WorldWideScience

Sample records for cell culture method

  1. Sponge cell culture? A molecular identification method for sponge cells

    NARCIS (Netherlands)

    Sipkema, D.; Heilig, G.H.J.; Akkermans, A.D.L.; Osinga, R.; Tramper, J.; Wijffels, R.H.

    2003-01-01

    Dissociated sponge cells are easily confused with unicellular organisms. This has been an obstacle in the development of sponge-cell lines. We developed a molecular detection method to identify cells of the sponge Dysidea avara in dissociated cell cultures. The 18S ribosomal RNA gene from a Dysidea

  2. Mouse cell culture - Methods and protocols

    Directory of Open Access Journals (Sweden)

    CarloAlberto Redi

    2010-12-01

    Full Text Available The mouse is, out of any doubt, the experimental animal par excellence for many many colleagues within the scientific community, notably for those working in mammalian biology (in a broad sense, from basic genetic to modeling human diseases, starting at least from 1664 Robert Hooke experiments on air’s propertyn. Not surprising then that mouse cell cultures is a well established field of research itself and that there are several handbooks devoted to this discipline. Here, Andrew Ward and David Tosh provide a necessary update of the protocols currently needed. In fact, nearly half of the book is devoted to stem cells culture protocols, mainly embryonic, from a list of several organs (kidney, lung, oesophagus and intestine, pancreas and liver to mention some........

  3. A method for culturing human hair follicle cells.

    Science.gov (United States)

    Weterings, P J; Vermorken, A J; Bloemendal, H

    1981-01-01

    For the first time a method for culturing human hair follicle cells is described. The bovine eye lens capsule, a basement membrane-like structure, is used as the substrate for the cultures. In a culture medium supplemented with hydrocortisone and insulin about 70% of the original follicles will form growing colonies of diploid keratinocytes.

  4. Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models

    Science.gov (United States)

    Marquette, Michele L.; Sognier, Marguerite A.

    2013-01-01

    An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.

  5. EXPLANTATION OF MESANGIAL CELL HILLOCKS - A METHOD FOR OBTAINING HUMAN MESANGIAL CELLS IN CULTURE

    NARCIS (Netherlands)

    MULLER, EW; KIM, Y; MICHAEL, AF; VERNIER, RL; VANDERHEM, GK; VANDERWOUDE, FJ

    A simple method is presented for selective cell culture of human mesangial cells using explanatation of mesangial cell hillocks. Glomeruli which had been incubated with collagenase were explanted on plastic tissue culture flasks. Three to 6 weeks after explantation, a rapidly growing multilayer of

  6. The evolution of chicken stem cell culture methods.

    Science.gov (United States)

    Farzaneh, M; Attari, F; Mozdziak, P E; Khoshnam, S E

    2017-12-01

    1. The avian embryo is an excellent model for studying embryology and the production of pharmaceutical proteins in transgenic chickens. Furthermore, chicken stem cells have the potential for proliferation and differentiation and emerged as an attractive tool for various cell-based technologies. 2. The objective of these studies is the derivation and culture of these stem cells is the production of transgenic birds for recombinant biomaterials and vaccine manufacture, drug and cytotoxicity testing, as well as to gain insight into basic science, including cell tracking. 3. Despite similarities among the established chicken stem cell lines, fundamental differences have been reported between their culture conditions and applications. Recent conventional protocols used for expansion and culture of chicken stem cells mostly depend on feeder cells, serum-containing media and static culture. 4. Utilising chicken stem cells for generation of cell-based transgenic birds and a variety of vaccines requires large-scale cell production. However, scaling up the conventional adherent chicken stem cells is challenging and labour intensive. Development of a suspension cell culture process for chicken embryonic stem cells (cESCs), chicken primordial germ cells (PGCs) and chicken induced pluripotent stem cells (ciPSCs) will be an important advance for increasing the growth kinetics of these cells. 6. This review describes various approaches and suggestions to achieve optimal cell growth for defined chicken stem cells cultures and use in future manufacturing applications.

  7. Rapid method for culturing embryonic neuron-glial cell cocultures

    DEFF Research Database (Denmark)

    Svenningsen, Åsa Fex; Shan, Wei-Song; Colman, David R

    2003-01-01

    neurons is seen after 3 weeks (2 weeks in ascorbic acid), suggesting that basal lamina production is important even for glial ensheathment in the enteric nervous system. No overgrowth of fibroblasts or other nonneuronal cells was noted in any cultures, and myelination of the peripheral nervous system...

  8. A method for isolating identifying and culturing of rat trachea-bronchia epithelial cells

    International Nuclear Information System (INIS)

    Cui Fengmei; Su Shibiao; Nie Jihua; Li Bingyan; Tong Jian

    2005-01-01

    Objective: To explore a method for isolating identifying and culturing the rat trachea-bronchia epithelial cells. Methods: The rat trachea-bronchia epithelial cells were isolated by digestion with pronase and brushing with cell brush, identified using confocul and cultured in entire F12 media with no serum. Results: With this method, cells in high purity and high viability could be obtained, and about 10 6 cells per rat. The cells grow well in entire F12 media with no serum. Conclusion: The method is useful for isolating rate trachea-bronchia epithelial cells and the entire F12 media with no serum is effective for culturing. (authors)

  9. A method for establishing human primary gastric epithelial cell culture from fresh surgical gastric tissues.

    Science.gov (United States)

    Aziz, Faisal; Yang, Xuesong; Wen, Qingping; Yan, Qiu

    2015-08-01

    At present, biopsy specimens, cancer cell lines and tissues obtained by gastric surgery are used in the study and analysis of gastric cancer, including the molecular mechanisms and proteomics. However, fibroblasts and other tissue components may interfere with these techniques. Therefore, the present study aimed to develop a procedure for the isolation of viable human gastric epithelial cells from gastric surgical tissues. A method was developed to culture human gastric epithelial cells using fresh, surgically excised tissues and was evaluated using immunocytochemistry, periodic acid-Schiff (PAS) staining and cell viability assays. Low cell growth was observed surrounding the gastric tissue on the seventh day of tissue explant culture. Cell growth subsequently increased, and at 12 days post-explant a high number of pure epithelial cells were detected. The gastric cancer cells exhibited rapid growth with a doubling time of 13-52 h, as compared to normal cells, which had a doubling time of 20-53 h. Immunocytochemical analyses of primary gastric cells revealed positive staining for cytokeratin 18 and 19, which indicated that the culture was comprised of pure epithelial cells and contained no fibroblasts. Furthermore, PAS staining demonstrated that the cultured gastric cells produced neutral mucin. Granulin and carbohydrate antigen 724 staining confirmed the purity of gastric cancer and normal cells in culture. This method of cell culture indicated that the gastric cells in primary culture consisted of mucin-secreting gastric epithelial cells, which may be useful for the study of gastric infection with Helicobacter pylori and gastric cancer.

  10. A Method Sustaining the Bioelectric, Biophysical, and Bioenergetic Function of Cultured Rabbit Atrial Cells

    OpenAIRE

    Noa Kirschner Peretz; Sofia Segal; Limor Arbel-Ganon; Ronen Ben Jehuda; Ronen Ben Jehuda; Yuval Shemer; Yuval Shemer; Binyamin Eisen; Binyamin Eisen; Moran Davoodi; Ofer Binah; Ofer Binah; Yael Yaniv

    2017-01-01

    Culturing atrial cells leads to a loss in their ability to be externally paced at physiological rates and to maintain their shape. We aim to develop a culture method that sustains the shape of atrial cells along with their biophysical and bioenergetic properties in response to physiological pacing. We hypothesize that adding 2,3-Butanedione 2-monoxime (BDM), which inhibits contraction during the culture period, will preserve these biophysical and bioenergetic properties. Rabbit atrial cells w...

  11. A new cell primo-culture method for freshwater benthic diatom communities

    OpenAIRE

    Debenest, Timothée; Silvestre, Jérôme; Coste, Michel; Delmas, François; Pinelli, Eric

    2009-01-01

    A new cell primo-culture method was developed for the benthic diatom community isolated from biofilm sampled in rivers. The approach comprised three steps: (1) scraping biofilm from river pebbles, (2) diatom isolation from biofilm, and (3) diatom community culture. With a view to designing a method able to stimulate the growth of diatoms, to limit the development of other microorganisms, and to maintain in culture a community similar to the original natural one, different factors were test...

  12. A Method Sustaining the Bioelectric, Biophysical, and Bioenergetic Function of Cultured Rabbit Atrial Cells

    Directory of Open Access Journals (Sweden)

    Noa Kirschner Peretz

    2017-08-01

    Full Text Available Culturing atrial cells leads to a loss in their ability to be externally paced at physiological rates and to maintain their shape. We aim to develop a culture method that sustains the shape of atrial cells along with their biophysical and bioenergetic properties in response to physiological pacing. We hypothesize that adding 2,3-Butanedione 2-monoxime (BDM, which inhibits contraction during the culture period, will preserve these biophysical and bioenergetic properties. Rabbit atrial cells were maintained in culture for 24 h in a medium enriched with a myofilament contraction inhibitor, BDM. The morphology and volume of the cells, including their ability to contract in response to 1–3 Hz electrical pacing, was maintained at the same level as fresh cells. Importantly, the cells could be successfully infected with a GFP adenovirus. Action potentials, Ca2+ transients, and local Ca2+ spark parameters were similar in the cultured and in fresh cells. Finally, these cultured cells' flavoprotein autofluorescence was maintained at a constant level in response to electrical pacing, a response similar to that of fresh cells. Thus, eliminating contraction during the culture period preserves the bioelectric, biophysical and bioenergetic properties of rabbit atrial myocytes. This method therefore has the potential to further improve our understanding of energetic and biochemical regulation in the atria.

  13. A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

    Science.gov (United States)

    Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

    2018-02-01

    Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Method and Apparatus for a Miniature Bioreactor System for Long-Term Cell Culture

    Science.gov (United States)

    Kleis, Stanley J. (Inventor); Geffert, Sandra K. (Inventor); Gonda, Steve R. (Inventor)

    2015-01-01

    A bioreactor and method that permits continuous and simultaneous short, moderate, or long term cell culturing of one or more cell types or tissue in a laminar flow configuration is disclosed, where the bioreactor supports at least two laminar flow zones, which are isolated by laminar flow without the need for physical barriers between the zones. The bioreactors of this invention are ideally suited for studying short, moderate and long term studies of cell cultures and the response of cell cultures to one or more stressors such as pharmaceuticals, hypoxia, pathogens, or any other stressor. The bioreactors of this invention are also ideally suited for short, moderate or long term cell culturing with periodic cell harvesting and/or medium processing for secreted cellular components.

  15. A fluorescence anisotropy method for measuring protein concentration in complex cell culture media.

    Science.gov (United States)

    Groza, Radu Constantin; Calvet, Amandine; Ryder, Alan G

    2014-04-22

    The rapid, quantitative analysis of the complex cell culture media used in biopharmaceutical manufacturing is of critical importance. Requirements for cell culture media composition profiling, or changes in specific analyte concentrations (e.g. amino acids in the media or product protein in the bioprocess broth) often necessitate the use of complicated analytical methods and extensive sample handling. Rapid spectroscopic methods like multi-dimensional fluorescence (MDF) spectroscopy have been successfully applied for the routine determination of compositional changes in cell culture media and bioprocess broths. Quantifying macromolecules in cell culture media is a specific challenge as there is a need to implement measurements rapidly on the prepared media. However, the use of standard fluorescence spectroscopy is complicated by the emission overlap from many media components. Here, we demonstrate how combining anisotropy measurements with standard total synchronous fluorescence spectroscopy (TSFS) provides a rapid, accurate quantitation method for cell culture media. Anisotropy provides emission resolution between large and small fluorophores while TSFS provides a robust measurement space. Model cell culture media was prepared using yeastolate (2.5 mg mL(-1)) spiked with bovine serum albumin (0 to 5 mg mL(-1)). Using this method, protein emission is clearly discriminated from background yeastolate emission, allowing for accurate bovine serum albumin (BSA) quantification over a 0.1 to 4.0 mg mL(-1) range with a limit of detection (LOD) of 13.8 μg mL(-1). Copyright © 2014. Published by Elsevier B.V.

  16. Establishment of primary bovine intestinal epithelial cell culture and clone method.

    Science.gov (United States)

    Zhan, Kang; Lin, Miao; Liu, Ming-Mei; Sui, Yang-Nan; Zhao, Guo-Qi

    2017-01-01

    The aim of this study was to establish bovine intestinal epithelial cell (BIEC) line and provide a novel clone cell method. Although various strategies of bovine cell culture and clone techniques have been reported, these methods remain not established. Here, we culture successfully primary BIECs and establish a novel clone cell method. Our result showed that BIECs could be successfully cultured and passaged about generation 5. These cellular aggregates and clusters were adherent loosely at day 2 of culture. Cell aggregates and clusters start to proliferate after approximately 4 d. The BIECs showed positive reaction against cytokeratin 18, E-cadherin, and characteristics of epithelial-like morphology. In addition, the fatty acid-binding proteins (FABPs), villin, and intestinal peptidase (IP) band were positive in BIECs. Our results suggest that the establishment of culturing and clone BIEC methods will apply to isolate and clone other primary cells. These BIECs could therefore contribute to the study of bovine intestinal nutrient absorption and regulation, immune regulation, and the pathogenesis of the bovine intestinal disease, which will provide intestinal cell model in vitro.

  17. An efficient method for the establishment of cell suspension cultures in potato (Solanum tuberosum L.)

    International Nuclear Information System (INIS)

    Sajid, Z.A.

    2016-01-01

    Cell suspension cultures offers an In vitro system that can be used as a tool for various studies involving mutant selection, mass propagation, protoplast isolation, gene transfer and selection of cell-lines which are resistant to various biotic or abiotic stresses. Research work on the development of cell suspension cultures was carried out to establish the most efficient method in Potato (cv. Desiree). Healthy, well-proliferating tissues from different types of callus cultures (compact, friable, embryogenic or non-embryogenic) were inoculated on various media combinations, i.e., MS, MS2 or AA liquid medium containing 18.09 micro M 2, 4-D. A fixed quantity (0.5-1.0 g) of callus tissue from 60-day-old callus cultures was transferred to 10-25 ml of liquid medium in 100 ml Erlenmeyer flask. Cultures were placed on an orbital shaker and agitated at different speeds (75, 100 or 125 rpm) under 16-h photoperiod at 25 ± 2 degree C. Medium was changed after every 3 days and fractionated tissue was filtered after every 6 days through sterile mesh (100-800 micro m) to develop a cell-line by transferring resulting suspension to fresh medium under the same conditions. Results indicated that eight-week-old translucent, friable, off-white callus cultures were an excellent starting material for the initiation of homogeneous cell suspension cultures as compared to other tested sources. Of the three tested media (MS, MS2 or AA medium containing 18.09 micro M 2, 4-D), MS2 was found to be a better medium for the initiation of cell suspension cultures. Cell suspension cultures, placed in 16-h photoperiod at 25 ± 2 degree C and agitated at 120 rpm using a gyratory shaker showed excellent results. Several other factors influencing quick establishment of cell suspension cultures in this cultivar are also discussed in this communication. (author)

  18. Simple and high yielding method for preparing tissue specific extracellular matrix coatings for cell culture.

    Science.gov (United States)

    DeQuach, Jessica A; Mezzano, Valeria; Miglani, Amar; Lange, Stephan; Keller, Gordon M; Sheikh, Farah; Christman, Karen L

    2010-09-27

    The native extracellular matrix (ECM) consists of a highly complex, tissue-specific network of proteins and polysaccharides, which help regulate many cellular functions. Despite the complex nature of the ECM, in vitro cell-based studies traditionally assess cell behavior on single ECM component substrates, which do not adequately mimic the in vivo extracellular milieu. We present a simple approach for developing naturally derived ECM coatings for cell culture that provide important tissue-specific cues unlike traditional cell culture coatings, thereby enabling the maturation of committed C2C12 skeletal myoblast progenitors and human embryonic stem cells differentiated into cardiomyocytes. Here we show that natural muscle-specific coatings can (i) be derived from decellularized, solubilized adult porcine muscle, (ii) contain a complex mixture of ECM components including polysaccharides, (iii) adsorb onto tissue culture plastic and (iv) promote cell maturation of committed muscle progenitor and stem cells. This versatile method can create tissue-specific ECM coatings, which offer a promising platform for cell culture to more closely mimic the mature in vivo ECM microenvironment.

  19. A novel method to generate and culture human mast cells: Peripheral CD34+ stem cell-derived mast cells (PSCMCs).

    Science.gov (United States)

    Schmetzer, Oliver; Valentin, Patricia; Smorodchenko, Anna; Domenis, Rossana; Gri, Giorgia; Siebenhaar, Frank; Metz, Martin; Maurer, Marcus

    2014-11-01

    The identification and characterization of human mast cell (MC) functions are hindered by the shortage of MC populations suitable for investigation. Here, we present a novel technique for generating large numbers of well differentiated and functional human MCs from peripheral stem cells (=peripheral stem cell-derived MCs, PSCMCs). Innovative and key features of this technique include 1) the use of stem cell concentrates, which are routinely discarded by blood banks, as the source of CD34+ stem cells, 2) cell culture in serum-free medium and 3) the addition of LDL as well as selected cytokines. In contrast to established and published protocols that use CD34+ or CD133+ progenitor cells from full blood, we used a pre-enriched cell population obtained from stem cell concentrates, which yielded up to 10(8) differentiated human MCs per batch after only three weeks of culture starting with 10(6) total CD34+ cells. The total purity on MCs (CD117+, FcεR1+) generated by this method varied between 55 and 90%, of which 4-20% were mature MCs that contain tryptase and chymase and show expression of FcεRI and CD117 in immunohistochemistry. PSCMCs showed robust histamine release in response to stimulation with anti-FcεR1 or IgE/anti-IgE, and increased proliferation and differentiation in response to IL-1β or IFN-γ. Taken together, this new protocol of the generation of large numbers of human MCs provides for an innovative and suitable option to investigate the biology of human MCs. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Establishment and Characterization of Primary Cultures from Iranian Oral Squamous Cell Carcinoma Patients by Enzymatic Method and Explant Culture

    Directory of Open Access Journals (Sweden)

    Meysam Ganjibakhsh

    2017-10-01

    Full Text Available Objectives: Oral Squamous Cell Carcinoma (OSCC is the most frequent oral cancer worldwide. It is known as the eighth most common cancer in men and as the fifth most common cancer in women. Cytogenetic and biochemical studies in recent decades have emphasized the necessity of providing an appropriate tool for such researches. Cancer cell culture is a useful tool for investigations on biochemical, genetic, molecular and immunological characteristics of different cancers, including oral cancer. Here, we explain the establishment process of five primary oral cancer cells derived from an Iranian population.Materials and Methods: The specimens were obtained from five oral cancer patients. Enzymatic, explant culture and magnetic-activated cell sorting (MACS methods were used for cell isolation. After quality control tests, characterization and authentication of primary oral cancer cells were performed by short tandem repeats (STR profiling, chromosome analysis, species identification, and monitoring the growth, morphology and the expression of CD326 and CD133 markers.Results: Five primary oral cancer cells were established from an Iranian population. The flow cytometry results showed that the isolated cells were positive for CD326 and CD133 markers. Furthermore, the cells were free from mycoplasma, bacterial and fungal contamination. No misidentified or cross-contaminated cells were detected by STR analysis.Conclusions: Human primary oral cancer cells provide an extremely useful platform for studying carcinogenesis pathways of oral cancer in Iranian population. They may be helpful in explaining the ethnic differences in cancer biology and the individuality in anticancer drug response in future studies.

  1. Different Donor Cell Culture Methods Can Influence the Developmental Ability of Cloned Sheep Embryos.

    Directory of Open Access Journals (Sweden)

    LiBing Ma

    Full Text Available It was proposed that arresting nuclear donor cells in G0/G1 phase facilitates the development of embryos that are derived from somatic cell nuclear transfer (SCNT. Full confluency or serum starvation is commonly used to arrest in vitro cultured somatic cells in G0/G1 phase. However, it is controversial as to whether these two methods have the same efficiency in arresting somatic cells in G0/G1 phase. Moreover, it is unclear whether the cloned embryos have comparable developmental ability after somatic cells are subjected to one of these methods and then used as nuclear donors in SCNT. In the present study, in vitro cultured sheep skin fibroblasts were divided into four groups: (1 cultured to 70-80% confluency (control group, (2 cultured to full confluency, (3 starved in low serum medium for 4 d, or (4 cultured to full confluency and then further starved for 4 d. Flow cytometry was used to assay the percentage of fibroblasts in G0/G1 phase, and cell counting was used to assay the viability of the fibroblasts. Then, real-time reverse transcription PCR was used to determine the levels of expression of several cell cycle-related genes. Subsequently, the four groups of fibroblasts were separately used as nuclear donors in SCNT, and the developmental ability and the quality of the cloned embryos were compared. The results showed that the percentage of fibroblasts in G0/G1 phase, the viability of fibroblasts, and the expression levels of cell cycle-related genes was different among the four groups of fibroblasts. Moreover, the quality of the cloned embryos was comparable after these four groups of fibroblasts were separately used as nuclear donors in SCNT. However, cloned embryos derived from fibroblasts that were cultured to full confluency combined with serum starvation had the highest developmental ability. The results of the present study indicate that there are synergistic effects of full confluency and serum starvation on arresting fibroblasts in

  2. A rapid and sensitive method for measuring N-acetylglucosaminidase activity in cultured cells.

    Directory of Open Access Journals (Sweden)

    Victor Mauri

    Full Text Available A rapid and sensitive method to quantitatively assess N-acetylglucosaminidase (NAG activity in cultured cells is highly desirable for both basic research and clinical studies. NAG activity is deficient in cells from patients with Mucopolysaccharidosis type IIIB (MPS IIIB due to mutations in NAGLU, the gene that encodes NAG. Currently available techniques for measuring NAG activity in patient-derived cell lines include chromogenic and fluorogenic assays and provide a biochemical method for the diagnosis of MPS IIIB. However, standard protocols require large amounts of cells, cell disruption by sonication or freeze-thawing, and normalization to the cellular protein content, resulting in an error-prone procedure that is material- and time-consuming and that produces highly variable results. Here we report a new procedure for measuring NAG activity in cultured cells. This procedure is based on the use of the fluorogenic NAG substrate, 4-Methylumbelliferyl-2-acetamido-2-deoxy-alpha-D-glucopyranoside (MUG, in a one-step cell assay that does not require cell disruption or post-assay normalization and that employs a low number of cells in 96-well plate format. We show that the NAG one-step cell assay greatly discriminates between wild-type and MPS IIIB patient-derived fibroblasts, thus providing a rapid method for the detection of deficiencies in NAG activity. We also show that the assay is sensitive to changes in NAG activity due to increases in NAGLU expression achieved by either overexpressing the transcription factor EB (TFEB, a master regulator of lysosomal function, or by inducing TFEB activation chemically. Because of its small format, rapidity, sensitivity and reproducibility, the NAG one-step cell assay is suitable for multiple procedures, including the high-throughput screening of chemical libraries to identify modulators of NAG expression, folding and activity, and the investigation of candidate molecules and constructs for applications in

  3. Intracellular localization of pregnane X receptor in HepG2 cells cultured by the hanging drop method.

    Science.gov (United States)

    Yokobori, Kosuke; Kobayashi, Kaoru; Azuma, Ikuko; Akita, Hidetaka; Chiba, Kan

    2017-10-01

    Pregnane X receptor (PXR) is localized in the cytoplasm of liver cells, whereas it is localized in the nucleus of monolayer-cultured HepG2 cells. Since cultured cells are affected by the microenvironment in which they are grown, we studied the effect of three-dimensional (3D) culture on the localization of PXR in HepG2 cells using the hanging drop method. The results showed that PXR was retained in the cytoplasm of HepG2 cells and other human hepatocarcinoma cell lines (FLC5, FLC7 and Huh7) when they were cultured by the hanging drop method. Treatment with rifampicin, a ligand of PXR, translocated PXR from the cytoplasm to nucleus and increased expression levels of CYP3A4 mRNA in HepG2 cells cultured by the hanging drop method. These findings suggest that 3D culture is a key factor determining the intracellular localization of PXR in human hepatocarcinoma cells and that PXR that becomes retained in the cytoplasm of HepG2 cells with 3D culture has functions of nuclear translocation and regulation of target genes in response to human PXR ligands. Three-dimensionally cultured hepatocarcinoma cells would be a useful tool to evaluate induction potency of drug candidates and also to study mechanisms of nuclear translocation of PXR by human PXR ligands. Copyright © 2017 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.

  4. A Non-Destructive Culturing and Cell Sorting Method for Cardiomyocytes and Neurons Using a Double Alginate Layer

    Science.gov (United States)

    Terazono, Hideyuki; Kim, Hyonchol; Hayashi, Masahito; Hattori, Akihiro; Nomura, Fumimasa; Kaneko, Tomoyuki; Yasuda, Kenji

    2012-01-01

    A non-destructive method of collecting cultured cells after identifying their in situ functional characteristics is proposed. In this method, cells are cultivated on an alginate layer in a culture dish and released by spot application of a calcium chelate buffer that locally melts the alginate layer and enables the collection of cultured cells at the single-cell level. Primary hippocampal neurons, beating human embryonic stem (hES) cell-derived cardiomyocytes, and beating hES cell-derived cardiomyocyte clusters cultivated on an alginate layer were successfully released and collected with a micropipette. The collected cells were recultured while maintaining their physiological function, including beating, and elongated neurites. These results suggest that the proposed method may eventually facilitate the transplantation of ES- or iPS-derived cardiomyocytes and neurons differentiated in culture. PMID:22870332

  5. A non-destructive culturing and cell sorting method for cardiomyocytes and neurons using a double alginate layer.

    Directory of Open Access Journals (Sweden)

    Hideyuki Terazono

    Full Text Available A non-destructive method of collecting cultured cells after identifying their in situ functional characteristics is proposed. In this method, cells are cultivated on an alginate layer in a culture dish and released by spot application of a calcium chelate buffer that locally melts the alginate layer and enables the collection of cultured cells at the single-cell level. Primary hippocampal neurons, beating human embryonic stem (hES cell-derived cardiomyocytes, and beating hES cell-derived cardiomyocyte clusters cultivated on an alginate layer were successfully released and collected with a micropipette. The collected cells were recultured while maintaining their physiological function, including beating, and elongated neurites. These results suggest that the proposed method may eventually facilitate the transplantation of ES- or iPS-derived cardiomyocytes and neurons differentiated in culture.

  6. New method for exopolysaccharide determination in culture broth using stirred ultrafiltration cells.

    Science.gov (United States)

    Bergmaier, D; Lacroix, C; Guadalupe Macedo, M; Champagne, C P

    2001-10-01

    A new method to remove simple carbohydrates from culture broth prior to the quantification of exopolysaccharides (EPS) was developed and validated for the EPS-producing strain, Lactobacillus rhamnosus RW-9595M. This method uses ultrafiltration (UF) in stirred cells followed by polysaccharide detection in the retentate by the phenol-sulfuric acid method. The UF method was compared with a conventional method based on ethanol extraction, dialysis, protein removal by trichloroacetic acid (TCA) and freeze-drying. EPS production during pH-controlled batch fermentations in basal minimum medium, whey permeate (WP). and whey permeate supplemented with yeast extract, minerals and Tween-80 (SWP) was determined by the new UF and conventional methods. EPS recovery by the new method ranged from 83% to 104% for EPS added in the concentration range 40-1,500 mg/l in 0.1 M NaCl solution or culture medium. The UF method was rapid (8 h), accurate and simple, and required only a small sample volume (1-5 ml). A very high maximum EPS production was measured in SWP by both the UF and conventional methods (1,718 and 1,755 mg/l).

  7. A Simple and Robust Method for Culturing Human-Induced Pluripotent Stem Cells in an Undifferentiated State Using Botulinum Hemagglutinin.

    Science.gov (United States)

    Kim, Mee-Hae; Matsubara, Yoshifumi; Fujinaga, Yukako; Kino-Oka, Masahiro

    2018-02-01

    Clinical and industrial applications of human-induced pluripotent stem cells (hiPSCs) is hindered by the lack of robust culture strategies capable of sustaining a culture in an undifferentiated state. Here, a simple and robust hiPSC-culture-propagation strategy incorporating botulinum hemagglutinin (HA)-mediated selective removal of cells deviating from an undifferentiated state is developed. After HA treatment, cell-cell adhesion is disrupted, and deviated cells detached from the central region of the colony to subsequently form tight monolayer colonies following prolonged incubation. The authors find that the temporal and dose-dependent activity of HA regulated deviated-cell removal and recoverability after disruption of cell-cell adhesion in hiPSC colonies. The effects of HA are confirmed under all culture conditions examined, regardless of hiPSC line and feeder-dependent or -free culture conditions. After routine application of our HA-treatment paradigm for serial passages, hiPSCs maintains expression of pluripotent markers and readily forms embryoid bodies expressing markers for all three germ-cell layers. This method enables highly efficient culturing of hiPSCs and use of entire undifferentiated portions without having to pick deviated cells manually. This simple and readily reproducible culture strategy is a potentially useful tool for improving the robust and scalable maintenance of undifferentiated hiPSC cultures. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Optimization of Ex Vivo Murine Bone Marrow Derived Immature Dendritic Cells: A Comparative Analysis of Flask Culture Method and Mouse CD11c Positive Selection Kit Method

    Directory of Open Access Journals (Sweden)

    Rahul Ashok Gosavi

    2018-01-01

    Full Text Available 12–14 days of culturing of bone marrow (BM cells containing various growth factors is widely used method for generating dendritic cells (DCs from suspended cell population. Here we compared flask culture method and commercially available CD11c Positive Selection kit method. Immature BMDCs’ purity of adherent as well as suspended cell population was generated in the decreasing concentration of recombinant-murine granulocyte-macrophage colony-stimulating factor (rmGM-CSF in nontreated tissue culture flasks. The expression of CD11c, MHCII, CD40, and CD86 was measured by flow cytometry. We found significant difference (P<0.05 between the two methods in the adherent cells population but no significant difference was observed between the suspended cell populations with respect to CD11c+ count. However, CD11c+ was significantly higher in both adhered and suspended cell population by culture method but kit method gave more CD11c+ from suspended cells population only. On the other hand, using both methods, immature DC expressed moderate level of MHC class II molecules as well as low levels of CD40 and CD86. Our findings suggest that widely used culture method gives the best results in terms of yield, viability, and purity of BMDCs from both adherent and suspended cell population whereas kit method works well for suspended cell population.

  9. Insect Cell Culture

    NARCIS (Netherlands)

    Oers, van M.M.; Lynn, D.E.

    2010-01-01

    Insect cell cultures are widely used in studies on insect cell physiology, developmental biology and microbial pathology. In particular, insect cell culture is an indispensable tool for the study of insect viruses. The first continuously growing insect cell cultures were established from

  10. An efficient 3D cell culture method on biomimetic nanostructured grids.

    Directory of Open Access Journals (Sweden)

    Maria Wolun-Cholewa

    Full Text Available Current techniques of in vitro cell cultures are able to mimic the in vivo environment only to a limited extent, as they enable cells to grow only in two dimensions. Therefore cell culture approaches should rely on scaffolds that provide support comparable to the extracellular matrix. Here we demonstrate the advantages of novel nanostructured three-dimensional grids fabricated using electro-spinning technique, as scaffolds for cultures of neoplastic cells. The results of the study show that the fibers allow for a dynamic growth of HeLa cells, which form multi-layer structures of symmetrical and spherical character. This indicates that the applied scaffolds are nontoxic and allow proper flow of oxygen, nutrients, and growth factors. In addition, grids have been proven to be useful in in situ examination of cells ultrastructure.

  11. Using qualitative research methods in biomedical innovation: the case of cultured red blood cells for transfusion.

    Science.gov (United States)

    Lyall, Catherine; King, Emma

    2016-05-11

    Qualitative research has a key role to play in biomedical innovation projects. This article focuses on the appropriate use of robust social science methodologies (primarily focus group studies) for identifying the public's willingness and preference for emerging medical technologies. Our study was part of the BloodPharma project (now known as the Novosang project) to deliver industrially generated red blood cells for transfusion. Previous work on blood substitutes shows that the public prefers donated human blood. However, no research has been conducted concerning attitudes to stem cell derived red blood cells. Qualitative research methods including interviews and focus groups provide the methodological context for this paper. Focus groups were used to elicit views from sub-sections of the UK population about the potential use of such cultured red blood cells. We reflect on the appropriateness of that methodology in the context of the BloodPharma project. Findings are in the form of lessons transferable to other interdisciplinary, science-led teams about what a social science dimension can bring; why qualitative research should be included; and how it can be used effectively. Qualitative data collection offers the strength of exploring ambivalence and investigating the reasons for views, but not necessarily their prevalence in wider society. The inherent value of a qualitative method, such as focus groups, therefore lies in its ability to uncover new information. This contrasts with a quantitative approach to simply 'measuring' public opinion on a topic about which participants may have little prior knowledge. We discuss a number of challenges including: appropriate roles for embedded social scientists and the intricacies of doing upstream engagement as well as some of the design issues and limitations associated with the focus group method.

  12. Drifter technique: a new method to obtain metaphases in Hep-2 cell line cultures

    Directory of Open Access Journals (Sweden)

    Eleonidas Moura Lima

    2005-07-01

    Full Text Available The Hep-2 cell line is derived from laryngeal carcinoma cells and is often utilized as a model in carcinogenesis and mutagenesis tests. To evaluate the proliferative potential of this line, we developed a cytogenetic methodology (drifter technique to obtain metaphases from cells that loose cellular adhesion when they underwent mitosis in culture. By this procedure, 2000 cells were counted, resulting in a mitotic index (MI of 22.2%. Although this MI was not statistically different from the one obtained using either a classical cytogenetic method or a cell synchronization technique, the drifter technique has the advantage of not requiring the use of some reagents for the obtention of metaphases and also of diminishing the consumption of maintenance reagents for this cell line.A linhagem celular Hep-2 é formada por células de carcinoma da laringe e é muito utilizada em modelos de carcinogênese e mutagenêse. Para avaliar o potencial proliferativo desta linhagem, desenvolvemos uma metodologia citogenética (técnica do sobrenadante para obtenção de metáfases a partir de células que, ao entrarem em mitose, perdem adesão celular, ficando em suspensão no meio de cultura. Através deste procedimento, foram contadas 2000 células, correspondendo a um índice mitótico (IM de 22.2% . Apesar de o IM obtido por esta técnica não ter sido estatisticamente diferente do IM obtido por outras metodologias citogenéticas clássicas, a técnica do sobrenadante é vantajosa porque elimina o uso de alguns reagentes utilizados na obtenção de metáfases e também diminui o consumo de reagentes de manutenção desta linhagem.

  13. DEVELOPMENT OF AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR THE DETECTION OF ENTEROVIRUS IN WATER

    Science.gov (United States)

    Virus contamination in environmental samples is believed to be underestimated due to the limitations in the methods available for detection. A major detection method is based upon the formation of cytopathic effect (CPE) in cell culture. The main limitations to this method are ...

  14. Cell Adhesion Minimization by a Novel Mesh Culture Method Mechanically Directs Trophoblast Differentiation and Self-Assembly Organization of Human Pluripotent Stem Cells.

    Science.gov (United States)

    Okeyo, Kennedy Omondi; Kurosawa, Osamu; Yamazaki, Satoshi; Oana, Hidehiro; Kotera, Hidetoshi; Nakauchi, Hiromitsu; Washizu, Masao

    2015-10-01

    Mechanical methods for inducing differentiation and directing lineage specification will be instrumental in the application of pluripotent stem cells. Here, we demonstrate that minimization of cell-substrate adhesion can initiate and direct the differentiation of human pluripotent stem cells (hiPSCs) into cyst-forming trophoblast lineage cells (TLCs) without stimulation with cytokines or small molecules. To precisely control cell-substrate adhesion area, we developed a novel culture method where cells are cultured on microstructured mesh sheets suspended in a culture medium such that cells on mesh are completely out of contact with the culture dish. We used microfabricated mesh sheets that consisted of open meshes (100∼200 μm in pitch) with narrow mesh strands (3-5 μm in width) to provide support for initial cell attachment and growth. We demonstrate that minimization of cell adhesion area achieved by this culture method can trigger a sequence of morphogenetic transformations that begin with individual hiPSCs attached on the mesh strands proliferating to form cell sheets by self-assembly organization and ultimately differentiating after 10-15 days of mesh culture to generate spherical cysts that secreted human chorionic gonadotropin (hCG) hormone and expressed caudal-related homeobox 2 factor (CDX2), a specific marker of trophoblast lineage. Thus, this study demonstrates a simple and direct mechanical approach to induce trophoblast differentiation and generate cysts for application in the study of early human embryogenesis and drug development and screening.

  15. Progress on CD-DVD laser microfabrication method to develop cell culture scaffolds integrating biomimetic characteristics

    Science.gov (United States)

    Hautefeuille, Mathieu; Vázquez-Victorio, Genaro; Cruz-Ramírez, Aaron; Cabriales, Lucia; Jiménez-Diaz, Edgar; Escutia-Guadarrama, Lidia; López-Aparicio, Jehú; Pérez-Calixto, Daniel; Cano-Jorge, Mariel; Nieto-Rivera, Brenda; Sánchez-Olvera, Raúl

    2018-02-01

    The development of organ-on-chip and biological scaffolds is currently requiring simpler methods to microstructure biocompatible materials in three dimensions, fabricate structural and functional elements in biomaterials or modify the physicochemical properties of desired substrates. With the aim of creating simple, cost-effective alternatives to conventional existing techniques to produce such platforms with very specific properties, a low-power CD-DVD laser pickup head was recycled and mounted on a programmable three-axis micro-displacement system in order to modify the surface of polymeric materials in a local fashion. Thanks to a specially-designed method using a strongly absorbing additive coating the materials of interest, it has been possible to establish and precisely control processes useful in microtechnology for biomedical applications and normally restricted to much less affordable high-power lasers. In this work, we present our latest progress regarding the application of our fabrication technique to the development of organ-on-chip platforms thanks to the simple integration of several biomimetic characteristics typically achieved with traditional, less cost-effective microtechnology methods in one step or through replica-molding. Our straightforward approach indeed enables great control of local laser microablation for true on-demand biomimetic micropatterned designs in several transparent polymers and hydrogels of tunable stiffness and is allowing integration of microfluidics, microelectronics, optical waveguides, surface microstructuring and even transfer of superficial protein micropatterns on a variety of biocompatible materials. The results presented here were validated using hepatic and fibroblasts cell lines to demonstrate the viability of our procedure for organ-on-chip development and show the impact of such features in cell culture.

  16. A method for the isolation and culture of adult rat retinal pigment epithelial (RPE cells to study retinal diseases

    Directory of Open Access Journals (Sweden)

    Janosch Peter Heller

    2015-11-01

    Full Text Available Diseases such as age-related macular degeneration (AMD affect the retinal pigment epithelium (RPE and lead to the death of the epithelial cells and ultimately blindness. RPE transplantation is currently a major focus of eye research and clinical trials using human stem cell-derived RPE cells are ongoing. However, it remains to be established to which extent the source of RPE cells for transplantation affects their therapeutic efficacy and this needs to be explored in animal models. Autotransplantation of RPE cells has attractions as a therapy, but existing protocols to isolate adult RPE cells from rodents are technically difficult, time-consuming, have a low yield and are not optimized for long-term cell culturing. Here, we report a newly devised protocol which facilitates reliable and simple isolation and culture of RPE cells from adult rats. Incubation of a whole rat eyeball in 20 U/ml papain solution for 50 minutes yielded 4 x 104 viable RPE cells. These cells were hexagonal and pigmented upon culture. Using immunostaining, we demonstrated that the cells expressed RPE cell-specific marker proteins including cytokeratin 18 and RPE65, similar to RPE cells in vivo. Additionally, the cells were able to produce and secrete Bruch’s membrane matrix components similar to in vivo situation. Similarly, the cultured RPE cells adhered to isolated Bruch’s membrane as has previously been reported. Therefore, the protocol described in this article provides an efficient method for the rapid and easy isolation of high quantities of adult rat RPE cells. This provides a reliable platform for studying the therapeutic targets, testing the effects of drugs in a preclinical setup and to perform in vitro and in vivo transplantation experiments to study retinal diseases.

  17. Microfluidic Cell Culture Device

    Science.gov (United States)

    Takayama, Shuichi (Inventor); Cabrera, Lourdes Marcella (Inventor); Heo, Yun Seok (Inventor); Smith, Gary Daniel (Inventor)

    2014-01-01

    Microfluidic devices for cell culturing and methods for using the same are disclosed. One device includes a substrate and membrane. The substrate includes a reservoir in fluid communication with a passage. A bio-compatible fluid may be added to the reservoir and passage. The reservoir is configured to receive and retain at least a portion of a cell mass. The membrane acts as a barrier to evaporation of the bio-compatible fluid from the passage. A cover fluid may be added to cover the bio-compatible fluid to prevent evaporation of the bio-compatible fluid.

  18. Influence of sterilization methods on cell behavior and functionality of osteoblasts cultured on TiO2 nanotubes

    International Nuclear Information System (INIS)

    Oh, Seunghan; Brammer, Karla S.; Moon, Kyung-Suk; Bae, Ji-Myung; Jin, Sungho

    2011-01-01

    We investigated the adhesion, proliferation and osteogenic functionality of osteoblasts cultured on titanium dioxide (TiO 2 ) nanotubes in response to different sterilization methods (dry autoclaving vs. wet autoclaving). We prepared various sizes (30-100 nm diameter) of TiO 2 nanotubes on titanium substrates by anodization, sterilized nanotubes by different conditions, and seeded osteoblast cells onto the nanotube surfaces with two different cell seeding densities (10,000 vs. 50,000 cells/well in 12-culture well). The result of this study indicates that the adhesion, proliferation and alkaline phosphatase activity of osteoblasts cultured on only the larger 70 and 100 nm TiO 2 nanotube arrays were dramatically changed by the different sterilization conditions at a low cell seeding density. However, with a higher cell seeding density (50,000 cells/well in 12-cell culture well), the results revealed no significant difference among altered nanotube geometry, 30-100 nm diameters, nor sterilization methods. Next, it was revealed that the nanofeatures of proteins adhered on nanotubular TiO 2 morphology are altered by the sterilization method. It was determined that this protein adhesion effect, in combination with the cell density of osteoblasts seeded onto such TiO 2 nanotube surfaces, has profound effects on cell behavior. This study clearly shows that these are some of the important in vitro culture factors that need to be taken into consideration, as well as TiO 2 nanotube diameters which play an important role in the improvement of cell behavior and functionality.

  19. Ex vivo electroporation of retinal cells: a novel, high efficiency method for functional studies in primary retinal cultures.

    Science.gov (United States)

    Vergara, M Natalia; Gutierrez, Christian; O'Brien, David R; Canto-Soler, M Valeria

    2013-04-01

    Primary retinal cultures constitute valuable tools not only for basic research on retinal cell development and physiology, but also for the identification of factors or drugs that promote cell survival and differentiation. In order to take full advantage of the benefits of this system it is imperative to develop efficient and reliable techniques for the manipulation of gene expression. However, achieving appropriate transfection efficiencies in these cultures has remained challenging. The purpose of this work was to develop and optimize a technique that would allow the transfection of chick retinal cells with high efficiency and reproducibility for multiple applications. We developed an ex vivo electroporation method applied to dissociated retinal cell cultures that offers a significant improvement over other currently available transfection techniques, increasing efficiency by five-fold. In this method, eyes were enucleated, devoid of RPE, and electroporated with GFP-encoding plasmids using custom-made electrodes. Electroporated retinas were then dissociated into single cells and plated in low density conditions, to be analyzed after 4 days of incubation. Parameters such as voltage and number of electric pulses, as well as plasmid concentration and developmental stage of the animal were optimized for efficiency. The characteristics of the cultures were assessed by morphology and immunocytochemistry, and cell viability was determined by ethidium homodimer staining. Cell imaging and counting was performed using an automated high-throughput system. This procedure resulted in transfection efficiencies in the order of 22-25% of cultured cells, encompassing both photoreceptors and non-photoreceptor neurons, and without affecting normal cell survival and differentiation. Finally, the feasibility of the technique for cell-autonomous studies of gene function in a biologically relevant context was tested by carrying out gain and loss-of-function experiments for the

  20. Cell Culture Made Easy.

    Science.gov (United States)

    Dye, Frank J.

    1985-01-01

    Outlines steps to generate cell samples for observation and experimentation. The procedures (which use ordinary laboratory equipment) will establish a short-term primary culture of normal mammalian cells. Information on culture vessels and cell division and a list of questions to generate student interest and involvement in the topics are…

  1. Methods for culturing retinal pigment epithelial cells: a review of current protocols and future recommendations

    Directory of Open Access Journals (Sweden)

    Aaron H Fronk

    2016-07-01

    Full Text Available The retinal pigment epithelium is an important part of the vertebrate eye, particularly in studying the causes and possible treatment of age-related macular degeneration. The retinal pigment epithelium is difficult to access in vivo due to its location at the back of the eye, making experimentation with age-related macular degeneration treatments problematic. An alternative to in vivo experimentation is cultivating the retinal pigment epithelium in vitro, a practice that has been going on since the 1970s, providing a wide range of retinal pigment epithelial culture protocols, each producing cells and tissue of varying degrees of similarity to natural retinal pigment epithelium. The purpose of this review is to provide researchers with a ready list of retinal pigment epithelial protocols, their effects on cultured tissue, and their specific possible applications. Protocols using human and animal retinal pigment epithelium cells, derived from tissue or cell lines, are discussed, and recommendations for future researchers included.

  2. Differentiation of mouse embryonic stem cells into cardiomyocytes via the hanging-drop and mass culture methods.

    Science.gov (United States)

    Fuegemann, Christopher J; Samraj, Ajoy K; Walsh, Stuart; Fleischmann, Bernd K; Jovinge, Stefan; Breitbach, Martin

    2010-12-01

    Herein, we describe two protocols for the in vitro differentiation of mouse embryonic stem cells (mESCs) into cardiomyocytes. mESCs are pluripotent and can be differentiated into cells of all three germ layers, including cardiomyocytes. The methods described here facilitate the differentiation of mESCs into the different cardiac subtypes (atrial-, ventricular-, nodal-like cells). The duration of cell culture determines whether preferentially early- or late-developmental stage cardiomyocytes can be obtained preferentially. This approach allows the investigation of cardiomyocyte development and differentiation in vitro, and also allows for the enrichment and isolation of physiologically intact cardiomyocytes for transplantation purposes. © 2010 by John Wiley & Sons, Inc.

  3. Automated Method for the Rapid and Precise Estimation of Adherent Cell Culture Characteristics from Phase Contrast Microscopy Images

    Science.gov (United States)

    Jaccard, Nicolas; Griffin, Lewis D; Keser, Ana; Macown, Rhys J; Super, Alexandre; Veraitch, Farlan S; Szita, Nicolas

    2014-01-01

    The quantitative determination of key adherent cell culture characteristics such as confluency, morphology, and cell density is necessary for the evaluation of experimental outcomes and to provide a suitable basis for the establishment of robust cell culture protocols. Automated processing of images acquired using phase contrast microscopy (PCM), an imaging modality widely used for the visual inspection of adherent cell cultures, could enable the non-invasive determination of these characteristics. We present an image-processing approach that accurately detects cellular objects in PCM images through a combination of local contrast thresholding and post hoc correction of halo artifacts. The method was thoroughly validated using a variety of cell lines, microscope models and imaging conditions, demonstrating consistently high segmentation performance in all cases and very short processing times (image). Based on the high segmentation performance, it was possible to precisely determine culture confluency, cell density, and the morphology of cellular objects, demonstrating the wide applicability of our algorithm for typical microscopy image processing pipelines. Furthermore, PCM image segmentation was used to facilitate the interpretation and analysis of fluorescence microscopy data, enabling the determination of temporal and spatial expression patterns of a fluorescent reporter. We created a software toolbox (PHANTAST) that bundles all the algorithms and provides an easy to use graphical user interface. Source-code for MATLAB and ImageJ is freely available under a permissive open-source license. Biotechnol. Bioeng. 2014;111: 504–517. © 2013 Wiley Periodicals, Inc. PMID:24037521

  4. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    Science.gov (United States)

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  5. Development of a rapid culture method to induce adipocyte differentiation of human bone marrow-derived mesenchymal stem cells

    International Nuclear Information System (INIS)

    Ninomiya, Yuichi; Sugahara-Yamashita, Yzumi; Nakachi, Yutaka; Tokuzawa, Yoshimi; Okazaki, Yasushi; Nishiyama, Masahiko

    2010-01-01

    Human mesenchymal stem cells (hMSCs) derived from bone marrow are multipotent stem cells that can regenerate mesenchymal tissues such as adipose, bone or muscle. It is thought that hMSCs can be utilized as a cell resource for tissue engineering and as human models to study cell differentiation mechanisms, such as adipogenesis, osteoblastogenesis and so on. Since it takes 2-3 weeks for hMSCs to differentiate into adipocytes using conventional culture methods, the development of methods to induce faster differentiation into adipocytes is required. In this study we optimized the culture conditions for adipocyte induction to achieve a shorter cultivation time for the induction of adipocyte differentiation in bone marrow-derived hMSCs. Briefly, we used a cocktail of dexamethasone, insulin, methylisobutylxanthine (DIM) plus a peroxisome proliferator-activated receptor γ agonist, rosiglitazone (DIMRo) as a new adipogenic differentiation medium. We successfully shortened the period of cultivation to 7-8 days from 2-3 weeks. We also found that rosiglitazone alone was unable to induce adipocyte differentiation from hMSCs in vitro. However, rosiglitazone appears to enhance hMSC adipogenesis in the presence of other hormones and/or compounds, such as DIM. Furthermore, the inhibitory activity of TGF-β1 on adipogenesis could be investigated using DIMRo-treated hMSCs. We conclude that our rapid new culture method is very useful in measuring the effect of molecules that affect adipogenesis in hMSCs.

  6. Mammalian Cell Culture Simplified.

    Science.gov (United States)

    Moss, Robert; Solomon, Sondra

    1991-01-01

    A tissue culture experiment that does not require elaborate equipment and that can be used to teach sterile technique, the principles of animal cell line maintenance, and the concept of cell growth curves is described. The differences between cancerous and normal cells can be highlighted. The procedure is included. (KR)

  7. Methods Development for the Isolation and Culture of Primary Corneal Endothelial Cells

    Science.gov (United States)

    2017-02-01

    a cell population particularly suitable for low serum propagation, provided that appropriate growth factors are available. A low serum medium...of MGK. 15. SUBJECT TERMS Cornea, chemical warfare agent, corneal endothelial cell, endothelium, growth , isolation, mouse, rabbit, porcine, in...with corneal SM exposure.2 A primary requirement in achieving this goal is to develop methods that enable the isolation of a pure CEC population and

  8. Generation of hematopoietic stem cells from human embryonic stem cells using a defined, stepwise, serum-free, and serum replacement-free monolayer culture method.

    Science.gov (United States)

    Kim, So-Jung; Jung, Ji-Won; Ha, Hye-Yeong; Koo, Soo Kyung; Kim, Eung-Gook; Kim, Jung-Hyun

    2017-03-01

    Embryonic stem cells (ESCs) can be expanded infinitely in vitro and have the potential to differentiate into hematopoietic stem cells (HSCs); thus, they are considered a useful source of cells for HSC production. Although several technical in vitro methods for engineering HSCs from pluripotent stem cells have been developed, clinical application of HSCs engineered from pluripotent stem cells is restricted because of the possibility of xenogeneic contamination resulting from the use of murine materials. Human ESCs (CHA-hES15) were cultured on growth factor-reduced Matrigel-coated dishes in the mTeSR1 serum-free medium. When the cells were 70% confluent, we initiated HSC differentiation by three methods involving (1) knockout serum replacement (KSR), cytokines, TGFb1, EPO, and FLT3L; (2) KSR, cytokines, and bFGF; or (3) cytokines and bFGF. Among the three differentiation methods, the minimal number of cytokines without KSR resulted in the greatest production of HSCs. The optimized method resulted in a higher proportion of CD34 + CD43 + hematopoietic progenitor cells (HPCs) and CD34 + CD45 + HPCs compared to the other methods. In addition, the HSCs showed the potential to differentiate into multiple lineages of hematopoietic cells in vitro . In this study, we optimized a two-step, serum-free, animal protein-free, KSR-free, feeder-free, chemically defined monolayer culture method for generation of HSCs and hematopoietic stem and progenitor cells (HSPCs) from human ESCs.

  9. Gold cleaning methods for preparation of cell culture surfaces for self-assembled monolayers of zwitterionic oligopeptides.

    Science.gov (United States)

    Enomoto, Junko; Kageyama, Tatsuto; Myasnikova, Dina; Onishi, Kisaki; Kobayashi, Yuka; Taruno, Yoko; Kanai, Takahiro; Fukuda, Junji

    2018-05-01

    Self-assembled monolayers (SAMs) have been used to elucidate interactions between cells and material surface chemistry. Gold surfaces modified with oligopeptide SAMs exhibit several unique characteristics, such as cell-repulsive surfaces, micropatterns of cell adhesion and non-adhesion regions for control over cell microenvironments, and dynamic release of cells upon external stimuli under culture conditions. However, basic procedures for the preparation of oligopeptide SAMs, including appropriate cleaning methods of the gold surface before modification, have not been fully established. Because gold surfaces are readily contaminated with organic compounds in the air, cleaning methods may be critical for SAM formation. In this study, we examined the effects of four gold cleaning methods: dilute aqua regia, an ozone water, atmospheric plasma, and UV irradiation. Among the methods, UV irradiation most significantly improved the formation of oligopeptide SAMs in terms of repulsion of cells on the surfaces. We fabricated an apparatus with a UV light source, a rotation table, and HEPA filter, to treat a number of gold substrates simultaneously. Furthermore, UV-cleaned gold substrates were capable of detaching cell sheets without serious cell injury. This may potentially provide a stable and robust approach to oligopeptide SAM-based experiments for biomedical studies. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Bacterial cell culture

    OpenAIRE

    sprotocols

    2014-01-01

    ### Materials 1. Glass culture tubes with metal caps and labels - Growth medium, from media room or customized - Glass pipette tubes - Parafilm ### Equipment 1. Vortexer - Fireboy or Bunsen burner - Motorized pipette - Micropipettes and sterile tips ### Procedure For a typical liquid culture, use 5 ml of appropriate medium. The amount in each tube does not have to be exact if you are just trying to culture cells for their precious DNA. 1. Streak an a...

  11. Liver Cell Culture Devices

    NARCIS (Netherlands)

    Andria, B.; Bracco, A.; Cirino, G.; Chamuleau, R. A. F. M.

    2010-01-01

    In the last 15 years many different liver cell culture devices, consisting of functional liver cells and artificial materials, have been developed. They have been devised for numerous different applications, such as temporary organ replacement (a bridge to liver transplantation or native liver

  12. Evaluation of the radiosensitivity of acute myeloblastic leukaemia progenitor cells by culture methods exploring self-renewal. Evaluation de la radiosensibilite des progeniteurs de leucemie aigue myeloblastique par des methodes de culture explorant ou non l'autorenouvellement

    Energy Technology Data Exchange (ETDEWEB)

    Cowen, D; Richaud, P; Landriau, S; Lagarde, P; Gualde, N [Fondation Bergonie, 33 - Bordeaux (France); Boiron, J M [Hopital du Haut-Leveque, 33 - Pessac (France); Mahon, F X; Belloc, F [Hopital Regional, 33 - Bordeaux (France); Reiffers, J [Hopital du Haut-Leveque, 33 - Pessac (France) Hopital Regional, 33 - Bordeaux (France)

    1993-01-01

    The progenitor cells of acute myeloblastic leukaemia (AML) are usually cultured in methylcellulose which selects for terminal dividing cells. Suspension cultures have been developed because they reflect self-renewal: the exponential growth of the progenitors of AML cultured in suspension is due to self-renewal. We have compared the radiosensitivity of the progenitors of AML grown either in methylcellulose alone or first in suspension for 7 days before being plated in methylcellulose. Cells were harvested from leukaemic bone marrows at the moment of diagnosis. The myeloblastic lineage of the colonies was assessed by morphological, cytochemical and immunophenotypic analysis and by the use of growth factors which do not stimulate T-lymphocytes. The cell-cycle distribution of leukaemic blasts was comparable for all the samples. This method enabled aggressive leukaemias to be selected. The radiosensitivity showed wide variations from one patient to another (Do ranging from 0.35 to 2.6 Gy) whichever culture method used. The progenitor cells capable of self-renewal were more radiosensitive (Mean Do 0.9[+-]0.4 Gy) than terminal dividing cells (Mean Do = 1.35[+-]0.5 Gy). In two cases, a shoulder was found in the initial part of the cell-survival curves of cells capable of self-renewal. The shape of the curves was better fitted by the linear quadratic model with very low values of [alpha]/[beta], suggesting a reduced antileukaemic effect in case of fractionation.

  13. Improvement of large quantity breeding method for making radiation breeding efficient and development of cell culture techniques, (3)

    International Nuclear Information System (INIS)

    Hogetsu, Daisuke; Koyama, Motoko; Minami, Harufumi

    1990-01-01

    In the creation of useful mutant plants using cell culture techniques, the examination on the effectiveness of selecting useful mutation at cell level and the possibility of raising the selection efficiency by irradiation was aimed at. The experimental method is described. The young plants which accumulate proline were obtained. The cells which showed the resistance to hydroxyproline also showed the resistance to salt. In the improvement of redifferentiation ability by irradiation, the method of fixing IAA in the tissues of azuki plants was examined. The possibility of examining the change of IAA due to irradiation by microautoradiography was obtained. It is intended to examine the distribution of IAA in the formation of adventitious roots from the epicotyl of azuki plants. In the introduction of cell engineering techniques in radiation breeding, it is the objective to introduce the genes which resist sour rot that Brassica campestris, Brassica napus, Brassica oleracea and so on have by utilizing cell fusion process. The fusion of the reproduction cells of Brassica napus pollens and the cell protoplasts of Brassica campestris was successfully carried out. The possibility of new asymmetric fusion in Brassica napus was shown. (K.I.)

  14. A quantitative method for measurement of lysosomal acid phosphatase latency in cultured rat heart cells with 210Pb

    International Nuclear Information System (INIS)

    Hale, T.W.; Wenzel, D.G.

    1978-01-01

    A method is described for measuring the latency of lysomal acid phosphatase in cultured rat heart endotheloid cells. 210 Pb was added to a medium used to demonstrate acid phosphatase activity by the Gomori lead method, and the amount of lead deposited was measured with a liquid scintillation counter. Deposition rates were measured after enzyme activation pretreatments with acetate buffer (pH 5.0) at various osmolalities, and after formaldehyde fixation. Formaldehyde, alloxan, or fluoride in the Gomori medium were evaluated for their differential effects on lysosomal and non-lysosomal acid phosphatase The method was found to provide a sensitive, rapid and quantitative evaluation of acid phosphatase latency and should be useful for studying the integrity of lysosomes within cells. (author)

  15. Cell Culturing of Cytoskeleton

    Science.gov (United States)

    2004-01-01

    Biomedical research offers hope for a variety of medical problems, from diabetes to the replacement of damaged bone and tissues. Bioreactors, which are used to grow cells and tissue cultures, play a major role in such research and production efforts. Cell culturing, such as this bone cell culture, is an important part of biomedical research. The BioDyn payload includes a tissue engineering investigation. The commercial affiliate, Millenium Biologix, Inc., has been conducting bone implant experiments to better understand how synthetic bone can be used to treat bone-related illnesses and bone damaged in accidents. On STS-95, the BioDyn payload will include a bone cell culture aimed to help develop this commercial synthetic bone product. Millenium Biologix, Inc., is exploring the potential for making human bone implantable materials by seeding its proprietary artificial scaffold material with human bone cells. The product of this tissue engineering experiment using the Bioprocessing Modules (BPMs) on STS-95 is space-grown bone implants, which could have potential for dental implants, long bone grafts, and coating for orthopedic implants such as hip replacements.

  16. Oscillating Cell Culture Bioreactor

    Science.gov (United States)

    Freed, Lisa E.; Cheng, Mingyu; Moretti, Matteo G.

    2010-01-01

    To better exploit the principles of gas transport and mass transport during the processes of cell seeding of 3D scaffolds and in vitro culture of 3D tissue engineered constructs, the oscillatory cell culture bioreactor provides a flow of cell suspensions and culture media directly through a porous 3D scaffold (during cell seeding) and a 3D construct (during subsequent cultivation) within a highly gas-permeable closed-loop tube. This design is simple, modular, and flexible, and its component parts are easy to assemble and operate, and are inexpensive. Chamber volume can be very low, but can be easily scaled up. This innovation is well suited to work with different biological specimens, particularly with cells having high oxygen requirements and/or shear sensitivity, and different scaffold structures and dimensions. The closed-loop changer is highly gas permeable to allow efficient gas exchange during the cell seeding/culturing process. A porous scaffold, which may be seeded with cells, is fixed by means of a scaffold holder to the chamber wall with scaffold/construct orientation with respect to the chamber determined by the geometry of the scaffold holder. A fluid, with/without biological specimens, is added to the chamber such that all, or most, of the air is displaced (i.e., with or without an enclosed air bubble). Motion is applied to the chamber within a controlled environment (e.g., oscillatory motion within a humidified 37 C incubator). Movement of the chamber induces relative motion of the scaffold/construct with respect to the fluid. In case the fluid is a cell suspension, cells will come into contact with the scaffold and eventually adhere to it. Alternatively, cells can be seeded on scaffolds by gel entrapment prior to bioreactor cultivation. Subsequently, the oscillatory cell culture bioreactor will provide efficient gas exchange (i.e., of oxygen and carbon dioxide, as required for viability of metabolically active cells) and controlled levels of fluid

  17. Single Cell Electroporation Method for Mammalian CNS Neurons in Organotypic Slice Cultures

    Science.gov (United States)

    Uesaka, Naofumi; Hayano, Yasufumi; Yamada, Akito; Yamamoto, Nobuhiko

    Axon tracing is an essential technique to study the projection pattern of neurons in the CNS. Horse radish peroxidase and lectins have contributed to revealing many neural connection patterns in the CNS (Itaya and van Hoesen, 1982; Fabian and Coulter, 1985; Yoshihara, 2002). Moreover, a tracing method with fluorescent dye has enabled the observation of growing axons in living conditions, and demon strated a lot of developmental aspects in axon growth and guidance (Harris et al., 1987; O'Rourke and Fraser, 1990; Kaethner and Stuermer, 1992; Halloran and Kalil, 1994; Yamamoto et al., 1997). More recently, genetically encoded fluores cent proteins can be used as a powerful tool to observe various biological events. Several gene transfer techniques such as microinjection, biolistic gene gun, viral infection, lipofection and transgenic technology have been developed (Feng et al., 2000; Ehrengruber et al., 2001; O'Brien et al., 2001; Ma et al., 2002; Sahly et al., 2003). In particular, the electroporation technique was proved as a valuable tool, since it can be applied to a wide range of tissues and cell types with little toxicity and can be performed with relative technical easiness. Most methods, including a stand ard electroporation technique, are suitable for gene transfer to a large number of cells. However, this is not ideal for axonal tracing, because observation of individ ual axons is occasionally required. To overcome this problem, we have developed an electroporation method using glass micropipettes containing plasmid solutions and small current injection. Here we introduce the method in detail and exemplified results with some example applications and discuss its usefulness.

  18. Plant cell culture initiation

    NARCIS (Netherlands)

    Hall, R.D.

    2000-01-01

    The use of cultured plant cells in either organized or unorganized form has increased vey considerably in the last 10-15 yr. Many new technologies have been developed and applications in both fundamental and applied research have led to the development of some powerful tools for improving our

  19. Fabrication of agarose concave petridish for 3D-culture microarray method for spheroids formation of hepatic cells.

    Science.gov (United States)

    Zhang, Binbin; Li, Yang; Wang, Gaoshang; Jia, Zhidong; Li, Haiyan; Peng, Qing; Gao, Yi

    2018-04-19

    Liver is one of the most important organ in the body. But there are many limitations about liver transplantation for liver failure. It is quite important to develop the xenogeneic biological liver for providing an alternation to transplantation or liver regeneration. In this paper, we proposed a method to construct a novel kind of agarose 3D-culture concave microwell array for spheroids formation of hepatic cells. Using the 3D printing method, the microwell array was fabricated with an overall size of 6.4 mm × 6.4 mm, containing 121 microwells with 400 μm width/400 μm thickness. By exploiting the Polydimethylsiloxane (PDMS) membranes as a bridge, we finally fabricated the agarose one. We co-cultured three types of liver cells with bionics design in the microwell arrays. Using the methods described above, the resulting co-formed hepatocyte spheroids maintained the high viability and stable liver-specific functions. This engineered agarose concave microwell array could be a potentially useful tool for forming the elements for biological liver support. After developing the complete system, we also would consider to scale up the application of this system. It will be not only applied to the therapy of human organ damage, but also to the development of disease models and drug screening models.

  20. Metabolic labeling of sialic acids in tissue culture cell lines: methods to identify substituted and modified radioactive neuraminic acids

    International Nuclear Information System (INIS)

    Diaz, S.; Varki, A.

    1985-01-01

    The parent sialic acid N-acetylneuraminic acid can be modified or substituted in various ways, giving rise to a family of more than 25 compounds. The definitive identification of these compounds has previously required isolation of nanomole amounts for mass spectrometry or NMR. We have explored the possibility of using the known metabolic precursors of the sialic acids, particularly N-acetyl-[6-3H]mannosamine, to label and identify various forms of sialic acids in tissue culture cells. Firstly, we defined several variables that affect the labeling of sialic acids with N-acetyl-[6-3H]mannosamine. Secondly, we have devised a simple screening method to identify cell lines that synthesize substituted or modified sialic acids. We next demonstrate that it is possible to definitively identify the natures of the various labeled sialic acids without the use of mass spectrometry, even though they are present only in tracer amounts. The methods used include paper chromatography, analytical de-O-acetylation, periodate release of the 9-3H as [3H]formaldehyde (which is subsequently converted to a specific 3H-labeled chromophore), acylneuraminate pyruvate lyase treatment with identification of [3H]acylmannosamines, gas-liquid chromatography with radioactive detection, and two new high-pressure liquid chromatography methods utilizing the amine-adsorption:ion suppression and ion-pair principles. The use of an internal N-acetyl-[4-14C]neuraminic acid standard in each of these methods assures precision and accuracy. The combined use of these methods now allows the identification of radioactive tracer amounts of the various types of sialic acids in well-defined populations of tissue culture cells; it may also allow the identification of hitherto unknown forms of sialic acids

  1. Method for combined 3H and 14C autoradiography with a single emulsion tested in cultured mammalian cells

    International Nuclear Information System (INIS)

    Perdue, S.W.; Kimball, R.F.; Hsie, A.W.

    1977-01-01

    A single-gelatin expanded film method for double-isotope autoradiography is described. A preliminary classification based upon silver-grain distribution is used to assign labeled cells to 3 H only or with 14 C classes. Optical sectioning combined with grain counting is employed to obtain ratios for classifying cells labeled with 14 C into 14 C only and 3 H + 14 C classes. The method has been tested with CHO-K1 cells in plateau-phase cultures using two 24-h labeling periods. The experimental design allowed for independent estimation of the expected frequencies of label classes under conditions that provided a wide range of possible label levels and combinations. Previous methods have used time-consuming applications of two emulsion layers and exposures to distinguish between cells labeled with 3 H only or with 14 C and do not identify the 3 H + 14 C class. A single-gelatin expanded film requires only one exposure and permits all label classes to be determined by an objective grain-counting procedure

  2. Novel method to dynamically load cells in 3D-hydrogels culture for blast injury studies

    Science.gov (United States)

    Sory, David R.; Areias, Anabela C.; Overby, Darryl R.; Proud, William G.

    2017-01-01

    For at least a century explosive devices have been one of the most important causes of injuries in military conflicts as well as in terrorist attacks. Although significant experimental and modelling efforts have been focussed on blast injuries at the organ or tissue level, few studies have investigated the mechanisms of blast injuries at the cellular level. This paper introduces an in vitro method compatible with living cells to examine the effects of high stress and short-duration pulses relevant to blast loadings and blunt trauma. The experimental phase involves high strain-rate axial compression of cylindrical specimens within an hermetically sealed chamber made of biocompatible polymer. Numerical simulations were performed in order to verify the experimental loading conditions and to characterize the loading path within the sample. A proof of concept is presented so as to establish a new window to address fundamental questions regarding blast injury at the cellular level.

  3. Subcellular localization of SV2 and other secretory vesicle components in PC12 cells by an efficient method of preembedding EM immunocytochemistry for cell cultures

    DEFF Research Database (Denmark)

    Tanner, V A; Ploug, Thorkil; Tao-Cheng, J H

    1996-01-01

    substantially improved the efficiency of the preembedding EM ICC procedures for cell cultures. The advantages and related caveats of this method are discussed. SV2 was distinctly localized on dusters of synaptic vesicles and large dense-cored vesicles (LDCV). The distribution of SV2 on these two types...... of secretory vesicles was compared quantitatively to that of another secretory vesicle-associated transmembrane protein, synaptophysin. In cultures under similar experimental conditions, the ratio of SV2 vs synaptophysin ICC staining on synaptic vesicle dusters was about 1:1, whereas it was about 9:1 on LDCV...

  4. A new LC-ESI-MS/MS method to measure long-chain acylcarnitine levels in cultured cells

    International Nuclear Information System (INIS)

    Jauregui, Olga; Sierra, Adriana Y.; Carrasco, Patricia; Gratacos, Esther; Hegardt, Fausto G.; Casals, Nuria

    2007-01-01

    The quantitative evaluation of long-chain acylcarnitines in lipid extracts from cultured cells or tissues is a prerequisite to study carnitine palmitoyltransferase (CPT) activity. There is thus a need for the accurate measurement of the concentration of long-chain acylcarnitines at the lowest concentration present in lipid extracts. Here we report a fast and reliable quantitative method based on the use of weak acid extraction and liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) to quantify acylcarnitines through hydrophilic interaction chromatography. The method was validated using isotopic dilution and the results allow the analysis of a large number of samples at low concentration levels (down to 0.35 nmol L -1 for palmitoylcarnitine) with good inter- and intra-day precision. The method was used for the quantitative study of changes in concentration of palmitoylcarnitine and other acylcarnitines in PC-12 cells over-expressing CPT1a gene. It was also used to measure CPT1 activity in mitochondria isolated from transfected cells, giving similar results to the more common radiometric method, but with higher sensitivity

  5. A new LC-ESI-MS/MS method to measure long-chain acylcarnitine levels in cultured cells

    Energy Technology Data Exchange (ETDEWEB)

    Jauregui, Olga [Scientific and Technical Services, University of Barcelona (Spain); Sierra, Adriana Y.; Carrasco, Patricia; Gratacos, Esther [Molecular and Cellular Unit, School of Health Sciences, International University of Catalonia (Spain); Hegardt, Fausto G. [Department of Biochemistry and Molecular Biology, University of Barcelona, School of Pharmacy (Spain); Casals, Nuria [Molecular and Cellular Unit, School of Health Sciences, International University of Catalonia (Spain)], E-mail: ncasals@csc.uic.es

    2007-09-05

    The quantitative evaluation of long-chain acylcarnitines in lipid extracts from cultured cells or tissues is a prerequisite to study carnitine palmitoyltransferase (CPT) activity. There is thus a need for the accurate measurement of the concentration of long-chain acylcarnitines at the lowest concentration present in lipid extracts. Here we report a fast and reliable quantitative method based on the use of weak acid extraction and liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) to quantify acylcarnitines through hydrophilic interaction chromatography. The method was validated using isotopic dilution and the results allow the analysis of a large number of samples at low concentration levels (down to 0.35 nmol L{sup -1} for palmitoylcarnitine) with good inter- and intra-day precision. The method was used for the quantitative study of changes in concentration of palmitoylcarnitine and other acylcarnitines in PC-12 cells over-expressing CPT1a gene. It was also used to measure CPT1 activity in mitochondria isolated from transfected cells, giving similar results to the more common radiometric method, but with higher sensitivity.

  6. Development of an in vitro culture method for stepwise differentiation of mouse embryonic stem cells and induced pluripotent stem cells into mature osteoclasts.

    Science.gov (United States)

    Nishikawa, Keizo; Iwamoto, Yoriko; Ishii, Masaru

    2014-05-01

    The development of methods for differentiation of embryonic stem cells (ESCs) and induced pluripotent stem cell (iPSCs) into functional cells have helped to analyze the mechanism regulating cellular processes and to explore cell-based assays for drug discovery. Although several reports have demonstrated methods for differentiation of mouse ESCs into osteoclast-like cells, it remains unclear whether these methods are applicable for differentiation of iPSCs to osteoclasts. In this study, we developed a simple method for stepwise differentiation of mouse ESCs and iPSCs into bone-resorbing osteoclasts based upon a monoculture approach consisting of three steps. First, based on conventional hanging-drop methods, embryoid bodies (EBs) were produced from mouse ESCs or iPSCs. Second, EBs were cultured in medium supplemented with macrophage colony-stimulating factor (M-CSF), and differentiated to osteoclast precursors, which expressed CD11b. Finally, ESC- or iPSC-derived osteoclast precursors stimulated with receptor activator of nuclear factor-B ligand (RANKL) and M-CSF formed large multinucleated osteoclast-like cells that expressed tartrate-resistant acid phosphatase and were capable of bone resorption. Molecular analysis showed that the expression of osteoclast marker genes such as Nfatc1, Ctsk, and Acp5 are increased in a RANKL-dependent manner. Thus, our procedure is simple and easy and would be helpful for stem cell-based bone research.

  7. The effect of isolation and culture methods on epithelial stem cell populations and their progeny-toward an improved cell expansion protocol for clinical application.

    Science.gov (United States)

    Lenihan, Catherine; Rogers, Caroline; Metcalfe, Anthony D; Martin, Yella H

    2014-12-01

    The use of cultured epithelial keratinocytes in the treatment of burns and skin graft donor sites is well established in clinical practice. The most widely used culture method for clinical use was originally developed by Rheinwald and Green 40 years ago. This system uses irradiated mouse dermal fibroblasts as a feeder cell layer to promote keratinocyte growth, a process that is costly and labor-intensive for health care providers. The medium formulation contains several components of animal origin, which pose further safety risks for patients. Improvements and simplification in the culturing process would lead to clear advantages: improved safety through reduction of xenobiotic components and reduction in cost for health care providers by dispensing with feeder cells. We compared the Rheinwald and Green method to culture in three commercially available, feeder-free media systems with defined/absent components of animal origin. During the isolation process, short incubation times in high-strength trypsin resulted in increased numbers of liberated keratinocyte stem cells compared with longer incubation times. All three commercially available media tested in this study could support the expansion of keratinocytes, with phenotypes comparable to cells expanded using the established Rheinwald and Green method. Growth rates varied, with two of the media displaying comparable growth rates, whereas the third was significantly slower. Our study demonstrates the suitability of such feeder-free media systems in clinical use. It further outlines a range of techniques to evaluate keratinocyte phenotype when assessing the suitability of cells for clinical application. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  8. Epithelial Cell Cultures

    Directory of Open Access Journals (Sweden)

    Imran S. Chaudhry

    2011-01-01

    Full Text Available The biological effects of only a finite number of tobacco toxins have been studied. Here, we describe exposure of cultures of human bronchial epithelial cells to low concentrations of tobacco carcinogens: nickel sulphate, benzo(bfluoranthene, N-nitrosodiethylamine, and 4-(methylnitrosamino-1-(3-pyridyl-1-butanone (NNK. After a 24-hour exposure, EGFR was expressed in cell membrane and cytoplasm, BCL-2 was expressed only in the irregular nuclei of large atypical cells, MKI67 was expressed in nuclei with no staining in larger cells, cytoplasmic BIRC5 with stronger nuclear staining was seen in large atypical cells, and nuclear TP53 was strongly expressed in all cells. After only a 24-hour exposure, cells exhibited atypical nuclear and cytoplasmic features. After a 48-hour exposure, EGFR staining was localized to the nucleus, BCL-2 was slightly decreased in intensity, BIRC5 was localized to the cytoplasm, and TP53 staining was increased in small and large cells. BCL2L1 was expressed in both the cytoplasm and nuclei of cells at 24- and 48-hour exposures. We illustrate that short-termexposure of a bronchial epithelial cell line to smoking-equivalent concentrations of tobacco carcinogens alters the expression of key proliferation regulatory genes, EGFR, BCL-2, BCL2L1, BIRC5, TP53, and MKI67, similar to that reported in biopsy specimens of pulmonary epithelium described to be preneoplastic lesions.

  9. Optimization of chemically defined cell culture media--replacing fetal bovine serum in mammalian in vitro methods

    DEFF Research Database (Denmark)

    van der Valk, J; Brunner, D; De Smet, K

    2010-01-01

    with an undefined and variable composition. Defined media supplements are commercially available for some cell types. However, information on the formulation by the companies is often limited and such supplements can therefore not be regarded as completely defined. The development of defined media is difficult......, reproducible and reduce the use of experimental animals. Good cell culture practice (GCCP) is an attempt to develop a common standard for in vitro methods. The implementation of the use of chemically defined media is part of the GCCP. This will decrease the dependence on animal serum, a supplement...... and often takes place in isolation. A workshop was organised in 2009 in Copenhagen to discuss strategies to improve the development and use of serum-free defined media. In this report, the results from the meeting are discussed and the formulation of a basic serum-free medium is suggested. Furthermore...

  10. A simple method to determine evaporation and compensate for liquid losses in small-scale cell culture systems.

    Science.gov (United States)

    Wiegmann, Vincent; Martinez, Cristina Bernal; Baganz, Frank

    2018-04-24

    Establish a method to indirectly measure evaporation in microwell-based cell culture systems and show that the proposed method allows compensating for liquid losses in fed-batch processes. A correlation between evaporation and the concentration of Na + was found (R 2  = 0.95) when using the 24-well-based miniature bioreactor system (micro-Matrix) for a batch culture with GS-CHO. Based on these results, a method was developed to counteract evaporation with periodic water additions based on measurements of the Na + concentration. Implementation of this method resulted in a reduction of the relative liquid loss after 15 days of a fed-batch cultivation from 36.7 ± 6.7% without volume corrections to 6.9 ± 6.5% with volume corrections. A procedure was established to indirectly measure evaporation through a correlation with the level of Na + ions in solution and deriving a simple formula to account for liquid losses.

  11. A novel in vitro method for detecting undifferentiated human pluripotent stem cells as impurities in cell therapy products using a highly efficient culture system.

    Directory of Open Access Journals (Sweden)

    Keiko Tano

    Full Text Available Innovative applications of cell therapy products (CTPs derived from human pluripotent stem cells (hPSCs in regenerative medicine are currently being developed. The presence of residual undifferentiated hPSCs in CTPs is a quality concern associated with tumorigencity. However, no simple in vitro method for direct detection of undifferentiated hPSCs that contaminate CTPs has been developed. Here, we show a novel approach for direct and sensitive detection of a trace amount of undifferentiated human induced pluripotent stem cells (hiPSCs using a highly efficient amplification method in combination with laminin-521 and Essential 8 medium. Essential 8 medium better facilitated the growth of hiPSCs dissociated into single cells on laminin-521 than in mTeSR1 medium. hiPSCs cultured on laminin-521 in Essential 8 medium were maintained in an undifferentiated state and they maintained the ability to differentiate into various cell types. Essential 8 medium allowed robust hiPSC proliferation plated on laminin-521 at low cell density, whereas mTeSR1 did not enhance the cell growth. The highly efficient culture system using laminin-521 and Essential 8 medium detected hiPSCs spiked into primary human mesenchymal stem cells (hMSCs or human neurons at the ratio of 0.001%-0.01% as formed colonies. Moreover, this assay method was demonstrated to detect residual undifferentiated hiPSCs in cell preparations during the process of hMSC differentiation from hiPSCs. These results indicate that our highly efficient amplification system using a combination of laminin-521 and Essential 8 medium is able to detect a trace amount of undifferentiated hPSCs contained as impurities in CTPs and would contribute to quality assessment of hPSC-derived CTPs during the manufacturing process.

  12. Cultivation of murine bone marrow macrophages in sponges: a method that permits recovery of viable cultured cells

    Energy Technology Data Exchange (ETDEWEB)

    Akporiaye, E T; Stewart, S; Stewart, C C

    1984-01-01

    Various investigators have cultured murine bone marrow or peritoneal cells in vitro on glass or plastic surfaces with the ultimate aim of retrieving adherent macrophages for morphologic and functional evaluation. The removal of these adherent macrophages by conventional techniques has been consistently accompanied by low yield and significant cell damage. The authors report here a simple technique for culturing murine bone marrow cells in gelatin sponges (Spongostan and Gelfoam) in growth medium containing 10% fetal bovine serum and 10% L-cell conditioned medium. Viable cells were retrieved from the sponges in 10 min by digestion with collagenase. The in situ growth kinetics were similar to those found for cells cultured on plastic dishes. The recovered cells were adherent, phagocytic, positive for Fc ..gamma.. receptors, and had esterase activity. 23 references, 1 figure, 1 table.

  13. Perfusion based cell culture chips

    DEFF Research Database (Denmark)

    Heiskanen, Arto; Emnéus, Jenny; Dufva, Martin

    2010-01-01

    Performing cell culture in miniaturized perfusion chambers gives possibilities to experiment with cells under near in vivo like conditions. In contrast to traditional batch cultures, miniaturized perfusion systems provide precise control of medium composition, long term unattended cultures...... and tissue like structuring of the cultures. However, as this chapter illustrates, many issues remain to be identified regarding perfusion cell culture such as design, material choice and how to use these systems before they will be widespread amongst biomedical researchers....

  14. Expression of human immunodeficiency virus (HIV) in naturally infected peripheral blood mononuclear cells: comparison of a standard co-culture technique with a newly developed microculture method.

    Science.gov (United States)

    Eberlein, B; Baur, A; Neundorfer, M; Jahn, G

    1991-05-01

    Peripheral blood mononuclear cells (PBMCs) from 29 patients infected with human immunodeficiency virus (HIV) were cultured by two different methods. One was the standard co-culture technique, the other a newly developed microculture method. In this assay 10(6) PBMCs were cultivated in 250 microliters medium, no activating agents or allogeneic cells were present. P24 antigen production measured by this method was found in 7 out of 11 PBMC cultures of patients in the Walter Reed (WR) stage 1 or 2, whereas only 4 samples were positive by the co-culture procedure. Cultures from patients in the later stages of the disease (WR 5/6) showed a higher p24 production by the co-culture method than by the microculture assay. It is assumed that rapidly growing HIV strains can be better assessed by the co-culture method which may select for these strains. P24 expression can be more easily obtained by the microculture technique even in cases where slowly replicating strains may be present. In conclusion, results from the microculture procedure described may be a useful supplementation to findings observed by the co-culture method.

  15. Extremely thin layer plastification for focused-ion beam scanning electron microscopy: an improved method to study cell surfaces and organelles of cultured cells.

    Science.gov (United States)

    VAN Donselaar, E G; Dorresteijn, B; Popov-Čeleketić, D; VAN DE Wetering, W J; Verrips, T C; Boekhout, T; Schneijdenberg, C T W M; Xenaki, A T; VAN DER Krift, T P; Müller, W H

    2018-03-25

    Since the recent boost in the usage of electron microscopy in life-science research, there is a great need for new methods. Recently minimal resin embedding methods have been successfully introduced in the sample preparation for focused-ion beam scanning electron microscopy (FIB-SEM). In these methods several possibilities are given to remove as much resin as possible from the surface of cultured cells or multicellular organisms. Here we introduce an alternative way in the minimal resin embedding method to remove excess of resin from two widely different cell types by the use of Mascotte filter paper. Our goal in correlative light and electron microscopic studies of immunogold-labelled breast cancer SKBR3 cells was to visualise gold-labelled HER2 plasma membrane proteins as well as the intracellular structures of flat and round cells. We found a significant difference (p flat cell contained 2.46 ± 1.98 gold particles, and a round cell 5.66 ± 2.92 gold particles. Moreover, there was a clear difference in the subcellular organisation of these two cells. The round SKBR3 cell contained many organelles, such as mitochondria, Golgi and endoplasmic reticulum, when compared with flat SKBR3 cells. Our next goal was to visualise crosswall associated organelles, septal pore caps, of Rhizoctonia solani fungal cells by the combined use of a heavy metal staining and our extremely thin layer plastification (ETLP) method. At low magnifications this resulted into easily finding septa which appeared as bright crosswalls in the back-scattered electron mode in the scanning electron microscope. Then, a septum was selected for FIB-SEM. Cross-sectioned views clearly revealed the perforate septal pore cap of R. solani next to other structures, such as mitochondria, endoplasmic reticulum, lipid bodies, dolipore septum, and the pore channel. As the ETLP method was applied on two widely different cell types, the use of the ETLP method will be beneficial to correlative studies of other cell

  16. Umbilical cord Wharton's jelly repeated culture system: a new device and method for obtaining abundant mesenchymal stem cells for bone tissue engineering.

    Directory of Open Access Journals (Sweden)

    Zhengqi Chang

    Full Text Available To date, various types of cells for seeding regenerative scaffolds have been used for bone tissue engineering. Among seed cells, the mesenchymal stem cells derived from human umbilical cord Wharton's jelly (hUCMSCs represent a promising candidate and hold potential for bone tissue engineering due to the the lack of ethical controversies, accessibility, sourced by non-invasive procedures for donors, a reduced risk of contamination, osteogenic differentiation capacities, and higher immunomodulatory capacity. However, the current culture methods are somewhat complicated and inefficient and often fail to make the best use of the umbilical cord (UC tissues. Moreover, these culture processes cannot be performed on a large scale and under strict quality control. As a result, only a small quantity of cells can be harvested using the current culture methods. To solve these problems, we designed and evaluated an UC Wharton's jelly repeated culture device. Using this device, hUCMSCs were obtained from the repeated cultures and their quantities and biological characteristics were compared. We found that using our culture device, which retained all tissue blocks on the bottom of the dish, the total number of obtained cells increased 15-20 times, and the time required for the primary passage was reduced. Moreover, cells harvested from the repeated cultures exhibited no significant difference in their immunophenotype, potential for multilineage differentiation, or proliferative, osteoinductive capacities, and final osteogenesis. The application of the repeated culture frame (RCF not only made full use of the Wharton's jelly but also simplified and specified the culture process, and thus, the culture efficiency was significantly improved. In summary, abundant hUCMSCs of dependable quality can be acquired using the RCF.

  17. Microfluidic cell culture systems for drug research.

    Science.gov (United States)

    Wu, Min-Hsien; Huang, Song-Bin; Lee, Gwo-Bin

    2010-04-21

    In pharmaceutical research, an adequate cell-based assay scheme to efficiently screen and to validate potential drug candidates in the initial stage of drug discovery is crucial. In order to better predict the clinical response to drug compounds, a cell culture model that is faithful to in vivo behavior is required. With the recent advances in microfluidic technology, the utilization of a microfluidic-based cell culture has several advantages, making it a promising alternative to the conventional cell culture methods. This review starts with a comprehensive discussion on the general process for drug discovery and development, the role of cell culture in drug research, and the characteristics of the cell culture formats commonly used in current microfluidic-based, cell-culture practices. Due to the significant differences in several physical phenomena between microscale and macroscale devices, microfluidic technology provides unique functionality, which is not previously possible by using traditional techniques. In a subsequent section, the niches for using microfluidic-based cell culture systems for drug research are discussed. Moreover, some critical issues such as cell immobilization, medium pumping or gradient generation in microfluidic-based, cell-culture systems are also reviewed. Finally, some practical applications of microfluidic-based, cell-culture systems in drug research particularly those pertaining to drug toxicity testing and those with a high-throughput capability are highlighted.

  18. AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR DETECTING ENTEROVIRUS IN WATER

    Science.gov (United States)

    Echovirus and coxsackievirus can cause mild to severe disease following consumption of contaminated drinking water. However, comprehensive occurrence studies of enteroviruses in drinking water matrices are limited, in part because of the lack of available methods that are rapid, ...

  19. Comparison of different sample preparation methods for platinum determination in cultured cells by graphite furnace atomic absorption spectrometry

    Directory of Open Access Journals (Sweden)

    Man Xiao

    2017-01-01

    Full Text Available Background Platinum-based agents are widely used in chemotherapy against solid tumors and insufficient intracellular drug accumulation is one of the leading causes of platinum resistance which is associated with poor survival of tumor patients. Thus, the detection of intracellular platinum is pivotal for studies aiming to overcome platinum resistance. In the present study, we aimed to establish a reliable graphite furnace atomic absorption spectrometry (GFAAS-based assay to quantify the intracellular platinum content for cultured cells. Methods Several most commonly applied cell preparation methods, including 0.2% HNO3, 0.2% Triton X-100, concentrated nitric acid, RIPA combined with concentrated nitric acid and hydroxide, followed by GFAAS for platinum detection were compared in ovarian, cervical and liver cancer cell lines to obtain the optimal one, and parameters regarding linearity, accuracy, precision and sensitivity were evaluated. Influence of other metals on platinum detection and the storage conditions of samples were also determined. Results The treatment of cells with 0.2% HNO3 was superior to other approaches with fewer platinum loss and better repeatability. The recovery rate and precision of this method were 97.3%–103.0% and 1.4%–3.8%, respectively. The average recoveries in the presence of other metals were 95.1%–103.1%. The detection limit was 13.23 ug/L. The recovery rate of platinum remained acceptable even in cell samples stored in −20 °C or −80 °C for two months. Discussion After comparison, we found that 0.2% HNO3 was optimal for intracellular platinum quantification based on GFAAS, which presented values compatible with that of inductively-coupled plasma mass-spectrometry (ICP-MS, and this is partially attributed to the simplicity of this method. Moreover, the assay was proved to be accurate, sensitive, cost-effective and suitable for the research of platinum-based antitumor therapy.

  20. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  1. A spore counting method and cell culture model for chlorine disinfection studies of Encephalitozoon syn. Septata intestinalis.

    Science.gov (United States)

    Wolk, D M; Johnson, C H; Rice, E W; Marshall, M M; Grahn, K F; Plummer, C B; Sterling, C R

    2000-04-01

    The microsporidia have recently been recognized as a group of pathogens that have potential for waterborne transmission; however, little is known about the effects of routine disinfection on microsporidian spore viability. In this study, in vitro growth of Encephalitozoon syn. Septata intestinalis, a microsporidium found in the human gut, was used as a model to assess the effect of chlorine on the infectivity and viability of microsporidian spores. Spore inoculum concentrations were determined by using spectrophotometric measurements (percent transmittance at 625 nm) and by traditional hemacytometer counting. To determine quantitative dose-response data for spore infectivity, we optimized a rabbit kidney cell culture system in 24-well plates, which facilitated calculation of a 50% tissue culture infective dose (TCID(50)) and a minimal infective dose (MID) for E. intestinalis. The TCID(50) is a quantitative measure of infectivity and growth and is the number of organisms that must be present to infect 50% of the cell culture wells tested. The MID is as a measure of a system's permissiveness to infection and a measure of spore infectivity. A standardized MID and a standardized TCID(50) have not been reported previously for any microsporidian species. Both types of doses are reported in this paper, and the values were used to evaluate the effects of chlorine disinfection on the in vitro growth of microsporidia. Spores were treated with chlorine at concentrations of 0, 1, 2, 5, and 10 mg/liter. The exposure times ranged from 0 to 80 min at 25 degrees C and pH 7. MID data for E. intestinalis were compared before and after chlorine disinfection. A 3-log reduction (99.9% inhibition) in the E. intestinalis MID was observed at a chlorine concentration of 2 mg/liter after a minimum exposure time of 16 min. The log(10) reduction results based on percent transmittance-derived spore counts were equivalent to the results based on hemacytometer-derived spore counts. Our data

  2. Increasing cell culture population doublings for long-term growth of finite life span human cell cultures

    Science.gov (United States)

    Stampfer, Martha R; Garbe, James C

    2015-02-24

    Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.

  3. Rapid method for direct identification of bacteria in urine and blood culture samples by matrix-assisted laser desorption ionization time-of-flight mass spectrometry: intact cell vs. extraction method.

    Science.gov (United States)

    Ferreira, L; Sánchez-Juanes, F; Muñoz-Bellido, J L; González-Buitrago, J M

    2011-07-01

    Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) is a fast and reliable technology for the identification of microorganisms with proteomics approaches. Here, we compare an intact cell method and a protein extraction method before application on the MALDI plate for the direct identification of microorganisms in both urine and blood culture samples from clinical microbiology laboratories. The results show that the intact cell method provides excellent results for urine and is a good initial method for blood cultures. The extraction method complements the intact cell method, improving microorganism identification from blood culture. Thus, we consider that MALDI-TOF MS performed directly on urine and blood culture samples, with the protocols that we propose, is a suitable technique for microorganism identification, as compared with the routine methods used in the clinical microbiology laboratory. © 2010 The Authors. Clinical Microbiology and Infection © 2010 European Society of Clinical Microbiology and Infectious Diseases.

  4. Double isotopic method using dansyl chloride for the determination of GABA in rat C6 astrocytoma cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Kohl, R.L.; Quay, W.B.; Perez-Polo, J.R.

    1986-01-01

    Methods are described for the quantitative measurement of GABA in culture. The method can be adapted to any amino acid or dansyl-chloride-reactive species. The sensitivity and selectivity of the procedure result from the double isotopic design in which (/sup 14/C)-labeled internal standard was added to the samples before reaction with (3M)-labeled dansyl chloride. Values obtained by ion-exchange amino acid analysis of cultures agree closely with the values obtained by the double isotopic method. This method is sensitive enough to measure GABA intracellularly and the condition medium.

  5. Cell culture compositions

    Science.gov (United States)

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

    2014-03-18

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  6. Development of a method for the accurate measurement of protein turnover in neoplastic cells grown in culture

    International Nuclear Information System (INIS)

    Silverman, J.A.

    1984-01-01

    In this study, it was shown that standard techniques for cell recovery and sample preparation for liquid scintillation counting led to underestimation of the radioactivity present in cell proteins by 20-40%. These techniques involved labeling with 3 He leucine or 14 C leucine, scraping the cells from the dish in a buffer, TCA precipitation of the cell proteins, solubilization in NaOH and counting in a liquid scintillation counter. Hydrolysis of the proteins with HCl or Pronase significantly increased the recovery of the labeled proteins. Also, solubilization in situ with NaOH or hydrolysis in situ with Pronase recovered 5-10% additional labeled proteins. The techniques developed here allow the accurate measurement of radioactivity in cell proteins. In addition, these techniques were used to study protein turnover in rat hepatoma cells grown in culture. These cells regulated their growth rate through changes in the protein synthesis rate as opposed to changes in the protein degradation rate. These data support the hypothesis that neoplastic cells, unlike normal cells, do not regulate proteolysis in growth control; normal cells under similar conditions have been shown to activate lysosomal proteolysis as they reach confluence. The physiologic implications of this observation are discussed

  7. A method for high purity intestinal epithelial cell culture from adult human and murine tissues for the investigation of innate immune function.

    Science.gov (United States)

    Graves, Christina L; Harden, Scott W; LaPato, Melissa; Nelson, Michael; Amador, Byron; Sorenson, Heather; Frazier, Charles J; Wallet, Shannon M

    2014-12-01

    Intestinal epithelial cells (IECs) serve as an important physiologic barrier between environmental antigens and the host intestinal immune system. Thus, IECs serve as a first line of defense and may act as sentinel cells during inflammatory insults. Despite recent renewed interest in IEC contributions to host immune function, the study of primary IEC has been hindered by lack of a robust culture technique, particularly for small intestinal and adult tissues. Here, a novel adaptation for culture of primary IEC is described for human duodenal organ donor tissue as well as duodenum and colon of adult mice. These epithelial cell cultures display characteristic phenotypes and are of high purity. In addition, the innate immune function of human primary IEC, specifically with regard to Toll-like receptor (TLR) expression and microbial ligand responsiveness, is contrasted with a commonly used intestinal epithelial cell line (HT-29). Specifically, TLR expression at the mRNA level and production of cytokine (IFNγ and TNFα) in response to TLR agonist stimulation is assessed. Differential expression of TLRs as well as innate immune responses to ligand stimulation is observed in human-derived cultures compared to that of HT-29. Thus, use of this adapted method to culture primary epithelial cells from adult human donors and from adult mice will allow for more appropriate studies of IECs as innate immune effectors. Published by Elsevier B.V.

  8. Traditional and Modern Cell Culture in Virus Diagnosis.

    Science.gov (United States)

    Hematian, Ali; Sadeghifard, Nourkhoda; Mohebi, Reza; Taherikalani, Morovat; Nasrolahi, Abbas; Amraei, Mansour; Ghafourian, Sobhan

    2016-04-01

    Cell cultures are developed from tissue samples and then disaggregated by mechanical, chemical, and enzymatic methods to extract cells suitable for isolation of viruses. With the recent advances in technology, cell culture is considered a gold standard for virus isolation. This paper reviews the evolution of cell culture methods and demonstrates why cell culture is a preferred method for identification of viruses. In addition, the advantages and disadvantages of both traditional and modern cell culture methods for diagnosis of each type of virus are discussed. Detection of viruses by the novel cell culture methods is considered more accurate and sensitive. However, there is a need to include some more accurate methods such as molecular methods in cell culture for precise identification of viruses.

  9. Photothermal Microneedle Etching: Improved Three-Dimensional Microfabrication Method for Agarose Gel for Topographical Control of Cultured Cell Communities

    Science.gov (United States)

    Moriguchi, Hiroyuki; Yasuda, Kenji

    2006-08-01

    We have developed a new three-dimensional (3D) microfabrication method for agarose gel, photothermal microneedle etching (PTMNE), by means of an improved photothermal spot heating using a focused 1064 nm laser beam for melting a portion of the agarose layer at the tip of the microneedle, where a photoabsorbent chromium layer is coated to be heated. The advantage of this method is that it allows the 3D control of the melting topography within the thick agarose layer with a 2 μm resolution, whereas conventional photothermal etching can enable only two-dimensional (2D) control on the surface of the chip. By this method, we can form the spheroid clusters of particular cells from isolated single cells without any physical contact with other cells in other chambers, which is important for measuring the community effect of the cell group from isolated single cells. When we set single cancer cells in microchambers of 100 μm in diameter, formed in a 50-μm-thick agarose layer, we observed that they grew, divided, and formed spheroid clusters of cells in each microchamber. The result indicates the potential of this method to be a fundamental technique in the research of multicellular spherical clusters of cells for checking the community effect of cells in 3D structures, such as the permeabilities of chemicals and substrates into the cluster, which is complementary to conventional 2D dish cultivation and can contribute to the cell-based screening of drugs.

  10. Comparison of various methods of detection of different forms of dengue virus type 2 RNA in cultured cells

    International Nuclear Information System (INIS)

    Liu, H.S.; Lin, Y.L.; Chen, C.C.

    1997-01-01

    In this report, the sensitivity of various methods of detection of dengue virus type 2 (DEN-2) sense, antisense, replicative intermediate (RI) and replicative form (RF) RNAs in infected mosquito Aedes pseudoscutellaris AP-61 and mammalian baby hamster kidney BHK-21 cells is compared. LiCl precipitation was used for separation of viral RF RNA from RI RNA. Our results show that reverse transcription-polymerase chain reaction (RT-PCR) followed by Southern blot analysis and slot blot hybridisation of LiCl-fractionated RNA were the most sensitive methods of detection of viral RNA and determination of its single-stranded form. Northern blot analysis was the least sensitive method of detection of any form of viral RNA. U sing slot blot hybridisation of LiCl-precipitated RNA, viral RI RNA containing de novo synthesised negative strand viral RNA was first detected 30 min after virus inoculation in both cell lines. This is the earliest time of detection of DEN viral RNA synthesis in host cells so far reported. However, RF RNA could not be detected until 24 hrs post infection (p.i.) in AP-61 and 2 days p.i. in BHK-21 cells, respectively. The sequential order of individual forms of viral RNA detected in the infected cells was RI, RF and genomic RNAs. Viral RNA was detected in AP-61 cells always earlier than in BHK-21 cells. Moreover, the level of viral RNA in AP-61 cells was higher than that in BHK-21 cells, suggesting that the virus replicated more actively in AP-61 cells. In conclusion, the LiCl separation of viral RNA followed by slot blot hybridisation was found to be the most sensitive and reliable method of detection of DEN virus RI, RF and genomic RNAs in the infected cells. Moreover, this method can be applied to determine the replication status of any single-stranded RNA virus in the host. (authors)

  11. Principles of cancer cell culture.

    Science.gov (United States)

    Cree, Ian A

    2011-01-01

    The basics of cell culture are now relatively common, though it was not always so. The pioneers of cell culture would envy our simple access to manufactured plastics, media and equipment for such studies. The prerequisites for cell culture are a well lit and suitably ventilated laboratory with a laminar flow hood (Class II), CO(2) incubator, benchtop centrifuge, microscope, plasticware (flasks and plates) and a supply of media with or without serum supplements. Not only can all of this be ordered easily over the internet, but large numbers of well-characterised cell lines are available from libraries maintained to a very high standard allowing the researcher to commence experiments rapidly and economically. Attention to safety and disposal is important, and maintenance of equipment remains essential. This chapter should enable researchers with little prior knowledge to set up a suitable laboratory to do basic cell culture, but there is still no substitute for experience within an existing well-run laboratory.

  12. A simple and fast method for fixation of cultured cell lines that preserves cellular structures containing gamma-tubulin.

    Science.gov (United States)

    Alvarado-Kristensson, Maria

    2018-01-01

    When using fluorescence microscope techniques to study cells, it is essential that the cell structure and contents are preserved after preparation of the samples, and that the preparation method employed does not create artefacts that can be perceived as cellular structure/components. γ-Tubulin forms filaments that in some cases are immunostained with an anti-γ-tubulin antibody, but this immunostaining is not reproducible [[1], [2

  13. EVALUATION OF POTENCY OF MUMPS VACCINE USED IN IRAN: COMPARISON OF WHO AND NIBSC METHOD IN CELL CULTURE

    Directory of Open Access Journals (Sweden)

    S. Tavajohi

    2005-06-01

    Full Text Available Vaccination against mumps is included in world Health Organization (WHO program of global immunization. Safety and efficacy of vaccines must be confirmed by control units in charge of public health. In Iran, the secondary control on potency of vaccine has not been set up yet. We decided to overcome this problem by developing WHO and NIBSC methods in Food and Drug Control Lab. ‎Nine dilutions of vaccine from 10-1 to 10-5 in ‎0.5log10 steps were mixed with Vero cell suspension. In WHO method, the cell suspension was seeded in octaplicate (8 wells of each dilution in 24-well plate and incubated at 36°C for 10 days, during which the cells were checked for cytopathic changes everyday and positive wells were recorded. We used 5% serum and 1 × 105 cells for the assays. The test was repeated with six different vaccines produced in one batch. The mean potency was 10 4.475±0.134 CCID50/vial for each ten-dose vial. For NIBSC method the dilutions of vaccine were added to hexaplicate (6 well per dilution in 24-wells plate. After 3 hours, the medium was removed and overlay was added. Then the plates were incubated at 35°C for 10 days. After incubation period, the plaques were stained with methyl violet and counted. This assay was repeated three times and the mean of results was 5.93 log10 PFU/dose. ‎ Results indicate that the potency of the vaccine is in acceptable range in either method. WHO method is simple and less time consuming compared to NIBSC method.

  14. Identification and root cause analysis of cell culture media precipitates in the viral deactivation treatment with high-temperature/short-time method.

    Science.gov (United States)

    Cao, Xiaolin; Stimpfl, Gregory; Wen, Zai-Qing; Frank, Gregory; Hunter, Glenn

    2013-01-01

    High-temperature/short-time (HTST) treatment of cell culture media is one of the proven techniques used in the biopharmaceutical manufacturing industry for the prevention and mitigation of media viral contamination. With the HTST method, the formulated media is pasteurized (virus-deactivated) by heating and pumping the media continuously through the preset high-temperature holding tubes to achieve a specified period of time at a specific temperature. Recently, during the evaluation and implementation of HTST method in multiple Amgen, Inc. manufacturing facilities, media precipitates were observed in the tests of HTST treatments. The media precipitates may have adverse consequences such as clogging the HTST system, altering operating conditions and compromising the efficacy of viral deactivation, and ultimately affecting the media composition and cell growth. In this study, we report the identification of the composition of media precipitates from multiple media HTST runs using combined microspectroscopic methods including Raman, Fourier transform infrared spectroscopy, and scanning electron microscopy with energy-dispersive X-ray spectroscopy. The major composition in the precipitates was determined to be metal phosphates, including calcium phosphate, magnesium phosphate, and iron (III) phosphate. Based on the composition, stoichiometry, and root-cause study of media precipitations, methods were implemented for the mitigation and prevention of the occurrence of the media precipitation. Viral contamination in cell culture media is an important issue in the biopharmaceutical manufacturing industry and may have serious consequences on product quality, efficacy, and safety. High-temperature/short-time (HTST) treatment of cell culture media is one of the proven techniques used in the industry for the prevention and mitigation of media viral contamination. With the HTST method, the formulated media is pasteurized (virus-deactivated) by heating at preset conditions. This

  15. Mutation in cultured mammalian cells

    International Nuclear Information System (INIS)

    Nakamura, N.; Okada, S.

    1982-01-01

    Mammalian cell cultures were exposed to gamma-rays at various dose rates. Dose-rate effects were observed in cultured somatic cells of the mouse for cell killing and mutations resistant to 6-thioguanine (TGsup(r)) and to methotrexate (MTXsup(r)). Linear quadratic model may be applied to cell killing and TGsup(r) mutations in some cases but can not explain the whole data. Results at low doses with far low dose-rate were not predictable from data at high doses with acute or chronic irradiation. Radioprotective effects of dimethyl sulfoxide were seen only after acute exposure but not after chronic one, suggesting that damages by indirect action of radiations may be potentially reparable by cells. TGsup(r) mutations seem to contain gross structural changes whereas MTXsup(r) ones may have smaller alterations. (Namekawa, K.)

  16. Preliminary viability studies of fibroblastic cells cultured on microcrystalline and nanocrystalline diamonds produced by chemical vapour deposition method

    Directory of Open Access Journals (Sweden)

    Ana Amélia Rodrigues

    2013-02-01

    Full Text Available Implant materials used in orthopedics surgery have demonstrated some disadvantages, such as metallic corrosion processes, generation of wear particles, inflammation reactions and bone reabsorption in the implant region. The diamond produced through hot-filament chemical vapour deposition method is a new potential biomedical material due to its chemical inertness, extreme hardness and low coefficient of friction. In the present study we analysis two samples: the microcrystalline diamond and the nanocrystalline diamond. The aim of this study was to evaluate the surface properties of the diamond samples by scanning electron microscopy, Raman spectroscopy and atomic force microscopy. Cell viability and morphology were assessed using thiazolyl blue tetrazolium bromide, cytochemical assay and scanning electron microscopy, respectively. The results revealed that the two samples did not interfere in the cell viability, however the proliferation of fibroblasts cells observed was comparatively higher with the nanocrystalline diamond.

  17. Cell suspension method to improve green spot in in-vitro culture of jarak pagar (Jatropha curcas L ) mutant lines

    International Nuclear Information System (INIS)

    Ita Dwimahyani

    2007-01-01

    Jatropha curcas has a high potential as an alternative energy source, since it can produce natural oil which could be processed into fuel replacing fossil energy. Increasing demand of biodiesel has resulted in increasing demand for high quality of Jatropha germplasm. Cell suspension method is expected to assure the production of a homogeneous germplasm of Jatropha. A laboratory experiment was conducted to evaluate the effectiveness cell suspension method in of Jatropha curcas cotyledon. The explant used in this experiment was Jatropha curcas seed mutant line (JH-38) which has superiority in plant height, early maturity and unseasonable fruiting. Two kinds of in-vitro medium were used for callus induction, i.e. medium A (MS + 2,4-D 2.0 mg/l + BAP 0.5 mg/l + malt extract 0.1 g + agar 8.0 g/l) and medium B (MS + 2,4-D 3.0 mg/l + BAP 0,5 mg/l + malt extract 0,1 g + agar 8.0 g/l). The same medium composition without agar was used for cell generating, and medium ECS (MS + glutamine 0.5 g + casein hydrolysate 0.5 g + IAA 0.5 mg/l + BAP 3.0 mg/l + agar 8.0 g/l for cell growth. Results of the experiment showed that the optimum growth of calli was obtained by explant JH-38/3 in medium A. The growth level of embryonic cell ranged from 0 to 130 %. The optimum percentage green spot is shown by JH-38/1 explant in medium A. (author)

  18. Comparison of radiosensitivity and thermosensitivity among three types of cultured mammalian cells and detection of heat-induced cell killing by eosin-staining method

    Energy Technology Data Exchange (ETDEWEB)

    Kashiwado, Kouzou

    1988-12-01

    Radiosensitivity, Thermosensitivity and their combined sensitivity on cell death were studied using mouse L5178Y, mouse FM3A and human Burkitt lymphoma. Eosin-staining method was tested for counting the heat-induced dead cells. The results obtained in the present study were as follows: (1) In irradiation with /sup 60/Co gamma-rays D/sub 0/ values of 1.3 Gy, 1.4 Gy and 1.7 Gy were obtained for Burkitt lymphoma, L5178Y and FM3A respectively. (2) By heating at 43degC, T/sub 0/ values of 4.1 min, 12.5 min and 32 min were obtained for L5178Y, FM3A and Burkitt lymphoma respectively. (3) Thermotolerance decay depended on cell doubling time, that is, the shorter the doubling time, the faster the decay. Furthermore, the cell line with the higher thermosensitivity showed a faster decay of thermotolerance for the three cell lines used in the present study. (4) The radiosensitizing effects were nearly the same in all three cell lines. (5) Using eosin-staining method, the cell survival curves after hyperthermia were ascertained and compared with those obtained by colony forming method. In L5178Y the survival curves obtained by the two methods were nearly the same. In FM3A only some correlation was found betweewn the cell survival curves obtained by the two methods but in Burkitt lymphoma no correlation was found. (author) 52 refs.

  19. Comparison of radiosensitivity and thermosensitivity among three types of cultured mammalian cells and detection of heat-induced cell killing by eosin-staining method

    International Nuclear Information System (INIS)

    Kashiwado, Kouzou

    1988-01-01

    Radiosensitivity, Thermosensitivity and their combined sensitivity on cell death were studied using mouse L5178Y, mouse FM3A and human Burkitt lymphoma. Eosin-staining method was tested for counting the heat-induced dead cells. The results obtained in the present study were as follows: 1) In irradiation with 60 Co gamma-rays D 0 values of 1.3 Gy, 1.4 Gy and 1.7 Gy were obtained for Burkitt lymphoma, L5178Y and FM3A respectively. 2) By heating at 43degC, T 0 values of 4.1 min, 12.5 min and 32 min were obtained for L5178Y, FM3A and Burkitt lymphoma respectively. 3) Thermotolerance decay depended on cell doubling time, that is, the shorter the doubling time, the faster the decay. Furthermore, the cell line with the higher thermosensitivity showed a faster decay of thermotolerance for the three cell lines used in the present study. 4) The radiosensitizing effects were nearly the same in all three cell lines. 5) Using eosin-staining method, the cell survival curves after hyperthermia were ascertained and compared with those obtained by colony forming method. In L5178Y the survival curves obtained by the two methods were nearly the same. In FM3A only some correlation was found betweewn the cell survival curves obtained by the two methods but in Burkitt lymphoma no correlation was found. (author) 52 refs

  20. Methods for Stem Cell Production and Therapy

    Science.gov (United States)

    Valluri, Jagan V. (Inventor); Claudio, Pier Paolo (Inventor)

    2015-01-01

    The present invention relates to methods for rapidly expanding a stem cell population with or without culture supplements in simulated microgravity conditions. The present invention relates to methods for rapidly increasing the life span of stem cell populations without culture supplements in simulated microgravity conditions. The present invention also relates to methods for increasing the sensitivity of cancer stem cells to chemotherapeutic agents by culturing the cancer stem cells under microgravity conditions and in the presence of omega-3 fatty acids. The methods of the present invention can also be used to proliferate cancer cells by culturing them in the presence of omega-3 fatty acids. The present invention also relates to methods for testing the sensitivity of cancer cells and cancer stem cells to chemotherapeutic agents by culturing the cancer cells and cancer stem cells under microgravity conditions. The methods of the present invention can also be used to produce tissue for use in transplantation by culturing stem cells or cancer stem cells under microgravity conditions. The methods of the present invention can also be used to produce cellular factors and growth factors by culturing stem cells or cancer stem cells under microgravity conditions. The methods of the present invention can also be used to produce cellular factors and growth factors to promote differentiation of cancer stem cells under microgravity conditions.

  1. 9 CFR 101.6 - Cell cultures.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Cell cultures. 101.6 Section 101.6..., SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS DEFINITIONS § 101.6 Cell cultures. When used in conjunction with or in reference to cell cultures, which may be referred to as tissue cultures...

  2. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures.

    Science.gov (United States)

    McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and

  3. Cell culture from sponges: pluripotency and immortality

    NARCIS (Netherlands)

    Caralt Bosch, de S.; Uriz, M.J.; Wijffels, R.H.

    2007-01-01

    Sponges are a source of compounds with potential pharmaceutical applications. In this article, methods of sponge cell culture for production of these bioactive compounds are reviewed, and new approaches for overcoming the problem of metabolite supply are examined. The use of embryos is proposed as a

  4. Basic study on a lower-energy defibrillation method using computer simulation and cultured myocardial cell models.

    Science.gov (United States)

    Yaguchi, A; Nagase, K; Ishikawa, M; Iwasaka, T; Odagaki, M; Hosaka, H

    2006-01-01

    Computer simulation and myocardial cell models were used to evaluate a low-energy defibrillation technique. A generated spiral wave, considered to be a mechanism of fibrillation, and fibrillation were investigated using two myocardial sheet models: a two-dimensional computer simulation model and a two-dimensional experimental model. A new defibrillation technique that has few side effects, which are induced by the current passing into the patient's body, on cardiac muscle is desired. The purpose of the present study is to conduct a basic investigation into an efficient defibrillation method. In order to evaluate the defibrillation method, the propagation of excitation in the myocardial sheet is measured during the normal state and during fibrillation, respectively. The advantages of the low-energy defibrillation technique are then discussed based on the stimulation timing.

  5. Youth Culture and Cell Phone

    Directory of Open Access Journals (Sweden)

    mohammad saeed zokaei

    2009-11-01

    Full Text Available Iranian youth’s leisure culture has been immediately affected by the digital media culture. As a communicative media, cell phone has crossed borders of youth norms and identity; and in addition to facilitating their communication, has changed its patterns. Applying Bourdieu’s concepts of habitus and field, and relied on the qualitative and quantitative data gathered from the mobile youth users, the present study argues that mobile has produced a new field in which youth’s opportunities for leisure, entertainment, communication, and independence have extended. In addition, cell phone has facilitated and compensated for some defects in public sphere, and therefore empowered youth agency, individuality, and power. Despite this strengthening, cell phone does not cross borders of gender and class differences, or the levels of social capital.

  6. A novel culture method reveals unique neural stem/progenitors in mature porcine iris tissues that differentiate into neuronal and rod photoreceptor-like cells.

    Science.gov (United States)

    Royall, Lars N; Lea, Daniel; Matsushita, Tamami; Takeda, Taka-Aki; Taketani, Shigeru; Araki, Masasuke

    2017-11-15

    Iris neural stem/progenitor cells from mature porcine eyes were investigated using a new protocol for tissue culture, which consists of dispase treatment and Matrigel embedding. We used a number of culture conditions and found an intense differentiation of neuronal cells from both the iris pigmented epithelial (IPE) cells and the stroma tissue cells. Rod photoreceptor-like cells were also observed but mostly in a later stage of culture. Neuronal differentiation does not require any additives such as fetal bovine serum or FGF2, although FGF2 and IGF2 appeared to promote neural differentiation in the IPE cultures. Furthermore, the stroma-derived cells were able to be maintained in vitro indefinitely. The evolutionary similarity between humans and domestic pigs highlight the potential for this methodology in the modeling of human diseases and characterizing human ocular stem cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. In silico characterization of cell-cell interactions using a cellular automata model of cell culture.

    Science.gov (United States)

    Kihara, Takanori; Kashitani, Kosuke; Miyake, Jun

    2017-07-14

    Cell proliferation is a key characteristic of eukaryotic cells. During cell proliferation, cells interact with each other. In this study, we developed a cellular automata model to estimate cell-cell interactions using experimentally obtained images of cultured cells. We used four types of cells; HeLa cells, human osteosarcoma (HOS) cells, rat mesenchymal stem cells (MSCs), and rat smooth muscle A7r5 cells. These cells were cultured and stained daily. The obtained cell images were binarized and clipped into squares containing about 10 4 cells. These cells showed characteristic cell proliferation patterns. The growth curves of these cells were generated from the cell proliferation images and we determined the doubling time of these cells from the growth curves. We developed a simple cellular automata system with an easily accessible graphical user interface. This system has five variable parameters, namely, initial cell number, doubling time, motility, cell-cell adhesion, and cell-cell contact inhibition (of proliferation). Within these parameters, we obtained initial cell numbers and doubling times experimentally. We set the motility at a constant value because the effect of the parameter for our simulation was restricted. Therefore, we simulated cell proliferation behavior with cell-cell adhesion and cell-cell contact inhibition as variables. By comparing growth curves and proliferation cell images, we succeeded in determining the cell-cell interaction properties of each cell. Simulated HeLa and HOS cells exhibited low cell-cell adhesion and weak cell-cell contact inhibition. Simulated MSCs exhibited high cell-cell adhesion and positive cell-cell contact inhibition. Simulated A7r5 cells exhibited low cell-cell adhesion and strong cell-cell contact inhibition. These simulated results correlated with the experimental growth curves and proliferation images. Our simulation approach is an easy method for evaluating the cell-cell interaction properties of cells.

  8. Multistage carcinogenesis in cell culture.

    Science.gov (United States)

    Rubin, H

    2001-01-01

    Rodent fibroblasts explanted from embryos to culture undergo a period of declining growth rate in serial passages leading to crisis, followed by the appearance of variants which can multiply indefinitely. If the "immortal" cell line was established by low density passage, i.e., 3T3 cells, it has a low saturation density and is non-tumorigenic. If it was established by high density passage, it has a high saturation density and is tumorigenic. The establishment of cells goes through successive stages, including increased capacity to multiply in low serum concentration, growth to high saturation density, growth in suspension, assisted tumour formation in susceptible hosts and unassisted tumour formation. Chromosome aberrations and aneuploidy occur long before the capacity to produce tumours appears. Contrary to conventional belief, human fibroblast populations also undergo a continuous loss of capacity to multiply from the time of explantation, with only the longest surviving clone reaching the Hayflick limit. Neoplastic transformation of rodent cells is strongly favoured by maintaining them in a quiescent state at confluence for prolonged periods, which results in genetic damage to the cells. It also produces a large variety of chromosomal aberrations in human cells and extends their replicative lifespan. Individual clones are more susceptible to spontaneous transformation than their heterogeneous parental cultures. The implications of these results for tumour development in vivo are that oncogenic genetic changes may be common under stressful conditions which restrict replication, and that such changes are maximized when a rogue clone reaches a critical size that reduces stabilizing interactions with neighbouring clones. An alternative explanation, described in the Addendum, which we retrospectively favor is that the easily transformed clones are a minority in the uncloned parental population. The reason they transform before the parental population is that when

  9. Novel method to dynamically load cells in 3D-gel culture for primary blast injury studies

    Science.gov (United States)

    Sory, David; Cepa-Areias, Anabela; Overby, Darryl; Proud, William; Institute of Shock Physics, Department of Bioengineering; Royal British Legion CentreBlast I Collaboration

    2015-06-01

    For at least a century explosive devices have been reported as one of the most important causes of injuries on battlefield in military conflicts as well as in terrorist attacks. Although significant experimental and modelling efforts have been focussed on blast injury at the organ or tissue level, few studies have investigated the mechanism of blast injury at the cellular level. This paper introduces an in vitro method compatible with living cells to examine the effects of high stress and short-duration pulses similar to those observed in blast waves. The experimental phase involved high strain rate axial compression of biological cylindrical specimens within a hermetically sealed sample holder made of a biocompatible polymer. Numerical simulations were performed in order to characterize the loading path within the sample and assess the loading conditions. A proof of concept is presented so as to establish a new window to address fundamental questions regarding primary blast injury at the cellular level. The Institute of Shock Physics acknowledges the support of AWE, Aldermaston, UK and Imperial College London. The Centre for Blast Injury Studies acknowledges the support of the Royal British Legion and Imperial College London.

  10. Fluorometric method of quantitative cell mutagenesis

    Science.gov (United States)

    Dolbeare, F.A.

    1980-12-12

    A method for assaying a cell culture for mutagenesis is described. A cell culture is stained first with a histochemical stain, and then a fluorescent stain. Normal cells in the culture are stained by both the histochemical and fluorescent stains, while abnormal cells are stained only by the fluorescent stain. The two stains are chosen so that the histochemical stain absorbs the wavelengths that the fluorescent stain emits. After the counterstained culture is subjected to exciting light, the fluorescence from the abnormal cells is detected.

  11. Dynamized Preparations in Cell Culture

    Directory of Open Access Journals (Sweden)

    Ellanzhiyil Surendran Sunila

    2009-01-01

    Full Text Available Although reports on the efficacy of homeopathic medicines in animal models are limited, there are even fewer reports on the in vitro action of these dynamized preparations. We have evaluated the cytotoxic activity of 30C and 200C potencies of ten dynamized medicines against Dalton's Lymphoma Ascites, Ehrlich's Ascites Carcinoma, lung fibroblast (L929 and Chinese Hamster Ovary (CHO cell lines and compared activity with their mother tinctures during short-term and long-term cell culture. The effect of dynamized medicines to induce apoptosis was also evaluated and we studied how dynamized medicines affected genes expressed during apoptosis. Mother tinctures as well as some dynamized medicines showed significant cytotoxicity to cells during short and long-term incubation. Potentiated alcohol control did not produce any cytotoxicity at concentrations studied. The dynamized medicines were found to inhibit CHO cell colony formation and thymidine uptake in L929 cells and those of Thuja, Hydrastis and Carcinosinum were found to induce apoptosis in DLA cells. Moreover, dynamized Carcinosinum was found to induce the expression of p53 while dynamized Thuja produced characteristic laddering pattern in agarose gel electrophoresis of DNA. These results indicate that dynamized medicines possess cytotoxic as well as apoptosis-inducing properties.

  12. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  13. Cell Culture Assay for Human Noroviruses [response

    Energy Technology Data Exchange (ETDEWEB)

    Straub, Tim M.; Honer Zu Bentrup, Kerstin; Orosz Coghlan, Patricia; Dohnalkova, Alice; Mayer, Brooke K.; Bartholomew, Rachel A.; Valdez, Catherine O.; Bruckner-Lea, Cindy J.; Gerba, Charles P.; Abbaszadegan, Morteza A.; Nickerson, Cheryl A.

    2007-07-01

    We appreciate the comments provided by Leung et al., in response to our recently published article “In Vitro Cell Culture Infectivity Assay for Human Noroviruses” by Straub et al. (1). The specific aim of our project was to develop an in vitro cell culture infectivity assay for human noroviruses (hNoV) to enhance risk assessments when they are detected in water supplies. Reverse transcription (RT) qualitative or quantitative PCR are the primary assays for waterborne NoV monitoring. However, these assays cannot distinguish between infectious vs. non-infectious virions. When hNoV is detected in water supplies, information provided by our infectivity assay will significantly improve risk assessment models and protect human health, regardless of whether we are propagating NoV. Indeed, in vitro cell culture infectivity assays for the waterborne pathogen Cryptosporidium parvum that supplement approved fluorescent microscopy assays, do not result in amplification of the environmentally resistant hard-walled oocysts (2). However, identification of life cycle stages in cell culture provides evidence of infectious oocysts in a water supply. Nonetheless, Leung et al.’s assertion regarding the suitability of our method for the in vitro propagation of high titers of NoV is valid for the medical research community. In this case, well-characterized challenge pools of virus would be useful for developing and testing diagnostics, therapeutics, and vaccines. As further validation of our published findings, we have now optimized RT quantitative PCR to assess the level of viral production in cell culture, where we are indeed finding significant increases in viral titer. The magnitude and time course of these increases is dependent on both virus strain and multiplicity of infection. We are currently preparing a manuscript that will discuss these findings in greater detail, and the implications this may have for creating viral challenge pools

  14. Good cell culture practices &in vitro toxicology.

    Science.gov (United States)

    Eskes, Chantra; Boström, Ann-Charlotte; Bowe, Gerhard; Coecke, Sandra; Hartung, Thomas; Hendriks, Giel; Pamies, David; Piton, Alain; Rovida, Costanza

    2017-12-01

    Good Cell Culture Practices (GCCP) is of high relevance to in vitro toxicology. The European Society of Toxicology In Vitro (ESTIV), the Center for Alternatives for Animal Testing (CAAT) and the In Vitro Toxicology Industrial Platform (IVTIP) joined forces to address by means of an ESTIV 2016 pre-congress session the different aspects and applications of GCCP. The covered aspects comprised the current status of the OECD guidance document on Good In Vitro Method Practices, the importance of quality assurance for new technological advances in in vitro toxicology including stem cells, and the optimized implementation of Good Manufacturing Practices and Good Laboratory Practices for regulatory testing purposes. General discussions raised the duality related to the difficulties in implementing GCCP in an academic innovative research framework on one hand, and on the other hand, the need for such GCCP principles in order to ensure reproducibility and robustness of in vitro test methods for toxicity testing. Indeed, if good cell culture principles are critical to take into consideration for all uses of in vitro test methods for toxicity testing, the level of application of such principles may depend on the stage of development of the test method as well as on the applications of the test methods, i.e., academic innovative research vs. regulatory standardized test method. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Methods for safety culture improvement

    International Nuclear Information System (INIS)

    Sivintsev, Yu.V.

    1998-01-01

    New IAEA publication concerning the problems of safety assurance covering different aspects beginning from terminology applied and up to concrete examples of well and poor safety culture development at nuclear facilities is discussed. The safety culture is defined as such set of characteristics and specific activities of institutions and individual persons which states that safety problems of a nuclear facility are given the attention determined by their importance as being of highest priority. The statements of the new document have recommended, not mandatory character. It is emphasized that the process of safety culture improvement at nuclear facilities should be integral component of management procedure, not a bolt on extra

  16. Identification of differences in gene expression in primary cell cultures of human endometrial epithelial cells and trophoblast cells following their interaction

    DEFF Research Database (Denmark)

    Høgh, Mette; Islin, Henrik; Møller, Charlotte

    2006-01-01

    The interaction between the cell types was simulated in vitro by growing primary cell cultures of human endometrial epithelial cells and trophoblast cells together (co-culture) and separately (control cultures). Gene expression in the cell cultures was compared using the Differential Display method and confirmed...

  17. Isolation and culture of larval cells from C. elegans.

    Directory of Open Access Journals (Sweden)

    Sihui Zhang

    Full Text Available Cell culture is an essential tool to study cell function. In C. elegans the ability to isolate and culture cells has been limited to embryonically derived cells. However, cells or blastomeres isolated from mixed stage embryos terminally differentiate within 24 hours of culture, thus precluding post-embryonic stage cell culture. We have developed an efficient and technically simple method for large-scale isolation and primary culture of larval-stage cells. We have optimized the treatment to maximize cell number and minimize cell death for each of the four larval stages. We obtained up to 7.8×10(4 cells per microliter of packed larvae, and up to 97% of adherent cells isolated by this method were viable for at least 16 hours. Cultured larval cells showed stage-specific increases in both cell size and multinuclearity and expressed lineage- and cell type-specific reporters. The majority (81% of larval cells isolated by our method were muscle cells that exhibited stage-specific phenotypes. L1 muscle cells developed 1 to 2 wide cytoplasmic processes, while L4 muscle cells developed 4 to 14 processes of various thicknesses. L4 muscle cells developed bands of myosin heavy chain A thick filaments at the cell center and spontaneously contracted ex vivo. Neurons constituted less than 10% of the isolated cells and the majority of neurons developed one or more long, microtubule-rich protrusions that terminated in actin-rich growth cones. In addition to cells such as muscle and neuron that are high abundance in vivo, we were also able to isolate M-lineage cells that constitute less than 0.2% of cells in vivo. Our novel method of cell isolation extends C. elegans cell culture to larval developmental stages, and allows use of the wealth of cell culture tools, such as cell sorting, electrophysiology, co-culture, and high-resolution imaging of subcellular dynamics, in investigation of post-embryonic development and physiology.

  18. Melphalan metabolism in cultured cells

    International Nuclear Information System (INIS)

    Seagrave, J.C.; Valdez, J.G.; Tobey, R.A.; Gurley, L.R.

    1985-06-01

    Procedures are presented for the adaptation of reversed-phase-HPLC methods to accomplish separation and isolation of the cancer therapeutic drug melphalan (L-phenylalanine mustard) and its metabolic products from whole cells. Five major degradation products of melphalan were observed following its hydrolysis in phosphate buffer in vitro. The two most polar of these products (or modifications of them) were also found in the cytosol of Chinese hamster CHO cells. The amounts of these two polar products (shown not to be mono- or dihydroxymelphalan) were significantly changed by the pretreatment of cells with ZnC1 2 , one being increased in amount while the other was reduced to an insignificant level. In ZnC1 2 -treated cells, there was also an increased binding of melphalan (or its derivatives) to one protein fraction resolved by gel filtration-HPLC. These observations suggest that changes in polar melphalan products, and perhaps their interaction with a protein, may by involved in the reduction of melphalan cytotoxicity observed in ZnC1 2 -treated cells. While ZnC1 2 is also known to increase the level of glutathione in cells, no significant amounts of glutathione-melphalan derivatives of the type formed non-enzymatically in vitro could be detected in ZnC1 2 -treated or untreated cells. Formation of derivatives of melphalan with glutathione catabolic products in ZnC1 2 -treated cells has not yet been eliminated, however. 17 refs., 5 figs., 1 tab

  19. Biogelx: Cell Culture on Self-Assembling Peptide Gels.

    Science.gov (United States)

    Harper, Mhairi M; Connolly, Michael L; Goldie, Laura; Irvine, Eleanore J; Shaw, Joshua E; Jayawarna, Vineetha; Richardson, Stephen M; Dalby, Matthew J; Lightbody, David; Ulijn, Rein V

    2018-01-01

    Aromatic peptide amphiphiles can form self-supporting nanostructured hydrogels with tunable mechanical properties and chemical compositions. These hydrogels are increasingly applied in two-dimensional (2D) and three-dimensional (3D) cell culture, where there is a rapidly growing need to store, grow, proliferate, and manipulate naturally derived cells within a hydrated, 3D matrix. Biogelx Limited is a biomaterials company, created to commercialize these bio-inspired hydrogels to cell biologists for a range of cell culture applications. This chapter describes methods of various characterization and cell culture techniques specifically optimized for compatibility with Biogelx products.

  20. Usability and Applicability of Microfluidic Cell Culture Systems

    DEFF Research Database (Denmark)

    Hemmingsen, Mette

    possibilities for, for example, precise control of the chemical environment, 3D cultures, controlled co-culture of different cell types or automated, individual control of up to 96 cell culture chambers in one integrated system. Despite the great new opportunities to perform novel experimental designs......Microfluidic cell culture has been a research area with great attention the last decade due to its potential to mimic the in vivo cellular environment more closely compared to what is possible by conventional cell culture methods. Many exciting and complex devices have been presented providing......, these devices still lack general implementation into biological research laboratories. In this project, the usability and applicability of microfluidic cell culture systems have been investigated. The tested systems display good properties regarding optics and compatibility with standard laboratory equipment...

  1. Cell Culture as an Alternative in Education.

    Science.gov (United States)

    Nardone, Roland M.

    1990-01-01

    Programs that are intended to inform and provide "hands-on" experience for students and to facilitate the introduction of cell culture-based laboratory exercises into the high school and college laboratory are examined. The components of the CellServ Program and the Cell Culture Toxicology Training Programs are described. (KR)

  2. Cell culture techniques in honey bee research

    Science.gov (United States)

    Cell culture techniques are indispensable in most if not all life science disciplines to date. Wherever cell culture models are lacking scientific development is hampered. Unfortunately this has been and still is the case in honey bee research because permanent honey bee cell lines have not yet been...

  3. A defined and xeno-free culture method enabling the establishment of clinical-grade human embryonic, induced pluripotent and adipose stem cells.

    Directory of Open Access Journals (Sweden)

    Kristiina Rajala

    2010-04-01

    Full Text Available The growth of stem cells in in vitro conditions requires optimal balance between signals mediating cell survival, proliferation, and self-renewal. For clinical application of stem cells, the use of completely defined conditions and elimination of all animal-derived materials from the establishment, culture, and differentiation processes is desirable.Here, we report the development of a fully defined xeno-free medium (RegES, capable of supporting the expansion of human embryonic stem cells (hESC, induced pluripotent stem cells (iPSC and adipose stem cells (ASC. We describe the use of the xeno-free medium in the derivation and long-term (>80 passages culture of three pluripotent karyotypically normal hESC lines: Regea 06/015, Regea 07/046, and Regea 08/013. Cardiomyocytes and neural cells differentiated from these cells exhibit features characteristic to these cell types. The same formulation of the xeno-free medium is capable of supporting the undifferentiated growth of iPSCs on human feeder cells. The characteristics of the pluripotent hESC and iPSC lines are comparable to lines derived and cultured in standard undefined culture conditions. In the culture of ASCs, the xeno-free medium provided significantly higher proliferation rates than ASCs cultured in medium containing allogeneic human serum (HS, while maintaining the differentiation potential and characteristic surface marker expression profile of ASCs, although significant differences in the surface marker expression of ASCs cultured in HS and RegES media were revealed.Our results demonstrate that human ESCs, iPSCs and ASCs can be maintained in the same defined xeno-free medium formulation for a prolonged period of time while maintaining their characteristics, demonstrating the applicability of the simplified xeno-free medium formulation for the production of clinical-grade stem cells. The basic xeno-free formulation described herein has the potential to be further optimized for specific

  4. Silk fibroin immobilization on poly(ethylene terephthalate) films: Comparison of two surface modification methods and their effect on mesenchymal stem cells culture

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Meini; Yao, Jinrong; Chen, Xin; Huang, Lei; Shao, Zhengzhong, E-mail: zzshao@fudan.edu.cn

    2013-04-01

    Silk fibroin (SF) has played a curial role for the surface modification of conventional materials to improve the biocompatibility, and SF modified poly(ethylene terephthalate) (PET) materials have potential applications on tissue engineering such as artificial ligament, artificial vessel, artificial heart valve sewing cuffs dacron and surgical mesh engineering. In this work, SF was immobilized onto PET film via two different methods: 1) plasma pretreatment followed by SF dip coating (PET-SF) and 2) plasma-induce acrylic acid graft polymerization and subsequent covalent immobilization of SF on PET film (PET-PAA-SF). It could be found that plasma treatment provided higher surface roughness which was suitable for further SF dip coating, while grafted poly(acrylic acid) (PAA) promised the covalent bonding between SF and PAA. ATR-FTIR adsorption band at 3284 cm{sup −1}, 1623 cm{sup −1} and 1520 cm{sup −1} suggested the successful introduction of SF onto PET surface, while the amount of immobilized SF of PET-SF was higher than PET-PAA-SF according to XPS investigation (0.29 vs 0.23 for N/C ratio). Surface modified PET film was used as substrate for mesenchymal stem cells (MSCs) culture, the cells on PET-SF surface exhibited optimum density compared to PET-PAA-SF according to CCK-8 assays, which indicated that plasma pretreatment followed by SF dip coating was a simple and effective way to prepare biocompatible PET surface. Highlights: ► Silk fibroins were immobilized onto PET films with or without the linker of PAA. ► Various techniques were performed to characterize the modified surfaces ► Plasma treatment followed by SF dip coating introduced more SF onto PET films. ► Compare to PET-PAA-SF, PET-SF has better biocompatibility base on MSCs culture.

  5. The Method of Culture Contrast

    DEFF Research Database (Denmark)

    Hasse, Cathrine; Trentemøller, Stine; Motzkau, Johanna

    2009-01-01

    -cultural research can be argued to rest on what has been called implicit comparisons (Nader 1994) of such categorisations. We assume that research of local activities, such as schooling and higher education, is influenced by the researcher's emic and etic categorisations. To get beyond the risk of reproducing...... and surprising challenges of the researcher's emic categorisations. We illustrate the case with examples of different understandings of three terms, hierarchy, family, and sexual harassment, in the Understanding Puzzles in the Gendered European Map (UPGEM) project....

  6. PHYTOCHEMICAL STUDY OF CELL CULTURE JATROPHA CURCAS

    Directory of Open Access Journals (Sweden)

    KOMAR RUSLAN

    2011-01-01

    Full Text Available Jatropha curcas belongs to the Euphorbiaceae family which has potential economically. This plant has been reported to contain toxic compounds such as curcin and phorbol ester and its derivatives. These compounds may become a problem if J. curcas will be explored as a source of biofuel. In order to provide safety plants, the research on the study of phytochemical and initiation of cell and organ culture have been carried out. J curcas which has been collected from different regions in Indonesia showed to contain relatively the same profile of chemical contents. Dominant compounds that were detected by GCMS are hidrocarbon such as 2-heptenal, decadienal, hexsadecane, pentadecane, cyclooctane etc, fatty acid such as oktadecanoate acid, etthyl linoleate, ethyl stearate, heksadecanoate acid and steroid such as stigmasterol, fucosterol, sitosterol. No phorbol ester and its derivatives have been detected yet by the GCMS method. Callus and suspension cultures of J. curcas have been established to be used for further investigation.

  7. Replication of cultured lung epithelial cells

    International Nuclear Information System (INIS)

    Guzowski, D.; Bienkowski, R.

    1986-01-01

    The authors have investigated the conditions necessary to support replication of lung type 2 epithelial cells in culture. Cells were isolated from mature fetal rabbit lungs (29d gestation) and cultured on feeder layers of mitotically inactivated 3T3 fibroblasts. The epithelial nature of the cells was demonstrated by indirect immunofluorescent staining for keratin and by polyacid dichrome stain. Ultrastructural examination during the first week showed that the cells contained myofilaments, microvilli and lamellar bodies (markers for type 2 cells). The following changes were observed after the first week: increase in cell size; loss of lamellar bodies and appearance of multivesicular bodies; increase in rough endoplasmic reticulum and golgi; increase in tonafilaments and well-defined junctions. General cell morphology was good for up to 10 wk. Cells cultured on plastic surface degenerated after 1 wk. Cell replication was assayed by autoradiography of cultures exposed to ( 3 H)-thymidine and by direct cell counts. The cells did not replicate during the first week; however, between 2-10 wk the cells incorporated the label and went through approximately 6 population doublings. They have demonstrated that lung alveolar epithelial cells can replicate in culture if they are maintained on an appropriate substrate. The coincidence of ability to replicate and loss of markers for differentiation may reflect the dichotomy between growth and differentiation commonly observed in developing systems

  8. Culture conditions for bovine embryonic stem cell-like cells isolated from blastocysts after external fertilization

    OpenAIRE

    Jin, Muzi; Wu, Asga; Dorzhin, Sergei; Yue, Qunhua; Ma, Yuzhen; Liu, Dongjun

    2012-01-01

    Although isolation and characterization of embryonic stem cells have been successful in cattle, maintenance of bovine embryonic stem cells in culture remains difficult. In this study, we compared different methods of cell passaging, feeder cell layers and medium conditions for bovine embryonic stem cell-like cells. We found that a murine embryonic fibroblast feeder layer is more suitable for embryonic stem cell-like cells than bovine embryonic fibroblasts. When murine embryonic fibroblasts we...

  9. 3D Cell Culture in Alginate Hydrogels

    Directory of Open Access Journals (Sweden)

    Therese Andersen

    2015-03-01

    Full Text Available This review compiles information regarding the use of alginate, and in particular alginate hydrogels, in culturing cells in 3D. Knowledge of alginate chemical structure and functionality are shown to be important parameters in design of alginate-based matrices for cell culture. Gel elasticity as well as hydrogel stability can be impacted by the type of alginate used, its concentration, the choice of gelation technique (ionic or covalent, and divalent cation chosen as the gel inducing ion. The use of peptide-coupled alginate can control cell–matrix interactions. Gelation of alginate with concomitant immobilization of cells can take various forms. Droplets or beads have been utilized since the 1980s for immobilizing cells. Newer matrices such as macroporous scaffolds are now entering the 3D cell culture product market. Finally, delayed gelling, injectable, alginate systems show utility in the translation of in vitro cell culture to in vivo tissue engineering applications. Alginate has a history and a future in 3D cell culture. Historically, cells were encapsulated in alginate droplets cross-linked with calcium for the development of artificial organs. Now, several commercial products based on alginate are being used as 3D cell culture systems that also demonstrate the possibility of replacing or regenerating tissue.

  10. A simple method for multiday imaging of slice cultures.

    Science.gov (United States)

    Seidl, Armin H; Rubel, Edwin W

    2010-01-01

    The organotypic slice culture (Stoppini et al. A simple method for organotypic cultures of nervous tissue. 1991;37:173-182) has become the method of choice to answer a variety of questions in neuroscience. For many experiments, however, it would be beneficial to image or manipulate a slice culture repeatedly, for example, over the course of many days. We prepared organotypic slice cultures of the auditory brainstem of P3 and P4 mice and kept them in vitro for up to 4 weeks. Single cells in the auditory brainstem were transfected with plasmids expressing fluorescent proteins by way of electroporation (Haas et al. Single-cell electroporation for gene transfer in vivo. 2001;29:583-591). The culture was then placed in a chamber perfused with oxygenated ACSF and the labeled cell imaged with an inverted wide-field microscope repeatedly for multiple days, recording several time-points per day, before returning the slice to the incubator. We describe a simple method to image a slice culture preparation during the course of multiple days and over many continuous hours, without noticeable damage to the tissue or photobleaching. Our method uses a simple, inexpensive custom-built insulator constructed around the microscope to maintain controlled temperature and uses a perfusion chamber as used for in vitro slice recordings. (c) 2009 Wiley-Liss, Inc.

  11. 21st Century Cell Culture for 21st Century Toxicology.

    Science.gov (United States)

    Pamies, David; Hartung, Thomas

    2017-01-17

    There is no good science in bad models. Cell culture is especially prone to artifacts. A number of novel cell culture technologies have become more broadly available in the 21st century, which allow overcoming limitations of traditional culture and are more physiologically relevant. These include the use of stem-cell derived human cells, cocultures of different cell types, scaffolds and extracellular matrices, perfusion platforms (such as microfluidics), 3D culture, organ-on-chip technologies, tissue architecture, and organ functionality. The physiological relevance of such models is further enhanced by the measurement of biomarkers (e.g., key events of pathways), organ specific functionality, and more comprehensive assessment cell responses by high-content methods. These approaches are still rarely combined to create microphysiological systems. The complexity of the combination of these technologies can generate results closer to the in vivo situation but increases the number of parameters to control, bringing some new challenges. In fact, we do not argue that all cell culture needs to be that sophisticated. The efforts taken are determined by the purpose of our experiments and tests. If only a very specific molecular target to cell response is of interest, a very simple model, which reflects this, might be much more suited to allow standardization and high-throughput. However, the less defined the end point of interest and cellular response are, the better we should approximate organ- or tissue-like culture conditions to make physiological responses more probable. Besides these technologic advances, important progress in the quality assurance and reporting on cell cultures as well as the validation of cellular test systems brings the utility of cell cultures to a new level. The advancement and broader implementation of Good Cell Culture Practice (GCCP) is key here. In toxicology, this is a major prerequisite for meaningful and reliable results, ultimately

  12. A Simple Hydrophilic Treatment of SU-8 Surfaces for Cell Culturing and Cell Patterning

    DEFF Research Database (Denmark)

    Wang, Zhenyu; Stangegaard, Michael; Dufva, Hans Martin

    2005-01-01

    SU-8, an epoxy-based photoresist, widely used in constitution different mTAS systems, is incompatible with mammalian cell adhesion and culture in its native form. Here, we demonstrate a simple, cheap and robust two-step method to render a SU-8 surface hydrophilic and compatible with cell culture........ The contact angle of SU-8 surface was significantly reduced from 90° to 25° after the surface modification. The treated SU-8 surfaces provided a cell culture environment that was comparable with cell culture flask surface in terms of generation time and morphology....

  13. Differentiation of oligodendrocyte progenitor cells from dissociated monolayer and feeder-free cultured pluripotent stem cells.

    Science.gov (United States)

    Yamashita, Tomoko; Miyamoto, Yuki; Bando, Yoshio; Ono, Takashi; Kobayashi, Sakurako; Doi, Ayano; Araki, Toshihiro; Kato, Yosuke; Shirakawa, Takayuki; Suzuki, Yutaka; Yamauchi, Junji; Yoshida, Shigetaka; Sato, Naoya

    2017-01-01

    Oligodendrocytes myelinate axons and form myelin sheaths in the central nervous system. The development of therapies for demyelinating diseases, including multiple sclerosis and leukodystrophies, is a challenge because the pathogenic mechanisms of disease remain poorly understood. Primate pluripotent stem cell-derived oligodendrocytes are expected to help elucidate the molecular pathogenesis of these diseases. Oligodendrocytes have been successfully differentiated from human pluripotent stem cells. However, it is challenging to prepare large amounts of oligodendrocytes over a short amount of time because of manipulation difficulties under conventional primate pluripotent stem cell culture methods. We developed a proprietary dissociated monolayer and feeder-free culture system to handle pluripotent stem cell cultures. Because the dissociated monolayer and feeder-free culture system improves the quality and growth of primate pluripotent stem cells, these cells could potentially be differentiated into any desired functional cells and consistently cultured in large-scale conditions. In the current study, oligodendrocyte progenitor cells and mature oligodendrocytes were generated within three months from monkey embryonic stem cells. The embryonic stem cell-derived oligodendrocytes exhibited in vitro myelinogenic potency with rat dorsal root ganglion neurons. Additionally, the transplanted oligodendrocyte progenitor cells differentiated into myelin basic protein-positive mature oligodendrocytes in the mouse corpus callosum. This preparative method was used for human induced pluripotent stem cells, which were also successfully differentiated into oligodendrocyte progenitor cells and mature oligodendrocytes that were capable of myelinating rat dorsal root ganglion neurons. Moreover, it was possible to freeze, thaw, and successfully re-culture the differentiating cells. These results showed that embryonic stem cells and human induced pluripotent stem cells maintained in a

  14. Advances in cell culture: anchorage dependence

    Science.gov (United States)

    Merten, Otto-Wilhelm

    2015-01-01

    Anchorage-dependent cells are of great interest for various biotechnological applications. (i) They represent a formidable production means of viruses for vaccination purposes at very large scales (in 1000–6000 l reactors) using microcarriers, and in the last decade many more novel viral vaccines have been developed using this production technology. (ii) With the advent of stem cells and their use/potential use in clinics for cell therapy and regenerative medicine purposes, the development of novel culture devices and technologies for adherent cells has accelerated greatly with a view to the large-scale expansion of these cells. Presently, the really scalable systems—microcarrier/microcarrier-clump cultures using stirred-tank reactors—for the expansion of stem cells are still in their infancy. Only laboratory scale reactors of maximally 2.5 l working volume have been evaluated because thorough knowledge and basic understanding of critical issues with respect to cell expansion while retaining pluripotency and differentiation potential, and the impact of the culture environment on stem cell fate, etc., are still lacking and require further studies. This article gives an overview on critical issues common to all cell culture systems for adherent cells as well as specifics for different types of stem cells in view of small- and large-scale cell expansion and production processes. PMID:25533097

  15. Introducing Mammalian Cell Culture and Cell Viability Techniques in the Undergraduate Biology Laboratory.

    Science.gov (United States)

    Bowey-Dellinger, Kristen; Dixon, Luke; Ackerman, Kristin; Vigueira, Cynthia; Suh, Yewseok K; Lyda, Todd; Sapp, Kelli; Grider, Michael; Crater, Dinene; Russell, Travis; Elias, Michael; Coffield, V McNeil; Segarra, Verónica A

    2017-01-01

    Undergraduate students learn about mammalian cell culture applications in introductory biology courses. However, laboratory modules are rarely designed to provide hands-on experience with mammalian cells or teach cell culture techniques, such as trypsinization and cell counting. Students are more likely to learn about cell culture using bacteria or yeast, as they are typically easier to grow, culture, and manipulate given the equipment, tools, and environment of most undergraduate biology laboratories. In contrast, the utilization of mammalian cells requires a dedicated biological safety cabinet and rigorous antiseptic techniques. For this reason, we have devised a laboratory module and method herein that familiarizes students with common cell culture procedures, without the use of a sterile hood or large cell culture facility. Students design and perform a time-efficient inquiry-based cell viability experiment using HeLa cells and tools that are readily available in an undergraduate biology laboratory. Students will become familiar with common techniques such as trypsinizing cells, cell counting with a hemocytometer, performing serial dilutions, and determining cell viability using trypan blue dye. Additionally, students will work with graphing software to analyze their data and think critically about the mechanism of death on a cellular level. Two different adaptations of this inquiry-based lab are presented-one for non-biology majors and one for biology majors. Overall, these laboratories aim to expose students to mammalian cell culture and basic techniques and help them to conceptualize their application in scientific research.

  16. Multizone Paper Platform for 3D Cell Cultures

    Science.gov (United States)

    Derda, Ratmir; Hong, Estrella; Mwangi, Martin; Mammoto, Akiko; Ingber, Donald E.; Whitesides, George M.

    2011-01-01

    In vitro 3D culture is an important model for tissues in vivo. Cells in different locations of 3D tissues are physiologically different, because they are exposed to different concentrations of oxygen, nutrients, and signaling molecules, and to other environmental factors (temperature, mechanical stress, etc). The majority of high-throughput assays based on 3D cultures, however, can only detect the average behavior of cells in the whole 3D construct. Isolation of cells from specific regions of 3D cultures is possible, but relies on low-throughput techniques such as tissue sectioning and micromanipulation. Based on a procedure reported previously (“cells-in-gels-in-paper” or CiGiP), this paper describes a simple method for culture of arrays of thin planar sections of tissues, either alone or stacked to create more complex 3D tissue structures. This procedure starts with sheets of paper patterned with hydrophobic regions that form 96 hydrophilic zones. Serial spotting of cells suspended in extracellular matrix (ECM) gel onto the patterned paper creates an array of 200 micron-thick slabs of ECM gel (supported mechanically by cellulose fibers) containing cells. Stacking the sheets with zones aligned on top of one another assembles 96 3D multilayer constructs. De-stacking the layers of the 3D culture, by peeling apart the sheets of paper, “sections” all 96 cultures at once. It is, thus, simple to isolate 200-micron-thick cell-containing slabs from each 3D culture in the 96-zone array. Because the 3D cultures are assembled from multiple layers, the number of cells plated initially in each layer determines the spatial distribution of cells in the stacked 3D cultures. This capability made it possible to compare the growth of 3D tumor models of different spatial composition, and to examine the migration of cells in these structures. PMID:21573103

  17. Advances in 3D neuronal cell culture

    NARCIS (Netherlands)

    Frimat, Jean Philippe; Xie, Sijia; Bastiaens, Alex; Schurink, Bart; Wolbers, Floor; Den Toonder, Jaap; Luttge, Regina

    2015-01-01

    In this contribution, the authors present our advances in three-dimensional (3D) neuronal cell culture platform technology contributing to controlled environments for microtissue engineering and analysis of cellular physiological and pathological responses. First, a micromachined silicon sieving

  18. Surface modified alginate microcapsules for 3D cell culture

    Science.gov (United States)

    Chen, Yi-Wen; Kuo, Chiung Wen; Chueh, Di-Yen; Chen, Peilin

    2016-06-01

    Culture as three dimensional cell aggregates or spheroids can offer an ideal platform for tissue engineering applications and for pharmaceutical screening. Such 3D culture models, however, may suffer from the problems such as immune response and ineffective and cumbersome culture. This paper describes a simple method for producing microcapsules with alginate cores and a thin shell of poly(L-lysine)-graft-poly(ethylene glycol) (PLL-g-PEG) to encapsulate mouse induced pluripotent stem (miPS) cells, generating a non-fouling surface as an effective immunoisolation barrier. We demonstrated the trapping of the alginate microcapsules in a microwell array for the continuous observation and culture of a large number of encapsulated miPS cells in parallel. miPS cells cultured in the microcapsules survived well and proliferated to form a single cell aggregate. Droplet formation of monodisperse microcapsules with controlled size combined with flow cytometry provided an efficient way to quantitatively analyze the growth of encapsulated cells in a high-throughput manner. The simple and cost-effective coating technique employed to produce the core-shell microcapsules could be used in the emerging field of cell therapy. The microwell array would provide a convenient, user friendly and high-throughput platform for long-term cell culture and monitoring.

  19. A microwell cell culture platform for the aggregation of pancreatic β-cells.

    Science.gov (United States)

    Bernard, Abigail B; Lin, Chien-Chi; Anseth, Kristi S

    2012-08-01

    Cell-cell contact between pancreatic β-cells is important for maintaining survival and normal insulin secretion. Various techniques have been developed to promote cell-cell contact between β-cells, but a simple yet robust method that affords precise control over three-dimensional (3D) β-cell cluster size has not been demonstrated. To address this need, we developed a poly(ethylene glycol) (PEG) hydrogel microwell platform using photolithography. This microwell cell-culture platform promotes the formation of 3D β-cell aggregates of defined sizes from 25 to 210 μm in diameter. Using this platform, mouse insulinoma 6 (MIN6) β-cells formed aggregates with cell-cell adherin junctions. These naturally formed cell aggregates with controllable sizes can be removed from the microwells for macroencapsulation, implantation, or other biological assays. When removed and subsequently encapsulated in PEG hydrogels, the aggregated cell clusters demonstrated improved cellular viability (>90%) over 7 days in culture, while the β-cells encapsulated as single cells maintained only 20% viability. Aggregated MIN6 cells also exhibited more than fourfold higher insulin secretion in response to a glucose challenge compared with encapsulated single β-cells. Further, the cell aggregates stained positively for E-cadherin, indicative of the formation of cell junctions. Using this hydrogel microwell cell-culture method, viable and functional β-cell aggregates of specific sizes were created, providing a platform from which other biologically relevant questions may be answered.

  20. Culture of Mouse Neural Stem Cell Precursors

    OpenAIRE

    Currle, D. Spencer; Hu, Jia Sheng; Kolski-Andreaco, Aaron; Monuki, Edwin S.

    2007-01-01

    Primary neural stem cell cultures are useful for studying the mechanisms underlying central nervous system development. Stem cell research will increase our understanding of the nervous system and may allow us to develop treatments for currently incurable brain diseases and injuries. In addition, stem cells should be used for stem cell research aimed at the detailed study of mechanisms of neural differentiation and transdifferentiation and the genetic and environmental signals that direct the...

  1. Method of monolayer cultures of the guinea pig spleen used to evaluate the radioprotective action of mexamine on the survival of colony-forming cells. [Method of monolayer cultures, quantitative estimation of radioprotective action of drugs

    Energy Technology Data Exchange (ETDEWEB)

    Baisogolov, G D; Rudakova, S F; Rudakov, I A; Konoplyannikov, A G [Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii

    1976-01-01

    Dose dependent survival of colony-forming splenic cells of guinea pigs has been studied after ..gamma..-irradiation in vitro. The average lethal dose (D/sub 0/) for colony-forming cells is 245 rads, the extrapolation number - 1.5. Radiosensitivity of the splenic cells is markedly lower than that of the bone marrow cells (128 rads). After intraperitoneal administration of mexamine (150 mg/kg) to guinea pigs 10-15 min before irradiation, D/sub 0/ increases up to 319 rads, extrapolation number is 1.4, and DRF is 1.3.

  2. Micro fluidic System for Culturing and Monitoring of Neuronal Cells and Tissue

    DEFF Research Database (Denmark)

    Bakmand, Tanya; Waagepetersen, Helle S.

    The aim of this Ph.D. project was to combine experience within cell and tissue culturing, electrochemistry and microfabrication in order to develop an in vivo-like fluidic culturing platform, challenging the traditional culturing methods. The first goal was to develope a fluidic system for cultur...... with mass production. The last part of this thesis also includes perspectives on how to expand the latest designed device to facilitate culturing of tissue and co-culturing of cells....

  3. Multiplexed Single Intact Cell Droplet Digital PCR (MuSIC ddPCR) Method for Specific Detection of Enterohemorrhagic E. coli (EHEC) in Food Enrichment Cultures

    OpenAIRE

    McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.

    2017-01-01

    Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...

  4. Flux analysis of mammalian cell culture

    NARCIS (Netherlands)

    Martens, D.E.; Tramper, J.

    2010-01-01

    Animal cells are used for the production of vaccines and pharmaceutical proteins. The increase in demand for these products requires an increase in volumetric productivity of animal cell culture processes, which can be attained through an increase in biomass concentration and/or specific

  5. Quantitative volumetric Raman imaging of three dimensional cell cultures

    KAUST Repository

    Kallepitis, Charalambos; Bergholt, Mads S.; Mazo, Manuel M.; Leonardo, Vincent; Skaalure, Stacey C.; Maynard, Stephanie A.; Stevens, Molly M.

    2017-01-01

    in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies

  6. Towards quantification of toxicity of lithium ion battery electrolytes - development and validation of a liquid-liquid extraction GC-MS method for the determination of organic carbonates in cell culture materials.

    Science.gov (United States)

    Strehlau, Jenny; Weber, Till; Lürenbaum, Constantin; Bornhorst, Julia; Galla, Hans-Joachim; Schwerdtle, Tanja; Winter, Martin; Nowak, Sascha

    2017-10-01

    A novel method based on liquid-liquid extraction with subsequent gas chromatography separation and mass spectrometric detection (GC-MS) for the quantification of organic carbonates in cell culture materials is presented. Method parameters including the choice of extraction solvent, of extraction method and of extraction time were optimised and the method was validated. The setup allowed for determination within a linear range of more than two orders of magnitude. The limits of detection (LODs) were between 0.0002 and 0.002 mmol/L and the repeatability precisions were in the range of 1.5-12.9%. It could be shown that no matrix effects were present and recovery rates between 98 and 104% were achieved. The methodology was applied to cell culture models incubated with commercial lithium ion battery (LIB) electrolytes to gain more insight into the potential toxic effects of these compounds. The stability of the organic carbonates in cell culture medium after incubation was studied. In a porcine model of the blood-cerebrospinal fluid (CSF) barrier, it could be shown that a transfer of organic carbonates into the brain facing compartment took place. Graphical abstract Schematic setup for the investigation of toxicity of lithium ion battery electrolytes.

  7. High-Throughput Cancer Cell Sphere Formation for 3D Cell Culture.

    Science.gov (United States)

    Chen, Yu-Chih; Yoon, Euisik

    2017-01-01

    Three-dimensional (3D) cell culture is critical in studying cancer pathology and drug response. Though 3D cancer sphere culture can be performed in low-adherent dishes or well plates, the unregulated cell aggregation may skew the results. On contrary, microfluidic 3D culture can allow precise control of cell microenvironments, and provide higher throughput by orders of magnitude. In this chapter, we will look into engineering innovations in a microfluidic platform for high-throughput cancer cell sphere formation and review the implementation methods in detail.

  8. A correction method for systematic error in (1)H-NMR time-course data validated through stochastic cell culture simulation.

    Science.gov (United States)

    Sokolenko, Stanislav; Aucoin, Marc G

    2015-09-04

    The growing ubiquity of metabolomic techniques has facilitated high frequency time-course data collection for an increasing number of applications. While the concentration trends of individual metabolites can be modeled with common curve fitting techniques, a more accurate representation of the data needs to consider effects that act on more than one metabolite in a given sample. To this end, we present a simple algorithm that uses nonparametric smoothing carried out on all observed metabolites at once to identify and correct systematic error from dilution effects. In addition, we develop a simulation of metabolite concentration time-course trends to supplement available data and explore algorithm performance. Although we focus on nuclear magnetic resonance (NMR) analysis in the context of cell culture, a number of possible extensions are discussed. Realistic metabolic data was successfully simulated using a 4-step process. Starting with a set of metabolite concentration time-courses from a metabolomic experiment, each time-course was classified as either increasing, decreasing, concave, or approximately constant. Trend shapes were simulated from generic functions corresponding to each classification. The resulting shapes were then scaled to simulated compound concentrations. Finally, the scaled trends were perturbed using a combination of random and systematic errors. To detect systematic errors, a nonparametric fit was applied to each trend and percent deviations calculated at every timepoint. Systematic errors could be identified at time-points where the median percent deviation exceeded a threshold value, determined by the choice of smoothing model and the number of observed trends. Regardless of model, increasing the number of observations over a time-course resulted in more accurate error estimates, although the improvement was not particularly large between 10 and 20 samples per trend. The presented algorithm was able to identify systematic errors as small

  9. Substrate utilisation by plant-cell cultures

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, M W

    1982-01-01

    Plant cell cultures have been grown on a wide range of carbon sources in addition to the traditional ones of sucrose and glucose. Biomass yields and growth rates vary greatly between the different carbon sources and there is a variation in response between different cell cultures to individual carbon sources. Some attempts have been made to grow cell cultures on 'waste' and related carbon sources, such as lactose, maltose, starch, molasses and milk whey. Only maltose was found to support growth to anything near the levels observed with glucose and sucrose. In the case of molasses carbon source cell growth was either non-existent or only just measurable. All the data point to glucose as being the most suitable carbon source, principally on the grounds of biomass yield and growth rate. It should be noted, however, that other carbon sources do appear to have a major (positive) influence on natural product synthesis. Uptake into the cell is an important aspect of carbohydrate utilisation. There is strong evidence that from disaccharides upwards, major degradation to smaller units occurs before uptake. In some cases the necessary enzymes appear to be excreted into the culture broth, in others they may be located within the cell wall; invertase that hydrolyses sucrose is a good example. Once the products of carbohydrate degradation and mobilisation enter the cell they may suffer one of two fates, oxidation or utilisation for biosynthesis. The precise split between these two varies depending on such factors as cell growth rate, cell size, nutrient broth composition and carbohydrate status of the cells. In general rapidly growing cells have a high rate of oxidation, whereas cells growing more slowly tend to be more directed towards biosynthesis. Carbohydrate utilisation is a key area of study, underpinning as it does both biomass yield and natural product synthesis. (Refs. 13).

  10. Isolation and Culture of Postnatal Stem Cells from Deciduous Teeth

    OpenAIRE

    Olávez, Daniela; Facultad de Odontología Universidad de Los Andes; Salmen, Siham; Instituto de Inmunología Clínica, Universidad de Los Andes.; Padrón, Karla; Facultad de Odontología. Univerisdad de Los Andes.; Lobo, Carmine; Facultad de Odontología. Univerisdad de Los Andes.; Díaz, Nancy; Facultad de Odontología, Universidad de Los Andes.; Berrueta, Lisbeth; Doctora en Inmunología por Instituto Venezolano de Investigaciones Científicas (IVIC). Instituto de Inmunología Clínica, Facultad de Medicina, Universidad de Los Andes, Venezuela.; Solorzanio, Eduvigis; Facultad de Odontología, Universidad de Los Andes.

    2014-01-01

    Background: Currently, degenerative diseases represent a public health problem; therefore, the development and implementation of strategies to fully or partially recover of damaged tissues has a special interest in the biomedical field. Therapeutic strategies based on mesenchymal stem cells transplantation from dental pulp have been proposed as an alternative. Purpose: To develop a mesenchymal stem cells culture isolated from dental pulp of deciduous teeth. Methods: The mesenchymal stem cells...

  11. Isolation and Characterization of Poliovirus in Cell Culture Systems.

    Science.gov (United States)

    Thorley, Bruce R; Roberts, Jason A

    2016-01-01

    The isolation and characterization of enteroviruses by cell culture was accepted as the "gold standard" by clinical virology laboratories. Methods for the direct detection of all enteroviruses by reverse transcription polymerase chain reaction, targeting a conserved region of the genome, have largely supplanted cell culture as the principal diagnostic procedure. However, the World Health Organization's Global Polio Eradication Initiative continues to rely upon cell culture to isolate poliovirus due to the lack of a reliable sensitive genetic test for direct typing of enteroviruses from clinical specimens. Poliovirus is able to infect a wide range of mammalian cell lines, with CD155 identified as the primary human receptor for all three seroytpes, and virus replication leads to an observable cytopathic effect. Inoculation of cell lines with extracts of clinical specimens and subsequent passaging of the cells leads to an increased virus titre. Cultured isolates of poliovirus are suitable for testing by a variety of methods and remain viable for years when stored at low temperature.This chapter describes general procedures for establishing a cell bank and routine passaging of cell lines. While the sections on specimen preparation and virus isolation focus on poliovirus, the protocols are suitable for other enteroviruses.

  12. Maintenance of mesenchymal stem cells culture due to the cells with reduced attachment rate

    Directory of Open Access Journals (Sweden)

    Shuvalova N. S.

    2013-01-01

    Full Text Available Aim. The classic detachment techniques lead to changes in cells properties. We offer a simple method of cultivating the population of cells that avoided an influence on the surface structures. Methods. Mesenchymal stem cells (MSC from human umbilical cord matrix were obtained and cultivated in standard conditions. While substituting the culture media by a fresh portion, the conditioned culture medium, where the cells were maintained for three days, was transferred to other culture flacks with addition of serum and growth factors. Results. In the flacks, one day after medium transfer, we observed attached cells with typical MSC morphology. The cultures originated from these cells had the same rate of surface markers expression and clonogenic potential as those replated by standard methods. Conclusions. MSC culture, derived by preserving the cells with reduced attachment ability, actually has the properties of «parent» passage. Using this method with accepted techniques of cells reseeding would allow maintaining the cells that avoided an impact on the cell surface proteins.

  13. Cell culture experiments planned for the space bioreactor

    Science.gov (United States)

    Morrison, Dennis R.; Cross, John H.

    1987-01-01

    Culturing of cells in a pilot-scale bioreactor remains to be done in microgravity. An approach is presented based on several studies of cell culture systems. Previous and current cell culture research in microgravity which is specifically directed towards development of a space bioprocess is described. Cell culture experiments planned for a microgravity sciences mission are described in abstract form.

  14. Expression and functional activity of P-glycoprotein in passaged primary human nasal epithelial cell monolayers cultured by the air-liquid interface method for nasal drug transport study.

    Science.gov (United States)

    Cho, Hyun-Jong; Choi, Min-Koo; Lin, Hongxia; Kim, Jung Sun; Chung, Suk-Jae; Shim, Chang-Koo; Kim, Dae-Duk

    2011-03-01

    P-glycoprotein (P-gp) is an efflux transporter encoded by the multidrug resistance gene (MDR1), which is also known as the human ABCB1 gene (ATP-binding cassette, subfamily-B). The objectives of this study were to investigate the expression of P-gp in passaged primary human nasal epithelial (HNE) cell monolayer, cultured by the air-liquid interface (ALI) method, and to evaluate its feasibility as an in-vitro model for cellular uptake and transport studies of P-gp substrates. Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed to verify the expression of the MDR1 gene. Transport and cellular uptake studies with P-gp substrate (rhodamine123) and P-gp inhibitors (verapamil and cyclosporin A) were conducted to assess the functional activity of P-gp in HNE cell monolayers cultured by the ALI method. MDR1 gene expression in primary HNE cell monolayers cultured by ALI method was confirmed by RT-PCR. The apparent permeability coefficient (P(app) ) of the P-gp substrate (rhodamine123) in the basolateral to apical (B to A) direction was 6.9 times higher than that in the apical to basolateral (A to B) direction. B to A transport was saturated at high rhodamine123 concentration, and the treatment of P-gp inhibitors increased cellular uptake of rhodamine123 in a time- and concentration-dependent manner. These results support the MDR1 gene expression and the functional activity of P-gp in primary HNE cell monolayers cultured by the ALI method. © 2011 The Authors. JPP © 2011 Royal Pharmaceutical Society.

  15. Contributions of 3D Cell Cultures for Cancer Research.

    Science.gov (United States)

    Ravi, Maddaly; Ramesh, Aarthi; Pattabhi, Aishwarya

    2017-10-01

    Cancer cell lines have contributed immensely in understanding the complex physiology of cancers. They are excellent material for studies as they offer homogenous samples without individual variations and can be utilised with ease and flexibility. Also, the number of assays and end-points one can study is almost limitless; with the advantage of improvising, modifying or altering several variables and methods. Literally, a new dimension to cancer research has been achieved by the advent of 3Dimensional (3D) cell culture techniques. This approach increased many folds the ways in which cancer cell lines can be utilised for understanding complex cancer biology. 3D cell culture techniques are now the preferred way of using cancer cell lines to bridge the gap between the 'absolute in vitro' and 'true in vivo'. The aspects of cancer biology that 3D cell culture systems have contributed include morphology, microenvironment, gene and protein expression, invasion/migration/metastasis, angiogenesis, tumour metabolism and drug discovery, testing chemotherapeutic agents, adaptive responses and cancer stem cells. We present here, a comprehensive review on the applications of 3D cell culture systems for these aspects of cancers. J. Cell. Physiol. 232: 2679-2697, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. The Evolution of Polystyrene as a Cell Culture Material.

    Science.gov (United States)

    Lerman, Max J; Lembong, Josephine; Muramoto, Shin; Gillen, Greg; Fisher, John P

    2018-04-10

    Polystyrene (PS) has brought in vitro cell culture from its humble beginnings to the modern era, propelling dozens of research fields along the way. This review discusses the development of the material, fabrication, and treatment approaches to create the culture material. However, native PS surfaces poorly facilitate cell adhesion and growthin vitro. To overcome this, liquid surface deposition, energetic plasma activation, and emerging functionalization methods transform the surface chemistry. This review seeks to highlight the many potential applications of the first widely accepted polymer growth surface. Although the majority of in vitro research occurs on 2D surfaces, the importance of 3D culture models cannot be overlooked. Here the methods to transition PS to specialized 3D culture surfaces are also reviewed. Specifically, casting, electrospinning, 3D printing, and microcarrier approaches to shift PS to a 3D culture surface are highlighted. The breadth of applications of the material makes it impossible to highlight every use, but the aim remains to demonstrate the versatility and potential as both a general and custom cell culture surface. The review concludes with emerging scaffolding approaches and, based on the findings, presents our insights on the future steps for PS as a tissue culture platform.

  17. Isolation of Lysosomes from Mammalian Tissues and Cultured Cells.

    Science.gov (United States)

    Aguado, Carmen; Pérez-Jiménez, Eva; Lahuerta, Marcos; Knecht, Erwin

    2016-01-01

    Lysosomes participate within the cells in the degradation of organelles, macromolecules, and a wide variety of substrates. In any study on specific roles of lysosomes, both under physiological and pathological conditions, it is advisable to include methods that allow their reproducible and reliable isolation. However, purification of lysosomes is a difficult task, particularly in the case of cultured cells. This is mainly because of the heterogeneity of these organelles, along with their low number and high fragility. Also, isolation methods, while disrupting plasma membranes, have to preserve the integrity of lysosomes, as the breakdown of their membranes releases enzymes that could damage all cell organelles, including themselves. The protocols described below have been routinely used in our laboratory for the specific isolation of lysosomes from rat liver, NIH/3T3, and other cultured cells, but can be adapted to other mammalian tissues or cell lines.

  18. Cloning higher plants from aseptically cultured tissues and cells

    Science.gov (United States)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  19. A single-cell and feeder-free culture system for monkey embryonic stem cells.

    Science.gov (United States)

    Ono, Takashi; Suzuki, Yutaka; Kato, Yosuke; Fujita, Risako; Araki, Toshihiro; Yamashita, Tomoko; Kato, Hidemasa; Torii, Ryuzo; Sato, Naoya

    2014-01-01

    Primate pluripotent stem cells (PSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), hold great potential for research and application in regenerative medicine and drug discovery. To maximize primate PSC potential, a practical system is required for generating desired functional cells and reproducible differentiation techniques. Much progress regarding their culture systems has been reported to date; however, better methods would still be required for their practical use, particularly in industrial and clinical fields. Here we report a new single-cell and feeder-free culture system for primate PSCs, the key feature of which is an originally formulated serum-free medium containing FGF and activin. In this culture system, cynomolgus monkey ESCs can be passaged many times by single-cell dissociation with traditional trypsin treatment and can be propagated with a high proliferation rate as a monolayer without any feeder cells; further, typical PSC properties and genomic stability can be retained. In addition, it has been demonstrated that monkey ESCs maintained in the culture system can be used for various experiments such as in vitro differentiation and gene manipulation. Thus, compared with the conventional culture system, monkey ESCs grown in the aforementioned culture system can serve as a cell source with the following practical advantages: simple, stable, and easy cell maintenance; gene manipulation; cryopreservation; and desired differentiation. We propose that this culture system can serve as a reliable platform to prepare primate PSCs useful for future research and application.

  20. Radiosensitivity and TP 53, EGFR amplification and LOH10 analysis of primary glioma cell cultures

    NARCIS (Netherlands)

    Gerlach, Bärbel; Harder, Anna H.; Hulsebos, Theo J. M.; Leenstra, Sieger; Slotman, Berend J.; Vandertop, W. Peter; Hartmann, Karl-Axel; Sminia, Peter

    2002-01-01

    Aim: Determination of in-vitro radiosensitivity and genetic alterations of cell cultures derived from human glioma biopsy tissue and established glioma cell lines. Material and Methods: Fresh brain tumor specimens of six patients were processed to early passage cell cultures. In addition the cell

  1. Induction of pluripotent stem cells from fibroblast cultures.

    Science.gov (United States)

    Takahashi, Kazutoshi; Okita, Keisuke; Nakagawa, Masato; Yamanaka, Shinya

    2007-01-01

    Clinical application of embryonic stem (ES) cells faces difficulties regarding use of embryos, as well as tissue rejection after implantation. One way to circumvent these issues is to generate pluripotent stem cells directly from somatic cells. Somatic cells can be reprogrammed to an embryonic-like state by the injection of a nucleus into an enucleated oocyte or by fusion with ES cells. However, little is known about the mechanisms underlying these processes. We have recently shown that the combination of four transcription factors can generate ES-like pluripotent stem cells directly from mouse fibroblast cultures. The cells, named induced pluripotent stem (iPS) cells, can be differentiated into three germ layers and committed to chimeric mice. Here we describe detailed methods and tips for the generation of iPS cells.

  2. Establishment of Cancer Stem Cell Cultures from Human Conventional Osteosarcoma.

    Science.gov (United States)

    Palmini, Gaia; Zonefrati, Roberto; Mavilia, Carmelo; Aldinucci, Alessandra; Luzi, Ettore; Marini, Francesca; Franchi, Alessandro; Capanna, Rodolfo; Tanini, Annalisa; Brandi, Maria Luisa

    2016-10-14

    The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains poor when metastasis has occurred. The Cancer Stem Cell (CSC) theory holds that there is a subset of tumor cells within the tumor that have stem-like characteristics, including the capacity to maintain the tumor and to resist multidrug chemotherapy. Therefore, a better understanding of OS biology and pathogenesis is needed in order to advance the development of targeted therapies to eradicate this particular subset and to reduce morbidity and mortality among patients. Isolating CSCs, establishing cell cultures of CSCs, and studying their biology are important steps to improving our understanding of OS biology and pathogenesis. The establishment of human-derived OS-CSCs from biopsies of OS has been made possible using several methods, including the capacity to create 3-dimensional stem cell cultures under nonadherent conditions. Under these conditions, CSCs are able to create spherical floating colonies formed by daughter stem cells; these colonies are termed "cellular spheres". Here, we describe a method to establish CSC cultures from primary cell cultures of conventional OS obtained from OS biopsies. We clearly describe the several passages required to isolate and characterize CSCs.

  3. Transfection in Primary Cultured Neuronal Cells.

    Science.gov (United States)

    Marwick, Katie F M; Hardingham, Giles E

    2017-01-01

    Transfection allows the introduction of foreign nucleic acid into eukaryotic cells. It is an important tool in understanding the roles of NMDARs in neurons. Here, we describe using lipofection-mediated transfection to introduce cDNA encoding NMDAR subunits into postmitotic rodent primary cortical neurons maintained in culture.

  4. Cell Culture Microfluidic Biochips: Experimental Throughput Maximization

    DEFF Research Database (Denmark)

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan

    2011-01-01

    Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory, integrating all necessary functionalities on-chip in order to perform biochemical applications. Researchers have started to propose computer-aided design tools for the synthesis of such biochips. Our focus...... metaheuristic for experimental design generation for the cell culture microfluidic biochips, and we have evaluated our approach using multiple experimental setups....

  5. Plant Cell Culture Initiation: practical tips

    NARCIS (Netherlands)

    Hall, R.D.

    2001-01-01

    The use of cultured plant cells in either organized or unorganized form has increased vey considerably in the last 10-15 yr. Many new technologies have been developed and applications in both fundamental and applied research have led to the development of some powerful tools for improving our

  6. Nanotechnology, Cell Culture and Tissue Engineering

    Directory of Open Access Journals (Sweden)

    Kazutoshi Haraguchi

    2011-01-01

    Full Text Available We have fabricated new types of polymer hydrogels and polymer nanocomposites, i.e., nanocomposite gels (NC gels and soft, polymer nanocomposites (M-NCs: solid, with novel organic/inorganic network structures. Both NC gels and M-NCs were synthesized by in-situ free-radical polymerization in the presence of exfoliated clay platelets in aqueous systems and were obtained in various forms such as film, sheet, tube, coating, etc. and sizes with a wide range of clay contents. Here, disk-like inorganic clay nanoparticles act as multi-functional crosslinkers to form new types of network systems. Both NC gels and M-NCs have extraordinary optical and mechanical properties including ultra-high reversible extensibility, as well as a number of new characteristics relating to optical anisotropy, polymer/clay morphology, biocompatibility, stimuli-sensitive surfaces, micro-patterning, etc. For examples, the biological testing of medical devices, comprised of a sensitization test, an irritation test, an intracutaneous test and an in vitro cytotoxicity test,was carried out for NC gels and M-NCs. The safety of NC gels and M-NCs was confirmed in all tests. Also, the interaction of living tissue with NC gel was investigated in vivo by implantation in live goats; neither inflammation nor concrescence occurred around the NC gels. Furthermore, it was found that both N-NC gels consisting of poly(N-isopropylacrylamide(PNIPA/clay network and M-NCs consisting of poly(2-methoxyethyacrylate(PMEA/clay network show characteristic cell culture and subsequent cell detachment on their surfaces, although it was almost impossible to culture cells on conventional, chemically-crosslinked PNIPA hydrogels and chemically crossslinked PMEA, regardless of their crosslinker concentration. Various kinds of cells, such ashumanhepatoma cells (HepG2, normal human dermal fibroblast (NHDF, and human umbilical vein endothelial cells (HUVEC, could be cultured to be confluent on the surfaces of N

  7. Radiation effects on cultured human lymphoid cells

    International Nuclear Information System (INIS)

    Johansson, L.; Nilsson, K.; Carlsson, J.; Larsson, B.; Jakobsson, P.

    1981-01-01

    The cloning efficiency of human normal and malignant lymphoid cells is usually low. Radiation effects in vitro on such cells can therefore not be analysed with conventional cloning. However, this problem can be circumscribed by using the growth extrapolation method. A panel of human leukemia-lymphoma cell-lines representing Epstein-Barr virus carrying lymphoblastoid cells of presumed non-neoplastic derivation and neoplastic T- and B-lymphocytes was used to test the efficiency of this method. The sensitivity to radiation could be determined for all these cell types. The growth extrapolation method gave generally the same result as conventional cloning demonstrated by comparison with one exceptional cell-line with capacity for cloning in agar. The sensitivity varied largely between the different cell types. A common feature was that none of the cell lines had a good capacity to accumulate sublethal radiation injury. (Auth.)

  8. Hypoxic contraction of cultured pulmonary vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Murray, T.R.; Chen, L.; Marshall, B.E.; Macarak, E.J.

    1990-01-01

    The cellular events involved in generating the hypoxic pulmonary vasoconstriction response are not clearly understood, in part because of the multitude of factors that alter pulmonary vascular tone. The goal of the present studies was to determine if a cell culture preparation containing vascular smooth muscle (VSM) cells could be made to contract when exposed to a hypoxic atmosphere. Cultures containing only fetal bovine pulmonary artery VSM cells were assessed for contractile responses to hypoxic stimuli by two methods. In the first, tension forces generated by cells grown on a flexible growth surface (polymerized polydimethyl siloxane) were manifested as wrinkles and distortions of the surface under the cells. Wrinkling of the surface was noted to progressively increase with time as the culture medium bathing the cells was made hypoxic (PO2 approximately 25 mmHg). The changes were sometimes reversible upon return to normoxic conditions and appeared to be enhanced in cells already exhibiting evidence of some baseline tone. Repeated passage in culture did not diminish the hypoxic response. Evidence for contractile responses to hypoxia was also obtained from measurements of myosin light chain (MLC) phosphorylation. Conversion of MLC to the phosphorylated species is an early step in the activation of smooth muscle contraction. Lowering the PO2 in the culture medium to 59 mmHg caused a 45% increase in the proportion of MLC in the phosphorylated form as determined by two-dimensional gel electrophoresis. Similarly, cultures preincubated for 4 h with 32P and then exposed to normoxia or hypoxia for a 5-min experimental period showed more than twice as much of the label in MLCs of the hypoxic cells

  9. THE ALKALOID CYTISINE IN THE CELL CULTURE

    Directory of Open Access Journals (Sweden)

    Gazaliev A.M.

    2012-08-01

    Full Text Available Alkaloids are vegetative establishments of complex and original structure with nitrous heterocycles in the basis. For a long time they drew researchers’ attention because of their unique and specific physiological effect on alive organisms. Not all the representatives of the globe’s flora contain these unique substances. Alkaloid cytisine is to be found mainly in the plants of the fabaceous family - Fabaceae. For the cytisine production the seeds of Thermopsis lanceolata R.Br (T. lanceolata R.Br and Cytisus laburnum (C. laburnum are used as a raw material. The object of the research is T. lanceolata cell culture. Sterile sprouts are used at the first stage of the experiment. Callus genesis is accompanied with dedifferentiation. It leads to the cellular organization simplification. Based on an important property of a plant cell, such as totipotency, there appears the formation of the “de novo” biosynthetic device. The cultivation algorithm consists of two basic stages: (i the cultivation conditions optimization of callus with a high level of the primary metabolites biosynthesis (Aspartat – lysine; (ii the research of cultivation chemical and physical factors influence on the secondary metabolite (cytisine biosynthesis and accumulation. During the cultivation the Murashige and Skoog classical recipe of nutrient medium will be used. Optimization of the cultivation conditions will concern the phytohormones, macro- and micronutrients content, as the purpose of optimization is the production of the determined high-level competence embriogenical callus. The main problem is genetic heterogeneity of a cellular population and instability of morpho-physiological processes. The correct management of higher plants cells population is possible at the synchronization of a cellular cycle phases. The references analysis has shown that it is almost impossible to synchronize cellular cycles in the culture of plant tissue. The application of chemical

  10. Enrichment of skin-derived neural precursor cells from dermal cell populations by altering culture conditions.

    Science.gov (United States)

    Bayati, Vahid; Gazor, Rohoullah; Nejatbakhsh, Reza; Negad Dehbashi, Fereshteh

    2016-01-01

    As stem cells play a critical role in tissue repair, their manipulation for being applied in regenerative medicine is of great importance. Skin-derived precursors (SKPs) may be good candidates for use in cell-based therapy as the only neural stem cells which can be isolated from an accessible tissue, skin. Herein, we presented a simple protocol to enrich neural SKPs by monolayer adherent cultivation to prove the efficacy of this method. To enrich neural SKPs from dermal cell populations, we have found that a monolayer adherent cultivation helps to increase the numbers of neural precursor cells. Indeed, we have cultured dermal cells as monolayer under serum-supplemented (control) and serum-supplemented culture, followed by serum free cultivation (test) and compared. Finally, protein markers of SKPs were assessed and compared in both experimental groups and differentiation potential was evaluated in enriched culture. The cells of enriched culture concurrently expressed fibronectin, vimentin and nestin, an intermediate filament protein expressed in neural and skeletal muscle precursors as compared to control culture. In addition, they possessed a multipotential capacity to differentiate into neurogenic, glial, adipogenic, osteogenic and skeletal myogenic cell lineages. It was concluded that serum-free adherent culture reinforced by growth factors have been shown to be effective on proliferation of skin-derived neural precursor cells (skin-NPCs) and drive their selective and rapid expansion.

  11. Use of an adaptable cell culture kit for performing lymphocyte and monocyte cell cultures in microgravity

    Science.gov (United States)

    Hatton, J. P.; Lewis, M. L.; Roquefeuil, S. B.; Chaput, D.; Cazenave, J. P.; Schmitt, D. A.

    1998-01-01

    The results of experiments performed in recent years on board facilities such as the Space Shuttle/Spacelab have demonstrated that many cell systems, ranging from simple bacteria to mammalian cells, are sensitive to the microgravity environment, suggesting gravity affects fundamental cellular processes. However, performing well-controlled experiments aboard spacecraft offers unique challenges to the cell biologist. Although systems such as the European 'Biorack' provide generic experiment facilities including an incubator, on-board 1-g reference centrifuge, and contained area for manipulations, the experimenter must still establish a system for performing cell culture experiments that is compatible with the constraints of spaceflight. Two different cell culture kits developed by the French Space Agency, CNES, were recently used to perform a series of experiments during four flights of the 'Biorack' facility aboard the Space Shuttle. The first unit, Generic Cell Activation Kit 1 (GCAK-1), contains six separate culture units per cassette, each consisting of a culture chamber, activator chamber, filtration system (permitting separation of cells from supernatant in-flight), injection port, and supernatant collection chamber. The second unit (GCAK-2) also contains six separate culture units, including a culture, activator, and fixation chambers. Both hardware units permit relatively complex cell culture manipulations without extensive use of spacecraft resources (crew time, volume, mass, power), or the need for excessive safety measures. Possible operations include stimulation of cultures with activators, separation of cells from supernatant, fixation/lysis, manipulation of radiolabelled reagents, and medium exchange. Investigations performed aboard the Space Shuttle in six different experiments used Jurkat, purified T-cells or U937 cells, the results of which are reported separately. We report here the behaviour of Jurkat and U937 cells in the GCAK hardware in ground

  12. A biocompatible micro cell culture chamber (mu CCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, Anders Michael

    2006-01-01

    culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...... on cell survival. Low grade light exposure was however compatible with optical recordings as well as cell viability. These results strongly indicate that a cell culture chip could be constructed that allowed for on-line optical recording of cellular events without affecting the cell culturing condition...

  13. A biocompatible micro cell culture chamber (microCCC) for the culturing and on-line monitoring of eukaryote cells

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Petronis, Sarunas; Jørgensen, A M

    2006-01-01

    culture chip compared to cell culture flasks. The cell culture chip could without further modification support cell growth of two other cell lines. Light coming from the microscope lamp during optical recordings of the cells was the only external factor identified, that could have a negative effect...... on cell survival. Low grade light exposure was however compatible with optical recordings as well as cell viability. These results strongly indicate that a cell culture chip could be constructed that allowed for on-line optical recording of cellular events without affecting the cell culturing condition...

  14. Characterization of primary human mammary epithelial cells isolated and propagated by conditional reprogrammed cell culture.

    Science.gov (United States)

    Jin, Liting; Qu, Ying; Gomez, Liliana J; Chung, Stacey; Han, Bingchen; Gao, Bowen; Yue, Yong; Gong, Yiping; Liu, Xuefeng; Amersi, Farin; Dang, Catherine; Giuliano, Armando E; Cui, Xiaojiang

    2018-02-20

    Conditional reprogramming methods allow for the inexhaustible in vitro proliferation of primary epithelial cells from human tissue specimens. This methodology has the potential to enhance the utility of primary cell culture as a model for mammary gland research. However, few studies have systematically characterized this method in generating in vitro normal human mammary epithelial cell models. We show that cells derived from fresh normal breast tissues can be propagated and exhibit heterogeneous morphologic features. The cultures are composed of CK18, desmoglein 3, and CK19-positive luminal cells and vimentin, p63, and CK14-positive myoepithelial cells, suggesting the maintenance of in vivo heterogeneity. In addition, the cultures contain subpopulations with different CD49f and EpCAM expression profiles. When grown in 3D conditions, cells self-organize into distinct structures that express either luminal or basal cell markers. Among these structures, CK8-positive cells enclosing a lumen are capable of differentiation into milk-producing cells in the presence of lactogenic stimulus. Furthermore, our short-term cultures retain the expression of ERα, as well as its ability to respond to estrogen stimulation. We have investigated conditionally reprogrammed normal epithelial cells in terms of cell type heterogeneity, cellular marker expression, and structural arrangement in two-dimensional (2D) and three-dimensional (3D) systems. The conditional reprogramming methodology allows generation of a heterogeneous culture from normal human mammary tissue in vitro . We believe that this cell culture model will provide a valuable tool to study mammary cell function and malignant transformation.

  15. Lipoprotein receptors in cultured bovine endothelial cells

    International Nuclear Information System (INIS)

    Struempfer, A.E.M.

    1983-07-01

    In this study, receptors that may be involved in the uptake of low density lipoproteins (LDL) and low density lipoproteins which have been modified by acetylation (AcLDL), were characterized. Aortic epithelial cells were used and a cell culture system which closely resembled the in vivo monolayer was established. Endothelial cell and lipoprotein interactions were examined by incubating the cells with 125 l-labelled lipoproteins under various conditions. The receptor affinity of bovine aortic endothelial cells was higher for AcLDL than that for LDL. Competition studies demonstrated that there were two distinct receptors for LDL and AcLDL on the endothelial cells. AcLDL did not compete with LDL for the LDL receptor, and conversely LDL did not compete with AcLDL for the AcLDL receptor. The receptor activities for LDL and AcLDL were examined as a function of culture age. Whereas the LDL receptor could be regulated, the AcLDL receptor was not as susceptible to regulation. Upon exposing endothelial cells for 72 h to either LDL or AcLDL, it was found that the total amount of cellular cholesterol increased by about 50%. However, the increase of total cholesterol was largely in the form of free cholesterol. This is in contrast to macrophages, where the increase in total cholesterol upon exposure to AcLDL is largely in the form cholesteryl esters

  16. Dynamic cell culture system (7-IML-1)

    Science.gov (United States)

    Cogoli, Augusto

    1992-01-01

    This experiment is one of the Biorack experiments being flown on the International Microgravity Laboratory 1 (MIL-1) mission as part of an investigation studying cell proliferation and performance in space. One of the objectives of this investigation is to assess the potential benefits of bioprocessing in space with the ultimate goal of developing a bioreactor for continuous cell cultures in space. This experiment will test the operation of an automated culture chamber that was designed for use in a Bioreactor in space. The device to be tested is called the Dynamic Cell Culture System (DCCS). It is a simple device in which media are renewed or chemicals are injected automatically, by means of osmotic pumps. This experiment uses four Type I/O experiment containers. One DCCS unit, which contains a culture chamber with renewal of medium and a second chamber without a medium supply fits in each container. Two DCCS units are maintained under zero gravity conditions during the on-orbit period. The other two units are maintained under 1 gh conditions in a 1 g centrifuge. The schedule for incubator transfer is given.

  17. Human hematopoietic cell culture, transduction, and analyses

    DEFF Research Database (Denmark)

    Bonde, Jesper; Wirthlin, Louisa; Kohn, Donald B

    2008-01-01

    This unit provides methods for introducing genes into human hematopoietic progenitor cells. The Basic Protocol describes isolation of CD34(+) cells, transduction of these cells with a retroviral vector on fibronectin-coated plates, assaying the efficiency of transduction, and establishing long-te...

  18. 21 CFR 864.2280 - Cultured animal and human cells.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cultured animal and human cells. 864.2280 Section... Cultured animal and human cells. (a) Identification. Cultured animal and human cells are in vitro cultivated cell lines from the tissue of humans or other animals which are used in various diagnostic...

  19. Simple method for culture of peripheral blood lymphocytes of Testudinidae.

    Science.gov (United States)

    Silva, T L; Silva, M I A; Venancio, L P R; Zago, C E S; Moscheta, V A G; Lima, A V B; Vizotto, L D; Santos, J R; Bonini-Domingos, C R; Azeredo-Oliveira, M T V

    2011-12-06

    We developed and optimized a simple, efficient and inexpensive method for in vitro culture of peripheral blood lymphocytes from the Brazilian tortoise Chelonoidis carbonaria (Testudinidae), testing various parameters, including culture medium, mitogen concentration, mitotic index, culture volume, incubation time, and mitotic arrest. Peripheral blood samples were obtained from the costal vein of four couples. The conditions that gave a good mitotic index were lymphocytes cultured at 37°C in minimum essential medium (7.5 mL), with phytohemagglutinin as a mitogen (0.375 mL), plus streptomycin/penicillin (0.1 mL), and an incubation period of 72 h. Mitotic arrest was induced by 2-h exposure to colchicine (0.1 mL), 70 h after establishing the culture. After mitotic arrest, the cells were hypotonized with 0.075 M KCl for 2 h and fixed with methanol/acetic acid (3:1). The non-banded mitotic chromosomes were visualized by Giemsa staining. The diploid chromosome number of C. carbonaria was found to be 52 in females and males, and sex chromosomes were not observed. We were able to culture peripheral blood lymphocytes of a Brazilian tortoise in vitro, for the preparation of mitotic chromosomes.

  20. Cells and methods for producing fatty alcohols

    Science.gov (United States)

    Pfleger, Brian F.; Youngquist, Tyler J.

    2017-07-18

    Recombinant cells and methods for improved yield of fatty alcohols. The recombinant cells harbor a recombinant thioesterase gene, a recombinant acyl-CoA synthetase gene, and a recombinant acyl-CoA reductase gene. In addition, a gene product from one or more of an acyl-CoA dehydrogenase gene, an enoyl-CoA hydratase gene, a 3-hydroxyacyl-CoA dehydrogenase gene, and a 3-ketoacyl-CoA thiolase gene in the recombinant cells is functionally deleted. Culturing the recombinant cells produces fatty alcohols at high yields.

  1. Lingual Epithelial Stem Cells and Organoid Culture of Them

    Directory of Open Access Journals (Sweden)

    Hiroko Hisha

    2016-01-01

    Full Text Available As tongue cancer is one of the major malignant cancers in the world, understanding the mechanism of maintenance of lingual epithelial tissue, which is known to be the origin of tongue cancer, is unquestionably important. However, the actual stem cells that are responsible for the long-term maintenance of the lingual epithelium have not been identified. Moreover, a simple and convenient culture method for lingual epithelial stem cells has not yet been established. Recently, we have shown that Bmi1-positive cells, residing at the second or third layer of the epithelial cell layer at the base of the interpapillary pit (IPP, were slow-cycling and could supply keratinized epithelial cells for over one year, indicating that Bmi1-positive cells are long-term lingual epithelial stem cells. In addition, we have developed a novel lingual epithelium organoid culture system using a three-dimensional matrix and growth factors. Here, we discuss current progress in the identification of lingual stem cells and future applications of the lingual culture system for studying the regulatory mechanisms of the lingual epithelium and for regenerative medicine.

  2. Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions.

    Science.gov (United States)

    Kaji, Hirokazu; Camci-Unal, Gulden; Langer, Robert; Khademhosseini, Ali

    2011-03-01

    Inside the body, cells lie in direct contact or in close proximity to other cell types in a tightly controlled architecture that often regulates the resulting tissue function. Therefore, tissue engineering constructs that aim to reproduce the architecture and the geometry of tissues will benefit from methods of controlling cell-cell interactions with microscale resolution. We discuss the use of microfabrication technologies for generating patterned co-cultures. In addition, we categorize patterned co-culture systems by cell type and discuss the implications of regulating cell-cell interactions in the resulting biological function of the tissues. Patterned co-cultures are a useful tool for fabricating tissue engineered constructs and for studying cell-cell interactions in vitro, because they can be used to control the degree of homotypic and heterotypic cell-cell contact. In addition, this approach can be manipulated to elucidate important factors involved in cell-matrix interactions. Patterned co-culture strategies hold significant potential to develop biomimetic structures for tissue engineering. It is expected that they would create opportunities to develop artificial tissues in the future. This article is part of a Special Issue entitled Nanotechnologies - Emerging Applications in Biomedicine. 2010 Elsevier B.V. All rights reserved.

  3. The Stimulatory Effect of Notochordal-Cell Conditioned Medium in a Nucleus Pulposus Explant Culture

    NARCIS (Netherlands)

    de Vries, Stefan; Doeselaar, Marina van; Meij, Björn; Tryfonidou, M; Ito, Keita

    2015-01-01

    OBJECTIVES: Notochordal cell-conditioned medium (NCCM) has previously shown to have a stimulatory effect on nucleus pulposus cells (NPCs) and bone marrow stromal cells (BMSCs) in alginate and pellet cultures. These culture methods provide a different environment than the nucleus pulposus (NP)

  4. The Stimulatory Effect of Notochordal Cell-Conditioned Medium in a Nucleus Pulposus Explant Culture

    NARCIS (Netherlands)

    de Vries, Stefan A H; van Doeselaar, Marina; Meij, Björn P; Tryfonidou, Marianna A; Ito, K

    2016-01-01

    Objectives: Notochordal cell-conditioned medium (NCCM) has previously shown to have a stimulatory effect on nucleus pulposus cells (NPCs) and bone marrow stromal cells (BMSCs) in alginate and pellet cultures. These culture methods provide a different environment than the nucleus pulposus (NP)

  5. Plant cell tissue culture: A potential source of chemicals

    Energy Technology Data Exchange (ETDEWEB)

    Scott, C.D.; Dougall, D.K.

    1987-08-01

    Higher plants produce many industrially important products. Among these are drugs and medicinal chemicals, essential oils and flavors, vegetable oils and fats, fine and specialty chemicals, and even some commodity chemicals. Although, currently, whole-plant extraction is the primary means of harvesting these materials, the advent of plant cell tissue culture could be a much more effective method of producing many types of phytochemicals. The use of immobilized plant cells in an advanced bioreactor configuration with excretion of the product into the reactor medium may represent the most straightforward way of commercializing such techniques for lower-value chemicals. Important research and development opportunities in this area include screening for plant cultures for nonmedical, lower-value chemicals; understanding and controlling plant cell physiology and biochemistry; optimizing effective immobilization methods; developing more efficient bioreactor concepts; and perfecting product extraction and purification techniques. 62 refs., 2 figs.

  6. Advantages and challenges of microfluidic cell culture in polydimethylsiloxane devices.

    Science.gov (United States)

    Halldorsson, Skarphedinn; Lucumi, Edinson; Gómez-Sjöberg, Rafael; Fleming, Ronan M T

    2015-01-15

    Culture of cells using various microfluidic devices is becoming more common within experimental cell biology. At the same time, a technological radiation of microfluidic cell culture device designs is currently in progress. Ultimately, the utility of microfluidic cell culture will be determined by its capacity to permit new insights into cellular function. Especially insights that would otherwise be difficult or impossible to obtain with macroscopic cell culture in traditional polystyrene dishes, flasks or well-plates. Many decades of heuristic optimization have gone into perfecting conventional cell culture devices and protocols. In comparison, even for the most commonly used microfluidic cell culture devices, such as those fabricated from polydimethylsiloxane (PDMS), collective understanding of the differences in cellular behavior between microfluidic and macroscopic culture is still developing. Moving in vitro culture from macroscopic culture to PDMS based devices can come with unforeseen challenges. Changes in device material, surface coating, cell number per unit surface area or per unit media volume may all affect the outcome of otherwise standard protocols. In this review, we outline some of the advantages and challenges that may accompany a transition from macroscopic to microfluidic cell culture. We focus on decisive factors that distinguish macroscopic from microfluidic cell culture to encourage a reconsideration of how macroscopic cell culture principles might apply to microfluidic cell culture. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Serum-free media formulations are cell line-specific and require optimization for microcarrier culture.

    Science.gov (United States)

    Tan, Kah Yong; Teo, Kim Leng; Lim, Jessica F Y; Chen, Allen K L; Choolani, Mahesh; Reuveny, Shaul; Chan, Jerry; Oh, Steve Kw

    2015-08-01

    Mesenchymal stromal cells (MSCs) are being investigated as potential cell therapies for many different indications. Current methods of production rely on traditional monolayer culture on tissue-culture plastic, usually with the use of serum-supplemented growth media. However, the monolayer culturing system has scale-up limitations and may not meet the projected hundreds of billions to trillions batches of cells needed for therapy. Furthermore, serum-free medium offers several advantages over serum-supplemented medium, which may have supply and contaminant issues, leading to many serum-free medium formulations being developed. We cultured seven MSC lines in six different serum-free media and compared their growth between monolayer and microcarrier culture. We show that (i) expansion levels of MSCs in serum-free monolayer cultures may not correlate with expansion in serum-containing media; (ii) optimal culture conditions (serum-free media for monolayer or microcarrier culture) differ for each cell line; (iii) growth in static microcarrier culture does not correlate with growth in stirred spinner culture; (iv) and that early cell attachment and spreading onto microcarriers does not necessarily predict efficiency of cell expansion in agitated microcarrier culture. Current serum-free media developed for monolayer cultures of MSCs may not support MSC proliferation in microcarrier cultures. Further optimization in medium composition will be required for microcarrier suspension culture for each cell line. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  8. Differentiation of mammalian skeletal muscle cells cultured on microcarrier beads in a rotating cell culture system

    Science.gov (United States)

    Torgan, C. E.; Burge, S. S.; Collinsworth, A. M.; Truskey, G. A.; Kraus, W. E.

    2000-01-01

    The growth and repair of adult skeletal muscle are due in part to activation of muscle precursor cells, commonly known as satellite cells or myoblasts. These cells are responsive to a variety of environmental cues, including mechanical stimuli. The overall goal of the research is to examine the role of mechanical signalling mechanisms in muscle growth and plasticity through utilisation of cell culture systems where other potential signalling pathways (i.e. chemical and electrical stimuli) are controlled. To explore the effects of decreased mechanical loading on muscle differentiation, mammalian myoblasts are cultured in a bioreactor (rotating cell culture system), a model that has been utilised to simulate microgravity. C2C12 murine myoblasts are cultured on microcarrier beads in a bioreactor and followed throughout differentiation as they form a network of multinucleated myotubes. In comparison with three-dimensional control cultures that consist of myoblasts cultured on microcarrier beads in teflon bags, myoblasts cultured in the bioreactor exhibit an attenuation in differentiation. This is demonstrated by reduced immunohistochemical staining for myogenin and alpha-actinin. Western analysis shows a decrease, in bioreactor cultures compared with control cultures, in levels of the contractile proteins myosin (47% decrease, p < 0.01) and tropomyosin (63% decrease, p < 0.01). Hydrodynamic measurements indicate that the decrease in differentiation may be due, at least in part, to fluid stresses acting on the myotubes. In addition, constraints on aggregate size imposed by the action of fluid forces in the bioreactor affect differentiation. These results may have implications for muscle growth and repair during spaceflight.

  9. Antitumor Activity of Rat Mesenchymal Stem Cells during Direct or Indirect Co-Culturing with C6 Glioma Cells.

    Science.gov (United States)

    Gabashvili, A N; Baklaushev, V P; Grinenko, N F; Mel'nikov, P A; Cherepanov, S A; Levinsky, A B; Chehonin, V P

    2016-02-01

    The tumor-suppressive effect of rat mesenchymal stem cells against low-differentiated rat C6 glioma cells during their direct and indirect co-culturing and during culturing of C6 glioma cells in the medium conditioned by mesenchymal stem cells was studied in an in vitro experiment. The most pronounced antitumor activity of mesenchymal stem cells was observed during direct co-culturing with C6 glioma cells. The number of live C6 glioma cells during indirect co-culturing and during culturing in conditioned medium was slightly higher than during direct co-culturing, but significantly differed from the control (C6 glioma cells cultured in medium conditioned by C6 glioma cells). The cytotoxic effect of medium conditioned by mesenchymal stem cells was not related to medium depletion by glioma cells during their growth. The medium conditioned by other "non-stem" cells (rat astrocytes and fibroblasts) produced no tumor-suppressive effect. Rat mesenchymal stem cells, similar to rat C6 glioma cells express connexin 43, the main astroglial gap junction protein. During co-culturing, mesenchymal stem cells and glioma C6 cells formed functionally active gap junctions. Gap junction blockade with connexon inhibitor carbenoxolone attenuated the antitumor effect observed during direct co-culturing of C6 glioma cells and mesenchymal stem cells to the level produced by conditioned medium. Cell-cell signaling mediated by gap junctions can be a mechanism of the tumor-suppressive effect of mesenchymal stem cells against C6 glioma cells. This phenomenon can be used for the development of new methods of cell therapy for high-grade malignant gliomas.

  10. Effects of TiO2 nanoparticles on the NO2− levels in cell culture media analysed by Griess colorimetric methods

    International Nuclear Information System (INIS)

    Popescu, Traian; Lupu, Andreea R.; Diamandescu, Lucian; Tarabasanu-Mihaila, Doina; Teodorescu, Valentin S.; Raditoiu, Valentin; Purcar, Violeta; Vlaicu, Aurel M.

    2013-01-01

    The Griess assay has been used to determine the possible changes in the measured NO 2 − concentrations induced by TiO 2 nanoparticles in three types of nitrite-containing samples: aqueous NaNO 2 solutions with known concentrations, and two types of cell culture media—Roswell Park Memorial Institute medium (RPMI-1640) and Dulbecco’s Modified Eagle Medium (DMEM-F12) used either as delivered or enriched in NO 2 − by NaNO 2 addition. We have used three types of titania with average particle sizes between 10 and 30 nm: Degussa P25 and two other samples (undoped and Fe 3+ -doped anatase TiO 2 ) synthesised by a hydrothermal route in our laboratory. The structural, morphological, optical and physicochemical characteristics of the used materials have been studied by X-ray diffraction, transmission electron microscopy (EDX), Mössbauer spectroscopy, Brunauer–Emmett–Teller nitrogen adsorption, UV–Vis reflectance spectroscopy, dynamic light scattering and diffuse reflectance infrared Fourier transform spectroscopy. The opacity and sedimentation behaviour of the studied TiO 2 suspensions have been investigated by photometric attenuance measurements at 540 nm. To account for the photocatalytic properties of titania in a biologically relevant context, multiple Griess tests have been performed under controlled exposure to laboratory natural daylight illumination. The results show significant variations of light attenuance (associated with NO 2 − concentrations in the Griess test) depending on the opacity, sedimentation behaviour, NO 2 − adsorption and photocatalytic properties of the tested TiO 2 nanomaterials. These findings identify material characteristics recommended to be considered when analysing the results of Griess tests performed in biological studies involving TiO 2 nanoparticles.

  11. Effects of TiO{sub 2} nanoparticles on the NO{sub 2}{sup -} levels in cell culture media analysed by Griess colorimetric methods

    Energy Technology Data Exchange (ETDEWEB)

    Popescu, Traian, E-mail: tr.popescu@gmail.com [National Institute of Materials Physics (Romania); Lupu, Andreea R. [University of Bucharest, Faculty of Biology (Romania); Diamandescu, Lucian; Tarabasanu-Mihaila, Doina; Teodorescu, Valentin S. [National Institute of Materials Physics (Romania); Raditoiu, Valentin; Purcar, Violeta [National Research and Development Institute for Chemistry and Petrochemistry (ICECHIM) (Romania); Vlaicu, Aurel M. [National Institute of Materials Physics (Romania)

    2013-02-15

    The Griess assay has been used to determine the possible changes in the measured NO{sub 2}{sup -} concentrations induced by TiO{sub 2} nanoparticles in three types of nitrite-containing samples: aqueous NaNO{sub 2} solutions with known concentrations, and two types of cell culture media-Roswell Park Memorial Institute medium (RPMI-1640) and Dulbecco's Modified Eagle Medium (DMEM-F12) used either as delivered or enriched in NO{sub 2}{sup -} by NaNO{sub 2} addition. We have used three types of titania with average particle sizes between 10 and 30 nm: Degussa P25 and two other samples (undoped and Fe{sup 3+}-doped anatase TiO{sub 2}) synthesised by a hydrothermal route in our laboratory. The structural, morphological, optical and physicochemical characteristics of the used materials have been studied by X-ray diffraction, transmission electron microscopy (EDX), Moessbauer spectroscopy, Brunauer-Emmett-Teller nitrogen adsorption, UV-Vis reflectance spectroscopy, dynamic light scattering and diffuse reflectance infrared Fourier transform spectroscopy. The opacity and sedimentation behaviour of the studied TiO{sub 2} suspensions have been investigated by photometric attenuance measurements at 540 nm. To account for the photocatalytic properties of titania in a biologically relevant context, multiple Griess tests have been performed under controlled exposure to laboratory natural daylight illumination. The results show significant variations of light attenuance (associated with NO{sub 2}{sup -} concentrations in the Griess test) depending on the opacity, sedimentation behaviour, NO{sub 2}{sup -} adsorption and photocatalytic properties of the tested TiO{sub 2} nanomaterials. These findings identify material characteristics recommended to be considered when analysing the results of Griess tests performed in biological studies involving TiO{sub 2} nanoparticles.

  12. Somatic embryogenesis in cell cultures of Glycine species.

    Science.gov (United States)

    Gamborg, O L; Davis, B P; Stahlhut, R W

    1983-08-01

    This report describes the development of procedures for the production of somatic embryos in cell cultures of Glycine species including soybean. The conditions for callus induction and initiation of rapidly growing cell suspension cultures were defined. Methods for inducing embryogenesis were tested on 16 lines of several Glycine species and cultivars of soybean. The SB-26 Culture of a G. soja gave the best results and was used in the experiments. Embryogenesis required the presence of picloram or 2,4-D. AMO 1618, CCC, PP-333 and Ancymidol enhanced the embryogenesis frequency. Plants of the G. soja (SB-26) were grown to maturity from seed-derived shoot tips. Characteristics of the plants are discussed.

  13. Endothelial cells stimulate growth of normal and cancerous breast epithelial cells in 3D culture

    Directory of Open Access Journals (Sweden)

    Magnusson Magnus K

    2010-07-01

    Full Text Available Abstract Background Epithelial-stromal interaction provides regulatory signals that maintain correct histoarchitecture and homeostasis in the normal breast and facilitates tumor progression in breast cancer. However, research on the regulatory role of the endothelial component in the normal and malignant breast gland has largely been neglected. The aim of the study was to investigate the effects of endothelial cells on growth and differentiation of human breast epithelial cells in a three-dimensional (3D co-culture assay. Methods Breast luminal and myoepithelial cells and endothelial cells were isolated from reduction mammoplasties. Primary cells and established normal and malignant breast cell lines were embedded in reconstituted basement membrane in direct co-culture with endothelial cells and by separation of Transwell filters. Morphogenic and phenotypic profiles of co-cultures was evaluated by phase contrast microscopy, immunostaining and confocal microscopy. Results In co-culture, endothelial cells stimulate proliferation of both luminal- and myoepithelial cells. Furthermore, endothelial cells induce a subpopulation of luminal epithelial cells to form large acini/ducts with a large and clear lumen. Endothelial cells also stimulate growth and cloning efficiency of normal and malignant breast epithelial cell lines. Transwell and gradient co-culture studies show that endothelial derived effects are mediated - at least partially - by soluble factors. Conclusion Breast endothelial cells - beside their role in transporting nutrients and oxygen to tissues - are vital component of the epithelial microenvironment in the breast and provide proliferative signals to the normal and malignant breast epithelium. These growth promoting effects of endothelial cells should be taken into consideration in breast cancer biology.

  14. Oxidative Stress Induces Senescence in Cultured RPE Cells.

    Science.gov (United States)

    Aryan, Nona; Betts-Obregon, Brandi S; Perry, George; Tsin, Andrew T

    2016-01-01

    The aim of this research is to determine whether oxidative stress induces cellular senescence in human retinal pigment epithelial cells. Cultured ARPE19 cells were subjected to different concentrations of hydrogen peroxide to induce oxidative stress. Cells were seeded into 24-well plates with hydrogen peroxide added to cell medium and incubated at 37°C + 5% CO2 for a 90-minute period [at 0, 300, 400 and 800 micromolar (MCM) hydrogen peroxide]. The number of viable ARPE19 cells were recorded using the Trypan Blue Dye Exclusion Method and cell senescence was measured by positive staining for senescence-associated beta-galactosidase (SA-beta-Gal) protein. Without hydrogen peroxide treatment, the number of viable ARPE19 cells increased significantly from 50,000 cells/well to 197,000 within 72 hours. Treatment with hydrogen peroxide reduced this level of cell proliferation significantly (to 52,167 cells at 400 MCM; to 49,263 cells at 800 MCM). Meanwhile, cells with a high level of positive senescence-indicator SA-Beta-Gal-positive staining was induced by hydrogen peroxide treatment (from a baseline level of 12% to 80% at 400 MCM and at 800 MCM). Our data suggests that oxidative stress from hydrogen peroxide treatment inhibited ARPE19 cell proliferation and induced cellular senescence.

  15. How do culture media influence in vitro perivascular cell behavior?

    Science.gov (United States)

    Huber, Birgit; Volz, Ann-Cathrin; Kluger, Petra Juliane

    2015-12-01

    Perivascular cells are multilineage cells located around the vessel wall and important for wall stabilization. In this study, we evaluated a stem cell media and a perivascular cell-specific media for the culture of primary perivascular cells regarding their cell morphology, doubling time, stem cell properties, and expression of cell type-specific markers. When the two cell culture media were compared to each other, perivascular cells cultured in the stem cell medium had a more elongated morphology and a faster doubling rate and cells cultured in the pericyte medium had a more typical morphology, with several filopodia, and a slower doubling rate. To evaluate stem cell properties, perivascular cells, CD146(-) cells, and mesenchymal stem cells (MSCs) were differentiated into the adipogenic, osteogenic, and chondrogenic lineages. It was seen that perivascular cells, as well as CD146(-) cells and MSCs, cultured in stem cell medium showed greater differentiation than cells cultured in pericyte-specific medium. The expression of pericyte-specific markers CD146, neural/glial antigen 2 (NG2), platelet-derived growth factor receptor-β (PDGFR-β), myosin, and α-smooth muscle actin (α-SMA) could be found in both pericyte cultures, as well as to varying amounts in CD146(-) cells, MSCs, and endothelial cells. The here presented work shows that perivascular cells can adapt to their in vitro environment and cell culture conditions influence cell functionality, such as doubling rate or differentiation behavior. Pericyte-specific markers were shown to be expressed also from cells other than perivascular cells. We can further conclude that CD146(+) perivascular cells are inhomogeneous cell population probably containing stem cell subpopulations, which are located perivascular around capillaries. © 2015 International Federation for Cell Biology.

  16. Reversible gelling culture media for in-vitro cell culture in three-dimensional matrices

    Science.gov (United States)

    An, Yuehuei H.; Mironov, Vladimir A.; Gutowska, Anna

    2000-01-01

    A gelling cell culture medium useful for forming a three dimensional matrix for cell culture in vitro is prepared by copolymerizing an acrylamide derivative with a hydrophilic comonomer to form a reversible (preferably thermally reversible) gelling linear random copolymer in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum gelling molecular weight cutoff, mixing the copolymer with an aqueous solvent to form a reversible gelling solution and adding a cell culture medium to the gelling solution to form the gelling cell culture medium. Cells such as chondrocytes or hepatocytes are added to the culture medium to form a seeded culture medium, and temperature of the medium is raised to gel the seeded culture medium and form a three dimensional matrix containing the cells. After propagating the cells in the matrix, the cells may be recovered by lowering the temperature to dissolve the matrix and centrifuging.

  17. Effects of viscoelastic ophthalmic solutions on cell cultures

    Directory of Open Access Journals (Sweden)

    Madhavan Hajib

    1998-01-01

    Full Text Available The development of mild but significant inflammation probably attributable to viscoelastic ophthalmic solutions in cataract surgery was recently brought to the notice of the authors, and hence a study of the effects of these solutions available in India, on cell cultures was undertaken. We studied the effects of 6 viscoelastic ophthalmic solutions (2 sodium hyaluronate designated as A and B, and 4 hydroxypropylmethylcellulose designated as C, D, E and F on HeLa, Vero and BHK-21 cell lines in tissue culture microtitre plates using undiluted, 1:10 and 1:100 dilutions of the solutions, and in cover slip cultures using undiluted solutions. Phase contrast microscopic examination of the solutions was also done to determine the presence of floating particles. The products D and F produced cytotoxic changes in HeLa cell line and these products also showed the presence of floating particles under phase contrast microscopy. Other products did not have any adverse effects on the cell lines nor did they show floating particles. The viscoelastic ophthalmic pharmaceutical products designated D and F have cytotoxic effects on HeLa cell line which appears to be a useful cell line for testing these products for their toxicity. The presence of particulate materials in products D and F indicates that the methods used for purification of the solution are not effective.

  18. Isolation, Culture, Functional Assays, and Immunofluorescence of Myofiber-Associated Satellite Cells.

    Science.gov (United States)

    Vogler, Thomas O; Gadek, Katherine E; Cadwallader, Adam B; Elston, Tiffany L; Olwin, Bradley B

    2016-01-01

    Adult skeletal muscle stem cells, termed satellite cells, regenerate and repair the functional contractile cells in adult skeletal muscle called myofibers. Satellite cells reside in a niche between the basal lamina and sarcolemma of myofibers. Isolating single myofibers and their associated satellite cells provides a culture system that partially mimics the in vivo environment. We describe methods for isolating and culturing intact individual myofibers and their associated satellite cells from the mouse extensor digitorum longus muscle. Following dissection and isolation of individual myofibers we provide protocols for myofiber transplantation, satellite cell transfection, immune detection of satellite cell antigens, and assays to examine satellite cell self-renewal and proliferation.

  19. Lethal impacts of cigarette smoke in cultured tobacco cells

    Directory of Open Access Journals (Sweden)

    Kawano Tomonori

    2011-07-01

    Full Text Available Abstract Background In order to understand and generalize the toxic mechanism of cigarette smoke in living cells, comparison of the data between animal systems and other biological system such as microbial and plant systems is highly beneficial. Objective By employing the tobacco cells as model materials for cigarette smoke toxicity assay, the impacts of the combustion by-products such as nitrogen oxides could be highlighted as the toxic impacts of the plant-derived endogenous chemicals could be excluded in the plant cells. Methods Cigarette smoke-induced cell death was assessed in tobacco cell suspension cultures in the presence and absence of pharmacological inhibitors. Results Cigarette smoke was effective in induction of cell death. The smoke-induced cell death could be partially prevented by addition of nitric oxide (NO scavenger, suggesting the role for NO as the cell death mediator. Addition of NO donor to tobacco cells also resulted in development of partial cell death further confirming the role of NO as cell death mediator. Members of reactive oxygen species and calcium ion were shown to be protecting the cells from the toxic action of smoke-derived NO.

  20. Preparing nuclei from cells in monolayer cultures suitable for counting and for following synchronized cells through the cell cycle.

    Science.gov (United States)

    Butler, W B

    1984-08-15

    A procedure is described for preparing nuclei from cells in monolayer culture so that they may be counted using an electronic particle counter. It takes only 10 to 15 min, and consists of swelling the cells in hypotonic buffer and then lysing them with the quaternary ammonium salt, ethylhexadecyldimethylammonium bromide. The cells are completely lysed, yielding a suspension of clean single nuclei which is stable, free of debris, and easily counted. The method was developed for a cell line of epithelial origin (MCF-7), which is often difficult to trypsinize to single cells. It works equally well at all cell densities up to and beyond confluence, and has been used with a variety of cells in culture, including 3T3 cells, bovine macrophages, rat mammary epithelial cells, mouse mammary tumor cell lines, and human fibroblasts. The size of the nuclei produced by this procedure is related to their DNA content, and the method is thus suitable for following cultures of synchronized cells through the cell cycle, and for performing differential counts of cells with substantial differences in DNA content.

  1. Enhanced infectivity of bluetongue virus in cell culture by centrifugation.

    OpenAIRE

    Sundin, D R; Mecham, J O

    1989-01-01

    The effects of centrifugation of the infection of cell culture with bluetongue virus (BTV) were investigated. Baby hamster kidney cells were infected with BTV with or without centrifugation. Viral antigen was detected by immunofluorescence at 24 h in both centrifuged and noncentrifuged cultures. However, after 24 h of infection, the production of PFU in centrifuged cell cultures was 10- to 20-fold greater than that seen in cultures not centrifuged. In addition, centrifugation enhanced the dir...

  2. The usefulness of three-dimensional cell culture in induction of cancer stem cells from esophageal squamous cell carcinoma cell lines

    International Nuclear Information System (INIS)

    Fujiwara, Daisuke; Kato, Kazunori; Nohara, Shigeo; Iwanuma, Yoshimi; Kajiyama, Yoshiaki

    2013-01-01

    Highlights: •Spheroids were created from esophageal carcinoma cells using NanoCulture® Plates. •The proportion of strongly ALDH-positive cells increased in 3-D culture. •Expression of cancer stem cell-related genes was enhanced in 3-D culture. •CA-9 expression was enhanced, suggesting hypoxia had been induced in 3-D culture. •Drug resistance was increased. 3-D culture is useful for inducing cancer stem cells. -- Abstract: In recent years, research on resistance to chemotherapy and radiotherapy in cancer treatment has come under the spotlight, and researchers have also begun investigating the relationship between resistance and cancer stem cells. Cancer stem cells are assumed to be present in esophageal cancer, but experimental methods for identification and culture of these cells have not yet been established. To solve this problem, we created spheroids using a NanoCulture® Plate (NCP) for 3-dimensional (3-D) cell culture, which was designed as a means for experimentally reproducing the 3-D structures found in the body. We investigated the potential for induction of cancer stem cells from esophageal cancer cells. Using flow cytometry we analyzed the expression of surface antigen markers CD44, CD133, CD338 (ABCG2), CD318 (CDCP1), and CD326 (EpCAM), which are known cancer stem cell markers. None of these surface antigen markers showed enhanced expression in 3-D cultured cells. We then analyzed aldehyde dehydrogenase (ALDH) enzymatic activity using the ALDEFLUOR reagent, which can identify immature cells such as stem cells and precursor cells. 3-D-cultured cells were strongly positive for ALDH enzyme activity. We also analyzed the expression of the stem cell-related genes Sox-2, Nanog, Oct3/4, and Lin28 using RT-PCR. Expression of Sox-2, Nanog, and Lin28 was enhanced. Analysis of expression of the hypoxic surface antigen marker carbonic anhydrase-9 (CA-9), which is an indicator of cancer stem cell induction and maintenance, revealed that CA-9 expression

  3. Local cell metrics: a novel method for analysis of cell-cell interactions.

    Science.gov (United States)

    Su, Jing; Zapata, Pedro J; Chen, Chien-Chiang; Meredith, J Carson

    2009-10-23

    The regulation of many cell functions is inherently linked to cell-cell contact interactions. However, effects of contact interactions among adherent cells can be difficult to detect with global summary statistics due to the localized nature and noise inherent to cell-cell interactions. The lack of informatics approaches specific for detecting cell-cell interactions is a limitation in the analysis of large sets of cell image data, including traditional and combinatorial or high-throughput studies. Here we introduce a novel histogram-based data analysis strategy, termed local cell metrics (LCMs), which addresses this shortcoming. The new LCM method is demonstrated via a study of contact inhibition of proliferation of MC3T3-E1 osteoblasts. We describe how LCMs can be used to quantify the local environment of cells and how LCMs are decomposed mathematically into metrics specific to each cell type in a culture, e.g., differently-labelled cells in fluorescence imaging. Using this approach, a quantitative, probabilistic description of the contact inhibition effects in MC3T3-E1 cultures has been achieved. We also show how LCMs are related to the naïve Bayes model. Namely, LCMs are Bayes class-conditional probability functions, suggesting their use for data mining and classification. LCMs are successful in robust detection of cell contact inhibition in situations where conventional global statistics fail to do so. The noise due to the random features of cell behavior was suppressed significantly as a result of the focus on local distances, providing sensitive detection of cell-cell contact effects. The methodology can be extended to any quantifiable feature that can be obtained from imaging of cell cultures or tissue samples, including optical, fluorescent, and confocal microscopy. This approach may prove useful in interpreting culture and histological data in fields where cell-cell interactions play a critical role in determining cell fate, e.g., cancer, developmental

  4. Phytases Improve Myo-Inositol Bioaccessibility in Rye Bread: A Study Using an In Vitro Method of Digestion and a Caco-2 Cell Culture Model.

    Science.gov (United States)

    Duliński, Robert; Cielecka, Emilia Katarzyna; Pierzchalska, Małgorzata; Żyła, Krzysztof

    2015-03-01

    Preparations of 6-phytase A (EC 3.1.3.26) and phytase B (acid phosphatase, EC 3.1.3.2) were applied alone and combined in the preparation of dough to estimate their catalytic potential for myo- inositol liberation from rye flour in the breadmaking technology. The experimental bread samples were ground after baking and subjected to determination of myo- inositol bioavailability by an in vitro method that simulated digestion in a human alimentary tract, followed by measurements of myo- inositol transport through enterocyte- -like differentiated Caco-2 cells to determine its bioaccessibility. Myo- inositol content was measured by a high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) technique. The concentration of myo- inositol in the dialysates of control bread was 25.3 µg/mL, whereas in the dialysates of bread sample baked with 6-phytase A, the concentration increased to 35.4 µg/mL, and in the bread baked with phytase B to 64.98 µg/mL. Simultaneous application of both enzymes resulted in myo- inositol release of 64.04 µg/mL. The highest bioaccessibility of myo- inositol, assessed by the measurement of the passage through the Caco-2 monolayer was determined in the bread baked with the addition of 6-phytase A. Enzymatically modified rye bread, particularly by the addition of 6-phytase A, may be therefore a rich source of a highly bioaccessible myo - -inositol.

  5. Cardiac Cells Beating in Culture: A Laboratory Exercise

    Science.gov (United States)

    Weaver, Debora

    2007-01-01

    This article describes how to establish a primary tissue culture, where cells are taken directly from an organ of a living animal. Cardiac cells are taken from chick embryos and transferred to culture dishes. These cells are not transformed and therefore have a limited life span. However, the unique characteristics of cardiac cells are maintained…

  6. A Cell Culture Approach to Optimized Human Corneal Endothelial Cell Function

    Science.gov (United States)

    Bartakova, Alena; Kuzmenko, Olga; Alvarez-Delfin, Karen; Kunzevitzky, Noelia J.; Goldberg, Jeffrey L.

    2018-01-01

    Purpose Cell-based therapies to replace corneal endothelium depend on culture methods to optimize human corneal endothelial cell (HCEC) function and minimize endothelial-mesenchymal transition (EnMT). Here we explore contribution of low-mitogenic media on stabilization of phenotypes in vitro that mimic those of HCECs in vivo. Methods HCECs were isolated from cadaveric donor corneas and expanded in vitro, comparing continuous presence of exogenous growth factors (“proliferative media”) to media without those factors (“stabilizing media”). Identity based on canonical morphology and expression of surface marker CD56, and function based on formation of tight junction barriers measured by trans-endothelial electrical resistance assays (TEER) were assessed. Results Primary HCECs cultured in proliferative media underwent EnMT after three to four passages, becoming increasingly fibroblastic. Stabilizing the cells before each passage by switching them to a media low in mitogenic growth factors and serum preserved canonical morphology and yielded a higher number of cells. HCECs cultured in stabilizing media increased both expression of the identity marker CD56 and also tight junction monolayer integrity compared to cells cultured without stabilization. Conclusions HCECs isolated from donor corneas and expanded in vitro with a low-mitogenic media stabilizing step before each passage demonstrate more canonical structural and functional features and defer EnMT, increasing the number of passages and total canonical cell yield. This approach may facilitate development of HCEC-based cell therapies. PMID:29625488

  7. DNA MUTAGENESIS IN PANAX GINSENG CELL CULTURES

    Directory of Open Access Journals (Sweden)

    Kiselev K.V.

    2012-08-01

    Full Text Available At the present time, it is well documented that plant tissue culture induces a number of mutations and chromosome rearrangements termed “somaclonal variations”. However, little is known about the nature and the molecular mechanisms of the tissue culture-induced mutagenesis and the effects of long-term subculturing on the rate and specific features of the mutagenesis. The aim of the present study was to investigate and compare DNA mutagenesis in different genes of Panax ginseng callus cultures of different age. It has previously been shown that the nucleotide sequences of the Agrobacterium rhizogenes rolC locus and the selective marker nptII developed mutations during long-term cultivation of transgenic cell cultures of P. ginseng. In the present work, we analyzed nucleotide sequences of selected plant gene families in a 2-year-old and 20-year-old P. ginseng 1c cell culture and in leaves of cultivated P. ginseng plants. We analysed sequence variability between the Actin genes, which are a family of house-keeping genes; the phenylalanine ammonia-lyase (PAL and dammarenediol synthase (DDS genes, which actively participate in the biosynthesis of ginsenosides; and the somatic embryogenesis receptor kinase (SERK genes, which control plant development. The frequency of point mutations in the Actin, PAL, DDS, and SERK genes in the 2-year-old callus culture was markedly higher than that in cultivated plants but lower than that in the 20-year-old callus culture of P. ginseng. Most of the mutations in the 2- and 20-year-old P. ginseng calli were A↔G and T↔C transitions. The number of nonsynonymous mutations was higher in the 2- and 20-year-old callus cultures than the number of nonsynonymous mutations in the cultivated plants of P. ginseng. Interestingly, the total number of N→G or N→C substitutions in the analyzed genes was 1.6 times higher than the total number of N→A or N→T substitutions. Using methylation-sensitive DNA fragmentation

  8. Propagation and isolation of ranaviruses in cell culture

    DEFF Research Database (Denmark)

    Ariel, Ellen; Nicolajsen, Nicole; Christophersen, Maj-Britt

    2009-01-01

    The optimal in vitro propagation procedure for a panel of ranavirus isolates and the best method for isolation of Epizootic haematopoietic necrosis virus (EHNV) from organ material in cell-culture were investigated. The panel of ranavirus isolates included: Frog virus 3 (FV3), Bohle iridovirus (BIV......), Pike-perch iridovirus (PPIV), European catfish virus (ECV), European sheatfish virus (ESV), EHNV, Doctor fish virus (DFV), Guppy virus 6 (GF6), short-finned eel virus (SERV) and Rana esculenta virus Italy 282/102 (REV 282/102). Each isolate was titrated in five cell lines: bluegill fry (BF-2......), epithelioma papulosum cyprini (EPC), chinook salmon embryo (CHSE-214) rainbow trout gonad (RTG-2) and fathead minnow (FHM), and incubated at 10, 15, 20, 24 and 28 °C for two weeks. BF-2, EPC and CHSE-214 cells performed well and titers obtained in the three cell lines were similar, whereas FHM and RTG-2 cells...

  9. Properties of Dental Pulp-derived Mesenchymal Stem Cells and the Effects of Culture Conditions.

    Science.gov (United States)

    Kawashima, Nobuyuki; Noda, Sonoko; Yamamoto, Mioko; Okiji, Takashi

    2017-09-01

    Dental pulp mesenchymal stem cells (DPMSCs) highly express mesenchymal stem cell markers and possess the potential to differentiate into neural cells, osteoblasts, adipocytes, and chondrocytes. Thus, DPMSCs are considered suitable for tissue regeneration. The colony isolation method has commonly been used to collect relatively large amounts of heterogeneous DPMSCs. Homogenous DPMSCs can be isolated by fluorescence-activated cell sorting using antibodies against mesenchymal stem cell markers, although this method yields a limited number of cells. Both quality and quantity of DPMSCs are critical to regenerative therapy, and cell culture methods need to be improved. We thus investigated the properties of DPMSCs cultured with different methods. DPMSCs in a three-dimensional spheroid culture system, which is similar to the hanging drop culture for differentiation of embryonic stem cells, showed upregulation of odonto-/osteoblastic markers and mineralized nodule formation. This suggests that this three-dimensional spheroid culturing system for DPMSCs may be suitable for inducing hard tissues. We further examined the effect of cell culture density on the properties of DPMSCs because the properties of stem cells can be altered depending on the cell density. DPMSCs cultured under the confluent cell density condition showed slight downregulation of some mesenchymal stem cell markers compared with those under the sparse condition. The ability of DPMSCs to differentiate into hard tissue-forming cells was found to be enhanced in the confluent condition, suggesting that the confluent culture condition may not be suitable for maintaining the stemness of DPMSCs. When DPMSCs are to be used for hard tissue regeneration, dense followed by sparse cell culture conditions may be a better alternative strategy. Copyright © 2017 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  10. Turbulent Dynamics of Epithelial Cell Cultures

    Science.gov (United States)

    Blanch-Mercader, C.; Yashunsky, V.; Garcia, S.; Duclos, G.; Giomi, L.; Silberzan, P.

    2018-05-01

    We investigate the large length and long time scales collective flows and structural rearrangements within in vitro human bronchial epithelial cell (HBEC) cultures. Activity-driven collective flows result in ensembles of vortices randomly positioned in space. By analyzing a large population of vortices, we show that their area follows an exponential law with a constant mean value and their rotational frequency is size independent, both being characteristic features of the chaotic dynamics of active nematic suspensions. Indeed, we find that HBECs self-organize in nematic domains of several cell lengths. Nematic defects are found at the interface between domains with a total number that remains constant due to the dynamical balance of nucleation and annihilation events. The mean velocity fields in the vicinity of defects are well described by a hydrodynamic theory of extensile active nematics.

  11. Some major deviations for biomass determination by indirect method and estimation based on alkali consumption. [Ratio of cell mass produced and alkali consumed; diesel fuel culture medium

    Energy Technology Data Exchange (ETDEWEB)

    Concone, B R.V.; Doin, P A; Pinto, A G

    1978-01-01

    Some factors like the variation of the liquid volume, the variation of cellular nitrogen content and the mass of cells taken with the samples during batch cultivation of microorganisms on diesel oil, were considered for the computation of the ratio between cell mass produced and the mass of alkali consumed to maintain constant the pH of the fermentation medium. The results obtained showed that if such ratios are computed with cell concentration instead of cell mass the deviations can be of the order of 27% caused by the variation of the liquid medium volume. Otherwise, the results showed also that those ratios are variable during batch cultivation on diesel oil probably because of the variations on the nitrogen content of microorganisms. The relative difference between the mass of cells measured and the mass of cells calculated from the alkali consumption curve can be of the order of 63%.

  12. Recombinant Protein Production and Insect Cell Culture and Process

    Science.gov (United States)

    Spaulding, Glenn F. (Inventor); Goodwin, Thomas J. (Inventor); OConnor, Kim C. (Inventor); Francis, Karen M. (Inventor); Andrews, Angela D. (Inventor); Prewett, Tracey L. (Inventor)

    1997-01-01

    A process has been developed for recombinant production of selected polypeptides using transformed insect cells cultured in a horizontally rotating culture vessel modulated to create low shear conditions. A metabolically transformed insect cell line is produced using the culture procedure regardless of genetic transformation. The recombinant polypeptide can be produced by an alternative process using virtually infected or stably transformed insect cells containing a gene encoding the described polypeptide. The insect cells can also be a host for viral production.

  13. Culture, Interface Design, and Design Methods for Mobile Devices

    Science.gov (United States)

    Lee, Kun-Pyo

    Aesthetic differences and similarities among cultures are obviously one of the very important issues in cultural design. However, ever since products became knowledge-supporting tools, the visible elements of products have become more universal so that the invisible parts of products such as interface and interaction are getting more important. Therefore, the cultural design should be extended to the invisible elements of culture like people's conceptual models beyond material and phenomenal culture. This chapter aims to explain how we address the invisible cultural elements in interface design and design methods by exploring the users' cognitive styles and communication patterns in different cultures. Regarding cultural interface design, we examined users' conceptual models while interacting with mobile phone and website interfaces, and observed cultural difference in performing tasks and viewing patterns, which appeared to agree with cultural cognitive styles known as Holistic thoughts vs. Analytic thoughts. Regarding design methods for culture, we explored how to localize design methods such as focus group interview and generative session for specific cultural groups, and the results of comparative experiments revealed cultural difference on participants' behaviors and performance in each design method and led us to suggest how to conduct them in East Asian culture. Mobile Observation Analyzer and Wi-Pro, user research tools we invented to capture user behaviors and needs especially in their mobile context, were also introduced.

  14. Phytases Improve Myo-Inositol Bioaccessibility in Rye Bread: A Study Using an In Vitro Method of Digestion and a Caco-2 Cell Culture Model

    Directory of Open Access Journals (Sweden)

    Emilia Katarzyna Cielecka

    2015-01-01

    Full Text Available Preparations of 6-phytase A (EC 3.1.3.26 and phytase B (acid phosphatase, EC 3.1.3.2 were applied alone and combined in the preparation of dough to estimate their catalytic potential for myo-inositol liberation from rye flour in the breadmaking technology. The experimental bread samples were ground after baking and subjected to determination of myo-inositol bioavailability by an in vitro method that simulated digestion in a human alimentary tract, followed by measurements of myo-inositol transport through enterocyte-like differentiated Caco-2 cells to determine its bioaccessibility. Myo-inositol content was measured by a high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD technique. The concentration of myo-inositol in the dialysates of control bread was 25.3 μg/mL, whereas in the dialysates of bread sample baked with 6-phytase A, the concentration increased to 35.4 μg/mL, and in the bread baked with phytase B to 64.98 μg/mL. Simultaneous application of both enzymes resulted in myo-inositol release of 64.04 μg/mL. The highest bioaccessibility of myo-inositol, assessed by the measurement of the passage through the Caco-2 monolayer was determined in the bread baked with the addition of 6-phytase A. Enzymatically modifi ed rye bread, particularly by the addition of 6-phytase A, may be therefore a rich source of a highly bioaccessible myo-inositol.

  15. Phytases Improve Myo-Inositol Bioaccessibility in Rye Bread: A Study Using an In Vitro Method of Digestion and a Caco-2 Cell Culture Model

    Science.gov (United States)

    Cielecka, Emilia Katarzyna; Pierzchalska, Małgorzata; Żyła, Krzysztof

    2015-01-01

    Summary Preparations of 6-phytase A (EC 3.1.3.26) and phytase B (acid phosphatase, EC 3.1.3.2) were applied alone and combined in the preparation of dough to estimate their catalytic potential for myo-inositol liberation from rye flour in the breadmaking technology. The experimental bread samples were ground after baking and subjected to determination of myo-inositol bioavailability by an in vitro method that simulated digestion in a human alimentary tract, followed by measurements of myo-inositol transport through enterocyte- -like differentiated Caco-2 cells to determine its bioaccessibility. Myo-inositol content was measured by a high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) technique. The concentration of myo-inositol in the dialysates of control bread was 25.3 µg/mL, whereas in the dialysates of bread sample baked with 6-phytase A, the concentration increased to 35.4 µg/mL, and in the bread baked with phytase B to 64.98 µg/mL. Simultaneous application of both enzymes resulted in myo-inositol release of 64.04 µg/mL. The highest bioaccessibility of myo-inositol, assessed by the measurement of the passage through the Caco-2 monolayer was determined in the bread baked with the addition of 6-phytase A. Enzymatically modified rye bread, particularly by the addition of 6-phytase A, may be therefore a rich source of a highly bioaccessible myo- -inositol. PMID:27904333

  16. Impedance Spectroscopic Characterisation of Porosity in 3D Cell Culture Scaffolds with Different Channel Networks

    DEFF Research Database (Denmark)

    Canali, Chiara; Mohanty, Soumyaranjan; Heiskanen, Arto

    2015-01-01

    We present the application of electrochemical impedance spectroscopy (EIS) as a method for discriminating between different polydimethylsiloxane (PDMS) scaffolds for three-dimensional (3D) cell cultures. The validity of EIS characterisation for scaffolds having different degree of porosity...... serve as means of single-frequency measurements for fast scaffold characterization combined with in vitro monitoring of 3D cell cultures....

  17. Differential marker expression by cultures rich in mesenchymal stem cells

    Science.gov (United States)

    2013-01-01

    Background Mesenchymal stem cells have properties that make them amenable to therapeutic use. However, the acceptance of mesenchymal stem cells in clinical practice requires standardized techniques for their specific isolation. To date, there are no conclusive marker (s) for the exclusive isolation of mesenchymal stem cells. Our aim was to identify markers differentially expressed between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. We compared and contrasted the phenotype of tissue cultures in which mesenchymal stem cells are rich and rare. By initially assessing mesenchymal stem cell differentiation, we established that bone marrow and breast adipose cultures are rich in mesenchymal stem cells while, in our hands, foreskin fibroblast and olfactory tissue cultures contain rare mesenchymal stem cells. In particular, olfactory tissue cells represent non-stem cell mesenchymal cells. Subsequently, the phenotype of the tissue cultures were thoroughly assessed using immuno-fluorescence, flow-cytometry, proteomics, antibody arrays and qPCR. Results Our analysis revealed that all tissue cultures, regardless of differentiation potential, demonstrated remarkably similar phenotypes. Importantly, it was also observed that common mesenchymal stem cell markers, and fibroblast-associated markers, do not discriminate between mesenchymal stem cell and non-stem cell mesenchymal cell cultures. Examination and comparison of the phenotypes of mesenchymal stem cell and non-stem cell mesenchymal cell cultures revealed three differentially expressed markers – CD24, CD108 and CD40. Conclusion We indicate the importance of establishing differential marker expression between mesenchymal stem cells and non-stem cell mesenchymal cells in order to determine stem cell specific markers. PMID:24304471

  18. Protection of cultured mammalian cells by rebamipide

    Energy Technology Data Exchange (ETDEWEB)

    Antoku, Shigetoshi; Aramaki, Ryoji [Kyushu Univ., Fukuoka (Japan). Faculty of Medicine; Tanaka, Hisashi; Kusumoto, Naotoshi

    1997-06-01

    Rebamipide which is used as a drug for gastritis and stomach ulcer has large capability for OH radical scavenging. It is expected that rebamipide has protective effect against ionizing radiations. The present paper deals with protective effect of rebamipide for cultured mammalian cells exposed to ionizing radiations. As rebamipide is insoluble in water, three solvents were used to dissolve. Rebamipide dissolved in dimethyl sulfoxide (DMSO), dimethyl formamide (DMFA) and 0.02 N NaOH was added to the cells in Eagle`s minimum essential medium (MEM) supplemented with 10% fetal calf serum and the cells were irradiated with X-rays. After irradiation, the cells were trypsinized, plated in MEM with 10% fetal calf serum and incubated for 7 days in a CO{sub 2} incubator to form colonies. Rebamipide dissolved in 0.02 N NaOH exhibited the protective effect expected its OH radical scavenging capability. However, the protective effect of rebamipide dissolved in DMSO was about half of that expected by its radical scavenging capability and that of rebamipide dissolved in DMFA was not observed. Uptake of rebamipide labeled with {sup 14}C increased with increasing contact time with rebamipide. These rebamipide mainly distributed in nucleus rather than cytoplasm. (author)

  19. Protection of cultured mammalian cells by rebamipide

    International Nuclear Information System (INIS)

    Antoku, Shigetoshi; Aramaki, Ryoji; Tanaka, Hisashi; Kusumoto, Naotoshi.

    1997-01-01

    Rebamipide which is used as a drug for gastritis and stomach ulcer has large capability for OH radical scavenging. It is expected that rebamipide has protective effect against ionizing radiations. The present paper deals with protective effect of rebamipide for cultured mammalian cells exposed to ionizing radiations. As rebamipide is insoluble in water, three solvents were used to dissolve. Rebamipide dissolved in dimethyl sulfoxide (DMSO), dimethyl formamide (DMFA) and 0.02 N NaOH was added to the cells in Eagle's minimum essential medium (MEM) supplemented with 10% fetal calf serum and the cells were irradiated with X-rays. After irradiation, the cells were trypsinized, plated in MEM with 10% fetal calf serum and incubated for 7 days in a CO 2 incubator to form colonies. Rebamipide dissolved in 0.02 N NaOH exhibited the protective effect expected its OH radical scavenging capability. However, the protective effect of rebamipide dissolved in DMSO was about half of that expected by its radical scavenging capability and that of rebamipide dissolved in DMFA was not observed. Uptake of rebamipide labeled with 14 C increased with increasing contact time with rebamipide. These rebamipide mainly distributed in nucleus rather than cytoplasm. (author)

  20. Ultrastructural and radiobiological characterization of stromal cells in continuous, long-term marrow culture

    International Nuclear Information System (INIS)

    Tavassoli, M.

    1982-01-01

    Hemopoietic stromal cells were studied in continuous, long-term marrow culture. A correlative study was carried out involving cytochemistry as well as scanning (SEM), and transmission electron microscopy (TEM) with sections cut either perpendicular or parallel to the substratum. Only two stromal cell types were identified: epithelioid cells and macrophages. The appearance of these cells, however, varied according to their topography in the culture and the method of observation; a finding that may explain the multiplicity of the cell types reported in these cultures. The two cell types displayed considerable interconnections and interactions which may be essential in their support function for the proliferation and maintenance of hemopoietic stem cells. They also demonstrated numerous coated pits and vesicles suggestive of extensive receptor-mediated endocytosis. Stromal cells, generally thought to be relatively radioresistant, demonstrated hitherto unrecognized radiosensitivity in culture. Doses of radiation as low as 500 rads interfered with their support function for the maintenance of the hemopoietic stem cell

  1. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure.

    Science.gov (United States)

    Akahane, M; Shimizu, T; Kira, T; Onishi, T; Uchihara, Y; Imamura, T; Tanaka, Y

    2016-11-01

    To assess the structure and extracellular matrix molecule expression of osteogenic cell sheets created via culture in medium with both dexamethasone (Dex) and ascorbic acid phosphate (AscP) compared either Dex or AscP alone. Osteogenic cell sheets were prepared by culturing rat bone marrow stromal cells in a minimal essential medium (MEM), MEM with AscP, MEM with Dex, and MEM with Dex and AscP (Dex/AscP). The cell number and messenger (m)RNA expression were assessed in vitro, and the appearance of the cell sheets was observed after mechanical retrieval using a scraper. β-tricalcium phosphate (β-TCP) was then wrapped with the cell sheets from the four different groups and subcutaneously implanted into rats. After mechanical retrieval, the osteogenic cell sheets from the MEM, MEM with AscP, and MEM with Dex groups appeared to be fragmented or incomplete structures. The cell sheets cultured with Dex/AscP remained intact after mechanical retrieval, without any identifiable tears. Culture with Dex/AscP increased the mRNA and protein expression of extracellular matrix proteins and cell number compared with those of the other three groups. More bridging bone formation was observed after transplantation of the β-TCP scaffold wrapped with cell sheets cultured with Dex/AscP, than in the other groups. These results suggest that culture with Dex/AscP improves the mechanical integrity of the osteogenic cell sheets, allowing retrieval of the confluent cells in a single cell sheet structure. This method may be beneficial when applied in cases of difficult tissue reconstruction, such as nonunion, bone defects, and osteonecrosis.Cite this article: M. Akahane, T. Shimizu, T. Kira, T. Onishi, Y. Uchihara, T. Imamura, Y. Tanaka. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure. Bone Joint Res 2016;5:569-576. DOI: 10.1302/2046-3758.511.BJR-2016-0013.R1. © 2016 Akahane et al.

  2. Computerized microfluidic cell culture using elastomeric channels and Braille displays.

    Science.gov (United States)

    Gu, Wei; Zhu, Xiaoyue; Futai, Nobuyuki; Cho, Brenda S; Takayama, Shuichi

    2004-11-09

    Computer-controlled microfluidics would advance many types of cellular assays and microscale tissue engineering studies wherever spatiotemporal changes in fluidics need to be defined. However, this goal has been elusive because of the limited availability of integrated, programmable pumps and valves. This paper demonstrates how a refreshable Braille display, with its grid of 320 vertically moving pins, can power integrated pumps and valves through localized deformations of channel networks within elastic silicone rubber. The resulting computerized fluidic control is able to switch among: (i) rapid and efficient mixing between streams, (ii) multiple laminar flows with minimal mixing between streams, and (iii) segmented plug-flow of immiscible fluids within the same channel architecture. The same control method is used to precisely seed cells, compartmentalize them into distinct subpopulations through channel reconfiguration, and culture each cell subpopulation for up to 3 weeks under perfusion. These reliable microscale cell cultures showed gradients of cellular behavior from C2C12 myoblasts along channel lengths, as well as differences in cell density of undifferentiated myoblasts and differentiation patterns, both programmable through different flow rates of serum-containing media. This technology will allow future microscale tissue or cell studies to be more accessible, especially for high-throughput, complex, and long-term experiments. The microfluidic actuation method described is versatile and computer programmable, yet simple, well packaged, and portable enough for personal use.

  3. The Effect of Spaceflight on Bone Cell Cultures

    Science.gov (United States)

    Landis, William J.

    1999-01-01

    Understanding the response of bone to mechanical loading (unloading) is extremely important in defining the means of adaptation of the body to a variety of environmental conditions such as during heightened physical activity or in extended explorations of space or the sea floor. The mechanisms of the adaptive response of bone are not well defined, but undoubtedly they involve changes occurring at the cellular level of bone structure. This proposal has intended to examine the hypothesis that the loading (unloading) response of bone is mediated by specific cells through modifications of their activity cytoskeletal elements, and/or elaboration of their extracellular matrices. For this purpose, this laboratory has utilized the results of a number of previous studies defining molecular biological, biochemical, morphological, and ultrastructural events of the reproducible mineralization of a primary bone cell (osteoblast) culture system under normal loading (1G gravity level). These data and the culture system then were examined following the use of the cultures in two NASA shuttle flights, STS-59 and STS-63. The cells collected from each of the flights were compared to respective synchronous ground (1G) control cells examined as the flight samples were simultaneously analyzed and to other control cells maintained at 1G until the time of shuttle launch, at which point they were terminated and studied (defined as basal cells). Each of the cell cultures was assayed in terms of metabolic markers- gene expression; synthesis and secretion of collagen and non-collagenous proteins, including certain cytoskeletal components; assembly of collagen into macrostructural arrays- formation of mineral; and interaction of collagen and mineral crystals during calcification of the cultures. The work has utilized a combination of biochemical techniques (radiolabeling, electrophoresis, fluorography, Western and Northern Blotting, and light microscopic immunofluorescence) and structural

  4. Isolation and culture of porcine neural progenitor cells from embryos and pluripotent stem cells

    DEFF Research Database (Denmark)

    Rasmussen, Mikkel Aabech; Hall, Vanessa Jane; Hyttel, Poul

    2013-01-01

    from porcine embryos or induced pluripotent stem cells is presented. The neural induction is performed in coculture and the isolation of rosette structures is carried out manually to ensure a homogenous population of NPCs. Using this method, multipotent NPCs can be obtained in approximately 1 month......The isolation and culture of neural progenitor cells (NPCs) from pluripotent stem cells has facilitated in vitro mechanistic studies of diseases related to the nervous system, as well as discovery of new medicine. In addition, NPCs are envisioned to play a crucial role in future cell replacement...... therapy. The pig has become recognized as an important large animal model and establishment of in vitro-derived porcine NPCs would allow for preclinical safety testing by transplantation in a porcine biomedical model. In this chapter, a detailed method for isolation and in vitro culture of porcine NPCs...

  5. Single molecule microscopy in 3D cell cultures and tissues.

    Science.gov (United States)

    Lauer, Florian M; Kaemmerer, Elke; Meckel, Tobias

    2014-12-15

    From the onset of the first microscopic visualization of single fluorescent molecules in living cells at the beginning of this century, to the present, almost routine application of single molecule microscopy, the method has well-proven its ability to contribute unmatched detailed insight into the heterogeneous and dynamic molecular world life is composed of. Except for investigations on bacteria and yeast, almost the entire story of success is based on studies on adherent mammalian 2D cell cultures. However, despite this continuous progress, the technique was not able to keep pace with the move of the cell biology community to adapt 3D cell culture models for basic research, regenerative medicine, or drug development and screening. In this review, we will summarize the progress, which only recently allowed for the application of single molecule microscopy to 3D cell systems and give an overview of the technical advances that led to it. While initially posing a challenge, we finally conclude that relevant 3D cell models will become an integral part of the on-going success of single molecule microscopy. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Ultra-thin Polyethylene glycol Coatings for Stem Cell Culture

    Science.gov (United States)

    Schmitt, Samantha K.

    Human mesenchymal stem cells (hMSCs) are a widely accessible and a clinically relevant cell type that are having a transformative impact on regenerative medicine. However, current clinical expansion methods can lead to selective changes in hMSC phenotype resulting from relatively undefined cell culture surfaces. Chemically defined synthetic surfaces can aid in understanding stem cell behavior. In particular we have developed chemically defined ultra-thin coatings that are stable over timeframes relevant to differentiation of hMSCs (several weeks). The approach employs synthesis of a copolymer with distinct chemistry in solution before application to a substrate. This provides wide compositional flexibility and allows for characterization of the orthogonal crosslinking and peptide binding groups. Characterization is done in solution by proton NMR and after crosslinking by X-ray photoelectron spectroscopy (XPS). The solubility of the copolymer in ethanol and low temperature crosslinking, expands its applicability to plastic substrates, in addition to silicon, glass, and gold. Cell adhesive peptides, namely Arg-Gly-Asp (RGD) fragments, are coupled to coating via different chemistries resulting in the urethane, amide or the thioester polymer-peptide bonds. Development of azlactone-based chemistry allowed for coupling in water at low peptide concentrations and resulted in either an amide or thioester bonds, depending on reactants. Characterization of the peptide functionalized coating by XPS, infrared spectroscopy and cell culture assays, showed that the amide linkages can present peptides for multiple weeks, while shorter-term presentation of a few days is possible using the more labile thioester bond. Regardless, coatings promoted initial adhesion and spreading of hMSCs in a peptide density dependent manner. These coatings address the following challenges in chemically defined cell culture simultaneously: (i) substrate adaptability, (ii) scalability over large areas

  7. X-ray microanalysis of single and cultured cells

    International Nuclear Information System (INIS)

    Wroblewski, J.; Roomans, G.M.

    1984-01-01

    X-ray microanalysis of single or cultured cells is often a useful alternative or complement to the analysis of the corresponding tissue. It also allows the analysis of individual cells in a cell population. Preparation for X-ray microanalysis poses a number of typical problems. Suspensions of single cells can be prepared by either of two pathways: (1) washing - mounting - drying, or (2) centrifugation - freezing or fixation - sectioning. The washing step in the preparation of single or cultured cells presents the most severe problems. Cultured cells are generally grown on a substrate that is compatible with both the analysis and the culture, washed and dried. In some cases, sectioning of cultured cell monolayers has been performed. Special problems in quantitative analysis occur in those cases where the cells are analyzed on a thick substrate, since the substrate contributes to the spectral background

  8. Primary Human Uterine Leiomyoma Cell Culture Quality Control: Some Properties of Myometrial Cells Cultured under Serum Deprivation Conditions in the Presence of Ovarian Steroids.

    Science.gov (United States)

    Bonazza, Camila; Andrade, Sheila Siqueira; Sumikawa, Joana Tomomi; Batista, Fabrício Pereira; Paredes-Gamero, Edgar J; Girão, Manoel J B C; Oliva, Maria Luiza V; Castro, Rodrigo Aquino

    2016-01-01

    Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2) and progesterone (P4) effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation). These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.

  9. Primary Human Uterine Leiomyoma Cell Culture Quality Control: Some Properties of Myometrial Cells Cultured under Serum Deprivation Conditions in the Presence of Ovarian Steroids.

    Directory of Open Access Journals (Sweden)

    Camila Bonazza

    Full Text Available Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2 and progesterone (P4 effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation. These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.

  10. A microfluidic cell culture array with various oxygen tensions.

    Science.gov (United States)

    Peng, Chien-Chung; Liao, Wei-Hao; Chen, Ying-Hua; Wu, Chueh-Yu; Tung, Yi-Chung

    2013-08-21

    Oxygen tension plays an important role in regulating various cellular functions in both normal physiology and disease states. Therefore, drug testing using conventional in vitro cell models under normoxia often possesses limited prediction capability. A traditional method of setting an oxygen tension in a liquid medium is by saturating it with a gas mixture at the desired level of oxygen, which requires bulky gas cylinders, sophisticated control, and tedious interconnections. Moreover, only a single oxygen tension can be tested at the same time. In this paper, we develop a microfluidic cell culture array platform capable of performing cell culture and drug testing under various oxygen tensions simultaneously. The device is fabricated using an elastomeric material, polydimethylsiloxane (PDMS) and the well-developed multi-layer soft lithography (MSL) technique. The prototype device has 4 × 4 wells, arranged in the same dimensions as a conventional 96-well plate, for cell culture. The oxygen tensions are controlled by spatially confined oxygen scavenging chemical reactions underneath the wells using microfluidics. The platform takes advantage of microfluidic phenomena while exhibiting the combinatorial diversities achieved by microarrays. Importantly, the platform is compatible with existing cell incubators and high-throughput instruments (liquid handling systems and plate readers) for cost-effective setup and straightforward operation. Utilizing the developed platform, we successfully perform drug testing using an anti-cancer drug, triapazamine (TPZ), on adenocarcinomic human alveolar basal epithelial cell line (A549) under three oxygen tensions ranging from 1.4% to normoxia. The developed platform is promising to provide a more meaningful in vitro cell model for various biomedical applications while maintaining desired high throughput capabilities.

  11. Establishment and characterization of American elm cell suspension cultures

    Science.gov (United States)

    Steven M. Eshita; Joseph C. Kamalay; Vicki M. Gingas; Daniel A. Yaussy

    2000-01-01

    Cell suspension cultures of Dutch elm disease (DED)-tolerant and DED-susceptible American elms clones have been established and characterized as prerequisites for contrasts of cellular responses to pathogen-derived elicitors. Characteristics of cultured elm cell growth were monitored by A700 and media conductivity. Combined cell growth data for all experiments within a...

  12. Ultrasonic three-dimensional on-chip cell culture for dynamic studies of tumor immune surveillance by natural killer cells.

    Science.gov (United States)

    Christakou, Athanasia E; Ohlin, Mathias; Önfelt, Björn; Wiklund, Martin

    2015-08-07

    We demonstrate a simple method for three-dimensional (3D) cell culture controlled by ultrasonic standing waves in a multi-well microplate. The method gently arranges cells in a suspension into a single aggregate in each well of the microplate and, by this, nucleates 3D tissue-like cell growth for culture times between two and seven days. The microplate device is compatible with both high-resolution optical microscopy and maintenance in a standard cell incubator. The result is a scaffold- and coating-free method for 3D cell culture that can be used for controlling the cellular architecture, as well as the cellular and molecular composition of the microenvironment in and around the formed cell structures. We demonstrate the parallel production of one hundred synthetic 3D solid tumors comprising up to thousands of human hepatocellular carcinoma (HCC) HepG2 cells, we characterize the tumor structure by high-resolution optical microscopy, and we monitor the functional behavior of natural killer (NK) cells migrating, docking and interacting with the tumor model during culture. Our results show that the method can be used for determining the collective ability of a given number of NK cells to defeat a solid tumor having a certain size, shape and composition. The ultrasound-based method itself is generic and can meet any demand from applications where it is advantageous to monitor cell culture from production to analysis of 3D tissue or tumor models using microscopy in one single microplate device.

  13. In vitro culture method of powdery mildew (Oidium heveae ...

    African Journals Online (AJOL)

    ELOHO

    2012-08-23

    Aug 23, 2012 ... A method for culturing powdery mildew (Oidium heveae) from isolated leaves of ... solution; d, Colour phase leaves with nutrient solution in culture dish; e, in vitro ... Plant and fungus materials .... same change trend during whole culture period. ... consistent with the field resistance identification results of.

  14. Simple and convenient method for culturing anaerobic bacteria.

    OpenAIRE

    Behbehani, M J; Jordan, H V; Santoro, D L

    1982-01-01

    A simple and convenient method for culturing anaerobic bacteria is described. Cultures can be grown in commercially available flasks normally used for preparation of sterile external solutions. A special disposable rubber flask closure maintains anaerobic conditions in the flask after autoclaving. Growth of a variety of anaerobic oral bacteria was comparable to that obtained after anaerobic incubation of broth cultures in Brewer Anaerobic Jars.

  15. Electrospinning of microbial polyester for cell culture

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Oh Hyeong [Department of Polymer Science and Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Lee, Ik Sang [Department of Polymer Science and Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Ko, Young-Gwang [Department of Polymer Science and Engineering, Kumoh National Institute of Technology, 1 Yangho-dong, Gumi, Gyeongbuk 730-701 (Korea, Republic of); Meng, Wan [Department of Polymer Science, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Jung, Kyung-Hye [Department of Polymer Science, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Kang, Inn-Kyu [Department of Polymer Science, Kyungpook National University, 1370 Sankyuk-dong, Buk-gu, Daegu 702-701 (Korea, Republic of); Ito, Yoshihiro [Kanagawa Academy of Science and Technology, KSP East 309, Sakado 3-2-1, Takatsu-ku, Kawasaki 213-0012 (Japan)

    2007-03-01

    Biodegradable and biocompatible poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), a copolymer of microbial polyester, was fabricated as a nanofibrous mat by electrospinning. The specific surface area and the porosity of electrospun PHBV nanofibrous mat were determined. When the mechanical properties of flat film and electrospun PHBV nanofibrous mats were investigated, both the tensile modulus and strength of electrospun PHBV were less than those of cast PHBV film. However, the elongation ratio of nanofiber mat was higher than that of the cast film. The structure of electrospun nanofibers using PHBV-trifluoroethanol solutions depended on the solution concentrations. When x-ray diffraction patterns of bulk PHBV before and after electrospinning were compared, the crystallinity of PHBV was not significantly affected by the electrospinning process. Chondrocytes adhered and grew on the electrospun PHBV nanofibrous mat better than on the cast PHBV film. Therefore, the electrospun PHBV was considered to be suitable for cell culture.

  16. Stimulation of the proliferation of hemopoietic stem cells in irradiated bone marrow cell culture

    International Nuclear Information System (INIS)

    Mori, K.J.; Izumi, H.; Seto, A.

    1981-01-01

    Long-term hemopoiesis was established in bone marrow cell culture in vitro. This culture was shown to support the recovery proliferation of hemopoietic stem cells completely in vitro after irradiation. Hemopoietic stem cells were stimulated into proliferation in culture when normal bone marrow cells were overlayed on top of the irradiated adherent cell colonies. These results indicate that proliferation and differentiation of hemopoietic stem cells in vitro are also supported by stromahemopoietic cell interactions

  17. Cell-Culture Reactor Having a Porous Organic Polymer Membrane

    Science.gov (United States)

    Koontz, Steven L. (Inventor)

    2000-01-01

    A method for making a biocompatible polymer article using a uniform atomic oxygen treatment is disclosed. The substrate may be subsequently optionally grated with a compatibilizing compound. Compatibilizing compounds may include proteins, phosphory1choline groups, platelet adhesion preventing polymers, albumin adhesion promoters, and the like. The compatibilized substrate may also have a living cell layer adhered thereto. The atomic oxygen is preferably produced by a flowing afterglow microwave discharge, wherein the substrate resides in a sidearm out of the plasma. Also, methods for culturing cells for various purposes using the various membranes are disclosed as well. Also disclosed are porous organic polymers having a distributed pore chemistry (DPC) comprising hydrophilic and hydrophobic regions, and a method for making the DPC by exposing the polymer to atomic oxygen wherein the rate of hydrophilization is greater than the rate of mass loss.

  18. Cell cultures for schistosomes - Chances of success or wishful thinking?

    Science.gov (United States)

    Quack, T; Wippersteg, V; Grevelding, C G

    2010-08-01

    Due to their worldwide importance for human and animal health, schistosomes are in the focus of national and international research activities. Their aims are to elucidate the genome, the transcriptome, the proteome and the glycome of schistosomes with the expectation to understand the biology of these blood flukes and to identify new candidate antigens for the development of a vaccine, or target molecules for the design of novel pharmaceutical compounds. All of these efforts have delivered a vast amount of information about the genetic equipment of schistosomes. In the emerging era of post-genomic research, however, methods and tools are necessary to interpret all available data and to characterise molecules of interest in more detail. In addition to transgenesis, it is generally accepted that cell lines for schistosomes are among the requirements to overcome present research limitations. In our commentary the prospect of establishing cell cultures for schistosomes is discussed. To this end we summarise the comprehensive endeavours made in the past regarding the establishment of invertebrate cell lines pointing to critical parameters that should be considered when making new attempts towards schistosome cell culturing. Furthermore, based on preliminary data with pilot-character, we discuss recent advances indicating the possibility of overcoming existing restrictions with respect to the 'immortalisation' of cells by oncogenes. Copyright 2010 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  19. Particle Trajectories in Rotating Wall Cell Culture Devices

    Science.gov (United States)

    Ramachandran N.; Downey, J. P.

    1999-01-01

    Cell cultures are extremely important to the medical community since such cultures provide an opportunity to perform research on human tissue without the concerns inherent in experiments on individual humans. Development of cells in cultures has been found to be greatly influenced by the conditions of the culture. Much work has focused on the effect of the motions of cells in the culture relative to the solution. Recently rotating wall vessels have been used with success in achieving improved cellular cultures. Speculation and limited research have focused on the low shear environment and the ability of rotating vessels to keep cells suspended in solution rather than floating or sedimenting as the primary reasons for the improved cellular cultures using these devices. It is widely believed that the cultures obtained using a rotating wall vessel simulates to some degree the effect of microgravity on cultures. It has also been speculated that the microgravity environment may provide the ideal acceleration environment for culturing of cellular tissues due to the nearly negligible levels of sedimentation and shear possible. This work predicts particle trajectories of cells in rotating wall vessels of cylindrical and annular design consistent with the estimated properties of typical cellular cultures. Estimates of the shear encountered by cells in solution and the interactions with walls are studied. Comparisons of potential experiments in ground and microgravity environments are performed.

  20. Microfluidic engineered high cell density three-dimensional neural cultures

    Science.gov (United States)

    Cullen, D. Kacy; Vukasinovic, Jelena; Glezer, Ari; La Placa, Michelle C.

    2007-06-01

    Three-dimensional (3D) neural cultures with cells distributed throughout a thick, bioactive protein scaffold may better represent neurobiological phenomena than planar correlates lacking matrix support. Neural cells in vivo interact within a complex, multicellular environment with tightly coupled 3D cell-cell/cell-matrix interactions; however, thick 3D neural cultures at cell densities approaching that of brain rapidly decay, presumably due to diffusion limited interstitial mass transport. To address this issue, we have developed a novel perfusion platform that utilizes forced intercellular convection to enhance mass transport. First, we demonstrated that in thick (>500 µm) 3D neural cultures supported by passive diffusion, cell densities =104 cells mm-3), continuous medium perfusion at 2.0-11.0 µL min-1 improved viability compared to non-perfused cultures (p death and matrix degradation. In perfused cultures, survival was dependent on proximity to the perfusion source at 2.00-6.25 µL min-1 (p 90% viability in both neuronal cultures and neuronal-astrocytic co-cultures. This work demonstrates the utility of forced interstitial convection in improving the survival of high cell density 3D engineered neural constructs and may aid in the development of novel tissue-engineered systems reconstituting 3D cell-cell/cell-matrix interactions.

  1. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  2. Fabrication of micropatterned alginate-gelatin and k-carrageenan hydrogels of defined shapes using simple wax mould method as a platform for stem cell/induced Pluripotent Stem Cells (iPSC) culture.

    Science.gov (United States)

    Vignesh, S; Gopalakrishnan, Aswathi; M R, Poorna; Nair, Shantikumar V; Jayakumar, R; Mony, Ullas

    2018-06-01

    Micropatterning techniques involve soft lithography, which is laborious, expensive and restricted to a narrow spectrum of biomaterials. In this work we report, first time employment of patterned wax moulds for generation of micropatterned alginate-gelatin and κ-carrageenan (κ-CRG) hydrogel systems by a novel, simple and cost effective method. We generated and characterized uniform and reproducible micropatterned hydrogels of varying sizes and shapes such as square projections, square grooves, and circular grids and crisscrossed hillocks. The rheological analysis showed that κ-carrageenan hydrogels had higher gel strength when compared to alginate-gelatin hydrogels. Human Mesenchymal stem cells (hMSCs) and Human Induced Pluripotent Stem Cells (hiPSCs) were found to be cytocompatible with these hydrogels. This micropatterned hydrogel system may have potential application in tissue engineering and also in understanding the basic biology behind the stem cell/iPSC fate. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Treating cell culture media with UV irradiation against adventitious agents: minimal impact on CHO performance.

    Science.gov (United States)

    Yen, Sandi; Sokolenko, Stanislav; Manocha, Bhavik; Blondeel, Eric J M; Aucoin, Marc G; Patras, Ankit; Daynouri-Pancino, Farnaz; Sasges, Michael

    2014-01-01

    Sterility of cell culture media is an important concern in biotherapeutic processing. In large scale biotherapeutic production, a unit contamination of cell culture media can have costly effects. Ultraviolet (UV) irradiation is a sterilization method effective against bacteria and viruses while being non-thermal and non-adulterating in its mechanism of action. This makes UV irradiation attractive for use in sterilization of cell culture media. The objective of this study was to evaluate the effect of UV irradiation of cell culture media in terms of chemical composition and the ability to grow cell cultures in the treated media. The results showed that UV irradiation of commercial cell culture media at relevant disinfection doses impacted the chemical composition of the media with respect to several carboxylic acids, and to a minimal extent, amino acids. The cumulative effect of these changes, however, did not negatively influence the ability to culture Chinese Hamster Ovary cells, as evaluated by cell viability, growth rate, and protein titer measurements in simple batch growth compared with the same cells cultured in control media exposed to visible light. © 2014 The Authors. Published by Wiley Periodicals, Inc. on behalf of American Institute of Chemical Engineers.

  4. Culture of human intestinal epithelial cell using the dissociating enzyme thermolysin and endothelin-3

    Directory of Open Access Journals (Sweden)

    Z. Liu

    2010-05-01

    Full Text Available Epithelium, a highly dynamic system, plays a key role in the homeostasis of the intestine. However, thus far a human intestinal epithelial cell line has not been established in many countries. Fetal tissue was selected to generate viable cell cultures for its sterile condition, effective generation, and differentiated character. The purpose of the present study was to culture human intestinal epithelial cells by a relatively simple method. Thermolysin was added to improve the yield of epithelial cells, while endothelin-3 was added to stimulate their growth. By adding endothelin-3, the achievement ratio (viable cell cultures/total cultures was enhanced to 60% of a total of 10 cultures (initiated from 8 distinct fetal small intestines, allowing the generation of viable epithelial cell cultures. Western blot, real-time PCR and immunofluorescent staining showed that cytokeratins 8, 18 and mouse intestinal mucosa-1/39 had high expression levels in human intestinal epithelial cells. Differentiated markers such as sucrase-isomaltase, aminopeptidase N and dipeptidylpeptidase IV also showed high expression levels in human intestinal epithelial cells. Differentiated human intestinal epithelial cells, with the expression of surface markers (cytokeratins 8, 18 and mouse intestinal mucosa-1/39 and secretion of cytokines (sucrase-isomaltase, aminopeptidase N and dipeptidylpeptidase IV, may be cultured by the thermolysin and endothelin-3 method and maintained for at least 20 passages. This is relatively simple, requiring no sophisticated techniques or instruments, and may have a number of varied applications.

  5. mRNA transfection of mouse and human neural stem cell cultures

    OpenAIRE

    McLenachan, Samuel; Zhang, D.; Palomo, A.B.; Edel, Michael John; Chen, F.K.

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has ...

  6. Culture of human intestinal epithelial cell using the dissociating enzyme thermolysin and endothelin-3

    OpenAIRE

    Liu, Z.; Zhang, P.; Zhou, Y.; Qin, H.; Shen, T.

    2010-01-01

    Epithelium, a highly dynamic system, plays a key role in the homeostasis of the intestine. However, thus far a human intestinal epithelial cell line has not been established in many countries. Fetal tissue was selected to generate viable cell cultures for its sterile condition, effective generation, and differentiated character. The purpose of the present study was to culture human intestinal epithelial cells by a relatively simple method. Thermolysin was added to improve the yield of epithel...

  7. Development of a microfluidic perfusion 3D cell culture system

    Science.gov (United States)

    Park, D. H.; Jeon, H. J.; Kim, M. J.; Nguyen, X. D.; Morten, K.; Go, J. S.

    2018-04-01

    Recently, 3-dimensional in vitro cell cultures have gained much attention in biomedical sciences because of the closer relevance between in vitro cell cultures and in vivo environments. This paper presents a microfluidic perfusion 3D cell culture system with consistent control of long-term culture conditions to mimic an in vivo microenvironment. It consists of two sudden expansion reservoirs to trap incoming air bubbles, gradient generators to provide a linear concentration, and microchannel mixers. Specifically, the air bubbles disturb a flow in the microfluidic channel resulting in the instability of the perfusion cell culture conditions. For long-term stable operation, the sudden expansion reservoir is designed to trap air bubbles by using buoyancy before they enter the culture system. The performance of the developed microfluidic perfusion 3D cell culture system was examined experimentally and compared with analytical results. Finally, it was applied to test the cytotoxicity of cells infected with Ewing’s sarcoma. Cell death was observed for different concentrations of H2O2. For future work, the developed microfluidic perfusion 3D cell culture system can be used to examine the behavior of cells treated with various drugs and concentrations for high-throughput drug screening.

  8. Systems Biology for Organotypic Cell Cultures

    Energy Technology Data Exchange (ETDEWEB)

    Grego, Sonia [RTI International, Research Triangle Park, NC (United States); Dougherty, Edward R. [Texas A & M Univ., College Station, TX (United States); Alexander, Francis J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Auerbach, Scott S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Berridge, Brian R. [GlaxoSmithKline, Research Triangle Park, NC (United States); Bittner, Michael L. [Translational Genomics Research Inst., Phoenix, AZ (United States); Casey, Warren [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Cooley, Philip C. [RTI International, Research Triangle Park, NC (United States); Dash, Ajit [HemoShear Therapeutics, Charlottesville, VA (United States); Ferguson, Stephen S. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Fennell, Timothy R. [RTI International, Research Triangle Park, NC (United States); Hawkins, Brian T. [RTI International, Research Triangle Park, NC (United States); Hickey, Anthony J. [RTI International, Research Triangle Park, NC (United States); Kleensang, Andre [Johns Hopkins Univ., Baltimore, MD (United States). Center for Alternatives to Animal Testing; Liebman, Michael N. [IPQ Analytics, Kennett Square, PA (United States); Martin, Florian [Phillip Morris International, Neuchatel (Switzerland); Maull, Elizabeth A. [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Paragas, Jason [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Qiao, Guilin [Defense Threat Reduction Agency, Ft. Belvoir, VA (United States); Ramaiahgari, Sreenivasa [National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States); Sumner, Susan J. [RTI International, Research Triangle Park, NC (United States); Yoon, Miyoung [The Hamner Inst. for Health Sciences, Research Triangle Park, NC (United States); ScitoVation, Research Triangle Park, NC (United States)

    2016-08-04

    Translating in vitro biological data into actionable information related to human health holds the potential to improve disease treatment and risk assessment of chemical exposures. While genomics has identified regulatory pathways at the cellular level, translation to the organism level requires a multiscale approach accounting for intra-cellular regulation, inter-cellular interaction, and tissue/organ-level effects. Tissue-level effects can now be probed in vitro thanks to recently developed systems of three-dimensional (3D), multicellular, “organotypic” cell cultures, which mimic functional responses of living tissue. However, there remains a knowledge gap regarding interactions across different biological scales, complicating accurate prediction of health outcomes from molecular/genomic data and tissue responses. Systems biology aims at mathematical modeling of complex, non-linear biological systems. We propose to apply a systems biology approach to achieve a computational representation of tissue-level physiological responses by integrating empirical data derived from organotypic culture systems with computational models of intracellular pathways to better predict human responses. Successful implementation of this integrated approach will provide a powerful tool for faster, more accurate and cost-effective screening of potential toxicants and therapeutics. On September 11, 2015, an interdisciplinary group of scientists, engineers, and clinicians gathered for a workshop in Research Triangle Park, North Carolina, to discuss this ambitious goal. Participants represented laboratory-based and computational modeling approaches to pharmacology and toxicology, as well as the pharmaceutical industry, government, non-profits, and academia. Discussions focused on identifying critical system perturbations to model, the computational tools required, and the experimental approaches best suited to generating key data. This consensus report summarizes the discussions held.

  9. Cell cycle phase of nondividing cells in aging human cell cultures determined by DNA content and chromosomal constitution

    International Nuclear Information System (INIS)

    Yanishevsky, R.M.

    1975-01-01

    Human diploid cell cultures, strain WI-38, have a finite proliferative capacity and have been proposed as a model of biological aging. To identify the cell cycle phase of the nondividing cells, cultures of various ages were exposed to 3 Hdt for 48 hours to label dividing cells, then the cycle phase was identified for individual cells by one of two methods, and finally, the proliferative status of the same cells was scored by autoradiographic evidence of 3 HdT uptake. The methods to identify the cycle phase were: determination of DNA strain content by Feulgen scanning cytophotometry, and determination of chromosome constitution by the technique of premature chromosome condensation (PCC). Preliminary experiments showed the effect of continuous exposure to various levels of 3 HdT on cell growth. High levels of 3 HdT inhibited cell cycle traverse: the cell number and labeling index curves reached a plateau; the cell volume increased; the cells accumulated with 4C DNA contents and it appeared that they blocked in G 2 phase. This pattern is consistent with a radiation effect. (U.S.)

  10. Cell-surface glycoproteins of human sarcomas: differential expression in normal and malignant tissues and cultured cells

    International Nuclear Information System (INIS)

    Rettig, W.F.; Garin-Chesa, P.; Beresford, H.R.; Oettgen, H.F.; Melamed, M.R.; Old, L.J.

    1988-01-01

    Normal differentiation and malignant transformation of human cells are characterized by specific changes in surface antigen phenotype. In the present study, the authors have defined six cell-surface antigens of human sarcomas and normal mesenchymal cells, by using mixed hemadsorption assays and immunochemical methods for the analysis of cultured cells and immunohistochemical staining for the analysis of normal tissues and > 200 tumor specimens. Differential patterns of F19, F24, G171, G253, S5, and Thy-1 antigen expression were found to characterize (i) subsets of cultured sarcoma cell lines, (ii) cultured fibroblasts derived from various organs, (iii) normal resting and activated mesenchymal tissues, and (iv) sarcoma and nonmesenchymal tumor tissues. These results provide a basic surface antigenic map for cultured mesenchymal cells and mesenchymal tissues and permit the classification of human sarcomas according to their antigenic phenotypes

  11. Optimization of Storage Temperature for Cultured ARPE-19 Cells

    Directory of Open Access Journals (Sweden)

    Lara Pasovic

    2013-01-01

    Full Text Available Purpose. The establishment of future retinal pigment epithelium (RPE replacement therapy is partly dependent on the availability of tissue-engineered RPE cells, which may be enhanced by the development of suitable storage methods for RPE. This study investigates the effect of different storage temperatures on the viability, morphology, and phenotype of cultured RPE. Methods. ARPE-19 cells were cultured under standard conditions and stored in HEPES-buffered MEM at nine temperatures (4°C, 8°C, 12°C, 16°C, 20°C, 24°C, 28°C, 32°C, and 37°C for seven days. Viability and phenotype were assessed by a microplate fluorometer and epifluorescence microscopy, while morphology was analyzed by scanning electron microscopy. Results. The percentage of viable cells preserved after storage was highest in the 16°C group (48.7%±9.8%; P<0.01 compared to 4°C, 8°C, and 24°C–37°C; P<0.05 compared to 12°C. Ultrastructure was best preserved at 12°C, 16°C, and 20°C. Expression of actin, ZO-1, PCNA, caspase-3, and RPE65 was maintained after storage at 16°C compared to control cells that were not stored. Conclusion. Out of nine temperatures tested between 4°C and 37°C, storage at 12°C, 16°C, and 20°C was optimal for maintenance of RPE cell viability, morphology, and phenotype. The preservation of RPE cells is critically dependent on storage temperature.

  12. Cell cycle regulation in human embryonic stem cells: links to adaptation to cell culture.

    Science.gov (United States)

    Barta, Tomas; Dolezalova, Dasa; Holubcova, Zuzana; Hampl, Ales

    2013-03-01

    Cell cycle represents not only a tightly orchestrated mechanism of cell replication and cell division but it also plays an important role in regulation of cell fate decision. Particularly in the context of pluripotent stem cells or multipotent progenitor cells, regulation of cell fate decision is of paramount importance. It has been shown that human embryonic stem cells (hESCs) show unique cell cycle characteristics, such as short doubling time due to abbreviated G1 phase; these properties change with the onset of differentiation. This review summarizes the current understanding of cell cycle regulation in hESCs. We discuss cell cycle properties as well as regulatory machinery governing cell cycle progression of undifferentiated hESCs. Additionally, we provide evidence that long-term culture of hESCs is accompanied by changes in cell cycle properties as well as configuration of several cell cycle regulatory molecules.

  13. Rabbit uterine epithelial cells: Co-culture with spermatozoa

    International Nuclear Information System (INIS)

    Boice, M.L.

    1988-01-01

    A primary culture of rabbit uterine epithelial cells was established and their effects on sperm function were examined in vitro. Epithelial cells were isolated from uteri of estrous rabbits and cultured on floating collagen gels in phenol red-free medium supplemented with 5% fetal bovine serum. Light microscopy and keratin staining showed that the epithelial cell population established in culture had morphological characteristics similar to that seen in the intact endometrium. Cells were cultured with 3 H-leucine and uptake of label by cells and its incorporation into cellular and secretory proteins determined. When compared to cells cultured for 24-48 h, incorporation of label into cellular protein was lower at 72-96 h, but secretion increased. Estradiol 17-β did not affect label uptake or incorporation, but did enhance proliferation of cells as judged by total DNA content of the cell population. Analysis of proteins in media by sodium dodecyl sulfate polyacrylamide gel electrophoresis and fluorography suggested that epithelial and stromal cells synthesis proteins that may be secretory in nature during 72-96 h culture. Twenty-nine to thirty-one h after initiation of epithelial cultures, 1-2 x 10 6 sperm were co-incubated with cells and sperm viability, motility, loss of acrosome and fertilizing ability determined

  14. A simple hanging drop cell culture protocol for generation of 3D spheroids.

    Science.gov (United States)

    Foty, Ramsey

    2011-05-06

    Studies of cell-cell cohesion and cell-substratum adhesion have historically been performed on monolayer cultures adherent to rigid substrates. Cells within a tissue, however, are typically encased within a closely packed tissue mass in which cells establish intimate connections with many near-neighbors and with extracellular matrix components. Accordingly, the chemical milieu and physical forces experienced by cells within a 3D tissue are fundamentally different than those experienced by cells grown in monolayer culture. This has been shown to markedly impact cellular morphology and signaling. Several methods have been devised to generate 3D cell cultures including encapsulation of cells in collagen gels or in biomaterial scaffolds. Such methods, while useful, do not recapitulate the intimate direct cell-cell adhesion architecture found in normal tissues. Rather, they more closely approximate culture systems in which single cells are loosely dispersed within a 3D meshwork of ECM products. Here, we describe a simple method in which cells are placed in hanging drop culture and incubated under physiological conditions until they form true 3D spheroids in which cells are in direct contact with each other and with extracellular matrix components. The method requires no specialized equipment and can be adapted to include addition of any biological agent in very small quantities that may be of interest in elucidating effects on cell-cell or cell-ECM interaction. The method can also be used to co-culture two (or more) different cell populations so as to elucidate the role of cell-cell or cell-ECM interactions in specifying spatial relationships between cells. Cell-cell cohesion and cell-ECM adhesion are the cornerstones of studies of embryonic development, tumor-stromal cell interaction in malignant invasion, wound healing, and for applications to tissue engineering. This simple method will provide a means of generating tissue-like cellular aggregates for measurement of

  15. [Culture of pancreatic progenitor cells in hanging drop and on floating filter].

    Science.gov (United States)

    Ma, Feng-xia; Chen, Fang; Chi, Ying; Yang, Shao-guang; Lu, Shi-hong; Han, Zhong-chao

    2013-06-01

    To construct a method to culture pancreatic progenitor cells in hanging drop and on floating filter,and to examine if pancreatic progenitor cells can differentiate into mature endocrine cells with this method. Murine embryos at day 12.5 were isolated and digested into single cells,which were then cultured in hanging drop for 24h and formed spheres.Spheres were cultured on the filter for 6 days,which floated in the dish containing medium.During culture,the expressions of pancreas duodenum homeobox-1(PDX-1)and neurogenin3(Ngn3)were determined.The expressions of endocrine and exocrine markers,insulin,glucagon,and carboxypeptidase(CPA)were determined on day 7 by immunohistochemistry.Insulin secretion of spheres stimulated by glucose was detected by ELISA.The changes of pancreatic marker expressions during culture were monitored by real-time polymerase chain reaction(PCR). One day after the culture,there were still a large amount of PDX-1 positive cells in pancreatic spheres,and these cells proliferated.On day 3,high expression of Ngn3 was detected,and the Ngn3-positive cells did not proliferate.On day 7,The expressions of endocrine and exocrine markers in the differentiated pancreatic progenitor cells were detected,which were consistent with that in vivo.Insulin was secreted by spheres upon the stimulation of glucose. In hanging drop and on floating filter,pancreatic progenitor cells can differentiate into mature endocrine cells.

  16. Establishing long-term cultures with self-renewing acute myeloid leukemia stem/progenitor cells

    NARCIS (Netherlands)

    van Gosliga, Djoke; Schepers, Hein; Rizo, Aleksandra; van der Kolk, Dorina; Vellenga, Edo; Schuringa, Jan Jacob

    2007-01-01

    Objective. With the emergence of the concept of the leukemia stem cell, assays to study them remain pivotal in understanding (leukemic) stem cell biology. Methods. We have cultured acute myeloid leukemia CD34(+) cells on bone marrow stroma. Long-term expansion was monitored and self-renewal was

  17. Long-term maintenance of human induced pluripotent stem cells by automated cell culture system.

    Science.gov (United States)

    Konagaya, Shuhei; Ando, Takeshi; Yamauchi, Toshiaki; Suemori, Hirofumi; Iwata, Hiroo

    2015-11-17

    Pluripotent stem cells, such as embryonic stem cells and induced pluripotent stem (iPS) cells, are regarded as new sources for cell replacement therapy. These cells can unlimitedly expand under undifferentiated conditions and be differentiated into multiple cell types. Automated culture systems enable the large-scale production of cells. In addition to reducing the time and effort of researchers, an automated culture system improves the reproducibility of cell cultures. In the present study, we newly designed a fully automated cell culture system for human iPS maintenance. Using an automated culture system, hiPS cells maintained their undifferentiated state for 60 days. Automatically prepared hiPS cells had a potency of differentiation into three germ layer cells including dopaminergic neurons and pancreatic cells.

  18. The impact of cell culture equipment on energy loss.

    Science.gov (United States)

    Davies, Lleucu B; Kiernan, Michael N; Bishop, Joanna C; Thornton, Catherine A; Morgan, Gareth

    2014-01-01

    Light energy of discrete wavelengths supplied via lasers and broadband intense pulsed light have been used therapeutically for many years. In vitro models complement clinical studies, especially for the elucidation of underlying mechanisms of action. Clarification that light energy reaches the cells is necessary when developing protocols for the treatment of cells using in vitro models. Few studies report on energy loss in cell culture equipment. The ability of energy from light with therapeutic potential to reach cells in culture needs to be determined; this includes determining the proportion of light energy lost within standard cell culture media and cell culture vessels. The energy absorption of cell culture media, with/without the pH indicator dye phenol red, and the loss of energy within different plastics and glassware used typically for in vitro cell culture were investigated using intense pulsed light and a yellow pulsed dye laser. Media containing phenol red have a distinctive absorption peak (560 nm) absent in phenol red-free media and restored by the addition of phenol red. For both light sources, energy loss was lowest in standard polystyrene tissue culture flasks or multi-well plates and highest in polypropylene vessels or glass tubes. The effects of phenol red-free media on the absorption of energy varied with the light source used. Phenol red-free media are the media of choice; polystyrene vessels with flat surfaces such as culture flasks or multi-well plates should be used in preference to polypropylene or glass vessels.

  19. The awareness of employees in safety culture through the improved nuclear safety culture evaluation method

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub [KHNP Central Research Institute, Daejeon (Korea, Republic of)

    2012-10-15

    After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology.

  20. The awareness of employees in safety culture through the improved nuclear safety culture evaluation method

    International Nuclear Information System (INIS)

    Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub

    2012-01-01

    After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology

  1. Explaining the Effectiveness of the Contrast Culture Method for Managing Interpersonal Interactions across Cultures

    Science.gov (United States)

    Hiratsuka, Hiroyoshi; Suzuki, Hanako; Pusina, Alexis

    2016-01-01

    One of the current challenges in the field of intercultural education comes from the limited availability of training efficacy studies. The present study focused on explaining the effectiveness of the Contrast Culture Method (CCM) as an intercultural education method for managing interpersonal interactions across cultures between graduate…

  2. Simple suspension culture system of human iPS cells maintaining their pluripotency for cardiac cell sheet engineering.

    Science.gov (United States)

    Haraguchi, Yuji; Matsuura, Katsuhisa; Shimizu, Tatsuya; Yamato, Masayuki; Okano, Teruo

    2015-12-01

    In this study, a simple three-dimensional (3D) suspension culture method for the expansion and cardiac differentiation of human induced pluripotent stem cells (hiPSCs) is reported. The culture methods were easily adapted from two-dimensional (2D) to 3D culture without any additional manipulations. When hiPSCs were directly applied to 3D culture from 2D in a single-cell suspension, only a few aggregated cells were observed. However, after 3 days, culture of the small hiPSC aggregates in a spinner flask at the optimal agitation rate created aggregates which were capable of cell passages from the single-cell suspension. Cell numbers increased to approximately 10-fold after 12 days of culture. The undifferentiated state of expanded hiPSCs was confirmed by flow cytometry, immunocytochemistry and quantitative RT-PCR, and the hiPSCs differentiated into three germ layers. When the hiPSCs were subsequently cultured in a flask using cardiac differentiation medium, expression of cardiac cell-specific genes and beating cardiomyocytes were observed. Furthermore, the culture of hiPSCs on Matrigel-coated dishes with serum-free medium containing activin A, BMP4 and FGF-2 enabled it to generate robust spontaneous beating cardiomyocytes and these cells expressed several cardiac cell-related genes, including HCN4, MLC-2a and MLC-2v. This suggests that the expanded hiPSCs might maintain the potential to differentiate into several types of cardiomyocytes, including pacemakers. Moreover, when cardiac cell sheets were fabricated using differentiated cardiomyocytes, they beat spontaneously and synchronously, indicating electrically communicative tissue. This simple culture system might enable the generation of sufficient amounts of beating cardiomyocytes for use in cardiac regenerative medicine and tissue engineering. Copyright © 2013 John Wiley & Sons, Ltd.

  3. Discarded human fetal tissue and cell cultures for transplantation research

    International Nuclear Information System (INIS)

    Hay, R.J.; Phillips, T.; Thompson, A.; Vilner, L.; Cleland, M.; Tchaw-ren Chen; Zabrenetzky, V.

    1999-01-01

    A feasibility study has been performed to explore the utility of various tissues from discarded human abortuses for transplantation and related research. Specifically, aborted fetuses plus parental blood samples and all relevant clinical data were obtained through a local hospital complex. Whenever possible, pancreas, skin and skeletal muscle, heart, liver, kidney, cartilage and lung tissues were removed, dissociated and subfractionated for cryopreservation, characterization and cultivation trials in vitro. Existing protocols for these manipulations were compared and improved upon as required. Clonal culture, cell aggregate maintenance techniques and use of feeder cell populations have been utilized where appropriate to develop quantitative comparative data. Histological and biochemical assays were applied both to evaluate separation/cultivation methods and to identify optimal culture conditions for maintaining functional cells. Immunochemical and molecular biological procedures were applied to study expression of Major Histocompatibility Vomplex (MHC) class 1 and 11 molecules on cell lines derived. Tissue and cell culture populations were examined for infections with bacteria, ftingi, mycoplasma, HIV, CMV, hepatitis B and other viruses. Only 1% of the abortuses tested were virally infected. Cytogenetic analyses confin-ned the normal diploid status in the vast majority (>98%) of lines tested. A total of over 250 abortuses have been obtained and processed. Only 25 were found to be contaminated with bacteria or fungi and unsuitable for further cultivation trials. A total of over 200 cell populations were isolated, characterized and cryopreserved for further study. Included were kidney, lung, liver and epidermal epithelia: cartilage-derived cells from the spine and epiphyses plus myogenic myoblasts. Selected lines have been immortalized using HPV I 6E6/E7 sequences. Epithelia from the liver and pancreas and cardiac myocytes were the most problematic in that initial

  4. Primary culture of human Schwann and schwannoma cells: improved and simplified protocol.

    Science.gov (United States)

    Dilwali, Sonam; Patel, Pratik B; Roberts, Daniel S; Basinsky, Gina M; Harris, Gordon J; Emerick, Kevin S; Stankovic, Konstantina M

    2014-09-01

    Primary culture of human Schwann cells (SCs) and vestibular schwannoma (VS) cells are invaluable tools to investigate SC physiology and VS pathobiology, and to devise effective pharmacotherapies against VS, which are sorely needed. However, existing culture protocols, in aiming to create robust, pure cultures, employ methods that can lead to loss of biological characteristics of the original cells, potentially resulting in misleading biological findings. We have developed a minimally manipulative method to culture primary human SC and VS cells, without the use of selective mitogens, toxins, or time-consuming and potentially transformative laboratory techniques. Schwann cell purity was quantified longitudinally using S100 staining in SC cultures derived from the great auricular nerve and VS cultures followed for 7 and 12 weeks, respectively. SC cultures retained approximately ≥85% purity for 2 weeks. VS cultures retained approximately ≥80% purity for the majority of the span of 12 weeks, with maximal purity of 87% at 2 weeks. The VS cultures showed high level of biological similarity (68% on average) to their respective parent tumors, as assessed using a protein array featuring 41 growth factors and receptors. Apoptosis rate in vitro negatively correlated with tumor volume. Our results, obtained using a faster, simplified culturing method than previously utilized, indicate that highly pure, primary human SC and VS cultures can be established with minimal manipulation, reaching maximal purity at 2 weeks of culture. The VS cultures recapitulate the parent tumors' biology to a great degree, making them relevant models to investigate VS pathobiology. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Elimination of remaining undifferentiated induced pluripotent stem cells in the process of human cardiac cell sheet fabrication using a methionine-free culture condition.

    Science.gov (United States)

    Matsuura, Katsuhisa; Kodama, Fumiko; Sugiyama, Kasumi; Shimizu, Tatsuya; Hagiwara, Nobuhisa; Okano, Teruo

    2015-03-01

    Cardiac tissue engineering is a promising method for regenerative medicine. Although we have developed human cardiac cell sheets by integration of cell sheet-based tissue engineering and scalable bioreactor culture, the risk of contamination by induced pluripotent stem (iPS) cells in cardiac cell sheets remains unresolved. In the present study, we established a novel culture method to fabricate human cardiac cell sheets with a decreased risk of iPS cell contamination while maintaining viabilities of iPS cell-derived cells, including cardiomyocytes and fibroblasts, using a methionine-free culture condition. When cultured in the methionine-free condition, human iPS cells did not survive without feeder cells and could not proliferate or form colonies on feeder cells or in coculture with cells for cardiac cell sheet fabrication. When iPS cell-derived cells after the cardiac differentiation were transiently cultured in the methionine-free condition, gene expression of OCT3/4 and NANOG was downregulated significantly compared with that in the standard culture condition. Furthermore, in fabricated cardiac cell sheets, spontaneous and synchronous beating was observed in the whole area while maintaining or upregulating the expression of various cardiac and extracellular matrix genes. These findings suggest that human iPS cells are methionine dependent and a methionine-free culture condition for cardiac cell sheet fabrication might reduce the risk of iPS cell contamination.

  6. Biona-C Cell Culture pH Monitoring System

    Science.gov (United States)

    Friedericks, C.

    1999-01-01

    Sensors 2000! is developing a system to demonstrate the ability to perform accurate, real-time measurements of pH and CO2 in a cell culture media in Space. The BIONA-C Cell Culture pH Monitoring System consists of S2K! developed ion selective sensors and control electronics integrated with the fluidics of a cell culture system. The integrated system comprises a "rail" in the Cell Culture Module (CCM) of WRAIR (Space Biosciences of Walter Read Army Institute of Research). The CCM is a Space Shuttle mid-deck locker experiment payload. The BIONA-C is displayed along with associated graphics and text explanations. The presentation will stimulate interest in development of sensor technology for real-time cell culture measurements. The transfer of this technology to other applications will also be of interest. Additional information is contained in the original document.

  7. Sequential cancer mutations in cultured human intestinal stem cells

    NARCIS (Netherlands)

    Drost, Jarno; van Jaarsveld, Richard H.; Ponsioen, Bas; Zimberlin, Cheryl; van Boxtel, Ruben; Buijs, Arjan; Sachs, Norman; Overmeer, René M.; Offerhaus, G. Johan; Begthel, Harry; Korving, Jeroen; van de Wetering, Marc; Schwank, Gerald; Logtenberg, Meike; Cuppen, Edwin; Snippert, Hugo J.; Medema, Jan Paul; Kops, Geert J. P. L.; Clevers, Hans

    2015-01-01

    Crypt stem cells represent the cells of origin for intestinal neoplasia. Both mouse and human intestinal stem cells can be cultured in medium containing the stem-cell-niche factors WNT, R-spondin, epidermal growth factor (EGF) and noggin over long time periods as epithelial organoids that remain

  8. PECULIARITIES OF SECONDARY METABOLITES BIOSYNTHESIS IN PLANT CELL CULTURES

    Directory of Open Access Journals (Sweden)

    A.M. NOSOV

    2014-06-01

    Full Text Available metabolites formation in plant cell cultures of Panax spp., (ginsenosides; Dioscorea deltoidea (steroid glycosides; Ajuga reptans, Serratula coronata, Rhaponticum carthamoides (ecdisteroids; Polyscias spp., (triterpene glycosides, Taxus spp. (taxoids, Stevia rebaudiana (diterpene steviol-glycosides, Stephania glabra (alkaloids. They are some regular trends of secondary metabolites synthesis in the plant cell culture:It can be noted the stable synthesis of the compound promoting cell proliferation. Indeed, cell cultures of Dioscorea deltoidea were demonstrated to accumulate only furostanol glycosides, which promoted cell division. Furostanol glycoside content of Dioscorea strain DM-0.5 was up to 6 - 12% by dry biomass.Panax ginseng and P. japonicus plant cell cultures synthesize as minimum seven triterpene glycosides (ginsenosides, the productivity of these compounds was up to 6.0 - 8.0% on dry biomass.By contrast, the detectable synthesis of diterpene steviol-glycosides in cultivated cells of Stevia rebaudiana initiated in the mixotrophic cultures during chloroplast formation only.Despite these differences, or mainly due to them, plant cell cultures have become an attractive source of phytochemicals in alternative to collecting wild plants. It provides a guideline to bioreactor-based production of isoprenoids using undifferentiated plant cell cultures

  9. Evaluation of hollow fiber culture for large-scale production of mouse embryonic stem cell-derived hematopoietic stem cells.

    Science.gov (United States)

    Nakano, Yu; Iwanaga, Shinya; Mizumoto, Hiroshi; Kajiwara, Toshihisa

    2018-03-03

    Hematopoietic stem cells (HSCs) have the ability to differentiate into all types of blood cells and can be transplanted to treat blood disorders. However, it is difficult to obtain HSCs in large quantities because of the shortage of donors. Recent efforts have focused on acquiring HSCs by differentiation of pluripotent stem cells. As a conventional differentiation method of pluripotent stem cells, the formation of embryoid bodies (EBs) is often employed. However, the size of EBs is limited by depletion of oxygen and nutrients, which prevents them from being efficient for the production of HSCs. In this study, we developed a large-scale hematopoietic differentiation approach for mouse embryonic stem (ES) cells by applying a hollow fiber (HF)/organoid culture method. Cylindrical organoids, which had the potential for further spontaneous differentiation, were established inside of hollow fibers. Using this method, we improved the proliferation rate of mouse ES cells to produce an increased HSC population and achieved around a 40-fold higher production volume of HSCs in HF culture than in conventional EB culture. Therefore, the HF/organoid culture method may be a new mass culture method to acquire pluripotent stem cell-derived HSCs.

  10. Suspension culture combined with chemotherapeutic agents for sorting of breast cancer stem cells

    International Nuclear Information System (INIS)

    Li, Hai-zhi; Yi, Tong-bo; Wu, Zheng-yan

    2008-01-01

    Cancer stem cell (CSC) hypothesis has not been well demonstrated by the lack of the most convincing evidence concerning a single cell capable of giving rise to a tumor. The scarcity in quantity and improper approaches for isolation and purification of CSCs have become the major obstacles for great development in CSCs. Here we adopted suspension culture combined with anticancer regimens as a strategy for screening breast cancer stem cells (BrCSCs). BrCSCs could survive and be highly enriched in non-adherent suspension culture while chemotherapeutic agents could destroy most rapidly dividing cancer cells and spare relatively quiescent BrCSCs. TM40D murine breast cancer cells were cultured in serum-free medium. The expression of CD44 + CD24 - was measured by flow cytometry. Cells of passage 10 were treated in combination with anticancer agents pacilitaxel and epirubicin at different peak plasma concentrations for 24 hours, and then maintained under suspension culture. The rate of apoptosis was examined by flow cytometry with Annexin-V fluorescein isothiocyanate (FITC)/propidium iodide (PI) double staining method. Selected cells in different amounts were injected subcutaneously into BALB/C mice to observe tumor formation. Cells of passage 10 in suspension culture had the highest percentage of CD44 + CD24 - (about 77 percent). A single tumor cell in 0.35 PPC could generate tumors in 3 of 20 BALB/C mice. Suspension culture combined with anticancer regimens provides an effective means of isolating, culturing and purifying BrCSCs

  11. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  12. Morphological and Immunohistochemical Characterization of Canine Osteosarcoma Spheroid Cell Cultures.

    Science.gov (United States)

    Gebhard, C; Gabriel, C; Walter, I

    2016-06-01

    Spheroid cell culture emerges as powerful in vitro tool for experimental tumour research. In this study, we established a scaffold-free three-dimensional spheroid system built from canine osteosarcoma (OS) cells (D17). Spheroids (7, 14 and 19 days of cultivation) and monolayer cultures (2 and 7 days of cultivation) were evaluated and compared on light and electron microscopy. Monolayer and spheroid cultures were tested for vimentin, cytokeratin, alkaline phosphatase, osteocalcin and collagen I by means of immunohistochemistry. The spheroid cell culture exhibited a distinct network of collagen I in particular after 19-day cultivation, whereas in monolayer cultures, collagen I was arranged as a lamellar basal structure. Necrotic centres of large spheroids, as observed in 14- and 19-day cultures, were characterized by significant amounts of osteocalcin. Proliferative activity as determined by Ki-67 immunoreactivity showed an even distribution in two-dimensional cultures. In spheroids, proliferation was predominating in the peripheral areas. Metastasis-associated markers ezrin and S100A4 were shown to be continuously expressed in monolayer and spheroid cultures. We conclude that the scaffold-free spheroid system from canine OS cells has the ability to mimic the architecture of the in vivo tumour, in particular cell-cell and cell-matrix interactions. © 2015 The Authors. Anatomia, Histologia, Embryologia Published by Blackwell Verlag GmbH.

  13. Surface-engineered substrates for improved human pluripotent stem cell culture under fully defined conditions.

    Science.gov (United States)

    Saha, Krishanu; Mei, Ying; Reisterer, Colin M; Pyzocha, Neena Kenton; Yang, Jing; Muffat, Julien; Davies, Martyn C; Alexander, Morgan R; Langer, Robert; Anderson, Daniel G; Jaenisch, Rudolf

    2011-11-15

    The current gold standard for the culture of human pluripotent stem cells requires the use of a feeder layer of cells. Here, we develop a spatially defined culture system based on UV/ozone radiation modification of typical cell culture plastics to define a favorable surface environment for human pluripotent stem cell culture. Chemical and geometrical optimization of the surfaces enables control of early cell aggregation from fully dissociated cells, as predicted from a numerical model of cell migration, and results in significant increases in cell growth of undifferentiated cells. These chemically defined xeno-free substrates generate more than three times the number of cells than feeder-containing substrates per surface area. Further, reprogramming and typical gene-targeting protocols can be readily performed on these engineered surfaces. These substrates provide an attractive cell culture platform for the production of clinically relevant factor-free reprogrammed cells from patient tissue samples and facilitate the definition of standardized scale-up friendly methods for disease modeling and cell therapeutic applications.

  14. Self-assembling Fmoc dipeptide hydrogel for in situ 3D cell culturing

    Directory of Open Access Journals (Sweden)

    Akpe Victor

    2007-12-01

    Full Text Available Abstract Background Conventional cell culture studies have been performed on 2D surfaces, resulting in flat, extended cell growth. More relevant studies are desired to better mimic 3D in vivo tissue growth. Such realistic environments should be the aim of any cell growth study, requiring new methods for culturing cells in vitro. Cell biology is also tending toward miniaturization for increased efficiency and specificity. This paper discusses the application of a self-assembling peptide-derived hydrogel for use as a 3D cell culture scaffold at the microscale. Results Phenylalanine derivative hydrogel formation was seen to occur in multiple dispersion media. Cells were immobilized in situ within microchambers designed for cell analysis. Use of the highly biocompatible hydrogel components and simplistic procedures significantly reduced the cytotoxic effects seen with alternate 3D culture materials and microstructure loading methods. Cells were easily immobilized, sustained and removed from microchambers. Differences in growth morphology were seen in the cultured cells, owing to the 3-dimentional character of the gel structure. Degradation improved the removal of hydrogel from the microstructures, permitting reuse of the analysis platforms. Conclusion Self-assembling diphenylalanine derivative hydrogel provided a method to dramatically reduce the typical difficulties of microculture formation. Effective generation of patterned 3D cultures will lead to improved cell study results by better modeling in vivo growth environments and increasing efficiency and specificity of cell studies. Use of simplified growth scaffolds such as peptide-derived hydrogel should be seen as highly advantageous and will likely become more commonplace in cell culture methodology.

  15. Assessment of long-term effects of nanoparticles in a microcarrier cell culture system.

    Directory of Open Access Journals (Sweden)

    Maria Mrakovcic

    Full Text Available Nano-sized materials could find multiple applications in medical diagnosis and therapy. One main concern is that engineered nanoparticles, similar to combustion-derived nanoparticles, may cause adverse effects on human health by accumulation of entire particles or their degradation products. Chronic cytotoxicity must therefore be evaluated. In order to perform chronic cytotoxicity testing of plain polystyrene nanoparticles on the endothelial cell line EAhy 926, we established a microcarrier cell culture system for anchorage-dependent cells (BioLevitator(TM. Cells were cultured for four weeks and exposed to doses, which were not cytotoxic upon 24 hours of exposure. For comparison, these particles were also studied in regularly sub-cultured cells, a method that has traditionally been used to assess chronic cellular effects. Culturing on basal membrane coated microcarriers produced very high cell densities. Fluorescent particles were mainly localized in the lysosomes of the exposed cells. After four weeks of exposure, the number of cells exposed to 20 nm polystyrene particles decreased by 60% as compared to untreated controls. When tested in sub-cultured cells, the same particles decreased cell numbers to 80% of the untreated controls. Dose-dependent decreases in cell numbers were also noted after exposure of microcarrier cultured cells to 50 nm short multi-walled carbon nanotubes. Our findings support that necrosis, but not apoptosis, contributed to cell death of the exposed cells in the microcarrier culture system. In conclusion, the established microcarrier model appears to be more sensitive for the identification of cellular effects upon prolonged and repeated exposure to nanoparticles than traditional sub-culturing.

  16. Inhibition of apoptosis using exosomes in Chinese hamster ovary cell culture.

    Science.gov (United States)

    Han, Seora; Rhee, Won Jong

    2018-05-01

    Animal cell culture technology for therapeutic protein production has shown significant improvement over the last few decades. Chinese hamster ovary (CHO) cells have been widely adapted for the production of biopharmaceutical drugs. In the biopharmaceutical industry, it is crucial to develop cell culture media and culturing conditions to achieve the highest productivity and quality. However, CHO cells are significantly affected by apoptosis in the bioreactors, resulting in a substantial decrease in product quantity and quality. Thus, to overcome the obstacle of apoptosis in CHO cell culture, it is critical to develop a novel method that does not have minimal concern of safety or cost. Herein, we showed for the first time that exosomes, which are nano-sized extracellular vesicles, derived from CHO cells inhibited apoptosis in CHO cell culture when supplemented to the culture medium. Flow cytometric and microscopic analyses revealed that substantial amounts of exosomes were delivered to CHO cells. Higher cell viability after staurosporine treatment was observed by exosome supplementation (67.3%) as compared to control (41.1%). Furthermore, exosomes prevented the mitochondrial membrane potential loss and caspase-3 activation, meaning that the exosomes enhanced cellular activities under pro-apoptotic condition. As the exosomes supplements are derived from CHO cells themselves, it is not only beneficial for the biopharmaceutical productivity of CHO cell culture to inhibit apoptosis, but also from a regulatory standpoint to diminish any safety concerns. Thus, we conclude that the method developed in this research may contribute to the biopharmaceutical industry where minimizing apoptosis in CHO cell culture is beneficial. © 2018 Wiley Periodicals, Inc.

  17. Morphology of primary human venous endothelial cell cultures before and after culture medium exchange.

    Science.gov (United States)

    Krüger-Genge, A; Fuhrmann, R; Jung, F; Franke, R P

    2015-01-01

    The evaluation of the interaction of human, venous endothelial cells (HUVEC) with body foreign materials on the cellular level cannot be performed in vivo, but is investigated in vitro under standard culture conditions. To maintain the vitality, proliferation and morphology of HUVEC seeded on body foreign substrates over days, the cell culture medium is usually exchanged every second day. It is well known, that alterations in the microenvironment of cells bear the risk of influencing cell morphology and function. In the current study the influence of cell culture medium exchange on HUVEC cytoskeletal microfilament structure and function was investigated. HUVEC in the third passage were seeded on extracellular matrix (ECM) - which was secreted from bovine corneal endothelial cells on glass- until functional confluence was reached. The experiment started 11 days after HUVEC seeding with an exchange of the cell culture medium followed by a staining of the actin microfilaments with phalloidin-rhodamin 1.5 and 5 minutes after medium exchange. The microfilaments were documented by use of an Olympus microscope (IMT-2) equipped with a UV lamp and online connected to a TV chain (Sony XC 50 ST/monochrome) implying an OPTIMAS - Image analysis system. Prostacyclin was analysed in the cell culture supernatant. 1.5 min after culture medium exchange in the functionally confluent cultures a slight disturbance of the actin microfilament structure with a broadening of the marginal filament band, a partial disconnection of cell-cell contacts and the appearance of intercellular fenestrations were observed. 5 minutes after medium exchange a redevelopment of the slightly disturbed microfilament structure with a condensation and narrowing of the marginal filament band was seen. 12 h later a further consolidation of the microfilament structure occurred. In addition, a perturbation of the cultured HUVEC occurred after cell culture medium exchange. The prostacyclin concentration in the

  18. Examining the sources of variability in cell culture media used for biopharmaceutical production.

    Science.gov (United States)

    McGillicuddy, Nicola; Floris, Patrick; Albrecht, Simone; Bones, Jonathan

    2018-01-01

    Raw materials, in particular cell culture media, represent a significant source of variability to biopharmaceutical manufacturing processes that can detrimentally affect cellular growth, viability and specific productivity or alter the quality profile of the expressed therapeutic protein. The continual expansion of the biopharmaceutical industry is creating an increasing demand on the production and supply chain consistency for cell culture media, especially as companies embrace intensive continuous processing. Here, we provide a historical perspective regarding the transition from serum containing to serum-free media, the development of chemically-defined cell culture media for biopharmaceutical production using industrial scale bioprocesses and review production mechanisms for liquid and powder culture media. An overview and critique of analytical approaches used for the characterisation of cell culture media and the identification of root causes of variability are also provided, including in-depth liquid phase separations, mass spectrometry and spectroscopic methods.

  19. Radiosensitivity of primary cultured fish cells with different ploidy

    International Nuclear Information System (INIS)

    Mitani, Hiroshi; Egami, Nobuo; Kobayashi, Hiromu.

    1986-01-01

    The radiosensitivity of primary cultured goldfish cells (Carassius auratus) was investigated by colony formation assay. The radiosensitivity of cells from two varieties of goldfish, which show different sensitivity to lethal effect of ionizing radiation in vivo, was almost identical. Primary cultured cells from diploid, triploid and tetraploid fish retained their DNA content as measured by microfluorometry, and the nuclear size increases as ploidy increases. However, radiosensitivity was not related to ploidy. (author)

  20. Whole-cell Escherichia coli lactate biosensor for monitoring mammalian cell cultures during biopharmaceutical production.

    Science.gov (United States)

    Goers, Lisa; Ainsworth, Catherine; Goey, Cher Hui; Kontoravdi, Cleo; Freemont, Paul S; Polizzi, Karen M

    2017-06-01

    Many high-value added recombinant proteins, such as therapeutic glycoproteins, are produced using mammalian cell cultures. In order to optimize the productivity of these cultures it is important to monitor cellular metabolism, for example the utilization of nutrients and the accumulation of metabolic waste products. One metabolic waste product of interest is lactic acid (lactate), overaccumulation of which can decrease cellular growth and protein production. Current methods for the detection of lactate are limited in terms of cost, sensitivity, and robustness. Therefore, we developed a whole-cell Escherichia coli lactate biosensor based on the lldPRD operon and successfully used it to monitor lactate concentration in mammalian cell cultures. Using real samples and analytical validation we demonstrate that our biosensor can be used for absolute quantification of metabolites in complex samples with high accuracy, sensitivity, and robustness. Importantly, our whole-cell biosensor was able to detect lactate at concentrations more than two orders of magnitude lower than the industry standard method, making it useful for monitoring lactate concentrations in early phase culture. Given the importance of lactate in a variety of both industrial and clinical contexts we anticipate that our whole-cell biosensor can be used to address a range of interesting biological questions. It also serves as a blueprint for how to capitalize on the wealth of genetic operons for metabolite sensing available in nature for the development of other whole-cell biosensors. Biotechnol. Bioeng. 2017;114: 1290-1300. © 2017 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. © 2017 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.

  1. Whole‐cell Escherichia coli lactate biosensor for monitoring mammalian cell cultures during biopharmaceutical production

    Science.gov (United States)

    Goers, Lisa; Ainsworth, Catherine; Goey, Cher Hui; Kontoravdi, Cleo; Freemont, Paul S.

    2017-01-01

    ABSTRACT Many high‐value added recombinant proteins, such as therapeutic glycoproteins, are produced using mammalian cell cultures. In order to optimize the productivity of these cultures it is important to monitor cellular metabolism, for example the utilization of nutrients and the accumulation of metabolic waste products. One metabolic waste product of interest is lactic acid (lactate), overaccumulation of which can decrease cellular growth and protein production. Current methods for the detection of lactate are limited in terms of cost, sensitivity, and robustness. Therefore, we developed a whole‐cell Escherichia coli lactate biosensor based on the lldPRD operon and successfully used it to monitor lactate concentration in mammalian cell cultures. Using real samples and analytical validation we demonstrate that our biosensor can be used for absolute quantification of metabolites in complex samples with high accuracy, sensitivity, and robustness. Importantly, our whole‐cell biosensor was able to detect lactate at concentrations more than two orders of magnitude lower than the industry standard method, making it useful for monitoring lactate concentrations in early phase culture. Given the importance of lactate in a variety of both industrial and clinical contexts we anticipate that our whole‐cell biosensor can be used to address a range of interesting biological questions. It also serves as a blueprint for how to capitalize on the wealth of genetic operons for metabolite sensing available in nature for the development of other whole‐cell biosensors. Biotechnol. Bioeng. 2017;114: 1290–1300. © 2017 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:28112405

  2. Local cell metrics: a novel method for analysis of cell-cell interactions

    Directory of Open Access Journals (Sweden)

    Chen Chien-Chiang

    2009-10-01

    Full Text Available Abstract Background The regulation of many cell functions is inherently linked to cell-cell contact interactions. However, effects of contact interactions among adherent cells can be difficult to detect with global summary statistics due to the localized nature and noise inherent to cell-cell interactions. The lack of informatics approaches specific for detecting cell-cell interactions is a limitation in the analysis of large sets of cell image data, including traditional and combinatorial or high-throughput studies. Here we introduce a novel histogram-based data analysis strategy, termed local cell metrics (LCMs, which addresses this shortcoming. Results The new LCM method is demonstrated via a study of contact inhibition of proliferation of MC3T3-E1 osteoblasts. We describe how LCMs can be used to quantify the local environment of cells and how LCMs are decomposed mathematically into metrics specific to each cell type in a culture, e.g., differently-labelled cells in fluorescence imaging. Using this approach, a quantitative, probabilistic description of the contact inhibition effects in MC3T3-E1 cultures has been achieved. We also show how LCMs are related to the naïve Bayes model. Namely, LCMs are Bayes class-conditional probability functions, suggesting their use for data mining and classification. Conclusion LCMs are successful in robust detection of cell contact inhibition in situations where conventional global statistics fail to do so. The noise due to the random features of cell behavior was suppressed significantly as a result of the focus on local distances, providing sensitive detection of cell-cell contact effects. The methodology can be extended to any quantifiable feature that can be obtained from imaging of cell cultures or tissue samples, including optical, fluorescent, and confocal microscopy. This approach may prove useful in interpreting culture and histological data in fields where cell-cell interactions play a critical

  3. Feeding Frequency Affects Cultured Rat Pituitary Cells in Low Gravity

    Science.gov (United States)

    Hymer, W. C.; Grindeland, R. E.; Salada, T.; Cenci, R.; Krishnan, K.; Mukai, C.; Nagaoka, S.

    1996-01-01

    In this report, we describe the results of a rat pituitary cell culture experiment done on STS-65 in which the effect of cell feeding on the release of the six anterior pituitary hormones was studied. We found complex microgravity related interactions between the frequency of cell feeding and the quantity and quality (i.e. biological activity) of some of the six hormones released in flight. Analyses of growth hormone (GH) released from cells into culture media on different mission days using gel filtration and ion exchange chromatography yielded qualitatively similar results between ground and flight samples. Lack of cell feeding resulted in extensive cell clumping in flight (but not ground) cultures. Vigorous fibroblast growth occurred in both ground and flight cultures fed 4 times. These results are interpreted within the context of autocrine and or paracrine feedback interactions. Finally the payload specialist successfully prepared a fresh trypsin solution in microgravity, detached the cells from their surface and reinserted them back into the culture chamber. These cells reattached and continued to release hormone in microgravity. In summary, this experiment shows that pituitary cells are microgravity sensitive and that coupled operations routinely associated with laboratory cel1 culture can also be accomplished in low gravity.

  4. Radiation adaptive response for the growth of cultured glial cells

    International Nuclear Information System (INIS)

    Suzuki, S.; Miura, Y.; Kano, M.; Toda, T.; Urano, S.

    2003-01-01

    Full text: To examine the molecular mechanism of radiation adaptive response (RAR) for the growth of cultured glial cells and to investigate the influence of aging on the response, glial cells were cultured from young and aged rats (1 month and 24 months old). RAR for the growth of glial cells conditioned with a low dose of X-rays and subsequently exposed to a high dose of X-rays was examined for cell number and BrdU incorporation. Involvement of the subcellular signaling pathway factors in RAR was investigated using their inhibitors, activators and mutated glial cells. RAR was observed in cells cultured from young rats, but was not in cells from aged rats. The inhibitors of protein kinase C (PKC) and DNA-dependent protein kinase (DNA-PK) or phosphatidylinositol 3-kinase (PI3K) suppressed RAR. The activators of PKC instead of low dose irradiation also caused RAR. Moreover, glial cells cultured from severe combined immunodeficiency (scid) mice (CB-17 scid) and ataxia-telangiectasia (AT) cells from AT patients showed no RAR. These results indicated that PKC, ATM, DNAPK and/or PI3K were involved in RAR for growth and BrdU incorporation of cultured glial cells and RAR decreased with aging. Proteomics data of glial cells exposed to severe stress of H 2 O 2 or X-rays also will be presented in the conference since little or no difference has not been observed with slight stress yet

  5. Preparation of labelled lipids by the use of plant cell cultures

    International Nuclear Information System (INIS)

    Mangold, H.K.

    1978-01-01

    The preparation of some radioacitvely labelled lipids by the use of plant cell cultures is discussed and further applications of the new method are suggested. Cell suspension cultures of rape (Brassica napus) and soya (Glycine max) have been used for the preparation of lipids labelled with radioisotopes. Radioactive acetic acid as well as various long-chain fatty acids are readily incorporated into the neutral and ionic lipids of plant cell cultures. In addition, 14 C-labelled glycerol, ethanolamine and choline are well utilized by the cells. Randomly labelled lipids have been obtained by incubating cell suspension cultures of rape and soya with [1- 14 C] acetic acid, and uniformly labelled lipids have been isolated from cultures that had been incubated with a mixture of [1- 14 C] acetic acid plus [2- 14 C] acetic acid. The use of techniques of plant cell cultures for the preparation of lipds labelled with stable or radioactive isotopesappears particularly rewarding because the uptake of precursors by the cells and their incorporation into various lipid compounds proceeds rapidly and often quanitatively.This new approach should be useful also for the biosynthesis of lipids whose acyl moieties contain a spn radical, a fluorescent group, or a light-sensitive label. Thus, plant cell cultures constitute valuable new tools for the biosynthetic preparation of a great variety of labelled lipids. (A.G.)

  6. An alternative method for Plasmodium culture synchronization.

    Science.gov (United States)

    Lelièvre, J; Berry, A; Benoit-Vical, F

    2005-03-01

    Since the synchronization of Plasmodium falciparum has become an essential tool in research, we have investigated the use of a commercial gelatine solution, Plasmion, to replace Plasmagel, which is now difficult to obtain. This method also avoids the use of techniques based on Percoll-glucose gradients. The Plasmion-based technique proved to be a good method and could become an alternative to Plasmagel.

  7. Real-time monitoring of specific oxygen uptake rates of embryonic stem cells in a microfluidic cell culture device.

    Science.gov (United States)

    Super, Alexandre; Jaccard, Nicolas; Cardoso Marques, Marco Paulo; Macown, Rhys Jarred; Griffin, Lewis Donald; Veraitch, Farlan Singh; Szita, Nicolas

    2016-09-01

    Oxygen plays a key role in stem cell biology as a signaling molecule and as an indicator of cell energy metabolism. Quantification of cellular oxygen kinetics, i.e. the determination of specific oxygen uptake rates (sOURs), is routinely used to understand metabolic shifts. However current methods to determine sOUR in adherent cell cultures rely on cell sampling, which impacts on cellular phenotype. We present real-time monitoring of cell growth from phase contrast microscopy images, and of respiration using optical sensors for dissolved oxygen. Time-course data for bulk and peri-cellular oxygen concentrations obtained for Chinese hamster ovary (CHO) and mouse embryonic stem cell (mESCs) cultures successfully demonstrated this non-invasive and label-free approach. Additionally, we confirmed non-invasive detection of cellular responses to rapidly changing culture conditions by exposing the cells to mitochondrial inhibiting and uncoupling agents. For the CHO and mESCs, sOUR values between 8 and 60 amol cell(-1) s(-1) , and 5 and 35 amol cell(-1) s(-1) were obtained, respectively. These values compare favorably with literature data. The capability to monitor oxygen tensions, cell growth, and sOUR, of adherent stem cell cultures, non-invasively and in real time, will be of significant benefit for future studies in stem cell biology and stem cell-based therapies. © 2016 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Controlling the diversity of cell populations in a stem cell culture

    NARCIS (Netherlands)

    Heo, Inha; Clevers, Hans

    2015-01-01

    Culturing intestinal stem cells into 3D organoids results in heterogeneous cell populations, reflecting the in vivo cell type diversity. In a recent paper published in Nature, Wang et al. established a culture condition for a highly homogeneous population of intestinal stem cells.

  9. Novel culturing platform for brain slices and neuronal cells

    DEFF Research Database (Denmark)

    Svendsen, Winnie Edith; Al Atraktchi, Fatima Al-Zahraa; Bakmand, Tanya

    2015-01-01

    In this paper we demonstrate a novel culturing system for brain slices and neuronal cells, which can control the concentration of nutrients and the waste removal from the culture by adjusting the fluid flow within the device. The entire system can be placed in an incubator. The system has been...... tested successfully with brain slices and PC12 cells. The culture substrate can be modified using metal electrodes and/or nanostructures for conducting electrical measurements while culturing and for better mimicking the in vivo conditions....

  10. A modified efficient method for dental pulp stem cell isolation.

    Science.gov (United States)

    Raoof, Maryam; Yaghoobi, Mohammad Mehdi; Derakhshani, Ali; Kamal-Abadi, Ali Mohammadi; Ebrahimi, Behnam; Abbasnejad, Mehdi; Shokouhinejad, Noushin

    2014-03-01

    Dental pulp stem cells can be used in regenerative endodontic therapy. The aim of this study was to introduce an efficient method for dental pulp stem cells isolation. In this in-vitro study, 60 extracted human third molars were split and pulp tissue was extracted. Dental pulp stem cells were isolated by the following three different methods: (1) digestion of pulp by collagenase/dispase enzyme and culture of the released cells; (2) outgrowth of the cells by culture of undigested pulp pieces; (3) digestion of pulp tissue pieces and fixing them. The cells were cultured in minimum essential medium alpha modification (αMEM) medium supplemented with 20% fetal bovine serum(FBS) in humid 37°C incubator with 5% CO 2. The markers of stem cells were studied by reverse transcriptase polymerase chain reaction (PCR). The student t-test was used for comparing the means of independent groups. P third method, we obtained stem cells successfully with about 60% efficiency after 2 days. The results of RT-PCR suggested the expression of Nanog, Oct-4, and Nucleostemin markers in the isolated cells from dental pulps. This study proposes a new method with high efficacy to obtain dental pulp stem cells in a short time.

  11. Stimulation and support of haemopoietic stem cell proliferation by irradiated stroma cell colonies in bone marrow cell culture in vitro

    International Nuclear Information System (INIS)

    Mori, K.J.; Izumi, Hiroko; Seto, Akira

    1981-01-01

    A culture system was established in which haemopoietic stem cells can undergo a recovery proliferation after a depletion of the stem cells, completely in vitro. To elucidate the source of the stimulatory factors, normal bone marrow cells were overlayed on top of the irradiated adherent 'stromal' cell colonies in the bone marrow cell culture. This stimulated the proliferation of haemopoietic stem cells in the cultured cells in suspension. The present results indicate that the stromal cells produce factors which stimulate stem cell proliferation. Whether the stimulation is evoked by direct cell-cell interactions or by humoral factors is as yet to be studied. (author)

  12. Fabrication of corneal epithelial cell sheets maintaining colony-forming cells without feeder cells by oxygen-controlled method.

    Science.gov (United States)

    Nakajima, Ryota; Takeda, Shizu

    2014-01-01

    The use of murine 3T3 feeder cells needs to be avoided when fabricating corneal epithelial cell sheets for use in treating ocular surface diseases. However, the expression level of the epithelial stem/progenitor cell marker, p63, is down-regulated in feeder-free culture systems. In this study, in order to fabricate corneal epithelial cell sheets that maintain colony-forming cells without using any feeder cells, we investigated the use of an oxygen-controlled method that was developed previously to fabricate cell sheets efficiently. Rabbit limbal epithelial cells were cultured under hypoxia (1-10% O2) and under normoxia during stratification after reaching confluence. Multilayered corneal epithelial cell sheets were fabricated using an oxygen-controlled method, and immunofluorescence analysis showed that cytokeratin 3 and p63 was expressed in appropriate localization in the cell sheets. The colony-forming efficiency of the cell sheets fabricated by the oxygen-controlled method without feeder cells was significantly higher than that of cell sheets fabricated under 20% O2 without feeder cells. These results indicate that the oxygen-controlled method has the potential to achieve a feeder-free culture system for fabricating corneal epithelial cell sheets for corneal regeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Growing Arabidopsis in vitro: cell suspensions, in vitro culture, and regeneration.

    Science.gov (United States)

    Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar

    2014-01-01

    An understanding of basic methods in Arabidopsis tissue culture is beneficial for any laboratory working on this model plant. Tissue culture refers to the aseptic growth of cells, organs, or plants in a controlled environment, in which physical, nutrient, and hormonal conditions can all be easily manipulated and monitored. The methodology facilitates the production of a large number of plants that are genetically identical over a relatively short growth period. Techniques, including callus production, cell suspension cultures, and plant regeneration, are all indispensable tools for the study of cellular biochemical and molecular processes. Plant regeneration is a key technology for successful stable plant transformation, while cell suspension cultures can be exploited for metabolite profiling and mining. In this chapter we report methods for the successful and highly efficient in vitro regeneration of plants and production of stable cell suspension lines from leaf explants of both Arabidopsis thaliana and Arabidopsis halleri.

  14. Quantitative volumetric Raman imaging of three dimensional cell cultures

    Science.gov (United States)

    Kallepitis, Charalambos; Bergholt, Mads S.; Mazo, Manuel M.; Leonardo, Vincent; Skaalure, Stacey C.; Maynard, Stephanie A.; Stevens, Molly M.

    2017-03-01

    The ability to simultaneously image multiple biomolecules in biologically relevant three-dimensional (3D) cell culture environments would contribute greatly to the understanding of complex cellular mechanisms and cell-material interactions. Here, we present a computational framework for label-free quantitative volumetric Raman imaging (qVRI). We apply qVRI to a selection of biological systems: human pluripotent stem cells with their cardiac derivatives, monocytes and monocyte-derived macrophages in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies and cytoskeletal structures in 3D with unprecedented biomolecular specificity for vibrational microspectroscopy.

  15. Cell-cycle research with synchronous cultures: an evaluation

    Science.gov (United States)

    Helmstetter, C. E.; Thornton, M.; Grover, N. B.

    2001-01-01

    The baby-machine system, which produces new-born Escherichia coli cells from cultures immobilized on a membrane, was developed many years ago in an attempt to attain optimal synchrony with minimal disturbance of steady-state growth. In the present article, we put forward a model to describe the behaviour of cells produced by this method, and provide quantitative evaluation of the parameters involved, at each of four different growth rates. Considering the high level of selection achievable with this technique and the natural dispersion in interdivision times, we believe that the output of the baby machine is probably close to optimal in terms of both quality and persistence of synchrony. We show that considerable information on events in the cell cycle can be obtained from populations with age distributions very much broader than those achieved with the baby machine and differing only modestly from steady state. The data presented here, together with the long and fruitful history of findings employing the baby-machine technique, suggest that minimisation of stress on cells is the single most important factor for successful cell-cycle analysis.

  16. Radiation induced damage to the lipid contents of bacteria and cultured mammalian cells

    International Nuclear Information System (INIS)

    Gholipour Khalili, K.

    1993-01-01

    In this study, exponentially growing phase of E. Coli. K12-N167 and cultured mouse leukemic L5178Y were used to study the effect of gamma irradiation on phospholipid contents. Following irradiation, both bacteria and cultured cells were incubated with either 14 C or 32 P labelled precursors for periods of cell division time. Phospholipid composition and their contents were detected in both the bacteria and cultured cells by using liquid scintillation counting and autoradiography methods. In contrast, as radiation dose increased, the Phospholipid contents were decreased in the both bacteria and cultured cells. It was concluded that the changes of phospholipid contents may result to altered activities of phospholipid pathway enzymes damaged by a radiation dose. The results of this investigation would be helpful in control of induced radiation damages in cell killings in radiation workers and radiation treatment of human cancer in the clinics. (author). 35 refs, 3 figs, 4 tabs

  17. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  18. Evaluation of safety of Hammada salicornica in cell culture

    Directory of Open Access Journals (Sweden)

    F. Hosseini Hamedani

    2017-11-01

    Full Text Available Background and objectives: A pharmaceutical products that is planned to be used in clinic, should not only have beneficial effects but also be safe too. Preclinical studies in animals are costly and need considering ethical issues. Cell culture can be used before animal tests. Considering useful effects of these methods, we have evaluated safety of total methanol extract of Hammada salicornica and its aqueous and petroleum ether fractions in cell culture.Methods: Total methanol extract was prepared with the standard method of maceration. Different fractions were prepared by liquid-liquid fractionation and the extracts were then dried with rotary evaporator. After determination of bactericidal concentration of the extracts, 400 ug/mL, the cytotoxicity was tested at various concentrations regarding the minimum antibacterial concentration by MTT test. Hep-2c and VERO cell lines were used in MTT test. A range of concentrations (10-500 ug/mL of the extracts were prepared and were added to about 70% confluent 96 well plates. After exposure for 48 h, MTT solution was added to the wells, and 4 h later formazan crystals were solubilized and optical densities were read at 570 nm. Results: Cytotoxicity Index was calculated and significance test was performed using t-test comparing the Index of the test and control group at each concentration. No significant difference was observed. Conclusion: Various fractions of H. salicornica were not cytotoxic at concentrations above bactericidal concentrations (up to 500 ug/mL. The results need to be confirmed in animal studies before using in human subjects.

  19. Myofibroblast androgen receptor expression determines cell survival in co-cultures of myofibroblasts and prostate cancer cells in vitro.

    Science.gov (United States)

    Palethorpe, Helen M; Leach, Damien A; Need, Eleanor F; Drew, Paul A; Smith, Eric

    2018-04-10

    Fibroblasts express androgen receptor (AR) in the normal prostate and during prostate cancer development. We have reported that loss of AR expression in prostate cancer-associated fibroblasts is a poor prognostic indicator. Here we report outcomes of direct and indirect co-cultures of immortalised AR-positive (PShTert-AR) or AR-negative (PShTert) myofibroblasts with prostate cancer cells. In the initial co-cultures the AR-negative PC3 cell line was used so AR expression and signalling were restricted to the myofibroblasts. In both direct and indirect co-culture with PShTert-AR myofibroblasts, paracrine signalling to the PC3 cells slowed proliferation and induced apoptosis. In contrast, PC3 cells proliferated with PShTert myofibroblasts irrespective of the co-culture method. In direct co-culture PC3 cells induced apoptosis in and destroyed PShTerts by direct signalling. Similar results were seen in direct co-cultures with AR-negative DU145 and AR-positive LNCaP and C4-2B prostate cancer cell lines. The AR ligand 5α-dihydrotestosterone (DHT) inhibited the proliferation of the PShTert-AR myofibroblasts, thereby reducing the extent of their inhibitory effect on cancer cell growth. These results suggest loss of stromal AR would favour prostate cancer cell growth in vivo , providing an explanation for the clinical observation that reduced stromal AR is associated with a poorer outcome.

  20. PDMS/glass microfluidic cell culture system for cytotoxicity tests and cells passage

    DEFF Research Database (Denmark)

    Ziolkowska, K.; Jedrych, E.; Kwapiszewski, R.

    2010-01-01

    In this paper, hybrid (PDMS/glass) microfluidic cell culture system (MCCS) integrated with the concentration gradient generator (CGG) is presented. PDMS gas permeability enabled cells' respiration in the fabricated microdevices and excellent glass hydrophilicity allowed successful cells' seeding...

  1. Application of cell co-culture system to study fat and muscle cells.

    Science.gov (United States)

    Pandurangan, Muthuraman; Hwang, Inho

    2014-09-01

    Animal cell culture is a highly complex process, in which cells are grown under specific conditions. The growth and development of these cells is a highly unnatural process in vitro condition. Cells are removed from animal tissues and artificially cultured in various culture vessels. Vitamins, minerals, and serum growth factors are supplied to maintain cell viability. Obtaining result homogeneity of in vitro and in vivo experiments is rare, because their structure and function are different. Living tissues have highly ordered complex architecture and are three-dimensional (3D) in structure. The interaction between adjacent cell types is quite distinct from the in vitro cell culture, which is usually two-dimensional (2D). Co-culture systems are studied to analyze the interactions between the two different cell types. The muscle and fat co-culture system is useful in addressing several questions related to muscle modeling, muscle degeneration, apoptosis, and muscle regeneration. Co-culture of C2C12 and 3T3-L1 cells could be a useful diagnostic tool to understand the muscle and fat formation in animals. Even though, co-culture systems have certain limitations, they provide a more realistic 3D view and information than the individual cell culture system. It is suggested that co-culture systems are useful in evaluating the intercellular communication and composition of two different cell types.

  2. Microfluidic bioreactors for culture of non-adherent cells

    DEFF Research Database (Denmark)

    Shah, Pranjul Jaykumar; Vedarethinam, Indumathi; Kwasny, Dorota

    2011-01-01

    Microfluidic bioreactors (μBR) are becoming increasingly popular for cell culture, sample preparation and analysis in case of routine genetic and clinical diagnostics. We present a novel μBR for non-adherent cells designed to mimic in vivo perfusion of cells based on diffusion of media through...

  3. Enhanced casein kinase II activity in human tumour cell cultures

    DEFF Research Database (Denmark)

    Prowald, K; Fischer, H; Issinger, O G

    1984-01-01

    Casein kinase II (CKII) activity is enhanced as much as 2-3 fold in established and 4-5-fold in transformed human cell lines when compared to that of fibroblasts and primary human tumour cell cultures where CKII activity never exceeded a basic level. The high activity of CKII in transformed cells...

  4. Suggestions on the Development of Safety Culture Assessment Method

    International Nuclear Information System (INIS)

    Choi, Young Sung; Choi, Kwang Sik; Kim, Woong Sik

    2006-01-01

    Several efforts have been made to assess safety culture of organization that operates nuclear power plants in Korea. The MOST and KINS played a major role to develop assessment methods and KHNP applied them to its NPPs. This paper explains the two methods developed by KINS briefly and presents the insights obtained from the two different applications. It concludes with some suggestions for safety culture assessment based on the insights

  5. Protein biosynthesis in cultured human hair follicle cells.

    Science.gov (United States)

    Weterings, P J; Vermorken, A J; Bloemendal, H

    1980-10-31

    A new technique has been used for culturing human keratinocytes. The cells grow on the basement membrane-like capsules of bovine lenses. Lens cells were removed from the capsules by rigid trypsinization. In order to exclude any contamination with remaining living cells the isolated capsules were irradiated with X-rays at a dose of 10,000 rad. In this way human epithelial cells can be brought in culture from individual hair follicles. Since feeder cells are not used in this culture technique, the biosynthesis of keratinocyte proteins can be studied in these cultures. The newly synthesized proteins can be separated into a water-soluble, a urea-soluble, and a urea-insoluble fraction. Product analysis has been performed on the first two fractions revealing protein patterns identical to those of intact hair follicles. Product analysis of the urea-soluble fractions of microdissected hair follicles shows that the protein pattern of the cultured keratinocytes resembles the protein pattern of the hair follicle sheath. Studies on the metabolism of benzo(a)pyrene revealed that the enzyme aryl hydrocarbon hydroxylase (AHH) is present in cultured hair follicle cells. A possible use of our culture system for eventual detection of inherited predisposition for smoking-dependent lung cancer is discussed.

  6. Micropit: a new cell culturing approach for characterization of solitary astrocytes and small networks of these glial cells

    Directory of Open Access Journals (Sweden)

    William Lee

    2008-12-01

    Full Text Available Astrocytes play an important role in cell-cell signaling in the mammalian central nervous system. The ability of astrocytes to communicate with surrounding cells through gap-junctional coupling or signaling via the release of transmitters makes characterization of these cells difficult in vitro and even more so in vivo. To simplify the complexity of common in vitro systems, introduced by intercellular communication between astrocytes, we developed a novel cell culturing method, in which purified rat visual cortical astrocytes were grown in spatially defined cell-adhesion wells which we termed micropits. We showed that astrocytes cultured in micropit regions were viable and exhibited similar characteristics of Ca2+ dynamics and astrocytic marker expression to those of cells cultured in non-micropit regions. Examination of intracellular Ca2+ oscillations in solitary astrocytes cultured in micropits revealed less variable oscillations than those of non-micropit grouped astrocytes, which were in contact with their neighbors. Solitary cells in micropit regions can undergo ATP-mediated astrocyte-microglia signaling, demonstrating that this culturing method can also be used to investigate glial-glial interactions in a spatially well-defined microenvironment.

  7. Culture conditions have an impact on the maturation of traceable, transplantable mouse embryonic stem cell-derived otic progenitor cells.

    Science.gov (United States)

    Abboud, Nesrine; Fontbonne, Arnaud; Watabe, Isabelle; Tonetto, Alain; Brezun, Jean Michel; Feron, François; Zine, Azel

    2017-09-01

    The generation of replacement inner ear hair cells (HCs) remains a challenge and stem cell therapy holds the potential for developing therapeutic solutions to hearing and balance disorders. Recent developments have made significant strides in producing mouse otic progenitors using cell culture techniques to initiate HC differentiation. However, no consensus has been reached as to efficiency and therefore current methods remain unsatisfactory. In order to address these issues, we compare the generation of otic and HC progenitors from embryonic stem (ES) cells in two cell culture systems: suspension vs. adherent conditions. In the present study, an ES cell line derived from an Atoh1-green fluorescent protein (GFP) transgenic mouse was used to track the generation of otic progenitors, initial HCs and to compare these two differentiation systems. We used a two-step short-term differentiation method involving an induction period of 5 days during which ES cells were cultured in the presence of Wnt/transforming growth factor TGF-β inhibitors and insulin-like growth factor IGF-1 to suppress mesoderm and reinforce presumptive ectoderm and otic lineages. The generated embryoid bodies were then differentiated in medium containing basic fibroblast growth factor (bFGF) for an additional 5 days using either suspension or adherent culture methods. Upon completion of differentiation, quantitative polymerase chain reaction analysis and immunostaining monitored the expression of otic/HC progenitor lineage markers. The results indicate that cells differentiated in suspension cultures produced cells expressing otic progenitor/HC markers at a higher efficiency compared with the production of these cell types within adherent cultures. Furthermore, we demonstrated that a fraction of these cells can incorporate into ototoxin-injured mouse postnatal cochlea explants and express MYO7A after transplantation. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons

  8. Stable isotope labelling with amino acids in cell culture for human embryonic stem cell proteomic analysis

    DEFF Research Database (Denmark)

    Harkness, Linda; Prokhorova, Tatyana A; Kassem, Moustapha

    2012-01-01

    The identification and quantitative measurements of proteins in human embryonic stem cells (hESC) is a fast growing interdisciplinary area with an enormous impact on understanding the biology of hESC and the mechanism controlling self-renewal and differentiation. Using a quantitative mass...... spectroscopic method of stable isotope labelling with amino acids during cell culture (SILAC), we are able to analyse differential expression of proteins from different cellular compartments and to identify intracellular signalling pathways involved in self-renewal and differentiation. In this chapter, we...

  9. Effect of primarily cultured human lung cancer-associated fibroblasts on radiosensitivity of lung cancer cells

    International Nuclear Information System (INIS)

    Ji Xiaoqin; Ji Jiang; Chen Yongbing; Shan Fang; Lu Xueguan

    2014-01-01

    Objective: To investigate the effect of human lung cancer-associated fibroblasts (CAF) on the radiosensitivity of lung cancer cells when CAF is placed in direct contact co-culture with lung cancer cells. Methods: Human lung CAF was obtained from fresh human lung adenocarcinoma tissue specimens by primary culture and subculture and was then identified by immunofluorescence staining. The CAF was placed in direct contact co-culture with lung cancer A 549 and H 1299 cells, and the effects of CAF on the radiosensitivity of A 549 and H 1299 cells were evaluated by colony-forming assay. Results: The human lung CAF obtained by adherent culture could stably grow and proliferate, and it had specific expression of α-smooth muscle actin, vimentin, and fibroblast activation protein,but without expression of cytokeratin-18. The plating efficiency (PE, %) of A 549 cells at 0 Gy irradiation was (20.0 ± 3.9)% when cultured alone versus (32.3 ± 5.5)% when co-cultured with CAF (t=3.16, P<0.05), and the PE of H 1299 cells at 0 Gy irradiation was (20.6 ± 3.1)% when cultured alone versus (35.2 ± 2.3)% when co-cultured with CAF (t=6.55, P<0.05). The cell survival rate at 2 Gy irradiation (SF 2 ) of A 549 cells was 0.727 ±0.061 when cultured alone versus 0.782 ± 0.089 when co-cultured with CAF (t=0.88, P>0.05), and the SF 2 of H 1299 cells was 0.692 ±0.065 when cultured alone versus 0.782 ± 0.037 when co-cultured with CAF (t=2.08, P>0.05). The protection enhancement ratios of human lung CAF for A 549 cells and H 1299 cells were 1.29 and 1.25, respectively. Conclusions: Human lung CAF reduces the radiosensitivity of lung cancer cells when placed in direct contact co-culture with them, and the radioprotective effect may be attributed to CAF promoting the proliferation of lung cancer cells. (authors)

  10. Control of fibronectin synthesis by rat granulosa cells in culture

    International Nuclear Information System (INIS)

    Skinner, M.K.; Dorrington, J.H.

    1984-01-01

    The secreted and cellular [ 35 S]methionine-radiolabeled proteins of cultured rat granulosa cells were separated by electrophoresis on sodium dodecylsulfate (SDS) polyacrylamide gradient slab gels. From 24 to 72 h of culture FSH increased the intensity of labeling of most of the secreted proteins. A 220,000-dalton protein, however, increased in intensity only in control cultures and became the major secreted protein after 72 h, comprising 20% of the total radiolabeled proteins. This protein was identified as fibronectin by immunoprecipitation. There was no increase in the secreted or cellular fibronectin in FSH- or testosterone- and insulin-treated cultures. These studies indicate that a component of extracellular matrix is a major secretory product of unstimulated immature granulosa cells. As hormones induce the differentiated functions of granulosa cells in culture, the secretion of fibronectin is inhibited

  11. Cytotoxicity of TSP in 3D Agarose Gel Cultured Cell.

    Directory of Open Access Journals (Sweden)

    Song-I Chun

    Full Text Available A reference reagent, 3-(trimethylsilyl propionic-2, 2, 3, 3-d4 acid sodium (TSP, has been used frequently in nuclear magnetic resonance (NMR and magnetic resonance spectroscopy (MRS as an internal reference to identify cell and tissue metabolites, and determine chemical and protein structures. This reference material has been exploited for the quantitative and dynamic analyses of metabolite spectra acquired from cells. The aim of this study was to evaluate the cytotoxicity of TSP on three-dimensionally, agarose gel, cultured cells.A human osteosarcoma cell line (MG-63 was selected, and cells were three dimensionally cultured for two weeks in an agarose gel. The culture system contained a mixture of conventional culture medium and various concentrations (0, 1, 3, 5, 7, 10, 20 30 mM of TSP. A DNA quantification assay was conducted to assess cell proliferation using Quant-iT PicoGreen dsDNA reagent and kit, and cell viability was determined using a LIVE/DEAD Viability/Cytotoxicity kit. Both examinations were performed simultaneously at 1, 3, 7 and 14 days from cell seeding.In this study, the cytotoxicity of TSP in the 3D culture of MG-63 cells was evaluated by quantifying DNA (cell proliferation and cell viability. High concentrations of TSP (from 10 to 30 mM reduced both cell proliferation and viability (to 30% of the control after one week of exposure, but no such effects were found using low concentrations of TSP (0-10 mM.This study shows that low concentrations of TSP in 3D cell culture medium can be used for quantitative NMR or MRS examinations for up to two weeks post exposure.

  12. The effect of Montessori Method on teaching cultural and creative ...

    African Journals Online (AJOL)

    The Effect of the Montessori Method on teaching was investigated among children to discover their artistic development in Zaria, Kaduna State. The problem of the study is that the Montessori Method on teaching cultural and creative arts is not adequately explored in the primary schools, while other teaching methods used, ...

  13. Safe sorting of GFP-transduced live cells for subsequent culture using a modified FACS vantage

    DEFF Research Database (Denmark)

    Sørensen, T U; Gram, G J; Nielsen, S D

    1999-01-01

    BACKGROUND: A stream-in-air cell sorter enables rapid sorting to a high purity, but it is not well suited for sorting of infectious material due to the risk of airborne spread to the surroundings. METHODS: A FACS Vantage cell sorter was modified for safe use with potentially HIV infected cells...... culture. CONCLUSIONS: Sorting of live infected cells can be performed safely and with no deleterious effects on vector expression using the modified FACS Vantage instrument....

  14. Microfluidic perfusion culture of human induced pluripotent stem cells under fully defined culture conditions.

    Science.gov (United States)

    Yoshimitsu, Ryosuke; Hattori, Koji; Sugiura, Shinji; Kondo, Yuki; Yamada, Rotaro; Tachikawa, Saoko; Satoh, Taku; Kurisaki, Akira; Ohnuma, Kiyoshi; Asashima, Makoto; Kanamori, Toshiyuki

    2014-05-01

    Human induced pluripotent stem cells (hiPSCs) are a promising cell source for drug screening. For this application, self-renewal or differentiation of the cells is required, and undefined factors in the culture conditions are not desirable. Microfluidic perfusion culture allows the production of small volume cultures with precisely controlled microenvironments, and is applicable to high-throughput cellular environment screening. Here, we developed a microfluidic perfusion culture system for hiPSCs that uses a microchamber array chip under defined extracellular matrix (ECM) and culture medium conditions. By screening various ECMs we determined that fibronectin and laminin are appropriate for microfluidic devices made out of the most popular material, polydimethylsiloxane (PDMS). We found that the growth rate of hiPSCs under pressure-driven perfusion culture conditions was higher than under static culture conditions in the microchamber array. We applied our new system to self-renewal and differentiation cultures of hiPSCs, and immunocytochemical analysis showed that the state of the hiPSCs was successfully controlled. The effects of three antitumor drugs on hiPSCs were comparable between microchamber array and 96-well plates. We believe that our system will be a platform technology for future large-scale screening of fully defined conditions for differentiation cultures on integrated microfluidic devices. © 2013 Wiley Periodicals, Inc.

  15. Quantitative volumetric Raman imaging of three dimensional cell cultures

    KAUST Repository

    Kallepitis, Charalambos

    2017-03-22

    The ability to simultaneously image multiple biomolecules in biologically relevant three-dimensional (3D) cell culture environments would contribute greatly to the understanding of complex cellular mechanisms and cell–material interactions. Here, we present a computational framework for label-free quantitative volumetric Raman imaging (qVRI). We apply qVRI to a selection of biological systems: human pluripotent stem cells with their cardiac derivatives, monocytes and monocyte-derived macrophages in conventional cell culture systems and mesenchymal stem cells inside biomimetic hydrogels that supplied a 3D cell culture environment. We demonstrate visualization and quantification of fine details in cell shape, cytoplasm, nucleus, lipid bodies and cytoskeletal structures in 3D with unprecedented biomolecular specificity for vibrational microspectroscopy.

  16. Adherence of Moraxella bovis to cell cultures of bovine origin.

    Science.gov (United States)

    Annuar, B O; Wilcox, G E

    1985-09-01

    The adherence of five strains of Moraxella bovis to cell cultures was investigated. M bovis adhered to cultures of bovine corneal epithelial and Madin-Darby bovine kidney cells but not to cell types of non-bovine origin. Both piliated and unpiliated strains adhered but piliated strains adhered to a greater extent than unpiliated strains. Antiserum against pili of one strain inhibited adherence of piliated strains but caused only slight inhibition of adherence to the unpiliated strains. Treatment of bacteria with magnesium chloride caused detachment of pili from the bacterial cell and markedly inhibited adherence of piliated strains but caused only slight inhibition of adherence by the unpiliated strains. The results suggested that adhesion of piliated strains to cell cultures was mediated via pili but that adhesins other than pili may be involved in the attachment of unpiliated strains of M bovis to cells.

  17. Isolation, Culture, and Differentiation of Bone Marrow Stromal Cells and Osteoclast Progenitors from Mice.

    Science.gov (United States)

    Maridas, David E; Rendina-Ruedy, Elizabeth; Le, Phuong T; Rosen, Clifford J

    2018-01-06

    Bone marrow stromal cells (BMSCs) constitute a cell population routinely used as a representation of mesenchymal stem cells in vitro. They reside within the bone marrow cavity alongside hematopoietic stem cells (HSCs), which can give rise to red blood cells, immune progenitors, and osteoclasts. Thus, extractions of cell populations from the bone marrow results in a very heterogeneous mix of various cell populations, which can present challenges in experimental design and confound data interpretation. Several isolation and culture techniques have been developed in laboratories in order to obtain more or less homogeneous populations of BMSCs and HSCs invitro. Here, we present two methods for isolation of BMSCs and HSCs from mouse long bones: one method that yields a mixed population of BMSCs and HSCs and one method that attempts to separate the two cell populations based on adherence. Both methods provide cells suitable for osteogenic and adipogenic differentiation experiments as well as functional assays.

  18. Expression of hepatitis C virus envelope protein 2 induces apoptosis in cultured mammalian cells

    Institute of Scientific and Technical Information of China (English)

    Li-Xin Zhu; Jing Liu; You-Hua Xie; Yu-Ying Kong; Ye Ye; Chun-Lin Wang; Guang-Di Li; Yuan Wang

    2004-01-01

    AIM: To explore the role of hepatitis C virus (HCV) envelope protein 2 (E2) in the induction of apoptosis.METHODS: A carboxyterminal truncated E2 (E2-661) was transiently expressed in several cultured mammalian cell lines or stably expressed in Chinese hamster ovary (CHO)cell line. Cell proliferation was assessed by 3H thymidine uptake. Apoptosis was examined by Hoechst 33258staining, flow cytometry and DNA fragmentation analysis.RESULTS: Reduced proliferation was readily observed in the E2-661 expressing cells. These cells manifested the typical features of apoptosis, including cell shrinkage,chromatin condensation and hypodiploid genomic DNA content. Similar apoptotic cell death was observed in an E2-661 stably expressing cell line.CONCLUSION: HCV E2 can induce apoptosis in cultured mammalian cells.

  19. Radiosensitivity and TP 53, EGFR amplification and LOH10 analysis of primary glioma cell cultures

    International Nuclear Information System (INIS)

    Gerlach, B.; Harder, A.H.; Slotman, B.J.; Sminia, P.; Hulsebos, T.J.M.; Leenstra, S.; Peter Vandertop, W.; Hartmann, K.A.

    2002-01-01

    Aim: Determination of in-vitro radiosensitivity and genetic alterations of cell cultures derived from human glioma biopsy tissue and established glioma cell lines. Material and Methods: Fresh brain tumor specimens of six patients were processed to early passage cell cultures. In addition the cell lines D 384 and Gli 6 were used. Cell cultures were irradiated with doses from 2 to 10 Gy. Following irradiation, cell survival was determined by clonogenic assay and survival curves were generated. The surviving fractions after 2 Gy (SF2) and 4 Gy (SF4) were used as radiosensitivity parameters. Genetic analysis included determination of the mutational and loss of heterozygosity (LOH) status of TP 53 (exons 5-8), the LOH 10- and epidermal growth factor receptor gene (EGFR) amplification status. Results: The SF2 and SF4 values ranged from 0.54 to 0.88 (mean: 0.70) and from 0.13 to 0.52 (mean: 0.32), respectively. Genetic alterations were found in the Gli 6 cell line and in two primary cell cultures. The genetic profile of Gli 6 showed LOH but no TP 53 mutation, complete LOH 10 and no EGFR amplification. The VU 15 cell culture showed TP 53 mutation but no LOH 10 or EGFR amplification, while VU 24 showed incomplete LOH 10, EGFR amplification and no TP 53 mutation. In the other four cell cultures and D 384 cell line no genetic alterations were diagnosed. Histopathological classification of glioblastoma multiforme and/or genetic alterations resulted in lower radiosensitivity. Conclusion: In this small series of early passage glioma cell cultures low radiosensitivity and alterations in cell regulatory genes were seen. Further testing of biological behavior in larger series of patient-derived material is ongoing. (orig.)

  20. Long-term culture and differentiation of porcine red bone marrow hematopoietic cells co-cultured with immortalized mesenchymal cells.

    Science.gov (United States)

    Garba, Abubakar; Acar, Delphine D; Roukaerts, Inge D M; Desmarets, Lowiese M B; Devriendt, Bert; Nauwynck, Hans J

    2017-09-01

    Mesenchymal cells are multipotent stromal cells with self-renewal, differentiation and immunomodulatory capabilities. We aimed to develop a co-culture model for differentiating hematopoietic cells on top of immortalized mesenchymal cells for studying interactions between hematopoietic and mesenchymal cells, useful for adequately exploring the therapeutic potential of mesenchymal cells. In this study, we investigated the survival, proliferation and differentiation of porcine red bone marrow hematopoietic cells co-cultured with immortalized porcine bone marrow mesenchymal cells for a period of five weeks. Directly after collection, primary porcine bone marrow mesenchymal cells adhered firmly to the bottom of the culture plates and showed a fibroblast-like appearance, one week after isolation. Upon immortalization, porcine bone marrow mesenchymal cells were continuously proliferating. They were positive for simian virus 40 (SV40) large T antigen and the mesenchymal cell markers CD44 and CD55. Isolated red bone marrow cells were added to these immortalized mesenchymal cells. Five weeks post-seeding, 92±6% of the red bone marrow hematopoietic cells were still alive and their number increased 3-fold during five weekly subpassages on top of the immortalized mesenchymal cells. The red bone marrow hematopoietic cells were originally small and round; later, the cells increased in size. Some of them became elongated, while others remained round. Tiny dendrites appeared attaching hematopoietic cells to the underlying immortalized mesenchymal cells. Furthermore, weekly differential-quick staining of the cells indicated the presence of monoblasts, monocytes, macrophages and lymphocytes in the co-cultures. At three weeks of co-culture, flow cytometry analysis showed an increased surface expression of CD172a, CD14, CD163, CD169, CD4 and CD8 up to 37±0.8%, 40±8%, 41±4%, 23±3% and 19±5% of the hematopoietic cells, respectively. In conclusion, continuous mesenchymal cell

  1. Isolation, culture and intraportal transplantation of rat marrow stromal cell

    International Nuclear Information System (INIS)

    Wang Ping; Wang Jianhua; Yan Zhiping; Li Wentao; Lin Genlai; Hu Meiyu; Wang Yanhong

    2004-01-01

    Objective: To observe the tracing and evolution of marrow stromal cell (MSC) after intraportal transplantation into the liver of homogenous rats, and to provide experimental data for MSC differentiation to hepatocyte in vivo. Methods: The MSC was isolated from the leg bone marrow of adult SD rats, and purified by culture-expanded in vitro. Before transplantation, MSC was labeled with DAPI. Then 10 5 MSC were intraportally transplanted into the homogenous rat liver. Rats were killed at 2 hours and 1, 2, 3 and 4 weeks after transplantation. The cryosection samples of liver and lung were observed under fluorescence microscopy. Results: MSC in vitro culture had high ability of proliferation. Except 4 rats were dead because of abdominal bleeding or infection, other recipients were healthy until sacrificed. The implantation cells were detected by identifying the DAPI labeled MSC in the host livers, but not in the host lungs. Conclusion: Intraportal transplanted MSC could immigrate and survive in the host livers at least for 4 weeks. They could immigrate from the small branches of portal veins to hepatic parenchyma

  2. In vitro production of azadirachtin from cell suspension cultures of ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    proven effective in the control of agricultural pests in an environmentally ..... Prakash G and Srivastava A K 2005 Statistical media optimization for cell growth and ... Juss. suspension cultures; Process Biochemistry 40 3795–3800. Prakash G ...

  3. Establishment of the callus and cell suspension culture of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-05

    Oct 5, 2009 ... Full Length Research Paper. Establishment of the callus ... study provided an efficient way for E. angustifolia cell suspension culture to produce secondary metabolite. .... was also observed that in these treatments the stem.

  4. Enhancement of Diosgenin Production in Plantlet and Cell Cultures ...

    African Journals Online (AJOL)

    Enhancement of Diosgenin Production in Plantlet and Cell Cultures of Dioscorea zingiberensis by Palmarumycin C13 from the Endophytic fungus, Berkleasmium sp. Dzf12. Y Mou, K Zhou, D Xu, R Yu, J Li, C Yin, L Zhou ...

  5. Establishment of sorghum cell suspension culture system for ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-03-18

    Mar 18, 2008 ... Additionally, sorghum cell suspension cultures have been initiated from the friable ... proteomics technologies. The field of proteomics is .... air dried at room temperature and resuspended in 2 ml of urea buffer [9 M urea, 2 M ...

  6. Cell-cycle distributions and radiation responses of Chinese hamster cells cultured continuously under hypoxic conditions

    International Nuclear Information System (INIS)

    Tokita, N.; Carpenter, S.G.; Raju, M.R.

    1984-01-01

    Cell-cycle distributions were measured by flow cytometry for Chinese hamster (CHO) cells cultured continuously under hypoxic conditions. DNA histograms showed an accumulation of cells in the early S phase followed by a traverse delay through the S phase, and a G 2 block. During hypoxic culturing, cell viability decreased rapidly to less than 0.1% at 120 h. Radiation responses for cells cultured under these conditions showed an extreme radioresistance at 72 h. Results suggest that hypoxia induces a condition similar to cell synchrony which itself changes the radioresistance of hypoxic cells. (author)

  7. Enhanced production and isotope enrichment of recombinant glycoproteins produced in cultured mammalian cells

    International Nuclear Information System (INIS)

    Skelton, David; Goodyear, Abbey; Ni, DaQun; Walton, Wendy J.; Rolle, Myron; Hare, Joan T.; Logan, Timothy M.

    2010-01-01

    NMR studies of post-translationally modified proteins are complicated by the lack of an efficient method to produce isotope enriched recombinant proteins in cultured mammalian cells. We show that reducing the glucose concentration and substituting glutamate for glutamine in serum-free medium increased cell viability while simultaneously increasing recombinant protein yield and the enrichment of non-essential amino acids compared to culture in unmodified, serum-free medium. Adding dichloroacetate, a pyruvate dehydrogenase kinase inhibitor, further improves cell viability, recombinant protein yield, and isotope enrichment. We demonstrate the method by producing partially enriched recombinant Thy1 glycoprotein from Lec1 Chinese hamster ovary (CHO) cells using U- 13 C-glucose and 15 N-glutamate as labeled precursors. This study suggests that uniformly 15 N, 13 C-labeled recombinant proteins may be produced in cultured mammalian cells starting from a mixture of labeled essential amino acids, glucose, and glutamate.

  8. Enhanced production and isotope enrichment of recombinant glycoproteins produced in cultured mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Skelton, David; Goodyear, Abbey [Florida State University, Department of Chemistry and Biochemistry (United States); Ni, DaQun; Walton, Wendy J.; Rolle, Myron; Hare, Joan T. [Florida State University, Institute of Molecular Biophysics (United States); Logan, Timothy M., E-mail: tlogan@fsu.ed [Florida State University, Department of Chemistry and Biochemistry (United States)

    2010-10-15

    NMR studies of post-translationally modified proteins are complicated by the lack of an efficient method to produce isotope enriched recombinant proteins in cultured mammalian cells. We show that reducing the glucose concentration and substituting glutamate for glutamine in serum-free medium increased cell viability while simultaneously increasing recombinant protein yield and the enrichment of non-essential amino acids compared to culture in unmodified, serum-free medium. Adding dichloroacetate, a pyruvate dehydrogenase kinase inhibitor, further improves cell viability, recombinant protein yield, and isotope enrichment. We demonstrate the method by producing partially enriched recombinant Thy1 glycoprotein from Lec1 Chinese hamster ovary (CHO) cells using U-{sup 13}C-glucose and {sup 15}N-glutamate as labeled precursors. This study suggests that uniformly {sup 15}N,{sup 13}C-labeled recombinant proteins may be produced in cultured mammalian cells starting from a mixture of labeled essential amino acids, glucose, and glutamate.

  9. Immunocytochemical characterization of explant cultures of human prostatic stromal cells

    NARCIS (Netherlands)

    A. Kooistra (Anko); A.M.J. Elissen (Arianne ); J.J. Konig (Josee); M. Vermey; Th.H. van der Kwast (Theo); J.C. Romijn (Johannes); F.H. Schröder (Fritz)

    1995-01-01

    textabstractThe study of stromal-epithelial interactions greatly depends on the ability to culture both cell types separately, in order to permit analysis of their interactions under defined conditions in reconstitution experiments. Here we report the establishment of explant cultures of human

  10. Epithelial cell detachment by Porphyromonas gingivalis biofilm and planktonic cultures

    NARCIS (Netherlands)

    Huang, L.; van Loveren, C.; Ling, J.; Wei, X.; Crielaard, W.; Deng, D.M.

    2016-01-01

    Porphyromonas gingivalis is present as a biofilm at the sites of periodontal infections. The detachment of gingival epithelial cells induced by P. gingivalis biofilms was examined using planktonic cultures as a comparison. Exponentially grown planktonic cultures or 40-h biofilms were co-incubated

  11. Free-energy carriers in human cultured muscle cells

    NARCIS (Netherlands)

    Bolhuis, P. A.; de Zwart, H. J.; Ponne, N. J.; de Jong, J. M.

    1985-01-01

    Creatine phosphate (CrP), adenosine triphosphate (ATP), creatine kinase (CK), adenylate kinase (AK), protein, and DNA were quantified in human muscle cell cultures undergoing transition from dividing myoblasts to multinucleate myotubes. CrP is negligible in cultures grown in commonly applied media

  12. Radiosensitivity of cultured insect cells: II. Diptera

    International Nuclear Information System (INIS)

    Koval, T.M.

    1983-01-01

    The radiosensitivity of five dipteran cell lines representing three mosquito genera and one fruit fly genus were examined. These lines are: (1) ATC-10, Aedes aegypti; (2) RU-TAE-14, Toxorhynchites amboinensis; (3) RU-ASE-2A, Anopheles stephensi; (4) WR69-DM-1, Drosophila melanogaster; and (5) WR69-DM-2, Drosophila melanogaster. Population doubling times for these lines range from approximately 16 to 48 hr. Diploid chromosome numbers are six for the mosquito cells and eight for the fruit fly cells D 0 values are 5.1 and 6.5 Gy for the Drosophila cell lines and 3.6, 6.2, and 10.2 Gy for the mosquito cell lines. The results of this study demonstrate that dipteran insect cells are a few times more resistant to radiation than mammalian cells, but not nearly as radioresistant as lepidopteran cells

  13. Implications of long-term culture for mesenchymal stem cells: genetic defects or epigenetic regulation?

    Science.gov (United States)

    Wagner, Wolfgang

    2012-12-20

    Mesenchymal stem cells change dramatically during culture expansion. Long-term culture has been suspected to evoke oncogenic transformation: overall, the genome appears to be relatively stable throughout culture but transient clonal aneuploidies have been observed. Oncogenic transformation does not necessarily entail growth advantage in vitro and, therefore, the available methods - such as karyotypic analysis or genomic profiling - cannot exclude this risk. On the other hand, long-term culture is associated with specific senescence-associated DNA methylation (SA-DNAm) changes, particularly in developmental genes. SA-DNAm changes are highly reproducible and can be used to monitor the state of senescence for quality control. Notably, neither telomere attrition nor SA-DNAm changes occur in pluripotent stem cells, which can evade the 'Hayflick limit'. Long-term culture of mesenchymal stem cells seems to involve a tightly regulated epigenetic program. These epigenetic modifications may counteract dominant clones, which are more prone to transformation.

  14. Isolation, culture and adenoviral transduction of parietal cells from mouse gastric mucosa

    International Nuclear Information System (INIS)

    Gliddon, Briony L; Nguyen, Nhung V; Gunn, Priscilla A; Gleeson, Paul A; Driel, Ian R van

    2008-01-01

    Here we describe a method for the isolation of intact gastric glands from mice and primary culture and transfection of mouse gastric epithelial cells. Collagenase digestion of PBS-perfused mouse stomachs released large intact gastric glands that were plated on a basement membrane matrix. The heterogeneous gland cell cultures typically contain ∼60% parietal cells. Isolated mouse parietal cells remain viable in culture for up to 5 days and react strongly with an antibody specific to the gastric H + /K + ATPase. Isolated intact mouse gastric glands and primary cultures of mouse parietal cells respond to the secretagogue, histamine. Typical morphological changes from a resting to an acid-secreting active parietal cell were observed. In resting cultures of mouse parietal cells, the H + /K + ATPase displayed a cytoplasmic punctate staining pattern consistent with tubulovesicle element structures. Following histamine stimulation, an expansion of internal apical vacuole structures was observed together with a pronounced redistribution of the H + /K + ATPase from the cytoplasm to the apical vacuoles. A reproducible procedure to express genes of interest exogenously in these cultures of mouse parietal cells was also established. This method combines recombinant adenoviral transduction with magnetic field-assisted transfection resulting in ∼30% transduced parietal cells. Adenoviral-transduced parietal cells maintain their ability to undergo agonist-induced activation. This protocol will be useful for the isolation, culture and expression of genes in parietal cells from genetically modified mice and as such will be an invaluable tool for studying the complex exocytic and endocytic trafficking events of the H + /K + ATPase which underpin the regulation of acid secretion

  15. Impact of cell culture process changes on endogenous retrovirus expression.

    Science.gov (United States)

    Brorson, Kurt; De Wit, Christina; Hamilton, Elizabeth; Mustafa, Mehnaz; Swann, Patrick G; Kiss, Robert; Taticek, Ron; Polastri, Gian; Stein, Kathryn E; Xu, Yuan

    2002-11-05

    Cell culture process changes (e.g., changes in scale, medium formulation, operational conditions) and cell line changes are common during the development life cycle of a therapeutic protein. To ensure that the impact of such process changes on product quality and safety is minimal, it is standard practice to compare critical product quality and safety attributes before and after the changes. One potential concern introduced by cell culture process improvements is the possibility of increased endogenous retrovirus expression to a level above the clearance capability of the subsequent purification process. To address this, retrovirus expression was measured in scaled down and full production scaled Chinese hamster ovary (CHO) cell cultures of four monoclonal antibodies and one recombinant protein before and after process changes. Two highly sensitive, quantitative (Q)-PCR-based assays were used to measure endogenous retroviruses. It is shown that cell culture process changes that primarily alter media components, nutrient feed volume, seed density, cell bank source (i.e., master cell bank vs. working cell bank), and vial size, or culture scale, singly or in combination, do not impact the rate of retrovirus expression to an extent greater than the variability of the Q-PCR assays (0.2-0.5 log(10)). Cell culture changes that significantly alter the metabolic state of the cells and/or rates of protein expression (e.g., pH and temperature shifts, NaButyrate addition) measurably impact the rate of retrovirus synthesis (up to 2 log(10)). The greatest degree of variation in endogenous retrovirus expression was observed between individual cell lines (up to 3 log(10)). These data support the practice of measuring endogenous retrovirus output for each new cell line introduced into manufacturing or after process changes that significantly increase product-specific productivity or alter the metabolic state, but suggest that reassessment of retrovirus expression after other

  16. A modified efficient method for dental pulp stem cell isolation

    Directory of Open Access Journals (Sweden)

    Maryam Raoof

    2014-01-01

    Full Text Available Background: Dental pulp stem cells can be used in regenerative endodontic therapy. The aim of this study was to introduce an efficient method for dental pulp stem cells isolation. Materials and Methods: In this in-vitro study, 60 extracted human third molars were split and pulp tissue was extracted. Dental pulp stem cells were isolated by the following three different methods: (1 digestion of pulp by collagenase/dispase enzyme and culture of the released cells; (2 outgrowth of the cells by culture of undigested pulp pieces; (3 digestion of pulp tissue pieces and fixing them. The cells were cultured in minimum essential medium alpha modification (αMEM medium supplemented with 20% fetal bovine serum(FBS in humid 37°C incubator with 5% CO 2 . The markers of stem cells were studied by reverse transcriptase polymerase chain reaction (PCR. The student t-test was used for comparing the means of independent groups. P <0.05 was considered as significant. Results: The results indicated that by the first method a few cell colonies with homogenous morphology were detectable after 4 days, while in the outgrowth method more time was needed (10-12 days to allow sufficient numbers of heterogeneous phenotype stem cells to migrate out of tissue. Interestingly, with the improved third method, we obtained stem cells successfully with about 60% efficiency after 2 days. The results of RT-PCR suggested the expression of Nanog, Oct-4, and Nucleostemin markers in the isolated cells from dental pulps. Conclusion: This study proposes a new method with high efficacy to obtain dental pulp stem cells in a short time.

  17. 5-Fluorouracil-induced apoptosis in cultured oral cancer cells.

    Science.gov (United States)

    Tong, D; Poot, M; Hu, D; Oda, D

    2000-03-01

    Chemotherapy is commonly used to treat advanced oral squamous cell carcinoma (SCC) and is known to kill cancer cells through apoptosis. Our hypothesis states that 5-fluorouracil (5FU) also kills cultured oral epithelial cells through programmed cell death or apoptosis. Cultured oral cancer cells were exposed to an optimum dose of 20 mg/ml of 5FU. Cells were analyzed for changes in cell cycle distribution and induction of cell death including apoptosis. Normal control, human papilloma virus-immortalized (PP), ATCC SCC cell line (CA1) and two primary oral SCC cell lines (CA3 and -4) were studied. Inhibition of apoptosis by a pan-caspase inhibitor was used. SYTO 11 flow cytometry showed increased apoptosis in all 5FU-treated cell cultures compared to untreated controls. The results show biological variation in apoptotic response. CA1 had the lowest apoptotic rate of the cancer cell lines at 1.5%. Next lowest was CA3, followed by CA4 and PP. In addition, alteration in the G1 and S phase fractions were found. Untreated CA1 showed 28% G1, 53% S compared to 43% G1, and 40% S of treated. We investigated the pathway of apoptosis using the pan-caspase inhibitor IDN-1529 by methylthiazolyl diphenyl tetrazolium bromide (MTT) colorimetric analysis. Results showed mild inhibition of cell death when cells were incubated with 50 microM IDN-1529 for 24 h. This suggests a probable caspase-dependent apoptotic pathway. In conclusion, our data suggest that 5FU induces oral cancer cell death through apoptosis and that biological variation exists between normal and cancer cells and between different types of cancer cells themselves. Our data indicate that cultures of a useful in vitro model for chemosensitivity assays are possible. Our results also suggest a caspase-dependent pathway for chemocytotoxicity in oral SCC.

  18. Effect of amniotic fluid on the in vitro culture of human corneal endothelial cells.

    Science.gov (United States)

    Feizi, Sepehr; Soheili, Zahra-Soheila; Bagheri, Abouzar; Balagholi, Sahar; Mohammadian, Azam; Rezaei-Kanavi, Mozhgan; Ahmadieh, Hamid; Samiei, Shahram; Negahban, Kambiz

    2014-05-01

    The present study was designed to evaluate the effects of human amniotic fluid (HAF) on the growth of human corneal endothelial cells (HCECs) and to establish an in vitro method for expanding HCECs. HCECs were cultured in DMEM-F12 supplemented with 20% fetal bovine serum (FBS). Confluent monolayer cultures were trypsinized and passaged using either FBS- or HAF-containing media. Cell proliferation and cell death ELISA assays were performed to determine the effect of HAF on cell growth and viability. The identity of the cells cultured in 20% HAF was determined using immunocytochemistry (ICC) and real-time reverse transcription polymerase chain reaction (RT-PCR) techniques to evaluate the expression of factors that are characteristic of HCECs, including Ki-67, Vimentin, Na+/K+-ATPase and ZO-1. HCEC primary cultures were successfully established using 20% HAF-containing medium, and these cultures demonstrated rapid cell proliferation according to the cell proliferation and death ELISA assay results. The ICC and real time RT-PCR results indicated that there was a higher expression of Na+/K+-ATPase and ZO-1 in the 20% HAF cell cultures compared with the control (20% FBS) (P < 0.05). The 20% HAF-containing medium exhibited a greater stimulatory effect on HCEC growth and could represent a potential enriched supplement for HCEC regeneration studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Good Cell Culture Practice for stem cells and stem-cell-derived models.

    Science.gov (United States)

    Pamies, David; Bal-Price, Anna; Simeonov, Anton; Tagle, Danilo; Allen, Dave; Gerhold, David; Yin, Dezhong; Pistollato, Francesca; Inutsuka, Takashi; Sullivan, Kristie; Stacey, Glyn; Salem, Harry; Leist, Marcel; Daneshian, Mardas; Vemuri, Mohan C; McFarland, Richard; Coecke, Sandra; Fitzpatrick, Suzanne C; Lakshmipathy, Uma; Mack, Amanda; Wang, Wen Bo; Yamazaki, Daiju; Sekino, Yuko; Kanda, Yasunari; Smirnova, Lena; Hartung, Thomas

    2017-01-01

    The first guidance on Good Cell Culture Practice (GCCP) dates back to 2005. This document expands this to include aspects of quality assurance for in vitro cell culture focusing on the increasingly diverse cell types and culture formats used in research, product development, testing and manufacture of biotechnology products and cell-based medicines. It provides a set of basic principles of best practice that can be used in training new personnel, reviewing and improving local procedures, and helping to assure standard practices and conditions for the comparison of data between laboratories and experimentation performed at different times. This includes recommendations for the documentation and reporting of culture conditions. It is intended as guidance to facilitate the generation of reliable data from cell culture systems, and is not intended to conflict with local or higher level legislation or regulatory requirements. It may not be possible to meet all recommendations in this guidance for practical, legal or other reasons. However, when it is necessary to divert from the principles of GCCP, the risk of decreasing the quality of work and the safety of laboratory staff should be addressed and any conclusions or alternative approaches justified. This workshop report is considered a first step toward a revised GCCP 2.0.

  20. Aggregate formation and suspension culture of human pluripotent stem cells and differentiated progeny.

    Science.gov (United States)

    Hookway, Tracy A; Butts, Jessica C; Lee, Emily; Tang, Hengli; McDevitt, Todd C

    2016-05-15

    Culture of human pluripotent stem cells (hPSC) as in vitro multicellular aggregates has been increasingly used as a method to model early embryonic development. Three-dimensional assemblies of hPSCs facilitate interactions between cells and their microenvironment to promote morphogenesis, analogous to the multicellular organization that accompanies embryogenesis. In this paper, we describe a method for reproducibly generating and maintaining populations of homogeneous three-dimensional hPSC aggregates using forced aggregation and rotary orbital suspension culture. We propose solutions to several challenges associated with the consistent formation and extended culture of cell spheroids generated from hPSCs and their differentiated progeny. Further, we provide examples to demonstrate how aggregation can be used as a tool to select specific subpopulations of cells to create homotypic spheroids, or as a means to introduce multiple cell types to create heterotypic tissue constructs. Finally, we demonstrate that the aggregation and rotary suspension method can be used to support culture and maintenance of hPSC-derived cell populations representing each of the three germ layers, underscoring the utility of this platform for culturing many different cell types. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. mRNA transfection of mouse and human neural stem cell cultures.

    Directory of Open Access Journals (Sweden)

    Samuel McLenachan

    Full Text Available The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has not been previously reported. Here we sought to establish an efficient method for delivering mRNA to primary neurosphere cultures. Neurospheres derived from the subventricular zone of adult mice or from human embryonic stem cells were transfected with EGFP mRNA by lipofection and electroporation. Transfection efficiency and expression levels were monitored by flow cytometry. Cell survival following transfection was examined using live cell counting and the MTT assay. Both lipofection and electroporation provided high efficiency transfection of neurospheres. In comparison with lipofection, electroporation resulted in increased transfection efficiencies, but lower expression per cell and shorter durations of expression. Additional rounds of lipofection renewed EGFP expression in neurospheres, suggesting this method may be suitable for reprogramming applications. In summary, we have developed a protocol for achieving high efficiency transfection rates in mouse and human neurosphere cell culture that can be applied for future studies of gene function studies in neural stem cells, such as defining efficient differentiation protocols for glial and neuronal linages.

  2. mRNA Transfection of Mouse and Human Neural Stem Cell Cultures

    Science.gov (United States)

    McLenachan, Samuel; Zhang, Dan; Palomo, Ana Belén Alvarez; Edel, Michael J.; Chen, Fred K.

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has not been previously reported. Here we sought to establish an efficient method for delivering mRNA to primary neurosphere cultures. Neurospheres derived from the subventricular zone of adult mice or from human embryonic stem cells were transfected with EGFP mRNA by lipofection and electroporation. Transfection efficiency and expression levels were monitored by flow cytometry. Cell survival following transfection was examined using live cell counting and the MTT assay. Both lipofection and electroporation provided high efficiency transfection of neurospheres. In comparison with lipofection, electroporation resulted in increased transfection efficiencies, but lower expression per cell and shorter durations of expression. Additional rounds of lipofection renewed EGFP expression in neurospheres, suggesting this method may be suitable for reprogramming applications. In summary, we have developed a protocol for achieving high efficiency transfection rates in mouse and human neurosphere cell culture that can be applied for future studies of gene function studies in neural stem cells, such as defining efficient differentiation protocols for glial and neuronal linages. PMID:24386231

  3. mRNA transfection of mouse and human neural stem cell cultures.

    Science.gov (United States)

    McLenachan, Samuel; Zhang, Dan; Palomo, Ana Belén Alvarez; Edel, Michael J; Chen, Fred K

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has not been previously reported. Here we sought to establish an efficient method for delivering mRNA to primary neurosphere cultures. Neurospheres derived from the subventricular zone of adult mice or from human embryonic stem cells were transfected with EGFP mRNA by lipofection and electroporation. Transfection efficiency and expression levels were monitored by flow cytometry. Cell survival following transfection was examined using live cell counting and the MTT assay. Both lipofection and electroporation provided high efficiency transfection of neurospheres. In comparison with lipofection, electroporation resulted in increased transfection efficiencies, but lower expression per cell and shorter durations of expression. Additional rounds of lipofection renewed EGFP expression in neurospheres, suggesting this method may be suitable for reprogramming applications. In summary, we have developed a protocol for achieving high efficiency transfection rates in mouse and human neurosphere cell culture that can be applied for future studies of gene function studies in neural stem cells, such as defining efficient differentiation protocols for glial and neuronal linages.

  4. Cell proliferation and radiosensitivity of cow lymphocytes in culture

    International Nuclear Information System (INIS)

    Modave, C.; Fabry, L.; Leonard, A.

    1982-01-01

    The harlequin-staining technique has been used to study, after PHA-stimulation, the cell proliferation of cow lymphocytes in culture and to assess the radiosensitivity in first mitosis cells. At the 48 h fixation time, only 34% of the cells are in first mitosis whereas 55% are already in second and 11% in third mitosis. The exposure of cow lymphocytes to 200 rad X-rays result in the production of 16% dicentric chromosomes in first mitosis cells [fr

  5. Topological defects control collective dynamics in neural progenitor cell cultures

    Science.gov (United States)

    Kawaguchi, Kyogo; Kageyama, Ryoichiro; Sano, Masaki

    2017-04-01

    Cultured stem cells have become a standard platform not only for regenerative medicine and developmental biology but also for biophysical studies. Yet, the characterization of cultured stem cells at the level of morphology and of the macroscopic patterns resulting from cell-to-cell interactions remains largely qualitative. Here we report on the collective dynamics of cultured murine neural progenitor cells (NPCs), which are multipotent stem cells that give rise to cells in the central nervous system. At low densities, NPCs moved randomly in an amoeba-like fashion. However, NPCs at high density elongated and aligned their shapes with one another, gliding at relatively high velocities. Although the direction of motion of individual cells reversed stochastically along the axes of alignment, the cells were capable of forming an aligned pattern up to length scales similar to that of the migratory stream observed in the adult brain. The two-dimensional order of alignment within the culture showed a liquid-crystalline pattern containing interspersed topological defects with winding numbers of +1/2 and -1/2 (half-integer due to the nematic feature that arises from the head-tail symmetry of cell-to-cell interaction). We identified rapid cell accumulation at +1/2 defects and the formation of three-dimensional mounds. Imaging at the single-cell level around the defects allowed us to quantify the velocity field and the evolving cell density; cells not only concentrate at +1/2 defects, but also escape from -1/2 defects. We propose a generic mechanism for the instability in cell density around the defects that arises from the interplay between the anisotropic friction and the active force field.

  6. Characterization of glucocerebrosidase in peripheral blood cells and cultured blastoid cells

    NARCIS (Netherlands)

    Aerts, J. M.; Heikoop, J.; van Weely, S.; Donker-Koopman, W. E.; Barranger, J. A.; Tager, J. M.; Schram, A. W.

    1988-01-01

    We have characterized glucocerebrosidase in various cell types of peripheral blood of control subjects and in cultured human blastoid cells. The intracellular level of glucocerebrosidase in cultured blastoid cells (10-30 nmol substrate hydrolyzed/h.mg protein) resembles closely values observed for

  7. Host cells and methods for producing isoprenyl alkanoates

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Taek Soon; Fortman, Jeffrey L.; Keasling, Jay D.

    2015-12-01

    The invention provides for a method of producing an isoprenyl alkanoate in a genetically modified host cell. In one embodiment, the method comprises culturing a genetically modified host cell which expresses an enzyme capable of catalyzing the esterification of an isoprenol and a straight-chain fatty acid, such as an alcohol acetyltransferase (AAT), wax ester synthase/diacylglycerol acyltransferase (WS/DGAT) or lipase, under a suitable condition so that the isoprenyl alkanoate is produced.

  8. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Tissue culture media for human ex vivo tissue and cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture...

  9. Limited hair cell induction from human induced pluripotent stem cells using a simple stepwise method.

    Science.gov (United States)

    Ohnishi, Hiroe; Skerleva, Desislava; Kitajiri, Shin-ichiro; Sakamoto, Tatsunori; Yamamoto, Norio; Ito, Juichi; Nakagawa, Takayuki

    2015-07-10

    Disease-specific induced pluripotent stem cells (iPS) cells are expected to contribute to exploring useful tools for studying the pathophysiology of inner ear diseases and to drug discovery for treating inner ear diseases. For this purpose, stable induction methods for the differentiation of human iPS cells into inner ear hair cells are required. In the present study, we examined the efficacy of a simple induction method for inducing the differentiation of human iPS cells into hair cells. The induction of inner ear hair cell-like cells was performed using a stepwise method mimicking inner ear development. Human iPS cells were sequentially transformed into the preplacodal ectoderm, otic placode, and hair cell-like cells. As a first step, preplacodal ectoderm induction, human iPS cells were seeded on a Matrigel-coated plate and cultured in a serum free N2/B27 medium for 8 days according to a previous study that demonstrated spontaneous differentiation of human ES cells into the preplacodal ectoderm. As the second step, the cells after preplacodal ectoderm induction were treated with basic fibroblast growth factor (bFGF) for induction of differentiation into otic-placode-like cells for 15 days. As the final step, cultured cells were incubated in a serum free medium containing Matrigel for 48 days. After preplacodal ectoderm induction, over 90% of cultured cells expressed the genes that express in preplacodal ectoderm. By culture with bFGF, otic placode marker-positive cells were obtained, although their number was limited. Further 48-day culture in serum free media resulted in the induction of hair cell-like cells, which expressed a hair cell marker and had stereocilia bundle-like constructions on their apical surface. Our results indicate that hair cell-like cells are induced from human iPS cells using a simple stepwise method with only bFGF, without the use of xenogeneic cells. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Aromatase inhibitor (anastrozole) affects growth of endometrioma cells in culture.

    Science.gov (United States)

    Badawy, Shawky Z A; Brown, Shereene; Kaufman, Lydia; Wojtowycz, Martha A

    2015-05-01

    To study the effects of aromatase inhibitor (anastrozole) on the growth and estradiol secretion of endometrioma cells in culture. Endometrioma cells are grown in vitro until maximum growth before used in this study. This was done in the research laboratory for tissue culture, in an academic hospital. Testosterone at a concentration of 10 μg/mL was added as a substrate for the intracellular aromatase. In addition, aromatase inhibitor was added at a concentration of 200 and 300 μg/mL. The effect on cell growth and estradiol secretion is evaluated using Student's t-test. The use of testosterone increased estradiol secretion by endometrioma cells in culture. The use of aromatase inhibitor significantly inhibited the growth of endometrioma cells, and estradiol secretion. Aromatase inhibitor (anastrozole) may be an effective treatment for endometriosis due to inhibition of cellular aromatase. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  11. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Özcan

    2011-01-01

    Standard cell culture plastic was surface modified by passive adsorption or covalent attachment of interleukin (IL)-4 and investigated for its ability to induce differentiation of human monocytes into mature dendritic cells, a process dose-dependently regulated by IL-4. Covalent attachment of IL-4...... in water instead of phosphate-buffered saline. Passively adsorbed IL-4 was observed to induce differentiation to dendritic cells, but analysis of cell culture supernatants revealed that leakage of IL-4 into solution could account for the differentiation observed. Covalent attachment resulted in bound IL-4...... at similar concentrations to the passive adsorption process, as measured by enzyme-linked immunosorbent assays, and the bound IL-4 did not leak into solution to any measurable extent during cell culture. However, covalently bound IL-4 was incapable of inducing monocyte differentiation. This may be caused...

  12. Determination of thymidine in serum used for cell culture media

    International Nuclear Information System (INIS)

    Schaer, J.C.; Maurer, U.; Schindler, R.

    1978-01-01

    Thymidine concentrations in serum used for cell culture media were determined with an assay based on isotope dilution. In this assay, incorporation of (3H)-thymidine into DNA of cultured cells was measured in the presence of 5 and 20% serum as a function of the concentration of unlabeled thymidine added to the medium. Thymidine concentrations were measured using horse serum as well as fetal calf serum in the culture media. Dialysis of serum resulted in a reduction of thymidine levels by factors of at least 10

  13. Callus and cell suspension cultures of carnation

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1972-01-01

    Callus cultures of carnation, Dianthus caryophyllus L. ev. G. J. Sim, were grown on a synthetic medium of half strength Murashige and Skoog salts, 3 % sucrose, 100 mg/l of myo-inositol, 0.5 mg/l each of thiamin, HCl, pyridoxin, HCl and nicotinic acid and 10 g/l agar. Optimal concentrations...

  14. Improved Performance in Mammalian Cell Perfusion Cultures by Growth Inhibition.

    Science.gov (United States)

    Wolf, Moritz K F; Closet, Aurélie; Bzowska, Monika; Bielser, Jean-Marc; Souquet, Jonathan; Broly, Hervé; Morbidelli, Massimo

    2018-05-21

    Mammalian cell perfusion cultures represent a promising alternative to the current fed-batch technology for the production of various biopharmaceuticals. Long-term operation at a fixed viable cell density (VCD) requires a viable culture and a constant removal of excessive cells. Product loss in the cell removing bleed stream deteriorates the process yield. In this study, the authors investigate the use of chemical and environmental growth inhibition on culture performance by either adding valeric acid (VA) to the production media or by reducing the culture temperature (33.0 °C) with respect to control conditions (36.5 °C, no VA). Low temperature significantly reduces cellular growth, thus, resulting in lower bleed rates accompanied by a reduced product loss of 11% compared to 26% under control conditions. Additionally, the cell specific productivity of the target protein improves and maintained stable leading to media savings per mass of product. VA shows initially an inhibitory effect on cellular growth. However, cells seemed to adapt to the presence of the inhibitor resulting in a recovery of the cellular growth. Cell cycle and Western blot analyses support the observed results. This work underlines the role of temperature as a key operating variable for the optimization of perfusion cultures. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Cell death in Tetrahymena thermophila: new observations on culture conditions.

    Science.gov (United States)

    Christensen, S T; Sørensen, H; Beyer, N H; Kristiansen, K; Rasmussen, L; Rasmussen, M I

    2001-01-01

    We previously suggested that the cell fate of the protozoan ciliate, Tetrahymena thermophila, effectively relates to a quorum-sensing mechanism where cell-released factors support cell survival and proliferation. The cells have to be present above a critical initial density in a chemically defined nutrient medium in order to release a sufficient level of these factors to allow a new colony to flourish. At a relatively high rate of metabolism and/or macromolecular synthesis and below this critical density, cells began to die abruptly within 30 min of inoculation, and this death took the form of an explosive disintegration lasting less than 50 milliseconds. The cells died at any location in the culture, and the frequency of cell death was always lower in well-filled vials than those with medium/air interface. Cell death was inhibited by the addition of Actinomycin D or through modifications of the culture conditions either by reducing the oxygen tension or by decreasing the temperature of the growth medium. In addition, plastic caps in well-filled vials release substances, which promote cell survival. The fate of low-density cultures is related to certain 'physical' conditions, in addition to the availability of oxygen within closed culture systems. Copyright 2001 Academic Press.

  16. Development and characterization of cell culture systems from Puntius (Tor) chelynoides (McClelland).

    Science.gov (United States)

    Goswami, M; Sharma, B S; Tripathi, A K; Yadav, Kamalendra; Bahuguna, S N; Nagpure, N S; Lakra, W S; Jena, J K

    2012-05-25

    Puntius (Tor) chelynoides, commonly known as dark mahseer, is a commercially important coldwater fish species which inhabits fast-flowing hill-streams of India and Nepal. Cell culture systems were developed from eye, fin, heart and swim bladder tissues of P. chelynoides using explant method. The cell culture system developed from eye has been maintained towards a continuous cell line designated as PCE. The cells were grown in 25cm(2) tissue culture flasks with Leibovitz' L-15 media supplemented with 20 % fetal bovine serum (FBS) at 24°C. The PCE cell line consists of predominantly fibroblast-like cells and showed high plating efficiency. The monolayer formed from the fin and heart explants were comprised of epithelial as well as fibroblast-like cells, a prominent and rhythmic heartbeat was also observed in heart explants. Monolayer formed from swim bladder explants showed the morphology of fibroblast-like cells. All the cells from different tissues are able to grow at an optimum temperature of 24°C and growth rate increased as the FBS concentration increased. The PCE cell line was characterized using amplification of mitochondrial cytochrome oxidase subunit I (COI) & 16S rRNA genes which confirmed that the cell line originated from P. chelynoides. Cytogenetic analysis of PCE cell line and cells from fin revealed a diploid count of 100 chromosomes. Upon transfection with pEGFP-C1 plasmid, bright fluorescent signals were observed, suggesting that this cell line can be used for transgenic and genetic manipulation studies. Further, genotoxicity assessment of PCE cells illustrated the utility of this cell line as an in vitro model for aquatic toxicological studies. The PCE cell line was successfully cryopreserved and revived at different passage levels. The cell line and culture systems are being maintained to develop continuous cell lines for further studies. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. [Effective productions of plant secondary metabolites having antitumor activity by plant cell and tissue cultures].

    Science.gov (United States)

    Taniguchi, Shoko

    2005-06-01

    Methods for the effective production of plant secondary metabolites with antitumor activity using plant cell and tissue cultures were developed. The factors in tannin productivity were investigated using culture strains producing different types of hydrolyzable tannins, i.e., gallotannins (mixture of galloylglucoses), ellagi-, and dehydroellagitannins. Production of ellagi- and dehydroellagitannins was affected by the concentrations and ratio of nitrogen sources in the medium. The formation of oligomeric ellagitannins in shoots of Oenothera tetraptera was correlated with the differentiation of tissues. Cultured cells of Eriobotrya japonica producing ursane- and oleanane-type triterpenes with antitumor activities were also established.

  18. Suspension culture of pluripotent stem cells: effect of shear on stem cell fate.

    Science.gov (United States)

    Keller, Kevin C; Rodrigues, Beatriz; zur Nieden, Nicole I

    2014-01-01

    Despite significant promise, the routine usage of suspension cell culture to manufacture stem cell-derived differentiated cells has progressed slowly. Suspension culture is an innovative way of either expanding or differentiating cells and sometimes both are combined into a single bioprocess. Its advantages over static 2D culturing include a homogeneous and controllable culture environment and producing a large quantity of cells in a fraction of time. This feature makes suspension cell culture ideal for use in stem cell research and eventually ideal in the large-scale production of differentiated cells for regenerative medicine. Because of their tremendous differentiation capacities and unlimited growth properties, pluripotent stem cells (PSCs) in particular are considered potential sources for future cell-replacement therapies. Currently, expansion of PSCs is accomplished in 2D, which only permits a limited amount of cell growth per culture flask before cells need to be passaged. However, before stem cells can be applied clinically, several aspects of their expansion, such as directed growth, but also differentiation, need to be better controlled. This review will summarize recent advantages in suspension culture of PSCs, while at the same time highlighting current challenges.

  19. Cellular heredity in haploid cultures of somatic cells, March 1968-April 1981. Final report

    International Nuclear Information System (INIS)

    Freed, J.J.

    1982-03-01

    An account is given of the development and application to cell-culture genetics of unique haploid cell lines from frog embryo developed in this laboratory. Since 1968, the main aim of this project has been to develop the haploid cell system for studies of mutagenesis in culture, particularly by ultraviolet radiation. In the course of this work we isolated chromosomally stable cell lines, derived and characterized a number of variants, and adapted cell hybridization and other methods to this material. Particular emphasis was placed on ultraviolet photobiology, including studies of cell survival, mutagenesis, and pathways of repair of uv-damaged DNA. Although at present less widely used for genetic experiments than mammalian cell lines, the frog cells offer the advantages of authentic haploidy and a favorable repertory of DNA repair pathways for study of uv mutagenesis

  20. Comparison of Nested-PCR technique and culture method in ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

  1. Relative biological effectiveness (RBE) of alpha radiation in cultured porcine aortic endothelial cells.

    Science.gov (United States)

    Thomas, Patricia; Tracy, Bliss; Ping, Tilly; Baweja, Anar; Wickstrom, Mark; Sidhu, Narinder; Hiebert, Linda

    2007-03-01

    Northern peoples can receive elevated radiation doses (1- 10 mSv/y) from transfer of polonium-210 (210Po) through the lichen-caribou-human food chain. Ingested 210Po is primarily blood-borne and thus many of its short range alpha particles irradiate the endothelial cells lining the blood vessels. The relative biological effectiveness (RBE) of alpha particles vs. x-rays was examined in porcine aortic endothelial cells as a surrogate for understanding what might happen to human endothelial cells in northern populations consuming traditional foods. Cultured porcine aortic endothelial cells were exposed to x-ray and 210Po alpha particle radiation. Alpha irradiation was applied to the cell cultures internally via the culture medium and externally, using thin-bottomed culture dishes. The results given here are based on the external irradiation method, which was found to be more reliable. Dose-response curves were compared for four lethal endpoints (cell viability, live cell fraction, release of lactate dehydrogenase [LDH] and clonogenic survival) to determine the relative biological effectiveness (RBE) of alpha radiation. The alpha RBE for porcine cells varied from 1.6-21, depending on the endpoint: 21.2+/-4.5 for cell viability, 12.9+/-2.7 for decrease in live cell number, 5.3+/-0.4 for LDH release to the medium but only 1.6 +/-0.1 for clonogenic survival. The low RBE of 1.6 was due to x-ray hypersensitivity of endothelial cells at low doses.

  2. Stability of resazurin in buffers and mammalian cell culture media

    DEFF Research Database (Denmark)

    Rasmussen, Eva; Nicolaisen, G.M.

    1999-01-01

    The utility of a ferricyanide/ferrocyanide system used in the AlamarBlue(TM) (Serotec, Oxford, UK) vital. dye to inhibit the reduction of resazurin by mammalian cell culture media is questioned. Resazurin was found to be relatively stable when dissolved in phosphate-buffered saline (PBS). The use...... of HEPES resulted in a huge immediate dye reduction, which was significantly enhanced by exposure to diffuse light from fluorescent tubes in the laboratory 8 h per day. The reduction of resazurin by various cell culture media was time and temperature dependent, and it was significantly enhanced......'s nutrient mixture F-10 and F-12. Fetal calf serum (5-20%) slightly decreased resazurin reduction during the first 2 days of incubation. The reduction of resazurin by mammalian cell culture media do not appear to be problematic under normal culture conditions, and it is primarily dependent upon the presence...

  3. Dissolution of short and long rockwool and glasswool fibers by macrophages in flowthrough cell culture.

    Science.gov (United States)

    Luoto, K; Holopainen, M; Kangas, J; Kalliokoski, P; Savolainen, K

    1998-07-01

    Dissolution of MMVF (man-made vitreous fibers) by macrophages has previously been studied utilizing cell cultures in wells. A new, more dynamic method has been developed to explore the effects of macrophages on MMVF dissolution. In this method, the culture medium flows through a membrane on which the macrophages and fibers are placed. The dissolution of short and long rockwool and glasswool fibers was investigated in the present study by macrophages by assessing the dissolution of Si (silicon), Fe (iron), and Al (aluminium) from the fibers. Dissolution of these elements usually increased as a function of time. Generally, the dissolution of elements from the fibers in the flowthrough culture exceeded that observed with the culture in wells system. The dissolution of glasswool fibers was greater in medium than in cell culture, whereas the opposite was true for rockwool fibers. Dissolution of Si was greater from glasswool than from rockwool fibers, while the opposite was true for Fe and Al. Macrophages that had phagocytized fibers in flowthrough culture contained Si, and there were also precipitations with Si in the samples. The fibers in the flowthrough culture also exhibited surface changes such as breakings, pittings, etching, and peeling. The short rockwool fibers tended to fracture more than short glasswool fibers, while long glasswool fibers were more extensively broken than short glasswool fibers. The results with this new, dynamic, flowthrough culture method with macrophages demonstrate that this method provides valuable information on the abilities of macrophages to dissolve MMVF leading to subsequent morphological changes of fibers.

  4. Automation of 3D cell culture using chemically defined hydrogels.

    Science.gov (United States)

    Rimann, Markus; Angres, Brigitte; Patocchi-Tenzer, Isabel; Braum, Susanne; Graf-Hausner, Ursula

    2014-04-01

    Drug development relies on high-throughput screening involving cell-based assays. Most of the assays are still based on cells grown in monolayer rather than in three-dimensional (3D) formats, although cells behave more in vivo-like in 3D. To exemplify the adoption of 3D techniques in drug development, this project investigated the automation of a hydrogel-based 3D cell culture system using a liquid-handling robot. The hydrogel technology used offers high flexibility of gel design due to a modular composition of a polymer network and bioactive components. The cell inert degradation of the gel at the end of the culture period guaranteed the harmless isolation of live cells for further downstream processing. Human colon carcinoma cells HCT-116 were encapsulated and grown in these dextran-based hydrogels, thereby forming 3D multicellular spheroids. Viability and DNA content of the cells were shown to be similar in automated and manually produced hydrogels. Furthermore, cell treatment with toxic Taxol concentrations (100 nM) had the same effect on HCT-116 cell viability in manually and automated hydrogel preparations. Finally, a fully automated dose-response curve with the reference compound Taxol showed the potential of this hydrogel-based 3D cell culture system in advanced drug development.

  5. Cell culture supernatants for detection perforin ELISA

    African Journals Online (AJOL)

    Najwa

    2014-02-19

    Feb 19, 2014 ... Leukemia is a cancer originating in any of hematopoietic cell that tends to ... treatment of children (Borek and Jaskolski, 2001). The current study was .... which led to the best results at 48 h of exposure than after 72 h of cells ...

  6. Differential heat shock response of primary human cell cultures and established cell lines

    DEFF Research Database (Denmark)

    Richter, W W; Issinger, O G

    1986-01-01

    degrees C treatment, whereas in immortalized cell lines usually 90% of the cells were found in suspension. Enhanced expression of the major heat shock protein (hsp 70) was found in all heat-treated cells. In contrast to the primary cell cultures, established and transformed cell lines synthesized...

  7. Establishment of a long-term three-dimensional primary culture of mouse glandular stomach epithelial cells within the stem cell niche

    International Nuclear Information System (INIS)

    Katano, Takahito; Ootani, Akifumi; Mizoshita, Tsutomu; Tanida, Satoshi; Tsukamoto, Hironobu; Ozeki, Keiji; Ebi, Masahide; Mori, Yoshinori; Kataoka, Hiromi; Kamiya, Takeshi; Toda, Shuji; Joh, Takashi

    2013-01-01

    Highlights: ► We established a 3D culture system to allow long-term culture of stomach cells. ► In this culture system, gastric epithelial cells grew for about 3 months. ► The cultured cells differentiated into multi-units of the stomach. ► This culture method should be useful for elucidating the cause of gastric diseases. -- Abstract: Compared to the small intestine and colon, little is known about stem cells in the stomach because of a lack of specific stem cell markers and an in vitro system that allows long-term culture. Here we describe a long-term three-dimensional (3D) primary gastric culture system within the stem cell niche. Glandular stomach cells from neonatal mice cultured in collagen gel yielded expanding sphere-like structures for 3 months. The wall of the gastrospheres consisted of a highly polarized epithelial monolayer with an outer lining of myofibroblasts. The epithelial cells showed a tall columnar cell shape, basal round nuclei, and mucus-filled cytoplasm as well as expression of MUC5AC, indicating differentiation into gastric surface mucous cells. These cells demonstrated the features of fully differentiated gastric surface mucous cells such as microvilli, junctional complexes, and glycogen and secretory granules. Fewer than 1% of cultured epithelial cells differentiated into enteroendocrine cells. Active proliferation of the epithelial cells and many apoptotic cells in the inner lumen revealed the rapid cell turnover in gastrospheres in vitro. This method enables us to investigate the role of signaling between cell–cell and epithelial–mesenchymal interactions in an environment that is extremely similar to the in vivo environment

  8. Establishment of a long-term three-dimensional primary culture of mouse glandular stomach epithelial cells within the stem cell niche

    Energy Technology Data Exchange (ETDEWEB)

    Katano, Takahito [Department of Gastroenterology and Metabolism, Nagoya City University Graduate School of Medical Sciences, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Ootani, Akifumi [Department of Gastroenterology and GI Endoscopy Center, Shin-Kokura Hospital, Federation of National Public Service Personnel Mutual Aid Associations, 1-3-1 Kanada, Kokurakita-ku, Kitakyushu 803-0816 (Japan); Department of Internal Medicine, Faculty of Medicine, Saga University, 5-1-1 Nabeshima, Saga 849-8501 (Japan); Mizoshita, Tsutomu, E-mail: tmizoshi@med.nagoya-cu.ac.jp [Department of Gastroenterology and Metabolism, Nagoya City University Graduate School of Medical Sciences, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Tanida, Satoshi; Tsukamoto, Hironobu; Ozeki, Keiji; Ebi, Masahide; Mori, Yoshinori; Kataoka, Hiromi; Kamiya, Takeshi [Department of Gastroenterology and Metabolism, Nagoya City University Graduate School of Medical Sciences, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Toda, Shuji [Department of Pathology and Microbiology, Faculty of Medicine, Saga University, 5-1-1 Nabeshima, Saga 849-8501 (Japan); Joh, Takashi [Department of Gastroenterology and Metabolism, Nagoya City University Graduate School of Medical Sciences, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan)

    2013-03-22

    Highlights: ► We established a 3D culture system to allow long-term culture of stomach cells. ► In this culture system, gastric epithelial cells grew for about 3 months. ► The cultured cells differentiated into multi-units of the stomach. ► This culture method should be useful for elucidating the cause of gastric diseases. -- Abstract: Compared to the small intestine and colon, little is known about stem cells in the stomach because of a lack of specific stem cell markers and an in vitro system that allows long-term culture. Here we describe a long-term three-dimensional (3D) primary gastric culture system within the stem cell niche. Glandular stomach cells from neonatal mice cultured in collagen gel yielded expanding sphere-like structures for 3 months. The wall of the gastrospheres consisted of a highly polarized epithelial monolayer with an outer lining of myofibroblasts. The epithelial cells showed a tall columnar cell shape, basal round nuclei, and mucus-filled cytoplasm as well as expression of MUC5AC, indicating differentiation into gastric surface mucous cells. These cells demonstrated the features of fully differentiated gastric surface mucous cells such as microvilli, junctional complexes, and glycogen and secretory granules. Fewer than 1% of cultured epithelial cells differentiated into enteroendocrine cells. Active proliferation of the epithelial cells and many apoptotic cells in the inner lumen revealed the rapid cell turnover in gastrospheres in vitro. This method enables us to investigate the role of signaling between cell–cell and epithelial–mesenchymal interactions in an environment that is extremely similar to the in vivo environment.

  9. Animal-cell culture in aqueous two-phase systems

    NARCIS (Netherlands)

    Zijlstra, G.M.

    1998-01-01

    In current industrial biotechnology, animal-cell culture is an important source of therapeutic protein products. The conventional animal-cell production processes, however, include many unit operations as part of the fermentation and downstream processing strategy. The research described in

  10. Endothelial cell cultures as a tool in biomaterial research

    NARCIS (Netherlands)

    Kirkpatrick, CJ; Otto, M; van Kooten, T; Krump, [No Value; Kriegsmann, J; Bittinger, F

    1999-01-01

    Progress in biocompatibility and tissue engineering would today be inconceivable without the aid of in vitro techniques. Endothelial cell cultures represent a valuable tool not just in haemocompatibility testing, but also in the concept of designing hybrid organs. In the past endothelial cells (EC)

  11. Radiosensitivity of cultured insect cells: I. Lepidoptera

    International Nuclear Information System (INIS)

    Koval, T.M.

    1983-01-01

    The radiosensitivity of five lepidopteran insect cell lines representing five different genera has been investigated. These lines are: (1) TN-368, Trichoplusia ni; (2) IPLB-SF-1254, Spodoptera frugiperda; (3) IPLB-1075, Heliothis zea; (4) MRRL-CHl, clone GVl, Manduca sexta; and (5) IAL-PID2, Plodia interpunctella. The cell lines grew at different rates and had population doubling times that ranged from 19 to 52 hr. All of the lines are highly heteroploid and have approximate chromosome numbers near or above 100. The chromosomes are very small. All of the lines are extremely radioresistant; cell populations are able to recover from 260 kVp X-ray exposures up to and including 400 Gy, the highest dose examined. Cell survival curves were obtainable for only the TN-368 and IPLB-SF-1254 lines. The TN-368 cells displayed a biphasic survival response with D 0 , d/sub q/, and n values of 65.7 and 130.2 Gy, 9.0 and -36.1 Gy, and 1.2 and 0.8, respectively, for the steep and shallow portions of the curve. The IPLB-SF-1254 cells had a D 0 of 63.9 Gy. D/sub q/ of 19.0 Gy, and n value of 1.4. These studies provide definitive evidence of the radioresistance of lepidopteran cells, and suggest that this radioresistance is a characteristic of lepidopteran insects

  12. Adenosine formation in contracting primary rat skeletal muscle cells and endothelial cells in culture

    DEFF Research Database (Denmark)

    Hellsten, Ylva; Frandsen, Ulrik

    1997-01-01

    1. The present study examined the capacity for adenosine formation, uptake and metabolism in contracting primary rat muscle cells and in microvascular endothelial cells in culture. 2. Strong and moderate electrical simulation of skeletal muscle cells led to a significantly greater increase....... 3. Addition of microvascular endothelial cells to the cultured skeletal muscle cells enhanced the contraction-induced accumulation of extracellular adenosine (P Skeletal muscle cells were...... in the extracellular adenosine concentration (421 +/- 91 and 235 +/- 30 nmol (g protein)-1, respectively; P muscle cells (161 +/- 20 nmol (g protein)-1). The ATP concentration was lower (18%; P contracted, but not in the moderately contracted muscle cells...

  13. Thymic epithelial cells. I. Expression of strong suppressive (veto) activity in mouse thymic epithelial cell cultures

    DEFF Research Database (Denmark)

    Claesson, Mogens Helweg; Ropke, C

    1990-01-01

    We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level. It is conclu......We show that thymic epithelial cells grown under serum-free conditions in a chemically defined culture medium can act as veto cells in vitro. The veto activity of thymic epithelial cells results in inactivation of specific alloreactive cytotoxic T-cell precursors at the clonal level...

  14. Culture and Characterization of Circulating Endothelial Progenitor Cells in Patients with Renal Cell Carcinoma.

    Science.gov (United States)

    Gu, Wenyu; Sun, Wei; Guo, Changcheng; Yan, Yang; Liu, Min; Yao, Xudong; Yang, Bin; Zheng, Junhua

    2015-07-01

    Although emerging evidence demonstrates increased circulating endothelial progenitor cells in patients with solid tumors, to our knowledge it is still unknown whether such cells can be cultured from patients with highly angiogenic renal cell carcinoma. We cultured and characterized circulating endothelial progenitor cells from patients with renal cell carcinoma. The circulating endothelial progenitor cell level (percent of CD45(-)CD34(+) VEGF-R2(+) cells in total peripheral blood mononuclear cells) was quantified in 47 patients with renal cell carcinoma and 40 healthy controls. Peripheral blood mononuclear cells were then isolated from 33 patients with renal cell carcinoma and 30 healthy controls to culture and characterize circulating endothelial progenitor cells. The circulating endothelial progenitor cell level was significantly higher in patients with renal cell carcinoma than in healthy controls (0.276% vs 0.086%, p cells first emerged significantly earlier in patient than in control preparations (6.72 vs 14.67 days, p culture success rate (87.8% vs 40.0% of participants) and the number of colonies (10.06 vs 1.83) were significantly greater for patients than for controls (each p cell level correlated positively with the number of patient colonies (r = 0.762, p Cells cultured from patients and controls showed a similar growth pattern, immunophenotype, ability to uptake Ac-LDL and bind lectin, and form capillary tubes in vitro. However, significantly more VEGF-R2(+) circulating endothelial progenitor cells were found in preparations from patients with renal cell carcinoma than from healthy controls (21.1% vs 13.4%, p cell colonies, a higher cell culture success rate and more colonies were found for patients with renal cell carcinoma than for healthy controls. Results indicate the important significance of VEGF-R2(+) circulating endothelial progenitors in patients with renal cell carcinoma. Copyright © 2015 American Urological Association Education and Research

  15. Advanced Good Cell Culture Practice for human primary, stem cell-derived and organoid models as well as microphysiological systems.

    Science.gov (United States)

    Pamies, David; Bal-Price, Anna; Chesné, Christophe; Coecke, Sandra; Dinnyes, Andras; Eskes, Chantra; Grillari, Regina; Gstraunthaler, Gerhard; Hartung, Thomas; Jennings, Paul; Leist, Marcel; Martin, Ulrich; Passier, Robert; Schwamborn, Jens C; Stacey, Glyn N; Ellinger-Ziegelbauer, Heidrun; Daneshian, Mardas

    2018-04-13

    A major reason for the current reproducibility crisis in the life sciences is the poor implementation of quality control measures and reporting standards. Improvement is needed, especially regarding increasingly complex in vitro methods. Good Cell Culture Practice (GCCP) was an effort from 1996 to 2005 to develop such minimum quality standards also applicable in academia. This paper summarizes recent key developments in in vitro cell culture and addresses the issues resulting for GCCP, e.g. the development of induced pluripotent stem cells (iPSCs) and gene-edited cells. It further deals with human stem-cell-derived models and bioengineering of organo-typic cell cultures, including organoids, organ-on-chip and human-on-chip approaches. Commercial vendors and cell banks have made human primary cells more widely available over the last decade, increasing their use, but also requiring specific guidance as to GCCP. The characterization of cell culture systems including high-content imaging and high-throughput measurement technologies increasingly combined with more complex cell and tissue cultures represent a further challenge for GCCP. The increasing use of gene editing techniques to generate and modify in vitro culture models also requires discussion of its impact on GCCP. International (often varying) legislations and market forces originating from the commercialization of cell and tissue products and technologies are further impacting on the need for the use of GCCP. This report summarizes the recommendations of the second of two workshops, held in Germany in December 2015, aiming map the challenge and organize the process or developing a revised GCCP 2.0.

  16. Duchenne muscular dystrophy: normal ATP turnover in cultured cells

    International Nuclear Information System (INIS)

    Fox, I.H.; Bertorini, T.; Palmieri, G.M.A.; Shefner, R.

    1986-01-01

    This paper examines ATP metabolism in cultured muscle cells and fibroblasts from patients with Duchenne dystrophy. ATP and ADP levels were the same in cultured cells from normal subjects and patients and there was no difference in ATP synthesis or degradation. The ATP synthesis was measured by the incorporation of C 14-U-adenine into aTP and ADP. although there was a significant decrease in radioactively labelled ATP after incubation with deoxyglucose in Duchenne muscle cells, there was no difference in ATP concentration of ADP metabolism

  17. Cell culture plastics with immobilized interleukin-4 for monocyte differentiation

    DEFF Research Database (Denmark)

    Hansen, Morten; Hjortø, Gertrud Malene; Met, Ozcan

    2011-01-01

    in water instead of phosphate-buffered saline. Passively adsorbed IL-4 was observed to induce differentiation to dendritic cells, but analysis of cell culture supernatants revealed that leakage of IL-4 into solution could account for the differentiation observed. Covalent attachment resulted in bound IL-4...... at similar concentrations to the passive adsorption process, as measured by enzyme-linked immunosorbent assays, and the bound IL-4 did not leak into solution to any measurable extent during cell culture. However, covalently bound IL-4 was incapable of inducing monocyte differentiation. This may be caused...

  18. Semi-automated relative quantification of cell culture contamination with mycoplasma by Photoshop-based image analysis on immunofluorescence preparations.

    Science.gov (United States)

    Kumar, Ashok; Yerneni, Lakshmana K

    2009-01-01

    Mycoplasma contamination in cell culture is a serious setback for the cell-culturist. The experiments undertaken using contaminated cell cultures are known to yield unreliable or false results due to various morphological, biochemical and genetic effects. Earlier surveys revealed incidences of mycoplasma contamination in cell cultures to range from 15 to 80%. Out of a vast array of methods for detecting mycoplasma in cell culture, the cytological methods directly demonstrate the contaminating organism present in association with the cultured cells. In this investigation, we report the adoption of a cytological immunofluorescence assay (IFA), in an attempt to obtain a semi-automated relative quantification of contamination by employing the user-friendly Photoshop-based image analysis. The study performed on 77 cell cultures randomly collected from various laboratories revealed mycoplasma contamination in 18 cell cultures simultaneously by IFA and Hoechst DNA fluorochrome staining methods. It was observed that the Photoshop-based image analysis on IFA stained slides was very valuable as a sensitive tool in providing quantitative assessment on the extent of contamination both per se and in comparison to cellularity of cell cultures. The technique could be useful in estimating the efficacy of anti-mycoplasma agents during decontaminating measures.

  19. Cultural adaptation and translation of measures: an integrated method.

    Science.gov (United States)

    Sidani, Souraya; Guruge, Sepali; Miranda, Joyal; Ford-Gilboe, Marilyn; Varcoe, Colleen

    2010-04-01

    Differences in the conceptualization and operationalization of health-related concepts may exist across cultures. Such differences underscore the importance of examining conceptual equivalence when adapting and translating instruments. In this article, we describe an integrated method for exploring conceptual equivalence within the process of adapting and translating measures. The integrated method involves five phases including selection of instruments for cultural adaptation and translation; assessment of conceptual equivalence, leading to the generation of a set of items deemed to be culturally and linguistically appropriate to assess the concept of interest in the target community; forward translation; back translation (optional); and pre-testing of the set of items. Strengths and limitations of the proposed integrated method are discussed. (c) 2010 Wiley Periodicals, Inc.

  20. [Human myoblast culture as muscle stem cells in medical and biological studies].

    Science.gov (United States)

    Terekhov, S M; Krokhina, T B; Shishkin, S S; Krakhmaleva, I N; Zakharov, S F; Ershova, E S

    2001-01-01

    The method for obtaining human myoblast culture has been modified to consider the specific histological localization of the satellite cells as well as their growth properties; the cultivation conditions have been selected to grow up to 150000 cells/cm2. At high densities, the cells remain mononuclear and preserve their typical myoblast morphology as well as the capacity for fusion and the formation of myotubes. By contrast to fibroblasts, up to 80% of the cells in the myoblast culture were positive in the acid phosphatase test, which indicates their stem nature. The obtained myoblast cultures were used in the clinical tests of cell-mediated gene therapy of Duchenne's muscular dystrophy as well as in the bioassay for the effects of biologically active compounds.

  1. Miniature Bioreactor System for Long-Term Cell Culture

    Science.gov (United States)

    Gonda, Steve R.; Kleis, Stanley J.; Geffert, Sandara K.

    2010-01-01

    A prototype miniature bioreactor system is designed to serve as a laboratory benchtop cell-culturing system that minimizes the need for relatively expensive equipment and reagents and can be operated under computer control, thereby reducing the time and effort required of human investigators and reducing uncertainty in results. The system includes a bioreactor, a fluid-handling subsystem, a chamber wherein the bioreactor is maintained in a controlled atmosphere at a controlled temperature, and associated control subsystems. The system can be used to culture both anchorage-dependent and suspension cells, which can be either prokaryotic or eukaryotic. Cells can be cultured for extended periods of time in this system, and samples of cells can be extracted and analyzed at specified intervals. By integrating this system with one or more microanalytical instrument(s), one can construct a complete automated analytical system that can be tailored to perform one or more of a large variety of assays.

  2. Neural stem cell isolation and culture from C57BL/6 mice

    Directory of Open Access Journals (Sweden)

    S Koirala

    2015-07-01

    Full Text Available INTRODUCTION A widely used in vitro culture, the neurosphere assay (NSA has provided a means to retrospectively identify neural progenitor cells as well as to determine both their selfrenewal capacity. Objective of study was to isolate and compare growth of the embryonic neuronal stem cell and adult neuronal stem cells in presence of Epidermal Growth Factor (EGF and Fibroblastic Growth Factor (FGF2. MATERIALS AND METHODS Embryonic neuronal stem cell were collected from cortical plate of dorsal telencephalon of fifteen C57BL/6 transgenic mice using stereoscopic microscope on 11th gestational day (GD. Adult mammalian neuronal stem cells taken from subventricular zone (SVZ of the lateral ventricles and subgranular layer of the dentate gyrus of the hippocampus were cultured. The growth for the neurosphere was then observed in interval of 24 and 72 hours. RESULT The adult stem cell culture showed few intact cells with high amount of debris and 9% heterogeneous sphere after 24 hours while only 20 % was observed at the end of 72 hours. Higher proliferation rate was observed in embryonic neurospheres than the adult stem cell culture. CONCLUSION Presence of EGF and basic FGF2 is essential for culture of neurospheres.DOI: http://dx.doi.org/10.3126/jcmsn.v10i2.12946 Journal of College of Medical Sciences-Nepal, 2014, Vol.10(2; 1-3

  3. Label-Free Raman Hyperspectral Imaging of Single Cells Cultured on Polymer Substrates.

    Science.gov (United States)

    Sinjab, Faris; Sicilia, Giovanna; Shipp, Dustin W; Marlow, Maria; Notingher, Ioan

    2017-12-01

    While Raman hyperspectral imaging has been widely used for label-free mapping of biomolecules in cells, these measurements require the cells to be cultured on weakly Raman scattering substrates. However, many applications in biological sciences and engineering require the cells to be cultured on polymer substrates that often generate large Raman scattering signals. Here, we discuss the theoretical limits of the signal-to-noise ratio in the Raman spectra of cells in the presence of polymer signals and how optical aberrations may affect these measurements. We show that Raman spectra of cells cultured on polymer substrates can be obtained using automatic subtraction of the polymer signals and demonstrate the capabilities of these methods in two important applications: tissue engineering and in vitro toxicology screening of drugs. Apart from their scientific and technological importance, these applications are examples of the two most common measurement configurations: (1) cells cultured on an optically thick polymer substrate measured using an immersion/dipping objective; and (2) cells cultured on a transparent polymer substrate and measured using an inverted optical microscope. In these examples, we show that Raman hyperspectral data sets with sufficient quality can be successfully acquired to map the distribution of common biomolecules in cells, such as nucleic acids, proteins, and lipids, as well as detecting the early stages of apoptosis. We also discuss strategies for further improvements that could expand the application of Raman hyperspectral imaging on polymer substrates even further in biomedical sciences and engineering.

  4. Enhanced Mulberroside A Production from Cell Suspension and Root Cultures of Morus alba Using Elicitation.

    Science.gov (United States)

    Komaikul, Jukrapun; Kitisripanya, Tharita; Tanaka, Hiroyuki; Sritularak, Boonchoo; Putalun, Waraporn

    2015-07-01

    Morus alba L. has been used in Asian traditional medicine as an anti-inflammatory, anti-asthmatic, anthelmintic and as a whitening agent in cosmetic products. Mulberroside A is the major active compound from M. alba root bark. In this study, cell suspension and root cultures of M. alba were established, and the effect of the elicitors on the enhancement of mulberroside A production in M. alba was investigated. The cell suspension and root cultures of M. alba were exposed to elicitors and then mulberroside A contents were determined by an indirect competitive ELISA method. High levels of mulberroside A were obtained by addition of 100 and 200 μM salicylic acid with 24 h exposure time in cell suspension cultures (37.9 ± 1.5 and 34.0 ± 4.7 mg/g dry wt., respectively). Furthermore, addition of yeast extract at 2 mg/mL with 24 h exposure time can significantly increase mulberroside A contents from both cell suspension (3.2-fold) and root cultures (6.6-fold). Mulberroside A contents from both cell suspension and root cultures after treatment with elicitors are similar or higher than those found in the intact root and root bark of several years old M. alba. These results indicate that mulberry tissue cultures using the elicitation method are interesting alternative sources for mulberroside A production.

  5. Cell killing and chromosomal aberration induced by heavy-ion beams in cultured human tumor cells

    International Nuclear Information System (INIS)

    Takakura, K.; Funada, A.; Mohri, M.; Lee, R.; Aoki, M.; Furusawa, Y.; Gotoh, E.

    2003-01-01

    Full text: To clarify the relation between cell death and chromosomal aberration in cultured human tumor cells irradaited with heavy-ion beams. The analyses were carried out on the basis of the linear energy transfer (LET) values of heavy ion beams as radiation source. Exponentially growing human tumor cells, Human Salivary Gland Tumor cells (HSG cells), were irradiated with various high energy heavy ions, such as 13 keV/micrometer carbon (C) ions as low LET charged particle radiation source, 120 keV/ micrometer carbon (C) ions and 440 keV/micrometer iron (Fe) ions as high LET charged particle radiation sources.The cell death was analysed by the colony formation method, and the chromosomal aberration and its repairing kinetics was analysed by prematurely chromosome condensation method (PCC method) using calyculin A. Chromatid-type breaks, isochromatid breaks and exchanges were scored for the samples from the cells keeping with various incubation time after irradiation. The LET dependence of the cell death was similar to that of the chromosome exchange formation after 12 hours incubation. A maximum peak was around 120 keV/micrometer. However it was not similar to the LET dependence of isochromatid breaks or chromatid breaks after 12 hours incubation. These results suggest that the exchanges formed in chromosome after irradiation should be one of essential causes to lead the cell death. The different quality of induced chromosome damage between high-LET and low-LET radiation was also shown. About 89 % and 88 % chromatid breaks induced by X rays and 13 keV/micrometer C ions were rejoined within 12 hours of post-irradiation, though only 71% and 58 % of chromatid breaks induced by 120 keV/micrometer C ions and 440 keV/micrometer Fe ions were rejoined within 12 hours of post-irradiation

  6. Efficient generation of hepatic cells from mesenchymal stromal cells by an innovative bio-microfluidic cell culture device.

    Science.gov (United States)

    Yen, Meng-Hua; Wu, Yuan-Yi; Liu, Yi-Shiuan; Rimando, Marilyn; Ho, Jennifer Hui-Chun; Lee, Oscar Kuang-Sheng

    2016-08-19

    Mesenchymal stromal cells (MSCs) are multipotent and have great potential in cell therapy. Previously we reported the differentiation potential of human MSCs into hepatocytes in vitro and that these cells can rescue fulminant hepatic failure. However, the conventional static culture method neither maintains growth factors at an optimal level constantly nor removes cellular waste efficiently. In addition, not only is the duration of differentiating hepatocyte lineage cells from MSCs required to improve, but also the need for a large number of hepatocytes for cell therapy has not to date been addressed fully. The purpose of this study is to design and develop an innovative microfluidic device to overcome these shortcomings. We designed and fabricated a microfluidic device and a culture system for hepatic differentiation of MSCs using our protocol reported previously. The microfluidic device contains a large culture chamber with a stable uniform flow to allow homogeneous distribution and expansion as well as efficient induction of hepatic differentiation for MSCs. The device enables real-time observation under light microscopy and exhibits a better differentiation efficiency for MSCs compared with conventional static culture. MSCs grown in the microfluidic device showed a higher level of hepatocyte marker gene expression under hepatic induction. Functional analysis of hepatic differentiation demonstrated significantly higher urea production in the microfluidic device after 21 days of hepatic differentiation. The microfluidic device allows the generation of a large number of MSCs and induces hepatic differentiation of MSCs efficiently. The device can be adapted for scale-up production of hepatic cells from MSCs for cellular therapy.

  7. Use of immunoradiometric analysis to determine Rickettsia antigens in cell cultures and chick embryos

    Energy Technology Data Exchange (ETDEWEB)

    Prozorovskiy, S.V.; Alekseeva, N.V.; Knyazeva, E.N.; Ignatovich, V.F.; Barkhatova, O.T.

    1984-02-01

    A modification of an immunoradiometric analysis to determine Rickettsia antigens in various biological substrates was studied, using rickettsious diagnostricums, egg and cell cultures of Rickettsia. The method was highly sensitive for the determination of minimal quantities of antigens in these substrates. The method appears to be promising for studies related to the detection of microorganisms and their antigens. 5 references.

  8. The replacement of serum by hormones in cell culture media.

    Science.gov (United States)

    Sato, G; Hayashi, I

    1976-12-01

    The replacement of serum by hormones in cell culture media. (Reemplazo del suero por hormonas en el medio de cultivo de células). Arch. Biol. Med. Exper. 10: 120-121, 1976. The serum used in cell culture media can be replaced by a mixture of hormones and some accesory blood factors. The pituitary cell line GH3 can be grown in a medium in which serum is replaced by triiodothyronine, transferrin, parathormone, tyrotrophin releasing hormone and somatomedins. Hela and BHK cell strains can also be grown in serum free medium supplemented with hormones. Each cell type appears to have different hormonal requirements yet it may found that some hormones are required for most cell types.

  9. Cell kinetics of differentiation of Na+-dependent hexose transport in a cultured renal epithelial cell line

    International Nuclear Information System (INIS)

    Cook, J.S.; Weiss, E.R.

    1985-01-01

    Fully differentiated cells of the renal proximal tubule have the capability of taking up hexoses across their apical borders by transport coupled to the Na + -electrochemical gradient. This property is also found in postconfluent cultures of the cloned cell line LLC-PK 1 , a morphologically polarized line of renal cells. Postconfluent cells develop the Na + -dependent capacity to transport hexoses at their apical surface. This function is not observable during the growth phase of the cultures. To analyze the developmental process at the cellular level a method has been derived to separate transporting cells, expressing the differentiated function, from nontransporting cells. The method is based on the swelling of the cells accompanying the uptake of the nonmetabolizable glucose analog alpha methylglucoside. The swollen cells have a lower buoyant density than the undifferentiated cells and may be separated from them on density gradients. Analysis of the distribution of cells on such gradients shows that after the cells reach confluence the undifferentiated subpopulation is recruited onto the differentiation pathway with a rate constant of 0.2 per day, that 5 to 7 days are required for a cell to traverse this pathway to the fully differentiated state, and that once the maximum uptake capacity is achieved the cells do not develop further

  10. Optimizing structural and mechanical properties of cryogel scaffolds for use in prostate cancer cell culturing

    International Nuclear Information System (INIS)

    Cecilia, A.; Baecker, A.; Hamann, E.; Rack, A.; Kamp, T. van de; Gruhl, F.J.; Hofmann, R.; Moosmann, J.; Hahn, S.; Kashef, J.; Bauer, S.; Farago, T.; Helfen, L.

    2017-01-01

    Prostate cancer (PCa) currently is the second most diagnosed cancer in men and the second most cause of cancer death after lung cancer in Western societies. This sets the necessity of modelling prostatic disorders to optimize a therapy against them. The conventional approach to investigating prostatic diseases is based on two-dimensional (2D) cell culturing. This method, however, does not provide a three-dimensional (3D) environment, therefore impeding a satisfying simulation of the prostate gland in which the PCa cells proliferate. Cryogel scaffolds represent a valid alternative to 2D culturing systems for studying the normal and pathological behavior of the prostate cells thanks to their 3D pore architecture that reflects more closely the physiological environment in which PCa cells develop. In this work the 3D morphology of three potential scaffolds for PCa cell culturing was investigated by means of synchrotron X-ray computed micro tomography (SXCμT) fitting the according requirements of high spatial resolution, 3D imaging capability and low dose requirements very well. In combination with mechanical tests, the results allowed identifying an optimal cryogel architecture, meeting the needs for a well-suited scaffold to be used for 3D PCa cell culture applications. The selected cryogel was then used for culturing prostatic lymph node metastasis (LNCaP) cells and subsequently, the presence of multi-cellular tumor spheroids inside the matrix was demonstrated again by using SXCμT. - Highlights: • Synthesis of cryogel scaffolds for prostate cancer cell culturing. • Study of cryogel morphology by synchrotron X-ray computed micro tomography. • Analysis of cryogel mechanical properties with laboratory techniques. • Culturing of prostate cancer cell in the optimal cryogel composition for 21 days. • 3D visualization of the cells by synchrotron X-ray computed micro tomography.

  11. Optimizing structural and mechanical properties of cryogel scaffolds for use in prostate cancer cell culturing

    Energy Technology Data Exchange (ETDEWEB)

    Cecilia, A. [Institute for Photon Science and Synchrotron Radiation (IPS), Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, D-76344 Eggenstein-Leopoldshafen (Germany); Baecker, A. [Institute of Microstructure Technology (IMT), Karlsruhe Institute of Technology (KIT), Hermann-von-Helmholtz-Platz 1 Bldg 329, Eggenstein-Leopoldshafen, Karlsruhe D-76344 (Germany); Hamann, E. [Institute for Photon Science and Synchrotron Radiation (IPS), Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, D-76344 Eggenstein-Leopoldshafen (Germany); Rack, A. [European Synchrotron Radiation Facility (ESRF), 6 rue Jules Horowitz, 38000 Grenoble (France); Kamp, T. van de [Laboratory for Applications of Synchrotron Radiation (LAS), Karlsruhe Institute of Technology, 6980, D-76128 Karlsruhe (Germany); Gruhl, F.J. [Institute of Microstructure Technology (IMT), Karlsruhe Institute of Technology (KIT), Hermann-von-Helmholtz-Platz 1 Bldg 329, Eggenstein-Leopoldshafen, Karlsruhe D-76344 (Germany); Hofmann, R. [Institute for Photon Science and Synchrotron Radiation (IPS), Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, D-76344 Eggenstein-Leopoldshafen (Germany); Moosmann, J. [Institute of Materials Research, Helmholtz-Zentrum Geesthacht (HZG), Max-Planck-Str. 1, D-21502 Geesthacht (Germany); Hahn, S.; Kashef, J.; Bauer, S.; Farago, T. [Institute for Photon Science and Synchrotron Radiation (IPS), Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, D-76344 Eggenstein-Leopoldshafen (Germany); Helfen, L. [Institute for Photon Science and Synchrotron Radiation (IPS), Karlsruhe Institute of Technology, Hermann-von-Helmholtz-Platz 1, D-76344 Eggenstein-Leopoldshafen (Germany); European Synchrotron Radiation Facility (ESRF), 6 rue Jules Horowitz, 38000 Grenoble (France); and others

    2017-02-01

    Prostate cancer (PCa) currently is the second most diagnosed cancer in men and the second most cause of cancer death after lung cancer in Western societies. This sets the necessity of modelling prostatic disorders to optimize a therapy against them. The conventional approach to investigating prostatic diseases is based on two-dimensional (2D) cell culturing. This method, however, does not provide a three-dimensional (3D) environment, therefore impeding a satisfying simulation of the prostate gland in which the PCa cells proliferate. Cryogel scaffolds represent a valid alternative to 2D culturing systems for studying the normal and pathological behavior of the prostate cells thanks to their 3D pore architecture that reflects more closely the physiological environment in which PCa cells develop. In this work the 3D morphology of three potential scaffolds for PCa cell culturing was investigated by means of synchrotron X-ray computed micro tomography (SXCμT) fitting the according requirements of high spatial resolution, 3D imaging capability and low dose requirements very well. In combination with mechanical tests, the results allowed identifying an optimal cryogel architecture, meeting the needs for a well-suited scaffold to be used for 3D PCa cell culture applications. The selected cryogel was then used for culturing prostatic lymph node metastasis (LNCaP) cells and subsequently, the presence of multi-cellular tumor spheroids inside the matrix was demonstrated again by using SXCμT. - Highlights: • Synthesis of cryogel scaffolds for prostate cancer cell culturing. • Study of cryogel morphology by synchrotron X-ray computed micro tomography. • Analysis of cryogel mechanical properties with laboratory techniques. • Culturing of prostate cancer cell in the optimal cryogel composition for 21 days. • 3D visualization of the cells by synchrotron X-ray computed micro tomography.

  12. Separation of active and inactive fractions from starved culture of Vibrio parahaemolyticus by density dependent cell sorting.

    Science.gov (United States)

    Nayak, Binaya Bhusan; Kamiya, Eriko; Nishino, Tomohiko; Wada, Minoru; Nishimura, Masahiko; Kogure, Kazuhiro

    2005-01-01

    The co-existence of physiologically different cells in bacterial cultures is a general phenomenon. We have examined the applicability of the density dependent cell sorting (DDCS) method to separate subpopulations from a long-term starvation culture of Vibrio parahaemolyticus. The cells were subjected to Percoll density gradient and separated into 12 fractions of different buoyant densities, followed by measuring the cell numbers, culturability, respiratory activity and leucine incorporation activity. While more than 78% of cells were in lighter fractions, about 95% of culturable cells were present in heavier fractions. The high-density subpopulations also had high proportion of cells capable of forming formazan granules. Although this was accompanied by the cell specific INT-reduction rate, both leucine incorporation rates and INT-reduction rates per cell had a peak at mid-density fraction. The present results indicated that DDCS could be used to separate subpopulations of different physiological conditions.

  13. Effect of Co-Culturing of Mice Liver Cells and Embryonic Carcinomatous Stem Cells on the Rate of Differentiation to Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    AA Pourfatollah

    2005-10-01

    Full Text Available Introduction: Considering the importance of co-culture in differentiation of embryonic stem cells, the aim of this study was evaluation of the effect of co-culturing fetal liver stroma cells with P19 cells on the line of differentiation. Materials and Methods: For this purpose, P19 cells were cultured directly in semisolid medium. These cells proliferated and primarily differentiated to colonies know as embryoid bodies (EBs after 8-12 days. The Ebs cells were trypsinized and dissociated to single or double cells. Then these cells were co-cultured on the mouse fetal liver feeder layer in the absence of exogenous factors. After 14-18 days, the colonies were studied morphologically by benzidine and giemsa staining and also counted under invert microscope. Results: The percentages of benzidine positive (or erythroid and negative colonies were 94% and 6% respectively and also the cells of colonies were studied by Giemsa staining. Results showed that they were myeloid or lymphoid type cells. Thus, the results show that in the presence of mouse fetal liver feeder layer, the number of erythroid colonies was increased. Conclusions: Therefore, this technique may be effective for differentiation of stem cells from different sources into hematopoietic cells and can be used in future for human cell therapy.

  14. Animal-cell culture media: History, characteristics, and current issues.

    Science.gov (United States)

    Yao, Tatsuma; Asayama, Yuta

    2017-04-01

    Cell culture technology has spread prolifically within a century, a variety of culture media has been designed. This review goes through the history, characteristics and current issues of animal-cell culture media. A literature search was performed on PubMed and Google Scholar between 1880 and May 2016 using appropriate keywords. At the dawn of cell culture technology, the major components of media were naturally derived products such as serum. The field then gradually shifted to the use of chemical-based synthetic media because naturally derived ingredients have their disadvantages such as large batch-to-batch variation. Today, industrially important cells can be cultured in synthetic media. Nevertheless, the combinations and concentrations of the components in these media remain to be optimized. In addition, serum-containing media are still in general use in the field of basic research. In the fields of assisted reproductive technologies and regenerative medicine, some of the medium components are naturally derived in nearly all instances. Further improvements of culture media are desirable, which will certainly contribute to a reduction in the experimental variation, enhance productivity among biopharmaceuticals, improve treatment outcomes of assisted reproductive technologies, and facilitate implementation and popularization of regenerative medicine.

  15. Dose verification by OSLDs in the irradiation of cell cultures

    International Nuclear Information System (INIS)

    Meca C, E. A.; Bourel, V.; Notcovich, C.; Duran, H.

    2015-10-01

    The determination of value of irradiation dose presents difficulties when targets are irradiated located in regions where electronic equilibrium of charged particle is not reached, as in the case of irradiation -in vitro- of cell lines monolayer-cultured, in culture dishes or flasks covered with culture medium. The present study aimed to implement a methodology for dose verification in irradiation of cells in culture media by optically stimulated luminescence dosimetry (OSLD). For the determination of the absorbed dose in terms of cell proliferation OSL dosimeters of aluminum oxide doped with carbon (Al 2 O 3 :C) were used, which were calibrated to the irradiation conditions of culture medium and at doses that ranged from 0.1 to 15 Gy obtained with a linear accelerator of 6 MV photons. Intercomparison measurements were performed with an ionization chamber of 6 cm 3 . Different geometries were evaluated by varying the thicknesses of solid water, air and cell culture medium. The results showed deviations below 2.2% when compared with the obtained doses of OSLDs and planning system used. Also deviations were observed below 3.4% by eccentric points of the irradiation plane, finding homogeneous dose distribution. Uncertainty in the readings was less than 2%. The proposed methodology contributes a contribution in the dose verification in this type of irradiations, eliminating from the calculation uncertainties, potential errors in settling irradiation or possible equipment failure with which is radiating. It also provides certainty about the survival curves to be plotted with the experimental data. (Author)

  16. Characteristics of ovulation method acceptors: a cross-cultural assessment.

    Science.gov (United States)

    Klaus, H; Labbok, M; Barker, D

    1988-01-01

    Five programs of instruction in the ovulation method (OM) in diverse geographic and cultural settings are described, and characteristics of approximately 200 consecutive OM acceptors in each program are examined. Major findings include: the religious background and family size of acceptors are variable, as is the level of previous contraceptive use. Acceptors are drawn from a wide range of socioeconomic and religious backgrounds; however, family planning intention was similarly distributed in all five countries. In sum, the ovulation method is accepted by persons from a variety of backgrounds within and between cultural setting.

  17. Determination of residual cell culture media components by MEKC.

    Science.gov (United States)

    Zhang, Junge; Chakraborty, Utpal; Foley, Joe P

    2009-11-01

    Folic acid, hypoxanthine, mycophenolic acid, nicotinic acid, riboflavin, and xanthine are widely used as cell culture media components in monoclonal antibody manufacturing. These components are subsequently removed during the downstream purification processes. This article describes a single MEKC method that can simultaneously determine all the listed compounds with acceptable LOD and LOQ. All the analytes were successfully separated by MEKC using running buffer containing 40 mM SDS, 20 mM sodium phosphate, and 20 mM sodium borate at pH 9.0. The MEKC method was compared to the corresponding CZE method using the same running buffer containing no SDS. The effect of SDS concentration on separation, the pH of the running buffer, and the detection wavelength were studied and optimal MEKC conditions were established. Good linearity was obtained with correlation coefficients of more than 0.99 for all analytes. Specificity, accuracy, and precision were also evaluated. The recovery was in the range of 89-112%. The precision results were in the range of 1.7-4.8%. The experimentally determined data demonstrated that the MEKC method is applicable to the determination of the six analytes in in-process samples from monoclonal antibody manufacturing processes.

  18. Effect of different stress factors on IL-6 and leptin expression in HELA cell cultures

    International Nuclear Information System (INIS)

    Chu Zhenwei; Yang Tao; Wang Luhuan; Hao Xiuhua; Yan Guangtao

    2009-01-01

    Objective: To study the effect of three stress factors high glucose (HG), lipopolysaccharide (LPS) and hydrogen peroxide (H 2 O 2 ) on the expression of culture supernatant IL-6 (IL-6) and leptin contents of HELA cell line. Methods: HELA cell culture models of severe inflammatory response syndrome were prepared with cultures treated with 50 mmol/L glucose (HG), 4 μg/ ml LPS and 100 μmol/L H 2 O 2 respectively and supernatant contents of IL-6 and leptin were measured with RIA at 1h, 6h and 24h. Results: Generally speaking, the culture supernatant contents of IL-6 gradually increased and leptin contents gradually decreased with significant differences from those in cultures not treated with either stress factor at 6h and 12h (P<0.05). Conclusion: Leptin as a possible anti-inflammatory cytokine might plays an important protective role in severe inflammatory response. (authors)

  19. Three-dimensional hydrogel cell culture systems for modeling neural tissue

    Science.gov (United States)

    Frampton, John

    Two-dimensional (2-D) neural cell culture systems have served as physiological models for understanding the cellular and molecular events that underlie responses to physical and chemical stimuli, control sensory and motor function, and lead to the development of neurological diseases. However, the development of three-dimensional (3-D) cell culture systems will be essential for the advancement of experimental research in a variety of fields including tissue engineering, chemical transport and delivery, cell growth, and cell-cell communication. In 3-D cell culture, cells are provided with an environment similar to tissue, in which they are surrounded on all sides by other cells, structural molecules and adhesion ligands. Cells grown in 3-D culture systems display morphologies and functions more similar to those observed in vivo, and can be cultured in such a way as to recapitulate the structural organization and biological properties of tissue. This thesis describes a hydrogel-based culture system, capable of supporting the growth and function of several neural cell types in 3-D. Alginate hydrogels were characterized in terms of their biomechanical and biochemical properties and were functionalized by covalent attachment of whole proteins and peptide epitopes. Methods were developed for rapid cross-linking of alginate hydrogels, thus permitting the incorporation of cells into 3-D scaffolds without adversely affecting cell viability or function. A variety of neural cell types were tested including astrocytes, microglia, and neurons. Cells remained viable and functional for longer than two weeks in culture and displayed process outgrowth in 3-D. Cell constructs were created that varied in cell density, type and organization, providing experimental flexibility for studying cell interactions and behavior. In one set of experiments, 3-D glial-endothelial cell co-cultures were used to model blood-brain barrier (BBB) structure and function. This co-culture system was

  20. Formation and action of oxygen activated species in cell cultures

    International Nuclear Information System (INIS)

    Hoffmann, M.E.; Meneghini, R.

    1982-01-01

    The differences of hydrogen peroxide sensibility of mammal cell lineages (man, mouse, chinese hamster) in culture are studied. The cellular survival and the frequency of DNA induced breaks by hydrogen peroxide are analysed. The efficiency of elimination of DNA breaks by cells is determined. The possible relation between the cell capacity of repair and its survival to hydrogen peroxide action is also discussed. (M.A.) [pt

  1. System-level modeling and simulation of the cell culture microfluidic biochip ProCell

    DEFF Research Database (Denmark)

    Minhass, Wajid Hassan; Pop, Paul; Madsen, Jan

    2010-01-01

    Microfluidic biochips offer a promising alternative to a conventional biochemical laboratory. There are two technologies for the microfluidic biochips: droplet-based and flow-based. In this paper we are interested in flow-based microfluidic biochips, where the liquid flows continuously through pre......-defined micro-channels using valves and pumps. We present an approach to the system-level modeling and simulation of a cell culture microfluidic biochip called ProCell, Programmable Cell Culture Chip. ProCell contains a cell culture chamber, which is envisioned to run 256 simultaneous experiments (viewed...

  2. Cell synchrony techniques. I. A comparison of methods

    Energy Technology Data Exchange (ETDEWEB)

    Grdina, D.J.; Meistrich, M.L.; Meyn, R.E.; Johnson, T.S.; White, R.A.

    1984-01-01

    Selected cell synchrony techniques, as applied to asynchronous populations of Chinese hamster ovary (CHO) cells, have been compared. Aliquots from the same culture of exponentially growing cells were synchronized using mitotic selection, mitotic selection and hydroxyurea block, centrifugal elutriation, or an EPICS V cell sorter. Sorting of cells was achieved after staining cells with Hoechst 33258. After syncronization by the various methods the relative distribution of cells in G/sub 1/, S, or G/sub 2/ + M phases of the cell cycle was determined by flow cytometry. Fractions of synchronized cells obtained from each method were replated and allowed to progress through a second cell cycle. Mitotic selection gave rise to relatively pure and unperturbed early G/sub 1/ phase cells. While cell synchrony rapidly dispersed with time, cells progressed through the cell cycle in 12 hr. Sorting with the EPIC V on the modal G/sub 1/ peak yielded a relatively pure but heterogeneous G/sub 1/ population (i.e. early to late G/sub 1/). Again, synchrony dispersed with time, but cell-cycle progression required 14 hr. With centrifugal elutriation, several different cell populations synchronized throughout the cell cycle could be rapidly obtained with a purity comparable to mitotic selection and cell sorting. It was concluded that, either alone or in combination with blocking agents such as hydroxyurea, elutriation and mitotic selection were both excellent methods for synchronizing CHO cells. Cell sorting exhibited limitations in sample size and time required for synchronizing CHO cells. Its major advantage would be its ability to isolate cell populations unique with respect to selected cellular parameters. 19 references, 9 figures.

  3. Lack of FasL expression in cultured human retinal pigment epithelial cells

    DEFF Research Database (Denmark)

    Kaestel, C G; Madsen, H O; Prause, J U

    2001-01-01

    Retinal pigment epithelial (RPE) cells have been proposed to play a part in maintaining the eye as an immune privileged organ. However, our knowledge of the implicated mechanism is still sparse. Fas ligand (FasL) expression of RPE cells is generally recognized to be essential for the immune...... privilege of the eye, but due to contradictory published results, it is unclear whether RPE cells express this molecule. The purpose of this study was to investigate the expression of FasL in RPE cells in vitro and in vivo. Cultured human fetal and adult RPE cells were examined by flow cytometry, Western...... blotting, RT-PCR and RNase Protection assay for FasL expression. Additionally, sections of ocular tissue were stained for FasL by immunohistochemistry. None of the used methods indicated FasL expression in cultured fetal or adult RPE cells of various passages. However, RPE cells in vivo, as judged from...

  4. Quantitative intracellular flux modeling and applications in biotherapeutic development and production using CHO cell cultures.

    Science.gov (United States)

    Huang, Zhuangrong; Lee, Dong-Yup; Yoon, Seongkyu

    2017-12-01

    Chinese hamster ovary (CHO) cells have been widely used for producing many recombinant therapeutic proteins. Constraint-based modeling, such as flux balance analysis (FBA) and metabolic flux analysis (MFA), has been developing rapidly for the quantification of intracellular metabolic flux distribution at a systematic level. Such methods would produce detailed maps of flows through metabolic networks, which contribute significantly to better understanding of metabolism in cells. Although these approaches have been extensively established in microbial systems, their application to mammalian cells is sparse. This review brings together the recent development of constraint-based models and their applications in CHO cells. The further development of constraint-based modeling approaches driven by multi-omics datasets is discussed, and a framework of potential modeling application in cell culture engineering is proposed. Improved cell culture system understanding will enable robust developments in cell line and bioprocess engineering thus accelerating consistent process quality control in biopharmaceutical manufacturing. © 2017 Wiley Periodicals, Inc.

  5. Human cultured cells are capable to incorporate isolated plant mitochondria loaded with exogenous DNA

    Directory of Open Access Journals (Sweden)

    Laktionov P. P.

    2012-07-01

    Full Text Available Aim. To investigate the possibility of human cultured cells to incorporate isolated mitochondria together with exogenous DNA introduced into organelles. Methods. Two approaches were used for this purpose, fluorescent labelling of mitochondria and/or DNA with subsequent analysis of the cells subjected to incubation by microscopy or by quantitative PCR. Results. We have shown that human cultured cells lines, HeLa and HUVEC, are capable to uptake isolated plant mitochondria and that this process depends on the incubation time and concentration of organelles present in medium. The incorporated mitochondria can serve as vehicles to deliver exogenous DNA into human cells, this DNA is then distributed in different cell compartments. Conclusions. These results are preliminary and need further investigations, including testing the possibility of human cells to incorporate the mitochondria of human or animal origin and creating genetic construction which could provide certain selectivity or stability of the transferred exogenous DNA upon cell uptake of the mitochondria as vectors.

  6. Microbial Diversity of a Camembert-Type Cheese Using Freeze-Dried Tibetan Kefir Coculture as Starter Culture by Culture-Dependent and Culture-Independent Methods

    Science.gov (United States)

    Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei

    2014-01-01

    The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese. PMID:25360757

  7. Microbial diversity of a Camembert-type cheese using freeze-dried Tibetan kefir coculture as starter culture by culture-dependent and culture-independent methods.

    Directory of Open Access Journals (Sweden)

    Jun Mei

    Full Text Available The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR-denaturing gradient gel electrophoresis (DGGE analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates. Meanwhile, Kazachstania servazzii (51 isolates represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates. However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese.

  8. Microbial diversity of a Camembert-type cheese using freeze-dried Tibetan kefir coculture as starter culture by culture-dependent and culture-independent methods.

    Science.gov (United States)

    Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei

    2014-01-01

    The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese.

  9. Development of a cell culture surface conversion technique using alginate thin film for evaluating effect upon cellular differentiation

    International Nuclear Information System (INIS)

    Nakashima, Y.; Tsusu, K.; Minami, K.; Nakanishi, Y.

    2014-01-01

    Here, we sought to develop a cell culture surface conversion technique that would not damage living cells. An alginate thin film, formed on a glass plate by spin coating of sodium alginate solution and dipping into calcium chloride solution, was used to inhibit adhesion of cells. The film could be removed by ethylenediaminetetraacetate (EDTA) at any time during cell culture, permitting observation of cellular responses to conversion of the culture surface in real time. Additionally, we demonstrated the validity of the alginate thin film coating method and the performance of the film. The thickness of the alginate thin film was controlled by varying the rotation speed during spin coating. Moreover, the alginate thin film completely inhibited the adhesion of cultured cells to the culture surface, irrespective of the thickness of the film. When the alginate thin film was removed from the culture surface by EDTA, the cultured cells adhered to the culture surface, and their morphology changed. Finally, we achieved effective differentiation of C2C12 myoblasts into myotube cells by cell culture on the convertible culture surface, demonstrating the utility of our novel technique

  10. Capture of cell culture-derived influenza virus by lectins: strain independent, but host cell dependent.

    Science.gov (United States)

    Opitz, Lars; Zimmermann, Anke; Lehmann, Sylvia; Genzel, Yvonne; Lübben, Holger; Reichl, Udo; Wolff, Michael W

    2008-12-01

    Strategies to control influenza outbreaks are focused mainly on prophylactic vaccination. Human influenza vaccines are trivalent blends of different virus subtypes. Therefore and due to frequent antigenic drifts, strain independent manufacturing processes are required for vaccine production. This study verifies the strain independency of a capture method based on Euonymus europaeus lectin-affinity chromatography (EEL-AC) for downstream processing of influenza viruses under various culture conditions propagated in MDCK cells. A comprehensive lectin binding screening was conducted for two influenza virus types from the season 2007/2008 (A/Wisconsin/67/2005, B/Malaysia/2506/2004) including a comparison of virus-lectin interaction by surface plasmon resonance technology. EEL-AC resulted in a reproducible high product recovery rate and a high degree of contaminant removal in the case of both MDCK cell-derived influenza virus types demonstrating clearly the general applicability of EEL-AC. In addition, host cell dependency of EEL-AC was studied with two industrial relevant cell lines: Vero and MDCK cells. However, the choice of the host cell lines is known to lead to different product glycosylation profiles. Hence, altered lectin specificities have been observed between the two cell lines, requiring process adaptations between different influenza vaccine production systems.

  11. Establishment and culture optimization of a new type of pituitary immortalized cell line

    Energy Technology Data Exchange (ETDEWEB)

    Kokubu, Yuko [Graduate School of Life and Environmental Sciences, The University of Tsukuba, Tsukuba, Ibaraki 305-8562 (Japan); Asashima, Makoto [Graduate School of Life and Environmental Sciences, The University of Tsukuba, Tsukuba, Ibaraki 305-8562 (Japan); Life Science Center of TARA, The University of Tsukuba, Ibaraki-ken 305-8577 (Japan); Kurisaki, Akira, E-mail: akikuri@hotmail.com [Graduate School of Life and Environmental Sciences, The University of Tsukuba, Tsukuba, Ibaraki 305-8562 (Japan); Biotechnology Research Institute for Drug Discovery, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8562 (Japan)

    2015-08-07

    The pituitary gland is a center of the endocrine system that controls homeostasis in an organism by secreting various hormones. The glandular anterior pituitary consists of five different cell types, each expressing specific hormones. However, their regulation and the appropriate conditions for their in vitro culture are not well defined. Here, we report the immortalization of mouse pituitary cells by introducing TERT, E6, and E7 transgenes. The immortalized cell lines mainly expressed a thyrotroph-specific thyroid stimulating hormone beta (Tshb). After optimization of the culture conditions, these immortalized cells proliferated and maintained morphological characteristics similar to those of primary pituitary cells under sphere culture conditions in DMEM/F12 medium supplemented with N2, B27, basic FGF, and EGF. These cell lines responded to PKA or PKC pathway activators and induced the expression of Tshb mRNA. Moreover, transplantation of the immortalized cell line into subcutaneous regions and kidney capsules of mice further increased Tshb expression. These results suggest that immortalization of pituitary cells with TERT, E6, and E7 transgenes is a useful method for generating proliferating cells for the in vitro analysis of pituitary regulatory mechanisms. - Highlights: • Mouse pituitary cell lines were immortalized by introducing TERT, E6, and E7. • The immortalized cell lines mainly expressed thyroid stimulating hormone beta. • The cell lines responded to PKA or PKC pathway activators, and induced Tshb.

  12. In vitro culture of skin fibroblast cells for potential cloning by nuclear transfer

    International Nuclear Information System (INIS)

    Gupta, S.C.; Gupta, N.; Ahlawat, S.P.S.; Kumar, A.; Taneja, R.; Sharma, R.; Sunder, S.; Tantia, M.S.

    2005-01-01

    Donor cell lines were developed from skin tissue for the conservation of the endangered Jaiselmeri camel breed of India. Average cell proliferation rates varied from 0.82 to 0.69 in different passages, and population doubling time from 29.3 h to 34.8 h. Around 15 population doublings were accomplished during this culturing. Cell viability was 97 to 99% in different passages. Growth curves of cells from the JC-5 cell line reached a plateau on day 7, while the slower-growing cultures of JC-3 showed elevation even on day 10, possibly due to donor age differences. Cell proliferation rates by both cell count and MTT absorbance showed similar patterns, with a correlation coefficient of 0.79. MTT assay, a colorimetric method, can handle large samples in somatic cell cultures. Diploid chromosomal counts in passages 1, 3 and 5 were normal (2N=74, XY) in 97% of the cells. Occasional metaphase plates showed polyploidy. The present baseline data on standard growth curve, linear relationship in colorimetric assay for estimation of cell proliferation rate, and normal ploidy and karyological levels in camel skin fibroblast cells in multiplication could be useful in developing competent donor somatic cell lines for conservation now and revival of this camel breed by cloning in the future. (author)

  13. 40 CFR 798.5300 - Detection of gene mutations in somatic cells in culture.

    Science.gov (United States)

    2010-07-01

    ... cells in culture. 798.5300 Section 798.5300 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5300 Detection of gene mutations in somatic cells in culture. (a) Purpose. Mammalian cell culture... selected by resistance to ouabain. (2) Description. Cells in suspension or monolayer culture are exposed to...

  14. Cell sources for in vitro human liver cell culture models

    Science.gov (United States)

    Freyer, Nora; Damm, Georg; Seehofer, Daniel; Knöspel, Fanny

    2016-01-01

    In vitro liver cell culture models are gaining increasing importance in pharmacological and toxicological research. The source of cells used is critical for the relevance and the predictive value of such models. Primary human hepatocytes (PHH) are currently considered to be the gold standard for hepatic in vitro culture models, since they directly reflect the specific metabolism and functionality of the human liver; however, the scarcity and difficult logistics of PHH have driven researchers to explore alternative cell sources, including liver cell lines and pluripotent stem cells. Liver cell lines generated from hepatomas or by genetic manipulation are widely used due to their good availability, but they are generally altered in certain metabolic functions. For the past few years, adult and pluripotent stem cells have been attracting increasing attention, due their ability to proliferate and to differentiate into hepatocyte-like cells in vitro. However, controlling the differentiation of these cells is still a challenge. This review gives an overview of the major human cell sources under investigation for in vitro liver cell culture models, including primary human liver cells, liver cell lines, and stem cells. The promises and challenges of different cell types are discussed with a focus on the complex 2D and 3D culture approaches under investigation for improving liver cell functionality in vitro. Finally, the specific application options of individual cell sources in pharmacological research or disease modeling are described. PMID:27385595

  15. HUMAN CELLS IN CULTURE: REVISlTED*

    African Journals Online (AJOL)

    advantages, e.g. the generation time is reduced to about. 1/10000 that of the ... or less reflects the cellular biology of the donor tissut:'Y .... X-linked. Autosomal recessive. Autosomal recessive. Autosomal recessive mothers of affected males, however, show that only 50% of the cell population is defective, which furnishes an.

  16. Immunogenicity of guinea pig cells transformed in culture by chemical carcinogens.

    Science.gov (United States)

    Ohanian, S H; McCabe, R P; Evans, C H

    1981-12-01

    The immunogenicity of inbred strain 2/N guinea pig fibroblasts transformed to the malignant state in vitro by chemical carcinogens was evaluated with the use of a variety of in vivo and in vitro methods including delayed-type hypersensitivity skin and tumor transplantation tests and analysis of antibody production by immunofluorescence, complement fixation, and staphylococcal protein A binding tests. Neoplastic transformation was induced by direct treatment of cells in culture with benzo[a]pyrene, 3-methylcholanthrene, or N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) or by the host-mediated method by which fetuses were exposed to diethylnitrosamine or MNNG in vivo prior to cell culture. Rabbits and syngeneic guinea pigs were inoculated with unirradiated and X-irradiated clonally derived cells. Delayed hypersensitivity skin reactions to immunizing or other cells were equivalent in immunized or control guinea pigs, and no protection to tumor outgrowth from a challenge inoculum of immunizing cells was observed. Antibody activity induced in the sera of immunized guinea pigs was cross-reactive and removed by absorption with nontumorigenic cells. Rabbit antisera after absorption with fetal guinea pig cells were nonreactive with the specific immunizing or other culture cells. Chemical carcinogen-induced neoplastic transformation of guinea pig cells can, therefore, occur without formation of detectable, individually distinct cell surface tumor-specific neoantigens.

  17. Immunogenicity of guinea pig cells transformed in culture by chemical carcinogens

    International Nuclear Information System (INIS)

    Ohanian, S.H.; McCabe, R.P.; Evans, C.H.

    1981-01-01

    The immunogenicity of inbred strain 2/N guinea pig fibroblasts transformed to the malignant state in vitro by chemical carcinogens was evaluated with the use of a variety of in vivo and in vitro methods including delayed-type hypersensitivity skin and tumor transplantation tests and analysis of antibody production by immunofluorescence, complement fixation, and staphylococcal protein A binding tests. Neoplastic transformation was induced by direct treatment of cells in culture with benzo[a]pyrene, 3-methylcholanthrene, or N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) or by the host-mediated method by which fetuses were exposed to diethylnitrosamine or MNNG in vivo prior to cell culture. Rabbits and syngeneic guinea pigs were inoculated with unirradiated and X-irradiated clonally derived cells. Delayed hypersensitivity skin reactions to immunizing or other cells were equivalent in immunized or control guinea pigs, and no protection to tumor outgrowth from a challenge inoculum of immunizing cells was observed. Antibody activity induced in the sera of immunized guinea pigs was cross-reactive and removed by absorption with nontumorigenic cells. Rabbit anitsera after absorption with fetal guinea pig cells were nonreactive with the specific immunizing or other cultured cells. Chemical carcinogen-induced neoplastic transformation of guinea pig cells can, therefore, occur without formation of detectable, individually distinct cell surface tumor-specific neoantigens

  18. In vitro culture and characterization of human umbilical cord blood-derived plasmacytoid dendritic cell subsets

    Directory of Open Access Journals (Sweden)

    PENG Jianping

    2015-11-01

    Full Text Available ObjectiveTo establish a method for in vitro culture of plasmacytoid dendritic cell (pDC. MethodsUmbilical cord blood (40 ml was collected from healthy parturients in the First Affiliated Hospital of Hunan University of Chinese Medicine, and cord blood mononuclear cell (CBMC were isolated. The CBMC were cultured for 7 days with RPMI 1640 complete medium containing rh Flt3-ligand (Flt3-L (100 ng/ml and rh interleukin (IL-3 (10 ng/ml, and the medium was half changed every 2 days. On the eighth day, CpG ODN (2 μg/ml was added to the cells, and the attached cells and supernatant were collected 24 h later for flow cytometry and interferon (IFNα measurement, respectively. On days 1, 3, 5, 7, and 8 of cell culture, the morphological changes of pDC were observed. Results After 2 h of culture, the CBMC showed circular, flat morphology. Twenty-four hours later, the cells began to adhere to the wall, with extended cytoplasm and increased volumes, and they became round and translucent, with scattered small colonies. On days 3-4 of culture, the cell volume continued increasing; most cells were round, and some had small protrusions; few cells were spindle-, tadpole-, star- or irregularly shaped; the number and volumes of colonies increased substantially. On days 5-8 of culture, the number of colonies and the number of cells in colonies gradually decreased, and suspended cells that were round or had small protrusions gradually increased in the medium. The cells expressing CD123, BDCA-2, and BDCA-4, which were considered pDC, were detected by flow cytometry. Flow cytometry revealed that the proportion of pDC in CBMC increased during the culture: increasing from 1.08% at the beginning of culture to 5.32% on day 4, and finally reaching a peak of 19.8% on day 8. On day 8, the level of IFNα in pDC culture supernatant was(11 302.61±1745.31 pg/ml. ConclusionpDC can be successfully induced in vitro by rh Flt3-L combined with IL-3 from human umbilical CBMC.

  19. Cultural relativism: maintenance of genomic imprints in pluripotent stem cell culture systems.

    Science.gov (United States)

    Greenberg, Maxim Vc; Bourc'his, Déborah

    2015-04-01

    Pluripotent stem cells (PSCs) in culture have become a widely used model for studying events occurring during mammalian development; they also present an exciting avenue for therapeutics. However, compared to their in vivo counterparts, cultured PSC derivatives have unique properties, and it is well established that their epigenome is sensitive to medium composition. Here we review the specific effects on genomic imprints in various PSC types and culture systems. Imprinted gene regulation is developmentally important, and imprinting defects have been associated with several human diseases. Therefore, imprint abnormalities in PSCs may have considerable consequences for downstream applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. In Vitro Culturing and Live Imaging of Drosophila Egg Chambers: A History and Adaptable Method.

    Science.gov (United States)

    Peters, Nathaniel C; Berg, Celeste A

    2016-01-01

    The development of the Drosophila egg chamber encompasses a myriad of diverse germline and somatic events, and as such, the egg chamber has become a widely used and influential developmental model. Advantages of this system include physical accessibility, genetic tractability, and amenability to microscopy and live culturing, the last of which is the focus of this chapter. To provide adequate context, we summarize the structure of the Drosophila ovary and egg chamber, the morphogenetic events of oogenesis, the history of egg-chamber live culturing, and many of the important discoveries that this culturing has afforded. Subsequently, we discuss various culturing methods that have facilitated analyses of different stages of egg-chamber development and different types of cells within the egg chamber, and we present an optimized protocol for live culturing Drosophila egg chambers.We designed this protocol for culturing late-stage Drosophila egg chambers and live imaging epithelial tube morphogenesis, but with appropriate modifications, it can be used to culture egg chambers of any stage. The protocol employs a liquid-permeable, weighted "blanket" to gently hold egg chambers against the coverslip in a glass-bottomed culture dish so the egg chambers can be imaged on an inverted microscope. This setup provides a more buffered, stable, culturing environment than previously published methods by using a larger volume of culture media, but the setup is also compatible with small volumes. This chapter should aid researchers in their efforts to culture and live-image Drosophila egg chambers, further augmenting the impressive power of this model system.

  1. Functional enhancement of chitosan and nanoparticles in cell culture, tissue engineering, and pharmaceutical applications

    Directory of Open Access Journals (Sweden)

    Wenjuan eGao

    2012-08-01

    Full Text Available Abstract: As a biomaterial, chitosan has been widely used in tissue engineering, wound healing, drug delivery, and other biomedical applications. It can be formulated in a variety of forms, such as powder, film, sphere, gel and fiber. These features make chitosan an almost ideal biomaterial in cell culture applications, and cell cultures arguably constitute the most practical way to evaluate biocompatibility and biotoxicity. The advantages of cell cultures are that they can be performed under totally controlled environments, allow high throughput functional screening, and are less costly, as compared to other assessment methods. Chitosan can also be modified into multilayer composite by combining with other polymers and moieties to alter the properties of chitosan for particular biomedical applications. This review briefly depicts and discusses applications of chitosan and nanoparticles in cell culture, in particular, the effects of chitosan and nanoparticles on cell adhesion, cell survival, and the underlying molecular mechanisms: both stimulatory and inhibitory influences are discussed. Our aim is to update the current status of how nanoparticles can be utilized to modify the properties of chitosan to advance the art of tissue engineering by using cell cultures.

  2. Definition and dynamic control of a continuous chromatography process independent of cell culture titer and impurities.

    Science.gov (United States)

    Chmielowski, Rebecca A; Mathiasson, Linda; Blom, Hans; Go, Daniel; Ehring, Hanno; Khan, Heera; Li, Hong; Cutler, Collette; Lacki, Karol; Tugcu, Nihal; Roush, David

    2017-12-01

    Advances in cell culture technology have enabled the production of antibody titers upwards of 30g/L. These highly productive cell culture systems can potentially lead to productivity bottlenecks in downstream purification due to lower column loadings, especially in the primary capture chromatography step. Alternative chromatography solutions to help remedy this bottleneck include the utilization of continuous processing systems such as periodic counter-current chromatography (PCC). Recent studies have provided methods to optimize and improve the design of PCC for cell culture titers up to about 3g/L. This paper defines a continuous loading strategy for PCC that is independent of cell culture background and encompasses cell culture titers up to about 31g/L. Initial experimentation showed a challenge with determining a difference in change in UV280nm signal (ie. ΔUV) between cell culture feed and monoclonal antibody (mAb) concentration. Further investigation revealed UV280nm absorbance of the cell culture feedstock without antibody was outside of the linear range of detection for a given cell pathlength. Additional experimentation showed the difference in ΔUV for various cell culture feeds can be either theoretically predicted by Beer's Law given a known absorbance of the media background and impurities or experimentally determined using various UV280nm cell pathlengths. Based on these results, a 0.35mm pathlength at UV280nm was chosen for dynamic control to overcome the background signal. The pore diffusion model showed good agreement with the experimental frontal analysis data, which resulted in definition of a ΔUV setpoint range between 20 and 70% for 3C-PCC experiments. Product quality of the elution pools was acceptable between various cell culture feeds and titers up to about 41g/L. Results indicated the following ΔUV setpoints to achieve robust dynamic control and maintain 3C-PCC yield: ∼20-45% for titers greater than 10g/L depending on UV absorbance of

  3. A Novel Method for Culturing of Leptothrix sp. Strain OUMS1 in Natural Conditions

    Directory of Open Access Journals (Sweden)

    Tomoko Suzuki

    2012-05-01

    Full Text Available Although some strains of Leptothrix spp. isolated from aquatic environments have been characterized by culturing them in laboratory conditions, they often show morphological and chemical features distinct from those found in natural environments. To resolve this discrepancy, a novel cultivation method was devised for culturing such strains in natural groundwater. Leptothrix sp. strain OUMS1 was pre-cultured in a medium lacking Fe for 2 days, and then injected into a small dialysis tube bag and immersed in a container with continuously flowing groundwater for 1–3 and 14 days. Microscopic analysis of the initial phase of sheath formation and arbitrary comparisons with medium cultures revealed that in groundwater the surface coat of the sheath comprised much thinner fibrils, and an inner sheath wall that was much thinner and more indistinct compared with medium cultures. These differences were probably attributable to poorer secretion from the cell surface in groundwater conditions. A nutrient-rich medium likely activates cell metabolism and promotes secretion, resulting in a thicker inner sheath wall and thicker outer coat fibrils. Aqueous-phase Fe was deposited on immature sheaths in a similar manner in both cultures. These results indicate that laboratory culture of isolated microbes does not always reflect their characteristics in natural environments.

  4. Dynamic cell culture system: a new cell cultivation instrument for biological experiments in space

    Science.gov (United States)

    Gmunder, F. K.; Nordau, C. G.; Tschopp, A.; Huber, B.; Cogoli, A.

    1988-01-01

    The prototype of a miniaturized cell cultivation instrument for animal cell culture experiments aboard Spacelab is presented (Dynamic cell culture system: DCCS). The cell chamber is completely filled and has a working volume of 200 microliters. Medium exchange is achieved with a self-powered osmotic pump (flowrate 1 microliter h-1). The reservoir volume of culture medium is 230 microliters. The system is neither mechanically stirred nor equipped with sensors. Hamster kidney (Hak) cells growing on Cytodex 3 microcarriers were used to test the biological performance of the DCCS. Growth characteristics in the DCCS, as judged by maximal cell density, glucose consumption, lactic acid secretion and pH, were similar to those in cell culture tubes.

  5. Reporting of sex as a variable in cardiovascular studies using cultured cells

    Directory of Open Access Journals (Sweden)

    Taylor K

    2011-11-01

    Full Text Available Abstract Background Chromosomal complement, including that provided by the sex chromosomes, influences expression of proteins and molecular signaling in every cell. However, less than 50% of the scientific studies published in 2009 using experimental animals reported sex as a biological variable. Because every cell has a sex, we conducted a literature review to determine the extent to which sex is reported as a variable in cardiovascular studies on cultured cells. Methods Articles from 10 cardiovascular journals with high impact factors (Circulation, J Am Coll Cardiol, Eur Heart J, Circ Res, Arterioscler Thromb Vasc Biol, Cardiovasc Res, J Mol Cell Cardiol, Am J Physiol Heart Circ Physiol, J Heart Lung Transplant and J Cardiovasc Pharmacol and published in 2010 were searched using terms 'cultured' and 'cells' in any order to determine if the sex of those cells was reported. Studies using established cell lines were excluded. Results Using two separate search strategies, we found that only 25 of 90 articles (28% and 20 of 101 articles (19.8% reported the sex of cells. Of those reporting the sex of cells, most (68.9%; n = 31 used only male cells and none used exclusively female cells. In studies reporting the sex of cells of cardiovascular origin, 40% used vascular smooth-muscle cells, and 30% used stem/progenitor cells. In studies using cells of human origin, 35% did not report the sex of those cells. None of the studies using neonatal cardiac myocytes reported the sex of those cells. Conclusions The complement of sex chromosomes in cells studied in culture has the potential to affect expression of proteins and 'mechanistic' signaling pathways. Therefore, consistent with scientific excellence, editorial policies should require reporting sex of cells used in in vitro experiments.

  6. Cell lineage identification and stem cell culture in a porcine model for the study of intestinal epithelial regeneration.

    Directory of Open Access Journals (Sweden)

    Liara M Gonzalez

    Full Text Available Significant advances in intestinal stem cell biology have been made in murine models; however, anatomical and physiological differences between mice and humans limit mice as a translational model for stem cell based research. The pig has been an effective translational model, and represents a candidate species to study intestinal epithelial stem cell (IESC driven regeneration. The lack of validated reagents and epithelial culture methods is an obstacle to investigating IESC driven regeneration in a pig model. In this study, antibodies against Epithelial Adhesion Molecule 1 (EpCAM and Villin marked cells of epithelial origin. Antibodies against Proliferative Cell Nuclear Antigen (PCNA, Minichromosome Maintenance Complex 2 (MCM2, Bromodeoxyuridine (BrdU and phosphorylated Histone H3 (pH3 distinguished proliferating cells at various stages of the cell cycle. SOX9, localized to the stem/progenitor cells zone, while HOPX was restricted to the +4/'reserve' stem cell zone. Immunostaining also identified major differentiated lineages. Goblet cells were identified by Mucin 2 (MUC2; enteroendocrine cells by Chromogranin A (CGA, Gastrin and Somatostatin; and absorptive enterocytes by carbonic anhydrase II (CAII and sucrase isomaltase (SIM. Transmission electron microscopy demonstrated morphologic and sub-cellular characteristics of stem cell and differentiated intestinal epithelial cell types. Quantitative PCR gene expression analysis enabled identification of stem/progenitor cells, post mitotic cell lineages, and important growth and differentiation pathways. Additionally, a method for long-term culture of porcine crypts was developed. Biomarker characterization and development of IESC culture in the porcine model represents a foundation for translational studies of IESC-driven regeneration of the intestinal epithelium in physiology and disease.

  7. Cytotoxicity of extracts of spices to cultured cells.

    Science.gov (United States)

    Unnikrishnan, M C; Kuttan, R

    1988-01-01

    The cytotoxicity of the extracts from eight different spices used in the Indian diet was determined using Dalton's lymphoma ascites tumor cells and human lymphocytes in vitro and Chinese Hamster Ovary cells and Vero cells in tissue culture. Alcoholic extracts of the spices were found to be more cytotoxic to these cells than their aqueous extracts. Alcoholic extracts of several spices inhibited cell growth at concentrations of 0.2-1 mg/ml in vitro and 0.12-0.3 mg/ml in tissue culture. Ginger, pippali (native to India; also called dried catkins), pepper, and garlic showed the highest activity followed by asafetida, mustard, and horse-gram (native to India). These extracts also inhibited the thymidine uptake into DNA.

  8. Three-dimensional spheroid culture promotes odonto/osteoblastic differentiation of dental pulp cells.

    Science.gov (United States)

    Yamamoto, Mioko; Kawashima, Nobuyuki; Takashino, Nami; Koizumi, Yu; Takimoto, Koyo; Suzuki, Noriyuki; Saito, Masahiro; Suda, Hideaki

    2014-03-01

    Three-dimensional (3D) spheroid culture is a method for creating 3D aggregations of cells and their extracellular matrix without a scaffold mimicking the actual tissues. The aim of this study was to evaluate the effects of 3D spheroid culture on the phenotype of immortalized mouse dental papilla cells (MDPs) that have the ability to differentiate into odontoblasts. We cultured MDPs for 1, 3, 7, and 14 days in 96-well low-attachment culture plates for 3D spheroid culture or flat-bottomed plates for two-dimensional (2D) monolayer culture. Cell proliferation and apoptosis were detected by immunohistochemical staining of Ki67 and cleaved caspase-3, respectively. Hypoxia was measured by the hypoxia probe LOX-1. Odonto/osteoblastic differentiation marker gene expression was evaluated by quantitative PCR. We also determined mineralized nodule formation, alkaline phosphatase (ALP) activity, and dentine matrix protein-1 (DMP1) expression. Vinculin and integrin signalling-related proteins were detected immunohistochemically. Odonto/osteoblastic marker gene expression and mineralized nodule formation were significantly up-regulated in 3D spheroid-cultured MDPs compared with those in 2D monolayer-cultured MDPs (podonto/osteoblastic differentiation of MDPs, which may be mediated by integrin signalling. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Optimization of human corneal endothelial cell culture: density dependency of successful cultures in vitro.

    Science.gov (United States)

    Peh, Gary S L; Toh, Kah-Peng; Ang, Heng-Pei; Seah, Xin-Yi; George, Benjamin L; Mehta, Jodhbir S

    2013-05-03

    Global shortage of donor corneas greatly restricts the numbers of corneal transplantations performed yearly. Limited ex vivo expansion of primary human corneal endothelial cells is possible, and a considerable clinical interest exists for development of tissue-engineered constructs using cultivated corneal endothelial cells. The objective of this study was to investigate the density-dependent growth of human corneal endothelial cells isolated from paired donor corneas and to elucidate an optimal seeding density for their extended expansion in vitro whilst maintaining their unique cellular morphology. Established primary human corneal endothelial cells were propagated to the second passage (P2) before they were utilized for this study. Confluent P2 cells were dissociated and seeded at four seeding densities: 2,500 cells per cm2 ('LOW'); 5,000 cells per cm2 ('MID'); 10,000 cells per cm2 ('HIGH'); and 20,000 cells per cm2 ('HIGH(×2)'), and subsequently analyzed for their propensity to proliferate. They were also subjected to morphometric analyses comparing cell sizes, coefficient of variance, as well as cell circularity when each culture became confluent. At the two lower densities, proliferation rates were higher than cells seeded at higher densities, though not statistically significant. However, corneal endothelial cells seeded at lower densities were significantly larger in size, heterogeneous in shape and less circular (fibroblastic-like), and remained hypertrophic after one month in culture. Comparatively, cells seeded at higher densities were significantly homogeneous, compact and circular at confluence. Potentially, at an optimal seeding density of 10,000 cells per cm2, it is possible to obtain between 10 million to 25 million cells at the third passage. More importantly, these expanded human corneal endothelial cells retained their unique cellular morphology. Our results demonstrated a density dependency in the culture of primary human corneal endothelial

  10. Differences in the characteristics of cell cultures established from seven human osteosarcomas

    International Nuclear Information System (INIS)

    Lloyd, E.L.; Henning, C.B.; Mackevicius, F.

    1975-01-01

    Cell cultures derived from seven human osteosarcomas have been characterized with respect to their pattern of growth and cell morphology using light microscopy, transmission electron microscopy, and scanning electron microscopy. Other characteristics studied included growth rates, chromosomal abnormalities, and ability to grow in low serum concentrations and on a semisolid substrate. Normal human fibroblasts in culture have also been examined by the same methods. The results show many differences both between individual osteosarcoma cultures and normal fibroblasts. Two of the osteosarcoma cultures were epithelium-like, and five had a more fibroblastic appearance when viewed by the light microscope. Examination by electron microscopy showed a wide variety of cells in each culture. Many of the features exhibited in the fibroblast-like tumor cells were different from those seen with the normal fibroblast cultures. Growth rates differed widely with characteristic doubling times varying between 1 and 7 days from the osteosarcoma cultures, compared to 3 to 4 days for normal fibroblasts. Unlike normal mouse fibroblasts, which grow poorly or not at all in low serum concentrations, the normal human fibroblasts tested grew almost as well in media with 1 percent serum as with 15 percent serum

  11. Dialectical Method and the Critical Political Economy of Culture

    Directory of Open Access Journals (Sweden)

    Brice Nixon

    2012-05-01

    Full Text Available This article argues that the quality that defines critical political economy is its critical method. Definitions of the critical political economy of culture are considered and shown to focus on specific theoretical concerns while not fully addressing the fundamental issue of method. Method is here discussed in terms of the way human reason is used to produce knowledge. A critical method for Marx is a historical materialist dialectical method, thus this paper argues for a deeper consideration of the Marxist dialectical method in relation to critical political-economic theorizing. Sources for methodological consideration from Marx to 20th-century Western Marxists are outlined. The potential contribution of the Marxist dialectical method in the continued development of the critical political economy of culture is demonstrated by showing the possibility of developing a complementary critical political economy of consciousness. Smythe’s theorizing of audiences as workers is considered as a useful starting point, and its potential development through incorporation of the work of other critical scholars of media and culture is outlined.

  12. Cytokinesis-block micronucleus method in micro-blood cultures

    International Nuclear Information System (INIS)

    Liu Jinwen; Wang Lianzhi; Yang Cangzhen; Yao Yanyu

    1991-01-01

    This paper reports the cytokinesis-block micronucleus method in micro-blood cultures. The observations on detection induced micronuclei of different doses of 60 Co γ-rays irradiation and spontaneous micronucleus of different ages were performed with CB method in comporison with conventional micronucleus (CM) method. The results showed that with direct peripheral micro-blood cultures the cytoknesis-block micronuclei is also obtained. Using CB method, the micronuclei fequency of different ages was linear relationship, Y = 1.62 + 0.74 D, the spontaneous micronuclei frequency of different ages was 4.14%, the induced micronuclei also was a linear relationship, Y = 6.01 + 0.692 D. Using CM method, it showed that the induced micronuclei was a linear relationship, Y = 0.486 D - 1.968, but there is no significant difference between the micronuclei frequency of different ages. Comparison with CM and direct blood smear methods confirmed that the cytokinesis-block method of micro-blood cultures is more sensitive and precise

  13. Bridging the gap between cell culture and live tissue

    Directory of Open Access Journals (Sweden)

    Stefan Przyborski

    2017-11-01

    Full Text Available Traditional in vitro two-dimensional (2-D culture systems only partly imitate the physiological and biochemical features of cells in their original tissue. In vivo, in organs and tissues, cells are surrounded by a three-dimensional (3-D organization of supporting matrix and neighbouring cells, and a gradient of chemical and mechanical signals. Furthermore, the presence of blood flow and mechanical movement provides a dynamic environment (Jong et al., 2011. In contrast, traditional in vitro culture, carried out on 2-D plastic or glass substrates, typically provides a static environment, which, however is the base of the present understanding of many biological processes, tissue homeostasis as well as disease. It is clear that this is not an exact representation of what is happening in vivo and the microenvironment provided by in vitro cell culture models are significantly different and can cause deviations in cell response and behaviour from those distinctive of in vivo tissues. In order to translate the present basic knowledge in cell control, cell repair and regeneration from the laboratory bench to the clinical application, we need a better understanding of the cell and tissue interactions. This implies a detailed comprehension of the natural tissue environment, with its organization and local signals, in order to more closely mimic what happens in vivo, developing more physiological models for efficient in vitro systems. In particular, it is imperative to understand the role of the environmental cues which can be mainly divided into those of a chemical and mechanical nature.

  14. Effect of integration of cultural, botanical, and chemical methods of ...

    African Journals Online (AJOL)

    A field experiment was conducted from November 2011 to June 2013 to evaluate the effects of botanical, cultural, and chemical methods on termite colony survival, crop and wooden damage, and other biological activities in Ghimbi district of western Ethiopia. The termite mounds were dug and the following treatments were ...

  15. Batch variation between branchial cell cultures: An analysis of variance

    DEFF Research Database (Denmark)

    Hansen, Heinz Johs. Max; Grosell, M.; Kristensen, L.

    2003-01-01

    We present in detail how a statistical analysis of variance (ANOVA) is used to sort out the effect of an unexpected batch-to-batch variation between cell cultures. Two separate cultures of rainbow trout branchial cells were grown on permeable filtersupports ("inserts"). They were supposed...... and introducing the observed difference between batches as one of the factors in an expanded three-dimensional ANOVA, we were able to overcome an otherwisecrucial lack of sufficiently reproducible duplicate values. We could thereby show that the effect of changing the apical medium was much more marked when...... the radioactive lipid precursors were added on the apical, rather than on the basolateral, side. Theinsert cell cultures were obviously polarized. We argue that it is not reasonable to reject troublesome experimental results, when we do not know a priori that something went wrong. The ANOVA is a very useful...

  16. Culture of somatic cells isolated from frozen-thawed equine semen using fluorescence-assisted cell sorting.

    Science.gov (United States)

    Brom-de-Luna, Joao Gatto; Canesin, Heloísa Siqueira; Wright, Gus; Hinrichs, Katrin

    2018-03-01

    Nuclear transfer using somatic cells from frozen semen (FzSC) would allow cloning of animals for which no other genetic material is available. Horses are one of the few species for which cloning is commercially feasible; despite this, there is no information available on the culture of equine FzSC. After preliminary trials on equine FzSC, recovered by density-gradient centrifugation, resulted in no growth, we hypothesized that sperm in the culture system negatively affected cell proliferation. Therefore, we evaluated culture of FzSC isolated using fluorescence-assisted cell sorting. In Exp. 1, sperm were labeled using antibodies to a sperm-specific antigen, SP17, and unlabeled cells were collected. This resulted in high sperm contamination. In Exp. 2, FzSC were labeled using an anti-MHC class I antibody. This resulted in an essentially pure population of FzSC, 13-25% of which were nucleated. Culture yielded no proliferation in any of nine replicates. In Exp. 3, 5 × 10 3 viable fresh, cultured horse fibroblasts were added to the frozen-thawed, washed semen, then this suspension was labeled and sorted as for Exp. 2. The enriched population had a mean of five sperm per recovered somatic cell; culture yielded formation of monolayers. In conclusion, an essentially pure population of equine FzSC could be obtained using sorting for presence of MHC class I antigens. No equine FzSC grew in culture; however, the proliferation of fibroblasts subjected to the same processing demonstrated that the labeling and sorting methods, and the presence of few sperm in culture, were compatible with cell viability. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. On-chip gradient generation in 256 microfluidic cell cultures: simulation and experimental validation.

    Science.gov (United States)

    Somaweera, Himali; Haputhanthri, Shehan O; Ibraguimov, Akif; Pappas, Dimitri

    2015-08-07

    A microfluidic diffusion diluter was used to create a stable concentration gradient for dose response studies. The microfluidic diffusion diluter used in this study consisted of 128 culture chambers on each side of the main fluidic channel. A calibration method was used to find unknown concentrations with 12% error. Flow rate dependent studies showed that changing the flow rates generated different gradient patterns. Mathematical simulations using COMSOL Multi-physics were performed to validate the experimental data. The experimental data obtained for the flow rate studies agreed with the simulation results. Cells could be loaded into culture chambers using vacuum actuation and cultured for long times under low shear stress. Decreasing the size of the culture chambers resulted in faster gradient formation (20 min). Mass transport into the side channels of the microfluidic diffusion diluter used in this study is an important factor in creating the gradient using diffusional mixing as a function of the distance. To demonstrate the device's utility, an H2O2 gradient was generated while culturing Ramos cells. Cell viability was assayed in the 256 culture chambers, each at a discrete H2O2 concentration. As expected, the cell viability for the high concentration side channels increased (by injecting H2O2) whereas the cell viability in the low concentration side channels decreased along the chip due to diffusional mixing as a function of distance. COMSOL simulations were used to identify the effective concentration of H2O2 for cell viability in each side chamber at 45 min. The gradient effects were confirmed using traditional H2O2 culture experiments. Viability of cells in the microfluidic device under gradient conditions showed a linear relationship with the viability of the traditional culture experiment. Development of the microfluidic device used in this study could be used to study hundreds of concentrations of a compound in a single experiment.

  18. Photovoltaic cell module and method of forming

    Science.gov (United States)

    Howell, Malinda; Juen, Donnie; Ketola, Barry; Tomalia, Mary Kay

    2017-12-12

    A photovoltaic cell module, a photovoltaic array including at least two modules, and a method of forming the module are provided. The module includes a first outermost layer and a photovoltaic cell disposed on the first outermost layer. The module also includes a second outermost layer disposed on the photovoltaic cell and sandwiching the photovoltaic cell between the second outermost layer and the first outermost layer. The method of forming the module includes the steps of disposing the photovoltaic cell on the first outermost layer, disposing a silicone composition on the photovoltaic cell, and compressing the first outermost layer, the photovoltaic cell, and the second layer to form the photovoltaic cell module.

  19. Aragonite precipitation by "proto-polyps" in coral cell cultures.

    Directory of Open Access Journals (Sweden)

    Tali Mass

    Full Text Available The mechanisms of coral calcification at the molecular, cellular and tissue levels are poorly understood. In this study, we examine calcium carbonate precipitation using novel coral tissue cultures that aggregate to form "proto-polyps". Our goal is to establish an experimental system in which calcification is facilitated at the cellular level, while simultaneously allowing in vitro manipulations of the calcifying fluid. This novel coral culturing technique enables us to study the mechanisms of biomineralization and their implications for geochemical proxies. Viable cell cultures of the hermatypic, zooxanthellate coral, Stylophora pistillata, have been maintained for 6 to 8 weeks. Using an enriched seawater medium with aragonite saturation state similar to open ocean surface waters (Ω(arag~4, the primary cell cultures assemble into "proto-polyps" which form an extracellular organic matrix (ECM and precipitate aragonite crystals. These extracellular aragonite crystals, about 10 µm in length, are formed on the external face of the proto-polyps and are identified by their distinctive elongated crystallography and X-ray diffraction pattern. The precipitation of aragonite is independent of photosynthesis by the zooxanthellae, and does not occur in control experiments lacking coral cells or when the coral cells are poisoned with sodium azide. Our results demonstrate that proto-polyps, aggregated from primary coral tissue culture, function (from a biomineralization perspective similarly to whole corals. This approach provides a novel tool for investigating the biophysical mechanism of calcification in these organisms.

  20. A porcine astrocyte/endothelial cell co-culture model of the blood-brain barrier.

    Science.gov (United States)

    Jeliazkova-Mecheva, Valentina V; Bobilya, Dennis J

    2003-10-01

    A method for the isolation of porcine atrocytes as a simple extension of a previously described procedure for isolation of brain capillary endothelial cells from adolescent pigs [Methods Cell Sci. 17 (1995) 2] is described. The obtained astroglial culture purified through two passages and by the method of the selective detachment was validated by a phase contrast microscopy and through an immunofluorescent assay for the glial fibrillary acidic protein (GFAP). Porcine astrocytes were co-cultivated with porcine brain capillary endothelial cells (PBCEC) for the development of an in vitro blood-brain barrier (BBB) model. The model was visualized by an electron microscopy and showed elevated transendothellial electrical resistance and reduced inulin permeability. To our knowledge, this is the first report for the establishment of a porcine astrocyte/endothelial cell co-culture BBB model, which avoids interspecies and age differences between the two cell types, usually encountered in the other reported co-culture BBB models. Considering the availability of the porcine brain tissue and the close physiological and anatomical relation between the human and pig brain, the porcine astrocyte/endothelial cell co-culture system can serve as a reliable and easily reproducible model for different in vitro BBB studies.

  1. Oxidative stress induced by cerium oxide nanoparticles in cultured BEAS-2B cells

    International Nuclear Information System (INIS)

    Park, Eun-Jung; Choi, Jinhee; Park, Young-Kwon; Park, Kwangsik

    2008-01-01

    Cerium oxide nanoparticles of different sizes (15, 25, 30, 45 nm) were prepared by the supercritical synthesis method, and cytotoxicity was evaluated using cultured human lung epithelial cells (BEAS-2B). Exposure of the cultured cells to nanoparticles (5, 10, 20, 40 μg/ml) led to cell death, ROS increase, GSH decrease, and the inductions of oxidative stress-related genes such as heme oxygenase-1, catalase, glutathione S-transferase, and thioredoxin reductase. The increased ROS by cerium oxide nanoparticles triggered the activation of cytosolic caspase-3 and chromatin condensation, which means that cerium oxide nanoparticles exert cytotoxicity by an apoptotic process. Uptake of the nanoparticles to the cultured cells was also tested. It was observed that cerium oxide nanoparticles penetrated into the cytoplasm and located in the peri-region of the nucleus as aggregated particles, which may induce the direct interaction between nanoparticles and cellular molecules to cause adverse cellular responses

  2. Evaluating the role of low-speed centrifugation towards transfecting human peripheral blood mononuclear cell culture

    Directory of Open Access Journals (Sweden)

    M Majumdar

    2014-01-01

    Full Text Available The conventional method of transfection of suspension cells by chemical has proven to be very difficult. We present a new transfection protocol, wherein, low-speed centrifugation of cell culture plates immediately after adding the lipid: DNA complex significantly enhances the transfection efficiency. Peripheral blood mononuclear cells (PBMCs were transfected with BLOCK-iT™ Fluorescent Oligo (scrambled siRNA and lipofectamine complex using conventional and low-speed centrifugation modified transfection protocols. The efficiency of transfection was determined using flowcytometer and cell viability was checked using MTT assay. Incorporation of low-speed centrifugation significantly enhances the transfection efficiency of BLOCK-iT™ in the suspension culture of PBMCs as compared to conventional transfection method (99.8% vs 28.3%; P < 0.0001, even at a low concentration of 40 picomoles without affecting the cell viability. Centrifugation enhanced transfection (CET technique is simple, time-saving and novel application without compromising the cell viability in the context of recently popular RNA interference in suspension cultures of PBMCs. This undemanding modification might be applicable to a wide variety of cell lines and solve crucial problem of researchers working with RNA interference in suspension cultures.

  3. Testicular Sertoli cells influence the proliferation and immunogenicity of co-cultured endothelial cells

    International Nuclear Information System (INIS)

    Fan, Ping; He, Lan; Pu, Dan; Lv, Xiaohong; Zhou, Wenxu; Sun, Yining; Hu, Nan

    2011-01-01

    Research highlights: → The proliferation of dramatic increased by co-cultured with Sertoli cells. → VEGF receptor-2 expression of ECs was up-regulated by co-cultured with Sertoli cells. → The MHC expression of ECs induced by INF-γ and IL-6, IL-8 and sICAM induced by TNF-α decreased respectively after co-cultured with Sertoli cells. → ECs co-cultured with Sertoli cells also didn't increase the stimulation index of spleen lymphocytes. -- Abstract: The major problem of the application of endothelial cells (ECs) in transplantation is the lack of proliferation and their immunogenicity. In this study, we co-cultured ECs with Sertoli cells to monitor whether Sertoli cells can influence the proliferation and immunogenicity of co-cultured ECs. Sertoli cells were isolated from adult testicular tissue. ECs were divided into the control group and the experimental group, which included three sub-groups co-cultured with 1 x 10 3 , 1 x 10 4 or 1 x 10 5 cell/ml of Sertoli cells. The growth and proliferation of ECs were observed microscopically, and the expression of vascular endothelial growth factor (VEGF) receptor-2 (KDR) was examined by Western blotting. In another experiment, ECs were divided into the control group, the single culture group and the co-culture group with the optimal concentration of Sertoli cells. After INF-γ and TNF-α were added to the culture medium, MHC II antigen expression was detected by immunofluorescence staining and western blotting; interleukin (IL)-6, IL-8 and soluble intercellular adhesion molecule (sICAM) were measured in the culture medium by ELISA. We demonstrated that 1 x 10 4 cell/ml Sertoli cells promoted the proliferation of co-cultured ECs more dramatically than that in other groups (P 4 cell/ml of the Sertoli cells was most effective in the up-regulation of KDR expression in the co-cultured ECs (P < 0.05). Sertoli cells can effectively suppress INF-γ-induced MHC II antigen expression in co-cultured ECs compared with single

  4. Effects of achilline on lipid metabolism gene expression in cell culture

    Directory of Open Access Journals (Sweden)

    A. V. Ratkin

    2016-01-01

    Full Text Available Objective. Evaluation in vitro of the mechanisms of the hypolipidemic effect of sesquiterpene γ-lactone achilline in the hepatoma tissue culture (HTC.Materials and methods.The influence of sesquiterpene γ-lactone achilline and gemfibrozil (comparison drug on the viability, lipid content and expression of key genes of lipid metabolism in the hepatoma tissue culture. The lipid content was assessed by fluorescent method with the vital dye Nile Red, the cell viability was assessed using MTT assay.Results. Cultivation of of cell cultures of rat’s hepatoma cell line HTC for 48 h with achilline in a concentration of from 0.25 to 1.0 mm and gemfibrozil from 0,25 to 0,5 mm did not change cell viability compared to control. In these same concentrations of the test substance reduced the lipid content in the cells, assessed by fluorescent method with the vital dye Nile Red. To study the mechanism of hypolipidemicaction of achillinedetermined the expression of key genes of lipid metabolism in cell culture lines HTC. The possible mechanism of hypolipidemic action of achilline can be attributed to the increased transport and oxidation of long-chain fatty acids in mitochondria, as evidenced by the increase in the gene expression of carnitine-palmitoyltransferase 2 (Cpt2. The decrease in cholesterol level may be due to increased synthesis of bile acids from cholesterol, due to increased gene expression of 7-alphahydroxylase (Cyp7a1. Conclusion. In cell cultures of rat’s hepatoma cell line HTC sesquiterpene γ-lactone achilline reduces the accumulation of lipids in cells, as evidenced by the decrease in the fluorescence of Nile Red, increased gene expression of the carnitine-palmitoyltransferase 2 (Cpt2 gene and 7-alpha-hydroxylase (Cyp7a1.

  5. A study of chromosomal aberrations in amniotic fluid cell cultures.

    Science.gov (United States)

    Wolstenholme, J; Crocker, M; Jonasson, J

    1988-06-01

    This paper represents the analysis of 1916 routine amniotic fluid specimens harvested by an in situ fixation technique in a prospective study with regard to cultural chromosome anomalies. Excluding constitutional abnormalities, 2.9 per cent of 19,432 cells analysed showed some form of chromosome anomaly, terminal deletions (57 per cent) and chromatid/chromosome breaks and gaps (18 per cent) being the most frequent, followed by interchange aberrations (13 per cent) and trisomy (5 per cent). No case was found of more than one colony from the same culture showing the same anomaly without it being present in other cultures from the same fluid. The wholly abnormal colonies had a surplus of trisomies and from the mathematical considerations presented one may infer that these are likely to reflect the presence of abnormal cells in the amniotic fluid. Partly abnormal colonies appeared at a frequency that would correspond to virtual absence of selection against chromosomally abnormal cells when cultured in vitro. The aberrations found were similar to those seen as single cell anomalies, except for chromatid breaks and exchanges. The data suggest a basic preferential induction of trisomy for chromosomes 2, 18, 21, and the Y-chromosome. Structural aberrations showed a marked clustering of breakpoints around the centromeres. The frequency of mutant cells was low (1.4 X 10(-3)) before culture was initiated. At harvest, the frequency of abnormal cells was much higher (3 X 10(-2)) corresponding to 3 X 10(-3) mutations per cell per generation accumulating over approximately ten generations in vitro.

  6. Testing of serum atherogenicity in cell cultures: questionable data published

    Directory of Open Access Journals (Sweden)

    Sergei V. Jargin

    2012-01-01

    Full Text Available In a large series of studies was reported that culturing of smooth muscle cells with serum from atherosclerosis patients caused intracellular lipid accumulation, while serum from healthy controls had no such effect. Cultures were used for evaluation of antiatherogenic drugs. Numerous substances were reported to lower serum atherogenicity: statins, trapidil, calcium antagonists, garlic derivatives etc. On the contrary, beta-blockers, phenothiazines and oral hypoglycemics were reported to be pro-atherogenic. Known antiatherogenic agents can influence lipid metabolism and cholesterol synthesis, intestinal absorption or endothelium-related mechanisms. All these targets are absent in cell monocultures. Inflammatory factors, addressed by some antiatherogenic drugs, are also not reproduced. In vivo, relationship between cholesterol uptake by cells and atherogenesis must be inverse rather than direct: in familial hypercholesterolemia, inefficient clearance of LDL-cholesterol by cells predisposes to atherosclerosis. Accordingly, if a pharmacological agent reduces cholesterol uptake by cells in vitro, it should be expected to elevate cholesterol in vivo. Validity of clinical recommendations, based on serum atherogenicity testing in cell monocultures, is therefore questionable. These considerations pertain also to the drugs developed on the basis of the cell culture experiments.

  7. Arsenic exposure induces the Warburg effect in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Fei; Severson, Paul; Pacheco, Samantha; Futscher, Bernard W.; Klimecki, Walter T., E-mail: klimecki@pharmacy.arizona.edu

    2013-08-15

    Understanding how arsenic exacts its diverse, global disease burden is hampered by a limited understanding of the particular biological pathways that are disrupted by arsenic and underlie pathogenesis. A reductionist view would predict that a small number of basic pathways are generally perturbed by arsenic, and manifest as diverse diseases. Following an initial observation that arsenite-exposed cells in culture acidify their media more rapidly than control cells, the report here shows that low level exposure to arsenite (75 ppb) is sufficient to induce aerobic glycolysis (the Warburg effect) as a generalized phenomenon in cultured human primary cells and cell lines. Expanded studies in one such cell line, the non-malignant pulmonary epithelial line, BEAS-2B, established that the arsenite-induced Warburg effect was associated with increased accumulation of intracellular and extracellular lactate, an increased rate of extracellular acidification, and inhibition by the non-metabolized glucose analog, 2-deoxy-D-glucose. Associated with the induction of aerobic glycolysis was a pathway-wide induction of glycolysis gene expression, as well as protein accumulation of an established glycolysis master-regulator, hypoxia-inducible factor 1A. Arsenite-induced alteration of energy production in human cells represents the type of fundamental perturbation that could extend to many tissue targets and diseases. - Highlights: • Chronic arsenite exposure induces aerobic glycolysis, dubbed the “Warburg effect”. • Arsenite-induced Warburg effect is a general phenomenon in cultured human cells. • HIF-1A may mediate arsenite induced Warburg effect.

  8. Transfection in perfused microfluidic cell culture devices: A case study.

    Science.gov (United States)

    Raimes, William; Rubi, Mathieu; Super, Alexandre; Marques, Marco P C; Veraitch, Farlan; Szita, Nicolas

    2017-08-01

    Automated microfluidic devices are a promising route towards a point-of-care autologous cell therapy. The initial steps of induced pluripotent stem cell (iPSC) derivation involve transfection and long term cell culture. Integration of these steps would help reduce the cost and footprint of micro-scale devices with applications in cell reprogramming or gene correction. Current examples of transfection integration focus on maximising efficiency rather than viable long-term culture. Here we look for whole process compatibility by integrating automated transfection with a perfused microfluidic device designed for homogeneous culture conditions. The injection process was characterised using fluorescein to establish a LabVIEW-based routine for user-defined automation. Proof-of-concept is demonstrated by chemically transfecting a GFP plasmid into mouse embryonic stem cells (mESCs). Cells transfected in the device showed an improvement in efficiency (34%, n = 3) compared with standard protocols (17.2%, n = 3). This represents a first step towards microfluidic processing systems for cell reprogramming or gene therapy.

  9. Cell culture media impact on drug product solution stability.

    Science.gov (United States)

    Purdie, Jennifer L; Kowle, Ronald L; Langland, Amie L; Patel, Chetan N; Ouyang, Anli; Olson, Donald J

    2016-07-08

    To enable subcutaneous administration of monoclonal antibodies, drug product solutions are often needed at high concentrations. A significant risk associated with high drug product concentrations is an increase in aggregate level over the shelf-life dating period. While much work has been done to understand the impact of drug product formulation on aggregation, there is limited understanding of the link between cell culture process conditions and soluble aggregate growth in drug product. During cell culture process development, soluble aggregates are often measured at harvest using cell-free material purified by Protein A chromatography. In the work reported here, cell culture media components were evaluated with respect to their impact on aggregate levels in high concentration solution drug product during accelerated stability studies. Two components, cysteine and ferric ammonium citrate, were found to impact aggregate growth rates in our current media (version 1) leading to the development of new chemically defined media and concentrated feed formulations. The new version of media and associated concentrated feeds (version 2) were evaluated across four cell lines producing recombinant IgG4 monoclonal antibodies and a bispecific antibody. In all four cell lines, the version 2 media reduced aggregate growth over the course of a 12 week accelerated stability study compared with the version 1 media, although the degree to which aggregate growth decreased was cell line dependent. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:998-1008, 2016. © 2016 American Institute of Chemical Engineers.

  10. Arsenic exposure induces the Warburg effect in cultured human cells

    International Nuclear Information System (INIS)

    Zhao, Fei; Severson, Paul; Pacheco, Samantha; Futscher, Bernard W.; Klimecki, Walter T.

    2013-01-01

    Understanding how arsenic exacts its diverse, global disease burden is hampered by a limited understanding of the particular biological pathways that are disrupted by arsenic and underlie pathogenesis. A reductionist view would predict that a small number of basic pathways are generally perturbed by arsenic, and manifest as diverse diseases. Following an initial observation that arsenite-exposed cells in culture acidify their media more rapidly than control cells, the report here shows that low level exposure to arsenite (75 ppb) is sufficient to induce aerobic glycolysis (the Warburg effect) as a generalized phenomenon in cultured human primary cells and cell lines. Expanded studies in one such cell line, the non-malignant pulmonary epithelial line, BEAS-2B, established that the arsenite-induced Warburg effect was associated with increased accumulation of intracellular and extracellular lactate, an increased rate of extracellular acidification, and inhibition by the non-metabolized glucose analog, 2-deoxy-D-glucose. Associated with the induction of aerobic glycolysis was a pathway-wide induction of glycolysis gene expression, as well as protein accumulation of an established glycolysis master-regulator, hypoxia-inducible factor 1A. Arsenite-induced alteration of energy production in human cells represents the type of fundamental perturbation that could extend to many tissue targets and diseases. - Highlights: • Chronic arsenite exposure induces aerobic glycolysis, dubbed the “Warburg effect”. • Arsenite-induced Warburg effect is a general phenomenon in cultured human cells. • HIF-1A may mediate arsenite induced Warburg effect

  11. Molecular purging of multiple myeloma