Comparison of EBV DNA viral load in whole blood, plasma, B-cells and B-cell culture supernatant.
Ouedraogo, David Eric; Bollore, Karine; Viljoen, Johannes; Foulongne, Vincent; Reynes, Jacques; Cartron, Guillaume; Vendrell, Jean-Pierre; Van de Perre, Philippe; Tuaillon, Edouard
2014-05-01
Epstein-Barr virus (EBV) genome quantitation in whole blood is used widely for therapeutic monitoring of EBV-associated disorders in immunosuppressed individuals and in patients with EBV-associated lymphoma. However, the most appropriate biological material to be used for EBV DNA quantitation remains a subject of debate. This study compare the detection rate and levels of EBV DNA from whole blood, plasma, enriched B-cells, and B-cell short-term culture supernatant using quantitative real-time PCR. Samples were collected from 33 subjects with either HIV infection or B-cell lymphoma. Overall, EBV DNA was detected in 100% of enriched B-cell samples, in 82% of B-cell culture supernatants, in 57% of plasma, and 42% of whole blood samples. A significant correlation for EBV viral load was found between enriched B-cell and B-cell culture supernatant material (ρ = 0.92; P cells (ρ = -0.02; P = 0.89), whole blood and plasma (ρ = 0.24; P = 0.24), or enriched B-cells and plasma (ρ = 0.08; P = 0.77). Testing of enriched B-cells appeared to be the most sensitive method for detection of EBV DNA as well as for exploration of the cellular reservoir. Quantitation of EBV DNA in plasma and B-cell culture supernatant may be of interest to assess EBV reactivation dynamics and response to treatment as well as to decipher EBV host-pathogen interactions in various clinical scenarios. © 2013 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Huget, R.P.; Flad, H.D.; Opitz, H.G.
1977-01-01
L1210 cells and their culture supernatants were found to inhibit the generation of PFC in the in vitro primary immune response of spleen cells to SRBC. As few as 1 percent of L1210 cells and 1 percent of culture fluid were inhibitory. Inhibition of DNA or protein synthesis of L1210 cells did not abolish their immunosuppressive activity, excluding exhaustion of culture medium as a possible mechanism of inhibition of PFC. Heating of the supernatant completely abrogated the suppressive effect and resulted in a marked increase of PFC. Daily evaluation of cell viability in the cultures revealed that, in the presence of L1210 and supernatants, the fraction of surviving cells is markedly reduced. We conclude that a direct cytotoxic effect on splenic lymphocytes and macrophages is the predominant immunosuppressive mechanism of L1210 cells and their culture supernatants
McKeever, P E; Wahl, R L; Shakui, P; Jackson, G A; Letica, L H; Liebert, M; Taren, J A; Beierwaltes, W H; Hoff, J T
1990-06-01
To test the feasibility of primary screening of hybridoma supernatants against human glioma tissue, over 5000 combinations of hybridoma supernatants with glioma tissue, cultured glioma cells, and normal central neural tissue were screened with a new multiple-well (M-well) screening system. This is an immunoperoxidase assay system with visual endpoints for screening 20-30 hybridoma supernatants per single microscope slide. There were extensive differences between specificities to tissue and to cultured glioma cells when both were screened with M-wells and when cultured cells were screened with standard semi-automated fluorescence. Primary M-well screening with glioma tissue detected seven hybridoma supernatants that specifically identified parenchymal cells of glioma tissue and that were not detected with cultured cells. Immunoreactivities of individual supernatants for vascular components (nine supernatants), necrosis (five supernatants), and nuclei (three supernatants) were detected. Other supernatants bound multiple sites on glioma tissue and/or subpopulations of neurons and glia of normal tissue. The results show that primary screening with glioma tissue detects a number of different specificities of hybridoma supernatants to gliomas not detected by conventional screening with cultured cells. These are potentially applicable to diagnosis and therapy.
Matsuda, Yuko; Cho, Otomi; Sugita, Takashi; Ogishima, Daiki; Takeda, Satoru
2018-03-30
Vulvovaginal candidiasis (VVC) is a common superficial infection of the vaginal mucous membranes caused by the fungus Candida albicans. The aim of this study was to assess the mechanisms underlying the inhibitory effects of the culture supernatants of Lactobacillus gasseri and L. crispatus, the predominant microbiota in Asian healthy women, on C. albicans biofilm formation. The inhibition of C. albicans adhesion to HeLa cells by Lactobacillus culture supernatant was also investigated. Candida albicans biofilm was formed on polystyrene flat-bottomed 96-well plates, and the inhibitory effects on the initial colonization and maturation phases were determined using the XTT reduction assay. The expression levels of biofilm formation-associated genes (HWP1, ECE1, ALS3, BCR1, EFG1, TEC1, and CPH1) were determined by reverse transcription quantitative polymerase chain reaction. The inhibition of C. albicans adhesion to HeLa cells by Lactobacillus culture supernatant was evaluated by enumerating viable C. albicans cells. The culture supernatants of both Lactobacillus species inhibited the initial colonization and maturation of C. albicans biofilm. The expression levels of all biofilm formation-related genes were downregulated in the presence of Lactobacillus culture supernatant. The culture supernatant also inhibited C. albicans adhesion to HeLa cells. The culture supernatants of L. gasseri and L. crispatus inhibited C. albicans biofilm formation by downregulating biofilm formation-related genes and C. albicans adhesion to HeLa cells. These findings support the notion that Lactobacillus metabolites may be useful alternatives to antifungal drugs for the management of VVC.
Zhou, B; Tu, H L; Ba, T; Wang, L F; Wang, S J; Nie, S Y
2017-06-20
Objective: To explore the effects of combined application of culture supernatant of human umbilical cord mesenchymal stem cells (hUCMSCs) and ciprofloxacin on Staphylococcus aureus (SA) in vitro. Methods: hUCMSCs were isolated from umbilical cord tissue of full-term healthy fetus after cesarean section and cultured. Cells in the third passage were used in the experiments after identification. SA strains isolated from wounds of burn patients in our burn wards were used in the experiments. Cells were divided into 0, 10, 100, and 1 000 ng/mL lipopolysaccharide (LPS) groups according to the random number table (the same dividing method below). Cells were cultured with culture medium of mesenchymal stem cells (MSCs) after being treated with medium containing the corresponding mass concentrations of LPS for 12 h. At post culture hour (PCH) 6, 12, and 24, 6 wells of culture supernatant of cells in each group were obtained to measure the content of LL-37 with enzyme-linked immunosorbent assay. Ninety blood agar plates were divided into ciprofloxacin control group (CC), ciprofloxacin+ supernatant group (CS), and ciprofloxacin+ supernatant+ LL-37 antibody group (CSL), with 30 blood agar plates in each group. Blood agar plates in group CC were coated with 1.5×10(8) colony forming unit (CFU)/mL bacteria solution prepared with normal saline. Blood agar plates in group CS were coated with 1.5×10(8) CFU/mL bacteria solution prepared with normal saline and culture supernatant of hUCMSCs (cultured by culture medium of MSCs, the same below) in double volume of normal saline. Blood agar plates in group CSL were coated with 1.5×10(8) CFU/mL bacteria solution prepared with normal saline, culture supernatant of hUCMSCs in double volume of normal saline, and 2.6 μL LL-37 antibody in the concentration of 2 μg/mL. At PCH 12, 24, and 48, 10 blood agar plates of each group were harvested to observe the distribution of SA colony on blood agar plate and to measure the diameter of
Optimized exosome isolation protocol for cell culture supernatant and human plasma
Directory of Open Access Journals (Sweden)
Richard J. Lobb
2015-07-01
Full Text Available Extracellular vesicles represent a rich source of novel biomarkers in the diagnosis and prognosis of disease. However, there is currently limited information elucidating the most efficient methods for obtaining high yields of pure exosomes, a subset of extracellular vesicles, from cell culture supernatant and complex biological fluids such as plasma. To this end, we comprehensively characterize a variety of exosome isolation protocols for their efficiency, yield and purity of isolated exosomes. Repeated ultracentrifugation steps can reduce the quality of exosome preparations leading to lower exosome yield. We show that concentration of cell culture conditioned media using ultrafiltration devices results in increased vesicle isolation when compared to traditional ultracentrifugation protocols. However, our data on using conditioned media isolated from the Non-Small-Cell Lung Cancer (NSCLC SK-MES-1 cell line demonstrates that the choice of concentrating device can greatly impact the yield of isolated exosomes. We find that centrifuge-based concentrating methods are more appropriate than pressure-driven concentrating devices and allow the rapid isolation of exosomes from both NSCLC cell culture conditioned media and complex biological fluids. In fact to date, no protocol detailing exosome isolation utilizing current commercial methods from both cells and patient samples has been described. Utilizing tunable resistive pulse sensing and protein analysis, we provide a comparative analysis of 4 exosome isolation techniques, indicating their efficacy and preparation purity. Our results demonstrate that current precipitation protocols for the isolation of exosomes from cell culture conditioned media and plasma provide the least pure preparations of exosomes, whereas size exclusion isolation is comparable to density gradient purification of exosomes. We have identified current shortcomings in common extracellular vesicle isolation methods and provide a
The effects of three types of macrophages culture supernatant on CFU-GM in irradiated mice
International Nuclear Information System (INIS)
Quan Hongxun; Fu Li; Zhao Fengchen; Han Fen
2008-01-01
Objective: To study the effects of peritional macrophyge(PM), alveolar macrophage (AM), and Kupffer cell (KC) on colony forming unite granulacyte/macrophage (CFU -GM) in irradiated mice. Methods: Using techniques of hemopoietic progenitors in vitro, the authors studied the effects of three types of macrophages culture supernatant on CFU - GM. Results: It is shown that three types of macrophages culture supernatant may stimulate proliferation and differentiation of CFU-GM in irradiated mice, and KC is the best one in comparison to others. Conclusion: three types of macrophages culture supernatant may protect CFU-GM irradiated mice with KC being the best method. (authors)
Hadj-Romdhane, F.; Zheng, Xing; Jaouen, Pascal; Pruvost, Jé ré my; Grizeau, Dominique; Croue, Jean-Philippe; Bourseau, Patrick
2013-01-01
Reusing supernatant of microalgae culture medium can have inhibitory or toxic effects on the biomass production because of the release of organic metabolites by cells in the culture medium during their growth. This work investigated the impact of Chlorella vulgaris medium recycling on culture productivity, cells quality and accumulation of excreted metabolites in the culture medium. No significant impact on the C. vulgaris growth was observed after 63days of recycling, the productivity remained stable at around 0.55kgm-3day-1. Organic matters accumulated in supernatant were identified as biopolymers (BP) poor in nitrogen and with a size above 40kDa (probably polysaccharides), and small organic molecules (SOM) richer in nitrogen with a molecular size ranging from 1 to 3kDa. The concentration of biopolymers in the supernatant increased till to a maximum and then decreased, possibly consumed by bacteria, whereas small organic compounds accumulated in the medium. © 2013 Elsevier Ltd.
Hadj-Romdhane, F.
2013-03-01
Reusing supernatant of microalgae culture medium can have inhibitory or toxic effects on the biomass production because of the release of organic metabolites by cells in the culture medium during their growth. This work investigated the impact of Chlorella vulgaris medium recycling on culture productivity, cells quality and accumulation of excreted metabolites in the culture medium. No significant impact on the C. vulgaris growth was observed after 63days of recycling, the productivity remained stable at around 0.55kgm-3day-1. Organic matters accumulated in supernatant were identified as biopolymers (BP) poor in nitrogen and with a size above 40kDa (probably polysaccharides), and small organic molecules (SOM) richer in nitrogen with a molecular size ranging from 1 to 3kDa. The concentration of biopolymers in the supernatant increased till to a maximum and then decreased, possibly consumed by bacteria, whereas small organic compounds accumulated in the medium. © 2013 Elsevier Ltd.
Hahn, Hans; Huck, Christian W; Rainer, Matthias; Najam-ul-Haq, Muhammad; Bakry, Rania; Abberger, Thomas; Jennings, Paul; Pfaller, Walter; Bonn, Günther K
A simple and highly effective reversed-phase (RP) high-performance liquid chromatography (HPLC) method is described for analysing glutathione (GSH) and glutathione disulfide (GSSG) in out-flowing supernatants and lysates of perfusion cell cultures of human kidney cells (HK-2 cells) continuously
Chorianopoulos, Nikos G; Giaouris, Efstathios D; Kourkoutas, Yiannis; Nychas, George-John E
2010-03-01
Compounds present in Hafnia alvei cell-free culture supernatant cumulatively negatively influence the early stage of biofilm development by Salmonella enterica serovar Enteritidis on stainless steel while they also reduce the overall metabolic activity of S. Enteritidis planktonic cells. Although acylhomoserine lactones (AHLs) were detected among these compounds, the use of several synthetic AHLs was not able to affect the initial stage of biofilm formation by this pathogen.
Bermudez-Brito, Miriam; Muñoz-Quezada, Sergio; Gomez-Llorente, Carolina; Matencio, Esther; Bernal, Maria J; Romero, Fernando; Gil, Angel
2013-01-01
Dendritic cells (DCs) constitute the first point of contact between gut commensals and our immune system. Despite growing evidence of the immunomodulatory effects of probiotics, the interactions between the cells of the intestinal immune system and bacteria remain largely unknown. Indeed,, the aim of this work was to determine whether the probiotic Bifidobacterium breve CNCM I-4035 and its cell-free culture supernatant (CFS) have immunomodulatory effects in human intestinal-like dendritic cells (DCs) and how they respond to the pathogenic bacterium Salmonella enterica serovar Typhi, and also to elucidate the molecular mechanisms involved in these interactions. Human DCs were directly challenged with B. breve/CFS, S. typhi or a combination of these stimuli for 4 h. The expression pattern of genes involved in Toll-like receptor (TLR) signaling pathway and cytokine secretion was analyzed. CFS decreased pro-inflammatory cytokines and chemokines in human intestinal DCs challenged with S. typhi. In contrast, the B. breve CNCM I-4035 probiotic strain was a potent inducer of the pro-inflammatory cytokines and chemokines tested, i.e., TNF-α, IL-8 and RANTES, as well as anti-inflammatory cytokines including IL-10. CFS restored TGF-β levels in the presence of Salmonella. Live B.breve and its supernatant enhanced innate immune responses by the activation of TLR signaling pathway. These treatments upregulated TLR9 gene transcription. In addition, CFS was a more potent inducer of TLR9 expression than the probiotic bacteria in the presence of S. typhi. Expression levels of CASP8 and IRAK4 were also increased by CFS, and both treatments induced TOLLIP gene expression. Our results indicate that the probiotic strain B. breve CNCM I-4035 affects the intestinal immune response, whereas its supernatant exerts anti-inflammatory effects mediated by DCs. This supernatant may protect immune system from highly infectious agents such as Salmonella typhi and can down-regulate pro
Directory of Open Access Journals (Sweden)
Miriam Bermudez-Brito
Full Text Available Dendritic cells (DCs constitute the first point of contact between gut commensals and our immune system. Despite growing evidence of the immunomodulatory effects of probiotics, the interactions between the cells of the intestinal immune system and bacteria remain largely unknown. Indeed,, the aim of this work was to determine whether the probiotic Bifidobacterium breve CNCM I-4035 and its cell-free culture supernatant (CFS have immunomodulatory effects in human intestinal-like dendritic cells (DCs and how they respond to the pathogenic bacterium Salmonella enterica serovar Typhi, and also to elucidate the molecular mechanisms involved in these interactions. Human DCs were directly challenged with B. breve/CFS, S. typhi or a combination of these stimuli for 4 h. The expression pattern of genes involved in Toll-like receptor (TLR signaling pathway and cytokine secretion was analyzed. CFS decreased pro-inflammatory cytokines and chemokines in human intestinal DCs challenged with S. typhi. In contrast, the B. breve CNCM I-4035 probiotic strain was a potent inducer of the pro-inflammatory cytokines and chemokines tested, i.e., TNF-α, IL-8 and RANTES, as well as anti-inflammatory cytokines including IL-10. CFS restored TGF-β levels in the presence of Salmonella. Live B.breve and its supernatant enhanced innate immune responses by the activation of TLR signaling pathway. These treatments upregulated TLR9 gene transcription. In addition, CFS was a more potent inducer of TLR9 expression than the probiotic bacteria in the presence of S. typhi. Expression levels of CASP8 and IRAK4 were also increased by CFS, and both treatments induced TOLLIP gene expression. Our results indicate that the probiotic strain B. breve CNCM I-4035 affects the intestinal immune response, whereas its supernatant exerts anti-inflammatory effects mediated by DCs. This supernatant may protect immune system from highly infectious agents such as Salmonella typhi and can down
Shankar, Jayendra; Walker, Rachel G; Wilkinson, Mark C; Ward, Deborah; Horsburgh, Malcolm J
2012-07-01
The culture supernatant fraction of an Enterococcus faecalis gelE mutant of strain OG1RF contained elevated levels of the secreted antigen SalB. Using differential fluorescence gel electrophoresis (DIGE) the salB mutant was shown to possess a unique complement of exoproteins. Differentially abundant exoproteins were identified using matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry. Stress-related proteins including DnaK, Dps family protein, SOD, and NADH peroxidase were present in greater quantity in the OG1RF salB mutant culture supernatant. Moreover, several proteins involved in cell wall synthesis and cell division, including d-Ala-d-Lac ligase and EzrA, were present in reduced quantity in OG1RF salB relative to the parent strain. The salB mutant displayed reduced viability and anomalous cell division, and these phenotypes were exacerbated in a gelE salB double mutant. An epistatic relationship between gelE and salB was not identified with respect to increased autolysis and cell morphological changes observed in the salB mutant. SalB was purified as a six-histidine-tagged protein to investigate peptidoglycan hydrolytic activity; however, activity was not evident. High-pressure liquid chromatography (HPLC) analysis of reduced muropeptides from peptidoglycan digested with mutanolysin revealed that the salB mutant and OG1RF were indistinguishable.
Directory of Open Access Journals (Sweden)
Perno Carlo
2002-09-01
Full Text Available Abstract Background Oxidative stress has shown to contribute in the mechanisms underlying apoptotic cell death occuring in AIDS-dementia complex. Here we investigated the role of peroxynitrite in apoptosis occurring in astroglial cells incubated with supernatants of HIV-infected human primary macrophages (M/M. Results Flow cytometric analysis (FACS of human cultured astrocytes shortly incubated with HIV-1-infected M/M supernatants showed apoptotic cell death, an effect accompanied by pronounced staining for nitrotyrosine (footprint of peroxynitrite and by abnormal formation of malondialdehyde (MDA. Pretreatment of astrocytes with the peroxynitrite decomposition catalyst FeTMPS antagonized HIV-related astrocytic apoptosis, MDA formation and nitrotyrosine staining. Conclusions Taken together, our results suggest that inibition of peroxynitrite leads to protection against peroxidative stress accompanying HIV-related apoptosis of astrocytes. Overall results support the role of peroxynitrite in HIV-related programmed death of astrocytes and suggest the use of peroxynitrite decomposition catalyst to counteract HIV-1-related neurological disorders.
Hatton, J. P.; Lewis, M. L.; Roquefeuil, S. B.; Chaput, D.; Cazenave, J. P.; Schmitt, D. A.
1998-01-01
The results of experiments performed in recent years on board facilities such as the Space Shuttle/Spacelab have demonstrated that many cell systems, ranging from simple bacteria to mammalian cells, are sensitive to the microgravity environment, suggesting gravity affects fundamental cellular processes. However, performing well-controlled experiments aboard spacecraft offers unique challenges to the cell biologist. Although systems such as the European 'Biorack' provide generic experiment facilities including an incubator, on-board 1-g reference centrifuge, and contained area for manipulations, the experimenter must still establish a system for performing cell culture experiments that is compatible with the constraints of spaceflight. Two different cell culture kits developed by the French Space Agency, CNES, were recently used to perform a series of experiments during four flights of the 'Biorack' facility aboard the Space Shuttle. The first unit, Generic Cell Activation Kit 1 (GCAK-1), contains six separate culture units per cassette, each consisting of a culture chamber, activator chamber, filtration system (permitting separation of cells from supernatant in-flight), injection port, and supernatant collection chamber. The second unit (GCAK-2) also contains six separate culture units, including a culture, activator, and fixation chambers. Both hardware units permit relatively complex cell culture manipulations without extensive use of spacecraft resources (crew time, volume, mass, power), or the need for excessive safety measures. Possible operations include stimulation of cultures with activators, separation of cells from supernatant, fixation/lysis, manipulation of radiolabelled reagents, and medium exchange. Investigations performed aboard the Space Shuttle in six different experiments used Jurkat, purified T-cells or U937 cells, the results of which are reported separately. We report here the behaviour of Jurkat and U937 cells in the GCAK hardware in ground
Zhang, Wenling; Deng, Xiaohong; Zhou, Xuedong; Hao, Yuqing; Li, Yuqing
2018-01-01
Dental caries is a chronic progressive disease occurring in the tooth hard tissue due to multiple factors, in which bacteria are the initial cause. Both Streptococcus mutans and Streptococcus sanguinis are main members of oral biofilm. Helicobacter pylori may also be detected in dental plaque, playing an important role in the development of dental caries. The aim of this study was to investigate the effect of H. pylori culture supernatant on S. mutans and S. sanguinis dual-species biofilm and to evaluate its potential ability on affecting dental health. The effect of H. pylori supernatant on single-species and dual-species biofilm was measured by colony forming units counting and fluorescence in situ hybridization (FISH) assay, respectively. The effect of H. pylori supernatant on S. mutans and S. sanguinis extracellular polysaccharides (EPS) production was measured by both confocal laser scanning microscopy observation and anthrone-sulfuric acid method. The effect of H. pylori supernatant on S. mutans gene expression was measured by quantitative real-time PCR (qRT-PCR) assays. H. pylori supernatant could inhibit both S. mutans and S. sanguinis biofilm formation and EPS production. S. sanguinis inhibition rate was significantly higher than that of S. mutans. Finally, S. mutans bacteriocin and acidogenicity related genes expression were affected by H. pylori culture supernatant. Our results showed that H. pylori could destroy the balance between S. mutans and S. sanguinis in oral biofilm, creating an advantageous environment for S. mutans, which became the dominant bacteria, promoting the formation and development of dental caries.
Directory of Open Access Journals (Sweden)
Wenling Zhang
2018-02-01
Full Text Available Abstract Dental caries is a chronic progressive disease occurring in the tooth hard tissue due to multiple factors, in which bacteria are the initial cause. Both Streptococcus mutans and Streptococcus sanguinis are main members of oral biofilm. Helicobacter pylori may also be detected in dental plaque, playing an important role in the development of dental caries. Objective The aim of this study was to investigate the effect of H. pylori culture supernatant on S. mutans and S. sanguinis dual-species biofilm and to evaluate its potential ability on affecting dental health. Material and methods The effect of H. pylori supernatant on single-species and dual-species biofilm was measured by colony forming units counting and fluorescence in situ hybridization (FISH assay, respectively. The effect of H. pylori supernatant on S. mutans and S. sanguinis extracellular polysaccharides (EPS production was measured by both confocal laser scanning microscopy observation and anthrone-sulfuric acid method. The effect of H. pylori supernatant on S. mutans gene expression was measured by quantitative real-time PCR (qRT-PCR assays. Results H. pylori supernatant could inhibit both S. mutans and S. sanguinis biofilm formation and EPS production. S. sanguinis inhibition rate was significantly higher than that of S. mutans. Finally, S. mutans bacteriocin and acidogenicity related genes expression were affected by H. pylori culture supernatant. Conclusion Our results showed that H. pylori could destroy the balance between S. mutans and S. sanguinis in oral biofilm, creating an advantageous environment for S. mutans, which became the dominant bacteria, promoting the formation and development of dental caries.
Monggoot, Sakon; Kulsing, Chadin; Wong, Yong Foo; Pripdeevech, Patcharee
2018-06-01
Incubation with microbial culture supernatants improved essential oil yield from Aquilaria subintegra woodchips. The harvested woodchips were incubated with de man, rogosa and sharpe (MRS) agar, yeast mold (YM) agar medium and six different microbial culture supernatants obtained from Lactobacillus bulgaricus , L. acidophilus , Streptococcus thermophilus , Lactococcus lactis , Saccharomyces carlsbergensis and S. cerevisiae prior to hydrodistillation. Incubation with lactic acid bacteria supernatants provided higher yield of agarwood oil (0.45% w/w) than that obtained from yeast (0.25% w/w), agar media (0.23% w/w) and water (0.22% w/w). The composition of agarwood oil from all media and microbial supernatant incubations was investigated by using gas chromatography-mass spectrometry. Overall, three major volatile profiles were obtained, which corresponded to water soaking (control), as well as, both YM and MRS media, lactic acid bacteria, and yeast supernatant incubations. Sesquiterpenes and their oxygenated derivatives were key components of agarwood oil. Fifty-two volatile components were tentatively identified in all samples. Beta-agarofuran, α-eudesmol, karanone, α-agarofuran and agarospirol were major components present in most of the incubated samples, while S. cerevisiae -incubated A. subintegra provided higher amount of phenyl acetaldehyde. Microbial culture supernatant incubation numerically provided the highest yield of agarwood oil compared to water soaking traditional method, possibly resulting from activity of extracellular enzymes produced by the microbes. Incubation of agarwood with lactic acid bacteria supernatant significantly enhanced oil yields without changing volatile profile/composition of agarwood essential oil, thus this is a promising method for future use.
Qin, Ying-Song; Zhang, X U; Zhang, Xiang-Yu
2015-07-01
The development of immunological therapies for melanoma has been of considerable concern in recent years. Whole tumor cell lysates have been used to develop antitumor vaccines, but the effective components of the lysates have not been identified. In the present study, protein elements were purified from the B16 supernatant to analyze the in vitro chemotaxis towards mouse spleen lymphocytes using a Boyden chamber. Prior to establishing a B16 melanoma model, C57BL/6 mice were vaccinated with these proteins, and melanoma growth, tumor appearance time and behavioral changes were observed. Next, the cytotoxicity and subsets of the tumor infiltrating lymphocytes, and the histological characteristics of the melanoma were analyzed. The isolated purified fragments of B16 melanoma culture supernatant had strong antitumor effects. The possible antitumor mechanism was delineated, and was identified to possibly be through the activation of cluster of differentiation 8-positive T cells and the promotion of B16 cell differentiation. These methods will provide a novel insight into understanding antitumor immunological mechanisms and provide a potential avenue for immunotherapy.
Vickstrom, Kyle E; Azizian, Mohammad F; Semprini, Lewis
2017-09-01
Carbon tetrachloride (CT) and chloroform (CF) were transformed in batch reactor experiments conducted with anaerobic dechlorinating cultures and supernatant (ADC + S) harvested from continuous flow reactors. The Evanite (EV) and Victoria/Stanford (VS) cultures, capable of respiring trichloroethene (TCE), 1,2-cis-dichloroethene (cDCE), and vinyl chloride (VC) to ethene (ETH), were grown in continuous flow reactors receiving an influent feed of saturated TCE (10 mM; 60 mEq) and formate (45 mM; 90 mEq) but no CT or CF. Cells and supernatant were harvested from the chemostats and inoculated into batch reactors at the onset of each experiment. CT transformation was complete following first order kinetics with CF, DCM and CS 2 as the measurable transformation products, representing 20-40% of the original mass of CT, with CO 2 likely the unknown transformation product. CF was transformed to DCM and likely CO 2 at an order of magnitude rate lower than CT, while DCM was not further transformed. An analytical first order model including multiple key reactions effectively simulated CT transformation, product formation and transformation, and provided reasonable estimates of transformation rate coefficients. Biotic and abiotic treatments indicated that CT was mainly transformed via abiotic processes. However, the presence of live cells was associated with the transformation of CF to DCM. In biotic tests both TCE and CT were simultaneously transformed, with TCE transformed to ETH and approximately 15-53% less CF formed via CT transformation. A 14-day exposure to CF (CF max = 1.4 μM) reduced all rates of chlorinated ethene respiration by a factor of 10 or greater. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Hirschberg, A.; Thorsby, E.
1977-01-01
A micromethod for the 51 Cr release assay is described. Allogeneically induced cytotoxic lymphocytes are generated in mixed lymphocyte microcultures in the wells of microplates. Their cytotoxic capacity is assayed by adding 51 Cr-labelled PHA derived lymphoblasts directly into the microcultures with no pooling or transfer of the cytotoxic effector cells being required. The 51 Cr isotope released into the cell supernatants is collected by inserting a cellulose acetate absorption cartridge into each well. A glass fiber filter attached to the cartridge effectively separates the supernatant from the cellular elemets. This system allows the simultaneous collection of the supernatant from 96 wells, and can be used with either adherent or non-adherent target cells
Brown, Monica; Postlethwaite, Arnold E; Myers, Linda K; Hasty, Karen A
2012-06-01
Systemic sclerosis (SSc) is a chronic fibrosing disease characterized by vasculopathy, autoimmunity, and an accumulation of collagen in tissues. Numerous studies have shown that compared to healthy or diseased controls, the peripheral blood mononuclear cells (PBMC) from patients with SSc produce a variety of cytokines or proliferate when cultured with solubilized type I collagen (CI) or constituent α1(II) and α2(I) polypeptide chains. The purpose of this study was to determine whether PBMC isolated from patients with SSc and cultured in vitro with soluble CI elaborated soluble mediators that inhibit the production of collagenase (i.e., matrix metalloproteinase, MMP-1) by fibroblasts. Supernatants of CI-stimulated PBMC from juvenile and adult diffuse cutaneous (dc)SSc patients significantly reduced MMP-1 production by SSc dermal fibroblasts, while supernatants of CI-stimulated PBMC from patients with localized scleroderma (LS) did not. CI-stimulated PBMC culture supernatants from patients with dcSSc in contrast to patients with LS exhibited increased levels of platelet-derived growth factor (PDGF)-AA, PDGF-BB, TNF-α, IL-13, and EGF. Prolonged culture of SSc dermal fibroblasts with recombinant PDGF-BB or IL-13 inhibited the induction of MMP-1 in response to subsequent TNF-α stimulation. These data suggest that therapies aimed at reducing these cytokines may decrease collagen accumulation in SSc, preventing the development of chronic fibrosis.
Directory of Open Access Journals (Sweden)
Nawrocki-Raby Béatrice
2010-01-01
Full Text Available Abstract Background Staphylococcus aureus releases virulence factors (VF that may impair the innate protective functions of airway cells. The aim of this study was to determine whether a long-acting β2 adrenergic receptor agonist (salmeterol hydroxynaphthoate, Sal combined with a corticosteroid (fluticasone propionate, FP was able to regulate ion content and cytokine expression by airway glandular cells after exposure to S. aureus supernatant. Methods A human airway glandular cell line was incubated with S. aureus supernatant for 1 h and then treated with the combination Sal/FP for 4 h. The expression of actin and CFTR proteins was analyzed by immunofluorescence. Videomicroscopy was used to evaluate chloride secretion and X-ray microanalysis to measure the intracellular ion and water content. The pro-inflammatory cytokine expression was assessed by RT-PCR and ELISA. Results When the cells were incubated with S. aureus supernatant and then with Sal/FP, the cellular localisation of CFTR was apical compared to the cytoplasmic localisation in cells incubated with S. aureus supernatant alone. The incubation of airway epithelial cells with S. aureus supernatant reduced by 66% the chloride efflux that was fully restored by Sal/FP treatment. We also observed that Sal/FP treatment induced the restoration of ion (Cl and S and water content within the intracellular secretory granules of airway glandular cells and reduced the bacterial supernatant-dependent increase of pro-inflammatory cytokines IL8 and TNFα. Conclusions Our results demonstrate that treatment with the combination of a corticosteroid and a long-acting β2 adrenergic receptor agonist after bacterial infection restores the airway glandular cell function. Abnormal mucus induced by defective ion transport during pulmonary infection could benefit from treatment with a combination of β2 adrenergic receptor agonist and glucocorticoid.
Vidal, Jorge E; Enríquez-Rincón, Fernando; Giono-Cerezo, Silvia; Ribas-Aparicio, Rosa María; Figueroa-Arredondo, Paula
2009-01-01
To investigate whether the HlyA-induced vacuolating effect is produced by V. cholerae O1 ElTor strains isolated from different geographic origins, including Mexico. Supernatant-induced haemolysis, vacuolating activity and cytotoxicity in Vero cells were recorded. PCR, RFLP analysis and molecular cloning were performed. All ElTor strains analyzed induced cellular vacuolation. Ribotype 2 strains isolates from the U.S. gulf coast yielded the highest titer of vacuolating activity. Eight of nine strains were haemolytic, while all strains were PCR positive for the hlyA gene. We cloned the hlyA gene from two ElTor strains, a toxigenic (2514-88, ctxAB+) and a non-toxigenic Mexican strain (CM 91-3, ctxAB-). Supernatant from those recombinant E. coli strains induced haemolysis, cell vacuolation and cytotoxicity. RFLP-PCR analysis revealed similarities in the hlyA gene from all strains tested. The HlyA-induced vacuolating effect is a widespread phenotype of epidemic V. cholerae O1 ElTor strains.
Lee, Jin Ju; Lim, Jeong Ju; Kim, Dae Geun; Simborio, Hannah Leah; Kim, Dong Hyeok; Reyes, Alisha Wehdnesday Bernardo; Min, WonGi; Lee, Hu Jang; Kim, Dong Hee; Chang, Hong Hee; Kim, Suk
2014-09-01
In this study, we characterized the secreted proteins of Brucella abortus into the enriched media under the bacterial laboratory growth condition and investigated the pathogenic importance of culture supernatant (CS) proteins to B. abortus infection. CS proteins from stationary phase were concentrated and analyzed using 2D electrophoresis. In MALDI TOF/TOF analysis, more than 27 proteins including CuZn SOD, Dps, Tat, OMPs, Adh, LivF, Tuf, SucC, GroEL and DnaK were identified. Cytotoxic effects of CS proteins were found to increase in a dose-dependent manner in RAW 264.7 cells. Upon B. abortus challenge into phagocytes, however, CS proteins pre-treated cells exhibited lower bacterial uptake and intracellular replication compared to untreated cells. Immunization with CS proteins induced a strong humoral and cell mediated immune responses and exhibited significant higher degree of protection against virulence of B. abortus infection compared to mice immunized with Brucella broth protein (BBP). Taken together, these results indicate that B. abortus secreted a number of soluble immunogenic proteins under laboratory culture condition, which can promote antibody production resulted in enhancing host defense against to subsequently bacterial infection. Moreover, further analysis of CS proteins may help to understand the pathogenic mechanism of B. abortus infection and host-pathogen interaction. Copyright © 2014 Elsevier Ltd. All rights reserved.
Effect of different stress factors on IL-6 and leptin expression in HELA cell cultures
International Nuclear Information System (INIS)
Chu Zhenwei; Yang Tao; Wang Luhuan; Hao Xiuhua; Yan Guangtao
2009-01-01
Objective: To study the effect of three stress factors high glucose (HG), lipopolysaccharide (LPS) and hydrogen peroxide (H 2 O 2 ) on the expression of culture supernatant IL-6 (IL-6) and leptin contents of HELA cell line. Methods: HELA cell culture models of severe inflammatory response syndrome were prepared with cultures treated with 50 mmol/L glucose (HG), 4 μg/ ml LPS and 100 μmol/L H 2 O 2 respectively and supernatant contents of IL-6 and leptin were measured with RIA at 1h, 6h and 24h. Results: Generally speaking, the culture supernatant contents of IL-6 gradually increased and leptin contents gradually decreased with significant differences from those in cultures not treated with either stress factor at 6h and 12h (P<0.05). Conclusion: Leptin as a possible anti-inflammatory cytokine might plays an important protective role in severe inflammatory response. (authors)
Castillo, Benjamín Moreno; Dunn, Michael F; Navarro, Karina Guillén; Meléndez, Francisco Holguín; Ortiz, Magdalena Hernández; Guevara, Sergio Encarnación; Palacios, Graciela Huerta
2016-03-01
The tropical and mycoparasite strain Streptomyces galilaeus CFFSUR-B12 was evaluated as an antagonist of Mycosphaerella fijiensis Morelet, causal agent of the Black Sigatoka Disease (BSD) of banana. On zymograms of CFFSUR-B12 culture supernatants, we detected four chitinases of approximately 32 kDa (Chi32), 20 kDa (Chi20), and two with masses well over 170 kDa (ChiU) that showed little migration during denaturing electrophoresis at different concentrations of polyacrylamide. The thymol-sulphuric acid assay showed that the ChiU were glycosylated chitinases. Moreover, matrix assisted laser desorption ionization time-of-flight MS analysis revealed that the ChiU are the same protein and identical to a family 18 chitinase from Streptomyces sp. S4 (gi|498328075). Chi32 was similar to an extracellular protein from Streptomyces albus J1074 (gi|478687481) and Chi20 was non-significantly similar to chitinases from five different strains of Streptomyces (P > 0.05). Subsequently, Chi32 and Chi20 were partially purified by anion exchange and hydrophobic interaction chromatography and tested against M. fijiensis. Chitinases failed to inhibit ascospore germination, but inhibited up to 35 and 62% of germ tube elongation and mycelial growth, respectively. We found that crude culture supernatant and living cells of S. galilaeus CFFSUR-B12 were the most effective in inhibiting M. fijiensis and are potential biocontrol agents of BSD.
Kim, Dong-Hyeon; Chon, Jung-Whan; Kang, Il-Byeong; Kim, Hyunsook; Kim, Hong-Seok; Song, Kwang-Young; Seo, Kun-Ho
2015-09-01
Kefir is a type of fermented milk containing lactic and acetic acid bacteria and yeast. In this study, we evaluated the antimicrobial activity of kefir supernatant against Cronobacter sakazakii in powdered infant formula (PIF). In a spot-on-lawn test, the growth of 20 C. sakazakii strains, including 10 clinical and 10 food isolates, was completely inhibited in the presence of kefir supernatant. Significant differences in the diameters of inhibition zones were observed upon treatment with kefir compared with the results for Lactobacillus kefiri and Candida kefyr culture supernatants or solutions of lactic and acetic acid and ethyl alcohol in the agar well diffusion test (P < 0.05). The addition of 100 μl of kefir supernatant to 1 ml of nutrient broth completely inhibited the growth of C. sakazakii, as evaluated by spectrophotometry. The antimicrobial activity of kefir supernatant in experimentally contaminated PIF was also tested; we found no viable C. sakazakii cells remaining in PIF rehydrated with 30% kefir supernatant solution for 1 h, demonstrating that the antimicrobial activity of kefir supernatant against C. sakazakii could be applied in real food samples.
A novel cell growth-promoting factor identified in a B cell leukemia cell line, BALL-1
International Nuclear Information System (INIS)
Dao, T.; Holan, V.; Minowada, J.
1993-01-01
A novel leukemia cell growth-promoting activity has been identified in the culture supernatant from a human B cell leukemia cell line, BALL-1. The supernatant from unstimulated cultures of the BALL-1 cells significantly promoted the growth of 16 out of 24 leukemia/lymphoma cell lines of different lineages (T, B and non-lymphoid) in a minimal concentration of fetal bovine serum (FBS), and 5 out of 12 cases of fresh leukemia cells in FBS-free medium. The growth-promoting sieve filtration and dialysis. The MW of the factor was less than 10 kDa. The growth-promoting activity was heat and acid stable and resistant to trypsin treatment. The factor isolated from the BALL-1 supernatant was distinct from known polypeptide growth factors with MW below 10 kDa, such as epidermal growth factor, transforming growth factor α, insulin-like growth factor I (IGF-I), IGF-II and insulin, as determine by specific antibodies and by cell-growth-promoting tests. The factor is the BALL-1 supernatant did not promote the proliferation of normal human fresh peripheral blood lymphocytes or mouse fibroblast cell line, BALB/C 3T3. In addition to the BALL-1 supernatant, a similar growth-promoting activity was found in the culture supernatant from 13 of 17 leukemia/lymphoma cell lines tested. The activity in these culture supernatant promoted the growth of leukemia/lymphoma cell lines in autocrine and/or paracrine fashions. These observations suggest that the low MW cell growth-promoting activity found in the BALL-1 culture supernatant is mediated by a novel factor which may be responsible for the clonal expansion of particular leukemic clones. (author)
Directory of Open Access Journals (Sweden)
Yoshiko Matsuda
2017-07-01
Full Text Available The recent attention given to diseases associated with memory B-cell (mBC-produced antibodies (Abs suggests the need for a similar in vitro assay to evaluate the functions of mBCs. Here, we cultured peripheral blood mononuclear cells (PBMCs with the intent to collect mBC-derived Abs in vitro and maintain their cell–cell contact-dependent interactions with helper T-cells. PBMCs were cultured with interleukin (IL-21, CpG-oligodeoxynucleotides (ODN, phorbol myristate acetate (PMA, and phytohemagglutinin/leucoagglutinin (PHA-L in 24-well flat-bottom plates (5 × 105 cells/well. A culture supernatant analysis of PBMCs from healthy donors (n = 10 indicated that antigen-specific IgM Ab levels in a PBMC culture supernatant might be better able to demonstrate the antigen sensitization status in a smaller peripheral blood sample, compared to IgG because Epstein–Barr virus-specific IgM mBCs circulate peripherally at a significantly higher frequency once antiviral humoral immunity has stabilized. Thus, our in vitro assay demonstrated the potential significance of antigen-specific IgM Ab production in the culture supernatants. Furthermore, an analysis of cultured PBMCs from allograft kidney recipients (n = 16 sensitized with de novo donor-specific human leukocyte antigen (HLA-specific Abs (DSAs showed that IgM-type HLA-specific Abs were detected mainly from the culture supernatants from PBMCs of patients with stable graft function, whereas IgG isotype HLA Abs were detectable only from patients with biopsy-proven antibody-mediated rejection. In other words, these IgG isotype Abs also represented an activated humoral immune response in vivo. Additionally, IgM- and IgG-expressing mBCs from healthy donors (n = 5 were cultured with IL-21, CpG-ODN, and a supernatant produced by stimulating CD19+ B-cell-depleted PBMCs with PHA-L and PMA in 24-well flat-bottom plates (1 × 105 cells/well, and the resulting in vitro analysis provided some
Amel, Ait Meddour; Farida, Bendali; Djamila, Sadoun
2015-07-01
It is demonstrated that numerous bacteria are able to attach to surfaces of equipment used for food handling or processing. In this study, a strain of Enterococcus durans, originally isolated from a milking machine surface, was firstly studied for its biofilm formation potential on plastic and stainless steel supports. The strain was found to be a biofilm producer either at 25, 30 or 37 °C on polystyrene microtitre plates, with a best adherence level observed at 25 °C. En. durans showed a strong adhesion to stainless steel AISI-304. Antibacterial and anti-adherence activities of En. durans were tested against four foodborne pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Listeria innocua CLIP 74915) which were shown as biofilm producers on both plastic and stainless steel. En. durans cells and cell-free culture supernatant showed a significant (P < 0.05) inhibition potential of the pathogens either on solid media or in broth co-cultures. Characterization of the antibacterial substances indicated their proteinaceous nature which assigned them most probably to bacteriocins group.
Contag, Christopher H.; Lie, Wen-Rong; Bammer, Marie C.; Hardy, Jonathan W.; Schmidt, Tobi L.; Maloney, William J.; King, Bonnie L.
2015-01-01
Purpose Bone is a preferential site of breast cancer metastasis and models are needed to study this process at the level of the microenvironment. We have used bioluminescence imaging (BLI) and multiplex biomarker immunoassays to monitor dynamic breast cancer cell behaviors in co-culture with human bone tissue. Procedures Femur tissue fragments harvested from hip replacement surgeries were co-cultured with luciferase-positive MDA-MB-231-fLuc cells. BLI was performed to quantify breast cell division and track migration relative to bone tissue. Breast cell colonization of bone tissues was assessed with immunohistochemistry. Biomarkers in co-culture supernatants were profiled with MILLIPLEX® immunoassays. Results BLI demonstrated increased MDA-MB-231-fLuc proliferation (pbones, and revealed breast cell migration toward bone. Immunohistochemistry illustrated MDA-MB-231-fLuc colonization of bone, and MILLIPLEX® profiles of culture supernatants suggested breast/bone crosstalk. Conclusions Breast cell behaviors that facilitate metastasis occur reproducibly in human bone tissue co-cultures and can be monitored and quantified using BLI and multiplex immunoassays. PMID:24008275
International Nuclear Information System (INIS)
Mokhtari, Narges; Daneshpajouh, Shahram; Seyedbagheri, Seyedali; Atashdehghan, Reza; Abdi, Khosro; Sarkar, Saeed; Minaian, Sara; Shahverdi, Hamid Reza; Shahverdi, Ahmad Reza
2009-01-01
This study has investigated different visible-light irradiation's effect on the formation of silver nanoparticles from silver nitrate using the culture supernatant of Klebsiella pneumonia. Our study shows that visible-light emission can significantly prompt the synthesis of silver nanoparticles. Also, the study experimentally investigated the liquid mixing process effect on silver nanoparticle synthesis by visible-light irradiation. This study successfully synthesized uniformly dispersed silver nanoparticles with a uniform size and shape in the range of 1-6 nm with an average size of 3 nm. Furthermore, the study investigated the mechanism of the reduction of silver ions by culture supernatant of K. pneumonia, and used X-ray diffraction to characterize silver chloride as an intermediate compound. Silver chloride was prepared synthetically and used as a substrate for the synthesis of silver nanoparticles by culture supernatant of K. pneumonia. The silver nanoparticles have been prepared from silver chloride during this investigation for the first time.
Energy Technology Data Exchange (ETDEWEB)
Mokhtari, Narges [Department of Pharmaceutical Biotechnology and Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Daneshpajouh, Shahram; Seyedbagheri, Seyedali; Atashdehghan, Reza [Hydrometallurgy Research Unit, Research and Development Center, National Iranian Copper Industries Company, Sarcheshmeh, Rafsanjan (Iran, Islamic Republic of); Abdi, Khosro [Department of Pharmaceutical Biotechnology and Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Sarkar, Saeed [Research Center for Science and Technology in Medicine, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Minaian, Sara [Department of Pharmaceutical Biotechnology and Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Shahverdi, Hamid Reza [Department of Material Science, Faculty of Engineering, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Shahverdi, Ahmad Reza, E-mail: shahverd@sina.tums.ac.ir [Department of Pharmaceutical Biotechnology and Biotechnology Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of)
2009-06-03
This study has investigated different visible-light irradiation's effect on the formation of silver nanoparticles from silver nitrate using the culture supernatant of Klebsiella pneumonia. Our study shows that visible-light emission can significantly prompt the synthesis of silver nanoparticles. Also, the study experimentally investigated the liquid mixing process effect on silver nanoparticle synthesis by visible-light irradiation. This study successfully synthesized uniformly dispersed silver nanoparticles with a uniform size and shape in the range of 1-6 nm with an average size of 3 nm. Furthermore, the study investigated the mechanism of the reduction of silver ions by culture supernatant of K. pneumonia, and used X-ray diffraction to characterize silver chloride as an intermediate compound. Silver chloride was prepared synthetically and used as a substrate for the synthesis of silver nanoparticles by culture supernatant of K. pneumonia. The silver nanoparticles have been prepared from silver chloride during this investigation for the first time.
Directory of Open Access Journals (Sweden)
Ricardo Chaves Vilela
2013-02-01
Full Text Available Trichomonas vaginalis and Tritrichomonas foetus are parasitic protists of the human and bovine urogenital tracts, respectively. Several studies have described the cytotoxic effects of trichomonads on urogenital tract epithelial cells. However, little is known about the host cell response against trichomonads. The aim of this study was to determine whether T. foetus and T. vaginalis stimulated the release of the cytokine interleukin (IL-10 from cultured bovine epithelial cells. To characterise the inflammatory response induced by these parasites, primary cultures of bovine oviduct epithelial cells were exposed to either T. vaginalis or T. foetus. Within 12 h after parasite challenge, supernatants were collected and cytokine production was analysed. Large amounts of IL-10 were detected in the supernatants of cultures that had been stimulated with T. foetus. Interestingly, T. vaginalis induced only a small increase in the release of IL-10 upon exposure to the same bovine cells. Thus, the inflammatory response of the host cell is species-specific. Only T. foetus and not T. vaginalis induced the release of IL-10 by bovine oviduct epithelial cells.
International Nuclear Information System (INIS)
Haubner, Frank; Leyh, Michaela; Ohmann, Elisabeth; Pohl, Fabian; Prantl, Lukas; Gassner, Holger G
2013-01-01
The inflammatory response clinically observed after radiation has been described to correlate with elevated expression of cytokines and adhesion molecules by endothelial cells. Therapeutic compensation for this microvascular compromise could be an important approach in the treatment of irradiated wounds. Clinical reports describe the potential of adipose-derived stem cells to enhance wound healing, but the underlying cellular mechanisms remain largely unclear. Human dermal microvascular endothelial cells (HDMEC) and human adipose-derived stem cells (ASC) were cultured in a co-culture setting and irradiated with sequential doses of 2 to 12 Gy. Cell count was determined 48 h after radiation using a semi-automated cell counting system. Levels of interleukin-6 (IL-6), basic fibroblast growth factor (FGF), intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) were determined in the supernatants using enzyme-linked immunosorbent assay (ELISA). Irradiated HDMEC and ASC as well as non-irradiated co-cultures, HDMEC or ASC respectively were used as controls. Cell count was significantly reduced in irradiated co-cultures of HDMEC and ASC compared to non-irradiated controls. Levels of IL-6, FGF, ICAM-1 and VCAM-1 in the supernatants of the co-cultures were significantly less affected by external radiation in comparison to HDMEC. The increased expression of cytokines and adhesion molecules by HDMEC after external radiation is mitigated in the co-culture setting with ASC. These in vitro changes seem to support the clinical observation that ASC may have a stabilizing effect when injected into irradiated wounds
Krüger-Genge, A; Fuhrmann, R; Jung, F; Franke, R P
2015-01-01
The evaluation of the interaction of human, venous endothelial cells (HUVEC) with body foreign materials on the cellular level cannot be performed in vivo, but is investigated in vitro under standard culture conditions. To maintain the vitality, proliferation and morphology of HUVEC seeded on body foreign substrates over days, the cell culture medium is usually exchanged every second day. It is well known, that alterations in the microenvironment of cells bear the risk of influencing cell morphology and function. In the current study the influence of cell culture medium exchange on HUVEC cytoskeletal microfilament structure and function was investigated. HUVEC in the third passage were seeded on extracellular matrix (ECM) - which was secreted from bovine corneal endothelial cells on glass- until functional confluence was reached. The experiment started 11 days after HUVEC seeding with an exchange of the cell culture medium followed by a staining of the actin microfilaments with phalloidin-rhodamin 1.5 and 5 minutes after medium exchange. The microfilaments were documented by use of an Olympus microscope (IMT-2) equipped with a UV lamp and online connected to a TV chain (Sony XC 50 ST/monochrome) implying an OPTIMAS - Image analysis system. Prostacyclin was analysed in the cell culture supernatant. 1.5 min after culture medium exchange in the functionally confluent cultures a slight disturbance of the actin microfilament structure with a broadening of the marginal filament band, a partial disconnection of cell-cell contacts and the appearance of intercellular fenestrations were observed. 5 minutes after medium exchange a redevelopment of the slightly disturbed microfilament structure with a condensation and narrowing of the marginal filament band was seen. 12 h later a further consolidation of the microfilament structure occurred. In addition, a perturbation of the cultured HUVEC occurred after cell culture medium exchange. The prostacyclin concentration in the
Cell culture plastics with immobilized interleukin-4 for monocyte differentiation
DEFF Research Database (Denmark)
Hansen, Morten; Hjortø, Gertrud Malene; Met, Ozcan
2011-01-01
in water instead of phosphate-buffered saline. Passively adsorbed IL-4 was observed to induce differentiation to dendritic cells, but analysis of cell culture supernatants revealed that leakage of IL-4 into solution could account for the differentiation observed. Covalent attachment resulted in bound IL-4...... at similar concentrations to the passive adsorption process, as measured by enzyme-linked immunosorbent assays, and the bound IL-4 did not leak into solution to any measurable extent during cell culture. However, covalently bound IL-4 was incapable of inducing monocyte differentiation. This may be caused...
Aranha, Clara; Natraj, Usha; Iyer, K. S.; Shahani, Savitri
1998-01-01
Purpose:Our purpose was to determine whether lymphocytes synthesize proteins during pregnancy, to observe whether one of the proteins synthesized has early pregnancy factor (EPF)–like activity and to isolate and purify this molecule from culture supernatants obtained from stimulated lymphocytes of pregnant women.
Cell culture supernatants for detection perforin ELISA
African Journals Online (AJOL)
Najwa
2014-02-19
Feb 19, 2014 ... Leukemia is a cancer originating in any of hematopoietic cell that tends to ... treatment of children (Borek and Jaskolski, 2001). The current study was .... which led to the best results at 48 h of exposure than after 72 h of cells ...
Wenling Zhang; Xiaohong Deng; Xuedong Zhou; Yuqing Hao; Yuqing Li
2018-01-01
Abstract Dental caries is a chronic progressive disease occurring in the tooth hard tissue due to multiple factors, in which bacteria are the initial cause. Both Streptococcus mutans and Streptococcus sanguinis are main members of oral biofilm. Helicobacter pylori may also be detected in dental plaque, playing an important role in the development of dental caries. Objective The aim of this study was to investigate the effect of H. pylori culture supernatant on S. mutans and S. sanguinis dual...
Han, Nannan; Zhang, Zun; Jv, Houyu; Hu, Jingzhou; Ruan, Min; Zhang, Chenping
2018-06-05
The aim of the present study was to investigate whether tumor-derived supernatants down-regulate the immune function of plasmacytoid dendritic cells (pDCs) in oral cancer and the potential molecular mechanisms of this effect. Immunohistochemistry (IHC) and flow cytometry were used to detect tumor-infiltrating and peripheral blood pDCs. MTS and flow cytometry were employed to evaluate the immune response of CD4 + T cells. Real-time PCR and ELISA assays were used to identify TLR-7 and TLR-9 expression, IFN-α production and tumor-secreted soluble cytokines. The proportion of pDCs (0.121%±0.043%) was significantly higher in Oral squamous cell carcinoma (OSCC) samples than in normal tissue (0.023%±0.016%) (P = 0.021). TLR9 mRNA was significantly lower in tumor-infiltrating pDCs and positively correlated to low IFN-α production (r = 0.956; Poral cancer cells negatively regulated TLR9 mRNA expression and the subsequent IFN-α production of pDCs, which inhibited the immune response of CD4 + T cells. The neutralizing antibodies blocking assay showed that the specific inhibitory effect of pDC functionality was associated with the soluble fraction of the oral cancer environment, which is mainly mediated by IL-10 and TGF-β cooperation. Tumor-derived supernatants may impair the function of tumor-infiltrating pDCs, which subsequently decreases the immune response of CD4 + T cells in human oral cancer through TGF-β- and IL-10- dependent mechanisms. Careful manipulation of these impaired pDCs may help develop an important alternative immunotherapy for the treatment of oral cancer. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Na Di
2012-04-01
Full Text Available Abstract Background In this study, we examined effects of soluble factors released by gastric cancer cells on peritoneal mesothelial cells in vitro and in vivo. Methods HMrSV5, a human peritoneal mesothelial cell line, was incubated with supernatants from gastric cancer cells. Morphological changes of HMrSV5 cells were observed. Apoptosis of HMrSV5 cells was observed under a transmission electron microscope and quantitatively determined by MTT assay and flow cytometry. Expressions of apoptosis-related proteins (caspase-3, caspase-8, Bax, bcl-2 were immunochemically evaluated. Results Conspicuous morphological changes indicating apoptosis were observed in HMrSV5 cells 24 h after treatment with the supernatants of gastric cancer cells. In vivo, peritoneal tissues treated with gastric cancer cell supernatant were substantially thickened and contained extensive fibrosis. Conclusions These findings demonstrate that supernatants of gastric cancer cells can induce apoptosis and fibrosis in HMrSV5 human peritoneal mesothelial cells through supernatants in the early peritoneal metastasis, in a time-dependent manner, and indicate that soluble factors in the peritoneal cavity affect the morphology and function of mesothelial cells so that the resulting environment can become favorable to peritoneal metastases.
Gool, van M.P.; Toth, K.; Schols, H.A.; Szakacs, G.; Gruppen, H.
2012-01-01
Filamentous fungi are a good source of hemicellulolytic enzymes for biomass degradation. Enzyme preparations were obtained as culture supernatants from 78 fungal isolates grown on wheat straw as carbon source. These enzyme preparations were utilized in the hydrolysis of insoluble wheat straw and
Cell culture plastics with immobilized interleukin-4 for monocyte differentiation
DEFF Research Database (Denmark)
Hansen, Morten; Hjortø, Gertrud Malene; Met, Özcan
2011-01-01
Standard cell culture plastic was surface modified by passive adsorption or covalent attachment of interleukin (IL)-4 and investigated for its ability to induce differentiation of human monocytes into mature dendritic cells, a process dose-dependently regulated by IL-4. Covalent attachment of IL-4...... in water instead of phosphate-buffered saline. Passively adsorbed IL-4 was observed to induce differentiation to dendritic cells, but analysis of cell culture supernatants revealed that leakage of IL-4 into solution could account for the differentiation observed. Covalent attachment resulted in bound IL-4...... at similar concentrations to the passive adsorption process, as measured by enzyme-linked immunosorbent assays, and the bound IL-4 did not leak into solution to any measurable extent during cell culture. However, covalently bound IL-4 was incapable of inducing monocyte differentiation. This may be caused...
González, O A; Ebersole, J L; Huang, C B
2010-04-01
Bacterial and host cell products during coinfections of Human Immunodeficiency Virus type 1-positive (HIV-1(+)) patients regulate HIV-1 recrudescence in latently infected cells (e.g. T cells, monocytes/macrophages), impacting highly active antiretroviral therapy (HAART) failure and progression of acquired immunodeficiency syndrome. A high frequency of oral opportunistic infections (e.g. periodontitis) in HIV-1(+) patients has been demonstrated; however, their potential to impact HIV-1 exacerbation is unclear. We sought to determine the ability of supernatants derived from oral epithelial cells (OKF4) and human gingival fibroblasts (Gin-4) challenged with periodontal pathogens, to modulate the HIV-1 promoter activation in monocytes/macrophages. BF24 monocytes/macrophages transfected with the HIV-1 promoter driving the expression of chloramphenicol acetyltransferase (CAT) were stimulated with Porphyromonas gingivalis, Fusobacterium nucleatum, or Treponema denticola in the presence of supernatants from OKF4 or Gin4 cells either unstimulated or previously pulsed with bacteria. CAT levels were determined by enzyme-linked immunosorbent assay and cytokine production was evaluated by Luminex beadlyte assays. OKF4 and Gin4 supernatants enhanced HIV-1 promoter activation particularly related to F. nucleatum challenge. An additive effect was observed in HIV-1 promoter activation when monocytes/macrophages were simultaneously stimulated with gingival cell supernatants and bacterial extracts. OKF4 cells produced higher levels of granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukins -6 and -8 in response to F. nucleatum and P. gingivalis. Preincubation of OKF4 supernatants with anti-GM-CSF reduced the additive effect in periodontopathogen-induced HIV-1 promoter activation. These results suggest that soluble mediators produced by gingival resident cells in response to periodontopathogens could contribute to HIV-1 promoter activation in monocytes
Kepenekci, Ilker; Hazir, Selcuk; Lewis, Edwin E
2016-02-01
The suppressive effects of various formulations of four entomopathogenic nematode (EPN) species and the supernatants of their mutualistic bacteria on the root-knot nematodes (RKNs) Meloidogyne incognita and M. arenaria in tomato roots were evaluated. The EPNs Steinernema carpocapsae, S. feltiae, S. glaseri and Heterorhabditis bacteriophora were applied as either live infective juveniles (IJs) or infected insect cadavers. Spent medium from culturing the bacterial symbionts Xenorhabdus bovienii and Photorhabdus luminescens kayaii with the cells removed was also applied without their nematode partners. The aqueous suspensions of IJs, infected cadaver applications of EPNs and especially treatments of X. bovienii supernatant suppressed the negative impact of RKNs on tomatoes. Specific responses to treatment were reduced RKN egg masses, increased plant height and increased fresh and dry weights compared with the control where only RKNs were applied. Among the treatments tested, the plant-dipping method of X. bovienii into bacterial culture fluid may be the most practical and effective method for M. incognita and M. arenaria control. © 2015 Society of Chemical Industry.
Evaluation of the Antibody in Lymphocyte Supernatant Assay to Detect Active Tuberculosis.
Directory of Open Access Journals (Sweden)
Margaretha Sariko
Full Text Available We aimed to evaluate the antibody in lymphocyte supernatant (ALS assay as a biomarker to diagnose tuberculosis among adults from Tanzania with and without HIV.Adults admitted with suspicion for tuberculosis had sputa obtained for GeneXpert MTB/RIF, acid-fast bacilli smear and mycobacterial culture; blood was obtained prior to treatment initiation and after 4 weeks. Adults hospitalized with non-infectious conditions served as controls. Peripheral blood mononuclear cells were cultured unstimulated for 72 hours. Anti-mycobacterial antibodies were measured from culture supernatants by ELISA, using BCG vaccine as the coating antigen. Median ALS responses were compared between cases and controls at baseline and between cases over time.Of 97 TB cases, 85 were microbiologically confirmed and 12 were clinically diagnosed. Median ALS responses from TB cases (0.366 OD from confirmed cases and 0.285 from clinical cases were higher compared to controls (0.085, p<0.001. ALS responses did not differ based on HIV status, CD4 count or sputum smear status. Over time, the median ALS values declined significantly (0.357 at baseline; 0.198 after 4-weeks, p<0.001.Robust ALS responses were mounted by patients with TB regardless of HIV status, CD4 count, or low sputum bacillary burden, potentially conferring a unique niche for this immunologic biomarker for TB.
Asaka, Shiho; Yoshizawa, Akihiko; Saito, Kazusa; Kobayashi, Yukihiro; Yamamoto, Hiroshi; Negishi, Tatsuya; Nakata, Rie; Matsuda, Kazuyuki; Yamaguchi, Akemi; Honda, Takayuki
2018-06-01
Epidermal growth factor receptor (EGFR) mutations are associated with responses to EGFR tyrosine kinase inhibitors (EGFR-TKIs) in non-small-cell lung cancer (NSCLC). Our previous study revealed a rapid point-of-care system for detecting EGFR mutations. This system analyzes cell pellets from cytology specimens using droplet-polymerase chain reaction (d-PCR), and has a reaction time of 10 min. The present study aimed to validate the performance of the EGFR d-PCR assay using cell-free DNA (cfDNA) from supernatants obtained from cytology specimens. Assay results from cfDNA supernatant analyses were compared with those from cell pellets for 90 patients who were clinically diagnosed with, or suspected of having, lung cancer (80 bronchial lavage fluid samples, nine pleural effusion samples and one spinal fluid sample). EGFR mutations were identified in 12 and 15 cases using cfDNA supernatants and cell pellets, respectively. The concordance rates between cfDNA-supernatant and cell‑pellet assay results were 96.7% [kappa coefficient (K)=0.87], 98.9% (K=0.94), 98.9% (K=0.79) and 98.9% (K=0.79) for total EGFR mutations, L858R, E746_A750del and T790M, respectively. All 15 patients with EGFR mutation-positive results, as determined by EGFR d-PCR assay using cfDNA supernatants or cell pellets, also displayed positive results by conventional EGFR assays using tumor tissue or cytology specimens. Notably, EGFR mutations were even detected in five cfDNA supernatants for which the cytological diagnoses of the corresponding cell pellets were 'suspicious for malignancy', 'atypical' or 'negative for malignancy.' In conclusion, this rapid point-of-care system may be considered a promising novel screening method that may enable patients with NSCLC to receive EGFR-TKI therapy more rapidly, whilst also reserving cell pellets for additional morphological and molecular analyses.
Directory of Open Access Journals (Sweden)
Aderbal Antonio dos Santos
2002-01-01
Full Text Available Candida albicans is a potent activator of the complement system, and heat labile opsonins produced by activation of C3 (C3b and iC3b enhance phagocytosis of C. albicans mediated by complement receptors. In this study we treated mouse serum with supernatants from cultures of a protease producer strain of C. albicans and evaluated the ability of this serum to enhance phagocytosis of C. albicans. Cell-free supernatants from cultures of C. albicans were concentrated 5 fold and added to mouse serum for 30 min at 37ºC, before using this serum for opsonization of glutaraldehyde-fixed yeast cells. We observed that normal mouse serum increased about 3 fold the phagocytosis of C. albicans by mice peritoneal macrophages, whereas supernatant-treated serum did not increase phagocytosis. This effect of supernatants on serum was prevented by addition of pepstatin (5 µg/ ml; an inhibitor of C. albicans acid proteases to the medium. Serum treated with supernatants from cultures of a protease-deficient mutant of C. albicans also increased about 3 fold phagocytosis of the yeast. These results suggest that a protease produced by C. albicans causes proteolysis of serum opsonins, thereby reducing the phagocytosis of the yeast.Candida albicans é um potente ativador do sistema complemento, e opsoninas lábeis ao calor produzidas por ativação de C3 (C3b e iC3b aumentam a fagocitose de C. albicans mediada por receptores de complemento. Neste estudo, tratamos o soro de camundongo com sobrenadante de culturas de uma cepa de C. albicans produtora de proteases e avaliamos a capacidade deste soro reduzir a fagocitose de C. albicans. Sobrenadantes livres de células obtidos de cultura de C. albicans foram concentrados 5 vezes e adicionados ao soro de camundongo por 30 minutos a 37ºC, antes deste soro ser usado para opsonização de C. albicans na forma de levedura e fixadas em glutaraldeido. Nós observamos que soro normal aumentou 3 vezes a fagocitose de C. albicans por
Supernatant treatment system design through testing
International Nuclear Information System (INIS)
Ploetz, D.K.; Leonard, I.M.
1988-12-01
The main purpose of the Supernatant Treatment System (STS) is to remove more than 99.9 percent of the radioactive cesium (Cs-137) from the high-level waste stored in tank 8D-2. Cesium removal is accomplished in the STS by processing the supernatant (liquid) portion of the high-level waste through three or four ion exchange columns filled with zeolite. After treatment in the STS, the decontaminated supernatant is processed as low-level waste and finally encapsulated in cement for eventual disposal. The Cs-137 removed from the waste and absorbed onto zeolite ion exchange material is temporarily stored in tank 8D-1 until it can be encapsulated in glass and disposed of as high-level waste. This report discusses construction and testing of the STS. Design of the STS was started in 1982 in parallel with the selection of the ion exchange material. The construction of this system was accomplished in five phase in parallel with completion of design to allow for faster completion of the project. The existing high-level waste storage tanks -- 8D-1, 8D-2, and 8D-3 -- required major renovations to permit transfer of the high-level waste from tank 8D-2 to tank 8D-1, to house the components that comprise the STS in tank 8D-1, and to store decontaminated wastes in tank 8D-3. Testing in the STS started before construction was complete and was accomplished by first testing components individually. Then the system was retested using simulated supernatant. Integrated testing of the whole Integrated Radwaste Treatment System (IRTS), which includes the STS, Liquid Waste Treatment System (LWTS), Cement Solidification System (CSS), and the Drum Cell, was also performed using simulated supernatant. Finally, slightly radioactive condensate water from tank 8D-1 was processed. After successfully completing this testing, the STS started operations with radioactive supernatant on May 23, 1988. 21 refs., 33 figs., 21 tabs
A dense cell retention culture system using stirred ceramic membrane reactor.
Suzuki, T; Sato, T; Kominami, M
1994-11-20
A novel reactor design incorporating porous ceramic tubes into a stirred jar fermentor was developed. The stirred ceramic membrane reactor has two ceramic tubular membrane units inside the vessel and maintains high filtration flux by alternating use for filtering and recovering from clogging. Each filter unit was linked for both extraction of culture broth and gas sparging. High permeability was maintained for long periods by applying the periodical control between filtering and air sparging during the stirred retention culture of Saccharomyces cerevisiae. The ceramic filter aeration system increased the k(L)a to about five times that of ordinary gas sparing. Using the automatic feeding and filtering system, cell mass concentration reached 207 g/L in a short time, while it was 64 g/L in a fed-batch culture. More than 99% of the growing cells were retained in the fermentor by the filtering culture. Both yield and productivity of cells were also increased by controlling the feeding of fresh medium and filtering the supernatant of the dense cells culture. (c) 1994 John Wiley & Sons, Inc.
Maslennikova, Irina L; Kuznetsova, Marina V; Nekrasova, Irina V; Shirshev, Sergei V
2017-11-30
Pseudomonas aeruginosa (PA) responsible for acute and chronic infections often forms a well-organized bacterial population with different microbial species including commensal strains of Escherichia coli. Bacterial extracellular components of mixed culture can modulate the influence of bacteria on the neutrophil functions. The objective of this study was to compare the effect of pyocyanin, pyoverdine, LPS, exopolysaccharide of single species and mixed culture supernatants of PA strains and E. coli K12 on microbicidal, secretory activity of human neutrophils in vitro. Bacterial components of E. coli K12 in mixed supernatants with 'biofilm' PA strains (PA ATCC, PA BALG) enhanced short-term microbicidal mechanisms and inhibited neutrophil secretion delayed in time. The influence of 'planktonic' PA (PA 9-3) exometabolites in mixed culture is almost mimicked by E. coli K12 effect on functional neutrophil changes. This investigation may help to understand some of the mechanisms of neutrophil response to mixed infections of different PA with other bacteria species. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
PENG Jianping
2015-11-01
Full Text Available ObjectiveTo establish a method for in vitro culture of plasmacytoid dendritic cell (pDC. MethodsUmbilical cord blood (40 ml was collected from healthy parturients in the First Affiliated Hospital of Hunan University of Chinese Medicine, and cord blood mononuclear cell (CBMC were isolated. The CBMC were cultured for 7 days with RPMI 1640 complete medium containing rh Flt3-ligand (Flt3-L (100 ng/ml and rh interleukin (IL-3 (10 ng/ml, and the medium was half changed every 2 days. On the eighth day, CpG ODN (2 μg/ml was added to the cells, and the attached cells and supernatant were collected 24 h later for flow cytometry and interferon (IFNα measurement, respectively. On days 1, 3, 5, 7, and 8 of cell culture, the morphological changes of pDC were observed. Results After 2 h of culture, the CBMC showed circular, flat morphology. Twenty-four hours later, the cells began to adhere to the wall, with extended cytoplasm and increased volumes, and they became round and translucent, with scattered small colonies. On days 3-4 of culture, the cell volume continued increasing; most cells were round, and some had small protrusions; few cells were spindle-, tadpole-, star- or irregularly shaped; the number and volumes of colonies increased substantially. On days 5-8 of culture, the number of colonies and the number of cells in colonies gradually decreased, and suspended cells that were round or had small protrusions gradually increased in the medium. The cells expressing CD123, BDCA-2, and BDCA-4, which were considered pDC, were detected by flow cytometry. Flow cytometry revealed that the proportion of pDC in CBMC increased during the culture: increasing from 1.08% at the beginning of culture to 5.32% on day 4, and finally reaching a peak of 19.8% on day 8. On day 8, the level of IFNα in pDC culture supernatant was(11 302.61±1745.31 pg/ml. ConclusionpDC can be successfully induced in vitro by rh Flt3-L combined with IL-3 from human umbilical CBMC.
International Nuclear Information System (INIS)
Ruemke, H.C.; Terpstra, F.G.; Huis, B.; Out, T.A.; Zeijlemaker, W.P.
1982-01-01
When human peripheral blood lymphocytes (PBL) are cultured in the presence of irradiated allogeneic lymphocytes, the resulting mixed lymphocyte reaction (MLR) leads to the secretion into the supernatant of substantial amounts of IgM and IgG, derived from nonirradiated responder B lymphocytes. Our data indicate that stimulation to Ig production by responder B cells may result from different types of of interactions. First, B cells and monocytes among the irradiated stimulator cells activate T responder B cells to produce Ig; second, ''responder'' B cells activate irradiated ''stimulator'' T cells, leading to a ''helper'' signal, back to the responder B cells and leading to Ig production. The latter system is radiosensitive, because allogeneic T cells, irradiated at a dose of 4000 rad or more, failed to induce Ig production by responder B cells. In some combinations of human allogeneic lymphocytes, the co-culture of the cells leads to inhibition of Ig production, both in the presence and in the absence of PWM. Thus, co-culture of allogeneic cells may cause ''positive'' as well as ''negative'' allogeneic effects. The implications of these findings for the interpretation of co-cultures that are aimed at establishing defects in lymphocytes from patients with, for example, immunodeficiencies, who fail to produce Ig in the presence of PWM are discussed
Meza-Lucas, Antonio; Pérez-Villagómez, María-Fernanda; Martínez-López, José-Patricio; García-Rodea, Ricardo; Martínez-Castelán, María-Guadalupe; Escobar-Gutiérrez, Alejandro; de-la-Rosa-Arana, Jorge-Luis; Villanueva-Zamudio, Altagracia
2016-09-01
A comparison of DOT-ELISA and Standard-ELISA was made for detection of Vibrio cholerae toxin in culture supernatants of bacteria isolated from human and environmental samples. A total of 293 supernatants were tested in a double blind assay. A correlation of 100 % was obtained between both techniques. The cholera toxin was found in 20 Inaba and 3 Ogawa strains. Positive samples were from seafood (17 samples), potable water (1 sample) and sewage (5 samples). The DOT-ELISA was useful as the standard-ELISA to confirm the presence of cholera toxin in the environmental samples.
Use of QuantiFERON®-TB Gold in-tube culture supernatants for measurement of antibody responses.
Directory of Open Access Journals (Sweden)
Simon G Kimuda
Full Text Available QuantiFERON®-TB Gold in-tube (QFT-GIT supernatants may be important samples for use in assessment of anti-tuberculosis (TB antibodies when only limited volumes of blood can be collected and when a combination of antibody and cytokine measurements are required. These analytes, when used together, may also have the potential to differentiate active pulmonary TB (APTB from latent TB infection (LTBI. However, few studies have explored the use of QFT-GIT supernatants for investigations of antibody responses. This study determined the correlation and agreement between anti-CFP-10 and anti-ESAT-6 antibody concentrations in QFT-GIT nil supernatant and serum pairs from 68 TB household contacts. We also explored the ability of Mycobacterium tuberculosis (M.tb specific antibodies, or ratios of antibody to interferon gamma (IFN-γ in QFT-GIT supernatants, to differentiate 97 APTB cases from 58 individuals with LTBI. Sputum smear microscopy was used to define APTB, whereas the QFT-GIT and tuberculin skin test were used to define LTBI. There were strong and statistically significant correlations between anti-CFP-10 and anti-ESAT-6 antibodies in unstimulated QFT-GIT supernatants and sera (r = 0.89; p<0.0001 for both, and no significant differences in antibody concentration between them. Anti-CFP-10 & anti-ESAT-6 antibodies differentiated APTB from LTBI with sensitivities of 88.7% & 71.1% and specificities of 41.4% & 51.7% respectively. Anti-CFP-10 antibody/M.tb specific IFN-γ and anti-ESAT-6 antibody/M.tb specific IFN-γ ratios had sensitivities of 48.5% & 54.6% and specificities of 89.7% and 75.9% respectively. We conclude that QFT-GIT nil supernatants may be used in the place of sera when measuring antibody responses, reducing blood volumes needed for such investigations. Antibodies in QFT-GIT nil supernatants on their own discriminate APTB from LTBI with high sensitivity but have poor specificity, whereas the reverse is true when antibodies are used in
Prapas, Yannis; Petousis, Stamatios; Panagiotidis, Yannis; Gullo, Giuseppe; Kasapi, Lia; Papadeothodorou, Achilleas; Prapas, Nikos
2012-06-01
To evaluate whether intrauterine injection of embryo culture supernatant before embryo transfer has any impact on pregnancy and implantation rates. A total of 400 cycles, of which 200 IVF/ICSI and 200 oocyte donor (OD), were randomly assigned to have their uterine cavity injected (group I) or not (group II). Primary endpoints to be studied were pregnancy and implantation rates. Clinical pregnancy rate per transfer (47.87%, 90/188 versus 48.45%, 94/194) based on transvaginal scan findings at 7 weeks of gestation and implantation rate (25.6% versus 26.5%) were similar in the two groups. The day of embryo transfer, day 3 or day 5, did not affect the final outcome. Injection of embryo culture supernatant into the uterine cavity, 30 min before the embryo transfer on either day 3 or 5, neither improves nor adversely affects the pregnancy rate in IVF/ICSI or oocyte donation cycles. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Sha, Yujie; Liu, Mei; Wang, Baojie; Jiang, Keyong; Qi, Cancan; Wang, Lei
2016-10-28
The interactions of microbiota in the gut play an important role in promoting or maintaining the health of hosts. In this study, in order to investigate and compare the effects of dietary supplementation with Lactobacillus pentosus HC-2 (HC-2), Enterococcus faecium NRW-2, or the bacteria-free supernatant of a HC-2 culture on the bacterial composition of Litopenaeus vannamei , Illumina sequencing of the V1-V2 region of the 16S rRNA gene was used. The results showed that unique species exclusively existed in specific dietary groups, and the abundance of Actinobacteria was significantly increased in the intestinal bacterial community of shrimp fed with the bacteria-free supernatant of an HC-2 culture compared with the control. In addition, the histology of intestines of the shrimp from the four dietary groups was also described, but no obvious improvements in the intestinal histology were observed. The findings in this work will help to promote the understanding of the roles of intestinal bacteria in shrimps when fed with probiotics or probiotic supernatant.
Vaitkuviene, A.; Gegzna, V.; Juodkazis, S.; Jursenas, S.; Miasojedovas, S.; Kurtinaitiene, R.; Rimiene, J.; Vaitkus, J.
2009-06-01
Cervical smear material contains endo and exocervical cells, mucus and inflammative, immune cells in cases of pathology. Just not destroyed keratinocytes lay on the glass for microscopy. Liquid cytology supernatant apart other diagnostics could be used for photodiagnostic. The spectroscopic parameters suitable for Normal and HSIL cytology groups supernatant differentiation are demonstrated. The dried liquid PAP supernatant fractions—sediment and liquid were investigated. Excitation and emission matrices (EEM), supernatant fluorescence decay measured under 280 nm diode short pulse excitation and fluorescence spectroscopy by excitation with 355 nm laser light were analyzed. The differences between Normal and HSIL groups were statistically proven in the certain spectral regions. Fluorescence decay peculiarities show spectral regions consisting of few fluorophores. Obtained results on fluorescence differences in Normal and HSIL groups' supernatant shows the potency of photodiagnosis application in cervical screening.
Holban, Alina Maria; Bleotu, Coralia; Chifiriuc, Mariana Carmen; Lazar, Veronica
2017-01-01
The objective of this study was to investigate the effects of P. aeruginosa PAO1 cellular and soluble culture fractions on human mesenchymal stem cells (MSCs) death signaling pathways and cytokine profile. The bone marrow isolated MSCs, incubated for different periods of time with one of the three P. aeruginosa PAO1 culture fractions, i.e. low density whole cultures, heat inactivated bacterial cultures sediments and sterile supernatants, were submitted to the following assays: i) fluorescence microscopy evaluation of cellular morphology and viability; ii) bax, caspase 9, relA and bcl-2 genes expression analysis by qRT-PCR; and iii) quantification of the level of IL-1β, IL-6, IL-8 and IL-10 cytokines released in the MSCs supernatants determined by ELISA. Results were statistically analyzed using the GraphPad In Stat software. The PAO1 whole cultures exhibited the most relevant influences, impacting on MSCs morphology and viability, interfering with apoptotic pathways and significantly stimulating the production of IL-1β and IL-10, while decreasing the production of IL-6 and IL-8. The culture supernatants increased the production of IL-1β and reduced the secretion of all other tested cytokines, while heat-inactivated bacterial cells significantly stimulated both IL-1β and IL-10 production. These data could suggest that in vivo, the fate of P. aeruginosa infection depends on the proportion between different bacterial culture fractions (i.e. the number of viable bacterial cells, the number of dead cells and the amount of bacterial soluble products accumulated locally) that could be influenced by the initial infective dose, by the host defense mechanisms, and also by the administered antimicrobial treatment that may thus interfere with the evolution and magnitude of the induced lesions. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Shin, Saeam; Kim, Juwon; Kim, Yoonjung; Cho, Sun-Mi; Lee, Kyung-A
2017-10-26
EGFR mutation is an emerging biomarker for treatment selection in non-small-cell lung cancer (NSCLC) patients. However, optimal mutation detection is hindered by complications associated with the biopsy procedure, tumor heterogeneity and limited sensitivity of test methodology. In this study, we evaluated the diagnostic utility of real-time PCR using malignant pleural effusion samples. A total of 77 pleural fluid samples from 77 NSCLC patients were tested using the cobas EGFR mutation test (Roche Molecular Systems). Pleural fluid was centrifuged, and separated cell pellets and supernatants were tested in parallel. Results were compared with Sanger sequencing and/or peptide nucleic acid (PNA)-mediated PCR clamping of matched tumor tissue or pleural fluid samples. All samples showed valid real-time PCR results in one or more DNA samples extracted from cell pellets and supernatants. Compared with other molecular methods, the sensitivity of real-time PCR method was 100%. Concordance rate of real-time PCR and Sanger sequencing plus PNA-mediated PCR clamping was 98.7%. We have confirmed that real-time PCR using pleural fluid had a high concordance rate compared to conventional methods, with no failed samples. Our data demonstrated that the parallel real-time PCR testing using supernatant and cell pellet could offer reliable and robust surrogate strategy when tissue is not available.
International Nuclear Information System (INIS)
Daehnfeldt, J.L.; Winge, P.
1975-01-01
With an enzyme degradative technique, isotope inequilibrium of glucose metabolites was demonstrated in intact cells and particle-free supernatants of Ehrlich ascites tumor using I- 14 C-glucose as tracer. Inequilibrium was found between glucose and glucose-6-phosphate, glucose and fructose-6-phosphate, glucose and 6-phosphogluconate, while glucose-6-phosphate and fructose-6-phosphate were found to be in near equilibrium within the incubation time investigated. Glucose and lactate were found to be in near equilibrium after 8 min in intact cells. Calculations based on the equilibrium levels found, showed that these inequilibria could not be explained by the effects of the pentose cycle. (U.S.)
Directory of Open Access Journals (Sweden)
DA Ribeiro
2011-01-01
Full Text Available Enteric infections caused by the ingestion of contaminated water, especially by Escherichia coli, are important to define the virulence properties of these bacteria. Due to frequent infantile diarrhea in the city of Ouro Preto, Minas Gerais state, Brazil, the phenotypic and genotypic diarrheagenic properties of E. coli isolated from drinking water were studied. The culture supernatants of 39 (40% among a total of 97 E. coli isolates from drinking water were positive by suckling mouse assay and induced cytotoxic effects on Vero cells. The enterotoxic and cytotoxic activities were present in the fraction with less than 10 kDa and were not lost when heated up to 60°C and 100°C for 30 minutes. PCR assays showed that among these 39 Vero cytotoxigenic E. coli, four (10.2% were positive for ST II (estB and two (5% positive for αHly (hlyA. Gene amplification of SLT (stx 1, stx 2, ST I (estA, LT (eltI, eltII, EAST1 (astA, EHly (enhly and plasmid-encoded enterotoxin (pet were not observed. This heat-stable cytotoxic enterotoxin of E. coli is probably a new putative diarrheagenic virulence factor, as a toxin presenting these characteristics has not yet been described.
Abe, P M; Kendall, C J; Stauffer, L R; Holland, J W
1979-01-01
Culture supernatants of Fusobacterium necrophorum demonstrated hemolytic activity. The hemolysin(s), which was partially purified by ammonium sulfate precipitation, was temperature-dependent and heat labile. The spectrum of hemolytic activity against various erythrocytes included rabbit, human, and dog erythrocytes. Goats, sheep, and bovine erythrocytes showed only trace hemolysis. According to results of thin-layer chromatography, the hemolysin hydrolyzed rabbit erythrocyte phosphatidyl choline, phosphatidyl ethanolamine, lysophosphatidyl choline, and bovine phosphatidyl choline. Hydrolysis of egg yolk phosphatidyl choline, bovine phosphatidyl ethanolamine, cholesterol, 1,2-dipalmitin, 1,3-dipalmitin, sphingomyelin, or triolein was not detected by thin layer chromatography. A more sensitive procedure utilizing gas-liquid chromatography revealed that, of the substrates tested, the following were bein hydrolyzed: bovine and egg yolk phosphatidyl choline, lysophosphatidyl choline, alpha-palmito-beta-eleoyl-L-alpha lecithin and alpha-oleoyl-betal-palmitoyl-L-alpha lecithin. Substrates which were weakly hydrolyzed were bovine phosphatidyl ethanolamine, DL-alpha-hosphatidyl ethanolamine dipalmitoyl, 1,2-dipalmitin, 1,3-dipalmitin, and triolein.
Directory of Open Access Journals (Sweden)
Alaín González Pose
2014-09-01
Full Text Available Avian influenza virus H5N1 has caused extensive damage worldwide among poultry and humans. Effective expression systems are needed for the production of viral proteins required for monitoring this devastating disease. The present study deals with the establishment of a stable expression system for the hemagglutinin H5 (HAH5 of avian influenza virus using CHO cells in suspension culture transduced with a recombinant lentiviral vector. The synthetic gene coding the HAH5 protein was inserted in a lentiviral vector with the aim of performing a stable transduction of CHO cells. After the selection of recombinant clones, the one with the highest expression level was adapted to suspension culture and the HAH5 protein was purified by immunoaffinity chromatography from the culture supernatant. There were no significant differences when this protein, purified or direct from the culture supernatant of CHO or SiHa cells, was utilized in an immunologic assay using positive and negative sera as reference. It was also demonstrated that the HAH5 protein in its purified form is able to bind anti-HAH5 antibodies generated with proper and non-proper folded proteins. The results demonstrate that the CHO cell line stably transduced with a lentiviral vector coding the sequence of the HAH5 protein and cultured in suspension can be a suitable expression system to obtain this protein for diagnostic purpose in a consistent and reliable manner.
Influence of in vitro irradiation upon LIF production by ConA stimulated mononuclear cells
International Nuclear Information System (INIS)
Sandru, G.; Veraguth, P.
1981-01-01
Leukocyte migration inhibitory factor (LIF) activity of culture supernatants of in vitro irradiated Concanavalin A (ConA) stimulated lymphocytes was tested by measuring granulocyte migration from clotted plasma droplets placed in flat bottom microplates. The specificity of inhibition was assured by pretreating the assay supernatants with anti-LIF antibodies which abrogated granulocyte migration inhibition but did not impair guinea pig Peritoneal Exudate Cells (PEC) migration inhibition. In vitro irradiation (150-1200 rads) of MNC cultures either before or after ConA stimulation did not impair lymphokine production and sometimes significantly improved the supernatants' LIF activity as compared with that of unirradiated cultures. The existence of radiosensitive suppressor cells regulating LIF production by ConA stimulated mononuclear cells is suggested
TR146 cells grown on filters as a model of human buccal epithelium
DEFF Research Database (Denmark)
Mørck Nielsen, H; Rømer Rassing, M; Nielsen, Hanne Mørck
2000-01-01
cell culture model, and human and porcine buccal epithelium were compared. The esterase activity in the intact cell culture model and in the porcine buccal mucosa was compared. Further, the TR146 cell culture model was used to study the permeability rate and metabolism of leu-enkephalin. The activity...... of the three enzymes in the TR146 homogenate supernatants was in the same range as the activity in homogenate supernatants of human buccal epithelium. In the TR146 cell culture model, the activity of aminopeptidase (13.70+/-2.10 nmol/min per mg protein) was approx. four times the activity of carboxypeptidase...
Xiaolong He; Qing Zeng; Santhosh Puthiyakunnon; Zhijie Zeng; Weijun Yang; Jiawen Qiu; Lei Du; Swapna Boddu; Tongwei Wu; Danxian Cai; Sheng-He Huang; Hong Cao
2017-01-01
The objective of this study was to determine whether Lactobacillus rhamnosus GG culture supernatant (LCS) has a preventive effect against gut-derived systemic neonatal Escherichia coli (E. coli) K1 infection. The preventive effects were evaluated in human colonic carcinoma cell line Caco-2 and neonatal rat models. Our in vitro results showed that LCS could block adhesion, invasion and translocation of E. coli K1 to Caco-2 monolayer via up-regulating mucin production and maintaining intestinal...
International Nuclear Information System (INIS)
Mongini, P.K.A.; Heber-Katz, E.
1982-01-01
A solid-phase radioimmunoassay (RIA) for assaying immunoglobulin produced from antibody-secreting myeloma, hybridoma and immune spleen cells is described. Specific antibody is detected by culturing antibody-producing cells on antigen-coated flexible polyvinylchloride microtiter wells, washing away the cells, and measuring the bound specific antibody with tritiated affinity-purified anti-isotype reagents. Antibody produced from 10 3 myeloma cells can be detected with as little as 4 h of incubation. With 24-48 h of incubation, antibody from as few as approximately 3-15 myeloma, hybridoma or immune spleen plaque-forming cells (PFC) can be detected. This culture-well RIA has certain distinct advantages over the hemolytic PFC assay and RIA assays in which antibody in culture supernatants is measured. (Auth.)
Bystander Host Cell Killing Effects of Clostridium perfringens Enterotoxin
Directory of Open Access Journals (Sweden)
Archana Shrestha
2016-12-01
Full Text Available Clostridium perfringens enterotoxin (CPE binds to claudin receptors, e.g., claudin-4, and then forms a pore that triggers cell death. Pure cultures of host cells that do not express claudin receptors, e.g., fibroblasts, are unaffected by pathophysiologically relevant CPE concentrations in vitro. However, both CPE-insensitive and CPE-sensitive host cells are present in vivo. Therefore, this study tested whether CPE treatment might affect fibroblasts when cocultured with CPE-sensitive claudin-4 fibroblast transfectants or Caco-2 cells. Under these conditions, immunofluorescence microscopy detected increased death of fibroblasts. This cytotoxic effect involved release of a toxic factor from the dying CPE-sensitive cells, since it could be reproduced using culture supernatants from CPE-treated sensitive cells. Supernatants from CPE-treated sensitive cells, particularly Caco-2 cells, were found to contain high levels of membrane vesicles, often containing a CPE species. However, most cytotoxic activity remained in those supernatants even after membrane vesicle depletion, and CPE was not detected in fibroblasts treated with supernatants from CPE-treated sensitive cells. Instead, characterization studies suggest that a major cytotoxic factor present in supernatants from CPE-treated sensitive cells may be a 10- to 30-kDa host serine protease or require the action of that host serine protease. Induction of caspase-3-mediated apoptosis was found to be important for triggering release of the cytotoxic factor(s from CPE-treated sensitive host cells. Furthermore, the cytotoxic factor(s in these supernatants was shown to induce a caspase-3-mediated killing of fibroblasts. This bystander killing effect due to release of cytotoxic factors from CPE-treated sensitive cells could contribute to CPE-mediated disease.
Aminnezhad, Sargol; Kermanshahi, Rouha Kasra; Ranjbar, Reza
2015-01-01
Background: The indiscriminate use of antibiotics in the treatment of infectious diseases can increase the development of antibiotic resistance. Therefore, there is a big demand for new sources of antimicrobial agents and alternative treatments for reduction of antibiotic dosage required to decrease the associated side effects. Objectives: In this study, the synergistic action of aminoglycoside antibiotics and cell-free supernatant (CFS) of probiotic (Lactobacillus rahmnosus and L. casei) aga...
Response to Dengue virus infections altered by cytokine-like substances from mosquito cell cultures
Directory of Open Access Journals (Sweden)
Laosutthipong Chaowanee
2010-11-01
Full Text Available Abstract Background With both shrimp and commercial insects such as honey bees, it is known that stable, persistent viral infections characterized by absence of disease can sometimes shift to overt disease states as a result of various stress triggers and that this can result in serious economic losses. The main research interest of our group is to understand the dynamics of stable viral infections in shrimp and how they can be destabilized by stress. Since there are no continuous cell lines for crustaceans, we have used a C6/36 mosquito cell line infected with Dengue virus to test hypotheses regarding these interactions. As a result, we accidentally discovered two new cytokine-like substances in 5 kDa extracts from supernatant solutions of acutely and persistently infected mosquito cells. Results Naïve C6/36 cells were exposed for 48 h to 5 kDa membrane filtrates prepared from the supernatant medium of stable C6/36 mosquito cell cultures persistently-infected with Dengue virus. Subsequent challenge of naïve cells with a virulent stock of Dengue virus 2 (DEN-2 and analysis by confocal immunofluorescence microscopy using anti-DEN-2 antibody revealed a dramatic reduction in the percentage of DEN-2 infected cells when compared to control cells. Similar filtrates prepared from C6/36 cells with acute DEN-2 infections were used to treat stable C6/36 mosquito cell cultures persistently-infected with Dengue virus. Confocal immunofluorescence microscopy revealed destabilization in the form of an apoptosis-like response. Proteinase K treatment removed the cell-altering activities indicating that they were caused by small polypeptides similar to those previously reported from insects. Conclusions This is the first report of cytokine-like substances that can alter the responses of mosquito cells to Dengue virus. This simple model system allows detailed molecular studies on insect cytokine production and on cytokine activity in a standard insect cell line.
Kuvibidila, Solo; Porretta, Connie; Baliga, Surendra
2014-02-01
Aneuploidy, a condition associated with altered chromosome number, hence DNA index, is frequently seen in many diseases including cancers and affects immunity. Iron, an essential nutrient for humans, modulates the immune function and the proliferation of normal and cancer cells. To determine whether impaired immunity seen in iron-deficient subjects may be related to aneuploidy, we measured spleen cell DNA index, percent of cells in different phases of the cell cycle, plasma and/or supernatant IL-2, IL-10, IL-12, and interferon-gamma in control, pair-fed, iron-deficient, and iron-replete mice (N=20-22/group). The test and control diets differed only in iron content (0.09mmol/kg versus 0.9mmol/kg) and were fed for 68days. Mean levels of hemoglobin and liver iron stores of iron-deficient and iron-replete mice were 40-60% lower than those of control and pair-fed mice (P<0.05). Mean plasma levels of IL-10, interferon-gamma and percent of cells in S+G2/M phases were lower in mice with than in those without aneuploidy (P<0.05). Lowest plasma IL-12 and interferon-gamma concentrations were observed in iron-deficient mice with aneuploidy. Mean percents of cultures with aneuploidy and DNA indexes were higher in iron-deficient and iron-replete than in control and pair-fed mice likely due to delayed cell division (P<0.05). Aneuploidy decreased the concentration of IL-2 and interferon-gamma in baseline cultures while it increased that of interferon-gamma in anti-CD3 treated cultures. Aneuploidic indexes negatively correlated with cytokine levels, percents of cells in S+G2/M phases and indicators of iron status (P<0.05). Although chromosome cytogenetics was not performed, for the first time, we report that increased aneuploidy rate may modulate the immune function during iron-deficiency. Copyright © 2014. Published by Elsevier Ltd.
DEVELOPMENT OF PRIMARY CELL CULTURE FROM TAIL EPIDERMAL TISSUE OF KOI CARP (Cyprinus carpio koi
Directory of Open Access Journals (Sweden)
Lila Gardenia
2014-06-01
Full Text Available Primary cell culture from tail epidermal tissue of koi carp (Cyprinus carpio koi was developed. Cells were grown in Leibovits-15 medium supplemented with 20% fetal bovine serum and antibiotics (Penicillin/Streptomycin and Kanamycin. Cell growth was observed in a range of incubation temperature (17oC±2oC, 22oC±2oC, 27oC±2oC, and 32oC±2oC in order to determine the optimum temperature. The cells were able to grow at a range of temperature between 17oC to 32oC with optimal growth at 22oC. Primary cells infected with koi herpes virus produced typical cytopathic effects characterized by severe vacuolation and deformation of nuclei, which is consistent with those of previous reports. Artificial injection experiment by using supernatant koi herpes virus SKBM-1 isolate revealed that it could cause 90% mortality in infected fish within two weeks. PCR test with Sph I-5 specific primers carried out with DNA template from supernatant virus, pellet cell, and gills of infected fish showed positive results in all samples (molecular weight of DNA target 290 bp. The cells were found to be susceptible to koi herpes virus and can be used for virus propagation.
Delneste, Y; Jeannin, P; Gosset, P; Lassalle, P; Cardot, E; Tillie-Leblond, I; Joseph, M; Pestel, J; Tonnel, A B
1995-01-01
Adhesion of inflammatory cells to endothelium is a critical step for their transvascular migration to inflammatory sites. To evaluate the relationship between T lymphocytes (TL) and vascular endothelium, supernatants from allergen-stimulated TL obtained from patients sensitive to Dermatophagoides pteronyssinus (Dpt) versus healthy subjects were added to endothelial cell (EC) cultures. TL were stimulated by autologous-activated antigen-presenting cells (APC) previously fixed in paraformaldehyde to prevent monokine secretion. Two parameters were measured: the expression of adhesion molecule and the production of IL-6. Related allergen-stimulated TL supernatants from allergic patients induced an increase of VCAM-1 and intercellular adhesion molecule-1 (ICAM-1) expression when supernatants of the control groups (TL exposed to an unrelated allergen or not stimulated or TL obtained from healthy subjects) did not. E-selectin expression was not modulated whatever the supernatant added to EC culture. IL-6 production by EC was significantly enhanced after activation with related allergen-stimulated TL supernatants from allergics compared with control supernatants. Induction of VCAM-1 expression was inhibited by adding neutralizing antibodies against IL-4, whereas IL-6 production and ICAM-1 expression were inhibited by anti-interferon-gamma (IFN-gamma) antibodies. Enhanced production of IL-4 and IFN-gamma was detected in related allergen-stimulated TL supernatants from allergic subjects compared with the different supernatants. These data suggest that allergen-specific TL present in the peripheral blood of allergic patients are of Th1 and Th2 subtypes. Their stimulation in allergic patients may lead to the activation of endothelial cells and thereby participate in leucocyte recruitment towards the inflammatory site. PMID:7542574
Soft sensor for monitoring biomass subpopulations in mammalian cell culture processes.
Kroll, Paul; Stelzer, Ines V; Herwig, Christoph
2017-11-01
Biomass subpopulations in mammalian cell culture processes cause impurities and influence productivity, which requires this critical process parameter to be monitored in real-time. For this reason, a novel soft sensor concept for estimating viable, dead and lysed cell concentration was developed, based on the robust and cheap in situ measurements of permittivity and turbidity in combination with a simple model. It could be shown that the turbidity measurements contain information about all investigated biomass subpopulations. The novelty of the developed soft sensor is the real-time estimation of lysed cell concentration, which is directly correlated to process-related impurities such as DNA and host cell protein in the supernatant. Based on data generated by two fed-batch processes the developed soft sensor is described and discussed. The presented soft sensor concept provides a tool for viable, dead and lysed cell concentration estimation in real-time with adequate accuracy and enables further applications with respect to process optimization and control.
Directory of Open Access Journals (Sweden)
Zänker Kurt S
2010-07-01
Full Text Available Abstract Background Tumor cells interact with the cells of the microenvironment not only by cell-cell-contacts but also by the release of signal substances. These substances are known to induce tumor vascularization, especially under hypoxic conditions, but are also supposed to provoke other processes such as tumor innervation and inflammatory conditions. Inflammation is mediated by two organ systems, the neuroendocrine system and the immune system. Therefore, we investigated the influence of substances released by PC-3 human prostate carcinoma cells on SH-SY5Y neuroblastoma cells as well as neutrophil granulocytes and cytotoxic T lymphocytes, especially with regard to their migratory activity. Results PC-3 cells express several cytokines and growth factors including vascular endothelial growth factors, fibroblast growth factors, interleukins and neurotrophic factors. SH-SY5Y cells are impaired in their migratory activity by PC-3 cell culture supernatant, but orientate chemotactically towards the source. Neutrophil granulocytes increase their locomotory activity only in response to cell culture supernantant of hypoxic but not of normoxic PC-3 cells. In contrast, cytotoxic T lymphocytes do not change their migratory activity in response to either culture supernatant, but increase their cytotoxicity, whereas supernatant of normoxic PC-3 cells leads to a stronger increase than that of hypoxic PC-3 cells. Conclusions PC-3 cells release several signal substances that influence the behavior of the cells in the tumor's microenvironment, whereas no clear pattern towards proinflammatory or immunosuppressive conditions can be seen.
Directory of Open Access Journals (Sweden)
Wang Qin
2012-12-01
Full Text Available Abstract Background Previous in vivo studies have shown that mesenchymal stem cell (MSC transplantation significantly improves the condition of a number of autoimmune diseases including autoimmune cerebrospinal meningitis, multiple sclerosis, glomerulonephritis and systemic lupus erythematosus. Methods To investigate the immunoregulatory effect of stem cell transplantation, human umbilical cord MSCs were co-cultured with peripheral blood mononuclear cells (PBMCs from patients with rheumatoid arthritis (RA. Orphan nuclear receptor gamma (ROR-γ mRNA and protein expression was detected with real-time PCR and Western blotting. Interleukin (IL-17, IL-6 and tumor necrosis factor (TNF-α in the cell culture supernatant were measured using a flow cytometric bead capture method. Results After 72 hours of co-culture, the mRNA and protein expression levels of ROR-γ in co-cultured PBMCs were decreased compared with that in PBMC of RA patients cultured alone (p Conclusions In vitro co-culture with MSCs down-regulated the inflammatory response of PBMCs from RA patients with severe disease activity, but had no significant effect on PBMCs from healthy controls or patients with mild disease activity, suggesting that the immunoregulatory role of MSCs may associate with the occurrence of inflammatory mediators.
Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge
International Nuclear Information System (INIS)
Pestana, Carlos J.; Reeve, Petra J.; Sawade, Emma; Voldoire, Camille F.; Newton, Kelly; Praptiwi, Radisti; Collingnon, Lea; Dreyfus, Jennifer; Hobson, Peter; Gaget, Virginie; Newcombe, Gayle
2016-01-01
In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10 days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. - Highlights: • Cyanobacteria in water treatment sludge significantly impact supernatant quality • Cyanobacteria can survive, and thrive, in sludge lagoon supernatant and in treatment sludge • Metabolite concentrations in cyanobacteria in sludge can increase up to 500% • The risk associated with supernatant recycling was assessed relative to available treatment barriers
Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge
Energy Technology Data Exchange (ETDEWEB)
Pestana, Carlos J.; Reeve, Petra J.; Sawade, Emma [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); Voldoire, Camille F. [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); École Européenne de Chimie, Polymères et Matériaux (ECPM), Strasbourg 67087 (France); Newton, Kelly; Praptiwi, Radisti [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); Collingnon, Lea [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); École Européenne de Chimie, Polymères et Matériaux (ECPM), Strasbourg 67087 (France); Dreyfus, Jennifer [Allwater, Adelaide Services Alliance, Wakefield St, Adelaide, SA 5001 (Australia); Hobson, Peter [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia); Gaget, Virginie [University of Adelaide, Ecology and Environmental Sciences, School of Biological Sciences, Adelaide, SA 5005 (Australia); Newcombe, Gayle, E-mail: gayle.newcombe@sawater.com.au [Australian Water Quality Centre, South Australian Water Corporation, Adelaide, SA 5000 (Australia)
2016-09-15
In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10 days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. - Highlights: • Cyanobacteria in water treatment sludge significantly impact supernatant quality • Cyanobacteria can survive, and thrive, in sludge lagoon supernatant and in treatment sludge • Metabolite concentrations in cyanobacteria in sludge can increase up to 500% • The risk associated with supernatant recycling was assessed relative to available treatment barriers.
International Nuclear Information System (INIS)
Fleisher, T.A.; Greene, W.C.; Blaese, R.M.; Waldmann, T.A.
1981-01-01
Human peripheral blood mononuclear cells (PBMC) activated with the mitogenic lectin concanavalin A (Con A) elaborate a soluble immune suppressor supernatant (SISS) that contains at least 2 distinct suppressor factors. One of these, SISS-B, inhibits polyclonal B cell immunoglobulin production, whereas the other, SISS-T, suppresses T cell proliferation to both mitogens and antigens. The latter mediator is discussed in the companion paper. Characteristics of the human soluble suppressor of B cell immunoglobulin production (SISS-B) include: 1) inhibition by a noncytotoxic mechanism, 2) loss of activity in the presence of the monosaccharide L-rhamnose, 3) appearance within 8 to 16 hr after the addition of Con A, 4) elaboration by cells irradiated with 500 or 2000 rads, 5) production by highly purified T cells, 6) stability at pH 2.5 but instability at 56/sup o/C, and 7) m.w. of 60 to 80,000. These data indicate that after Con A activation, selected T cells not only become potent suppressor cells, but also generate a soluble saccharide-specific factor(s) that inhibits polyclonal immunoglobulin production by human B cells
Directory of Open Access Journals (Sweden)
Karina Sánchez-Reyes
2014-01-01
Full Text Available Cervical cancer (CC is the second most common cancer among women worldwide. Infection with human papillomavirus (HPV is the main risk factor for developing CC. Macrophages are important immune effector cells; they can be differentiated into two phenotypes, identified as M1 (classically activated and M2 (alternatively activated. Macrophage polarization exerts profound effects on the Toll-like receptor (TLR profile. In this study, we evaluated whether the supernatant of human CC cells HeLa, SiHa, and C-33A induces a shift of M1 macrophage toward M2 macrophage in U937-derived macrophages. Results. The results showed that soluble factors secreted by CC cells induce a change in the immunophenotype of macrophages from macrophage M1 into macrophage M2. U937-derived macrophages M1 released proinflammatory cytokines and nitric oxide; however, when these cells were treated with the supernatant of CC cell lines, we observed a turnover of M1 toward M2. These cells increased CD163 and IL-10 expression. The expression of TLR-3, -7, and -9 is increased when the macrophages were treated with the supernatant of CC cells. Conclusions. Our result strongly suggests that CC cells may, through the secretion of soluble factors, induce a change of immunophenotype M1 into M2 macrophages.
Hill, R. R.; Collins, N. E.; Cowley, H. M.
2011-01-01
The full dysentery syndrome of human shigellosis is often preceded by a transient diarrhoea that may be induced by bacterial extracellular products before invasion of the colonic mucosa and development of subsequent pathology. To examine this hypothesis, we studied the effects of cell-free cultures of Shigella sp. on the ultrastructure of monkey colonic epithelium in vitro. Clinical isolates of shigella strains were grown in a niche-simulating medium. Sheets of colon wall collected from verve...
Oleas, Gabriela; Callegari, Eduardo; Sepulveda, Romina; Eyzaguirre, Jaime
2016-01-01
The filamentous fungus Penicillium purpurogenum grows on a variety of natural carbon sources, such as sugar beet pulp, and secretes to the medium a large number of enzymes that degrade the carbohydrate components of lignocellulose. Sugar beet pulp is rich in pectin, and the purpose of this work is to identify novel esterases produced by the fungus, which may participate in pectin degradation. Partially purified culture supernatants of the fungus grown on sugar beet pulp were subjected to mass spectrometry analysis. Peptides thus identified, which may be part of potential esterases were probed against the proteins deduced from the fungal genome sequence. The cDNAs of two putative esterases identified were expressed in Pichia pastoris and their properties studied. One of these enzymes, named FAET, is a feruloyl esterase, while the other, PE, is classified as a pectin methyl esterase. These findings add to our knowledge of the enzymology of pectin degradation by Penicillium purpurogenum, and define properties of two novel esterases acting on de-esterification of pectin. Their availability may be useful as tools for the study of pectin structure and degradation.
International Nuclear Information System (INIS)
Schmid, D.S.; Tite, J.P.; Ruddle, N.H.
1986-01-01
A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery
Human lung mast cells modulate the functions of airway smooth muscle cells in asthma.
Alkhouri, H; Hollins, F; Moir, L M; Brightling, C E; Armour, C L; Hughes, J M
2011-09-01
Activated mast cell densities are increased on the airway smooth muscle in asthma where they may modulate muscle functions and thus contribute to airway inflammation, remodelling and airflow obstruction. To determine the effects of human lung mast cells on the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Freshly isolated human lung mast cells were stimulated with IgE/anti-IgE. Culture supernatants were collected after 2 and 24 h and the mast cells lysed. The supernatants/lysates were added to serum-deprived, subconfluent airway smooth muscle cells for up to 48 h. Released chemokines and extracellular matrix were measured by ELISA, proliferation was quantified by [(3) H]-thymidine incorporation and cell counting, and intracellular signalling by phospho-arrays. Mast cell 2-h supernatants reduced CCL11 and increased CXCL8 and fibronectin production from both asthmatic and nonasthmatic muscle cells. Leupeptin reversed these effects. Mast cell 24-h supernatants and lysates reduced CCL11 release from both muscle cell types but increased CXCL8 release by nonasthmatic cells. The 24-h supernatants also reduced asthmatic, but not nonasthmatic, muscle cell DNA synthesis and asthmatic cell numbers over 5 days through inhibiting extracellular signal-regulated kinase (ERK) and phosphatidylinositol (PI3)-kinase pathways. However, prostaglandins, thromboxanes, IL-4 and IL-13 were not involved in reducing the proliferation. Mast cell proteases and newly synthesized products differentially modulated the secretory and proliferative functions of airway smooth muscle cells from donors with and without asthma. Thus, mast cells may modulate their own recruitment and airway smooth muscle functions locally in asthma. © 2011 John Wiley & Sons A/S.
[Comparison of two types of cell cultures for preparation of sTNFRII-gAD fusion protein].
Huang, Shigao; Yin, Yuting; Xiong, Chunhui; Wang, Caihong; Lü, Jianxin; Gao, Jimin
2013-01-01
In this study we used two types of cell cultures, i.e., anchorage-dependent basket and full suspension batch cultures of sTNFRII-gAD-expressing CHO cells in the CelliGen 310 bioreactor (7.5 L) to compare their yields in order to optimize the culturing conditions for efficient expression of sTNFRII-gAD fusion protein consisting of soluble tumor necrosis factor receptor II and globular domain of adiponectin. The anchorage-dependent basket culture was performed in 4L 10% serum-containing medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 3 days, and then switched to 4 L serum-free LK021 medium to continue the culture for 4 days. The full suspension batch culture was carried out in the 4 L serum-free LK021 medium with the final inoculating concentration of 3 x 10(5) to 4 x 10(5) cells/mL of sTNFRII-gAD-expressing CHO cells for 7 days. The culturing conditions were monitored in real-time to maintain pH and dissolved oxygen stability through the whole process. The supernatants were collected by centrifuge, and the protein was concentrated through Pellicon flow ultrafiltration system and then purified by DEAE anion exchange. The results showed that the yields of sTNFRII-gAD fusion protein were 8.0 mg/L with 95% purity and 7.5 mg/L with 98% purity in the anchorage-dependent basket and the full suspension batch cultures, respectively. The study provided the framework for the pilot production of sTNFRII-gAD fusion protein.
Treatment of supernatant from sewage sludge by elctron beam irradiation
International Nuclear Information System (INIS)
Arai, Hidehiko; Sugiyama, Masashi; Shimizu, Ken.
1988-01-01
Part of the results was presented on the investigation of treatment of supernatant from sewage sludge by combination of electron beam irradiation and microbiological treatment. Supernatant is electron-beam irradiated after microbiologically treated, and then treated microbiologically again. Based this method, by irradiation of 10 kGy, chemical oxygen demand (COD) in supernatant can be decreased lower than 30 ppm. Moreover, electron-beam irradiation induces remarkable decolorization and deodorization. (author)
Chen, Bin; Che, Tuanjie; Bai, Decheng; He, Xiangyi
2013-04-01
To evaluate the effects of non-Saccharomyces albicans metabolic products on the cell cycle distribution and proliferation of human umbilical vein endothelial cell ECV304 cells in vitro. The parallel dilution supernatant of Saccharomyces tropicalis, Saccharomyces krusei and Saccharomyces glabrata were prepared, and 1, 4, 16-fold(s) diluted concentration and control group were set up. The line of human umbilical vein endothelial cell ECV304 was cultured in vitro and treated by non-Saccharomyces albicans supernatant. The proliferous effect of ECV304 induced by non-Saccharomyces albicans supernatant after 24, 48, 72 h was detected by the methods of MTT, and the changes of cell density and cycle after 48 h were investigated by inverted microscope and flow cytometry. At the 24th hour, all of the higher concentration (1-fold) of non-Saccharomyces albicans supernatant and the 4-folds diluted Saccharomyces krusei could promote ECV304 proliferation(P Saccharomyces albicans supernatant at 48h and 72th hour, Saccharomyces krusei supernatant and Saccharomyces glabrata supernatant significantly increased proliferation rate of ECV304, while Saccharomyces tropicalis supernatant group showed no significant change no matter which concentration was tested. At 48th hour after adding the non-Saccharomyces albicans supernatant, the ECV304 cells density treated by Saccharomyces krusei supernatant and Saccharomyces glabrata supernatant were significantly higher under the inverted microscope. The G0/G1 population of ECV304 cells decreased while cell proliferation index (PI) increased after incubated with Saccharomyces krusei supernatant and Saccharomyces glabrata supernatant for 48 hours (P Saccharomyces tropicalis group showed no significant change (P > 0.05). The metabolic products of Sacharoymces krusei and Saccharomyces glabrata could induce proliferation of ECV304 cell, which suggests non-Saccharomyces albicans should be undergone more attention clinically in detection and treatment.
Park, H S; Suh, J H; Kim, S S; Kwon, O J
2000-06-01
There have been several investigations suggesting an involvement of activated neutrophils in the development of grain dust (GD)-induced occupational asthma. Interleukin-8 in the sputa from GD-induced asthmatic patients increased significantly after the exposure to GD. To confirm IL-8 production from bronchial epithelial cells when exposed to GD, and to evaluate the role of IL-8 on neutrophil recruitment. We cultured Beas-2B, a bronchial epithelial cell line. To observe GD-induced responses, four different concentrations ranging from 1 to 200 microg/mL of GD were incubated for 24 hours and compared with those without incubation of GD. To evaluate the effect of pro-inflammatory cytokines on IL-8 production and neutrophil chemotaxis, epithelial cells were incubated with peripheral blood mononuclear cell (PBMC) culture supernatant derived from subjects with GD-induced asthma exposed to 10 microg/mL of GD, and then compared with those without addition of PBMC supernatant. The level of released IL-8 in the supernatant was measured by enzyme-linked immunosorbent assay. Neutrophil chemotactic activity of the culture supernatant was determined by modified Boyden chamber method. Interleukin-8 production and neutrophil chemotactic activity from bronchial epithelial cells significantly increased with additions of GD in a dose-dependent manner (P < .05, respectively), and were significantly augmented with additions of PBMC supernatant (P < .05, respectively) at each concentration. Close correlation was noted between neutrophil chemotactic activity and IL-8 level (r = 0.87, P < .05). Compared with the untreated sample, pre-treatment of anti-IL-8 antibody induced a significant suppression (up to 67.2%) of neutrophil chemotactic activity in a dose-dependent manner. These results suggest that IL-8 produced from bronchial epithelial cells may be a major cytokine, which induces neutrophil migration into the airways when exposed to GD.
DEFF Research Database (Denmark)
Fredborg, Marlene; Theil, Peter Kappel; Jensen, Bent Borg
2012-01-01
RNA abundance. Supernatants of the 12 bacteria were added to differentiated Caco-2 intestinal epithelial cells cultured on filter inserts in concentrations corresponding to a cell:bacteria ratio of 1:200. After 4 h of incubation, changes in cellular mRNA of GLP-1 and GPR120 by bacterial supernatant were...
Lavocat, Fabien; Maggi, Laura; Annunziato, Francesco; Miossec, Pierre
2016-12-01
To compare the direct effect of cytokines on synoviocytes and endothelial cells to the effects of supernatants from Th1, Th17 and Th1/17 clones and the direct cell-cell interactions with the same clones. Th17 and Th1/17 clones were obtained from the CD161+CCR6+ fraction and Th1 clones from the CD161-CCR6- fraction of human CD4+ T-cells. Endothelial cells or synoviocytes were cultured in the presence of either isolated pro-inflammatory cytokines (IL-17 and/or TNF-α) or supernatants from the T-cell clones or co-cultured with T-cell clones themselves. IL-6 and IL-8 expression and production were analyzed. IL-17 and TNF-α induced IL-6 and IL-8 expression, although IL-17 alone had a limited effect on endothelial cells compared to synoviocytes. Supernatants from activated T-helper clones also induced IL-6 and IL-8 expression but with discrepancies between endothelial cells and synoviocytes. Endothelial cells were mostly activated by Th1 clone supernatants whereas synoviocytes were activated by all T-cell subtypes. Finally, cell-cell contact experiments showed a great heterogeneity among cell clones, even from the same lineage. IL-6 expression was mostly induced by contact with Th1 clones both in endothelial and mesenchymal cells whereas IL-8 expression was induced by all T-cell clones whatever their phenotype. We showed that endothelial cells were much more sensitive to Th1 activation whereas synoviocytes were activated by all T-helper lineages. This work highlights the heterogeneity of interactions between T-cells and stromal cells through soluble factors or direct cell contact. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Doelken, G.; Klein, G.
1977-01-01
Epstein-Barr virus (EBV)-associated membrane antigen (MA) was concentrated from B95-8 cell culture media by precipitation with polyethylene glycol followed by chromatography on Bio-Gel A-50m. In a RAJI cell-binding assay, MA-positive material could only be found in the void volume of the column. After ultracentrifugation all antigenic activity appeared in the pellet, which suggested that MA was present in aggregates, presumably fragments of cellular membranes and/or virus envelopes. The MA-containing preparation was photopolymerized in polyacrylamide gel. The homogenized gel was used in a solid-phase radioimmunoassay with 125 I-labeled IgG from an anti-MA positive reference serum and an anti-MA negative control serum. The specificity of the reaction was confirmed in blocking tests with anti-EBV positive and negative sera. A good correlation was found between the results obtained in the radioimmunoassay and the results obtained in direct immunofluorescence tests for the detection of MA. The existence of at least two subspecificities of the MA complex could be confirmed by this radioimmunoassay
Ramila, G; Studer, S; Kennedy, M; Sklenar, I; Erb, P
1985-01-01
Several Ia+ tumor cell lines and peritoneal exudate macrophages were tested as accessory cells (AC) for the activation of antigen-specific T cells and for T-B cooperation. The macrophages and all the Ia+ tumor lines tested induced the release of lymphokines from T cells in a major histocompatibility complex (MHC)-restricted fashion and reconstituted the antibody responses of AC-depleted spleen cells or of purified T and B cells. However, only the normal macrophages but none of the tumor lines induced carrier-specific T helper (Th) cells which help B cells for specific antihapten antibody responses by linked recognition. For T-B cooperation accessory cells were also required, but in contrast to Th cell activation any type of Ia+ AC (e.g. macrophage or tumor line) was effective. Strong MHC-restriction between the lymphocytes and the AC was seen if antigen-pulsed AC were added into the AC-depleted T-B cooperation cultures. If the AC and antigen were concomitantly added to the AC-depleted T-B cultures, MHC-restriction was less obvious. Concanavalin A supernatant reconstituted the response of AC-depleted T-B cultures provided antigen-specific Th cells and the hapten-carrier conjugate were present. If, however, tumor line-activated T cells were added instead of macrophage-induced Th cells, no cooperation with B cells took place even in the presence of Con A supernatant. The results obtained demonstrate a differential AC requirement for the induction of Th cells depending on the differentiation stage of the Th cells.
Oers, van M.M.; Lynn, D.E.
2010-01-01
Insect cell cultures are widely used in studies on insect cell physiology, developmental biology and microbial pathology. In particular, insect cell culture is an indispensable tool for the study of insect viruses. The first continuously growing insect cell cultures were established from
Effect of L-arginine on the growth of Plasmodium falciparum and immune modulation of host cells.
Awasthi, Vikky; Chauhan, Rubika; Chattopadhyay, Debprasad; Das, Jyoti
2017-01-01
Malaria is a life-threatening disease caused by Plasmodium parasites. The life-cycle of Plasmodium species involves several stages both in mosquito and the vertebrate host. In the erythrocytic stage, Plasmodium resides inside the red blood cells (RBCs), where it meets most of its nutritional requirement by degrad- ing host's haemoglobin. L-arginine is required for growth and division of cells. The present study was aimed to demonstrate the effect of supplementation of different concentrations of L-arginine and L-citrulline on the growth of parasite, and effect of the culture supernatant on the host's peripheral blood mononuclear cells (PBMCs). To examine the effect of supplementation of L-arginine and L-citrulline, Plasmodium falciparum (3D7 strain) was cultured in RPMI 1640, L-arginine deficient RPMI 1640, and in different concentrations of L-arginine, and L-citrulline supplemented in arginine deficient RPMI 1640 medium. To have a holistic view of in vivo cell activation, the PBMCs isolated from healthy human host were cultured in the supernatant collected from P. falciparum culture. Growth of the parasite was greatly enhanced in L-arginine supplemented media and was found to be concentration dependent. However, parasite growth was compromised in L-citrulline supplemented and L-arginine deficient media. The supernatant collected from L-arginine supplemented parasite media (sArg) showed increased FOXP3 and interleukin-10 (IL-10) expression as compared to the supernatant collected from L-citrulline supple- mented parasite media (sCit). The in vitro culture results showed, decreased parasite growth, and decreased expression of programmed cell death-1 (PD-1) (a coinhibitory molecule) and IL-10 in the L-citrulline supplemented media as compared to L-arginine supplemented media. Hence, it was concluded that L-citrulline supplementation would be a better alternative than L-arginine to inhibit the parasite growth.
Directory of Open Access Journals (Sweden)
O. I. Stepanova
2012-01-01
Full Text Available Abstract. Placental cell populations produce a great variety of angiogenic factors and cytokines than control angiogenesis in placenta. Functional regulation of endothelial cells proceeds via modulation of endothelial cell receptors for endogenous angiogenic and apoptotic signals. Endothelial phenotype alteration during normal pregnancy and in cases of preclampsia is not well understood. The goal of this investigation was to evaluate altered expression of angiogenic and cytokine receptors at EA.hy926 endothelial cells under the influence of placental tissue supernatants. Normal placental tissue supernatants from 1st and 3rd trimesters, and pre-eclamptic placental tissue supernatants (3rd trimester stimulated angiogenic and cytokine receptors expression by the cultured endothelial cells, as compared with their background expression. Tissue supernatants from placental samples of 3rd trimester caused a decreased expression of angiogenic and cytokine receptors by endothelial cells, thus reflecting maturation of placental vascular system at these terms. Supernatants from preeclamptic placental tissue induced an increase of CD119 expression, in comparison with normal placental supernatants from the 3rd trimester. This finding suggests that IFNγ may be a factor of endothelial activation in pre-eclampsia. The study was supported by grants ГК №02.740.11.0711, НШ-3594.2010.7., and МД-150.2011.7.
Cell culture supernatants for detection perforin ELISA
African Journals Online (AJOL)
Najwa
2014-02-19
Feb 19, 2014 ... filtration chromatography using Sephadex G-150, and the study utilized an in vitro ... 1.73 U/mg in crude extract to 2.29 U/mg after ion-exchange and 10.5 U/mg ..... survival: application to proliferation and cytotoxicity assays .J.
Yamamoto, N; Schneider, J; Hinuma, Y; Hunsmann, G
1982-01-01
A glycoprotein of an apparent molecular mass of 46,000, gp 46, was enriched by affinity chromatography from the virus- and cell-free culture medium of adult T-cell leukemia virus (ATLV) infected cells. gp 46 was specifically precipitated with sera from patients with adult T-cell leukemia associated antigen (ATLA). Thus, gp 46 is a novel component of the ATLA antigen complex.
Directory of Open Access Journals (Sweden)
Stefan Riwaldt
2015-11-01
Full Text Available We recently demonstrated that the CAV1 gene was down-regulated, when poorly differentiated thyroid FTC-133 cancer cells formed spheroids under simulated microgravity conditions. Here, we present evidence that the caveolin-1 protein is involved in the inhibition of spheroid formation, when confluent monolayers are exposed to microgravity. The evidence is based on proteins detected in cells and their supernatants of the recent spaceflight experiment: “NanoRacks-CellBox-Thyroid Cancer”. The culture supernatant had been collected in a special container adjacent to the flight hardware incubation chamber and stored at low temperature until it was analyzed by Multi-Analyte Profiling (MAP technology, while the cells remaining in the incubation chamber were fixed by RNAlater and examined by mass spectrometry. The soluble proteins identified by MAP were investigated in regard to their mutual interactions and their influence on proteins, which were associated with the cells secreting the soluble proteins and had been identified in a preceding study. A Pathway Studio v.11 analysis of the soluble and cell-associated proteins together with protein kinase C alpha (PRKCA suggests that caveolin-1 is involved, when plasminogen enriched in the extracellular space is not activated and the vascular cellular adhesion molecule (VCAM-1 mediated cell–cell adhesion is simultaneously strengthened and activated PRKCA is recruited in caveolae, while the thyroid cancer cells do not form spheroids.
Half-liter supernatant sampler system engineering work plan
International Nuclear Information System (INIS)
Ritter, G.A.
1995-01-01
The Tank Waste Remediation System (TWRS) pretreatment facility project W-236B, known as the Initial Pretreatment Module (IPM), requires samples of supernatants and sludges from 200 Area tank farms for planned hot testing work in support of IPM design. The IPM project has proposed the development of several new sampler systems. These systems include a 0.5-l supernatant sampler, 3-l and 25-l supernatant and sludge samplers, and a 4,000-l sampler system. The 0.5-l sampler will support IPM sampling needs in the 1 to 3 l range starting in late fiscal year 1995. This sampler is intended to be used in conjunction with the existing 100 ml bottle-on-a-string. The 3-l and 25-l systems will be based on the Savannah River Site's sampler system and will support IPM sampling needs in the 3 to 100 liter range. Most of the hot testing required for design of the IPM must be accomplished in the next 3 years. This work plan defines the tasks associated with the development of a 0.5-l sampler system. This system will be referred to as the Half-Liter Supernatant Sampler System (HLSSS). Specifically, this work plan will define the scope of work, identify organizational responsibilities, identify major technical requirements, describe configuration control and verification requirements, and provide estimated costs and schedule. The sampler system will be fully operational, including trained staff and operating procedures, upon completion of this task
Antimicrobial Activity of Cell Free Supernatant of Irradiated Lactic Acid Bacteria Isolates
International Nuclear Information System (INIS)
Abdelaleem, M.A.; AL-Hagar, O.E.Aa.
2015-01-01
Attempts were made to isolate bio preservatives using food wastes with no value and low cost. Whey is the raw material achieved that value. Whey and many other food wastes are used in our study to isolate Lactic acid bacteria (LAB). Cell free supernatants (CFS) of isolates are used to evaluate their antimicrobial activity against indicator pathogenic bacterial strains. CFS-9 isolate from whey has the highest inhibitory activity compared to all other isolates. The inhibitory activity of CFS-9, Nisin (400 IU / ml) and the standard Lactococcus Lactis Subsp. Lactis ATCC 11454 (Lacto) were determined. Furthermore, isolate-9 and Lacto strains were exposed to irradiation at different doses. The inhibition zones of; control isolate-9 (non-irradiated) showed the highest values against all indicator strains, CFS of irradiated Lacto at dose 250 Gy was the highest value against Bacillus cereus and Escherichia coli compared to other irradiation treatments, CFS of irradiated Lacto at dose 100 Gy was the highest value against Staph aureus, while the inhibition zone was in the highest value in CFS of irradiated Lacto at dose 500 Gy against Salmonella typhimurium. Nisin (400 IU / ml) was significantly higher than all CFS of irradiated isolate-9 while, the inhibition zones of all CFS-Lacto (irradiated and nonirradiated) are better and higher than nisin-400
Tang, Fei; Wang, Fukun; An, Liyun; Wang, Xianling
2015-01-01
T cell Ig and mucin domain-containing molecule-3 (Tim-3) is a negative regulator preferentially expressed on Th1 cells. Allergic asthma is a clinical syndrome well characterized by Th1/Th2 imbalance. To investigate the role of Tim-3 in the pathogenesis of asthma and its relationship with Th1/Th2 imbalance, a total of 40 patients with allergic asthma and 40 healthy controls were enrolled. Expression of Tim-3 and Th1/Th2 imbalance as well as the relationship between them was analyzed by flow cytometry and real-time PCR. Peripheral blood mononuclear cells (PBMCs) were cultured in vitro and anti-Tim-3 was used to block Tim-3 signaling; Th1/Th2 cytokines in the culture supernatant were detected by enzyme linked immunosorbent assay (ELISA). CD4(+) T cells and B cells were sorted and co-cultured in vitro, and anti-Tim-3 was used to block Tim-3 signaling; Total IgG/IgE in the culture supernatant was detected by ELISA. The mRNA level of T-bet and IFN-γ were significantly decreased in allergic asthma patients, while GATA-3 and IL-4 were significantly increased. Expression of Tim-3 on CD4(+) T cells was much higher in allergic asthma patients and it was negatively correlated with T-bet/GATA-3 ratio or IFN-γ/IL-4 ratio. Blocking of Tim-3 significantly increased Th1 cytokines (TNF-α and IFN-γ) and decreased Th2 cytokines (IL-4, IL-5, IL-13) in the culture supernatant of PBMCs. Blocking of Tim-3 dramatically reduced the production of IgG and IgE in the co-culture supernatant of CD4(+) T cells and B cells. In conclusion, Tim-3 was up-regulated in allergic asthma patients and related with the Th1/Th2 imbalance. Blocking of Tim-3 may be of therapeutic benefit by enhancing the Th1 cytokines response, down-regulating the Th2 cytokines response, and reducing IgG/IgE production.
Wan, Ying; Xin, Yi; Zhang, Cuili; Wu, Dachang; Ding, Dapeng; Tang, Li; Owusu, Lawrence; Bai, Jing; Li, Weiling
2014-05-01
Probiotic bacteria are known to exert a wide range of beneficial effects on their animal hosts. Therefore, the present study explored the effect of the supernatants obtained from Lactobacillus delbrueckii fermentation (LBF) on colon cancer. The results indicated that the proliferation of LBF solution-treated colon cancer SW620 cells was arrested and accumulated in the G1 phase in a concentration-dependent manner. The LBF solution efficiently induced apoptosis through the intrinsic caspase 3-depedent pathway, with a corresponding decreased expression of Bcl-2. The activity of matrix metalloproteinase 9, which is associated with the invasion of colon cancer cells, was also decreased in the LBF-treated cells. In conclusion, the results demonstrate the antitumor effect of LBF in vitro and may contribute to the development of novel therapies for the treatment of colon cancer.
Dextran Sulfate Sodium Inhibits Alanine Synthesis in Caco-2 Cells
Directory of Open Access Journals (Sweden)
Carolyn M. Slupsky
2011-04-01
Full Text Available To understand and characterize the pathogenic mechanisms of inflammatory bowel disease, dextran sulfate sodium (DSS has been used to induce acute and chronic colitis in animal models by causing intestinal epithelium damage. The mechanism of action of DSS in producing this outcome is not well understood. In an effort to understand how DSS might impact epithelial cell metabolism, we studied the intestinal epithelial cell line Caco-2 incubated with 1% DSS over 56 hours using 1H NMR spectroscopy. We observed no difference in cell viability as compared to control cultures, and an approximately 1.5-fold increase in IL-6 production upon incubation with 1% DSS. The effect on Caco-2 cell metabolism as measured through changes in the concentration of metabolites in the cell supernatant included a three-fold decrease in the concentration of alanine. Given that the concentrations of other amino acids in the cell culture supernatant were not different between treated and control cultures over 56 hours suggest that DSS inhibits alanine synthesis, specifically alanine aminotransferase, without affecting other key metabolic pathways. The importance of alanine aminotransferase in inflammatory bowel disease is discussed.
Kuznetsova, M V; Karpunina, T I; Maslennikova, I L; Nesterova, L Iu; Demakov, V A
2012-01-01
Study the effect of P. aeruginosa exometabolites on planktonic and biofilm cultures of bioluminescent E. coli strain. E. coli K12 TG1 (pF1 lux+ Ap(r)) recombinant bioluminescent strain, P. aeruginosa ATCC 27853 reference strain and 2 nosocomial isolates were used. Pyocyanin and pyoverdin content in supernatant of P. aeruginosa over-night cultures was evaluated according to E. Deziel et al. (2001). Planktonic and biofilm cultures of E. coli were obtained in 96-well plates (LB, statically, 37 degrees C), optical density of plankton, film biomass (OD600, OD580) and bioluminescence in plankton and biofilm were evaluated in microplate reader Infiniti M200 (Tecan, Austria). P. aeruginosa exometabolites increased the duration of lag-phase in E. coli, and short term exposition inhibited luminescence of planktonic cells. These effects are determined by bactericidal action ofpyocyanin and pyoverdin. Supernatants ofover-night cultures of P. aeruginosa inhibit formation of biofilm and disrupt the formed biofilm of E. coli. Effect of pyocyanin and pyoverdin on these processes is not established, other factors may have higher significance. Bioluminescence of E. coli K12 TGI that reflects the energetic status of the cell allows to evaluate and prognose the character of coexistence of P. aeruginosa in combined with E. coli planktonic and biofilm culture.
Kim, Jung-Hyun; Kim, Sang-Su; Han, Ik-Hwan; Sim, Seobo; Ahn, Myoung-Hee; Ryu, Jae-Sook
2016-11-01
Chronic inflammation has a role in the pathogenesis of benign prostatic hyperplasia (BPH) and prostate cancer. Mast cells have been detected in chronic inflammatory infiltrate of the prostate, and it is possible that the interaction between prostate epithelial cells and Trichomonas vaginalis influences the activity of mast cells in the prostate stroma. Activated mast cells might influence the biological functions of nearby tissues and cells. In this study, we investigated whether mast cells reacted with the culture supernatant of BPH epithelial cells infected with T. vaginalis may induce the proliferation of prostate stromal cells. To measure the proliferation of prostate stromal cells in response to chronic inflammation caused by the infection of BPH-1 cells with T. vaginalis, the CCK-8 assay and wound healing assay were used. ELISAs, quantitative real-time PCR, western blotting and immunofluorescence were used to measure the production and expression of inflammatory cytokine and cytokine receptor. BPH-1 cells incubated with live trichomonads produced increased levels of CCL2, IL-1β, IL-6, and CXCL8, and induced the migration of mast cells and monocytes. When the culture supernatant of BPH-1 cells stimulated with trichomonads (TCM) was added to mast cells, they became activated, as confirmed by release of β-hexosaminidase and CXCL8. Prostate stromal cells incubated with the culture supernatant of mast cells activated with TCM (M-TCM) proliferated and expressed increased levels of CXCL8, CCL2, and the cytokine receptors CXCR1 and CCR2. Blocking the chemokine receptors reduced the proliferation of stromal cells and also decreased the production of CXCL8 and CCL2. Moreover, the expression of FGF2, cyclin D1, and Bcl-2 was increased in the proliferated stromal cells stimulated with M-TCM. Additionally, the M-TCM-treated stromal cells were more invasive than control cells. The inflammatory mediators released by BPH epithelial cells in response to infection by
DEFF Research Database (Denmark)
Owens, T
1988-01-01
on resting B cells (even in the presence of intact F23.1 antibody), but could induce antibody secretion by anti-Ig-preactivated B cells. Both F23.1+ clones (E9.D4 and 4.35F2) and one F23.1- clone (D2.2) could synergize with supernatants from activated E9.D4 T cells to induce B cell activation. F(ab')2......Culture of small resting allogeneic B cells (of an irrelevant haplotype) with two clones of T helper (Th) cells that were activated by the F23.1 anti-T cell receptor antibody led to the activation of B cells to proliferate and to secrete antibody. Th cell supernatants by themselves had no effect...... fragments of F23.1 induced E9.D4 to activate B cells as efficiently as intact F23.1 and B cell populations that had been incubated with F23.1 were not activated when cultured with E9.D4, although T cells recognized cell-presented F23.1 and were weakly activated. Reduction of the density of F23.1 adsorbed...
Networked T cell death following macrophage infection by Mycobacterium tuberculosis.
Directory of Open Access Journals (Sweden)
Stephen H-F Macdonald
Full Text Available BACKGROUND: Depletion of T cells following infection by Mycobacterium tuberculosis (Mtb impairs disease resolution, and interferes with clinical test performance that relies on cell-mediated immunity. A number of mechanisms contribute to this T cell suppression, such as activation-induced death and trafficking of T cells out of the peripheral circulation and into the diseased lungs. The extent to which Mtb infection of human macrophages affects T cell viability however, is not well characterised. METHODOLOGY/PRINCIPAL FINDINGS: We found that lymphopenia (<1.5 × 10(9 cells/l was prevalent among culture-positive tuberculosis patients, and lymphocyte counts significantly improved post-therapy. We previously reported that Mtb-infected human macrophages resulted in death of infected and uninfected bystander macrophages. In the current study, we sought to examine the influence of infected human alveolar macrophages on T cells. We infected primary human alveolar macrophages (the primary host cell for Mtb or PMA-differentiated THP-1 cells with Mtb H37Ra, then prepared cell-free supernatants. The supernatants of Mtb-infected macrophages caused dose-dependent, caspase-dependent, T cell apoptosis. This toxic effect of infected macrophage secreted factors did not require TNF-α or Fas. The supernatant cytotoxic signal(s were heat-labile and greater than 50 kDa in molecular size. Although ESAT-6 was toxic to T cells, other Mtb-secreted factors tested did not influence T cell viability; nor did macrophage-free Mtb bacilli or broth from Mtb cultures. Furthermore, supernatants from Mycobacterium bovis Bacille de Calmette et Guerin (BCG- infected macrophages also elicited T cell death suggesting that ESAT-6 itself, although cytotoxic, was not the principal mediator of T cell death in our system. CONCLUSIONS: Mtb-Infected macrophages secrete heat-labile factors that are toxic to T cells, and may contribute to the immunosuppression seen in tuberculosis as well as
Stranieri, Angelica; Paltrinieri, Saverio; Giordano, Alessia
2017-05-01
The delta total nucleated cells (ΔTNC) measurement with the Sysmex XT-2000iV (Sysmex Europe, Norderstedt, Germany) has high diagnostic accuracy on effusions in feline infectious peritonitis (FIP) cases, but the test can be performed only on fresh samples. We evaluated whether supernatants from effusions retain the ability to induce cell clumping and assessed the diagnostic accuracy of this modified ΔTNC method. Effusions were collected from FIP cats ( n = 19) and from cats with other diseases ( n = 15). ΔTNC was measured on fresh samples and on frozen-thawed supernatants after the addition of feline blood at 1:10 dilution. Diagnostic accuracy was assessed at the cutoffs of suggestive of FIP (ΔTNC = 1.7) and consistent with FIP (ΔTNC = 3.4). The influence of the protein content, number of added cells, and magnitude of dilution were also investigated. Specificity and positive predictive value were 100% for both the methods. Sensitivity and negative predictive value were higher for the modified ΔTNC (84.2% and 83.3%, respectively, at the cutoff of 1.7; 78.9% and 78.9%, respectively, at the cutoff of 3.4) than for the ΔTNC on fresh samples (78.6% and 81.3%, respectively, at the cutoff of 1.7; 57.1% and 68.4%, respectively, at the cutoff of 3.4). Protein content, total cell count of the added blood, and magnitude of dilutions did not influence the results. Supernatants of frozen effusions from FIP cats retain the ability to induce cell clumping, thus the modified ΔTNC measurement is a reliable tool to diagnose FIP on samples that cannot be analyzed immediately.
Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier
2017-11-01
Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.
International Nuclear Information System (INIS)
Hasei, K.; Ichihashi, M.; Mojamdar, M.
1984-01-01
The effect of chlorpromazine (CPZ) and UVA on lysosomes of cultured normal human fibroblasts has been investigated. Acid phosphatase (ACPase) activity in 12000 g pellet of cells treated with CPZ (10 μg/ml) and UVA (6 x 10 4 J/m 2 ) was found to be decreased as compared with non-treated, CPZ or UVA treated control cells. This decrease, however, was not accompanied by a concomitant increase in ACPase activity in the 12000 g supernatant. The addition of Triton X-100 to cells pre-treated with CPZ + UVA resulted in only a moderate increase in ACPase activity of the 12000 g supernatant. ACPase activity of the cells incubated in media containing pre-irradiated CPZ was also found to be decreased. These results indicate that CPZ + UVA directly inactivate lysosomal enzymes, possibly without affecting the membrane. (author)
Maxisorp RAST. A sensitive method for detection of antigen-specific human IgE in culture fluids
DEFF Research Database (Denmark)
Poulsen, L K; Pedersen, M F; Malling, H J
1989-01-01
For determination of allergen-specific IgE in cell culture supernatants and other highly diluted IgE preparations a radioallergosorbent test (RAST) based on high adsorption polystyrene test tubes has been developed ("Maxisorp RAST"). Cladosporium herbarum extract was used as a model allergen...
Nakaya, K; Mizuno, R; Ohhashi, T
2001-12-01
We investigated whether supernatant cultured with melanoma cell lines B16-BL6 and K1735 or the Lewis lung carcinoma cell line (LLC) can regulate lymphatic pump activity with bioassay preparations isolated from murine iliac lymph vessels. B16-BL6 and LLC supernatants caused significant dilation of lymph microvessels with cessation of pump activity. B16-BL6 supernatant produced dose-related cessation of lymphatic pump activity. There was no significant tachyphylaxis in the supernatant-mediated inhibitory response of lymphatic pump activity. Pretreatment with 3 x 10(-5) M N(omega)-nitro-L-arginine methyl ester (L-NAME) or 10(-7) M or 10(-6) M glibenclamide and 5 x 10(-4) M 5-hydroxydecanoic acid caused significant reduction of supernatant-mediated inhibitory responses. Simultaneous treatment with 10(-3) M L-arginine and 3 x 10(-5) M L-NAME significantly lessened L-NAME-induced inhibition of the supernatant-mediated response, suggesting that endogenous nitric oxide (NO) plays important roles in supernatant-mediated inhibitory responses. Chemical treatment dialyzed substances of B16-BL6 cells may release nonpeptide substance(s) of <1,000 MW, resulting in significant cessation of lymphatic pump activity via production and release of endogenous NO and activation of mitochondrial ATP-sensitive K(+) channels.
Park, H S; Suh, J H; Kim, H Y; Kwon, O J; Choi, D C
1999-04-01
Recent publications have suggested an active participation of neutrophils to induce bronchoconstriction after inhalation of grain dust (GD). To further understand the role of neutrophils in the pathogenesis of GD-induced asthma, this investigation was designed to determine whether human bronchial epithelial cells could produce IL-8 production and to observe the effect of dexamethasone on IL-8 production. We cultured Beas-2B, a bronchial epithelial cell line. To observe GD-induced responses, four concentrations (1 to 200 microg/mL) of GD were incubated for 24 hours and compared with those without incubation of GD. To evaluate the effect of pro-inflammatory cytokines on IL-8 production, epithelial cells were incubated with peripheral blood mononuclear cell (PBMC) culture supernatant, which was derived from the culture of PBMC from a GD-induced asthmatic subject under the exposure to 10 microg/mL of GD, and compared with those cultured without addition of PBMC supernatant. The level of released IL-8 in the supernatant was measured by enzyme-linked immunosorbent assay. To evaluate the effect of dexamethasone on IL-8 production, four concentrations (5 to 5000 ng/mL) of dexamethasone were pre-incubated for 24 hours and the same experiments were repeated. There was significant production of IL-8 from bronchial epithelial cells with additions of GD in a dose-dependent manner (P < .05), which was significantly augmented with additions of PBMC supernatant (P < .05) at each concentration. Compared with the untreated sample, pretreatment of dexamethasone could induced a remarkable inhibitions (15% to 55%) of IL-8 production from bronchial epithelial cells in a dose-dependent manner. These results suggest that IL-8 production from bronchial epithelial cells may contribute to neutrophil recruitment occurring in GD-induced airway inflammation. The downregulation of IL-8 production by dexamethasone from bronchial epithelial cells may contribute to the efficacy of this compound in
Musante, Luca; Tataruch-Weinert, Dorota; Kerjaschki, Dontscho; Henry, Michael; Meleady, Paula; Holthofer, Harry
2017-01-01
Urinary extracellular vesicles (UEVs) appear an ideal source of biomarkers for kidney and urogenital diseases. The majority of protocols designed for their isolation are based on differential centrifugation steps. However, little is still known of the type and amount of vesicles left in the supernatant. Here we used an isolation protocol for UEVs which uses hydrostatic filtration dialysis as first pre-enrichment step, followed by differential centrifugation. Transmission electron microscopy (TEM), mass spectrometry (MS), western blot, ELISA assays and tuneable resistive pulse sensing (TRPS) were used to characterise and quantify UEVs in the ultracentrifugation supernatant. TEM showed the presence of a variety of small size vesicles in the supernatant while protein identification by MS matched accurately with the protein list available in Vesiclepedia. Screening and relative quantification for specific vesicle markers showed that the supernatant was preferentially positive for CD9 and TSG101. ELISA tests for quantification of exosome revealed that 14%, was left in the supernatant with a particle diameter of 110 nm and concentration of 1.54 × 10 10 /ml. Here we show a comprehensive characterisation of exosomes and other small size urinary vesicles which the conventional differential centrifugation protocol may lose.
Stampfer, Martha R; Garbe, James C
2015-02-24
Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.
Silva, Manuel A; Bercik, Premysl
2012-06-01
Airway goblet cell hyperplasia (GCH)--detectable by mucin staining--and abnormal macrophage infiltrate are pathological features present in many chronic respiratory disorders. However, it is unknown if both factors are associated. Using in-vivo and in-vitro models, we investigated whether macrophages are related with GCH and changes in mucin immunophenotypes. Lung sections from Sprague-Dawley rats treated for 48 h with one intra-tracheal dose of PBS or LPS (n=4-6 per group) were immunophenotyped for rat-goblet cells, immune, and proliferation markers. Human monocyte-derived macrophages (MDM) were pre-treated with or without LPS, immunophenotyped, and their supernatant, as well as cytokines at levels equivalent to supernatant were used to challenge primary culture of normal human bronchus epithelial cells (HBEC) in air-liquid interface, followed by MUC5B and MUC5AC mucin immunostaining. An association between increased bronchiolar goblet cells and terminal-bronchiolar proliferative epithelial cells confirmed the presence of GCH in our LPS rat model, which was related with augmented bronchiolar CD68 macrophage infiltration. The in-vitro experiments have shown that MUC5AC phenotype was inhibited when HBEC were challenged with supernatant from MDM pre-treated with or without LPS. In contrast, TNF-α and interleukin-1β at levels equivalent to supernatant from LPS-treated MDM increased MUC5AC. MUC5B was induced by LPS, supernatant from LPS-treated MDM, a mix of cytokines including TNF-α and TNF-α alone at levels present in supernatant from LPS-treated MDM. We demonstrated that macrophages are related with bronchiolar GCH, and that they induced MUC5B and inhibited MUC5AC in HBEC, suggesting a role for them in the pathogenesis of airway MUC5B-related GCH.
Ion exchange flowsheet for recovery of cesium from purex sludge supernatant at B Plant
International Nuclear Information System (INIS)
Carlstrom, R.F.
1977-01-01
Purex Sludge Supernatant (PSS) contains significant amounts of 137 Cs left after removal of strontium from fission product bearing Purex wastes. To remove cesium from PSS, an Ion Exchange Recovery system has been set up in Cells 17-21 at B Plant. The cesium that is recovered is stored within B Plant for eventual purification through the Cesium Purification process in Cell 38 and eventual encapsulation and storage in a powdered form at the Waste Encapsulation Storage Facility. Cesium depleted waste streams from the Ion Exchange processes are transferred to underground storage
Nishimura, Yuri; Kitagishi, Yasuko; Yoshida, Hitomi; Okumura, Naoko; Matsuda, Satoru
2011-01-01
SIRT1 is a mammalian candidate molecule involved in longevity and diverse metabolic processes. The present study aimed to determine the effects of certain herbs and spices on SIRT1 expression. Human cell lines Daudi, Jurkat, U937 and K562 were cultured in RPMI-1640. Herb and spice powders were prepared and the supernatants were collected. RT-PCR was used to quantify the expression level of the gene. Protein samples were then analyzed by Western blotting. Western blotting revealed the down-regulation of SIRT1 protein expression in Daudi cells treated with extracts of black pepper or turmeric. On the other hand, the effect on the SIRT1 gene expression examined by reverse transcription polymerase chain reaction was unaltered. In conclusion, component(s) of certain herbs and spices may induce the down-regulation of SIRT1 protein.
Xia, Harry Hua-Xiang; Lam, Shiu Kum; Chan, Annie O.O.; Lin, Marie Chia Mi; Kung, Hsiang Fu; Ogura, Keiji; Berg, Douglas E.; Wong, Benjamin C. Y.
2005-01-01
AIM: Helicobacter pylori (H pylori) is associated with increased gastric inflammatory and epithelial expression of macrophage migration inhibitory factor (MIF) and gastric epithelial cell proliferation. This study aimed at determining whether H pylori directly stimulates release of MIF in monocytes, whether the cag pathogenicity island (PAI) is involved for this function, and whether MIF stimulated by H pylori increases gastric epithelial cell proliferation in vitro. METHODS: A cytotoxic wild-type H pylori strain (TN2)and its three isogenic mutants (TN2△cag, TN2△cagA and TN2△cagE) were co-cultured with cells of a human monocyte cell line, THP-1, for 24 h at different organism/cell ratios. MIF in the supernatants was measured by an ELISA. Cells of a human gastric cancer cell line, MKN45, were then co-cultured with the supernatants, with and without monoclonal anti-MIF antibody for 24 h. The cells were further incubated for 12 h after addition of 3H-thymidine, and the levels of incorporation of 3H-thymidine were measured with a liquid scintillation counter. RESULTS: The wild-type strain and the isogenic mutants, TN2△cagA and TN2△cagE, increased MIF release at organism/cell ratios of 200/1 and 400/1, but not at the ratios of 50/1 and 100/1. However, the mutant TN2△cag did not increase the release of MIF at any of the four ratios. 3H-thymidine readings for MKN-45 cells were significantly increased with supernatants derived from the wild-type strain and the mutants TN2△cagA and TN2△cagE, but not from the mutant TN2△cag. Moreover, in the presence of monoclonal anti-MIF antibody, the stimulatory effects of the wild-type strain on cell proliferation disappeared. CONCLUSION: H pylori stimulates MIF release in monocytes, likely through its cag PAI, but not related to cagA or cagE. H pylori-stimulated monocyte culture supernatant increases gastric cell proliferation, which is blocked by anti-MIF antibody, suggesting that MIF plays an important role in H
Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng
2016-03-01
A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.
Andersen, Ditte C; Jensen, Charlotte H; Gregersen, Annemette; Brandt, Jette; Kliem, Anette; Skjødt, Karsten; Koch, Claus; Teisner, Børge
2004-01-01
This report describes an assay for comparison of epitope specificity in groups of monoclonal antibodies against a given antigen. The only prerequisite is the biotin-labeled antigen. One of the monoclonal antibodies is captured onto a plastic surface via a rabbit anti-mouse Ig, and the other preincubated with biotinylated antigen. When the two antibodies react with the same epitope subsequent binding of the biotin-labeled antigen is abolished (inhibition). In the cases where no inhibition was observed, the two antibodies were considered to react with distinct, independent epitopes. The obvious advantages using this assay, are that it can be performed directly on culture supernatants in the early phase of monoclonal antibody production, and also works for antigens with repetitive epitopes. Moreover, the bonus effect, i.e., a signal in excess of the reference signal when sets of monoclonal antibodies with different epitope specificity are compared, gives a relative measure of affinity.
Directory of Open Access Journals (Sweden)
S Hamounnavard
2014-11-01
Full Text Available Introduction: Mesenchymal stem cells have immunomodulatory properties and own extensive potentials to proliferate and differentiate into different cell lineages. Thus, this study was conducted to investigate the effect of supernatant of rat MSCs on the neutrophils viability. Methods: MSCs was isolated from femoral and tibial bone marrow of rat (6-8 weeks and was cultured in DMEM. After maturation of MSCs, its supernatant was incubated with neutrophils isolated from peripheral blood of rat at 37 ° C for 1 h. Neutrophil survival was measured at 6 and 24 h incubation with supernatant of MSCs by flow cytometric analysis using An/PI. Data were analyzed by one-way ANOVA followed by Tukey test (P˂0.05. Results: 6-hour incubation of neutrophils with supernatant of MSCs significantly increased the healthy cells percentage and significantly decreased the amount of necrosis (P˂0.05, but no significant decrease was observed in regard with apoptosis compared to the controls (P˃0.05. The 24-hour incubation of neutrophils with cell supernatant significantly increased the percentage of healthy cells and apoptosis was significantly reduced compared to the control group (P˂0.05. Moreover, a reduction in cell necrosis was not significant in the treated groups compared to the control (P˃0.05. Conclusions: In addition to the clinical importance of MSCs, their biological aspects are of great potential for cell therapy, such as self-renewal, proliferation and immune modulatory effects.
Metabolomics analysis was performed on the supernatant of human embryonic stem (hES) cell cultures exposed to a blinded subset of 11 chemicals selected from the chemical library of EPA's ToxCast™ chemical screening and prioritization research project. Metabolites from hES cultur...
Sanjurjo-Rodríguez, Clara; Martínez-Sánchez, Adela Helvia; Hermida-Gómez, Tamara; Fuentes-Boquete, Isaac; Díaz-Prado, Silvia; Blanco, Francisco J
2016-11-01
The aim of this study was to evaluate proliferation and chondrogenic differentiation of human bone-marrow mesenchymal stromal cells (hBMSCs) cultured on collagen biomaterials. hBMSCs were seeded on five different collagen (Col) sponges: C1C2 (types I and II Col), C1C2HS (types I and II Col plus heparan sulphate (HS)), C1C2CHS (types I and II Col plus chondroitin sulphate (CHS)), C1-OLH3 (type I Col plus low molecular weight heparin) and C1CHS (type I Col plus CHS). The resulting constructs were analyzed by histological and immunohistochemical staining, molecular biology and electron microscopy. Col released into culture media was measured by a dye-binding method Results: hBMSCs on biomaterials C1C2, C1C2HS and C1C2CHS had more capacity to attach, proliferate and synthesize Col II and proteoglycans in the extracellular matrix (ECM) than on C1-OLH3 and C1CHS. The presence of aggrecan was detected only at the gene level. Total Col liberated by the cells in the supernatants in all scaffold cultures was detected. The level of Col I in the ECM was lower in C1-OLH3 and that of Col II was highest in C1C2 and C1C2HS. Electron microscopy showed differently shaped cells, from rounded to flattened, in all constructs. Col fibers in bundles were observed in C1C2CHS by transmission electron microscopy. The results show that Col I and Col II (C1C2, C1C2HS and C1C2CHS) biomaterials allowed cell proliferation and chondrogenic-like differentiation of hBMSCs at an early stage. Constructs cultured on C1C2HS and C1C2CHS showed better cartilage-like phenotype than the other ones.
In vitro culture and characterization of alveolar bone osteoblasts isolated from type 2 diabetics
Energy Technology Data Exchange (ETDEWEB)
Sun, Dao-Cai [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China); Department of Stomatology, The 291st Hospital of P.L.A, Baotou (China); Li, De-Hua [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China); Ji, Hui-Cang [Military Sanatorium of Retired Cadres, Baotou (China); Rao, Guo-Zhou [Center of Laboratory, School of Stomatology, Xi' an Jiaotong University, Xi' an (China); Liang, Li-Hua [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China); Ma, Ai-Jie [Xi' an Technology University, Xi' an (China); Xie, Chao; Zou, Gui-Ke; Song, Ying-Liang [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China)
2012-04-05
In order to understand the mechanisms of poor osseointegration following dental implants in type 2 diabetics, it is important to study the biological properties of alveolar bone osteoblasts isolated from these patients. We collected alveolar bone chips under aseptic conditions and cultured them in vitro using the tissue explants adherent method. The biological properties of these cells were characterized using the following methods: alkaline phosphatase (ALP) chemical staining for cell viability, Alizarin red staining for osteogenic characteristics, MTT test for cell proliferation, enzyme dynamics for ALP contents, radio-immunoassay for bone gla protein (BGP) concentration, and ELISA for the concentration of type I collagen (COL-I) in the supernatant. Furthermore, we detected the adhesion ability of two types of cells from titanium slices using non-specific immunofluorescence staining and cell count. The two cell forms showed no significant difference in morphology under the same culture conditions. However, the alveolar bone osteoblasts received from type 2 diabetic patients had slower growth, lower cell activity and calcium nodule formation than the normal ones. The concentration of ALP, BGP and COL-I was lower in the supernatant of alveolar bone osteoblasts received from type 2 diabetic patients than in that received from normal subjects (P < 0.05). The alveolar bone osteoblasts obtained from type 2 diabetic patients can be successfully cultured in vitro with the same morphology and biological characteristics as those from normal patients, but with slower growth and lower concentration of specific secretion and lower combining ability with titanium than normal ones.
In vitro culture and characterization of alveolar bone osteoblasts isolated from type 2 diabetics
International Nuclear Information System (INIS)
Sun, Dao-Cai; Li, De-Hua; Ji, Hui-Cang; Rao, Guo-Zhou; Liang, Li-Hua; Ma, Ai-Jie; Xie, Chao; Zou, Gui-Ke; Song, Ying-Liang
2012-01-01
In order to understand the mechanisms of poor osseointegration following dental implants in type 2 diabetics, it is important to study the biological properties of alveolar bone osteoblasts isolated from these patients. We collected alveolar bone chips under aseptic conditions and cultured them in vitro using the tissue explants adherent method. The biological properties of these cells were characterized using the following methods: alkaline phosphatase (ALP) chemical staining for cell viability, Alizarin red staining for osteogenic characteristics, MTT test for cell proliferation, enzyme dynamics for ALP contents, radio-immunoassay for bone gla protein (BGP) concentration, and ELISA for the concentration of type I collagen (COL-I) in the supernatant. Furthermore, we detected the adhesion ability of two types of cells from titanium slices using non-specific immunofluorescence staining and cell count. The two cell forms showed no significant difference in morphology under the same culture conditions. However, the alveolar bone osteoblasts received from type 2 diabetic patients had slower growth, lower cell activity and calcium nodule formation than the normal ones. The concentration of ALP, BGP and COL-I was lower in the supernatant of alveolar bone osteoblasts received from type 2 diabetic patients than in that received from normal subjects (P < 0.05). The alveolar bone osteoblasts obtained from type 2 diabetic patients can be successfully cultured in vitro with the same morphology and biological characteristics as those from normal patients, but with slower growth and lower concentration of specific secretion and lower combining ability with titanium than normal ones
Proteomics of apheresis platelet supernatants during routine storage: Gender-related differences.
Dzieciatkowska, Monika; D'Alessandro, Angelo; Burke, Timothy A; Kelher, Marguerite R; Moore, Ernest E; Banerjee, Anirban; Silliman, Christopher C; West, Bernadette F; Hansen, Kirk C
2015-01-01
Proteomics has identified potential pathways involved in platelet storage lesions, which correlate with untoward effects in the recipient, including febrile non-haemolytic reactions. We hypothesize that an additional pathway involves protein mediators that accumulate in the platelet supernatants during routine storage in a donor gender-specific fashion. Apheresis platelet concentrates were collected from 5 healthy males and 5 females and routinely stored. The 14 most abundant plasma proteins were removed and the supernatant proteins from days 1 and 5 were analyzed via 1D-SDS-PAGE/nanoLC-MS/MS, before label-free quantitative proteomics analyses. Findings from a subset of 18 proteins were validated via LC-SRM analyses against stable isotope labeled standards. A total of 503 distinct proteins were detected in the platelet supernatants from the 4 sample groups: female or male donor platelets, either at storage day 1 or 5. Proteomics suggested a storage and gender-dependent impairment of blood coagulation mediators, pro-inflammatory complement components and cytokines, energy and redox metabolic enzymes. The supernatants from female donors demonstrated increased deregulation of structural proteins, extracellular matrix proteins and focal adhesion proteins, possibly indicating storage-dependent platelet activation. Routine storage of platelet concentrates induces changes in the supernatant proteome, which may have effects on the transfused patient, some of which are related to donor gender. The rationale behind this study is that protein components in platelet releasates have been increasingly observed to play a key role in adverse events and impaired homeostasis in transfused recipients. In this view, proteomics has recently emerged as a functional tool to address the issue of protein composition of platelet releasates from buffy coat-derived platelet concentrates in the blood bank. Despite early encouraging studies on buffy coat-derived platelet concentrates, platelet
Autenshlyus, Alexander I; Arkhipov, Sergey A; Kunts, Tatiana A; Marinkin, Igor O; Mikhailova, Elena S; Karpukhina, Xenia V; Varaksin, Nikolay A
2017-03-01
Interrelations between cytokines, produced by invasive ductal carcinoma (IDC) and fibroadenoma (FA) of the breast, and angiogenic growth factor VEGF-A, expressed in IDC and FA, were investigated. The analysis of the cytokine profiles of IDC and FA was performed by cultivation of tumor biopsy specimens in vitro. Testing of the cytokine-producing reserve of the tumors for production of VEGF-A was conducted by culturing samples of IDC and FA in a medium containing polyclonal activator (a complex of phytohemagglutinin, concanavalin A, and lipopolysaccharide). Levels of cytokines and growth factors (IL-2, IL-6, IL-8, IL-10, IL-17, IL-18, IL-1β, IL-1Ra, TNF-α, IFN-γ, G-CSF, GM-CSF, VEGF-A) and MCP-1 (monocyte chemoattractant protein-1) in tumor supernatants were determined by an ELISA. Expression of VEGF-A was analyzed in tumor biopsy specimens by immunohistochemical analysis. In the IDC supernatants, the concentrations of IL-17, IL-18, and IFN-γ were higher and the concentrations of IL-10 and MCP-1 were lower in comparison with the FA supernatants. We observed negative correlations between the macrophage infiltration and VEGF-A concentration in the IDC supernatants (r = -0.508; P = 0.011) and between VEGF-A expression and the IDC vascularization degree (r = -0.423, P = 0.039). Spontaneous expression of VEGF-A in samples of IDC significantly exceeded the VEGF-A expression in FA. There was no difference between IDC and FA in VEGF-A expression after treatment with the polyclonal activators. Our results indicate that greater malignancy may have a paradoxical effect that is controlled by cytokines and characterized by weakening of tumor angiogenesis during overproduction of VEGF-A. These findings point to complex mechanisms of positive and negative regulation of tumor angiogenesis by cytokines that are produced by the tumor and by cells in its microenvironment, whose cytokine profiles may change at different stages of tumor progression.
[Experimental research in vitro of TK/GCV system for osteosarcoma MG-63 cell damage].
Zhang, Hua-Dong; Lu, Zhi; Feng, Yi; Liu, Xiao-Li; Hou, Hui-Ming
2014-03-01
To study the killing effects of the liposome-mediated thymidine kinase (TK)/ganciclovir (GCV) system on MG-63 osteosarcoma (OS) cells and its bystander effects. Liposome-mediated TK gene transfected into MG-63 OS cells, the efficiency of transfection was analyzed by flow cytometry and observed under inverted fluorescence microscope. Non-transfected osteosarcoma MG-63 cells were divided into three groups,in the experimental group 1 transfected TK/GCV cells cultured in solutiona liquid mixture by supernatant by 1/10,1/7,1/5,1/2 ratio to original broth; in the experimental group 2 transfected cells cultured in solutiona liquid mixture of supernatant filtered through 0.22 microm filter by 1/10,1/7, 1/5, 1/2 ratio to original broth, in control group the transfection cells cultured in original culture solution. Cell growth inhibition rate and osteosarcoma cell sensitivity to TK/GCV system were measured by MTT assay in each group. The TK gene was transfected into MG-63 OS cells successfully by liposome-mediated, flow cytometry instrument detection TK gene transfection cell transfection efficiency can reach 75.5%. Six days later the MTT assay showed that in the experimental group 1 inhibition rate of all concentration ratio of the mixed culture fluid were statistically significant as compared with the control group (P culture medium was not statistically significant as compared with the control group (P > 0.05). TK gene transfected MG-63 cells increased with the the GCV concentration,the cell apoptosis rate increased. The experiment demonstrated that the MG-63 OS cells are sensitive to the liposome-mediated TK/GCV system and bystander effects are significant.
Energy Technology Data Exchange (ETDEWEB)
Reddehase, M.; Suessmith, W.; Moyers, C.; Falk, W.; Droege, W.
1982-01-01
Interleukin 2-containing supernatants from concanavalin A-activated spleen cells (CSCS) were found to provide strong helper activity for cytotoxic T lymphocyte (CTL) responses against allogeneic stimulator cells in microculture systems, but provided usually insufficient help for CTL responses against l-region compatible allogeneic or TNP-haptenated syngeneic stimulator cells. The interleukin 2-containing supernatant from HGG-activated AODH 7.1 hybridoma cells also mediated only relatively weak CTL responses against TNP-haptenated syngeneic cells in microcultures. Both types of supernatants, however, supported substantial responses against TNP-haptenated syngeneic stimulator cells if irradiated allogeneically activated syngeneic T cells or irradiated allogeneic spleen cells were added to the cultures. The allogeneic cells and the activated syngeneic T cells provided little helper activity if they were added in the absence of the interleukin 2-containing supernatants, thus demonstrating a synergistic effect between these 2 helper components. An l-region difference was sufficient for the helper effect of the allogeneic cells and control experiments showed that the presence of foreign l-region determinants could not be substituted for the TNP-haptenated stimulator cells.
International Nuclear Information System (INIS)
Reddehase, M.; Suessmith, W.; Moyers, C.; Falk, W.; Droege, W.
1982-01-01
Interleukin 2-containing supernatants from concanavalin A-activated spleen cells (CSCS) were found to provide strong helper activity for cytotoxic T lymphocyte (CTL) responses against allogeneic stimulator cells in microculture systems, but provided usually insufficient help for CTL responses against l-region compatible allogeneic or TNP-haptenated syngeneic stimulator cells. The interleukin 2-containing supernatant from HGG-activated AODH 7.1 hybridoma cells also mediated only relatively weak CTL responses against TNP-haptenated syngeneic cells in microcultures. Both types of supernatants, however, supported substantial responses against TNP-haptenated syngeneic stimulator cells if irradiated allogeneically activated syngeneic T cells or irradiated allogeneic spleen cells were added to the cultures. The allogeneic cells and the activated syngeneic T cells provided little helper activity if they were added in the absence of the interleukin 2-containing supernatants, thus demonstrating a synergistic effect between these 2 helper components. An l-region difference was sufficient for the helper effect of the allogeneic cells and control experiments showed that the presence of foreign l-region determinants could not be substituted for the TNP-haptenated stimulator cells
In vitro inhibition of Eimeria tenella sporozoite invasion into host cells by probiotics.
Hessenberger, S; Schatzmayr, G; Teichmann, K
2016-10-15
The aim was to study the effects of probiotics isolated from the intestinal tract of livestock animals on Eimeria tenella invasion into Madin-Darby bovine kidney (MDBK) cells in vitro. E. tenella sporozoites were purified and labeled with 5(6)-carboxyfluorescein diacetate N-succinimidyl ester before seeding on cell cultures, and invasion was evaluated by fluorescence microscopy. Two protocols (A and B) were used. In protocol A, Enterococcus faecium # 589 or Lactobacillus salivarius subsp. salivarius # 505 were added together with sporozoites to MDBK cell cultures and invasion was evaluated after incubation for approximately 20h. Viable, dead, or spent culture supernatants of probiotics were tested. In protocol B, viable probiotics were incubated with MDBK cells for one hour before sporozoites were added and invasion was evaluated after two more hours of incubation. Parasite invasion of viable, dead, or spent culture supernatant of E. faecium # 589 was assessed. Using protocol A, it was shown that parasite invasion was inhibited by viable (80%) or dead (75%) E. faecium # 589. While inhibition by viable L. salivarius subsp. salivarius # 505 was not valid at the highest concentration and not significant at the other test concentrations, dead cells inhibited parasite invasion up to 45%. Spent culture supernatants of both probiotics had no influence on parasite invasion. Using protocol B, it was shown that viable Bifidobacterium animalis subsp. animalis # 503, E. faecium # 497, E. faecium # 589, L. reuteri # 514, L. salivarius subsp. salivarius # 505, and Bacillus subtilis # 588 inhibited parasite invasion into MDBK cells up to 80%. Anticoccidial activity was strain-specific for E. faecium strains, and the strongest effect was shown by E. faecium # 589. Anticoccidial effects of some of the tested probiotics have already been shown in vivo, which makes them candidates to prevent coccidiosis. These findings have now been confirmed in vitro. The used parasite invasion
Rapid detection of bacterial contamination in cell or tissue cultures based on Raman spectroscopy
Bolwien, Carsten; Sulz, Gerd; Becker, Sebastian; Thielecke, Hagen; Mertsching, Heike; Koch, Steffen
2008-02-01
Monitoring the sterility of cell or tissue cultures is an essential task, particularly in the fields of regenerative medicine and tissue engineering when implanting cells into the human body. We present a system based on a commercially available microscope equipped with a microfluidic cell that prepares the particles found in the solution for analysis, a Raman-spectrometer attachment optimized for non-destructive, rapid recording of Raman spectra, and a data acquisition and analysis tool for identification of the particles. In contrast to conventional sterility testing in which samples are incubated over weeks, our system is able to analyze milliliters of supernatant or cell suspension within hours by filtering relevant particles and placing them on a Raman-friendly substrate in the microfluidic cell. Identification of critical particles via microscopic imaging and subsequent image analysis is carried out before micro-Raman analysis of those particles is then carried out with an excitation wavelength of 785 nm. The potential of this setup is demonstrated by results of artificial contamination of samples with a pool of bacteria, fungi, and spores: single-channel spectra of the critical particles are automatically baseline-corrected without using background data and classified via hierarchical cluster analysis, showing great promise for accurate and rapid detection and identification of contaminants.
Directory of Open Access Journals (Sweden)
Gleiter Christoph H
2007-11-01
Full Text Available Abstract Background Cancer, like other diseases accompanied by strong metabolic disorders, shows characteristic effects on cell turnover rate, activity of modifying enzymes and DNA/RNA modifications, resulting also in elevated amounts of excreted modified nucleosides. For a better understanding of the impaired RNA metabolism in breast cancer cells, we screened these metabolites in the cell culture supernatants of the breast cancer cell line MCF-7 and compared it to the human mammary epithelial cells MCF-10A. The nucleosides were isolated and analyzed via 2D-chromatographic techniques: In the first dimension by cis-diol specific boronate affinity extraction and subsequently by reversed phase chromatography coupled to an ion trap mass spectrometer. Results Besides the determination of ribonucleosides, additional compounds with cis-diol structure, deriving from cross-linked biochemical pathways, like purine-, histidine- and polyamine metabolism were detected. In total, 36 metabolites were identified by comparison of fragmentation patterns and retention time. Relation to the internal standard isoguanosine yielded normalized area ratios for each identified compound and enabled a semi-quantitative metabolic signature of both analyzed cell lines. 13 of the identified 26 modified ribonucleosides were elevated in the cell culture supernatants of MCF-7 cells, with 5-methyluridine, N2,N2,7-trimethylguanosine, N6-methyl-N6-threonylcarbamoyladenosine and 3-(3-aminocarboxypropyl-uridine showing the most significant differences. 1-ribosylimidazole-4-acetic acid, a histamine metabolite, was solely found in the supernatants of MCF-10A cells, whereas 1-ribosyl-4-carboxamido-5-aminoimidazole and S-adenosylmethionine occurred only in supernatants of MCF-7 cells. Conclusion The obtained results are discussed against the background of pathological changes in cell metabolism, resulting in new perspectives for modified nucleosides and related metabolites as possible
Effect of Lactobacillus reuteri on Cell Viability and PGE2 Production in Human Gingival Fibroblasts.
A Castiblanco, Gina; Yucel-Lindberg, Tulay; Roos, Stefan; Twetman, Svante
2017-09-01
Emerging evidence suggests that probiotic therapy can play a role in the prevention and management of oral inflammatory diseases through immunomodulation and down-regulation of the inflammatory cascade. The aim of this in vitro study was to investigate the viability of human gingival fibroblasts (HGF) and its production of prostaglandin E 2 (PGE 2 ), when exposed to supernatants of two mixed Lactobacillus reuteri strains (ATCC PTA 5289 and DSM 17938). The experiments were conducted in the presence and absence of the pro-inflammatory cytokine IL-1β. L. reuteri strains were grown and the bacterial supernatant was collected. The cell-free supernatant was diluted to concentrations equivalent to the ones produced by 0.5 to 5.0 × 10 7 CFU/mL bacteria. Cell viability was assessed with the MTT colorimetric assay and the amount of PGE 2 in the cell culture medium was determined using the monoclonal enzyme immune assay kits. Our findings showed that none of the L. reuteri supernatants were cytotoxic or affected the viability of HGF. The most concentrated bacterial supernatant stimulated the production of PGE 2 by the gingival cells in a significant way in the presence of IL-1β (p reuteri might play a role in the resolution of inflammation in HGF. Thus, our findings justify further investigations on the influence of probiotic bacteria on gingival inflammatory reactions.
Test procedures and instructions for Hanford tank waste supernatant cesium removal
Energy Technology Data Exchange (ETDEWEB)
Hendrickson, D.W., Westinghouse Hanford
1996-05-31
This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test using Hanford Double-Shell Slurry Feed supernatant liquor from tank 251-AW-101 in a bench-scale column.Cesium sorbents to be tested include resorcinol-formaldehyde resin and crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-022, Hanford Tank Waste Supernatant Cesium Removal Test Plan.
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Huang Haoyue; Shen Zhenya; Liu Hongcheng; Meng Zili; Teng Xiaomei
2004-01-01
Objective: To explore the change of the cytotoxicity of natural killer cells induced by vascular endothelial cells in vitro and the relationship between this change and the variety of cytokine level. Methods: After fixed by paraformaldehyde, vascular endothelial cells from pigs were co-cultured in vitro with natural killer cells from Chinese monkeys at different ratios. The change of the cytotoxicity of natural killer cells occurring after this contact and the content of IFN-γ and TNF-α in the supernatants were detected. Results: The cytotoxicity of natural killer cells improved gradually in accordance with the co-culture ratio after co-cultured with fixed vascular endothelial cells. The secretion of INF-γ and TNF-α also improved gradually. Conclusion: After contact with xeno-target cells, the cytotoxicity of natural killer cells and the secretion of cytokines are related to the ratio of effective cells and target cells
López-Sanz, Sara; Fariñas, Nuria Rodríguez; Vargas, Rosario Serrano; Martín-Doimeadios, Rosa Del Carmen Rodríguez; Ríos, Ángel
2017-03-01
An analytical methodology based on coupling reversed-phase liquid chromatography (HPLC) to an inductively coupled plasma mass spectrometry (ICP-MS) has been developed for the characterization and identification of gold nanoparticles (AuNPs) and gold dissolved species (Au 3+ ) in culture medium (Dulbecco's Modified Eagle Medium, DMEM) and HeLa cells (a human cervical adenocarcinoma cell line) used in nanotoxicity tests. The influence of the culture medium was also studied and the method applied for nanotoxicity tests. It was also observed that AuNPs can undergo an oxidation process in the supernatants and only a small amount of AuNPs and dissolved Au 3+ was associated with cells. To evaluate the biological impact of AuNPs, a classical viability assay onto HeLa cells was performed using cellular media DMEM in the presence of increasing dosage of 10nm AuNPs. The results showed that 10nm AuNPs exhibit a slight toxic effect. Copyright © 2016 Elsevier B.V. All rights reserved.
Stern-Straeter, Jens; Bonaterra, Gabriel Alejandro; Juritz, Stephanie; Birk, Richard; Goessler, Ulrich Reinhart; Bieback, Karen; Bugert, Peter; Schultz, Johannes; Hörmann, Karl; Kinscherf, Ralf; Faber, Anne
2014-01-01
The creation of functional muscles/muscle tissue from human stem cells is a major goal of skeletal muscle tissue engineering. Mesenchymal stem cells (MSCs) from fat/adipose tissue (AT-MSCs), as well as bone marrow (BM-MSCs) have been shown to bear myogenic potential, which makes them candidate stem cells for skeletal muscle tissue engineering applications. The aim of this study was to analyse the myogenic differentiation potential of human AT-MSCs and BM-MSCs cultured in six different cell culture media containing different mixtures of growth factors. The following cell culture media were used in our experiments: mesenchymal stem cell growth medium (MSCGM)™ as growth medium, MSCGM + 5-azacytidine (5-Aza), skeletal muscle myoblast cell growth medium (SkGM)-2 BulletKit™, and 5, 30 and 50% conditioned cell culture media, i.e., supernatant of human satellite cell cultures after three days in cell culture mixed with MSCGM. Following the incubation of human AT-MSCs or BM-MSCs for 0, 4, 8, 11, 16 or 21 days with each of the cell culture media, cell proliferation was measured using the alamarBlue® assay. Myogenic differentiation was evaluated by quantitative gene expression analyses, using quantitative RT-PCR (qRT-PCR) and immunocytochemical staining (ICC), using well-defined skeletal markers, such as desmin (DES), myogenic factor 5 (MYF5), myosin, heavy chain 8, skeletal muscle, perinatal (MYH8), myosin, heavy chain 1, skeletal muscle, adult (MYH1) and skeletal muscle actin-α1 (ACTA1). The highest proliferation rates were observed in the AT-MSCs and BM-MSCs cultured with SkGM-2 BulletKit medium. The average proliferation rate was higher in the AT-MSCs than in the BM-MSCs, taking all six culture media into account. qRT-PCR revealed the expression levels of the myogenic markers, ACTA1, MYH1 and MYH8, in the AT-MSC cell cultures, but not in the BM-MSC cultures. The muscle-specific intermediate filament, DES, was only detected (by ICC) in the AT-MSCs, but not in the BM
Perfusion based cell culture chips
DEFF Research Database (Denmark)
Heiskanen, Arto; Emnéus, Jenny; Dufva, Martin
2010-01-01
Performing cell culture in miniaturized perfusion chambers gives possibilities to experiment with cells under near in vivo like conditions. In contrast to traditional batch cultures, miniaturized perfusion systems provide precise control of medium composition, long term unattended cultures...... and tissue like structuring of the cultures. However, as this chapter illustrates, many issues remain to be identified regarding perfusion cell culture such as design, material choice and how to use these systems before they will be widespread amongst biomedical researchers....
Directory of Open Access Journals (Sweden)
Larissa B. Poppi
2015-04-01
Full Text Available Many attempts have been made to establish the control of foodborne pathogens through Lactobacillus isolates and their metabolism products with success being obtained in several situations. The aim of this study was to investigate the antagonistic effect of eight Lactobacillus isolates, including L. casei subsp. pseudoplantarum, L. plantarum, L. reuteri and L. delbrueckii subsp. delbrueckii, on the pathogenic Escherichia colistrain O157:H7. The inhibitory effect of pure cultures and two pooled cultures supernatants of Lactobacillus on the growth of pathogenic bacteria was evaluated by the spot agar method and by monitoring turbidity. Antimicrobial activity was confirmed for L. reuteri and L. delbrueckii subsp. delbrueckii and for a pool of lactic acid bacteria. The neutralized supernatant of the pool exerted a higher antimicrobial activity than that of the individual strains. Furthermore, D-lactic acid and acetic acid were produced during growth of the Lactobacillus isolates studied.
Directory of Open Access Journals (Sweden)
Jiali Xing
Full Text Available Antioxidant activity of lactic acid bacteria is associated with multiple health-protective effects. Traditional indexes of chemical antioxidant activities poorly reflect the antioxidant effects of these bacteria in vivo. Cellular antioxidant activity (CAA assay was used in this study to determine the antioxidant activity of cell-free supernatants (CFSs of 10 Lactobacillus strains. The performance of the CAA assay was compared with that of four chemical antioxidant activity assays, namely, DPPH radical scavenging, hydroxyl radical scavenging (HRS, reducing power (RP, and inhibition of linoleic acid peroxidation (ILAP. Results of the CAA assay were associated with those of DPPH and ILAP assays, but not with those of RP and HRS assays. The inter- and intra-specific antioxidant activities of CFS were characterized by chemical and CAA assays. L. rhamnosus CCFM 1107 displayed a high antioxidative effect similar to positive control L. rhamnosus GG ATCC 53103 in all of the assays. The CAA assay is a potential method for the detection of antioxidant activities of lactobacilli CFSs.
Dye, Frank J.
1985-01-01
Outlines steps to generate cell samples for observation and experimentation. The procedures (which use ordinary laboratory equipment) will establish a short-term primary culture of normal mammalian cells. Information on culture vessels and cell division and a list of questions to generate student interest and involvement in the topics are…
Bapat, Prachi R; Husain, Aliabbas A; Daginawala, Hatim F; Agrawal, Neha P; Panchbhai, Milind S; Satav, Ashish R; Taori, Girdhar M; Kashyap, Rajpal S
2015-01-01
The tuberculin skin test (TST) and interferon-gamma release assays (IGRA), namely, the QuantiFERON-TB Gold test (QFT), remain the standard immunological diagnostic tools for latent tuberculosis (TB) infection (LTBI). However, the sub-optimal detection rates of both of these tests are major impediments in recognizing the population at risk. This study was aimed at evaluating additional cytokines besides interferon-gamma (IFN-γ) as biomarkers for improving LTBI diagnosis in the tribal population of Melghat, India. Seventy-four close TB contacts were stratified by QFT and TST results into: (i) QFT+/TST+ (n = 26), (ii) QFT+/TST- (n = 12), (iii) QFT-/TST- (n = 35) and (iv) QFT-/TST+ (n = 1) groups. A panel of cytokines (IL-6, IL-10, TNF-α and IL-2R) was then evaluated in antigen-stimulated QFT cell-free culture supernatants using IMMULITE-1000, an automated immunoassay analyzer. Cytokine estimation showed significantly higher levels of IL-6 in the QFT+/TST+ group, while significantly higher levels of IL-10 were found in the QFT-/TST- group. Correlation analysis identified a positive correlation between IL-6 and the QFT response (r = 0.6723, P < 0.0001), while a negative correlation was seen between QFT and IL-10 expression (r = -0.3271, P = 0.0044). Similarly, IL-6 was positively correlated with TST levels (r = 0.6631, P <0 .0001), and conversely, a negative correlation was found between TST and IL-10 expression (r = -0.5698, P < 0.0001). The positive and negative predictive values of IL-6 were found to be 92.59 and 93.33%, respectively, and the positive and negative predictive values of IL-10 were 96.55 and 91.18%, respectively. No significant impact of the demographic characteristics on cytokine positivity was observed. Our preliminary results suggest that the evaluation of additional cytokines in QFT cell-free culture supernatants may be valuable for the identification of LTBI. Combining IL-6 and IL-10 with QFT and/or TST could markedly improve the detection
Ren, Hong-ying; Zhao, Qin-jun; Xing, Wen; Yang, Shao-guang; Lu, Shi-hong; Ren, Qian; Zhang, Lei; Han, Zhong-chao
2010-04-01
To investigate the biological function of hepatocyte-like cells derived from mesenchymal stem cells that isolated from human umbilical cord UC-MSCs in vitro, and to detect the changes in the immunogenicity of the differentiated hepatocyte-like cells (DHC). Transdifferentiation of UC-MSCs into hepatic lineage in vitro was induced in modified two-step induction medium. The expressions of hepatic specific markers were detected by RT-PCR analysis and immunofluorescence staining at different time points after induction. The levels of albumin and urea in the supernatants of cultures were measured by enzyme-linked immunosorbent assay. Furthermore, the immunosuppressive property of DHC was detected by one-way mixed lymphocyte culture. The mRNA and proteins of alpha fetoprotein (AFP), albumin (ALB),and cytokeratin-19 (CK-19) were expressed in naive UC-MSCs at low levels. DHC highly expressed hepatic markers AFP, ALB, CK-19, and tryptophan 2, 3-dioxygenase 14 and 28 days after hepatic differentiation and were accompanied by an increased production of ALB and urea in supernatant in a time-dependent manner. DHC did not express human leukocyte antigen DR antigen and significantly decreased the lymphocyte proliferation. UC-MSCs are able to differentiate into functional hepatocyte-like cells in vitro, while the immunogenicity of DHC remains low.
Directory of Open Access Journals (Sweden)
John K Bui
2017-02-01
Full Text Available The fate of HIV-infected cells after reversal of proviral latency is not well characterized. Simonetti, et al. recently showed that CD4+ T-cells containing intact proviruses can clonally expand in vivo and produce low-level infectious viremia. We hypothesized that reversal of HIV latency by activation of CD4+ T-cells can lead to the expansion of a subset of virus-producing cells rather than their elimination. We established an ex vivo cell culture system involving stimulation of CD4+ T-cells from donors on suppressive antiretroviral therapy (ART with PMA/ionomycin (day 1-7, followed by rest (day 7-21, and then repeat stimulation (day 21-28, always in the presence of high concentrations of raltegravir and efavirenz to effectively block new cycles of viral replication. HIV DNA and virion RNA in the supernatant were quantified by qPCR. Single genome sequencing (SGS of p6-PR-RT was performed to genetically characterize proviruses and virion-associated genomic RNA. The replication-competence of the virions produced was determined by the viral outgrowth assay (VOA and SGS of co-culture supernatants from multiple time points. Experiments were performed with purified CD4+ T-cells from five consecutively recruited donors who had been on suppressive ART for > 2 years. In all experiments, HIV RNA levels in supernatant increased following initial stimulation, decreased or remained stable during the rest period, and increased again with repeat stimulation. HIV DNA levels did not show a consistent pattern of change. SGS of proviruses revealed diverse outcomes of infected cell populations, ranging from their apparent elimination to persistence and expansion. Importantly, a subset of infected cells expanded and produced infectious virus continuously after stimulation. These findings underscore the complexity of eliminating reservoirs of HIV-infected cells and highlight the need for new strategies to kill HIV-infected cells before they can proliferate.
UP-REGULATION OF ANTITHROMBOTIC ECTONUCLEOTIDASES BY ASPIRIN IN HUMAN ENDOTHELIAL-CELLS IN-VITRO
CHEUNG, PK; VISSER, J; BAKKER, WW
1994-01-01
Ecto ATP-diphosphohydrolase (apyrase) activity of human endothelial cells following aspirin treatment has been studied in-vitro. It was shown by HPLC analysis of supernatant samples that pre-incubation of the cultures with aspirin resulted in a significantly increased turnover of supplemented ATP
DEFF Research Database (Denmark)
Stangegaard, Michael; Petronis, Sarunas; Jørgensen, Anders Michael
2006-01-01
culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...... on cell survival. Low grade light exposure was however compatible with optical recordings as well as cell viability. These results strongly indicate that a cell culture chip could be constructed that allowed for on-line optical recording of cellular events without affecting the cell culturing condition...
DEFF Research Database (Denmark)
Stangegaard, Michael; Petronis, Sarunas; Jørgensen, A M
2006-01-01
culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...... on cell survival. Low grade light exposure was however compatible with optical recordings as well as cell viability. These results strongly indicate that a cell culture chip could be constructed that allowed for on-line optical recording of cellular events without affecting the cell culturing condition...
Assessment of chemical composition and microbiological properties of titanium nickelide supernatant
Directory of Open Access Journals (Sweden)
Uruzbaev R.M.
2018-03-01
Full Text Available According to the World Health Organization, in the structure of internal injuries, burns occur in 2.1 per 1000 adults. In practice, all victims after stabilization of the condition are treated surgically with the autodermoplasty, which in the late period is accompanied by a rough scarring, sometimes with the deformation of the damaged area. In addition, infectious complications worsen and aggravate the wound healing process, and also significantly prolong the epithelialization time. A wound is usually infected by opportunistic pathogenic microflora resistant to various groups of antibiotics and antiseptics, by which the affected areas are treated. Modern researches are aimed at finding ways to accelerate regenerative processes of the affected area, to avoid surgical treatment and prevent infection contamination. The object of this study was titanium nickelide supernatant. Currently, there are no published data on the chemical composition of the supernatant, as well as its microbiological safety. This alloy is actively and successfully used in traumatology, dentistry and other fields of medicine. The supernatant was prepared under sterile conditions at a rate of 10 g of titanium nickelide powder per 1 liter of distilled water. In the course of the studies it was proved that nickel and titanium ions are present in the solution, in addition, its bactericidal and bacteriostatic properties are reflected. Thus, the supernatant of nitinol can be used in biological environment and is safe for them.
Naskou, Maria C; Sumner, Scarlett M; Chocallo, Anna; Kemelmakher, Hannah; Thoresen, Merrilee; Copland, Ian; Galipeau, Jacques; Peroni, John F
2018-03-22
Mesenchymal stem cells (MSCs) produced for clinical purposes rely on culture media containing fetal bovine serum (FBS) which is xenogeneic and has the potential to significantly alter the MSC phenotype, rendering these cells immunogenic. As a result of bovine-derived exogenous proteins expressed on the cell surface, MSCs may be recognized by the host immune system as non-self and be rejected. Platelet lysate (PL) may obviate some of these concerns and shows promising results in human medicine as a possible alternative to FBS. Our goal was to evaluate the use of equine platelet lysate (ePL) pooled from donor horses in place of FBS to culture equine MSCs. We hypothesized that ePL, produced following apheresis, will function as the sole media supplement to accelerate the expansion of equine bone marrow-derived MSCs without altering their phenotype and their immunomodulatory capacity. Platelet concentrate was obtained via plateletpheresis and ePL were produced via freeze-thaw and centrifugation cycles. Population doublings (PD) and doubling time (DT) of bone marrow-derived MSCs (n = 3) cultured with FBS or ePL media were calculated. Cell viability, immunophenotypic analysis, and trilineage differentiation capacity of MSCs were assessed accordingly. To assess the ability of MSCs to modulate inflammatory responses, E. coli lipopolysaccharide (LPS)-stimulated monocytes were cocultured with MSCs cultured in the two different media formulations, and cell culture supernatants were assayed for the production of tumor necrosis factor (TNF)-α. Our results showed that MSCs cultured in ePL media exhibited similar proliferation rates (PD and DT) compared with those cultured in FBS at individual time points. MSCs cultured in ePL showed a statistically significant increased viability following a single washing step, expressed similar levels of MSC markers compared to FBS, and were able to differentiate towards the three lineages. Finally, MSCs cultured in ePL efficiently suppressed
Chifiriuc, Mariana Carmen; Bleotu, Coralia; Pîrcălăbioru, Gratiela; Israil, Anca Michaela; Dinu, Sorin; Rută, Simona Maria; Grancea, Camelia; Lazăr, Veronica
2010-01-01
Vibrio (V.) parahaemolyticus is an aquatic halophilic bacteria which produces gastroenteritis and in rare cases septicaemia after the consumption of raw or under-cooked contaminated seafood.The severity of diarrheal illness caused by this bacterium is closely related to the presence of two types of hemolysins (the thermostable direct hemolysin-TDH and TDH related hemolysin-TRH) and also of type III secretion system (TTSS) proteins. The TTSS type 1 induces a wide array of effects on infected HeLa cells such as autophagy, oncosis, cell rounding and lysis. Previous studies have shown that heat shock proteins have the ability to stimulate the production of interleukins in different cellular cultures. In our studies we have stimulated two cellular lines (HeLa and human diploid cells) with different V. parahaemolyticus culture fractions in order to observe the effect on cytokines production. Thus, the purpose of this study was to analyze the expression of IL-1, IL-2, IL-4, IL-6, IL-10 and TNF-alpha induced by the cell treatment with total cellular lysate, periplasmic fractions and culture supernatants extracted from V. parahaemolyticus exposed to normal and also to stress conditions. The ELISA assay of the cytokine profile of the HeLa and HDC cell lines stimulated with different bacterial fractions revealed that in the V. parahemolyticus cultures submitted to osmotic and heat shock stress are accumulating factors (probably heat shock proteins) which are exhibiting immunomodulatory activity, responsible for the induction of a pro-inflammatory response associated with increased levels of IL-6 and TNF-alpha expression, however balanced by the stimulation of the anti-inflammatory cytokine IL-4 synthesis.
Aminnezhad, Sargol; Kermanshahi, Rouha Kasra; Ranjbar, Reza
2015-04-01
The indiscriminate use of antibiotics in the treatment of infectious diseases can increase the development of antibiotic resistance. Therefore, there is a big demand for new sources of antimicrobial agents and alternative treatments for reduction of antibiotic dosage required to decrease the associated side effects. In this study, the synergistic action of aminoglycoside antibiotics and cell-free supernatant (CFS) of probiotic (Lactobacillus rahmnosus and L. casei) against Pseudomonas aeruginosa PTCC 1430 was evaluated. A growth medium for culturing of probiotic bacteria was separated by centrifugation. The antimicrobial effects of CFS of probiotic bacteria were evaluated using the agar well diffusion assay. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were evaluated using the micro dilution method. Finally, an interaction between CFS and amikacin or gentamicin against P. aeruginosa PTCC 1430 was examined through the checkerboard method and fractional inhibitory concentration (FIC). Furthermore, CFSs from Lactobacillus strains were analyzed by reversed phase HPLC (RP-HPLC) for antimicrobial compounds. The results showed a significant effect of CFS on the growth of P. aeruginosa. The MIC and MBC of CFS from L. casei were 62.5 µL⁄mL while the MIC and MBC of CFS from L. rhamnosus were 62.5 μL⁄mL and 125 μL⁄mL, respectively. Using the FIC indices, synergistic interactions were observed in combination of CFS and antibiotics. Fractional Inhibitory Concentration indices of CFS from L. casei and aminoglycoside antibiotics were 0.124 and 0.312 while FIC indices of CFS from L. rhamnosus and aminoglycoside antibiotics were 0.124 and 0.56, respectively showing a synergism effect. The results of RP-HPLC showed that CFS of Lactobacillus strains contained acetic acid, lactic acid and hydrogen peroxide (H2O2). Our findings indicate that probiotic bacterial strains of Lactobacillus have a significant inhibitory effect on the
International Nuclear Information System (INIS)
Masure, H.R.; Donovan, M.G.; Storm, D.R.
1991-01-01
An invasive form of the CaM-sensitive adenylyl cyclase from Bordetella pertussis can be isolated from bacterial culture supernatants. This isolation is achieved through the use of QAE-Sephadex anion-exchange chromatography. It has been demonstrated that the addition of exogenous Ca 2+ to the anion-exchange gradient buffers will affect elution from the column and will thereby affect the isolation of invasive adenylyl cyclase. This is probably due to a Ca2(+)-dependent interaction of the catalytic subunit with another component in the culture supernatant. Two peaks of adenylyl cyclase activity are obtained. The Pk1 adenylyl cyclase preparation is able to cause significant increases in intracellular cAMP levels in animal cells. This increase occurs rapidly and in a dose-dependent manner in both N1E-115 mouse neuroblastoma cells and human erythrocytes. The Pk2 adenylyl cyclase has catalytic activity but is not cell invasive. This material can serve, therefore, as a control to ensure that the cAMP which is measured is, indeed, intracellular. A second control is to add exogenous CaM to the Pk1 adenylyl cyclase preparation. The 45-kDa catalytic subunit-CaM complex is not cell invasive. Although the mechanism for membrane translocation of the adenylyl cyclase is unknown, there is evidence that the adenylyl cyclase enters animal cells by a mechanism distinct from receptor-mediated endocytosis. Calmodulin-sensitive adenylyl cyclase activity can be removed from preparations of the adenylyl cyclase that have been subjected to SDS-polyacrylamide gel electrophoresis. This property of the enzyme has enabled purification of the catalytic subunit to apparent homogeneity. The purified catalytic subunit from culture supernatants has a predicted molecular weight of 45,000. This polypeptide interacts directly with Ca 2+ and this interaction may be important for its invasion into animal cells
Energy Technology Data Exchange (ETDEWEB)
Masure, H.R.; Donovan, M.G.; Storm, D.R.
1991-01-01
An invasive form of the CaM-sensitive adenylyl cyclase from Bordetella pertussis can be isolated from bacterial culture supernatants. This isolation is achieved through the use of QAE-Sephadex anion-exchange chromatography. It has been demonstrated that the addition of exogenous Ca{sup 2}{sup +} to the anion-exchange gradient buffers will affect elution from the column and will thereby affect the isolation of invasive adenylyl cyclase. This is probably due to a Ca2(+)-dependent interaction of the catalytic subunit with another component in the culture supernatant. Two peaks of adenylyl cyclase activity are obtained. The Pk1 adenylyl cyclase preparation is able to cause significant increases in intracellular cAMP levels in animal cells. This increase occurs rapidly and in a dose-dependent manner in both N1E-115 mouse neuroblastoma cells and human erythrocytes. The Pk2 adenylyl cyclase has catalytic activity but is not cell invasive. This material can serve, therefore, as a control to ensure that the cAMP which is measured is, indeed, intracellular. A second control is to add exogenous CaM to the Pk1 adenylyl cyclase preparation. The 45-kDa catalytic subunit-CaM complex is not cell invasive. Although the mechanism for membrane translocation of the adenylyl cyclase is unknown, there is evidence that the adenylyl cyclase enters animal cells by a mechanism distinct from receptor-mediated endocytosis. Calmodulin-sensitive adenylyl cyclase activity can be removed from preparations of the adenylyl cyclase that have been subjected to SDS-polyacrylamide gel electrophoresis. This property of the enzyme has enabled purification of the catalytic subunit to apparent homogeneity. The purified catalytic subunit from culture supernatants has a predicted molecular weight of 45,000. This polypeptide interacts directly with Ca{sup 2}{sup +} and this interaction may be important for its invasion into animal cells.
Cell Culturing of Cytoskeleton
2004-01-01
Biomedical research offers hope for a variety of medical problems, from diabetes to the replacement of damaged bone and tissues. Bioreactors, which are used to grow cells and tissue cultures, play a major role in such research and production efforts. Cell culturing, such as this bone cell culture, is an important part of biomedical research. The BioDyn payload includes a tissue engineering investigation. The commercial affiliate, Millenium Biologix, Inc., has been conducting bone implant experiments to better understand how synthetic bone can be used to treat bone-related illnesses and bone damaged in accidents. On STS-95, the BioDyn payload will include a bone cell culture aimed to help develop this commercial synthetic bone product. Millenium Biologix, Inc., is exploring the potential for making human bone implantable materials by seeding its proprietary artificial scaffold material with human bone cells. The product of this tissue engineering experiment using the Bioprocessing Modules (BPMs) on STS-95 is space-grown bone implants, which could have potential for dental implants, long bone grafts, and coating for orthopedic implants such as hip replacements.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Cell cultures. 101.6 Section 101.6..., SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS DEFINITIONS § 101.6 Cell cultures. When used in conjunction with or in reference to cell cultures, which may be referred to as tissue cultures...
Ability of γδ T cells to modulate the Foxp3 T cell response is dependent on adenosine.
Directory of Open Access Journals (Sweden)
Dongchun Liang
Full Text Available Whether γδ T cells inhibit or enhance the Foxp3 T cell response depends upon their activation status. The critical enhancing effector in the supernatant is adenosine. Activated γδ T cells express adenosine receptors at high levels, which enables them to deprive Foxp3+ T cells of adenosine, and to inhibit their expansion. Meanwhile, cell-free supernatants of γδ T cell cultures enhance Foxp3 T cell expansion. Thus, inhibition and enhancement by γδ T cells of Foxp3 T cell response are a reflection of the balance between adenosine production and absorption by γδ T cells. Non-activated γδ T cells produce adenosine but bind little, and thus enhance the Foxp3 T cell response. Activated γδ T cells express high density of adenosine receptors and have a greatly increased ability to bind adenosine. Extracellular adenosine metabolism and expression of adenosine receptor A2ARs by γδ T cells played a major role in the outcome of γδ and Foxp3 T cell interactions. A better understanding of the functional conversion of γδ T cells could lead to γδ T cell-targeted immunotherapies for related diseases.
Fate of cyanobacteria in drinking water treatment plant lagoon supernatant and sludge.
Pestana, Carlos J; Reeve, Petra J; Sawade, Emma; Voldoire, Camille F; Newton, Kelly; Praptiwi, Radisti; Collingnon, Lea; Dreyfus, Jennifer; Hobson, Peter; Gaget, Virginie; Newcombe, Gayle
2016-09-15
In conventional water treatment processes, where the coagulation and flocculation steps are designed to remove particles from drinking water, cyanobacteria are also concentrated into the resultant sludge. As a consequence, cyanobacteria-laden sludge can act as a reservoir for metabolites such as taste and odour compounds and cyanotoxins. This can pose a significant risk to water quality where supernatant from the sludge treatment facility is returned to the inlet to the plant. In this study the complex processes that can take place in a sludge treatment lagoon were investigated. It was shown that cyanobacteria can proliferate in the conditions manifest in a sludge treatment lagoon, and that cyanobacteria can survive and produce metabolites for at least 10days in sludge. The major processes of metabolite release and degradation are very dependent on the physical, chemical and biological environment in the sludge treatment facility and it was not possible to accurately model the net effect. For the first time evidence is provided to suggest that there is a greater risk associated with recycling sludge supernatant than can be estimated from the raw water quality, as metabolite concentrations increased by up to 500% over several days after coagulation, attributed to increased metabolite production and/or cell proliferation in the sludge. Copyright © 2016 Elsevier B.V. All rights reserved.
Functional cell mediated lympholysis I. Description of the assay
International Nuclear Information System (INIS)
Goeken, N.E.; Thompson, J.S.
1981-01-01
The anamnestic response by human bi-directional (BD) mixed lymphocyte cultures (MLC) to restimulation by cells of the original stimulating type is generally strikingly reduced as compared to that of standard one-way cultures. This difference was shown not to be related to a change in kinetics nor was it due to exhaustion of the media or soluble factors since fresh media did not ameliorate the effect nor were supernatants from BD cultures found to be suppressive. The relative inhibition was also not reversed by removal of the allogeneic cells by phenotype specific antiserum. Cytotoxic tests with donor and responder specific antisera revealed that the cells bearing that phenotype were dramatically reduced in BD as compared to one-way cultures. Thus, the diminished secondary response appears to be due to cytotoxic elimination of the responder cells. This allogeneic cytotoxicity is dependent on non-T, phagocytic, adherent cells. The phenomenon is called Functional Cell Mediated Lympholysis (F-CML). (author)
Ramos, Alberto N; Sesto Cabral, Maria E; Arena, Mario E; Arrighi, Carlos F; Arroyo Aguilar, Abel A; Valdéz, Juan C
2015-03-01
It is necessary to advance the field of alternative treatments for chronic wounds that are financially accessible to the least economically developed countries. Previously we demonstrated that topical applications of Lactobacillus plantarum culture supernatants (LAPS) on human-infected chronic wounds reduce the pathogenic bioburden, the amount of necrotic tissue, and the wound area, as well as promote debridement, granulation tissue, and wound healing. To study LAPS chemically and biologically and to find potential molecules responsible for its pro-healing and anti-pathogenic properties in chronic wounds. (1) Chemical analysis: extracts were subjected to a column chromatography and the fractions obtained were studied by GCMS. (2) Quantification: dl-lactic acid (commercial kit), phenolic compounds (Folin-Ciocalteu), H2O2 (micro-titration), and cations (flame photometry). (3) Biological analysis: autoinducers type 2 (AI-2) (Vibrio harveyi BB170 bioassay), DNAase activity (Agar DNAase), and Pseudomonas aeruginosa biofilm inhibition (crystal violet technique). According to its biological activity, the most significant molecules found by GCMS were the following: antimicrobials (mevalonolactone, 5-methyl-hydantoine, benzoic acid, etc.); surfactants (di-palmitin, distearin, and 1,5-monolinolein); anesthetics (barbituric acid derivatives), and AI-2 precursors (4,5-dihydroxy-2,3-pentanedione and 2-methyl-2,3,3,4-tetrahydroxytetrahydrofurane). Concentrations measured (µg/mL): DL-lactic acid (11.71 ± 1.53) and H2O2 (36 ± 2.0); phenolic compounds (485.2 ± 15.20); sodium (370 ± 17); potassium 920 ± 24); calcium (20 ± 4); and magnesium (15 ± 3). DNAase from LAPS had activity on genomic DNA from PMNs and P. aeruginosa. The molecules and biological activities found in LAPS could explain the observed effects in human chronic wounds.
International Nuclear Information System (INIS)
Aizaki, Hideki; Nagamori, Seishi; Matsuda, Mami; Kawakami, Hayato; Hashimoto, Osamu; Ishiko, Hiroaki; Kawada, Masaaki; Matsuura, Tomokazu; Hasumura, Satoshi; Matsuura, Yoshiharu; Suzuki, Tetsuro; Miyamura, Tatsuo
2003-01-01
Lack of efficient culture systems for hepatitis C virus (HCV) has been a major obstacle in HCV research. Human liver cells grown in a three-dimensional radial-flow bioreactor were successfully infected following inoculation with plasma from an HCV carrier. Subsequent detection of increased HCV RNA suggested viral replication. Furthermore, transfection of HCV RNA transcribed from full-length cDNA also resulted in the production and release of HCV virions into supernatant. Infectivity was shown by successful secondary passage to a new culture. Introduction of mutations in RNA helicase and polymerase regions of HCV cDNA abolished virus replication, indicating that reverse genetics of this system is possible. The ability to replicate and detect the extracellular release of HCV might provide clues with regard to the persistent nature of HCV infection. It will also accelerate research into the pathogenicity of HCV, as well as the development of prophylactic agents and new therapy
Energy Technology Data Exchange (ETDEWEB)
Hendrickson, D.W.
1997-01-08
This document provides specific test procedures and instructions to implement the test plan for the preparation and conduct of a cesium removal test, using Hanford Complexant Concentrate supernatant liquor from tank 241-AN-107, in a bench-scale column. The cesium sorbent to be tested is crystalline silicotitanate. The test plan for which this provides instructions is WHC-SD-RE-TP-023, Hanford Complexant Concentrate Supernatant Cesium Removal Test Plan.
Porphyromonas endodontalis reactivates latent Epstein-Barr virus.
Makino, K; Takeichi, O; Imai, K; Inoue, H; Hatori, K; Himi, K; Saito, I; Ochiai, K; Ogiso, B
2018-06-01
To determine whether Porphyromonas endodontalis can reactivate latent Epstein-Barr virus (EBV). The concentrations of short-chain fatty acids (SCFAs) in P. endodontalis culture supernatants were determined using high-performance liquid chromatography. A promoter region of BamHI fragment Z leftward open reading frame 1 (BZLF-1), which is a transcription factor that controls the EBV lytic cycle, was cloned into luciferase expression vectors. Then, the luciferase assay was performed using P. endodontalis culture supernatants. Histone acetylation using Daudi cells treated with P. endodontalis culture supernatants was examined using Western blotting. BZLF-1 mRNA and BamHI fragment Z EB replication activator (ZEBRA) protein were also detected quantitatively using real-time polymerase chain reaction (PCR) and Western blotting. Surgically removed periapical granulomas were examined to detect P. endodontalis, EBV DNA, and BZLF-1 mRNA expression using quantitative real-time PCR. Statistical analysis using Steel tests was performed. The concentrations of n-butyric acid in P. endodontalis culture supernatants were significantly higher than those of other SCFAs (P=0.0173). Using B-95-8-221 Luc cells treated with P. endodontalis culture supernatants, the luciferase assay demonstrated that P. endodontalis induced BZLF-1 expression. Hyperacetylation of histones was also observed with the culture supernatants. BZLF-1 mRNA and ZEBRA protein were expressed by Daudi cells in a dose-dependent manner after the treatment with P. endodontalis culture supernatants. P. endodontalis and BZLF-1 in periapical granulomas were also detected. The expression levels of BZLF-1 mRNA were similar to the numbers of P. endodontalis cells in each specimen. n-butyric acid produced by P. endodontalis reactivated latent EBV. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Microfluidic cell culture systems for drug research.
Wu, Min-Hsien; Huang, Song-Bin; Lee, Gwo-Bin
2010-04-21
In pharmaceutical research, an adequate cell-based assay scheme to efficiently screen and to validate potential drug candidates in the initial stage of drug discovery is crucial. In order to better predict the clinical response to drug compounds, a cell culture model that is faithful to in vivo behavior is required. With the recent advances in microfluidic technology, the utilization of a microfluidic-based cell culture has several advantages, making it a promising alternative to the conventional cell culture methods. This review starts with a comprehensive discussion on the general process for drug discovery and development, the role of cell culture in drug research, and the characteristics of the cell culture formats commonly used in current microfluidic-based, cell-culture practices. Due to the significant differences in several physical phenomena between microscale and macroscale devices, microfluidic technology provides unique functionality, which is not previously possible by using traditional techniques. In a subsequent section, the niches for using microfluidic-based cell culture systems for drug research are discussed. Moreover, some critical issues such as cell immobilization, medium pumping or gradient generation in microfluidic-based, cell-culture systems are also reviewed. Finally, some practical applications of microfluidic-based, cell-culture systems in drug research particularly those pertaining to drug toxicity testing and those with a high-throughput capability are highlighted.
Charles, Richelle C; Liang, Li; Khanam, Farhana; Sayeed, M Abu; Hung, Chris; Leung, Daniel T; Baker, Stephen; Ludwig, Albrecht; Harris, Jason B; Larocque, Regina C; Calderwood, Stephen B; Qadri, Firdausi; Felgner, Philip L; Ryan, Edward T
2014-03-01
We have previously shown that an assay based on detection of anti-Salmonella enterica serotype Typhi antibodies in supernatant of lymphocytes harvested from patients presenting with typhoid fever (antibody in lymphocyte supernatant [ALS] assay) can identify 100% of patients with blood culture-confirmed typhoid fever in Bangladesh. In order to define immunodominant proteins within the S. Typhi membrane preparation used as antigen in these prior studies and to identify potential biomarkers unique to S. Typhi bacteremic patients, we probed microarrays containing 2,724 S. Typhi proteins with ALS collected at the time of clinical presentation from 10 Bangladeshis with acute typhoid fever. We identified 62 immunoreactive antigens when evaluating both the IgG and IgA responses. Immune responses to 10 of these antigens discriminated between individuals with acute typhoid infection and healthy control individuals from areas where typhoid infection is endemic, as well as Bangladeshi patients presenting with fever who were subsequently confirmed to have a nontyphoid illness. Using an ALS enzyme-linked immunosorbent assay (ELISA) format and purified antigen, we then confirmed that immune responses against the antigen with the highest immunoreactivity (hemolysin E [HlyE]) correctly identified individuals with acute typhoid or paratyphoid fever in Dhaka, Bangladesh. These observations suggest that purified antigens could be used with ALS and corresponding acute-phase activated B lymphocytes in diagnostic platforms to identify acutely infected patients, even in areas where enteric fever is endemic.
Ishii, Kenichi; Adachi, Tatsuo; Hamamoto, Hiroshi; Sekimizu, Kazuhisa
2014-01-01
Injection of a culture supernatant of Serratia marcescens into the bloodstream of the silkworm Bombyx mori increased the number of freely circulating immunosurveillance cells (hemocytes). Using a bioassay with live silkworms, serralysin metalloprotease was purified from the culture supernatant and identified as the factor responsible for this activity. Serralysin inhibited the in vitro attachment of both silkworm hemocytes and murine peritoneal macrophages. Incubation of silkworm hemocytes or murine macrophages with serralysin resulted in degradation of the cellular immune factor BmSPH-1 or calreticulin, respectively. Furthermore, serralysin suppressed in vitro phagocytosis of bacteria by hemocytes and in vivo bacterial clearance in silkworms. Disruption of the ser gene in S. marcescens attenuated its host killing ability in silkworms and mice. These findings suggest that serralysin metalloprotease secreted by S. marcescens suppresses cellular immunity by decreasing the adhesive properties of immunosurveillance cells, thereby contributing to bacterial pathogenesis. PMID:24398686
Ishii, Kenichi; Adachi, Tatsuo; Hamamoto, Hiroshi; Sekimizu, Kazuhisa
2014-02-28
Injection of a culture supernatant of Serratia marcescens into the bloodstream of the silkworm Bombyx mori increased the number of freely circulating immunosurveillance cells (hemocytes). Using a bioassay with live silkworms, serralysin metalloprotease was purified from the culture supernatant and identified as the factor responsible for this activity. Serralysin inhibited the in vitro attachment of both silkworm hemocytes and murine peritoneal macrophages. Incubation of silkworm hemocytes or murine macrophages with serralysin resulted in degradation of the cellular immune factor BmSPH-1 or calreticulin, respectively. Furthermore, serralysin suppressed in vitro phagocytosis of bacteria by hemocytes and in vivo bacterial clearance in silkworms. Disruption of the ser gene in S. marcescens attenuated its host killing ability in silkworms and mice. These findings suggest that serralysin metalloprotease secreted by S. marcescens suppresses cellular immunity by decreasing the adhesive properties of immunosurveillance cells, thereby contributing to bacterial pathogenesis.
Principles of cancer cell culture.
Cree, Ian A
2011-01-01
The basics of cell culture are now relatively common, though it was not always so. The pioneers of cell culture would envy our simple access to manufactured plastics, media and equipment for such studies. The prerequisites for cell culture are a well lit and suitably ventilated laboratory with a laminar flow hood (Class II), CO(2) incubator, benchtop centrifuge, microscope, plasticware (flasks and plates) and a supply of media with or without serum supplements. Not only can all of this be ordered easily over the internet, but large numbers of well-characterised cell lines are available from libraries maintained to a very high standard allowing the researcher to commence experiments rapidly and economically. Attention to safety and disposal is important, and maintenance of equipment remains essential. This chapter should enable researchers with little prior knowledge to set up a suitable laboratory to do basic cell culture, but there is still no substitute for experience within an existing well-run laboratory.
Zeng, Bin; Ren, Xiaofeng; Lin, Guosheng; Zhu, Chengang; Chen, Honglei; Yin, Jiechao; Jiang, Hong; Yang, Bo; Ding, Danhua
2008-10-01
The aim has been to determine whether the supernatants of mesenchymal stem cells (MSCs) transfected with adenovirus carrying human heme oxygenase-1 (hHO-1) gene protect cardiomyocytes from ischemic injury. We have found that hHO-1 infected MSCs (hHO-1-MSCs) increased expression of hHO-1 protein. Apoptosis of cultured hHO-1-MSCs exposed to hypoxia was suppressed. Several cytokines, including HGF, bFGF, TGF-beta, VEGF and IL-1beta, were produced by hHO-1-MSCs, some being significantly enhanced under hypoxia stimulation. Meanwhile, those cytokines reduced caspase-3 level and activity in cultured adult rat ventricular cardiomyocytes (ARVCs) exposed to hypoxia. Supernatants obtained from hHO-1-MSCs improved left ventricular function, limited myocardial infarct size, increased microvessel density, and inhibited apoptosis of cardiomyocytes in rat myocardial infarction. It can be concluded hHO-1-modified MSCs prevent myocardial cell injury via secretion of paracrine-acting mediators.
Directory of Open Access Journals (Sweden)
Prachi R. Bapat
2015-07-01
Full Text Available Summary: The tuberculin skin test (TST and interferon-gamma release assays (IGRA, namely, the QuantiFERON-TB Gold test (QFT, remain the standard immunological diagnostic tools for latent tuberculosis (TB infection (LTBI. However, the sub-optimal detection rates of both of these tests are major impediments in recognizing the population at risk. This study was aimed at evaluating additional cytokines besides interferon-gamma (IFN-γ as biomarkers for improving LTBI diagnosis in the tribal population of Melghat, India. Seventy-four close TB contacts were stratified by QFT and TST results into: (i QFT+/TST+ (n = 26, (ii QFT+/TST− (n = 12, (iii QFT−/TST− (n = 35 and (iv QFT−/TST+ (n = 1 groups. A panel of cytokines (IL-6, IL-10, TNF-α and IL-2R was then evaluated in antigen-stimulated QFT cell-free culture supernatants using IMMULITE-1000, an automated immunoassay analyzer. Cytokine estimation showed significantly higher levels of IL-6 in the QFT+/TST+ group, while significantly higher levels of IL-10 were found in the QFT−/TST− group. Correlation analysis identified a positive correlation between IL-6 and the QFT response (r = 0.6723, P < 0.0001, while a negative correlation was seen between QFT and IL-10 expression (r = −0.3271, P = 0.0044. Similarly, IL-6 was positively correlated with TST levels (r = 0.6631, P < 0.0001, and conversely, a negative correlation was found between TST and IL-10 expression (r = −0.5698, P < 0.0001. The positive and negative predictive values of IL-6 were found to be 92.59 and 93.33%, respectively, and the positive and negative predictive values of IL-10 were 96.55 and 91.18%, respectively. No significant impact of the demographic characteristics on cytokine positivity was observed. Our preliminary results suggest that the evaluation of additional cytokines in QFT cell-free culture supernatants may be valuable for the identification of LTBI. Combining IL-6 and IL-10 with QFT and
sprotocols
2014-01-01
### Materials 1. Glass culture tubes with metal caps and labels - Growth medium, from media room or customized - Glass pipette tubes - Parafilm ### Equipment 1. Vortexer - Fireboy or Bunsen burner - Motorized pipette - Micropipettes and sterile tips ### Procedure For a typical liquid culture, use 5 ml of appropriate medium. The amount in each tube does not have to be exact if you are just trying to culture cells for their precious DNA. 1. Streak an a...
B-1 cells modulate the murine macrophage response to Leishmania major infection.
Arcanjo, Angelica F; Nunes, Marise P; Silva-Junior, Elias B; Leandro, Monique; da Rocha, Juliana Dutra Barbosa; Morrot, Alexandre; Decote-Ricardo, Debora; Freire-de-Lima, Celio Geraldo
2017-05-26
To investigate the modulatory effect of B-1 cells on murine peritoneal macrophages infected with Leishmania major ( L. major ) in vitro . Peritoneal macrophages obtained from BALB/c and BALB/c XID mice were infected with L. major and cultured in the presence or absence of B-1 cells obtained from wild-type BALB/c mice. Intracellular amastigotes were counted, and interleukin-10 (IL-10) production was quantified in the cellular supernatants using an enzyme-linked immunosorbent assay. The levels of the lipid mediator prostaglandin E2 (PGE 2 ) were determined using a PGE 2 enzyme immunoassay kit (Cayman Chemical, Ann Arbor, MI), and the number of lipid bodies was quantified in the cytoplasm of infected macrophages in the presence and absence of B-1 cells. Culturing the cells with selective PGE 2 -neutralizing drugs inhibited PGE 2 production and confirmed the role of this lipid mediator in IL-10 production. In contrast, we demonstrated that B-1 cells derived from IL-10 KO mice did not favor the intracellular growth of L. major . We report that B-1 cells promote the growth of L. major amastigotes inside peritoneal murine macrophages. We demonstrated that the modulatory effect was independent of physical contact between the cells, suggesting that soluble factor(s) were released into the cultures. We demonstrated in our co-culture system that B-1 cells trigger IL-10 production by L. major -infected macrophages. Furthermore, the increased secretion of IL-10 was attributed to the presence of the lipid mediator PGE 2 in supernatants of L. major -infected macrophages. The presence of B-1 cells also favors the production of lipid bodies by infected macrophages. In contrast, we failed to obtain the same effect on parasite replication inside L. major -infected macrophages when the B-1 cells were isolated from IL-10 knockout mice. Our results show that elevated levels of PGE 2 and IL-10 produced by B-1 cells increase L. major growth, as indicated by the number of parasites in cell
Replication of cultured lung epithelial cells
International Nuclear Information System (INIS)
Guzowski, D.; Bienkowski, R.
1986-01-01
The authors have investigated the conditions necessary to support replication of lung type 2 epithelial cells in culture. Cells were isolated from mature fetal rabbit lungs (29d gestation) and cultured on feeder layers of mitotically inactivated 3T3 fibroblasts. The epithelial nature of the cells was demonstrated by indirect immunofluorescent staining for keratin and by polyacid dichrome stain. Ultrastructural examination during the first week showed that the cells contained myofilaments, microvilli and lamellar bodies (markers for type 2 cells). The following changes were observed after the first week: increase in cell size; loss of lamellar bodies and appearance of multivesicular bodies; increase in rough endoplasmic reticulum and golgi; increase in tonafilaments and well-defined junctions. General cell morphology was good for up to 10 wk. Cells cultured on plastic surface degenerated after 1 wk. Cell replication was assayed by autoradiography of cultures exposed to ( 3 H)-thymidine and by direct cell counts. The cells did not replicate during the first week; however, between 2-10 wk the cells incorporated the label and went through approximately 6 population doublings. They have demonstrated that lung alveolar epithelial cells can replicate in culture if they are maintained on an appropriate substrate. The coincidence of ability to replicate and loss of markers for differentiation may reflect the dichotomy between growth and differentiation commonly observed in developing systems
Reversible gelling culture media for in-vitro cell culture in three-dimensional matrices
An, Yuehuei H.; Mironov, Vladimir A.; Gutowska, Anna
2000-01-01
A gelling cell culture medium useful for forming a three dimensional matrix for cell culture in vitro is prepared by copolymerizing an acrylamide derivative with a hydrophilic comonomer to form a reversible (preferably thermally reversible) gelling linear random copolymer in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum gelling molecular weight cutoff, mixing the copolymer with an aqueous solvent to form a reversible gelling solution and adding a cell culture medium to the gelling solution to form the gelling cell culture medium. Cells such as chondrocytes or hepatocytes are added to the culture medium to form a seeded culture medium, and temperature of the medium is raised to gel the seeded culture medium and form a three dimensional matrix containing the cells. After propagating the cells in the matrix, the cells may be recovered by lowering the temperature to dissolve the matrix and centrifuging.
Directory of Open Access Journals (Sweden)
I. Yu. Chicherin
2013-01-01
Full Text Available The dynamics of the content of lactobacilli, microbial metabolites and antimicrobial activity of growing cultures of Lactobacillus plantarum 8Р-А3 was studied. Lactobacilli L. plantarum 8Р-А3 and test microorganisms isolated from the intestinal contents of patients with dysbacteriosis were used in experiments. Study of the component composition of growing culture supernatant of lactobacilli was carried out by gas liquid chromatography with mass selective detection. By 54 h of cultivation the content of viable microbial cells in the native culture of Lactobacillus achieves 3,0·109 in 1 mL without further increase during the cultivation. The principal component of lactobacilli culture medium possessing antibacterial activity is lactic acid. In addition to lactic acid, which accounts for 70% of the total metabolites, the culture medium and the supernatant contain salts of phosphoric acid (14% as well as amino acids, carboxylic acids, fatty acids, sugars and polyhydric alcohol constituting of up to 16% of the total metabolites. It is found that during the cultivation in liquid medium lactobacilli produce metabolites which possess antibacterial activity against pathogenic bacteria that cause intestinal infections.
Traditional and Modern Cell Culture in Virus Diagnosis.
Hematian, Ali; Sadeghifard, Nourkhoda; Mohebi, Reza; Taherikalani, Morovat; Nasrolahi, Abbas; Amraei, Mansour; Ghafourian, Sobhan
2016-04-01
Cell cultures are developed from tissue samples and then disaggregated by mechanical, chemical, and enzymatic methods to extract cells suitable for isolation of viruses. With the recent advances in technology, cell culture is considered a gold standard for virus isolation. This paper reviews the evolution of cell culture methods and demonstrates why cell culture is a preferred method for identification of viruses. In addition, the advantages and disadvantages of both traditional and modern cell culture methods for diagnosis of each type of virus are discussed. Detection of viruses by the novel cell culture methods is considered more accurate and sensitive. However, there is a need to include some more accurate methods such as molecular methods in cell culture for precise identification of viruses.
Application of cell co-culture system to study fat and muscle cells.
Pandurangan, Muthuraman; Hwang, Inho
2014-09-01
Animal cell culture is a highly complex process, in which cells are grown under specific conditions. The growth and development of these cells is a highly unnatural process in vitro condition. Cells are removed from animal tissues and artificially cultured in various culture vessels. Vitamins, minerals, and serum growth factors are supplied to maintain cell viability. Obtaining result homogeneity of in vitro and in vivo experiments is rare, because their structure and function are different. Living tissues have highly ordered complex architecture and are three-dimensional (3D) in structure. The interaction between adjacent cell types is quite distinct from the in vitro cell culture, which is usually two-dimensional (2D). Co-culture systems are studied to analyze the interactions between the two different cell types. The muscle and fat co-culture system is useful in addressing several questions related to muscle modeling, muscle degeneration, apoptosis, and muscle regeneration. Co-culture of C2C12 and 3T3-L1 cells could be a useful diagnostic tool to understand the muscle and fat formation in animals. Even though, co-culture systems have certain limitations, they provide a more realistic 3D view and information than the individual cell culture system. It is suggested that co-culture systems are useful in evaluating the intercellular communication and composition of two different cell types.
Torgan, C. E.; Burge, S. S.; Collinsworth, A. M.; Truskey, G. A.; Kraus, W. E.
2000-01-01
The growth and repair of adult skeletal muscle are due in part to activation of muscle precursor cells, commonly known as satellite cells or myoblasts. These cells are responsive to a variety of environmental cues, including mechanical stimuli. The overall goal of the research is to examine the role of mechanical signalling mechanisms in muscle growth and plasticity through utilisation of cell culture systems where other potential signalling pathways (i.e. chemical and electrical stimuli) are controlled. To explore the effects of decreased mechanical loading on muscle differentiation, mammalian myoblasts are cultured in a bioreactor (rotating cell culture system), a model that has been utilised to simulate microgravity. C2C12 murine myoblasts are cultured on microcarrier beads in a bioreactor and followed throughout differentiation as they form a network of multinucleated myotubes. In comparison with three-dimensional control cultures that consist of myoblasts cultured on microcarrier beads in teflon bags, myoblasts cultured in the bioreactor exhibit an attenuation in differentiation. This is demonstrated by reduced immunohistochemical staining for myogenin and alpha-actinin. Western analysis shows a decrease, in bioreactor cultures compared with control cultures, in levels of the contractile proteins myosin (47% decrease, p < 0.01) and tropomyosin (63% decrease, p < 0.01). Hydrodynamic measurements indicate that the decrease in differentiation may be due, at least in part, to fluid stresses acting on the myotubes. In addition, constraints on aggregate size imposed by the action of fluid forces in the bioreactor affect differentiation. These results may have implications for muscle growth and repair during spaceflight.
Jadhav, Umesh U; Hocheng, Hong
2015-01-01
Aspergillus niger culture supernatant is used for bioleaching process. Before starting bioleaching process, fly ash was washed with distilled water. This removed 100 % sodium, 47 % (±0.45) boron, 38.07 % (±0.12) calcium, 29.89 % (±0.78) magnesium, and 11.8 % (±0.05) potassium. The pH was reduced from 10.5 to 8.5 after water washing. During bioleaching process, around 100 % metal removal was achieved in 4 h for all metals except chromium 93 % (±1.18), nickel 83 % (±0.32), arsenic 78 % (±0.52), and lead 70 % (±0.20). The process parameters including temperature, shaking speed, and solid/liquid ratio were optimized for bioleaching process. Experiments were conducted to evaluate effect of fly ash on growth of mung bean (Vigna radiata). At 20 g/100 ml fly ash concentration no germination of V. radiata seeds was observed. With an increasing concentration of untreated fly ash, a gradual decrease in root/shoot length was observed. After bioleaching process 78 % (±0.19) germination of V. radiata was observed with 20 g/100 ml fly ash. This study will help to develop an efficient process to remove the toxic metals from fly ash.
Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa
Directory of Open Access Journals (Sweden)
Yunfeng Xu
2017-09-01
Full Text Available In the natural environments microorganisms coexist in communities as biofilms. Since foodborne pathogens have varying abilities to form biofilms, investigation of bacterial interactions in biofilm formation may enhance our understanding of the persistence of these foodborne pathogens in the environment. Thus the objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development after 24 h was measured using crystal violet in 96-well microtiter plate. Scanning electron microscopy and cell enumeration were employed after growth on stainless steel coupons. When compared with their single species counterparts, the dual species biofilms exhibited a significant increase in biofilm biomass. The number of L. monocytogenes in co-culture biofilms on stainless steel also increased significantly. However, there was no effect on the biofilm formation of L. monocytogenes when cultured with R. insidiosa separated by a semi-permeable membrane-linked compartment or cultured in R. insidiosa cell-free supernatant, indicating that direct cell-cell contact is critical for this interaction.
Oscillating Cell Culture Bioreactor
Freed, Lisa E.; Cheng, Mingyu; Moretti, Matteo G.
2010-01-01
To better exploit the principles of gas transport and mass transport during the processes of cell seeding of 3D scaffolds and in vitro culture of 3D tissue engineered constructs, the oscillatory cell culture bioreactor provides a flow of cell suspensions and culture media directly through a porous 3D scaffold (during cell seeding) and a 3D construct (during subsequent cultivation) within a highly gas-permeable closed-loop tube. This design is simple, modular, and flexible, and its component parts are easy to assemble and operate, and are inexpensive. Chamber volume can be very low, but can be easily scaled up. This innovation is well suited to work with different biological specimens, particularly with cells having high oxygen requirements and/or shear sensitivity, and different scaffold structures and dimensions. The closed-loop changer is highly gas permeable to allow efficient gas exchange during the cell seeding/culturing process. A porous scaffold, which may be seeded with cells, is fixed by means of a scaffold holder to the chamber wall with scaffold/construct orientation with respect to the chamber determined by the geometry of the scaffold holder. A fluid, with/without biological specimens, is added to the chamber such that all, or most, of the air is displaced (i.e., with or without an enclosed air bubble). Motion is applied to the chamber within a controlled environment (e.g., oscillatory motion within a humidified 37 C incubator). Movement of the chamber induces relative motion of the scaffold/construct with respect to the fluid. In case the fluid is a cell suspension, cells will come into contact with the scaffold and eventually adhere to it. Alternatively, cells can be seeded on scaffolds by gel entrapment prior to bioreactor cultivation. Subsequently, the oscillatory cell culture bioreactor will provide efficient gas exchange (i.e., of oxygen and carbon dioxide, as required for viability of metabolically active cells) and controlled levels of fluid
International Nuclear Information System (INIS)
Gordon, J.R.; McLaren, D.J.
1988-01-01
This study addresses macrophage activation in guinea-pigs vaccinated with radiation-attenuated cercariae of Schistosom mansoni. Peritoneal exudate macrophages elicited in vaccinated animals by mineral oil injection were activated to kill larval schistosomes in vitro. Killing efficiency is dependent upon the cell:target ratio employed and is enhanced by, but is not strictly dependent on, the presence of specific antibodies. Macrophages co-cultured with parasites release superoxide radicals and hydrogen peroxide, but the use of inhibitors has shown that neither of these reactive oxygen intermediates are the causal agents of cellular cytotoxicity in this system. Oil-elicited macrophages from naive guinea-pigs do not show comparable activation; they can, however, be activated in vitro by incubation with culture supernatant fluids from schistosome antigen-stimulated spleen, or lymph node cells harvested from vaccinated guinea-pigs. Naive macrophages activated in this way kill schistosomula in vitro and release the activation markers IL-l and superoxide anion. The macrophage-activating factor (MAF) present in spleen cell culture supernatant fluids has a MW of 35,000-55,000, but does not have the chemical characteristics of gamma-interferon. (author)
The Effect of Anaerobic and Aerobic Fish Sludge Supernatant on Hydroponic Lettuce
Directory of Open Access Journals (Sweden)
Simon Goddek
2016-06-01
Full Text Available The mobilization of nutrients from fish sludge (i.e., feces and uneaten feed plays a key role in optimizing the resource utilization and thus in improving the sustainability of aquaponic systems. While several studies have documented the aerobic and anaerobic digestion performance of aquaculture sludge, the impact of the digestate on plant growth has yet to be understood. The present study examines the impact of either an aerobic or an anaerobic digestion effluent on lettuce plant growth, by enriching a mixture of aquaculture and tap water with supernatants from both aerobic and anaerobic batch reactors. The lettuce plants grown in the hydroponic system supplied with supernatant from an anaerobic reactor had significantly better performance with respect to weight gain than both, those in the system where supernatant from the aerobic reactor was added, as well as the control system. It can be hypothesized that this effect was caused by the presence of NH4+ as well as dissolved organic matter, plant growth promoting rhizobacteria and fungi, and humic acid, which are predominantly present in anaerobic effluents. This study should therefore be of value to researchers and practitioners wishing to further develop sludge remineralization in aquaponic systems.
Rapid and non-enzymatic in vitro retrieval of tumour cells from surgical specimens.
Directory of Open Access Journals (Sweden)
Brigitte Mack
Full Text Available The study of tumourigenesis commonly involves the use of established cell lines or single cell suspensions of primary tumours. Standard methods for the generation of short-term tumour cell cultures include the disintegration of tissue based on enzymatic and mechanical stress. Here, we describe a simple and rapid method for the preparation of single cells from primary carcinomas, which is independent of enzymatic treatment and feeder cells. Tumour biopsies are processed to 1 mm(3 cubes termed explants, which are cultured 1-3 days on agarose-coated well plates in specified medium. Through incisions generated in the explants, single cells are retrieved and collected from the culture supernatant and can be used for further analysis including in vitro and in vivo studies. Collected cells retain tumour-forming capacity in xenotransplantation assays, mimic the phenotype of the primary tumour, and facilitate the generation of cell lines.
International Nuclear Information System (INIS)
Fan, Ping; He, Lan; Pu, Dan; Lv, Xiaohong; Zhou, Wenxu; Sun, Yining; Hu, Nan
2011-01-01
Research highlights: → The proliferation of dramatic increased by co-cultured with Sertoli cells. → VEGF receptor-2 expression of ECs was up-regulated by co-cultured with Sertoli cells. → The MHC expression of ECs induced by INF-γ and IL-6, IL-8 and sICAM induced by TNF-α decreased respectively after co-cultured with Sertoli cells. → ECs co-cultured with Sertoli cells also didn't increase the stimulation index of spleen lymphocytes. -- Abstract: The major problem of the application of endothelial cells (ECs) in transplantation is the lack of proliferation and their immunogenicity. In this study, we co-cultured ECs with Sertoli cells to monitor whether Sertoli cells can influence the proliferation and immunogenicity of co-cultured ECs. Sertoli cells were isolated from adult testicular tissue. ECs were divided into the control group and the experimental group, which included three sub-groups co-cultured with 1 x 10 3 , 1 x 10 4 or 1 x 10 5 cell/ml of Sertoli cells. The growth and proliferation of ECs were observed microscopically, and the expression of vascular endothelial growth factor (VEGF) receptor-2 (KDR) was examined by Western blotting. In another experiment, ECs were divided into the control group, the single culture group and the co-culture group with the optimal concentration of Sertoli cells. After INF-γ and TNF-α were added to the culture medium, MHC II antigen expression was detected by immunofluorescence staining and western blotting; interleukin (IL)-6, IL-8 and soluble intercellular adhesion molecule (sICAM) were measured in the culture medium by ELISA. We demonstrated that 1 x 10 4 cell/ml Sertoli cells promoted the proliferation of co-cultured ECs more dramatically than that in other groups (P 4 cell/ml of the Sertoli cells was most effective in the up-regulation of KDR expression in the co-cultured ECs (P < 0.05). Sertoli cells can effectively suppress INF-γ-induced MHC II antigen expression in co-cultured ECs compared with single
Role of interleukin-1 in antigen presentation by normal articular chondrocytes
International Nuclear Information System (INIS)
Tiku, M.L.; Liu, S.; Tiku, K.
1986-01-01
Recently the authors have described that normal articular chondrocytes of rabbits present antigen to immune T cells. In the present study the authors investigated the role of interleukin-1 (IL-1) on antigen presentation by chondrocytes. For these experiments the antigen pulsed chondroyctes were either untreated or fixed with paraformaldehyde and then co-cultured with immune T cells. T cell proliferation was measured by 3 H-thymidine incorporation. Pulsed non-fixed chondrocytes presented antigen, as expected, but pulsed and fixed cells failed to present antigen to T cells. The 3 H-TdR incorporation was partially restored by addition of purified human IL-1. Next, IL-1 activity was measured in primary chondrocyte culture supernatants stimulated with or without lipopolysaccharide (LPS) in comitogen thymocyte assay. No activity was detected in chondrocyte supernatants. Propagated chondrocyte culture supernatants also lacked IL-1 activity when stimulated with LPS in the presence of increasing concentration of indomethacin. On the other hand the authors observed that chondrocyte culture supernatants in a dose dependent manner inhibited human IL-1 induced 3 H-TdR incorporation of murine thymocytes. This suggested that these cells may produce an inhibitor of IL-1 and IL-1 production by chondrocytes may be essential for T cell proliferation by these cells. Inability to detect IL-1 in chondrocyte supernatants may be due to the presence of an inhibitor to IL-1. These findings may help in elucidating the immunological mechanisms in situations where chondrocytes and T cell interact, such as in arthritis
Dennis, V A; Klei, T R; Chapman, M R
1993-07-01
Supernatants generated by stimulation of peripheral blood mononuclear cells (PBMC) from Strongylus vulgaris sensitized or immunized ponies were assayed in vitro for eosinophil chemotactic activity (ECA) using the filter system in blind well chambers. The supernatants from these cultures were chemotactic for eosinophils, but not for neutrophils. Supernates from cultures of unsensitized PBMC stimulated with S. vulgaris antigen were not chemotactic for eosinophils. ECA was first detected in culture supernatants after 1.5 h of incubation and was dependent on both antigen and PBMC concentrations, but independent of serum concentrations. Both female and male S. vulgaris worm antigens stimulated ECA production from sensitized PBMC. ECA was not induced by in vitro stimulation of sensitized S. vulgaris PBMC by female Strongylus edentatus worm antigen. Partial characterization of the eosinophil chemotactic cytokine showed it to be nondialyzable, greater than 8000 molecular weight (MW), and sensitive to heating (56 and 95 degrees C), trypsin, and sodium metaperiodate treatments, suggesting that the cytokine is a protein containing some essential carbohydrate moieties. The cytokine described in this paper could partially contribute to the in vivo blood and tissue eosinophilia in experimental S. vulgaris infection.
Membrane damage induced in cultured human skin fibroblasts by UVA irradiation
International Nuclear Information System (INIS)
Gaboriau, F.; Morliere, P.; Marquis, I.; Moysan, A.; Geze, M.; Dubertret, L.
1993-01-01
Irradiation of cultured human skin fibroblasts with ultraviolet light from 320 to 400 nm (UVA) leads to a decrease in the membrane fluidity exemplified by an enhanced fluorescence anisotropy of the lipophilic fluorescent probe 1-[4-trimethylamino)-phenyl]-6-phenylhexa-1,3,5-triene. This UVA-induced decrease in fluidity is associated with lactate dehydrogenase leakage in the supernatant. Vitamin E, an inhibitor of lipid peroxidation, exerts a protective effect on both phenomena. Therefore, this UVA-induced damage in membrane properties may be related to lipid peroxidation processes. Moreover, exponentially growing cells are more sensitive to these UVA-induced alterations than confluent cells. (Author)
Garba, Abubakar; Acar, Delphine D; Roukaerts, Inge D M; Desmarets, Lowiese M B; Devriendt, Bert; Nauwynck, Hans J
2017-09-01
Mesenchymal cells are multipotent stromal cells with self-renewal, differentiation and immunomodulatory capabilities. We aimed to develop a co-culture model for differentiating hematopoietic cells on top of immortalized mesenchymal cells for studying interactions between hematopoietic and mesenchymal cells, useful for adequately exploring the therapeutic potential of mesenchymal cells. In this study, we investigated the survival, proliferation and differentiation of porcine red bone marrow hematopoietic cells co-cultured with immortalized porcine bone marrow mesenchymal cells for a period of five weeks. Directly after collection, primary porcine bone marrow mesenchymal cells adhered firmly to the bottom of the culture plates and showed a fibroblast-like appearance, one week after isolation. Upon immortalization, porcine bone marrow mesenchymal cells were continuously proliferating. They were positive for simian virus 40 (SV40) large T antigen and the mesenchymal cell markers CD44 and CD55. Isolated red bone marrow cells were added to these immortalized mesenchymal cells. Five weeks post-seeding, 92±6% of the red bone marrow hematopoietic cells were still alive and their number increased 3-fold during five weekly subpassages on top of the immortalized mesenchymal cells. The red bone marrow hematopoietic cells were originally small and round; later, the cells increased in size. Some of them became elongated, while others remained round. Tiny dendrites appeared attaching hematopoietic cells to the underlying immortalized mesenchymal cells. Furthermore, weekly differential-quick staining of the cells indicated the presence of monoblasts, monocytes, macrophages and lymphocytes in the co-cultures. At three weeks of co-culture, flow cytometry analysis showed an increased surface expression of CD172a, CD14, CD163, CD169, CD4 and CD8 up to 37±0.8%, 40±8%, 41±4%, 23±3% and 19±5% of the hematopoietic cells, respectively. In conclusion, continuous mesenchymal cell
Detection of mast cell secretion by using surface enhanced Raman scattering
Li, Juan; Li, Ren; Zheng, Liqin; Wang, Yuhua; Xie, Shusen; Lin, Juqiang
2016-10-01
Acupuncture can cause a remarkable increase in degranulation of the mast cells, which has attracted the interest of researchers since the 1980s. Surface-enhanced Raman scattering (SERS) could obtain biochemical information with high sensitivity and specificity. In this study, SERS was used to detect the degree of degranulation of mast cells according to different incubate time. Mast cells was incubated with culture medium for 0 h, 12 h and 24 h, then centrifuge the culture medium, decant the supernatant, and discard the mast cell. SERS was performed to obtain the biochemical fingerprinting signatures of the centrifuged medium. The spectra data are then analyzed by spectral peaks attribution and the principal component analysis (PCA). The measured Raman spectra of the two groups were separated well by PCA. It indicated that mast cells had secreted some substances into cultured medium though degranulation did not happen.
DEFF Research Database (Denmark)
Hofmann, B; Ødum, Niels; Jakobsen, B K
1986-01-01
The lymphocyte transformation responses to mitogens (phytohaemagglutinin (PHA), concanavalin A (Con A), and pokeweed mitogen (PWM)), allogeneic cells, and the antigen-purified protein derivative (PPD) were studied in six acquired immunodeficiency syndrome (AIDS) patients and in six healthy controls...... with the strong mitogens PHA and Con A or with allogeneic cells, but suppression may be involved in the decreased responses in cultures stimulated with PWM or PPD. Addition of supernatants from macrocultures of AIDS cells did not suppress responses of control PBMC. Thus, suppression by any lymphocyte subset...
3D Cell Culture in Alginate Hydrogels
Directory of Open Access Journals (Sweden)
Therese Andersen
2015-03-01
Full Text Available This review compiles information regarding the use of alginate, and in particular alginate hydrogels, in culturing cells in 3D. Knowledge of alginate chemical structure and functionality are shown to be important parameters in design of alginate-based matrices for cell culture. Gel elasticity as well as hydrogel stability can be impacted by the type of alginate used, its concentration, the choice of gelation technique (ionic or covalent, and divalent cation chosen as the gel inducing ion. The use of peptide-coupled alginate can control cell–matrix interactions. Gelation of alginate with concomitant immobilization of cells can take various forms. Droplets or beads have been utilized since the 1980s for immobilizing cells. Newer matrices such as macroporous scaffolds are now entering the 3D cell culture product market. Finally, delayed gelling, injectable, alginate systems show utility in the translation of in vitro cell culture to in vivo tissue engineering applications. Alginate has a history and a future in 3D cell culture. Historically, cells were encapsulated in alginate droplets cross-linked with calcium for the development of artificial organs. Now, several commercial products based on alginate are being used as 3D cell culture systems that also demonstrate the possibility of replacing or regenerating tissue.
Cell interactions in concanavalin A activated cation flux and DNA synthesis of mouse lymphocytes
DEFF Research Database (Denmark)
Owens, T; Kaplan, J G
1980-01-01
Co-culture at constant cell density of nude mouse spleen cells (by themselves unresponsive to the T-cell mitogen concanavalin A (Con A)), with congenic T-enriched lymphocyte suspensions and Con A caused anomalously high activation of K+ transport (measured by 86Rb uptake) and of incorporation...... cells. Attempts to demonstrate a diffusible factor in the supernatants of stimulated T cells were unsuccessful. The measured interaction is sufficient to explain our previous paradoxical findings that enrichment of T cells as measured by membrane markers did not cause a corresponding enrichment...
Cell culture experiments planned for the space bioreactor
Morrison, Dennis R.; Cross, John H.
1987-01-01
Culturing of cells in a pilot-scale bioreactor remains to be done in microgravity. An approach is presented based on several studies of cell culture systems. Previous and current cell culture research in microgravity which is specifically directed towards development of a space bioprocess is described. Cell culture experiments planned for a microgravity sciences mission are described in abstract form.
Advances in cell culture: anchorage dependence
Merten, Otto-Wilhelm
2015-01-01
Anchorage-dependent cells are of great interest for various biotechnological applications. (i) They represent a formidable production means of viruses for vaccination purposes at very large scales (in 1000–6000 l reactors) using microcarriers, and in the last decade many more novel viral vaccines have been developed using this production technology. (ii) With the advent of stem cells and their use/potential use in clinics for cell therapy and regenerative medicine purposes, the development of novel culture devices and technologies for adherent cells has accelerated greatly with a view to the large-scale expansion of these cells. Presently, the really scalable systems—microcarrier/microcarrier-clump cultures using stirred-tank reactors—for the expansion of stem cells are still in their infancy. Only laboratory scale reactors of maximally 2.5 l working volume have been evaluated because thorough knowledge and basic understanding of critical issues with respect to cell expansion while retaining pluripotency and differentiation potential, and the impact of the culture environment on stem cell fate, etc., are still lacking and require further studies. This article gives an overview on critical issues common to all cell culture systems for adherent cells as well as specifics for different types of stem cells in view of small- and large-scale cell expansion and production processes. PMID:25533097
Lysák, Daniel; Holubová, Monika; Bergerová, Tamara; Vávrová, Monika; Cangemi, Giuseppina Cristina; Ciccocioppo, Rachele; Kruzliak, Peter; Jindra, Pavel
2016-03-01
Cell therapy products represent a new trend of treatment in the field of immunotherapy and regenerative medicine. Their biological nature and multistep preparation procedure require the application of complex release criteria and quality control. Microbial contamination of cell therapy products is a potential source of morbidity in recipients. The automated blood culture systems are widely used for the detection of microorganisms in cell therapy products. However the standard 2-week cultivation period is too long for some cell-based treatments and alternative methods have to be devised. We tried to verify whether a shortened cultivation of the supernatant from the mesenchymal stem cell (MSC) culture obtained 2 days before the cell harvest could sufficiently detect microbial growth and allow the release of MSC for clinical application. We compared the standard Ph. Eur. cultivation method and the automated blood culture system BACTEC (Becton Dickinson). The time to detection (TTD) and the detection limit were analyzed for three bacterial and two fungal strains. The Staphylococcus aureus and Pseudomonas aeruginosa were recognized within 24 h with both methods (detection limit ~10 CFU). The time required for the detection of Bacillus subtilis was shorter with the automated method (TTD 10.3 vs. 60 h for 10-100 CFU). The BACTEC system reached significantly shorter times to the detection of Candida albicans and Aspergillus brasiliensis growth compared to the classical method (15.5 vs. 48 and 31.5 vs. 48 h, respectively; 10-100 CFU). The positivity was demonstrated within 48 h in all bottles, regardless of the size of the inoculum. This study validated the automated cultivation system as a method able to detect all tested microorganisms within a 48-h period with a detection limit of ~10 CFU. Only in case of B. subtilis, the lowest inoculum (~10 CFU) was not recognized. The 2-day cultivation technique is then capable of confirming the microbiological safety of MSC and
Transcriptional and metabolic flux profiling of triadimefon effects on cultured hepatocytes
International Nuclear Information System (INIS)
Iyer, Vidya V.; Ovacik, Meric A.; Androulakis, Ioannis P.; Roth, Charles M.; Ierapetritou, Marianthi G.
2010-01-01
Conazoles are a class of azole fungicides used to prevent fungal growth in agriculture, for treatment of fungal infections, and are found to be tumorigenic in rats and/or mice. In this study, cultured primary rat hepatocytes were treated to two different concentrations (0.3 and 0.15 mM) of triadimefon, which is a tumorigenic conazole in rat and mouse liver, on a temporal basis with daily media change. Following treatment, cells were harvested for microarray data ranging from 6 to 72 h. Supernatant was collected daily for three days, and the concentrations of various metabolites in the media and supernatant were quantified. Gene expression changes were most significant following exposure to 0.3 mM triadimefon and were characterized mainly by metabolic pathways related to carbohydrate, lipid and amino acid metabolism. Correspondingly, metabolic network flexibility analysis demonstrated a switch from fatty acid synthesis to fatty acid oxidation in cells exposed to triadimefon. It is likely that fatty acid oxidation is active in order to supply energy required for triadimefon detoxification. In 0.15 mM triadimefon treatment, the hepatocytes are able to detoxify the relatively low concentration of triadimefon with less pronounced changes in hepatic metabolism.
Suspension culture of pluripotent stem cells: effect of shear on stem cell fate.
Keller, Kevin C; Rodrigues, Beatriz; zur Nieden, Nicole I
2014-01-01
Despite significant promise, the routine usage of suspension cell culture to manufacture stem cell-derived differentiated cells has progressed slowly. Suspension culture is an innovative way of either expanding or differentiating cells and sometimes both are combined into a single bioprocess. Its advantages over static 2D culturing include a homogeneous and controllable culture environment and producing a large quantity of cells in a fraction of time. This feature makes suspension cell culture ideal for use in stem cell research and eventually ideal in the large-scale production of differentiated cells for regenerative medicine. Because of their tremendous differentiation capacities and unlimited growth properties, pluripotent stem cells (PSCs) in particular are considered potential sources for future cell-replacement therapies. Currently, expansion of PSCs is accomplished in 2D, which only permits a limited amount of cell growth per culture flask before cells need to be passaged. However, before stem cells can be applied clinically, several aspects of their expansion, such as directed growth, but also differentiation, need to be better controlled. This review will summarize recent advantages in suspension culture of PSCs, while at the same time highlighting current challenges.
Energy Technology Data Exchange (ETDEWEB)
Bray, L.A.; Holton, L.K.; Myers, T.R.; Richardson, G.M.; Wise, B.M.
1984-01-01
At the request of West Valley Nuclear Services Co., Inc., the Pacific Northwest Laboratory (PNL) has studied alternative treatment processes for the alkaline PUREX waste presently being stored in Tank 8D2 at West Valley, New York. Five tasks were completed during FY 1983: (1) simulation and characterization of the alkaline supernatant and sludge from the tank. The radiochemical and chemical distributions between the aqueous and solid phase were determined, and the efficiency of washing sludge with water to remove ions such as Na/sup +/ and SO/sub 4//sup 2 -/ was investigated; (2) evaluation of a sodium tetraphenylboron (Na-TPB) precipitation process to recover cesium (Cs) and a sodium titanate (Na-TiA) sorption process to recover strontium (Sr) and plutonium (Pu) from the West Valley Alkaline supernatant. These processes were previously developed and tested at the US Department of Energy's Savannah River Plant; (3) evaluation of an organic cation-exchange resin (Duolite CS-100) to recover Cs and Pu from the alkaline supernatant followed by an organic macroreticular cation exchange resin (Amberlite IRC-718) to recover Sr; (4) evaluation of an inorganic ion exchanger (Linde Ionsiv IE-95) to recover Cs, Sr, and Pu from the alkaline supernatant; and (5) evaluation of Dowex-1,X8 organic anion exchange resin to recover technetium (Tc) from alkaline supernatant. The findings of these tasks are reported. 21 references, 36 figures, 34 tables.
Controlling the diversity of cell populations in a stem cell culture
Heo, Inha; Clevers, Hans
2015-01-01
Culturing intestinal stem cells into 3D organoids results in heterogeneous cell populations, reflecting the in vivo cell type diversity. In a recent paper published in Nature, Wang et al. established a culture condition for a highly homogeneous population of intestinal stem cells.
The evolution of chicken stem cell culture methods.
Farzaneh, M; Attari, F; Mozdziak, P E; Khoshnam, S E
2017-12-01
1. The avian embryo is an excellent model for studying embryology and the production of pharmaceutical proteins in transgenic chickens. Furthermore, chicken stem cells have the potential for proliferation and differentiation and emerged as an attractive tool for various cell-based technologies. 2. The objective of these studies is the derivation and culture of these stem cells is the production of transgenic birds for recombinant biomaterials and vaccine manufacture, drug and cytotoxicity testing, as well as to gain insight into basic science, including cell tracking. 3. Despite similarities among the established chicken stem cell lines, fundamental differences have been reported between their culture conditions and applications. Recent conventional protocols used for expansion and culture of chicken stem cells mostly depend on feeder cells, serum-containing media and static culture. 4. Utilising chicken stem cells for generation of cell-based transgenic birds and a variety of vaccines requires large-scale cell production. However, scaling up the conventional adherent chicken stem cells is challenging and labour intensive. Development of a suspension cell culture process for chicken embryonic stem cells (cESCs), chicken primordial germ cells (PGCs) and chicken induced pluripotent stem cells (ciPSCs) will be an important advance for increasing the growth kinetics of these cells. 6. This review describes various approaches and suggestions to achieve optimal cell growth for defined chicken stem cells cultures and use in future manufacturing applications.
Mammalian Cell Culture Simplified.
Moss, Robert; Solomon, Sondra
1991-01-01
A tissue culture experiment that does not require elaborate equipment and that can be used to teach sterile technique, the principles of animal cell line maintenance, and the concept of cell growth curves is described. The differences between cancerous and normal cells can be highlighted. The procedure is included. (KR)
Rabbit uterine epithelial cells: Co-culture with spermatozoa
International Nuclear Information System (INIS)
Boice, M.L.
1988-01-01
A primary culture of rabbit uterine epithelial cells was established and their effects on sperm function were examined in vitro. Epithelial cells were isolated from uteri of estrous rabbits and cultured on floating collagen gels in phenol red-free medium supplemented with 5% fetal bovine serum. Light microscopy and keratin staining showed that the epithelial cell population established in culture had morphological characteristics similar to that seen in the intact endometrium. Cells were cultured with 3 H-leucine and uptake of label by cells and its incorporation into cellular and secretory proteins determined. When compared to cells cultured for 24-48 h, incorporation of label into cellular protein was lower at 72-96 h, but secretion increased. Estradiol 17-β did not affect label uptake or incorporation, but did enhance proliferation of cells as judged by total DNA content of the cell population. Analysis of proteins in media by sodium dodecyl sulfate polyacrylamide gel electrophoresis and fluorography suggested that epithelial and stromal cells synthesis proteins that may be secretory in nature during 72-96 h culture. Twenty-nine to thirty-one h after initiation of epithelial cultures, 1-2 x 10 6 sperm were co-incubated with cells and sperm viability, motility, loss of acrosome and fertilizing ability determined
X-ray microanalysis of single and cultured cells
International Nuclear Information System (INIS)
Wroblewski, J.; Roomans, G.M.
1984-01-01
X-ray microanalysis of single or cultured cells is often a useful alternative or complement to the analysis of the corresponding tissue. It also allows the analysis of individual cells in a cell population. Preparation for X-ray microanalysis poses a number of typical problems. Suspensions of single cells can be prepared by either of two pathways: (1) washing - mounting - drying, or (2) centrifugation - freezing or fixation - sectioning. The washing step in the preparation of single or cultured cells presents the most severe problems. Cultured cells are generally grown on a substrate that is compatible with both the analysis and the culture, washed and dried. In some cases, sectioning of cultured cell monolayers has been performed. Special problems in quantitative analysis occur in those cases where the cells are analyzed on a thick substrate, since the substrate contributes to the spectral background
Directory of Open Access Journals (Sweden)
S Giovannini
2010-10-01
Full Text Available Cell therapies for articular cartilage defects rely on expanded chondrocytes. Mesenchymal stem cells (MSC represent an alternative cell source should their hypertrophic differentiation pathway be prevented. Possible cellular instruction between human articular chondrocytes (HAC and human bone marrow MSC was investigated in micromass pellets. HAC and MSC were mixed in different percentages or incubated individually in pellets for 3 or 6 weeks with and without TGF-beta1 and dexamethasone (±T±D as chondrogenic factors. Collagen II, collagen X and S100 protein expression were assessed using immunohistochemistry. Proteoglycan synthesis was evaluated applying the Bern score and quantified using dimethylmethylene blue dye binding assay. Alkaline phosphatase activity (ALP was detected on cryosections and soluble ALP measured in pellet supernatants. HAC alone generated hyaline-like discs, while MSC formed spheroid pellets in ±T±D. Co-cultured pellets changed from disc to spheroid shape with decreasing number of HAC, and displayed random cell distribution. In -T-D, HAC expressed S100, produced GAG and collagen II, and formed lacunae, while MSC did not produce any cartilage-specific proteins. Based on GAG, collagen type II and S100 expression chondrogenic differentiation occurred in -T-D MSC co-cultures. However, quantitative experimental GAG and DNA values did not differ from predicted values, suggesting only HAC contribution to GAG production. MSC produced cartilage-specific matrix only in +T+D but underwent hypertrophy in all pellet cultures. In summary, influence of HAC on MSC was restricted to early signs of neochondrogenesis. However, MSC did not contribute to the proteoglycan deposition, and HAC could not prevent hypertrophy of MSC induced by chondrogenic stimuli.
Weerkamp, Anton H.; Jacobs, Ton
1982-01-01
Three cell wall-associated protein antigens (antigens b, c, and d) were isolated from mutanolysin-solubilized cell walls of Streptococcus salivarius HB and purified to apparent homogeneity by a combination of ion-exchange chromatography, gel filtration, and immunoadsorption chromatography. Antigens b and c were also isolated from culture supernatants. Antigen b consisted of more than 80% protein and had an apparent molecular weight as determined by sodium dodecyl sulfate-polyacrylamide gel el...
An endogenous immune adjuvant released by necrotic cells for enhancement of DNA vaccine potency.
Dorostkar, Rohollah; Bamdad, Taravat; Parsania, Masoud; Pouriayevali, Hassan
2012-12-01
Improving vaccine potency in the induction of a strong cell-mediated cytotoxicity can enhance the efficacy of vaccines. Necrotic cells and the supernatant of necrotic tumor cells are attractive adjuvants, on account of their ability to recruit antigen-presenting cells to the site of antigen synthesis as well as its ability to stimulate the maturation of dendritic cells. To evaluate the utility of supernatant of necrotic tumor cells as a DNA vaccine adjuvant in a murine model. The supernatant of EL4 necrotic cells was co-administered with a DNA vaccine expressing the glycoprotein B of Herpes simplex virus-1 as an antigen model under the control of Cytomegalovirus promoter. C57BL/6 mice were vaccinated three times at two weeks intervals with glycoprotein B DNA vaccine and supernatant of necrotic EL4 cells. Five days after the last immunization, cell cytotoxicity, IFN-γ and IL-4 were evaluated. The obtained data showed that the production of IFN-γ from the splenocytes after antigenic stimulation in the presence of the supernatant of necrotic EL4 cells was significantly higher than the other groups (pEL4 cells in the mice immunized with DNA vaccine and supernatant of necrotic EL4 cells comparing to the other groups (p<0.001). The supernatant of necrotic cells contains adjuvant properties that can be considered as a candidate for tumor vaccination.
Picarelli, Antonio; Di Tola, Marco; Borghini, Raffaele; Isonne, Claudia; Saponara, Annarita; Marino, Mariacatia; Casale, Rossella; Tiberti, Antonio; Pica, Roberta; Donato, Giuseppe; Frieri, Giuseppe; Corazziari, Enrico
2013-10-01
Celiac disease (CD), a systemic autoimmune disorder that typically involves duodenal mucosa, can also affect other intestinal areas. Duodenal and oral mucosa organ culture has already been demonstrated as a reliable procedure to identify CD. The present study investigated gluten-dependent immunological activation of colonic mucosa in CD patients. We took advantage of the numerous colonoscopies performed for various clinical conditions or only for defensive medicine. Forty-four patients with gastrointestinal symptoms or in need of colorectal cancer screening were divided into patients with serum anti-endomysium (EMA) and anti-tissue transglutaminase (anti-tTG) antibody positive results (Group A), patients with serum antibody negative results (Group B), and patients with inflammatory bowel disease (IBD) (Group C). The autoantibodies EMA and anti-tTG were evaluated in supernatants of cultured sigmoid and duodenal biopsies from patients on a gluten-containing diet. In Group A, EMA and anti-tTG resulted positive in all duodenal culture supernatants. In sigmoid culture supernatants, EMA and anti-tTG were detected in 12/16 (75 %) and 13/16 (81.3 %) patients, respectively. In Group B, none of the 17 patients showed EMA and anti-tTG positive results in both duodenal and sigmoid cultures. In Group C, all 11 patients presented EMA negative results in sigmoid cultures. Only in one patient, anti-tTG were detectable in the sigmoid culture supernatant, as expected in cases of IBD. Data confirm that the gluten-dependent immunological activation affects more intestinal tracts with different degrees of involvement, suggesting that the organ culture of colonic biopsies could represent a new tool to opportunistically detect CD.
Directory of Open Access Journals (Sweden)
Farzaneh Chobsaz
2011-01-01
Full Text Available Background: Sildenafil is a selective inhibitor of cyclic-guanosine monphosphat-specificphosphodiesterase type 5. It increases intracellular nitric oxide (NO production in some cells.There are reports on its positive effect on uterine circulation, endometrial thickness, and infertilityimprovement. Endometrial epithelial cells (EEC play an important role in embryo attachment andimplantation. The present work investigates the effect of sildenafil on human EEC and their NOsecretion in vitro.Materials and Methods: In this experimental in vitro study, endometrial biopsies (n=10 werewashed in a phosphate buffered solution (PBS and digested with collagenase I (2 mg/ml in DMEM/F12 medium at 37°C for 90 minutes. Epithelial glands were collected by sequential filtrationthrough nylon meshes (70 and 40 μm pores, respectively. Epithelial glands were then treated withtrypsin to obtain individual cells. The cells were counted and divided into four groups: control and1, 10, and 20 μM sildenafil concentrations. Cells were cultured for 15 days at 37ºC and 5% CO2; themedia were changed every 3 days, and their supernatants were collected for the NO assay. NO wasmeasured by standard Greiss methods. Data were analyzed by one way ANOVA.Results: There was no significant difference between groups in cell count and NO secretion, but thelevel of NO increased slightly in the experimental groups. The 10 μM dose showed the highest cellcount. EEC morphology changed into long spindle cells in the case groups.Conclusion: Sildenafil (1, 10, and 20 μM showed a mild proliferative effect on human EECnumbers, but no significant change was seen in NO production.
Particle Trajectories in Rotating Wall Cell Culture Devices
Ramachandran N.; Downey, J. P.
1999-01-01
Cell cultures are extremely important to the medical community since such cultures provide an opportunity to perform research on human tissue without the concerns inherent in experiments on individual humans. Development of cells in cultures has been found to be greatly influenced by the conditions of the culture. Much work has focused on the effect of the motions of cells in the culture relative to the solution. Recently rotating wall vessels have been used with success in achieving improved cellular cultures. Speculation and limited research have focused on the low shear environment and the ability of rotating vessels to keep cells suspended in solution rather than floating or sedimenting as the primary reasons for the improved cellular cultures using these devices. It is widely believed that the cultures obtained using a rotating wall vessel simulates to some degree the effect of microgravity on cultures. It has also been speculated that the microgravity environment may provide the ideal acceleration environment for culturing of cellular tissues due to the nearly negligible levels of sedimentation and shear possible. This work predicts particle trajectories of cells in rotating wall vessels of cylindrical and annular design consistent with the estimated properties of typical cellular cultures. Estimates of the shear encountered by cells in solution and the interactions with walls are studied. Comparisons of potential experiments in ground and microgravity environments are performed.
Usability and Applicability of Microfluidic Cell Culture Systems
DEFF Research Database (Denmark)
Hemmingsen, Mette
possibilities for, for example, precise control of the chemical environment, 3D cultures, controlled co-culture of different cell types or automated, individual control of up to 96 cell culture chambers in one integrated system. Despite the great new opportunities to perform novel experimental designs......Microfluidic cell culture has been a research area with great attention the last decade due to its potential to mimic the in vivo cellular environment more closely compared to what is possible by conventional cell culture methods. Many exciting and complex devices have been presented providing......, these devices still lack general implementation into biological research laboratories. In this project, the usability and applicability of microfluidic cell culture systems have been investigated. The tested systems display good properties regarding optics and compatibility with standard laboratory equipment...
HCMV spread and cell tropism are determined by distinct virus populations.
Directory of Open Access Journals (Sweden)
Laura Scrivano
Full Text Available Human cytomegalovirus (HCMV can infect many different cell types in vivo. Two gH/gL complexes are used for entry into cells. gH/gL/pUL(128,130,131A shows no selectivity for its host cell, whereas formation of a gH/gL/gO complex only restricts the tropism mainly to fibroblasts. Here, we describe that depending on the cell type in which virus replication takes place, virus carrying the gH/gL/pUL(128,130,131A complex is either released or retained cell-associated. We observed that virus spread in fibroblast cultures was predominantly supernatant-driven, whereas spread in endothelial cell (EC cultures was predominantly focal. This was due to properties of virus released from fibroblasts and EC. Fibroblasts released virus which could infect both fibroblasts and EC. In contrast, EC released virus which readily infected fibroblasts, but was barely able to infect EC. The EC infection capacities of virus released from fibroblasts or EC correlated with respectively high or low amounts of gH/gL/pUL(128,130,131A in virus particles. Moreover, we found that focal spread in EC cultures could be attributed to EC-tropic virus tightly associated with EC and not released into the supernatant. Preincubation of fibroblast-derived virus progeny with EC or beads coated with pUL131A-specific antibodies depleted the fraction that could infect EC, and left a fraction that could predominantly infect fibroblasts. These data strongly suggest that HCMV progeny is composed of distinct virus populations. EC specifically retain the EC-tropic population, whereas fibroblasts release EC-tropic and non EC-tropic virus. Our findings offer completely new views on how HCMV spread may be controlled by its host cells.
Directory of Open Access Journals (Sweden)
Han Wu
2016-01-01
Full Text Available Oxidative stress is considered to be a critical factor in diabetes-induced endothelial progenitor cell (EPC dysfunction, although the underlying mechanisms are not fully understood. In this study, we investigated the role of high mobility group box-1 (HMGB-1 in diabetes-induced oxidative stress. HMGB-1 was upregulated in both serum and bone marrow-derived monocytes from diabetic mice compared with control mice. In vitro, advanced glycation end productions (AGEs induced, expression of HMGB-1 in EPCs and in cell culture supernatants in a dose-dependent manner. However, inhibition of oxidative stress with N-acetylcysteine (NAC partially inhibited the induction of HMGB-1 induced by AGEs. Furthermore, p66shc expression in EPCs induced by AGEs was abrogated by incubation with glycyrrhizin (Gly, while increased superoxide dismutase (SOD activity in cell culture supernatants was observed in the Gly treated group. Thus, HMGB-1 may play an important role in diabetes-induced oxidative stress in EPCs via a positive feedback loop involving the AGE/reactive oxygen species/HMGB-1 pathway.
Good Cell Culture Practice for stem cells and stem-cell-derived models.
Pamies, David; Bal-Price, Anna; Simeonov, Anton; Tagle, Danilo; Allen, Dave; Gerhold, David; Yin, Dezhong; Pistollato, Francesca; Inutsuka, Takashi; Sullivan, Kristie; Stacey, Glyn; Salem, Harry; Leist, Marcel; Daneshian, Mardas; Vemuri, Mohan C; McFarland, Richard; Coecke, Sandra; Fitzpatrick, Suzanne C; Lakshmipathy, Uma; Mack, Amanda; Wang, Wen Bo; Yamazaki, Daiju; Sekino, Yuko; Kanda, Yasunari; Smirnova, Lena; Hartung, Thomas
2017-01-01
The first guidance on Good Cell Culture Practice (GCCP) dates back to 2005. This document expands this to include aspects of quality assurance for in vitro cell culture focusing on the increasingly diverse cell types and culture formats used in research, product development, testing and manufacture of biotechnology products and cell-based medicines. It provides a set of basic principles of best practice that can be used in training new personnel, reviewing and improving local procedures, and helping to assure standard practices and conditions for the comparison of data between laboratories and experimentation performed at different times. This includes recommendations for the documentation and reporting of culture conditions. It is intended as guidance to facilitate the generation of reliable data from cell culture systems, and is not intended to conflict with local or higher level legislation or regulatory requirements. It may not be possible to meet all recommendations in this guidance for practical, legal or other reasons. However, when it is necessary to divert from the principles of GCCP, the risk of decreasing the quality of work and the safety of laboratory staff should be addressed and any conclusions or alternative approaches justified. This workshop report is considered a first step toward a revised GCCP 2.0.
Long-term maintenance of human induced pluripotent stem cells by automated cell culture system.
Konagaya, Shuhei; Ando, Takeshi; Yamauchi, Toshiaki; Suemori, Hirofumi; Iwata, Hiroo
2015-11-17
Pluripotent stem cells, such as embryonic stem cells and induced pluripotent stem (iPS) cells, are regarded as new sources for cell replacement therapy. These cells can unlimitedly expand under undifferentiated conditions and be differentiated into multiple cell types. Automated culture systems enable the large-scale production of cells. In addition to reducing the time and effort of researchers, an automated culture system improves the reproducibility of cell cultures. In the present study, we newly designed a fully automated cell culture system for human iPS maintenance. Using an automated culture system, hiPS cells maintained their undifferentiated state for 60 days. Automatically prepared hiPS cells had a potency of differentiation into three germ layer cells including dopaminergic neurons and pancreatic cells.
High-Throughput Cancer Cell Sphere Formation for 3D Cell Culture.
Chen, Yu-Chih; Yoon, Euisik
2017-01-01
Three-dimensional (3D) cell culture is critical in studying cancer pathology and drug response. Though 3D cancer sphere culture can be performed in low-adherent dishes or well plates, the unregulated cell aggregation may skew the results. On contrary, microfluidic 3D culture can allow precise control of cell microenvironments, and provide higher throughput by orders of magnitude. In this chapter, we will look into engineering innovations in a microfluidic platform for high-throughput cancer cell sphere formation and review the implementation methods in detail.
International Nuclear Information System (INIS)
Vie, H.; Miller, R.A.
1986-01-01
We present here a culture method for the estimation, in human blood, of the number of lymphocytes that can respond to mitogen by producing interleukin 2 (IL 2). T cells are cultured at limiting dilutions with PHA or Con A in the presence of Epstein Barr virus-transformed human lymphoblastoid cells (EB-LCL), and supernatants are tested 3 days later for IL 2 content by a cell proliferation assay. The distribution of negative wells follows the expected Poisson single-hit relationship, suggesting that the assay is sensitive to single cells of a single limiting cell type. On average, 16.3% of peripheral blood mononuclear cells can produce IL 2 in such clonal cultures (mean of 12 determinations; SD = 5.6%). Surprisingly, irradiation (up to 2000 rad) of the titrated responder cell population diminishes the estimated frequencies by less than 50%. The ability to detect IL 2 levels in cultures containing only a single, nonproliferating T lymphocyte allows us to estimate the amount of IL 2 generated by an individual effector cell during a 3-day culture interval after mitogen stimulation. The average responding, irradiated T cell generates 0.92 pg of IL 2 (median) within 3 days. The method presented provides a straightforward way to provide independent estimates of responding cell number and of lymphokine production per cell in a variety of clinical situations
Lin, Chi-Hung; Chik, Jenny H L; Packer, Nicolle H; Molloy, Mark P
2015-02-06
Glycosylation results from the concerted action of glycosylation enzymes in the secretory pathway. In general, gene expression serves as the primary control mechanism, but post-translational fine-tuning of glycosylation enzyme functions is often necessary for efficient synthesis of specific glycan epitopes. While the field of glycomics has rapidly advanced, there lacks routine proteomic methods to measure expression of specific glycosylation enzymes needed to fill the gap between mRNA expression and the glycomic profile in a "reverse genomics" workflow. Toward developing this workflow we enriched Golgi membranes from two human colon cancer cell lines by sucrose density centrifugation and further mass-based fractionation by SDS-PAGE. We then applied mass spectrometry to demonstrate a doubling in the number of Golgi resident proteins identified, compared to the unenriched, low speed centrifuged supernatant of lysed cells. A total of 35 Golgi-resident glycosylation enzymes, of which 23 were glycosyltransferases, were identified making this the largest protein database so far of Golgi resident glycosylation enzymes experimentally identified in cultured human cells. We developed targeted mass spectrometry assays for specific quantitation of many of these glycosylation enzymes. Our results show that alterations in abundance of glycosylation enzymes at the protein level were generally consistent with the resultant glycomic profiles, but not necessarily with the corresponding glycosyltransferase mRNA expression as exemplified by the case of O-glycan core 1 T synthase.
Andria, B.; Bracco, A.; Cirino, G.; Chamuleau, R. A. F. M.
2010-01-01
In the last 15 years many different liver cell culture devices, consisting of functional liver cells and artificial materials, have been developed. They have been devised for numerous different applications, such as temporary organ replacement (a bridge to liver transplantation or native liver
Characterization of glucocerebrosidase in peripheral blood cells and cultured blastoid cells
Aerts, J. M.; Heikoop, J.; van Weely, S.; Donker-Koopman, W. E.; Barranger, J. A.; Tager, J. M.; Schram, A. W.
1988-01-01
We have characterized glucocerebrosidase in various cell types of peripheral blood of control subjects and in cultured human blastoid cells. The intracellular level of glucocerebrosidase in cultured blastoid cells (10-30 nmol substrate hydrolyzed/h.mg protein) resembles closely values observed for
Campbell, Jessica K; Rogers, Randy B; Lila, Mary Ann; Erdman, John W
2006-02-08
This work describes the development and utilization of a plant cell culture production approach to biosynthesize and radiolabel phytoene and phytofluene for prostate cancer cell culture studies. The herbicide norflurazon was added to established cell suspension cultures of tomato (Lycopersicon esculentum cv. VFNT cherry), to induce the biosynthesis and accumulation of the lycopene precursors, phytoene and phytofluene, in their natural isomeric forms (15-cis-phytoene and two cis-phytofluene isomers). Norflurazon concentrations, solvent carrier type and concentration, and duration of culture exposure to norflurazon were screened to optimize phytoene and phytofluene synthesis. Maximum yields of both phytoene and phytofluene were achieved after 7 days of treatment with 0.03 mg norflurazon/40 mL fresh medium, provided in 0.07% solvent carrier. Introduction of 14C-sucrose to the tomato cell culture medium enabled the production of 14C-labeled phytoene for subsequent prostate tumor cell uptake studies. In DU 145 prostate tumor cells, it was determined that 15-cis-phytoene and an oxidized product of phytoene were taken up and partially metabolized by the cells. The ability to biosynthesize, radiolabel, and isolate these carotenoids from tomato cell cultures is a novel, valuable methodology for further in vitro and in vivo investigations into the roles of phytoene and phytofluene in cancer chemoprevention.
Advantages and challenges of microfluidic cell culture in polydimethylsiloxane devices.
Halldorsson, Skarphedinn; Lucumi, Edinson; Gómez-Sjöberg, Rafael; Fleming, Ronan M T
2015-01-15
Culture of cells using various microfluidic devices is becoming more common within experimental cell biology. At the same time, a technological radiation of microfluidic cell culture device designs is currently in progress. Ultimately, the utility of microfluidic cell culture will be determined by its capacity to permit new insights into cellular function. Especially insights that would otherwise be difficult or impossible to obtain with macroscopic cell culture in traditional polystyrene dishes, flasks or well-plates. Many decades of heuristic optimization have gone into perfecting conventional cell culture devices and protocols. In comparison, even for the most commonly used microfluidic cell culture devices, such as those fabricated from polydimethylsiloxane (PDMS), collective understanding of the differences in cellular behavior between microfluidic and macroscopic culture is still developing. Moving in vitro culture from macroscopic culture to PDMS based devices can come with unforeseen challenges. Changes in device material, surface coating, cell number per unit surface area or per unit media volume may all affect the outcome of otherwise standard protocols. In this review, we outline some of the advantages and challenges that may accompany a transition from macroscopic to microfluidic cell culture. We focus on decisive factors that distinguish macroscopic from microfluidic cell culture to encourage a reconsideration of how macroscopic cell culture principles might apply to microfluidic cell culture. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Isolation and culture of larval cells from C. elegans.
Directory of Open Access Journals (Sweden)
Sihui Zhang
Full Text Available Cell culture is an essential tool to study cell function. In C. elegans the ability to isolate and culture cells has been limited to embryonically derived cells. However, cells or blastomeres isolated from mixed stage embryos terminally differentiate within 24 hours of culture, thus precluding post-embryonic stage cell culture. We have developed an efficient and technically simple method for large-scale isolation and primary culture of larval-stage cells. We have optimized the treatment to maximize cell number and minimize cell death for each of the four larval stages. We obtained up to 7.8×10(4 cells per microliter of packed larvae, and up to 97% of adherent cells isolated by this method were viable for at least 16 hours. Cultured larval cells showed stage-specific increases in both cell size and multinuclearity and expressed lineage- and cell type-specific reporters. The majority (81% of larval cells isolated by our method were muscle cells that exhibited stage-specific phenotypes. L1 muscle cells developed 1 to 2 wide cytoplasmic processes, while L4 muscle cells developed 4 to 14 processes of various thicknesses. L4 muscle cells developed bands of myosin heavy chain A thick filaments at the cell center and spontaneously contracted ex vivo. Neurons constituted less than 10% of the isolated cells and the majority of neurons developed one or more long, microtubule-rich protrusions that terminated in actin-rich growth cones. In addition to cells such as muscle and neuron that are high abundance in vivo, we were also able to isolate M-lineage cells that constitute less than 0.2% of cells in vivo. Our novel method of cell isolation extends C. elegans cell culture to larval developmental stages, and allows use of the wealth of cell culture tools, such as cell sorting, electrophysiology, co-culture, and high-resolution imaging of subcellular dynamics, in investigation of post-embryonic development and physiology.
Bowey-Dellinger, Kristen; Dixon, Luke; Ackerman, Kristin; Vigueira, Cynthia; Suh, Yewseok K; Lyda, Todd; Sapp, Kelli; Grider, Michael; Crater, Dinene; Russell, Travis; Elias, Michael; Coffield, V McNeil; Segarra, Verónica A
2017-01-01
Undergraduate students learn about mammalian cell culture applications in introductory biology courses. However, laboratory modules are rarely designed to provide hands-on experience with mammalian cells or teach cell culture techniques, such as trypsinization and cell counting. Students are more likely to learn about cell culture using bacteria or yeast, as they are typically easier to grow, culture, and manipulate given the equipment, tools, and environment of most undergraduate biology laboratories. In contrast, the utilization of mammalian cells requires a dedicated biological safety cabinet and rigorous antiseptic techniques. For this reason, we have devised a laboratory module and method herein that familiarizes students with common cell culture procedures, without the use of a sterile hood or large cell culture facility. Students design and perform a time-efficient inquiry-based cell viability experiment using HeLa cells and tools that are readily available in an undergraduate biology laboratory. Students will become familiar with common techniques such as trypsinizing cells, cell counting with a hemocytometer, performing serial dilutions, and determining cell viability using trypan blue dye. Additionally, students will work with graphing software to analyze their data and think critically about the mechanism of death on a cellular level. Two different adaptations of this inquiry-based lab are presented-one for non-biology majors and one for biology majors. Overall, these laboratories aim to expose students to mammalian cell culture and basic techniques and help them to conceptualize their application in scientific research.
Multizone Paper Platform for 3D Cell Cultures
Derda, Ratmir; Hong, Estrella; Mwangi, Martin; Mammoto, Akiko; Ingber, Donald E.; Whitesides, George M.
2011-01-01
In vitro 3D culture is an important model for tissues in vivo. Cells in different locations of 3D tissues are physiologically different, because they are exposed to different concentrations of oxygen, nutrients, and signaling molecules, and to other environmental factors (temperature, mechanical stress, etc). The majority of high-throughput assays based on 3D cultures, however, can only detect the average behavior of cells in the whole 3D construct. Isolation of cells from specific regions of 3D cultures is possible, but relies on low-throughput techniques such as tissue sectioning and micromanipulation. Based on a procedure reported previously (“cells-in-gels-in-paper” or CiGiP), this paper describes a simple method for culture of arrays of thin planar sections of tissues, either alone or stacked to create more complex 3D tissue structures. This procedure starts with sheets of paper patterned with hydrophobic regions that form 96 hydrophilic zones. Serial spotting of cells suspended in extracellular matrix (ECM) gel onto the patterned paper creates an array of 200 micron-thick slabs of ECM gel (supported mechanically by cellulose fibers) containing cells. Stacking the sheets with zones aligned on top of one another assembles 96 3D multilayer constructs. De-stacking the layers of the 3D culture, by peeling apart the sheets of paper, “sections” all 96 cultures at once. It is, thus, simple to isolate 200-micron-thick cell-containing slabs from each 3D culture in the 96-zone array. Because the 3D cultures are assembled from multiple layers, the number of cells plated initially in each layer determines the spatial distribution of cells in the stacked 3D cultures. This capability made it possible to compare the growth of 3D tumor models of different spatial composition, and to examine the migration of cells in these structures. PMID:21573103
Mutation in cultured mammalian cells
International Nuclear Information System (INIS)
Nakamura, N.; Okada, S.
1982-01-01
Mammalian cell cultures were exposed to gamma-rays at various dose rates. Dose-rate effects were observed in cultured somatic cells of the mouse for cell killing and mutations resistant to 6-thioguanine (TGsup(r)) and to methotrexate (MTXsup(r)). Linear quadratic model may be applied to cell killing and TGsup(r) mutations in some cases but can not explain the whole data. Results at low doses with far low dose-rate were not predictable from data at high doses with acute or chronic irradiation. Radioprotective effects of dimethyl sulfoxide were seen only after acute exposure but not after chronic one, suggesting that damages by indirect action of radiations may be potentially reparable by cells. TGsup(r) mutations seem to contain gross structural changes whereas MTXsup(r) ones may have smaller alterations. (Namekawa, K.)
Cell-free DNA in a three-dimensional spheroid cell culture model
DEFF Research Database (Denmark)
Aucamp, Janine; Calitz, Carlemi; Bronkhorst, Abel J.
2017-01-01
Background Investigating the biological functions of cell-free DNA (cfDNA) is limited by the interference of vast numbers of putative sources and causes of DNA release into circulation. Utilization of three-dimensional (3D) spheroid cell cultures, models with characteristics closer to the in vivo...... cultures can serve as effective, simplified in vivo-simulating “closed-circuit” models since putative sources of cfDNA are limited to only the targeted cells. In addition, cfDNA can also serve as an alternative or auxiliary marker for tracking spheroid growth, development and culture stability. Biological...... significance 3D cell cultures can be used to translate “closed-circuit” in vitro model research into data that is relevant for in vivo studies and clinical applications. In turn, the utilization of cfDNA during 3D culture research can optimize sample collection without affecting the stability of the growth...
Cell culture techniques in honey bee research
Cell culture techniques are indispensable in most if not all life science disciplines to date. Wherever cell culture models are lacking scientific development is hampered. Unfortunately this has been and still is the case in honey bee research because permanent honey bee cell lines have not yet been...
MEMS-based dynamic cell-to-cell culture platforms using electrochemical surface modifications
International Nuclear Information System (INIS)
Chang, Jiyoung; Lin, Liwei; Yoon, Sang-Hee; Mofrad, Mohammad R K
2011-01-01
MEMS-based biological platforms with the capability of both spatial placements and time releases of living cells for cell-to-cell culture experiments have been designed and demonstrated utilizing electrochemical surface modification effects. The spatial placement is accomplished by electrochemical surface modification of substrate surfaces to be either adhesive or non-adhesive for living cells. The time control is achieved by the electrical activation of the selective indium tin oxide co-culture electrode to allow the migration of living cells onto the electrode to start the cell-to-cell culture studies. Prototype devices have a three-electrode design with an electrode size of 50 × 50 µm 2 and the separation gaps of 2 µm between them. An electrical voltage of −1.5 V has been used to activate the electrodes independently and sequentially to demonstrate the dynamic cell-to-cell culture experiments of NIH 3T3 fibroblast and Madin Darby canine kidney cells. As such, this MEMS platform could be a basic yet versatile tool to characterize transient cell-to-cell interactions
Microfluidic engineered high cell density three-dimensional neural cultures
Cullen, D. Kacy; Vukasinovic, Jelena; Glezer, Ari; La Placa, Michelle C.
2007-06-01
Three-dimensional (3D) neural cultures with cells distributed throughout a thick, bioactive protein scaffold may better represent neurobiological phenomena than planar correlates lacking matrix support. Neural cells in vivo interact within a complex, multicellular environment with tightly coupled 3D cell-cell/cell-matrix interactions; however, thick 3D neural cultures at cell densities approaching that of brain rapidly decay, presumably due to diffusion limited interstitial mass transport. To address this issue, we have developed a novel perfusion platform that utilizes forced intercellular convection to enhance mass transport. First, we demonstrated that in thick (>500 µm) 3D neural cultures supported by passive diffusion, cell densities =104 cells mm-3), continuous medium perfusion at 2.0-11.0 µL min-1 improved viability compared to non-perfused cultures (p death and matrix degradation. In perfused cultures, survival was dependent on proximity to the perfusion source at 2.00-6.25 µL min-1 (p 90% viability in both neuronal cultures and neuronal-astrocytic co-cultures. This work demonstrates the utility of forced interstitial convection in improving the survival of high cell density 3D engineered neural constructs and may aid in the development of novel tissue-engineered systems reconstituting 3D cell-cell/cell-matrix interactions.
Cell sources for in vitro human liver cell culture models
Freyer, Nora; Damm, Georg; Seehofer, Daniel; Knöspel, Fanny
2016-01-01
In vitro liver cell culture models are gaining increasing importance in pharmacological and toxicological research. The source of cells used is critical for the relevance and the predictive value of such models. Primary human hepatocytes (PHH) are currently considered to be the gold standard for hepatic in vitro culture models, since they directly reflect the specific metabolism and functionality of the human liver; however, the scarcity and difficult logistics of PHH have driven researchers to explore alternative cell sources, including liver cell lines and pluripotent stem cells. Liver cell lines generated from hepatomas or by genetic manipulation are widely used due to their good availability, but they are generally altered in certain metabolic functions. For the past few years, adult and pluripotent stem cells have been attracting increasing attention, due their ability to proliferate and to differentiate into hepatocyte-like cells in vitro. However, controlling the differentiation of these cells is still a challenge. This review gives an overview of the major human cell sources under investigation for in vitro liver cell culture models, including primary human liver cells, liver cell lines, and stem cells. The promises and challenges of different cell types are discussed with a focus on the complex 2D and 3D culture approaches under investigation for improving liver cell functionality in vitro. Finally, the specific application options of individual cell sources in pharmacological research or disease modeling are described. PMID:27385595
Directory of Open Access Journals (Sweden)
P. R. Prathiush
Full Text Available Coproantigen detection of Echinococcosis in dogs by counter immunoelectrophoresis was standardized. Adult Echinococcus granulosus worms were obtained from intestine of a necropsied positive dog. Excretory-secretory antigen was prepared by culturing adult worms in Medium 199 (pH 7.4. Faeces of positive dog were collected and fecal supernatant was prepared and used for coproantigen detection. CIEP was carried out using tris-borate buffer (pH 8.0 at a constant current of 8mA/slide for 60 minutes. CIEP detected infection with both the antigens. [Vet World 2009; 2(11.000: 421-422
Growth of melanocytes in human epidermal cell cultures
International Nuclear Information System (INIS)
Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.
1990-01-01
Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient
International Nuclear Information System (INIS)
McVay, C.W.; Stimmel, J.R.; Marchetti, S.
1988-08-01
This report provides a summary of work performed to develop a cement-based, low-level waste formulation suitable for the solidification of decontaminated high-level waste liquid produced as a by-product of PUREX spent fuel reprocessing. The resultant waste form is suitable for interim storage and is intended for ultimate disposal as low-level Class C waste; it also meets the stability requirements of the NRC Branch Technical Position on Waste Form Qualification, May 1983 and the requirements of 10 CFR 61. A recipe was developed utilizing only Portland Type I cement based on an inorganic salts simulant of the PUREX supernatant. The qualified recipe was tested full scale in the production facility and was observed to produce a product with entrained air, low density, and lower-than-expected compressive strength. Further laboratory scale testing with actual decontaminated supernatant revealed that set retarders were present in the supernatant, precluding setting of the product and allowing the production of ''bleed water.'' Calcium nitrate and sodium silicate were added to overcome the set retarding effect and produced a final product with improved performance when compared to the original formulation. This report describes the qualification process and qualification test results for the final product formulation. 7 refs., 38 figs., 21 tabs
DEFF Research Database (Denmark)
Jensen, Tanja B; Gottwein, Judith Margarete; Scheel, Troels Kasper Høyer
2008-01-01
of recovered genomes and reverse-genetic studies. Receptor blockage was performed with anti-CD81 and anti-SR-BI. For neutralization experiments, SA13/JFH1 or JFH1-based viruses of other genotypes were incubated with patient sera. Results. @nbsp; SA13/JFH1 with NS2 and NS3 mutations yielded infectivity titers......Background. @nbsp; Recently, a hepatitis C virus (HCV) cell-culture system was developed that employed strain JFH1 (genotype 2a), and JFH1-based intra- and intergenotypic recombinants now permit functional studies of the structural genes (Core, E1, and E2), p7, and NS2 of genotypes 1-4. The goal...... was to adapt the system to employ genotype 5. Methods. @nbsp; Huh7.5 cells infected with SA13/JFH1, containing Core-NS2 of strain SA13 (genotype 5a), were monitored for Core expression and for supernatant infectivity and HCV-RNA titers. Adaptive mutations of SA13/JFH1 were identified by sequence analysis...
Cell Culture as an Alternative in Education.
Nardone, Roland M.
1990-01-01
Programs that are intended to inform and provide "hands-on" experience for students and to facilitate the introduction of cell culture-based laboratory exercises into the high school and college laboratory are examined. The components of the CellServ Program and the Cell Culture Toxicology Training Programs are described. (KR)
International Nuclear Information System (INIS)
Fujiwara, Daisuke; Kato, Kazunori; Nohara, Shigeo; Iwanuma, Yoshimi; Kajiyama, Yoshiaki
2013-01-01
Highlights: •Spheroids were created from esophageal carcinoma cells using NanoCulture® Plates. •The proportion of strongly ALDH-positive cells increased in 3-D culture. •Expression of cancer stem cell-related genes was enhanced in 3-D culture. •CA-9 expression was enhanced, suggesting hypoxia had been induced in 3-D culture. •Drug resistance was increased. 3-D culture is useful for inducing cancer stem cells. -- Abstract: In recent years, research on resistance to chemotherapy and radiotherapy in cancer treatment has come under the spotlight, and researchers have also begun investigating the relationship between resistance and cancer stem cells. Cancer stem cells are assumed to be present in esophageal cancer, but experimental methods for identification and culture of these cells have not yet been established. To solve this problem, we created spheroids using a NanoCulture® Plate (NCP) for 3-dimensional (3-D) cell culture, which was designed as a means for experimentally reproducing the 3-D structures found in the body. We investigated the potential for induction of cancer stem cells from esophageal cancer cells. Using flow cytometry we analyzed the expression of surface antigen markers CD44, CD133, CD338 (ABCG2), CD318 (CDCP1), and CD326 (EpCAM), which are known cancer stem cell markers. None of these surface antigen markers showed enhanced expression in 3-D cultured cells. We then analyzed aldehyde dehydrogenase (ALDH) enzymatic activity using the ALDEFLUOR reagent, which can identify immature cells such as stem cells and precursor cells. 3-D-cultured cells were strongly positive for ALDH enzyme activity. We also analyzed the expression of the stem cell-related genes Sox-2, Nanog, Oct3/4, and Lin28 using RT-PCR. Expression of Sox-2, Nanog, and Lin28 was enhanced. Analysis of expression of the hypoxic surface antigen marker carbonic anhydrase-9 (CA-9), which is an indicator of cancer stem cell induction and maintenance, revealed that CA-9 expression
Buhner, Sabine; Hahne, Hannes; Hartwig, Kerstin; Li, Qin; Vignali, Sheila; Ostertag, Daniela; Meng, Chen; Hörmannsperger, Gabriele; Braak, Breg; Pehl, Christian; Frieling, Thomas; Barbara, Giovanni; De Giorgio, Roberto; Demir, Ihsan Ekin; Ceyhan, Güralp Onur; Zeller, Florian; Boeckxstaens, Guy; Haller, Dirk; Kuster, Bernhard; Schemann, Michael
2018-01-01
The causes of gastrointestinal complaints in irritable bowel syndrome (IBS) remain poorly understood. Altered nerve function has emerged as an important pathogenic factor as IBS mucosal biopsy supernatants consistently activate enteric and sensory neurons. We investigated the neurally active molecular components of such supernatants from patients with IBS and quiescent ulcerative colitis (UC). Effects of supernatants from 7 healthy controls (HC), 20 IBS and 12 UC patients on human and guinea pig submucous neurons were studied with neuroimaging techniques. We identify differentially expressed proteins with proteome analysis. Nerve activation by IBS supernatants was prevented by the protease activated receptor 1 (PAR1) antagonist SCHE79797. UC supernatants also activated enteric neurons through protease dependent mechanisms but without PAR1 involvement. Proteome analysis of the supernatants identified 204 proteins, among them 17 proteases as differentially expressed between IBS, UC and HC. Of those the four proteases elastase 3a, chymotrypsin C, proteasome subunit type beta-2 and an unspecified isoform of complement C3 were significantly more abundant in IBS compared to HC and UC supernatants. Of eight proteases, which were upregulated in IBS, the combination of elastase 3a, cathepsin L and proteasome alpha subunit-4 showed the highest prediction accuracy of 98% to discriminate between IBS and HC groups. Elastase synergistically potentiated the effects of histamine and serotonin-the two other main neuroactive substances in the IBS supernatants. A serine protease inhibitor isolated from the probiotic Bifidobacterium longum NCC2705 (SERPINBL), known to inhibit elastase-like proteases, prevented nerve activation by IBS supernatants. Proteases in IBS and UC supernatants were responsible for nerve activation. Our data demonstrate that proteases, particularly those signalling through neuronal PAR1, are biomarker candidates for IBS, and protease profiling may be used to
PECULIARITIES OF SECONDARY METABOLITES BIOSYNTHESIS IN PLANT CELL CULTURES
Directory of Open Access Journals (Sweden)
A.M. NOSOV
2014-06-01
Full Text Available metabolites formation in plant cell cultures of Panax spp., (ginsenosides; Dioscorea deltoidea (steroid glycosides; Ajuga reptans, Serratula coronata, Rhaponticum carthamoides (ecdisteroids; Polyscias spp., (triterpene glycosides, Taxus spp. (taxoids, Stevia rebaudiana (diterpene steviol-glycosides, Stephania glabra (alkaloids. They are some regular trends of secondary metabolites synthesis in the plant cell culture:It can be noted the stable synthesis of the compound promoting cell proliferation. Indeed, cell cultures of Dioscorea deltoidea were demonstrated to accumulate only furostanol glycosides, which promoted cell division. Furostanol glycoside content of Dioscorea strain DM-0.5 was up to 6 - 12% by dry biomass.Panax ginseng and P. japonicus plant cell cultures synthesize as minimum seven triterpene glycosides (ginsenosides, the productivity of these compounds was up to 6.0 - 8.0% on dry biomass.By contrast, the detectable synthesis of diterpene steviol-glycosides in cultivated cells of Stevia rebaudiana initiated in the mixotrophic cultures during chloroplast formation only.Despite these differences, or mainly due to them, plant cell cultures have become an attractive source of phytochemicals in alternative to collecting wild plants. It provides a guideline to bioreactor-based production of isoprenoids using undifferentiated plant cell cultures.
Substrate utilisation by plant-cell cultures
Energy Technology Data Exchange (ETDEWEB)
Fowler, M W
1982-01-01
Plant cell cultures have been grown on a wide range of carbon sources in addition to the traditional ones of sucrose and glucose. Biomass yields and growth rates vary greatly between the different carbon sources and there is a variation in response between different cell cultures to individual carbon sources. Some attempts have been made to grow cell cultures on 'waste' and related carbon sources, such as lactose, maltose, starch, molasses and milk whey. Only maltose was found to support growth to anything near the levels observed with glucose and sucrose. In the case of molasses carbon source cell growth was either non-existent or only just measurable. All the data point to glucose as being the most suitable carbon source, principally on the grounds of biomass yield and growth rate. It should be noted, however, that other carbon sources do appear to have a major (positive) influence on natural product synthesis. Uptake into the cell is an important aspect of carbohydrate utilisation. There is strong evidence that from disaccharides upwards, major degradation to smaller units occurs before uptake. In some cases the necessary enzymes appear to be excreted into the culture broth, in others they may be located within the cell wall; invertase that hydrolyses sucrose is a good example. Once the products of carbohydrate degradation and mobilisation enter the cell they may suffer one of two fates, oxidation or utilisation for biosynthesis. The precise split between these two varies depending on such factors as cell growth rate, cell size, nutrient broth composition and carbohydrate status of the cells. In general rapidly growing cells have a high rate of oxidation, whereas cells growing more slowly tend to be more directed towards biosynthesis. Carbohydrate utilisation is a key area of study, underpinning as it does both biomass yield and natural product synthesis. (Refs. 13).
Uptake and cytotoxic effects of multi-walled carbon nanotubes in human bronchial epithelial cells
International Nuclear Information System (INIS)
Hirano, Seishiro; Fujitani, Yuji; Furuyama, Akiko; Kanno, Sanae
2010-01-01
Carbon nanotubes (CNT) are cytotoxic to several cell types. However, the mechanism of CNT toxicity has not been fully studied, and dosimetric analyses of CNT in the cell culture system are lacking. Here, we describe a novel, high throughput method to measure cellular uptake of CNT using turbimetry. BEAS-2B, a human bronchial epithelial cell line, was used to investigate cellular uptake, cytotoxicity, and inflammatory effects of multi-walled CNT (MWCNT). The cytotoxicity of MWCNT was higher than that of crocidolite asbestos in BEAS-2B cells. The IC 50 of MWCNT was 12 μg/ml, whereas that of asbestos (crocidolite) was 678 μg/ml. Over the course of 5 to 8 h, BEAS-2B cells took up 17-18% of the MWCNT when they were added to the culture medium at a concentration of 10 μg/ml. BEAS-2B cells were exposed to 2, 5, or 10 μg/ml of MWCNT, and total RNA was extracted for cytokine cDNA primer array assays. The culture supernatant was collected for cytokine antibody array assays. Cytokines IL-6 and IL-8 increased in a dose dependent manner at both the mRNA and protein levels. Migration inhibitory factor (MIF) also increased in the culture supernatant in response to MWCNT. A phosphokinase array study using lysates from BEAS-2B cells exposed to MWCNT indicated that phosphorylation of p38, ERK1, and HSP27 increased significantly in response to MWCNT. Results from a reporter gene assays using the NF-κB or AP-1 promoter linked to the luciferase gene in transiently transfected CHO-KI cells revealed that NF-κB was activated following MWCNT exposure, while AP-1 was not changed. Collectively, MWCNT activated NF-κB, enhanced phosphorylation of MAP kinase pathway components, and increased production of proinflammatory cytokines in human bronchial epithelial cells.
Biona-C Cell Culture pH Monitoring System
Friedericks, C.
1999-01-01
Sensors 2000! is developing a system to demonstrate the ability to perform accurate, real-time measurements of pH and CO2 in a cell culture media in Space. The BIONA-C Cell Culture pH Monitoring System consists of S2K! developed ion selective sensors and control electronics integrated with the fluidics of a cell culture system. The integrated system comprises a "rail" in the Cell Culture Module (CCM) of WRAIR (Space Biosciences of Walter Read Army Institute of Research). The CCM is a Space Shuttle mid-deck locker experiment payload. The BIONA-C is displayed along with associated graphics and text explanations. The presentation will stimulate interest in development of sensor technology for real-time cell culture measurements. The transfer of this technology to other applications will also be of interest. Additional information is contained in the original document.
Primary microglia isolation from mixed glial cell cultures of neonatal rat brain tissue.
Tamashiro, Tami T; Dalgard, Clifton Lee; Byrnes, Kimberly R
2012-08-15
by density gradient centrifugation to yield primary microglia. However, the centrifugation is of moderate length (45 min) and may cause cellular damage and activation, as well as, cause enriched microglia and other cellular populations. Another protocol has been utilized to isolate primary microglia in a variety of organisms by prolonged (16 hr) shaking while in culture. After shaking, the media supernatant is centrifuged to isolate microglia. This longer two-step isolation method may also perturb microglial function and activation. We chiefly utilize the following microglia isolation protocol in our laboratory for a number of reasons: (1) primary microglia simulate in vivo biology more faithfully than immortalized rodent microglia cell lines, (2) nominal mechanical disruption minimizes potential cellular dysfunction or activation, and (3) sufficient yield can be obtained without passage of the mixed glial cell cultures. It is important to note that this protocol uses brain tissue from neonatal rat pups to isolate microglia and that using older rats to isolate microglia can significantly impact the yield, activation status, and functional properties of isolated microglia. There is evidence that aging is linked with microglia dysfunction, increased neuroinflammation and neurodegenerative pathologies, so previous studies have used ex vivo adult microglia to better understand the role of microglia in neurodegenerative diseases where aging is important parameter. However, ex vivo microglia cannot be kept in culture for prolonged periods of time. Therefore, while this protocol extends the life of primary microglia in culture, it should be noted that the microglia behave differently from adult microglia and in vitro studies should be carefully considered when translated to an in vivo setting.
Directory of Open Access Journals (Sweden)
Mukae Hiroshi
2005-08-01
Full Text Available Abstract Background Studies from our laboratory have shown that human alveolar macrophages (AM and bronchial epithelial cells (HBEC exposed to ambient particles (PM10 in vitro increase their production of inflammatory mediators and that supernatants from PM10-exposed cells shorten the transit time of monocytes through the bone marrow and promote their release into the circulation. Methods The present study concerns co-culture of AM and HBEC exposed to PM10 (EHC-93 and the production of mediators involved in monocyte kinetics measured at both the mRNA and protein levels. The experiments were also designed to determine the role of the adhesive interaction between these cells via the intercellular adhesion molecule (ICAM-1 in the production of these mediators. Results AM/HBEC co-cultures exposed to 100 μg/ml of PM10 for 2 or 24 h increased their levels of granulocyte-macrophage colony-stimulating factor (GM-CSF, M-CSF, macrophage inflammatory protein (MIP-1β, monocyte chemotactic protein (MCP-1, interleukin (IL-6 and ICAM-1 mRNA, compared to exposed AM or HBEC mono-cultures, or control non-exposed co-cultures. The levels of GM-CSF, M-CSF, MIP-1β and IL-6 increased in co-cultured supernatants collected after 24 h exposure compared to control cells (p 10-induced increase in co-culture mRNA expression. Conclusion We conclude that an ICAM-1 independent interaction between AM and HBEC, lung cells that process inhaled particles, increases the production and release of mediators that enhance bone marrow turnover of monocytes and their recruitment into tissues. We speculate that this interaction amplifies PM10-induced lung inflammation and contributes to both the pulmonary and systemic morbidity associated with exposure to air pollution.
Laundos, Tiago L; Silva, Joana; Assunção, Marisa; Quelhas, Pedro; Monteiro, Cátia; Oliveira, Carla; Oliveira, Maria J; Pêgo, Ana P; Amaral, Isabel F
2017-08-01
Embryonic stem (ES)-derived neural stem/progenitor cells (ES-NSPCs) constitute a promising cell source for application in cell therapies for the treatment of central nervous system disorders. In this study, a rotary orbital hydrodynamic culture system was applied to single-cell suspensions of ES-NSPCs, to obtain homogeneously-sized ES-NSPC cellular aggregates (neurospheres). Hydrodynamic culture allowed the formation of ES-NSPC neurospheres with a narrower size distribution than statically cultured neurospheres, increasing orbital speeds leading to smaller-sized neurospheres and higher neurosphere yield. Neurospheres formed under hydrodynamic conditions (72 h at 55 rpm) showed higher cell compaction and comparable percentages of viable, dead, apoptotic and proliferative cells. Further characterization of cellular aggregates provided new insights into the effect of hydrodynamic shear on ES-NSPC behaviour. Rotary neurospheres exhibited reduced protein levels of N-cadherin and β-catenin, and higher deposition of laminin (without impacting fibronectin deposition), matrix metalloproteinase-2 (MMP-2) activity and percentage of neuronal cells. In line with the increased MMP-2 activity levels found, hydrodynamically-cultured neurospheres showed higher outward migration on laminin. Moreover, when cultured in a 3D fibrin hydrogel, rotary neurospheres generated an increased percentage of neuronal cells. In conclusion, the application of a constant orbital speed to single-cell suspensions of ES-NSPCs, besides allowing the formation of homogeneously-sized neurospheres, promoted ES-NSPC differentiation and outward migration, possibly by influencing the expression of cell-cell adhesion molecules and the secretion of proteases/extracellular matrix proteins. These findings are important when establishing the culture conditions needed to obtain uniformly-sized ES-NSPC aggregates, either for use in regenerative therapies or in in vitro platforms for biomaterial development or
Protein biosynthesis in cultured human hair follicle cells.
Weterings, P J; Vermorken, A J; Bloemendal, H
1980-10-31
A new technique has been used for culturing human keratinocytes. The cells grow on the basement membrane-like capsules of bovine lenses. Lens cells were removed from the capsules by rigid trypsinization. In order to exclude any contamination with remaining living cells the isolated capsules were irradiated with X-rays at a dose of 10,000 rad. In this way human epithelial cells can be brought in culture from individual hair follicles. Since feeder cells are not used in this culture technique, the biosynthesis of keratinocyte proteins can be studied in these cultures. The newly synthesized proteins can be separated into a water-soluble, a urea-soluble, and a urea-insoluble fraction. Product analysis has been performed on the first two fractions revealing protein patterns identical to those of intact hair follicles. Product analysis of the urea-soluble fractions of microdissected hair follicles shows that the protein pattern of the cultured keratinocytes resembles the protein pattern of the hair follicle sheath. Studies on the metabolism of benzo(a)pyrene revealed that the enzyme aryl hydrocarbon hydroxylase (AHH) is present in cultured hair follicle cells. A possible use of our culture system for eventual detection of inherited predisposition for smoking-dependent lung cancer is discussed.
In vitro differentiation of neural cells from human adipose tissue derived stromal cells.
Dave, Shruti D; Patel, Chetan N; Vanikar, Aruna V; Trivedi, Hargovind L
2018-01-01
Stem cells, including neural stem cells (NSCs), are endowed with self-renewal capability and hence hold great opportunity for the institution of replacement/protective therapy. We propose a method for in vitro generation of stromal cells from human adipose tissue and their differentiation into neural cells. Ten grams of donor adipose tissue was surgically resected from the abdominal wall of the human donor after the participants' informed consents. The resected adipose tissue was minced and incubated for 1 hour in the presence of an enzyme (collagenase-type I) at 37 0 C followed by its centrifugation. After centrifugation, the supernatant and pellets were separated and cultured in a medium for proliferation at 37 0 C with 5% CO2 for 9-10 days in separate tissue culture dishes for generation of mesenchymal stromal cells (MSC). At the end of the culture, MSC were harvested and analyzed. The harvested MSC were subjected for further culture for their differentiation into neural cells for 5-7 days using differentiation medium mainly comprising of neurobasal medium. At the end of the procedure, culture cells were isolated and studied for expression of transcriptional factor proteins: orthodenticle homolog-2 (OTX-2), beta-III-tubulin (β3-Tubulin), glial-fibrillary acid protein (GFAP) and synaptophysin-β2. In total, 50 neural cells-lines were generated. In vitro generated MSC differentiated neural cells' mean quantum was 5.4 ± 6.9 ml with the mean cell count being, 5.27 ± 2.65 × 10 3/ μl. All of them showed the presence of OTX-2, β3-Tubulin, GFAP, synaptophysin-β2. Neural cells can be differentiated in vitro from MSC safely and effectively. In vitro generated neural cells represent a potential therapy for recovery from spinal cord injuries and neurodegenerative disease.
Thomas, S; Przesdzing, I; Metzke, D; Schmitz, J; Radbruch, A; Baumgart, D C
2009-01-01
Saccharomyces boulardii (Sb) is a probiotic yeast preparation that has demonstrated efficacy in inflammatory and infectious disorders of the gastrointestinal tract in controlled clinical trials. Although patients clearly benefit from treatment with Sb, little is known on how Sb unfolds its anti-inflammatory properties in humans. Dendritic cells (DC) balance tolerance and immunity and are involved critically in the control of T cell activation. Thus, they are believed to have a pivotal role in the initiation and perpetuation of chronic inflammatory disorders, not only in the gut. We therefore decided to investigate if Sb modulates DC function. Culture of primary (native, non-monocyte-derived) human myeloid CD1c+CD11c+CD123– DC (mDC) in the presence of Sb culture supernatant (active component molecular weight < 3 kDa, as evaluated by membrane partition chromatography) reduced significantly expression of the co-stimulatory molecules CD40 and CD80 (P < 0·01) and the DC mobilization marker CC-chemokine receptor CCR7 (CD197) (P < 0·001) induced by the prototypical microbial antigen lipopolysaccharide (LPS). Moreover, secretion of key proinflammatory cytokines such as tumour necrosis factor-α and interleukin (IL)-6 were notably reduced, while the secretion of anti-inflammatory IL-10 increased. Finally, Sb supernatant inhibited the proliferation of naive T cells in a mixed lymphocyte reaction with mDC. In summary, our data suggest that Sb may exhibit part of its anti-inflammatory potential through modulation of DC phenotype, function and migration by inhibition of their immune response to bacterial microbial surrogate antigens such as LPS. PMID:19161443
21 CFR 864.2280 - Cultured animal and human cells.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cultured animal and human cells. 864.2280 Section... Cultured animal and human cells. (a) Identification. Cultured animal and human cells are in vitro cultivated cell lines from the tissue of humans or other animals which are used in various diagnostic...
Díez, José M; Bauman, Ewa; Gajardo, Rodrigo; Jorquera, Juan I
2015-03-13
Fetal bovine serum (FBS) is an animal product used as a medium supplement. The animal origin of FBS is a concern if cultured stem cells are to be utilized for human cell therapy. Therefore, a substitute for FBS is desirable. In this study, an industrial, xeno-free, pharmaceutical-grade supplement for cell culture (SCC) under development at Grifols was tested for growth of human mesenchymal stem cells (hMSCs), cell characterization, and differentiation capacity. SCC is a freeze-dried product obtained through cold-ethanol fractionation of industrial human plasma pools from healthy donors. Bone marrow-derived hMSC cell lines were obtained from two commercial suppliers. Cell growth was evaluated by culturing hMSCs with commercial media or media supplemented with SCC or FBS. Cell viability and cell yield were assessed with an automated cell counter. Cell surface markers were studied by indirect immunofluorescence assay. Cells were cultured then differentiated into adipocytes, chondrocytes, osteoblasts, and neurons, as assessed by specific staining and microscopy observation. SCC supported the growth of commercial hMSCs. Starting from the same number of seeded cells in two consecutive passages of culture with medium supplemented with SCC, hMSC yield and cell population doubling time were equivalent to the values obtained with the commercial medium and was consistent among lots. The viability of hMSCs was higher than 90%, while maintaining the characteristic phenotype of undifferentiated hMSCs (positive for CD29, CD44, CD90, CD105, CD146, CD166 and Stro-1; negative for CD14 and CD19). Cultured hMSCs maintained the potential for differentiation into adipocytes, chondrocytes, osteoblasts, and neurons. The tested human plasma-derived SCC sustains the adequate growth of hMSCs, while preserving their differentiation capacity. SCC can be a potential candidate for cell culture supplement in advanced cell therapies.
Differential marker expression by cultures rich in mesenchymal stem cells
2013-01-01
Background Mesenchymal stem cells have properties that make them amenable to therapeutic use. However, the acceptance of mesenchymal stem cells in clinical practice requires standardized techniques for their specific isolation. To date, there are no conclusive marker (s) for the exclusive isolation of mesenchymal stem cells. Our aim was to identify markers differentially expressed between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. We compared and contrasted the phenotype of tissue cultures in which mesenchymal stem cells are rich and rare. By initially assessing mesenchymal stem cell differentiation, we established that bone marrow and breast adipose cultures are rich in mesenchymal stem cells while, in our hands, foreskin fibroblast and olfactory tissue cultures contain rare mesenchymal stem cells. In particular, olfactory tissue cells represent non-stem cell mesenchymal cells. Subsequently, the phenotype of the tissue cultures were thoroughly assessed using immuno-fluorescence, flow-cytometry, proteomics, antibody arrays and qPCR. Results Our analysis revealed that all tissue cultures, regardless of differentiation potential, demonstrated remarkably similar phenotypes. Importantly, it was also observed that common mesenchymal stem cell markers, and fibroblast-associated markers, do not discriminate between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. Examination and comparison of the phenotypes of mesenchymal stem cell and non-stem cell mesenchymal cell cultures revealed three differentially expressed markers – CD24, CD108 and CD40. Conclusion We indicate the importance of establishing differential marker expression between mesenchymal stem cells and non-stem cell mesenchymal cells in order to determine stem cell specific markers. PMID:24304471
Energy Technology Data Exchange (ETDEWEB)
Eom, Young Woo [Cell Therapy and Tissue Engineering Center, Wonju College of Medicine, Yonsei Univ., Wonju (Korea, Republic of); Biomedical Research Institute, Lifeliver Co., Ltd., Suwon (Korea, Republic of); Lee, Jong Eun; Yang, Mal Sook; Jang, In Keun; Kim, Hyo Eun; Lee, Doo Hoon; Kim, Young Jin [Biomedical Research Institute, Lifeliver Co., Ltd., Suwon (Korea, Republic of); Park, Won Jin [Dr. Park' s Aesthetic Clinic, Seoul (Korea, Republic of); Kong, Jee Hyun; Shim, Kwang Yong [Department of Hematology-Oncology, Wonju College of Medicine, Yonsei Univ., Wonju (Korea, Republic of); Lee, Jong In, E-mail: oncochem@yonsei.ac.kr [Department of Hematology-Oncology, Wonju College of Medicine, Yonsei Univ., Wonju (Korea, Republic of); Kim, Hyun Soo, E-mail: khsmd@unitel.co.kr [Department of Hematology-Oncology, Wonju College of Medicine, Yonsei Univ., Wonju (Korea, Republic of)
2011-04-29
Highlights: {yields} hASCs were differentiated into skeletal muscle cells by treatment with 5-azacytidine, FGF-2, and the supernatant of cultured hASCs. {yields} Dystrophin and MyHC were expressed in late differentiation step by treatment with the supernatant of cultured hASCs. {yields} hASCs expressing dystrophin and MyHC contributed to myotube formation during co-culture with mouse myoblast C2C12 cells. -- Abstract: Stem cell therapy for muscular dystrophies requires stem cells that are able to participate in the formation of new muscle fibers. However, the differentiation steps that are the most critical for this process are not clear. We investigated the myogenic phases of human adipose tissue-derived stem cells (hASCs) step by step and the capability of myotube formation according to the differentiation phase by cellular fusion with mouse myoblast C2C12 cells. In hASCs treated with 5-azacytidine and fibroblast growth factor-2 (FGF-2) for 1 day, the early differentiation step to express MyoD and myogenin was induced by FGF-2 treatment for 6 days. Dystrophin and myosin heavy chain (MyHC) expression was induced by hASC conditioned medium in the late differentiation step. Myotubes were observed only in hASCs undergoing the late differentiation step by cellular fusion with C2C12 cells. In contrast, hASCs that were normal or in the early stage were not involved in myotube formation. Our results indicate that stem cells expressing dystrophin and MyHC are more suitable for myotube formation by co-culture with myoblasts than normal or early differentiated stem cells expressing MyoD and myogenin.
International Nuclear Information System (INIS)
Eom, Young Woo; Lee, Jong Eun; Yang, Mal Sook; Jang, In Keun; Kim, Hyo Eun; Lee, Doo Hoon; Kim, Young Jin; Park, Won Jin; Kong, Jee Hyun; Shim, Kwang Yong; Lee, Jong In; Kim, Hyun Soo
2011-01-01
Highlights: → hASCs were differentiated into skeletal muscle cells by treatment with 5-azacytidine, FGF-2, and the supernatant of cultured hASCs. → Dystrophin and MyHC were expressed in late differentiation step by treatment with the supernatant of cultured hASCs. → hASCs expressing dystrophin and MyHC contributed to myotube formation during co-culture with mouse myoblast C2C12 cells. -- Abstract: Stem cell therapy for muscular dystrophies requires stem cells that are able to participate in the formation of new muscle fibers. However, the differentiation steps that are the most critical for this process are not clear. We investigated the myogenic phases of human adipose tissue-derived stem cells (hASCs) step by step and the capability of myotube formation according to the differentiation phase by cellular fusion with mouse myoblast C2C12 cells. In hASCs treated with 5-azacytidine and fibroblast growth factor-2 (FGF-2) for 1 day, the early differentiation step to express MyoD and myogenin was induced by FGF-2 treatment for 6 days. Dystrophin and myosin heavy chain (MyHC) expression was induced by hASC conditioned medium in the late differentiation step. Myotubes were observed only in hASCs undergoing the late differentiation step by cellular fusion with C2C12 cells. In contrast, hASCs that were normal or in the early stage were not involved in myotube formation. Our results indicate that stem cells expressing dystrophin and MyHC are more suitable for myotube formation by co-culture with myoblasts than normal or early differentiated stem cells expressing MyoD and myogenin.
Thomay, K; Schienke, A; Vajen, B; Modlich, U; Schambach, A; Hofmann, W; Schlegelberger, B; Göhring, G
2014-01-01
The fate of cultivated primary hematopoietic stem cells (HSCs) with respect to genetic instability and telomere attrition has not yet been described in great detail. Thus, knowledge of the genetic constitution of HSCs is important when interpreting results of HSCs in culture. While establishing a cell culture model for myelodysplastic syndrome with a deletion in 5q by performing RPS14 knockdown, we found surprising data that may be of importance for any CD34+ cell culture experiments. We performed cytogenetic analyses and telomere length measurement on transduced CD34+ cells and untransduced control cells to observe the effects of long-term culturing. Initially, CD34+ cells had a normal median telomere length of about 12 kb and showed no signs of chromosomal instability. During follow-up, the median telomere length seemed to decrease and, simultaneously, increased chromosomal instability could be observed - in modified and control cells. One culture showed a clonal monosomy 7 - independent of prior RPS14 knockdown. During further culturing, it seemed that the telomeres re-elongated, and chromosomes stabilized, while TERT expression was not elevated. In summary, irrespective of our results of RPS14 knockdown in the long-term culture of CD34+ cells, it becomes clear that cell culture artefacts inducing telomere shortening and chromosomal instability have to be taken into account and regular cytogenetic analyses should always be performed. © 2013 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Amauri Braga Simonetti
2007-03-01
Full Text Available The main goal of this study is to alert researchers who work with cell cultures for the risk of contamination by structures called nanobacteria (NB. NB are tiny structures with size varying from 80 to 500 nm, commonly occurring in clusters and producing a biofilm which contains carbonate or hydroxyl apatite. The most likely source of cell culture contamination by such organisms is serum used as supplement in culture media. The presence of NB leads to a progressive culture deterioration with accumulation of granules (probably phagocytized NB in cytoplasmic vacuoles, an increasing number of dead cells in the supernatant and degeneration of cells that remained attached to the bottom of the vessel. NB can also be found in culture supernatants where they are found in clusters with variable size and displaying brownian movement. In this study, 19 cell lineages, 8 batches of sera and 1 batch of growth supplement from different sources were analyzed. Samples from sera were cultured in Eagle's Minimum Essential Medium (E-MEM or incubated directly at 37ºC. Tests carried out to detect the presence of extracellular bacteria, Mycoplasma sp and viruses were all negative. Analysis by scanning electron microscopy (SEM revealed tiny oval structures less than 500 nm in size, isolated or in small groups, in all material analyzed except in one fetal bovine serum batch.O principal objetivo deste estudo é alertar aos pesquisadores que trabalham com cultivos celulares sobre o risco de contaminação por estruturas denominadas nanobactérias (NB. NB são estruturas muito pequenas cujo tamanho varia de 80 a 500 nm e que comumente ocorrem em agrupamentos, produzindo biofilme de carbonato ou hidroxiapatita. A fonte mais provável de contaminação dos cultivos celulares por tais organismos é o soro utilizado como suplemento nos meios de cultura. A presença de NB leva a uma progressiva deterioração do cultivo com acúmulo de grânulos (provavelmente NB fagocitadas em
A single-cell and feeder-free culture system for monkey embryonic stem cells.
Ono, Takashi; Suzuki, Yutaka; Kato, Yosuke; Fujita, Risako; Araki, Toshihiro; Yamashita, Tomoko; Kato, Hidemasa; Torii, Ryuzo; Sato, Naoya
2014-01-01
Primate pluripotent stem cells (PSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), hold great potential for research and application in regenerative medicine and drug discovery. To maximize primate PSC potential, a practical system is required for generating desired functional cells and reproducible differentiation techniques. Much progress regarding their culture systems has been reported to date; however, better methods would still be required for their practical use, particularly in industrial and clinical fields. Here we report a new single-cell and feeder-free culture system for primate PSCs, the key feature of which is an originally formulated serum-free medium containing FGF and activin. In this culture system, cynomolgus monkey ESCs can be passaged many times by single-cell dissociation with traditional trypsin treatment and can be propagated with a high proliferation rate as a monolayer without any feeder cells; further, typical PSC properties and genomic stability can be retained. In addition, it has been demonstrated that monkey ESCs maintained in the culture system can be used for various experiments such as in vitro differentiation and gene manipulation. Thus, compared with the conventional culture system, monkey ESCs grown in the aforementioned culture system can serve as a cell source with the following practical advantages: simple, stable, and easy cell maintenance; gene manipulation; cryopreservation; and desired differentiation. We propose that this culture system can serve as a reliable platform to prepare primate PSCs useful for future research and application.
ArF excimer laser modulation of TNF-alpha and gelatinase B in NIH 3T3 cells
International Nuclear Information System (INIS)
Naudy-Vives, C.; Courant, D.; Perot, J.C.; Garcia, J.; Fretier, P.; Court, L.; Dormont, D.
1995-01-01
The effects on TNF-alpha and gelatinase B activity in mammalian cells induced by 193 nm argon fluoride excimer laser have been investigated. The data show that a secretion of 92 kDa type IV collagenase and TNF-alpha were increased in cell culture supernatants. Moreover, the 193 nm laser radiation produces a decrease of cell proliferation and an increase of cell activation 8 hours after irradiation. The total protein amount increases with the delivered dose. Same, but less effects were obtained after exposure to a conventional UV lamp at 254 nm. (author)
Stimulation of the proliferation of hemopoietic stem cells in irradiated bone marrow cell culture
International Nuclear Information System (INIS)
Mori, K.J.; Izumi, H.; Seto, A.
1981-01-01
Long-term hemopoiesis was established in bone marrow cell culture in vitro. This culture was shown to support the recovery proliferation of hemopoietic stem cells completely in vitro after irradiation. Hemopoietic stem cells were stimulated into proliferation in culture when normal bone marrow cells were overlayed on top of the irradiated adherent cell colonies. These results indicate that proliferation and differentiation of hemopoietic stem cells in vitro are also supported by stromahemopoietic cell interactions
Cell Culture in Microgravity: Opening the Door to Space Cell Biology
Pellis, Neal R.; Dawson, David L. (Technical Monitor)
1999-01-01
Adaptational response of human cell populations to microgravity is investigated using simulation, short-term Shuttle experiments, and long-term microgravity. Simulation consists of a clinostatically-rotated cell culture system. The system is a horizontally-rotated cylinder completely filled with culture medium. Low speed rotation results in continuous-fall of the cells through the fluid medium. In this setting, cells: 1) aggregate, 2) propagate in three dimensions, 3) synthesize matrix, 4) differentiate, and 5) form sinusoids that facilitate mass transfer. Space cell culture is conducted in flight bioreactors and in static incubators. Cells grown in microgravity are: bovine cartilage, promyelocytic leukemia, kidney proximal tubule cells, adrenal medulla, breast and colon cancer, and endothelium. Cells were cultured in space to test specific hypotheses. Cartilage cells were used to determine structural differences in cartilage grown in space compared to ground-based bioreactors. Results from a 130-day experiment on Mir revealed that cartilage grown in space was substantially more compressible due to insufficient glycosaminoglycan in the matrix. Interestingly, earth-grown cartilage conformed better to the dimensions of the scaffolding material, while the Mir specimens were spherical. The other cell populations are currently being analyzed for cell surface properties, gene expression, and differentiation. Results suggest that some cells spontaneously differentiate in microgravity. Additionally, vast changes in gene expression may occur in response to microgravity. In conclusion, the transition to microgravity may constitute a physical perturbation in cells resulting in unique gene expressions, the consequences of which may be useful in tissue engineering, disease modeling, and space cell biology.
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
How do culture media influence in vitro perivascular cell behavior?
Huber, Birgit; Volz, Ann-Cathrin; Kluger, Petra Juliane
2015-12-01
Perivascular cells are multilineage cells located around the vessel wall and important for wall stabilization. In this study, we evaluated a stem cell media and a perivascular cell-specific media for the culture of primary perivascular cells regarding their cell morphology, doubling time, stem cell properties, and expression of cell type-specific markers. When the two cell culture media were compared to each other, perivascular cells cultured in the stem cell medium had a more elongated morphology and a faster doubling rate and cells cultured in the pericyte medium had a more typical morphology, with several filopodia, and a slower doubling rate. To evaluate stem cell properties, perivascular cells, CD146(-) cells, and mesenchymal stem cells (MSCs) were differentiated into the adipogenic, osteogenic, and chondrogenic lineages. It was seen that perivascular cells, as well as CD146(-) cells and MSCs, cultured in stem cell medium showed greater differentiation than cells cultured in pericyte-specific medium. The expression of pericyte-specific markers CD146, neural/glial antigen 2 (NG2), platelet-derived growth factor receptor-β (PDGFR-β), myosin, and α-smooth muscle actin (α-SMA) could be found in both pericyte cultures, as well as to varying amounts in CD146(-) cells, MSCs, and endothelial cells. The here presented work shows that perivascular cells can adapt to their in vitro environment and cell culture conditions influence cell functionality, such as doubling rate or differentiation behavior. Pericyte-specific markers were shown to be expressed also from cells other than perivascular cells. We can further conclude that CD146(+) perivascular cells are inhomogeneous cell population probably containing stem cell subpopulations, which are located perivascular around capillaries. © 2015 International Federation for Cell Biology.
Biogelx: Cell Culture on Self-Assembling Peptide Gels.
Harper, Mhairi M; Connolly, Michael L; Goldie, Laura; Irvine, Eleanore J; Shaw, Joshua E; Jayawarna, Vineetha; Richardson, Stephen M; Dalby, Matthew J; Lightbody, David; Ulijn, Rein V
2018-01-01
Aromatic peptide amphiphiles can form self-supporting nanostructured hydrogels with tunable mechanical properties and chemical compositions. These hydrogels are increasingly applied in two-dimensional (2D) and three-dimensional (3D) cell culture, where there is a rapidly growing need to store, grow, proliferate, and manipulate naturally derived cells within a hydrated, 3D matrix. Biogelx Limited is a biomaterials company, created to commercialize these bio-inspired hydrogels to cell biologists for a range of cell culture applications. This chapter describes methods of various characterization and cell culture techniques specifically optimized for compatibility with Biogelx products.
Zhang, X M; Xu, Q
2001-12-01
Nitric oxide (NO) is known to facilitate tumour metastasis through the promotion of angiogenesis, vascular dilation, platelet aggregation, etc. In the present study we explored its novel role in producing dysfunction of the host immune system in the metastasis of murine metastatic melanoma B16-BL6 cells. A significant reduction in the mixed lymphocyte reaction (MLR) was observed in the spleen cells from B16-BL6-bearing mice, but not in those from mice bearing the parent cell B16. When B16-BL6 cells were added in vitro to the MLR, a significant decrease was also found, even when they were co-cultured with the lymphocytes in two compartments of a Transwell chamber separated by an 8.0 microm filter. The supernatant from cultured B16-BL6 but not B16 cells, which had a greatly increased NO activity, significantly inhibited concanavalin A- and lipopolysaccharide-induced lymphocyte proliferation. A remarkably higher expression of inducible NO synthase (iNOS) was detected in B16-BL6 cells than in B16 cells. Nomega-Nitro-l-arginine (l-NNA), a NO synthase inhibitor and superoxide dismutase, significantly antagonized the above inhibition by B16-BL6 cells, while l-arginine, a NO precursor, and S-nitroso-N-acetyl-d,l-penicillamine, a NO donor, strengthened the inhibition. Furthermore, l-NNA significantly inhibited lung metastasis of B16-BL6 cells, while l-arginine tended to enhance the metastasis. The cytotoxicity of B16-BL6-specific T-cells was significantly decreased by pre-culture with B16-BL6 cells in a Transwell chamber or the culture supernatants of B16-BL6 cells, whereas l-iminoethyl-lysine, a selective inhibitor of iNOS, showed a significant recovery from the disease. These results suggest that NO released by metastatic tumour cells may impair the immune system, which facilitates the escape from immunosurveillance and metastasis of tumour cells.
Li, Y J; Yang, L; Wang, L P; Zhang, Y
2017-06-23
Objective: To investigate the key cytokine which polarizes M2 macrophages and promotes invasion and metastasis in non-small cell lung cancer (NSCLC). Methods: After co-culture with A549 cells in vitro, the proportion of CD14(+) CD163(+) M2 macrophages in monocytes and macrophage colony stimulating factor (M-CSF) levels in culture supernatant were detected by flow cytometry, ELISA assay and real-time qPCR, respectively. The effects of CD14(+) CD163(+) M2 macrophages on invasion of A549 cells and angiogenesis of HUVEC cells were measured by transwell assay and tubule formation assay, respectively. The clinical and prognostic significance of M-CSF expression in NSCLC was further analyzed. Results: The percentage of CD14(+) CD163(+) M2 macrophages in monocytes and the concentration of M-CSF in the supernatant followed by co-culture was (12.03±0.46)% and (299.80±73.76)pg/ml, respectively, which were significantly higher than those in control group [(2.80±1.04)% and (43.07±11.22)pg/ml, respectively, P macrophages in vitro . M2 macrophages enhanced the invasion of A549 cells (66 cells/field vs. 26 cells/field) and the angiogenesis of HUVEC cells (22 tubes/field vs. 8 tubes/field). The mRNA expression of M-CSF in stage Ⅰ-Ⅱ patients (16.23±4.83) was significantly lower than that in stage Ⅲ-Ⅳ (53.84±16.08; P macrophages, which can further promote the metastasis and angiogenesis of NSCLC. M-CSF could be used as a potential therapeutic target of NSCLC.
International Nuclear Information System (INIS)
Lomnitzer, R.; Rabson, A.R.
1979-01-01
The capacity of human mononuclear (MN) cells pretreated with concanavalin A (Con A) to suppress the activity of fresh phytohemagglutinin (PHA)-pulsed mononuclear cells was assessed. Con A-pretreated MN cells suppressed leukocyte inhibitory factor (LIF) activity in supernatants of PHA-pulsed cell cultures and [ 3 H]thymidine incorporation by these cells. Suppression was obtained in both allogeneic and autologous systems with mitomycin-treated, irradiated, or untreated Con A-induced cells. Lymphocytes from two patients that, following treatment with Con A, did not suppress mitogen-induced proliferative response of normal cells also did not suppress LIF production
[Study on detoxication of kansui radix on normal liver cells LO2 after stir-baking with vinegar].
Yan, Xiaojing; Zhang, Li; Li, Lin; Cao, Yudan; Li, Zhengjun; Tang, Yuping; Ding, Anwei
2012-06-01
To compare the toxicity on normal liver cells LO2 before and after Kansui Radix stir-baked with vinegar, and make a preliminary study on the mechanism of detoxication of Kansui Radix stir-baked with vinegar. The MTT method was adopted to detect the cell activity, with normal liver cells LO2 as the study object. The morphology of cells were observed, and the level or content of AST, ALT, LDH, SOD, Na+-K+-ATPase, Ca2+-Mg2+ -ATPase, GSH and MDA were determined in cell culture supernatant and splitting supernatant. Compared with the control group, Kansui can obviously inhibit the cell activity (P baked with vinegar can significantly decrease the cell proliferation inhibition and the trend of morphological variation, and obviously decrease the levels of ALT, AST, and LDH (P baking with rice vinegar can release the hepatotoxicity of Kansui Radix. Its possible mechanism was that Kansui Radix stir-baked with vinegar can decrease the influence of Kansui Radix on the permeability of liver cells LO2 membrane and oxidative damage, in order to provide basis for further exploration of the detoxication mechanism of Kansui Radix stir-baked with vinegar.
Development of a microfluidic perfusion 3D cell culture system
Park, D. H.; Jeon, H. J.; Kim, M. J.; Nguyen, X. D.; Morten, K.; Go, J. S.
2018-04-01
Recently, 3-dimensional in vitro cell cultures have gained much attention in biomedical sciences because of the closer relevance between in vitro cell cultures and in vivo environments. This paper presents a microfluidic perfusion 3D cell culture system with consistent control of long-term culture conditions to mimic an in vivo microenvironment. It consists of two sudden expansion reservoirs to trap incoming air bubbles, gradient generators to provide a linear concentration, and microchannel mixers. Specifically, the air bubbles disturb a flow in the microfluidic channel resulting in the instability of the perfusion cell culture conditions. For long-term stable operation, the sudden expansion reservoir is designed to trap air bubbles by using buoyancy before they enter the culture system. The performance of the developed microfluidic perfusion 3D cell culture system was examined experimentally and compared with analytical results. Finally, it was applied to test the cytotoxicity of cells infected with Ewing’s sarcoma. Cell death was observed for different concentrations of H2O2. For future work, the developed microfluidic perfusion 3D cell culture system can be used to examine the behavior of cells treated with various drugs and concentrations for high-throughput drug screening.
Cardiac Cells Beating in Culture: A Laboratory Exercise
Weaver, Debora
2007-01-01
This article describes how to establish a primary tissue culture, where cells are taken directly from an organ of a living animal. Cardiac cells are taken from chick embryos and transferred to culture dishes. These cells are not transformed and therefore have a limited life span. However, the unique characteristics of cardiac cells are maintained…
Improved endothelial cell seeding with cultured cells and fibronectin-coated grafts
International Nuclear Information System (INIS)
Seeger, J.M.; Klingman, N.
1985-01-01
A possible approach to the low seeding efficiency of endothelial cells into prosthetic grafts is to increase the number of cells to be seeded in cell culture and improve seeding efficiency by graft precoating with fibronectin. The effect of cell culture on cell adhesion is unknown, however, and fibronectin also binds fibrin, which may increase the thrombogenicity of the graft luminal surface. To investigate these questions, freshly harvested canine jugular vein endothelial cells from six animals and similar cells harvested from six primary and eight secondary cell cultures were labeled with 111 Indium and seeded into 5 cm, 4 mm PTFE grafts coated with fibronectin, using similar uncoated PTFE grafts as controls. Platelet accumulation and distribution on six similar coated and uncoated grafts placed in canine carotid, external jugular arterial venous shunts for 2 hr were also determined using autogenous 111 Indium-labeled platelets. Significant differences between group means were determined using the paired Student's t test. Results reveal that seeding efficiency is significantly better in all groups of coated grafts compared to uncoated grafts (P less than 0.01). Cells derived from cell culture also had significantly higher seeding efficiencies than freshly harvested cells when seeded into coated grafts (P less than 0.05) and tended to have higher seeding efficiencies than harvested cells when seeded into uncoated grafts (P = 0.53). Fibronectin coating increased mean platelet accumulation on the entire graft luminal surface, but not to a statistically significant degree (P greater than 0.1). Whether this increased seeding efficiency will improve graft endothelialization remains to be investigated
Dynamic cell culture system: a new cell cultivation instrument for biological experiments in space
Gmunder, F. K.; Nordau, C. G.; Tschopp, A.; Huber, B.; Cogoli, A.
1988-01-01
The prototype of a miniaturized cell cultivation instrument for animal cell culture experiments aboard Spacelab is presented (Dynamic cell culture system: DCCS). The cell chamber is completely filled and has a working volume of 200 microliters. Medium exchange is achieved with a self-powered osmotic pump (flowrate 1 microliter h-1). The reservoir volume of culture medium is 230 microliters. The system is neither mechanically stirred nor equipped with sensors. Hamster kidney (Hak) cells growing on Cytodex 3 microcarriers were used to test the biological performance of the DCCS. Growth characteristics in the DCCS, as judged by maximal cell density, glucose consumption, lactic acid secretion and pH, were similar to those in cell culture tubes.
Complement protein C1q induces maturation of human dendritic cells
DEFF Research Database (Denmark)
Csomor, Eszter; Bajtay, Zsuzsa; Sándor, Noémi
2007-01-01
Maturation of dendritic cells (DCs) is known to be induced by several stimuli, including microbial products, inflammatory cytokines and immobilized IgG, as demonstrated recently. Since immune complexes formed in vivo also contain C1q, moreover apoptotic cells and several pathogens fix C1q...... activity of the cells was assessed by measuring cytokine secretion and their ability to activate allogeneic T lymphocytes. Cytokine production by T cells co-cultured with C1q-matured DCs was also investigated. C1q, but not the structurally related mannose-binding lectin was found to bind to imMDC in a dose......-dependent manner and induced NF-kappaB translocation to the nucleus. Immobilized C1q induced maturation of MDCs and enhanced secretion of IL-12 and TNF-alpha, moreover, elevated their T-cell stimulating capacity. As IFN-gamma levels were increased in supernatants of MDC-T cell co-cultures, our data suggest that C1...
Quantitative volumetric Raman imaging of three dimensional cell cultures
Kallepitis, Charalambos; Bergholt, Mads S.; Mazo, Manuel M.; Leonardo, Vincent; Skaalure, Stacey C.; Maynard, Stephanie A.; Stevens, Molly M.
2017-01-01
in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies
Culture medium for amylase production by toxigenic fungi
Directory of Open Access Journals (Sweden)
Figueira Edson Luiz Zangrando
2000-01-01
Full Text Available Mycelial growth and amylase production by a mycotoxigenic strain of Fusarium moniliforme and Aspergillus flavus were evaluated in a culture medium containing starch, glycerol, wheat bran or corn. With emphasis on corn, different fractions composed by germ, degermed seed, starch, milky stage corn and the respective starch or supernatant fraction were analyzed for F. moniliforme growth . The medium composed of milky stage corn supernatant promoted the best mycelial growth (p<0.05, and it was used to prepare amylase production medium in the next step. The medium composed with 2% ground corn in milky stage corn supernatant (350g of milky stage corn blended with 250mL water and centrifuged promoted the highest amylase production, which was at the 10th day of fermentation, both for F. moniliforme (42.32U/mL and A. flavus (4,745.54U/mL.
System-level modeling and simulation of the cell culture microfluidic biochip ProCell
DEFF Research Database (Denmark)
Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan
2010-01-01
Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory. There are two technologies for the microfluidic biochips: droplet-based and flow-based. In this paper we are interested in flow-based microfluidic biochips, where the liquid flows continuously through pre......-defined micro-channels using valves and pumps. We present an approach to the system-level modeling and simulation of a cell culture microfluidic biochip called ProCell, Programmable Cell Culture Chip. ProCell contains a cell culture chamber, which is envisioned to run 256 simultaneous experiments (viewed...
Mononuclear cell secretome protects from experimental autoimmune myocarditis.
Hoetzenecker, Konrad; Zimmermann, Matthias; Hoetzenecker, Wolfram; Schweiger, Thomas; Kollmann, Dagmar; Mildner, Michael; Hegedus, Balazs; Mitterbauer, Andreas; Hacker, Stefan; Birner, Peter; Gabriel, Christian; Gyöngyösi, Mariann; Blyszczuk, Przemyslaw; Eriksson, Urs; Ankersmit, Hendrik Jan
2015-03-14
Supernatants of serum-free cultured mononuclear cells (MNC) contain a mix of immunomodulating factors (secretome), which have been shown to attenuate detrimental inflammatory responses following myocardial ischaemia. Inflammatory dilated cardiomyopathy (iDCM) is a common cause of heart failure in young patients. Experimental autoimmune myocarditis (EAM) is a CD4+ T cell-dependent model, which mirrors important pathogenic aspects of iDCM. The aim of this study was to determine the influence of MNC secretome on myocardial inflammation in the EAM model. BALB/c mice were immunized twice with an alpha myosin heavy chain peptide together with Complete Freund adjuvant. Supernatants from mouse mononuclear cells were collected, dialysed, and injected i.p. at Day 0, Day 7, or Day 14, respectively. Myocarditis severity, T cell responses, and autoantibody formation were assessed at Day 21. The impact of MNC secretome on CD4+ T cell function and viability was evaluated using in vitro proliferation and cell viability assays. A single high-dose application of MNC secretome, injected at Day 14 after the first immunization, effectively attenuated myocardial inflammation. Mechanistically, MNC secretome induced caspase-8-dependent apoptosis in autoreactive CD4+ T cells. MNC secretome abrogated myocardial inflammation in a CD4+ T cell-dependent animal model of autoimmune myocarditis. This anti-inflammatory effect of MNC secretome suggests a novel and simple potential treatment concept for inflammatory heart diseases. © The Author 2013. Published by Oxford University Press on behalf of the European Society of Cardiology.
DEFF Research Database (Denmark)
Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya; Rømer Sørensen, Ane
The brain is the center of the nervous system, where serious neurodegenerative diseases such as Parkinson’s, Alzheimer’s and Huntington’s are products of functional loss in the neural cells (1). Typical techniques used to investigate these diseases lack precise control of the cellular surroundings......, in addition to isolating the neural tissue from nutrient delivery and to creating unwanted gradients (2). This means that typical techniques used to investigate neurodegenerative diseases cannot mimic in vivo conditions, as closely as desired. We have developed a novel microfluidic system for culturing PC12...... cells, neuronal cells, astrocytes cultures and brain slices. The microfluidic system provides efficient nutrient delivery, waste removal, access to oxygen, fine control over the neurochemical environment and access to modern microscopy. Additionally, the setup consists of an in vitro culturing...
Experimental Clostridium perfringens type D enterotoxemia in goats.
Uzal, F A; Kelly, W R
1998-03-01
The effects of intraduodenal administration of Clostridium perfringens cultures and culture products in goats were evaluated to develop a reliable experimental model of enterotoxemia in this species. Five conventionally reared, 11-16-week-old Angora goat kids were dosed intraduodenally with whole cultures of C. perfringens type D; five similar animals were dosed with C. perfringens type D filtered culture supernatant; and a third group of five kids was dosed with C. perfringens type D washed cells. Two kids were used as controls and received sterile, nontoxic culture medium intraduodenally. All animals received starch solution into the abomasum. All five kids inoculated with whole culture and three of five dosed with culture supernatant and with washed cells developed central nervous system signs. Diarrhea was observed in two of five kids inoculated with whole culture, in all five of those dosed with culture supernatant, and in three of five of those that received washed cells. The most striking postmortem findings consisted of lung edema, necrotizing pseudomembranous colitis, and cerebral vasogenic edema. The protocol thus provided a reasonable model of naturally occurring enterotoxemia in goats, producing a range of clinical signs and postmortem changes similar to those observed in the natural disease.
Directory of Open Access Journals (Sweden)
Costa Nicola
2007-12-01
Full Text Available Abstract Background HIV envelope gp 120 glycoprotein is released during active HIV infection of brain macrophages thereby generating inflammation and oxidative stress which contribute to the development of the AIDS-Dementia Complex (ADC. Gp120 has also been found capable to generate excitotoxic effect on brain tissue via enhancement of glutamatergic neurotransmission, leading to neuronal and astroglial damage, though the mechanism is still to be better understood. Here we investigated on the effect of N-acetylcysteine (NAC, on gp120-induced damage in human cultured astroglial cells and the possible contribution of gp120-related reacting oxygen species (ROS in the imbalanced activity of glutamine synthase (GS, the enzyme that metabolizes glutamate into glutamine within astroglial cells playing a neuroprotective role in brain disorders. Results Incubation of Lipari human cultured astroglial cells with gp 120 (0.1–10 nM produced a significant reduction of astroglial cell viability and apoptosis as evaluated by TUNEL reaction and flow cytometric analysis (FACS. This effect was accompanied by lipid peroxidation as detected by means of malondialdehyde assay (MDA. In addition, gp 120 reduced both glutamine concentration in astroglial cell supernatants and GS expression as detected by immunocytochemistry and western blotting analysis. Pre-treatment of cells with NAC (0.5–5 mM, dose-dependently antagonised astroglial apoptotic cell death induced by gp 120, an effect accompanied by significant attenuation of MDA accumulation. Furthermore, both effects were closely associated with a significant recovery of glutamine levels in cell supernatants and by GS expression, thus suggesting that overproduction of free radicals might contribute in gp 120-related dysfunction of GS in astroglial cells. Conclusion In conclusion, the present experiments demonstrate that gp 120 is toxic to astroglial cells, an effect accompanied by lipid peroxidation and by altered
Maintenance of mesenchymal stem cells culture due to the cells with reduced attachment rate
Directory of Open Access Journals (Sweden)
Shuvalova N. S.
2013-01-01
Full Text Available Aim. The classic detachment techniques lead to changes in cells properties. We offer a simple method of cultivating the population of cells that avoided an influence on the surface structures. Methods. Mesenchymal stem cells (MSC from human umbilical cord matrix were obtained and cultivated in standard conditions. While substituting the culture media by a fresh portion, the conditioned culture medium, where the cells were maintained for three days, was transferred to other culture flacks with addition of serum and growth factors. Results. In the flacks, one day after medium transfer, we observed attached cells with typical MSC morphology. The cultures originated from these cells had the same rate of surface markers expression and clonogenic potential as those replated by standard methods. Conclusions. MSC culture, derived by preserving the cells with reduced attachment ability, actually has the properties of «parent» passage. Using this method with accepted techniques of cells reseeding would allow maintaining the cells that avoided an impact on the cell surface proteins.
Effects of Different Sera Conditions on Olfactory Ensheathing Cells in Vitro
Directory of Open Access Journals (Sweden)
Meng Lu
2014-12-01
Full Text Available Transplantation of olfactory ensheathing cells (OEC is a promising therapy in spinal cord injury (SCI treatment. However, the therapeutic efficacy of this method is unstable due to unknown reasons. Considering the alterations in the culture environment that occur during OEC preparation for transplantation, we hypothesize that these changes may cause variations in the curative effects of this method. In this study, we compared OEC cultured in medium containing different types and concentrations of serum. After purification and passage, the OEC were cultured for 7 days in different media containing 5%, 10%, 15% or 20% fetal bovine serum (FBS or rat serum (RS, or the cells were cultured in FBS-containing medium first, followed by medium containing RS. In another group, the OEC were first cultured in 10% FBS for 3 days and then cultured with rat spinal cord explants with 10% RS for another 4 days. An MTT assay and P75 neurotrophin receptor immunofluorescence staining were used to examine cell viability and OEC numbers, respectively. The concentration of neurotrophin-3 (NT-3, which is secreted by OEC into the culture supernatant, was detected using the enzyme-linked immunosorbent assay (ELISA. RT-PCR was applied to investigate the NT-3 gene expression in OEC according to different groups. Compared with FBS, RS reduced OEC proliferation in relation to OEC counts (χ2 = 166.279, df = 1, p < 0.01, the optical density (OD value in the MTT assay (χ2 = 34.730, df = 1, p < 0.01, and NT-3 concentration in the supernatant (χ2 = 242.997, df = 1, p < 0.01. OEC cultured with spinal cord explants secreted less NT-3 than OEC cultured alone (F = 9.611, df = 5.139, p < 0.01. Meanwhile, the order of application of different sera was not influential. There was statistically significant difference in NT-3 gene expression among different groups when the serum concentration was 15% (χ2 = 64.347, df = 1, p < 0.01. In conclusion, different serum conditions may be
Lee, Sung-Il; Ko, Youngkyung; Park, Jun-Beom
2017-09-01
Three-dimensional cell culture systems provide a convenient in vitro model for the study of complex cell-cell and cell-matrix interactions in the absence of exogenous substrates. The current study aimed to evaluate the osteogenic differentiation potential of gingiva-derived stem cells cultured in two-dimensional or three-dimensional systems. To the best of our knowledge, the present study is the first to compare the growth of gingiva-derived stem cells in monolayer culture to a three-dimensional culture system with microwells. For three-dimensional culture, gingiva-derived stem cells were isolated and seeded into polydimethylsiloxane-based concave micromolds. Alkaline phosphatase activity and alizarin red S staining assays were then performed to evaluate osteogenesis and the degree of mineralization, respectively. Stem cell spheroids had a significantly increased level of alkaline phosphatase activity and mineralization compared with cells from the two-dimensional culture. In addition, an increase in mineralized deposits was observed with an increase in the loading cell number. The results of present study indicate that gingiva-derived stem cell spheroids exhibit an increased osteogenic potential compared with stem cells from two-dimensional culture. This highlights the potential of three-dimensional culture systems using gingiva-derived stem cells for regenerative medicine applications requiring stem cells with osteogenic potential.
Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz
2018-02-01
Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.
Mesenchymal stem cells enhance the metastasis of 3D-cultured hepatocellular carcinoma cells
International Nuclear Information System (INIS)
Liu, Chang; Liu, Yang; Xu, Xiao-xi; Guo, Xin; Sun, Guang-wei; Ma, Xiao-jun
2016-01-01
Accumulating evidences have demonstrated that mesenchymal stem cells (MSC) could be recruited to the tumor microenvironment. Umbilical cord mesenchymal stem cells (UCMSC) were attractive vehicles for delivering therapeutic agents against cancer. Nevertheless, the safety of UCMSC in the treatment of tumors including hepatocellular carcinoma (HCC) was still undetermined. In this study, an in vitro co-culture system was established to evaluate the effect of UCMSC on the cell growth, cancer stem cell (CSC) characteristics, drug resistance, metastasis of 3D-cultured HCC cells, and the underlying mechanism was also investigated. It was found that after co-cultured with UCMSC, the metastatic ability of 3D-cultured HCC cells was significantly enhanced as indicated by up-regulation of matrix metalloproteinase (MMP), epithelial-mesenchymal transition (EMT)-related genes, and migration ability. However, cell growth, drug resistance and CSC-related gene expression of HCC cells were not affected by UCMSC. Moreover, EMT was reversed, MMP-2 expression was down-regulated, and migration ability of HCC cell was significantly inhibited when TGF-β receptor inhibitor SB431542 was added into the co-culture system. Therefore, these data indicated that UCMSC could significantly enhance the tumor cell metastasis, which was due to the EMT of HCC cells induced by TGF-β. The online version of this article (doi:10.1186/s12885-016-2595-4) contains supplementary material, which is available to authorized users
Hatanaka, Miho; Higashi, Yuko; Fukushige, Tomoko; Baba, Naoko; Kawai, Kazuhiro; Hashiguchi, Teruto; Su, Juan; Zeng, Weiqi; Chen, Xiang; Kanekura, Takuro
2014-12-01
Cluster of differentiation 147 (CD147)/basigin on the malignant tumor cell surface is critical for tumor proliferation, invasiveness, metastasis, and angiogenesis. CD147 expressed on malignant melanoma cells can induce tumor cell invasion by stimulating the production of matrix metalloproteinases (MMPs) by surrounding fibroblasts. Membrane vesicles, microvesicles and exosomes have attracted attention, as vehicles of functional molecules and their association with CD147 has been reported. Cleaved CD147 fragments released from tumor cells were reported to interact with fibroblasts. We investigated the intercellular mechanisms by which CD147 stimulates fibroblasts to induce MMP2 activity. CD147 was knocked-down using short hairpin RNA (shRNA). The stimulatory effect of CD147 in cell culture supernatants, microvesicles, and exosomes on the enzymatic activity of MMP2 was examined by gelatin zymography. Supernatants from A375 control cells induced increased enzymatic activity of fibroblasts; such activity was significantly lower in CD147 knock-down cells. Cleaved CD147 plays a pivotal role in stimulating fibroblasts to induce MMP2 activity. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Bonazza, Camila; Andrade, Sheila Siqueira; Sumikawa, Joana Tomomi; Batista, Fabrício Pereira; Paredes-Gamero, Edgar J; Girão, Manoel J B C; Oliva, Maria Luiza V; Castro, Rodrigo Aquino
2016-01-01
Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2) and progesterone (P4) effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation). These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.
Radiosensitivity of normal human epidermal cells in culture
International Nuclear Information System (INIS)
Dover, R.; Potten, C.S.
1983-01-01
Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)
Yamashita, Tomoko; Miyamoto, Yuki; Bando, Yoshio; Ono, Takashi; Kobayashi, Sakurako; Doi, Ayano; Araki, Toshihiro; Kato, Yosuke; Shirakawa, Takayuki; Suzuki, Yutaka; Yamauchi, Junji; Yoshida, Shigetaka; Sato, Naoya
2017-01-01
Oligodendrocytes myelinate axons and form myelin sheaths in the central nervous system. The development of therapies for demyelinating diseases, including multiple sclerosis and leukodystrophies, is a challenge because the pathogenic mechanisms of disease remain poorly understood. Primate pluripotent stem cell-derived oligodendrocytes are expected to help elucidate the molecular pathogenesis of these diseases. Oligodendrocytes have been successfully differentiated from human pluripotent stem cells. However, it is challenging to prepare large amounts of oligodendrocytes over a short amount of time because of manipulation difficulties under conventional primate pluripotent stem cell culture methods. We developed a proprietary dissociated monolayer and feeder-free culture system to handle pluripotent stem cell cultures. Because the dissociated monolayer and feeder-free culture system improves the quality and growth of primate pluripotent stem cells, these cells could potentially be differentiated into any desired functional cells and consistently cultured in large-scale conditions. In the current study, oligodendrocyte progenitor cells and mature oligodendrocytes were generated within three months from monkey embryonic stem cells. The embryonic stem cell-derived oligodendrocytes exhibited in vitro myelinogenic potency with rat dorsal root ganglion neurons. Additionally, the transplanted oligodendrocyte progenitor cells differentiated into myelin basic protein-positive mature oligodendrocytes in the mouse corpus callosum. This preparative method was used for human induced pluripotent stem cells, which were also successfully differentiated into oligodendrocyte progenitor cells and mature oligodendrocytes that were capable of myelinating rat dorsal root ganglion neurons. Moreover, it was possible to freeze, thaw, and successfully re-culture the differentiating cells. These results showed that embryonic stem cells and human induced pluripotent stem cells maintained in a
Gu, Wenyu; Sun, Wei; Guo, Changcheng; Yan, Yang; Liu, Min; Yao, Xudong; Yang, Bin; Zheng, Junhua
2015-07-01
Although emerging evidence demonstrates increased circulating endothelial progenitor cells in patients with solid tumors, to our knowledge it is still unknown whether such cells can be cultured from patients with highly angiogenic renal cell carcinoma. We cultured and characterized circulating endothelial progenitor cells from patients with renal cell carcinoma. The circulating endothelial progenitor cell level (percent of CD45(-)CD34(+) VEGF-R2(+) cells in total peripheral blood mononuclear cells) was quantified in 47 patients with renal cell carcinoma and 40 healthy controls. Peripheral blood mononuclear cells were then isolated from 33 patients with renal cell carcinoma and 30 healthy controls to culture and characterize circulating endothelial progenitor cells. The circulating endothelial progenitor cell level was significantly higher in patients with renal cell carcinoma than in healthy controls (0.276% vs 0.086%, p cells first emerged significantly earlier in patient than in control preparations (6.72 vs 14.67 days, p culture success rate (87.8% vs 40.0% of participants) and the number of colonies (10.06 vs 1.83) were significantly greater for patients than for controls (each p cell level correlated positively with the number of patient colonies (r = 0.762, p Cells cultured from patients and controls showed a similar growth pattern, immunophenotype, ability to uptake Ac-LDL and bind lectin, and form capillary tubes in vitro. However, significantly more VEGF-R2(+) circulating endothelial progenitor cells were found in preparations from patients with renal cell carcinoma than from healthy controls (21.1% vs 13.4%, p cell colonies, a higher cell culture success rate and more colonies were found for patients with renal cell carcinoma than for healthy controls. Results indicate the important significance of VEGF-R2(+) circulating endothelial progenitors in patients with renal cell carcinoma. Copyright © 2015 American Urological Association Education and Research
The impact of cell culture equipment on energy loss.
Davies, Lleucu B; Kiernan, Michael N; Bishop, Joanna C; Thornton, Catherine A; Morgan, Gareth
2014-01-01
Light energy of discrete wavelengths supplied via lasers and broadband intense pulsed light have been used therapeutically for many years. In vitro models complement clinical studies, especially for the elucidation of underlying mechanisms of action. Clarification that light energy reaches the cells is necessary when developing protocols for the treatment of cells using in vitro models. Few studies report on energy loss in cell culture equipment. The ability of energy from light with therapeutic potential to reach cells in culture needs to be determined; this includes determining the proportion of light energy lost within standard cell culture media and cell culture vessels. The energy absorption of cell culture media, with/without the pH indicator dye phenol red, and the loss of energy within different plastics and glassware used typically for in vitro cell culture were investigated using intense pulsed light and a yellow pulsed dye laser. Media containing phenol red have a distinctive absorption peak (560 nm) absent in phenol red-free media and restored by the addition of phenol red. For both light sources, energy loss was lowest in standard polystyrene tissue culture flasks or multi-well plates and highest in polypropylene vessels or glass tubes. The effects of phenol red-free media on the absorption of energy varied with the light source used. Phenol red-free media are the media of choice; polystyrene vessels with flat surfaces such as culture flasks or multi-well plates should be used in preference to polypropylene or glass vessels.
Surface modified alginate microcapsules for 3D cell culture
Chen, Yi-Wen; Kuo, Chiung Wen; Chueh, Di-Yen; Chen, Peilin
2016-06-01
Culture as three dimensional cell aggregates or spheroids can offer an ideal platform for tissue engineering applications and for pharmaceutical screening. Such 3D culture models, however, may suffer from the problems such as immune response and ineffective and cumbersome culture. This paper describes a simple method for producing microcapsules with alginate cores and a thin shell of poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG) to encapsulate mouse induced pluripotent stem (miPS) cells, generating a non-fouling surface as an effective immunoisolation barrier. We demonstrated the trapping of the alginate microcapsules in a microwell array for the continuous observation and culture of a large number of encapsulated miPS cells in parallel. miPS cells cultured in the microcapsules survived well and proliferated to form a single cell aggregate. Droplet formation of monodisperse microcapsules with controlled size combined with flow cytometry provided an efficient way to quantitatively analyze the growth of encapsulated cells in a high-throughput manner. The simple and cost-effective coating technique employed to produce the core-shell microcapsules could be used in the emerging field of cell therapy. The microwell array would provide a convenient, user friendly and high-throughput platform for long-term cell culture and monitoring.
A Simple Hydrophilic Treatment of SU-8 Surfaces for Cell Culturing and Cell Patterning
DEFF Research Database (Denmark)
Wang, Zhenyu; Stangegaard, Michael; Dufva, Hans Martin
2005-01-01
SU-8, an epoxy-based photoresist, widely used in constitution different mTAS systems, is incompatible with mammalian cell adhesion and culture in its native form. Here, we demonstrate a simple, cheap and robust two-step method to render a SU-8 surface hydrophilic and compatible with cell culture........ The contact angle of SU-8 surface was significantly reduced from 90° to 25° after the surface modification. The treated SU-8 surfaces provided a cell culture environment that was comparable with cell culture flask surface in terms of generation time and morphology....
DEFF Research Database (Denmark)
Kaestel, Charlotte G; Lovato, Paola; Ødum, Niels
2005-01-01
PURPOSE: To examine the effect of human retinal pigment epithelial (RPE) cells on phytohemagglutinin (PHA) activation of T cells. METHODS: Resting peripheral blood lymphocytes (PBLs) were stimulated with PHA with or without the presence of gamma-irradiated RPE cells. Proliferation and the cell...... in cell culture supernatant was measured by ELISA. RESULTS: Human RPE cells were found to suppress PHA-induced proliferation, cyclin A, IL-2R-alpha and -gamma, and CD71 expression and decrease the production of IL-2; but RPE cells do not inhibit the PHA-induced expression of early activation markers CD69......, MHC class I and II, and of cyclin D of the PBLs. CONCLUSIONS: These results are the first to indicate that RPE cells impede generation of activated T cells by interfering with the induction of high-affinity IL-2R-alphabetagamma, IL-2 production, and the expression of CD71 and cyclin A....
DEFF Research Database (Denmark)
Høgh, Mette; Islin, Henrik; Møller, Charlotte
2006-01-01
The interaction between the cell types was simulated in vitro by growing primary cell cultures of human endometrial epithelial cells and trophoblast cells together (co-culture) and separately (control cultures). Gene expression in the cell cultures was compared using the Differential Display method and confirmed...
Establishment of automated culture system for murine induced pluripotent stem cells
Directory of Open Access Journals (Sweden)
Koike Hiroyuki
2012-11-01
Full Text Available Abstract Background Induced pluripotent stem (iPS cells can differentiate into any cell type, which makes them an attractive resource in fields such as regenerative medicine, drug screening, or in vitro toxicology. The most important prerequisite for these industrial applications is stable supply and uniform quality of iPS cells. Variation in quality largely results from differences in handling skills between operators in laboratories. To minimize these differences, establishment of an automated iPS cell culture system is necessary. Results We developed a standardized mouse iPS cell maintenance culture, using an automated cell culture system housed in a CO2 incubator commonly used in many laboratories. The iPS cells propagated in a chamber uniquely designed for automated culture and showed specific colony morphology, as for manual culture. A cell detachment device in the system passaged iPS cells automatically by dispersing colonies to single cells. In addition, iPS cells were passaged without any change in colony morphology or expression of undifferentiated stem cell markers during the 4 weeks of automated culture. Conclusions Our results show that use of this compact, automated cell culture system facilitates stable iPS cell culture without obvious effects on iPS cell pluripotency or colony-forming ability. The feasibility of iPS cell culture automation may greatly facilitate the use of this versatile cell source for a variety of biomedical applications.
Directory of Open Access Journals (Sweden)
mohammad saeed zokaei
2009-11-01
Full Text Available Iranian youth’s leisure culture has been immediately affected by the digital media culture. As a communicative media, cell phone has crossed borders of youth norms and identity; and in addition to facilitating their communication, has changed its patterns. Applying Bourdieu’s concepts of habitus and field, and relied on the qualitative and quantitative data gathered from the mobile youth users, the present study argues that mobile has produced a new field in which youth’s opportunities for leisure, entertainment, communication, and independence have extended. In addition, cell phone has facilitated and compensated for some defects in public sphere, and therefore empowered youth agency, individuality, and power. Despite this strengthening, cell phone does not cross borders of gender and class differences, or the levels of social capital.
Directory of Open Access Journals (Sweden)
Camila Bonazza
Full Text Available Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2 and progesterone (P4 effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation. These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.
Energy Technology Data Exchange (ETDEWEB)
Hareyama, M.; Imai, K.; Kubo, K.; Takahashi, H.; Koshiba, H.; Hinoda, Y.; Shidou, M.; Oouchi, A.; Yachi, A.; Morita, K. (Sapporo Medical College (Japan))
1991-05-01
The changes of antigenic expression of cultured human gastric adenocarcinoma MKN45 cells caused by irradiation were investigated to elucidate the immune responses to localized irradiation. The expression of carcinoembryonic antigen (CEA) showed remarkable increases in the culture supernatant and on the surface of the membrane of irradiated cells. The expression of major histocompatibility complex Class I antigen on the membrane also was enhanced by irradiation. In addition, the irradiated cell groups, when analyzed using a CEA-specific probe, showed remarkable increases in the CEA mRNA. These enhancements increased in the 10-Gy and 15-Gy irradiated populations compared with the 5-Gy irradiated population. These results suggest that the enhancement of expression of CEA by radiation takes place at the CEA gene expression (mRNA) level but not at the protein level.
Cell culture density affects the proliferation activity of human adipose tissue stem cells.
Kim, Dae Seong; Lee, Myoung Woo; Ko, Young Jong; Chun, Yong Hoon; Kim, Hyung Joon; Sung, Ki Woong; Koo, Hong Hoe; Yoo, Keon Hee
2016-01-01
In this study, we investigated the effect of cell density on the proliferation activity of human mesenchymal stem cells (MSCs) derived from adipose tissue (AT-MSCs) over time in culture. Passage #4 (P4) and #12 (P12) AT-MSCs from two donors were plated at a density of 200 (culture condition 1, CC1) or 5000 (culture condition 2, CC2) cells cm(-2) . After 7 days of incubation, P4 and P12 AT-MSCs cultured in CC1 were thin and spindle-shaped, whereas those cultured in CC2 had extensive cell-to-cell contacts and an expanded cell volume. In addition, P4 and P12 AT-MSCs in CC1 divided more than three times, while those in CC2 divided less than once on average. Flow cytometric analysis using 5(6)-carboxyfluorescein diacetate N-succinimidyl ester dye showed that the fluorescence intensity of AT-MSCs was lower in CC1 than in CC2. Furthermore, expression of proliferation-associated genes, such as CDC45L, CDC20A and KIF20A, in P4 AT-MSCs was higher in CC1 than in CC2, and this difference was also observed in P12 AT-MSCs. These data demonstrated that cell culture density affects the proliferation activity of MSCs, suggesting that it is feasible to design a strategy to prepare suitable MSCs using specific culture conditions. Copyright © 2016 John Wiley & Sons, Ltd.
Nanotechnology, Cell Culture and Tissue Engineering
Directory of Open Access Journals (Sweden)
Kazutoshi Haraguchi
2011-01-01
Full Text Available We have fabricated new types of polymer hydrogels and polymer nanocomposites, i.e., nanocomposite gels (NC gels and soft, polymer nanocomposites (M-NCs: solid, with novel organic/inorganic network structures. Both NC gels and M-NCs were synthesized by in-situ free-radical polymerization in the presence of exfoliated clay platelets in aqueous systems and were obtained in various forms such as film, sheet, tube, coating, etc. and sizes with a wide range of clay contents. Here, disk-like inorganic clay nanoparticles act as multi-functional crosslinkers to form new types of network systems. Both NC gels and M-NCs have extraordinary optical and mechanical properties including ultra-high reversible extensibility, as well as a number of new characteristics relating to optical anisotropy, polymer/clay morphology, biocompatibility, stimuli-sensitive surfaces, micro-patterning, etc. For examples, the biological testing of medical devices, comprised of a sensitization test, an irritation test, an intracutaneous test and an in vitro cytotoxicity test,was carried out for NC gels and M-NCs. The safety of NC gels and M-NCs was confirmed in all tests. Also, the interaction of living tissue with NC gel was investigated in vivo by implantation in live goats; neither inflammation nor concrescence occurred around the NC gels. Furthermore, it was found that both N-NC gels consisting of poly(N-isopropylacrylamide(PNIPA/clay network and M-NCs consisting of poly(2-methoxyethyacrylate(PMEA/clay network show characteristic cell culture and subsequent cell detachment on their surfaces, although it was almost impossible to culture cells on conventional, chemically-crosslinked PNIPA hydrogels and chemically crossslinked PMEA, regardless of their crosslinker concentration. Various kinds of cells, such ashumanhepatoma cells (HepG2, normal human dermal fibroblast (NHDF, and human umbilical vein endothelial cells (HUVEC, could be cultured to be confluent on the surfaces of N
Directory of Open Access Journals (Sweden)
Jorge E Vidal
2009-02-01
Full Text Available OBJECTIVE: To investigate whether the HlyA-induced vacuolating effect is produced by V. cholerae O1 ElTor strains isolated from different geographic origins, including Mexico. MATERIAL AND METHODS: Supernatant-induced haemolysis, vacuolating activity and cytotoxicity in Vero cells were recorded. PCR, RFLP analysis and molecular cloning were performed. RESULTS: All ElTor strains analyzed induced cellular vacuolation. Ribotype 2 strains isolates from the U.S. gulf coast yielded the highest titer of vacuolating activity. Eight of nine strains were haemolytic, while all strains were PCR positive for the hlyA gene. We cloned the hlyA gene from two ElTor strains, a toxigenic (2514-88, ctxAB+ and a non-toxigenic Mexican strain (CM 91-3, ctxAB-. Supernatant from those recombinant E. coli strains induced haemolysis, cell vacuolation and cytotoxicity. RFLP-PCR analysis revealed similarities in the hlyA gene from all strains tested. CONCLUSION: The HlyA-induced vacuolating effect is a widespread phenotype of epidemic V. cholerae O1 ElTor strains.OBJETIVO: Analizar el efecto vacuolizante de cepas de V. cholerae O1 ElTor aisladas de diferente origen geográfico, incluyendo México. MATERIAL Y MÉTODOS: Se realizaron pruebas de hemolisis, vacuolización y citotoxicidad en células Vero, así como PCR, análisis por RFLP y clonación molecular. RESULTADOS: Todas las cepas indujeron el efecto vacuolizante. Las cepas del ribotipo 2, aisladas de las costas del Golfo en Estados Unidos, presentaron títulos altos de vacuolización. El gen hlyA fue amplificado en las nueve cepas mediante PCR, aunque sólo ocho fueron hemolíticas. Se clonó el gen hlyA de una cepa toxigénica (2514-88, ctxAB+ y de una cepa no toxigénica aislada en México (CM 91-3, ctxAB-. El sobrenadante de las clonas recombinantes indujo hemólisis, efecto vacuolizante y citotoxicidad. El RFLP mostró alta similitud del gen hlyA de las cepas estudiadas. CONCLUSIÓN: El efecto vacuolizante es un
Effects of Human Umbilical Cord Mesenchymal Stem Cells on Human Trophoblast Cell Functions In Vitro
Directory of Open Access Journals (Sweden)
Yajing Huang
2016-01-01
Full Text Available Trophoblast cell dysfunction is involved in many disorders during pregnancy such as preeclampsia and intrauterine growth restriction. Few treatments exist, however, that target improving trophoblast cell function. Human umbilical cord mesenchymal stem cells (hUCMSCs are capable of self-renewing, can undergo multilineage differentiation, and have homing abilities; in addition, they have immunomodulatory effects and paracrine properties and thus are a prospective source for cell therapy. To identify whether hUCMSCs can regulate trophoblast cell functions, we treated trophoblast cells with hUCMSC supernatant or cocultured them with hUCMSCs. Both treatments remarkably enhanced the migration and invasion abilities of trophoblast cells and upregulated their proliferation ability. At a certain concentration, hUCMSCs also modulated hCG, PIGF, and sEndoglin levels in the trophoblast culture medium. Thus, hUCMSCs have a positive effect on trophoblast cellular functions, which may provide a new avenue for treatment of placenta-related diseases during pregnancy.
Recombinant Protein Production and Insect Cell Culture and Process
Spaulding, Glenn F. (Inventor); Goodwin, Thomas J. (Inventor); OConnor, Kim C. (Inventor); Francis, Karen M. (Inventor); Andrews, Angela D. (Inventor); Prewett, Tracey L. (Inventor)
1997-01-01
A process has been developed for recombinant production of selected polypeptides using transformed insect cells cultured in a horizontally rotating culture vessel modulated to create low shear conditions. A metabolically transformed insect cell line is produced using the culture procedure regardless of genetic transformation. The recombinant polypeptide can be produced by an alternative process using virtually infected or stably transformed insect cells containing a gene encoding the described polypeptide. The insect cells can also be a host for viral production.
Metabolite profiling of microfluidic cell culture conditions for droplet based screening
DEFF Research Database (Denmark)
Björk, Sara M.; Sjoström, Staffan L.; Svahn, Helene Andersson
2015-01-01
We investigate the impact of droplet culture conditions on cell metabolic state by determining key metabolite concentrations in S. cerevisiae cultures in different microfluidic droplet culture formats. Control of culture conditions is critical for single cell/clone screening in droplets......, such as directed evolution of yeast, as cell metabolic state directly affects production yields from cell factories. Here, we analyze glucose, pyruvate, ethanol, and glycerol, central metabolites in yeast glucose dissimilation to establish culture formats for screening of respiring as well as fermenting yeast...... limited cultures, whereas the metabolite profiles of cells cultured in the alternative wide tube droplet incubation format resemble those from aerobic culture. Furthermore, we demonstrate retained droplet stability and size in the new better oxygenated droplet incubation format....
A Cell Culture Approach to Optimized Human Corneal Endothelial Cell Function
Bartakova, Alena; Kuzmenko, Olga; Alvarez-Delfin, Karen; Kunzevitzky, Noelia J.; Goldberg, Jeffrey L.
2018-01-01
Purpose Cell-based therapies to replace corneal endothelium depend on culture methods to optimize human corneal endothelial cell (HCEC) function and minimize endothelial-mesenchymal transition (EnMT). Here we explore contribution of low-mitogenic media on stabilization of phenotypes in vitro that mimic those of HCECs in vivo. Methods HCECs were isolated from cadaveric donor corneas and expanded in vitro, comparing continuous presence of exogenous growth factors (“proliferative media”) to media without those factors (“stabilizing media”). Identity based on canonical morphology and expression of surface marker CD56, and function based on formation of tight junction barriers measured by trans-endothelial electrical resistance assays (TEER) were assessed. Results Primary HCECs cultured in proliferative media underwent EnMT after three to four passages, becoming increasingly fibroblastic. Stabilizing the cells before each passage by switching them to a media low in mitogenic growth factors and serum preserved canonical morphology and yielded a higher number of cells. HCECs cultured in stabilizing media increased both expression of the identity marker CD56 and also tight junction monolayer integrity compared to cells cultured without stabilization. Conclusions HCECs isolated from donor corneas and expanded in vitro with a low-mitogenic media stabilizing step before each passage demonstrate more canonical structural and functional features and defer EnMT, increasing the number of passages and total canonical cell yield. This approach may facilitate development of HCEC-based cell therapies. PMID:29625488
Sponge cell culture? A molecular identification method for sponge cells
Sipkema, D.; Heilig, G.H.J.; Akkermans, A.D.L.; Osinga, R.; Tramper, J.; Wijffels, R.H.
2003-01-01
Dissociated sponge cells are easily confused with unicellular organisms. This has been an obstacle in the development of sponge-cell lines. We developed a molecular detection method to identify cells of the sponge Dysidea avara in dissociated cell cultures. The 18S ribosomal RNA gene from a Dysidea
Akahane, M; Shimizu, T; Kira, T; Onishi, T; Uchihara, Y; Imamura, T; Tanaka, Y
2016-11-01
To assess the structure and extracellular matrix molecule expression of osteogenic cell sheets created via culture in medium with both dexamethasone (Dex) and ascorbic acid phosphate (AscP) compared either Dex or AscP alone. Osteogenic cell sheets were prepared by culturing rat bone marrow stromal cells in a minimal essential medium (MEM), MEM with AscP, MEM with Dex, and MEM with Dex and AscP (Dex/AscP). The cell number and messenger (m)RNA expression were assessed in vitro, and the appearance of the cell sheets was observed after mechanical retrieval using a scraper. β-tricalcium phosphate (β-TCP) was then wrapped with the cell sheets from the four different groups and subcutaneously implanted into rats. After mechanical retrieval, the osteogenic cell sheets from the MEM, MEM with AscP, and MEM with Dex groups appeared to be fragmented or incomplete structures. The cell sheets cultured with Dex/AscP remained intact after mechanical retrieval, without any identifiable tears. Culture with Dex/AscP increased the mRNA and protein expression of extracellular matrix proteins and cell number compared with those of the other three groups. More bridging bone formation was observed after transplantation of the β-TCP scaffold wrapped with cell sheets cultured with Dex/AscP, than in the other groups. These results suggest that culture with Dex/AscP improves the mechanical integrity of the osteogenic cell sheets, allowing retrieval of the confluent cells in a single cell sheet structure. This method may be beneficial when applied in cases of difficult tissue reconstruction, such as nonunion, bone defects, and osteonecrosis.Cite this article: M. Akahane, T. Shimizu, T. Kira, T. Onishi, Y. Uchihara, T. Imamura, Y. Tanaka. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure. Bone Joint Res 2016;5:569-576. DOI: 10.1302/2046-3758.511.BJR-2016-0013.R1. © 2016 Akahane et al.
21st Century Cell Culture for 21st Century Toxicology.
Pamies, David; Hartung, Thomas
2017-01-17
There is no good science in bad models. Cell culture is especially prone to artifacts. A number of novel cell culture technologies have become more broadly available in the 21st century, which allow overcoming limitations of traditional culture and are more physiologically relevant. These include the use of stem-cell derived human cells, cocultures of different cell types, scaffolds and extracellular matrices, perfusion platforms (such as microfluidics), 3D culture, organ-on-chip technologies, tissue architecture, and organ functionality. The physiological relevance of such models is further enhanced by the measurement of biomarkers (e.g., key events of pathways), organ specific functionality, and more comprehensive assessment cell responses by high-content methods. These approaches are still rarely combined to create microphysiological systems. The complexity of the combination of these technologies can generate results closer to the in vivo situation but increases the number of parameters to control, bringing some new challenges. In fact, we do not argue that all cell culture needs to be that sophisticated. The efforts taken are determined by the purpose of our experiments and tests. If only a very specific molecular target to cell response is of interest, a very simple model, which reflects this, might be much more suited to allow standardization and high-throughput. However, the less defined the end point of interest and cellular response are, the better we should approximate organ- or tissue-like culture conditions to make physiological responses more probable. Besides these technologic advances, important progress in the quality assurance and reporting on cell cultures as well as the validation of cellular test systems brings the utility of cell cultures to a new level. The advancement and broader implementation of Good Cell Culture Practice (GCCP) is key here. In toxicology, this is a major prerequisite for meaningful and reliable results, ultimately
Yoshimitsu, Ryosuke; Hattori, Koji; Sugiura, Shinji; Kondo, Yuki; Yamada, Rotaro; Tachikawa, Saoko; Satoh, Taku; Kurisaki, Akira; Ohnuma, Kiyoshi; Asashima, Makoto; Kanamori, Toshiyuki
2014-05-01
Human induced pluripotent stem cells (hiPSCs) are a promising cell source for drug screening. For this application, self-renewal or differentiation of the cells is required, and undefined factors in the culture conditions are not desirable. Microfluidic perfusion culture allows the production of small volume cultures with precisely controlled microenvironments, and is applicable to high-throughput cellular environment screening. Here, we developed a microfluidic perfusion culture system for hiPSCs that uses a microchamber array chip under defined extracellular matrix (ECM) and culture medium conditions. By screening various ECMs we determined that fibronectin and laminin are appropriate for microfluidic devices made out of the most popular material, polydimethylsiloxane (PDMS). We found that the growth rate of hiPSCs under pressure-driven perfusion culture conditions was higher than under static culture conditions in the microchamber array. We applied our new system to self-renewal and differentiation cultures of hiPSCs, and immunocytochemical analysis showed that the state of the hiPSCs was successfully controlled. The effects of three antitumor drugs on hiPSCs were comparable between microchamber array and 96-well plates. We believe that our system will be a platform technology for future large-scale screening of fully defined conditions for differentiation cultures on integrated microfluidic devices. © 2013 Wiley Periodicals, Inc.
Quantitative volumetric Raman imaging of three dimensional cell cultures
Kallepitis, Charalambos; Bergholt, Mads S.; Mazo, Manuel M.; Leonardo, Vincent; Skaalure, Stacey C.; Maynard, Stephanie A.; Stevens, Molly M.
2017-03-01
The ability to simultaneously image multiple biomolecules in biologically relevant three-dimensional (3D) cell culture environments would contribute greatly to the understanding of complex cellular mechanisms and cell-material interactions. Here, we present a computational framework for label-free quantitative volumetric Raman imaging (qVRI). We apply qVRI to a selection of biological systems: human pluripotent stem cells with their cardiac derivatives, monocytes and monocyte-derived macrophages in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies and cytoskeletal structures in 3D with unprecedented biomolecular specificity for vibrational microspectroscopy.
DEFF Research Database (Denmark)
Bock, E; Richter-Landsberg, C; Faissner, A
1985-01-01
The nerve growth factor-inducible large external (NILE) glycoprotein and the neural cell adhesion molecule L1 were shown to be immunochemically identical. Immunoprecipitation with L1 and NILE antibodies of [3H]fucose-labeled material from culture supernatants and detergent extracts of NGF......-treated rat PC12 pheochromocytoma cells yielded comigrating bands by SDS-PAGE. NILE antibodies reacted with immunopurified L1 antigen, but not with N-CAM and other L2 epitope-bearing glycoproteins from adult mouse brain. Finally, by sequential immunoprecipitation from detergent extracts of [35S......]methionine-labeled early post-natal cerebellar cell cultures or [3H]fucose-labeled NGF-treated PC12 cells, all immunoreactivity for NILE antibody could be removed by pre-clearing with L1 antibody and vice versa....
Exosome release and low pH belong to a framework of resistance of human melanoma cells to cisplatin.
Directory of Open Access Journals (Sweden)
Cristina Federici
Full Text Available Intrinsic resistance to cytotoxic drugs has been a main issue in cancer therapy for decades. Microenvironmental acidity is a simple while highly efficient mechanism of chemoresistance, exploited through impairment of drug delivery. The latter is achieved by extracellular protonation and/or sequestration into acidic vesicles. This study investigates the importance of extracellular acidosis and nanovesicle (exosome release in the resistance of human tumour cell to cisplatin (CisPt; in parallel to proton pump inhibitors (PPI ability of interfering with these tumour cell features. The results showed that CisPt uptake by human tumour cells was markedly impaired by low pH conditions. Moreover, exosomes purified from supernatants of these cell cultures contained various amounts of CisPt, which correlated to the pH conditions of the culture medium. HPLC-Q-ICP-MS analysis revealed that exosome purified from tumour cell culture supernatants contained CisPt in its native form. PPI pre-treatment increased cellular uptake of CisPt, as compared to untreated cells, in an acidic-depend manner. Furthermore, it induced a clear inhibition of exosome release by tumour cells. Human tumours obtained from xenografts pretreated with PPI contained more CisPt as compared to tumours from xenografts treated with CisPt alone. Further analysis showed that in vivo PPI treatment induced a clear reduction in the plasmatic levels of tumour-derived exosomes which also contained lower level of CisPt. Altogether, these findings point to the identification of a double mechanism that human malignant melanoma use in resisting to a dreadful cellular poison such as cisplatin. This framework of resistance includes both low pH-dependent extracellular sequestration and an exosome-mediated elimination. Both mechanisms are markedly impaired by proton pump inhibition, leading to an increased CisPt-dependent cytotoxicity.
Exosome release and low pH belong to a framework of resistance of human melanoma cells to cisplatin.
Federici, Cristina; Petrucci, Francesco; Caimi, Stefano; Cesolini, Albino; Logozzi, Mariantonia; Borghi, Martina; D'Ilio, Sonia; Lugini, Luana; Violante, Nicola; Azzarito, Tommaso; Majorani, Costanza; Brambilla, Daria; Fais, Stefano
2014-01-01
Intrinsic resistance to cytotoxic drugs has been a main issue in cancer therapy for decades. Microenvironmental acidity is a simple while highly efficient mechanism of chemoresistance, exploited through impairment of drug delivery. The latter is achieved by extracellular protonation and/or sequestration into acidic vesicles. This study investigates the importance of extracellular acidosis and nanovesicle (exosome) release in the resistance of human tumour cell to cisplatin (CisPt); in parallel to proton pump inhibitors (PPI) ability of interfering with these tumour cell features. The results showed that CisPt uptake by human tumour cells was markedly impaired by low pH conditions. Moreover, exosomes purified from supernatants of these cell cultures contained various amounts of CisPt, which correlated to the pH conditions of the culture medium. HPLC-Q-ICP-MS analysis revealed that exosome purified from tumour cell culture supernatants contained CisPt in its native form. PPI pre-treatment increased cellular uptake of CisPt, as compared to untreated cells, in an acidic-depend manner. Furthermore, it induced a clear inhibition of exosome release by tumour cells. Human tumours obtained from xenografts pretreated with PPI contained more CisPt as compared to tumours from xenografts treated with CisPt alone. Further analysis showed that in vivo PPI treatment induced a clear reduction in the plasmatic levels of tumour-derived exosomes which also contained lower level of CisPt. Altogether, these findings point to the identification of a double mechanism that human malignant melanoma use in resisting to a dreadful cellular poison such as cisplatin. This framework of resistance includes both low pH-dependent extracellular sequestration and an exosome-mediated elimination. Both mechanisms are markedly impaired by proton pump inhibition, leading to an increased CisPt-dependent cytotoxicity.
Chen, Yi-Dao; Huang, Shiang-Fu; Wang, Hung-Ming
2015-01-01
To precisely and faithfully perform cell-based drug chemosensitivity assays, a well-defined and biologically relevant culture condition is required. For the former, a perfusion microbioreactor system capable of providing a stable culture condition was adopted. For the latter, however, little is known about the impact of culture models on the physiology and chemosensitivity assay results of primary oral cavity cancer cells. To address the issues, experiments were performed. Results showed that minor environmental pH change could significantly affect the metabolic activity of cells, demonstrating the importance of stable culture condition for such assays. Moreover, the culture models could also significantly influence the metabolic activity and proliferation of cells. Furthermore, the choice of culture models might lead to different outcomes of chemosensitivity assays. Compared with the similar test based on tumor-level assays, the spheroid model could overestimate the drug resistance of cells to cisplatin, whereas the 2D and 3D culture models might overestimate the chemosensitivity of cells to such anticancer drug. In this study, the 3D culture models with same cell density as that in tumor samples showed comparable chemosensitivity assay results as the tumor-level assays. Overall, this study has provided some fundamental information for establishing a precise and faithful drug chemosensitivity assay. PMID:25654105
Fekete, Natalie; Béland, Ariane V; Campbell, Katie; Clark, Sarah L; Hoesli, Corinne A
2018-04-19
In recent years, cell-based therapies targeting the immune system have emerged as promising strategies for cancer treatment. This review summarizes manufacturing challenges related to production of antigen presenting cells as a patient-tailored cancer therapy. Understanding cell-material interactions is essential because in vitro cell culture manipulations to obtain mature antigen-producing cells can significantly alter their in vivo performance. Traditional antigen-producing cell culture protocols often rely on cell adhesion to surface-treated hydrophilic polystyrene flasks. More recent commercial and investigational cancer immunotherapy products were manufactured using suspension cell culture in closed hydrophobic fluoropolymer bags. The shift to closed cell culture systems can decrease risks of contamination by individual operators, as well as facilitate scale-up and automation. Selecting closed cell culture bags over traditional open culture systems entails different handling procedures and processing controls, which can affect product quality. Changes in culture vessels also entail changes in vessel materials and geometry, which may alter the cell microenvironment and resulting cell fate decisions. Strategically designed culture systems will pave the way for the generation of more sophisticated and highly potent cell-based cancer vaccines. As an increasing number of cell-based therapies enter the clinic, the selection of appropriate cell culture vessels and materials becomes a critical consideration that can impact the therapeutic efficacy of the product, and hence clinical outcomes and patient quality of life. © 2018 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.
Yan, Jinlong; Jiang, Tao; Yao, Ying; Wang, Jun; Cai, Yuanli; Green, Nelson W; Wei, Shiqiang
2017-05-01
The phosphorus (P) fraction distribution and formation mechanism in the supernatant after P adsorption onto iron oxides and iron oxide-humic acid (HA) complexes were analyzed using the ultrafiltration method in this study. With an initial P concentration of 20mg/L (I=0.01mol/L and pH=7), it was shown that the colloid (1kDa-0.45μm) component of P accounted for 10.6%, 11.6%, 6.5%, and 4.0% of remaining total P concentration in the supernatant after P adsorption onto ferrihydrite (FH), goethite (GE), ferrihydrite-humic acid complex (FH-HA), goethite-humic acid complex (GE-HA), respectively. The oxide aggregates was the main mechanism for the formation of the colloid P in the supernatant. And colloidal adsorbent particles co-existing in the supernatant were another important reason for it. Additionally, dissolve organic matter dissolved from iron oxide-HA complexes could occupy large adsorption sites of colloidal iron causing less colloid P in the supernatant. Ultimately, we believe that the findings can provide a new way to deeply interpret the geochemical cycling of P, even when considering other contaminants such as organic pollutants, heavy metal ions, and arsenate at the sediment/soil-water interface in the real environment. Copyright © 2016. Published by Elsevier B.V.
GM-CSF augments the immunosuppressive capacity of neonatal spleen cells in vitro
International Nuclear Information System (INIS)
Morrissey, P.J.; Ireland, R.
1991-01-01
Addition of exogenous granulocyte-macrophage colony stimulating factor (GM-CSF) to cultures of adult murine spleen cells with sheep red blood cells (SRBC) results in an augmented plaque forming cell (PFC) response. The influence of GM-CSF on the ability of neonatal spleen cells to suppress the anti-SRBC plaque forming response of adult spleen cells was tested by adding GM-CSF to cultures of neonatal and adult spleen cells. The suppressive capacity of the neonatal spleen cells was augmented by exogenous GM-CSF. The augmented suppression of the neonatal spleen cells was dependent on a G-10 adherent population since the addition of GM-CSF to cultures containing G-10 passed neonatal spleen cells resulted in an augmented PFC response and not suppression. Neonatal splenic glass adherent cells were also capable of suppressing the response. Neonatal spleen cells or purified neonatal glass adherent spleen cells cultured in the presence of GM-CSF had markedly increased levels of PGE2 in the culture supernatant. Neonatal spleen cells cultured with GM-CSF had increased numbers of morphologically identifiable macrophages after 48 hr of culture. Both irradiation and G-10 passage of the neonatal spleen diminished the numbers of macrophages formed in response to GM-CSF, and both of these manipulations resulted in reversal of suppression in response to GM-CSF. Thus, the augmented suppressive capacity of neonatal spleen cells in response to GM-CSF is probably mediated by its ability to drive monocyte to macrophage differentiation as well as increase the suppressive capacity of the existing neonatal splenic macrophages by increasing their production of PGE2
Kumar, Sanjay; Stokes, James; Singh, Udai P; Scissum-Gunn, Karyn; Singh, Rajesh; Manne, Upender; Mishra, Manoj K
2017-10-01
Nitric oxide, a signaling molecule, inhibits mitochondrial respiration by binding with cytochrome c oxidase, resulting in elevated production of reactive superoxide species (reactive oxygen and nitrogen) in the mitochondria and increased susceptibility to cell death. Generation of mitochondrial superoxide species can be suppressed by natural compounds such as resveratrol, a dietary polyphenol found in the skin of red fruits. In various cancer cells, resveratrol shows anti-oxidant and cancer preventive properties. Since, the effect of resveratrol on reactive superoxide species-independent apoptosis in prostate cancer cells is not well illustrated; therefore, we investigated this phenomenon in TRAMP murine prostate cancer cells. To accomplish this, TRAMP cells were incubated with resveratrol, resveratrol + DETA-NONOate, DETA-NONOate (nitric oxide donor), resveratrol + L-NMMA, or L-NMMA (nitric oxide inhibitor) for 48 h, and reactive superoxide species in the mitochondria and culture supernatant were measured. In addition, the mitochondrial membrane potential, cell viability, expression of apoptotic markers (Bax and Bcl2), γ-H2A.x, p53, and caspase-3 was determined. We found that resveratrol suppressed reactive superoxide species such as reactive oxygen species in the mitochondria and nitric oxide in culture supernatant when compared to the DETA-NONOate treatment and disrupted the mitochondrial membrane potential. Resveratrol also reduced cell viability, altered the expression of apoptotic markers (Bax and Bcl2), and increased expression of γ-H2A.x (indicative marker of DNA fragmentation) and p53 (a critical DNA damage response protein). However, there was no appreciable modulation of the caspase-3. Therefore, our data suggest that resveratrol induces superoxide species-independent apoptosis and may act as a therapeutic agent against prostate cancer.
Three-dimensional hydrogel cell culture systems for modeling neural tissue
Frampton, John
Two-dimensional (2-D) neural cell culture systems have served as physiological models for understanding the cellular and molecular events that underlie responses to physical and chemical stimuli, control sensory and motor function, and lead to the development of neurological diseases. However, the development of three-dimensional (3-D) cell culture systems will be essential for the advancement of experimental research in a variety of fields including tissue engineering, chemical transport and delivery, cell growth, and cell-cell communication. In 3-D cell culture, cells are provided with an environment similar to tissue, in which they are surrounded on all sides by other cells, structural molecules and adhesion ligands. Cells grown in 3-D culture systems display morphologies and functions more similar to those observed in vivo, and can be cultured in such a way as to recapitulate the structural organization and biological properties of tissue. This thesis describes a hydrogel-based culture system, capable of supporting the growth and function of several neural cell types in 3-D. Alginate hydrogels were characterized in terms of their biomechanical and biochemical properties and were functionalized by covalent attachment of whole proteins and peptide epitopes. Methods were developed for rapid cross-linking of alginate hydrogels, thus permitting the incorporation of cells into 3-D scaffolds without adversely affecting cell viability or function. A variety of neural cell types were tested including astrocytes, microglia, and neurons. Cells remained viable and functional for longer than two weeks in culture and displayed process outgrowth in 3-D. Cell constructs were created that varied in cell density, type and organization, providing experimental flexibility for studying cell interactions and behavior. In one set of experiments, 3-D glial-endothelial cell co-cultures were used to model blood-brain barrier (BBB) structure and function. This co-culture system was
International Nuclear Information System (INIS)
Tokita, N.; Carpenter, S.G.; Raju, M.R.
1984-01-01
Cell-cycle distributions were measured by flow cytometry for Chinese hamster (CHO) cells cultured continuously under hypoxic conditions. DNA histograms showed an accumulation of cells in the early S phase followed by a traverse delay through the S phase, and a G 2 block. During hypoxic culturing, cell viability decreased rapidly to less than 0.1% at 120 h. Radiation responses for cells cultured under these conditions showed an extreme radioresistance at 72 h. Results suggest that hypoxia induces a condition similar to cell synchrony which itself changes the radioresistance of hypoxic cells. (author)
Fallico, Vincenzo; McAuliffe, Olivia; Fitzgerald, Gerald F; Hill, Colin; Ross, R Paul
2009-08-15
Conjugative transfer of plasmid-associated properties is routinely used to generate food-grade derivatives of lactococcal starter strains with improved technological traits. However, the introduction of one or more plasmids in a single strain is likely to impose a burden on regular cell metabolism and may affect the growth characteristics of the transconjugant culture. The aim of this study was to evaluate the impact of the 60.2-kb plasmid pMRC01 (encoding for an abortive infection bacteriophage resistance system and production of the anti-microbial, lacticin 3147) on starter performance. Five lactococcal strains (L. lactis HP, 255A, SK1, 712 and IL1403) and their pMRC01-containing derivatives were compared in terms of technological properties, including analysis of growth, acidification and autolysis rates. The transconjugants exhibited lower specific growth rates and higher generation times compared to the parental strains when grown at 30 degrees C in glucose-M17, but the presence of pMRC01 did not significantly affect the acidification capacity of strains in 11% reconstituted skimmed milk and synthetic media. Levels of lactate dehydrogenase were two-fold higher in supernatants of transconjugants than in those of parental strains, after 24 and 72 h of growth at 30 degrees C in glucose-M17, suggesting that the presence of pMRC01 somehow accelerates and promotes cellular autolysis. Analysis by flow cytometry following live/dead staining confirmed this result by showing larger populations of injured and dead cells in pMRC01-carrying cultures compared to the parental strains. The results of this study reveal that the plasmid pMRC01 places a burden on lactococcal host metabolism, which is associated with an increased cell permeability and autolysis, without significantly affecting the acidification capacity of the starter. While the magnitude of these effects appears to be strain dependent, the production of the bacteriocin lacticin 3147 may not be involved.
Kaji, Hirokazu; Camci-Unal, Gulden; Langer, Robert; Khademhosseini, Ali
2011-03-01
Inside the body, cells lie in direct contact or in close proximity to other cell types in a tightly controlled architecture that often regulates the resulting tissue function. Therefore, tissue engineering constructs that aim to reproduce the architecture and the geometry of tissues will benefit from methods of controlling cell-cell interactions with microscale resolution. We discuss the use of microfabrication technologies for generating patterned co-cultures. In addition, we categorize patterned co-culture systems by cell type and discuss the implications of regulating cell-cell interactions in the resulting biological function of the tissues. Patterned co-cultures are a useful tool for fabricating tissue engineered constructs and for studying cell-cell interactions in vitro, because they can be used to control the degree of homotypic and heterotypic cell-cell contact. In addition, this approach can be manipulated to elucidate important factors involved in cell-matrix interactions. Patterned co-culture strategies hold significant potential to develop biomimetic structures for tissue engineering. It is expected that they would create opportunities to develop artificial tissues in the future. This article is part of a Special Issue entitled Nanotechnologies - Emerging Applications in Biomedicine. 2010 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Piepkorn, M.; Carney, H.; Linker, A.
1985-01-01
Glycosaminoglycan synthesis was studied in cell populations of ultraviolet light-induced murine cutaneous fibrosarcoma cells under conditions of varying growth rates in vitro. After labeling with the precursors, 3 H-glucosamine and 35 SO 4 , sulfated glycosaminoglycans recoverable by direct proteolysis of the culture monolayers increased approximately 5-fold on a per cell basis from sparsely populated, exponential cell cultures (greater than 85% of cells in S, G2, or M phases) to stationary cultures inhibited by high cell density (greater than 50% of cells in G1). Within this cell surface-associated material, the relative ratio of heparan sulfate to the chondroitin sulfates was approximately 60/40% under conditions of exponential growth; in the growth-arrested cultures, the reverse ratio was found. The substratum attached material, obtained from the flask surface after ethyl glycol bis(beta-aminoethyl ether)-N,N'-tetraacetic acid (EGTA)-mediated detachment of the monolayers, contained relatively more hyaluronic acid, heparan sulfate, and chondroitin sulfates in the most actively proliferating cultures compared with the growth-inhibited cell populations. Furthermore, heparan sulfate and the chondroitin sulfates, which were enriched in the substratum material and in the cell pellet of exponential cultures, showed a relative shift to the cell surface-associated compartment (releasable by mild trypsinization after EGTA-mediated cell detachment) and to the compartment loosely associated with the pericellular matrix (i.e., released into the supernatant during detachment of the monolayers in the presence of EGTA)
Malamis, S; Katsou, E; Di Fabio, S; Bolzonella, D; Fatone, F
2014-09-01
This study critically evaluates the biological processes and techniques applied to remove nitrogen and phosphorus from the anaerobic supernatant produced from the treatment of the organic fraction of municipal solid waste (OFMSW) and from its co-digestion with other biodegradable organic waste (BOW) streams. The wide application of anaerobic digestion for the treatment of several organic waste streams results in the production of high quantities of anaerobic effluents. Such effluents are characterized by high nutrient content, because organic and particulate nitrogen and phosphorus are hydrolyzed in the anaerobic digestion process. Consequently, adequate post-treatment is required in order to comply with the existing land application and discharge legislation in the European Union countries. This may include physicochemical and biological processes, with the latter being more advantageous due to their lower cost. Nitrogen removal is accomplished through the conventional nitrification/denitrification, nitritation/denitritation and the complete autotrophic nitrogen removal process; the latter is accomplished by nitritation coupled with the anoxic ammonium oxidation process. As anaerobic digestion effluents are characterized by low COD/TKN ratio, conventional denitrification/nitrification is not an attractive option; short-cut nitrogen removal processes are more promising. Both suspended and attached growth processes have been employed to treat the anaerobic supernatant. Specifically, the sequencing batch reactor, the membrane bioreactor, the conventional activated sludge and the moving bed biofilm reactor processes have been investigated. Physicochemical phosphorus removal via struvite precipitation has been extensively examined. Enhanced biological phosphorus removal from the anaerobic supernatant can take place through the sequencing anaerobic/aerobic process. More recently, denitrifying phosphorus removal via nitrite or nitrate has been explored. The removal of
Gebhard, C; Gabriel, C; Walter, I
2016-06-01
Spheroid cell culture emerges as powerful in vitro tool for experimental tumour research. In this study, we established a scaffold-free three-dimensional spheroid system built from canine osteosarcoma (OS) cells (D17). Spheroids (7, 14 and 19 days of cultivation) and monolayer cultures (2 and 7 days of cultivation) were evaluated and compared on light and electron microscopy. Monolayer and spheroid cultures were tested for vimentin, cytokeratin, alkaline phosphatase, osteocalcin and collagen I by means of immunohistochemistry. The spheroid cell culture exhibited a distinct network of collagen I in particular after 19-day cultivation, whereas in monolayer cultures, collagen I was arranged as a lamellar basal structure. Necrotic centres of large spheroids, as observed in 14- and 19-day cultures, were characterized by significant amounts of osteocalcin. Proliferative activity as determined by Ki-67 immunoreactivity showed an even distribution in two-dimensional cultures. In spheroids, proliferation was predominating in the peripheral areas. Metastasis-associated markers ezrin and S100A4 were shown to be continuously expressed in monolayer and spheroid cultures. We conclude that the scaffold-free spheroid system from canine OS cells has the ability to mimic the architecture of the in vivo tumour, in particular cell-cell and cell-matrix interactions. © 2015 The Authors. Anatomia, Histologia, Embryologia Published by Blackwell Verlag GmbH.
A microwell cell culture platform for the aggregation of pancreatic β-cells.
Bernard, Abigail B; Lin, Chien-Chi; Anseth, Kristi S
2012-08-01
Cell-cell contact between pancreatic β-cells is important for maintaining survival and normal insulin secretion. Various techniques have been developed to promote cell-cell contact between β-cells, but a simple yet robust method that affords precise control over three-dimensional (3D) β-cell cluster size has not been demonstrated. To address this need, we developed a poly(ethylene glycol) (PEG) hydrogel microwell platform using photolithography. This microwell cell-culture platform promotes the formation of 3D β-cell aggregates of defined sizes from 25 to 210 μm in diameter. Using this platform, mouse insulinoma 6 (MIN6) β-cells formed aggregates with cell-cell adherin junctions. These naturally formed cell aggregates with controllable sizes can be removed from the microwells for macroencapsulation, implantation, or other biological assays. When removed and subsequently encapsulated in PEG hydrogels, the aggregated cell clusters demonstrated improved cellular viability (>90%) over 7 days in culture, while the β-cells encapsulated as single cells maintained only 20% viability. Aggregated MIN6 cells also exhibited more than fourfold higher insulin secretion in response to a glucose challenge compared with encapsulated single β-cells. Further, the cell aggregates stained positively for E-cadherin, indicative of the formation of cell junctions. Using this hydrogel microwell cell-culture method, viable and functional β-cell aggregates of specific sizes were created, providing a platform from which other biologically relevant questions may be answered.
International Nuclear Information System (INIS)
Hall, E.R.; Falkler, W.A. Jr.; Suzuki, J.B.
1990-01-01
B lymphocytes and plasma cells are histologically observed in granulomatous periodontal tissues of juvenile periodontitis (JP) patients. Local immune processes may participate in protective or immunopathologic roles in the pathogenesis of this disease. An in vitro explant culture system was utilized to demonstrate the production of immunoglobulins by diseased JP tissues. Immunodiffusion studies using goat anti-human gamma, alpha, or mu chain serum revealed IgG to be the major immunoglobulin present in 92% of the day 1 supernatant fluids (SF) of the 47 JP gingival tissue explant cultures. IgA was present in 15% of the SF; however, no IgM was detected. Staph Protein A isolated 14C-labeled IgG from the SF, when allowed to react with goat anti-human gamma chain serum, formed lines of precipitation. Positive autoradiographs confirmed the biosynthesis of IgG by the explant cultures. The in vitro gingival tissue explant culture system described provides a useful model for the study of localized immunoglobulins produced by diseased tissues of JP patients
Energy Technology Data Exchange (ETDEWEB)
Hall, E.R.; Falkler, W.A. Jr.; Suzuki, J.B. (Univ. of Maryland Dental School, Baltimore (USA))
1990-10-01
B lymphocytes and plasma cells are histologically observed in granulomatous periodontal tissues of juvenile periodontitis (JP) patients. Local immune processes may participate in protective or immunopathologic roles in the pathogenesis of this disease. An in vitro explant culture system was utilized to demonstrate the production of immunoglobulins by diseased JP tissues. Immunodiffusion studies using goat anti-human gamma, alpha, or mu chain serum revealed IgG to be the major immunoglobulin present in 92% of the day 1 supernatant fluids (SF) of the 47 JP gingival tissue explant cultures. IgA was present in 15% of the SF; however, no IgM was detected. Staph Protein A isolated 14C-labeled IgG from the SF, when allowed to react with goat anti-human gamma chain serum, formed lines of precipitation. Positive autoradiographs confirmed the biosynthesis of IgG by the explant cultures. The in vitro gingival tissue explant culture system described provides a useful model for the study of localized immunoglobulins produced by diseased tissues of JP patients.
Quantitative volumetric Raman imaging of three dimensional cell cultures
Kallepitis, Charalambos
2017-03-22
The ability to simultaneously image multiple biomolecules in biologically relevant three-dimensional (3D) cell culture environments would contribute greatly to the understanding of complex cellular mechanisms and cell–material interactions. Here, we present a computational framework for label-free quantitative volumetric Raman imaging (qVRI). We apply qVRI to a selection of biological systems: human pluripotent stem cells with their cardiac derivatives, monocytes and monocyte-derived macrophages in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies and cytoskeletal structures in 3D with unprecedented biomolecular specificity for vibrational microspectroscopy.
Cell division requirement for activation of murine leukemia virus in cell culture by irradiation
International Nuclear Information System (INIS)
Otten, J.A.; Quarles, J.M.; Tennant, R.W.
1976-01-01
Actively dividing cultures of AKR mouse cells were exposed to relatively low dose-rates of γ radiation and tested for activation of endogenous leukemia viruses. Efficient and reproducible induction of virus was obtained with actively dividing cells, but cultures deprived of serum to inhibit cell division before and during γ irradiation were not activated, even when medium with serum was added immediately after irradiation. These results show that cell division was required for virus induction but that a stable intermediate similar to the state induced by halogenated pyrimidines was not formed. In actively dividing AKR cell cultures, virus activation appeared to be proportional to the dose of γ radiation; the estimated frequency of activation was 1-8 x 10 - 5 per exposed cell and the efficiency of activation was approximately 0.012 inductions per cell per rad. Other normal primary and established mouse cell cultures tested were not activated by γ radiation. The requirement of cell division for radiation and chemical activation may reflect some common mechanism for initiation of virus expression
Bradley, Jillian H.; Stein, Rachel; Randolph, Brad; Molina, Emily; Arnold, Jennifer P.; Gregg, Randal K.
2017-11-01
Immune impairment mediated by microgravity threatens the success of space exploration requiring long-duration spaceflight. The cells of most concern, T lymphocytes, coordinate the host response against microbial and cancerous challenges leading to elimination and long-term protection. T cells are activated upon recognition of specific microbial peptides bound on the surface of antigen presenting cells, such as dendritic cells (DC). Subsequently, this engagement results in T cell proliferation and differentiation into effector T cells driven by autocrine interleukin-2 (IL-2) and other cytokines. Finally, the effector T cells acquire the weaponry needed to destroy microbial invaders and tumors. Studies conducted on T cells during spaceflight, or using Earth-based culture systems, have shown reduced production of cytokines, proliferation and effector functions as compared to controls. This may account for the cases of viral reactivation events and opportunistic infections associated with astronauts of numerous missions. This work has largely been based upon the outcome of T cell activation by stimulatory factors that target select T cell signaling pathways rather than the complex, signaling events related to the natural process of antigen presentation by DC. This study tested the response of an ovalbumin peptide-specific T cell line, OT-II TCH, to activation by DC when the T cells were cultured 24-120 h in a simulated microgravity (SMG) environment generated by a rotary cell culture system. Following 72 h culture of T cells in SMG (SMG-T) or control static (Static-T) conditions, IL-2 production by the T cells was reduced in SMG-T cells compared to Static-T cells upon stimulation by phorbol 12-myristate 13-acetate (PMA) and ionomycin. However, when the SMG-T cells were stimulated with DC and peptide, IL-2 was significantly increased compared to Static-T cells. Such enhanced IL-2 production by SMG-T cells peaked at 72 h SMG culture time and decreased thereafter. When
Tumor necrosis factor (cachetin) decreases adipose cell differentiation in primary cell culture
International Nuclear Information System (INIS)
Martin, R.J.; Jones, D.D.; Jewell, D.E.; Hausman, G.J.
1986-01-01
Cachetin has been shown to effect gene product expression in the established adipose cell line 3T3-L1. Expression of messenger RNA for lipoprotein lipase is suppressed in cultured adipocytes. The purpose of this study was to determine the effect of Cachetin on adipose cell differentiation in primary cell culture. Stromalvascular cells obtained from the inguinal fat pad of 4-5 week old Sprague-Dawley rats were grown in culture for two weeks. During the proliferative growth phase all cells were grown on the same medium and labelled with 3 H-thymidine. Cachetin treatment (10 -6 to 10 -10 M) was initiated on day 5, the initial phase of preadipocyte differentiation. Adipocytes and stromal cells were separated using density gradient, and 3 H-thymidine was determined for both cell types. Thymidine incorporation into adipose cells was decreased maximally (∼ 50%) at 10 -10 M. Stromalvascular cells were not influenced at any of the doses tested. Adipose cell lipid content as indicated by oil red-O staining was decreased by Cachetin. Esterase staining by adipose cells treated with Cachetin was increased indicating an increase in intracellular lipase. These studies show that Cachetin has specific effects on primary adipose cell differentiation
Feeding Frequency Affects Cultured Rat Pituitary Cells in Low Gravity
Hymer, W. C.; Grindeland, R. E.; Salada, T.; Cenci, R.; Krishnan, K.; Mukai, C.; Nagaoka, S.
1996-01-01
In this report, we describe the results of a rat pituitary cell culture experiment done on STS-65 in which the effect of cell feeding on the release of the six anterior pituitary hormones was studied. We found complex microgravity related interactions between the frequency of cell feeding and the quantity and quality (i.e. biological activity) of some of the six hormones released in flight. Analyses of growth hormone (GH) released from cells into culture media on different mission days using gel filtration and ion exchange chromatography yielded qualitatively similar results between ground and flight samples. Lack of cell feeding resulted in extensive cell clumping in flight (but not ground) cultures. Vigorous fibroblast growth occurred in both ground and flight cultures fed 4 times. These results are interpreted within the context of autocrine and or paracrine feedback interactions. Finally the payload specialist successfully prepared a fresh trypsin solution in microgravity, detached the cells from their surface and reinserted them back into the culture chamber. These cells reattached and continued to release hormone in microgravity. In summary, this experiment shows that pituitary cells are microgravity sensitive and that coupled operations routinely associated with laboratory cel1 culture can also be accomplished in low gravity.
Ruiz, Christian; Kustermann, Stefan; Pietilae, Elina; Vlajnic, Tatjana; Baschiera, Betty; Arabi, Leila; Lorber, Thomas; Oeggerli, Martin; Savic, Spasenija; Obermann, Ellen; Singer, Thomas; Rothschild, Sacha I; Zippelius, Alfred; Roth, Adrian B; Bubendorf, Lukas
2016-01-01
The use of patients' own cancer cells for in vitro selection of the most promising treatment is an attractive concept in personalized medicine. Human carcinoma cells from malignant pleural effusions (MPEs) are suited for this purpose since they have already adapted to the liquid environment in the patient and do not depend on a stromal cell compartment. Aim of this study was to develop a systematic approach for the in-vitro culture of MPEs to analyze the effect of chemotherapeutic as well as targeted drugs. MPEs from patients with solid tumors were selected for this study. After morphological and molecular characterization, they were cultured in medium supplemented with patient-derived sterile-filtered effusion supernatant. Growth characteristics were monitored in real-time using the xCELLigence system. MPEs were treated with a targeted therapeutic (erlotinib) according to the mutational status or chemotherapeutics based on the recommendation of the oncologists. We have established a robust system for the ex-vivo culture of MPEs and the application of drug tests in-vitro. The use of an antibody based magnetic cell separation system for epithelial cells before culture allowed treatment of effusions with only moderate tumor cell proportion. Experiments using drugs and drug-combinations revealed dose-dependent and specific growth inhibitory effects of targeted drugs. We developed a new approach for the ex-vivo culture of MPEs and the application of drug tests in-vitro using real-time measuring of cell growth, which precisely reproduced the effect of clinically established treatments by standard chemotherapy and targeted drugs. This sets the stage for future studies testing agents against specific targets from genomic profiling of metastatic tumor cells and multiple drug-combinations in a personalized manner.
Directory of Open Access Journals (Sweden)
Christian Ruiz
Full Text Available The use of patients' own cancer cells for in vitro selection of the most promising treatment is an attractive concept in personalized medicine. Human carcinoma cells from malignant pleural effusions (MPEs are suited for this purpose since they have already adapted to the liquid environment in the patient and do not depend on a stromal cell compartment. Aim of this study was to develop a systematic approach for the in-vitro culture of MPEs to analyze the effect of chemotherapeutic as well as targeted drugs.MPEs from patients with solid tumors were selected for this study. After morphological and molecular characterization, they were cultured in medium supplemented with patient-derived sterile-filtered effusion supernatant. Growth characteristics were monitored in real-time using the xCELLigence system. MPEs were treated with a targeted therapeutic (erlotinib according to the mutational status or chemotherapeutics based on the recommendation of the oncologists.We have established a robust system for the ex-vivo culture of MPEs and the application of drug tests in-vitro. The use of an antibody based magnetic cell separation system for epithelial cells before culture allowed treatment of effusions with only moderate tumor cell proportion. Experiments using drugs and drug-combinations revealed dose-dependent and specific growth inhibitory effects of targeted drugs.We developed a new approach for the ex-vivo culture of MPEs and the application of drug tests in-vitro using real-time measuring of cell growth, which precisely reproduced the effect of clinically established treatments by standard chemotherapy and targeted drugs. This sets the stage for future studies testing agents against specific targets from genomic profiling of metastatic tumor cells and multiple drug-combinations in a personalized manner.
Jin, Liting; Qu, Ying; Gomez, Liliana J; Chung, Stacey; Han, Bingchen; Gao, Bowen; Yue, Yong; Gong, Yiping; Liu, Xuefeng; Amersi, Farin; Dang, Catherine; Giuliano, Armando E; Cui, Xiaojiang
2018-02-20
Conditional reprogramming methods allow for the inexhaustible in vitro proliferation of primary epithelial cells from human tissue specimens. This methodology has the potential to enhance the utility of primary cell culture as a model for mammary gland research. However, few studies have systematically characterized this method in generating in vitro normal human mammary epithelial cell models. We show that cells derived from fresh normal breast tissues can be propagated and exhibit heterogeneous morphologic features. The cultures are composed of CK18, desmoglein 3, and CK19-positive luminal cells and vimentin, p63, and CK14-positive myoepithelial cells, suggesting the maintenance of in vivo heterogeneity. In addition, the cultures contain subpopulations with different CD49f and EpCAM expression profiles. When grown in 3D conditions, cells self-organize into distinct structures that express either luminal or basal cell markers. Among these structures, CK8-positive cells enclosing a lumen are capable of differentiation into milk-producing cells in the presence of lactogenic stimulus. Furthermore, our short-term cultures retain the expression of ERα, as well as its ability to respond to estrogen stimulation. We have investigated conditionally reprogrammed normal epithelial cells in terms of cell type heterogeneity, cellular marker expression, and structural arrangement in two-dimensional (2D) and three-dimensional (3D) systems. The conditional reprogramming methodology allows generation of a heterogeneous culture from normal human mammary tissue in vitro . We believe that this cell culture model will provide a valuable tool to study mammary cell function and malignant transformation.
Gabashvili, A N; Baklaushev, V P; Grinenko, N F; Mel'nikov, P A; Cherepanov, S A; Levinsky, A B; Chehonin, V P
2016-02-01
The tumor-suppressive effect of rat mesenchymal stem cells against low-differentiated rat C6 glioma cells during their direct and indirect co-culturing and during culturing of C6 glioma cells in the medium conditioned by mesenchymal stem cells was studied in an in vitro experiment. The most pronounced antitumor activity of mesenchymal stem cells was observed during direct co-culturing with C6 glioma cells. The number of live C6 glioma cells during indirect co-culturing and during culturing in conditioned medium was slightly higher than during direct co-culturing, but significantly differed from the control (C6 glioma cells cultured in medium conditioned by C6 glioma cells). The cytotoxic effect of medium conditioned by mesenchymal stem cells was not related to medium depletion by glioma cells during their growth. The medium conditioned by other "non-stem" cells (rat astrocytes and fibroblasts) produced no tumor-suppressive effect. Rat mesenchymal stem cells, similar to rat C6 glioma cells express connexin 43, the main astroglial gap junction protein. During co-culturing, mesenchymal stem cells and glioma C6 cells formed functionally active gap junctions. Gap junction blockade with connexon inhibitor carbenoxolone attenuated the antitumor effect observed during direct co-culturing of C6 glioma cells and mesenchymal stem cells to the level produced by conditioned medium. Cell-cell signaling mediated by gap junctions can be a mechanism of the tumor-suppressive effect of mesenchymal stem cells against C6 glioma cells. This phenomenon can be used for the development of new methods of cell therapy for high-grade malignant gliomas.
Advances in tissue engineering through stem cell-based co-culture.
Paschos, Nikolaos K; Brown, Wendy E; Eswaramoorthy, Rajalakshmanan; Hu, Jerry C; Athanasiou, Kyriacos A
2015-05-01
Stem cells are the future in tissue engineering and regeneration. In a co-culture, stem cells not only provide a target cell source with multipotent differentiation capacity, but can also act as assisting cells that promote tissue homeostasis, metabolism, growth and repair. Their incorporation into co-culture systems seems to be important in the creation of complex tissues or organs. In this review, critical aspects of stem cell use in co-culture systems are discussed. Direct and indirect co-culture methodologies used in tissue engineering are described, along with various characteristics of cellular interactions in these systems. Direct cell-cell contact, cell-extracellular matrix interaction and signalling via soluble factors are presented. The advantages of stem cell co-culture strategies and their applications in tissue engineering and regenerative medicine are portrayed through specific examples for several tissues, including orthopaedic soft tissues, bone, heart, vasculature, lung, kidney, liver and nerve. A concise review of the progress and the lessons learned are provided, with a focus on recent developments and their implications. It is hoped that knowledge developed from one tissue can be translated to other tissues. Finally, we address challenges in tissue engineering and regenerative medicine that can potentially be overcome via employing strategies for stem cell co-culture use. Copyright © 2014 John Wiley & Sons, Ltd.
DEFF Research Database (Denmark)
Kurtzhals, J A; Kemp, M; Poulsen, L K
1995-01-01
of antigen stimulation suggesting a response due to antigen recognition. Both IL-4 and IFN-gamma production was abrogated by depletion of CD2+ or CD4+ but not CD8+ cells. CD2+ or CD4+ but not CD8+ enriched cultures produced cytokines as unseparated PBMC. Thus, in non-exposed individuals circulating...... call for studies of the importance of cytokine production by cross-reactive T cells for the outcome of L. donovani infections in humans and show that the method for IL-4 detection is useful for this purpose.......Interferon-gamma (IFN-gamma) and interleukin-4 (IL-4) production by Leishmania reactive peripheral blood mononuclear cells (PBMC) from non-exposed individuals was investigated. IFN-gamma was measured in culture supernatants after antigen stimulation. For the measurement of IL-4, antigen stimulated...
Stimulation of DNA synthesis in cultured rat alveolar type II cells
International Nuclear Information System (INIS)
Leslie, C.C.; McCormick-Shannon, K.; Robinson, P.C.; Mason, R.J.
1985-01-01
Restoration of the alveolar epithelium after injury is thought to be dependent on the proliferation of alveolar type II cells. To understand the factors that may be involved in promoting type II cell proliferation in vivo, we determined the effect of potential mitogens and culture substrata on DNA synthesis in rat alveolar type II cells in primary culture. Type II cells cultured in basal medium containing 10% fetal bovine serum (FBS) exhibited essentially no DNA synthesis. Factors that stimulated 3 H-thymidine incorporation included cholera toxin, epidermal growth factor, and rat serum. The greatest degree of stimulation was achieved by plating type II cells on an extracellular matrix prepared from bovine corneal endothelial cells and then by culturing the pneumocytes in medium containing rat serum, cholera toxin, insulin, and epidermal growth factor. Under conditions of stimulation of 3 H-thymidine incorporation there was an increased DNA content per culture dish but no increase in cell number. The ability of various culture conditions to promote DNA synthesis in type II cells was verified by autoradiography. Type II cells were identified by the presence of cytoplasmic inclusions, which were visualized by tannic acid staining before autoradiography. These results demonstrate the importance of soluble factors and culture substratum in stimulating DNA synthesis in rat alveolar type II cells in primary culture
Directory of Open Access Journals (Sweden)
Li Z
2018-05-01
Full Text Available Zhuohong Li, Chaofu Zhu, Baiping An, Yu Chen, Xiuyun He, Lin Qian, Lan Lan, Shijie Li Department of Oncology, The Affiliated Hospital of Chengdu University of Traditional Chinese Medicine, Chengdu, Sichuan, China Purpose: Hepatocellular carcinoma is one of the most predominant malignancies with high fatality rate and its incidence is rising at an alarming rate because of its resistance to radio- and chemotherapy. Indirubin is the major active anti-tumor ingredient of a traditional Chinese herbal medicine. The present study aimed to analyze the effects of indirubin on cell proliferation, migration, invasion, and angiogenesis of tumor-derived endothelial cells (Td-EC. Methods: Td-EC were derived from human umbilical vein endothelial cells (HUVEC by treating HUVEC with the conditioned medium of human liver cancer cell line HepG2. Cell proliferation, migration, invasion, and angiogenesis were assessed by MTT, wound healing, in vitro cell invasion, and in vitro tube formation assay. Results: Td-EC were successfully obtained from HUVEC cultured with 50% culture supernatant from serum-starved HepG2 cells. Indirubin significantly inhibited Td-EC proliferation in a dose- and time-dependent manner. Indirubin also inhibited Td-EC migration, invasion, and angiogenesis. However, indirubin’s effects were weaker on HUVEC than Td-EC. Conclusion: Indirubin significantly inhibited Td-EC proliferation, migration, invasion, and angiogenesis. Keywords: indirubin, Td-EC, proliferation, migration, invasion, angiogenesis
EXPLANTATION OF MESANGIAL CELL HILLOCKS - A METHOD FOR OBTAINING HUMAN MESANGIAL CELLS IN CULTURE
MULLER, EW; KIM, Y; MICHAEL, AF; VERNIER, RL; VANDERHEM, GK; VANDERWOUDE, FJ
A simple method is presented for selective cell culture of human mesangial cells using explanatation of mesangial cell hillocks. Glomeruli which had been incubated with collagenase were explanted on plastic tissue culture flasks. Three to 6 weeks after explantation, a rapidly growing multilayer of
International Nuclear Information System (INIS)
Fujitake, Hideki; Okamoto, Yuruko; Okubo, Hiroshi; Miyanomae, Takeshi; Kumagai, Keiko; Mori, K.J.
1981-01-01
Effects of cell concentrations on the survival and repopulation of haemopoietic stem cells after irradiation were studied in the long-term culture of mouse bone marrow cells in vitro. No difference was observed in the survival of the stem cells among cultures in which 0 - 10 7 cells were re-inoculated on the adherent cell colonies in the culture flask. Stem cells showed a significant proliferation within 1 week and the number of the stem cells exceeded the control in 3 weeks after irradiation in the cultures with less than 10 6 re-inoculated cells per flask. In contrast, there was a considerable delay in the onset of stem cell proliferation after irradiation in the culture with 10 7 cells per flask. Based on these results, a possibility that a stimulator of stem cell proliferation, released from irradiated stromal cells, is cancelled by an inhibitory factor produced by irradiated or unirradiated haemopoietic cells is postulated. (author)
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tissue culture media for human ex vivo tissue and cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture...
Retinal pigment epithelium culture;a potential source of retinal stem cells.
Akrami, Hassan; Soheili, Zahra-Soheila; Khalooghi, Keynoush; Ahmadieh, Hamid; Rezaie-Kanavi, Mojgan; Samiei, Shahram; Davari, Malihe; Ghaderi, Shima; Sanie-Jahromi, Fatemeh
2009-07-01
To establish human retinal pigment epithelial (RPE) cell culture as a source for cell replacement therapy in ocular diseases. Human cadaver globes were used to isolate RPE cells. Each globe was cut into several pieces of a few millimeters in size. After removing the sclera and choroid, remaining tissues were washed in phosphate buffer saline and RPE cells were isolated using dispase enzyme solution and cultured in Dulbecco's Modified Eagle's Medium: Nutrient Mixture F-12 supplemented with 10% fetal calf serum. Primary cultures of RPE cells were established and spheroid colonies related to progenitor/stem cells developed in a number of cultures. The colonies included purely pigmented or mixed pigmented and non-pigmented cells. After multiple cellular passages, several types of photoreceptors and neural-like cells were detected morphologically. Cellular plasticity in RPE cell cultures revealed promising results in terms of generation of stem/progenitor cells from human RPE cells. Whether the spheroids and neural-like retinal cells were directly derived from retinal stem cells or offspring of trans-differentiating or de-differentiating RPE cells remains to be answered.
Enhanced infectivity of bluetongue virus in cell culture by centrifugation.
Sundin, D R; Mecham, J O
1989-01-01
The effects of centrifugation of the infection of cell culture with bluetongue virus (BTV) were investigated. Baby hamster kidney cells were infected with BTV with or without centrifugation. Viral antigen was detected by immunofluorescence at 24 h in both centrifuged and noncentrifuged cultures. However, after 24 h of infection, the production of PFU in centrifuged cell cultures was 10- to 20-fold greater than that seen in cultures not centrifuged. In addition, centrifugation enhanced the dir...
Aceves-Diez, Angel E; Estrada-Castañeda, Kelly J; Castañeda-Sandoval, Laura M
2015-07-01
The aim of this research was to investigate the potential of a nutrient-rich organic waste, namely the cell-free supernatant of Bacillus thuringiensis (BtS) gathered from fermentation, as a biostimulating agent to improve and sustain microbial populations and their enzymatic activities, thereby assisting in the bioremediation of chlorpyrifos-contaminated soil at a high dose (70 mg kg(-1)). Experiments were performed for up to 80 d. Chlorpyrifos degradation and its major metabolic product, 3,5,6-trichloro-2-pyridinol (TCP), were quantified by high-performance liquid chromatography (HPLC); total microbial populations were enumerated by direct counts in specific medium; and fluorescein diacetate (FDA) hydrolysis was measured as an index of soil microbial activity. Throughout the experiment, there was higher chlorpyrifos degradation in soil supplemented with BtS (83.1%) as compared to non-supplemented soil. TCP formation and degradation occurred in all soils, but the greatest degradation (30.34%) was observed in soil supplemented with BtS. The total microbial populations were significantly improved by supplementation with BtS. The application of chlorpyrifos to soil inhibited the enzymatic activity; however, this negative effect was counteracted by BtS, inducing an increase of approximately 16% in FDA hydrolysis. These results demonstrate the potential of B. thuringiensis supernatant as a suitable biostimulation agent for enhancing chlorpyrifos and TCP biodegradation in chlorpyrifos-contaminated soils. Copyright © 2015 Elsevier Ltd. All rights reserved.
Bayati, Vahid; Gazor, Rohoullah; Nejatbakhsh, Reza; Negad Dehbashi, Fereshteh
2016-01-01
As stem cells play a critical role in tissue repair, their manipulation for being applied in regenerative medicine is of great importance. Skin-derived precursors (SKPs) may be good candidates for use in cell-based therapy as the only neural stem cells which can be isolated from an accessible tissue, skin. Herein, we presented a simple protocol to enrich neural SKPs by monolayer adherent cultivation to prove the efficacy of this method. To enrich neural SKPs from dermal cell populations, we have found that a monolayer adherent cultivation helps to increase the numbers of neural precursor cells. Indeed, we have cultured dermal cells as monolayer under serum-supplemented (control) and serum-supplemented culture, followed by serum free cultivation (test) and compared. Finally, protein markers of SKPs were assessed and compared in both experimental groups and differentiation potential was evaluated in enriched culture. The cells of enriched culture concurrently expressed fibronectin, vimentin and nestin, an intermediate filament protein expressed in neural and skeletal muscle precursors as compared to control culture. In addition, they possessed a multipotential capacity to differentiate into neurogenic, glial, adipogenic, osteogenic and skeletal myogenic cell lineages. It was concluded that serum-free adherent culture reinforced by growth factors have been shown to be effective on proliferation of skin-derived neural precursor cells (skin-NPCs) and drive their selective and rapid expansion.
Bradley, Jillian H; Stein, Rachel; Randolph, Brad; Molina, Emily; Arnold, Jennifer P; Gregg, Randal K
2017-11-01
Immune impairment mediated by microgravity threatens the success of space exploration requiring long-duration spaceflight. The cells of most concern, T lymphocytes, coordinate the host response against microbial and cancerous challenges leading to elimination and long-term protection. T cells are activated upon recognition of specific microbial peptides bound on the surface of antigen presenting cells, such as dendritic cells (DC). Subsequently, this engagement results in T cell proliferation and differentiation into effector T cells driven by autocrine interleukin-2 (IL-2) and other cytokines. Finally, the effector T cells acquire the weaponry needed to destroy microbial invaders and tumors. Studies conducted on T cells during spaceflight, or using Earth-based culture systems, have shown reduced production of cytokines, proliferation and effector functions as compared to controls. This may account for the cases of viral reactivation events and opportunistic infections associated with astronauts of numerous missions. This work has largely been based upon the outcome of T cell activation by stimulatory factors that target select T cell signaling pathways rather than the complex, signaling events related to the natural process of antigen presentation by DC. This study tested the response of an ovalbumin peptide-specific T cell line, OT-II TCH, to activation by DC when the T cells were cultured 24-120 h in a simulated microgravity (SMG) environment generated by a rotary cell culture system. Following 72 h culture of T cells in SMG (SMG-T) or control static (Static-T) conditions, IL-2 production by the T cells was reduced in SMG-T cells compared to Static-T cells upon stimulation by phorbol 12-myristate 13-acetate (PMA) and ionomycin. However, when the SMG-T cells were stimulated with DC and peptide, IL-2 was significantly increased compared to Static-T cells. Such enhanced IL-2 production by SMG-T cells peaked at 72 h SMG culture time and decreased thereafter
International Nuclear Information System (INIS)
Nobuhisa, Ikuo; Ohtsu, Naoki; Okada, Seiji; Nakagata, Naomi; Taga, Tetsuya
2007-01-01
The aorta-gonad-mesonephros (AGM) region is a primary source of definitive hematopoietic cells in the midgestation mouse embryo. In cultures of dispersed AGM regions, adherent cells containing endothelial cells are observed first, and then non-adherent hematopoietic cells are produced. Here we report on the characterization of hematopoietic cells that emerge in the AGM culture. Based on the expression profiles of CD45 and c-Kit, we defined three cell populations: CD45 low c-Kit + cells that had the ability to form hematopoietic cell colonies in methylcellulose media and in co-cultures with stromal cells; CD45 low c-Kit - cells that showed a granulocyte morphology; CD45 high c-Kit low/- that exhibited a macrophage morphology. In co-cultures of OP9 stromal cells and freshly prepared AGM cultures, CD45 low c-Kit + cells from the AGM culture had the abilities to reproduce CD45 low c-Kit + cells and differentiate into CD45 low c-Kit - and CD45 high c-Kit low/- cells, whereas CD45 low c-Kit - and CD45 high c-Kit low/- did not produce CD45 low c-Kit + cells. Furthermore, CD45 low c-Kit + cells displayed a long-term repopulating activity in adult hematopoietic tissue when transplanted into the liver of irradiated newborn mice. These results indicate that CD45 low c-Kit + cells from the AGM culture have the potential to reconstitute multi-lineage hematopoietic cells
Ikeda, Kazuhiro; Nagata, Shogo; Okitsu, Teru; Takeuchi, Shoji
2017-06-06
Human pluripotent stem cells are a potentially powerful cellular resource for application in regenerative medicine. Because such applications require large numbers of human pluripotent stem cell-derived cells, a scalable culture system of human pluripotent stem cell needs to be developed. Several suspension culture systems for human pluripotent stem cell expansion exist; however, it is difficult to control the thickness of cell aggregations in these systems, leading to increased cell death likely caused by limited diffusion of gases and nutrients into the aggregations. Here, we describe a scalable culture system using the cell fiber technology for the expansion of human induced pluripotent stem (iPS) cells. The cells were encapsulated and cultured within the core region of core-shell hydrogel microfibers, resulting in the formation of rod-shaped or fiber-shaped cell aggregations with sustained thickness and high viability. By encapsulating the cells with type I collagen, we demonstrated a long-term culture of the cells by serial passaging at a high expansion rate (14-fold in four days) while retaining its pluripotency. Therefore, our culture system could be used for large-scale expansion of human pluripotent stem cells for use in regenerative medicine.
Cystine uptake by cultured cells originating from dog proximal tubule segments
International Nuclear Information System (INIS)
States, B.; Reynolds, R.; Lee, J.; Segal, S.
1990-01-01
Large numbers of kidney epithelial cells were cultured successfully from isolated dog proximal tubule segments. Cells in primary culture and in first passage retained the cystine-dibasic amino acid co-transporter system which is found in vivo and in freshly isolated proximal tubule segments. In contrast to other cultured cells, the cystine-glutamate anti-porter was absent in primary cultures. However, this anti-porter system seemed to be developing in cells in first passage. The intracellular ratio of cysteine:reduced glutathione (CSH:GSH) was maintained at 1:36 in both primary cultures and in low passage cells. Incubation of cells in primary culture for 5 min at 37 degrees C with 0.025 mM [ 35 S]L-cystine resulted in incorporation of approximately 36 and 8.5% of the label into intracellular CSH and GSH, respectively. These cultured cells, therefore, seem to be an excellent model system for the eventual elucidation of (a) the inticacies of cystine metabolism and (b) regulation of (1) the cystine-dibasic amino acid co-transporter system and (2) the development of the cysteine-glutamate anti-porter system
Selection of the treatment method for the West Valley alkaline supernatant
International Nuclear Information System (INIS)
Carl, D.E.; Leonard, I.M.
1987-02-01
As part of the West Valley Demonstration Project (WVDP), th PUREX supernatant stored in Tank 8d-2 will be partially decontaminated before encapsulation in the final glass form. This report discusses selection of a method for removing Cs-137, the major radioactive ion in the supernatant. Methods considered were: (1) electrodialysis; (2) hyperfiltration; (3) precipitation with ferrocyanide, NaTPB, or PTA; (4) organic ion exchange using Cs-100 or a biologically derived media; (5) chelation using DeVoe/Holbein compostions; and (6) inorganic ion exchange using Durasil, natural zeolities, IE-95 or IE-96 media. Several different methods of using inorganic ion exchange media were also reviewed including (1) four columns with elution, and (2) two, three, or four columns without elution. After the careful evaluation of experimental data with all process constraints taken into account, the inorganic exchange media IE-96 (Linde Ionsiv IE-96 synthetic zeolite) was chosen for WVDP cesium recovery. IE-96 was chosen for the following reasons: high sorption rate, a decontamination factor (DF) over 1000, excellent exchange capacity at WVDP conditions, compatability with the glass formers used for borosilicate glass in direct melter feed applications, and a history of successful application in radio chemical seperation for waste streams. 34 refs., 29 figs., 27 tabs
ERC/mesothelin is expressed in human gastric cancer tissues and cell lines.
Ito, Tomoaki; Kajino, Kazunori; Abe, Masaaki; Sato, Koichi; Maekawa, Hiroshi; Sakurada, Mutsumi; Orita, Hajime; Wada, Ryo; Kajiyama, Yoshiaki; Hino, Okio
2014-01-01
ERC/mesothelin is expressed in mesothelioma and other malignancies. The ERC/mesothelin gene (MSLN) encodes a 71-kDa precursor protein, which is cleaved to yield 31-kDa N-terminal (N-ERC/mesothelin) and 40-kDa C-terminal (C-ERC/mesothelin) proteins. N-ERC/mesothelin is a soluble protein and has been reported to be a diagnostic serum marker of mesothelioma and ovarian cancer. Gastric cancer tissue also expresses C-ERC/mesothelin, but the significance of serum N-ERC levels for diagnosing gastric cancer has not yet been studied. We examined the latter issue in the present study as well as C-ERC/mesothelin expression in human gastric cancer tissues and cell lines. We immunohistochemically examined C-ERC/mesothelin expression in tissue samples from 50 cases of gastric cancer, and we also assessed the C-ERC/mesothelin expression in 6 gastric cancer cell lines (MKN-1, MKN-7, MKN-74, NUGC-3, NUGC-4 and TMK-1) using reverse transcription-polymerase chain reaction, flow cytometry, immunohistochemistry and immunoblotting. We also examined the N-ERC/mesothelin concentrations in the supernatants of cultured cells and in the sera of gastric cancer patients using an enzyme-linked immunosorbent assay (ELISA). N-ERC/mesothelin was detected in the supernatants of 3 gastric cancer cell lines (MKN-1, NUGC-4 and TMK-1) by ELISA, but its concentration in the sera of gastric cancer patients was almost same as that observed in the sera of the normal controls. In the gastric cancer tissues, C-ERC/mesothelin expression was associated with lymphatic invasion. N-ERC/mesothelin was secreted into the supernatants of gastric cancer cell lines, but does not appear to be a useful serum marker of gastric cancer.
Wang, Qin; Gao, Lina; Han, Feng; Lu, Jiaxi; Liu, Yiqun; Sun, Licui; Huang, Zhenwu
2016-03-01
To compare the effect of several selenocompounds on the productions of SEPP and GPx in HepG2 and Hela cells. The cultured HepG2 and Hela cells were divided into the control, Na2SeO3, SeMet and MeSeCys groups. After adding the selected selenocompounds (with the respective concentration 0.01 and 0.1 μmol/L), the experimental groups were then incubated for 48 h and 72 h. Finally, the cell culture supernatants and homogenates were collected for the SEPP and GPx concentrations detection by a double-antibody sandwich enyme-linked immuno-sorbent-assay (ELISA). The SEPP and GPx concentrations in Hela cells treated with 0.1 μmol/L SeMet and MeSeCys were significantly higher than that in the control group (P cell treated with 0.1 μmol/L selenocompounds were significantly higher than that in Hela cells (P cells are more beneficial to the production of selenoproteins than Hela cells.
Inhibition of apoptosis using exosomes in Chinese hamster ovary cell culture.
Han, Seora; Rhee, Won Jong
2018-05-01
Animal cell culture technology for therapeutic protein production has shown significant improvement over the last few decades. Chinese hamster ovary (CHO) cells have been widely adapted for the production of biopharmaceutical drugs. In the biopharmaceutical industry, it is crucial to develop cell culture media and culturing conditions to achieve the highest productivity and quality. However, CHO cells are significantly affected by apoptosis in the bioreactors, resulting in a substantial decrease in product quantity and quality. Thus, to overcome the obstacle of apoptosis in CHO cell culture, it is critical to develop a novel method that does not have minimal concern of safety or cost. Herein, we showed for the first time that exosomes, which are nano-sized extracellular vesicles, derived from CHO cells inhibited apoptosis in CHO cell culture when supplemented to the culture medium. Flow cytometric and microscopic analyses revealed that substantial amounts of exosomes were delivered to CHO cells. Higher cell viability after staurosporine treatment was observed by exosome supplementation (67.3%) as compared to control (41.1%). Furthermore, exosomes prevented the mitochondrial membrane potential loss and caspase-3 activation, meaning that the exosomes enhanced cellular activities under pro-apoptotic condition. As the exosomes supplements are derived from CHO cells themselves, it is not only beneficial for the biopharmaceutical productivity of CHO cell culture to inhibit apoptosis, but also from a regulatory standpoint to diminish any safety concerns. Thus, we conclude that the method developed in this research may contribute to the biopharmaceutical industry where minimizing apoptosis in CHO cell culture is beneficial. © 2018 Wiley Periodicals, Inc.
Isolation and Characterization of Poliovirus in Cell Culture Systems.
Thorley, Bruce R; Roberts, Jason A
2016-01-01
The isolation and characterization of enteroviruses by cell culture was accepted as the "gold standard" by clinical virology laboratories. Methods for the direct detection of all enteroviruses by reverse transcription polymerase chain reaction, targeting a conserved region of the genome, have largely supplanted cell culture as the principal diagnostic procedure. However, the World Health Organization's Global Polio Eradication Initiative continues to rely upon cell culture to isolate poliovirus due to the lack of a reliable sensitive genetic test for direct typing of enteroviruses from clinical specimens. Poliovirus is able to infect a wide range of mammalian cell lines, with CD155 identified as the primary human receptor for all three seroytpes, and virus replication leads to an observable cytopathic effect. Inoculation of cell lines with extracts of clinical specimens and subsequent passaging of the cells leads to an increased virus titre. Cultured isolates of poliovirus are suitable for testing by a variety of methods and remain viable for years when stored at low temperature.This chapter describes general procedures for establishing a cell bank and routine passaging of cell lines. While the sections on specimen preparation and virus isolation focus on poliovirus, the protocols are suitable for other enteroviruses.
SAHA-induced TRAIL-sensitisation of Multiple Myeloma cells is enhanced in 3D cell culture.
Arhoma, A; Chantry, A D; Haywood-Small, S L; Cross, N A
2017-11-15
Multiple Myeloma (MM) is currently incurable despite many novel therapies. Tumour Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL) is a potential anti-tumour agent although effects as a single agent are limited. In this study, we investigated whether the Histone Deacetylase (HDAC) inhibitor SAHA can enhance TRAIL-induced apoptosis and target TRAIL resistance in both suspension culture, and 3D cell culture as a model of disseminated MM lesions that form in bone. The effects of SAHA and/or TRAIL in 6 Multiple Myeloma cell lines were assessed in both suspension cultures and in an Alginate-based 3D cell culture model. The effect of SAHA and/or TRAIL was assessed on apoptosis by assessment of nuclear morphology using Hoechst 33342/Propidium Iodide staining. Viable cell number was assessed by CellTiter-Glo luminescence assay, Caspase-8 and -9 activities were measured by Caspase-Glo™ assay kit. TRAIL-resistant cells were generated by culture of RPMI 8226 and NCI-H929 by acute exposure to TRAIL followed by selection of TRAIL-resistant cells. TRAIL significantly induced apoptosis in a dose-dependent manner in OPM-2, RPMI 8226, NCI-H929, U266, JJN-3 MM cell lines and ADC-1 plasma cell leukaemia cells. SAHA amplified TRAIL responses in all lines except OPM-2, and enhanced TRAIL responses were both via Caspase-8 and -9. SAHA treatment induced growth inhibition that further increased in the combination treatment with TRAIL in MM cells. The co-treatment of TRAIL and SAHA reduced viable cell numbers all cell lines. TRAIL responses were further potentiated by SAHA in 3D cell culture in NCI-H929, RPMI 8226 and U266 at lower TRAIL + SAHA doses than in suspension culture. However TRAIL responses in cells that had been selected for TRAIL resistance were not further enhanced by SAHA treatment. SAHA is a potent sensitizer of TRAIL responses in both TRAIL sensitive and resistant cell lines, in both suspension and 3D culture, however SAHA did not sensitise TRAIL-sensitive cell
Flux analysis of mammalian cell culture
Martens, D.E.; Tramper, J.
2010-01-01
Animal cells are used for the production of vaccines and pharmaceutical proteins. The increase in demand for these products requires an increase in volumetric productivity of animal cell culture processes, which can be attained through an increase in biomass concentration and/or specific
Hall, R.D.
2000-01-01
The use of cultured plant cells in either organized or unorganized form has increased vey considerably in the last 10-15 yr. Many new technologies have been developed and applications in both fundamental and applied research have led to the development of some powerful tools for improving our
Hirao, A; Ehlers, R-U
2009-08-01
The rhabditid nematodes Steinernema carpocapsae and Steinernema feltiae are used in biological control of insect pests. Mass production is done in liquid culture media pre-incubated with their bacterial symbionts Xenorhabdus nematophila and Xenorhabdus bovienii, respectively, before nematode dauer juveniles (DJs) are inoculated. As a response to food signals produced by the bacterial symbionts, the DJs exit from the developmentally arrested dauer stage (they recover development) and grow to adults, which produce DJ offspring. Variable DJ recovery after inoculation often causes process failure due to non-synchronous population development and low numbers of adult nematodes. This contribution investigated the influence of the bacterial cell density on DJ recovery and development to adults. At higher density of 10(10) bacterial cells ml(-1), a higher percentage of DJ recovery was induced, and adults occurred earlier in both Steinernema spp. than at lower density of 10(9) and 10(8) cells ml(-1). Xenorhabdus symbionts produce phase variants. Recovery in bacteria-free supernatants was lower than in supernatants containing bacterial cells for both primary and secondary phase Xenorhabdus spp. and lower in secondary than in primary phase supernatants or cell suspensions. In general, recovery was lower for Steinernema feltiae and the time at which 50% of the population had recovered after exposure to the food signal was longer (RT(50) = 17.1 h) than for Steinernema carpocapsae (RT(50) = 6.6 h). Whereas >90% S. carpocapsae DJs recovered in hemolymph serum of the lepidopteran insect Galleria mellonella, recovery of S. feltiae only reached 31%. Penetration into a host insect prior to exposure to the insect's food signal did not enhance DJ recovery. Consequences for liquid culture mass production of the nematodes and differences between species of the genera Steinernema and Heterorhabditis are discussed.
Directory of Open Access Journals (Sweden)
Ruth Olmer
2018-05-01
Full Text Available Summary: Endothelial cells (ECs are involved in a variety of cellular responses. As multifunctional components of vascular structures, endothelial (progenitor cells have been utilized in cellular therapies and are required as an important cellular component of engineered tissue constructs and in vitro disease models. Although primary ECs from different sources are readily isolated and expanded, cell quantity and quality in terms of functionality and karyotype stability is limited. ECs derived from human induced pluripotent stem cells (hiPSCs represent an alternative and potentially superior cell source, but traditional culture approaches and 2D differentiation protocols hardly allow for production of large cell numbers. Aiming at the production of ECs, we have developed a robust approach for efficient endothelial differentiation of hiPSCs in scalable suspension culture. The established protocol results in relevant numbers of ECs for regenerative approaches and industrial applications that show in vitro proliferation capacity and a high degree of chromosomal stability. : In this article, U. Martin and colleagues show the generation of hiPSC endothelial cells in scalable cultures in up to 100 mL culture volume. The generated ECs show in vitro proliferation capacity and a high degree of chromosomal stability after in vitro expansion. The established protocol allows to generate hiPSC-derived ECs in relevant numbers for regenerative approaches. Keywords: hiPSC differentiation, endothelial cells, scalable culture
Electrospinning PCL Scaffolds Manufacture for Three-Dimensional Breast Cancer Cell Culture
Directory of Open Access Journals (Sweden)
Marc Rabionet
2017-08-01
Full Text Available In vitro cell culture is traditionally performed within two-dimensional (2D environments, providing a quick and cheap way to study cell properties in a laboratory. However, 2D systems differ from the in vivo environment and may not mimic the physiological cell behavior realistically. For instance, 2D culture models are thought to induce cancer stem cells (CSCs differentiation, a rare cancer cell subpopulation responsible for tumor initiation and relapse. This fact hinders the development of therapeutic strategies for tumors with a high relapse percentage, such as triple negative breast cancer (TNBC. Thus, three-dimensional (3D scaffolds have emerged as an attractive alternative to monolayer culture, simulating the extracellular matrix structure and maintaining the differentiation state of cells. In this work, scaffolds were fabricated through electrospinning different poly(ε-caprolactone-acetone solutions. Poly(ε-caprolactone (PCL meshes were seeded with triple negative breast cancer (TNBC cells and 15% PCL scaffolds displayed significantly (p < 0.05 higher cell proliferation and elongation than the other culture systems. Moreover, cells cultured on PCL scaffolds exhibited higher mammosphere forming capacity and aldehyde dehydrogenase activity than 2D-cultured cells, indicating a breast CSCs enrichment. These results prove the powerful capability of electrospinning technology in terms of poly(ε-caprolactone nanofibers fabrication. In addition, this study has demonstrated that electrospun 15% PCL scaffolds are suitable tools to culture breast cancer cells in a more physiological way and to expand the niche of breast CSCs. In conclusion, three-dimensional cell culture using PCL scaffolds could be useful to study cancer stem cell behavior and may also trigger the development of new specific targets against such malignant subpopulation.
Directory of Open Access Journals (Sweden)
Mee-Hae Kim
2017-10-01
Full Text Available In cell manufacturing, the establishment of a fully automated, microfluidic, cell culture system that can be used for long-term cell cultures, as well as for process optimization is highly desirable. This study reports the development of a novel chip bioreactor system that can be used for automated long-term maturation cultures of retinal pigment epithelial (RPE cells. The system consists of an incubation unit, a medium supply unit, a culture observation unit, and a control unit. In the incubation unit, the chip contains a closed culture vessel (2.5 mm diameter, working volume 9.1 μL, which can be set to 37 °C and 5% CO2, and uses a gas-permeable resin (poly- dimethylsiloxane as the vessel wall. RPE cells were seeded at 5.0 × 104 cells/cm2 and the medium was changed every day by introducing fresh medium using the medium supply unit. Culture solutions were stored either in the refrigerator or the freezer, and fresh medium was prepared before any medium change by warming to 37 °C and mixing. Automated culture was allowed to continue for 30 days to allow maturation of the RPE cells. This chip culture system allows for the long-term, bubble-free, culture of RPE cells, while also being able to observe cells in order to elucidate their cell morphology or show the presence of tight junctions. This culture system, along with an integrated on-line monitoring system, can therefore be applied to long-term cultures of RPE cells, and should contribute to process control in RPE cell manufacturing.
Wei, Wei; Xu, Chao; Ye, Zhi-Yong; Huang, Xiao-Jun; Yuan, Jia-En; Ma, Tian-Bao; Lin, Han-Biao; Chen, Xiu-Qiong
2016-10-25
The aim of the present study was to obtain the qualified hematopoietic stem/progenitor cells (HSC/HPC) and human umbilical cord-mesenchymal stem cells (MSC) in vitro in the co-culture system. Cord blood mononuclear cells were separated from umbilical cord blood by Ficoll lymphocyte separation medium, and then CD34 + HSC was collected by MACS immunomagnetic beads. The selected CD34 + HSC/HPC and MSC were transferred into culture flask. IMDM culture medium with 15% AB-type cord plasma supplemented with interleukin-3 (IL-3), IL-6, thrombopoietin (TPO), stem cell factor (SCF) and FMS-like tyrosine kinase 3 ligand (Flt-3L) factors were used as the co-culture system for the amplification of HSC/HPC and MSC. The cellular growth status and proliferation on day 6 and 10 after co-culture were observed by using inverted microscope. The percentage of positive expression of CD34 in HSC/HPC, as well as the percentages of positive expressions of CD105, CD90, CD73, CD45, CD34 and HLA-DR in the 4 th generation MSC, was tested by flow cytometry. Semisolid colony culture was used to test the HSC/HPC colony forming ability. The osteogenic, chondrogenesis and adipogenic ability of the 4 th generation MSC were assessed. The karyotype analysis of MSC was conducted by colchicines. The results demonstrated that the HSC/HPC of co-culture group showed higher ability of amplification, CFU-GM and higher CD34 + percentage compared with the control group. The co-cultured MSC maintained the ability to differentiate into bone cells, fat cells and chondrocytes. And the karyotype stability of MSC remained normal. These results reveal that the appropriate co-culture system for MSC and HSC is developed, and via this co-culture system we could gain both two kinds of these cells. The MSCs under the co-culture system maintain the biological characteristics. The CFU-GM ability, cell counting and the flow cytometry results of HSC/HPC under the co-culture system are conform to the criterion, showing that
Energy Technology Data Exchange (ETDEWEB)
Bulard, C; Mary, J; Chaumont, D; Gudin, C
1982-11-01
Myrtillocactus tissue cultures are grown from the epicotyl of young plantlets. With an appropriate growing medium it is possible, after transfer of fragments of these cultures to a liquid environment, to obtain dissociation and proliferation of cells. The production of betalaic pigments is induced in solid surroundings by adjustement of the growing medium composition and can be maintained in a liquid environment. The multiplication of pigmented cells in suspension may thus be obtained. The conversion of Asparagus cell suspensions from the heterotrophic state (use of lactose as source of carbon) to the autotrophic state (carbon supplied by CO/sub 2/) is obtained by a gradual reduction in the sugar concentration of the medium combined with a rise in the CO/sub 2/ content of the gas mixture atmosphere injected into the cultivator. The passage to the autotrophic state of a Myrtillocactus suspension would enable the production conditions of a metabolite (Betalaine) to be studied by micro-algae culture techniques.
Campylobacter jejuni induces diverse kinetics and profiles of cytokine genes in INT-407 cells
International Nuclear Information System (INIS)
Al-Amri, Ahlam I.; Bakhiet, Moiz O.; Botta, Giuseppe A.; Tabbara, Khaled S.; Ismaeel, Abdelrahman Y.; Al-Mahmeed, Ali E.; Bin Danya, Khalid M.
2008-01-01
Objective was to examine the kinetic ability of embryonic human epithelial INT-407 cells to express messenger ribonucleic acid (mRNA) for various cytokines and chemokines in response to Campylobacter jejuni (C. jejuni) stimulation. In an experimental single-blind study, cultured embryonic human epithelial INT-407 cells were treated with different concentrations of viable C. jejuni, its sonicated and filtered supernatant. A modified non-radioactive in situ hybridization using probe cocktails was used to measure mRNA levels for the pro-inflammatory cytokines interleukin (IL)-1beta, IL-6, interferon-gamma, tumor necrosis factor (TNF)-alpha, transforming growth factor (TGF)-beta1 and IL-8 and the anti-inflammatory cytokines, IL-4 and IL-10. The study was carried out from September 2005 to March 2007 at the Department of Microbiology, Immunology and Infectious Diseases, College of Medicine and Medical Sciences, Arabian Gulf University, Bahrain. Viable C. jejuni sonicated bacteria and filtered supernatant induced high mRNA expression for the pro-inflammatory cytokines IL-1 beta, IL-6, IFN-gama, TNF-alpha, TGF-beta and IL-8 which peaked at the 12 hours post stimulation. Anti-inflammatory cytokine IL-4 and IL-10 mNRA expression were induced maximally at 3 hours post stimulation mainly by sonicated bacteria and filtrated supernatant, however, not with living bacteria and filtrated supernatant, however, not with living bacteria. Untreated embryonic human epithelial INT-407 cells expressed low amount of mNRA for the various cytokines and chemokines at all time points. For each cytokine, 4 samples were used per time hour. This study demonstrated that embryonic human epithelial INT-407 cells in response to viable C. jejuni or its cytotxins can alter cytokine and chemokine mNRA expression patterns and kinetics suggesting a potential role for these mediators in the immunopathogenesis of the infection caused by this pathogen, which might be relevant for future immunotherapeutic
Hypoxic contraction of cultured pulmonary vascular smooth muscle cells
International Nuclear Information System (INIS)
Murray, T.R.; Chen, L.; Marshall, B.E.; Macarak, E.J.
1990-01-01
The cellular events involved in generating the hypoxic pulmonary vasoconstriction response are not clearly understood, in part because of the multitude of factors that alter pulmonary vascular tone. The goal of the present studies was to determine if a cell culture preparation containing vascular smooth muscle (VSM) cells could be made to contract when exposed to a hypoxic atmosphere. Cultures containing only fetal bovine pulmonary artery VSM cells were assessed for contractile responses to hypoxic stimuli by two methods. In the first, tension forces generated by cells grown on a flexible growth surface (polymerized polydimethyl siloxane) were manifested as wrinkles and distortions of the surface under the cells. Wrinkling of the surface was noted to progressively increase with time as the culture medium bathing the cells was made hypoxic (PO2 approximately 25 mmHg). The changes were sometimes reversible upon return to normoxic conditions and appeared to be enhanced in cells already exhibiting evidence of some baseline tone. Repeated passage in culture did not diminish the hypoxic response. Evidence for contractile responses to hypoxia was also obtained from measurements of myosin light chain (MLC) phosphorylation. Conversion of MLC to the phosphorylated species is an early step in the activation of smooth muscle contraction. Lowering the PO2 in the culture medium to 59 mmHg caused a 45% increase in the proportion of MLC in the phosphorylated form as determined by two-dimensional gel electrophoresis. Similarly, cultures preincubated for 4 h with 32P and then exposed to normoxia or hypoxia for a 5-min experimental period showed more than twice as much of the label in MLCs of the hypoxic cells
Contributions of 3D Cell Cultures for Cancer Research.
Ravi, Maddaly; Ramesh, Aarthi; Pattabhi, Aishwarya
2017-10-01
Cancer cell lines have contributed immensely in understanding the complex physiology of cancers. They are excellent material for studies as they offer homogenous samples without individual variations and can be utilised with ease and flexibility. Also, the number of assays and end-points one can study is almost limitless; with the advantage of improvising, modifying or altering several variables and methods. Literally, a new dimension to cancer research has been achieved by the advent of 3Dimensional (3D) cell culture techniques. This approach increased many folds the ways in which cancer cell lines can be utilised for understanding complex cancer biology. 3D cell culture techniques are now the preferred way of using cancer cell lines to bridge the gap between the 'absolute in vitro' and 'true in vivo'. The aspects of cancer biology that 3D cell culture systems have contributed include morphology, microenvironment, gene and protein expression, invasion/migration/metastasis, angiogenesis, tumour metabolism and drug discovery, testing chemotherapeutic agents, adaptive responses and cancer stem cells. We present here, a comprehensive review on the applications of 3D cell culture systems for these aspects of cancers. J. Cell. Physiol. 232: 2679-2697, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Evaluation of a dental pulp-derived cell sheet cultured on amniotic membrane substrate.
Honjo, Ken-ichi; Yamamoto, Toshiro; Adachi, Tetsuya; Amemiya, Takeshi; Mazda, Osam; Kanamura, Narisato; Kita, Masakazu
2015-01-01
Mesenchymal stem cells (MSC) are transplanted for periodontal tissue regeneration, and the periodontal ligament (PDL) is regenerated using a cultured cell sheet. This cultured cell sheet is prepared using PDL-derived cells, growth factors, and amniotic membrane (AM). Dental pulp (DP)-derived cells can be easily obtained from extracted wisdom teeth, proliferate rapidly, and are less susceptible to bacterial infection than PDL-derived cells. Thus, to prepare a novel cell sheet, DP-derived cells were cultured on AM as a culture substrate for immunohistochemical examination. Wisdom teeth extracted from three adults were cut along the cement-enamel border. DP tissue was collected, minced, and primarily cultured. After three or four passage cultures, DP-derived cells were cultured on AM, followed by hematoxylin-eosin (H-E) and immunofluorescence staining. DP-derived cells cultured on AM formed a layered structure. Cells positive for vimentin, Ki-67, ZO-1, desmoplakin, CD29, 44, 105 or 146, STRO-1, collagen IV or VII or laminin 5 or α5 chain were localized. DP-derived cells proliferated on AM, while retaining the properties of DP, which allowed the cultured cell sheet to be prepared. In addition, the cultured cell sheet contained MSC, which suggests its potential application in periodontal tissue regeneration.
Cytotoxicity of TSP in 3D Agarose Gel Cultured Cell.
Directory of Open Access Journals (Sweden)
Song-I Chun
Full Text Available A reference reagent, 3-(trimethylsilyl propionic-2, 2, 3, 3-d4 acid sodium (TSP, has been used frequently in nuclear magnetic resonance (NMR and magnetic resonance spectroscopy (MRS as an internal reference to identify cell and tissue metabolites, and determine chemical and protein structures. This reference material has been exploited for the quantitative and dynamic analyses of metabolite spectra acquired from cells. The aim of this study was to evaluate the cytotoxicity of TSP on three-dimensionally, agarose gel, cultured cells.A human osteosarcoma cell line (MG-63 was selected, and cells were three dimensionally cultured for two weeks in an agarose gel. The culture system contained a mixture of conventional culture medium and various concentrations (0, 1, 3, 5, 7, 10, 20 30 mM of TSP. A DNA quantification assay was conducted to assess cell proliferation using Quant-iT PicoGreen dsDNA reagent and kit, and cell viability was determined using a LIVE/DEAD Viability/Cytotoxicity kit. Both examinations were performed simultaneously at 1, 3, 7 and 14 days from cell seeding.In this study, the cytotoxicity of TSP in the 3D culture of MG-63 cells was evaluated by quantifying DNA (cell proliferation and cell viability. High concentrations of TSP (from 10 to 30 mM reduced both cell proliferation and viability (to 30% of the control after one week of exposure, but no such effects were found using low concentrations of TSP (0-10 mM.This study shows that low concentrations of TSP in 3D cell culture medium can be used for quantitative NMR or MRS examinations for up to two weeks post exposure.
Establishment and characterization of American elm cell suspension cultures
Steven M. Eshita; Joseph C. Kamalay; Vicki M. Gingas; Daniel A. Yaussy
2000-01-01
Cell suspension cultures of Dutch elm disease (DED)-tolerant and DED-susceptible American elms clones have been established and characterized as prerequisites for contrasts of cellular responses to pathogen-derived elicitors. Characteristics of cultured elm cell growth were monitored by A700 and media conductivity. Combined cell growth data for all experiments within a...
Directory of Open Access Journals (Sweden)
Imran S. Chaudhry
2011-01-01
Full Text Available The biological effects of only a finite number of tobacco toxins have been studied. Here, we describe exposure of cultures of human bronchial epithelial cells to low concentrations of tobacco carcinogens: nickel sulphate, benzo(bfluoranthene, N-nitrosodiethylamine, and 4-(methylnitrosamino-1-(3-pyridyl-1-butanone (NNK. After a 24-hour exposure, EGFR was expressed in cell membrane and cytoplasm, BCL-2 was expressed only in the irregular nuclei of large atypical cells, MKI67 was expressed in nuclei with no staining in larger cells, cytoplasmic BIRC5 with stronger nuclear staining was seen in large atypical cells, and nuclear TP53 was strongly expressed in all cells. After only a 24-hour exposure, cells exhibited atypical nuclear and cytoplasmic features. After a 48-hour exposure, EGFR staining was localized to the nucleus, BCL-2 was slightly decreased in intensity, BIRC5 was localized to the cytoplasm, and TP53 staining was increased in small and large cells. BCL2L1 was expressed in both the cytoplasm and nuclei of cells at 24- and 48-hour exposures. We illustrate that short-termexposure of a bronchial epithelial cell line to smoking-equivalent concentrations of tobacco carcinogens alters the expression of key proliferation regulatory genes, EGFR, BCL-2, BCL2L1, BIRC5, TP53, and MKI67, similar to that reported in biopsy specimens of pulmonary epithelium described to be preneoplastic lesions.
International Nuclear Information System (INIS)
Mori, K.J.; Izumi, Hiroko; Seto, Akira
1981-01-01
A culture system was established in which haemopoietic stem cells can undergo a recovery proliferation after a depletion of the stem cells, completely in vitro. To elucidate the source of the stimulatory factors, normal bone marrow cells were overlayed on top of the irradiated adherent 'stromal' cell colonies in the bone marrow cell culture. This stimulated the proliferation of haemopoietic stem cells in the cultured cells in suspension. The present results indicate that the stromal cells produce factors which stimulate stem cell proliferation. Whether the stimulation is evoked by direct cell-cell interactions or by humoral factors is as yet to be studied. (author)
Immunocytochemical characterization of primary cell culture in canine transmissible venereal tumor
Directory of Open Access Journals (Sweden)
Luis M.M. Flórez
Full Text Available Abstract: Immunochemistry with anti-vimentin, anti-lysozyme, anti-alpha 1 antitrypsin, anti-CD3 and anti-CD79α antibodies has been used for characterization of primary cell culture in the transmissible venereal tumor (TVT. Samples for primary cell culture and immunohistochemistry assays were taken from eight dogs with cytological and clinical diagnosis of TVT. To validate the immunochemical results in the primary cell culture of TVT, a chromosome count was performed. For the statistical analysis, the Mann-Whitney test with p<0.05 was used. TVT tissues and culture cells showed intense anti-vimentin immunoreactivity, lightly to moderate immunoreactivity for anti-lysozyme, and mild for anti-alpha-antitrypsin. No marking was achieved for CD3 and CD79α. All culture cells showed chromosomes variable number of 56 to 68. This is the first report on the use of immunocytochemical characterization in cell culture of TVT. Significant statistic difference between immunochemistry in tissue and culture cell was not established, what suggests that the use of this technique may provide greater certainty for the confirmation of tumors in the primary culture. This fact is particularly important because in vitro culture of tumor tissues has been increasingly used to provide quick access to drug efficacy and presents relevant information to identify potential response to anticancer medicine; so it is possible to understand the behavior of the tumor.
Irradiated murine fibroblasts as feeder layer used in human cell culture
International Nuclear Information System (INIS)
Almeida, Tiago L.; Klingbeil, Fatima G.; Yoshito, Daniele; Caproni, Priscila; Mathor, Monica B.; Herson, Marisa R.
2007-01-01
In 1975, Rheinwald and Green published an in vitro model for keratinocyte cell cultures in which the use of murine fibroblasts, as a feeder layer was introduced. These cells are modified fibroblasts, which presence render keratinocyte cells to remain proliferative for longer periods of time. This optimization of culture outputs has allowed for several clinical applications of confluent keratinocyte cultures as skin substitutes or wound dressings in situations such as post burn extensive skin loss, loss of oral mucosa, and other skin disorders. Nevertheless, proliferation of fibroblast in co-culture with keratinocytes must be controlled by anti-proliferative measures such as irradiation; at the same time, keratinocytes require specific nutrients in the culture medium, which may interfere with the fibroblast feeder layer viability. Therefore, the thorough understanding of the impact of different issues such as culture media composition, irradiation dose and pre-plating storage conditions of irradiated fibroblast to be used as feeder layer in these co-culture systems is important. In this work, changes as far as viability and proliferative rates of irradiated fibroblasts in culture were evaluated in relation to the type of culture medium used, dose of gamma radiation exposure, storage and timing of cell plating post irradiation. Results indicate that the type of culture medium used and time-lag between irradiation, refrigeration and plating of irradiated cells do not have significant impact in culture outcomes. However, the dose of gamma radiation administered to the cells may influence the final quality of these cells if to be used as a feeder layer. (author)
Dykes, Carrie; Wang, Jiong; Jin, Xia; Planelles, Vicente; An, Dong Sung; Tallo, Amanda; Huang, Yangxin; Wu, Hulin; Demeter, Lisa M
2006-06-01
Human immunodeficiency virus type 1 (HIV-1) replication efficiency or fitness, as measured in cell culture, has been postulated to correlate with clinical outcome of HIV infection, although this is still controversial. One limitation is the lack of high-throughput assays that can measure replication efficiency over multiple rounds of replication. We have developed a multiple-cycle growth competition assay to measure HIV-1 replication efficiency that uses flow cytometry to determine the relative proportions of test and reference viruses, each of which expresses a different reporter gene in place of nef. The reporter genes are expressed on the surface of infected cells and are detected by commercially available fluorescence-labeled antibodies. This method is less labor-intensive than those that require isolation and amplification of nucleic acids. The two reporter gene products are detected with similar specificity and sensitivity, and the proportion of infected cells in culture correlates with the amount of viral p24 antigen produced in the culture supernatant. HIV replication efficiencies of six different drug-resistant site-directed mutants were reproducibly quantified and were similar to those obtained with a growth competition assay in which the relative proportion of each variant was measured by sequence analysis, indicating that recombination between the pol and reporter genes was negligible. This assay also reproducibly quantified the relative fitness conferred by protease and reverse transcriptase sequences containing multiple drug resistance mutations, amplified from patient plasma. This flow cytometry-based growth competition assay offers advantages over current assays for HIV replication efficiency and should prove useful for the evaluation of patient samples in clinical trials.
Animal-cell culture media: History, characteristics, and current issues.
Yao, Tatsuma; Asayama, Yuta
2017-04-01
Cell culture technology has spread prolifically within a century, a variety of culture media has been designed. This review goes through the history, characteristics and current issues of animal-cell culture media. A literature search was performed on PubMed and Google Scholar between 1880 and May 2016 using appropriate keywords. At the dawn of cell culture technology, the major components of media were naturally derived products such as serum. The field then gradually shifted to the use of chemical-based synthetic media because naturally derived ingredients have their disadvantages such as large batch-to-batch variation. Today, industrially important cells can be cultured in synthetic media. Nevertheless, the combinations and concentrations of the components in these media remain to be optimized. In addition, serum-containing media are still in general use in the field of basic research. In the fields of assisted reproductive technologies and regenerative medicine, some of the medium components are naturally derived in nearly all instances. Further improvements of culture media are desirable, which will certainly contribute to a reduction in the experimental variation, enhance productivity among biopharmaceuticals, improve treatment outcomes of assisted reproductive technologies, and facilitate implementation and popularization of regenerative medicine.
Bertho, Jean Marc; Demarquay, Christelle; Mouiseddine, Moubarak; Douenat, Noémie; Stefani, Johanna; Prat, Marie; Paquet, François
2008-08-01
To define the ability of human bone marrow (BM) stromal cells to produce fms-like tyrosine kinase 3 (Flt3)-ligand (FL), and the effect of irradiation, tumour necrosis factor-alpha (TNFalpha) or tumour growth factor beta (TGFbeta) on FL production. Primary BM stromal cell cultures were irradiated at 2-10 Gy or were stimulated with TNFalpha or TGFbeta1. The presence of FL was tested in culture supernatants and in cell lysate. The presence of a membrane-bound form of FL and the level of gene expression were also tested. Primary BM stromal cells spontaneously released FL. This production was increased by TNFalpha but not by TGFbeta1 or by irradiation. Chemical induction of osteoblastic differentiation from BM stromal cells also induced an increase in FL release. Our results suggest that the observed increase in FL concentration after in vivo irradiation is an indirect effect. The possible implication of BM stromal cells in these mechanisms is discussed.
Cell Culture Assay for Human Noroviruses [response
Energy Technology Data Exchange (ETDEWEB)
Straub, Tim M.; Honer Zu Bentrup, Kerstin; Orosz Coghlan, Patricia; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza A.; Nickerson, Cheryl A.
2007-07-01
We appreciate the comments provided by Leung et al., in response to our recently published article “In Vitro Cell Culture Infectivity Assay for Human Noroviruses” by Straub et al. (1). The specific aim of our project was to develop an in vitro cell culture infectivity assay for human noroviruses (hNoV) to enhance risk assessments when they are detected in water supplies. Reverse transcription (RT) qualitative or quantitative PCR are the primary assays for waterborne NoV monitoring. However, these assays cannot distinguish between infectious vs. non-infectious virions. When hNoV is detected in water supplies, information provided by our infectivity assay will significantly improve risk assessment models and protect human health, regardless of whether we are propagating NoV. Indeed, in vitro cell culture infectivity assays for the waterborne pathogen Cryptosporidium parvum that supplement approved fluorescent microscopy assays, do not result in amplification of the environmentally resistant hard-walled oocysts (2). However, identification of life cycle stages in cell culture provides evidence of infectious oocysts in a water supply. Nonetheless, Leung et al.’s assertion regarding the suitability of our method for the in vitro propagation of high titers of NoV is valid for the medical research community. In this case, well-characterized challenge pools of virus would be useful for developing and testing diagnostics, therapeutics, and vaccines. As further validation of our published findings, we have now optimized RT quantitative PCR to assess the level of viral production in cell culture, where we are indeed finding significant increases in viral titer. The magnitude and time course of these increases is dependent on both virus strain and multiplicity of infection. We are currently preparing a manuscript that will discuss these findings in greater detail, and the implications this may have for creating viral challenge pools
Rheological characteristics of cell suspension and cell culture of Perilla frutescens.
Zhong, J J; Seki, T; Kinoshita, S; Yoshida, T
1992-12-05
Physical properties such as viscosity, fluid dynamic behavior of cell suspension, and size distribution of cell aggregates of a plant, Perilla frustescens, cultured in a liquid medium were studied. As a result of investigations using cells harvester after 12 days of cultivation in a flask, it was found that the apparent viscosity of the cell suspension did not change with any variation of cell concentration below 5 g dry cell/L but markedly increased when the cell concentration increased over 12.8 g dry cell/L. The cell suspension exhibited the characteristics of a Bingham plastic fluid with a small yield stress. The size of cell aggregates in the range 74 to 500 mum did not influence the rheological characteristics of the cell suspension. The rheological characteristics of cultivation mixtures of P. frutescens cultivated in a flask and in a bioreactor were also investigated. The results showed that the flow characteristics of the cell culture could be described by a Bingham plastic model. At the later stage of cultivation, the apparent viscosity increased steadily, even though the biomass concentration (by dry weight) decreased, due to the increase of individual cell size. (c) 1992 John Wiley & Sons, Inc.
International Nuclear Information System (INIS)
Zhang, Fenxi; Hong, Yan; Liang, Wenmei; Ren, Tongming; Jing, Suhua; Lin, Juntang
2012-01-01
Highlights: ► Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). ► Presence of SCs dramatically increased proliferation and migration of UCMSCs. ► Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of “nurse” cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.
Endothelial cells stimulate growth of normal and cancerous breast epithelial cells in 3D culture
Directory of Open Access Journals (Sweden)
Magnusson Magnus K
2010-07-01
Full Text Available Abstract Background Epithelial-stromal interaction provides regulatory signals that maintain correct histoarchitecture and homeostasis in the normal breast and facilitates tumor progression in breast cancer. However, research on the regulatory role of the endothelial component in the normal and malignant breast gland has largely been neglected. The aim of the study was to investigate the effects of endothelial cells on growth and differentiation of human breast epithelial cells in a three-dimensional (3D co-culture assay. Methods Breast luminal and myoepithelial cells and endothelial cells were isolated from reduction mammoplasties. Primary cells and established normal and malignant breast cell lines were embedded in reconstituted basement membrane in direct co-culture with endothelial cells and by separation of Transwell filters. Morphogenic and phenotypic profiles of co-cultures was evaluated by phase contrast microscopy, immunostaining and confocal microscopy. Results In co-culture, endothelial cells stimulate proliferation of both luminal- and myoepithelial cells. Furthermore, endothelial cells induce a subpopulation of luminal epithelial cells to form large acini/ducts with a large and clear lumen. Endothelial cells also stimulate growth and cloning efficiency of normal and malignant breast epithelial cell lines. Transwell and gradient co-culture studies show that endothelial derived effects are mediated - at least partially - by soluble factors. Conclusion Breast endothelial cells - beside their role in transporting nutrients and oxygen to tissues - are vital component of the epithelial microenvironment in the breast and provide proliferative signals to the normal and malignant breast epithelium. These growth promoting effects of endothelial cells should be taken into consideration in breast cancer biology.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Fenxi, E-mail: fxzhang0824@gmail.com [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Hong, Yan; Liang, Wenmei [Department of Histology and Embryology, Guiyang Medical University, Guizhou 550004, People' s Republic of China (China); Ren, Tongming [Department of Anatomy, Sanquan College, Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Jing, Suhua [ICU Center, The Third Hospital of Xinxiang Medical University, Henan 453003, People' s Republic of China (China); Lin, Juntang [Stem Cell Center, Xinxiang Medical University, Henan 453003, People' s Republic of China (China)
2012-10-12
Highlights: Black-Right-Pointing-Pointer Co-culture of Sertoli cells (SCs) with human umbilical cord mesenchymal stem cells (UCMSCs). Black-Right-Pointing-Pointer Presence of SCs dramatically increased proliferation and migration of UCMSCs. Black-Right-Pointing-Pointer Presence of SCs stimulated expression of Mdm2, Akt, CDC2, Cyclin D, CXCR4, MAPKs. -- Abstract: Human umbilical cord mesenchymal stem cells (hUCMSCs) have been recently used in transplant therapy. The proliferation and migration of MSCs are the determinants of the efficiency of MSC transplant therapy. Sertoli cells are a kind of 'nurse' cells that support the development of sperm cells. Recent studies show that Sertoli cells promote proliferation of endothelial cells and neural stem cells in co-culture. We hypothesized that co-culture of UCMSCs with Sertoli cells may also promote proliferation and migration of UCMSCs. To examine this hypothesis, we isolated UCMSCs from human cords and Sertoli cells from mouse testes, and co-cultured them using a Transwell system. We found that UCMSCs exhibited strong proliferation ability and potential to differentiate to other cell lineages such as osteocytes and adipocytes. The presence of Sertoli cells in co-culture significantly enhanced the proliferation and migration potential of UCMSCs (P < 0.01). Moreover, these phenotypic changes were accompanied with upregulation of multiple genes involved in cell proliferation and migration including phospho-Akt, Mdm2, phospho-CDC2, Cyclin D1, Cyclin D3 as well as CXCR4, phospho-p44 MAPK and phospho-p38 MAPK. These findings indicate that Sertoli cells boost UCMSC proliferation and migration potential.
Directory of Open Access Journals (Sweden)
Alec Chabwinja
2017-10-01
Full Text Available Objective: To investigate the antifungal activity of crude cultures of putative strains of lactic acid bacteria (LAB from a selection of Zimbabwean traditional and commercial food/ medicinal products against yeasts (strains of environmental isolates of Candida albicans and Rhodotorula spp.. Methods: Cultures of putative LAB from our selection of fermented products were enriched in de Man, Rogosa and Sharpe and isolated on de Man, Rogosa and Sharpe agar. Results: The crude microbial cultures from the products that showed high antifungal activities (zone of inhibition, mm were as follows: supernatant-free microbial pellet (SFMP from an extract of Melia azedarach leaves [(27.0 ± 2.5 mm] > cell-free culture supernatants (CFCS from Maaz Dairy sour milk and Mnandi sour milk [approximately (26.0 ± 1.8/2.5 mm] > CFCS and SFMP from Amansi hodzeko [(25.0 ± 1.5 mm] > CFCS from Parinari curatellifolia fruit [(24.0 ± 1.5 mm], SFMP from Parinari curatellifolia fruit [(24.0 ± 1.4 mm] and SFMP from mahewu [(20.0 ± 1.5 mm]. These cultures also showed high tolerance to acidic conditions (pH 4.0 and pH 5.0. However, culture from WAYA LGG (shown elsewhere to harbour antimicrobial activities showed no antifungal activity. The LAB could have inhibited yeasts by either competitive exclusion or the release of antimicrobial metabolites. Conclusions: Our cultures of LAB from a selection of Zimbabwean fermented products, especially Ziziphus mauritiana and fermented milk products have great potential for use as antifungal probiotics against yeast infections. Studies are ongoing to determine the exact mechanisms that are employed by the putative LAB to inhibit Candida albicans.
International Nuclear Information System (INIS)
Yamada, Y; Umegaki, G; Kawashima, T; Nagai, M; Shibata, T; Masuzawa, T; Kimura, T; Kishida, A
2012-01-01
In order to realize a cell culture microdevice actuated by piezoelectric thin films for on-chip regulation of cell functions, this paper reported on a feasibility study by using the microdevice with KOH-etched cavities surrounded by four (111) sidewalls as microchambers in order to introduce cells to be cultured. As a result, the vibration characteristic of the PZT actuator was improved by using an electric field -150 kV/cm at 70 C for 30 min in poling process. A feasibility study on cell culture for delivering mechanical vibratory stimuli to cells revealed the microdevice could be applicable to the culture with actual biological cells. In addition, it was found that O 2 -plasma treated parylene-C process could be applicable for obtaining homogeneous surface of cell culture microdevice.
Impact of nicotine on the interplay between human periodontal ligament cells and CD4+ T cells.
Ge, Xin; Liu, Ying-Feng; Wong, Yong; Wu, Li-Zheng; Tan, Ling; Liu, Fen; Wang, Xiao-Jing
2016-09-01
Periodontitis is a common infectious disease associated with destruction of periodontal ligaments and alveolar bones. CD4(+) T cell-mediated immune response is involved in the progression of periodontitis. Tobacco consumption increases the risk of periodontal disease. However, the impact of nicotine on the interaction between human periodontal ligament (PDL) cells and CD4(+) T cells remains unrevealed. Our study aims to investigate the effect of nicotine on PDL cells and the cocultured CD4(+) T cells. The PDL cell cultures were established by explants from healthy individuals, exposed to nicotine or α-bungarotoxin (α-BTX), and incubated solely or in combination with CD4(+) T cells. Afterwards, cell viability, secreted cytokines, and matrix metalloproteinases (MMPs) were evaluated. In monoculture of PDL cells, nicotine dramatically repressed cell viability and increased apoptosis. Meanwhile, α-BTX largely reversed the nicotine-induced apoptosis and increased viability of PDL cells. Compared with the monoculture, MMP-1, MMP-3, interleukin (IL)-1β, IL-6, IL-17, and IL-21 in supernatant of cocultures were markedly elevated after treatment with nicotine. Moreover, α-BTX significantly attenuated nicotine-triggered production of these components either in mono- or co-cultures. In addition, PDL cell-derived CXCL12 following nicotine treatment recruited CD4(+) T cells. Above all, nicotine deteriorated periodontitis partially by promoting PDL cell-CD4(+) T cell-mediated inflammatory response and matrix degradation. © The Author(s) 2015.
Microfluidic Cell Culture Device
Takayama, Shuichi (Inventor); Cabrera, Lourdes Marcella (Inventor); Heo, Yun Seok (Inventor); Smith, Gary Daniel (Inventor)
2014-01-01
Microfluidic devices for cell culturing and methods for using the same are disclosed. One device includes a substrate and membrane. The substrate includes a reservoir in fluid communication with a passage. A bio-compatible fluid may be added to the reservoir and passage. The reservoir is configured to receive and retain at least a portion of a cell mass. The membrane acts as a barrier to evaporation of the bio-compatible fluid from the passage. A cover fluid may be added to cover the bio-compatible fluid to prevent evaporation of the bio-compatible fluid.
Novel culturing platform for brain slices and neuronal cells
DEFF Research Database (Denmark)
Svendsen, Winnie Edith; Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya
2015-01-01
In this paper we demonstrate a novel culturing system for brain slices and neuronal cells, which can control the concentration of nutrients and the waste removal from the culture by adjusting the fluid flow within the device. The entire system can be placed in an incubator. The system has been...... tested successfully with brain slices and PC12 cells. The culture substrate can be modified using metal electrodes and/or nanostructures for conducting electrical measurements while culturing and for better mimicking the in vivo conditions....
Effectors of Th1 and Th17 cells act on astrocytes and augment their neuroinflammatory properties.
Prajeeth, Chittappen K; Kronisch, Julius; Khorooshi, Reza; Knier, Benjamin; Toft-Hansen, Henrik; Gudi, Viktoria; Floess, Stefan; Huehn, Jochen; Owens, Trevor; Korn, Thomas; Stangel, Martin
2017-10-16
Autoreactive Th1 and Th17 cells are believed to mediate the pathology of multiple sclerosis in the central nervous system (CNS). Their interaction with microglia and astrocytes in the CNS is crucial for the regulation of the neuroinflammation. Previously, we have shown that only Th1 but not Th17 effectors activate microglia. However, it is not clear which cells are targets of Th17 effectors in the CNS. To understand the effects driven by Th17 cells in the CNS, we induced experimental autoimmune encephalomyelitis in wild-type mice and CD4 + T cell-specific integrin α4-deficient mice where trafficking of Th1 cells into the CNS was affected. We compared microglial and astrocyte response in the brain and spinal cord of these mice. We further treated astrocytes with supernatants from highly pure Th1 and Th17 cultures and assessed the messenger RNA expression of neurotrophic factors, cytokines and chemokines, using real-time PCR. Data obtained was analyzed using the Kruskal-Wallis test. We observed in α4-deficient mice weak microglial activation but comparable astrogliosis to that of wild-type mice in the regions of the brain populated with Th17 infiltrates, suggesting that Th17 cells target astrocytes and not microglia. In vitro, in response to supernatants from Th1 and Th17 cultures, astrocytes showed altered expression of neurotrophic factors, pro-inflammatory cytokines and chemokines. Furthermore, increased expression of chemokines in Th1- and Th17-treated astrocytes enhanced recruitment of microglia and transendothelial migration of Th17 cells in vitro. Our results demonstrate the delicate interaction between T cell subsets and glial cells and how they communicate to mediate their effects. Effectors of Th1 act on both microglia and astrocytes whereas Th17 effectors preferentially target astrocytes to promote neuroinflammation.
Peptide Hydrogelation and Cell Encapsulation for 3D Culture of MCF-7 Breast Cancer Cells
Sun, Xiuzhi S.; Nguyen, Thu A.
2013-01-01
Three-dimensional (3D) cell culture plays an invaluable role in tumor biology by providing in vivo like microenviroment and responses to therapeutic agents. Among many established 3D scaffolds, hydrogels demonstrate a distinct property as matrics for 3D cell culture. Most of the existing pre-gel solutions are limited under physiological conditions such as undesirable pH or temperature. Here, we report a peptide hydrogel that shows superior physiological properties as an in vitro matrix for 3D cell culture. The 3D matrix can be accomplished by mixing a self-assembling peptide directly with a cell culture medium without any pH or temperature adjustment. Results of dynamic rheological studies showed that this hydrogel can be delivered multiple times via pipetting without permanently destroying the hydrogel architecture, indicating the deformability and remodeling ability of the hydrogel. Human epithelial cancer cells, MCF-7, are encapsulated homogeneously in the hydrogel matrix during hydrogelation. Compared with two-dimensional (2D) monolayer culture, cells residing in the hydrogel matrix grow as tumor-like clusters in 3D formation. Relevant parameters related to cell morphology, survival, proliferation, and apoptosis were analyzed using MCF-7 cells in 3D hydrogels. Interestingly, treatment of cisplatin, an anti-cancer drug, can cause a significant decrease of cell viability of MCF-7 clusters in hydrogels. The responses to cisplatin were dose- and time-dependent, indicating the potential usage of hydrogels for drug testing. Results of confocal microscopy and Western blotting showed that cells isolated from hydrogels are suitable for downstream proteomic analysis. The results provided evidence that this peptide hydrogel is a promising 3D cell culture material for drug testing. PMID:23527204
Dynamic cell culture system (7-IML-1)
Cogoli, Augusto
1992-01-01
This experiment is one of the Biorack experiments being flown on the International Microgravity Laboratory 1 (MIL-1) mission as part of an investigation studying cell proliferation and performance in space. One of the objectives of this investigation is to assess the potential benefits of bioprocessing in space with the ultimate goal of developing a bioreactor for continuous cell cultures in space. This experiment will test the operation of an automated culture chamber that was designed for use in a Bioreactor in space. The device to be tested is called the Dynamic Cell Culture System (DCCS). It is a simple device in which media are renewed or chemicals are injected automatically, by means of osmotic pumps. This experiment uses four Type I/O experiment containers. One DCCS unit, which contains a culture chamber with renewal of medium and a second chamber without a medium supply fits in each container. Two DCCS units are maintained under zero gravity conditions during the on-orbit period. The other two units are maintained under 1 gh conditions in a 1 g centrifuge. The schedule for incubator transfer is given.
Indirect induction of endothelial cell injury by PU- or PTFE-mediated activation of monocytes.
Liu, Xin; Xue, Yang; Sun, Jiao
2010-01-01
Polyurethanes (PUs) and polytetrafluoroethylene (PTFE) are widely used for making cardiovascular devices, but thrombus formation on the surfaces of these devices is inevitable. Since endothelial injury can lead to thrombosis, most of the studies on PUs or PTFE focused on their damage to endothelial cells. However, few studies have attempted to clarify whether the use of foreign objects as biomaterials can cause endothelial injury by activating the innate immune system. In this study, we aimed to investigate the roles of PU- or PTFE-stimulated immune cells in endothelial-cell injury. First, monocytes (THP-1 cells) were stimulated with PU or PTFE for 24 h and, subsequently, human umbilical vein endothelial cells (HUVECs) were treated with the supernatants of the stimulated cells for 24 h. We measured the generation of intracellular reactive oxygen species (ROS) from THP-1 cells treated with PU and PTFE for 24 h, meanwhile hydrogen dioxide (H(2)O(2)), tumor necrosis factor (TNF)-α and interleukin (IL)-1β in the supernatants were also detected. Then, we assessed the apoptosis rate of the HUVECs and determined the expression of NO, inducible nitric oxide synthase (iNOS), and apoptosis-related proteins (p53, Bax, Bcl-2) in the HUVECs. The results showed that large amounts of ROS and low levels of pro-inflammatory cytokines (TNF-α and IL-1β) were produced by the stimulated THP-1 cells. After culturing with the supernatants of the PU- or PTFE-stimulated THP-1 cells, the apoptosis rate, NO production and expression of iNOS, p53 and Bax in the HUVECs were up-regulated, while Bcl-2 expression was down-regulated. In conclusion, the release of ROS by PU- or PTFE-treated THP-1 cells may induce iNOS expression and cause apoptosis in HUVECs via the p53, Bax and Bcl-2 proteins. These data provide the interesting finding that endothelial injury in the process of biomaterial-induced thrombosis can be initiated through the release of soluble mediators by monocytes.
Directory of Open Access Journals (Sweden)
Wei Zhang
Full Text Available It has been reported that Annexin A2 (ANXA2 is up-regulated in hepatocellular carcinoma (HCC, but the roles of ANXA2 in the migration and invasion of HCC cells have not been determined. In this study, we found that ANXA2-specific siRNA (si-ANXA2 significantly inhibited the migration and invasion of HCC cells co-cultured with fibroblasts in vitro. In addition, the production of MMP-2 by fibroblasts cultured in supernatant collected from si-ANXA2-transfected HCC cells was notably down-regulated. ANXA2 was also found to be co-localized and co-immunoprecipitated with CD147. Further investigation revealed that the expression of ANXA2 in HCC cells affected the shedding of CD147-harboring membrane microvesicles, acting as a vehicle for CD147 in tumor-stromal interactions and thereby regulating the production of MMP-2 by fibroblasts. Together, these results suggest that ANXA2 enhances the migration and invasion potential of HCC cells in vitro by regulating the trafficking of CD147-harboring membrane microvesicles.
Trivalent MDCK cell culture-derived influenza vaccine Optaflu (Novartis Vaccines).
Doroshenko, Alexander; Halperin, Scott A
2009-06-01
Annual influenza epidemics continue to have a considerable impact in both developed and developing countries. Vaccination remains the principal measure to prevent seasonal influenza and reduce associated morbidity and mortality. The WHO recommends using established mammalian cell culture lines as an alternative to egg-based substrates in the manufacture of influenza vaccine. In June 2007, the EMEA approved Optaflu, a Madin Darby canine kidney cell culture-derived influenza vaccine manufactured by Novartis Vaccines. This review examines the advantages and disadvantages of cell culture-based technology for influenza vaccine production, compares immunogenicity and safety data for Optaflu with that of currently marketed conventional egg-based influenza vaccines, and considers the prospects for wider use of cell culture-based influenza vaccines.
Fabrication of cell-benign inverse opal hydrogels for three-dimensional cell culture.
Im, Pilseon; Ji, Dong Hwan; Kim, Min Kyung; Kim, Jaeyun
2017-05-15
Inverse opal hydrogels (IOHs) for cell culture were fabricated and optimized using calcium-crosslinked alginate microbeads as sacrificial template and gelatin as a matrix. In contrast to traditional three-dimensional (3D) scaffolds, the gelatin IOHs allowed the utilization of both the macropore surface and inner matrix for cell co-culture. In order to remove templates efficiently for the construction of 3D interconnected macropores and to maintain high cell viability during the template removal process using EDTA solution, various factors in fabrication, including alginate viscosity, alginate concentration, alginate microbeads size, crosslinking calcium concentration, and gelatin network density were investigated. Low viscosity alginate, lower crosslinking calcium ion concentration, and lower concentration of alginate and gelatin were found to obtain high viability of cells encapsulated in the gelatin matrix after removal of the alginate template by EDTA treatment by allowing rapid dissociation and diffusion of alginate polymers. Based on the optimized fabrication conditions, gelatin IOHs showed good potential as a cell co-culture system, applicable to tissue engineering and cancer research. Copyright © 2017 Elsevier Inc. All rights reserved.
Yeatts, Andrew B; Choquette, Daniel T; Fisher, John P
2013-02-01
Mesenchymal stem cells (MSCs) are a promising cell source for bone and cartilage tissue engineering as they can be easily isolated from the body and differentiated into osteoblasts and chondrocytes. A cell based tissue engineering strategy using MSCs often involves the culture of these cells on three-dimensional scaffolds; however the size of these scaffolds and the cell population they can support can be restricted in traditional static culture. Thus dynamic culture in bioreactor systems provides a promising means to culture and differentiate MSCs in vitro. This review seeks to characterize key MSC differentiation signaling pathways and provides evidence as to how dynamic culture is augmenting these pathways. Following an overview of dynamic culture systems, discussion will be provided on how these systems can effectively modify and maintain important culture parameters including oxygen content and shear stress. Literature is reviewed for both a highlight of key signaling pathways and evidence for regulation of these signaling pathways via dynamic culture systems. The ability to understand how these culture systems are affecting MSC signaling pathways could lead to a shear or oxygen regime to direct stem cell differentiation. In this way the efficacy of in vitro culture and differentiation of MSCs on three-dimensional scaffolds could be greatly increased. Bioreactor systems have the ability to control many key differentiation stimuli including mechanical stress and oxygen content. The further integration of cell signaling investigations within dynamic culture systems will lead to a quicker realization of the promise of tissue engineering and regenerative medicine. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Radiation adaptive response for the growth of cultured glial cells
International Nuclear Information System (INIS)
Suzuki, S.; Miura, Y.; Kano, M.; Toda, T.; Urano, S.
2003-01-01
Full text: To examine the molecular mechanism of radiation adaptive response (RAR) for the growth of cultured glial cells and to investigate the influence of aging on the response, glial cells were cultured from young and aged rats (1 month and 24 months old). RAR for the growth of glial cells conditioned with a low dose of X-rays and subsequently exposed to a high dose of X-rays was examined for cell number and BrdU incorporation. Involvement of the subcellular signaling pathway factors in RAR was investigated using their inhibitors, activators and mutated glial cells. RAR was observed in cells cultured from young rats, but was not in cells from aged rats. The inhibitors of protein kinase C (PKC) and DNA-dependent protein kinase (DNA-PK) or phosphatidylinositol 3-kinase (PI3K) suppressed RAR. The activators of PKC instead of low dose irradiation also caused RAR. Moreover, glial cells cultured from severe combined immunodeficiency (scid) mice (CB-17 scid) and ataxia-telangiectasia (AT) cells from AT patients showed no RAR. These results indicated that PKC, ATM, DNAPK and/or PI3K were involved in RAR for growth and BrdU incorporation of cultured glial cells and RAR decreased with aging. Proteomics data of glial cells exposed to severe stress of H 2 O 2 or X-rays also will be presented in the conference since little or no difference has not been observed with slight stress yet
LENUS (Irish Health Repository)
Corcoran, T B
2012-02-03
BACKGROUND: Reperfusion injury is characterized by free radical production and endothelial inflammation. Neutrophils mediate much of the end-organ injury that occurs, requiring P-selectin-mediated neutrophil-endothelial adhesion, and this is associated with decreased endothelial nitric oxide production. Propofol has antioxidant properties in vitro which might abrogate this inflammation. METHODS: Cultured human umbilical vein endothelial cells were exposed to 20 h of hypoxia and then returned to normoxic conditions. Cells were treated with saline, Diprivan 5 microg\\/l or propofol 5 microg\\/l for 4 h after re-oxygenation and were then examined for P-selectin expression and supernatant nitric oxide concentrations for 24 h. P-selectin was determined by flow cytometry, and culture supernatant nitric oxide was measured as nitrite. RESULTS: In saline-treated cells, a biphasic increase in P-selectin expression was demonstrated at 30 min (P = 0.01) and 4 h (P = 0.023) after re-oxygenation. Propofol and Diprivan prevented these increases in P-selectin expression (P < 0.05). Four hours after re-oxygenation, propofol decreased endothelial nitric oxide production (P = 0.035). CONCLUSION: This is the first study to demonstrate an effect of propofol upon endothelial P-selectin expression. Such an effect may be important in situations of reperfusion injury such as cardiac transplantation and coronary artery bypass surgery. We conclude that propofol attenuates re-oxygenation-induced endothelial inflammation in vitro.
Synergic production of neutrophil chemotactic activity by colonic epithelial cells and eosinophils.
Dent, Gordon; Loweth, Sam C; Hasan, Anwar Matar; Leslie, Fiona M
2014-10-01
The presence of eosinophils in the lumen and mucosa of the intestine is characteristic of both ulcerative colitis (UC) and Crohn's disease (CD). There is evidence of eosinophil activation in the intestine during acute inflammatory episodes of these diseases; these episodes are also characterized by an influx of neutrophils, which have the potential to cause extensive tissue damage. We undertook a study to determine whether eosinophils in contact with colonic epithelial cells produce factors that may attract neutrophils in response to immunological stimulation. Neutrophil chemotactic activity (NCA) and concentrations of three neutrophil-attracting CXC chemokines - CXCL1 (Groα), CXCL5 (Ena78) and CXCL8 (IL8) - were measured in supernatants of T84 colonic epithelial cells and blood eosinophils or eosinophil-like myeloid leukaemia cells (AML14.3D10), alone or in combination. Cells were stimulated with serum-opsonized zymosan (OZ) particles. NCA (Peosinophil co-cultures were significantly higher than in the supernatants of either cell type alone. Release of CXCL1 (Peosinophils but not higher than from OZ-stimulated epithelial cells. Eosinophils and colonic epithelial cells exhibit synergy in production of neutrophil chemoattractants in response to immunological stimulation. This may represent a mechanism for exaggerated recruitment of neutrophils to the intestine in response to acute infection in conditions that are characterized by the presence of eosinophils in the bowel. Copyright © 2014 Elsevier GmbH. All rights reserved.
Rakers, Sebastian; Klinger, Matthias; Kruse, Charli; Gebert, Marina
2011-12-01
Here, we report the establishment of a permanent skin cell culture from rainbow trout (Oncorhynchus mykiss). The cells of the fish skin cell culture could be propagated over 60 passages so far. Furthermore, we show for the first time that it is possible to integrate freshly harvested rainbow trout scales into this new fish skin cell culture. We further demonstrated that epithelial cells derived from the scales survived in the artificial micro-environment of surrounding fibroblast-like cells. Also, antibody staining indicated that both cell types proliferated and started to build connections with the other cell type. It seems that it is possible to generate an 'artificial skin' with two different cell types. This could lead to the development of a three-dimensional test system, which might be a better in vitro representative of fish skin in vivo than individual skin cell lines. Copyright © 2011 Elsevier GmbH. All rights reserved.
Preparation of labelled lipids by the use of plant cell cultures
International Nuclear Information System (INIS)
Mangold, H.K.
1978-01-01
The preparation of some radioacitvely labelled lipids by the use of plant cell cultures is discussed and further applications of the new method are suggested. Cell suspension cultures of rape (Brassica napus) and soya (Glycine max) have been used for the preparation of lipids labelled with radioisotopes. Radioactive acetic acid as well as various long-chain fatty acids are readily incorporated into the neutral and ionic lipids of plant cell cultures. In addition, 14 C-labelled glycerol, ethanolamine and choline are well utilized by the cells. Randomly labelled lipids have been obtained by incubating cell suspension cultures of rape and soya with [1- 14 C] acetic acid, and uniformly labelled lipids have been isolated from cultures that had been incubated with a mixture of [1- 14 C] acetic acid plus [2- 14 C] acetic acid. The use of techniques of plant cell cultures for the preparation of lipds labelled with stable or radioactive isotopesappears particularly rewarding because the uptake of precursors by the cells and their incorporation into various lipid compounds proceeds rapidly and often quanitatively.This new approach should be useful also for the biosynthesis of lipids whose acyl moieties contain a spn radical, a fluorescent group, or a light-sensitive label. Thus, plant cell cultures constitute valuable new tools for the biosynthetic preparation of a great variety of labelled lipids. (A.G.)
Alevizos, Michail; Karagkouni, Anna; Vasiadi, Magdalini; Sismanopoulos, Nikolaos; Makris, Michael; Kalogeromitros, Dimitrios; Theoharides, Theoharis C
2013-12-01
Mast cells are involved in allergy and inflammation by the secretion of multiple mediators, including histamine, cytokines, and platelet-activating factor (PAF), in response to different triggers, including emotional stress. PAF has been associated with allergic inflammation, but there are no clinically available PAF inhibitors. To investigate whether PAF could stimulate human mast cell mediator release and whether rupatadine (RUP), a dual histamine-1 and PAF receptor antagonist, could inhibit the effect of PAF on human mast cells. Laboratory of allergic diseases 2 cultured mast cells were stimulated with PAF (0.001, 0.01, and 0.1 μmol/L) and substance P (1 μmol/L) with or without pretreatment with RUP (2.5 and 25 μmol/L), which was added 10 minutes before stimulation. Release of β-hexosaminidase was measured in supernatant fluid by spectrophotoscopy, and histamine, interleukin-8, and tumor necrosis factor were measured by enzyme-linked immunosorbent assay. PAF stimulated a statistically significant release of histamine, interleukin-8, and tumor necrosis factor (0.001-0.1 μmol/L) that was comparable to that stimulated by substance P. Pretreatment with RUP (25 μmol/L) for 10 minutes inhibited this effect. In contrast, pretreatment of laboratory of allergic diseases 2 cells with diphenhydramine (25 μmol/L) did not inhibit mediator release, suggesting that the effect of RUP was not due to its antihistaminic effect. PAF stimulates human mast cell release of proinflammatory mediators that is inhibited by RUP. This action endows RUP with additional properties in treating allergic inflammation. Copyright © 2013 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Brock, W.A.; Bock, S.P.; Williams, M.; Baker, F.L.
1987-01-01
This study extends the use of the adhesive-tumor-cell culture system to include: over 100 sensitivity measurements at 2.0 Gy; tumorgenicity determinations in nude mice; and flow cytometry of the cells grown in the system. The malignant nature of the growing cells was proved by injecting cells into nude mice. Tumors resulted in 60% of the cases and the histology of each xenograft was similar to that of the human tumor. Flow cytometry was used to obtain DNA histograms of the original cell suspension and of cultures during the two week culture period in order to obtain quantitative information about the growth of aneuploid versus diploid populations. The results thus far demonstrate that 95% of aneuploid populations yield aneuploid growth; of the first 20 cases studied, only one suspension with an aneuploid peak resulted in diploid growth. Of further interest was the observation that it is not unusual for a minor aneuploid population to become the predominate growth fraction after two weeks in culture. These results demonstrate that the adhesive-tumor-cell culture system supports the growth of malignant cells, that multiple cell populations exist in cell suspensions derived from solid tumors, and that differences exist between the radiosensitivity of cells at 2.0 Gy in different histology types
Lactobacillus Decelerates Cervical Epithelial Cell Cycle Progression
Vielfort, Katarina; Weyler, Linda; Söderholm, Niklas; Engelbrecht, Mattias; Löfmark, Sonja; Aro, Helena
2013-01-01
We investigated cell cycle progression in epithelial cervical ME-180 cells during colonization of three different Lactobacillus species utilizing live cell microscopy, bromodeoxyuridine incorporation assays, and flow cytometry. The colonization of these ME-180 cells by L. rhamnosus and L. reuteri, originating from human gastric epithelia and saliva, respectively, was shown to reduce cell cycle progression and to cause host cells to accumulate in the G1 phase of the cell cycle. The G1 phase accumulation in L. rhamnosus-colonized cells was accompanied by the up-regulation and nuclear accumulation of p21. By contrast, the vaginal isolate L. crispatus did not affect cell cycle progression. Furthermore, both the supernatants from the lactic acid-producing L. rhamnosus colonies and lactic acid added to cell culture media were able to reduce the proliferation of ME-180 cells. In this study, we reveal the diversity of the Lactobacillus species to affect host cell cycle progression and demonstrate that L. rhamnosus and L. reuteri exert anti-proliferative effects on human cervical carcinoma cells. PMID:23675492
Lactobacillus decelerates cervical epithelial cell cycle progression.
Directory of Open Access Journals (Sweden)
Katarina Vielfort
Full Text Available We investigated cell cycle progression in epithelial cervical ME-180 cells during colonization of three different Lactobacillus species utilizing live cell microscopy, bromodeoxyuridine incorporation assays, and flow cytometry. The colonization of these ME-180 cells by L. rhamnosus and L. reuteri, originating from human gastric epithelia and saliva, respectively, was shown to reduce cell cycle progression and to cause host cells to accumulate in the G1 phase of the cell cycle. The G1 phase accumulation in L. rhamnosus-colonized cells was accompanied by the up-regulation and nuclear accumulation of p21. By contrast, the vaginal isolate L. crispatus did not affect cell cycle progression. Furthermore, both the supernatants from the lactic acid-producing L. rhamnosus colonies and lactic acid added to cell culture media were able to reduce the proliferation of ME-180 cells. In this study, we reveal the diversity of the Lactobacillus species to affect host cell cycle progression and demonstrate that L. rhamnosus and L. reuteri exert anti-proliferative effects on human cervical carcinoma cells.
Energy Technology Data Exchange (ETDEWEB)
Changyu, Zheng; Ji, Liu; Xiaoying, Bi
1986-04-01
It has been shown from cytochemical and other characteristic studies of bone marrow stromal cells in CFU-F that there are seven types of stromal cells in the stromal adherent cell layer of normal and irradiated C/sub 57/ mice whereas there are only six types in guinea pigs. On the other hand, a radioresistant cell subtype appears in adherent layer after irradiation of both C/sub 57/ mice and guinea pig since the supernatant of cultured CFU-F of the normal and irradiated C/sub 57/ mice can stimulate production of CFU-Gm. It is justifiable that the bone marrow stromal adherent cells of the C/sub 57/ mice could produce CSF.
Culture conditions defining glioblastoma cells behavior: what is the impact for novel discoveries?
Ledur, Pítia Flores; Onzi, Giovana Ravizzoni; Zong, Hui; Lenz, Guido
2017-09-15
In cancer research, the use of established cell lines has gradually been replaced by primary cell cultures due to their better representation of in vivo cancer cell behaviors. However, a major challenge with primary culture involves the finding of growth conditions that minimize alterations in the biological state of the cells. To ensure reproducibility and translational potentials for research findings, culture conditions need to be chosen so that the cell population in culture best mimics tumor cells in vivo . Glioblastoma (GBM) is one of the most aggressive and heterogeneous tumor types and the GBM research field would certainly benefit from culture conditions that could maintain the original plethora of phenotype of the cells. Here, we review culture media and supplementation options for GBM cultures, the rationale behind their use, and how much those choices affect drug-screening outcomes. We provide an overview of 120 papers that use primary GBM cultures and discuss the current predominant conditions. We also show important primary research data indicating that "mis-cultured" glioma cells can acquire unnatural drug sensitivity, which would have devastating effects for clinical translations. Finally, we propose the concurrent test of four culture conditions to minimize the loss of cell coverage in culture.
40 CFR 798.5300 - Detection of gene mutations in somatic cells in culture.
2010-07-01
... cells in culture. 798.5300 Section 798.5300 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5300 Detection of gene mutations in somatic cells in culture. (a) Purpose. Mammalian cell culture... selected by resistance to ouabain. (2) Description. Cells in suspension or monolayer culture are exposed to...
DEFF Research Database (Denmark)
Mandrup-Poulsen, T; Bendtzen, K; Nerup, J
1986-01-01
Supernatants of peripheral blood mononuclear cells from healthy human donors stimulated with recall antigen (purified protein derivative of tuberculin) or lectin (phytohaemagglutinin) markedly inhibited the insulin release from isolated human and rat islets of Langerhans, and decreased rat islet...... reconstituted with tuberculin or phytohaemagglutinin did not impair islet function. Electron microscopy demonstrated that supernatants were cytotoxic to islet cells. The cytotoxic mononuclear cell mediator(s) was non-dialysable, sensitive to heating to 56 degrees C, labile even when stored at -70 degrees C...
Prospects for the use of plant cell cultures in food biotechnology.
Davies, Kevin M; Deroles, Simon C
2014-04-01
Plant cell cultures can offer continuous production systems for high-value food and health ingredients, independent of geographical or environmental variations and constraints. Yet despite many improvements in culture technologies, cell line selection, and bioreactor design, there are few commercial successes. This is principally due to the culture yield and market price of food products not being sufficient to cover the plant cell culture production costs. A better understanding of the underpinning biological mechanisms that control the target metabolite biosynthetic pathways may allow the metabolic engineering of cell lines to provide for economically competitive product yields. However, uncertainty around the regulatory and public acceptance of products derived from engineered cell cultures presents a barrier to the uptake of the technology by food product companies. Copyright © 2014 Elsevier Ltd. All rights reserved.
Cytotoxicity of extracts of spices to cultured cells.
Unnikrishnan, M C; Kuttan, R
1988-01-01
The cytotoxicity of the extracts from eight different spices used in the Indian diet was determined using Dalton's lymphoma ascites tumor cells and human lymphocytes in vitro and Chinese Hamster Ovary cells and Vero cells in tissue culture. Alcoholic extracts of the spices were found to be more cytotoxic to these cells than their aqueous extracts. Alcoholic extracts of several spices inhibited cell growth at concentrations of 0.2-1 mg/ml in vitro and 0.12-0.3 mg/ml in tissue culture. Ginger, pippali (native to India; also called dried catkins), pepper, and garlic showed the highest activity followed by asafetida, mustard, and horse-gram (native to India). These extracts also inhibited the thymidine uptake into DNA.
Effects of X-irradiation on gonadotropin secretion in rat anterior pituitary cells
International Nuclear Information System (INIS)
Li Xinmin; Liu Shuzheng
1988-01-01
The dispersed rat anterior pituitary cells cultured in 3 days was exposed to single doses of X-irradiation in the range of 0.5-8.0 Gy. LH and FSH contents in both the supernatant and the cells were measured. The LH secretion was significantly increased at the doses greater than 0.5 Gy and FSH secretion was also significantly enhanced at the dose of 4.0 Gy. The cellular contents of both LH and FSH remained near the control levels. It is concluded that gonadotropin secretion can be stimulated by single doses of X-rays in the range of 0.5-8.0 Gy
A Novel Counter Sheet-flow Sandwich Cell Culture Device for Mammalian Cell Growth in Space
Sun, Shujin; Gao, Yuxin; Shu, Nanjiang; Tang, Zemei; Tao, Zulai; Long, Mian
2008-08-01
Cell culture and growth in space is crucial to understand the cellular responses under microgravity. The effects of microgravity were coupled with such environment restrictions as medium perfusion, in which the underlying mechanism has been poorly understood. In the present work, a customer-made counter sheet-flow sandwich cell culture device was developed upon a biomechanical concept from fish gill breathing. The sandwich culture unit consists of two side chambers where the medium flow is counter-directional, a central chamber where the cells are cultured, and two porous polycarbonate membranes between side and central chambers. Flow dynamics analysis revealed the symmetrical velocity profile and uniform low shear rate distribution of flowing medium inside the central culture chamber, which promotes sufficient mass transport and nutrient supply for mammalian cell growth. An on-orbit experiment performed on a recovery satellite was used to validate the availability of the device.
Enhanced chondrocyte culture and growth on biologically inspired nanofibrous cell culture dishes.
Bhardwaj, Garima; Webster, Thomas J
2016-01-01
Chondral and osteochondral defects affect a large number of people in which treatment options are currently limited. Due to its ability to mimic the natural nanofibrous structure of cartilage, this current in vitro study aimed at introducing a new scaffold, called XanoMatrix™, for cartilage regeneration. In addition, this same scaffold is introduced here as a new substrate onto which to study chondrocyte functions. Current studies on chondrocyte functions are limited due to nonbiologically inspired cell culture substrates. With its polyethylene terephthalate and cellulose acetate composition, good mechanical properties and nanofibrous structure resembling an extracellular matrix, XanoMatrix offers an ideal surface for chondrocyte growth and proliferation. This current study demonstrated that the XanoMatrix scaffolds promote chondrocyte growth and proliferation as compared with the Corning and Falcon surfaces normally used for chondrocyte cell culture. The XanoMatrix scaffolds also have greater hydrophobicity, three-dimensional surface area, and greater tensile strength, making them ideal candidates for alternative treatment options for chondral and osteochondral defects as well as cell culture substrates to study chondrocyte functions.
5-Fluorouracil-induced apoptosis in cultured oral cancer cells.
Tong, D; Poot, M; Hu, D; Oda, D
2000-03-01
Chemotherapy is commonly used to treat advanced oral squamous cell carcinoma (SCC) and is known to kill cancer cells through apoptosis. Our hypothesis states that 5-fluorouracil (5FU) also kills cultured oral epithelial cells through programmed cell death or apoptosis. Cultured oral cancer cells were exposed to an optimum dose of 20 mg/ml of 5FU. Cells were analyzed for changes in cell cycle distribution and induction of cell death including apoptosis. Normal control, human papilloma virus-immortalized (PP), ATCC SCC cell line (CA1) and two primary oral SCC cell lines (CA3 and -4) were studied. Inhibition of apoptosis by a pan-caspase inhibitor was used. SYTO 11 flow cytometry showed increased apoptosis in all 5FU-treated cell cultures compared to untreated controls. The results show biological variation in apoptotic response. CA1 had the lowest apoptotic rate of the cancer cell lines at 1.5%. Next lowest was CA3, followed by CA4 and PP. In addition, alteration in the G1 and S phase fractions were found. Untreated CA1 showed 28% G1, 53% S compared to 43% G1, and 40% S of treated. We investigated the pathway of apoptosis using the pan-caspase inhibitor IDN-1529 by methylthiazolyl diphenyl tetrazolium bromide (MTT) colorimetric analysis. Results showed mild inhibition of cell death when cells were incubated with 50 microM IDN-1529 for 24 h. This suggests a probable caspase-dependent apoptotic pathway. In conclusion, our data suggest that 5FU induces oral cancer cell death through apoptosis and that biological variation exists between normal and cancer cells and between different types of cancer cells themselves. Our data indicate that cultures of a useful in vitro model for chemosensitivity assays are possible. Our results also suggest a caspase-dependent pathway for chemocytotoxicity in oral SCC.
DEFF Research Database (Denmark)
Petronis, Sarunas; Stangegaard, Michael; Christensen, C.
2006-01-01
Modern microfabrication and microfluidic technologies offer new opportunities in the design and fabrication of miniaturized cell culture systems for online monitoring of living cells. We used laser micromachining and thermal bonding to fabricate an optically transparent, low-cost polymeric chip...... for long-term online cell culture observation under controlled conditions. The chip incorporated a microfluidic flow equalization system, assuring uniform perfusion of the cell culture media throughout the cell culture chamber. The integrated indium-tin-oxide heater and miniature temperature probe linked....... HeLa cells were cultured for up to 2 weeks within the cell culture chip and monitored using a time-lapse video recording microscopy setup. Cell attachment and spreading was observed during the first 10-20 h (lag phase). After approximately 20 h, cell growth gained exponential character...
Human Lung Mast Cell Products Regulate Airway Smooth Muscle CXCL10 Levels.
Alkhouri, H; Cha, V; Tong, K; Moir, L M; Armour, C L; Hughes, J M
2014-01-01
In asthma, the airway smooth muscle (ASM) produces CXCL10 which may attract CXCR3(+) mast/T cells to it. Our aim was to investigate the effects of mast cell products on ASM cell CXCL10 production. ASM cells from people with and without asthma were stimulated with IL-1 β , TNF- α , and/or IFN γ and treated with histamine (1-100 μ M) ± chlorpheniramine (H1R antagonist; 1 μ M) or ranitidine (H2R antagonist; 50 μ M) or tryptase (1 nM) ± leupeptin (serine protease inhibitor; 50 μ M), heat-inactivated tryptase, or vehicle for 4 h or 24 h. Human lung mast cells (MC) were isolated and activated with IgE/anti-IgE and supernatants were collected after 2 h or 24 h. The supernatants were added to ASM cells for 48 h and ASM cell CXCL10 production detected using ELISA (protein) and real-time PCR (mRNA). Histamine reduced IL-1 β /TNF- α -induced CXCL10 protein, but not mRNA, levels independent of H1 and H2 receptor activation, whereas tryptase and MC 2 h supernatants reduced all cytokine-induced CXCL10. Tryptase also reduced CXCL10 levels in a cell-free system. Leupeptin inhibited the effects of tryptase and MC 2 h supernatants. MC 24 h supernatants contained TNF- α and amplified IFN γ -induced ASM cell CXCL10 production. This is the first evidence that MC can regulate ASM cell CXCL10 production and its degradation. Thus MC may regulate airway myositis in asthma.
Vanneste, Y; Thome, A N; Vandersmissen, E; Charlet, C; Franchimont, D; Martens, H; Lhiaubet, A M; Schimpff, R M; Rostène, W; Geenen, V
1997-06-01
This study shows the expression at the cell surface of human thymic epithelial cells (TEC) of a neurotensin (NT)-like immunoreactivity. NT radio-immunoassay (RIA) revealed that cultured human TEC contain +/-5 ng immunoreactive (ir) NT/10(6) cells, of which 5% is associated with plasma cell membranes. HPLC analysis of NT-ir present in human TEC showed a major peak of NT-ir corresponding to NT1-13. NT-ir was not detected in the supernatant of human TEC cultures. Using an affinity column prepared with a anti-MHC class I monoclonal antibody, NT-ir-related peptides were retained on the column and eluted together with MHC class I-related proteins. According to the elution time on HPLC of these peptides, they correspond to intact NT1-13, as well as to smaller fragments of NT1-13.
Electrolytic destruction of oxalate ions in plutonium oxalate supernatant
International Nuclear Information System (INIS)
Michael, K.M.; Talnikar, S.G.; Jambunathan, U.; Kapoor, S.C.; Ramanujam, A.; Venkataraman, N.
1996-01-01
A simple and efficient electrolytic method is described for the destruction of the oxalate ions present in plutonium oxalate supernatant. Using platinum electrode and very little KMnO 4 , in situ generation of Mn 3+ ions is achieved which in turn destroys the oxalate. The use of lower current density helps in achieving maximum current efficiency. The end point is easily detectable by the pink colour of permanganate. By reversing the current, this slight excess of permanganate can be destroyed, thus avoiding the use of hydrogen peroxide. By this simple electrolytic method, the corrosive oxalate ion is completely destroyed and the salt content of the waste solution is considerably reduced. (author). 4 refs., 1 fig., 6 tabs
Directory of Open Access Journals (Sweden)
Yang Li
Full Text Available Improving islet graft revascularization and inhibiting rejection become crucial tasks for prolonging islet graft survival. Endothelial cells (ECs are the basis of islet vascularization and Sertoli cells (SCs have the talent to provide nutritional support and exert immunosuppressive effects. We construct a combined strategy of ECs coating in the presence of nutritious and immune factors supplied by SCs in a co-culture system to investigate the effect of vascularization and rejection inhibition for islet graft. In vivo, the combined strategy improved the survival and vascularization as well as inhibited lymphocytes and inflammatory cytokines. In vitro, we found the combinatorial strategy improved the function of islets and the effect of ECs-coating on islets. Combined strategy treated islets revealed higher levels of anti-apoptotic signal molecules (Bcl-2 and HSP-32, survival and function related molecules (PDX-1, Ki-67, ERK1/2 and Akt and demonstrated increased vascular endothelial growth factor receptor 2 (KDR and angiogenesis signal molecules (FAk and PLC-γ. SCs effectively inhibited the activation of lymphocyte stimulated by islets and ECs. Predominantly immunosuppressive cytokines could be detected in culture supernatants of the SCs coculture group. These results suggest that ECs-coating and Sertoli cells co-culture or infusion synergistically enhance islet survival and function after transplantation.