel surface. Whereas mid- and far-UV wavelengths and sunlamp radiation cause a gradual degeneration and detachment of cells in a dose-dependent manner, sunlight does not promote cell killing in repair proficient cells. Detachment of repair deficient cells is promoted to a limited extent but only at sunlight exposure times that are low with respect to the amount of DNA damage induced. Repair proficient and deficient cells exposed to sunlight for longer times do not detach. Pyrimidine dimer levels in these sunlight irradiated cells were great enough to have promoted detachment had these levels been induced by UV (254 nm) alone. Other photodamage induced by these exposures evidently inhibits the dimer induced cell degeneration that leads to cell detachment. It was concluded that pyrimidine dimers are responsible for cell killing at short sunlight exposure times (80 min) cells are killed by a different mechanism. (author)

  8. Long-term Cultured Human Neural Stem Cells Undergo Spontaneous Transformation to Tumor-Initiating Cells

    Directory of Open Access Journals (Sweden)

    Weihua Wu, Qihua He, Xiaoxia Li, Xiaoyan Zhang, Aili Lu, Ruimin Ge, HongYing Zhen, Alfred E. Chang, Qiao Li, Li Shen

    2011-01-01

    Full Text Available In this report, we describe the spontaneous malignant transformation of long-term cultured human fetal striatum neural stem cells (hsNSCs, passage 17. After subcutaneous transplantation of long-term cultured hsNSCs into immunodeficient nude mice, 2 out of 15 mice formed xenografts which expressed neuroendocrine tumor markers CgA and NSE. T1 cells, a cell line that we derived from one of the two subcutaneous xenografts, have undergone continuous expansion in vitro. These T1 cells showed stem cell-like features and expressed neural stem cell markers nestin and CD133. The T1 cells were involved in abnormal karyotype, genomic instability and fast proliferation. Importantly, after long-term in vitro culture, the T1 cells did not result in subcutaneous xenografts, but induced intracranial tumor formation, indicating that they adjusted themselves to the intracranial microenvironment. We further found that the T1 cells exhibited an overexpressed level of EGFR, and the CD133 positive T1 cells showed a truncation mutation in the exons 2-7 of the EGFR (EGFRvIII gene. These results suggest that continuous expansion of neural stem cells in culture may lead to malignant spontaneous transformation. This phenomenon may be functionally related to EGFR by EGFRvIII gene mutation.

  9. Endothelial cells stimulate growth of normal and cancerous breast epithelial cells in 3D culture

    Directory of Open Access Journals (Sweden)

    Magnusson Magnus K

    2010-07-01

    Full Text Available Abstract Background Epithelial-stromal interaction provides regulatory signals that maintain correct histoarchitecture and homeostasis in the normal breast and facilitates tumor progression in breast cancer. However, research on the regulatory role of the endothelial component in the normal and malignant breast gland has largely been neglected. The aim of the study was to investigate the effects of endothelial cells on growth and differentiation of human breast epithelial cells in a three-dimensional (3D co-culture assay. Methods Breast luminal and myoepithelial cells and endothelial cells were isolated from reduction mammoplasties. Primary cells and established normal and malignant breast cell lines were embedded in reconstituted basement membrane in direct co-culture with endothelial cells and by separation of Transwell filters. Morphogenic and phenotypic profiles of co-cultures was evaluated by phase contrast microscopy, immunostaining and confocal microscopy. Results In co-culture, endothelial cells stimulate proliferation of both luminal- and myoepithelial cells. Furthermore, endothelial cells induce a subpopulation of luminal epithelial cells to form large acini/ducts with a large and clear lumen. Endothelial cells also stimulate growth and cloning efficiency of normal and malignant breast epithelial cell lines. Transwell and gradient co-culture studies show that endothelial derived effects are mediated - at least partially - by soluble factors. Conclusion Breast endothelial cells - beside their role in transporting nutrients and oxygen to tissues - are vital component of the epithelial microenvironment in the breast and provide proliferative signals to the normal and malignant breast epithelium. These growth promoting effects of endothelial cells should be taken into consideration in breast cancer biology.

  10. Co-culture with Sertoli cells promotes proliferation and migration of umbilical cord mesenchymal stem cells

    International Nuclear Information System (INIS)

    Highlights: ► Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). ► Presence of SCs dramatically increased proliferation and migration of UCMSCs. ► Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of “nurse” cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.

  11. Co-culture with Sertoli cells promotes proliferation and migration of umbilical cord mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Fenxi, E-mail: fxzhang0824@gmail.com [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Hong, Yan; Liang, Wenmei [Department of Histology and Embryology, Guiyang Medical University, Guizhou 550004, People' s Republic of China (China); Ren, Tongming [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Jing, Suhua [ICU Center, The Third Hospital of Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Lin, Juntang [Stem Cell Center, Xinxiang Medical University, Henan 453003, People' s Republic of China (China)

    2012-10-12

    Highlights: Black-Right-Pointing-Pointer Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). Black-Right-Pointing-Pointer Presence of SCs dramatically increased proliferation and migration of UCMSCs. Black-Right-Pointing-Pointer Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of 'nurse' cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.

  12. Calcium exchange, structure, and function in cultured adult myocardial cells

    International Nuclear Information System (INIS)

    Cells digested from adult rat heart and cultured for 14 days demonstrate all the structural elements, in mature form, associated with the process of excitation-contraction (EC) coupling. The transverse tubular (TT) system is well developed with an extensive junctional sarcoplasmic reticulum (JSR). In nonphosphate-containing buffer contraction of the cells is lost as rapidly as zero extracellular Ca concentration ([Ca]0) solution is applied and a negative contraction staircase is produced on increase of stimulation frequency. Structurally and functionally the cells have the characteristics of adult cells in situ. 45Ca exchange and total 45Ca measurement in N-2-hydroxyethylpiperazine N'-2-ethanesulfonic acid (HEPES)-buffered perfusate define three components of cellular Ca: 1) a rapidly exchangeable component accounting for 36% of total Ca, 2) a slowly exchangeable component (t/sub 1/2/ 53 min) accounting for 7% total Ca, and 3) the remaining 57% cellular Ca is inexchangeable (demonstrates no significant exchange within 60 min). The slowly exchangeable component can be increased 10-fold within 60 min by addition of phosphate to the perfusate. The Ca distribution and exchange characteristics are little different from those of 3-day cultures of neonatal rat heart previously studied. The results suggest that the cells are representative of adult cells in situ and that both sarcolemmal-bound and sarcoplasmic reticular Ca contribute to the component of Ca that is rapidly exchangeable

  13. Aquaporin-1 Expressed in Cultured Human Trabecular Meshwork Cells

    Institute of Scientific and Technical Information of China (English)

    Mingkai Lin; Jian Ge; Yehong Zhuo; Yuqing Lan; Keming Yu; Jianliang Zheng

    2002-01-01

    Objective:To determine if aquaporin-1 could be detected in cultures of human trabecularshwork cells. Methods: Using primers specific for aquaporin-1, reverse transcription combined withpolymerase chain reaction (RT-PCR) yielded a product and its size with total RNAprepared from the human trabecular meshwork cells. SDS-PAGE and immunoblottingwere also used in this study to detect the specific water channel.Results: The presence of this product and its size (298 base pairs) are consistent withthat of an aquaporin-1 message in these cells. A band of 28 kD in agreement with themolecular size of aquaporin-1 was showed in a film by immunoblotting.Conclusion: The presence of aquaporin-1 in human trabecular meshwork cells, thepredominant cell-type of the primary outflow region of the human eye, suggests that waterchannels may be involved in the movement of aqueous fluid out of the eye. In addition,the existence of aquaporin-1 on cultures of human trabecular meshwork cells provides anin vitro model to study the endogenous expression of aquaporin-1 and its possible role inthe regulation of aqueous outflow.

  14. Granulocyte plasma membrane damage by leukotoxic supernatant from Pasteurella haemolytica A1 and protection by immune serum.

    Science.gov (United States)

    Styrt, B; Walker, R D; White, J C; Dahl, L D; Baker, J C

    1990-01-01

    Bovine respiratory disease caused by Pasteurella haemolytica may be partially mediated by a leukotoxin secreted by the microorganism. We examined the effect of leukotoxic Pasteurella supernatants on leakage of the cytosol enzyme lactate dehydrogenase and the lysosomal enzyme arylsulfatase from bovine granulocytes. Lactate dehydrogenase release (94%) was much higher than arylsulfatase release (38%) over 30 minutes of incubation. The Pasteurella supernatants inhibited superoxide production by stimulated granulocytes at concentrations which also caused substantial cell death as measured by failure to exclude trypan blue. Both toxic effects were prevented by serum from aerosol-immunized calves, and protection appeared to be antibody-specific by comparison with fetal bovine serum or with serum absorbed against intact P. haemolytica. These findings suggest that the leukotoxin may selectively disrupt the granulocyte plasma membrane, and that antibody directed against a surface component of the microorganism is also capable of protecting against the leukotoxin effect. PMID:2306664

  15. Methyl Jasmonate Represses Growth and Affects Cell Cycle Progression in Cultured Taxus Cells

    OpenAIRE

    Patil, Rohan A.; Lenka, Sangram K.; Normanly, Jennifer; Walker, Elsbeth L.; Roberts, Susan C.

    2014-01-01

    Methyl jasmonate (MeJA) elicitation is an effective strategy to induce and enhance synthesis of the anticancer agent paclitaxel (Taxol®) in Taxus cell suspension cultures; however, concurrent decreases in growth are often observed, which is problematic for large scale bioprocessing. Here, increased accumulation of paclitaxel in Taxus cuspidata suspension cultures with MeJA elicitation was accompanied by a concomitant decrease in cell growth, evident within the first three days post-elicitatio...

  16. Effects of simulated microgravity on mouse Sertoli cells in culture

    Science.gov (United States)

    Angela, Masini Maria; Prato, Paola; Linda, Scarabelli; Lanza, Cristina; Palmero, Silvio; Pointis, Georges; Ricci, Franco; Strollo, Felice

    With the advent of space flights questions concerning the effects of microgravity (0xG) on hu-man reproduction physiology have got priority Spermatogenesis is a complex, highly ordered process of cell division and differentiation by which spermatogonial cells give rise to mature spermatozoa. Sertoli cells play a crucial role in the development of germ cells and the regulation of spermatogenesis. In this study the influence of 0xG on Sertoli cells was evaluated. A Sertoli cell line from mouse testis (42GPA9) was analyzed for cytoskeletal (using the 3D reconstruction generated from a stack of confocal images) and SHBG changes by immunohistochemistry, for antioxidant agents by RT-PCR and for culture medium lactate concentrations by wet chemistry. Cells were cultured for 6, 24 and 48 hrs on a three-dimensional Random Positioning Machine (3D-RPM); static controls (1xG) were positioned on the supporting frame. At the end of each experiment, cultured cells were either fixed in paraformaldehyde or RNA-extracted or used for culture medium lactate measurements as needed. At 0xG Sertoli cytoskeleton got disorganized, microtubules fragmented and SHBG undetectable already after 24 hrs, with alterations wors-ening further until 48 hrs; various antioxidant systems (SOD, GST, PARP, MTs) appreciably increased during the first 24 hrs but significantly decreased at 48 hrs. No changes occurred in 1xG samples. At least initially, 0xG seems to perturb antioxidant protection strategies allowing the testes to support sperm production, thus generating an aging-like state of oxidative stress. Lactate production at 0xG slightly decreased only after 24 hrs. Further experiments need to be carried out in space to investigate upon steroidogenesis and germ cell differentiation within the testis, to rule out eventually pending male infertility consequences, which would be a problem nowadays, when life expectancy increases and male fertility might become a social issue often extending into 60 years

  17. An introduction to plant cell culture: the future ahead.

    Science.gov (United States)

    Loyola-Vargas, Víctor M; Ochoa-Alejo, Neftalí

    2012-01-01

    Plant cell, tissue, and organ culture (PTC) techniques were developed and established as an experimental necessity for solving important fundamental questions in plant biology, but they currently represent very useful biotechnological tools for a series of important applications such as commercial micropropagation of different plant species, generation of disease-free plant materials, production of haploid and doublehaploid plants, induction of epigenetic or genetic variation for the isolation of variant plants, obtention of novel hybrid plants through the rescue of hybrid embryos or somatic cell fusion from intra- or intergeneric sources, conservation of valuable plant germplasm, and is the keystone for genetic engineering of plants to produce disease and pest resistant varieties, to engineer metabolic pathways with the aim of producing specific secondary metabolites or as an alternative for biopharming. Some other miscellaneous applications involve the utilization of in vitro cultures to test toxic compounds and the possibilities of removing them (bioremediation), interaction of root cultures with nematodes or mycorrhiza, or the use of shoot cultures to maintain plant viruses. With the increased worldwide demand for biofuels, it seems that PTC will certainly be fundamental for engineering different plants species in order to increase the diversity of biofuel options, lower the price marketing, and enhance the production efficiency. Several aspects and applications of PTC such as those mentioned above are the focus of this edition. PMID:22610615

  18. A modular suite of hardware enabling spaceflight cell culture research

    Science.gov (United States)

    Hoehn, Alexander; Klaus, David M.; Stodieck, Louis S.

    2004-01-01

    BioServe Space Technologies, a NASA Research Partnership Center (RPC), has developed and operated various middeck payloads launched on 23 shuttle missions since 1991 in support of commercial space biotechnology projects. Modular cell culture systems are contained within the Commercial Generic Bioprocessing Apparatus (CGBA) suite of flight-qualified hardware, compatible with Space Shuttle, SPACEHAB, Spacelab and International Space Station (ISS) EXPRESS Rack interfaces. As part of the CGBA family, the Isothermal Containment Module (ICM) incubator provides thermal control, data acquisition and experiment manipulation capabilities, including accelerometer launch detection for automated activation and thermal profiling for culture incubation and sample preservation. The ICM can accommodate up to 8 individually controlled temperature zones. Command and telemetry capabilities allow real-time downlink of data and video permitting remote payload operation and ground control synchronization. Individual cell culture experiments can be accommodated in a variety of devices ranging from 'microgravity test tubes' or standard 100 mm Petri dishes, to complex, fed-batch bioreactors with automated culture feeding, waste removal and multiple sample draws. Up to 3 levels of containment can be achieved for chemical fixative addition, and passive gas exchange can be provided through hydrophobic membranes. Many additional options exist for designing customized hardware depending on specific science requirements.

  19. Ultrafiltration and Characterization of AW-101 Supernatant and Entrained Solids

    International Nuclear Information System (INIS)

    The River Protection Project Waste Treatment Plant (RPP-WTP) (1996) flow sheet uses cross-flow filtration as the solid/liquid separation technique. Unlike traditional dead-end filtration, which has a declining rate caused by the growth of a filter cake on the surface of the filter medium, in cross-flow filtration, the filter cake is swept away by the fluid flowing across it. This filtration method is especially beneficial when there are very fine particles and when system simplicity is required. The objective of this work was to test cross-flow filtration using actual Envelope A Hanford tank waste. Similar to the Phase 1A study, they evaluated the permeability of an Envelope A feed through a single element filter as a function of transmembrane pressure, axial velocity, solids concentration, and time. In addition, the efficiency of back pulse and chemical cleaning on the filter performance was evaluated. The chemical and radiochemical composition of the filtrate and solids was measured to determine efficiency of the filtration process. This report describes the test apparatus, the experimental approach, the results of the tests, and the chemical and radiochemical analysis for supernatants taken from Hanford Tank AW-101. This report also provides a means of transmitting to British Nuclear Fuels, Limited (BNFL) the completed test instruction and raw filtration and analytical data

  20. Gene probes to detect cross-culture contamination in hormone producing cell lines

    DEFF Research Database (Denmark)

    Matsuba, I; Lernmark, A; Madsen, Ole Dragsbæk;

    1988-01-01

    Cross-culture contamination of cell lines propagated in continuous culture is a frequent event and particularly difficult to resolve in cells expressing similar phenotypes. We demonstrate that DNA-DNA hybridization to blotted endonuclease-digested cell DNA effectively detects cross-culture contam...... effective use of gene probes to control the origin of cell cultures.......Cross-culture contamination of cell lines propagated in continuous culture is a frequent event and particularly difficult to resolve in cells expressing similar phenotypes. We demonstrate that DNA-DNA hybridization to blotted endonuclease-digested cell DNA effectively detects cross......-culture contamination to monitor inter-species as well as intra-species cross contamination. An insulin-producing cell-line, Clone-16, originally cloned from a human fetal endocrine pancreatic cell line did not produce human c-peptide as anticipated. DNA from these cells showed no hybridization to the human ALU...

  1. Handbook of plant cell culture. Volume 2. Crop species

    Energy Technology Data Exchange (ETDEWEB)

    Sharp, W.R.; Evans, D.A.; Ammirato, P.V.; Yamada, Y. (eds.)

    1984-01-01

    In this volume the state-of-the-art plant cell culture techniques described in the first volume are applied to several agricultural and horticultural crops. In 21 chapters, they include maize, oats, wheat, beans, red clover and other forage legumes, asparagus, celery, cassava, sweet potato, banana, pawpaw, apple, grapes, conifers, date palm, rubber, sugarcane and tobacco. Each chapter contains (1) detailed protocols to serve as the foundation for current research, (2) a critical review of the literature, and (3) in-depth evaluations of the potential shown by plant cell culture for crop improvement. The history and economic importance of each crop are discussed. This volume also includes an essay, ''Oil from plants'', by M. Calvin.

  2. Gill cell culture systems as models for aquatic environmental monitoring.

    Science.gov (United States)

    Bury, Nic R; Schnell, Sabine; Hogstrand, Christer

    2014-03-01

    A vast number of chemicals require environmental safety assessments for market authorisation. To ensure acceptable water quality, effluents and natural waters are monitored for their potential harmful effects. Tests for market authorisation and environmental monitoring usually involve the use of large numbers of organisms and, for ethical, cost and logistic reasons, there is a drive to develop alternative methods that can predict toxicity to fish without the need to expose any animals. There is therefore a great interest in the potential to use cultured fish cells in chemical toxicity testing. This review summarises the advances made in the area and focuses in particular on a system of cultured fish gill cells grown into an epithelium that permits direct treatment with water samples. PMID:24574380

  3. Long-term Cultured Human Neural Stem Cells Undergo Spontaneous Transformation to Tumor-Initiating Cells

    OpenAIRE

    Weihua Wu, Qihua He, Xiaoxia Li, Xiaoyan Zhang, Aili Lu, Ruimin Ge, HongYing Zhen, Alfred E. Chang, Qiao Li, Li Shen

    2011-01-01

    In this report, we describe the spontaneous malignant transformation of long-term cultured human fetal striatum neural stem cells (hsNSCs, passage 17). After subcutaneous transplantation of long-term cultured hsNSCs into immunodeficient nude mice, 2 out of 15 mice formed xenografts which expressed neuroendocrine tumor markers CgA and NSE. T1 cells, a cell line that we derived from one of the two subcutaneous xenografts, have undergone continuous expansion in vitro. These T1 cells showed stem ...

  4. Ion-selective microelectrode arrays for cell culture monitoring

    OpenAIRE

    Generelli, Silvia; De Rooij, Nicolas-F.

    2008-01-01

    The design, microfabrication and characterization of a platform comprising an array of ion-selective microelectrodes (µISE) aimed at in vitro cellular physiology and toxicology is described. This study focusses on K+ and Ca2+ monitoring in cell culture environments. A potential promising application of such a platform is based on recent findings in molecular biology, revealing connections between certain diseases, as for example some types of cancer or parkinsonism, and a malfunction in cellu...

  5. Transparent, biocompatible nanostructured surfaces for cancer cell capture and culture

    Directory of Open Access Journals (Sweden)

    Cheng BR

    2014-05-01

    Full Text Available Boran Cheng,1,* Zhaobo He,2,* Libo Zhao,2,* Yuan Fang,1 Yuanyuan Chen,1 Rongxiang He,2 Fangfang Chen,1 Haibin Song,1 Yuliang Deng,2 Xingzhong Zhao,2 Bin Xiong1 1Department of Oncology, Zhongnan Hospital of Wuhan University, Hubei Key Laboratory of Tumor Biological Behaviors, Hubei Cancer Clinical Study Center, Wuhan, Hubei, People’s Republic of China; 2Key Laboratory of Artificial Micro- and Nano-Structures of Ministry of Education, School of Physics and Technology, Wuhan University, Wuhan, Hubei, People’s Republic of China *These authors contributed equally to this work Abstract: Circulating tumor cells (CTCs in the blood which have detached from both the primary tumor and any metastases may be considered as a “liquid biopsy” and are expected to replace tumor biopsies in the monitoring of treatment response and determining patient prognosis. Here, we introduce a facile and efficient CTC detection material made of hydroxyapatite/chitosan (HA/CTS, which is beneficial because of its transparency and excellent biological compatibility. Atomic force microscopy images show that the roughness of the HA/CTS nanofilm (HA/CTSNF substrates can be controlled by changing the HA:CTS ratio. Enhanced local topographic interactions between nano-components on cancer cell membranes, and the antibody coated nanostructured substrate lead to improved CTC capture and separation. This remarkable nanostructured substrate has the potential for CTC culture in situ and merits further analysis. CTCs captured from artificial blood samples were observed in culture on HA/CTSNF substrates over a period of 14 days by using conventional staining methods (hematoxylin eosin and Wright’s stain. We conclude that these substrates are multifunctional materials capable of isolating and culturing CTCs for subsequent studies. Keywords: cell capture, cell culture, nanofilms, hydroxyapatite/chitosan

  6. Autoradiographic investigations on cell shape-mediated growth regulation of lens epithelial cells in culture

    International Nuclear Information System (INIS)

    An autoradiographic method is described which is well suited for the determination of the labelling index in flattened as well as rounded cells. Using this method DNA synthesis of lens epithelial cells in culture was found to be dependent on cell attachment, cell flattening and intact microfilaments. Thus previous results on cell shape-mediated growth regulation could be confirmed. Moreover, considering the labelling index it was possible to conclude that cell rounding or a disintegration of microfilaments did not impair ongoing DNA synthesis but did prevent cells from entering the S-phase of the cycle. (author)

  7. Propagation and isolation of ranaviruses in cell culture

    DEFF Research Database (Denmark)

    Ariel, Ellen; Nicolajsen, Nicole; Christophersen, Maj-Britt;

    2009-01-01

    The optimal in vitro propagation procedure for a panel of ranavirus isolates and the best method for isolation of Epizootic haematopoietic necrosis virus (EHNV) from organ material in cell-culture were investigated. The panel of ranavirus isolates included: Frog virus 3 (FV3), Bohle iridovirus (BIV......), Pike-perch iridovirus (PPIV), European catfish virus (ECV), European sheatfish virus (ESV), EHNV, Doctor fish virus (DFV), Guppy virus 6 (GF6), short-finned eel virus (SERV) and Rana esculenta virus Italy 282/102 (REV 282/102). Each isolate was titrated in five cell lines: bluegill fry (BF-2...

  8. [Inhibition of adenovirus reproduction in cell culture by specific antibodies].

    Science.gov (United States)

    Povnytsia, O Iu; Nosach, L M; Zhovnovata, V L; Zahorodnia, S D; Vantsak, N P; Tokarchuk, L V; Polishchuk, O M; Diachenko, N S

    2009-01-01

    The capacity of specific antibodies to inhibit the reproduction of homo- and heterologous adenoviruses in Hela cell added to culture medium after virus adsorption was studied. The inhibiting effect of polyclonal antivirus and monospecific antihexone antibodies to homo- and heterologous adenoviruses was shown. The effect was more expressed when using antibodies to homologous antibodies. The intensity of inhibition depended on antibodies concentration in the medium and infecting dose of the virus. Essential reduction of the quantity of infected cells and a decrease of the titer of adenovirus synthesized in the presence of homo- and heterologous antibodies was shown but adenovirus reproduction was not inhibited completely. PMID:19663330

  9. In Vitro Cell Culture Infectivity Assay for Human Noroviruses

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Honer Zu Bentrup, Kerstin A.; Orosz Coghlan, Patricia A.; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza; Nickerson, Cheryl A.

    2007-01-30

    Human noroviruses (NoV) cause severe, self-limiting gastroenteritis that typically lasts 24 - 48 hours. The true nature of NoV pathogenesis remains unknown due to the lack of suitable tissue culture or animal models. Here we show, for the first time, that NoV can infect and replicate in an organoid, three-dimensional (3-D) model of human small intestinal epithelium (INT-407). Cellular differentiation for this model was achieved by growing the cells in 3-D on porous collagen I-coated microcarrier beads under conditions of physiological fluid shear in rotating wall vessel bioreactors. Microscopy, PCR, and fluorescent in-situ hybridization were employed to provide evidence of NoV infection. CPE and norovirus RNA was detected at each of the five cell passages for both genogroup I and II viruses. Our results demonstrate that the highly differentiated 3-D cell culture model can support the natural growth of human noroviruses, whereas previous attempts using differentiated monolayer cultures failed.

  10. A Three-Dimensional Cell Culture Model To Study Enterovirus Infection of Polarized Intestinal Epithelial Cells.

    Science.gov (United States)

    Drummond, Coyne G; Nickerson, Cheryl A; Coyne, Carolyn B

    2016-01-01

    Despite serving as the primary entry portal for coxsackievirus B (CVB), little is known about CVB infection of the intestinal epithelium, owing at least in part to the lack of suitable in vivo models and the inability of cultured cells to recapitulate the complexity and structure associated with the gastrointestinal (GI) tract. Here, we report on the development of a three-dimensional (3-D) organotypic cell culture model of Caco-2 cells to model CVB infection of the gastrointestinal epithelium. We show that Caco-2 cells grown in 3-D using the rotating wall vessel (RWV) bioreactor recapitulate many of the properties of the intestinal epithelium, including the formation of well-developed tight junctions, apical-basolateral polarity, brush borders, and multicellular complexity. In addition, transcriptome analyses using transcriptome sequencing (RNA-Seq) revealed the induction of a number of genes associated with intestinal epithelial differentiation and/or intestinal processes in vivo when Caco-2 cells were cultured in 3-D. Applying this model to CVB infection, we found that although the levels of intracellular virus production were similar in two-dimensional (2-D) and 3-D Caco-2 cell cultures, the release of infectious CVB was enhanced in 3-D cultures at early stages of infection. Unlike CVB, the replication of poliovirus (PV) was significantly reduced in 3-D Caco-2 cell cultures. Collectively, our studies show that Caco-2 cells grown in 3-D using the RWV bioreactor provide a cell culture model that structurally and transcriptionally represents key aspects of cells in the human GI tract and can thus be used to expand our understanding of enterovirus-host interactions in intestinal epithelial cells. IMPORTANCE Coxsackievirus B (CVB), a member of the enterovirus family of RNA viruses, is associated with meningitis, pericarditis, diabetes, dilated cardiomyopathy, and myocarditis, among other pathologies. CVB is transmitted via the fecal-oral route and encounters the

  11. A Three-Dimensional Cell Culture Model To Study Enterovirus Infection of Polarized Intestinal Epithelial Cells

    Science.gov (United States)

    Drummond, Coyne G.

    2015-01-01

    ABSTRACT Despite serving as the primary entry portal for coxsackievirus B (CVB), little is known about CVB infection of the intestinal epithelium, owing at least in part to the lack of suitable in vivo models and the inability of cultured cells to recapitulate the complexity and structure associated with the gastrointestinal (GI) tract. Here, we report on the development of a three-dimensional (3-D) organotypic cell culture model of Caco-2 cells to model CVB infection of the gastrointestinal epithelium. We show that Caco-2 cells grown in 3-D using the rotating wall vessel (RWV) bioreactor recapitulate many of the properties of the intestinal epithelium, including the formation of well-developed tight junctions, apical-basolateral polarity, brush borders, and multicellular complexity. In addition, transcriptome analyses using transcriptome sequencing (RNA-Seq) revealed the induction of a number of genes associated with intestinal epithelial differentiation and/or intestinal processes in vivo when Caco-2 cells were cultured in 3-D. Applying this model to CVB infection, we found that although the levels of intracellular virus production were similar in two-dimensional (2-D) and 3-D Caco-2 cell cultures, the release of infectious CVB was enhanced in 3-D cultures at early stages of infection. Unlike CVB, the replication of poliovirus (PV) was significantly reduced in 3-D Caco-2 cell cultures. Collectively, our studies show that Caco-2 cells grown in 3-D using the RWV bioreactor provide a cell culture model that structurally and transcriptionally represents key aspects of cells in the human GI tract and can thus be used to expand our understanding of enterovirus-host interactions in intestinal epithelial cells. IMPORTANCE Coxsackievirus B (CVB), a member of the enterovirus family of RNA viruses, is associated with meningitis, pericarditis, diabetes, dilated cardiomyopathy, and myocarditis, among other pathologies. CVB is transmitted via the fecal-oral route and

  12. Ethanolamine metabolism in cultured bovine aortic endothelial cells

    International Nuclear Information System (INIS)

    The role of extracellular ethanolamine in phospholipid synthesis was examined in cultured bovine aortic endothelial cells. Serine and ethanolamine were both readily accumulated by these cells and incorporated into phospholipid. Exposing cells to extracellular ethanolamine for 4-6 weeks had no effect on cell growth, yet increased the phosphatidylethanolamine content of these cells by 31% as compared to control cells. The intracellular content of ethanolamine was measured by high performance liquid chromatography, and results showed that the ethanolamine-treated cells contained a significantly greater amount of free ethanolamine compared to control cells. Ethanolamine-treated cells also had decreased accumulation and incorporation into lipid of [3H]ethanolamine throughout a 48-h incubation and increased K'm and V'max parameters of ethanolamine transport as compared to control cells. Studies were also done to examine the effect of ethanolamine on the generation of free ethanolamine from phosphatidylserine. In pulse-chase experiments with [3H]serine, a physiological concentration of ethanolamine decreased the amount of 3H-labeled phosphatidylethanolamine produced from 3H-labeled phosphatidylserine by 12 h as compared to the amount of 3H-labeled phosphatidyl-ethanolamine produced in the absence of ethanolamine in the chase incubation. Furthermore, ethanolamine-treated cells accumulated 20% less labeled ethanolamine in the aqueous pool from [3H]serine after 24 h of incubation than did control cells. These results can be explained by isotope dilution with the ethanolamine pool that accumulates in these cells with time when exposed to media supplemented with a physiological concentration of ethanolamine and by an effect of ethanolamine on ethanolamine generation from phosphatidylserine

  13. Renal mesangial cell cultures as a model for study of erythropoietin production.

    OpenAIRE

    Kurtz, Armin; Jelkmann, W; Sinowatz, F.; Bauer, Christian

    1983-01-01

    Mesangial cells derived from isolated glomeruli of rat kidney were grown as homogeneous cell lines in culture. They released, into the culture medium, erythropoietin that had free terminal galactosyl residues and was therefore not active in vivo. The production of erythropoietin by these cells was significantly enhanced by either lowering the PO2 in the incubation atmosphere or by adding cobalt chloride to the culture medium. Therefore, mesangial cells in culture may be considered as an in vi...

  14. An Assessment of Cell Culture Plate Surface Chemistry for in Vitro Studies of Tissue Engineering Scaffolds

    OpenAIRE

    Alexander Röder; Elena García-Gareta; Christina Theodoropoulos; Nikola Ristovski; Keith A. Blackwood; Woodruff, Maria A.

    2015-01-01

    The use of biopolymers as a three dimensional (3D) support structure for cell growth is a leading tissue engineering approach in regenerative medicine. Achieving consistent cell seeding and uniform cell distribution throughout 3D scaffold culture in vitro is an ongoing challenge. Traditionally, 3D scaffolds are cultured within tissue culture plates to enable reproducible cell seeding and ease of culture media change. In this study, we compared two different well-plates with different surface ...

  15. THE STUDY OF VIRUSES REPRODUCTION IN CELL CULTURES BY THE METHOD OF MATHEMATICAL MODELING

    OpenAIRE

    N. A. Kontarov; S. A. Grishunina; N. V. Balaev; N. V. Yuminova; V. V. Zverev

    2014-01-01

    Abstract. In the study the mathematical analysis of viruses reproduction in cell culture using the Marchuk’ mathematical model to predict  reproduction of virus in one or another cell cultures has been conducted. The obtained theoretical results are corresponded to the experimental data on reproduction of rubella virus in cell cultures RK-13 and BHK-21. The sum of theoretical and experimental results can be used to select the optimal cell cultures for virus cumulation.

  16. Benchmarking of commercially available CHO cell culture media for antibody production

    OpenAIRE

    Reinhart, David; Damjanovic, Lukas; Kaisermayer, Christian; Kunert, Renate

    2015-01-01

    In this study, eight commercially available, chemically defined Chinese hamster ovary (CHO) cell culture media from different vendors were evaluated in batch culture using an IgG-producing CHO DG44 cell line as a model. Medium adaptation revealed that the occurrence of even small aggregates might be a good indicator of cell growth performance in subsequent high cell density cultures. Batch experiments confirmed that the culture medium has a significant impact on bioprocess performance, but hi...

  17. Pigment Cell Differentiation in Sea Urchin Blastula-Derived Primary Cell Cultures

    OpenAIRE

    Natalya V. Ageenko; Konstantin V. Kiselev; Dmitrenok, Pavel S.; Odintsova, Nelly A.

    2014-01-01

    The quinone pigments of sea urchins, specifically echinochrome and spinochromes, are known for their effective antioxidant, antibacterial, antifungal, and antitumor activities. We developed in vitro technology for inducing pigment differentiation in cell culture. The intensification of the pigment differentiation was accompanied by a simultaneous decrease in cell proliferation. The number of pigment cells was two-fold higher in the cells cultivated in the coelomic fluids of injured sea urchin...

  18. Cryopreservation of primary cell cultures of marine invertebrates.

    Science.gov (United States)

    Odintsova, N; Kiselev, K; Sanina, N; Kostetsky, E

    2001-01-01

    Primary cell cultures obtained from somatic and larval tissues of bivalve molluscs and from embryos of sea urchins were frozen to -196 degrees C by two-step freezing using 10% dimethyl sulfoxide (DMSO) or/and trehalose (3-30 mg/ml) as cryoprotectants. We estimated both cell viability and the RNA synthetic activity after freeze-thaw. Total lipid extracts from the tissues of echinoderms examined as possible cryoprotective agents demonstrated a weak cryoprotective capacity. Mussel lipid extract was found to possess a considerable cryoprotective activity. Cryoprotective capacity of tested lipids correlated with their thermotropic behaviour. DMSO + trehalose combination was shown to be a favourable cryoprotectant and sea urchin blastula cells the most freezing-tolerant cells. PMID:11788872

  19. Flow field measurements in the cell culture unit

    Science.gov (United States)

    Walker, Stephen; Wilder, Mike; Dimanlig, Arsenio; Jagger, Justin; Searby, Nancy

    2002-01-01

    The cell culture unit (CCU) is being designed to support cell growth for long-duration life science experiments on the International Space Station (ISS). The CCU is a perfused loop system that provides a fluid environment for controlled cell growth experiments within cell specimen chambers (CSCs), and is intended to accommodate diverse cell specimen types. Many of the functional requirements depend on the fluid flow field within the CSC (e.g., feeding and gas management). A design goal of the CCU is to match, within experimental limits, all environmental conditions, other than the effects of gravity on the cells, whether the hardware is in microgravity ( micro g), normal Earth gravity, or up to 2g on the ISS centrifuge. In order to achieve this goal, two steps are being taken. The first step is to characterize the environmental conditions of current 1g cell biology experiments being performed in laboratories using ground-based hardware. The second step is to ensure that the design of the CCU allows the fluid flow conditions found in 1g to be replicated from microgravity up to 2g. The techniques that are being used to take these steps include flow visualization, particle image velocimetry (PIV), and computational fluid dynamics (CFD). Flow visualization using the injection of dye has been used to gain a global perspective of the characteristics of the CSC flow field. To characterize laboratory cell culture conditions, PIV is being used to determine the flow field parameters of cell suspension cultures grown in Erlenmeyer flasks on orbital shakers. These measured parameters will be compared to PIV measurements in the CSCs to ensure that the flow field that cells encounter in CSCs is within the bounds determined for typical laboratory experiments. Using CFD, a detailed simulation is being developed to predict the flow field within the CSC for a wide variety of flow conditions, including microgravity environments. Results from all these measurements and analyses of the

  20. Medium for development of bee cell cultures (Apis mellifera: Hymenoptera: Apidae)

    Science.gov (United States)

    A bee cell culture system was developed. A medium, WH2, for the production of cell cultures from hymenopteran species such as honey bee, Apis mellifera L. (Hymenoptera: Apidae) was developed. Multiple bee cell cultures were produced when using bee larvae and pupae as starting material and the modif...

  1. Culture of porcine hepatocytes or bile duct epithelial cells by inductive serum-free media

    Science.gov (United States)

    A serum-free, feeder-cell-dependent, selective culture system for the long-term culture of porcine hepatocytes or cholangiocytes was developed. Liver cells were isolated from 1 wk old pigs or young adult pigs (25 and 63 kg live weight) and were placed in primary culture on feeder-cell layers of mit...

  2. Simultaneous quantification of intracellular and secreted active and inactive glucagon-like peptide-1 from cultured cells.

    Science.gov (United States)

    Amao, Michiko; Kitahara, Yoshiro; Tokunaga, Ayaka; Shimbo, Kazutaka; Eto, Yuzuru; Yamada, Naoyuki

    2015-03-01

    Glucagon-like peptide-1 (GLP-1) is an incretin peptide that regulates islet hormone secretion. During recent years, incretin-based therapies have been widely used for patients with type 2 diabetes. GLP-1 peptides undergo N- and C-terminal processing for gain or loss of functions. We developed a method to quantify picomolar quantities of intact GLP-1 peptides using liquid chromatography-tandem mass spectrometry (LC-MS/MS). By employing this label-free selected reaction monitoring (SRM) method, we were able to analyze secreted GLP-1(1-37), GLP-1(7-37), and GLP-1(7-36 amid from human enteroendocrine NCI-H716 cells after stimulation with nateglinide, glucose, and sucralose. The absolute total concentrations of secreted GLP-1 peptides at baseline and after stimulation with nateglinide, glucose, and sucralose were 167.3, 498.9, 238.3, and 143.1 pM, respectively. Meanwhile, the ratios of GLP-1(1-37), GLP-1(7-37), and GLP-1(7-36 amide) to total GLP-1 peptides were similar (6 ± 3, 26 ± 3, and 78 ± 5%, respectively). The SRM assay can analyze the concentrations of individual GLP-1 peptides and, therefore, is a tool to investigate the physiological roles of GLP-1 peptides. Furthermore, the molecular species secreted from NCI-H716 cells were unknown. Therefore, we performed a secretopeptidome analysis of supernatants collected from cultured NCI-H716 cells. Together with GLP-1 peptides, we detected neuroendocrine convertase 1, which regulates peptide hormones released from intestinal endocrine L-cells. PMID:25461479

  3. Human alveolar epithelial type II cells in primary culture.

    Science.gov (United States)

    Mao, Pu; Wu, Songling; Li, Jianchun; Fu, Wei; He, Weiqun; Liu, Xiaoqing; Slutsky, Arthur S; Zhang, Haibo; Li, Yimin

    2015-02-01

    Alveolar epithelial type II (AEII) cells are a key structure and defender in the lung but also are the targets in many lung diseases, including acute respiratory distress syndrome, ventilator-induced lung injury, and pulmonary fibrosis. We sought to establish an optimized method for high yielding and long maintenance of characteristics of primary human AEII cells to facilitate the investigation of the mechanisms of lung diseases at the cellular and molecular levels. Adult human peripheral normal lung tissues of oncologic patients undergoing lung resection were collected. The AEII cells were isolated and identified by the expression of pro-surfactant protein (SP)C, epithelial sodium channel (αENaC) and cytokeratin (CK)-8, the lamellar bodies specific for AEII cells, and confirmed by the histology using electron microscopy. The phenotype of AEII cells was characterized by the expression of surfactant proteins (SP-A, SP-B, SP-C, SP-D), CK-8, KL-6, αENaC, and aquaporin (AQP)-3, which was maintained over 20 days. The biological activity of the primary human AEII cells producing SP-C, cytokines, and intercellular adhesion molecule-1 was vigorous in response to stimulation with tumor necrosis factor-α. We have modified previous methods and optimized a method for isolation of high purity and long maintenance of the human AEII cell phenotype in primary culture. This method provides an important tool for studies aiming at elucidating the molecular mechanisms of lung diseases exclusively in AEII cells. PMID:25677546

  4. Discarded human fetal tissue and cell cultures for transplantation research

    International Nuclear Information System (INIS)

    A feasibility study has been performed to explore the utility of various tissues from discarded human abortuses for transplantation and related research. Specifically, aborted fetuses plus parental blood samples and all relevant clinical data were obtained through a local hospital complex. Whenever possible, pancreas, skin and skeletal muscle, heart, liver, kidney, cartilage and lung tissues were removed, dissociated and subfractionated for cryopreservation, characterization and cultivation trials in vitro. Existing protocols for these manipulations were compared and improved upon as required. Clonal culture, cell aggregate maintenance techniques and use of feeder cell populations have been utilized where appropriate to develop quantitative comparative data. Histological and biochemical assays were applied both to evaluate separation/cultivation methods and to identify optimal culture conditions for maintaining functional cells. Immunochemical and molecular biological procedures were applied to study expression of Major Histocompatibility Vomplex (MHC) class 1 and 11 molecules on cell lines derived. Tissue and cell culture populations were examined for infections with bacteria, ftingi, mycoplasma, HIV, CMV, hepatitis B and other viruses. Only 1% of the abortuses tested were virally infected. Cytogenetic analyses confin-ned the normal diploid status in the vast majority (>98%) of lines tested. A total of over 250 abortuses have been obtained and processed. Only 25 were found to be contaminated with bacteria or fungi and unsuitable for further cultivation trials. A total of over 200 cell populations were isolated, characterized and cryopreserved for further study. Included were kidney, lung, liver and epidermal epithelia: cartilage-derived cells from the spine and epiphyses plus myogenic myoblasts. Selected lines have been immortalized using HPV I 6E6/E7 sequences. Epithelia from the liver and pancreas and cardiac myocytes were the most problematic in that initial

  5. Establishment of automated culture system for murine induced pluripotent stem cells

    Directory of Open Access Journals (Sweden)

    Koike Hiroyuki

    2012-11-01

    Full Text Available Abstract Background Induced pluripotent stem (iPS cells can differentiate into any cell type, which makes them an attractive resource in fields such as regenerative medicine, drug screening, or in vitro toxicology. The most important prerequisite for these industrial applications is stable supply and uniform quality of iPS cells. Variation in quality largely results from differences in handling skills between operators in laboratories. To minimize these differences, establishment of an automated iPS cell culture system is necessary. Results We developed a standardized mouse iPS cell maintenance culture, using an automated cell culture system housed in a CO2 incubator commonly used in many laboratories. The iPS cells propagated in a chamber uniquely designed for automated culture and showed specific colony morphology, as for manual culture. A cell detachment device in the system passaged iPS cells automatically by dispersing colonies to single cells. In addition, iPS cells were passaged without any change in colony morphology or expression of undifferentiated stem cell markers during the 4 weeks of automated culture. Conclusions Our results show that use of this compact, automated cell culture system facilitates stable iPS cell culture without obvious effects on iPS cell pluripotency or colony-forming ability. The feasibility of iPS cell culture automation may greatly facilitate the use of this versatile cell source for a variety of biomedical applications.

  6. Cell Culture in Microgravity: Opening the Door to Space Cell Biology

    Science.gov (United States)

    Pellis, Neal R.; Dawson, David L. (Technical Monitor)

    1999-01-01

    Adaptational response of human cell populations to microgravity is investigated using simulation, short-term Shuttle experiments, and long-term microgravity. Simulation consists of a clinostatically-rotated cell culture system. The system is a horizontally-rotated cylinder completely filled with culture medium. Low speed rotation results in continuous-fall of the cells through the fluid medium. In this setting, cells: 1) aggregate, 2) propagate in three dimensions, 3) synthesize matrix, 4) differentiate, and 5) form sinusoids that facilitate mass transfer. Space cell culture is conducted in flight bioreactors and in static incubators. Cells grown in microgravity are: bovine cartilage, promyelocytic leukemia, kidney proximal tubule cells, adrenal medulla, breast and colon cancer, and endothelium. Cells were cultured in space to test specific hypotheses. Cartilage cells were used to determine structural differences in cartilage grown in space compared to ground-based bioreactors. Results from a 130-day experiment on Mir revealed that cartilage grown in space was substantially more compressible due to insufficient glycosaminoglycan in the matrix. Interestingly, earth-grown cartilage conformed better to the dimensions of the scaffolding material, while the Mir specimens were spherical. The other cell populations are currently being analyzed for cell surface properties, gene expression, and differentiation. Results suggest that some cells spontaneously differentiate in microgravity. Additionally, vast changes in gene expression may occur in response to microgravity. In conclusion, the transition to microgravity may constitute a physical perturbation in cells resulting in unique gene expressions, the consequences of which may be useful in tissue engineering, disease modeling, and space cell biology.

  7. Digital microfluidics for automated hanging drop cell spheroid culture.

    Science.gov (United States)

    Aijian, Andrew P; Garrell, Robin L

    2015-06-01

    Cell spheroids are multicellular aggregates, grown in vitro, that mimic the three-dimensional morphology of physiological tissues. Although there are numerous benefits to using spheroids in cell-based assays, the adoption of spheroids in routine biomedical research has been limited, in part, by the tedious workflow associated with spheroid formation and analysis. Here we describe a digital microfluidic platform that has been developed to automate liquid-handling protocols for the formation, maintenance, and analysis of multicellular spheroids in hanging drop culture. We show that droplets of liquid can be added to and extracted from through-holes, or "wells," and fabricated in the bottom plate of a digital microfluidic device, enabling the formation and assaying of hanging drops. Using this digital microfluidic platform, spheroids of mouse mesenchymal stem cells were formed and maintained in situ for 72 h, exhibiting good viability (>90%) and size uniformity (% coefficient of variation digital microfluidic platform provides a viable tool for automating cell spheroid culture and analysis. PMID:25510471

  8. Effects of methyl isocyanate on rat muscle cells in culture.

    Science.gov (United States)

    Anderson, D; Goyle, S; Phillips, B J; Tee, A; Beech, L; Butler, W H

    1988-04-01

    Since the Bhopal disaster, in which the causal agent was methyl isocyanate (MIC), exposed people have complained of various disorders including neuromuscular dysfunction. In an attempt to gain some information about the response of muscle tissue to MIC its effects were investigated in cells in culture isolated from muscle of 2 day old rats. After treatment with a range of MIC concentrations (0.025-0.5 microliter/5 ml culture) the total number of nuclei of the two main cell types (fibroblasts and myoblasts) and the number of nuclei in muscle fibres (myotubes) were recorded. At lower doses which had little effect on the total number of nuclei, the formation of muscle fibres--that is, fusion of muscle cells--was prevented as the proportion of nuclei in myotubes was decreased. At higher doses both cell types were killed. This would suggest either an effect on muscle differentiation or a selective toxicity towards myoblasts. The observations were supported by light and electron microscopy. PMID:3378004

  9. Thymic epithelial cells. I. Expression of strong suppressive (veto) activity in mouse thymic epithelial cell cultures

    DEFF Research Database (Denmark)

    Claesson, Mogens Helweg; Ropke, C

    1990-01-01

    We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level. It is...... concluded that the epithelial stromal cells of the thymus, by acting as veto cells, may be responsible for the negative intrathymic selection of self-reactive thymocytes leading to elimination of the vast majority of immature thymic lymphocytes....

  10. Cultured stem cells are sensitive to gravity changes

    Science.gov (United States)

    Buravkova, L. B.; Romanov, Yu. A.; Konstantinova, N. A.; Buravkov, S. V.; Gershovich, Yu. G.; Grivennikov, I. A.

    2008-09-01

    Stem and precursor cells play an important role in development and regeneration. The state of these cells is regulated by biochemical substances, mechanical stimuli and cellular interactions. To estimate gravity effects we used two types of cultured stem cells: human mesenchymal stromal cells (hMSCs) from bone marrow and mice embryonic stem (mESC) line R1. Gravity changes were simulated by long-term (4-7 days) slow clinorotation and leaded to decreased hMSC proliferation, changes of cell morphology and modified F-actin cytoskeleton. We did not find the shifts in cell phenotype except for decreased expression of HLA 1 and CD105 but excretion of IL-6 into medium increased significantly. Remodeling of cytoskeleton started after first 4 h and was similar to preapoptotic changes. This data suggested the modification in cell adhesion and possible commitment of hMSC. It was observed that expression of alkaline phosphatase by MSC in osteogenic medium was more intensive in control. On the contrary, clinorotation did not change formation of mESC colonies and increased proliferation activity in LIF+-medium. However, the number of embryonic bodies after clinorotation was less than in static control. It is suggested that ESCs kept the viability and proliferative potential but decreased the differentiation ability after changes in gravity stimulation.

  11. Glycosylation-mediated phenylpropanoid partitioning in Populus tremuloides cell cultures

    Directory of Open Access Journals (Sweden)

    Babst Benjamin A

    2009-12-01

    Full Text Available Abstract Background Phenylpropanoid-derived phenolic glycosides (PGs and condensed tannins (CTs comprise large, multi-purpose non-structural carbon sinks in Populus. A negative correlation between PG and CT concentrations has been observed in several studies. However, the molecular mechanism underlying the relationship is not known. Results Populus cell cultures produce CTs but not PGs under normal conditions. Feeding salicyl alcohol resulted in accumulation of salicins, the simplest PG, in the cells, but not higher-order PGs. Salicin accrual reflected the stimulation of a glycosylation response which altered a number of metabolic activities. We utilized this suspension cell feeding system as a model for analyzing the possible role of glycosylation in regulating the metabolic competition between PG formation, CT synthesis and growth. Cells accumulated salicins in a dose-dependent manner following salicyl alcohol feeding. Higher feeding levels led to a decrease in cellular CT concentrations (at 5 or 10 mM, and a negative effect on cell growth (at 10 mM. The competition between salicin and CT formation was reciprocal, and depended on the metabolic status of the cells. We analyzed gene expression changes between controls and cells fed with 5 mM salicyl alcohol for 48 hr, a time point when salicin accumulation was near maximum and CT synthesis was reduced, with no effect on growth. Several stress-responsive genes were up-regulated, suggestive of a general stress response in the fed cells. Salicyl alcohol feeding also induced expression of genes associated with sucrose catabolism, glycolysis and the Krebs cycle. Transcript levels of phenylalanine ammonia lyase and most of the flavonoid pathway genes were reduced, consistent with down-regulated CT synthesis. Conclusions Exogenous salicyl alcohol was readily glycosylated in Populus cell cultures, a process that altered sugar utilization and phenolic partitioning in the cells. Using this system, we

  12. In vitro cell culture lethal dose submitted to gamma radiation

    International Nuclear Information System (INIS)

    The present study was designed to evaluate the in vitro effect of gamma radiation in cell culture of mouse connective tissue exposed to different doses of gamma radiation and under several conditions. The cell viability was analyzed by neutral red uptake methodology. This assay was developed for establish a methodology to be used in the future in the study of resveratrol radioprotection. Resveratrol (3,4',5- trihydroxystilbene), a phenolic phytoalexin that occurs naturally in some spermatophytes, such as grapevines, in response to injury as fungal infections and exposure to ultraviolet light. In the wines this compound is found at high levels and is considered one of the highest antioxidant constituents. The intense antioxidant potential of resveratrol provides many pharmacological activities including cardioprotection, chemoprevention and anti-tumor effects. Our results demonstrated that 60Co gamma radiation lethal dose (LD50) on NCTC clone 929 cells was about 340Gy. (author)

  13. Ribavirin Inhibits Parrot Bornavirus 4 Replication in Cell Culture.

    Science.gov (United States)

    Musser, Jeffrey M B; Heatley, J Jill; Koinis, Anastasia V; Suchodolski, Paulette F; Guo, Jianhua; Escandon, Paulina; Tizard, Ian R

    2015-01-01

    Parrot bornavirus 4 is an etiological agent of proventricular dilatation disease, a fatal neurologic and gastrointestinal disease of psittacines and other birds. We tested the ability of ribavirin, an antiviral nucleoside analog with antiviral activity against a range of RNA and DNA viruses, to inhibit parrot bornavirus 4 replication in duck embryonic fibroblast cells. Two analytical methods that evaluate different products of viral replication, indirect immunocytochemistry for viral specific nucleoprotein and qRT-PCR for viral specific phosphoprotein gene mRNA, were used. Ribavirin at concentrations between 2.5 and 25 μg/mL inhibited parrot bornavirus 4 replication, decreasing viral mRNA and viral protein load, in infected duck embryonic fibroblast cells. The addition of guanosine diminished the antiviral activity of ribavirin suggesting that one possible mechanism of action against parrot bornavirus 4 may likely be through inosine monophosphate dehydrogenase inhibition. This study demonstrates parrot bornavirus 4 susceptibility to ribavirin in cell culture. PMID:26222794

  14. In vitro cell culture lethal dose submitted to gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Moreno, Carolina S.; Rogero, Sizue O.; Rogero, Jose Roberto [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)], e-mail: carolina_sm@hotmail.com; Ikeda, Tamiko I.; Cruz, Aurea S. [Instituto Adolfo Lutz, Sao Paulo, SP (Brazil)

    2009-07-01

    The present study was designed to evaluate the in vitro effect of gamma radiation in cell culture of mouse connective tissue exposed to different doses of gamma radiation and under several conditions. The cell viability was analyzed by neutral red uptake methodology. This assay was developed for establish a methodology to be used in the future in the study of resveratrol radioprotection. Resveratrol (3,4',5- trihydroxystilbene), a phenolic phytoalexin that occurs naturally in some spermatophytes, such as grapevines, in response to injury as fungal infections and exposure to ultraviolet light. In the wines this compound is found at high levels and is considered one of the highest antioxidant constituents. The intense antioxidant potential of resveratrol provides many pharmacological activities including cardioprotection, chemoprevention and anti-tumor effects. Our results demonstrated that {sup 60}Co gamma radiation lethal dose (LD50) on NCTC clone 929 cells was about 340Gy. (author)

  15. Sulphur XANES Analysis of Cultured Human Prostate Cancer Cells

    International Nuclear Information System (INIS)

    Prostate cancer is one of the most commonly diagnosed cancers in men throughout the world. It is believed that changes to the structure of protein binding sites, altering its metabolism, may play an important role in carcinogenesis. Sulphur, often present in binding sites, can influence such changes through its chemical speciation. Hence there is a need for precise investigation of coordination environment of sulphur. X-ray absorption near edge structure spectroscopy offers such possibility. Cell culture samples offer histologically well defined areas of good homogeneity, suitable for successful and reliable X-ray absorption near edge structure analysis. This paper presents sulphur speciation data collected from three different human prostate cancer cell lines (PC-3, LNCaP and DU-145). Sulphur X-ray absorption near edge structure analysis was performed on K-edge structure. The spectra of cells were compared with those of cancerous tissue and with organic substances as well as inorganic compounds. (authors)

  16. ret/PTC-1 expression alters the immunoprofile of thyroid follicular cells

    Directory of Open Access Journals (Sweden)

    Aherne Sinead

    2008-05-01

    Full Text Available Abstract Background Hashimoto Thyroiditis (H.T. is a destructive autoimmune thyroid condition whose precise molecular pathogenesis remains unclear. ret/PTC-1 is a chimeric transcript which has been described in autoimmune thyroid disease (AITD and thyroid neoplasia. The purpose of this study was to observe the immunogenic effect exposure to H.T. and control lymphocyte supernatant would have on normal (Nthy-ori and ret/PTC-1 (TPC-1 expressing thyroid cell line models. Results A 2 × 2 matrix comprising Nthy-ori and TPC-1 cell lines and H.T. and control lymphocyte supernatant was designed and utilised as follows; activated lymphocytic supernatant from a H.T. and normal control were co-cultured with a cell line derived from normal thyroid (Nthy-ori and also a cell line derived from a papillary thyroid carcinoma that endogenously expresses ret/PTC-1 (TPC-1. The co-cultures were harvested at 0, 6 and 18 hour time points. Gene expression analysis was performed on RNA extracted from thyrocytes using TaqMan® Immune profiling Low-Density Arrays (Applied Biosystems, CA, USA comprising gene expression markers for 93 immune related targets plus 3 endogenous controls. Stimulation of the normal thyroid cell line model with activated T cell supernatant from the H.T. donor yielded global up-regulation of immune targets when compared with control supernatant stimulation. In particular, a cohort of targets (granzyme B, CD3, CD25, CD152, CD45 associated with cytotoxic cell death; T cell receptor (TCR and T cell signaling were up-regulated in the normal cell line model. When the ret/PTC-1 expressing thyroid cell line was co-cultured with H.T. lymphocyte supernatant, in comparison to control supernatant stimulation, down-regulation of the same subset of immune targets was seen. Conclusion Co-culturing H.T. lymphocyte supernatant with a normal thyroid cell line model leads to over-expression of a subset of targets which could contribute to the pathogenesis of H

  17. PC-3 prostate carcinoma cells release signal substances that influence the migratory activity of cells in the tumor's microenvironment

    Directory of Open Access Journals (Sweden)

    Zänker Kurt S

    2010-07-01

    Full Text Available Abstract Background Tumor cells interact with the cells of the microenvironment not only by cell-cell-contacts but also by the release of signal substances. These substances are known to induce tumor vascularization, especially under hypoxic conditions, but are also supposed to provoke other processes such as tumor innervation and inflammatory conditions. Inflammation is mediated by two organ systems, the neuroendocrine system and the immune system. Therefore, we investigated the influence of substances released by PC-3 human prostate carcinoma cells on SH-SY5Y neuroblastoma cells as well as neutrophil granulocytes and cytotoxic T lymphocytes, especially with regard to their migratory activity. Results PC-3 cells express several cytokines and growth factors including vascular endothelial growth factors, fibroblast growth factors, interleukins and neurotrophic factors. SH-SY5Y cells are impaired in their migratory activity by PC-3 cell culture supernatant, but orientate chemotactically towards the source. Neutrophil granulocytes increase their locomotory activity only in response to cell culture supernantant of hypoxic but not of normoxic PC-3 cells. In contrast, cytotoxic T lymphocytes do not change their migratory activity in response to either culture supernatant, but increase their cytotoxicity, whereas supernatant of normoxic PC-3 cells leads to a stronger increase than that of hypoxic PC-3 cells. Conclusions PC-3 cells release several signal substances that influence the behavior of the cells in the tumor's microenvironment, whereas no clear pattern towards proinflammatory or immunosuppressive conditions can be seen.

  18. The Biological Study of the Cultured Human Lens Epithelial Cells in Vitro

    Institute of Scientific and Technical Information of China (English)

    1994-01-01

    The human lens epithelial cells (HLE) cultured in vitro was established in normal and cataractous lenses. The biological feature, histological characteristics and the ultrastructure of the cultured HLE cells were investigated. The results reveal that the proliferative capacity of the culutured HLE cells is reversely proportional to the donour age; the cultured HLE cells has the limited proliferative capacity in vitro. The relieve of the contact inhibition is the effective trigger of the HLE cell prolife...

  19. Bladder cancer cell in co-culture induces human stem cell differentiation to urothelial cells through paracrine FGF10 signaling

    OpenAIRE

    Chung, Seyung S.; Koh, Chester J.

    2013-01-01

    FGF10 is required for embryonic epidermal morphogenesis including brain development, lung morphogenesis, and initiation of limb bud formation. In this study, we investigated the role of FGF10 as a lead induction factor for stem cell differentiation toward urothelial cell. To this end, human multi-potent stem cell in vitro system was employed. Human amniotic fluid stem cells were co-cultured with immortalized bladder cancer lines to induce directed differentiation into urothelial cells. Urothe...

  20. Optimization of Storage Temperature for Cultured ARPE-19 Cells

    Directory of Open Access Journals (Sweden)

    Lara Pasovic

    2013-01-01

    Full Text Available Purpose. The establishment of future retinal pigment epithelium (RPE replacement therapy is partly dependent on the availability of tissue-engineered RPE cells, which may be enhanced by the development of suitable storage methods for RPE. This study investigates the effect of different storage temperatures on the viability, morphology, and phenotype of cultured RPE. Methods. ARPE-19 cells were cultured under standard conditions and stored in HEPES-buffered MEM at nine temperatures (4°C, 8°C, 12°C, 16°C, 20°C, 24°C, 28°C, 32°C, and 37°C for seven days. Viability and phenotype were assessed by a microplate fluorometer and epifluorescence microscopy, while morphology was analyzed by scanning electron microscopy. Results. The percentage of viable cells preserved after storage was highest in the 16°C group (48.7%±9.8%; P<0.01 compared to 4°C, 8°C, and 24°C–37°C; P<0.05 compared to 12°C. Ultrastructure was best preserved at 12°C, 16°C, and 20°C. Expression of actin, ZO-1, PCNA, caspase-3, and RPE65 was maintained after storage at 16°C compared to control cells that were not stored. Conclusion. Out of nine temperatures tested between 4°C and 37°C, storage at 12°C, 16°C, and 20°C was optimal for maintenance of RPE cell viability, morphology, and phenotype. The preservation of RPE cells is critically dependent on storage temperature.

  1. Responsiveness of fetal rat brain cells to glia maturation factor during neoplastic transformation in cell culture

    DEFF Research Database (Denmark)

    Haugen, A; Laerum, O D; Bock, E

    1981-01-01

    The effect of partially purified extracts from adult pig brains containing a glia maturation protein factor (BE) has been investigated on neural cells during carcinogenesis. Pregnant BD IX-rats were given a single transplacental dose of the carcinogen ethylnitrosourea (EtNU) on the 18th day of...... gestation. The brains of the treated fetuses were transferred to cell culture and underwent neoplastic transformation with a characteristic sequence of phenotypic alterations which could be divided into five different stages. During the first 40 days after explantation (stage I & II) BE induced...... appreciable effect on GFA-content was seen any longer, although some few weakly GFA positive cells could be observed in all permanent cell lines. Fetal rat brain cells therefore seem to become less responsive to this differentiation inducer during neoplastic transformation in cell culture....

  2. Surface modification of uniaxial cyclic strain cell culture platform with temperature-responsive polymer for cell sheet detachment†

    OpenAIRE

    Lee, E L; Bendre, H. H.; Kalmykov, A.; Wong, J Y

    2015-01-01

    Current cell sheet-based blood vessels lack biomimetic structure and require excessively long culture times that may compromise smooth muscle cell phenotype. We modified a commercially available product for uniaxial cell sheet conditioning with thermoresponsive copolymers. Thus, culture of detachable conditioned cell sheets is shortened while retaining structural integrity and contractility.

  3. Epithelial Cell Culture from Human Adenoids: A Functional Study Model for Ciliated and Secretory Cells

    Directory of Open Access Journals (Sweden)

    Claudia González

    2013-01-01

    Full Text Available Background. Mucociliary transport (MCT is a defense mechanism of the airway. To study the underlying mechanisms of MCT, we have both developed an experimental model of cultures, from human adenoid tissue of ciliated and secretory cells, and characterized the response to local chemical signals that control ciliary activity and the secretion of respiratory mucins in vitro. Materials and Methods. In ciliated cell cultures, ciliary beat frequency (CBF and intracellular Ca2+ levels were measured in response to ATP, UTP, and adenosine. In secretory cultures, mucin synthesis and secretion were identified by using immunodetection. Mucin content was taken from conditioned medium and analyzed in the presence or absence of UTP. Results. Enriched ciliated cell monolayers and secretory cells were obtained. Ciliated cells showed a basal CBF of 10.7 Hz that increased significantly after exposure to ATP, UTP, or adenosine. Mature secretory cells showed active secretion of granules containing different glycoproteins, including MUC5AC. Conclusion. Culture of ciliated and secretory cells grown from adenoid epithelium is a reproducible and feasible experimental model, in which it is possible to observe ciliary and secretory activities, with a potential use as a model to understand mucociliary transport control mechanisms.

  4. A specific Fc gamma receptor on cultured rat mesangial cells

    International Nuclear Information System (INIS)

    Mesangial cells represent specialized pericytes in the renal glomerulus that contribute to the regulation of a variety of glomerular functions. Recently we and others have shown that cultured mesangial cells bind and take up immune complexes in an Fc-dependent manner leading in turn to generation of PGE2, reactive oxygen, and platelet-activating factor. The present studies were designed to further characterize potential Fc-gamma R on mesangial cells. Binding assays with either monomeric or heat aggregated (HA) [125I] labeled rat subclass-specific IgG were performed at 4 degrees C for 2 h on subcultured rat mesangial cells. Monomeric rat IgG2a, IgG2b, IgG1 and HA IgG2a bound only nonspecifically. Saturable Fc-dependent binding occurred for HA IgG2b and HA IgG1 though maximal binding and affinity were much higher for IgG2b. The presence of an Fc-gamma R was confirmed by surface protein iodination of mesangial cells (MC) and immunoprecipitation with either a polyclonal or mAb 2.4G2 prepared against murine Fc-gamma R. Both antibodies precipitated a 45-kDa iodinated protein band from cultured rat MC that comigrated with that from murine macrophage J774 cells on SDS-PAGE. This protein band also reacted with the polyclonal anti Fc-gamma R antibody on immunoblots. In contrast rat renal papillary epithelial cells were negative. The 45-kDa protein recognized by the rat anti-Fc-gamma R antibody 2.4G2 probably represents the binding site for HA IgG2b, as the 2.4G2 antibody also blocked binding of HA IgG2b. By immunofluorescence microscopy all MC stained positively with the polyclonal anti-Fc-gamma R antibody. A cDNA probe for the Fc-gamma RII-alpha on murine macrophages hybridized to mRNA from cultured rat MC which was of the same size (though less abundant) as that from J774 macrophages

  5. A specific Fc gamma receptor on cultured rat mesangial cells

    Energy Technology Data Exchange (ETDEWEB)

    Santiago, A.; Satriano, J.; DeCandido, S.; Holthofer, H.; Schreiber, R.; Unkeless, J.; Schlondorff, D. (Albert Einstein College of Medicine, NY (USA))

    1989-10-15

    Mesangial cells represent specialized pericytes in the renal glomerulus that contribute to the regulation of a variety of glomerular functions. Recently we and others have shown that cultured mesangial cells bind and take up immune complexes in an Fc-dependent manner leading in turn to generation of PGE2, reactive oxygen, and platelet-activating factor. The present studies were designed to further characterize potential Fc-gamma R on mesangial cells. Binding assays with either monomeric or heat aggregated (HA) (125I) labeled rat subclass-specific IgG were performed at 4 degrees C for 2 h on subcultured rat mesangial cells. Monomeric rat IgG2a, IgG2b, IgG1 and HA IgG2a bound only nonspecifically. Saturable Fc-dependent binding occurred for HA IgG2b and HA IgG1 though maximal binding and affinity were much higher for IgG2b. The presence of an Fc-gamma R was confirmed by surface protein iodination of mesangial cells (MC) and immunoprecipitation with either a polyclonal or mAb 2.4G2 prepared against murine Fc-gamma R. Both antibodies precipitated a 45-kDa iodinated protein band from cultured rat MC that comigrated with that from murine macrophage J774 cells on SDS-PAGE. This protein band also reacted with the polyclonal anti Fc-gamma R antibody on immunoblots. In contrast rat renal papillary epithelial cells were negative. The 45-kDa protein recognized by the rat anti-Fc-gamma R antibody 2.4G2 probably represents the binding site for HA IgG2b, as the 2.4G2 antibody also blocked binding of HA IgG2b. By immunofluorescence microscopy all MC stained positively with the polyclonal anti-Fc-gamma R antibody. A cDNA probe for the Fc-gamma RII-alpha on murine macrophages hybridized to mRNA from cultured rat MC which was of the same size (though less abundant) as that from J774 macrophages.

  6. Rapid Ped-2E9 Cell-Based Cytotoxicity Analysis and Genotyping of Bacillus Species

    OpenAIRE

    Gray, Kristen M.; Banada, Padmapriya P.; O'Neal, Erin; Arun K. Bhunia

    2005-01-01

    Bacillus species causing food-borne disease produce multiple toxins eliciting gastroenteritis. Toxin assays with mammalian cell cultures are reliable but may take 24 to 72 h to complete and also lack sensitivity. Here, a sensitive and rapid assay was developed using a murine hybridoma Ped-2E9 cell model. Bacillus culture supernatants containing toxins were added to a Ped-2E9 cell line and analyzed for cytotoxicity with an alkaline phosphatase release assay. Most Bacillus cereus strains produc...

  7. From Three-Dimensional Cell Culture to Organs-on-Chips

    OpenAIRE

    Huh, Dongeun; Hamilton, Geraldine A.; Ingber, Donald E.

    2011-01-01

    Three-dimensional (3D) cell culture models have recently garnered great attention because they often promote levels of cell differentiation and tissue organization not possible in conventional two-dimensional (2D) culture systems. Here, we review new advances in 3D culture that leverage microfabrication technologies from the microchip industry and microfluidics approaches to create cell culture microenvironments that both support tissue differentiation and recapitulate the tissue-tissue inter...

  8. Human dental pulp stem cells cultured in serum-free supplemented medium

    OpenAIRE

    Bonnamain, Virginie; Thinard, Reynald; Sergent-Tanguy, Solène; Huet, Pascal; Bienvenu, Géraldine; Naveilhan, Philippe; Farges, Jean-Christophe; Alliot-Licht, Brigitte

    2013-01-01

    Growing evidence show that human dental pulp stem cells (DPSCs) could provide a source of adult stem cells for the treatment of neurodegenerative pathologies. In this study, DPSCs were expanded and cultured with a protocol generally used for the culture of neural stem/progenitor cells. Methodology: DPSC cultures were established from third molars. The pulp tissue was enzymatically digested and cultured in serum-supplemented basal medium for 12 h. Adherent (ADH) and non-adherent (non-ADH) ...

  9. Characterisation of resident multipotent vascular stem cell derived smooth muscle cells in culture

    OpenAIRE

    Kennedy, Eimear

    2015-01-01

    The origin of the vascular Smooth Muscle Cell (SMC) involved with vascular remodelling is very controversial. The theory that SMCs can dedifferentiate is long standing. However, in more recent years this idea has been challenged with the emergence of resident progenitor stem cells in the vascular wall. Here, a population of primary Multipotent Vascular Stem Cells (MVSCs) were isolated using explant culture from the medial layer of rat aortic tissue. MVSCs were characterised for multipotency b...

  10. Single-Cell-State Culture of Human Pluripotent Stem Cells Increases Transfection Efficiency

    OpenAIRE

    Nii, Takenobu; Kohara, Hiroshi; Marumoto, Tomotoshi; Sakuma, Tetsushi; Yamamoto, Takashi; Tani, Kenzaburo

    2016-01-01

    Abstract Efficient gene transfer into human pluripotent stem cells (hPSCs) holds great promise for regenerative medicine and pharmaceutical development. In the past decade, various methods were developed for gene transfer into hPSCs; however, hPSCs form tightly packed colonies, making gene transfer difficult. In this study, we established a stable culture method of hPSCs at a single-cell state to reduce cell density and investigated gene transfection efficiency followed by gene editing effici...

  11. A biocompatible micro cell culture chamber for culturing and on-line monitoring of Eukaryotic cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael

    2006-01-01

    Visualisering af cellulære processer over længere tidsperioder har været besværliggjort af cellernes krav til varme, fugtighed og et fysiologisk pH balanceret medie. Fremskridt indenfor mikro teknologi har muliggjort fabrikation af miniaturiserede celle kultur anordninger der er i stand til at ho...

  12. Further characterization of the adhesive-tumor-cell culture system for measuring the radiosensitivity of human tumor primary cultures

    International Nuclear Information System (INIS)

    This study extends the use of the adhesive-tumor-cell culture system to include: over 100 sensitivity measurements at 2.0 Gy; tumorgenicity determinations in nude mice; and flow cytometry of the cells grown in the system. The malignant nature of the growing cells was proved by injecting cells into nude mice. Tumors resulted in 60% of the cases and the histology of each xenograft was similar to that of the human tumor. Flow cytometry was used to obtain DNA histograms of the original cell suspension and of cultures during the two week culture period in order to obtain quantitative information about the growth of aneuploid versus diploid populations. The results thus far demonstrate that 95% of aneuploid populations yield aneuploid growth; of the first 20 cases studied, only one suspension with an aneuploid peak resulted in diploid growth. Of further interest was the observation that it is not unusual for a minor aneuploid population to become the predominate growth fraction after two weeks in culture. These results demonstrate that the adhesive-tumor-cell culture system supports the growth of malignant cells, that multiple cell populations exist in cell suspensions derived from solid tumors, and that differences exist between the radiosensitivity of cells at 2.0 Gy in different histology types

  13. Identification of a population of cells with hematopoietic stem cell properties in mouse aorta-gonad-mesonephros cultures

    International Nuclear Information System (INIS)

    The aorta-gonad-mesonephros (AGM) region is a primary source of definitive hematopoietic cells in the midgestation mouse embryo. In cultures of dispersed AGM regions, adherent cells containing endothelial cells are observed first, and then non-adherent hematopoietic cells are produced. Here we report on the characterization of hematopoietic cells that emerge in the AGM culture. Based on the expression profiles of CD45 and c-Kit, we defined three cell populations: CD45low c-Kit+ cells that had the ability to form hematopoietic cell colonies in methylcellulose media and in co-cultures with stromal cells; CD45low c-Kit- cells that showed a granulocyte morphology; CD45high c-Kitlow/- that exhibited a macrophage morphology. In co-cultures of OP9 stromal cells and freshly prepared AGM cultures, CD45low c-Kit+ cells from the AGM culture had the abilities to reproduce CD45low c-Kit+ cells and differentiate into CD45low c-Kit- and CD45high c-Kitlow/- cells, whereas CD45low c-Kit- and CD45high c-Kitlow/- did not produce CD45low c-Kit+ cells. Furthermore, CD45low c-Kit+ cells displayed a long-term repopulating activity in adult hematopoietic tissue when transplanted into the liver of irradiated newborn mice. These results indicate that CD45low c-Kit+ cells from the AGM culture have the potential to reconstitute multi-lineage hematopoietic cells

  14. Dibutyryl cyclic AMP reduces the radiosensitivity of cultured endothelial cells

    International Nuclear Information System (INIS)

    The purpose of this study was to determine whether dibutyryl cyclic AMP modifies the radiosensitivity of confluent monolayers of bovine aortic endothelial cells (BAEC). Three indices of BAEC function were monitored from 4-24 hrs after exposure to 1-10 Gy of 60Co gamma rays: the release of 51Cr from prelabeled cells, and release of lactate dehydrogenase (LDH) and plasminogen activator (PLA) into the culture medium. There was a time- and radiation dose-dependent increase in 51Cr, LDH and PLA release from the BAEC, detectable within 12 hrs after 5 Gy or higher, and by 24 hrs after 1 Gy or higher. This increased release was accompanied by a radiation dose-dependent decrease in 51Cr and LDH, and an increase in PLA activity in the lysate of cells adherent to the monolayer at 24 hrs. The continuous presence of cAMP from 1 hr before to 24 hrs after irradiation reduced all of these radiation reactions, although mM concentrations of cAMP were required for significant sparing. The presence of cAMP from 1 hr before to 10 min after irradiation had no effect on BAEC sensitivity, whereas cAMP added 10 min after irradiation was fully as effective as continuously administered drug. Thus, cultured BAEC exhibit membrane dysfunction within 24 hrs after clinically relevant radiation doses, and this dysfunction is ameliorated by cAMP present after irradiation

  15. Efficient flotation of yeast cells grown in batch culture.

    Science.gov (United States)

    Palmieri, M C; Greenhalf, W; Laluce, C

    1996-05-01

    A fast flotation assay was used to select new floating yeast strains. The flotation ability did not seem to be directly correlated to total extracellular protein concentration of the culture. However, the hydrophobicity of the cell was definitely correlated to the flotation capacity. The Saccharomyces strains (FLT strains) were highly hydrophobic and showed an excellent flotation performance in batch cultures without additives (flotation agents) and with no need for a special flotation chamber or flotation column. A stable and well-organized structure was evident in the dried foam as shown by scanning electron microscopy which revealed its unique structure showing mummified cells (dehydrated) attached to each other. The attachment among the cells and the high protein concentration of the foams indicated that proteins might be involved in the foam formation. The floating strains (strains FLT) which were not flocculent and showed no tendency to aggregate, were capable of growing and producing ethanol in a synthetic medium containing high glucose concentration as a carbon source. The phenomenon responsible for flotation seems to be quite different from the flocculation phenomenon. PMID:18626952

  16. Cell thickness of UV absorption by the cell: relation to UV action spectrum shift in mammalian cells in culture

    International Nuclear Information System (INIS)

    By means of reconstruction of series half - thin transverse sections the three - dimensional morphometry of SPEV cells for a series of their specific states in culture is performed: for exponential growth in a monolayer, in a merged monolayer, in the mitosis phase, for giant cells and suspension cells. In the monolayer the cell thickness in its central part depended mainly on the nucleus thickness and in average changed but slightly despite a wide range of changes in volumes of nuclei and cells and their density in culture. The cell thickness has noticeably increased in mitosis. For the above states of cells UV radiation absorption spectra are determined. It is shown that a certain shift of action spectrus of death of mammalian cells as compared with that for bacterial cell can be a seguence of selfshielding and not differences in the nature of active chromophores

  17. EFFECT OF MACROLIDE ANTIBIOTICS ON VARIOUS CELL CULTURES IN VITRO: 1. CELL MORPHOLOGY

    Directory of Open Access Journals (Sweden)

    Renáta Kováčová

    2012-08-01

    Full Text Available The aim of our study was to evaluate the cytotoxicity of macrolide antibiotics (tilmicosin, tylosin and spiramycin of various concentrations on different cell cultures in vitro. Cellular lines from animal tissues (VERO cells - kidney cells of Macacus rhesus, FE cells - feline embryonal cells, BHK 21 cellular line from young hamster kidneys were used. Tilmicosin effect: BHK cells are most sensitive, significant decrease in vital cells occurs already at the concentration of 50 μg.ml-1. VERO cells were most resistant, significant decrease of vital cells was observed only at the concentration of 300 μg.ml-1. Tylosin effect: BHK cells can be considered most sensitive, since at concentrations higher than 500 μg.ml-1, no vital cells were observed. At the concentration of 1000 μg.ml-1 were 3.13% of vital and 70.52% of subvital FE cells. In Vero cells, we observed a significant decrease at the concentration of 750 μg.ml-1. Spiramycin effect: Significant decrease of vital BHK cells was observed at the concentration of 150 μg.ml-1, at the concentration of 300 μg.ml-1, no vital cells and only 7.53% of subvital cells were observed. At the concentration of 500 μg.ml-1 reported 10.34% of vital FE cells. At the concentration of 500 μg.ml-1 22.48% of vital and 71.16% of subvital VERO cells were recorded.

  18. Comparative cytogenetic analysis of cultures of irradiated lymphocytes and mixed cultures of irradiated and nonirradiated cells

    International Nuclear Information System (INIS)

    Role is discussed of interphase death and mitotic delay of irradiated lymphocytes in unfoldment of the body mass distribution by radiation dose from the lymphocyte distribution by the number of dicentrics in case of nonuniform irradiation. Peripheral blood of 27 healthy donors nonirradiated and irradiated by doses 1-8 Gy was the material. Interphase death and mitotic delay of irradiated lymphocytes effect reduction of unfolding fraction of irradiated cells that require correction of computer method unfolding the body mass distribution by radiation dose from the lymphocyte distribution by the number of dicentrics in case of nonuniform irradiation. Reduction of unfold dose in mixed cultures apparently indicate computable interrelations of cells with different number of chromosome aberrations

  19. Thromboxane A2 receptors are influenced by cell density in cultured rat aortic smooth muscle cells

    International Nuclear Information System (INIS)

    The influence of cell density on the binding characteristics of thromboxane A2/prostaglandin H2 (TXA2/PGH2) receptors in rat aortic vascular smooth muscle cells in culture were determined using (1S- (1α, 2β (5Z), 3a (1E, 3R*), 4α)) - (3- (3-hydroxy-4- (4'-iodophenoxy)-1-butyenyl)-7-oxabicyclo-(2.2.1)heptan-2yl)-5-heptenoic acid (125I-BOP). The Bmax for 125I-BOP was 5,430 ± 139 sites/cell (26.9 ± 5.7 fmoles/mg protein) for cells cultured in 1% fetal calf serum and 2,809 ± 830 sites/cell (13.1 ± 2.2 fmoles/mg protein) for cells cultured in 10% fetal calf serum. Cells were allowed to grow to varying densities and then harvested for assay. There was a negative correlation between the Bmax and the cell density per flask. The Kd for I-BOP did not significantly vary in any of the studies. The results demonstrate that cell density plays an important role in influencing the expression of vascular TXA2/PGH2 receptors

  20. Biological effects of positron emitters in thyroid cell cultures

    International Nuclear Information System (INIS)

    Full text of publication follows. Aim: Today, the use of 124I- (β+, half-life 4.2 d) is an increasing field in positron emission tomography (PET). In principle, positrons deposit their energy in the surrounding material like electrons. Therefore, we investigated the biological effects of positron emitters in comparison to electrons in vitro. Materials and Methods: two different thyroid cell lines (Fischer Rat Thyroid Cell Line No. 5 (FRTL5) and human papillary thyroid cancer cell line BCPAP) were investigated in vitro. While FRTL5 has been described to express a high level of sodium iodine transporter (NIS), the NIS expression of BCPAP is known to be low. Parallel cultures were incubated with either 50 -400 kBq/ml 124I- (IBA) or 50-400 kBq/ml 131I- (GE Health care). Cell count and radioiodine uptake were determined 24 h to 144 h after isotope application. Additionally, 4',6-diamidino-2-phenylindole (DAPI) staining of ethanol fixed cells was performed and induced apoptosis was determined by morphological analysis of the cell nucleus (condensation, fragmentation) by fluorescence microscopy. Results: BCPAP showed no significant uptake (<0.1 % per one million cells). The proliferation of BCPAP cells was not significantly influenced by radioiodine incubation. The uptake of NIS-expressing FRTL5 cells ranged between 0.6 % and 4 % per one million cells, independently of the isotope. In FRTL5 cells the incubation with 131I- induced a significant dose-dependent inhibition of proliferation (p<0.05). The positron emitter 124I- induced analogue effects on proliferation compared to the electron emitter 131I- (30-40 % inhibition, 144 h incubation with 400 kBq/ml). In parallel, in FRTL5 cell lines an isotope-independent increase of morphological changes in the cell nuclei (up to 5 fold) could be determined. In contrast, no significant changes could be verified in BCPAP cell nuclei. Conclusions: As expected from the physical point of view, the biological effects of positrons

  1. Effects of ultraviolet irradiation on cultured B-16 melanoma cells

    International Nuclear Information System (INIS)

    Changes of the plasma membrane during exposure to ultraviolet light were studied in cultured B-16 melanoma cells by the method of electron spin resonance with the spin labelling technique. The lipid peroxide content increased immediately after exposure to UV light and returned to the normal level, 3 hrs post-exposure. Plasma membrane fluidity increased significantly, 3 - 6 hrs after exposure, and remained at the increased level in the hydrophobic region of the membrane until 18 hrs. There were no significant differences in phospholipid content before and after exposure, except for cardiolipin. (author)

  2. Self-Assembled Peptide Gels for 3D Cell Culture

    OpenAIRE

    Tang, Claire

    2010-01-01

    Under specific conditions short peptides modified with an N-terminal fluorenyl-9-methoxycarbonyl (Fmoc) group can self-assemble into hydrogel scaffolds similar in properties to the natural extracellular matrix. Fmoc-diphenylalanine (Fmoc-FF) for instance, has been shown to form hydrogels at physiological pH that have the ability to support 2D and 3D cell culture. The aim of this investigation is to provide further understanding of the self-assembly mechanism of such systems in order to progre...

  3. Regulation of Taurine transporter activity in cultured rat retinal ganglion cells and rat retinal Muller Cells

    International Nuclear Information System (INIS)

    Diabetic retinopathy is one of the most common complications of diabetes. The amino acid taurine is believed to play an antioxidant protective role in diabetic retinopathy through the scavenging of the reactive species. It is not well established whether taurine uptake is altered in retina cells during diabetic conditions. Thus, the present study was designed to investigate the changes in taurine transport in cultures of rat retinal Muller cells and rat retinal ganglion cells under conditions associated with diabetes. Taurine was abundantly taken up by retinal Muller cells and rat retinal ganglion cells under normal glycemic condition. Taurine was actively transported to rat Muller cells and rat retinal ganglion cells in a Na and Cl dependant manner. Taurine uptake further significantly elevated in both type of cells after the incubation with high glucose concentration. This effect could be attributed to the increase in osmolarity. Because Nitric Oxide (NO) is a molecule implicated in the pathogenesis of diabetes, we also determined the activity of taurine transporter in cultured rat retinal Muller cells and rat retinal ganglion cells in the presence of the NO donors, SIN-1 and SNAP. Taurine uptake was elevated above control value after 24-h incubation with low concentration of NO donors. We finally investigated the ability of neurotoxic glutamate to change taurine transporter activity in both types of cells. Uptake of taurine was significantly increased in rat retinal ganglion cells when only incubated with high concentration of glutamate. Our data provide evidence that taurine transporter is present in cultured rat retinal ganglion and Muller cells and is regulated by hyperosmolarity. The data are relevant to disease such as diabetes and neuronal degeneration where retinal cell volume may dramatically change. (author)

  4. Cell and Molecular Biology of Ataxia Telangiectasia Heterozygous Human Mammary Epithelial Cells Irradiated in Culture

    Science.gov (United States)

    Richmond, Robert C.

    2001-01-01

    Autologous isolates of cell types from obligate heterozygotes with the autosomal disorder ataxia-telangiectasia (A-T)were used to begin a tissue culture model for assessing pathways of radiation-induced cancer formation in this target tissue. This was done by establishing cultures of stromal fibroblasts and long-term growth human mammary epithelial cells (HMEC) in standard 2-dimensional tissue culture in order to establish expression of markers detailing early steps of carcinogenesis. The presumptive breast cancer susceptibility of A-T heterozygotes as a sequel to damage caused by ionizing radiation provided reason to study expression of markers in irradiated HMEC. Findings from our study with HMEC have included determination of differences in specific protein expression amongst growth phase (e.g., log vs stationary) and growth progression (e.g., pass 7 vs pass 9), as well as differences in morphologic markers within populations of irradiated HMEC (e.g., development of multinucleated cells).

  5. The Effect of Primary Cancer Cell Culture Models on the Results of Drug Chemosensitivity Assays: The Application of Perfusion Microbioreactor System as Cell Culture Vessel

    OpenAIRE

    Chia-Hsun Hsieh; Yi-Dao Chen; Shiang-Fu Huang; Hung-Ming Wang; Min-Hsien Wu

    2015-01-01

    To precisely and faithfully perform cell-based drug chemosensitivity assays, a well-defined and biologically relevant culture condition is required. For the former, a perfusion microbioreactor system capable of providing a stable culture condition was adopted. For the latter, however, little is known about the impact of culture models on the physiology and chemosensitivity assay results of primary oral cavity cancer cells. To address the issues, experiments were performed. Results showed that...

  6. Further analyses of human kidney cell populations separated on the space shuttle

    Science.gov (United States)

    Stewart, Robin M.; Todd, Paul; Cole, Kenneth D.; Morrison, Dennis R.

    Cultured human embryonic kidney cells were separated into electrophoretic subpopulations in laboratory experiments and in two separation experiments on the STS-8 (Challenger) Space Shuttle flight using the mid-deck Continuous Flow Electrophoretic Separator (CFES). Populations of cells from each fraction were cultured for the lifetime of the cells, and supernatant medium was withdrawn and replaced at 4-day intervals. Withdrawn medium was frozen at -120°C for subsequent analysis. Enzyme assays, antibodies and gel electrophoresis were used as analytical tools for the detection and quantitation of plasminogen activators in these samples. These assays of frozen culture supernatant fluids confirmed the electrophoretic separation of plasminogen-activator producing cells from non-producing cells, the isolation of cells capable of sustained production, and the separation of cells that produce different plasminogen activators from one another.

  7. Effect of Lactobacillus sp. isolates supernatant on Escherichia coli O157:H7 enhances the role of organic acids production as a factor for pathogen control

    Directory of Open Access Journals (Sweden)

    Larissa B. Poppi

    2015-04-01

    Full Text Available Many attempts have been made to establish the control of foodborne pathogens through Lactobacillus isolates and their metabolism products with success being obtained in several situations. The aim of this study was to investigate the antagonistic effect of eight Lactobacillus isolates, including L. casei subsp. pseudoplantarum, L. plantarum, L. reuteri and L. delbrueckii subsp. delbrueckii, on the pathogenic Escherichia colistrain O157:H7. The inhibitory effect of pure cultures and two pooled cultures supernatants of Lactobacillus on the growth of pathogenic bacteria was evaluated by the spot agar method and by monitoring turbidity. Antimicrobial activity was confirmed for L. reuteri and L. delbrueckii subsp. delbrueckii and for a pool of lactic acid bacteria. The neutralized supernatant of the pool exerted a higher antimicrobial activity than that of the individual strains. Furthermore, D-lactic acid and acetic acid were produced during growth of the Lactobacillus isolates studied.

  8. Studies on radiation transformation of cultured mammalian cells

    International Nuclear Information System (INIS)

    In an attempt to induce in vitro transformation by radiation, several cell lines and primary cultures derived from embryonal tissues of hamster, mouse and man were tested. Under various conditions favorable for transformation, none of these were successfully transformed except for C3H mouse embryo-derived 10Tl/2 cells. Normally the cells contact-inhibited were irradiated with single graded doses and dispersed 3 hours after, followed by inoculation and 8-week cultivation with repeated medium renewals. A few types of focus were identified according to the description of Reznikoff et al. The foci characterized by (i) high cell density, (ii) increased affinity to a basic dye, and (iii) piled-up structure, were taken as an indication of transformation. The frequency of transformation was 6.5 x 10-4 for 300 R which was 4 times higher than the frequency found in the untreated control. It increased dose-dependently until 500 R and then levelled off. Another type of experiment using TR cells derived from a leukemia-prone trisomy 21 human embryo, revealed that a single 300 R exposure to x-ray induced clones showing higher plating efficiency and plateau density than unirradiated control after 200 days of post-irradiation cultivation. However, the clones isolated did not show any particular transformational properties in vitro and tumorigenic activity on inoculation into nude mice. (author)

  9. From cells to organisms: Can we learn about aging from cells in culture?

    International Nuclear Information System (INIS)

    Can studying cultured cells inform us about the biology of aging? The idea that this may be was stimulated by the first formal description of replicative senescence. Replicative senescence limits the proliferation of normal human cells in culture, causing them to irreversibly arrest growth and adopt striking changes in cell function. We now know that telomere shortening, which occurs in most somatic cells as a consequence of DNA replication, drives replicative senescence in human cells. However, rodent cells also undergo replicative senescence, despite very long telomeres, and DNA damage,the action of certain oncogenes and changes in chromatin induce a phenotype similar to that of replicatively senescent cells. Thus,replicative senescence is an example of the more general process of cellular senescence, indicating that the telomere hypothesis of aging is a misnomer. Cellular senescence appears to be a response to potentially oncogenic insults, including oxidative stress. The growth arrest almost certainly suppresses tumorigenesis, at least in young organisms, whereas the functional changes may contribute to aging,although this has yet to be critically tested. Thus, cellular senescence may be an example of antagonistic pleiotropy.Cross-species comparisons suggest there is a relationship between the senescence of cells in culture and organismal life span, but the relationship is neither quantitative nor direct

  10. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  11. Investigation and Application Progress of Vero Cell Serum-free Culture

    OpenAIRE

    Tian Chen; Keping Chen

    2009-01-01

    Serum-free culture is now becoming the general trend of biological production. Its application in Vero cell culture issignificant. In the present paper, we reviewed factors affecting Vero cell serum-free culture and several culturetechniques. In light of these reviews, we outlined its extensive application prospect.

  12. Cell Monitoring and Manipulation Systems (CMMSs based on Glass Cell-Culture Chips (GC3s

    Directory of Open Access Journals (Sweden)

    Sebastian M. Buehler

    2016-06-01

    Full Text Available We developed different types of glass cell-culture chips (GC3s for culturing cells for microscopic observation in open media-containing troughs or in microfluidic structures. Platinum sensor and manipulation structures were used to monitor physiological parameters and to allocate and permeabilize cells. Electro-thermal micro pumps distributed chemical compounds in the microfluidic systems. The integrated temperature sensors showed a linear, Pt1000-like behavior. Cell adhesion and proliferation were monitored using interdigitated electrode structures (IDESs. The cell-doubling times of primary murine embryonic neuronal cells (PNCs were determined based on the IDES capacitance-peak shifts. The electrical activity of PNC networks was detected using multi-electrode arrays (MEAs. During seeding, the cells were dielectrophoretically allocated to individual MEAs to improve network structures. MEA pads with diameters of 15, 20, 25, and 35 µm were tested. After 3 weeks, the magnitudes of the determined action potentials were highest for pads of 25 µm in diameter and did not differ when the inter-pad distances were 100 or 170 µm. Using 25-µm diameter circular oxygen electrodes, the signal currents in the cell-culture media were found to range from approximately −0.08 nA (0% O2 to −2.35 nA (21% O2. It was observed that 60-nm thick silicon nitride-sensor layers were stable potentiometric pH sensors under cell-culture conditions for periods of days. Their sensitivity between pH 5 and 9 was as high as 45 mV per pH step. We concluded that sensorized GC3s are potential animal replacement systems for purposes such as toxicity pre-screening. For example, the effect of mefloquine, a medication used to treat malaria, on the electrical activity of neuronal cells was determined in this study using a GC3 system.

  13. Cell-Culture Reactor Having a Porous Organic Polymer Membrane

    Science.gov (United States)

    Koontz, Steven L. (Inventor)

    2000-01-01

    A method for making a biocompatible polymer article using a uniform atomic oxygen treatment is disclosed. The substrate may be subsequently optionally grated with a compatibilizing compound. Compatibilizing compounds may include proteins, phosphory1choline groups, platelet adhesion preventing polymers, albumin adhesion promoters, and the like. The compatibilized substrate may also have a living cell layer adhered thereto. The atomic oxygen is preferably produced by a flowing afterglow microwave discharge, wherein the substrate resides in a sidearm out of the plasma. Also, methods for culturing cells for various purposes using the various membranes are disclosed as well. Also disclosed are porous organic polymers having a distributed pore chemistry (DPC) comprising hydrophilic and hydrophobic regions, and a method for making the DPC by exposing the polymer to atomic oxygen wherein the rate of hydrophilization is greater than the rate of mass loss.

  14. CD34+ cells cultured in stem cell factor and interleukin-2 generate CD56+ cells with antiproliferative effects on tumor cell lines

    Directory of Open Access Journals (Sweden)

    Hensel Nancy

    2005-04-01

    Full Text Available Abstract In vitro stimulation of CD34+ cells with IL-2 induces NK cell differentiation. In order to define the stages of NK cell development, which influence their generation from CD34 cells, we cultured G-CSF mobilized peripheral blood CD34+ cells in the presence of stem cell factor and IL-2. After three weeks culture we found a diversity of CD56+ subsets which possessed granzyme A, but lacked the cytotoxic apparatus required for classical NK-like cytotoxicity. However, these CD56+ cells had the unusual property of inhibiting proliferation of K562 and P815 cell lines in a cell-contact dependent fashion.

  15. Development of 3-D Hydrogel Culture Systems With On-Demand Cell Separation

    OpenAIRE

    Hamilton, Sharon K.; Bloodworth, Nathaniel C.; Massad, Christopher S.; Hammoudi, Taymour M.; Suri, Shalu; Yang, Peter J.; Lu, Hang; Temenoff, Johnna S.

    2013-01-01

    Recently there has been an increased interest in the effects of paracrine signaling between groups of cells, particularly in the context of better understanding how stem cells contribute to tissue repair. Most current 3-D co-culture methods lack the ability to effectively separate 2 cell populations after the culture period, which is important for simultaneously analyzing the reciprocal effects of each cell type on the other. Here, we detail the development of a 3-D hydrogel co-culture system...

  16. A primary culture of guinea pig gallbladder epithelial cells that is responsive to secretagogues

    OpenAIRE

    Gunter-Smith, Pamela J.; Abdulkadir, Oluwakemi; Hammonds-Odie, Latanya; Scanlon, Mary; Terrell, Raquel

    2000-01-01

    We have developed a cell culture of guinea pig gallbladder epithelial cells with which to study ion transport. When grown on permeable supports, the cultured epithelia developed a transepithelial resistance (Rt) of ∼500 Ω·cm2. The epithelial cell origin of the cell culture was further confirmed by immunocytochemical localization of cytokeratin. Ionomycin and forskolin increased transepithelial voltage and short-circuit current (Isc) and decreased Rt. The response to ionomycin was transient, w...

  17. Receptor-mediated endocytosis of diphtheria toxin by cells in culture.

    OpenAIRE

    Keen, J H; Maxfield, F R; Hardegree, M C; Habig, W H

    1982-01-01

    The binding and uptake of fluorescently labeled diphtheria toxin by cells in culture has been examined by using epifluorescence video intensification microscopy. Rhodamine-labeled diphtheria toxin retained significant toxicity on bioassay and in cell culture and was tested for uptake by human WI-38 and mouse 3T3 fibroblasts grown in culture. When added to cells at 37 degrees C, toxin was observed to become concentrated and internalized in discrete vesicles in both cell lines. The appearance o...

  18. Hemopoietic cell precursor responses to erythropoietin in plasma clot cultures

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, W.L.

    1979-01-01

    The time dependence of the response of mouse bone marrow cells to erythropoietin (Ep) in vitro was studied. Experiments include studies on the Ep response of marrow cells from normal, plethoric, or bled mice. Results with normal marrow reveal: (1) Not all erythroid precursors (CFU-E) are alike in their response to Ep. A significant number of the precursors develop to a mature erythroid colony after very short Ep exposures, but they account for only approx. 13% of the total colonies generated when Ep is active for 48 hrs. If Ep is active more than 6 hrs, a second population of erythroid colonies emerges at a nearly constant rate until the end of the culture. Full erythroid colony production requires prolonged exposure to erythropoietin. (2) The longer erythropoietin is actively present, the larger the number of erythroid colonies that reach 17 cells or more. Two distinct populations of immediate erythroid precursors are also present in marrow from plethoric mice. In these mice, total colony numbers are equal to or below those obtained from normal mice. However, the population of fast-responding CFU-E is consistently decreased to 10 to 20% of that found in normal marrow. The remaining colonies are formed from plethoric marrow at a rate equal to normal marrow. With increasing Ep exposures, the number of large colonies produced increases. From the marrow of bled mice, total erythroid colony production is equal to or above that of normal marrow. Two populations of colony-forming cells are again evident, with the fast-responding CFU-E being below normal levels. The lack of colonies from this group was compensated in bled mice by rapid colony production in the second population. A real increase in numbers of precursors present in this pool increased the rate of colony production in culture to twice that of normal marrow. The number of large colonies obtained from bled mice was again increased as the Ep exposure was lengthened. (ERB)

  19. Degradation of high density lipoprotein in cultured rat luteal cells

    International Nuclear Information System (INIS)

    In rat ovary luteal cells, degradation of high density lipoprotein (HDL) to tricholoracetic acid (TCA)-soluble products accounts for only a fraction of the HDL-derived cholesterol used for steroidogenesis. In this study the authors have investigated the fate of 125I]HDL bound to cultured luteal cells using pulse-chase technique. Luteal cell cultures were pulse labeled with [125I]HDL3 and reincubated in the absence of HDL. By 24 h about 50% of the initallay bound radioactivity was released into the medium, of which 60-65% could be precipitated with 10% TCA. Gel filtration of the chase incubation medium on 10% agarose showed that the amount of TCA-soluble radioactivity was nearly completely accounted for by a sharp peak in the low molecular weight region which was identified as 96% monoiodotyrosine by paper chromatography. The TCA-precipitable radioactivity was nearly completely accounted for by a sharp peak in the low molecular weight region which was identified as 96% monoiodotyrosine by paper chromatography. The TCA-precipitable radioactivity eluted over a wide range of molecular weights (15,000-80,000), and there was very little intact HDL present. Electrophoresis of the chase medium showed that component of the TCA-precipitable portion had mobility similar to apo AI. Lysosomal inhibitors of receptor-mediated endocytosis had no effect on the composition or quantity of radioactivity released during chase incubation. The results show that HDL3 binding to luteal cells is followed by complete degradation of the lipoprotein, although the TCA-soluble part does not reflect the extent of degradation

  20. Cell-to-Cell Diversity in a Synchronized Chlamydomonas Culture As Revealed by Single-Cell Analyses

    OpenAIRE

    Garz, Andreas; Sandmann, Michael; Rading, Michael; Ramm, Sascha; Menzel, Ralf; Steup, Martin

    2012-01-01

    In a synchronized photoautotrophic culture of Chlamydomonas reinhardtii, cell size, cell number, and the averaged starch content were determined throughout the light-dark cycle. For single-cell analyses, the relative cellular starch was quantified by measuring the second harmonic generation (SHG). In destained cells, amylopectin essentially represents the only biophotonic structure. As revealed by various validation procedures, SHG signal intensities are a reliable relative measure of the cel...

  1. Phase-segregated model for plant cell culture: The effect of cell volume fraction

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, W. [Univ. of Adelaide, Adelaide (Australia). Dept. of Chemical Engineering]|[Tokyo Univ. (Japan)hinese Academy of Sciences, Dalian (China). Dalian Inst. of Chemical Physics; Furusaki, S. [Tokyo Univ. (Japan)] Middelberg, A. [Univ. of Adelaide, Adelaide (Australia). Dept. of Chemical Engineering

    1998-06-01

    Plant cells are characterized by low water content, so the fraction of cell volume (volume fraction) in a vessel is large compared with other cell systems, even if the cell concentrations are the same. Therefore, concentration of plant cells should preferably be expressed by the liquid volume basis rather than by the total vessel volume basis. In this paper, a new model is proposed to analyze behavior of a plant cell culture by dividing the cell suspension into the biotic- and abiotic-phases. Using this model, we analyzed the cell-growth and the alkaloid production by Catharanthus roseus. Large errors in the simulated results were observed if the phase-segregation was not considered. 12 refs., 3 figs.

  2. Salmonella typhimurium invasion of epithelial cells: role of induced host cell tyrosine protein phosphorylation.

    OpenAIRE

    Rosenshine, I.; Ruschkowski, S; Foubister, V; Finlay, B B

    1994-01-01

    Salmonella typhimurium invades nonphagocytic epithelial and fibroblast cells via a process resembling phagocytosis. We have compared some phenotypes that are involved in S. typhimurium invasion by using different host cell lines, including HeLa, Henle-407, and A431. Infection with either wild-type S. typhimurium, bacterial culture supernatant, or the noninvasive invA mutant was associated with induction of tyrosine phosphorylation of host cell mitogenic activating protein kinase. However, we ...

  3. Efficacy of decoquinate against Sarcocystis neurona in cell cultures.

    Science.gov (United States)

    Lindsay, David S; Nazir, M Mudasser; Maqbool, Azhar; Ellison, Siobhan P; Strobl, Jeannine S

    2013-09-01

    Decoquinate is a quinolone anticoccidial approved for use in the prevention of intestinal coccidiosis in farm animals. This compound has good activity against Toxoplasma gondii and Neospora caninum in cell cultures. The drug acts on the parasites' mitochondria. The activity of decoquinate against developing merozoites of 2 isolates of Sarcocystis neurona was examined in cell culture. Merozoite production at 10 days was completely inhibited when decoquinate was used at 20 or 240 nM. The IC50 of decoquinate was 0.5 ± 0.09nM for the Sn6 isolate of S. neurona from a horse and 1.1 ± 0.6 nM for the SnOP15 isolate of S. neurona from an opossum. Levamisole was toxic at 5 μg/ml and no synergism was observed when decoquinate was combined with levamisole and tested against the Sn3YFP isolate of S. neurona. Decoquinate was cidal for developing schizonts of S. neurona at 240 nM. PMID:23523012

  4. Isolation, culture and intraportal transplantation of rat marrow stromal cell

    International Nuclear Information System (INIS)

    Objective: To observe the tracing and evolution of marrow stromal cell (MSC) after intraportal transplantation into the liver of homogenous rats, and to provide experimental data for MSC differentiation to hepatocyte in vivo. Methods: The MSC was isolated from the leg bone marrow of adult SD rats, and purified by culture-expanded in vitro. Before transplantation, MSC was labeled with DAPI. Then 105 MSC were intraportally transplanted into the homogenous rat liver. Rats were killed at 2 hours and 1, 2, 3 and 4 weeks after transplantation. The cryosection samples of liver and lung were observed under fluorescence microscopy. Results: MSC in vitro culture had high ability of proliferation. Except 4 rats were dead because of abdominal bleeding or infection, other recipients were healthy until sacrificed. The implantation cells were detected by identifying the DAPI labeled MSC in the host livers, but not in the host lungs. Conclusion: Intraportal transplanted MSC could immigrate and survive in the host livers at least for 4 weeks. They could immigrate from the small branches of portal veins to hepatic parenchyma

  5. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  6. Boildown Study on Supernatant Liquid Retrieved from AW-106 in December 2012

    Energy Technology Data Exchange (ETDEWEB)

    Page, Jason S. [Washington River Protection Solutions, LLC, Richland, WA (United States)

    2013-06-04

    This document reports the results of a boil down study using a composite created from supernatant liquid grab samples retrieved from tank 241-AW-I06 in December of 2012. The composite was made using predetermined volumes of the grab samples which accounted for layering of the supernatant liquid in the tank. The finished composite was a clear, yellow liquid containing no visible solids at hot cell ambient temperatures (24 - 27°C). The density of the test composite was measured in the hot cell immediately before the boildown study and was 1.266 g/mL at 27.1 °C. The boiling temperature of the composite was measured at three different pressures (40, 60, and 80 Torr) throughout the volume reduction, and the results show steadily increasing boiling temperatures with increasing volume reduction and no significant discontinuities. Moderate foaming was observed at the onset of the boildown. The foaming disappeared during the first reduction step, and minimal foaming was observed throughout the rest of the study. The bulk densities at 18.0 °C (D{sub Bulk}{sup 18 °C}) and quantities of settled and centrifuged solids were measured on samples of the boildown concentrates. Estimated values of the bulk densities at the 60-Torr boiling temperatures (D{sub Bulk}{sup 60 Torr}) were also calculated. Solids were first observed at boildown temperatures when the % VWR reached 39.3%. The quantity of solids in the composite quickly increased after this initial formation; the amount of centrifuged solids increased by 22% as the %WVR increased from 39.3 to 44.1 %. A small amount of solids did appear in the samples collected prior to the initial formation during the boildown. These solids precipitated while they sat at hot cell ambient temperature and in the 18. 0 °C water bath. Analysis of boil down test samples indicated that natrophosphate (Na7{sub 3}F(PO{sub 4}){sub 2}{centerdot} 19 H{sub 2}O) and kogarkoite (Na3FS04) accounted for a majority of the initial solids (~80% of the

  7. Boildown Study on Supernatant Liquid Retrieved from AW-106 in December 2012

    International Nuclear Information System (INIS)

    This document reports the results of a boil down study using a composite created from supernatant liquid grab samples retrieved from tank 241-AW-I06 in December of 2012. The composite was made using predetermined volumes of the grab samples which accounted for layering of the supernatant liquid in the tank. The finished composite was a clear, yellow liquid containing no visible solids at hot cell ambient temperatures (24 - 27°C). The density of the test composite was measured in the hot cell immediately before the boildown study and was 1.266 g/mL at 27.1 °C. The boiling temperature of the composite was measured at three different pressures (40, 60, and 80 Torr) throughout the volume reduction, and the results show steadily increasing boiling temperatures with increasing volume reduction and no significant discontinuities. Moderate foaming was observed at the onset of the boildown. The foaming disappeared during the first reduction step, and minimal foaming was observed throughout the rest of the study. The bulk densities at 18.0 °C (Dbulk18°C) and quantities of settled and centrifuged solids were measured on samples of the boildown concentrates. Estimated values of the bulk densities at the 60-Torr boiling temperatures (Dbulk60Torr) were also calculated. Solids were first observed at boildown temperatures when the % VWR reached 39.3%. The quantity of solids in the composite quickly increased after this initial formation; the amount of centrifuged solids increased by 22% as the %WVR increased from 39.3 to 44.1 %. A small amount of solids did appear in the samples collected prior to the initial formation during the boildown. These solids precipitated while they sat at hot cell ambient temperature and in the 18. 0 °C water bath. Analysis of boil down test samples indicated that natrophosphate (Na7F(PO4)2 · 19 H2O) and kogarkoite (Na3FS04) accounted for a majority of the initial solids (∼80% of the dissolved sulfate and phosphate precipitated from the

  8. Gelatin methacrylamide as coating material in cell culture.

    Science.gov (United States)

    Egger, Michael; Tovar, Günter E M; Hoch, Eva; Southan, Alexander

    2016-01-01

    Unmodified gelatin (uG) is widely used as a coating material in cell culture for improving surface properties. In this study, the authors investigated if gelatin methacrylamide (GM) with a medium degree of methacrylamide modification (GM1.5) and a high degree of methacrylamide modification (GM4) are equally suitable for this purpose. Therefore, gold surfaces were coated with uG, GM1.5, and GM4 by adsorption of the polymers on the surfaces. Coating success was confirmed by spectroscopic ellipsometry, contact angle measurements, surface plasmon resonance spectroscopy (SPRS), and atomic force microscopy (AFM). The authors found that upon adsorption of uG, GM1.5, a nd GM4 on gold, thin films with thicknesses of 2.95 nm, 2.50 nm, and 2.26 nm were formed. The coated surfaces showed advancing contact angles of 46° (uG and GM1.5) and 52° (GM4) without alteration of the surface roughness determined by AFM. Protein adsorption taking place on the coated surfaces was measured during contact of the surfaces with fetal calf serum by SPRS. Protein adsorption on the coated surfaces was reduced by the factor of 6.4 (uG), 5.4 (GM1.5), and 4.6 (GM4) compared to gold surfaces. Human fibroblasts cultured on the surfaces showed excellent viability shown by water soluble tetrazolium salt assay as well as live/dead staining with propidium iodide and fluorescein diacetate. No cytotoxic effects of the GM coated surfaces were observed, giving rise to the conclusion that GMs are suitable materials as coatings in cell culture. PMID:27177620

  9. Micromass co-culture of human articular chondrocytes and human bone marrow mesenchymal stem cells to investigate stable neocartilage tissue formation in vitro

    Directory of Open Access Journals (Sweden)

    S Giovannini

    2010-10-01

    Full Text Available Cell therapies for articular cartilage defects rely on expanded chondrocytes. Mesenchymal stem cells (MSC represent an alternative cell source should their hypertrophic differentiation pathway be prevented. Possible cellular instruction between human articular chondrocytes (HAC and human bone marrow MSC was investigated in micromass pellets. HAC and MSC were mixed in different percentages or incubated individually in pellets for 3 or 6 weeks with and without TGF-beta1 and dexamethasone (±T±D as chondrogenic factors. Collagen II, collagen X and S100 protein expression were assessed using immunohistochemistry. Proteoglycan synthesis was evaluated applying the Bern score and quantified using dimethylmethylene blue dye binding assay. Alkaline phosphatase activity (ALP was detected on cryosections and soluble ALP measured in pellet supernatants. HAC alone generated hyaline-like discs, while MSC formed spheroid pellets in ±T±D. Co-cultured pellets changed from disc to spheroid shape with decreasing number of HAC, and displayed random cell distribution. In -T-D, HAC expressed S100, produced GAG and collagen II, and formed lacunae, while MSC did not produce any cartilage-specific proteins. Based on GAG, collagen type II and S100 expression chondrogenic differentiation occurred in -T-D MSC co-cultures. However, quantitative experimental GAG and DNA values did not differ from predicted values, suggesting only HAC contribution to GAG production. MSC produced cartilage-specific matrix only in +T+D but underwent hypertrophy in all pellet cultures. In summary, influence of HAC on MSC was restricted to early signs of neochondrogenesis. However, MSC did not contribute to the proteoglycan deposition, and HAC could not prevent hypertrophy of MSC induced by chondrogenic stimuli.

  10. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells.

    Science.gov (United States)

    Stecklum, Maria; Wulf-Goldenberg, Annika; Purfürst, Bettina; Siegert, Antje; Keil, Marlen; Eckert, Klaus; Fichtner, Iduna

    2015-02-01

    In the present study, purified human cord blood stem cells were co-cultivated with murine hepatic alpha mouse liver 12 (AML12) cells to compare the effect on endodermal stem cell differentiation by either direct cell-cell interaction or by soluble factors in conditioned hepatic cell medium. With that approach, we want to mimic in vitro the situation of preclinical transplantation experiments using human cells in mice. Cord blood stem cells, cultivated with hepatic conditioned medium, showed a low endodermal differentiation but an increased connexin 32 (Cx32) and Cx43, and cytokeratin 8 (CK8) and CK19 expression was monitored by reverse transcription polymerase chain reaction (RT-PCR). Microarray profiling indicated that in cultivated cord blood cells, 604 genes were upregulated 2-fold, with the highest expression for epithelial CK19 and epithelial cadherin (E-cadherin). On ultrastructural level, there were no major changes in the cellular morphology, except a higher presence of phago(ly)some-like structures observed. Direct co-culture of AML12 cells with cord blood cells led to less incisive differentiation with increased sex-determining region Y-box 17 (SOX17), Cx32 and Cx43, as well as epithelial CK8 and CK19 expressions. On ultrastructural level, tight cell contacts along the plasma membranes were revealed. FACS analysis in co-cultivated cells quantified dye exchange on low level, as also proved by time relapse video-imaging of labelled cells. Modulators of gap junction formation influenced dye transfer between the co-cultured cells, whereby retinoic acid increased and 3-heptanol reduced the dye transfer. The study indicated that the cell-co-cultured model of human umbilical cord blood cells and murine AML12 cells may be a suitable approach to study some aspects of endodermal/hepatic cell differentiation induction. PMID:25270685

  11. Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells in irradiated bone marrow cell culture in vitro

    International Nuclear Information System (INIS)

    Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells after irradiation were studied in the long-term culture of mouse bone marrow cells in vitro. No difference was observed in the survival of the stem cells among cultures in which 0 - 107 cells were re-inoculated on the adherent cell colonies in the culture flask. Stem cells showed a significant proliferation within 1 week and the number of the stem cells exceeded the control in 3 weeks after irradiation in the cultures with less than 106 re-inoculated cells per flask. In contrast, there was a considerable delay in the onset of stem cell proliferation after irradiation in the culture with 107 cells per flask. Based on these results, a possibility that a stimulator of stem cell proliferation, released from irradiated stromal cells, is cancelled by an inhibitory factor produced by irradiated or unirradiated haemopoietic cells is postulated. (author)

  12. Replication of parvovirus B19 in hematopoietic progenitor cells generated in vitro from normal human peripheral blood.

    OpenAIRE

    Schwarz, T F; Serke, S; Hottenträger, B; von Brunn, A; Baurmann, H; Kirsch, A.; Stolz, W.; Huhn, D; Deinhardt, F.; Roggendorf, M

    1992-01-01

    Erythroid progenitor cells generated in vitro from peripheral human blood in the presence of interleukin-3 and erythropoietin were infected with human parvovirus B19. B19 virus DNA replication was highest 48 to 72 h after infection, and maximum levels of B19 virus proteins were detected in culture supernatants at 72 to 96 h after infection. B19 virus propagated in vitro was infectious. This cell culture system with peripheral blood cells facilitates studies in vitro of B19 virus replication.

  13. Comparison of ultracentrifugation and density gradient separation methods for isolating Tca8113 human tongue cancer cell line-derived exosomes

    OpenAIRE

    Zhang, Zhuoyuan; Wang, Chenxing; Li, Tang; LIU, ZHE; LI, LONGJIANG

    2014-01-01

    The aim of the present study was to compare the method of ultracentrifugation and density gradient separation for isolating Tca8113 human tongue squamous cell carcinoma cell line-derived exosomes. The exosomes were obtained from the culture supernatant of cultured Tca8113 cells, respectively, followed by identification with transmission electron microscopy observation and western blot analysis. The two different methods were then compared by the morphology, the distribution range of the parti...

  14. Open-Porous Hydroxyapatite Scaffolds for Three-Dimensional Culture of Human Adult Liver Cells

    Directory of Open Access Journals (Sweden)

    Anthony Finoli

    2016-01-01

    Full Text Available Liver cell culture within three-dimensional structures provides an improved culture system for various applications in basic research, pharmacological screening, and implantable or extracorporeal liver support. Biodegradable calcium-based scaffolds in such systems could enhance liver cell functionality by providing endothelial and hepatic cell support through locally elevated calcium levels, increased surface area for cell attachment, and allowing three-dimensional tissue restructuring. Open-porous hydroxyapatite scaffolds were fabricated and seeded with primary adult human liver cells, which were embedded within or without gels of extracellular matrix protein collagen-1 or hyaluronan. Metabolic functions were assessed after 5, 15, and 28 days. Longer-term cultures exhibited highest cell numbers and liver specific gene expression when cultured on hydroxyapatite scaffolds in collagen-1. Endothelial gene expression was induced in cells cultured on scaffolds without extracellular matrix proteins. Hydroxyapatite induced gene expression for cytokeratin-19 when cells were cultured in collagen-1 gel while culture in hyaluronan increased cytokeratin-19 gene expression independent of the use of scaffold in long-term culture. The implementation of hydroxyapatite composites with extracellular matrices affected liver cell cultures and cell differentiation depending on the type of matrix protein and the presence of a scaffold. The hydroxyapatite scaffolds enable scale-up of hepatic three-dimensional culture models for regenerative medicine applications.

  15. Open-Porous Hydroxyapatite Scaffolds for Three-Dimensional Culture of Human Adult Liver Cells

    Science.gov (United States)

    Schmelzer, Eva; Over, Patrick; Nettleship, Ian; Gerlach, Joerg C.

    2016-01-01

    Liver cell culture within three-dimensional structures provides an improved culture system for various applications in basic research, pharmacological screening, and implantable or extracorporeal liver support. Biodegradable calcium-based scaffolds in such systems could enhance liver cell functionality by providing endothelial and hepatic cell support through locally elevated calcium levels, increased surface area for cell attachment, and allowing three-dimensional tissue restructuring. Open-porous hydroxyapatite scaffolds were fabricated and seeded with primary adult human liver cells, which were embedded within or without gels of extracellular matrix protein collagen-1 or hyaluronan. Metabolic functions were assessed after 5, 15, and 28 days. Longer-term cultures exhibited highest cell numbers and liver specific gene expression when cultured on hydroxyapatite scaffolds in collagen-1. Endothelial gene expression was induced in cells cultured on scaffolds without extracellular matrix proteins. Hydroxyapatite induced gene expression for cytokeratin-19 when cells were cultured in collagen-1 gel while culture in hyaluronan increased cytokeratin-19 gene expression independent of the use of scaffold in long-term culture. The implementation of hydroxyapatite composites with extracellular matrices affected liver cell cultures and cell differentiation depending on the type of matrix protein and the presence of a scaffold. The hydroxyapatite scaffolds enable scale-up of hepatic three-dimensional culture models for regenerative medicine applications.

  16. Technology for cell cycle research with unstressed steady-state cultures

    OpenAIRE

    Lebleu, Valerie S.; Thornton, Maureen; Gonda, Steven R.; Helmstetter, Charles E.

    2006-01-01

    A culture system for performing cell cycle analyses on cells in undisturbed steady-state populations was designed and tested. In this system, newborn cells are shed continuously from an immobilized, perfused culture rotating about the horizontal axis. As a result of this arrangement, the number of newborn cells released into the effluent medium each generation is identical to the number of cells residing in the immobilized population, indicating that one of the two new daughter cells is shed ...

  17. Enhanced cell attachment using a novel cell culture surface presenting functional domains from extracellular matrix proteins

    OpenAIRE

    Cooke, M. J.; Phillips, S R; Shah, D. S. H.; Athey, D.; Lakey, J H; Przyborski, S A

    2008-01-01

    Many factors contribute to the creation and maintenance of a realistic environment for cell growth in vitro, e.g. the consistency of the growth medium, the addition of supplements, and the surface on which the cells grow. The nature of the surface on which cells are cultured plays an important role in their ability to attach, proliferate, migrate and function. Components of the extracellular matrix (ECM) are often used to coat glass or plastic surfaces to enhance cell attachment in vitro. Fra...

  18. Azo-polysiloxanes as new supports for cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Hurduc, Nicolae, E-mail: nhurduc@ch.tuiasi.ro [“Gheorghe Asachi” Technical University of Iasi, Department of Natural and Synthetic Polymers, Prof. Dimitrie, Mangeron Street, 73, 700050-Iasi (Romania); Macovei, Alina [Institute of Biochemistry of the Romanian Academy, Department of Viral Glycoproteins, Splaiul Independentei 296, Sector 6, 060041-Bucuresti (Romania); Paius, Cristina; Raicu, Alina [“Gheorghe Asachi” Technical University of Iasi, Department of Natural and Synthetic Polymers, Prof. Dimitrie, Mangeron Street, 73, 700050-Iasi (Romania); Moleavin, Ioana [CEA, LIST Saclay, Laboratoire Capteurs et Architectures Électroniques, F-91191 Gif-sur-Yvette, Cedex (France); Branza-Nichita, Norica, E-mail: nichita@biochim.ro [Institute of Biochemistry of the Romanian Academy, Department of Viral Glycoproteins, Splaiul Independentei 296, Sector 6, 060041-Bucuresti (Romania); Hamel, Matthieu [CEA, LIST Saclay, Laboratoire Capteurs et Architectures Électroniques, F-91191 Gif-sur-Yvette, Cedex (France); Rocha, Licinio, E-mail: Licinio.ROCHA@cea.fr [CEA, LIST Saclay, Laboratoire Capteurs et Architectures Électroniques, F-91191 Gif-sur-Yvette, Cedex (France)

    2013-05-01

    The paper introduces a new class of materials with azo-polysiloxanic structure bearing the property to generate nano-structured surfaces by laser irradiation. The ability to modulate the optical response of the film, through a modification of the polymer chemical structure, has been investigated. The azo-materials were tested for their ability to support cell adhesion and growth, with very promising results. A future use of these materials as growth support in cell cultures is of great interest, due to an easy, one step-method to generate the surface relief grating and to the possibility to introduce a large range of chemical modifications due to the presence of the chlorobenzyl groups in the polymeric side-chain. - Graphical abstract: Cell development on a nano-structured surface obtained from an azo-polysiloxanic film. Highlights: ► New azo-polysiloxanic films for biological applications were reported. ► Nanostructured surfaces with controllable geometry are obtained by laser irradiation. ► Cells are very sensitive to the chemical and physical properties of the polymeric substrate.

  19. Azo-polysiloxanes as new supports for cell cultures

    International Nuclear Information System (INIS)

    The paper introduces a new class of materials with azo-polysiloxanic structure bearing the property to generate nano-structured surfaces by laser irradiation. The ability to modulate the optical response of the film, through a modification of the polymer chemical structure, has been investigated. The azo-materials were tested for their ability to support cell adhesion and growth, with very promising results. A future use of these materials as growth support in cell cultures is of great interest, due to an easy, one step-method to generate the surface relief grating and to the possibility to introduce a large range of chemical modifications due to the presence of the chlorobenzyl groups in the polymeric side-chain. - Graphical abstract: Cell development on a nano-structured surface obtained from an azo-polysiloxanic film. Highlights: ► New azo-polysiloxanic films for biological applications were reported. ► Nanostructured surfaces with controllable geometry are obtained by laser irradiation. ► Cells are very sensitive to the chemical and physical properties of the polymeric substrate

  20. Culture and identification of stem cells of uterine junctional zone

    Directory of Open Access Journals (Sweden)

    Kang KANG

    2015-04-01

    Full Text Available Objective To establish a method for isolation, culture, and identification of stem cells in uterine junctional zone (uJZSCs. Methods Specimens of uterus muscle layer at uterine junctional zone (uJZ were harvested under aseptic condition, and they digested, cultivated and amplified using trypsogen and collagenaseⅠ. The morphology of uJZSCs was observed with inverted microscope, and cell viability and phenotype were analyzed by flow cytometry. The adipogenic, osteogenic and chondrogenic differentiation was induced in vitro, and their biological growth characteristic was identified by CCK-8 marking. Results The cells were adhered after passage, and they presented long spindle in shape. Flow cytometry showed that the expressions of CD90, CD73, CD105, CD29, CD44, CD13, CD166, and HLA-ABC marking was also positive, while they were negative for CD34, CD45, CD14, HLA-DR and CD19. The CCK-8 growth curve was S-shaped. The induced differentiation experiments indicated that uJZSCs could be induced into osteoblast, adipocyte and chondrocytes. Conclusion uJZSCs possess a strong proliferation capacity, and they might become a new source of mesenchymal stem cells. DOI: 10.11855/j.issn.0577-7402.2015.03.01