
Sample records for cell clone specific

  1. Human T-Cell Clones from Autoimmune Thyroid Glands: Specific Recognition of Autologous Thyroid Cells (United States)

    Londei, Marco; Bottazzo, G. Franco; Feldmann, Marc


    The thyroid glands of patients with autoimmune diseases such as Graves' disease and certain forms of goiter contain infiltrating activated T lymphocytes and, unlike cells of normal glands, the epithelial follicular cells strongly express histocompatability antigens of the HLA-DR type. In a study of such autoimmune disorders, the infiltrating T cells from the thyroid glands of two patients with Graves' disease were cloned in mitogen-free interleukin-2 (T-cell growth factor). The clones were expanded and their specificity was tested. Three types of clones were found. One group, of T4 phenotype, specifically recognized autologous thyroid cells. Another, also of T4 phenotype, recognized autologous thyroid or blood cells and thus responded positively in the autologous mixed lymphocyte reaction. Other clones derived from cells that were activated in vivo were of no known specificity. These clones provide a model of a human autoimmune disease and their analysis should clarify mechanisms of pathogenesis and provide clues to abrogating these undesirable immune responses.

  2. Islet-specific T cell clones transfer diabetes to nonobese diabetic (NOD) F1 mice. (United States)

    Peterson, J D; Pike, B; McDuffie, M; Haskins, K


    To investigate diabetes resistance to T cell-mediated disease transfer, we administered islet-specific T cell clones to the F1 progeny of nonobese diabetic (NOD) mice that were crossed with various nondiabetes-prone inbred mouse strains. We investigated four diabetogenic CD4+ T cell clones and all induced insulitis and full development of diabetes in (SWR x NOD)F1, (SJL x NOD)F1, and (C57BL/6 x NOD)F1 mice. In contrast, (BALB/c x NOD)F1 and (CBA x NOD)F1 mice were susceptible to disease transfer by some T cell clones but not others, and (C57/L x NOD)F1 mice seemed to be resistant to both insulitis and disease transfer by all of the clones tested. Disease induced by the T cell clones in susceptible F1 strains was age dependent and could only be observed in recipients younger than 13 days old. Full or partial disease resistance did not correlate with the presence or absence of I-E, different levels of Ag expression in islet cells, or differences in APC function. The results from this study suggest that there may be multiple factors contributing to susceptibility of F1 mice to T cell clone-mediated induction of diabetes, including non-MHC-related genetic background, the immunologic maturity of the recipient, and individual characteristics of the T cell clones.

  3. T cell clones which share T cell receptor epitopes differ in phenotype, function and specificity

    NARCIS (Netherlands)

    Yssel, H.; Blanchard, D.; Boylston, A.; de Vries, J. E.; Spits, H.


    Recently, we described a monoclonal antibody (3D6) that reacts with the T cell receptor (Ti) of the T leukemic cell line HPB-ALL and that cross-reacts with 2-10% of the T cells of normal healthy individuals. In this study we report the establishment of T cell clones that are 3D6+ but that differ in

  4. T-cell libraries allow simple parallel generation of multiple peptide-specific human T-cell clones. (United States)

    Theaker, Sarah M; Rius, Cristina; Greenshields-Watson, Alexander; Lloyd, Angharad; Trimby, Andrew; Fuller, Anna; Miles, John J; Cole, David K; Peakman, Mark; Sewell, Andrew K; Dolton, Garry


    Isolation of peptide-specific T-cell clones is highly desirable for determining the role of T-cells in human disease, as well as for the development of therapies and diagnostics. However, generation of monoclonal T-cells with the required specificity is challenging and time-consuming. Here we describe a library-based strategy for the simple parallel detection and isolation of multiple peptide-specific human T-cell clones from CD8(+) or CD4(+) polyclonal T-cell populations. T-cells were first amplified by CD3/CD28 microbeads in a 96U-well library format, prior to screening for desired peptide recognition. T-cells from peptide-reactive wells were then subjected to cytokine-mediated enrichment followed by single-cell cloning, with the entire process from sample to validated clone taking as little as 6 weeks. Overall, T-cell libraries represent an efficient and relatively rapid tool for the generation of peptide-specific T-cell clones, with applications shown here in infectious disease (Epstein-Barr virus, influenza A, and Ebola virus), autoimmunity (type 1 diabetes) and cancer. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  5. TNP-specific Lyt-2+ cytolytic T cell clones preferentially respond to TNP-conjugated epidermal cells

    International Nuclear Information System (INIS)

    Shimada, S.; Katz, S.I.


    A most effective method for the induction of hapten-specific allergic contact sensitivity (CS) is via epicutaneous application of the hapten. Another effective method is by the administration of haptenated epidermal cells (EC) subcutaneously. The latter method induces more intense and longer lasting CS than does the subcutaneous administration of haptenated spleen cells (SC). Thus, there may be something unique about EC which, when haptenated, allows them to generate effector cells more effectively than do SC. The authors therefore, attempted to generate T cell clones that were both hapten- and epidermal-specific. Four days after painting mice with 7% trinitrochlorobenzene, draining lymph node cells were obtained and T cells were purified. These cells were co-cultured with trinitrophenylated (TNP) Langerhans cell-enriched EC. After 4 days, cells were harvested and rested on non-TNP-conjugated EC. The cells were restimulated and rested three times, and were then cloned by limiting dilution with added interleukin 2, which was then continually added. Proliferation of T cells was assessed by [ 3 H]-thymidine incorporation. Cytotoxicity assays utilized TNP-conjugated concanavalin A SC blasts or EC as targets. Clones A-2 and E-4 are Thy-1+, Lyt-2+, and L3T4-, and TNP-specific. In contrast to noncloned TNP-specific T cells, the clones proliferate preferentially in response to TNP-EC rather than TNP-SC. Also in contrast to noncloned T cells, the clones were preferentially cytotoxic for TNP-EC; compared to TNP-SC, there was an eight- to 32-fold increase in killing when TNP-EC were used as targets. Clones A-2 and E-4 therefore exhibit hapten and epidermal specificity

  6. Autoreactive T cell clones specific for class I and class II HLA antigens isolated from a human chimera

    NARCIS (Netherlands)

    Roncarolo, M. G.; Yssel, H.; Touraine, J. L.; Betuel, H.; de Vries, J. E.; Spits, H.


    T cell clones of donor origin that specifically react with recipient cells were obtained from a SCID patient successfully reconstituted by allogeneic fetal liver and thymus transplantation performed 10 yr ago. The majority of these clones displayed both cytotoxic and proliferative responses towards

  7. Antigen-specific murine T cell clones produce soluble interleukin 2 receptor on stimulation with specific antigens

    International Nuclear Information System (INIS)

    Wagner, D.K.; York-Jolley, J.; Malek, T.R.; Berzofsky, J.A.; Nelson, D.L.


    In this study, monoclonal antibodies were used to the murine IL 2 receptor (IL 2R) termed 3C7 and 7D4, which bind to different epitopes on the murine IL 2R, to develop an ELISA to measure soluble murine IL 2R. Surprisingly, stimulated murine spleen cells not only expressed cell-associated IL 2R, but also produced a considerable level of cellfree IL 2R in the culture supernatant fluid. To assess the fine specificity of this response, myoglobin-immune murine T cell clones were stimulated with appropriate or inappropriate antigen and syngeneic or allogeneic presenting cells. Proliferation, measured by [ 3 H] thymidine incorporation, and levels of soluble IL 2R were determined at day 4. The production of soluble IL2R displayed the same epitope fine specificity, genetic restriction, and antigen dose-response as the proliferative response. Indeed, in some cases there was sharper discrimination of epitope specificity and genetic restriction with the soluble IL 2R levels. There was also reproducible clone-to-clone variation in the amount of soluble receptor produced in response to antigen among 12 T cell clones and lines tested. In time course experiments, proliferation was greatest at day 3, whereas soluble IL 2R levels continued to rise in subsequent days. To the authors' knowledge, this is the first demonstration of release of secretion of soluble IL 2R by murine T cells, and the first demonstration of the fine specificity and genetic restriction of the induction of soluble IL 2R by specific antigen

  8. Establishment and characterization of canine parvovirus-specific murine CD4+ T cell clones and their use for the delineation of T cell epitopes.

    NARCIS (Netherlands)

    G.F. Rimmelzwaan (Guus); R.W.J. van der Heijden (Roger); E.J. Tijhaar (Edwin); M.C.M. Poelen (Martien); J. Carlson; A.D.M.E. Osterhaus (Albert); F.G.C.M. Uytdehaag (Fons)


    textabstractCanine parvovirus (CPV)-specific T cell clones were generated by culturing lymph node cells from CPV-immunized BALB/c mice at limiting dilutions in the presence of CPV antigen and interleukin-2 (IL-2). All isolated T cell clones exhibited the cell surface phenotype Thy1+, CD4+, CD8- and

  9. Antigen-specific T8+ human clone of cells with a nonspecific augmenting function on the T4 cell-B cell helper interaction

    International Nuclear Information System (INIS)

    Brines, R.D.; Sia, D.Y.; Lehner, T.


    The authors isolated a T8 + T3 + Ia + clone of cells from the peripheral blood mononuclear cells of a healthy subject. The clone was expanded and maintained with autologous feed cells, interleukin 2, and a streptococcal antigen. The T8 + clone of cells responded specifically to the streptococcal antigen, in the absence of accessory cells,and released a soluble factor. Both the cloned cells and the corresponding soluble factor expressed augmenting helper but not suppressor activity. The augmenting helper activity for B cell antibody synthesis was demonstrable only in the presence of autologous T 4 cells. Radioimmunoassay was used to measure antibodies. Although stimulation of the T8 + cloned cells was antigen-specific, the resulting soluble factor elicited nonspecific antibody synthesis in the presence of T4 and B cells. The T8 + cloned cell-derived factor was adsorbed by B cells but not by T4 cells. Preliminary studies suggest that the factor has the properties of a B cell growth factor. They suggest that the T8 + population consists of functionally heterogeneous cell subsets, some that have suppressor function and others that augment the T4 + helper-inducer activity in B cell antibody synthesis

  10. Antigen-specific cytotoxic T cell and antigen-specific proliferating T cell clones can be induced to cytolytic activity by monoclonal antibodies against T3

    NARCIS (Netherlands)

    Spits, H.; Yssel, H.; Leeuwenberg, J.; de Vries, J. E.


    T3 is a human differentiation antigen expressed exclusively on mature T cells. In this study it is shown that anti-T3 monoclonal antibodies, in addition to their capacity to induce T cells to proliferate, are able to induce antigen-specific cytotoxic T lymphocyte clones to mediate antigen

  11. Clonal analysis of T-cell responses to herpes simplex virus: isolation, characterization and antiviral properties of an antigen-specific helper T-cell clone. (United States)

    Leung, K N; Nash, A A; Sia, D Y; Wildy, P


    A herpes simplex virus (HSV)-specific long-term T-cell clone has been established from the draining lymph node cells of BALB/c mice; the cells required repeated in vitro restimulation with UV-irradiated virus. The established T-cell clone expresses the Thy-1 and Lyt-1+2,3- surface antigens. For optimal proliferation of the cloned cells, both the presence of specific antigen and an exogenous source of T-cell growth factor are required. The proliferative response of the cloned T cells was found to be virus-specific but it did not distinguish between HSV-1 and HSV-2. Adoptive cell transfer of the cloned T cells helped primed B cells to produce anti-herpes antibodies: the response was antigen-specific and cell dose-dependent. The clone failed to produce a significant DTH reaction in vivo, but did produce high levels of macrophage-activating factor. Furthermore, the T-cell clone could protect from HSV infection, as measured by a reduction in local virus growth, and by enhanced survival following the challenge of mice with a lethal dose of virus. The mechanism(s) whereby this clone protects in vivo is discussed.

  12. Species-specific challenges in dog cloning. (United States)

    Kim, G A; Oh, H J; Park, J E; Kim, M J; Park, E J; Jo, Y K; Jang, G; Kim, M K; Kim, H J; Lee, B C


    Somatic cell nuclear transfer (SCNT) is now an established procedure used in cloning of several species. SCNT in dogs involves multiple steps including the removal of the nuclear material, injection of a donor cell, fusion, activation of the reconstructed oocytes and finally transfer to a synchronized female recipient. There are therefore many factors that contribute to cloning efficiency. By performing a retrospective analysis of 2005-2012 published papers regarding dog cloning, we define the optimum procedure and summarize the specific feature for dog cloning. © 2012 Blackwell Verlag GmbH.

  13. Specific Schistosoma mansoni rat T cell clones. I. Generation and functional analysis in vitro and in vivo. (United States)

    Pestel, J; Dissous, C; Dessaint, J P; Louis, J; Engers, H; Capron, A


    In an attempt to determine the role of schistosome-specific T cells in the immune mechanisms developed during schistosomiasis, Schistosoma mansoni-specific T cells and clones were generated in vitro and some of their functions analyzed in vitro and in vivo in the fischer rat model. The data presented here can be summarized as follows: a) Lymph node cells (LNC) from rats primed with the excretory/secretory antigens-incubation products (IPSm) of adult worms proliferate in vitro only in response to the homologous schistosome antigens and not to unrelated antigens (Ag) such as ovalbumin (OVA) or Dipetalonema viteae and Fasciola hepatica parasite extracts. b) After in vitro restimulation of the primed LNC population with IPSm in the presence of antigen-presenting cells (APC) and maintenance in IL 2-containing medium, the frequency of IPSm-specific T cells is increased and the T cells can be restimulated only in the presence of APC possessing the same major histocompatibility complex (MHC) antigens. c) Following appropriate limiting dilution assays (LDA) (1 cell/well), 10 IPSm-specific T cell clones were obtained, and two of four maintained in culture were tested for their helper activity because they expressed only the W3/13+ W3/25+ surface phenotypes. d) The two highly proliferating IPSm-specific T cell clones (G5 and E23) exhibit an IPSm-dependent helper activity, as shown by the increase in IgG production by IPSm-primed B cells. e) IPSm-T cell clone (G5) as well as IPSm-T cell lines when injected in S. mansoni-infested rats can exert an in vivo helper activity, which is characterized by an accelerated production of IgG antibodies specific for the previously identified 30 to 40 kilodaltons (kd) schistosomula surface antigens (Ag). As recent studies have demonstrated that rat monoclonal antibodies recognize some incubation products of adult S. mansoni as well as one of the 30 to 40 kd schistosomula surface antigens, and taking into account the fact that the T cell

  14. Cloning of B cell-specific membrane tetraspanning molecule BTS possessing B cell proliferation-inhibitory function. (United States)

    Suenaga, Tadahiro; Arase, Hisashi; Yamasaki, Sho; Kohno, Masayuki; Yokosuka, Tadashi; Takeuchi, Arata; Hattori, Takamichi; Saito, Takashi


    Lymphocyte proliferation is regulated by signals through antigen receptors, co-stimulatory receptors, and other positive and negative modulators. Several membrane tetraspanning molecules are also involved in the regulation of lymphocyte growth and death. We cloned a new B cell-specific tetraspanning (BTS) membrane molecule, which is similar to CD20 in terms of expression, structure and function. BTS is specifically expressed in the B cell line and its expression is increased after the pre-B cell stage. BTS is expressed in intracellular granules and on the cell surface. Overexpression of BTS in immature B cell lines induces growth retardation through inhibition of cell cycle progression and cell size increase without inducing apoptosis. This inhibitory function is mediated predominantly by the N terminus of BTS. The development of mature B cells is inhibited in transgenic mice expressing BTS, suggesting that BTS is involved in the in vivo regulation of B cells. These results indicate that BTS plays a role in the regulation of cell division and B cell growth.

  15. Cloning analysis of HBV-specific CD8 T cell receptor gene in patients with acute hepatitis B

    Directory of Open Access Journals (Sweden)

    Ning DING


    Full Text Available Objective To investigate the molecular mechanism of T cell receptor(TCR in CD8 T cell-mediated immune response to HBV in patients with acute hepatitis B(AHB.Methods Peripheral blood mononuclear cells(PBMCs were collected from HLA-A2-positive AHB patients.To determine HBsAg183-191 and HBsAg335-343-specific CD8 T cell frequencies,the PBMCs were stained by fluorescence-labeled anti-CD3,anti-CD8 and pentamers,and analyzed by flow cytometry.PBMCs from 6 patients were stimulated with epitopic peptide HBsAg335-343 in vitro for 3 to 4 weeks.HBV-specific CD8 T cells were isolated by magnetic activated cell sorting followed by flow florescence activated cell sorting.The mRNA of sorted cells was extracted after expanding by IL-2,anti-CD3 and anti-CD8.The full-length gene fragments of variable region of TCR α and β chains were gained by 5’-RACE,and then cloned and sequenced(≥50 clones for single chain of each sample.The gene families of TCR α and β chains were identified and the sequence characters of CDR3 were compared.Results Analysis of more than 600 cloned gene sequences of TCR α and β chains showed that the proliferated HBV-specific CD8 T cells from 6 AHB patients presented a predominant expression in TCR α and chains,with 2-4 α chain families and 1-4 chain families in each case.The α2,α14,α15,β3,β13 and 23 families were detected in more than one case.The chain genes were all 13 for all tested clones in one case.For the same α chain or-chain family,CDR3 sequences tended to be identical in one case but different among cases.Conclusions HBV-specific CD8 T cells with antigenic peptide-induced proliferation present predominance in the usage of TCR α and β chains.This property might be one of the important molecular factors influencing anti-HBV immunity.

  16. Generation and functional analysis of T cell lines and clones specific for schistosomula released products (SRP-A). (United States)

    Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A


    Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula. PMID:3498590

  17. Generation and functional analysis of T cell lines and clones specific for schistosomula released products (SRP-A). (United States)

    Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A


    Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula.

  18. Clone-specific expression, transcriptional regulation, and action of interleukin-6 in human colon carcinoma cells

    International Nuclear Information System (INIS)

    Brozek, Wolfgang; Bises, Giovanna; Fabjani, Gerhild; Cross, Heide S; Peterlik, Meinrad


    Many cancer cells produce interleukin-6 (IL-6), a cytokine that plays a role in growth stimulation, metastasis, and angiogenesis of secondary tumours in a variety of malignancies, including colorectal cancer. Effectiveness of IL-6 in this respect may depend on the quantity of basal and inducible IL-6 expressed as the tumour progresses through stages of malignancy. We therefore have evaluated the effect of IL-6 modulators, i.e. IL-1β, prostaglandin E 2 , 17β-estradiol, and 1,25-dihydroxyvitamin D 3 , on expression and synthesis of the cytokine at different stages of tumour progression. We utilized cultures of the human colon carcinoma cell clones Caco-2/AQ, COGA-1A and COGA-13, all of which expressed differentiation and proliferation markers typical of distinct stages of tumour progression. IL-6 mRNA and protein levels were assayed by RT-PCR and ELISA, respectively. DNA sequencing was utilized to detect polymorphisms in the IL-6 gene promoter. IL-6 mRNA and protein concentrations were low in well and moderately differentiated Caco-2/AQ and COGA-1A cells, but were high in poorly differentiated COGA-13 cells. Addition of IL-1β (5 ng/ml) to a COGA-13 culture raised IL-6 production approximately thousandfold via a prostaglandin-independent mechanism. Addition of 17β-estradiol (10 -7 M) reduced basal IL-6 production by one-third, but IL-1β-inducible IL-6 was unaffected. Search for polymorphisms in the IL-6 promoter revealed the presence of a single haplotype, i.e., -597A/-572G/-174C, in COGA-13 cells, which is associated with a high degree of transcriptional activity of the IL-6 gene. IL-6 blocked differentiation only in Caco-2/AQ cells and stimulated mitosis through up-regulation of c-myc proto-oncogene expression. These effects were inhibited by 10 -8 M 1,25-dihydroxyvitamin D 3 . In human colon carcinoma cells derived from well and moderately differentiated tumours, IL-6 expression is low and only marginally affected, if at all, by PGE 2 , 1,25-dihydroxyvitamin D

  19. Mycobacterium leprae-specific protein antigens defined by cloned human helper T cells

    NARCIS (Netherlands)

    Ottenhoff, T. H.; Klatser, P. R.; Ivanyi, J.; Elferink, D. G.; de Wit, M. Y.; de Vries, R. R.


    Leprosy displays a remarkable spectrum of symptoms correlating with the T-cell-mediated immune reactivity of the host against the causative organism, Mycobacterium leprae. At one pole of this spectrum are lepromatous leprosy patients showing a M. leprae-specific T-cell unresponsiveness; at the other

  20. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.


    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  1. Persistence of collagen type II-specific T-cell clones in the synovial membrane of a patient with rheumatoid arthritis

    International Nuclear Information System (INIS)

    Londei, M.; Savill, C.M.; Verhoef, A.; Brennan, F.; Leech, Z.A.; Feldmann, M.; Duance, V.; Maini, R.N.


    Rheumatoid arthritis is an autoimmune disease characterized by T-cell infiltration of the synovium of joints. Analysis of the phenotype and antigen specificity of the infiltrating cells may thus provide insight into the pathogenesis of rheumatoid arthritis. T cells were cloned with interleukin 2, a procedure that selects for in vivo-activated cells. All clones had the CD4 CDW29 phenotype. Their antigen specificity was tested by using a panel of candidate joint autoantigens. Four of 17 reacted against autologous blood mononuclear cells. Two clones proliferated in response to collagen type II. After 21 months, another set of clones was derived from synovial tissue of the same joint. One of eight clones tested showed a strong proliferative response against collagen type II. The uncloned synovial T cells of a third operation from another joint also responded to collagen type II. The persistence of collagen type II-specific T cells in active rheumatoid joints over a period of 3 years suggests that collagen type II could be one of the autoantigens involved in perpetuating the inflammatory process in rheumatoid arthritis

  2. Use of high throughput qPCR screening to rapidly clone low frequency tumour specific T-cells from peripheral blood for adoptive immunotherapy

    Directory of Open Access Journals (Sweden)

    Serrano Oscar K


    Full Text Available Abstract Background The adoptive transfer of autologous tumor reactive lymphocytes can mediate significant tumor regression in some patients with refractory metastatic cancer. However, a significant obstacle for this promising therapy has been the availability of highly efficient methods to rapidly isolate and expand a variety of potentially rare tumor reactive lymphocytes from the natural repertoire of cancer patients. Methods We developed a novel in vitro T cell cloning methodology using high throughput quantitative RT-PCR (qPCR assay as a rapid functional screen to detect and facilitate the limiting dilution cloning of a variety of low frequency T cells from bulk PBMC. In preclinical studies, this strategy was applied to the isolation and expansion of gp100 specific CD8+ T cell clones from the peripheral blood of melanoma patients. Results In optimization studies, the qPCR assay could detect the reactivity of 1 antigen specific T cell in 100,000 background cells. When applied to short term sensitized PBMC microcultures, this assay could detect T cell reactivity against a variety of known melanoma tumor epitopes. This screening was combined with early limiting dilution cloning to rapidly isolate gp100154–162 reactive CD8+ T cell clones. These clones were highly avid against peptide pulsed targets and melanoma tumor lines. They had an effector memory phenotype and showed significant proliferative capacity to reach cell numbers appropriate for adoptive transfer trials (~1010 cells. Conclusion This report describes a novel high efficiency strategy to clone tumor reactive T cells from peripheral blood for use in adoptive immunotherapy.

  3. Heterogeneity in cytokine profiles of Babesia bovis-specific bovine CD4+ T cells clones activated in vitro.


    Brown, W C; Woods, V M; Dobbelaere, D A; Logan, K S


    The central role of T cells in the immune response against hemoprotozoan parasites, both as helper cells for T cell-dependent antibody production and as effector cells acting on intracellular parasites through the elaboration of cytokines, has prompted an investigation of the bovine cellular immune response against Babesia bovis antigens. CD4+ T helper (Th) cell clones generated from four B. bovis-immune cattle by in vitro stimulation with a soluble or membrane-associated merozoite antigen we...

  4. CD4+ T-cell clones obtained from cattle chronically infected with Fasciola hepatica and specific for adult worm antigen express both unrestricted and Th2 cytokine profiles. (United States)

    Brown, W C; Davis, W C; Dobbelaere, D A; Rice-Ficht, A C


    The well-established importance of helper T (Th)-cell subsets in immunity and immunoregulation of many experimental helminth infections prompted a detailed study of the cellular immune response against Fasciola hepatica in the natural bovine host. T-cell lines established from two cattle infected with F. hepatica were characterized for the expression of T-cell surface markers and proliferative responses against F. hepatica adult worm antigen. Parasite-specific T-cell lines contained a mixture of CD4+, CD8+, and gamma/delta T-cell-receptor-bearing T cells. However, cell lines containing either fewer than 10% CD8+ T cells or depleted of gamma/delta T cells proliferated vigorously against F. hepatica antigen, indicating that these T-cell subsets are not required for proliferative responses in vitro. Seventeen F. hepatica-specific CD4+ Th-cell clones were examined for cytokine expression following concanavalin A stimulation. Biological assays to measure interleukin-2 (IL-2) or IL-4, gamma interferon (IFN-gamma), and tumor necrosis factor and Northern (RNA) blot analysis to verify the expression of IL-2, IL-4, and IFN-gamma revealed that the Th-cell clones expressed a spectrum of cytokine profiles. Several Th-cell clones were identified as Th2 cells by the strong expression of IL-4 but little or no IL-2 or IFN-gamma mRNA. The majority of Th-cell clones were classified as Th0 cells by the expression of either all three cytokines or combinations of IL-2 and IL-4 or IL-4 and IFN-gamma. No Th1-cell clones were obtained. All of the Th-cell clones expressed a typical memory cell surface phenotype, characterized as CD45Rlow, and all expressed the lymph node homing receptor (L selectin). These results are the first to describe cytokine responses of F. hepatica-specific T cells obtained from infected cattle and extend our previous analysis of Th0 and Th1 cells from cattle immune to Babesia bovis (W. C. Brown, V. M. Woods, D. A. E. Dobbelaere, and K. S. Logan, Infect. Immun. 61

  5. Long term presence of a single predominant tyrosinase-specific T-cell clone associated with disease control in a patient with metastatic melanoma. (United States)

    Ochsenreither, Sebastian; Fusi, Alberto; Busse, Antonia; Letsch, Anne; Haase, Doreen; Thiel, Eckhard; Scheibenbogen, Carmen; Keilholz, Ulrich


    In an earlier study, we described a patient who developed an anti-tyrosinase T-cell response leading to long-term tumor control. Here we analyzed this response with regard to T-cell receptor (TCR) Vbeta family usage and clonality in order to further elucidate the nature of the T cell response in this patient. For identification of expanded specific cytotoxic T-cell (CTL) clones, tetramer enrichment of tyrosinase reactive T-cells was followed by comparative quantitative reverse transcribed PCR (qRT PCR) quantification of all TCR Vbeta-families and sequencing of family Vbeta4 elevated in the enriched fraction. The predominant specific clone was quantified by clonotypic qRT PCR in multiple samples from blood, bone marrow, and tumor tissue. FACS analyses with staining of TYR.A2 and TCR Vbeta4 were performed. Epitope specific enrichment revealed an isolated increase of Vbeta-family 4. FACS analysis showed a shift of specific CTLs to Vbeta-family 4 during tumor regression with a maximum of 80% of all TYR.A2 specific cells belonging to this family. Sequencing revealed a single predominant clone against polyclonal background coding for identical CDR3 loops. The predominant clone was highly expressed in bone marrow and tumor tissue, and was detectable in blood over a period of ten years. Considering the results of previous studies showing a specific effector phenotype in blood and a specific memory compartment in bone marrow of this patient, this data implicate the predominant clone featured all attributes of a sufficient CTL response including homing capacity and memory formation resulting in long term clonal persistence and tumor control.

  6. A novel SIV gag-specific CD4(+)T-cell clone suppresses SIVmac239 replication in CD4(+)T cells revealing the interplay between antiviral effector cells and their infected targets. (United States)

    Ayala, Victor I; Trivett, Matthew T; Coren, Lori V; Jain, Sumiti; Bohn, Patrick S; Wiseman, Roger W; O'Connor, David H; Ohlen, Claes; Ott, David E


    To study CD4(+)T-cell suppression of AIDS virus replication, we isolated nine rhesus macaque SIVGag-specific CD4(+)T-cell clones. One responding clone, Gag68, produced a typical cytotoxic CD8(+)T-cell response: induction of intracellular IFN-γ, MIP-1α, MIP-1β, and CD107a degranulation. Gag68 effectively suppressed the spread of SIVmac239 in CD4(+)T cells with a corresponding reduction of infected Gag68 effector cells, suggesting that CD4(+)effectors need to suppress their own infection in addition to their targets to be effective. Gag68 TCR cloning and gene transfer into CD4(+)T cells enabled additional experiments with this unique specificity after the original clone senesced. Our data supports the idea that CD4(+)T cells can directly limit AIDS virus spread in T cells. Furthermore, Gag68 TCR transfer into CD4(+)T-cell clones with differing properties holds promise to better understand the suppressive effector mechanisms used by this important component of the antiviral response using the rhesus macaque model. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Hepatocyte specific expression of human cloned genes

    Energy Technology Data Exchange (ETDEWEB)

    Cortese, R


    A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.

  8. Cloning (United States)

    Cloning describes the processes used to create an exact genetic replica of another cell, tissue or organism. ... named Dolly. There are three different types of cloning: Gene cloning, which creates copies of genes or ...

  9. Rabies virus-specific human T cell clones provide help for an in vitro antibody response against neutralizing antibody-inducing determinants of the viral glycoprotein.

    NARCIS (Netherlands)

    H. Bunschoten; R.J. Klapmuts; I.J.Th.M. Claassen (Ivo); S.D. Reijneveld; A.D.M.E. Osterhaus (Albert); F.G.C.M. Uytdehaag (Fons)


    textabstractHuman T cell clones were prepared from peripheral blood mononuclear cells from a vaccinated human donor and kept in culture in the presence of rabies virus antigen and growth factors. Phenotypic analysis of the T cell clones revealed expression of the CD3 and CD4 cell surface markers,

  10. Adoptive transfer of EBV specific CD8+ T cell clones can transiently control EBV infection in humanized mice.

    Directory of Open Access Journals (Sweden)

    Olga Antsiferova


    Full Text Available Epstein Barr virus (EBV infection expands CD8+ T cells specific for lytic antigens to high frequencies during symptomatic primary infection, and maintains these at significant numbers during persistence. Despite this, the protective function of these lytic EBV antigen-specific cytotoxic CD8+ T cells remains unclear. Here we demonstrate that lytic EBV replication does not significantly contribute to virus-induced B cell proliferation in vitro and in vivo in a mouse model with reconstituted human immune system components (huNSG mice. However, we report a trend to reduction of EBV-induced lymphoproliferation outside of lymphoid organs upon diminished lytic replication. Moreover, we could demonstrate that CD8+ T cells against the lytic EBV antigen BMLF1 can eliminate lytically replicating EBV-transformed B cells from lymphoblastoid cell lines (LCLs and in vivo, thereby transiently controlling high viremia after adoptive transfer into EBV infected huNSG mice. These findings suggest a protective function for lytic EBV antigen-specific CD8+ T cells against EBV infection and against virus-associated tumors in extra-lymphoid organs. These specificities should be explored for EBV-specific vaccine development.

  11. Osteoclast nuclei of myeloma patients show chromosome translocations specific for the myeloma cell clone: a new type of cancer-host partnership?

    DEFF Research Database (Denmark)

    Levin Andersen, Thomas; Boissy, Patrice; Sondergaard, T E


    through fusion between myeloma cells and osteoclasts. In conclusion, malignant cells contribute significantly to the formation of bone-resorbing osteoclasts in multiple myeloma. Osteoclast-myeloma clone hybrids reflect a previously unrecognized mechanism of bone destruction in which malignant cells...

  12. Automated Cell-Cutting for Cell Cloning (United States)

    Ichikawa, Akihiko; Tanikawa, Tamio; Matsukawa, Kazutsugu; Takahashi, Seiya; Ohba, Kohtaro

    We develop an automated cell-cutting technique for cell cloning. Animal cells softened by the cytochalasin treatment are injected into a microfluidic chip. The microfluidic chip contains two orthogonal channels: one microchannel is wide, used to transport cells, and generates the cutting flow; the other is thin and used for aspiration, fixing, and stretching of the cell. The injected cell is aspirated and stretched in the thin microchannel. Simultaneously, the volumes of the cell before and after aspiration are calculated; the volumes are used to calculate the fluid flow required to aspirate half the volume of the cell into the thin microchannel. Finally, we apply a high-speed flow in the orthogonal microchannel to bisect the cell. This paper reports the cutting process, the cutting system, and the results of the experiment.

  13. ReMixT: clone-specific genomic structure estimation in cancer. (United States)

    McPherson, Andrew W; Roth, Andrew; Ha, Gavin; Chauve, Cedric; Steif, Adi; de Souza, Camila P E; Eirew, Peter; Bouchard-Côté, Alexandre; Aparicio, Sam; Sahinalp, S Cenk; Shah, Sohrab P


    Somatic evolution of malignant cells produces tumors composed of multiple clonal populations, distinguished in part by rearrangements and copy number changes affecting chromosomal segments. Whole genome sequencing mixes the signals of sampled populations, diluting the signals of clone-specific aberrations, and complicating estimation of clone-specific genotypes. We introduce ReMixT, a method to unmix tumor and contaminating normal signals and jointly predict mixture proportions, clone-specific segment copy number, and clone specificity of breakpoints. ReMixT is free, open-source software and is available at .

  14. Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line. (United States)

    Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi


    TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

  15. Characteristics of Prevotella intermedia-specific CD4+ T cell clones from peripheral blood of a chronic adult periodontitis patient

    NARCIS (Netherlands)

    Wassenaar, A.; Reinhardus, C.; Abraham-Inpijn, L.; Snijders, A.; Kievits, F.


    Periodontitis is a chronic destructive inflammatory disease associated with periodontopathic bacteria. In addition, autoantigens such as collagen and heat shock proteins (hsp) have been suggested to play a role. Established periodontal lesions are characterized by dense infiltrations of immune cells

  16. Endangered wolves cloned from adult somatic cells. (United States)

    Kim, Min Kyu; Jang, Goo; Oh, Hyun Ju; Yuda, Fibrianto; Kim, Hye Jin; Hwang, Woo Suk; Hossein, Mohammad Shamim; Kim, Joung Joo; Shin, Nam Shik; Kang, Sung Keun; Lee, Byeong Chun


    Over the world, canine species, including the gray wolf, have been gradually endangered or extinct. Many efforts have been made to recover and conserve these canids. The aim of this study was to produce the endangered gray wolf with somatic cell nuclear transfer (SCNT) for conservation. Adult ear fibroblasts from a female gray wolf (Canis lupus) were isolated and cultured in vitro as donor cells. Because of limitations in obtaining gray wolf matured oocytes, in vivo matured canine oocytes obtained by flushing the oviducts from the isthmus to the infundibulum were used. After removing the cumulus cells, the oocyte was enucleated, microinjected, fused with a donor cell, and activated. The reconstructed cloned wolf embryos were transferred into the oviducts of the naturally synchronized surrogate mothers. Two pregnancies were detected by ultrasonography at 23 days of gestation in recipient dogs. In each surrogate dog, two fetal sacs were confirmed by early pregnancy diagnosis at 23 days, but only two cloned wolves were delivered. The first cloned wolf was delivered by cesarean section on October 18, 2005, 60 days after embryo transfer. The second cloned wolf was delivered on October 26, 2005, at 61 days postembryo transfer. Microsatellite analysis was performed with genomic DNA from the donor wolf, the two cloned wolves, and the two surrogate female recipients to confirm the genetic identity of the cloned wolves. Analysis of 19 microsatellite loci confirmed that the cloned wolves were genetically identical to the donor wolf. In conclusion, we demonstrated live birth of two cloned gray wolves by nuclear transfer of wolf somatic cells into enucleated canine oocyte, indicating that SCNT is a practical approach for conserving endangered canids.

  17. Effect of TH-lines and clones on the growth and differentiation of B cell clones in microculture. (United States)

    Kotloff, D B; Cebra, J J


    Antibody isotype expression by B cell clones was analyzed using in vitro microcultures containing low numbers of hapten-gelatin-enriched B cells and higher numbers of hemocyanin-specific helper T cell lines or clones. Twenty-eight to sixty-three percent of clones grown in microculture with haptenated hemocyanin and T cells from established lines expressed IgG and/or IgA isotypes in random mixtures, almost always accompanied by IgM. Helper T cells from hemocyanin-specific clones also supported the expression of non-IgM isotypes by the B cell clones, suggesting that a single specificity of T cell can provide sufficient growth and differentiation factors for the display of isotype switching. A positive correlation between the antibody output of clones and the expression of non-IgM isotypes indicated that the switching process may be associated with cell division. Although memory B cells that give clones expressing IgG and/or IgA in the absence of IgM are also enriched on haptenated gelatin, they are not stimulable under conditions of this microculture assay.

  18. Somatic cell nuclear transfer cloning: practical applications and current legislation. (United States)

    Niemann, H; Lucas-Hahn, A


    Somatic cloning is emerging as a new biotechnology by which the opportunities arising from the advances in molecular genetics and genome analysis can be implemented in animal breeding. Significant improvements have been made in SCNT protocols in the past years which now allow to embarking on practical applications. The main areas of application of SCNT are: Reproductive cloning, therapeutic cloning and basic research. A great application potential of SCNT based cloning is the production of genetically modified (transgenic) animals. Somatic cell nuclear transfer based transgenic animal production has significant advances over the previously employed microinjection of foreign DNA into pronuclei of zygotes. This cell based transgenesis is compatible with gene targeting and allows both, the addition of a specific gene and the deletion of an endogenous gene. Efficient transgenic animal production provides numerous opportunities for agriculture and biomedicine. Regulatory agencies around the world have agreed that food derived from cloned animals and their offspring is safe and there is no scientific basis for questioning this. Commercial application of somatic cloning within the EU is via the Novel Food regulation EC No. 258/97. Somatic cloning raises novel questions regarding the ethical and moral status of animals and their welfare which has prompted a controversial discussion in Europe which has not yet been resolved. © 2012 Blackwell Verlag GmbH.

  19. Dogs cloned from adult somatic cells. (United States)

    Lee, Byeong Chun; Kim, Min Kyu; Jang, Goo; Oh, Hyun Ju; Yuda, Fibrianto; Kim, Hye Jin; Hossein, M Shamim; Shamim, M Hossein; Kim, Jung Ju; Kang, Sung Keun; Schatten, Gerald; Hwang, Woo Suk


    Several mammals--including sheep, mice, cows, goats, pigs, rabbits, cats, a mule, a horse and a litter of three rats--have been cloned by transfer of a nucleus from a somatic cell into an egg cell (oocyte) that has had its nucleus removed. This technology has not so far been successful in dogs because of the difficulty of maturing canine oocytes in vitro. Here we describe the cloning of two Afghan hounds by nuclear transfer from adult skin cells into oocytes that had matured in vivo. Together with detailed sequence information generated by the canine-genome project, the ability to clone dogs by somatic-cell nuclear transfer should help to determine genetic and environmental contributions to the diverse biological and behavioural traits associated with the many different canine breeds.

  20. Mouse cloning and somatic cell reprogramming using electrofused blastomeres. (United States)

    Riaz, Amjad; Zhao, Xiaoyang; Dai, Xiangpeng; Li, Wei; Liu, Lei; Wan, Haifeng; Yu, Yang; Wang, Liu; Zhou, Qi


    Mouse cloning from fertilized eggs can assist development of approaches for the production of "genetically tailored" human embryonic stem (ES) cell lines that are not constrained by the limitations of oocyte availability. However, to date only zygotes have been successfully used as recipients of nuclei from terminally differentiated somatic cell donors leading to ES cell lines. In fertility clinics, embryos of advanced embryonic stages are usually stored for future use, but their ability to support the derivation of ES cell lines via somatic nuclear transfer has not yet been proved. Here, we report that two-cell stage electrofused mouse embryos, arrested in mitosis, can support developmental reprogramming of nuclei from donor cells ranging from blastomeres to somatic cells. Live, full-term cloned pups from embryonic donors, as well as pluripotent ES cell lines from embryonic or somatic donors, were successfully generated from these reconstructed embryos. Advanced stage pre-implantation embryos were unable to develop normally to term after electrofusion and transfer of a somatic cell nucleus, indicating that discarded pre-implantation human embryos could be an important resource for research that minimizes the ethical concerns for human therapeutic cloning. Our approach provides an attractive and practical alternative to therapeutic cloning using donated oocytes for the generation of patient-specific human ES cell lines.

  1. Cloning mice and ES cells by nuclear transfer from somatic stem cells and fully differentiated cells. (United States)

    Wang, Zhongde


    Cloning animals by nuclear transfer (NT) has been successful in several mammalian species. In addition to cloning live animals (reproductive cloning), this technique has also been used in several species to establish cloned embryonic stem (ntES) cell lines from somatic cells. It is the latter application of this technique that has been heralded as being the potential means to produce isogenic embryonic stem cells from patients for cell therapy (therapeutic cloning). These two types of cloning differ only in the steps after cloned embryos are produced: for reproductive cloning the cloned embryos are transferred to surrogate mothers to allow them to develop to full term and for therapeutic cloning the cloned embryos are used to derive ntES cells. In this chapter, a detailed NT protocol in mouse by using somatic stem cells (neuron and skin stem cells) and fully differentiated somatic cells (cumulus cells and fibroblast cells) as nuclear donors is described.

  2. Keith's MAGIC: Cloning and the Cell Cycle. (United States)

    Wells, D N


    Abstract Professor Keith Campbell's critical contribution to the discovery that a somatic cell from an adult animal can be fully reprogrammed by oocyte factors to form a cloned individual following nuclear transfer (NT)(Wilmut et al., 1997 ) overturned a dogma concerning the reversibility of cell fate that many scientists had considered to be biologically impossible. This seminal experiment proved the totipotency of adult somatic nuclei and finally confirmed that adult cells could differentiate without irreversible changes to the genetic material.

  3. Establishment and characterization of Epstein-Barr virus-specific human CD4+ T lymphocyte clones

    International Nuclear Information System (INIS)

    Honda, S.; Okuno, K.; Yasutomi, M.; Takasaki, T.; Kurane, I.


    We developed a simple method for establishing Epstein-Barr virus (EBV)-specific, human CD4+ T cell clones. The method originates from our experience that the regression of cell growth in in vitro EBV transformation of B cells occurs when round lymphoid cells appear in the culture. Peripheral blood mononuclear cells were cultured with EBV; and IL-2 (20 U/ml) was added to the culture on day 17 after the virus addition. The phenotype of the growing cells was CD3+ , CD4+ , and CD8-. The cells were cytotoxic for autologous lymphoblastoid B cell line (LCL) and EBV-super-infected autologous LCL. The cytotoxic T lymphocytes (CTLs) were confirmed to be CD4+ T cells but not CD8+ T cells in the culture. CTL clones were established by a limiting dilution method. All the CTL clones had the phenotype of CD3+ , CD4+ and CD8-, and proliferated in response to autologous LCL. They produced interferon (IFN)-gamma, interleukin 2 (IL-2) and tumour necrosis factor (TNF)-beta but not IL-4. All but one clone responded to both autologous, EBV-super-infected and non-super-infected LCLs. Proliferative and cytotoxic responses to allogeneic LCLs were heterogeneous. These results suggest that this method induces heterogeneous, EBV-specific CD4+ CTL clones and is useful for analysis of CD4+ T cells in EBV infections. (authors)

  4. Differentiated cells are more efficient than adult stem cells for cloning by somatic cell nuclear transfer. (United States)

    Sung, Li-Ying; Gao, Shaorong; Shen, Hongmei; Yu, Hui; Song, Yifang; Smith, Sadie L; Chang, Ching-Chien; Inoue, Kimiko; Kuo, Lynn; Lian, Jin; Li, Ao; Tian, X Cindy; Tuck, David P; Weissman, Sherman M; Yang, Xiangzhong; Cheng, Tao


    Since the creation of Dolly via somatic cell nuclear transfer (SCNT), more than a dozen species of mammals have been cloned using this technology. One hypothesis for the limited success of cloning via SCNT (1%-5%) is that the clones are likely to be derived from adult stem cells. Support for this hypothesis comes from the findings that the reproductive cloning efficiency for embryonic stem cells is five to ten times higher than that for somatic cells as donors and that cloned pups cannot be produced directly from cloned embryos derived from differentiated B and T cells or neuronal cells. The question remains as to whether SCNT-derived animal clones can be derived from truly differentiated somatic cells. We tested this hypothesis with mouse hematopoietic cells at different differentiation stages: hematopoietic stem cells, progenitor cells and granulocytes. We found that cloning efficiency increases over the differentiation hierarchy, and terminally differentiated postmitotic granulocytes yield cloned pups with the greatest cloning efficiency.

  5. Human cloning, stem cell research. An Islamic perspective. (United States)

    Al-Aqeel, Aida I


    The rapidly changing technologies that involve human subjects raise complex ethical, legal, social, and religious issues. Recent advances in the field of cloning and stem cell research have introduced new hopes for the treatment of serious diseases. But this promise has raised many complex questions. This field causes debate and challenge, not only among scientists but also among ethicists, religious scholars, governments, and politicians. There is no consensus on the morality of human cloning, even within specific religious traditions. In countries in which religion has a strong influence on political decision making, the moral status of the human embryo is at the center of the debate. Because of the inevitable consequences of reproductive cloning, it is prohibited in Islam. However, stem cell research for therapeutic purposes is permissible with full consideration, and all possible precautions in the pre-ensoulment stages of early fetus development, if the source is legitimate.

  6. Delayed reproductive death as a dominant phenotype in cell clones surviving X-irradiation

    International Nuclear Information System (INIS)

    Chang, W.P.; Little, J.B.


    Residual damage manifested as reduced cloning efficiency was observed in many of the cloned progeny of Chinese hamster ovary (CHO) cells and human carcinoma SQ-20B cells surviving X-irradiation. This stable phenotype, which we have termed delayed reproductive death, persisted for >50 generations of cell replication post-irradiation. Clones showing this phenotype were aneuploid, and formed colonies with a high proportion of giant cells. By somatic cell hybridization of CHO clones, the delayed reproductive death phenotype was found to be a dominant trait; the cloning efficiency of hybrid clones was persistently depressed, as compared with that of control hybrid cells. These results suggest that delayed reproductive death represents a specific cellular response that may persist in some of the progeny of mammalian cells for long periods after X-irradiation. (author)

  7. Old and New World arenaviruses share a highly conserved epitope in the fusion domain of the glycoprotein 2, which is recognized by Lassa virus-specific human CD4+ T-cell clones

    International Nuclear Information System (INIS)

    Meulen, Jan ter; Badusche, Marlis; Satoguina, Judith; Strecker, Thomas; Lenz, Oliver; Loeliger, Cornelius; Sakho, Mohamed; Koulemou, Kekoura; Koivogui, Lamine; Hoerauf, Achim


    Data from human studies and animal experiments indicate a dominant role of T-cells over antibodies in controlling acute Lassa virus infection and providing immunity to reinfection. Knowledge of the epitopes recognized by T-cells may therefore be crucial to the development of a recombinant Lassa virus vaccine. In order to study human T-cell reactivity to the most conserved structural protein of Lassa virus, the glycoprotein 2 (GP2), seven GP2-specific CD4+ T-cell clones (TCCs) were generated from the lymphocytes of a Lassa antibody positive individual. All TCC displayed high specific proliferation, showed DR-restriction, and produced IFN-γ upon stimulation with recombinant GP2. The epitope of four of the clones was localized to a short stretch of 13 amino acids located in the N-terminal part of GP2 (aa 289-301, numbering according to sequence of GPC). This epitope is conserved in all strains of Lassa virus and lymphocytic choriomeningitis virus (LCMV), shows >90% similarity in all New World arenaviruses of clade B, and overlaps with the proposed fusion domain of GP2. Peptides with conservative aa exchanges, as they naturally occur in the epitope 289-301 of the Old World arenavirus Mopeia and some New World arenaviruses, continued to effectively stimulate the Lassa-GP2-specific T-cell clones tested. The finding of a human T-helper cell epitope, which is highly conserved between Old and New World arenaviruses, is of importance for the design of arenavirus vaccines

  8. DNA Methylation in Peripheral Blood Cells of Pigs Cloned by Somatic Cell Nuclear Transfer

    DEFF Research Database (Denmark)

    Gao, Fei; Li, Shengting; Lin, Lin


    To date, the genome-wide DNA methylation status of cloned pigs has not been investigated. Due to the relatively low success rate of pig cloning by somatic cell nuclear transfer, a better understanding of the epigenetic reprogramming and the global methylation patterns associated with development...... in cloned pigs is required. In this study we applied methylation-specific digital karyotyping tag sequencing by Solexa technology and investigated the genome-wide DNA methylation profiles of peripheral blood cells in cloned pigs with normal phenotypes in comparison with their naturally bred controls....... In the result, we found that globally there was no significant difference of DNA methylation patterns between the two groups. Locus-specifically, some genes involved in embryonic development presented a generally increased level of methylation. Our findings suggest that in cloned pigs with normal phenotypes...

  9. Human somatic cell nuclear transfer and cloning. (United States)


    This document presents arguments that conclude that it is unethical to use somatic cell nuclear transfer (SCNT) for infertility treatment due to concerns about safety; the unknown impact of SCNT on children, families, and society; and the availability of other ethically acceptable means of assisted reproduction. This document replaces the ASRM Ethics Committee report titled, "Human somatic cell nuclear transfer (cloning)," last published in Fertil Steril 2000;74:873-6. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  10. Phage Display Breast Carcinoma cDNA Libraries: Isolation of Clones Which Specifically Bind to Membrane Glycoproteins, Mucins, and Endothelial Cell Surface

    National Research Council Canada - National Science Library

    Yamamoto, Fumiichiro


    .... Using blood- group H-expressing glycoprotein fraction as bait, we observed enrichment of phage clones expressing sequences from galectin-3, a lectin with an affinity with the blood-group substance...

  11. Cytotoxic T-lymphocyte clones, established by stimulation with the HLA-A2 binding p5365-73 wild type peptide loaded on dendritic cells In vitro, specifically recognize and lyse HLA-A2 tumour cells overexpressing the p53 protein

    DEFF Research Database (Denmark)

    Barfoed, Annette Malene; Petersen, T R; Kirkin, A F


    of recognizing p53 derived wild type (self) peptides. Furthermore, the capacity of R9V specific T cell clones to exert HLA restricted cytotoxicity, argues that the R9V peptide is naturally presented on certain cancer cells. This supports the view that p53 derived wild type peptides might serve as candidate......Mutations in the tumour suppressor gene p53 are among the most frequent genetic alterations in human malignancies, often associated with an accumulation of the p53 protein in the cytoplasm. We have generated a number of cytotoxic T lymphocyte (CTL) clones that specifically recognize the HLA-A*0201...

  12. Putative porcine embryonic stem cell lines derived from aggregated four-celled cloned embryos produced by oocyte bisection cloning. (United States)

    Siriboon, Chawalit; Lin, Yu-Hsuan; Kere, Michel; Chen, Chun-Da; Chen, Lih-Ren; Chen, Chien-Hong; Tu, Ching-Fu; Lo, Neng-Wen; Ju, Jyh-Cherng


    We attempted to isolate ES cell lines using inner cell masses from high-quality cloned porcine blastocysts. After being seeded onto feeders, embryos had better (P cloned embryos (62.8, 42.6 and 12.8% vs. 76.2, 55.2 and 26.2%, respectively) compared to the non-aggregated group (41.6, 23.4 and 3.9%). Effects of feeder types (STO vs. MEF) and serum sources (FBS vs. KSR) on extraction of cloned embryo-derived porcine ES cells were examined. More (17.1%) ntES cell lines over Passage 3 were generated in the MEF/KSR group. However, ntES cells cultured in KSR-supplemented medium had a low proliferation rate with defective morphology, and eventually underwent differentiation or apoptosis subsequently. Approximately 26.1, 22.7 and 35.7% of primary colonies were formed after plating embryos in DMEM, DMEM/F12 and α-MEM media, respectively. Survival rates of ntES cells cultured in α-MEM, DMEM and DMEM/F12 were 16.7, 4.3 and 6.8%, respectively (P > 0.05). We further examined the beneficial effect of TSA treatment of 3× aggregated cloned embryos on establishment of ntES cell lines. Primary colony numbers and survival rates of ntES cells beyond passage 3 were higher (P cells, remaining undifferentiated over 25 passages, had alkaline phosphatase activity and expressed ES specific markers Oct4, Nanog, Sox2, and Rex01. Moreover, these ntES cells successfully differentiated into embryoid bodies (EBs) that expressed specific genes of all three germ layers after being cultured in LIF-free medium. In conclusion, we have successfully derived putative porcine ntES cells with high efficiency from quality cloned embryos produced by embryo aggregation, and optimized the ES cell culture system suitable for establishing and maintaining ntES cell lines in undifferentiated state.

  13. Cloning Mice and Men: Prohibiting the Use of iPS Cells for Human Reproductive Cloning


    Lo, Bernard; Parham, Lindsay; Alvarez-Buylla, Arturo; Cedars, Marcelle; Conklin, Bruce; Fisher, Susan; Gates, Elena; Giudice, Linda; Halme, Dina Gould; Hershon, William; Kriegstein, Arnold; Kwok, Pui-Yan; Wagner, Richard


    The use of iPSCs and tetraploid complementation for human reproductive cloning would raise profound ethical objections. Professional standards and laws that ban human reproductive cloning by somatic cell nuclear transfer should be revised to also forbid it by other methods, such as iPSCs via tetraploid complementation.

  14. Cloning mice and men: prohibiting the use of iPS cells for human reproductive cloning. (United States)

    Lo, Bernard; Parham, Lindsay; Alvarez-Buylla, Arturo; Cedars, Marcelle; Conklin, Bruce; Fisher, Susan; Gates, Elena; Giudice, Linda; Halme, Dina Gould; Hershon, William; Kriegstein, Arnold; Kwok, Pui-Yan; Wagner, Richard


    The use of iPSCs and tetraploid complementation for human reproductive cloning would raise profound ethical objections. Professional standards and laws that ban human reproductive cloning by somatic cell nuclear transfer should be revised to also forbid it by other methods, such as iPSCs via tetraploid complementation. Copyright 2010 Elsevier Inc. All rights reserved.

  15. Lysis of cells infected with typhus group rickettsiae by a human cytotoxic T cell clone

    International Nuclear Information System (INIS)

    Carl, M.; Robbins, F.; Hartzman, R.J.; Dasch, G.A.


    Cytolytic human T cells clones generated in response to the intracellular bacterium Rickettsia typhi were characterized. Growing clones were tested for their ability to proliferate specifically in response to antigens derived from typhus group rickettsiae or to lyse targets infected with R. typhi or Rickettsia prowazekii, as measured by 51 Cr-release from target cells. Two clones were able to lyse targets infected with typhus group rickettsiae. One of these clones was more fully characterized because of its rapid growth characteristics. This cytolytic clone was capable of lysing an autologous infected target as well as a target matched for class I and II histocompatibility leukocyte antigens (HLA). It was not capable, however, of lysing either a target mismatched for both class I and II HLA or a target partially matched for class I HLA. In addition, the clone exhibited specificity in that it was able to lyse an autologous target infected with typhus group rickettsiae, but did not lyse an autologous target infected with an antigenically distinct rickettsial species, Rickettsia tsutsugamushi. These results demonstrate, for the first time, that cells infected with intracellular bacteria can be lysed by human cytotoxic T lymphocytes

  16. Transplantation and differentiation of donor cells in the cloned pigs

    International Nuclear Information System (INIS)

    Shimada, Arata; Tomii, Ryo; Kano, Koichiro; Nagashima, Hiroshi


    The application of nuclear transfer technology is an interesting approach to investigate stem and progenitor cell transplantation therapy. If stem cells are used as a nuclear donor, donor cells can engraft into cloned animals without histocompatible problems. However, it is still uncertain whether donor cells can engraft to cloned animal and differentiate in vivo. To address this problem, we transplanted donor cells to dermal tissues of cloned pigs developed by using preadipocytes as donor cells. Preadipocytes are adipocytic progenitor which can differentiate to mature adipocytes in vitro. We showed that the donor preadipocytes were successfully transplanted into the cloned pigs without immune rejection and they differentiated into mature adipocytes in vivo 3 weeks after transplantation. In contrast, allogenic control preadipocytes, which can differentiate in vitro, did not differentiate in vivo. These results indicate that donor progenitor cells can differentiate in cloned animal

  17. [Product safety analysis of somatic cell cloned bovine]. (United States)

    Hua, Song; Lan, Jie; Song, Yongli; Lu, Chenglong; Zhang, Yong


    Somatic cell cloning (nuclear transfer) is a technique through which the nucleus (DNA) of a somatic cell is transferred into an enucleated oocyte for the generation of a new individual, genetically identical to the somatic cell donor. It could be applied for the enhancement of reproduction rate and the improvement of food products involving quality, yield and nutrition. In recent years, the United States, Japan and Europe as well as other countries announced that meat and milk products made from cloned cattle are safe for human consumption. Yet, cloned animals are faced with a wide range of health problems, with a high death rate and a high incidence of disease. The precise causal mechanisms for the low efficiency of cloning remain unclear. Is it safe that any products from cloned animals were allowed into the food supply? This review focuses on the security of meat, milk and products from cloned cattle based on the available data.

  18. Transfer of experimental autoimmune thyroiditis with T cell clones

    International Nuclear Information System (INIS)

    Romball, C.G.; Weigle, W.O.


    We have investigated three T lymphocyte clones isolated from CBA/CaJ mice primed with mouse thyroid extract (MTE) in adjuvant. All three clones are L3T4+, Ig-, and Lyt2- and proliferate to MTE, mouse thyroglobulin (MTG) and rat thyroid extract. Clones A7 and B7 transfer thyroiditis to irradiated (475 rad) syngeneic mice, but not to normal recipients. The thyroid lesion induced by the B7 clone is characterized by the infiltration of both mononuclear and polymorphonuclear cells. The thyroiditis is transient in that lesions are apparent 7 and 14 days after transfer, but thyroids return to normal by day 21. Clone B7 showed helper activity for trinitrophenyl-keyhole limpet hemocyanin-primed B cells in vitro when stimulated with trinitrophenyl-MTG and also stimulated the production of anti-MTG antibody in recipient mice. Clone A7 induced thyroid lesions characterized by infiltration of the thyroid with mononuclear cells, with virtually no polymorphonuclear cell infiltration. This clone has shown no helper activity following stimulation with trinitrophenyl-MTG. The third clone (D2) proliferates to and shows helper activity to MTG, but fails to transfer thyroiditis to syngeneic, irradiated mice. On continuous culture, clone B7 lost its surface Thy. The loss of Thy appears unrelated to the ability to transfer thyroiditis since subclones of B7 with markedly different percentages of Thy+ cells transferred disease equally well

  19. Cloning animals by somatic cell nuclear transfer – biological factors (United States)

    Tian, X Cindy; Kubota, Chikara; Enright, Brian; Yang, Xiangzhong


    Cloning by nuclear transfer using mammalian somatic cells has enormous potential application. However, somatic cloning has been inefficient in all species in which live clones have been produced. High abortion and fetal mortality rates are commonly observed. These developmental defects have been attributed to incomplete reprogramming of the somatic nuclei by the cloning process. Various strategies have been used to improve the efficiency of nuclear transfer, however, significant breakthroughs are yet to happen. In this review we will discuss studies conducted, in our laboratories and those of others, to gain a better understanding of nuclear reprogramming. Because cattle are a species widely used for nuclear transfer studies, and more laboratories have succeeded in cloning cattle than any other specie, this review will be focused on somatic cell cloning of cattle. PMID:14614770

  20. Embryos, Clones, and Stem Cells: A Scientific Primer

    Directory of Open Access Journals (Sweden)

    Kenyon S. Tweedell


    Full Text Available This article is intended to give the nonspecialist an insight into the nuances of “clones”, cloning, and stem cells. It distinguishes embryonic and adult stem cells, their normal function in the organism, their origin, and how they are recovered to produce stem cell lines in culture. As background, the fundamental processes of embryo development are reviewed and defined, since the manipulation of stem cell lines into desired specialized cells employs many of the same events. Stem cells are defined and characterized and shown how they function in the intact organism during early development and later during cell regeneration in the adult. The complexity of stem cell recovery and their manipulation into specific cells and tissue is illustrated by reviewing current experimentation on both embryonic and adult stem cells in animals and limited research on human stem cell lines. The current and projected use of stem cells for human diseases and repair, along with the expanding methodology for the recovery of human embryonic stem cells, is described. An assessment on the use of human embryonic stem cells is considered from ethical, legal, religious, and political viewpoints.

  1. Cloning the interleukin 1 receptor from human T cells

    International Nuclear Information System (INIS)

    Sims, J.E.; Acres, R.B.; Grubin, C.E.; McMahan, C.J.; Wignall, J.M.; March, C.J.; Dower, S.K.


    cDNA clones of the interleukin 1 (IL-1) receptor expressed in a human T-cell clone have been isolated by using a murine IL-1 receptor cDNA as a probe. The human and mouse receptors show a high degree of sequence conservation. Both are integral membrane proteins possessing a single membrane-spanning segment. Similar to the mouse receptor, the human IL-1 receptor contains a large cytoplasmic region and an extracellular, IL-1 binding portion composed of three immunoglobulin-like domains. When transfected into COS cells, the human IL-1 receptor cDNA clone leads to expression of two different affinity classes of receptors, with K a values indistinguishable from those determined for IL-1 receptors in the original T-cell clone. An IL-1 receptor expressed in human dermal fibroblasts has also been cloned and sequenced and found to be identical to the IL-1 receptor expressed in T cells

  2. Six cloned calves produced from adult fibroblast cells after long-term culture (United States)

    Kubota, Chikara; Yamakuchi, Hiroshi; Todoroki, Junichi; Mizoshita, Kazunori; Tabara, Norio; Barber, Michele; Yang, Xiangzhong


    Cloning whole animals with somatic cells as parents offers the possibility of targeted genetic manipulations in vitro such as “gene knock-out” by homologous recombination. However, such manipulation requires prolonged culture of nuclear donor cells. Previous successes in cloning have been limited to the use of cells collected either fresh or after short-term culture. Therefore, demonstration of genetic totipotency of cells after prolonged culture is pivotal to combining site-specific genetic manipulations and cloning. Here we report birth of six clones of an aged (17-year-old) Japanese Black Beef bull using ear skin fibroblast cells as nuclear donor cells after up to 3 months of in vitro culture (10–15 passages). We observed higher developmental rates for embryos derived from later passages (10 and 15) as compared with those embryos from an early passage (passage 5). The four surviving clones are now 10–12 months of age and appear normal, similar to their naturally reproduced peers. These data show that fibroblasts of aged animals remain competent for cloning, and prolonged culture does not affect the cloning competence of adult somatic donor cells. PMID:10655472

  3. Heterogeneity in induced thermal resistance of rat tumor cell clones

    International Nuclear Information System (INIS)

    Tomasovic, S.P.; Rosenblatt, P.L.; Heitzman, D.


    Four 13762NF rat mammary adenocarcinoma clones were examined for their survival response to heating under conditions that induced transient thermal resistance (thermotolerance). Clones MTC and MTF7 were isolated from the subcutaneous locally growing tumor, whereas clones MTLn2 and MTLn3 were derived from spontaneous lung metastases. There was heterogeneity among these clones in thermotolerance induced by either fractionated 45 0 C or continuous 42 0 C heating, but the order of sensitivity was not necessarily the same. The clones developed thermal resistance at different rates and to different degrees within the same time intervals. There was heterogeneity between clones isolated from within either the primary site or metastatic lesions. However, clones derived from metastatic foci did not intrinsically acquire more or less thermotolerance to fractionated 45 0 C or continuous 42 0 C heating than did clones from the primary tumor. Further, there was no apparent relationship between any phenotypic properties that conferred more or less thermotolerance in vitro and any phenotypic properties that conferred enhanced metastatic success of these same clones by spontaneous (subcutaneous) or experimental (intravenous) routes in vivo. These tumor clones also differ in their karyotype, metastatic potential, cell surface features, sensitivity to x-irradiation and drugs, and ability to repair sublethal radiation damage. These results provide further credence to the concept that inherent heterogeneity within tumors may be as important in therapeutic success as other known modifiers of outcome such as site and treatment heterogeneity

  4. Universal cytotoxic activity of a HTLV-1 Tax-specific T cell clone from an HLA-A*24:02⁺ patient with adult T-cell leukemia against a variety of HTLV-I-infected T-cells. (United States)

    Tanaka, Yukie; Yamazaki, Rie; Terasako-Saito, Kiriko; Nakasone, Hideki; Akahoshi, Yu; Nakano, Hirofumi; Ugai, Tomotaka; Wada, Hidenori; Yamasaki, Ryoko; Ishihara, Yuko; Kawamura, Koji; Sakamoto, Kana; Ashizawa, Masahiro; Sato, Miki; Kimura, Shun-ichi; Kikuchi, Misato; Kako, Shinichi; Kanda, Junya; Tanihara, Aki; Nishida, Junji; Kanda, Yoshinobu


    Adult T cell leukemia/lymphoma (ATL) is an aggressive mature T cell malignancy that is causally associated with human T cell lymphotropic virus type 1 (HTLV-1) infection. The HTLV-1 regulatory protein Tax aggressively accelerates the proliferation of host cells and is also an important target antigen for CD8(+) cytotoxic T cells (CTLs). We previously reported that several predominant HLA-A*24:02-restricted HTLV-1 Tax301-309-specific CTL clones commonly expressed a particular amino acid sequence motif (P-D-R) in complementarity-determining region 3 of T-cell receptor (TCR)-β chain among unrelated ATL patients who underwent allogeneic stem cell transplantation (allo-HSCT). Furthermore, a PDR-motif(+) CTL clone persistently existed in a long-term survivor as a central CTL clone with strong CTL activities after HSCT. Although a larger analysis of the relationship between PDR-motif(+) CTLs and the clinical course is required, the expression of PDR-motif(+) TCR on CD8(+) T cells may play a critical role in the management of anti-HTLV-1 activities for HLA-A24:02(+) ATL patients. Therefore, in this study, we prepared an HTLV-1 Tax301-309 peptide-specific CTL clone (HT-9) expressing PDR-motif(+) TCR isolated from a long-term survivor after HSCT, and evaluated its CTL activity against a variety of HTLV-1-infected T-cells from HLA-A*24:02(+) ATL patients. Before the assay of CTL function, we confirmed that HT-9 expressed less-differentiated effector-memory phenotypes (CD45RA(-)CCR7(-)CD27(+)CD28(+/-)CD57(+/-)) and T-cell exhaustion marker PD-1(+). In assays of CTL function, HT-9 recognized HTLV-1 Tax in an HLA-restricted fashion and demonstrated strong CTL activities against a variety of HTLV-1-infected T-cells from HLA-A*24:02(+) ATL patients regardless of whether the sources were autologous or allogeneic, but not normal cells. These data indicate that PDR-motif(+) TCR could be an important TCR candidate for TCR-gene immunotherapy for HLA-A24:02(+) ATL patients, provided

  5. Clone-specific differences in Pragmites australis: Effects of ploidy level and geographic origin

    DEFF Research Database (Denmark)

    Hansen, D.; Lambertini, Carla; Jampeetong, Arunothai


    by the geographic origin, the euploidy level (4x, 6x, 8x and 12x), and to assess differences between native and introduced clones in North America. Growth, morphology, photosynthetic characteristics, photosynthetic pigments and enzymes were measured on 11 geographically distinct clones propagated in a common...... result in an increase in plant size, probably because the number of cell divisions during development is reduced. Four North American clones were included in the study. The clone from the Atlantic Coast and the supposed invasive European clone resembled each other. The Gulf Coast clone differed from...

  6. Specific genetic modifications of domestic animals by gene targeting and animal cloning

    Directory of Open Access Journals (Sweden)

    Zhou Jiangfeng


    Full Text Available Abstract The technology of gene targeting through homologous recombination has been extremely useful for elucidating gene functions in mice. The application of this technology was thought impossible in the large livestock species until the successful creation of the first mammalian clone "Dolly" the sheep. The combination of the technologies for gene targeting of somatic cells with those of animal cloning made it possible to introduce specific genetic mutations into domestic animals. In this review, the principles of gene targeting in somatic cells and the challenges of nuclear transfer using gene-targeted cells are discussed. The relevance of gene targeting in domestic animals for applications in bio-medicine and agriculture are also examined.

  7. Anti-idiotypic antibodies against UV-induced tumor-specific CTL clones. Preparation in syngeneic combination

    International Nuclear Information System (INIS)

    Kuribayashi, K.; Tanaka, C.; Matsubayashi, Y.; Masuda, T.; Udono, H.; Abe, M.; Nakayama, E.; Shiku, H.


    In this study, we first established several CTL clones of (BALB/c x C57BL/6)F1 origin that were specific for either syngeneic UV female 1 or UV male 1 fibrosarcoma cell lines. All the CTL clones had Thy-1+ Lyt-2+ L3T4- phenotypes and showed Kd restriction when lysing the corresponding target cells. Sera obtained from syngeneic animals immunized with three CTL clones, 10B-5 for UV female 1, and CTL9 and CTL10 for UV male 1, showed specific inhibition of target cell lysis with the corresponding CTL clones. The inhibitory activities were found in sera of the majority of immunized animals. Because the inhibitory activity resides in protein A-binding fraction, mAb were produced by hybridizing spleen cells of hyperimmune animals. N1-56 was thus obtained from a mouse immunized with 10B-5 CTL clone reactive with UV female 1. N1-56 was clonotype specific, reacting with 10B-5 but not with other CTL lines or leukemia cell lines. No N1-56+ cells were detectable in thymocytes, lymph node cells, or spleen cells of either naive or UV female 1-immune CB6F1 mice. Immunoprecipitation showed that N1-56 reacts with 90,000 Mr molecules on 10B-5 CTL clone under nonreducing conditions and 45,000 Mr molecules under reducing conditions, indicating its reactivities with idiotypic determinants of TCR on the CTL clone. N1-56 inhibited lytic activity of 10B-5, but neither N1-56 nor alpha-10B-5 hyperimmune serum inhibited that of alpha-UV female 1 mixed lymphocyte tumor cell culture cells. N1-56 induced proliferation of 10B-5 without addition of Ag

  8. Immunobiology of T cell responses to Mls-locus-disparate stimulator cells. III. Helper and cytolytic functions of cloned, Mls-reactive T cell lines

    International Nuclear Information System (INIS)

    Katz, M.E.; Tite, J.P.; Janeway, C.A. Jr.


    Mls-specific T cell clones derived by limiting dilution were tested for cytotoxic activity in a lectin-dependent 51 Cr-release assay. All the T cell clones tested were cytotoxic in such an assay in apparent contrast to previous reports (1, 2). However, only those target cells sensitive to cytolysis by other L3T4a + cytolytic T cells (3) were killed by Mls-specific T cell clones in short term 51 Cr-release assays, possibly explaining this discrepancy. All the T cell clones tested were L3T4a + ,Lyt-2 - and stimulated B cells from Mls strains of mice to proliferate and secrete immunoglobulin. Furthermore, lysis of innocent bystander targets was observed when the T cells were stimulated with Mls-disparate stimulator cells. These results are consistent with those obtained with L3T4a - T cells specific for protein antigen:self Ia and that express cytotoxic potential (3)

  9. Recent advancements in cloning by somatic cell nuclear transfer. (United States)

    Ogura, Atsuo; Inoue, Kimiko; Wakayama, Teruhiko


    Somatic cell nuclear transfer (SCNT) cloning is the sole reproductive engineering technology that endows the somatic cell genome with totipotency. Since the first report on the birth of a cloned sheep from adult somatic cells in 1997, many technical improvements in SCNT have been made by using different epigenetic approaches, including enhancement of the levels of histone acetylation in the chromatin of the reconstructed embryos. Although it will take a considerable time before we fully understand the nature of genomic programming and totipotency, we may expect that somatic cell cloning technology will soon become broadly applicable to practical purposes, including medicine, pharmaceutical manufacturing and agriculture. Here we review recent progress in somatic cell cloning, with a special emphasis on epigenetic studies using the laboratory mouse as a model.

  10. Recent advancements in cloning by somatic cell nuclear transfer (United States)

    Ogura, Atsuo; Inoue, Kimiko; Wakayama, Teruhiko


    Somatic cell nuclear transfer (SCNT) cloning is the sole reproductive engineering technology that endows the somatic cell genome with totipotency. Since the first report on the birth of a cloned sheep from adult somatic cells in 1997, many technical improvements in SCNT have been made by using different epigenetic approaches, including enhancement of the levels of histone acetylation in the chromatin of the reconstructed embryos. Although it will take a considerable time before we fully understand the nature of genomic programming and totipotency, we may expect that somatic cell cloning technology will soon become broadly applicable to practical purposes, including medicine, pharmaceutical manufacturing and agriculture. Here we review recent progress in somatic cell cloning, with a special emphasis on epigenetic studies using the laboratory mouse as a model. PMID:23166393

  11. Recombinant human albumin supports single cell cloning of CHO cells in chemically defined media. (United States)

    Zhu, Jiang; Wooh, Jong Wei; Hou, Jeff Jia Cheng; Hughes, Benjamin S; Gray, Peter P; Munro, Trent P


    Biologic drugs, such as monoclonal antibodies, are commonly made using mammalian cells in culture. The cell lines used for manufacturing should ideally be clonal, meaning derived from a single cell, which represents a technically challenging process. Fetal bovine serum is often used to support low cell density cultures, however, from a regulatory perspective, it is preferable to avoid animal-derived components to increase process consistency and reduce the risk of contamination from adventitious agents. Chinese hamster ovary (CHO) cells are the most widely used cell line in industry and a large number of serum-free, protein-free, and fully chemically defined growth media are commercially available, although these media alone do not readily support efficient single cell cloning. In this work, we have developed a simple, fully defined, single-cell cloning media, specifically for CHO cells, using commercially available reagents. Our results show that a 1:1 mixture of CD-CHO™ and DMEM/F12 supplemented with 1.5 g/L of recombinant albumin (Albucult®) supports single cell cloning. This formulation can support recovery of single cells in 43% of cultures compared to 62% in the presence of serum. Copyright © 2012 American Institute of Chemical Engineers (AIChE).

  12. Sex-reversed somatic cell cloning in the mouse. (United States)

    Inoue, Kimiko; Ogonuki, Narumi; Mekada, Kazuyuki; Yoshiki, Atsushi; Sado, Takashi; Ogura, Atsuo


    Somatic cell nuclear transfer has many potential applications in the fields of basic and applied sciences. However, it has a disadvantage that can never be overcome technically-the inflexibility of the sex of the offspring. Here, we report an accidental birth of a female mouse following nuclear transfer using an immature Sertoli cell. We produced a batch of 27 clones in a nuclear transfer experiment using Sertoli cells collected from neonatal male mice. Among them, one pup was female. This "male-derived female" clone grew into a normal adult and produced offspring by natural mating with a littermate. Chromosomal analysis revealed that the female clone had a 39,X karyotype, indicating that the Y chromosome had been deleted in the donor cell or at some early step during nuclear transfer. This finding suggests the possibility of resuming sexual reproduction after a single male is cloned, which should be especially useful for reviving extinct or endangered species.

  13. A systematic molecular analysis of the T cell-stimulating antigens from Mycobacterium leprae with T cell clones of leprosy patients. Identification of a novel M. leprae HSP 70 fragment by M. leprae-specific T cells

    NARCIS (Netherlands)

    Janson, A. A.; Klatser, P. R.; van der Zee, R.; Cornelisse, Y. E.; de Vries, R. R.; Thole, J. E.; Ottenhoff, T. H.


    Both protective immunity and immunopathology induced by mycobacteria are dependent on Ag-specific, CD4+ MHC class II-restricted T lymphocytes. The identification of Ag recognized by T cells is fundamental to the understanding of protective and pathologic immunity as well as to the design of

  14. Expression cloning of camelid nanobodies specific for Xenopus embryonic antigens.

    Directory of Open Access Journals (Sweden)

    Keiji Itoh

    Full Text Available Developmental biology relies heavily on the use of conventional antibodies, but their production and maintenance involves significant effort. Here we use an expression cloning approach to identify variable regions of llama single domain antibodies (known as nanobodies, which recognize specific embryonic antigens. A nanobody cDNA library was prepared from lymphocytes of a llama immunized with Xenopus embryo lysates. Pools of bacterially expressed cDNAs were sib-selected for the ability to produce specific staining patterns in gastrula embryos. Three different nanobodies were isolated: NbP1 and NbP3 stained yolk granules, while the reactivity of NbP7 was predominantly restricted to the cytoplasm and the cortex. The isolated nanobodies recognized specific protein bands in immunoblot analysis. A reverse proteomic approach identified NbP1 target antigen as EP45/Seryp, a serine protease inhibitor. Given the unique stability of nanobodies and the ease of their expression in diverse systems, we propose that nanobody cDNA libraries represent a promising resource for molecular markers for developmental biology.

  15. Cloning from stem cells: different lineages, different species, same story. (United States)

    Oback, Björn


    Following nuclear transfer (NT), the most stringent measure of extensive donor cell reprogramming is development into viable offspring. This is referred to as cloning efficiency and quantified as the proportion of cloned embryos transferred into surrogate mothers that survive into adulthood. Cloning efficiency depends on the ability of the enucleated recipient cell to carry out the reprogramming reactions ('reprogramming ability') and the ability of the nuclear donor cell to be reprogrammed ('reprogrammability'). It has been postulated that reprogrammability of the somatic donor cell epigenome is inversely proportional to its differentiation status. In order to test this hypothesis, reprogrammability was compared between undifferentiated stem cells and their differentiated isogenic progeny. In the mouse, cells of divergent differentiation status from the neuronal, haematopoietic and skin epithelial lineage were tested. In cattle and deer, skeletal muscle and antler cells, respectively, were used as donors. No conclusive correlation between differentiation status and cloning efficiency was found, indicating that somatic donor cell type may not be the limiting factor for cloning success. This may reflect technical limitations of the NT-induced reprogramming assay. Alternatively, differentiation status and reprogrammability may be unrelated, making all cells equally difficult to reprogramme once they have left the ground state of pluripotency.

  16. Dose dependency of the frequency of micronucleated binucleated clone cells and of division related median clone sizes difference. Pt. 2

    International Nuclear Information System (INIS)

    Hagemann, G,; Kreczik, A.; Treichel, M.


    Following irradiation of the progenitor cells the clone growth of CHO cells decreases as a result of cell losses. Lethally acting expressions of micronuclei are produced by heritable lethal mutations. The dependency of the frequency of micronucleated binucleated clone cells and of the median clone sizes difference on the radiation dose was measured and compared to non-irradiated controls. Using the cytokinesis-block-micronucleus-method binucleated cells with micronuclei were counted as ratio of all binucleated cells within a clone size distribution. This ratio (shortened: micronucleus yield) was determined for all clone size distributions, which had been exposed to different irradiation doses and incubation times. The micronucleus yields were compared to the corresponding median clone sizes differences. The micronucleus yield is linearly dependent on the dose and is independent of the incubation time. The same holds true for the division related median clone sizes difference, which as a result is also linearly dependent on the micronucleus yield. Due to the inevitably errors of the cell count of micronucleated binucleated cells, an automatic measurement of the median clone sizes differences is the preferred method for evaluation of cellular radiation sensitivity for heritable lethal mutations. This value should always be determined in addition, if clone survival fractions are used as predictive test because it allows for an estimation of the remission probability of surviving cells. (orig.) [de

  17. Production of cloned mice and ES cells from adult somatic cells by nuclear transfer: how to improve cloning efficiency? (United States)

    Wakayama, Teruhiko


    Although it has now been 10 years since the first cloned mammals were generated from somatic cells using nuclear transfer (NT), most cloned embryos usually undergo developmental arrest prior to or soon after implantation, and the success rate for producing live offspring by cloning remains below 5%. The low success rate is believed to be associated with epigenetic errors, including abnormal DNA hypermethylation, but the mechanism of "reprogramming" is unclear. We have been able to develop a stable NT method in the mouse in which donor nuclei are directly injected into the oocyte using a piezo-actuated micromanipulator. Especially in the mouse, only a few laboratories can make clones from adult somatic cells, and cloned mice are never successfully produced from most mouse strains. However, this technique promises to be an important tool for future research in basic biology. For example, NT can be used to generate embryonic stem (NT-ES) cell lines from a patient's own somatic cells. We have shown that NT-ES cells are equivalent to ES cells derived from fertilized embryos and that they can be generated relatively easily from a variety of mouse genotypes and cell types of both sexes, even though it may be more difficult to generate clones directly. In general, NT-ES cell techniques are expected to be applied to regenerative medicine; however, this technique can also be applied to the preservation of genetic resources of mouse strain instead of embryos, oocytes and spermatozoa. This review describes how to improve cloning efficiency and NT-ES cell establishment and further applications.

  18. Irreversible barrier to the reprogramming of donor cells in cloning with mouse embryos and embryonic stem cells. (United States)

    Ono, Yukiko; Kono, Tomohiro


    Somatic cloning does not always result in ontogeny in mammals, and development is often associated with various abnormalities and embryo loss with a high frequency. This is considered to be due to aberrant gene expression resulting from epigenetic reprogramming errors. However, a fundamental question in this context is whether the developmental abnormalities reported to date are specific to somatic cloning. The aim of this study was to determine the stage of nuclear differentiation during development that leads to developmental abnormalities associated with embryo cloning. In order to address this issue, we reconstructed cloned embryos using four- and eight-cell embryos, morula embryos, inner cell mass (ICM) cells, and embryonic stem cells as donor nuclei and determined the occurrence of abnormalities such as developmental arrest and placentomegaly, which are common characteristics of all mouse somatic cell clones. The present analysis revealed that an acute decline in the full-term developmental competence of cloned embryos occurred with the use of four- and eight-cell donor nuclei (22.7% vs. 1.8%) in cases of standard embryo cloning and with morula and ICM donor nuclei (11.4% vs. 6.6%) in serial nuclear transfer. Histological observation showed abnormal differentiation and proliferation of trophoblastic giant cells in the placentae of cloned concepti derived from four-cell to ICM cell donor nuclei. Enlargement of placenta along with excessive proliferation of the spongiotrophoblast layer and glycogen cells was observed in the clones derived from morula embryos and ICM cells. These results revealed that irreversible epigenetic events had already started to occur at the four-cell stage. In addition, the expression of genes involved in placentomegaly is regulated at the blastocyst stage by irreversible epigenetic events, and it could not be reprogrammed by the fusion of nuclei with unfertilized oocytes. Hence, developmental abnormalities such as placentomegaly as

  19. Cloning of Plasmodium falciparum by single-cell sorting. (United States)

    Miao, Jun; Li, Xiaolian; Cui, Liwang


    Malaria parasite cloning is traditionally carried out mainly by using the limiting dilution method, which is laborious, imprecise, and unable to distinguish multiply-infected RBCs. In this study, we used a parasite engineered to express green fluorescent protein (GFP) to evaluate a single-cell sorting method for rapidly cloning Plasmodium falciparum. By dividing a two-dimensional scattergram from a cell sorter into 17 gates, we determined the parameters for isolating singly-infected erythrocytes and sorted them into individual cultures. Pre-gating of the engineered parasites for GFP allowed the isolation of almost 100% GFP-positive clones. Compared with the limiting dilution method, the number of parasite clones obtained by single-cell sorting was much higher. Molecular analyses showed that parasite isolates obtained by single-cell sorting were highly homogenous. This highly efficient single-cell sorting method should prove very useful for cloning both P. falciparum laboratory populations from genetic manipulation experiments and clinical samples. Copyright 2010 Elsevier Inc. All rights reserved.

  20. Cloning of Plasmodium falciparum by single-cell sorting (United States)

    Miao, Jun; Li, Xiaolian; Cui, Liwang


    Malaria parasite cloning is traditionally carried out mainly by using the limiting dilution method, which is laborious, imprecise, and unable to distinguish multiply-infected RBCs. In this study, we used a parasite engineered to express green fluorescent protein (GFP) to evaluate a single-cell sorting method for rapidly cloning Plasmodium falciparum. By dividing a two dimensional scattergram from a cell sorter into 17 gates, we determined the parameters for isolating singly-infected erythrocytes and sorted them into individual cultures. Pre-gating of the engineered parasites for GFP allowed the isolation of almost 100% GFP-positive clones. Compared with the limiting dilution method, the number of parasite clones obtained by single-cell sorting was much higher. Molecular analyses showed that parasite isolates obtained by single-cell sorting were highly homogenous. This highly efficient single-cell sorting method should prove very useful for cloning both P. falciparum laboratory populations from genetic manipulation experiments and clinical samples. PMID:20435038

  1. Establishment of bipotent progenitor cell clone from rat skeletal muscle. (United States)

    Murakami, Yousuke; Yada, Erica; Nakano, Shin-ichi; Miyagoe-Suzuki, Yuko; Hosoyama, Tohru; Matsuwaki, Takashi; Yamanouchi, Keitaro; Nishihara, Masugi


    The present study describes the isolation, cloning and characterization of adipogenic progenitor cells from rat skeletal muscle. Among the obtained 10 clones, the most highly adipogenic progenitor, 2G11 cells, were further characterized. In addition to their adipogenicity, 2G11 cells retain myogenic potential as revealed by formation of multinucleated myotubes when co-cultured with myoblasts. 2G11 cells were resistant to an inhibitory effect of basic fibroblast growth factor on adipogenesis, while adipogenesis of widely used preadipogenic cell line, 3T3-L1 cells, was suppressed almost completely by the same treatment. In vivo transplantation experiments revealed that 2G11 cells are able to possess both adipogenicity and myogenicity in vivo. These results indicate the presence of bipotent progenitor cells in rat skeletal muscle, and suggest that such cells may contribute to ectopic fat formation in skeletal muscle. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  2. Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries

    DEFF Research Database (Denmark)

    Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.


    for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting......  FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes.  ...

  3. Effects of donor fibroblast cell type and transferred cloned embryo number on the efficiency of pig cloning. (United States)

    Li, Zicong; Shi, Junsong; Liu, Dewu; Zhou, Rong; Zeng, Haiyu; Zhou, Xiu; Mai, Ranbiao; Zeng, Shaofen; Luo, Lvhua; Yu, Wanxian; Zhang, Shouquan; Wu, Zhenfang


    Currently, cloning efficiency in pigs is very low. Donor cell type and number of cloned embryos transferred to an individual surrogate are two major factors that affect the successful rate of somatic cell nuclear transfer (SCNT) in pigs. This study aimed to compare the influence of different donor fibroblast cell types and different transferred embryo numbers on recipients' pregnancy rate and delivery rate, the average number of total clones born, clones born alive and clones born healthy per litter, and the birth rate of healthy clones (=total number of healthy cloned piglets born /total number of transferred cloned embryos). Three types of donor fibroblasts were tested in large-scale production of cloned pigs, including fetal fibroblasts (FFBs) from four genetically similar Western swine breeds of Pietrain (P), Duroc (D), Landrace (L), and Yorkshire (Y), which are referred to as P,D,LY-FFBs, adult fibroblasts (AFBs) from the same four breeds, which are designated P,D,L,Y-AFBs, and AFBs from a Chinese pig breed of Laiwu (LW), which is referred to as LW-AFBs. Within each donor fibroblast cell type group, five transferred cloned embryo number groups were tested. In each embryo number group, 150-199, 200-249, 250-299, 300-349, or 350-450 cloned embryos were transferred to each individual recipient sow. For the entire experiment, 92,005 cloned embryos were generated from nearly 115,000 matured oocytes and transferred to 328 recipients; in total, 488 cloned piglets were produced. The results showed that the mean clones born healthy per litter resulted from transfer of embryos cloned from LW-AFBs (2.53 ± 0.34) was similar with that associated with P,D,L,Y-FFBs (2.72 ± 0.29), but was significantly higher than that resulted from P,D,L,Y-AFBs (1.47 ± 0.18). Use of LW-AFBs as donor cells for SCNT resulted in a significantly higher pregnancy rate (72.00% vs. 59.30% and 48.11%) and delivery rate (60.00% vs. 45.93% and 35.85%) for cloned embryo recipients, and a

  4. Rabies virus cross-reactive murine T cell clones: analysis of helper and delayed-type hypersensitivity function.

    NARCIS (Netherlands)

    H. Bunschoten; B. Dietzschold; I.J.Th.M. Claassen (Ivo); R. Klapmuts; F. UytdeHaag; A.D.M.E. Osterhaus (Albert)


    textabstractThree T cell clones derived from rabies virus-immunized BALB/c mice were analysed for specificity and function. The clones proved to be broadly cross-reactive by responding to different rabies virus isolates (PM, ERA, CVS, HEP) and other representatives of the genus Lyssavirus, like the

  5. College Students' Conceptions of Stem Cells, Stem Cell Research, and Cloning (United States)

    Concannon, James P.; Siegel, Marcelle A.; Halverson, Kristy; Freyermuth, Sharyn


    In this study, we examined 96 undergraduate non-science majors' conceptions of stem cells, stem cell research, and cloning. This study was performed at a large, Midwest, research extensive university. Participants in the study were asked to answer 23 questions relating to stem cells, stem cell research, and cloning in an on-line assessment before…

  6. Evaluation of cloned cells, animal model, and ATRA sensitivity of human testicular yolk sac tumor

    Directory of Open Access Journals (Sweden)

    Zhao Junfeng


    Full Text Available Abstract The testicular yolk sac tumor (TYST is the most common neoplasm originated from germ cells differentiated abnormally, a major part of pediatric malignant testicular tumors. The present study aimed at developing and validating the in vitro and vivo models of TYST and evaluating the sensitivity of TYST to treatments, by cloning human TYST cells and investigating the histology, ultra-structure, growth kinetics and expression of specific proteins of cloned cells. We found biological characteristics of cloned TYST cells were similar to the yolk sac tumor and differentiated from the columnar to glandular-like or goblet cells-like cells. Chromosomes for tumor identification in each passage met nature of the primary tumor. TYST cells were more sensitive to all-trans-retinoic acid which had significantly inhibitory effects on cell proliferation. Cisplatin induced apoptosis of TYST cells through the activation of p53 expression and down-regulation of Bcl- expression. Thus, we believe that cloned TYST cells and the animal model developed here are useful to understand the molecular mechanism of TYST cells and develop potential therapies for human TYST.

  7. Cloning Endangered Felids by Interspecies Somatic Cell Nuclear Transfer. (United States)

    Gómez, Martha C; Pope, C Earle


    In 2003, the first wild felid was produced by interspecies somatic cell nuclear transfer. Since then other wild felid clone offspring have been produced by using the same technique with minor modifications. This chapter describes detailed protocols used in our laboratory for (1) the isolation, culture, and preparation of fibroblast cells as donor nucleus, and (2) embryo reconstruction with domestic cat enucleated oocytes to produce cloned embryos that develop to the blastocyst stage in vitro and, after transfer into synchronized recipients, establish successful pregnancies.

  8. In vivo localization of cloned IL-2-dependent T cells

    International Nuclear Information System (INIS)

    Carroll, A.M.; Palladino, M.A.; Oettgen, H.; De Sousa, M.


    The quantitative organ distribution and tissue microenvironment positioning of radioisotopically labeled cloned T cells were characterized. Intravenous (iv) injection of 51chromium ( 51 Cr)-labeled, long-term cultured cloned T-helper cells and cells from several cloned cytolytic T-lymphocyte lines (CTLL) resulted in poor localization of these cells in recipient lymphoid tissues, similar to results reported for activated lymphoblastoid cells. Simultaneous administration of interleukin 2 (IL-2) with labeled cells resulted in enhanced recovery from recipient spleen. By the intraperitoneal (ip) injection route, overall percentage recovery of injected radioactivity was lower than by the iv route, but significant localization to lymph nodes occurred. Examination of autoradiographs of tissue sections from recipients of [ 3 H]adenosine-labeled cells showed most label associated with intact, isolated cells in the liver, lungs, spleen, and small intestine. By 24 hr after iv injection, labeled cells in spleen sections were distributed to both nonlymphoid and T- and B-lymphoid areas. These findings suggest that poor localization of these cells to recipient lymphoid tissue is due both to intrinsic characteristics of cultured lymphocytes and to the possible reduced viability of IL-2-dependent cells in vivo

  9. T cell epitopes on the 36K and 65K Mycobacterium leprae antigens defined by human T cell clones

    NARCIS (Netherlands)

    van Schooten, W. C.; Ottenhoff, T. H.; Klatser, P. R.; Thole, J.; de Vries, R. R.; Kolk, A. H.


    To identify the molecular localization and specificity of Mycobacterium leprae antigenic determinants inducing T cell activation, we studied the reactivity of M. leprae-reactive T cell clones from two tuberculoid leprosy patients towards a battery of different mycobacterial strains and purified

  10. Cloned Hemoglobin Genes Enhance Growth Of Cells (United States)

    Khosla, Chaitan; Bailey, James E.


    Experiments show that portable deoxyribonucleic acid (DNA) sequences incorporated into host cells make them produce hemoglobins - oxygen-binding proteins essential to function of red blood cells. Method useful in several biotechnological applications. One, enhancement of growth of cells at higher densities. Another, production of hemoglobin to enhance supplies of oxygen in cells, for use in chemical reactions requiring oxygen, as additive to serum to increase transport of oxygen, and for binding and separating oxygen from mixtures of gases.

  11. Cloning of ES cells and mice by nuclear transfer. (United States)

    Wakayama, Sayaka; Kishigami, Satoshi; Wakayama, Teruhiko


    We have been able to develop a stable nuclear transfer (NT) method in the mouse, in which donor nuclei are directly injected into the oocyte using a piezo-actuated micromanipulator. Although the piezo unit is a complex tool, once mastered it is of great help not only in NT experiments, but also in almost all other forms of micromanipulation. Using this technique, embryonic stem (ntES) cell lines established from somatic cell nuclei can be generated relatively easily from a variety of mouse genotypes and cell types. Such ntES cells can be used not only for experimental models of human therapeutic cloning but also as a means of preserving mouse genomes instead of preserving germ cells. Here, we describe our most recent protocols for mouse cloning.

  12. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)



    Jan 25, 2010 ... intron. It had a high homology to previously cloned cell wall acid invertase genes in other plants by sequence .... Japan) in a final volume of 50 µl. The programs for ... The first strand of cDNA was synthesized by using SYBR ...

  13. Characterization of three newly established rat sarcoma cell clones

    Czech Academy of Sciences Publication Activity Database

    Holubová, Monika; Leba, M.; Sedmíková, M.; Vannucci, Luca; Horák, Vratislav


    Roč. 48, č. 10 (2012), s. 610-618 ISSN 1071-2690 R&D Projects: GA MŠk 2B08063 Institutional support: RVO:67985904 Keywords : sarcoma * cell clones * lewis rat Subject RIV: FD - Oncology ; Hematology Impact factor: 1.289, year: 2012

  14. Cloning and Characterization of Novel Testis-Specific Diacylglycerol Kinase η Splice Variants 3 and 4.

    Directory of Open Access Journals (Sweden)

    Eri Murakami

    Full Text Available Diacylglycerol kinase (DGK phosphorylates DG to generate phosphatidic acid. Recently, we found that a new alternative splicing product of the DGKη gene, DGKη3, which lacks exon 26 encoding 31 amino acid residues, was expressed only in the secondary spermatocytes and round spermatids of the testis. In this study, we cloned the full length DGKη3 gene and confirmed the endogenous expression of its protein product. During the cloning procedure, we found a new testis-specific alternative splicing product of the DGKη gene, DGKη4, which lacks half of the catalytic domain. We examined the DGK activity and subcellular localization of DGKη3 and η4. DGKη3 had almost the same activity as DGKη1, whereas the activity of DGKη4 was not detectable. In resting NEC8 cells (human testicular germ cell tumor cell line, DGKη1, η3 and η4 were broadly distributed in the cytoplasm. When osmotically shocked, DGKη1 and η4 were distributed in punctate vesicles in the cytoplasm. In contrast, DGKη3 was partly translocated to the plasma membrane and co-localized with the actin cytoskeleton. These results suggest that DGKη3 and η4 have properties different from those of DGKη1 and that they play roles in the testis in a different manner.

  15. Progenitor cells for regenerative medicine and consequences of ART and cloning-associated epimutations. (United States)

    Laprise, Shari L


    The "holy grail" of regenerative medicine is the identification of an undifferentiated progenitor cell that is pluripotent, patient specific, and ethically unambiguous. Such a progenitor cell must also be able to differentiate into functional, transplantable tissue, while avoiding the risks of immune rejection. With reports detailing aberrant genomic imprinting associated with assisted reproductive technologies (ART) and reproductive cloning, the idea that human embryonic stem cells (hESCs) derived from surplus in vitro fertilized embryos or nuclear transfer ESCs (ntESCs) harvested from cloned embryos may harbor dangerous epigenetic errors has gained attention. Various progenitor cell sources have been proposed for human therapy, from hESCs to ntESCs, and from adult stem cells to induced pluripotent stem cells (iPS and piPS cells). This review highlights the advantages and disadvantages of each of these technologies, with particular emphasis on epigenetic stability.

  16. Cloning the Gravity and Shear Stress Related Genes from MG-63 Cells by Subtracting Hybridization (United States)

    Zhang, Shu; Dai, Zhong-quan; Wang, Bing; Cao, Xin-sheng; Li, Ying-hui; Sun, Xi-qing


    Background The purpose of the present study was to clone the gravity and shear stress related genes from osteoblast-like human osteosarcoma MG-63 cells by subtractive hybridization. Method MG-63 cells were divided into two groups (1G group and simulated microgravity group). After cultured for 60 h in two different gravitational environments, two groups of MG-63 cells were treated with 1.5Pa fluid shear stress (FSS) for 60 min, respectively. The total RNA in cells was isolated. The gravity and shear stress related genes were cloned by subtractive hybridization. Result 200 clones were gained. 30 positive clones were selected using PCR method based on the primers of vector and sequenced. The obtained sequences were analyzed by blast. changes of 17 sequences were confirmed by RT-PCR and these genes are related to cell proliferation, cell differentiation, protein synthesis, signal transduction and apoptosis. 5 unknown genes related to gravity and shear stress were found. Conclusion In this part of our study, our result indicates that simulated microgravity may change the activities of MG-63 cells by inducing the functional alterations of specific genes.

  17. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    D' Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. (Universita di Bari (Italy)); Antonacci, R. (Instituto Anatomia Umana Normale, Modena (Italy))


    The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

  18. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing. (United States)

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  19. Quantum dot-based molecular imaging of cancer cell growth using a clone formation assay. (United States)

    Geng, Xia-Fei; Fang, Min; Liu, Shao-Ping; Li, Yan


    This aim of the present study was to investigate clonal growth behavior and analyze the proliferation characteristics of cancer cells. The MCF‑7 human breast cancer cell line, SW480 human colon cancer cell line and SGC7901 human gastric cancer cell line were selected to investigate the morphology of cell clones. Quantum dot‑based molecular targeted imaging techniques (which stained pan‑cytokeratin in the cytoplasm green and Ki67 in the cell nucleus yellow or red) were used to investigate the clone formation rate, cell morphology, discrete tendency, and Ki67 expression and distribution in clones. From the cell clone formation assay, the MCF‑7, SW480 and SGC7901 cells were observed to form clones on days 6, 8 and 12 of cell culture, respectively. These three types of cells had heterogeneous morphology, large nuclear:cytoplasmic ratios, and conspicuous pathological mitotic features. The cells at the clone periphery formed multiple pseudopodium. In certain clones, cancer cells at the borderline were separated from the central cell clusters or presented a discrete tendency. With quantum dot‑based molecular targeted imaging techniques, cells with strong Ki67 expression were predominantly shown to be distributed at the clone periphery, or concentrated on one side of the clones. In conclusion, cancer cell clones showed asymmetric growth behavior, and Ki67 was widely expressed in clones of these three cell lines, with strong expression around the clones, or aggregated at one side. Cell clone formation assay based on quantum dots molecular imaging offered a novel method to study the proliferative features of cancer cells, thus providing a further insight into tumor biology.


    Institute of Scientific and Technical Information of China (English)

    Jian-xiaoTian; Chang-youLi; Gui-lingZheng; Guo-xunLi; PingWang; Granados


    The characteristics of a cultured cell line do not always remain stable and may change upon continuous passage. Most continuous cell lines, even after cloning, possess several genotypes that are constantly changing. There are numerous selective and adaptive culture processes, in addition to genetic instability, that may improve phenotypic change in cell growth, virus susceptibility, gene expression, and production of virus. Similar detrimental effects of long term passaging of insect cells have also been reported for continuous cell lines, for example, Tn5B 1-4 cells, which are the most widely used for the baculovirus expression vector system (BEVS), provide superior production of recombinant proteins,however, this high productivity may be more evident in low passage cells. In this paper, we describe the isolation of a cell clone, Tn5B-40, from low passage Tn5B 1-4 cells. The growth characteristics,productions of virus, and high level of recombinant protein productions were determined. The results showed the susceptibility of both clone and Tn5B 1-4 cells to wild-type AcNPV was approximately the same rate with over 95% of infection; when the cloned cells were infected with recombinant baculoviruses expressing β-galactosidase and secreted alkaline phosphatase (SEAP), expression of the recombinant proteins from the cloned cells exceeded that from the parental Tn5B 1-4 cells.

  1. [Nuclear transfer and therapeutic cloning]. (United States)

    Xu, Xiao-Ming; Lei, An-Min; Hua, Jin-Lian; Dou, Zhong-Ying


    Nuclear transfer and therapeutic cloning have widespread and attractive prospects in animal agriculture and biomedical applications. We reviewed that the quality of oocytes and nuclear reprogramming of somatic donor cells were the main reasons of the common abnormalities in cloned animals and the low efficiency of cloning and showed the problems and outlets in therapeutic cloning, such as some basic problems in nuclear transfer affected clinical applications of therapeutic cloning. Study on isolation and culture of nuclear transfer embryonic stem (ntES) cells and specific differentiation of ntES cells into important functional cells should be emphasized and could enhance the efficiency. Adult stem cells could help to cure some great diseases, but could not replace therapeutic cloning. Ethics also impeded the development of therapeutic cloning. It is necessary to improve many techniques and reinforce the research of some basic theories, then somatic nuclear transfer and therapeutic cloning may apply to agriculture reproduction and benefit to human life better.

  2. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio


    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  3. Primer sets for cloning the human repertoire of T cell Receptor Variable regions. (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele


    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  4. Assay of mouse-cell clones for retrovirus p30 protein by use of an automated solid-state radioimmunoassay

    International Nuclear Information System (INIS)

    Kennel, S.J.; Tnnant, R.W.


    A solid-state radioimmunoassay system has been developed that is useful for automated analysis of samples in microtiter plates. Assays for interspecies and type-specific antigenic determinants of the C-type retrovirus protein, p30, have been used to identify clones of cells producing this protein. This method allows testing of at least 1000 clones a day, making it useful for studies of frequencies of virus protein induction, defective virus production, and formation of recombinant viruses

  5. Cloning and Expression of Luteinizing Hormone Subunits in Chinese Hamster Ovary Cell Line

    Directory of Open Access Journals (Sweden)

    Zeinab Soleimanifar


    Full Text Available Background: Luteinizing hormone (LH was secreted by the stimulating cells of the testes and ovaries in the anterior pituitary gland. The application of this hormone is in the treatment of men and women with infertility and amenorrhea respectively.Materials and Methods: In the present study the alpha and beta subunits of human LH gene were cloned into the pEGFP-N1 expression vector and produced the recombinant LH hormone in Chinese hamster ovary (CHO eukaryotic system.Results: Alpha and beta subunits of LH hormone were cloned between NheI and BamHI cut sites of pEGFP_N1 expression plasmid and confirmed by PCR.  Hormone expression was evaluated in CHO cell line by Western blotting using the specific antibody.Conclusion: Alpha and beta subunits of LH hormone were expressed in CHO cell line perfectly.


    Petrov, Yu P; Negulyaev, Yu A; Tsupkina, N V


    The period (1 h after reseeding) of behaviour of mouse NCTC clone 929 cells to the conditions of artificial cultivation was studied. The time-lapse imaging followed the processing of the cells with ImageJ program was applied. To characterize the parametres cell status we used the cell area (projection of the cell on substrate) and Rp/Ra ratio introduced earlier as a spreading coefficient (Kuz'minykh, Petrov, 2004). After attaching a substratum, cells have a form of sphere (the phase "sphere") as the daughter cells after a mitosis. We revealed however that after this phase the reseeded cells do not start usual spreading and migration along substratum. They pass a phase of equally spreading in all directions and shaping their area as a circle (phase "circle"). This phase is absent of the daughter cells spreading after mitosis. We assume that the phase "circle" is a result of adaptation of the cells to reseedings at artificial cultivation. It is necessary for formation of a substrate composed of own extracellular matrix components (ECM) of the cells. Own ECM facilitates transition of the cells to their usual spreading and migration along substratum.

  7. T Cell Receptor Vβ Staining Identifies the Malignant Clone in Adult T cell Leukemia and Reveals Killing of Leukemia Cells by Autologous CD8+ T cells.

    Directory of Open Access Journals (Sweden)

    Aileen G Rowan


    Full Text Available There is growing evidence that CD8+ cytotoxic T lymphocyte (CTL responses can contribute to long-term remission of many malignancies. The etiological agent of adult T-cell leukemia/lymphoma (ATL, human T lymphotropic virus type-1 (HTLV-1, contains highly immunogenic CTL epitopes, but ATL patients typically have low frequencies of cytokine-producing HTLV-1-specific CD8+ cells in the circulation. It remains unclear whether patients with ATL possess CTLs that can kill the malignant HTLV-1 infected clone. Here we used flow cytometric staining of TCRVβ and cell adhesion molecule-1 (CADM1 to identify monoclonal populations of HTLV-1-infected T cells in the peripheral blood of patients with ATL. Thus, we quantified the rate of CD8+-mediated killing of the putative malignant clone in ex vivo blood samples. We observed that CD8+ cells from ATL patients were unable to lyse autologous ATL clones when tested directly ex vivo. However, short in vitro culture restored the ability of CD8+ cells to kill ex vivo ATL clones in some donors. The capacity of CD8+ cells to lyse HTLV-1 infected cells which expressed the viral sense strand gene products was significantly enhanced after in vitro culture, and donors with an ATL clone that expressed the HTLV-1 Tax gene were most likely to make a detectable lytic CD8+ response to the ATL cells. We conclude that some patients with ATL possess functional tumour-specific CTLs which could be exploited to contribute to control of the disease.

  8. Cloning higher plants from aseptically cultured tissues and cells (United States)

    Krikorian, A. D.


    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  9. Efficient production of a gene mutant cell line through integrating TALENs and high-throughput cell cloning. (United States)

    Sun, Changhong; Fan, Yu; Li, Juan; Wang, Gancheng; Zhang, Hanshuo; Xi, Jianzhong Jeff


    Transcription activator-like effectors (TALEs) are becoming powerful DNA-targeting tools in a variety of mammalian cells and model organisms. However, generating a stable cell line with specific gene mutations in a simple and rapid manner remains a challenging task. Here, we report a new method to efficiently produce monoclonal cells using integrated TALE nuclease technology and a series of high-throughput cell cloning approaches. Following this method, we obtained three mTOR mutant 293T cell lines within 2 months, which included one homozygous mutant line. © 2014 Society for Laboratory Automation and Screening.

  10. Peripheral blood and intrathyroidal T cell clones from patients with thyroid autoimmune diseases. (United States)

    Massart, C; Caroff, G; Maugendre, D; Genetet, N; Gibassier, J


    For a better understanding of the pathogenesis of thyroid autoimmune diseases, we have studied morphological and functional properties of T clones from peripheral blood lymphocytes (PBL) and from intrathyroidal lymphocytes (ITL) obtained from 3 patients with Graves' disease or 1 Hashimoto's thyroiditis. Investigations were carried out on clones cultured alone or cocultured with autologous thyrocytes. Clonage efficiency ranged from 30% to 33% for PBL and 10% to 36% for ITL. A predominance of CD4-positive clones was observed whatever the origin of the lymphocytes or the autoimmune pathology. Gamma interferon (IFN-gamma) was detected in the majority (17/19) of the clones tested. Intracytoplasmic interleukin (IL-4) was secreted in 7/19 clones and both cytokines were produced in 5/19 clones. In coculture a proliferative response and tumour necrosis factor (TNF-alpha) production were observed with 6 clones (4 from Graves thyrocytes and 2 from thyroiditis). No cytotoxic clone was derived from Graves or thyroiditis tissues. These data demonstrate that the large majority of T clones are principally CD4-T cells; all the clones secreted TNF-alpha and a large majority produced IFN-gamma. Only a few clones produced IL-4 alone or associated with IFN-gamma. Six T clones induced proliferative response and of TNF-alpha secretion in coculture. Further investigations must be performed on these antigen-reactive T clones to analyse their role in the pathogenesis of the human thyroid autoimmune diseases.

  11. Identification of PblB mediating galactose-specific adhesion in a successful Streptococcus pneumoniae clone. (United States)

    Hsieh, Yu-Chia; Lin, Tzu-Lung; Lin, Che-Ming; Wang, Jin-Town


    The pneumococcal genome is variable and there are minimal data on the influence of the accessory genome on phenotype. Pneumococcal serotype 14 sequence type (ST) 46 had been the most prevalent clone causing pneumonia in children in Taiwan. A microarray was constructed using the genomic DNA of a clinical strain (NTUH-P15) of serotype 14 ST46. Using DNA hybridization, genomic variations in NTUH-P15 were compared to those of 3 control strains. Microarray analysis identified 7 genomic regions that had significant increases in hybridization signals in the NTUH-P15 strain compared to control strains. One of these regions encoded PblB, a phage-encoded virulence factor implicated (in Streptococcus mitis) in infective endocarditis. The isogenic pblB mutant decreased adherence to A549 human lung epithelial cell compared to wild-type NTUH-P15 strain (P = 0.01). Complementation with pblB restored the adherence. PblB is predicted to contain a galactose-binding domain-like region. Preincubation of NTUH-P15 with D-galactose resulted in decreases of adherence to A549 cell in a dose-dependent manner. Challenge of mice with NTUH-P15, isogenic pblB mutant and pblB complementation strains determined that PblB was required for bacterial persistence in the nasopharynx and lung. PblB, as an adhesin mediating the galactose-specific adhesion activity of pneumococci, promote pneumococcal clonal success.

  12. Prevalence of polyreactive innate clones among graft--infiltrating B cells in human cardiac allograft vasculopathy. (United States)

    Chatterjee, Debanjana; Moore, Carolina; Gao, Baoshan; Clerkin, Kevin J; See, Sarah B; Shaked, David; Rogers, Kortney; Nunez, Sarah; Veras, Yokarla; Addonizio, Linda; Givertz, Michael M; Naka, Yoshifumi; Mancini, Donna; Vasilescu, Rodica; Marboe, Charles; Restaino, Susan; Madsen, Joren C; Zorn, Emmanuel


    Cardiac allograft vasculopathy (CAV) has been associated with graft-infiltrating B cells, although their characteristics are still unclear. In this study we examined the frequency, localization and reactivity profile of graft-infiltrating B cells to determine their contribution to the pathophysiology of CAV. B cells, plasma cells and macrophages were examined by immunohistochemistry in 56 allografts with CAV, 49 native failed hearts and 25 autopsy specimens. A total of 102 B-cell clones were immortalized directly from the infiltrates of 3 fresh cardiac samples with CAV. Their secreted antibodies were assessed using enzyme-linked immunoassay and flow cytometry. B-cell infiltration was observed around coronary arteries in 93% of allograft explants with CAV. Comparatively, intragraft B cells were less frequent and less dense in the intraventricular myocardium from where routine biopsies are obtained. Plasma cells and macrophages were also detected in 85% and 95% of explants, respectively. Remarkably, B-cell infiltrates were not associated with circulating donor-specific antibodies (DSA) or prior episodes of antibody-mediated rejection (AMR). Among all B-cell clones generated from 3 explants with CAV, a majority secreted natural antibodies reactive to multiple autoantigens and apoptotic cells, a characteristic of innate B cells. Our study reveals a high frequency of infiltrating B cells around the coronary arteries of allografts with CAV, independent of DSA or AMR. These cells are enriched for innate B cells with a polyreactive profile. The findings shift the focus from conventional DSA-producing B cells to the potentially pathogenic polyreactive B cells in the development of clinical CAV. Copyright © 2018 International Society for the Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  13. Isolation and characterization of variant clones of Chinese hamster cells after treatment with irradiated 5-iodouridine

    International Nuclear Information System (INIS)

    Kuroda, Y.; Yokoiyama, A.; Kada, T.


    Variant clones were isolated from cultured Chinese hamster Don cells after treatment with irradiated 5-iodouridine. The following characters of a primary variant clone, C-11 and a secondary variant clone, C-24 were compared with those of the original clone C-1: colony-forming activity, growth rate in the presence of irradiated and unirradiated 5-iodouridine, distribution of chromosome numbers and cell cohesion. The variant clones C-11 and C-24 were partially resistant to unirradiated 5-iodouridine at lower concentration and C-24 cells were slightly resistant to short-term treatment with irradiated 5-iodouridine. Unlike clones C-1 and C-11, the variant clone C-24 showed no lag phase on growth in 5-iodouridine medium. The modal numbers of the chromosomes of all three clones were 22, like that of normal Chinese hamster diploid cells. Of the three clones, the variant C-24 cells showed the least mutual cohesion and the original C-1 cells showed the most. The possibility that an alteration in cellular membrane might be related to an increase in the resistance to radiosensitizing agents was discussed

  14. Characterization of T cell clones from chagasic patients: predominance of CD8 surface phenotype in clones from patients with pathology

    Directory of Open Access Journals (Sweden)

    Washington R. Cuna


    Full Text Available Human Chagas' disease, caused by the protozoan Trypanosoma cruzi, is associated with pathological processes whose mechanisms are not known. To address this question, T cell lines were developed from chronic chagasic patients peripheral blood mononuclear cells (PBMC and cloned. These T cell clones (TCC were analyzed phenotypically with monoclonal antibodies by the use of a fluorescence microscope. The surface phenotype of the TCC from the asymptomatic patient were predominantly CD4 positive (86%. On the contrary, the surface phenotype CD8 was predominant in the TCC from the patients suffering from cardiomegaly with right bundle branch block (83%, bradycardia with megacolon (75 % and bradycardia (75%. Future studies will be developed in order to identify the antigens eliciting these T cell subpopulations.

  15. Oncogenesis of melanoma B16 cell clones mutagenized by space environment

    International Nuclear Information System (INIS)

    Guo Yupeng; Yang Hongsheng; Tang Jingtian; Xu Mei; Geng Chuanying; Fang Qing; Xu Bo; Li Hongyan; Xiang Xing; Pan Lin


    Objective: To explore the oncogenesis of the melanoma B16 cell clones mutagenized by space environment, and find the B16 cell clones with remarkably mutated immunogenicity. Methods: B16 cells were carried by the Chinese 20th recoverable satellite to the outer space, and were harvested after 18 days' spaceflight and then monocloned. Four cell clones, which were randomly selected from the total 110 clones obtained , and the control clone were routinely cultured. The cultured cells were injected to 10 groups of C57BL/6J mice, 82.1 mice in each group. Five groups of mice received hypodermic injection and another 5 groups of mice received abdominal injection. The survival time was observed in abdominal injection groups. The mice in hypodermic injection groups were sacrificed after 14 days, the tumor, spleen and thymus were weighted, and the serum IL-2 concentration was determined. Moreover, the melanoma tumor tissues were examined histopathologically. Results: An experiment program suitable to screening space mutagenesis of B16 tumor cell clones in vivo and the observation indices were basically established. One clone was found out which was remarkably different from the control clone in latent period of tumor formation, tumor weight, survival time of the tumor-bearing mice and the expression of IL-2. Conclusions: Cultured melanoma B16 cells could be mutated by outer space environment. The further study will be focused on the influence of space environment on immunogenicity of mutagenized B16 cells. (authors)

  16. BIX-01294 increases pig cloning efficiency by improving epigenetic reprogramming of somatic cell nuclei. (United States)

    Huang, Jiaojiao; Zhang, Hongyong; Yao, Jing; Qin, Guosong; Wang, Feng; Wang, Xianlong; Luo, Ailing; Zheng, Qiantao; Cao, Chunwei; Zhao, Jianguo


    Accumulating evidence suggests that faulty epigenetic reprogramming leads to the abnormal development of cloned embryos and results in the low success rates observed in all mammals produced through somatic cell nuclear transfer (SCNT). The aberrant methylation status of H3K9me and H3K9me2 has been reported in cloned mouse embryos. To explore the role of H3K9me2 and H3K9me in the porcine somatic cell nuclear reprogramming, BIX-01294, known as a specific inhibitor of G9A (histone-lysine methyltransferase of H3K9), was used to treat the nuclear-transferred (NT) oocytes for 14-16 h after activation. The results showed that the developmental competence of porcine SCNT embryos was significantly enhanced both in vitro (blastocyst rate 16.4% vs 23.2%, Pcloning rate 1.59% vs 2.96%) after 50 nm BIX-01294 treatment. BIX-01294 treatment significantly decreased the levels of H3K9me2 and H3K9me at the 2- and 4-cell stages, which are associated with embryo genetic activation, and increased the transcriptional expression of the pluripotency genes SOX2, NANOG and OCT4 in cloned blastocysts. Furthermore, the histone acetylation levels of H3K9, H4K8 and H4K12 in cloned embryos were decreased after BIX-01294 treatment. However, co-treatment of activated NT oocytes with BIX-01294 and Scriptaid rescued donor nuclear chromatin from decreased histone acetylation of H4K8 that resulted from exposure to BIX-01294 only and consequently improved the preimplantation development of SCNT embryos (blastocyst formation rates of 23.7% vs 21.5%). These results indicated that treatment with BIX-01294 enhanced the developmental competence of porcine SCNT embryos through improvements in epigenetic reprogramming and gene expression. © 2016 Society for Reproduction and Fertility.

  17. Human Endothelial Cells: Use of Heparin in Cloning and Long-Term Serial Cultivation (United States)

    Thornton, Susan C.; Mueller, Stephen N.; Levine, Elliot M.


    Endothelial cells from human blood vessels were cultured in vitro, with doubling times of 17 to 21 hours for 42 to 79 population doublings. Cloned human endothelial cell strains were established for the first time and had similar proliferative capacities. This vigorous cell growth was achieved by addition of heparin to culture medium containing reduced concentrations of endothelial cell growth factor. The routine cloning and long-term culture of human endothelial cells will facilitate studying the human endothelium in vitro.

  18. Immune-mediated bone marrow failure syndromes of progenitor and stem cells: molecular analysis of cytotoxic T cell clones.

    Directory of Open Access Journals (Sweden)

    Ramon Tiu


    Full Text Available The unique structure of the T cell receptor (TCR enables molecular identification of individual T cell clones and provides an unique opportunity for the design of molecular diagnostic tests based on the structure of the rearranged TCR chain e.g., using the TCR CDR3 region. Initially, clonal T cell malignancies, including T cell large granular lymphocyte leukemia (T-LGL, mucosis fungoides and peripheral T cell lymphoma were targets for the TCR-based analytic assays such as detection of clonality by T-gamma rearrangement using y-chain-specific PCR or Southern Blotting. Study of these disorders facilitated further analytic concepts and application of rational methods of TCR analysis to investigations of polyclonal T cell-mediated diseases. In hematology, such conditions include graft versus host disease (GvHD and immune-mediated bone marrow failure syndromes. In aplastic anemia (AA, myelodysplastic syndrome (MDS or paroxysmal nocturnal hemoglobinuria (PNH, cytotoxic T cell responses may be directed against certain antigens located on stem or more lineage-restricted progenitor cells in single lineage cytopenias. The nature of the antigenic targets driving polyclonal CTL responses remains unclear. Novel methods of TCR repertoire analysis, include VB flow cytometry, peptide-specific tetramer staining, in vitro stimulation assays and TCR CDR3-specific PCR. Such PCR assay can be either VB family-specific or multiplexed for all VB families. Amplified products can be characterized and quantitated to facilitate detection of the most immunodominant clonotypes. Such clonotypes may serve as markers for the global polyclonal T cell response. Identification of these clonotypes can be performed in blood and tissue biopsy material by various methods. Once immunodominant clonotypes corresponding to pathogenic CTL clones are identified they can serve as surrogate markers for the activity of the pathophysiologic process or even indicate the presence of specific

  19. Individual clones of hemopoietic cells in murine long-term bone marrow culture

    International Nuclear Information System (INIS)

    Chertkov, J.L.; Deryugina, E.I.; Drize, N.J.; Udalov, G.A.


    Forty-seven individual hemopoietic cell clones bearing unique radiation markers were studied in long-term bone marrow cultures. Throughout cultivation clones appeared at different times, from 1 to 12 weeks after explantation, survived during 1-10 more weeks, and were characterized by marked variability in size. Usually, the number of metaphases peculiar to an individual clone rapidly increased, achieved maximum, and then underwent a decline. Cells of reliably disappearing clones were never seen again. The experimental results provide further evidence for the model of hemopoiesis by clonal succession

  20. The identification of specific cDNA clones from tall and dwarf rice plants

    International Nuclear Information System (INIS)

    Youssefian, S.; Kamada, I.; Sano, H.


    Full text: The use of dwarfing genes in rice breeding has proceeded for several years without a clear understanding of the genetic, hormonal and physiological mechanisms involved. This issue was addressed by focussing on the isolation of specific clones from tall- and dwarf-derived cDNA libraries. The materials used include near-isogenic lines of the tall rice cultivar 'Shiokari', differing at the DGWG or 'Tanginbozu' dwarfing gene loci. Also used were tall and dwarf 'Ginbozu' rice, the latter having been induced by treatment with 5-azacytidine, a potent demethylating agent. Subtractive and differential hybridisation have, to date, identified several candidate tall- and dwarf-specific clones. Their further characterisation is currently underway. (author)

  1. Enhanced specificity in immunoscreening of expression cDNA clones using radiolabeled antigen overlay

    International Nuclear Information System (INIS)

    Chao, S.; Chao, L.; Chao, J.


    A highly sensitive and specific method has been developed for immunoscreening clones from an expression cDNA library. The procedures utilize a radiolabeled antigen detection method described originally for the immunoblotting of plasma proteins. Screening of rat alpha 1-antitrypsin clones was used. Comparison between Western blots of alpha 1-antitrypsin using both labeled antigen and protein A detection methods showed that the former yielded lower background and greater sensitivity than the latter. Further, this technique was shown to have a lower detection limit of less than 20 ng through Western blot analysis of varying concentrations of alpha 1-antitrypsin. The procedures are based on the expression of the protein by cDNA clones containing the DNA inserts in the correct reading frame. Following the transfer of phage proteins to nitrocellulose membranes, the bivalent antibodies bind monovalently to both nitrocellulose-bound-antigen in the phage lysates and radiolabeled antigen. The radiolabeled antigen overlay method is superior to the protein A detection method in sensitivity, specificity and reproducibility. This improved method can be applied in general for screening expression cDNA libraries, provided that the specific antiserum and radiolabeled antigen are available

  2. Heterogeneity of functional properties of Clone 66 murine breast cancer cells expressing various stem cell phenotypes. (United States)

    Mukhopadhyay, Partha; Farrell, Tracy; Sharma, Gayatri; McGuire, Timothy R; O'Kane, Barbara; Sharp, J Graham


    Breast cancer grows, metastasizes and relapses from rare, therapy resistant cells with a stem cell phenotype (cancer stem cells/CSCs). However, there is a lack of studies comparing the functions of CSCs isolated using different phenotypes in order to determine if CSCs are homogeneous or heterogeneous. Cells with various stem cell phenotypes were isolated by sorting from Clone 66 murine breast cancer cells that grow orthotopically in immune intact syngeneic mice. These populations were compared by in vitro functional assays for proliferation, growth, sphere and colony formation; and in vivo limiting dilution analysis of tumorigenesis. The proportion of cells expressing CD44(high)CD24(low/neg), side population (SP) cells, ALDH1(+), CD49f(high), CD133(high), and CD34(high) differed, suggesting heterogeneity. Differences in frequency and size of tumor spheres from these populations were observed. Higher rates of proliferation of non-SP, ALDH1(+), CD34(low), and CD49f(high) suggested properties of transit amplifying cells. Colony formation was higher from ALDH1(-) and non-SP cells than ALDH1(+) and SP cells suggesting a progenitor phenotype. The frequency of clonal colonies that grew in agar varied and was differentially altered by the presence of Matrigel™. In vivo, fewer cells with a stem cell phenotype were needed for tumor formation than "non-stem" cells. Fewer SP cells were needed to form tumors than ALDH1(+) cells suggesting further heterogeneities of cells with stem phenotypes. Different levels of cytokines/chemokines were produced by Clone 66 with RANTES being the highest. Whether the heterogeneity reflects soluble factor production remains to be determined. These data demonstrate that Clone 66 murine breast cancer cells that express stem cell phenotypes are heterogeneous and exhibit different functional properties, and this may also be the case for human breast cancer stem cells.

  3. Chromosome painting analysis of radiation-induced aberrant cell clones in the mouse

    International Nuclear Information System (INIS)

    Spruill, M.D.; Nath, J.; Tucker, J.D.


    In a study of the persistence of radiation-induced translocations over the life span of the mouse, we observed a number of clonal cells in peripheral blood lymphocytes. The presence of clones caused the mean frequency of aberrations at various time points to be elevated which interfered with biodosimetry. For this reason, we have corrected our data for the presence of clones. Mice were given an acute dose of 0, 1, 2, 3 or 4 Gy 137 Cs at 8 weeks of age. Aberrations were measured by painting chromosomes 2 and 8 and cells were examined for clones at 3 months and every 3 months thereafter until 21 months. Clones were identified by comparing the color photographic slides of all abnormal cells from each animal. Determination of clonality was made on the basis of similar breakpoint locations or the presence of other identifying characteristics such as unusual aberrations. To correct the frequency of translocations for the presence of clones, each clone, regardless of how many cells it contained, was counted only once. This reflects the original aberration frequency since each clone originated as only one cell. Among mice exposed to 4 Gy, the mean frequencies of aberrant cell clones ranged from 3-29% of the total number of metaphase cells scored with the highest frequency being 1 year post exposure. 32-70% of reciprocal and 19-92% of non-reciprocal translocations were clonal. A dose response relationship for clones was evident until 21 months when the unexposed animals exhibited a mean frequency of aberrant cell clones >10% of the total number of cells scored. Almost 75% of reciprocal and 95% of non-reciprocal translocations in these unexposed control animals were of clonal origin. Correction for clonal expansion greatly reduced the means and their standard errors at most time points where clonal expansion was prevalent. The biodosimetry was much improved suggesting that correction is beneficial in long-term studies

  4. Characterization of cloned cells from an immortalized fetal pulmonary type II cell line

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, R.F.; Waide, J.J.; Lechner, J.F.


    A cultured cell line that maintained expression of pulmonary type II cell markers of differentiation would be advantageous to generate a large number of homogenous cells in which to study the biochemical functions of type II cells. Type II epithelial cells are the source of pulmonary surfactant and a cell of origin for pulmonary adenomas. Last year our laboratory reported the induction of expression of two phenotypic markers of pulmonary type II cells (alkaline phosphatase activity and surfactant lipid synthesis) in cultured fetal rat lung epithelial (FRLE) cells, a spontaneously immortalized cell line of fetal rat lung type II cell origin. Subsequently, the induction of the ability to synthesize surfactant lipid became difficult to repeat. We hypothesized that the cell line was heterogenuous and some cells were more like type II cells than others. The purpose of this study was to test this hypothesis and to obtain a cultured cell line with type II cell phenotypic markers by cloning several FRLE cells and characterizing them for phenotypic markers of type II cells (alkaline phosphatase activity and presence of surfactant lipids). Thirty cloned cell lines were analyzed for induced alkaline phosphatase activity (on x-axis) and for percent of phospholipids that were disaturated (i.e., surfactant).

  5. Donor cell differentiation, reprogramming, and cloning efficiency: elusive or illusive correlation? (United States)

    Oback, B; Wells, D N


    Compared to other assisted reproductive technologies, mammalian nuclear transfer (NT) cloning is inefficient in generating viable offspring. It has been postulated that nuclear reprogramming and cloning efficiency can be increased by choosing less differentiated cell types as nuclear donors. This hypothesis is mainly supported by comparative mouse cloning experiments using early blastomeres, embryonic stem (ES) cells, and terminally differentiated somatic donor cells. We have re-evaluated these comparisons, taking into account different NT procedures, the use of donor cells from different genetic backgrounds, sex, cell cycle stages, and the lack of robust statistical significance when post-blastocyst development is compared. We argue that while the reprogrammability of early blastomeres appears to be much higher than that of somatic cells, it has so far not been conclusively determined whether differentiation status affects cloning efficiency within somatic donor cell lineages. Copyright (c) 2006 Wiley-Liss, Inc.

  6. Isolation and partial characterization of peripheral blood CD4+ T cell clones expressing γδT cell receptors

    International Nuclear Information System (INIS)

    Kyoizumi, Seishi; Akiyama, Mitoshi; Hirai, Yuko; Kusunoki, Yoichiro.


    Rare T cell clones bearing both CD4 and T cell receptors (TCRγ and TCRδ) were obtained from human peripheral blood by cell sorting using anti-CD4 and anti-TCRδ1 antibodies. All the clones established were reactive with anti-TCRγδ1 antibody, whereas only about 20 % of the clones showed reactivity with anti-δTCS1 antibody. Unlike CD4 + T cells bearing TCRαβ, all the clones tested were lectin-dependent and showed CD3 antibody-redirected cytolytic activity. About 60 % exhibited natural killer cell-like activity. Immunoprecipitation analysis of TCRγδ showed that each clone expressed either a disulfide-linked or nondisulfide-linked heterodimer consisting of 37-44 kilodalton TCRγ and TCRδ chains. Southern blot analyses of TCRγ and TCRδ genes revealed some identical rearrangement patterns, suggesting the limited heterogeneity of CD4 + TCRγδ + T cells in peripheral blood. (author)

  7. CCL22-specific T Cells

    DEFF Research Database (Denmark)

    Martinenaite, Evelina; Munir Ahmad, Shamaila; Hansen, Morten


    Tumor cells and tumor-infiltrating macrophages produce the chemokine CCL22, which attracts regulatory T cells (Tregs) into the tumor microenvironment, decreasing anticancer immunity. Here, we investigated the possibility of targeting CCL22-expressing cells by activating specific T cells. We...... analyzed the CCL22 protein signal sequence, identifying a human leukocyte antigen A2- (HLA-A2-) restricted peptide epitope, which we then used to stimulate peripheral blood mononuclear cells (PMBCs) to expand populations of CCL22-specific T cells in vitro. T cells recognizing an epitope derived from...... the signal-peptide of CCL22 will recognize CCL22-expressing cells even though CCL22 is secreted out of the cell. CCL22-specific T cells recognized and killed CCL22-expressing cancer cells. Furthermore, CCL22-specific T cells lysed acute monocytic leukemia cells in a CCL22 expression-dependent manner. Using...

  8. Entamoeba Clone-Recognition Experiments: Morphometrics, Aggregative Behavior, and Cell-Signaling Characterization. (United States)

    Espinosa, Avelina; Paz-Y-Miño-C, Guillermo; Hackey, Meagan; Rutherford, Scott


    Studies on clone- and kin-discrimination in protists have proliferated during the past decade. We report clone-recognition experiments in seven Entamoeba lineages (E. invadens IP-1, E. invadens VK-1:NS, E. terrapinae, E. moshkovskii Laredo, E. moshkovskii Snake, E. histolytica HM-1:IMSS and E. dispar). First, we characterized morphometrically each clone (length, width, and cell-surface area) and documented how they differed statistically from one another (as per single-variable or canonical-discriminant analyses). Second, we demonstrated that amebas themselves could discriminate self (clone) from different (themselves vs. other clones). In mix-cell-line cultures between closely-related (E. invadens IP-1 vs. E. invadens VK-1:NS) or distant-phylogenetic clones (E. terrapinae vs. E. moshkovskii Laredo), amebas consistently aggregated with same-clone members. Third, we identified six putative cell-signals secreted by the amebas (RasGap/Ankyrin, coronin-WD40, actin, protein kinases, heat shock 70, and ubiquitin) and which known functions in Entamoeba spp. included: cell proliferation, cell adhesion, cell movement, and stress-induced encystation. To our knowledge, this is the first multi-clone characterization of Entamoeba spp. morphometrics, aggregative behavior, and cell-signaling secretion in the context of clone-recognition. Protists allow us to study cell-cell recognition from ecological and evolutionary perspectives. Modern protistan lineages can be central to studies about the origins and evolution of multicellularity. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  9. Effective donor cell fusion conditions for production of cloned dogs by somatic cell nuclear transfer. (United States)

    Park, JungEun; Oh, HyunJu; Hong, SoGun; Kim, MinJung; Kim, GeonA; Koo, OkJae; Kang, SungKeun; Jang, Goo; Lee, ByeongChun


    As shown by the birth of the first cloned dog 'Snuppy', a protocol to produce viable cloned dogs has been reported. In order to evaluate optimum fusion conditions for improving dog cloning efficiency, in vivo matured oocytes were reconstructed with adult somatic cells from a female Pekingese using different fusion conditions. Fusion with needle vs chamber methods, and with low vs high pulse strength was compared by evaluating fusion rate and in vivo development of canine cloned embryos. The fusion rates in the high voltage groups were significantly higher than in the low voltage groups regardless of fusion method (83.5 vs 66.1% for the needle fusion method, 67.4 vs 37.9% for the fusion chamber method). After embryo transfer, one each pregnancy was detected after using the needle fusion method with high and low voltage and in the chamber fusion method with high voltage, whereas no pregnancy was detected using the chamber method with low voltage. However, only the pregnancy from the needle fusion method with high voltage was maintained to term and one healthy puppy was delivered. The results of the present study demonstrated that two DC pulses of 3.8 to 4.0 kV/cm for 15 μsec using the needle fusion method were the most effective method for the production of cloned dogs under the conditions of this experiment. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Establishment and Analysis of Cancer Stem-Like and Non-Cancer Stem-Like Clone Cells from the Human Colon Cancer Cell Line SW480.

    Directory of Open Access Journals (Sweden)

    Akari Takaya

    Full Text Available Human cancer stem-like cells (CSCs/cancer-initiating cells (CICs can be isolated as side population (SP cells, aldehyde dehydrogenase high (ALDHhigh cells or cell surface marker-positive cells including CD44+ cells and CD133+ cells. CSCs/CICs and non-CSCs/CICs are unstable in in vitro culture, and CSCs/CICs can differentiate into non-CSCs/CICs and some non-CSCs/CICs can dedifferentiate into CSCs/CICs. Therefore, experiments using a large amount of CSCs/CICs are technically very difficult. In this study, we isolated single cell clones from SP cells and main population (MP cells derived from the human colon cancer cell line SW480. SP analysis revealed that SP clone cells had relatively high percentages of SP cells, whereas MP clone cells showed very few SP cells, and the phenotypes were sustainable for more than 2 months of in vitro culture. Xenograft transplantation revealed that SP clone cells have higher tumor-initiating ability than that of MP clone cells and SP clone cell showed higher chemo-resistance compared with MP clone cells. These results indicate that SP clone cells derived from SW480 cells are enriched with CSCs/CICs, whereas MP clone cells are pure non-CSCs/CICs. SP clone cells and MP clone cells are a very stable in vitro CSC/CIC-enriched and non-CSC/CIC model for further analysis.

  11. Establishment and Analysis of Cancer Stem-Like and Non-Cancer Stem-Like Clone Cells from the Human Colon Cancer Cell Line SW480. (United States)

    Takaya, Akari; Hirohashi, Yoshihiko; Murai, Aiko; Morita, Rena; Saijo, Hiroshi; Yamamoto, Eri; Kubo, Terufumi; Nakatsugawa, Munehide; Kanaseki, Takayuki; Tsukahara, Tomohide; Tamura, Yasuaki; Takemasa, Ichiro; Kondo, Toru; Sato, Noriyuki; Torigoe, Toshihiko


    Human cancer stem-like cells (CSCs)/cancer-initiating cells (CICs) can be isolated as side population (SP) cells, aldehyde dehydrogenase high (ALDHhigh) cells or cell surface marker-positive cells including CD44+ cells and CD133+ cells. CSCs/CICs and non-CSCs/CICs are unstable in in vitro culture, and CSCs/CICs can differentiate into non-CSCs/CICs and some non-CSCs/CICs can dedifferentiate into CSCs/CICs. Therefore, experiments using a large amount of CSCs/CICs are technically very difficult. In this study, we isolated single cell clones from SP cells and main population (MP) cells derived from the human colon cancer cell line SW480. SP analysis revealed that SP clone cells had relatively high percentages of SP cells, whereas MP clone cells showed very few SP cells, and the phenotypes were sustainable for more than 2 months of in vitro culture. Xenograft transplantation revealed that SP clone cells have higher tumor-initiating ability than that of MP clone cells and SP clone cell showed higher chemo-resistance compared with MP clone cells. These results indicate that SP clone cells derived from SW480 cells are enriched with CSCs/CICs, whereas MP clone cells are pure non-CSCs/CICs. SP clone cells and MP clone cells are a very stable in vitro CSC/CIC-enriched and non-CSC/CIC model for further analysis.

  12. Successful cloning of coyotes through interspecies somatic cell nuclear transfer using domestic dog oocytes. (United States)

    Hwang, Insung; Jeong, Yeon Woo; Kim, Joung Joo; Lee, Hyo Jeong; Kang, Mina; Park, Kang Bae; Park, Jung Hwan; Kim, Yeun Wook; Kim, Woo Tae; Shin, Taeyoung; Hyun, Sang Hwan; Jeung, Eui-Bae; Hwang, Woo Suk


    Interspecies somatic cell nuclear transfer (iSCNT) is an emerging assisted reproductive technology (ART) for preserving Nature's diversity. The scarcity of oocytes from some species makes utilisation of readily available oocytes inevitable. In the present study, we describe the successful cloning of coyotes (Canis latrans) through iSCNT using oocytes from domestic dogs (Canis lupus familiaris or dingo). Transfer of 320 interspecies-reconstructed embryos into 22 domestic dog recipients resulted in six pregnancies, from which eight viable offspring were delivered. Fusion rate and cloning efficiency during iSCNT cloning of coyotes were not significantly different from those observed during intraspecies cloning of domestic dogs. Using neonatal fibroblasts as donor cells significantly improved the cloning efficiency compared with cloning using adult fibroblast donor cells (Pcloning of coyotes in the present study holds promise for cloning other endangered species in the Canidae family using similar techniques. However, there are still limitations of the iSCNT technology, as demonstrated by births of morphologically abnormal coyotes and the clones' inheritance of maternal domestic dog mitochondrial DNA.

  13. An allospecific murine T helper clone which can help both T and B cell responses in vitro and in vivo

    DEFF Research Database (Denmark)

    Crispe, I N; Gascoigne, N R; Owens, T


    . Here we describe an in vitro and in vivo study of this problem, using a Th clone, designated MTH-1. The clone carries the cell surface markers Thy-1 and L3T4a, but lacks Lyt-2. It recognizes a minor alloantigen shared by DBA/2, B10.D2 and NZB spleen cells, and such recognition is restricted by H-2Ed...... in the polyclonal activation and maturation of the B cells to secrete immunoglobulin; also, antigen-primed B cells are augmented in their in vivo synthesis of specific antibody to the Thy-1 X 1 alloantigen by around 10(5) MTH-1 cells. Taken together, these results suggest a single Th clone can help both B cells......Both B lymphocytes and cytotoxic T lymphocytes respond to signals from the T helper (Th) compartment, and such signals are mediated by a number of biochemically distinct factors. This raises the question whether help for B cells and T cells is a function of one or several different kinds of Th cell...

  14. Aberrant DNA Methylation in Human iPSCs Associates with MYC-Binding Motifs in a Clone-Specific Manner Independent of Genetics. (United States)

    Panopoulos, Athanasia D; Smith, Erin N; Arias, Angelo D; Shepard, Peter J; Hishida, Yuriko; Modesto, Veronica; Diffenderfer, Kenneth E; Conner, Clay; Biggs, William; Sandoval, Efren; D'Antonio-Chronowska, Agnieszka; Berggren, W Travis; Izpisua Belmonte, Juan Carlos; Frazer, Kelly A


    Induced pluripotent stem cells (iPSCs) show variable methylation patterns between lines, some of which reflect aberrant differences relative to embryonic stem cells (ESCs). To examine whether this aberrant methylation results from genetic variation or non-genetic mechanisms, we generated human iPSCs from monozygotic twins to investigate how genetic background, clone, and passage number contribute. We found that aberrantly methylated CpGs are enriched in regulatory regions associated with MYC protein motifs and affect gene expression. We classified differentially methylated CpGs as being associated with genetic and/or non-genetic factors (clone and passage), and we found that aberrant methylation preferentially occurs at CpGs associated with clone-specific effects. We further found that clone-specific effects play a strong role in recurrent aberrant methylation at specific CpG sites across different studies. Our results argue that a non-genetic biological mechanism underlies aberrant methylation in iPSCs and that it is likely based on a probabilistic process involving MYC that takes place during or shortly after reprogramming. Published by Elsevier Inc.

  15. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva


    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  16. Differential Regulation of Gene Expression of Alveolar Epithelial Cell Markers in Human Lung Adenocarcinoma-Derived A549 Clones

    Directory of Open Access Journals (Sweden)

    Hiroshi Kondo


    Full Text Available Stem cell therapy appears to be promising for restoring damaged or irreparable lung tissue. However, establishing a simple and reproducible protocol for preparing lung progenitor populations is difficult because the molecular basis for alveolar epithelial cell differentiation is not fully understood. We investigated an in vitro system to analyze the regulatory mechanisms of alveolus-specific gene expression using a human alveolar epithelial type II (ATII cell line, A549. After cloning A549 subpopulations, each clone was classified into five groups according to cell morphology and marker gene expression. Two clones (B7 and H12 were further analyzed. Under serum-free culture conditions, surfactant protein C (SPC, an ATII marker, was upregulated in both H12 and B7. Aquaporin 5 (AQP5, an ATI marker, was upregulated in H12 and significantly induced in B7. When the RAS/MAPK pathway was inhibited, SPC and thyroid transcription factor-1 (TTF-1 expression levels were enhanced. After treatment with dexamethasone (DEX, 8-bromoadenosine 3′5′-cyclic monophosphate (8-Br-cAMP, 3-isobutyl-1-methylxanthine (IBMX, and keratinocyte growth factor (KGF, surfactant protein B and TTF-1 expression levels were enhanced. We found that A549-derived clones have plasticity in gene expression of alveolar epithelial differentiation markers and could be useful in studying ATII maintenance and differentiation.

  17. Molecular cloning of L-methylmalonyl-CoA mutase: Gene transfer and analysis of mut cell lines

    International Nuclear Information System (INIS)

    Ledley, F.D.; Lumetta, M.; Nguyen, P.N.; Kolhouse, J.F.; Allen, R.H.


    L-Methylmalonyl-CoA mutase (MCM, EC is a mitochondrial adenosylcobalamin-requiring enzyme that catalyzes the isomerization of L-methylmalonyl-CoA to succinyl-CoA. This enzyme is deficient in methylmalonic acidemia, an often fatal disorder of organic acid metabolism. Antibody against human placental MCM was used to screen human placenta and liver cDNA expression libraries for MCM cDNA clones. One clone expressed epitopes that could affinity-purify antibodies against MCM. A cDNA corresponding in length to the mRNA was obtained and introduced into COS cells by DNA-mediated gene transfer. Cells transformed with this clone expressed increased levels of MCM enzymatic activity. RNA blot analysis of cells genetically deficient in MCM indicates that several deficient cell lines have a specific decrease in the amount of hybridizable mRNA. These data confirm the authenticity of the MCM cDNA clone, establish the feasibility of constituting MCM activity by gene transfer for biochemical analysis and gene therapy, and provide a preliminary picture of the genotypic spectrum underlying MCM deficiency

  18. Cloning and Characterization of Genes that Inhibit TRAIL-Induced Apoptosis of Breast Cancer Cells

    National Research Council Canada - National Science Library

    Shu, Hong-Bing


    ...). However, some cancer cells are resistant to TRAIL-induced apoptosis (3, 4, 6-13). The purpose of this proposed study is to clone and characterize such inhibitory genes of TRAIL-induced apoptosis...

  19. Health status and productive performance of somatic cell cloned cattle and their offspring produced in Japan. (United States)

    Watanabe, Shinya; Nagai, Takashi


    Since the first somatic cell cloned calves were born in Japan in 1998, more than 500 cloned cattle have been produced by somatic cell nuclear transfer and many studies concerning cloned cattle and their offspring have been conducted in this country. However, most of the results have been published in Japanese; thus, the data produced in this country is not well utilized by researchers throughout the world. This article reviews the 65 reports produced by Japanese researchers (62 written in Japanese and 3 written in English), which employed 171 clones and 32 offspring, and categorizes them according to the following 7 categories: (1) genetic similarities and muzzle prints, (2) hematology and clinical chemistry findings, (3) pathology, (4) growth performance, (5) reproductive performance, (6) meat production performance and (7) milk production performance. No remarkable differences in health status or reproductive performance were found among conventionally bred cattle, somatic cell cloned cattle surviving to adulthood and offspring of somatic cell cloned cattle. Similarities in growth performance and meat quality were observed between nuclear donor cattle and their clones. The growth curves of the offspring resembled those of their full siblings.

  20. Can mammalian cloning combined with embryonic stem cell technologies be used to treat human diseases? (United States)

    Hadjantonakis, Anna-Katerina; Papaioannou, Virginia E


    Cloning is commonly perceived as a means of generating genetically identical individuals, but it can also be used to obtain genetically matched embryo-derived stem cells, which could potentially be used in the treatment of patients. A recent report offers the first 'proof of principle' of such cloning for therapeutic purposes, referred to as nuclear transplantation to produce stem cells for autologous transplantation. PMID:12186652

  1. A protocol for adult somatic cell nuclear transfer in medaka fish (Oryzias latipes) with a high rate of viable clone formation. (United States)

    Bubenshchikova, Ekaterina; Kaftanovskaya, Elena; Adachi, Tomoko; Hashimoto, Hisashi; Kinoshita, Masato; Wakamatsu, Yuko


    Previously, we successfully generated fully grown, cloned medaka (the Japanese rice fish, Oryzias latipes) using donor nuclei from primary culture cells of adult caudal fin tissue and nonenucleated recipient eggs that were heat shock-treated to induce diploidization of the nuclei. However, the mechanism of clone formation using this method is unknown, and the rate of adult clone formation is not high enough for studies in basic and applied sciences. To gain insight into the mechanism and increase the success rate of this method of clone formation, we tested two distinct nuclear transfer protocols. In one protocol, the timing of transfer of donor nuclei was changed, and in the other, the size of the donor cells was changed; each protocol was based on our original methodology. Ultimately, we obtained an unexpectedly high rate of adult clone formation using the protocol that differed with respect to the timing of donor nuclei transfer. Specifically, 17% of the transplants that developed to the blastula stage ultimately developed into adult clones. The success rate with this method was 13 times higher than that obtained using the original method. Analyses focusing on the reasons for this high success rate of clone formation will help to elucidate the mechanism of clone formation that occurs with this method.

  2. In vitro development of cloned bovine embryos produced by handmade cloning using somatic cells from distinct levels of cell culture confluence. (United States)

    Gerger, R P C; Ribeiro, E S; Forell, F; Bertolini, L R; Rodrigues, J L; Ambrósio, C E; Miglino, M A; Mezzalira, A; Bertolini, M


    The relationship between the level of cell confluence near the plateau phase of growth and blastocyst yield following somatic cell cloning is not well understood. We examined the effect of distinct cell culture confluence levels on in vitro development of cloned bovine embryos. In vitro-matured bovine oocytes were manually bisected and selected by DNA staining. One or two enucleated hemi-cytoplasts were paired and fused with an adult skin somatic cell. Cultured skin cells from an adult Nellore cow harvested at three distinct culture confluence levels (70-80, 80-90, and >95%) were used for construction of embryos and hemi-embryos. After activation, structures were cultured in vitro as one embryo (1 x 100%) or as aggregates of two hemi-embryos (2 x 50%) per microwell. Fusion, cleavage and blastocyst rates were compared using the chi(2) test. The fusion rate for hemi-embryos (51.4%) was lower than for embryos (67.6%), with no influence of degree of cell confluence. However, blastocyst rates improved linearly (7.0, 17.5, and 29.4%) with increases in cell confluence. We conclude that degree of cell culture confluence significantly influences subsequent embryo development; use of a cell population in high confluence (>90%) for nuclear transfer significantly improved blastocyst yield after cloning.

  3. Evidence for idiotypic- and antiidiotypic B-B cellular interaction with the use of cloned antiidiotypic B cell line. (United States)

    Bitoh, S; Fujimoto, S; Yamamoto, H


    Immunization of BALB/c mice with MOPC104E myeloma protein induces antiidiotypic B lymphocytes that have Id-specific enhancing activity on antibody production. The B-B cell interaction was restricted to both Igh and class II MHC. However, anti-Thy-1 and C-treated splenic B cells were maintained for more than 1 y in a mixture of Con A-stimulated splenocyte culture supernatant and synthetic medium. In applying the long term culture method, we have established a cloned B cell line named B19-1d, B19-1d cells are specific to MOPC104E or J558 cross-reactive Id and they express surface mu, lambda but no Ly-1. B19-1d do not spontaneously secrete Ig but produce them upon stimulation with bacterial LPS. The effect of B19-1d cell line on idiotypic antibody production was tested. Addition of only 10 to 100 B19-1d cells into dextran-immune B cell culture greatly enhanced the Id+ antidextran antibody responses. On the contrary, the antidextran antibody production was suppressed by the higher doses of B19-1d cells. The effective cooperation between dextran-immune B cells and B19-1d cloned B cells was restricted to class II MHC. The role of idiotypic- and antiidiotypic B-B cell interaction in immune regulation and repertoire generation was suggested.

  4. Cloning and molecular analyses of a gibberellin 20-oxidase gene expressed specifically in developing seeds of watermelon. (United States)

    Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G


    To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.

  5. Cloning and Molecular Analyses of a Gibberellin 20-Oxidase Gene Expressed Specifically in Developing Seeds of Watermelon1 (United States)

    Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung


    To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

  6. Single TCR-Vβ2 evaluation discloses the circulating T cell clone in Sezary syndrome: one family fits all! (United States)

    Scala, Enrico; Abeni, Damiano; Pomponi, Debora; Russo, Nicoletta; Russo, Giandomenico; Narducci, Maria Grazia


    Sézary Syndrome (SS/L-CTCL) is a rare but aggressive variant of cutaneous T cell lymphoma (CTCL), characterized by erythroderma, lymphadenopathy, and the presence of a circulating memory CD4(+) T cell malignant clone with a skin homing behavior, lacking CD26 and CD49d and over-expressing CD60. The availability of a panel of monoclonal antibodies recognizing distinct TCR-Vβ families, allows to typify the clone by flow cytometry in about 70 % of cases. The TCR-Vβ repertoire of 533 individuals, comprising 308 patients affected by CTCL, 50 healthy donors, and subjects affected by various non-neoplastic dermatological affections was evaluated by flow cytometry. Statistical analyses were performed using the SPSS statistical software package for Microsoft Windows (SPSS, version 21, Chicago, IL). TCR-Vβ2 levels below 5.4 % or above 39.5 %, within total CD4(+) T cells, showed the best balance between sensitivity (98.1 %) and specificity (96 %) to identify the presence of a clone in the peripheral blood of patients affected by SS. Based on this observation, a "two-step" procedure in the detection of the malignant T cell clone in CTCLs is herein suggested. TCR-Vβ2 assessment in all cases (first step). In the case of TCR-Vβ2 levels above 39.5 %, the presence of a clonal expansion of this family is suggested, deserving further confirmation by means of T cell gene rearrangement evaluation. In patients having a TCR-Vβ2 reactivity below 5.4 % (second step), the entire TCR-Vβ repertoire should be evaluated to typify the expanded clone. In conclusion, the single TCR-Vβ2 expression check, instead of the entire repertoire assessment, represents an easy and cost-effective method for the recognition of CTCL aggressive leukemic variant.

  7. Differentiation of human B lymphocyte subpopulations induced by an alloreactive helper T-cell clone

    International Nuclear Information System (INIS)

    Anderson, S.J.; Hummell, D.S.; Lawton, A.R.


    We have used cloned alloreactive helper T cells to determine if direct T cell-B cell interaction can induce differentiation of human peripheral blood B cells which do not respond to pokeweed mitogen (PWM). T-cell clone 2F8 was derived from a one-way mixed lymphocyte reaction. 2F8 cells are T3+T4+T8-IL-2R+ and proliferate in response to irradiated stimulator cells, but not autologous cells, in the absence of exogenous interleukin-2. 2F8 cells provide allospecific help for polyclonal proliferation and differentiation of B cells in the absence of any other stimulus. The magnitude of this response is comparable to that of the response of the same B cells to PWM and fresh autologous T cells. 2F8 cells could also provide nonspecific help for unrelated donor B cells in the presence of PWM, with no requirement for costimulation by irradiated stimulator cells. Allospecific stimulation of B cells was completely inhibited by antibodies to class II major histocompatibility complex (MHC) framework determinants and was abrogated by 1000-rad irradiation. Cloned 2F8 T cells stimulated differentiation of both small, high-density B cells and larger B cells, generating up to 30% plasma cells with either fraction. B cells forming rosettes with mouse erythrocytes were also induced to differentiate by the helper T cell clone. As found previously, neither small, high-density B cells nor mouse rosette+ B cells responded well to PWM. Direct interaction with allospecific T cells induces differentiation of a broader spectrum of B cells than soluble growth and differentiation factors in conjunction with polyclonal activators such as PWM and protein A containing staphylococci

  8. Stochastic differentiation into an osteoclast lineage from cloned macrophage-like cells

    Energy Technology Data Exchange (ETDEWEB)

    Hayashi, Shin-Ichi, E-mail: [Division of Immunology, Department of Molecular and Cellular Biology, School of Life Science, Faculty of Medicine, Tottori University, 86 Nishi-Cho, Yonago, Tottori 683-8503 (Japan); Murata, Akihiko; Okuyama, Kazuki; Shimoda, Yuhki; Hikosaka, Mari [Division of Immunology, Department of Molecular and Cellular Biology, School of Life Science, Faculty of Medicine, Tottori University, 86 Nishi-Cho, Yonago, Tottori 683-8503 (Japan); Yasuda, Hisataka [Planning and Development, Bioindustry Division, Oriental Yeast Co., Ltd, Itabashi-Ku, Tokyo 174-8505 (Japan); Yoshino, Miya [Division of Immunology, Department of Molecular and Cellular Biology, School of Life Science, Faculty of Medicine, Tottori University, 86 Nishi-Cho, Yonago, Tottori 683-8503 (Japan)


    Highlights: Black-Right-Pointing-Pointer The frequency of C7 differentiation into osteoclast was low and constant. Black-Right-Pointing-Pointer Only extended C7 cell cultures exponentially increased osteoclast+ cultures. Black-Right-Pointing-Pointer C7 cell differentiation into committed osteoclast precursors is on 'autopilot'. Black-Right-Pointing-Pointer The system may maintain the stem cell self-renewal and differentiation. -- Abstract: Differentiation into osteoclasts is induced by a macrophage colony-stimulating factor and receptor activator of nuclear-factor {kappa}B ligand. The macrophage-like cell line, C7 has the potential to differentiate into osteoclasts when it is cultured with both factors for 6 days. Although C7 is an established cell line, the frequency of differentiation into this lineage was less than 10%, and the ratio was maintained at a constant level, even after repeated cloning. In this study, to increase the differentiation of C7 cells to osteoclasts, C7 derivative treatments with several activators and/or inhibitors were performed for 3 days prior to setting osteoclast induction analysis; however, a reagent to significantly up-regulate the frequency of differentiation was not found. Only extended cultures for osteoclastogenesis exponentially increased the frequency of osteoclast precursors. It is likely that C7 cell differentiation into committed osteoclast precursors is on 'autopilot' rather than requiring specific signals to drive this process.

  9. Stochastic differentiation into an osteoclast lineage from cloned macrophage-like cells

    International Nuclear Information System (INIS)

    Hayashi, Shin-Ichi; Murata, Akihiko; Okuyama, Kazuki; Shimoda, Yuhki; Hikosaka, Mari; Yasuda, Hisataka; Yoshino, Miya


    Highlights: ► The frequency of C7 differentiation into osteoclast was low and constant. ► Only extended C7 cell cultures exponentially increased osteoclast+ cultures. ► C7 cell differentiation into committed osteoclast precursors is on ‘autopilot’. ► The system may maintain the stem cell self-renewal and differentiation. -- Abstract: Differentiation into osteoclasts is induced by a macrophage colony-stimulating factor and receptor activator of nuclear-factor κB ligand. The macrophage-like cell line, C7 has the potential to differentiate into osteoclasts when it is cultured with both factors for 6 days. Although C7 is an established cell line, the frequency of differentiation into this lineage was less than 10%, and the ratio was maintained at a constant level, even after repeated cloning. In this study, to increase the differentiation of C7 cells to osteoclasts, C7 derivative treatments with several activators and/or inhibitors were performed for 3 days prior to setting osteoclast induction analysis; however, a reagent to significantly up-regulate the frequency of differentiation was not found. Only extended cultures for osteoclastogenesis exponentially increased the frequency of osteoclast precursors. It is likely that C7 cell differentiation into committed osteoclast precursors is on ‘autopilot’ rather than requiring specific signals to drive this process.

  10. Cell cloning-on-the-spot by using an attachable silicone cylinder. (United States)

    Park, Hong Bum; Son, Wonseok; Chae, Dong Han; Lee, Jisu; Kim, Il-Woung; Yang, Woomi; Sung, Jae Kyu; Lim, Kyu; Lee, Jun Hee; Kim, Kyung-Hee; Park, Jong-Il


    Cell cloning is a laboratory routine to isolate and keep particular properties of cultured cells. Transfected or other genetically modified cells can be selected by the traditional microbiological cloning. In addition, common laboratory cell lines are prone to genotypic drift during their continual culture, so that supplementary cloning steps are often required to maintain correct lineage phenotypes. Here, we designed a silicone-made attachable cloning cylinder, which facilitated an easy and bona fide cloning of interested cells. This silicone cylinder was easy to make, showed competent stickiness to laboratory plastics including culture dishes, and hence enabled secure isolation and culture for days of selected single cells, especially, on the spots of preceding cell-plating dishes under microscopic examination of visible cellular phenotypes. We tested the silicone cylinder in the monoclonal subcloning from a heterogeneous population of a breast cancer cell line, MDA-MB-231, and readily established independent MDA-MB-231 subclones showing different sublineage phenotypes. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)

    A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

  12. Statistical analysis of clone formation in cultures of human stem cells. (United States)

    Bochkov, N P; Vinogradova, M S; Volkov, I K; Voronina, E S; Kuleshov, N P


    We performed a statistical analysis of clone formation from aneuploid cells (chromosomes 6, 8, 11, X) in cultures of bone marrow-derived human multipotent mesenchymal stromal cells by spontaneous level of aneuploidy at different terms of culturing (from 2 to 19 cell cycles). It was found that the duration of cell cycle increased from 65.6 h at passages 2-3 to 164.5 h at passage 12. The expected ratio of aneuploid cells was calculated using modeled 5, 10, 20 and 30% selective preference in reproduction. The size of samples for detecting 10, 25, and 50% increased level of aneuploidy was calculated. The presented principles for evaluation of aneuploid clone formation may be used to distinguish clones of any abnormal cells.

  13. Sensitivity and specificity of three Onchocerca volvulus cloned antigens in diagnosis of onchocerciasis

    International Nuclear Information System (INIS)

    Atti, Miska Elyemen; TR, Unnasch; Mukhtar, M.M.


    Onchcerciasis is endemic in three geographical regions in Sudan, and presented with variable clinical reactions. The current diagnosis of onchocerciasis is based on detection of live microflaraie in skin snips in addition to clinical signs and history of living in endemic regions. Different serological diagnostic trials using crude soluble antigens of O. volvulus have shown variable degrees of cross reaction with other nematodes co-endemic in the same area. We have studied the sensitivity and specificity of RAL-2, calreticulin and PDI O. volvulus cloned antigens using the ELISA techniques. Eighty serum samples of Onchocerciasis patients, 20 non endemic normal controls and 42 samples of patients of other endemic deseas including Leishmanoasis, malaria, tuberculosis and shestosomiasis were tested RAL-2 gave the best Ig G response, with 83.75% sensitivity and 91. 66% specificity. PDI sensitivity was 20% and specificity 91.66%, while calreticulum showed sensitivity of 37.5% and specificity of 73.30%. IgG3 subclasses was not significantly different from controls while IgG4 was significantly higher in patients. The sensitivity of RAL-2 for IgG4 was 90% with a specificity of 100%. For PDI sensitivity was 25% and 100% specificity while calreticulin resulted in sensitivity of 75% and specificity of 100%. Low levels of circulating IgE to RAL-2 antigen were detected. For all antigens there was significant correlation with gender, age, microflarial load or presence of nodules. (Author)

  14. In vitro and in vivo genotoxic effects of somatic cell nuclear transfer cloned cattle meat. (United States)

    Lee, Nam-Jin; Yang, Byoung-Chul; Jung, Yu-Ri; Lee, Jung-Won; Im, Gi-Sun; Seong, Hwan-Hoo; Park, Jin-Ki; Kang, Jong-Koo; Hwang, Seongsoo


    Although the nutritional composition and health status after consumption of the meat and milk derived from both conventionally bred (normal) and somatic cell nuclear transferred (cloned) animals and their progeny are not different, little is known about their food safeties like genetic toxicity. This study is performed to examine both in vitro (bacterial mutation and chromosome aberration) and in vivo (micronucleus) genotoxicity studies of cloned cattle meat. The concentrations of both normal and cloned cattle meat extracts (0-10×) were tested to five strains of bacteria (Salmonella typhimurium: TA98, TA100, TA1535, and TA1537; Escherichia coli: WP2uvrA) for bacterial mutation and to Chinese hamster lung (CHL/IU) cells for chromosome aberration, respectively. For micronucleus test, ICR mice were divided into five dietary groups: commercial pellets (control), pellets containing 5% (N-5) and 10% (N-10) normal cattle meat, and pellets containing 5% (C-5) and 10% (C-10) cloned cattle meat. No test substance-related genotoxicity was noted in the five bacterial strains, CHL/IU cells, or mouse bone marrow cells, suggesting that the cloned cattle meat potentially may be safe in terms of mutagenic hazards. Thus, it can be postulated that the cloned cattle meat do not induce any harmful genotoxic effects in vitro and in vivo. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment]. (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan


    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  16. Establishment of primary bovine intestinal epithelial cell culture and clone method. (United States)

    Zhan, Kang; Lin, Miao; Liu, Ming-Mei; Sui, Yang-Nan; Zhao, Guo-Qi


    The aim of this study was to establish bovine intestinal epithelial cell (BIEC) line and provide a novel clone cell method. Although various strategies of bovine cell culture and clone techniques have been reported, these methods remain not established. Here, we culture successfully primary BIECs and establish a novel clone cell method. Our result showed that BIECs could be successfully cultured and passaged about generation 5. These cellular aggregates and clusters were adherent loosely at day 2 of culture. Cell aggregates and clusters start to proliferate after approximately 4 d. The BIECs showed positive reaction against cytokeratin 18, E-cadherin, and characteristics of epithelial-like morphology. In addition, the fatty acid-binding proteins (FABPs), villin, and intestinal peptidase (IP) band were positive in BIECs. Our results suggest that the establishment of culturing and clone BIEC methods will apply to isolate and clone other primary cells. These BIECs could therefore contribute to the study of bovine intestinal nutrient absorption and regulation, immune regulation, and the pathogenesis of the bovine intestinal disease, which will provide intestinal cell model in vitro.

  17. In vitro properties and tumorigenicity of radiation-transformed clones of mouse 10T1/2 cells

    International Nuclear Information System (INIS)

    Otsu, Hiroshi; Yasukawa, Mieko; Terasima, Toyozo


    Nineteen radiation-induced and one spontaneously developed transformed foci were cloned from mouse 10T1/2 cells. Each clone was grown with normal 10T1/2 cells, and typing (types II and III) was carried out by making reference to the description of Reznikoff et al. Morphological characteristics of foci and their response to co-cultured normal counterparts are described. Some in vitro properties of the clones were examined and the relationship to each focus type is discussed. A reduced serum requirement of transformed clones was not recognized. Soft agar colonies were produced exclusively by type III clones. Tumorigenicity testing of the clones revealed that 93 % of type III clones were tumorigenic upon inoculation into syngeneic mice in an immunosuppressed condition. From these findings, it can be concluded that the tumorigenic potential of radiation-induced transformed cells can be predicted from the ability of the cells to form colonies in agar. (author)

  18. Derivation from an alloreactive T-cell line of a clone which cross-reacts with a self H2-E-restricted minor alloantigen

    DEFF Research Database (Denmark)

    Owens, T; Liddell, M E; Crispe, I N


    An alloreactive T-helper-cell line [(A.TH X Balb/c) anti-A.TL] was shown to recognize both H2-Ek and H2-Ed. Both proliferation and polyclonal B-cell activation (protein A plaques) were used in the analyses of specificity. On cloning, the H2-Ek/Ed cross-reaction was shown by one clonotype...

  19. To clone or not to clone? Induced pluripotent stem cells can be generated in bulk culture. (United States)

    Willmann, Charlotte A; Hemeda, Hatim; Pieper, Lisa A; Lenz, Michael; Qin, Jie; Joussen, Sylvia; Sontag, Stephanie; Wanek, Paul; Denecke, Bernd; Schüler, Herdit M; Zenke, Martin; Wagner, Wolfgang


    Induced pluripotent stem cells (iPSCs) are usually clonally derived. The selection of fully reprogrammed cells generally involves picking of individual colonies with morphology similar to embryonic stem cells (ESCs). Given that fully reprogrammed cells are highly proliferative and escape from cellular senescence, it is conceivable that they outgrow non-pluripotent and partially reprogrammed cells during culture expansion without the need of clonal selection. In this study, we have reprogrammed human dermal fibroblasts (HDFs) with episomal plasmid vectors. Colony frequency was higher and size was larger when using murine embryonic fibroblasts (MEFs) as stromal support instead of HDFs or human mesenchymal stromal cells (MSCs). We have then compared iPSCs which were either clonally derived by manual selection of a single colony, or derived from bulk-cultures of all initial colonies. After few passages their morphology, expression of pluripotency markers, and gene expression profiles did not reveal any significant differences. Furthermore, clonally-derived and bulk-cultured iPSCs revealed similar in vitro differentiation potential towards the three germ layers. Therefore, manual selection of individual colonies does not appear to be necessary for the generation of iPSCs - this is of relevance for standardization and automation of cell culture procedures.

  20. Numbers and dispersion of repopulating hematopoietic cell clones in radiation chimeras as functions of injected cell dose

    International Nuclear Information System (INIS)

    Micklem, H.S.; Lennon, J.E.; Ansell, J.D.; Gray, R.A.


    Lethally irradiated mice were repopulated with low (10(5)), medium (10(6)) or high (10(7)) doses of congenic bone marrow cells. Marrow donors were heterozygous for the X-chromosome-encoded allozyme marker phosphoglycerate kinase (PGK-1). A second allozyme marker, phosphoglucose isomerase (GPI-1), distinguished between donor and radioresistant host cells. Use of these markers allowed the numbers and dispersion of repopulating hematopoietic clones to be estimated by binomial statistics. The number of major repopulating clones was related to the injected cell dose in a linear fashion, the inferred frequency of clonogenic cells in donor bone marrow being about 1:40,000. In high-dose recipients, the clones grew locally, with little or no dispersion between bones. Low-dose recipients, in contrast, carried widely dispersed clones; these tended to become reduced in number with increasing time after repopulation. Most of the (few) bone marrow clones present in low-dose recipients were also present in the thymus. In contrast, only about 10% of bone marrow clones in high-dose recipients were substantially represented in the thymus at any one time--about 16 clones in each lobe

  1. Complete dissection of the Hb(64-76) determinant using T helper 1, T helper 2 clones, and T cell hybridomas

    DEFF Research Database (Denmark)

    Evavold, B D; Williams, S G; Hsu, B L


    We have generated cloned Th1 cells, Th2 cells, and T cell hybridomas specific for the single immunogenic peptide from the beta-chain of murine hemoglobin (Hb(64-76)). The availability of these various types of T cells provided us an unique opportunity to examine and dissect the T cell response...... to an immunogenic peptide. A panel of altered Hb peptides was made by replacing each amino acid in the Hb peptide (positions 64-76) with a conservative amino acid substitution or an alanine. Although none of the eleven T cell clones and hybridomas tested exhibited the same pattern of reactivity to the substituted...... Hb peptides, some general features were identified for all T cell responses. The primary T cell contact residue of Hb(64-76) was shown to be asparagine 72. For every Hb(64-76) specific T cell, no activation was observed using a peptide containing the conservative substitution of a glutamine...

  2. Inference of Cell Mechanics in Heterogeneous Epithelial Tissue Based on Multivariate Clone Shape Quantification (United States)

    Tsuboi, Alice; Umetsu, Daiki; Kuranaga, Erina; Fujimoto, Koichi


    Cell populations in multicellular organisms show genetic and non-genetic heterogeneity, even in undifferentiated tissues of multipotent cells during development and tumorigenesis. The heterogeneity causes difference of mechanical properties, such as, cell bond tension or adhesion, at the cell–cell interface, which determine the shape of clonal population boundaries via cell sorting or mixing. The boundary shape could alter the degree of cell–cell contacts and thus influence the physiological consequences of sorting or mixing at the boundary (e.g., tumor suppression or progression), suggesting that the cell mechanics could help clarify the physiology of heterogeneous tissues. While precise inference of mechanical tension loaded at each cell–cell contacts has been extensively developed, there has been little progress on how to distinguish the population-boundary geometry and identify the cause of geometry in heterogeneous tissues. We developed a pipeline by combining multivariate analysis of clone shape with tissue mechanical simulations. We examined clones with four different genotypes within Drosophila wing imaginal discs: wild-type, tartan (trn) overexpression, hibris (hbs) overexpression, and Eph RNAi. Although the clones were previously known to exhibit smoothed or convoluted morphologies, their mechanical properties were unknown. By applying a multivariate analysis to multiple criteria used to quantify the clone shapes based on individual cell shapes, we found the optimal criteria to distinguish not only among the four genotypes, but also non-genetic heterogeneity from genetic one. The efficient segregation of clone shape enabled us to quantitatively compare experimental data with tissue mechanical simulations. As a result, we identified the mechanical basis contributed to clone shape of distinct genotypes. The present pipeline will promote the understanding of the functions of mechanical interactions in heterogeneous tissue in a non-invasive manner. PMID

  3. Clonal analysis of the T-cell response to in vivo expressed Mycobacterium tuberculosis protein Rv2034, using a CD154 expression based T-cell cloning method.

    Directory of Open Access Journals (Sweden)

    Susanna Commandeur

    Full Text Available Tuberculosis (TB, caused by Mycobacterium tuberculosis (Mtb, remains a leading cause of death worldwide. A better understanding of the role of CD4+ and CD8+ T cells, which are both important to TB protection, is essential to unravel the mechanisms of protection and to identify the key antigens seen by these T cells. We have recently identified a set of in vivo expressed Mtb genes (IVE-TB which is expressed during in vivo pulmonary infection in mice, and shown that their encoded antigens are potently recognized by polyclonal T cells from tuberculin skin test-positive, in vitro ESAT-6/CFP10-responsive individuals. Here we have cloned T cells specific for one of these newly identified in vivo expressed Mtb (IVE-TB antigens, Rv2034. T cells were enriched based on the expression of CD154 (CD40L, which represents a new method for selecting antigen-specific (low frequency T cells independent of their specific function. An Rv2034-specific CD4+ T-cell clone expressed the Th1 markers T-bet, IFN-γ, TNF-α, IL-2 and the cytotoxicity related markers granzyme B and CD107a as measured by flow cytometry. The clone specifically recognized Rv2034 protein, Rv2034 peptide p81-100 and Mtb lysate. Remarkably, while the recognition of the dominant p81-100 epitope was HLA-DR restricted, the T-cell clone also recognized a neighboring epitope (p88-107 in an HLA-DR- as well as HLA-DQ1-restricted fashion. Importantly, the T-cell clone was able to inhibit Mtb outgrowth from infected monocytes significantly. The characterization of the polyfunctional and Mtb inhibitory T-cell response to IVE-TB Rv2034 at the clonal level provides detailed further insights into the potential of IVE-TB antigens as new vaccine candidate antigens in TB. Our new approach allowed the identification of T-cell subsets that likely play a significant role in controlling Mtb infection, and can be applied to the analysis of T-cell responses in patient populations.

  4. Spontaneous mutation rate in Chinese hamster cell clones differing in UV-sensitivity

    International Nuclear Information System (INIS)

    Manuilova, E.S.; Bagrova, A.M.; Moskovskij Gosudarstvennyj Univ.


    The spontaneous rate of appearance of mutations to 6-mercaptopurine (6 MP) resistence in the cells of CHR2 and CHs2 clones dofferent in sensitivity to lethal and matagenous effect of UV-rays, is investigated. Increased UV-sensitivity of CHs2 clone is caused by the violation of postreplicative DNA reparation. It is established that the purity of spontaneously occuring mutations in both clones turns out to be similar, i.e. (1.5-1.8)x10 -5 for the cell pergeneration. It is shown that the effect of postreplicative DNA reparation in the cells of chinese hamster is not connected with the increase of spontaneous mutation ability. The problem on the possible role of reparation in the mechanism of appearance of spontaneous and induced mutations in the cells of Chinese hamster with increased UV-sensitivity is discussed

  5. Glucocorticoids inhibit the proliferation of IL-2-dependent T cell clones

    International Nuclear Information System (INIS)

    Fresno, M.; Redondo, J.M.; Lopez-Rivas, A.


    It has been shown that glucocorticoids inhibit mitogen or antigen-induced lymphocyte proliferation by decreasing the production of interleukin-2 (IL-2). They have studied the effect of dexamethasone (Dx) on the proliferation of IL-2-dependent T cell clones. They have found that preincubation of these clones with Dx inhibits ( 3 H) thymidine incorporation and cell proliferation in a dose-dependent manner (ID 50 % 5 x 10 -10 M). The inhibition of DNA synthesis by Dx was dependent on the concentration of IL-2. High concentration of IL-2 reversed completely this inhibition. The action of Dx seems to be mediated through the induction of a protein since the simultaneous presence of cycloheximide and Dx prevented the inhibitory effect of the latter. Moreover, dialyzed conditioned medium of Dx treated cells inhibited DNA synthesis by T cell clones. The biochemical characterization of this protein is in progress

  6. Identification of candidate vaccine antigens of bovine hemoparasites Theileria parva and Babesia bovis by use of helper T cell clones. (United States)

    Brown, W C; Zhao, S; Logan, K S; Grab, D J; Rice-Ficht, A C


    Current vaccines for bovine hemoparasites utilize live attenuated organisms or virulent organisms administered concurrently with antiparasitic drugs. Although such vaccines can be effective, for most hemoparasites the mechanisms of acquired resistance to challenge infection with heterologous parasite isolates have not been clearly defined. Selection of potentially protective antigens has traditionally made use of antibodies to identify immunodominant proteins. However, numerous studies have indicated that induction of high antibody titers neither predicts the ability of an antigen to confer protective immunity nor correlates with protection. Because successful parasites have evolved antibody evasion tactics, alternative strategies to identify protective immunogens should be used. Through the elaboration of cytokines, T helper 1-(Th1)-like T cells and macrophages mediate protective immunity against many intracellular parasites, and therefore most likely play an important role in protective immunity against bovine hemoparasites. CD4+ T cell clones specific for soluble or membrane antigens of either Theileria parva schizonts or Babesia bovis merozoites were therefore employed to identify parasite antigens that elicit strong Th cell responses in vitro. Soluble cytosolic parasite antigen was fractionated by gel filtration, anion exchange chromatography or hydroxylapatite chromatography, or a combination thereof, and fractions were tested for the ability to induce proliferation of Th cell clones. This procedure enabled the identification of stimulatory fractions containing T. parva proteins of approximately 10 and 24 kDa. Antisera raised against the purified 24 kDa band reacted with a native schizont protein of approximately 30 kDa. Babesia bovis-specific Th cell clones tested against fractionated soluble Babesia bovis merozoite antigen revealed the presence of at least five distinct antigenic epitopes. Proteins separated by gel filtration revealed four patterns of

  7. Human T cell leukemia/lymphoma virus type I infection of a CD4+ proliferative/cytotoxic T cell clone progresses in at least two distinct phases based on changes in function and phenotype of the infected cells

    NARCIS (Netherlands)

    Yssel, H.; de Waal Malefyt, R.; Duc Dodon, M. D.; Blanchard, D.; Gazzolo, L.; de Vries, J. E.; Spits, H.


    The effect of human T cell leukemia/lymphoma virus type I (HTLV-I) infection on the function and the phenotype of a human proliferating/cytotoxic T cell clone, specific for tetanus toxin, was investigated. During the period after infection, two distinct phases were observed, based on growth

  8. Molecular cloning and expression in mammalian cells of ricin B chain

    International Nuclear Information System (INIS)

    Chang, M.


    In these studies, the cDNA encoding the B chain of ricin has been cloned and expressed in monkey kidney COS-M6 cells. The recombinant B chain was detected by labeling the transfected cells with 35 S-methionine and 35 S-cysteine and demonstrating secretion of a protein with a Mr of 30-32,000 which was not present in the medium of mock-transfected COS-M6 cells. This protein was specifically immunoprecipitated by an anti-ricin or anti-B chain antibody. The amount of recombinant B chain secreted by the COS-M6 cells was determined by radioimmunoassay to be 1-10 ng/ml of media. Virtually all the recombinant B chain formed active ricin when mixed with native A chain; it could also bind as effectively as native B chain to the galactose-containing glycoprotein, asialofetuin. These results indicate that the vast majority of recombinant B chains secreted into the medium of the COS-M6 cells retain biological function

  9. The DNA-instability test as a specific marker of malignancy and its application to detect cancer clones in borderline malignancy

    Directory of Open Access Journals (Sweden)

    M Fukuda


    Full Text Available Recent progress in cytogenetic and biochemical mutator assay technologies has enabled us to detect single gene alterations and gross chromosomal rearrangements, and it became clear that all cancer cells are genetically unstable. In order to detect the genome-wide instability of cancer cells, a new simple method, the DNA-instability test, was developed. The methods to detect genomic instability so far reported have only demonstrated the presence of qualitative and quantitative alterations in certain specific genomic loci. In contrast to these commonly used methods to reveal the genomic instability at certain specific DNA regions, the newly introduced DNA-instability test revealed the presence of physical DNA-instability in the entire DNA molecule of a cancer cell nucleus as revealed by increased liability to denature upon HCl hydrolysis or formamide exposure. When this test was applied to borderline malignancies, cancer clones were detected in all cases at an early-stage of cancer progression. We proposed a new concept of “procancer” clones to define those cancer clones with “functional atypia” showing positivities for various cancer markers, as well as DNA-instability testing, but showing no remarkable ordinary “morphological atypia” which is commonly used as the basis of histopathological diagnosis of malignancy.

  10. Mitochondrial DNA heteroplasmy in ovine fetuses and sheep cloned by somatic cell nuclear transfer

    Directory of Open Access Journals (Sweden)

    Müller Mathias


    Full Text Available Abstract Background The mitochondrial DNA (mtDNA of the cloned sheep "Dolly" and nine other ovine clones produced by somatic cell nuclear transfer (SCNT was reported to consist only of recipient oocyte mtDNA without any detectable mtDNA contribution from the nucleus donor cell. In cattle, mouse and pig several or most of the clones showed transmission of nuclear donor mtDNA resulting in mitochondrial heteroplasmy. To clarify the discrepant transmission pattern of donor mtDNA in sheep clones we analysed the mtDNA composition of seven fetuses and five lambs cloned from fetal fibroblasts. Results The three fetal fibroblast donor cells used for SCNT harboured low mtDNA copy numbers per cell (A: 753 ± 54, B: 292 ± 33 and C: 561 ± 88. The ratio of donor to recipient oocyte mtDNAs was determined using a quantitative amplification refractory mutation system (ARMS PCR (i.e. ARMS-qPCR. For quantification of SNP variants with frequencies below 0.1% we developed a restriction endonuclease-mediated selective quantitative PCR (REMS-qPCR. We report the first cases (n = 4 fetuses, n = 3 lambs of recipient oocyte/nuclear donor mtDNA heteroplasmy in SCNT-derived ovine clones demonstrating that there is no species-effect hindering ovine nucleus-donor mtDNA from being transmitted to the somatic clonal offspring. Most of the heteroplasmic clones exhibited low-level heteroplasmy (0.1% to 0.9%, n = 6 indicating neutral transmission of parental mtDNAs. High-level heteroplasmy (6.8% to 46.5% was observed in one case. This clone possessed a divergent recipient oocyte-derived mtDNA genotype with three rare amino acid changes compared to the donor including one substitution at an evolutionary conserved site. Conclusion Our study using state-of-the-art techniques for mtDNA quantification, like ARMS-qPCR and the novel REMS-qPCR, documents for the first time the transmission of donor mtDNA into somatic sheep clones. MtDNA heteroplasmy was detected in seven of 12 clones

  11. Hybrid clone cells derived from human breast epithelial cells and human breast cancer cells exhibit properties of cancer stem/initiating cells. (United States)

    Gauck, Daria; Keil, Silvia; Niggemann, Bernd; Zänker, Kurt S; Dittmar, Thomas


    The biological phenomenon of cell fusion has been associated with cancer progression since it was determined that normal cell × tumor cell fusion-derived hybrid cells could exhibit novel properties, such as enhanced metastatogenic capacity or increased drug resistance, and even as a mechanism that could give rise to cancer stem/initiating cells (CS/ICs). CS/ICs have been proposed as cancer cells that exhibit stem cell properties, including the ability to (re)initiate tumor growth. Five M13HS hybrid clone cells, which originated from spontaneous cell fusion events between M13SV1-EGFP-Neo human breast epithelial cells and HS578T-Hyg human breast cancer cells, and their parental cells were analyzed for expression of stemness and EMT-related marker proteins by Western blot analysis and confocal laser scanning microscopy. The frequency of ALDH1-positive cells was determined by flow cytometry using AldeRed fluorescent dye. Concurrently, the cells' colony forming capabilities as well as the cells' abilities to form mammospheres were investigated. The migratory activity of the cells was analyzed using a 3D collagen matrix migration assay. M13HS hybrid clone cells co-expressed SOX9, SLUG, CK8 and CK14, which were differently expressed in parental cells. A variation in the ALDH1-positive putative stem cell population was observed among the five hybrids ranging from 1.44% (M13HS-7) to 13.68% (M13HS-2). In comparison to the parental cells, all five hybrid clone cells possessed increased but also unique colony formation and mammosphere formation capabilities. M13HS-4 hybrid clone cells exhibited the highest colony formation capacity and second highest mammosphere formation capacity of all hybrids, whereby the mean diameter of the mammospheres was comparable to the parental cells. In contrast, the largest mammospheres originated from the M13HS-2 hybrid clone cells, whereas these cells' mammosphere formation capacity was comparable to the parental breast cancer cells. All M13HS

  12. [Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts]. (United States)

    Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang


    To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

  13. Plasticity of marrow mesenchymal stem cells from human first-trimester fetus: from single-cell clone to neuronal differentiation. (United States)

    Zhang, Yihua; Shen, Wenzheng; Sun, Bingjie; Lv, Changrong; Dou, Zhongying


    Recent results have shown that bone marrow mesenchymal stem cells (BMSCs) from human first-trimester abortus (hfBMSCs) are closer to embryonic stem cells and perform greater telomerase activity and faster propagation than mid- and late-prophase fetal and adult BMSCs. However, no research has been done on the plasticity of hfBMSCs into neuronal cells using single-cell cloned strains without cell contamination. In this study, we isolated five single cells from hfBMSCs and obtained five single-cell cloned strains, and investigated their biological property and neuronal differentiation potential. We found that four of the five strains showed similar expression profile of surface antigen markers to hfBMSCs, and most of them differentiated into neuron-like cells expressing Nestin, Pax6, Sox1, β-III Tubulin, NF-L, and NSE under induction. One strain showed different expression profile of surface antigen markers from the four strains and hfBMSCs, and did not differentiate toward neuronal cells. We demonstrated for the first time that some of single-cell cloned strains from hfBMSCs can differentiate into nerve tissue-like cell clusters under induction in vitro, and that the plasticity of each single-cell cloned strain into neuronal cells is different.

  14. Survival of irradiated glia and glioma cells studied with a new cloning technique

    International Nuclear Information System (INIS)

    Nilsson, S.; Carlsson, J.; Larsson, B.; Ponten, J.


    A method allowing cloning of monolayer cultured cells with a low plating efficiency was developed. Cells were grown in several small palladium squares to obtain a high cell density. These squares were surrounded by non-adhesive agarose to prevent large distance migration and thereby mixing of the clones. By using easily-cloned hamster cells for comparison it was found that the survival curves were similar to the curves obtained with conventional cloning. The new method was used to compare the radiosensitivity of cultured human glia and glioma cells which both have a low plating efficiency ( 0 -values (1.5 to 2.5 Gy) and large shoulders (extrapolation numbers around 5) indicating that they were rather resistant and had a high capacity for accumulation of sublethal damage. The survival curves for glia cells had lower D 0 -values (1.3 to 1.5 Gy) and no shoulders at all, indicating that they were more sensitive than the glioma cells. (author)

  15. A method for autoradiographic studies of single clones of plaque forming cells

    International Nuclear Information System (INIS)

    Andersen, V.; Lefkovits, I.; Rigshospitalet, Copenhagen


    By limiting dilution of B lymphocytes from spleens of immunized mice, microcultures were obtained that contained only one clone of plaque forming cells (PFC). The cultured cells were labelled with [ 14 C]thymidine for varying period of time. Plaques were obtained in monolayers of sheep erythrocytes in plastic dishes. After fixation with glutaraldehyde, the bottoms of the dishes were stripped off and autoradiograms prepared. By this method, it is possible to determine the proportion of labelled PFC within a given clone and to quantitate the incorporation of label. The method described can be applied to study the incorporation of other labelled molecules and for cytochemical investigations

  16. Clone DB: an integrated NCBI resource for clone-associated data (United States)

    Schneider, Valerie A.; Chen, Hsiu-Chuan; Clausen, Cliff; Meric, Peter A.; Zhou, Zhigang; Bouk, Nathan; Husain, Nora; Maglott, Donna R.; Church, Deanna M.


    The National Center for Biotechnology Information (NCBI) Clone DB ( is an integrated resource providing information about and facilitating access to clones, which serve as valuable research reagents in many fields, including genome sequencing and variation analysis. Clone DB represents an expansion and replacement of the former NCBI Clone Registry and has records for genomic and cell-based libraries and clones representing more than 100 different eukaryotic taxa. Records provide details of library construction, associated sequences, map positions and information about resource distribution. Clone DB is indexed in the NCBI Entrez system and can be queried by fields that include organism, clone name, gene name and sequence identifier. Whenever possible, genomic clones are mapped to reference assemblies and their map positions provided in clone records. Clones mapping to specific genomic regions can also be searched for using the NCBI Clone Finder tool, which accepts queries based on sequence coordinates or features such as gene or transcript names. Clone DB makes reports of library, clone and placement data on its FTP site available for download. With Clone DB, users now have available to them a centralized resource that provides them with the tools they will need to make use of these important research reagents. PMID:23193260

  17. GLUT3 is present in Clone 9 liver cells and translocates to the plasma membrane in response to insulin. (United States)

    Defries, Danielle M; Taylor, Carla G; Zahradka, Peter


    Clone 9 cells have been reported to express only the GLUT1 facilitative glucose transporter; however, previous studies have not examined Clone 9 cells for GLUT3 content. The current study sought to profile the presence of glucose transporters in Clone 9 cells, H4IIE hepatoma cells, and L6 myoblasts and myotubes. While the other cell types contained the expected complement of transporters, Clone 9 cells had GLUT3 which was previously not reported. Interestingly, both GLUT3 mRNA and protein were detected in Clone 9 cells, but only mRNA for GLUT1 was detected. Glucose transport in Clone 9 cells was insulin-sensitive in a concentration-dependent manner, concomitant with the presence of GLUT3 in the plasma membrane after insulin treatment. Although basal glucose uptake was unaffected, insulin-stimulated glucose uptake was abolished with siRNA-mediated GLUT3 knockdown. These results contradict previous reports that Clone 9 cells exclusively express GLUT1 and suggest GLUT3 is a key insulin-sensitive glucose transporter required for insulin-stimulated glucose uptake by Clone 9 cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Human Cloning

    National Research Council Canada - National Science Library

    Johnson, Judith A; Williams, Erin D


    .... Scientists in other labs, including Harvard University and the University of California at San Francisco, intend to produce cloned human embryos in order to derive stem cells for medical research...

  19. Representational difference analysis of Neisseria meningitidis identifies sequences that are specific for the hyper-virulent lineage III clone

    NARCIS (Netherlands)

    Bart, A.; Dankert, J.; van der Ende, A.


    Neisseria meningitidis may cause meningitis and septicemia. Since the early 1980s, an increased incidence of meningococcal disease has been caused by the lineage III clone in many countries in Europe and in New Zealand. We hypothesized that lineage III meningococci have specific DNA sequences,

  20. Automatic cell cloning assay for determining the clonogenic capacity of cancer and cancer stem-like cells. (United States)

    Fedr, Radek; Pernicová, Zuzana; Slabáková, Eva; Straková, Nicol; Bouchal, Jan; Grepl, Michal; Kozubík, Alois; Souček, Karel


    The clonogenic assay is a well-established in vitro method for testing the survival and proliferative capability of cells. It can be used to determine the cytotoxic effects of various treatments including chemotherapeutics and ionizing radiation. However, this approach can also characterize cells with different phenotypes and biological properties, such as stem cells or cancer stem cells. In this study, we implemented a faster and more precise method for assessing the cloning efficiency of cancer stem-like cells that were characterized and separated using a high-speed cell sorter. Cell plating onto a microplate using an automatic cell deposition unit was performed in a single-cell or dilution rank mode by the fluorescence-activated cell sorting method. We tested the new automatic cell-cloning assay (ACCA) on selected cancer cell lines and compared it with the manual approach. The obtained results were also compared with the results of the limiting dilution assay for different cell lines. We applied the ACCA to analyze the cloning capacity of different subpopulations of prostate and colon cancer cells based on the expression of the characteristic markers of stem (CD44 and CD133) and cancer stem cells (TROP-2, CD49f, and CD44). Our results revealed that the novel ACCA is a straightforward approach for determining the clonogenic capacity of cancer stem-like cells identified in both cell lines and patient samples. Copyright © 2013 International Society for Advancement of Cytometry.

  1. Exact, time-independent estimation of clone size distributions in normal and mutated cells. (United States)

    Roshan, A; Jones, P H; Greenman, C D


    Biological tools such as genetic lineage tracing, three-dimensional confocal microscopy and next-generation DNA sequencing are providing new ways to quantify the distribution of clones of normal and mutated cells. Understanding population-wide clone size distributions in vivo is complicated by multiple cell types within observed tissues, and overlapping birth and death processes. This has led to the increased need for mathematically informed models to understand their biological significance. Standard approaches usually require knowledge of clonal age. We show that modelling on clone size independent of time is an alternative method that offers certain analytical advantages; it can help parametrize these models, and obtain distributions for counts of mutated or proliferating cells, for example. When applied to a general birth-death process common in epithelial progenitors, this takes the form of a gambler's ruin problem, the solution of which relates to counting Motzkin lattice paths. Applying this approach to mutational processes, alternative, exact, formulations of classic Luria-Delbrück-type problems emerge. This approach can be extended beyond neutral models of mutant clonal evolution. Applications of these approaches are twofold. First, we resolve the probability of progenitor cells generating proliferating or differentiating progeny in clonal lineage tracing experiments in vivo or cell culture assays where clone age is not known. Second, we model mutation frequency distributions that deep sequencing of subclonal samples produce.

  2. Treatment of porcine donor cells and reconstructed embryos with the antioxidant melatonin enhances cloning efficiency. (United States)

    Pang, Yun-Wei; An, Lei; Wang, Peng; Yu, Yong; Yin, Qiu-Dan; Wang, Xiao-Hong; Xin-Zhang; Qian-Zhang; Yang, Mei-Ling; Min-Guo; Wu, Zhong-Hong; Tian, Jian-Hui


    This study was conducted to investigate the effect of melatonin during the culture of donor cells and cloned embryos on the in vitro developmental competence and quality of cloned porcine embryos. At concentrations of 10(-6 )M or 10(-8) M, melatonin significantly enhanced the proliferation of porcine fetal fibroblasts (PFFs), and the blastocyst rate was significantly increased in the 10(-10) M melatonin-treated donor cell group. Cloned embryo development was also improved in embryo culture medium that was supplemented with 10(-9) M or 10(-12) M melatonin. When both donor cells and cloned embryos were treated with melatonin, the cleavage rate and total cell number of blastocysts were not significantly affected; however, the blastocyst rate was increased significantly (20.0% versus 11.7%). TUNEL assays showed that combined melatonin treatment reduced the rate of apoptotic nuclei (3.6% versus 6.1%). Gene expression analysis of the apoptosis-related genes BAX, BCL2L1, and p53 showed that the expression of BCL2L1 was significantly elevated 2.7-fold relative to the control group, while the expression of BAX and p53 was significantly decreased by 3.7-fold and 23.2-fold, respectively. In addition, we detected the expression of two melatonin receptors (MT1 and MT2) in PFFs but not in porcine cloned embryos. We conclude that exogenous melatonin enhances the development of porcine cloned embryos and improves embryo quality by inhibiting p53-mediated apoptotic pathway. The proliferation of PFFs may be mediated by receptor binding, but the beneficial effects of melatonin on embryonic development may be receptor-independent, possibly through melatonin's ability to directly scavenge free radicals. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  3. Isolation of Specific Clones from Nonarrayed BAC Libraries through Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Mikhail Nefedov


    Full Text Available We have developed a new approach to screen bacterial artificial chromosome (BAC libraries by recombination selection. To test this method, we constructed an orangutan BAC library using an E. coli strain (DY380 with temperature inducible homologous recombination (HR capability. We amplified one library segment, induced HR at 42∘C to make it recombination proficient, and prepared electrocompetent cells for transformation with a kanamycin cassette to target sequences in the orangutan genome through terminal recombineering homologies. Kanamycin-resistant colonies were tested for the presence of BACs containing the targeted genes by the use of a PCR-assay to confirm the presence of the kanamycin insertion. The results indicate that this is an effective approach for screening clones. The advantage of recombination screening is that it avoids the high costs associated with the preparation, screening, and archival storage of arrayed BAC libraries. In addition, the screening can be conceivably combined with genetic engineering to create knockout and reporter constructs for functional studies.

  4. Molecular cloning of a seed specific multifunctional RFO synthase/ galactosylhydrolase in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Roman eGangl


    Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.

  5. T-cell clones from Th1, Th17 or Th1/17 lineages and their signature cytokines have different capacity to activate endothelial cells or synoviocytes. (United States)

    Lavocat, Fabien; Maggi, Laura; Annunziato, Francesco; Miossec, Pierre


    To compare the direct effect of cytokines on synoviocytes and endothelial cells to the effects of supernatants from Th1, Th17 and Th1/17 clones and the direct cell-cell interactions with the same clones. Th17 and Th1/17 clones were obtained from the CD161+CCR6+ fraction and Th1 clones from the CD161-CCR6- fraction of human CD4+ T-cells. Endothelial cells or synoviocytes were cultured in the presence of either isolated pro-inflammatory cytokines (IL-17 and/or TNF-α) or supernatants from the T-cell clones or co-cultured with T-cell clones themselves. IL-6 and IL-8 expression and production were analyzed. IL-17 and TNF-α induced IL-6 and IL-8 expression, although IL-17 alone had a limited effect on endothelial cells compared to synoviocytes. Supernatants from activated T-helper clones also induced IL-6 and IL-8 expression but with discrepancies between endothelial cells and synoviocytes. Endothelial cells were mostly activated by Th1 clone supernatants whereas synoviocytes were activated by all T-cell subtypes. Finally, cell-cell contact experiments showed a great heterogeneity among cell clones, even from the same lineage. IL-6 expression was mostly induced by contact with Th1 clones both in endothelial and mesenchymal cells whereas IL-8 expression was induced by all T-cell clones whatever their phenotype. We showed that endothelial cells were much more sensitive to Th1 activation whereas synoviocytes were activated by all T-helper lineages. This work highlights the heterogeneity of interactions between T-cells and stromal cells through soluble factors or direct cell contact. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Feedback regulation of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 via ATM/Chk2 pathway contributes to the resistance of MCF-7 breast cancer cells to cisplatin. (United States)

    Lv, Juan; Qian, Ying; Ni, Xiaoyan; Xu, Xiuping; Dong, Xuejun


    The methyl methanesulfonate and ultraviolet-sensitive gene clone 81 protein is a structure-specific nuclease that plays important roles in DNA replication and repair. Knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 has been found to sensitize cancer cells to chemotherapy. However, the underlying molecular mechanism is not well understood. We found that methyl methanesulfonate and ultraviolet-sensitive gene clone 81 was upregulated and the ATM/Chk2 pathway was activated at the same time when MCF-7 cells were treated with cisplatin. By using lentivirus targeting methyl methanesulfonate and ultraviolet-sensitive gene clone 81 gene, we showed that knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 enhanced cell apoptosis and inhibited cell proliferation in MCF-7 cells under cisplatin treatment. Abrogation of ATM/Chk2 pathway inhibited cell viability in MCF-7 cells in response to cisplatin. Importantly, we revealed that ATM/Chk2 was required for the upregulation of methyl methanesulfonate and ultraviolet-sensitive gene clone 81, and knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 resulted in inactivation of ATM/Chk2 pathway in response to cisplatin. Meanwhile, knockdown of methyl methanesulfonate and ultraviolet-sensitive gene clone 81 activated the p53/Bcl-2 pathway in response to cisplatin. These data suggest that the ATM/Chk2 may promote the repair of DNA damage caused by cisplatin by sustaining methyl methanesulfonate and ultraviolet-sensitive gene clone 81, and the double-strand breaks generated by methyl methanesulfonate and ultraviolet-sensitive gene clone 81 may activate the ATM/Chk2 pathway in turn, which provide a novel mechanism of how methyl methanesulfonate and ultraviolet-sensitive gene clone 81 modulates DNA damage response and repair.

  7. DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

    International Nuclear Information System (INIS)

    Schmid, D.S.; Tite, J.P.; Ruddle, N.H.


    A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

  8. Novel Technology for Cloning Prostate Cancer Cell Markers

    National Research Council Canada - National Science Library

    Bancroft, F


    The purpose of the project is to employ probes isolated from the LNCaP series of human prostate cancer cells, to probe human cDNA microarrays, so as to investigate genes differentially expressed among these cell lines...

  9. Immortalization of human myogenic progenitor cell clone retaining multipotentiality

    International Nuclear Information System (INIS)

    Hashimoto, Naohiro; Kiyono, Tohru; Wada, Michiko R.; Shimizu, Shirabe; Yasumoto, Shigeru; Inagawa, Masayo


    Human myogenic cells have limited ability to proliferate in culture. Although forced expression of telomerase can immortalize some cell types, telomerase alone delays senescence of human primary cultured myogenic cells, but fails to immortalize them. In contrast, constitutive expression of both telomerase and the E7 gene from human papillomavirus type 16 immortalizes primary human myogenic cells. We have established an immortalized primary human myogenic cell line preserving multipotentiality by ectopic expression of telomerase and E7. The immortalized human myogenic cells exhibit the phenotypic characteristics of their primary parent, including an ability to undergo myogenic, osteogenic, and adipogenic terminal differentiation under appropriate culture conditions. The immortalized cells will be useful for both basic and applied studies aimed at human muscle disorders. Furthermore, immortalization by transduction of telomerase and E7 represents a useful method by which to expand human myogenic cells in vitro without compromising their ability to differentiate

  10. Cloning endangered gray wolves (Canis lupus) from somatic cells collected postmortem. (United States)

    Oh, H J; Kim, M K; Jang, G; Kim, H J; Hong, S G; Park, J E; Park, K; Park, C; Sohn, S H; Kim, D Y; Shin, N S; Lee, B C


    The objective of the present study was to investigate whether nuclear transfer of postmortem wolf somatic cells into enucleated dog oocytes, is a feasible method to produce a cloned wolf. In vivo-matured oocytes (from domestic dogs) were enucleated and fused with somatic cells derived from culture of tissue obtained from a male gray wolf 6h after death. The reconstructed embryos were activated and transferred into the oviducts of naturally synchronous domestic bitches. Overall, 372 reconstructed embryos were transferred to 17 recipient dogs; four recipients (23.5%) were confirmed pregnant (ultrasonographically) 23-25 d after embryo transfer. One recipient spontaneously delivered two dead pups and three recipients delivered, by cesarean section, four cloned wolf pups, weighing 450, 190, 300, and 490g, respectively. The pup that weighed 190g died within 12h after birth. The six cloned wolf pups were genetically identical to the donor wolf, and their mitochondrial DNA originated from the oocyte donors. The three live wolf pups had a normal wolf karyotype (78, XY), and the amount of telomeric DNA, assessed by quantitative fluorescence in situ hybridization, was similar to, or lower than, that of the nuclear donor. In conclusion, the present study demonstrated the successful cloning of an endangered male gray wolf via interspecies transfer of somatic cells, isolated postmortem from a wolf, and transferred into enucleated dog oocytes. Therefore, somatic cell nuclear transfer has potential for preservation of canine species in extreme situations, including sudden death.

  11. Cloning, Stem Cells, and the Current National Debate: Incorporating Ethics into a Large Introductory Biology Course (United States)

    Fink, Rachel D.


    Discussing the ethical issues involved in topics such as cloning and stem cell research in a large introductory biology course is often difficult. Teachers may be wary of presenting material biased by personal beliefs, and students often feel inhibited speaking about moral issues in a large group. Yet, to ignore what is happening "out there"…

  12. Future issues in transplantation ethics: ethical and legal controversies in xenotransplantation, stem cell, and cloning research. (United States)

    Shapiro, Robyn S


    With little prospect of developing a sufficient supply of human transplantable organs to meet the large and growing demand, attention has turned to xenotransplantation, as well as stem cell and cloning research, as possible approaches for alleviating this allograft shortage. This article explores ethical and legal issues that surround developments in these fields.

  13. Purification, cDNA Cloning, and Developmental Expression of the Nodule-Specific Uricase from Phaseolus vulgaris L. 1 (United States)

    Sánchez, Federico; Campos, Francisco; Padilla, Jaime; Bonneville, Jean-Marc; Enríquez, Consuelo; Caput, Daniel


    Nodule-specific uricase (uricase II) from Phaseolus vulgaris L. was purified to homogeneity by chromatographic methods. Purification data indicated that uricase II is approximately 2% of the total soluble protein from mature nodules. Specific antiserum was raised and used to determine the developmental expression and for immunoselection of polysomes. Uricase II was antigenically detected early in nodule development, 2 to 3 days before nitrogen fixation. Uricase-encoding cDNA clones were isolated by hybridizing a nodule-specific pUC9 cDNA library with labeled mRNA from immunoselected polysomes and a 35,000 molecular weight uricase II-encoding cDNA from soybean. An homologous clone (pNF-UR07) was used to assess the expression pattern of the specific transcript during development. Northern-blot analysis indicated that uricase II mRNA is exclusively expressed in nodule tissue. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:16665575

  14. Improvement of cloning efficiency in minipigs using post-thawed donor cells treated with roscovitine. (United States)

    Hwang, Seongsoo; Oh, Keon Bong; Kwon, Dae-Jin; Ock, Sun-A; Lee, Jeong-Woong; Im, Gi-Sun; Lee, Sung-Soo; Lee, Kichoon; Park, Jin-Ki


    Massachusetts General Hospital miniature pigs (MGH minipigs) have been established for organ transplantation studies across the homozygous major histocompatibility complex, but cloning efficiency of MGH minipigs is extremely low. This study was designed to increase the productivity of MGH minipigs by nuclear transfer of post-thaw donor cells after 1 h co-incubation with roscovitine. The MGH minipig cells were genetically modified with GT KO (alpha1,3-galactosyltransferase knock-out) and hCD46 KI (human CD46 knock-in) and used as donor cells. The GT KO/hCD46 KI donor cells were cultured for either 3 days (control group) or 1 h after thawing with 15 μM roscovitine (experimental group) prior to the nuclear transfer. The relative percentage of the transgenic donor cells that entered into G0/G1 was 93.7 % (±2.54). This was different from the donor cells cultured for 1 h with the roscovitine-treated group (84.6 % ±4.6) (P cloning efficiency ranged from 0.74 to 2.54 %. In conclusion, gene-modified donor cells can be used for cloning of MGH minipigs if the cells are post-thawed and treated with roscovitine for 1 h prior to nuclear transfer.

  15. Chimeric antigen receptor (CAR-specific monoclonal antibody to detect CD19-specific T cells in clinical trials.

    Directory of Open Access Journals (Sweden)

    Bipulendu Jena

    Full Text Available Clinical trials targeting CD19 on B-cell malignancies are underway with encouraging anti-tumor responses. Most infuse T cells genetically modified to express a chimeric antigen receptor (CAR with specificity derived from the scFv region of a CD19-specific mouse monoclonal antibody (mAb, clone FMC63. We describe a novel anti-idiotype monoclonal antibody (mAb to detect CD19-specific CAR(+ T cells before and after their adoptive transfer. This mouse mAb was generated by immunizing with a cellular vaccine expressing the antigen-recognition domain of FMC63. The specificity of the mAb (clone no. 136.20.1 was confined to the scFv region of the CAR as validated by inhibiting CAR-dependent lysis of CD19(+ tumor targets. This clone can be used to detect CD19-specific CAR(+ T cells in peripheral blood mononuclear cells at a sensitivity of 1∶1,000. In clinical settings the mAb is used to inform on the immunophenotype and persistence of administered CD19-specific T cells. Thus, our CD19-specific CAR mAb (clone no. 136.20.1 will be useful to investigators implementing CD19-specific CAR(+ T cells to treat B-lineage malignancies. The methodology described to develop a CAR-specific anti-idiotypic mAb could be extended to other gene therapy trials targeting different tumor associated antigens in the context of CAR-based adoptive T-cell therapy.

  16. Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression. (United States)

    Nocarova, Eva; Fischer, Lukas


    Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with

  17. Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

    International Nuclear Information System (INIS)

    Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.; Yankovskii, N.K.; Debabov, V.G.


    Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector λpSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB + clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA + transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmids consistently transduced the markers thrB + and lysA + . The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes

  18. Development to term of cloned cattle derived from donor cells treated with valproic acid.

    Directory of Open Access Journals (Sweden)

    Juliano Rodrigues Sangalli

    Full Text Available Cloning of mammals by somatic cell nuclear transfer (SCNT is still plagued by low efficiency. The epigenetic modifications established during cellular differentiation are a major factor determining this low efficiency as they act as epigenetic barriers restricting reprogramming of somatic nuclei. In this regard, most factors that promote chromatin decondensation, including histone deacetylase inhibitors (HDACis, have been found to increase nuclear reprogramming efficiency, making their use common to improve SCNT rates. Herein we used valproic acid (VPA in SCNT to test whether the treatment of nuclear donor cells with this HDACi improves pre- and post-implantation development of cloned cattle. We found that the treatment of fibroblasts with VPA increased histone acetylation without affecting DNA methylation. Moreover, the treatment with VPA resulted in increased expression of IGF2R and PPARGC1A, but not of POU5F1. However, when treated cells were used as nuclear donors no difference of histone acetylation was found after oocyte reconstruction compared to the use of untreated cells. Moreover, shortly after artificial activation the histone acetylation levels were decreased in the embryos produced with VPA-treated cells. With respect to developmental rates, the use of treated cells as donors resulted in no difference during pre- and post-implantation development. In total, five clones developed to term; three produced with untreated cells and two with VPA-treated cells. Among the calves from treated group, one stillborn calf was delivered at day 270 of gestation whereas the other one was delivered at term but died shortly after birth. Among the calves from the control group, one died seven days after birth whereas the other two are still alive and healthy. Altogether, these results show that in spite of the alterations in fibroblasts resulting from the treatment with VPA, their use as donor cells in SCNT did not improve pre- and post

  19. Growth of single T cells and single thymocytes in a high cloning efficiency filler-cell free microculture system. (United States)

    Chen, W F; Ewing, T; Scollay, R; Shortman, K


    A high cloning-efficiency microculture system is described in which single T cells, stimulated to divide by phorbol ester and calcium ionophore, grow rapidly under the influence of purified growth factors in the absence of other cells. The kinetics of clonal growth has been monitored over a five day period by phase-contrast microscopy. Mature peripheral T cells, and mature subpopulations from the thymus, responded with a cloning efficiency over 80%; they required IL-2 as a minimum but several other factors enhanced growth. Ly2+L3T4- thymocytes (mean doubling time 10.4 hr) grew more rapidly than Ly2-L3T4+ thymocytes (mean doubling time 15.2 hr). Early (Ly2-L3T4-) thymocytes responded with a cloning efficiency of 60%; their efficient growth was dependent on both IL-1 and IL-2. The typical Ly2+L3T4+ cortical thymocyte did not grow under these conditions.

  20. Failure of anti-T-cell receptor V beta antibodies to consistently identify a malignant T-cell clone in Sézary syndrome. (United States)

    Bigler, R D; Boselli, C M; Foley, B; Vonderheid, E C


    Monoclonal antibodies (MAbs) reacting with the human T cell receptor (TCR) V beta or V alpha region have been shown to be almost as specific as a private idiotypic MAb in identifying T cell clones. When available, V beta-specific MAbs offer the ease of immunofluorescence analysis to identify and quantitate expanded malignant or nonmalignant T cell populations without requiring polymerase chain reaction (PCR) technology to evaluate expression of V beta gene families. The V beta expression of peripheral blood lymphocytes from twenty-three consecutive patients with Sézary syndrome has been analyzed by reverse transcriptase (RT)-PCR. Ten patients had malignant T cell clones that expressed a TCR V beta corresponding to a commercially available anti-V beta antibody. Immunofluorescence staining with anti-V beta MAbs showed a direct correlation with RT-PCR results in seven of ten patients. No false positive reactivity was noted on immunofluorescence staining with any MAb. Cells from three patients, however, did not react with the corresponding anti-V beta MAb. These three cases expressed a TCR V beta from gene families containing a single member, ie, V beta 14, V beta 18, and V beta 20, yet MAbs reported to be specific for these regions failed to react with the T cell clone from these patients. Sequencing of the PCR product in these cases confirmed the RT-PCR results. Cells from two patients expressed a TCR using V beta 5.1-D beta 1.1 genes with different J-C segments. One patient's cells reacted with an anti-V beta 5.1 MAb (LC4) whereas the other patient's cells bound one-tenth the amount of this same MAb. These results indicate that currently available anti-TCR V region MAbs may not react consistently with T cell clones expressing the corresponding V region or may react with a low affinity making detection difficult. Differences in the J-C junction or in CDR3 may influence the binding of these MAbs. Until the false negative rate is reduced and the fine specificity and

  1. Mammalian mediator 19 mediates H1299 lung adenocarcinoma cell clone conformation, growth, and metastasis. (United States)

    Xu, Lu-Lu; Guo, Shu-Liang; Ma, Su-Ren; Luo, Yong-Ai


    Mammalian mediator (MED) is a multi-protein coactivator that has been identified by several research groups. The involvement of the MED complex subunit 19 (MED 19) in the metastasis of lung adenocarcinoma cell line (H1299), which expresses the MED 19 subunit, was here investigated. When MED 19 expression was decreased by RNA interference H1299 cells demonstrated reduced clone formation, arrest in the S phase of the cell cycle, and lowered metastatic capacity. Thus, MED 19 appears to play important roles in the biological behavior of non-small cell lung carcinoma cells. These findings may be important for the development of novel lung carcinoma treatments.

  2. Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor

    International Nuclear Information System (INIS)

    Pohlmann, R.; Nagel, G.; Schmidt, B.


    Complementary DNA clones for the human cation-dependent mannose 6-phosphate-specific receptor have been isolated from a human placenta library in λgt11. The nucleotide sequence of the 2463-base-pair cDNA insert includes a 145-base-pair 5' untranslated region, an open reading frame of 831 base pairs corresponding to 277 amino acids, and a 1487-base-pair 3' untranslated region. The deduced amino acid sequence is colinear with that determined by amino acid sequencing of the N-terminus peptide (41 residues) and nine tryptic peptides (93 additional residues). The receptor is synthesized as a precursor with a signal peptide of 20 amino acids. The hydrophobicity profile of the receptor indicates a single membrane-spanning domain, which separates an N-terminal region containing five potential N-glycosylation sites from a C-terminal region lacking N-glycosylation sites. Thus the N-terminal (M/sub r/ = 18,299) and C-terminal (M/sub r/ ≤ 7648) segments of the mature receptor are assumed to be exposed to the extracytosolic and cytosolic sides of the membrane, respectively. Analysis of a panel of somatic cell (mouse-human) hybrids shows that the gene for the receptor is located on human chromosome 12

  3. Assessing cell fusion and cytokinesis failure as mechanisms of clone 9 hepatocyte multinucleation in vitro. (United States)

    Simic, Damir; Euler, Catherine; Thurby, Christina; Peden, Mike; Tannehill-Gregg, Sarah; Bunch, Todd; Sanderson, Thomas; Van Vleet, Terry


    In this in vitro model of hepatocyte multinucleation, separate cultures of rat Clone 9 cells are labeled with either red or green cell tracker dyes (Red Cell Tracker CMPTX or Vybrant CFDA SE Cell Tracer), plated together in mixed-color colonies, and treated with positive or negative control agents for 4 days. The fluorescent dyes become cell-impermeant after entering cells and are not transferred to adjacent cells in a population, but are inherited by daughter cells after fusion. The mixed-color cultures are then evaluated microscopically for multinucleation and analysis of the underlying mechanism (cell fusion/cytokinesis). Multinucleated cells containing only one dye have undergone cytokinesis failure, whereas dual-labeled multinucleated cells have resulted from fusion. © 2012 by John Wiley & Sons, Inc.

  4. Molecular cloning of transcripts induced by UV-radiation in rodent cells

    International Nuclear Information System (INIS)

    Fornace, A.J. Jr.; Mitchell, J.B.


    Several inducible DNA repair genes have been well characterized in bacteria. In eukaryotes including mammalian cells, there is increasing evidence that similar events may occur. Recently, the authors have shown that hybridization subtraction can be used to enrich for sequences induced only several fold by a particular cell treatment such as heat shock. Chinese hamster V79 cells were UV-irradiated with 17 Jm/sup -2/ and cDNA was synthesized from the polyadenylated (poly A) RNA. This ''UV'' cDNA was hybridized with a 3 fold excess of polyA RNA from unirradiated cells and the nonhybridizing cDNA was isolated. With this approach, UV-induced sequences were enriched over 20 fold. This enriched cDNA was cloned into a high copy number plasmid and a cDNA library was constructed. By RNA dot blot and northern analysis, 42 clones from this library were found to represent transcripts induced 3 to 25 fold by UV. The most common isolates were found to be metallothionein transcripts by DNA sequencing. The metallothionein transcripts were found to be induced 10 to 25 fold by UV with maximum induction at 4-8 h after 10 Jm/sup -2/. A similar approach was also used with a Chinese hamster ovary line which does not express metallothionein and multiple clones were isolated which represented transcripts induced 3-15 fold by UV. Except for the metallothionein clones, the other Chinese hamster cDNA clones have not been identified, but it is probable that the protein products of at least some of these transcripts play a role in the cellular response to UV damage

  5. Developments in stem cell research and therapeutic cloning: Islamic ethical positions, a review. (United States)

    Fadel, Hossam E


    Stem cell research is very promising. The use of human embryos has been confronted with objections based on ethical and religious positions. The recent production of reprogrammed adult (induced pluripotent) cells does not - in the opinion of scientists - reduce the need to continue human embryonic stem cell research. So the debate continues. Islam always encouraged scientific research, particularly research directed toward finding cures for human disease. Based on the expectation of potential benefits, Islamic teachings permit and support human embryonic stem cell research. The majority of Muslim scholars also support therapeutic cloning. This permissibility is conditional on the use of supernumerary early pre-embryos which are obtained during infertility treatment in vitro fertilization (IVF) clinics. The early pre-embryos are considered in Islamic jurisprudence as worthy of respect but do not have the full sanctity offered to the embryo after implantation in the uterus and especially after ensoulment. In this paper the Islamic positions regarding human embryonic stem cell research and therapeutic cloning are reviewed in some detail, whereas positions in other religious traditions are mentioned only briefly. The status of human embryonic stem cell research and therapeutic cloning in different countries, including the USA and especially in Muslim countries, is discussed. © 2010 Blackwell Publishing Ltd.

  6. Related B cell clones populate the meninges and parenchyma of patients with multiple sclerosis. (United States)

    Lovato, Laura; Willis, Simon N; Rodig, Scott J; Caron, Tyler; Almendinger, Stefany E; Howell, Owain W; Reynolds, Richard; O'Connor, Kevin C; Hafler, David A


    In the central nervous system of patients with multiple sclerosis, B cell aggregates populate the meninges, raising the central question as to whether these structures relate to the B cell infiltrates found in parenchymal lesions or instead, represent a separate central nervous system immune compartment. We characterized the repertoires derived from meningeal B cell aggregates and the corresponding parenchymal infiltrates from brain tissue derived primarily from patients with progressive multiple sclerosis. The majority of expanded antigen-experienced B cell clones derived from meningeal aggregates were also present in the parenchyma. We extended this investigation to include 20 grey matter specimens containing meninges, 26 inflammatory plaques, 19 areas of normal appearing white matter and cerebral spinal fluid. Analysis of 1833 B cell receptor heavy chain variable region sequences demonstrated that antigen-experienced clones were consistently shared among these distinct compartments. This study establishes a relationship between extraparenchymal lymphoid tissue and parenchymal infiltrates and defines the arrangement of B cell clones that populate the central nervous system of patients with multiple sclerosis.

  7. [Cloning of human CD45 gene and its expression in Hela cells]. (United States)

    Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang


    To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

  8. IgE production by normal human B cells induced by alloreactive T cell clones is mediated by IL-4 and suppressed by IFN-gamma

    NARCIS (Netherlands)

    Pène, J.; Rousset, F.; Brière, F.; Chrétien, I.; Paliard, X.; Banchereau, J.; Spits, H.; de Vries, J. E.


    Seven T cell clones were established from mixed leukocyte cultures in which PBMC from two healthy donors and from one patient suffering from the hyper-IgE syndrome were stimulated by the irradiated EBV-transformed B cell lines JY or UD53. Five of seven T cell clones, after activation by

  9. Characterization of a pollen-specific cDNA clone from Nicotiana tabacum expressed during microgametogenesis and germination. (United States)

    Weterings, K; Reijnen, W; van Aarssen, R; Kortstee, A; Spijkers, J; van Herpen, M; Schrauwen, J; Wullems, G


    This report describes the isolation and characterization of a cDNA clone representing a gene specifically expressed in pollen. A cDNA library was constructed against mRNA from mature pollen of Nicotiana tabacum. It was screened differentially against cDNA from mRNA of leaf and of pollen. One clone, NTPc303, was further characterized. On northern blot this clone hybridizes to a transcript 2100 nucleotides in length. NTPc303 is abundant in pollen. Expression of the corresponding gene is restricted to pollen, because no other generative or vegetative tissue contains transcripts hybridizing to NTPc303. Expression of NTP303 is evolutionarily conserved: homologous transcripts are present in pollen from various plant species. The first NTP303 transcripts are detectable on northern blot at the early bi-nucleate stage and accumulate until the pollen has reached maturity. During germination and pollen tube growth in vitro new NTP303 transcripts appear. This transcription has been proved by northern blots as well as by pulse labelling experiments. Nucleotide sequence analysis revealed that NTPc303 has an open reading frame coding for a predicted protein of 62 kDa. This protein shares homology to ascorbate oxidase and other members of the blue copper oxidase family. A possible function for this clone during pollen germination is discussed.

  10. Somatic Cell Nuclear Transfer Followed by CRIPSR/Cas9 Microinjection Results in Highly Efficient Genome Editing in Cloned Pigs

    Directory of Open Access Journals (Sweden)

    Timothy P. Sheets


    Full Text Available The domestic pig is an ideal “dual purpose” animal model for agricultural and biomedical research. With the availability of genome editing tools such as clustered regularly interspaced short palindromic repeat (CRISPR and associated nuclease Cas9 (CRISPR/Cas9, it is now possible to perform site-specific alterations with relative ease, and will likely help realize the potential of this valuable model. In this article, we investigated for the first time a combination of somatic cell nuclear transfer (SCNT and direct injection of CRISPR/Cas ribonucleoprotein complex targeting GRB10 into the reconstituted oocytes to generate GRB10 ablated Ossabaw fetuses. This strategy resulted in highly efficient (100% generation of biallelic modifications in cloned fetuses. By combining SCNT with CRISPR/Cas9 microinjection, genome edited animals can now be produced without the need to manage a founder herd, while simultaneously eliminating the need for laborious in vitro culture and screening. Our approach utilizes standard cloning techniques while simultaneously performing genome editing in the cloned zygotes of a large animal model for agriculture and biomedical applications.

  11. Cellular function reinstitution of offspring red blood cells cloned from the sickle cell disease patient blood post CRISPR genome editing

    Directory of Open Access Journals (Sweden)

    Jianguo Wen


    Full Text Available Abstract Background Sickle cell disease (SCD is a disorder of red blood cells (RBCs expressing abnormal hemoglobin-S (HbS due to genetic inheritance of homologous HbS gene. However, people with the sickle cell trait (SCT carry a single allele of HbS and do not usually suffer from SCD symptoms, thus providing a rationale to treat SCD. Methods To validate gene therapy potential, hematopoietic stem cells were isolated from the SCD patient blood and treated with CRISPR/Cas9 approach. To precisely dissect genome-editing effects, erythroid progenitor cells were cloned from single colonies of CRISPR-treated cells and then expanded for simultaneous gene, protein, and cellular function studies. Results Genotyping and sequencing analysis revealed that the genome-edited erythroid progenitor colonies were converted to SCT genotype from SCD genotype. HPLC protein assays confirmed reinstallation of normal hemoglobin at a similar level with HbS in the cloned genome-edited erythroid progenitor cells. For cell function evaluation, in vitro RBC differentiation of the cloned erythroid progenitor cells was induced. As expected, cell sickling assays indicated function reinstitution of the genome-edited offspring SCD RBCs, which became more resistant to sickling under hypoxia condition. Conclusions This study is an exploration of genome editing of SCD HSPCs.

  12. A versatile system for USER cloning-based assembly of expression vectors for mammalian cell engineering.

    Directory of Open Access Journals (Sweden)

    Anne Mathilde Lund

    Full Text Available A new versatile mammalian vector system for protein production, cell biology analyses, and cell factory engineering was developed. The vector system applies the ligation-free uracil-excision based technique--USER cloning--to rapidly construct mammalian expression vectors of multiple DNA fragments and with maximum flexibility, both for choice of vector backbone and cargo. The vector system includes a set of basic vectors and a toolbox containing a multitude of DNA building blocks including promoters, terminators, selectable marker- and reporter genes, and sequences encoding an internal ribosome entry site, cellular localization signals and epitope- and purification tags. Building blocks in the toolbox can be easily combined as they contain defined and tested Flexible Assembly Sequence Tags, FASTs. USER cloning with FASTs allows rapid swaps of gene, promoter or selection marker in existing plasmids and simple construction of vectors encoding proteins, which are fused to fluorescence-, purification-, localization-, or epitope tags. The mammalian expression vector assembly platform currently allows for the assembly of up to seven fragments in a single cloning step with correct directionality and with a cloning efficiency above 90%. The functionality of basic vectors for FAST assembly was tested and validated by transient expression of fluorescent model proteins in CHO, U-2-OS and HEK293 cell lines. In this test, we included many of the most common vector elements for heterologous gene expression in mammalian cells, in addition the system is fully extendable by other users. The vector system is designed to facilitate high-throughput genome-scale studies of mammalian cells, such as the newly sequenced CHO cell lines, through the ability to rapidly generate high-fidelity assembly of customizable gene expression vectors.

  13. Development of high-throughput phenotyping of metagenomic clones from the human gut microbiome for modulation of eukaryotic cell growth. (United States)

    Gloux, Karine; Leclerc, Marion; Iliozer, Harout; L'Haridon, René; Manichanh, Chaysavanh; Corthier, Gérard; Nalin, Renaud; Blottière, Hervé M; Doré, Joël


    Metagenomic libraries derived from human intestinal microbiota (20,725 clones) were screened for epithelial cell growth modulation. Modulatory clones belonging to the four phyla represented among the metagenomic libraries were identified (hit rate, 0.04 to 8.7% depending on the screening cutoff). Several candidate loci were identified by transposon mutagenesis and subcloning.

  14. Protein-free transfection of CHO host cells with an IgG-fusion protein: selection and characterization of stable high producers and comparison to conventionally transfected clones. (United States)

    Lattenmayer, Christine; Loeschel, Martina; Schriebl, Kornelia; Steinfellner, Willibald; Sterovsky, Thomas; Trummer, Evelyn; Vorauer-Uhl, Karola; Müller, Dethardt; Katinger, Hermann; Kunert, Renate


    In order to improve the current techniques of cell cultivation in the absence of serum, we have developed a protein-free transfection protocol for CHO cells, based on the Nucleofector technology. After starting with a heterogeneous pool of primary transfectants which express the fusion protein EpoFc, we isolated single clones and compared them with parallel clones generated by lipofection in serum-dependent cultivation. Our intensive characterization program was based on determination of specific productivity (q(p)) and analysis of genetic parameters. In two nucleofection experiments, transfection with 5 microg of DNA resulted in best productivities of the primary cell pools. After subcloning, the q(p) could be raised up to 27 pg x cells(-1) x day(-1). While the serum-dependent transfectants exhibited specific productivities up to 57 pg x cells(-1) x day(-1) in serum-dependent cultivation, a significant decrease that resulted in the range of q(p) of the protein-free transfectants was observed after switching to protein-free conditions. Investigation of genetic parameters revealed higher mRNA levels and gene copy numbers (GCN) for the protein-free adapted serum-dependent transfectants. Therefore, we assume that problems during protein-free adaptation (PFA) lead to a less efficient translation machinery after serum deprivation. We describe the generation of stable-producing recombinant CHO clones by protein-free transfection of a protein-free adapted host cell line, which reduces the risk of adverse clonal changes after PFA. The main advantage of this approach is the earlier predictability of clone behavior, which makes the generation of production clones by protein-free transfection, a viable and highly efficient strategy for recombinant cell line development. (c) 2006 Wiley Periodicals, Inc.

  15. [Cloning goat producing human lactoferrin with genetically modified donor cells selected by single or dual markers]. (United States)

    An, Liyou; Yuan, Yuguo; Yu, Baoli; Yang, Tingjia; Cheng, Yong


    We compared the efficiency of cloning goat using human lactoferrin (hLF) with genetically modified donor cells marked by single (Neo(r)) or double (Neo(r)/GFP) markers. Single marker expression vector (pBLC14) or dual markers expression vector (pAPLM) was delivered to goat fetal fibroblasts (GFF), and then the transgenic GFF was used as donor cells to produce transgenic goats. Respectively, 58.8% (20/34) and 86.7% (26/30) resistant cell lines confirmed the transgenic integration by PCR. Moreover, pAPLM cells lines were subcultured with several passages, only 20% (6/30) cell lines was observed fluorescence from each cell during the cell passage. Somatic cell nuclear transfer using the donor cells harbouring pBLC14 or pAPLM construct, resulting in a total of 806 reconstructed embryos, a pregnancy rate at 35 d (53.8%, 39.1%) and 60 d (26.9%, 21.7%), and an offspring birth rate (1.9%, 1.4%) with 5 and 7 newborn cloned goats, respectively. Transgene was confirmed by PCR and southern-blot in all cloned offspring. There were no significant differences at the reconstructed embryo fusion rates, pregnancy rates and the birth rate (P > 0.05) between single and double markers groups. The Neo(r)/GFP double markers could improve the reliability for accurately and efficiently selecting the genetically modified donor cells. No adverse effect was observed on the efficiency of transgenic goat production by SCNT using somatic cells transfected with double (Neo(r)/GFP) markers vector.

  16. Whole-organism clone tracing using single-cell sequencing

    NARCIS (Netherlands)

    Alemany, Anna; Florescu, Maria; Baron, Chloé S; Peterson-Maduro, Josi; van Oudenaarden, Alexander


    Embryonic development is a crucial period in the life of a multicellular organism, during which limited sets of embryonic progenitors produce all cells in the adult body. Determining which fate these progenitors acquire in adult tissues requires the simultaneous measurement of clonal history and

  17. Equivalency of Buffalo (Bubalus Bubalis) Embryonic Stem Cells Derived From Fertilized, Parthenogenetic, and Hand-Made Cloned Embryos (United States)

    Muzaffar, Musharifa; Selokar, Naresh L.; Singh, Karn P.; Zandi, Mohammad; Singh, Manoj K.; Shah, Riaz A.; Chauhan, Manmohan S.; Singla, Suresh K.; Palta, Prabhat


    Abstract This study was aimed at establishing buffalo embryonic stem cells (ESCs) from in vitro fertilized (IVF), parthenogenetic, and hand-made cloned (HMC) embryos and to check their equivalency in terms of stem cell marker expression, longevity, proliferation, and differentiation pattern. ESCs derived from all three sources were found by immunofluorescence to express the pluripotency markers SSEA-4, TRA-1-60, TRA-1-81, OCT4, and SOX2 and were able to form embryoid bodies containing cells expressing genes specific to endoderm (AFP, HNF4, and GATA4), mesoderm (MSX1, BMP4, and ASA), and ectoderm (cytokeratin 8 and NF68). Reverse transcriptase PCR (RT-PCR) showed cells from all sources to be positive for pluripotency markers OCT4, SOX2, NANOG, STAT3, REX1, FOXD3, NUCLEOSTEMIN, and TELOMERASE. Pluripotency markers OCT4, SOX2, NANOG, and c-MYC were also analyzed by real-time PCR. No significant differences were observed among ESCs from all three sources for all these genes except NANOG, whose expression was higher (pcells (1.603±0.315 and 1±0, respectively). Pluripotent, stable buffalo ESC lines derived from IVF, parthenogenesis, and HMC embryos may be genetically manipulated to provide a powerful tool for studies involving embryonic development, genomic imprinting, gene targeting, cloning, chimera formation, and transgenic animal production. PMID:22582863

  18. Human therapeutic cloning (NTSC): applying research from mammalian reproductive cloning. (United States)

    French, Andrew J; Wood, Samuel H; Trounson, Alan O


    Human therapeutic cloning or nuclear transfer stem cells (NTSC) to produce patient-specific stem cells, holds considerable promise in the field of regenerative medicine. The recent withdrawal of the only scientific publications claiming the successful generation of NTSC lines afford an opportunity to review the available research in mammalian reproductive somatic cell nuclear transfer (SCNT) with the goal of progressing human NTSC. The process of SCNT is prone to epigenetic abnormalities that contribute to very low success rates. Although there are high mortality rates in some species of cloned animals, most surviving clones have been shown to have normal phenotypic and physiological characteristics and to produce healthy offspring. This technology has been applied to an increasing number of mammals for utility in research, agriculture, conservation, and biomedicine. In contrast, attempts at SCNT to produce human embryonic stem cells (hESCs) have been disappointing. Only one group has published reliable evidence of success in deriving a cloned human blastocyst, using an undifferentiated hESC donor cell, and it failed to develop into a hESC line. When optimal conditions are present, it appears that in vitro development of cloned and parthenogenetic embryos, both of which may be utilized to produce hESCs, may be similar to in vitro fertilized embryos. The derivation of ESC lines from cloned embryos is substantially more efficient than the production of viable offspring. This review summarizes developments in mammalian reproductive cloning, cell-to-cell fusion alternatives, and strategies for oocyte procurement that may provide important clues facilitating progress in human therapeutic cloning leading to the successful application of cell-based therapies utilizing autologous hESC lines.

  19. Structure and organ specificity of an anionic peroxidase from Arabidopsis thaliana cell suspension culture

    DEFF Research Database (Denmark)

    Ostergaard, L; Abelskov, A K; Mattsson, O


    The predominant peroxidase (pI 3.5) (E.C. of an Arabidopsis thaliana cell suspension culture was purified and partially sequenced. Oligonucleotides were designed and a specific probe was obtained. A cDNA clone was isolated from an Arabidopsis cell suspension cDNA library and completely ...

  20. [Out of natural order: nature in discourses about cloning and stem cell research in Brazilian newspapers]. (United States)

    Medeiros, Flavia Natércia da Silva


    Different conceptions of nature influence media coverage and public opinion about biotechnology. This study reports on a discourse analysis of the ideas about nature and what is natural expressed in Brazilian media coverage of cloning and stem cell research. In the discourse against this research, the biotechnologies in question are placed outside the natural order of things and deemed immoral. In the discourse of those who defend it, nature is portrayed as indifferent to the fate of humans or even cruel, or else a barrier to be overcome, while cloning and embryonic stem cells are naturalized and Dolly the sheep is anthropomorphized. The mythifying or transcendental representations of nature do not just influence public opinion, but also have ethical and political implications.

  1. Attempt at cloning high-quality goldfish breed 'Ranchu' by fin-cultured cell nuclear transplantation. (United States)

    Tanaka, Daisuke; Takahashi, Akito; Takai, Akinori; Ohta, Hiromi; Ueno, Koichi


    The viability of ornamental fish culture relies on the maintenance of high-quality breeds. To improve the profitability of culture operations we attempted to produce cloned fish from the somatic nucleus of the high-quality Japanese goldfish (Carassius auratus auratus) breed 'Ranchu'. We transplanted the nucleus of a cultured fin-cell from an adult Ranchu into the non-enucleated egg of the original goldfish breed 'Wakin'. Of the 2323 eggs we treated, 802 underwent cleavage, 321 reached the blastula stage, and 51 reached the gastrula stage. Two of the gastrulas developed until the hatching stage. A considerable number of nuclear transplants retained only the donor nucleus. Some of these had only a 2n nucleus derived from the same donor fish. Our results provide insights into the process of somatic cell nuclear transplantation in teleosts, and the cloning of Ranchu.

  2. In silico cloning and B/T cell epitope prediction of triosephosphate isomerase from Echinococcus granulosus. (United States)

    Wang, Fen; Ye, Bin


    Cystic echinococcosis is a worldwide zoonosis caused by Echinococcus granulosus. Because the methods of diagnosis and treatment for cystic echinococcosis were limited, it is still necessary to screen target proteins for the development of new anti-hydatidosis vaccine. In this study, the triosephosphate isomerase gene of E. granulosus was in silico cloned. The B cell and T cell epitopes were predicted by bioinformatics methods. The cDNA sequence of EgTIM was composition of 1094 base pairs, with an open reading frame of 753 base pairs. The deduced amino acid sequences were composed of 250 amino acids. Five cross-reactive epitopes, locating on 21aa-35aa, 43aa-57aa, 94aa-107aa, 115-129aa, and 164aa-183aa, could be expected to serve as candidate epitopes in the development of vaccine against E. granulosus. These results could provide bases for gene cloning, recombinant expression, and the designation of anti-hydatidosis vaccine.

  3. Somatic donor cell type correlates with embryonic, but not extra-embryonic, gene expression in postimplantation cloned embryos.

    Directory of Open Access Journals (Sweden)

    Ryutaro Hirasawa

    Full Text Available The great majority of embryos generated by somatic cell nuclear transfer (SCNT display defined abnormal phenotypes after implantation, such as an increased likelihood of death and abnormal placentation. To gain better insight into the underlying mechanisms, we analyzed genome-wide gene expression profiles of day 6.5 postimplantation mouse embryos cloned from three different cell types (cumulus cells, neonatal Sertoli cells and fibroblasts. The embryos retrieved from the uteri were separated into embryonic (epiblast and extraembryonic (extraembryonic ectoderm and ectoplacental cone tissues and were subjected to gene microarray analysis. Genotype- and sex-matched embryos produced by in vitro fertilization were used as controls. Principal component analysis revealed that whereas the gene expression patterns in the embryonic tissues varied according to the donor cell type, those in extraembryonic tissues were relatively consistent across all groups. Within each group, the embryonic tissues had more differentially expressed genes (DEGs (>2-fold vs. controls than did the extraembryonic tissues (P<1.0 × 10(-26. In the embryonic tissues, one of the common abnormalities was upregulation of Dlk1, a paternally imprinted gene. This might be a potential cause of the occasional placenta-only conceptuses seen in SCNT-generated mouse embryos (1-5% per embryos transferred in our laboratory, because dysregulation of the same gene is known to cause developmental failure of embryos derived from induced pluripotent stem cells. There were also some DEGs in the extraembryonic tissues, which might explain the poor development of SCNT-derived placentas at early stages. These findings suggest that SCNT affects the embryonic and extraembryonic development differentially and might cause further deterioration in the embryonic lineage in a donor cell-specific manner. This could explain donor cell-dependent variations in cloning efficiency using SCNT.

  4. Establishment of a vascular endothelial cell-reactive type II NKT cell clone from a rat model of autoimmune vasculitis. (United States)

    Iinuma, Chihiro; Waki, Masashi; Kawakami, Ai; Yamaguchi, Madoka; Tomaru, Utano; Sasaki, Naomi; Masuda, Sakiko; Matsui, Yuki; Iwasaki, Sari; Baba, Tomohisa; Kasahara, Masanori; Yoshiki, Takashi; Paletta, Daniel; Herrmann, Thomas; Ishizu, Akihiro


    We previously generated a rat model that spontaneously developed small vessel vasculitis (SVV). In this study, a T cell clone reactive with rat vascular endothelial cells (REC) was established and named VASC-1. Intravenous injection of VASC-1 induced SVV in normal recipients. VASC-1 was a TCRαβ/CD3-positive CD4/CD8 double-negative T cell clone with expression of NKG2D. The cytokine mRNA profile under unstimulated condition was positive for IL-4 and IFN-γ but negative for IL-2 and IL-10. After interaction with REC, the mRNA expression of IL-2, IL-5 and IL-6 was induced in VASC-1, which was inhibited by blocking of CD1d on the REC surface. Although the protein levels of these cytokines seemed to be lower than the detection limit in the culture medium, IFN-γ was detectable. The production of IFN-γ from the VASC-1 stimulated with LPS-pre-treated REC was inhibited by the CD1d blockade on the REC. These findings indicated VASC-1 as an NKT cell clone. The NKT cell pool includes two major subsets, namely types I and II. Type I NKT cells are characterized by expression of semi-invariant TCRs and the potential to bind to marine sponge-derived α-galactosylceramide (α-GalCer) loaded on CD1d; whereas, type II NKT cells do not manifest these characteristics. VASC-1 exhibited a usage of TCR other than the type I invariant TCR α chain and did not bind to α-GalCer-loaded CD1d; therefore, it was determined as a type II NKT cell clone. The collective evidence suggested that REC-reactive type II NKT cells could be involved in the pathogenesis of SVV in rats. © The Japanese Society for Immunology. 2014. All rights reserved. For permissions, please e-mail:

  5. Histone deacetylase inhibitor significantly improved the cloning efficiency of porcine somatic cell nuclear transfer embryos. (United States)

    Huang, Yongye; Tang, Xiaochun; Xie, Wanhua; Zhou, Yan; Li, Dong; Yao, Chaogang; Zhou, Yang; Zhu, Jianguo; Lai, Liangxue; Ouyang, Hongsheng; Pang, Daxin


    Valproic acid (VPA), a histone deacetylase inbibitor, has been shown to generate inducible pluripotent stem (iPS) cells from mouse and human fibroblasts with a significant higher efficiency. Because successful cloning by somatic cell nuclear transfer (SCNT) undergoes a full reprogramming process in which the epigenetic state of a differentiated donor nuclear is converted into an embryonic totipotent state, we speculated that VPA would be useful in promoting cloning efficiency. Therefore, in the present study, we examined whether VPA can promote the developmental competence of SCNT embryos by improving the reprogramming state of donor nucleus. Here we report that 1 mM VPA for 14 to 16 h following activation significantly increased the rate of blastocyst formation of porcine SCNT embryos constructed from Landrace fetal fibroblast cells compared to the control (31.8 vs. 11.4%). However, we found that the acetylation level of Histone H3 lysine 14 and Histone H4 lysine 5 and expression level of Oct4, Sox2, and Klf4 was not significantly changed between VPA-treated and -untreated groups at the blastocyst stage. The SCNT embryos were transferred to 38 surrogates, and the cloning efficiency in the treated group was significantly improved compared with the control group. Taken together, we have demonstrated that VPA can improve both in vitro and in vivo development competence of porcine SCNT embryos.

  6. Semiallogenic fusions of MSI+ tumor cells and activated B cells induce MSI-specific T cell responses

    International Nuclear Information System (INIS)

    Garbe, Yvette; Klier, Ulrike; Linnebacher, Michael


    Various strategies have been developed to transfer tumor-specific antigens into antigen presenting cells in order to induce cytotoxic T cell responses against tumor cells. One approach uses cellular vaccines based on fusions of autologous antigen presenting cells and allogeneic tumor cells. The fusion cells combine antigenicity of the tumor cell with optimal immunostimulatory capacity of the antigen presenting cells. Microsatellite instability caused by mutational inactivation of DNA mismatch repair genes results in translational frameshifts when affecting coding regions. It has been shown by us and others that these mutant proteins lead to the presentation of immunogenic frameshift peptides that are - in principle - recognized by a multiplicity of effector T cells. We chose microsatellite instability-induced frameshift antigens as ideal to test for induction of tumor specific T cell responses by semiallogenic fusions of microsatellite instable carcinoma cells with CD40-activated B cells. Two fusion clones of HCT116 with activated B cells were selected for stimulation of T cells autologous to the B cell fusion partner. Outgrowing T cells were phenotyped and tested in functional assays. The fusion clones expressed frameshift antigens as well as high amounts of MHC and costimulatory molecules. Autologous T cells stimulated with these fusions were predominantly CD4 + , activated, and reacted specifically against the fusion clones and also against the tumor cell fusion partner. Interestingly, a response toward 6 frameshift-derived peptides (of 14 tested) could be observed. Cellular fusions of MSI + carcinoma cells and activated B cells combine the antigen-presenting capacity of the B cell with the antigenic repertoire of the carcinoma cell. They present frameshift-derived peptides and can induce specific and fully functional T cells recognizing not only fusion cells but also the carcinoma cells. These hybrid cells may have great potential for cellular immunotherapy and

  7. Improvement of mouse cloning using nuclear transfer-derived embryonic stem cells and/or histone deacetylase inhibitor. (United States)

    Wakayama, Sayaka; Wakayama, Teruhiko


    Nuclear transfer-derived ES (ntES) cell lines can be established from somatic cell nuclei with a relatively high success rate. Although ntES cells have been shown to be equivalent to ES cells, there are ethical objections concerning human cells, such as the use of fresh oocyte donation from young healthy woman. In contrast, the use of induced pluripotent stem (iPS) cells for cloning poses few ethical problems and is a relatively easy technique compared with nuclear transfer. Therefore, although there are several reports proposing the use of ntES cells as a model of regenerative medicine, the use of these cells in preliminary medical research is waning. However, in theory, 5 to 10 donor cells can establish one ntES cell line and, once established, these cells will propagate indefinitely. These cells can be used to generate cloned animals from ntES cell lines using a second round of NT. Even in infertile and "unclonable" strains of mice, we can generate offspring from somatic cells by combining cloning with ntES technology. Moreover, cloned offspring can be generated potentially even from the nuclei of dead bodies or freeze-dried cells via ntES cells, such as from an extinct frozen animal. Currently, only the ntES technology is available for this purpose, because all other techniques, including iPS cell derivation, require significant numbers of living donor cells. This review describes how to improve the efficiency of cloning, the establishment of clone-derived embryonic stem cells and further applications.

  8. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.


    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

  9. [Distribution of abnormal cell clone with deletion of chromosome 20q in marrow cell lineages and apoptosis cells in myelodysplastic syndrome]. (United States)

    Qin, Ling; Wang, Chun; Qin, You-Wen; Xie, Kuang-Cheng; Yan, Shi-Ke; Gao, Yan-Rong; Wang, Xiao-Rui; Zhao, Chu-Xian


    This study was aimed to investigate the distribution of abnormal clone in marrow cell lineages and apoptosis cells in myelodysplastic syndrome (MDS) with deletion of chromosome 20q. Monoclonal antibodies recognizing myeloid precursors (CD15), erythroid precursors (GPA), T cells (CD3(+)CD56(-)CD16(-)), B cells (CD19), NK cells (CD3(-)CD56(+)CD16(+)) were used to sort bone marrow cells in a MDS patient with del (20q) by fluorescence activated cell sorting (FACS). Annexin V-FITC and PI were used to sort bone marrow Annexin V(+)PI(-) and Annexin V(-)PI(-) cells by FACS. The sorted positive cells were detected by interphase dual-color fluorescence in situ hybridization (D-FISH) using a LSI D20S108 probe (Spectrum Orange) and a Telvysion TM 20p probe (Spectrum Green). FACS and FISH analysis were also performed on the samples from 4 cases with normal karyotype. The results showed that the proportions of MDS clone in the myeloid and erythroid precursors were 70.50% and 93.33% respectively, in the RAEB-1 patient with del (20q) and were obviously higher than that in control group (5.39% and 6.17%). The proportions of abnormal clone in T, B and NK cells were 3.23%, 4.32% and 5.77% respectively and were less than that in control group (5.76%, 4.85%, 6.36%). The percentage of apoptotic cells in the bone marrow nucleated cells was 16.09%. The proportions of MDS clone in Annexin V(+)PI(-) and Annexin V(-)PI(-) cells were 32.48% and 70.11%, respectively. It is concluded that most myeloid and erythroid precursors are originated from the abnormal clone in MDS with del (20q). A little part of apoptotic cells are derived from the abnormal clone.

  10. Control of the proportion of inner cells by asymmetric divisions and the ensuing resilience of cloned rabbit embryos (United States)

    Duranthon, Véronique


    ABSTRACT Mammalian embryo cloning by nuclear transfer has a low success rate. This is hypothesized to correlate with a high variability of early developmental steps that segregate outer cells, which are fated to extra-embryonic tissues, from inner cells, which give rise to the embryo proper. Exploring the cell lineage of wild-type embryos and clones, imaged in toto until hatching, highlights the respective contributions of cell proliferation, death and asymmetric divisions to phenotypic variability. Preferential cell death of inner cells in clones, probably pertaining to the epigenetic plasticity of the transferred nucleus, is identified as a major difference with effects on the proportion of inner cell. In wild type and clones, similar patterns of outer cell asymmetric divisions are shown to be essential to the robust proportion of inner cells observed in wild type. Asymmetric inner cell division, which is not described in mice, is identified as a regulator of the proportion of inner cells and likely gives rise to resilient clones. PMID:29567671

  11. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA. (United States)


    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  12. Different Donor Cell Culture Methods Can Influence the Developmental Ability of Cloned Sheep Embryos.

    Directory of Open Access Journals (Sweden)

    LiBing Ma

    Full Text Available It was proposed that arresting nuclear donor cells in G0/G1 phase facilitates the development of embryos that are derived from somatic cell nuclear transfer (SCNT. Full confluency or serum starvation is commonly used to arrest in vitro cultured somatic cells in G0/G1 phase. However, it is controversial as to whether these two methods have the same efficiency in arresting somatic cells in G0/G1 phase. Moreover, it is unclear whether the cloned embryos have comparable developmental ability after somatic cells are subjected to one of these methods and then used as nuclear donors in SCNT. In the present study, in vitro cultured sheep skin fibroblasts were divided into four groups: (1 cultured to 70-80% confluency (control group, (2 cultured to full confluency, (3 starved in low serum medium for 4 d, or (4 cultured to full confluency and then further starved for 4 d. Flow cytometry was used to assay the percentage of fibroblasts in G0/G1 phase, and cell counting was used to assay the viability of the fibroblasts. Then, real-time reverse transcription PCR was used to determine the levels of expression of several cell cycle-related genes. Subsequently, the four groups of fibroblasts were separately used as nuclear donors in SCNT, and the developmental ability and the quality of the cloned embryos were compared. The results showed that the percentage of fibroblasts in G0/G1 phase, the viability of fibroblasts, and the expression levels of cell cycle-related genes was different among the four groups of fibroblasts. Moreover, the quality of the cloned embryos was comparable after these four groups of fibroblasts were separately used as nuclear donors in SCNT. However, cloned embryos derived from fibroblasts that were cultured to full confluency combined with serum starvation had the highest developmental ability. The results of the present study indicate that there are synergistic effects of full confluency and serum starvation on arresting fibroblasts in

  13. Statement on Human Cloning (United States)

    ... as our understanding of this technology advances. Support Stem Cell Research (including Research Cloning) AAAS supports stem cell research, including the use of nuclear transplantation techniques (also ...

  14. Cloning and expression of a zebrafish SCN1B ortholog and identification of a species-specific splice variant

    Directory of Open Access Journals (Sweden)

    Slat Emily A


    Full Text Available Abstract Background Voltage-gated Na+ channel β1 (Scn1b subunits are multi-functional proteins that play roles in current modulation, channel cell surface expression, cell adhesion, cell migration, and neurite outgrowth. We have shown previously that β1 modulates electrical excitability in vivo using a mouse model. Scn1b null mice exhibit spontaneous seizures and ataxia, slowed action potential conduction, decreased numbers of nodes of Ranvier in myelinated axons, alterations in nodal architecture, and differences in Na+ channel α subunit localization. The early death of these mice at postnatal day 19, however, make them a challenging model system to study. As a first step toward development of an alternative model to investigate the physiological roles of β1 subunits in vivo we cloned two β1-like subunit cDNAs from D. rerio. Results Two β1-like subunit mRNAs from zebrafish, scn1ba_tv1 and scn1ba_tv2, arise from alternative splicing of scn1ba. The deduced amino acid sequences of Scn1ba_tv1 and Scn1ba_tv2 are identical except for their C-terminal domains. The C-terminus of Scn1ba_tv1 contains a tyrosine residue similar to that found to be critical for ankyrin association and Na+ channel modulation in mammalian β1. In contrast, Scn1ba_tv2 contains a unique, species-specific C-terminal domain that does not contain a tyrosine. Immunohistochemical analysis shows that, while the expression patterns of Scn1ba_tv1 and Scn1ba_tv2 overlap in some areas of the brain, retina, spinal cord, and skeletal muscle, only Scn1ba_tv1 is expressed in optic nerve where its staining pattern suggests nodal expression. Both scn1ba splice forms modulate Na+ currents expressed by zebrafish scn8aa, resulting in shifts in channel gating mode, increased current amplitude, negative shifts in the voltage dependence of current activation and inactivation, and increases in the rate of recovery from inactivation, similar to the function of mammalian β1 subunits. In

  15. Human somatic cell nuclear transfer and reproductive cloning: an Ethics Committee opinion. (United States)


    This document presents arguments that conclude that it is unethical to use somatic cell nuclear transfer (SCNT) for infertility treatment due to concerns about safety; the unknown impact of SCNT on children, families, and society; and the availability of other ethically acceptable means of assisted reproduction. This document replaces the ASRM Ethics Committee report titled, "Human somatic cell nuclear transfer and cloning," last published in Fertil Steril 2012;98:804-7. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  16. CD1b-mycolic acid tetramers demonstrate T-cell fine specificity for mycobacterial lipid tails

    NARCIS (Netherlands)

    Van Rhijn, Ildiko; Iwany, Sarah K; Fodran, Peter; Cheng, Tan-Yun; Gapin, Laurent; Minnaard, Adriaan J; Moody, D Branch

    Mycobacterium tuberculosis synthesizes a thick cell wall comprised of mycolic acids (MA), which are foreign antigens for human T cells. T-cell clones from multiple donors were used to determine the fine specificity of MA recognition by human αβ T cells. Most CD1-presented lipid antigens contain

  17. MAdCAM-1 is needed for diabetes development mediated by the T cell clone, BDC-2·5 (United States)

    Phillips, Jenny M; Haskins, Kathryn; Cooke, Anne


    The NOD-derived islet-reactive CD4+ T cell clone, BDC-2·5, is able to transfer diabetes to neonatal non-obese diabetic (NOD) mice but is unable to transfer disease to either adult NOD or NOD scid recipients. Transfer of diabetes to adult recipients by BDC-2·5 is only accomplished by cotransfer of CD8+ T cells from a diabetic donor. To understand why this CD4+ T cell clone is able to mediate diabetes in neonatal but not the adult recipients we examined the ability of the clone to traffic in the different recipients. Our studies showed that MAdCAM-1 has a very different expression pattern in the neonatal and adult pancreas. Blockade of this addressin prevents the clone from transferring diabetes to neonatal mice, suggesting that the differential pancreatic expression of MAdCAM-1 in neonatal and adult pancreas provides an explanation of the differences in diabetes development. PMID:16313366

  18. Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line (United States)

    Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid


    Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

  19. Hypoosmotic cell swelling as a novel mechanism for modulation of cloned HCN2 channels

    DEFF Research Database (Denmark)

    Calloe, Kirstine; Elmedyb, Pernille; Olesen, Søren-Peter


    This work demonstrates cell swelling as a new regulatory mechanism for the cloned hyperpolarization-activated, cyclic nucleotide-gated channel 2 (HCN2). HCN2 channels were coexpressed with aquaporin1 in Xenopus laevis oocytes and currents were monitored using a two-electrode voltage-clamp. HCN2...... channels were activated by hyperpolarization to -100 mV and the currents were measured before and during hypoosmotic cell swelling. Cell swelling increased HCN2 currents by 30% without changing the kinetics of the currents. Injection of 50 nl intracellular solution resulted in a current increase of 20......%, indicating that an increase in cell volume also under isoosmotic conditions may lead to activation of HCN2. In the absence of aquaporin1 only negligible changes in oocyte cell volume occur during exposure to hypoosmotic media and no significant change in HCN2 channel activity was observed during perfusion...

  20. Cloning of Soluble Human Stem Cell Factor in pET-26b(+ Vector

    Directory of Open Access Journals (Sweden)

    Salman Asghari


    Full Text Available Purpose: Stem cell factor (SCF plays an important role in the survival, proliferation and differentiation of hematopoietic stem cells and progenitor cells. Potential therapeutic applications of SCF include hematopoietic stem cell mobilization, exvivo stem/progenitor cell expansion, gene therapy, and immunotherapy. Considering the cost and problem in accessibility of this product in Iran, clears the importance of indigenizing production of rhSCF. In the present work, we describe the construction of the soluble rhSCF expression vector in pET-26b (+ with periplasmic localization potential. Methods: Following PCR amplification of human SCF ORF, it is cloned in pET-26b (+ vector in NcoI and XhoI sites. The recombinant construct was transformed into BL21 (DE3 Ecoli strains. Results: The construction of recombinant vector was verified by colony PCR and sequence analysis of pET26b-hSCF vector. Sequence analyses proved that human SCF ORF has been inserted into NcoI and XhoI site with correct orientation downstream of strong T7 promotor and showed no nucleotide errors. Conclusion: The SCF ORF was successfully cloned in pET-26b (+ expression vector and is ready for future production of SCF protein.

  1. Cloning of Soluble Human Stem Cell Factor in pET-26b(+) Vector. (United States)

    Asghari, Salman; Shekari Khaniani, Mahmoud; Darabi, Masood; Mansoori Derakhshan, Sima


    Stem cell factor (SCF) plays an important role in the survival, proliferation and differentiation of hematopoietic stem cells and progenitor cells. Potential therapeutic applications of SCF include hematopoietic stem cell mobilization, exvivo stem/progenitor cell expansion, gene therapy, and immunotherapy. Considering the cost and problem in accessibility of this product in Iran, clears the importance of indigenizing production of rhSCF. In the present work, we describe the construction of the soluble rhSCF expression vector in pET-26b (+) with periplasmic localization potential. Following PCR amplification of human SCF ORF, it is cloned in pET-26b (+) vector in NcoI and XhoI sites. The recombinant construct was transformed into BL21 (DE3) Ecoli strains. The construction of recombinant vector was verified by colony PCR and sequence analysis of pET26b-hSCF vector. Sequence analyses proved that human SCF ORF has been inserted into NcoI and XhoI site with correct orientation downstream of strong T7 promotor and showed no nucleotide errors. The SCF ORF was successfully cloned in pET-26b (+) expression vector and is ready for future production of SCF protein.

  2. Cloning, overexpression, purification, crystallization and preliminary X-ray analysis of a female-specific lipocalin (FLP) expressed in the lacrimal glands of Syrian hamsters

    International Nuclear Information System (INIS)

    Dubey, Ved Prakash; Pal, Biswajit; Srikantan, Subramanya; Pottabathini, Sambhavi; De, Prabir Kumar; Sankaranarayanan, Rajan


    A female-specific lacrimal protein from Syrian hamsters has been crystallized by the sitting-drop vapour-diffusion method. The crystals belonged to space group P2 1 2 1 2 1 and diffraction data were collected to 1.86 Å resolution. Proteins belonging to the lipocalin superfamily are usually secretory proteins of molecular mass ∼20 kDa with a hydrophobic pocket for the binding and transport of diverse small ligands. Various lipocalins have been associated with many biological processes, e.g. immunomodulation, odorant transport, pheromonal activity, retinoid transport, cancer-cell interactions etc. However, the exact functions of many lipocalins and the ligands bound by them are unclear. Previously, the cDNA of a 20 kDa lipocalin (FLP) which is female-specifically expressed in the lacrimal glands of Syrian (golden) hamsters and secreted in the tears of females has been identified and cloned. His-tagged recombinant FLP (rFLP) has now been cloned, overexpressed in Escherichia coli as a soluble protein and purified to homogeneity using Ni-affinity followed by size-exclusion chromatography. Purified rFLP was crystallized using the sitting-drop vapour-diffusion method. The crystals tested belonged to space group P2 1 2 1 2 1 and diffracted to beyond 1.86 Å resolution. Solvent-content analysis indicated the presence of one monomer in the asymmetric unit

  3. Cloning of a glutathione S-transferase decreasing during differentiation of HL60 cell line

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jae Chul; Park, In Kyu; Lee, Kyu Bo; Sohn, Sang Kyun; Kim, Moo Kyu; Kim, Jung Chul [College of Medicine, Kyungpook National Univ., Taegu (Korea, Republic of)


    By sequencing the Expressed Sequence Tags of human dermal papilla cDNA library, we identified a clone named K872 of which the expression decreased during differentiation of HL60 cell line. K872 plasmid DNA was isolated according to QIA plasmid extraction kit (Qiagen GmbH, Germany). The nucleotide sequencing was performed by Sanger's method with K872 plasmid DNA. The most updated GenBank EMBL necleic acid banks were searched through the internet by using BLAST (Basic Local Alignment Search Tools) program. Northern bots were performed using RNA isolated from various human tissues and cancer cell lines. The gene expression of the fusion protein was achieved by His-Patch Thiofusion expression system and the protein product was identified on SDS-PAGE. K872 clone is 1006 nucleotides long, and has a coding region of 675 nucleotides and a 3' non-coding region of 280 nucleotides. The presumed open reading frame starting at the 5' terminus of K872 encodes 226 amino acids, including the initiation methionine residue. The amino acid sequence deduced from the open reading frame of K872 shares 70% identity with that of rat glutathione S-transferase kappa 1 (rGSTK1). The transcripts were expressed inh a variety of human tissues and cancer cells. The levels of transcript were relatively high in those tissues such as heart, skeletal muscle, and peripheral blood leukocyte. It is noteworthy that K872 was found to be abundantly expressed in colorectal cancer and melanoma cell lines. Homology search result suggests that K872 clone is the human homolog of the rGSTK1 which is known to be involved in the resistance of cytotoxic therapy. We propose that meticulous functional analysis should be followed to confirm that.

  4. In vitro culture of skin fibroblast cells for potential cloning by nuclear transfer

    International Nuclear Information System (INIS)

    Gupta, S.C.; Gupta, N.; Ahlawat, S.P.S.; Kumar, A.; Taneja, R.; Sharma, R.; Sunder, S.; Tantia, M.S.


    Donor cell lines were developed from skin tissue for the conservation of the endangered Jaiselmeri camel breed of India. Average cell proliferation rates varied from 0.82 to 0.69 in different passages, and population doubling time from 29.3 h to 34.8 h. Around 15 population doublings were accomplished during this culturing. Cell viability was 97 to 99% in different passages. Growth curves of cells from the JC-5 cell line reached a plateau on day 7, while the slower-growing cultures of JC-3 showed elevation even on day 10, possibly due to donor age differences. Cell proliferation rates by both cell count and MTT absorbance showed similar patterns, with a correlation coefficient of 0.79. MTT assay, a colorimetric method, can handle large samples in somatic cell cultures. Diploid chromosomal counts in passages 1, 3 and 5 were normal (2N=74, XY) in 97% of the cells. Occasional metaphase plates showed polyploidy. The present baseline data on standard growth curve, linear relationship in colorimetric assay for estimation of cell proliferation rate, and normal ploidy and karyological levels in camel skin fibroblast cells in multiplication could be useful in developing competent donor somatic cell lines for conservation now and revival of this camel breed by cloning in the future. (author)

  5. Animal cloning: problems and prospects. (United States)

    Wells, D N


    An efficient animal cloning technology would provide many new opportunities for livestock agriculture, human medicine, and animal conservation. Nuclear cloning involves the production of animals that are genetically identical to the donor cells used in a technique known as nuclear transfer (NT). However, at present it is an inefficient process: in cattle, only around 6% of the embryos transferred to the reproductive tracts of recipient cows result in healthy, longterm surviving clones. Of concern are the high losses throughout gestation, during birth and in the post-natal period through to adulthood. Many of the pregnancy losses relate to failure of the placenta to develop and function correctly. Placental dysfunction may also have an adverse influence on postnatal health. These anomalies are probably due to incorrect epigenetic reprogramming of the donor genome following NT, leading to inappropriate patterns of gene expression during the development of clones. Whilst some physiological tests on surviving clones suggest normality, other reports indicate a variety of post-natal clone-associated abnormalities. This variability in outcome may reflect species-specific and/or cloning methodological differences. Importantly, to date it appears that these clone-associated phenotypes are not transmitted to offspring following sexual reproduction. This indicates that they represent epigenetic errors, rather than genetic errors, which are corrected during gametogenesis. Whilst this needs confirmation at the molecular level, it provides initial confidence in the first application of NT in agriculture, namely, the production of small numbers of cloned sires from genetically elite bulls, for natural mating, to effectively disseminate genetic gain. In addition to the animal welfare concerns with the technology, the underlying health of the animals and the consequential effect on food safety are critical aspects that require investigation to gain regulatory and consumer

  6. Nucleolar re-activation is delayed in mouse embryos cloned from two different cell lines

    DEFF Research Database (Denmark)

    Svarcova, Olga; Dinnyes, A.; Polgar, Z.


    displayed early NPBs transformation. In conclusion, despite normal onset of EGA in cloned embryos, activation of functional nucleoli was one cell cycle delayed in NT embryos. NT-MEF embryos displayed normal targeting but delayed activation of nucleolar proteins. Contrary, in NT-HM1 embryos, both......Aim of this study was to evaluate and compare embryonic genome activation (EGA) in mouse embryos of different origin using nucleolus as a marker. Early and late 2-cell and late 4-cell stage embryos, prepared by in vitro fertilization (IVF), parthenogenetic activation (PG), and nuclear transfer...... ofmouse embryonic fibroblast (MEF) and mouse HM1 emryonic stem cells (HM1), were processed for autoradiography following 3H-uridine incubation (transcriptional activity), transmission electron microscopy (ultrastructure) and immunofluorescence (nucleolar proteins; upstream binding factor, UBF...

  7. Cell colony formation induced by Xenopus egg extract as a marker for improvement of cloned blastocyst formation in pig

    DEFF Research Database (Denmark)

    Liu, Ying; Østrup, Olga; Li, Juan


    method based on the colony formation of cells after extract treatment, and subsequent in vitro cloning efficiency using treated cells as chromatin donors. Porcine fetal fibroblasts were treated with each batch of extract, and cultured in embryonic stem cell (ES) medium for 12 days. The number of forming...

  8. Optimization of cell line development in the GS-CHO expression system using a high-throughput, single cell-based clone selection system. (United States)

    Nakamura, Tsuyoshi; Omasa, Takeshi


    Therapeutic antibodies are commonly produced by high-expressing, clonal and recombinant Chinese hamster ovary (CHO) cell lines. Currently, CHO cells dominate as a commercial production host because of their ease of use, established regulatory track record, and safety profile. CHO-K1SV is a suspension, protein-free-adapted CHO-K1-derived cell line employing the glutamine synthetase (GS) gene expression system (GS-CHO expression system). The selection of high-producing mammalian cell lines is a crucial step in process development for the production of therapeutic antibodies. In general, cloning by the limiting dilution method is used to isolate high-producing monoclonal CHO cells. However, the limiting dilution method is time consuming and has a low probability of monoclonality. To minimize the duration and increase the probability of obtaining high-producing clones with high monoclonality, an automated single cell-based clone selector, the ClonePix FL system, is available. In this study, we applied the high-throughput ClonePix FL system for cell line development using CHO-K1SV cells and investigated efficient conditions for single cell-based clone selection. CHO-K1SV cell growth at the pre-picking stage was improved by optimizing the formulation of semi-solid medium. The efficiency of picking and cell growth at the post-picking stage was improved by optimization of the plating time without decreasing the diversity of clones. The conditions for selection, including the medium formulation, were the most important factors for the single cell-based clone selection system to construct a high-producing CHO cell line. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone

    International Nuclear Information System (INIS)

    Adachi, A.; Gendelman, H.E.; Koenig, S.; Folks, T.; Willey, R.; Rabson, A.; Martin, M.A.


    The authors considered an infectious molecular clone of acquired immunodeficiency syndrome-associated retrovirus. Upon transfection, this clone directed the production of infectious virus particles in a wide variety of cells in addition to human T4 cells. The progeny, infectious virions, were synthesized in mouse, mink, monkey, and several human non-T cell lines, indicating the absence of any intracellular obstacle to viral RNA or protein production or assembly. During the course of these studies, a human colon carcinoma cell line, exquisitely sensitive to DNA transfection, was identified

  10. PD-L1-specific T cells

    DEFF Research Database (Denmark)

    Ahmad, Shamaila Munir; Borch, Troels Holz; Hansen, Morten


    -specific T cells that recognize both PD-L1-expressing immune cells and malignant cells. Thus, PD-L1-specific T cells have the ability to modulate adaptive immune reactions by reacting to regulatory cells. Thus, utilization of PD-L1-derived T cell epitopes may represent an attractive vaccination strategy...... for targeting the tumor microenvironment and for boosting the clinical effects of additional anticancer immunotherapy. This review summarizes present information about PD-L1 as a T cell antigen, depicts the initial findings about the function of PD-L1-specific T cells in the adjustment of immune responses...

  11. Engineering antigen-specific T cells from genetically modified human hematopoietic stem cells in immunodeficient mice.

    Directory of Open Access Journals (Sweden)

    Scott G Kitchen

    Full Text Available There is a desperate need for effective therapies to fight chronic viral infections. The immune response is normally fastidious at controlling the majority of viral infections and a therapeutic strategy aimed at reestablishing immune control represents a potentially powerful approach towards treating persistent viral infections. We examined the potential of genetically programming human hematopoietic stem cells to generate mature CD8+ cytotoxic T lymphocytes that express a molecularly cloned, "transgenic" human anti-HIV T cell receptor (TCR. Anti-HIV TCR transduction of human hematopoietic stem cells directed the maturation of a large population of polyfunctional, HIV-specific CD8+ cells capable of recognizing and killing viral antigen-presenting cells. Thus, through this proof-of-concept we propose that genetic engineering of human hematopoietic stem cells will allow the tailoring of effector T cell responses to fight HIV infection or other diseases that are characterized by the loss of immune control.

  12. Physiological level production of antigen-specific human immunoglobulin in cloned transchromosomic cattle.

    Directory of Open Access Journals (Sweden)

    Akiko Sano

    Full Text Available Therapeutic human polyclonal antibodies (hpAbs derived from pooled plasma from human donors are Food and Drug Administration approved biologics used in the treatment of a variety of human diseases. Powered by the natural diversity of immune response, hpAbs are effective in treating diseases caused by complex or quickly-evolving antigens such as viruses. We previously showed that transchromosomic (Tc cattle carrying a human artificial chromosome (HAC comprising the entire unrearranged human immunoglobulin heavy-chain (hIGH and kappa-chain (hIGK germline loci (named as κHAC are capable of producing functional hpAbs when both of the bovine immunoglobulin mu heavy-chains, bIGHM and bIGHML1, are homozygously inactivated (double knockouts or DKO. However, B lymphocyte development in these Tc cattle is compromised, and the overall production of hpAbs is low. Here, we report the construction of an improved HAC, designated as cKSL-HACΔ, by incorporating all of the human immunoglobulin germline loci into the HAC. Furthermore, for avoiding the possible human-bovine interspecies incompatibility between the human immunoglobulin mu chain protein (hIgM and bovine transmembrane α and β immunoglobulins (bIgα and bIgβ in the pre-B cell receptor (pre-BCR complex, we partially replaced (bovinized the hIgM constant domain with the counterpart of bovine IgM (bIgM that is involved in the interaction between bIgM and bIgα/Igβ; human IgM bovinization would also improve the functionality of hIgM in supporting B cell activation and proliferation. We also report the successful production of DKO Tc cattle carrying the cKSL-HACΔ (cKSL-HACΔ/DKO, the dramatic improvement of B cell development in these cattle and the high level production of hpAbs (as measured for the human IgG isotype in the plasma. We further demonstrate that, upon immunization by tumor immunogens, high titer tumor immunogen-specific human IgG (hIgG can be produced from such Tc cattle.

  13. Saporin-conjugated tetramers identify efficacious anti-HIV CD8+ T-cell specificities

    DEFF Research Database (Denmark)

    Leitman, Ellen M.; Palmer, Christine D.; Buus, Søren


    Antigen-specific T-cells are highly variable, spanning potent antiviral efficacy and damaging auto-reactivity. In virus infections, identifying the most efficacious responses is critical to vaccine design. However, current methods depend on indirect measures or on ex vivo expanded CTL clones. We...

  14. Recovery of infectious pariacoto virus from cDNA clones and identification of susceptible cell lines. (United States)

    Johnson, K N; Ball, L A


    Pariacoto virus (PaV) is a nodavirus that was recently isolated in Peru from the Southern armyworm, Spodoptera eridania. Virus particles are non enveloped and about 30 nm in diameter and have T=3 icosahedral symmetry. The 3.0-A crystal structure shows that about 35% of the genomic RNA is icosahedrally ordered, with the RNA forming a dodecahedral cage of 25-nucleotide (nt) duplexes that underlie the inner surface of the capsid. The PaV genome comprises two single-stranded, positive-sense RNAs: RNA1 (3,011 nt), which encodes the 108-kDa catalytic subunit of the RNA-dependent RNA polymerase, and RNA2 (1,311 nt), which encodes the 43-kDa capsid protein precursor alpha. In order to apply molecular genetics to the structure and assembly of PaV, we identified susceptible cell lines and developed a reverse genetic system for this virus. Cell lines that were susceptible to infection by PaV included those from Spodoptera exigua, Helicoverpa zea and Aedes albopictus, whereas cells from Drosophila melanogaster and Spodoptera frugiperda were refractory to infection. To recover virus from molecular clones, full-length cDNAs of PaV RNAs 1 and 2 were cotranscribed by T7 RNA polymerase in baby hamster kidney cells that expressed T7 RNA polymerase. Lysates of these cells were infectious both for cultured cells from Helicoverpa zea (corn earworm) and for larvae of Galleria mellonella (greater wax moth). The combination of infectious cDNA clones, cell culture infectivity, and the ability to produce milligram amounts of virus allows the application of DNA-based genetic methods to the study of PaV structure and assembly.

  15. Molecular cloning, characterization and functional analysis of a novel juvenile-specific cathepsin L of Fasciola gigantica. (United States)

    Sansri, Veerawat; Changklungmoa, Narin; Chaichanasak, Pannigan; Sobhon, Prasert; Meemon, Krai


    Cathepsin L proteases are a major class of endopeptidases expressed at a high level in Fasciola parasites. Several isoforms of cathepsin L were detected and they may perform different functions during the parasite development. In this study, a complete cDNA encoding a cathepsin L protease was cloned from a newly excysted juvenile (NEJ) cDNA library of Fasciola gigantica and named FgCatL1H. It encoded a 326 amino acid preproenzyme which shared 62.8-83.1% and 39.5-42.9% identity to Fasciola spp. and mammalian cathepsins L, respectively. All functionally important residues previously described for cathepsin L were conserved in FgCatL1H. Phylogenetic analysis demonstrated that FgCatL1H belonged to a distinct group, clade 4, with respect to adult and other juvenile Fasciola cathepsin L genes. FgCatL1H expression was detected by RT-PCR, using gene specific primers, in metacercariae and NEJ, and the expression gradually decreased in advanced developmental stages. A recombinant proFgCatL1H (rproFgCatL1H) was expressed in the yeast Pichia pastoris, affinity purified, and found to migrate in SDS-PAGE at approximately 47.6 and 38.3kDa in glycosylated and deglycosylated forms, respectively. The molecular mass of the activated mature rFgCatL1H in glycosylated form was approximately 40.7kDa. Immunoblotting and immunohistochemistry using rabbit antibodies against rproFgCatL1H showed that FgCatL1H was predominantly expressed in epithelial cells of the digestive tract of metacercariae, NEJs and juveniles of F. gigantica. FgCatL1H could cleave the synthetic fluorogenic substrate Z-Phe-Arg-MCA preferentially over Z-Gly-Pro-Arg-MCA at an optimum pH of 6.5. It also showed hydrolytic activity against native substrates, including type I collagen, laminin, and immunoglobulin G (IgG) in vitro, suggesting possible roles in host tissue migration and immune evasion. Therefore, the FgCatL1H is a possible target for vaccine and chemotherapy for controlling F. gigantica infection. Copyright

  16. Screening and Identification of Peptides Specifically Targeted to Gastric Cancer Cells from a Phage Display Peptide Library (United States)

    Sahin, Deniz; Taflan, Sevket Onur; Yartas, Gizem; Ashktorab, Hassan; Smoot, Duane T


    Background: Gastric cancer is the second most common cancer among the malign cancer types. Inefficiency of traditional techniques both in diagnosis and therapy of the disease makes the development of alternative and novel techniques indispensable. As an alternative to traditional methods, tumor specific targeting small peptides can be used to increase the efficiency of the treatment and reduce the side effects related to traditional techniques. The aim of this study is screening and identification of individual peptides specifically targeted to human gastric cancer cells using a phage-displayed peptide library and designing specific peptide sequences by using experimentally-eluted peptide sequences. Methods: Here, MKN-45 human gastric cancer cells and HFE-145 human normal gastric epithelial cells were used as the target and control cells, respectively. 5 rounds of biopannning with a phage display 12-peptide library were applied following subtraction biopanning with HFE-145 control cells. The selected phage clones were established by enzyme-linked immunosorbent assay and immunofluorescence detection. We first obtain random phage clones after five biopanning rounds, determine the binding levels of each individual clone. Then, we analyze the frequencies of each amino acid in best binding clones to determine positively overexpressed amino acids for designing novel peptide sequences. Results: DE532 (VETSQYFRGTLS) phage clone was screened positive, showing specific binding on MKN-45 gastric cancer cells. DE-Obs (HNDLFPSWYHNY) peptide, which was designed by using amino acid frequencies of experimentally selected peptides in the 5th round of biopanning, showed specific binding in MKN-45 cells. Conclusion: Selection and characterization of individual clones may give us specifically binding peptides, but more importantly, data extracted from eluted phage clones may be used to design theoretical peptides with better binding properties than even experimentally selected ones

  17. Do endothelial cells belong to the primitive stem leukemic clone in CML? Role of extracellular vesicles. (United States)

    Ramos, Teresa L; Sánchez-Abarca, Luis Ignacio; López-Ruano, Guillermo; Muntión, Sandra; Preciado, Silvia; Hernández-Ruano, Montserrat; Rosado, Belén; de las Heras, Natalia; Chillón, M Carmen; Hernández-Hernández, Ángel; González, Marcos; Sánchez-Guijo, Fermín; Del Cañizo, Consuelo


    The expression of BCR-ABL in hematopoietic stem cells is a well-defined primary event in chronic myeloid leukemia (CML). Some reports have described the presence of BCR-ABL on endothelial cells from CML patients, suggesting the origin of the disease in a primitive hemangioblastic cell. On the other hand, extracellular vesicles (EVs) released by CML leukemic cells are involved in the angiogenesis modulation process. In the current work we hypothesized that EVs released from BCR-ABL(+) cells may carry inside the oncogene that can be transferred to endothelial cells leading to the expression of both BCR-ABL transcript and the oncoprotein. EVs from K562 cells and plasma of newly diagnosed CML patients were isolated by ultracentrifugation. RT-PCR analysis detected the presence of BCR-ABL RNA in the EVs isolated from both K562 cells and plasma of CML patients. The incorporation of these EVs into endothelial cells was demonstrated by flow cytometry and fluorescence microscopy showed that after 24h of incubation most EVs were incorporated. BCR-ABL transcripts were detected in all experiments on endothelial cells incubated with EVs from both sources. The presence of BCR-ABL on endothelial cells incubated with Philadelphia(+) EVs was also confirmed by Western blot assays. In summary, endothelial cells acquire BCR-ABL RNA and the oncoprotein after incubation with EVs released from Ph(+) positive cells (either from K562 cells or from plasma of newly diagnosed CML patients). This results challenge the hypothesis that endothelial cells may be part of the Philadelphia(+) clone in CML. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Cloning and expression of the receptor for human urokinase plasminogen activator, a central molecule in cell surface, plasmin dependent proteolysis

    DEFF Research Database (Denmark)

    Roldan, A.L.; Cubellis, M.V.; Masucci, M.T.


    , and therefore the capacity of cells to migrate and invade neighboring tissues. We have isolated a 1.4 kb cDNA clone coding for the entire human uPAR. An oligonucleotide synthesized on the basis of the N-terminal sequence of the purified protein was used to screen a cDNA library made from SV40 transformed human......, a size very close to that of the cloned cDNA. Expression of the uPAR cDNA in mouse cells confirms that the clone is complete and expresses a functional uPA binding protein, located on the cell surface and with properties similar to the human uPAR. Caseinolytic plaque assay, immunofluorescence analysis......The surface receptor for urokinase plasminogen activator (uPAR) has been recognized in recent years as a key molecule in regulating plasminogen mediated extracellular proteolysis. Surface plasminogen activation controls the connections between cells, basement membrane and extracellular matrix...

  19. Climbing Mount Efficiency--small steps, not giant leaps towards higher cloning success in farm animals. (United States)

    Oback, Björn


    Despite more than a decade of research efforts, farm animal cloning by somatic cell nuclear transfer (SCNT) is still frustratingly inefficient. Inefficiency manifests itself at different levels, which are currently not well integrated. At the molecular level, it leads to widespread genetic, epigenetic and transcriptional aberrations in cloned embryos. At the organismal level, these genome-wide abnormalities compromise development of cloned foetuses and offspring. Specific molecular defects need to be causally linked to specific cloned phenotypes, in order to design specific treatments to correct them. Cloning efficiency depends on the ability of the nuclear donor cell to be fully reprogrammed into an embryonic state and the ability of the enucleated recipient cell to carry out the reprogramming reactions. It has been postulated that reprogrammability of the somatic donor cell epigenome is influenced by its differentiation status. However, direct comparisons between cells of divergent differentiation status within several somatic lineages have found no conclusive evidence for this. Choosing somatic stem cells as donors has not improved cloning efficiency, indicating that donor cell type may be less critical for cloning success. Different recipient cells, on the other hand, vary in their reprogramming ability. In bovine, using zygotes instead of oocytes has increased cloning success. Other improvements in livestock cloning efficiency include better coordinating donor cell type with cell cycle stage and aggregating cloned embryos. In the future, it will be important to demonstrate if these small increases at every step are cumulative, adding up to an integrated cloning protocol with greatly improved efficiency.

  20. DNA repair characteristics of a hybrid cell clone between xeroderma pigmentosum and Potorous tridactilis

    International Nuclear Information System (INIS)

    Ida, Kenji


    A hybrid cell clone PX1 was isolated by fusing UV sensitive XP20S(SV)neo, an SV-40-transformed, neomycin-resistant xeroderma pigmentosum (XP) cell line, and Pt K2, a rat kangaroo (Potorous tridactilis) cell line. The UV-survival curve of PX1 cells fell midway between those of Pt K2 and XP20S(SV)neo cells, since mean lethal doses(D 0 ) were 2.5, 4.7 and 0.27 J/m 2 for PX1, Pt K2 and XP20S(SV)neo, respectively. Amounts of unscheduled DNA synthesis (UDS) after UV, relative to normal human cells, were 60.4 % for Pt K2, 37.7 % for PX1 and 0.1 % for XP20S(SV)neo. Such relative UDS capacities for excision repair of Pt K2, PX1 and XP20S(SV)neo were also consistent with the respective relative capacities of host cell reactivation (HCR) of UV-irradiated Herpes simplex virus. Apparently, there was no single Pt K2 chromosome in the PX1 cells. One possibility is that a gene which may account for the partial restoration of the UV resistance has been transferred from Pt K2 to PX1. (author)

  1. Determination of radioinduced delay in DNA synthesis in two-garlic-clones cells (Allium Sativum L.)

    International Nuclear Information System (INIS)

    Perez Lezcano, A.; Perez Talavera, S.


    To contribute to tech improvement of the use of ionizing radiations as an auxiliary tool in the fitoimprovement, dose-effect curves for the 'Martinez' and 'Sancti Spiritus-3' clones were stablished by using as effect the delay induced by radiations in DNA synthesis determined by the 'Martinez' clone which induces a delay of 50% in reference to the control is approximately 11 Gy, while the dose value for the 'Sancti Spiritus-3' clone is 18 Gy, thus the 'Martinez' clones has a higher sensitivity to radiations than the other clone, therefore it coincides with what we found for these clones other indexes are used as radiosensitivity criteria

  2. Somatic cell cloning in Buffalo (Bubalus bubalis): effects of interspecies cytoplasmic recipients and activation procedures. (United States)

    Kitiyanant, Y; Saikhun, J; Chaisalee, B; White, K L; Pavasuthipaisit, K


    Successful nuclear transfer (NT) of somatic cell nuclei from various mammalian species to enucleated bovine oocytes provides a universal cytoplast for NT in endangered or extinct species. Buffalo fetal fibroblasts were isolated from a day 40 fetus and were synchronized in presumptive G(0) by serum deprivation. Buffalo and bovine oocytes from abattoir ovaries were matured in vitro and enucleated at 22 h. In the first experiment, we compared the ability of buffalo and bovine oocyte cytoplasm to support in vitro development of NT embryos produced by buffalo fetal fibroblasts as donor nuclei. There were no significant differences (p > 0.05) between the NT embryos derived from buffalo and bovine oocytes, in fusion (74% versus 71%) and cleavage (77% versus 75%) rates, respectively. No significant differences were also observed in blastocyst development (39% versus 33%) and the mean cell numbers of day 7 cloned blastocysts (88.5 +/- 25.7 versus 51.7 +/- 5.4). In the second experiment, we evaluated the effects of activation with calcium ionophore A23187 on development of NT embryos after electrical fusion. A significantly higher (p cloned buffalo blastocysts similar to those transferred into buffalo oocytes. Calcium ionophore used in conjunction with 6-DMAP effectively induces NT embryo development.

  3. Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. (United States)

    Krebber, A; Bornhauser, S; Burmester, J; Honegger, A; Willuda, J; Bosshard, H R; Plückthun, A


    A prerequisite for the use of recombinant antibody technologies starting from hybridomas or immune repertoires is the reliable cloning of functional immunoglobulin genes. For this purpose, a standard phage display system was optimized for robustness, vector stability, tight control of scFv-delta geneIII expression, primer usage for PCR amplification of variable region genes, scFv assembly strategy and subsequent directional cloning using a single rare cutting restriction enzyme. This integrated cloning, screening and selection system allowed us to rapidly obtain antigen binding scFvs derived from spleen-cell repertoires of mice immunized with ampicillin as well as from all hybridoma cell lines tested to date. As representative examples, cloning of monoclonal antibodies against a his tag, leucine zippers, the tumor marker EGP-2 and the insecticide DDT is presented. Several hybridomas whose genes could not be cloned in previous experimental setups, but were successfully obtained with the present system, expressed high amounts of aberrant heavy and light chain mRNAs, which were amplified by PCR and greatly exceeded the amount of binding antibody sequences. These contaminating variable region genes were successfully eliminated by employing the optimized phage display system, thus avoiding time consuming sequencing of non-binding scFv genes. To maximize soluble expression of functional scFvs subsequent to cloning, a compatible vector series to simplify modification, detection, multimerization and rapid purification of recombinant antibody fragments was constructed.

  4. Big Animal Cloning Using Transgenic Induced Pluripotent Stem Cells: A Case Study of Goat Transgenic Induced Pluripotent Stem Cells. (United States)

    Song, Hui; Li, Hui; Huang, Mingrui; Xu, Dan; Wang, Ziyu; Wang, Feng


    Using of embryonic stem cells (ESCs) could improve production traits and disease resistance by improving the efficiency of somatic cell nuclear transfer (SCNT) technology. However, robust ESCs have not been established from domestic ungulates. In the present study, we generated goat induced pluripotent stem cells (giPSCs) and transgenic cloned dairy goat induced pluripotent stem cells (tgiPSCs) from dairy goat fibroblasts (gFs) and transgenic cloned dairy goat fibroblasts (tgFs), respectively, using lentiviruses that contained hOCT4, hSOX2, hMYC, and hKLF4 without chemical compounds. The giPSCs and tgiPSCs expressed endogenous pluripotent markers, including OCT4, SOX2, MYC, KLF4, and NANOG. Moreover, they were able to maintain a normal karyotype and differentiate into derivatives from all three germ layers in vitro and in vivo. Using SCNT, tgFs and tgiPSCs were used as donor cells to produce embryos, which were named tgF-Embryos and tgiPSC-Embryos. The fusion rates and cleavage rates had no significant differences between tgF-Embryos and tgiPSC-Embryos. However, the expression of IGF-2, which is an important gene associated with embryonic development, was significantly lower in tgiPSC-Embryos than in tgF-Embryos and was not significantly different from vivo-Embryos.

  5. Human cloning. Fact or fiction

    International Nuclear Information System (INIS)

    Abushama, Mandy D.; Ahmed, Badreldeen I.


    Cloning is the production of one or more individual plants or animals that are genetically identical to other plant, animal or human. Scientists even demonstrated that they were able to clone frog tadpoles from frog embryonic cells using nuclear transfer.Many animals have been cloned from adult cells using nuclear transfer. Somatic cell nuclear transfer which refers to the transfer of the nucleous from a somatic cell to an egg cell. Article further deals with benefits and misuses of human cloning

  6. The production of lymphokines by primary alloreactive T-cell clones: a co-ordinate analysis of 233 clones in seven lymphokine assays. (United States)

    Sanderson, C J; Strath, M; Warren, D J; O'Garra, A; Kirkwood, T B


    A total of 233 primary alloreactive T-cell clones have been tested for the production of interleukin-2 (IL-2), interleukin-3 (IL-3), immune(gamma) interferon (IFN) and granulocyte-macrophage colony-stimulating factor (CSF-2), B-cell growth factor I and II (BCGFI, BCGFII), and eosinophil differentiation factor (EDF). EDF was assayed by means of the eosinophil differentiation assay (EDA). Two principal correlations were observed: IL-3 was shown to be the major lymphokine detected in the bone marrow proliferation assay (BMPA) used to detect CSF-2, and there was a high correlation between the EDA and BCGFII. Subsequent work has suggested that this latter correlation is because a single factor is responsible for both activities. Apart from these two exceptions, and low level correlations probably due to the fact that different assays detect more than one lymphokine, there was no evidence for co-ordinate expression of lymphokines. There was a large variation in amounts of individual lymphokines produced. More clones produced multiple lymphokines than would be expected from independent control. Taken together, this pattern of regulation is consistent with the hypothesis that antigen stimulation of T cells results in the activation of all the lymphokine genes, but the amount of each produced is determined by secondary controlling mechanisms. PMID:3935571

  7. Malignant progressive tumor cell clone exhibits significant up-regulation of cofilin-2 and 27-kDa modified form of cofilin-1 compared to regressive clone. (United States)

    Kuramitsu, Yasuhiro; Wang, Yufeng; Okada, Futoshi; Baron, Byron; Tokuda, Kazuhiro; Kitagawa, Takao; Akada, Junko; Nakamura, Kazuyuki


    QR-32 is a regressive murine fibrosarcoma cell clone which cannot grow when they are transplanted in mice; QRsP-11 is a progressive malignant tumor cell clone derived from QR-32 which shows strong tumorigenicity. A recent study showed there to be differentially expressed up-regulated and down-regulated proteins in these cells, which were identified by proteomic differential display analyses by using two-dimensional gel electrophoresis and mass spectrometry. Cofilins are small proteins of less than 20 kDa. Their function is the regulation of actin assembly. Cofilin-1 is a small ubiquitous protein, and regulates actin dynamics by means of binding to actin filaments. Cofilin-1 plays roles in cell migration, proliferation and phagocytosis. Cofilin-2 is also a small protein, but it is mainly expressed in skeletal and cardiac muscles. There are many reports showing the positive correlation between the level of cofilin-1 and cancer progression. We have also reported an increased expression of cofilin-1 in pancreatic cancer tissues compared to adjacent paired normal tissues. On the other hand, cofilin-2 was significantly less expressed in pancreatic cancer tissues. Therefore, the present study investigated the comparison of the levels of cofilin-1 and cofilin-2 in regressive QR-32 and progressive QRsP-11cells by western blotting. Cofilin-2 was significantly up-regulated in QRsP-11 compared to QR-32 cells (p<0.001). On the other hand, the difference of the intensities of the bands of cofilin-1 (18 kDa) in QR-32 and QRsP-11 was not significant. However, bands of 27 kDa showed a quite different intensity between QR-32 and QRsP-11, with much higher intensities in QRsP-11 compared to QR-32 (p<0.001). These results suggested that the 27-kDa protein recognized by the antibody against cofilin-1 is a possible biomarker for progressive tumor cells.

  8. Three concepts of cloning in human beings. (United States)

    Cui, Ke-Hui


    Human cloning, organ cloning and tissue cloning are various types of cloning that occur at different levels with different methodologies. According to three standards of terminology for an embryo (fertilization through germ cells, development in the uterus and having the potential to produce a human life), tissue cloning and type I organ cloning will not produce an embryo. In contrast, human cloning and type II organ cloning will produce an embryo. Thus, only non-germinal tissue cloning and type I organ cloning are beyond the ethical question and will not change human beings as a species. Using cloned tissues to make new tissues or organs is promising for the future of medicine.

  9. Discovery, cloning and characterisation of proline specific prolyl endopeptidase, a gluten degrading thermo-stable enzyme from Sphaerobacter thermophiles

    DEFF Research Database (Denmark)

    Shetty, Radhakrishna; Vestergaard, Mike; Jessen, Flemming


    processes occur at elevated temperature. We present in this paper, the discovery, cloning and characterisation of a novel recombinant thermostable gluten degrading enzyme, a proline specific prolyl endoprotease (PEP) from Sphaerobacter thermophiles. The molecular mass of the prolyl endopeptidase......Gluten free products have emerged during the last decades, as a result of a growing public concern and technological advancements allowing gluten reduction in food products. One approach is to use gluten degrading enzymes, typically at low or ambient temperatures, whereas many food production...... was estimated to be 77 kDa by using SDS-PAGE. Enzyme activity assays with a synthetic dipeptide Z-Gly-Pro-p-nitroanilide as the substrate revealed that the enzyme had optimal activity at pH 6.6 and was most active from pH 5.0-8.0. The optimum temperature was 63 °C and residual activity after one hour incubation...

  10. Production of a Cloned Buffalo (Bubalus bubalis) Calf from Somatic Cells Isolated from Urine. (United States)

    Madheshiya, Pankaj K; Sahare, Amol A; Jyotsana, Basanti; Singh, Karn P; Saini, Monika; Raja, Anuj K; Kaith, Sakshi; Singla, Suresh K; Chauhan, Manmohan S; Manik, Radhey S; Palta, Prabhat


    This study was aimed at isolation of cells from urine and skin on the ventral part of the tails of healthy adult female buffaloes (Bubalus bubalis), an area rarely exposed to solar radiation, establishment of the cells in culture, and their use as donor cells for production of buffalo embryos by handmade cloning (HMC). The blastocyst rate and total cell number of urine- and tail skin-derived embryos were similar to those of control embryos derived from ear skin cells; however, their apoptotic index was lower (pear skin-derived cells, whereas in blastocysts, it was higher (p<0.05) in urine- and tail skin-derived HMC blastocysts than that in IVF blastocysts. The expression level of CASPASE3, CASPASE9, P53, DNMT1, DNMT3a, OCT4, and NANOG, which was similar in HMC blastocysts of three the groups, was lower (p<0.05) than that in IVF blastocysts, whereas that of HDAC1 was similar among the four groups. Following transfer of urine-derived embryos (n=10) to five recipients (two embryos/recipient), one of the recipients delivered a normal calf that is now 5 weeks old.

  11. Human Cloning (United States)


    Human Fertilization and Embryology Authority (HFEA). A team of scientists headed by Alison Murdoch at the University of Newcastle received permission...not yet reported success in isolating stem cells from a cloned human embryo. A research team headed by Ian Wilmut at the University of Edinburgh...research group, headed by Douglas Melton and Kevin Eggan, submitted their proposal to a Harvard committee composed of ethicists, scientists and public

  12. ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data. (United States)

    Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P


    Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

  13. Natural killer cells facilitate PRAME-specific T-cell reactivity against neuroblastoma (United States)

    Spel, Lotte; Boelens, Jaap-Jan; van der Steen, Dirk M.; Blokland, Nina J.G.; van Noesel, Max M.; Molenaar, Jan J.; Heemskerk, Mirjam H.M.


    Neuroblastoma is the most common solid tumor in children with an estimated 5-year progression free survival of 20–40% in stage 4 disease. Neuroblastoma actively avoids recognition by natural killer (NK) cells and cytotoxic T lymphocytes (CTLs). Although immunotherapy has gained traction for neuroblastoma treatment, these immune escape mechanisms restrain clinical results. Therefore, we aimed to improve neuroblastoma immunogenicity to further the development of antigen-specific immunotherapy against neuroblastoma. We found that neuroblastoma cells significantly increase surface expression of MHC I upon exposure to active NK cells which thereby readily sensitize neuroblastoma cells for recognition by CTLs. We show that oncoprotein PRAME serves as an immunodominant antigen for neuroblastoma as NK-modulated neuroblastoma cells are recognized by PRAMESLLQHLIGL/A2-specific CTL clones. Furthermore, NK cells induce MHC I upregulation in neuroblastoma through contact-dependent secretion of IFNγ. Our results demonstrate remarkable plasticity in the peptide/MHC I surface expression of neuroblastoma cells, which is reversed when neuroblastoma cells experience innate immune attack by sensitized NK cells. These findings support the exploration of NK cells as adjuvant therapy to enforce neuroblastoma-specific CTL responses. PMID:26452036

  14. Cell-cycle phase specificity of chloroethylnitrosoureas

    International Nuclear Information System (INIS)

    Linfoot, P.A.


    Although the cancer chemotherapeutic agent 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) is considered a non-cell cycle phase specific drug, it has been shown to produce differential cell killing in G 1 , S, and G 2 /M phase cells, with S phase cells appearing relatively resistant. Studies of cell cycle phase specific cell killing produced by nitrosoureas with different chemical reactivities, clearly indicated that the ability of compounds to cross-link DNA was important in determining their phase specificity. Cells that lacked guanine O 6 -alkytransferase activity showed similar patterns of BCNU phase specificity regardless of their intrinsic sensitivity to BCNU. DNA inter-strand cross-linking, as measured by alkaline elution, was similar in cells exposed to BCNU in G 1 or S phase. 3 H [1-chloroethyl-1nitrosourea] binding to DNA was the same in G 1 , S and G 2 /M phase cells indicating that phase-specific differences in drug uptake and intracellular drug dose were not responsible for phase specific cell kill. These studies suggest that cross-link lesions, other than DNA inter-strand cross-links, and/or effects on DNA repair, other than guanine O 6 -alkyltransferase, are additional important determinants of BCNU phase specific cell killing

  15. Cloning Mice. (United States)

    Ogura, Atsuo


    Viable and fertile mice can be generated by somatic nuclear transfer into enucleated oocytes, presumably because the transplanted somatic cell genome becomes reprogrammed by factors in the oocyte. The first somatic cloned offspring of mice were obtained by directly injecting donor nuclei into recipient enucleated oocytes. When this method is used (the so-called Honolulu method of somatic cell nuclear transfer [SCNT]), the donor nuclei readily and completely condense within the enucleated metaphase II-arrested oocytes, which contain high levels of M-phase-promoting factor (MPF). It is believed that the condensation of the donor chromosomes promotes complete reprogramming of the donor genome within the mouse oocytes. Another key to the success of mouse cloning is the use of blunt micropipettes attached to a piezo impact-driving micromanipulation device. This system saves a significant amount of time during the micromanipulation of oocytes and thus minimizes the loss of oocyte viability in vitro. For example, a group of 20 oocytes can be enucleated within 10 min by an experienced operator. This protocol is composed of seven parts: (1) preparing micropipettes, (2) setting up the enucleation and injection micropipettes, (3) collecting and enucleating oocytes, (4) preparing nucleus donor cells, (5) injecting donor nuclei, (6) activating embryos and culturing, and (7) transferring cloned embryos. © 2017 Cold Spring Harbor Laboratory Press.

  16. Hand-made cloned goat (Capra hircus) embryos—a comparison of different donor cells and culture systems. (United States)

    Akshey, Yogesh S; Malakar, Dhruba; De, Arun K; Jena, Manoj K; Garg, Shweta; Dutta, Rahul; Pawar, Sachin Kumar; Mukesh, Manisha


    Nuclear transfer is a very effective method for propagation of valuable, extinct, and endangered animals. Hand-made cloning (HMC) is an efficient alternative to the conventional micromanipulator-based technique in some domestic species. The present study was carried out for the selection of suitable somatic cells as a nuclear donor and development of an optimum culture system for in vitro culture of zona-free goat cloned embryos. Cleavage and blastocyst rates were observed 72.06 ± 2.94% and 0% for fresh cumulus cells, 81.95 ± 3.40% and 12.74 ± 2.12% for cultured cumulus cells, and 92.94 ± 0.91% and 23.78 ± 3.33% for fetal fibroblast cells, respectively. There was a significant (p cloned embryos and donor cells. In conclusion, the present study describes that the fetal fibroblast cell is a suitable candidate as nuclear donor, and the flat surface culture system is suitable for zona-free blastocyst development by the hand-made cloning technique in the goat.

  17. Cloning and regulation of rat tissue inhibitor of metalloproteinases-2 in osteoblastic cells (United States)

    Cook, T. F.; Burke, J. S.; Bergman, K. D.; Quinn, C. O.; Jeffrey, J. J.; Partridge, N. C.


    Rat tissue inhibitor of metalloproteinases-2 (TIMP-2) was cloned from a UMR 106-01 rat osteoblastic osteosarcoma cDNA library. The 969-bp full-length clone demonstrates 98 and 86% sequence identity to human TIMP-2 at the amino acid and nucleic acid levels, respectively. Parathyroid hormone (PTH), at 10(-8) M, stimulates an approximately twofold increase in both the 4.2- and 1.0-kb transcripts over basal levels in UMR cells after 24 h of exposure. The PTH stimulation of TIMP-2 transcripts was not affected by the inhibitor of protein synthesis, cycloheximide (10(-5) M), suggesting a primary effect of the hormone. This is in contradistinction to regulation of interstitial collagenase (matrix metalloproteinase-1) by PTH in these same cells. Nuclear run-on assays demonstrate that PTH causes an increase in TIMP-2 transcription that parallels the increase in message levels. Parathyroid hormone, in its stimulation of TIMP-2 mRNA, appears to act through a signal transduction pathway involving protein kinase A (PKA) since the increase in TIMP-2 mRNA is reproduced by treatment with the cAMP analogue, 8-bromo-cAMP (5 x 10(-3) M). The protein kinase C and calcium pathways do not appear to be involved due to the lack of effect of phorbol 12-myristate 13-acetate (2.6 x 10(-6) M) and the calcium ionophore, ionomycin (10(-7) M), on TIMP-2 transcript abundance. In this respect, regulation of TIMP-2 and collagenase in osteoblastic cells by PTH are similar. However, we conclude that since stimulation of TIMP-2 transcription is a primary event, the PKA pathway must be responsible for a direct increase in transcription of this gene.

  18. Disease-causing mitochondrial heteroplasmy segregated within induced pluripotent stem cell clones derived from a patient with MELAS. (United States)

    Folmes, Clifford D L; Martinez-Fernandez, Almudena; Perales-Clemente, Ester; Li, Xing; McDonald, Amber; Oglesbee, Devin; Hrstka, Sybil C; Perez-Terzic, Carmen; Terzic, Andre; Nelson, Timothy J


    Mitochondrial diseases display pathological phenotypes according to the mixture of mutant versus wild-type mitochondrial DNA (mtDNA), known as heteroplasmy. We herein examined the impact of nuclear reprogramming and clonal isolation of induced pluripotent stem cells (iPSC) on mitochondrial heteroplasmy. Patient-derived dermal fibroblasts with a prototypical mitochondrial deficiency diagnosed as mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS) demonstrated mitochondrial dysfunction with reduced oxidative reserve due to heteroplasmy at position G13513A in the ND5 subunit of complex I. Bioengineered iPSC clones acquired pluripotency with multilineage differentiation capacity and demonstrated reduction in mitochondrial density and oxygen consumption distinguishing them from the somatic source. Consistent with the cellular mosaicism of the original patient-derived fibroblasts, the MELAS-iPSC clones contained a similar range of mtDNA heteroplasmy of the disease-causing mutation with identical profiles in the remaining mtDNA. High-heteroplasmy iPSC clones were used to demonstrate that extended stem cell passaging was sufficient to purge mutant mtDNA, resulting in isogenic iPSC subclones with various degrees of disease-causing genotypes. On comparative differentiation of iPSC clones, improved cardiogenic yield was associated with iPSC clones containing lower heteroplasmy compared with isogenic clones with high heteroplasmy. Thus, mtDNA heteroplasmic segregation within patient-derived stem cell lines enables direct comparison of genotype/phenotype relationships in progenitor cells and lineage-restricted progeny, and indicates that cell fate decisions are regulated as a function of mtDNA mutation load. The novel nuclear reprogramming-based model system introduces a disease-in-a-dish tool to examine the impact of mutant genotypes for MELAS patients in bioengineered tissues and a cellular probe for molecular features of individual

  19. Nuclear donor cell lines considerably influence cloning efficiency and the incidence of large offspring syndrome in bovine somatic cell nuclear transfer. (United States)

    Liu, J; Wang, Y; Su, J; Luo, Y; Quan, F; Zhang, Y


    Total five ear skin fibroblast lines (named F1, F2, F3, F4 and F5) from different newborn Holstein cows have been used as nuclear donor cells for producing cloned cows by somatic cell nuclear transfer (SCNT). The effects of these cell lines on both in vitro and in vivo developmental rates of cloned embryos, post-natal survivability and incidence of large offspring syndrome (LOS) were examined in this study. We found that the different cell lines possessed the same capacity to support pre-implantation development of cloned embryos, the cleavage and blastocyst formation rates ranged from 80.2 ± 0.9 to 84.5 ± 2.5% and 28.5 ± 0.9 to 33.3 ± 1.4%, respectively. However, their capacities to support the in vivo development of SCNT embryos showed significant differences (p cloning efficiency was significantly higher in group F5 than those in group F1, F2, F3 and F4 (9.3% vs 4.1%, 1.2%, 2.0% and 5.0%, respectively, p cloned offspring from cell line F1, F2, F3 and F4 showed LOS and gestation length delay, while all cloned offspring from F5 showed normal birthweight and gestation length. We concluded that the nuclear donor cell lines have significant impact on the in vivo development of cloned embryos and the incidence of LOS in cloned calves. © 2013 Blackwell Verlag GmbH.

  20. Delineation of canine parvovirus T cell epitopes with peripheral blood mononuclear cells and T cell clones from immunized dogs.

    NARCIS (Netherlands)

    G.F. Rimmelzwaan (Guus); M.C.M. Poelen (Martien); R.H. Meloen; J. Carlson; F.G.C.M. Uytdehaag (Fons); A.D.M.E. Osterhaus (Albert)


    textabstractThree synthetic peptides derived from the amino acid sequence of VP2 of canine parvovirus (CPV) which were recently shown to represent three distinct T cell epitopes for BALB/c mice could prime BALB/c mice for a CPV-specific proliferative T cell response upon immunization. Proliferative

  1. Analysis of the factors in determining radiosensitivity in mammalian cells by using radio-sensitive and -resistant clones isolated from HeLa S3 cells in vitro

    International Nuclear Information System (INIS)

    Nikaido, Osamu; Horikawa, Masakatsu


    The factors in determining radiosensitivity of cultured mammalian cells were analysed by using two clones each having different radiosensitivities. The radiosensitive clones were isolated from HeLa S3 cells by the N-methyl-N'-nitro-N-nitrosoguanidine (MNNG)-treatment, X-irradiation (200 R) and 5-bromodeoxyuridine (BUdR)-visible light method. On the other hand, the radioresistant clone was isolated by single X-irradiation (2000 R) from MNNG-treated HeLa S3 cell population. The radiosensitivities expressed in D sub(o) and D sub(q) values were 110 and 140 R in radiosensitive SM-1a clone and 180 and 230 R in radioresistant RM-1b clone respectively. The biological and biochemical characteristics of both clones such as the distribution of chromosome numbers, formation and rejoining of single strand breaks in DNA caused by X-irradiation, non-protein sulfhydryl (NPSH) and apparent total sulfhydryl (APSH) contents were measured. Among the characteristics analysed, different contents of NPSH in the cell were well correlated to their daiosensitivities among the original HeLa S3 cells, SM-1a and RM-1b clone. Additionally, it was found that the radioresistant L.P3 Co-3 cells isolated by Tsuboi et al. from the original mouse L.P3 cells by means of serial irradiation with 60 Co γ-rays have more abundant NPSH than the original L.P3 cells. From these results, it can be concluded that the amount of NPSH play the main role in determining radiosensitivity in cultured mammalian cells. (auth.)

  2. Cdc42-mediated tubulogenesis controls cell specification

    DEFF Research Database (Denmark)

    Kesavan, Gokul; Sand, Fredrik Wolfhagen; Greiner, Thomas Uwe


    Understanding how cells polarize and coordinate tubulogenesis during organ formation is a central question in biology. Tubulogenesis often coincides with cell-lineage specification during organ development. Hence, an elementary question is whether these two processes are independently controlled......, or whether proper cell specification depends on formation of tubes. To address these fundamental questions, we have studied the functional role of Cdc42 in pancreatic tubulogenesis. We present evidence that Cdc42 is essential for tube formation, specifically for initiating microlumen formation and later...... for maintaining apical cell polarity. Finally, we show that Cdc42 controls cell specification non-cell-autonomously by providing the correct microenvironment for proper control of cell-fate choices of multipotent progenitors. For a video summary of this article, see the PaperFlick file with the Supplemental Data...

  3. Evaluation of Antigen-Conjugated Fluorescent Beads to Identify Antigen-Specific B Cells. (United States)

    Correa, Isabel; Ilieva, Kristina M; Crescioli, Silvia; Lombardi, Sara; Figini, Mariangela; Cheung, Anthony; Spicer, James F; Tutt, Andrew N J; Nestle, Frank O; Karagiannis, Panagiotis; Lacy, Katie E; Karagiannis, Sophia N


    Selection of single antigen-specific B cells to identify their expressed antibodies is of considerable interest for evaluating human immune responses. Here, we present a method to identify single antibody-expressing cells using antigen-conjugated fluorescent beads. To establish this, we selected Folate Receptor alpha (FRα) as a model antigen and a mouse B cell line, expressing both the soluble and the membrane-bound forms of a human/mouse chimeric antibody (MOv18 IgG1) specific for FRα, as test antibody-expressing cells. Beads were conjugated to FRα using streptavidin/avidin-biotin bridges and used to select single cells expressing the membrane-bound form of anti-FRα. Bead-bound cells were single cell-sorted and processed for single cell RNA retrotranscription and PCR to isolate antibody heavy and light chain variable regions. Variable regions were then cloned and expressed as human IgG1/k antibodies. Like the original clone, engineered antibodies from single cells recognized native FRα. To evaluate whether antigen-coated beads could identify specific antibody-expressing cells in mixed immune cell populations, human peripheral blood mononuclear cells (PBMCs) were spiked with test antibody-expressing cells. Antigen-specific cells could comprise up to 75% of cells selected with antigen-conjugated beads when the frequency of the antigen-positive cells was 1:100 or higher. In PBMC pools, beads conjugated to recombinant antigens FRα and HER2 bound antigen-specific anti-FRα MOv18 and anti-HER2 Trastuzumab antibody-expressing cells, respectively. From melanoma patient-derived B cells selected with melanoma cell line-derived protein-coated fluorescent beads, we generated a monoclonal antibody that recognized melanoma antigen-coated beads. This approach may be further developed to facilitate analysis of B cells and their antibody profiles at the single cell level and to help unravel humoral immune repertoires.

  4. Evaluation of Antigen-Conjugated Fluorescent Beads to Identify Antigen-Specific B Cells

    Directory of Open Access Journals (Sweden)

    Isabel Correa


    Full Text Available Selection of single antigen-specific B cells to identify their expressed antibodies is of considerable interest for evaluating human immune responses. Here, we present a method to identify single antibody-expressing cells using antigen-conjugated fluorescent beads. To establish this, we selected Folate Receptor alpha (FRα as a model antigen and a mouse B cell line, expressing both the soluble and the membrane-bound forms of a human/mouse chimeric antibody (MOv18 IgG1 specific for FRα, as test antibody-expressing cells. Beads were conjugated to FRα using streptavidin/avidin-biotin bridges and used to select single cells expressing the membrane-bound form of anti-FRα. Bead-bound cells were single cell-sorted and processed for single cell RNA retrotranscription and PCR to isolate antibody heavy and light chain variable regions. Variable regions were then cloned and expressed as human IgG1/k antibodies. Like the original clone, engineered antibodies from single cells recognized native FRα. To evaluate whether antigen-coated beads could identify specific antibody-expressing cells in mixed immune cell populations, human peripheral blood mononuclear cells (PBMCs were spiked with test antibody-expressing cells. Antigen-specific cells could comprise up to 75% of cells selected with antigen-conjugated beads when the frequency of the antigen-positive cells was 1:100 or higher. In PBMC pools, beads conjugated to recombinant antigens FRα and HER2 bound antigen-specific anti-FRα MOv18 and anti-HER2 Trastuzumab antibody-expressing cells, respectively. From melanoma patient-derived B cells selected with melanoma cell line-derived protein-coated fluorescent beads, we generated a monoclonal antibody that recognized melanoma antigen-coated beads. This approach may be further developed to facilitate analysis of B cells and their antibody profiles at the single cell level and to help unravel humoral immune repertoires.

  5. Evaluation of Antigen-Conjugated Fluorescent Beads to Identify Antigen-Specific B Cells (United States)

    Correa, Isabel; Ilieva, Kristina M.; Crescioli, Silvia; Lombardi, Sara; Figini, Mariangela; Cheung, Anthony; Spicer, James F.; Tutt, Andrew N. J.; Nestle, Frank O.; Karagiannis, Panagiotis; Lacy, Katie E.; Karagiannis, Sophia N.


    Selection of single antigen-specific B cells to identify their expressed antibodies is of considerable interest for evaluating human immune responses. Here, we present a method to identify single antibody-expressing cells using antigen-conjugated fluorescent beads. To establish this, we selected Folate Receptor alpha (FRα) as a model antigen and a mouse B cell line, expressing both the soluble and the membrane-bound forms of a human/mouse chimeric antibody (MOv18 IgG1) specific for FRα, as test antibody-expressing cells. Beads were conjugated to FRα using streptavidin/avidin-biotin bridges and used to select single cells expressing the membrane-bound form of anti-FRα. Bead-bound cells were single cell-sorted and processed for single cell RNA retrotranscription and PCR to isolate antibody heavy and light chain variable regions. Variable regions were then cloned and expressed as human IgG1/k antibodies. Like the original clone, engineered antibodies from single cells recognized native FRα. To evaluate whether antigen-coated beads could identify specific antibody-expressing cells in mixed immune cell populations, human peripheral blood mononuclear cells (PBMCs) were spiked with test antibody-expressing cells. Antigen-specific cells could comprise up to 75% of cells selected with antigen-conjugated beads when the frequency of the antigen-positive cells was 1:100 or higher. In PBMC pools, beads conjugated to recombinant antigens FRα and HER2 bound antigen-specific anti-FRα MOv18 and anti-HER2 Trastuzumab antibody-expressing cells, respectively. From melanoma patient-derived B cells selected with melanoma cell line-derived protein-coated fluorescent beads, we generated a monoclonal antibody that recognized melanoma antigen-coated beads. This approach may be further developed to facilitate analysis of B cells and their antibody profiles at the single cell level and to help unravel humoral immune repertoires. PMID:29628923

  6. Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23

    International Nuclear Information System (INIS)

    Wang, F.; Gregory, C.D.; Rowe, M.; Rickinson, A.B.; Wang, D.; Birkenbach, M.; Kikutani, H.; Kishimoto, T.; Kieff, E.


    Epstein-Barr virus (EBV) infection of EBV-negative Burkitt lymphoma (BL) cells includes some changes similar to those seen in normal B lymphocytes that have been growth transformed by EBV. The role of individual EBV genes in this process was evaluated by introducing each of the viral genes that are normally expressed in EBV growth-transformed and latently infected lymphoblasts into an EBV-negative BL cell line, using recombinant retrovirus-mediated transfer. Clones of cells were derived that stably express the EBV nuclear antigen 1 (EBNA-1), EBNA-2, EBNA-3, EBNA-leader protein, or EBV latent membrane protein (LMP). These were compared with control clones infected with the retrovirus vector. All 10 clones converted to EBNA-2 expression differed from control clones or clones expressing other EBV proteins by growth in tight clumps and by markedly increased expression of one particular surface marker of B-cell activation, CD23. Other activation antigens were unaffected by EBNA-2 expression, as were markers already expressed on the parent BL cell line. The results indicate that EBNA-2 is a specific direct or indirect trans-activator of CD23. This establishes a link between an EBV gene and cell gene expression. Since CD23 has been implicated in the transduction of B-cell growth signals, its specific induction by EBNA-2 could be important in EBV induction of B-lymphocyte transformation

  7. [Analysis on clone in vitro and tumorigenic capacity in vivo of different subsets cells from the MCF-7 human breast cancer cell line]. (United States)

    Li, Zhi; Liu, Chun-ping; He, Yan-li; Tian, Yuan; Huang, Tao


    To investigate whether there are cancer stem cells in the MCF-7 human breast cancer cell line. Flow cytometry was applied to separate different subpopulation cells from MCF-7 cells, and their ability of clone in vitro and reconstruction tumor in vivo were determined. The ability of clone in vitro and reconstruction tumor in vivo were observed in some MCF-7 cells. Contrast with CD44+ CD24+ cells, the proportion of tumorigenic cancer cells in CD44+ CD24- cells is higher. Breast cancer stem cell exists in MCF-7 and it mainly locates the subpopulation of CD44+ CD24- cells, CD44+ CD24+ cell possibly is breast cancer progenitor cell.

  8. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA. (United States)

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong


    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  9. Differential responses to radiation and hyperthermia of cloned cell lines derived from a single human melanoma xenograft

    International Nuclear Information System (INIS)

    Rofstad, E.K.; Brustad, T.


    One uncloned and five cloned cell lines were derived from a single human melanoma xenograft. Cells from passages 7-12 were exposed to either radiation or hyperthermia (42.5 0 C, pH = 7.4) under aerobic conditions and the colony forming ability of the cells was assayed in soft agar. The five cloned lines showed individual and characteristic responses to radiation as well as to hyperthermia. The variation in the response to radiation was mainly reflected in the size of the shoulders of the survival curves rather than in the D 0 -values. The variation in the response to hyperthermia was mainly reflected in the terminal slopes of the survival curves. The survival curve of cells from the uncloned line, both when exposed to radiation and hyperthermia, was positioned in the midst of those of the cloned lines. The response of the cloned lines to radiation did not correlate with the response to hyperthermia, indicating that tumor cell subpopulations which are resistant to radiation may respond well to hyperthermia

  10. The Cloning, Characterization, and Functional Analysis of Murine Pregnancy Specific Glycoproteins (United States)


    wash at 550 C Sense AS Probe CTCCTCTCI I IrCATCTGT TCACTCATTT(AG~CACAGCCAG CTGGTACAAAGGGCTGATTG Cloni"gflllll~"gtltPsg19 5861 (AceS) 5859 ( AccAS ) 8050...12p40, iNOS, orTGF-1J mRNA. In RAW 264.7 cells, LPS upregulated mRNA expression for all cytokines examined, except for TGF- f3 mRNA. However, treatment

  11. Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency. (United States)

    Zhou, Wenli; Sadeghieh, Sanaz; Abruzzese, Ronald; Uppada, Subhadra; Meredith, Justin; Ohlrichs, Charletta; Broek, Diane; Polejaeva, Irina


    Among many factors that potentially affect somatic cell nuclear transfer (SCNT) embryo development is the donor cell itself. Cloning potentials of somatic donor cells vary greatly, possibly because the cells have different capacities to be reprogrammed by ooplasma. It is therefore intriguing to identify factors that regulate the reprogrammability of somatic donor cells. Gene expression analysis is a widely used tool to investigate underlying mechanisms of various phenotypes. In this study, we conducted a retrospective analysis investigating whether donor cell lines with distinct cloning efficiencies express different levels of genes involved in epigenetic reprogramming including histone deacetylase-1 (HDAC1), -2 (HDAC2); DNA methyltransferase-1 (DNMT1), -3a (DNMT3a),-3b (DNMT3b), and the bovine homolog of yeast sucrose nonfermenting-2 (SNF2L), a SWI/SNF family of ATPases. Cell samples from 12 bovine donor cell lines were collected at the time of nuclear transfer experiments and expression levels of the genes were measured using quantitative polymerase chain reaction (PCR). Our results show that there are no significant differences in expression levels of these genes between donor cell lines of high and low cloning efficiency defined as live calving rates, although inverse correlations are observed between in vitro embryo developmental rates and expression levels of HDAC2 and SNF2L. We also show that selection of stable reference genes is important for relative quantification, and different batches of cells can have different gene expression patterns. In summary, we demonstrate that expression levels of these epigenome regulatory genes in bovine donor cells are not correlated with cloning potential. The experimental design and data analysis method reported here can be applied to study any genes expressed in donor cells.

  12. Complementation of radiation-sensitive Ataxia telangiectasia cells after transfection of cDNA expression libraries and cosmid clones from wildtype cells

    International Nuclear Information System (INIS)

    Fritz, E.


    In this Ph.D.-thesis, phenotypic complementation of AT-cells (AT5BIVA) by transfection of cDNA-expression-libraries was adressed: After stable transfection of cDNA-expression-libraries G418 resistant clones were selected for enhanced radioresistance by a fractionated X-ray selection. One surviving transfectant clone (clone 514) exhibited enhanced radiation resistance in dose-response experiments and further X-ray selections. Cell cycle analysis revealed complementation of untreated and irradiated 514-cells in cell cycle progression. The rate of DNA synthesis, however, is not diminished after irradiation but shows the reverse effect. A transfected cDNA-fragment (AT500-cDNA) was isolated from the genomic DNA of 514-cells and proved to be an unknown DNA sequence. A homologous sequence could be detected in genomic DNA from human cell lines, but not in DNA from other species. The cDNA-sequence could be localized to human chromosome 11. In human cells the cDNA sequence is part of two large mRNAs. 4 different cosmid clones containing high molecular genomic DNA from normal human cells could be isolated from a library, each hybridizing to the AT500-cDNA. After stable transfection into AT-cells, one cosmid-clone was able to confer enhanced radiation resistance both in X-ray selections and dose-response experiments. The results indicate that the cloned cDNA-fragment is based on an unknown gene from human chromosome 11 which partially complements the radiosensitivity and the defective cell cycle progression in AT5BIVA cells. (orig.) [de

  13. Predictive mutagenesis of ligation-independent cloning (LIC) vectors for protein expression and site-specific chemical conjugation

    DEFF Research Database (Denmark)

    Vernet, Erik; Sauer, Jørgen; Andersen, Peter Andreas


    Ligation-independent cloning (LIC) allows for cloning of DNA constructs independent of insert restriction sites and ligases. However, any required mutations are typically introduced by additional, time-consuming steps. We present a rapid, inexpensive method for mutagenesis in the 5' LIC site...

  14. Quantitative Proteomics of Gut-Derived Th1 and Th1/Th17 Clones Reveal the Presence of CD28+ NKG2D- Th1 Cytotoxic CD4+ T cells. (United States)

    Riaz, Tahira; Sollid, Ludvig Magne; Olsen, Ingrid; de Souza, Gustavo Antonio


    T-helper cells are differentiated from CD4+ T cells and are traditionally characterized by inflammatory or immunosuppressive responses in contrast to cytotoxic CD8+ T cells. Mass-spectrometry studies on T-helper cells are rare. In this study, we aimed to identify the proteomes of human Th1 and Th1/Th17 clones derived from intestinal biopsies of Crohn's disease patients and to identify differentially expressed proteins between the two phenotypes. Crohn's disease is an inflammatory bowel disease, with predominantly Th1- and Th17-mediated response where cells of the "mixed" phenotype Th1/Th17 have also been commonly found. High-resolution mass spectrometry was used for protein identification and quantitation. In total, we identified 7401 proteins from Th1 and Th1/Th17 clones, where 334 proteins were differentially expressed. Major differences were observed in cytotoxic proteins that were overrepresented in the Th1 clones. The findings were validated by flow cytometry analyses using staining with anti-granzyme B and anti-perforin and by a degranulation assay, confirming higher cytotoxic features of Th1 compared with Th1/Th17 clones. By testing a larger panel of T-helper cell clones from seven different Crohn's disease patients, we concluded that only a subgroup of the Th1 cell clones had cytotoxic features, and these expressed the surface markers T-cell-specific surface glycoprotein CD28 and were negative for expression of natural killer group 2 member D. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Hope for restoration of dead valuable bulls through cloning using donor somatic cells isolated from cryopreserved semen.

    Directory of Open Access Journals (Sweden)

    Naresh L Selokar

    Full Text Available Somatic cells were isolated from cryopreserved semen of 4 buffalo bulls, 3 of which had died over 10 years earlier, and were established in culture. The cells expressed cytokeratin-18, keratin and vimentin indicating that they were of epithelial origin. The cells were used as nuclear donors for hand-made cloning for producing buffalo embryos. The blastocyst rate and quality, as indicated by apoptotic index, were comparable among embryos produced using cells obtained from fresh or frozen-thawed semen or those obtained from conventional cell sources such as skin. Examination of the epigenetic status revealed that the global level of H3K27me3 but not that of H3K9/14ac and H4K5ac differed significantly (P<0.05 among cloned embryos from different bulls. The relative mRNA abundance of HDAC1, DNMT1, P53 and CASPASE 3 but not that of DNMT3a differed in cells and in cloned embryos. Following transfer of 24 cloned embryos produced from fresh semen-derived cells to 12 recipients, one calf weighing 55 kg, which is now 6 months of age and is normal, was born through normal parturition. Following transfer of 20 embryos produced from frozen-thawed semen-derived cells to 10 recipients, 2 became pregnant, one of which aborted in the first trimester; the calf born was severely underweight (17 kg, and died 12 h after birth. The ability of cells derived from fresh and frozen-thawed semen to produce live offspring confirms the ability of these cells to be reprogrammed. Our findings pave the way for restoration of highly precious progeny-tested bulls, which has immense economic importance, and can also be used for restoration of endangered species.

  16. Cloning-free genome engineering in Sinorhizobium meliloti advances applications of Cre/loxP site-specific recombination. (United States)

    Döhlemann, Johannes; Brennecke, Meike; Becker, Anke


    The soil-dwelling α-proteobacterium Sinorhizobium meliloti serves as model for studies of symbiotic nitrogen fixation, a highly important process in sustainable agriculture. Here, we report advancements of the genetic toolbox accelerating genome editing in S. meliloti. The hsdMSR operon encodes a type-I restriction-modification (R-M) system. Transformation of S. meliloti is counteracted by the restriction endonuclease HsdR degrading DNA which lacks the appropriate methylation pattern. We provide a stable S. meliloti hsdR deletion mutant showing enhanced transformation with Escherichia coli-derived plasmid DNA and demonstrate that using an E. coli plasmid donor, expressing S. meliloti methyl transferase genes, is an alternative strategy of increasing the transformation efficiency of S. meliloti. Furthermore, we devise a novel cloning-free genome editing (CFGE) method for S. meliloti, Agrobacterium tumefaciens and Xanthomonas campestris, and demonstrate the applicability of this method for intricate applications of the Cre/lox recombination system in S. meliloti. An enhanced Cre/lox system, allowing for serial deletions of large genomic regions, was established. An assay of lox spacer mutants identified a set of lox sites mediating specific recombination. The availability of several non-promiscuous Cre recognition sites enables simultaneous specific Cre/lox recombination events. CFGE combined with Cre/lox recombination is put forward as powerful approach for targeted genome editing, involving serial steps of manipulation to expedite the genetic accessibility of S. meliloti as chassis. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Food allergen (peanut)-specific TH2 clones generated from the peripheral blood of a patient with peanut allergy

    NARCIS (Netherlands)

    Jong, E.C. de; Spanhaak, S.; Martens, B.P.M.; Kapsenberg, M.L.; Penninks, A.H.; Wierenga, E.A.


    Background: Increasing evidence indicates a prominent role of allergen-specific TH2 cells, with high IL-4 and IL-5 production and low interferon-γ production, in the regulation of IgE and eosinophil production in allergic disorders. However, most studies have concentrated on T cells reactive with

  18. Generation of a lentiviral vector producer cell clone for human Wiskott-Aldrich syndrome gene therapy

    Directory of Open Access Journals (Sweden)

    Matthew M Wielgosz

    Full Text Available We have developed a producer cell line that generates lentiviral vector particles of high titer. The vector encodes the Wiskott-Aldrich syndrome (WAS protein. An insulator element has been added to the long terminal repeats of the integrated vector to limit proto-oncogene activation. The vector provides high-level, stable expression of WAS protein in transduced murine and human hematopoietic cells. We have also developed a monoclonal antibody specific for intracellular WAS protein. This antibody has been used to monitor expression in blood and bone marrow cells after transfer into lineage negative bone marrow cells from WAS mice and in a WAS negative human B-cell line. Persistent expression of the transgene has been observed in transduced murine cells 12–20 weeks following transplantation. The producer cell line and the specific monoclonal antibody will facilitate the development of a clinical protocol for gene transfer into WAS protein deficient stem cells.

  19. Genetic subclone architecture of tumor clone-initiating cells in colorectal cancer. (United States)

    Giessler, Klara M; Kleinheinz, Kortine; Huebschmann, Daniel; Balasubramanian, Gnana Prakash; Dubash, Taronish D; Dieter, Sebastian M; Siegl, Christine; Herbst, Friederike; Weber, Sarah; Hoffmann, Christopher M; Fronza, Raffaele; Buchhalter, Ivo; Paramasivam, Nagarajan; Eils, Roland; Schmidt, Manfred; von Kalle, Christof; Schneider, Martin; Ulrich, Alexis; Scholl, Claudia; Fröhling, Stefan; Weichert, Wilko; Brors, Benedikt; Schlesner, Matthias; Ball, Claudia R; Glimm, Hanno


    A hierarchically organized cell compartment drives colorectal cancer (CRC) progression. Genetic barcoding allows monitoring of the clonal output of tumorigenic cells without prospective isolation. In this study, we asked whether tumor clone-initiating cells (TcICs) were genetically heterogeneous and whether differences in self-renewal and activation reflected differential kinetics among individual subclones or functional hierarchies within subclones. Monitoring genomic subclone kinetics in three patient tumors and corresponding serial xenografts and spheroids by high-coverage whole-genome sequencing, clustering of genetic aberrations, subclone combinatorics, and mutational signature analysis revealed at least two to four genetic subclones per sample. Long-term growth in serial xenografts and spheroids was driven by multiple genomic subclones with profoundly differing growth dynamics and hence different quantitative contributions over time. Strikingly, genetic barcoding demonstrated stable functional heterogeneity of CRC TcICs during serial xenografting despite near-complete changes in genomic subclone contribution. This demonstrates that functional heterogeneity is, at least frequently, present within genomic subclones and independent of mutational subclone differences. © 2017 Giessler et al.

  20. Production of Pigs by Hand-Made Cloning Using Mesenchymal Stem Cells and Fibroblasts. (United States)

    Yang, Zhenzhen; Vajta, Gábor; Xu, Ying; Luan, Jing; Lin, Mufei; Liu, Cong; Tian, Jianing; Dou, Hongwei; Li, Yong; Liu, Tianbin; Zhang, Yijie; Li, Lin; Yang, Wenxian; Bolund, Lars; Yang, Huanming; Du, Yutao


    Mesenchymal stem cells (MSCs) exhibited self-renewal and less differentiation, making the MSCs promising candidates for adult somatic cell nuclear transfer (SCNT). In this article, we tried to produce genome identical pigs through hand-made cloning (HMC), with MSCs and adult skin fibroblasts as donor cells. MSCs were derived from either adipose tissue or peripheral blood (aMSCs and bMSCs, respectively). MSCs usually showed the expression pattern of CD29, CD73, CD90, and CD105 together with lack of expression of the hematopoietic markers CD34and CD45. Flow cytometry results demonstrated high expression of CD29 and CD90 in both MSC lines, while CD73, CD34, and CD45 expression were not detected. In contrary, in reverse transcription-polymerase chain reaction (RT-PCR) analysis, CD73 and CD34 were detected indicating that human antibodies CD73 and CD34 were not suitable to identify porcine cell surface markers and porcine MSC cellular surface markers of CD34 might be different from other species. MSCs also had potential to differentiate successfully into chondrocytes, osteoblasts, and adipocytes. After HMC, embryos reconstructed with aMSCs had higher blastocyst rate on day 5 and 6 than those reconstructed with bMSCs and fibroblasts (29.6% ± 1.3% and 41.1% ± 1.4% for aMSCs vs. 23.9% ± 1.2% and 35.5% ± 1.6% for bMSCs and 22.1% ± 0.9% and 33.3% ± 1.1% for fibroblasts, respectively). Live birth rate per transferred blastocyst achieved with bMSCs (1.59%) was the highest among the three groups. This article was the first report to compare the efficiency among bMSCs, aMSCs, and fibroblasts for boar cloning, which offered a realistic perspective to use the HMC technology for commercial breeding.

  1. Persistence and selection of an expanded B-cell clone in the setting of rituximab therapy for Sjögren’s syndrome (United States)


    Introduction Subjects with primary Sjögren’s syndrome (SjS) have an increased risk of developing B-cell lymphoma and may harbor monoclonal B-cell expansions in the peripheral blood. Expanded B-cell clones could be pathogenic, and their persistence could exacerbate disease or predispose toward the development of lymphoma. Therapy with anti-CD20 (rituximab) has the potential to eliminate expanded B-cell clones and thereby potentially ameliorate disease. This study was undertaken to identify and track expanded B-cell clones in the blood of subjects with primary SjS who were treated with rituximab. Methods To determine whether circulating B-cell clones in subjects with primary SjS emerge or remain after B cell-depleting therapy with rituximab, we studied the antibody heavy-chain repertoire. We performed single-memory B-cell and plasmablast sorting and antibody heavy-chain sequencing in six rituximab-treated SjS subjects over the course of a 1-year follow-up period. Results Expanded B-cell clones were identified in four out of the six rituximab-treated SjS subjects, based upon the independent amplification of sequences with identical or highly similar VH, DH, and JH gene segments. We identified one SjS subject with a large expanded B-cell clone that was present prior to therapy and persisted after therapy. Somatic mutations in the clone were numerous but did not increase in frequency over the course of the 1-year follow-up, suggesting that the clone had been present for a long period of time. Intriguingly, a majority of the somatic mutations in the clone were silent, suggesting that the clone was under chronic negative selection. Conclusions For some subjects with primary SjS, these data show that (a) expanded B-cell clones are readily identified in the peripheral blood, (b) some clones are not eliminated by rituximab, and (c) persistent clones may be under chronic negative selection or may not be antigen-driven. The analysis of sequence variation among members of an

  2. Persistence and selection of an expanded B-cell clone in the setting of rituximab therapy for Sjögren's syndrome. (United States)

    Hershberg, Uri; Meng, Wenzhao; Zhang, Bochao; Haff, Nancy; St Clair, E William; Cohen, Philip L; McNair, Patrice D; Li, Ling; Levesque, Marc C; Luning Prak, Eline T


    Subjects with primary Sjögren's syndrome (SjS) have an increased risk of developing B-cell lymphoma and may harbor monoclonal B-cell expansions in the peripheral blood. Expanded B-cell clones could be pathogenic, and their persistence could exacerbate disease or predispose toward the development of lymphoma. Therapy with anti-CD20 (rituximab) has the potential to eliminate expanded B-cell clones and thereby potentially ameliorate disease. This study was undertaken to identify and track expanded B-cell clones in the blood of subjects with primary SjS who were treated with rituximab. To determine whether circulating B-cell clones in subjects with primary SjS emerge or remain after B cell-depleting therapy with rituximab, we studied the antibody heavy-chain repertoire. We performed single-memory B-cell and plasmablast sorting and antibody heavy-chain sequencing in six rituximab-treated SjS subjects over the course of a 1-year follow-up period. Expanded B-cell clones were identified in four out of the six rituximab-treated SjS subjects, based upon the independent amplification of sequences with identical or highly similar VH, DH, and JH gene segments. We identified one SjS subject with a large expanded B-cell clone that was present prior to therapy and persisted after therapy. Somatic mutations in the clone were numerous but did not increase in frequency over the course of the 1-year follow-up, suggesting that the clone had been present for a long period of time. Intriguingly, a majority of the somatic mutations in the clone were silent, suggesting that the clone was under chronic negative selection. For some subjects with primary SjS, these data show that (a) expanded B-cell clones are readily identified in the peripheral blood, (b) some clones are not eliminated by rituximab, and (c) persistent clones may be under chronic negative selection or may not be antigen-driven. The analysis of sequence variation among members of an expanded clone may provide a novel means

  3. The cell agglutination agent, phytohemagglutinin-L, improves the efficiency of somatic nuclear transfer cloning in cattle (Bos taurus). (United States)

    Du, Fuliang; Shen, Perng-Chih; Xu, Jie; Sung, Li-Ying; Jeong, B-Seon; Lucky Nedambale, Tshimangadzo; Riesen, John; Cindy Tian, X; Cheng, Winston T K; Lee, Shan-Nan; Yang, Xiangzhong


    One of the several factors that contribute to the low efficiency of mammalian somatic cloning is poor fusion between the small somatic donor cell and the large recipient oocyte. This study was designed to test phytohemagglutinin (PHA) agglutination activity on fusion rate, and subsequent developmental potential of cloned bovine embryos. The toxicity of PHA was established by examining its effects on the development of parthenogenetic bovine oocytes treated with different doses (Experiment 1), and for different durations (Experiment 2). The effective dose and duration of PHA treatment (150 microg/mL, 20 min incubation) was selected and used to compare membrane fusion efficiency and embryo development following somatic cell nuclear transfer (Experiment 3). Cloning with somatic donor fibroblasts versus cumulus cells was also compared, both with and without PHA treatment (150 microg/mL, 20 min). Fusion rate of nuclear donor fibroblasts, after phytohemagglutinin treatment, was increased from 33 to 61% (P cell nuclear donors. The nuclear transfer (NT) efficiency per oocyte used was improved following PHA treatment, for both fibroblast (13% versus 22%) as well as cumulus cells (17% versus 34%; P cloned embryos, both with and without PHA treatment, were subjected to vitrification and embryo transfer testing, and resulted in similar survival (approximately 90% hatching) and pregnancy rates (17-25%). Three calves were born following vitrification and embryo transfer of these embryos; two from the PHA-treated group, and one from non-PHA control group. We concluded that PHA treatment significantly improved the fusion efficiency of somatic NT in cattle, and therefore, increased the development of cloned blastocysts. Furthermore, within a determined range of dose and duration, PHA had no detrimental effect on embryo survival post-vitrification, nor on pregnancy or calving rates following embryo transfer.

  4. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    International Nuclear Information System (INIS)

    Robinson, Claire; Kolb, Andreas F.


    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene

  5. Establishment and characterization of a spontaneously immortalized trophoblast cell line (HPT-8) and its hepatitis B virus-expressing clone. (United States)

    Zhang, Lei; Zhang, Weilu; Shao, Chen; Zhang, Jingxia; Men, Ke; Shao, Zhongjun; Yan, Yongping; Xu, Dezhong


    Most trophoblast cell lines currently available to study vertical transmission of hepatitis B virus (HBV) are immortalized by viral transformation. Our goal was to establish and characterize a spontaneously immortalized human first-trimester trophoblast cell line and its HBV-expressing clone. Chorionic villi of Asian human first-trimester placentae were digested with trypsin and collagenase I to obtain the primary trophoblast cell culture. A spontaneously immortalized trophoblast cell line (HPT-8) was analyzed by scanning and transmission electron microscopy, cell cycle analysis, immunohistochemistry and immunofluorescence. HPT-8 cells were stably transfected with the adr subtype of HBV (HPT-8-HBV) and characterized by PCR and enzyme-linked immunosorbent assay. We obtained a clonal derivative of a spontaneously immortalized primary cell clone (HPT-8). HPT-8 cells were epithelioid and polygonal, and formed multinucleate, giant cells. They exhibited microvilli, distinct desmosomes between adjacent cells, abundant endoplasm, lipid inclusions and glycogen granules, which are all characteristic of cytotrophoblasts. HPT-8 cells expressed cytokeratin 7, cytokeratin 18, vimentin, cluster of differentiation antigen 9, epidermal growth factor receptor, stromal cell-derived factor 1 and placental alkaline phosphatase. They secreted prolactin, estradiol, progesterone and hCG, and were positive for HLA-G, a marker of extravillous trophoblasts. HPT-8-HBV cells were positive for HBV relaxed-circular, covalently closed circular DNA and pre-S sequence. HPT-8-HBV cells also produced and secreted HBV surface antigen and HBV e antigen. We established a trophoblast cell line, HPT-8 and its HBV-expressing clone which could be valuable in exploring the mechanism of HBV viral integration in human trophoblasts during intrauterine infection.

  6. Graft rejection by cytolytic T cells. Specificity of the effector mechanism in the rejection of allogeneic marrow

    International Nuclear Information System (INIS)

    Nakamura, H.; Gress, R.E.


    Cellular effector mechanisms of allograft rejection remain incompletely described. Characterizing the rejection of foreign-marrow allografts rather than solid-organ grafts has the advantage that the cellular composition of the marrow graft, as a single cell suspension, can be altered to include cellular components with differing antigen expression. Rejection of marrow grafts is sensitive to lethal doses of radiation in the mouse but resistant to sublethal levels of radiation. In an effort to identify cells mediating host resistance, lymphocytes were isolated and cloned from spleens of mice 7 days after sublethal TBI (650 cGy) and inoculation with allogeneic marrow. All clones isolated were cytolytic with specificity for MHC encoded gene products of the allogeneic marrow donor. When cloned cells were transferred in vivo into lethally irradiated (1025 cGy) recipients unable to reject allogeneic marrow, results utilizing splenic 125IUdR uptake indicated that these MHC-specific cytotoxic clones could suppress marrow proliferation. In order to characterize the effector mechanism and the ability of the clones to affect final engraftment, double donor chimeras were constructed so that 2 target cell populations differing at the MHC from each other and from the host were present in the same marrow allograft. Results directly demonstrated an ability of CTL of host MHC type to mediate graft rejection and characterized the effector mechanism as one with specificity for MHC gene products

  7. Cloning-free CRISPR

    NARCIS (Netherlands)

    Arbab, Mandana; Srinivasan, Sharanya; Hashimoto, Tatsunori; Geijsen, Niels; Sherwood, Richard I.


    We present self-cloning CRISPR/Cas9 (scCRISPR), a technology that allows for CRISPR/Cas9-mediated genomic mutation and site-specific knockin transgene creation within several hours by circumventing the need to clone a site-specific single-guide RNA (sgRNA) or knockin homology construct for each

  8. Clone-Specific Response in Leaf Nitrate Reductase Activity among Unrelated Hybrid Poplars in relation to Soil Nitrate Availability

    Directory of Open Access Journals (Sweden)

    Julien Fortier


    Full Text Available In this field study, we used in vivo NRA activity in hybrid poplar leaves as an indicator of NO3- assimilation for five unrelated hybrid poplar clones. We also examined if leaf NRA of these clones is influenced to the same extent by different levels of soil NO3- availability in two riparian agroforestry systems located in pastures. Leaf NRA differences of more than one order of magnitude were observed between the clones, clearly showing their different abilities to reduce NO3- in leaves. Clone DxN-3570, a P. deltoides x P. nigra hybrid (Aigeiros intrasectional hybrid, always had the highest leaf NRA during the field assays. This clone was also the only one to increase its leaf NRA with increasing NO3- soil availability, which resulted in a significant Site x Clone interaction and a positive relationship between soil NO3- concentration and NRA. All of the four other clones studied had one or both parental species from the Tacamahaca section. They had relatively low leaf NRA and they did not increase their leaf NRA when grown on the NO3- rich site. These results provide evidence that NO3- assimilation in leaves varies widely among hybrid poplars of different parentages, suggesting potential preferences for N forms.

  9. What is Cloning? (United States)

    Donate Home Cloning What is Cloning What is Cloning Clones are organisms that are exact genetic copies. ... clones made through modern cloning technologies. How Is Cloning Done? Many people first heard of cloning when ...

  10. Human cloning and stem cell research: engaging in the political process. (Legislation review: prohibition of Human Cloning Act 2002 and the research involving Human Embryos Act). (United States)

    Skene, Loane


    Committees appointed by governments to inquire into specific policy issues often have no further role when the Committee's report is delivered to government, but that is not always so. This paper describes the activities of members of the Australian Committee on human cloning and embryo research (the Lockhart Committee) to inform Parliament and the community about the Committee's recommendations after its report was tabled in Parliament. It explains their participation in the political process as their recommendations were debated and amending legislation was passed by Parliament. It illustrates a method of communication about scientific and policy issues that explores people's concerns and what they 'need to know' to make a judgment; and then responds to questions they raise, with the aim of facilitating discussion, not arguing for one view. The paper considers whether this type of engagement and communication is appropriate and could be used in other policy discussions.

  11. Putative storage root specific promoters from cassava and yam: cloning and evaluation in transgenic carrots as a model system. (United States)

    Arango, Jacobo; Salazar, Bertha; Welsch, Ralf; Sarmiento, Felipe; Beyer, Peter; Al-Babili, Salim


    A prerequisite for biotechnological improvements of storage roots is the availability of tissue-specific promoters enabling high expression of transgenes. In this work, we cloned two genomic fragments, pMe1 and pDJ3S, controlling the expression of a gene with unknown function from cassava (Manihot esculenta) and of the storage protein dioscorin 3 small subunit gene from yam (Dioscorea japonica), respectively. Using beta-glucuronidase as a reporter, the activities of pMe1 and pDJ3S were evaluated in independent transgenic carrot lines and compared to the constitutive CaMV35S and the previously described cassava p15 promoters. Activities of pMe1 and pDJ3S in storage roots were assessed using quantitative GUS assays that showed pDJ3S as the most active one. To determine organ specificities, uidA transcript levels in leaves, stems and roots were measured by real-time RT-PCR analyses showing highest storage root specificity for pDJ3S. Root cross sections revealed that pMe1 was highly active in secondary xylem. In contrast, pDJ3S was active in all root tissues except for the central xylem. The expression patterns caused by the cassava p15 promoter in carrot storage roots were consistent with its previously described activities for the original storage organ. Our data demonstrate that the pDJ3S and, to a lesser extent, the pMe1 regulatory sequences represent feasible candidates to drive high and preferential expression of genes in carrot storage roots.

  12. In vitro stemness characterization of radio-resistant clones isolated from a medulloblastoma cell line ONS-76

    International Nuclear Information System (INIS)

    Sun, Lue; Suzuki, Kenshi; Gerelchuluun, Ariungerel; Hong, Zhengshan; Moritake, Takashi; Zenkoh, Junko; Tsuboi, Koji; Zheng, Yun-Wen; Taniguchi, Hideki


    One-third of patients with medulloblastoma die due to recurrence after various treatments including radiotherapy. Although it has been postulated that cancer stem-like cells are radio-resistant and play an important role in tumor recurrence, the 'stemness' of medulloblastoma cells surviving irradiation has not yet been elucidated. Using a medulloblastoma cell line ONS-76, cells that survived gamma irradiation were investigated on their 'stemness' in vitro. From 10 500 cells, 20 radio-resistant clones were selected after gamma ray irradiation (5 Gy x two fractions) using the replica micro-well technique. These 20 resistant clones were screened for CD133 positivity by flow cytometry followed by side population assay, tumor sphere formation assay and clonogenic survival assay. Results revealed CD133 fractions were significantly elevated in three clones, which also exhibited significantly increased levels of tumor sphere formation ability and side population fraction. Clonogenic survival assay demonstrated that their radio-resistance was significantly higher than the parental ONS-76. This may support the hypothesis that a small number of cancer stem-like cells (CSCs) are the main culprits in local recurrence after radiotherapy, and disruption of the resistance mechanism of these CSCs is a critical future issue in improving the outcome of patients with medulloblastoma. (author)

  13. Single-cell cloning of colon cancer stem cells reveals a multi-lineage differentiation capacity

    NARCIS (Netherlands)

    Vermeulen, L.; Todaro, M.; de Sousa E Melo, F.; Sprick, M. R.; Kemper, K.; Alea, M. Perez; Richel, D. J.; Stassi, G.; Medema, J. P.


    Colon carcinoma is one of the leading causes of death from cancer and is characterized by a heterogenic pool of cells with distinct differentiation patterns. Recently, it was reported that a population of undifferentiated cells from a primary tumor, so-called cancer stem cells (CSC), can

  14. Activation of nickel-specific CD4+ T lymphocytes in the absence of professional antigen-presenting cells. (United States)

    Nasorri, Francesca; Sebastiani, Silvia; Mariani, Valentina; De Pità, Ornella; Puddu, Pietro; Girolomoni, Giampiero; Cavani, Andrea


    Allergic contact dermatitis ensues from exaggerated T cell responses to haptens. Dendritic cells are required for the initiation of hapten sensitization, but they may not be necessary for disease expression. Here we investigated the antigen-presenting cell requirement of nickel-specific CD4+ lymphocytes isolated from the blood of six allergic individuals. A significant proportion (42 out of 121; 35%) of the T cell clones proliferated in vitro to nickel also in the absence of professional antigen-presenting cells, suggesting a direct T-T hapten presentation. Antigen-presenting-cell-independent T cells showed a predominant T helper 1 phenotype. Nickel recognition by these T cells was major histocompatibility complex class II restricted, not influenced by CD28 triggering, independent from their state of activation, and did not require processing. The capacity of this T cell subset to be directly stimulated by nickel was not due to unique antigen-presenting properties, as both antigen-presenting-cell-dependent and antigen-presenting-cell-independent clones displayed comparable levels of HLA-DR, CD80, and CD86, and were equally capable of presenting nickel to antigen-presenting-cell-independent clones. In contrast, neither T cell types activated antigen-presenting-cell-dependent T lymphocytes. T-T presentation induced T cell receptor downregulation, CD25, CD80, CD86, and HLA-DR upregulation, and interferon-gamma release, although to a lesser extent compared to those induced by dendritic cell-T presentation. Following T-T presentation, the clones did not undergo unresponsiveness and maintained the capacity to respond to dendritic cells pulsed with antigen. In aggregate, our data suggest that antigen-presenting-cell-independent T cell activation can effectively amplify hapten- specific immune responses.

  15. Evaluation of porcine stem cells competence for somatic cell nuclear transfer and production of cloned animals

    DEFF Research Database (Denmark)

    Secher, Jan; Liu, Ying; Petkov, Stoyan


    Porcine somatic cell nuclear transfer (SCNT) has been used extensively to create genetically modified pigs, but the efficiency of the methodology is still low. It has been hypothesized that pluripotent or multipotent stem cells might result in increased SCNT efficacy as these cells are closer than...... somatic cells to the epigenetic state found in the blastomeres and therefore need less reprogramming. Our group has worked with porcine SCNT during the last 20 years and here we describe our experience with SCNT of 3 different stem cell lines. The porcine stem cells used were: Induced pluripotent stem...... cells (iPSCs) created by lentiviral doxycycline-dependent reprogramming and cultered with a GSK3β- and MEK-inhibitor (2i) and leukemia inhibitor factor (LIF) (2i LIF DOX-iPSCs), iPSCs created by a plasmid-based reprogramming and cultured with 2i and fibroblast growth factor (FGF) (2i FGF Pl...

  16. Cloning of cDNA sequences of a progestin-regulated mRNA from MCF7 human breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Chalbos, D; Westley, B; Alibert, C; Rochefort, H


    A cDNA clone corresponding to an mRNA regulated by the progestin R5020, has been isolated by differential screening of a cDNA library from the MCF7 breast cancer cell line, which contains estrogen and progesterone receptors. This probe hybridized with a single species of poly A + RNA of 8-kb molecular weight as shown by Northern blot analysis and could also be used to total RNA preparation. This recombinant cone hybridized specifically to an mRNA coding for a 250,000 daltons protein when translated in vitro. This protein was identical to the 250 kDa progestin-regulated protein that the authors previously described as shown by immunoprecipitation with specific rabbit polyclonal antibodies. Dose-response curve and specificity studies show that the accumulation of the Pg8 mRNA and that of the 250-kDa protein was increased by 5 to 30-fold following progestin treatment and that this effect was mediated by the progesterone receptor. Time course of induction indicated that the accumulation of mRNA was rapid and preceded that of the protein. This is the first report on a cloned cDNA probe of progestin-regulated mRNA in human cell lines.

  17. A method for the isolation and characterization of functional murine monoclonal antibodies by single B cell cloning. (United States)

    Carbonetti, Sara; Oliver, Brian G; Vigdorovich, Vladimir; Dambrauskas, Nicholas; Sack, Brandon; Bergl, Emilee; Kappe, Stefan H I; Sather, D Noah


    Monoclonal antibody technologies have enabled dramatic advances in immunology, the study of infectious disease, and modern medicine over the past 40years. However, many monoclonal antibody discovery procedures are labor- and time-intensive, low efficiency, and expensive. Here we describe an optimized mAb discovery platform for the rapid and efficient isolation, cloning and characterization of monoclonal antibodies in murine systems. In this platform, antigen-binding splenic B cells from immunized mice are isolated by FACS and cocultured with CD40L positive cells to induce proliferation and mAb production. After 12days of coculture, cell culture supernatants are screened for antigen, and IgG positivity and RNA is isolated for reverse-transcription. Positive-well cDNA is then amplified by PCR and the resulting amplicons can be cloned into ligation-independent expression vectors, which are then used directly to transfect HEK293 cells for recombinant antibody production. After 4days of growth, conditioned medium can be screened using biolayer interferometry for antigen binding and affinity measurements. Using this method, we were able to isolate six unique, functional monoclonal antibodies against an antigen of the human malaria parasite Plasmodium falciparum. Importantly, this method incorporates several important advances that circumvent the need for single-cell PCR, restriction cloning, and large scale protein production, and can be applied to a wide array of protein antigens. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Changes in cell surface structure by viral transformation studied by binding of lectins differing in sugar specificity. (United States)

    Tsuda, M; Kurokawa, T; Takeuchi, M; Sugino, Y


    Changes in cell surface structure by viral transformation were studied by examining changes in the binding of various lectins differing in carbohydrate specificities. Binding of lectins was assayed directly using cells grown in coverslips. The following 125I-lectins were used: Concanavalin-A (specific for glucose and mannose), wheat germ agglutinin (specific for N-acetylglucosamine), castor bean agglutinin (specific for galactose), Wistaria floribunda agglutinin (specific for N-acetylgalactosamine), and soybean agglutinin (specific for N-acetyl-galactosamine). Cells for a clone, SS7, transformed by bovine adenovirus type-3, were found to bind 5 to 6 times more Wistaria floribunda agglutinin than the normal counterpart cells (clone C31, from C3H mouse kidney). In contrast, the binding of soybean agglutinin, which has a sugar specificity similar to Wistaria floribunda agglutinin, to normal and transformed cells was similar. The binding of wheat germ agglutinin and castor bean agglutinin, respectively, to normal and transformed cells was also similar. However, normal cells bound twice as much concanavalin-A as transformed cells. Only half as much Wistaria floribunda agglutinin was bound to transformed cells when they had been dispersed with EDTA. These changes in the number of lectin binding sites on transformation are thought to reflect alteration of the cell surface structure. The amount of lectins bound per cell decreased with increase in cell density, especially in the case of binding of Wistaria floribunda agglutinin to normal cells.

  19. Cell-specific targeting by heterobivalent ligands. (United States)

    Josan, Jatinder S; Handl, Heather L; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M; Vagner, Josef; Mash, Eugene A; Hruby, Victor J; Gillies, Robert J


    Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach--to specifically target combinations of cell-surface receptors using heteromultivalent ligands ("receptor combination approach"). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle(4), dPhe(7)]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20-50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH(2). Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging.

  20. Hope for restoration of dead valuable bulls through cloning using donor somatic cells isolated from cryopreserved semen. (United States)

    Selokar, Naresh L; Saini, Monika; Palta, Prabhat; Chauhan, Manmohan S; Manik, Radheysham; Singla, Suresh K


    Somatic cells were isolated from cryopreserved semen of 4 buffalo bulls, 3 of which had died over 10 years earlier, and were established in culture. The cells expressed cytokeratin-18, keratin and vimentin indicating that they were of epithelial origin. The cells were used as nuclear donors for hand-made cloning for producing buffalo embryos. The blastocyst rate and quality, as indicated by apoptotic index, were comparable among embryos produced using cells obtained from fresh or frozen-thawed semen or those obtained from conventional cell sources such as skin. Examination of the epigenetic status revealed that the global level of H3K27me3 but not that of H3K9/14ac and H4K5ac differed significantly (Pcloned embryos from different bulls. The relative mRNA abundance of HDAC1, DNMT1, P53 and CASPASE 3 but not that of DNMT3a differed in cells and in cloned embryos. Following transfer of 24 cloned embryos produced from fresh semen-derived cells to 12 recipients, one calf weighing 55 kg, which is now 6 months of age and is normal, was born through normal parturition. Following transfer of 20 embryos produced from frozen-thawed semen-derived cells to 10 recipients, 2 became pregnant, one of which aborted in the first trimester; the calf born was severely underweight (17 kg), and died 12 h after birth. The ability of cells derived from fresh and frozen-thawed semen to produce live offspring confirms the ability of these cells to be reprogrammed. Our findings pave the way for restoration of highly precious progeny-tested bulls, which has immense economic importance, and can also be used for restoration of endangered species.

  1. Hope for Restoration of Dead Valuable Bulls through Cloning Using Donor Somatic Cells Isolated from Cryopreserved Semen (United States)

    Selokar, Naresh L.; Saini, Monika; Palta, Prabhat; Chauhan, Manmohan S.; Manik, Radheysham; Singla, Suresh K.


    Somatic cells were isolated from cryopreserved semen of 4 buffalo bulls, 3 of which had died over 10 years earlier, and were established in culture. The cells expressed cytokeratin-18, keratin and vimentin indicating that they were of epithelial origin. The cells were used as nuclear donors for hand-made cloning for producing buffalo embryos. The blastocyst rate and quality, as indicated by apoptotic index, were comparable among embryos produced using cells obtained from fresh or frozen-thawed semen or those obtained from conventional cell sources such as skin. Examination of the epigenetic status revealed that the global level of H3K27me3 but not that of H3K9/14ac and H4K5ac differed significantly (Pcloned embryos from different bulls. The relative mRNA abundance of HDAC1, DNMT1, P53 and CASPASE 3 but not that of DNMT3a differed in cells and in cloned embryos. Following transfer of 24 cloned embryos produced from fresh semen-derived cells to 12 recipients, one calf weighing 55 kg, which is now 6 months of age and is normal, was born through normal parturition. Following transfer of 20 embryos produced from frozen-thawed semen-derived cells to 10 recipients, 2 became pregnant, one of which aborted in the first trimester; the calf born was severely underweight (17 kg), and died 12 h after birth. The ability of cells derived from fresh and frozen-thawed semen to produce live offspring confirms the ability of these cells to be reprogrammed. Our findings pave the way for restoration of highly precious progeny-tested bulls, which has immense economic importance, and can also be used for restoration of endangered species. PMID:24614586

  2. Longevity of a Paramecium cell clone in space: Hypergravity experiments as a basis for microgravity experiments (United States)

    Kato, Yuko; Mogami, Yoshihiro; Baba, Shoji A.

    We proposed a space experiment aboard International Space Station to explore the effects of microgravity on the longevity of a Paramecium cell clone. Earlier space experiments in CYTOS and Space Lab D-1 demonstrated that Paramecium proliferated faster in space. In combination with the fact that aging process in Paramecium is largely related to the fission age, the results of the proliferation experiment in space may predict that the longevity of Paramecium decreases when measured by clock time. In preparation of the space experiment, we assessed the aging process under hypergravity, which is known to reduce the proliferation rate. As a result, the length of autogamy immaturity increased when measured by clock time, whereas it remained unchanged by fission age. It is therefore expected that autogamy immaturity in the measure of the clock time would be shortened under microgravity. Since the length of clonal life span of Paramecium is related to the length of autogamy immaturity, the result of hypergravity experiment supports the prediction that the clonal longevity of Paramecium under microgravity decreases. Effects of gravity on proliferation are discussed in terms of energetics of swimming during gravikinesis and gravitaxis of Paramecium.

  3. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.


    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  4. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.


    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  5. Altering histone acetylation status in donor cells with suberoylanilide hydroxamic acid does not affect dog cloning efficiency. (United States)

    Kim, Min Jung; Oh, Hyun Ju; Kim, Geon A; Suh, Han Na; Jo, Young Kwang; Choi, Yoo Bin; Kim, Dong Hoon; Han, Ho Jae; Lee, Byeong Chun


    Although dog cloning technology has been applied to conservation of endangered canids, propagation of elite dogs, and production of transgenic dogs, the efficiency of cloning is still very low. To help overcome this problem, we evaluated the effect of treating donor cells with suberoylanilide hydroxamic acid (SAHA), a histone deacetylase inhibitor, on dog cloning efficiency. Relative messenger RNA expressions of the bax1/bcl2 ratio and Dnmt1 in fibroblasts treated with different concentrations (0, 1, 10, 50 μM) of SAHA and durations (0, 20, 44 hours) were compared. Treatment with 1 μM for 20 hours showed significantly lower bax1/bcl2 and Dnmt1 transcript abundance. Acetylation of H3K9 was significantly increased after SAHA treatment, but H4K5, H4K8 and H4K16 were not changed. After SCNT using control or donor cells treated with SAHA, a total of 76 and 64 cloned embryos were transferred to seven and five recipients, respectively. Three fetuses were diagnosed in both control and SAHA-treated groups by ultrasonography 29 days after the embryo transfer, but there was no significant difference in the pregnancy rate (4.2% vs. 4.3%). In conclusion, although SAHA treatment as used in this study significantly decreased bax1/bcl2 and Dnmt1 transcripts of donor nuclei, as well as increased H3 acetylation, it was not enough to increase in vivo developmental competence of cloned dog embryos. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Changing T cell specificity by retroviral T cell receptor display

    NARCIS (Netherlands)

    Kessels, H. W.; van den Boom, M. D.; Spits, H.; Hooijberg, E.; Schumacher, T. N.


    The diversity of the T cell receptor (TCR) repertoire is limited, because of the processes of positive and negative T cell selection. To obtain T cells with specificities beyond the immune system's capacity, we have developed a strategy for retroviral TCR display. In this approach, a library of T

  7. Effect of selenium compounds on murine B16 melanoma cells and pigmented cloned pB16 cells

    International Nuclear Information System (INIS)

    Siwek, B.; Bahbouth, E.; Serra, M.A.; Sabbioni, E.; Pauw-Gillet, M.C. de; Bassleer, R.


    The effects of selenium compounds such as sodium selenite, sodium selenate, seleno-DL-cystine and seleno-DL-methionine (100 μM and 10 μM) on B16 and pigmented cloned pB 16 murine melanoma cells were investigated in vitro. At the tested concentrations, B16 cells showed a greater sensitivity to the toxic effects of sodium selenite and seleno-DL-cystine than pB 16 cells, whereas no decrease of B 16 and pB 16 cell number was observed after incubation with sodium selenate or seleno-DL-methionine. Glutathione (GSH) percentages were strongly decreased only by selenite and seleno-DL-cystine; it was marked more in B 16 than in pB 16 cells. The pretreatment of B 16 cells with a GSH depleting agent (10 μM buthionine-[S,R]-sulfoximine) did not significantly influence the cytotoxic effects of selenite and seleno-DL-cystine. On both cell populations. GSH preincubation (50 μM) enhanced the cytotoxicity of selenite whereas the survival of seleno-DL-cystine treated cells was increased. Glutathione peroxidase (GSH-Px) activity in B 16 cells was more sensitive than in pB 16 cells to the activating effect of selenite, and particularly of seleno-DL-cystine; however, cell-free controls indicated that activation was mainly due to glutathione reductase. The rate of 75 Se (as sodium selenite) uptake in both cell populations was maximal within the first hour of incubation, with a preferential accumulation in the cytosol; after 24 h of incubation, the amount of 75 Se in cytosol and pellet was approximately the same. Gel filtration chromatography of lysed cells after incubation for 6 h with 10 μM 75 Se-selenite showed that the radioactivity was eluted as two peaks corresponding to low (4-9 kDa) and high (280-320 kDa) molecular weights. Possible toxicological mechanisms are discussed at molecular level. (orig./MG)

  8. PAF-receptor is preferentially expressed in a distinct synthetic phenotype of smooth muscle cells cloned from human internal thoracic artery: Functional implications in cell migration

    International Nuclear Information System (INIS)

    Stengel, Dominique; O'Neil, Caroline; Brocheriou, Isabelle; Karabina, Sonia-Athina; Durand, Herve; Caplice, Noel M.; Pickering, J. Geoffrey; Ninio, Ewa


    Platelet-activating-Factor (PAF) and its structural analogues formed upon low density lipoprotein oxidation are involved in atherosclerotic plaque formation and may signal through PAF-receptor (PAF-R) expressed in human macrophages and in certain smooth muscle cells (SMCs) in the media, but rarely in the intima of human plaques. Our aim was to determine which SMC phenotype expresses PAF-R and whether this receptor is functional in cell migration. Circulating SMC progenitors and two phenotypically distinct clones of proliferative, epithelioid phenotype vs contractile, spindle-shaped SMCs from the media of adult internal thoracic artery were studied for the presence of PAF-receptor (PAF-R). The levels of specific mRNA were obtained by reverse transcription/real-time PCR, the protein expression was deduced from immunohistochemistry staining, and the functional transmigration assay was performed by Boyden chamber-type chemotaxis assay. Only SMCs of spindle-shape and synthetic phenotype expressed both mRNA and PAF-R protein and in the functional test migrated at low concentrations of PAF. Two unrelated, specific PAF-R antagonists inhibited PAF-induced migration, but did not modify the migration initiated by PDGF. The presence of functional PAF-R in arterial spindle-shaped SMCs of synthetic phenotype may be important for their migration from the media into the intima and atherosclerotic plaques formation

  9. Cell swelling activates cloned Ca(2+)-activated K(+) channels: a role for the F-actin cytoskeleton

    DEFF Research Database (Denmark)

    Jorgensen, Nanna K; Pedersen, Stine F; Rasmussen, Hanne B


    Cloned Ca(2+)-activated K(+) channels of intermediate (hIK) or small (rSK3) conductance were expressed in HEK 293 cells, and channel activity was monitored using whole-cell patch clamp. hIK and rSK3 currents already activated by intracellular calcium were further increased by 95% and 125......%, respectively, upon exposure of the cells to a 33% decrease in extracellular osmolarity. hIK and rSK3 currents were inhibited by 46% and 32%, respectively, by a 50% increase in extracellular osmolarity. Cell swelling and channel activation were not associated with detectable increases in [Ca(2+)](i), evidenced...... by population and single-cell measurements. In addition, inhibitors of IK and SK channels significantly reduced the rate of regulatory volume decrease (RVD) in cells expressing these channels. Cell swelling induced a decrease, and cell shrinkage an increase, in net cellular F-actin content. The swelling...

  10. Production of cloned NIBS (Nippon Institute for Biological Science) and α-1, 3-galactosyltransferase knockout MGH miniature pigs by somatic cell nuclear transfer using the NIBS breed as surrogates (United States)

    Shimatsu, Yoshiki; Yamada, Kazuhiko; Horii, Wataru; Hirakata, Atsushi; Sakamoto, Yuji; Waki, Shiori; Sano, Junichi; Saitoh, Toshiki; Sahara, Hisashi; Shimizu, Akira; Yazawa, Hajime; Sachs, David H.; Nunoya, Tetsuo


    Background Nuclear transfer (NT) technologies offer a means for producing the genetically modified pigs necessary to develop swine models for mechanistic studies of disease processes as well as to serve as organ donors for xenotransplantation. Most previous studies have used commercial pigs as surrogates. Method and Results In this study, we established a cloning technique for miniature pigs by somatic cell nuclear transfer (SCNT) using Nippon Institute for Biological Science (NIBS) miniature pigs as surrogates. Moreover, utilizing this technique, we have successfully produced an α-1, 3-galactosyltransferase knockout (GalT-KO) miniature swine. Fibroblasts procured from a NIBS miniature pig fetus were injected into 1312 enucleated oocytes. The cloned embryos were transferred to 11 surrogates of which five successfully delivered 13 cloned offspring; the production efficiency was 1.0% (13/1312). In a second experiment, lung fibroblasts obtained from neonatal GalT-KO MGH miniature swine were used as donor cells and 1953 cloned embryos were transferred to 12 surrogates. Six cloned offspring were born from five surrogates, a production efficiency of 0.3% (6/1953). Conclusions These results demonstrate successful establishment of a miniature pig cloning technique by SCNT using NIBS miniature pigs as surrogates. To our knowledge, this is the first demonstration of successful production of GalT-KO miniature swine using miniature swine surrogates. This technique could help to ensure a stable supply of the cloned pigs through the use of miniature pig surrogates and could expand production in countries with limited space or in facilities with special regulations such as specific pathogen-free or good laboratory practice. PMID:23581451

  11. Cloned, CD117 selected human amniotic fluid stem cells are capable of modulating the immune response.

    Directory of Open Access Journals (Sweden)

    Emily C Moorefield

    Full Text Available Amniotic fluid stem (AFS cells are broadly multipotent, can be expanded extensively in culture, are not tumorigenic and can be readily cryopreserved for cell banking. Mesenchymal stem cells (MSC show immunomodulatory activity and secrete a wide spectrum of cytokines and chemokines that suppress inflammatory responses, block mixed lymphocyte reactions (MLR and other immune reactions, and have proven therapeutic against conditions such as graft-versus-host disease. AFS cells resemble MSCs in many respects including surface marker expression and differentiation potential. We therefore hypothesized that AFS cells may exhibit similar immunomodulatory capabilities. We present data to demonstrate that direct contact with AFS cells inhibits lymphocyte activation. In addition, we show that cell-free supernatants derived from AFS cells primed with total blood monocytes or IL-1β, a cytokine released by monocytes and essential in mediation of the inflammatory response, also inhibited lymphocyte activation. Further investigation of AFS cell-free supernatants by protein array revealed secretion of multiple factors in common with MSCs that are known to be involved in immune regulation including growth related oncogene (GRO and monocyte chemotactic protein (MCP family members as well as interleukin-6 (IL-6. AFS cells activated by PBMCs released several additional cytokines as compared to BM-MSCs, including macrophage inflammatory protein-3α (MIP-3α, MIP-1α and Activin. AFS cells also released higher levels of MCP-1 and lower levels of MCP-2 compared to BM-MSCs in response to IL-1β activation. This suggests that there may be some AFS-specific mechanisms of inhibition of lymphocyte activation. Our results indicate that AFS cells are able to suppress inflammatory responses in vitro and that soluble factors are an essential component in the communication between lymphocytes and AFS cells. Their extensive self-renewal capacity, possibility for banking and

  12. Monolayer culturing and cloning of human pluripotent stem cells on laminin-521-based matrices under xeno-free and chemically defined conditions. (United States)

    Rodin, Sergey; Antonsson, Liselotte; Hovatta, Outi; Tryggvason, Karl


    A robust method for culturing human pluripotent stem (hPS) cells under chemically defined and xeno-free conditions is an important tool for stem cell research and for the development of regenerative medicine. Here, we describe a protocol for monolayer culturing of Oct-4-positive hPS cells on a specific laminin-521 (LN-521) isoform, under xeno-free and chemically defined conditions. The cells are dispersed into single-cell suspension and then plated on LN-521 isoform at densities higher than 5,000 cells per cm², where they attach, migrate and survive by forming small monolayer cell groups. The cells avidly divide and expand horizontally until the entire dish is covered by a confluent monolayer. LN-521, in combination with E-cadherin, allows cloning of individual hPS cells in separate wells of 96-well plates without the presence of rho-associated protein kinase (ROCK) inhibitors or any other inhibitors of anoikis. Characterization of cells maintained for several months in culture reveals pluripotency with a minimal degree of genetic abnormalities.

  13. Characterization of the env gene and long terminal repeat of molecularly cloned Friend mink cell focus-inducing virus DNA.


    Adachi, A; Sakai, K; Kitamura, N; Nakanishi, S; Niwa, O; Matsuyama, M; Ishimoto, A


    The highly oncogenic erythroleukemia-inducing Friend mink cell focus-inducing (MCF) virus was molecularly cloned in phage lambda gtWES.lambda B, and the DNA sequences of the env gene and the long terminal repeat were determined. The nucleotide sequences of Friend MCF virus and Friend spleen focus-forming virus were quite homologous, supporting the hypothesis that Friend spleen focus-forming virus might be generated via Friend MCF virus from an ecotropic Friend virus mainly by some deletions. ...

  14. Genomewide analyses of pathogenic and regulatory T cells of NOD ...

    Indian Academy of Sciences (India)


    Two regulatory T cell clones (Tregs) were used in this study. Treg1 cells were clone-derived from the previously described. Keywords. methylation; cDNA microarray; type 1 diabetes; pathogenic T cells; .... Gender-specific differences in.

  15. Learning LM Specificity for Ganglion Cells (United States)

    Ahumada, Albert J.


    Unsupervised learning models have been proposed based on experience (Ahumada and Mulligan, 1990;Wachtler, Doi, Lee and Sejnowski, 2007) that allow the cortex to develop units with LM specific color opponent receptive fields like the blob cells reported by Hubel and Wiesel on the basis of visual experience. These models used ganglion cells with LM indiscriminate wiring as inputs to the learning mechanism, which was presumed to occur at the cortical level.

  16. Cloning of fusion protein gene of Newcastle disease virus into a baculovirus derived bacmid shuttle vector, in order to express it in insect cell line

    Directory of Open Access Journals (Sweden)

    Hashemzadeh MS


    Full Text Available Abstract Background: Newcastle disease virus (NDV is one of the major pathogens in poultry and vaccination is intended to control the disease, as an effective solution, yet. Fusion protein (F on surface of NDV, has a fundamental role in virus pathogenicity and can induce protective immunity, alone. With this background, here our aim was to construct a baculovirus derived recombinant bacmid shuttle vector (encoding F-protein in order to express it in insect cell line. Materials and Methods: In this experimental study, at first complete F gene from avirulent strain La Sota of NDV was amplified by RT-PCR to produce F cDNA. The amplicon was cloned into T/A cloning vector and afterwards into pFastBac Dual donor plasmid. After the verification of cloning process by two methods, PCR and enzymatic digestion analysis, the accuracy of F gene sequence was confirmed by sequencing. Finally, F-containing recombinant bacmid was subsequently generated in DH10Bac cell and the construct production was confirmed by a special PCR panel, using F specific primers and M13 universal primers. Results: Analysis of confirmatory tests showed that the recombinant bacmid, expressing of F-protein gene in correct sequence and framework, has been constructed successfully. Conclusion: The product of this F-containing recombinant bacmid, in addition to its independent application in the induction of protective immunity, can be used with the other individual recombinant baculoviruses, expressing HN and NP genes to produce NDV-VLPs in insect cell line.

  17. Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs

    International Nuclear Information System (INIS)

    Travis, G.H.; Sutcliffe, J.G.


    To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, the authors developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA

  18. A Seminar on Human Cloning: Cloning in Reproductive Medicine


    Illmensee, Karl


    This review article summarizes the historical development of mammalian cloning, presents current advances and presumed risk factors in the field of reproductive cloning, discusses possible clinical applications of therapeutic and diagnostic cloning and outlines prospective commercial trends in pharmacytical cloning. Predictable progress in biotechnology and stem cell engineering should prove to be advantageous for patients' health and for novel benefits in reproductive and regenerative medicine.

  19. Th1-like human T-cell clones recognizing Leishmania gp63 inhibit Leishmania major in human macrophages

    DEFF Research Database (Denmark)

    Kemp, M; Hey, A S; Bendtzen, K


    The major surface protease of Leishmania major, gp63, has been suggested as a vaccine candidate for cutaneous leishmaniasis. In this study gp63 was purified from L. major promastigotes. A panel of human T-cell clones recognizing this protein were generated from individuals who had previously had...... resembling Th1 cells. Autologous mononuclear cells and Epstein-Barr virus-transformed B cell lines were equally efficient in presenting the antigen to the T cells. The gp63 reactive T cells induced resistance to infection in cultured human macrophages by L. major. The data confirm that human CD4+ T cells...... recognizing gp63 can take part in the host defence against L. major infections....

  20. The role of Ca2+ and Mg2+ in the cytotoxic T lymphocyte reaction and in the secretion of N alpha-benzyloxycarbonyl-L-lysine thiobenzyl ester-serine esterase by human T cell clones

    NARCIS (Netherlands)

    Blanchard, D.; Aubry, J. P.; de Vries, J. E.; Spits, H.


    Human T cell clones contain enzymes that can cleave the substrate N-alpha-benzyloxycarbonyl-L-lysine thiobenzyl ester (BLT). All CTL clones tested in this study secreted BLT-serine esterase activity, whereas only one of three tested non-cytolytic T cell clones secreted this enzymatic activity upon

  1. Specific single-cell isolation and genomic amplification of uncultured microorganisms

    DEFF Research Database (Denmark)

    Kvist, Thomas; Ahring, Birgitte Kiær; Lasken, R.S.


    We in this study describe a new method for genomic studies of individual uncultured prokaryotic organisms, which was used for the isolation and partial genome sequencing of a soil archaeon. The diversity of Archaea in a soil sample was mapped by generating a clone library using group-specific pri......We in this study describe a new method for genomic studies of individual uncultured prokaryotic organisms, which was used for the isolation and partial genome sequencing of a soil archaeon. The diversity of Archaea in a soil sample was mapped by generating a clone library using group......-specific primers in combination with a terminal restriction fragment length polymorphism profile. Intact cells were extracted from the environmental sample, and fluorescent in situ hybridization probing with Cy3-labeled probes designed from the clone library was subsequently used to detect the organisms...... of interest. Single cells with a bright fluorescent signal were isolated using a micromanipulator and the genome of the single isolated cells served as a template for multiple displacement amplification (MDA) using the Phi29 DNA polymerase. The generated MDA product was afterwards used for 16S rRNA gene...

  2. Antigen-Specificity of T Cell Infiltrates in Biopsies With T Cell-Mediated Rejection and BK Polyomavirus Viremia: Analysis by Next Generation Sequencing. (United States)

    Zeng, G; Huang, Y; Huang, Y; Lyu, Z; Lesniak, D; Randhawa, P


    This study interrogates the antigen-specificity of inflammatory infiltrates in renal biopsies with BK polyomavirus (BKPyV) viremia (BKPyVM) with or without allograft nephropathy (BKPyVN). Peripheral blood mononuclear cells (PBMC) from five healthy HLA-A0101 subjects were stimulated by peptides derived from the BKPYV proteome or polymorphic regions of HLA. Next generation sequencing of the T cell-receptor complementary DNA was performed on peptide-stimulated PBMC and 23 biopsies with T cell-mediated rejection (TCMR) or BKPyVN. Biopsies from patients with BKPyVM or BKVPyVN contained 7.7732 times more alloreactive than virus-reactive clones. Biopsies with TCMR also contained BKPyV-specific clones, presumably a manifestation of heterologous immunity. The mean cumulative T cell clonal frequency was 0.1378 for alloreactive clones and 0.0375 for BKPyV-reactive clones. Samples with BKPyVN and TCMR clustered separately in dendrograms of V-family and J-gene utilization patterns. Dendrograms also revealed that V-gene, J-gene, and D-gene usage patterns were a function of HLA type. In conclusion, biopsies with BKPyVN contain abundant allospecific clones that exceed the number of virus-reactive clones. The T cell component of tissue injury in viral nephropathy appears to be mediated primarily by an "innocent bystander" mechanism in which the principal element is secondary T cell influx triggered by both antiviral and anti-HLA immunity. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

  3. Cloning and Characterization of a Cell Senescence Gene for Breast Cancer Cells (United States)


    have already established the inducible expression system in a retroviral vector for these studies. F. References 1. Hayflick , L. (1965). The limited ...CLASSIFICATION 18. SECURITY CLASSIFICATION 19. SECURITY CLASSIFICATION 20. LIMITATION OF ABSTRACT OF REPORT OF THIS PAGE OFABSTRACT Unclassified...13-14 Annual report A. Introduction Normal diploid mammalian cells display a limited proliferative life span in culture (1-3

  4. Inhibition of clone formation as an assay for T cell-mediated cytotoxicity: short-term kinetics and comparison with 51Cr release

    International Nuclear Information System (INIS)

    Lees, R.K.; MacDonald, H.R.; Sinclair, N.R.; University of Western Ontario London


    The short-term kinetics of T cell-mediated cytotoxicity was investigated using a cloning inhibition assay. Murine cytotoxic thymus-derived lymphocytes generated in vitro in mixed leukocyte cultures were incubated for various periods of time at 37degC with allogeneic mastocytoma target cells. The mixtures were then plated in soft agar, and mastocytoma clone formation was assessed after 5-7 days incubation. Using this technique, it was demonstrated that events leading to the loss of cloning ability could be detected after 1-3 min incubation at 37degC, and after 20-30 min, 95% of the clone forming cells had been inactivated. When these results were compared directly with those obtained using the conventional 51 Cr-release assay, it was found that the events leading to loss of cloning ability occurred more rapidly than indicated by the isotope assay. However, a modification of the 51 Cr-release assay involving EDTA addition gave comparable result to the cloning inhibition assay. These results raise the possibility that the events leading to 51 Cr-release of tumor target cells may be related in time to those leading to the loss of cloning ability

  5. Human cloning: can it be made safe? (United States)

    Rhind, Susan M; Taylor, Jane E; De Sousa, Paul A; King, Tim J; McGarry, Michelle; Wilmut, Ian


    There are continued claims of attempts to clone humans using nuclear transfer, despite the serious problems that have been encountered in cloning other mammals. It is known that epigenetic and genetic mechanisms are involved in clone failure, but we still do not know exactly how. Human reproductive cloning is unethical, but the production of cells from cloned embryos could offer many potential benefits. So, can human cloning be made safe?

  6. Effect of calf death loss on cloned cattle herd derived from somatic cell nuclear transfer: clones with congenital defects would be removed by the death loss. (United States)

    Watanabe, Shinya


    To increase public understanding on cloned cattle derived from somatic cell nuclear transfer (SCNT), the present review describes the effect of calf death loss on an SCNT cattle herd. The incidence of death loss in SCNT cattle surviving more than 200 days reached the same level as that in conventionally bred cattle. This process could be considered as removal of SCNT cattle with congenital defects caused by calf death loss. As a result of comparative studies of SCNT cattle and conventionally bred cattle, the substantial equivalences in animal health status, milk and meat productive performance have been confirmed. Both sexes of SCNT cattle surviving to adulthood were fertile and their reproductive performance, including efficiency of progeny production, was the same as that in conventionally bred cattle. The presence of substantial equivalence between their progeny and conventionally bred cattle also existed. Despite these scientific findings, the commercial use of food products derived from SCNT cattle and their progeny has not been allowed by governments for reasons including the lack of public acceptance of these products and the low efficiency of animal SCNT. To overcome this situation, communication of the low risk of SCNT technology and research to improve SCNT efficiency are required. © 2013 Japanese Society of Animal Science.

  7. Significant improvement of pig cloning efficiency by treatment with LBH589 after somatic cell nuclear transfer. (United States)

    Jin, Jun-Xue; Li, Suo; Gao, Qing-Shan; Hong, Yu; Jin, Long; Zhu, Hai-Ying; Yan, Chang-Guo; Kang, Jin-Dan; Yin, Xi-Jun


    The low success rate of animal cloning by somatic cell nuclear transfer (SCNT) associates with epigenetic aberrancy, including the abnormal acetylation of histones. Altering the epigenetic status by histone deacetylase inhibitors (HDACi) enhances the developmental potential of SCNT embryos. In the current study, we examined the effects of LBH589 (panobinostat), a novel broad-spectrum HDACi, on the nuclear reprogramming and development of pig SCNT embryos in vitro. In experiment 1, we compared the in vitro developmental competence of nuclear transfer embryos treated with different concentrations of LBH589. Embryos treated with 50 nM LBH589 for 24 hours showed a significant increase in the rate of blastocyst formation compared with the control or embryos treated with 5 or 500 nM LBH589 (32.4% vs. 11.8%, 12.1%, and 10.0%, respectively, P < 0.05). In experiment 2, we examined the in vitro developmental competence of nuclear transfer embryos treated with 50 nM LBH589 for various intervals after activation and 6-dimethylaminopurine. Embryos treated for 24 hours had higher rates of blastocyst formation than the other groups. In experiment 3, when the acetylation of H4K12 was examined in SCNT embryos treated for 6 hours with 50 nM LBH589 by immunohistochemistry, the staining intensities of these proteins in LBH589-treated SCNT embryos were significantly higher than in the control. In experiment 4, LBH589-treated nuclear transfer and control embryos were transferred into surrogate mothers, resulting in three (100%) and two (66.7%) pregnancies, respectively. In conclusion, LBH589 enhances the nuclear reprogramming and developmental potential of SCNT embryos by altering the epigenetic status and expression, and increasing blastocyst quality. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.

  8. Cell-Specific Aptamers as Emerging Therapeutics

    Directory of Open Access Journals (Sweden)

    Cindy Meyer


    Full Text Available Aptamers are short nucleic acids that bind to defined targets with high affinity and specificity. The first aptamers have been selected about two decades ago by an in vitro process named SELEX (systematic evolution of ligands by exponential enrichment. Since then, numerous aptamers with specificities for a variety of targets from small molecules to proteins or even whole cells have been selected. Their applications range from biosensing and diagnostics to therapy and target-oriented drug delivery. More recently, selections using complex targets such as live cells have become feasible. This paper summarizes progress in cell-SELEX techniques and highlights recent developments, particularly in the field of medically relevant aptamers with a focus on therapeutic and drug-delivery applications.

  9. Quantifying type-specific reproduction numbers for nosocomial pathogens: evidence for heightened transmission of an Asian sequence type 239 MRSA clone.

    Directory of Open Access Journals (Sweden)

    Ben S Cooper

    Full Text Available An important determinant of a pathogen's success is the rate at which it is transmitted from infected to susceptible hosts. Although there are anecdotal reports that methicillin-resistant Staphylococcus aureus (MRSA clones vary in their transmissibility in hospital settings, attempts to quantify such variation are lacking for common subtypes, as are methods for addressing this question using routinely-collected MRSA screening data in endemic settings. Here we present a method to quantify the time-varying transmissibility of different subtypes of common bacterial nosocomial pathogens using routine surveillance data. The method adapts approaches for estimating reproduction numbers based on the probabilistic reconstruction of epidemic trees, but uses relative hazards rather than serial intervals to assign probabilities to different sources for observed transmission events. The method is applied to data collected as part of a retrospective observational study of a concurrent MRSA outbreak in the United Kingdom with dominant endemic MRSA clones (ST22 and ST36 and an Asian ST239 MRSA strain (ST239-TW in two linked adult intensive care units, and compared with an approach based on a fully parametric transmission model. The results provide support for the hypothesis that the clones responded differently to an infection control measure based on the use of topical antiseptics, which was more effective at reducing transmission of endemic clones. They also suggest that in one of the two ICUs patients colonized or infected with the ST239-TW MRSA clone had consistently higher risks of transmitting MRSA to patients free of MRSA. These findings represent some of the first quantitative evidence of enhanced transmissibility of a pandemic MRSA lineage, and highlight the potential value of tailoring hospital infection control measures to specific pathogen subtypes.

  10. Consumers' attitudes toward consumption of cloned beef. The impact of exposure to technological information about animal cloning. (United States)

    Aizaki, Hideo; Sawada, Manabu; Sato, Kazuo


    Novel food technologies, such as cloning, have been introduced into the meat production sector; however, their use is not widely supported by many consumers. This study was designed to assess whether Japanese consumers' attitudes toward consumption of cloned beef (specifically, beef derived from bovine embryo and somatic cell-cloned cattle) would change after they were provided with technological information on animal cloning through a web-based survey. The results revealed that most respondents did not discriminate between their attitudes toward the consumption of the two types of cloned beef, and that most respondents did not change their attitudes toward cloned beef after receiving the technological information. The respondents' individual characteristics, including their knowledge about the food safety of cloned beef and their basic knowledge about animal cloning, influenced the likelihood of a change in their attitudes after they received the information. In conclusion, some consumers might become less uncomfortable about the consumption of cloned beef by the straightforward provision of technological information about animal cloning; however, most consumers are likely to maintain their attitudes. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Long-term effect on in vitro cloning efficiency after treatment of somatic cells with Xenopus egg extract in the pig. (United States)

    Liu, Ying; Ostrup, Olga; Li, Rong; Li, Juan; Vajta, Gábor; Kragh, Peter M; Schmidt, Mette; Purup, Stig; Hyttel, Poul; Klærke, Dan; Callesen, Henrik


    In somatic cell nuclear transfer (SCNT), donor cell reprogramming is considered as a biologically important and vulnerable event. Various donor cell pre-treatments with Xenopus egg extracts can promote reprogramming. Here we investigated if the reprogramming effect of one treatment with Xenopus egg extract on donor cells was maintained for several cell passages. The extract treatment resulted in increased cell-colony formation from early passages in treated porcine fibroblasts (ExTES), and increased development of cloned embryos. Partial dedifferentiation was observed in ExTES cells, shown as a tendency towards upregulation of NANOG, c-MYC and KLF-4 and downregulation of DESMIM compared with ExTES at Passage 2. Compared with our routine SCNT, continuously increased development of cloned embryos was observed in the ExTES group, and ExTES cloned blastocysts displayed hypermethylated DNA patterns and hypermethylation of H3K4me3 and H3K27me3 in ICM compared with TE. All seven recipients became pregnant after transferral of ExTES cloned embryos and gave birth to 7-22 piglets per litter (average 12). In conclusion, our results demonstrate that one treatment of porcine fibroblasts with Xenopus egg extract can result in long-term increased ability of the cells to promote their in vitro function in subsequent SCNT. Finally these cells can also result in successful development of cloned embryos to term.

  12. A plasma cell differentiation quality control ablates B cell clones with biallelic Ig rearrangements and truncated Ig production. (United States)

    Srour, Nivine; Chemin, Guillaume; Tinguely, Aurélien; Ashi, Mohamad Omar; Oruc, Zéliha; Péron, Sophie; Sirac, Christophe; Cogné, Michel; Delpy, Laurent


    Aberrantly rearranged immunoglobulin (Ig) alleles are frequent. They are usually considered sterile and innocuous as a result of nonsense-mediated mRNA decay. However, alternative splicing can yield internally deleted proteins from such nonproductively V(D)J-rearranged loci. We show that nonsense codons from variable (V) Igκ exons promote exon-skipping and synthesis of V domain-less κ light chains (ΔV-κLCs). Unexpectedly, such ΔV-κLCs inhibit plasma cell (PC) differentiation. Accordingly, in wild-type mice, rearrangements encoding ΔV-κLCs are rare in PCs, but frequent in B cells. Likewise, enforcing expression of ΔV-κLCs impaired PC differentiation and antibody responses without disturbing germinal center reactions. In addition, PCs expressing ΔV-κLCs synthesize low levels of Ig and are mostly found among short-lived plasmablasts. ΔV-κLCs have intrinsic toxic effects in PCs unrelated to Ig assembly, but mediated by ER stress-associated apoptosis, making PCs producing ΔV-κLCs highly sensitive to proteasome inhibitors. Altogether, these findings demonstrate a quality control checkpoint blunting terminal PC differentiation by eliminating those cells expressing nonfunctionally rearranged Igκ alleles. This truncated Ig exclusion (TIE) checkpoint ablates PC clones with ΔV-κLCs production and exacerbated ER stress response. The TIE checkpoint thus mediates selection of long-lived PCs with limited ER stress supporting high Ig secretion, but with a cost in terms of antigen-independent narrowing of the repertoire. © 2016 Srour et al.

  13. Cloning of smac gene and its overexpression effects on radiosensitivity of HeLa cells to γ-rays

    International Nuclear Information System (INIS)

    Zhao Baofeng; Tian Mei; Lei Hongwei; Su Xu


    Objective: To clone smac gene and construct eukaryocytic expression vector pcDNA3.1/ smac. The smac gene was transfected into HeLa cells to explore the effects of over-expression of extrinsic smac gene on radiosensitivity to γ-rays of HeLa cells. Methods: The full-length smac gene was amplified from total RNA of HeLa cells by RTPCR. The RTPCR product was ligated with the vector pcDNA3.1 and sequenced. The correct pcDNA3.1/smac was transfected into HeLa cells. The expression of smac gene was tested by RTPCR and Western blot. The cellular growth inhibition rates were evaluated by MTT 48 horns after irradiation with different doses of γ-rays. Results: Recombinant eukaryocytic expression vector pcDNA3.1/smac was successfully constructed. RTPCR and Western blot results indicated that the expression of smac gene of HeLa/smac cells was significantly enhanced compared with the expression of smac gene of HeLa/pcDNA3.1 and HeLa cells. 48 hours after different doses of γ-ray irradiation was significantly higher in pcDNA3.1/smac transfected HeLa/smac cells than those of non-transfected HeLa cells or pcDNA3.1 transfected HeLa/pcDNA3.1 cells, inhabitation rates were 38.85%, 17.64% and 20.32%, respectively. Conclusions: smac gene was successfully cloned. Extrinsic smac gene over-expression could significantly enhance radiosensitivity to γ-ray of HeLa cells, which would herald a new approach to improve radiosensitivity of cervical cancer. (authors)

  14. Therapeutic cloning: The ethical limits

    International Nuclear Information System (INIS)

    Whittaker, Peter A.


    A brief outline of stem cells, stem cell therapy and therapeutic cloning is given. The position of therapeutic cloning with regard to other embryonic manipulations - IVF-based reproduction, embryonic stem formation from IVF embryos and reproductive cloning - is indicated. The main ethically challenging stages in therapeutic cloning are considered to be the nuclear transfer process including the source of eggs for this and the destruction of an embryo to provide stem cells for therapeutic use. The extremely polarised nature of the debate regarding the status of an early human embryo is noted, and some potential alternative strategies for preparing immunocompatible pluripotent stem cells are indicated

  15. Functional pharmacology of cloned heterodimeric GABA-B receptors expressed in mammalian cells

    DEFF Research Database (Denmark)

    Bräuner-Osborne, Hans; Krogsgaard-Larsen, P


    reported in different tissues, and this study thus provides a functional assay of cloned GABAB receptors which should be a valuable tool for further characterization of GABAB ligands. Finally, we can conclude that the functional pharmacological profiles of the two GABABR1 splice variants are very similar....

  16. Interclonal variations in the molecular karyotype of Trypanosoma cruzi: chromosome rearrangements in a single cell-derived clone of the G strain. (United States)

    Lima, Fabio Mitsuo; Souza, Renata Torres; Santori, Fábio Rinaldo; Santos, Michele Fernandes; Cortez, Danielle Rodrigues; Barros, Roberto Moraes; Cano, Maria Isabel; Valadares, Helder Magno Silva; Macedo, Andréa Mara; Mortara, Renato Arruda; da Silveira, José Franco


    Trypanosoma cruzi comprises a pool of populations which are genetically diverse in terms of DNA content, growth and infectivity. Inter- and intra-strain karyotype heterogeneities have been reported, suggesting that chromosomal rearrangements occurred during the evolution of this parasite. Clone D11 is a single-cell-derived clone of the T. cruzi G strain selected by the minimal dilution method and by infecting Vero cells with metacyclic trypomastigotes. Here we report that the karyotype of clone D11 differs from that of the G strain in both number and size of chromosomal bands. Large chromosomal rearrangement was observed in the chromosomes carrying the tubulin loci. However, most of the chromosome length polymorphisms were of small amplitude, and the absence of one band in clone D11 in relation to its reference position in the G strain could be correlated to the presence of a novel band migrating above or below this position. Despite the presence of chromosomal polymorphism, large syntenic groups were conserved between the isolates. The appearance of new chromosomal bands in clone D11 could be explained by chromosome fusion followed by a chromosome break or interchromosomal exchange of large DNA segments. Our results also suggest that telomeric regions are involved in this process. The variant represented by clone D11 could have been induced by the stress of the cloning procedure or could, as has been suggested for Leishmania infantum, have emerged from a multiclonal, mosaic parasite population submitted to frequent DNA amplification/deletion events, leading to a 'mosaic' structure with different individuals having differently sized versions of the same chromosomes. If this is the case, the variant represented by clone D11 would be better adapted to survive the stress induced by cloning, which includes intracellular development in the mammalian cell. Karyotype polymorphism could be part of the T. cruzi arsenal for responding to environmental pressure.

  17. Cloning and characterisation of a putative pollen-specific polygalacturonase gene (CpPG1) differentially regulated during pollen development in zucchini (Cucurbita pepo L.). (United States)

    Carvajal, F; Garrido, D; Jamilena, M; Rosales, R


    Studies in zucchini (Cucurbita pepo L. spp. pepo) pollen have been limited to the viability and morphology of the mature pollen grain. The enzyme polygalacturonase (PG) is involved in pollen development and pollination in many species. In this work, we study anther and pollen development of C. pepo and present the cloning and characterisation of a putative PG CpPG1 (Accession no. HQ232488) from pollen cDNA in C. pepo. The predicted protein for CpPG1 has 416 amino acids, with a high homology to other pollen PGs, such as P22 from Oenothera organensis (76%) and PGA3 from Arabidopsis thaliana (73%). CpPG1 belongs to clade C, which comprises PGs expressed in pollen, and presents a 34 amino acid signal peptide for secretion towards the cell wall. DNA-blot analysis revealed that there are at least another two genes that code for PGs in C. pepo. The spatial and temporal accumulation of CpPG1 was studied by semi-quantitative- and qRT-PCR. In addition, mRNA was detected only in anthers, pollen and the rudimentary anthers of bisexual flowers (only present in some zucchini cultivars under certain environmental conditions that trigger anther development in the third whorl of female flowers). However, no expression was detected in cotyledons, stem or fruit. Furthermore, CpPG1 mRNA was accumulated throughout anther development, with the highest expression found in mature pollen. Similarly, exo-PG activity increased from immature anther stages to mature anthers and mature pollen. Overall, these data support the pollen specificity of this gene and suggest an involvement of CpPG1 in pollen development in C. pepo. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  18. Suppression induction in vivo by a T helper clone?

    DEFF Research Database (Denmark)

    Crispe, I N; Owens, T


    We have previously described a helper T cell clone which augments in vivo cytotoxic T cell responses when injected at 10(4) cells per mouse, but not at 10(5) per mouse (Crispe, I. N. et al., Immunology 1984. 52:55). To test whether this dose-response relationship was due to the induction...... of suppression, naive syngeneic mice were injected with 10(5) cloned T helper cells, and their spleen cells were subsequently assayed for suppressive activity in adoptive transfer experiments. Lymphocytes from such mice indeed suppressed an antigen-specific cytotoxic response, but only in the presence...... of the same T helper cell clone freshly added at the time of adoptive transfer. On this basis we argue that the distinction between T helper cell activity and T suppressor-inducer activity corresponds to differences in cell numbers, rather than to two separate cell lineages....

  19. Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes (United States)

    Throop, Andrea L.; LaBaer, Joshua


    The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

  20. Clip, connect, clone

    DEFF Research Database (Denmark)

    Fujima, Jun; Lunzer, Aran; Hornbæk, Kasper


    using three mechanisms: clipping of input and result elements from existing applications to form cells on a spreadsheet; connecting these cells using formulas, thus enabling result transfer between applications; and cloning cells so that multiple requests can be handled side by side. We demonstrate...

  1. Diversity in host clone performance within a Chinese hamster ovary cell line. (United States)

    O'Callaghan, Peter M; Berthelot, Maud E; Young, Robert J; Graham, James W A; Racher, Andrew J; Aldana, Dulce


    Much effort has been expended to improve the capabilities of individual Chinese hamster ovary (CHO) host cell lines to synthesize recombinant therapeutic proteins (rPs). However, given the increasing variety in rP molecular types and formats it may be advantageous to employ a toolbox of CHO host cell lines in biomanufacturing. Such a toolbox would contain a panel of hosts with specific capabilities to synthesize certain molecular types at high volumetric concentrations and with the correct product quality (PQ). In this work, we examine a panel of clonally derived host cell lines isolated from CHOK1SV for the ability to manufacture two model proteins, an IgG4 monoclonal antibody (Mab) and an Fc-fusion protein (etanercept). We show that these host cell lines vary in their relative ability to synthesize these proteins in transient and stable pool production format. Furthermore, we examined the PQ attributes of the stable pool-produced Mab and etanercept (by N-glycan ultra performance liquid chromatography (UPLC) and liquid chromatography - tandem mass spectrometry (LC-MS/MS), respectively), and uncovered substantial variation between the host cell lines in Mab N-glycan micro-heterogeneity and etanercept N and O-linked macro-heterogeneity. To further investigate the capabilities of these hosts to act as cell factories, we examined the glycosylation pathway gene expression profiles as well as the levels of endoplasmic reticulum (ER) and mitochondria in the untransfected hosts. We uncovered a moderate correlation between ER mass and the volumetric product concentration in transient and stable pool Mab production. This work demonstrates the utility of leveraging diversity within the CHOK1SV pool to identify new host cell lines with different performance characteristics. © 2015 American Institute of Chemical Engineers.

  2. Production of rhesus monkey cloned embryos expressing monomeric red fluorescent protein by interspecies somatic cell nuclear transfer

    International Nuclear Information System (INIS)

    Zhu, Hai-Ying; Kang, Jin-Dan; Li, Suo; Jin, Jun-Xue; Hong, Yu; Jin, Long; Guo, Qing; Gao, Qing-Shan; Yan, Chang-Guo; Yin, Xi-Jun


    Highlights: • Rhesus monkey cells were electroporated with a plasmid containing mRFP1, and an mRFP1-expressing cell line was generated. • For the first time, mRFP1-expressing rhesus monkey cells were used as donor cells for iSCNT. • The effect of VPA on the development of embryos cloned using iSCNT was determined. - Abstract: Interspecies somatic cell nuclear transfer (iSCNT) is a promising method to clone endangered animals from which oocytes are difficult to obtain. Monomeric red fluorescent protein 1 (mRFP1) is an excellent selection marker for transgenically modified cloned embryos during somatic cell nuclear transfer (SCNT). In this study, mRFP-expressing rhesus monkey cells or porcine cells were transferred into enucleated porcine oocytes to generate iSCNT and SCNT embryos, respectively. The development of these embryos was studied in vitro. The percentage of embryos that underwent cleavage did not significantly differ between iSCNT and SCNT embryos (P > 0.05; 71.53% vs. 80.30%). However, significantly fewer iSCNT embryos than SCNT embryos reached the blastocyst stage (2.04% vs. 10.19%, P < 0.05). Valproic acid was used in an attempt to increase the percentage of iSCNT embryos that developed to the blastocyst stage. However, the percentages of embryos that underwent cleavage and reached the blastocyst stage were similar between untreated iSCNT embryos and iSCNT embryos treated with 2 mM valproic acid for 24 h (72.12% vs. 70.83% and 2.67% vs. 2.35%, respectively). These data suggest that porcine-rhesus monkey interspecies embryos can be generated that efficiently express mRFP1. However, a significantly lower proportion of iSCNT embryos than SCNT embryos reach the blastocyst stage. Valproic acid does not increase the percentage of porcine-rhesus monkey iSCNT embryos that reach the blastocyst stage. The mechanisms underling nuclear reprogramming and epigenetic modifications in iSCNT need to be investigated further

  3. Production of rhesus monkey cloned embryos expressing monomeric red fluorescent protein by interspecies somatic cell nuclear transfer

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Hai-Ying; Kang, Jin-Dan; Li, Suo; Jin, Jun-Xue; Hong, Yu; Jin, Long; Guo, Qing; Gao, Qing-Shan; Yan, Chang-Guo; Yin, Xi-Jun, E-mail:


    Highlights: • Rhesus monkey cells were electroporated with a plasmid containing mRFP1, and an mRFP1-expressing cell line was generated. • For the first time, mRFP1-expressing rhesus monkey cells were used as donor cells for iSCNT. • The effect of VPA on the development of embryos cloned using iSCNT was determined. - Abstract: Interspecies somatic cell nuclear transfer (iSCNT) is a promising method to clone endangered animals from which oocytes are difficult to obtain. Monomeric red fluorescent protein 1 (mRFP1) is an excellent selection marker for transgenically modified cloned embryos during somatic cell nuclear transfer (SCNT). In this study, mRFP-expressing rhesus monkey cells or porcine cells were transferred into enucleated porcine oocytes to generate iSCNT and SCNT embryos, respectively. The development of these embryos was studied in vitro. The percentage of embryos that underwent cleavage did not significantly differ between iSCNT and SCNT embryos (P > 0.05; 71.53% vs. 80.30%). However, significantly fewer iSCNT embryos than SCNT embryos reached the blastocyst stage (2.04% vs. 10.19%, P < 0.05). Valproic acid was used in an attempt to increase the percentage of iSCNT embryos that developed to the blastocyst stage. However, the percentages of embryos that underwent cleavage and reached the blastocyst stage were similar between untreated iSCNT embryos and iSCNT embryos treated with 2 mM valproic acid for 24 h (72.12% vs. 70.83% and 2.67% vs. 2.35%, respectively). These data suggest that porcine-rhesus monkey interspecies embryos can be generated that efficiently express mRFP1. However, a significantly lower proportion of iSCNT embryos than SCNT embryos reach the blastocyst stage. Valproic acid does not increase the percentage of porcine-rhesus monkey iSCNT embryos that reach the blastocyst stage. The mechanisms underling nuclear reprogramming and epigenetic modifications in iSCNT need to be investigated further.

  4. Academic Cloning. (United States)

    Sikula, John P.; Sikula, Andrew F.


    The authors define "cloning" as an integral feature of all educational systems, citing teaching practices which reward students for closely reproducing the teacher's thoughts and/or behaviors and administrative systems which tend to promote like-minded subordinates. They insist, however, that "academic cloning" is not a totally…

  5. Production of a cloned calf from a fetal fibroblast cell line

    Directory of Open Access Journals (Sweden)

    Mello M.R.B.


    Full Text Available The present study examined the in vitro and in vivo development of bovine nuclear-transferred embryos. A bovine fetal fibroblast culture was established and used as nucleus donor. Slaughterhouse oocytes were matured in vitro for 18 h before enucleation. Enucleated oocytes were fused with fetal fibroblasts with an electric stimulus and treated with cytochalasin D and cycloheximide for 1 h followed by cycloheximide alone for 4 h. Reconstructed embryos were cultured for 7-9 days and those which developed to blastocysts were transferred to recipient cows. Of 191 enucleated oocytes, 83 (43.5% were successfully fused and 24 (28.9% developed to blastocysts. Eighteen freshly cloned blastocysts were transferred to 14 recipients, 5 (27.8% of which were pregnant on day 35 and 3 (16.7% on day 90. Of the three cows that reached the third trimester, one recipient died of hydrallantois 2 months before term, one aborted fetus was recovered at 8 months of gestation, and one delivered by cesarian section a healthy cloned calf. Today, the cloned calf is 15 months old and presents normal body development (378 kg and sexual behavior (libido and semen characteristics.

  6. The effect of vapour pressure deficit on stomatal conductance, sap pH and leaf-specific hydraulic conductance in Eucalyptus globulus clones grown under two watering regimes. (United States)

    Hernandez, Maria Jose; Montes, Fernando; Ruiz, Federico; Lopez, Gustavo; Pita, Pilar


    Stomatal conductance has long been considered of key interest in the study of plant adaptation to water stress. The expected increase in extreme meteorological events under a climate change scenario may compromise survival in Eucalyptus globulus plantations established in south-western Spain. We investigated to what extent changes in stomatal conductance in response to high vapour pressure deficits and water shortage are mediated by hydraulic and chemical signals in greenhouse-grown E. globulus clones. Rooted cuttings were grown in pots and submitted to two watering regimes. Stomatal conductance, shoot water potential, sap pH and hydraulic conductance were measured consecutively in each plant over 4 weeks under vapour pressure deficits ranging 0·42 to 2·25 kPa. Evapotranspiration, growth in leaf area and shoot biomass were also determined. There was a significant effect of both clone and watering regime in stomatal conductance and leaf-specific hydraulic conductance, but not in sap pH. Sap pH decreased as water potential and stomatal conductance decreased under increasing vapour pressure deficit. There was no significant relationship between stomatal conductance and leaf-specific hydraulic conductance. Stomata closure precluded shoot water potential from falling below -1·8 MPa. The percentage loss of hydraulic conductance ranged from 40 to 85 %. The highest and lowest leaf-specific hydraulic conductances were measured in clones from the same half-sib families. Water shortage reduced growth and evapotranspiration, decreases in evapotranspiration ranging from 14 to 32 % in the five clones tested. Changes in sap pH seemed to be a response to changes in atmospheric conditions rather than soil water in the species. Stomata closed after a considerable amount of hydraulic conductance was lost, although intraspecific differences in leaf-specific hydraulic conductance suggest the possibility of selection for improved productivity under water-limiting conditions

  7. Role of cloned carotenoid genes expressed in Escherichia coli in protecting against inactivation by near-UV light and specific phototoxic molecules

    International Nuclear Information System (INIS)

    Tuveson, R.W.; Larson, R.A.; Kagan, J.


    Genes controlling carotenoid synthesis were cloned from Erwinia herbicola and expressed in an Escherichia coli strain. Carotenoids protect against high fluences of near-UV (NUV; 320 to 400 nm) but not against far-UV (200-300 nm). Protection of E. coli cells was not observed following treatment with either psoralen or 8-methoxypsoralen plus NUV. However, significant protection of cells producing carotenoids was observed with three photosensitizing molecules activated by NUV (alpha-terthienyl, harmine, and phenylheptatriyne) which are thought to have the membrane as an important lethal target. Protection of carotenoid-producing cells against inactivation was not observed with acridine orange plus visible light but was seen with toluidine blue O plus visible light

  8. Revisiting the identification and cDNA cloning of T cell-replacing factor/interleukin-5

    Directory of Open Access Journals (Sweden)

    Kiyoshi eTakatsu


    Full Text Available This is a perspective based on the paper Cloning of complementary DNA encoding T cell replacing factor and identity with B cell growth factor II, by Kinashi T, Harada N, Severinson E, Tanabe T, Sideras P, Konishi M, Azuma C, Tominaga A, Bergstedt-Lindqvist S, Takahashi M, Matsuda F, Yaoita Y, Takatsu K, and Honjo, T. Nature (1986 32(6092: 70-3. We have been interested in understanding the molecular basis of T-B cell cooperation for antibody formation. Although many investigators had described a number of different soluble factors that appeared to have biological relevance to T-B cell interactions, molecular basis of such active substances remained unknown for a long period of time. In this perspective, I will briefly summarize the history of the initial discovery of T cell-replacing factor/B cell growth factor II that appeared to be involved in B-cell growth and differentiation, and outline the discovery and characterization of interleukin-5. Studies of interleukin-5 have provided strong evidence that a single cytokine exerts a variety of activities on diverse target cells.

  9. Transgenic mammalian species, generated by somatic cell cloning, in biomedicine, biopharmaceutical industry and human nutrition/dietetics--recent achievements. (United States)

    Samiec, M; Skrzyszowska, M


    Somatic cell cloning technology in mammals promotes the multiplication of productively-valuable genetically engineered individuals, and consequently allows also for standardization of transgenic farm animal-derived products, which, in the context of market requirements, will have growing significance. Gene farming is one of the most promising areas in modern biotechnology. The use of live bioreactors for the expression of human genes in the lactating mammary gland of transgenic animals seems to be the most cost-effective method for the production/processing of valuable recombinant therapeutic proteins. Among the transgenic farm livestock species used so far, cattle, goats, sheep, pigs and rabbits are useful candidates for the expression of tens to hundreds of grams of genetically-engineered proteins or xenogeneic biopreparations in the milk. At the beginning of the new millennium, a revolution in the treatment of disease is taking shape due to the emergence of new therapies based on recombinant human proteins. The ever-growing demand for such pharmaceutical or nutriceutical proteins is an important driving force for the development of safe and large-scale production platforms. The aim of this paper is to present an overall survey of the state of the art in investigations which provide the current knowledge for deciphering the possibilities of practical application of the transgenic mammalian species generated by somatic cell cloning in biomedicine, the biopharmaceutical industry, human nutrition/dietetics and agriculture.

  10. cDNA cloning and expression of a human platelet-derived growth factor (PDGF) receptor specific for B-chain-containing PDGF molecules

    International Nuclear Information System (INIS)

    Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.


    The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA

  11. Survival and mutation in clones derived from V79 Chinese hamster cells irradiated with multiple small exposures to far-UV and mid-UV

    International Nuclear Information System (INIS)

    Ikebuchi, M.; Osmak, M.; Hill, C.


    Clones were isolated from U81 and N80 cells that were established by irradiation of Chinese hamster V79-M12G cells on a once a day schedule with 81 and 80 fractions of 6 J m/sup -2/ far-UV and 150 Jm/sup -2/ mid-UV (UV-B), respectively. These clones were examined for UV sensitivity to cell lethality and induction of mutations at 6TG/sup r/ (resistance to 6-thioguanine) and Oua/sup R/ (resistance to ouabain) loci. Survival curves for these clones indicate that their UV sensitivities to lethality vary from that of M12G cells to that of U81 and N80 parental cells. Clones also show heterogeneity for mutability to mid-UV: For induction of 6TG/sup r/, for example, non-mutable (U814), hypomutable (U815) and hypermutable (U811) were isolated from U81 cells. The authors are investigating by chromosome analysis and repair experiments why resistance to far-UV and mid-UV cell killing in these cells appears to be induced but the resulting survivors have a heterogeneous response to mutation induction by further doses of UV light

  12. In vitro oocyte culture and somatic cell nuclear transfer used to produce a live-born cloned goat. (United States)

    Ohkoshi, Katsuhiro; Takahashi, Seiya; Koyama, Shin-Ichiro; Akagi, Satoshi; Adachi, Noritaka; Furusawa, Tadashi; Fujimoto, Jun-Ichiro; Takeda, Kumiko; Kubo, Masanori; Izaike, Yoshiaki; Tokunaga, Tomoyuki


    The use of an in vitro culture system was examined for production of somatic cells suitable for nuclear transfer in the goat. Goat cumulus-oocyte complexes were incubated in tissue culture medium TCM-199 supplemented with 10% fetal bovine serum (FBS) for 20 h. In vitro matured (IVM) oocytes were enucleated and used as karyoplast recipients. Donor cells obtained from the anterior pituitary of an adult male were introduced into the perivitelline space of enucleated IVM oocytes and fused by an electrical pulse. Reconstituted oocytes were cultured in chemically defined medium for 9 days. Two hundred and twenty-eight oocytes (70%) were fused with donor cells. After in vitro culture, seven somatic cell nuclear transfer (SCNT) oocytes (3%) developed to the blastocyst stage. SCNT embryos were transferred to the oviducts of recipient females (four 8-cell embryos per female) or uterine horn (two blastocysts per female). One male clone (NT1) was produced at day 153 from an SCNT blastocyst and died 16 days after birth. This study demonstrates that nuclear transferred goat oocytes produced using an in vitro culture system could develop to term and that donor anterior pituitary cells have the developmental potential to produce term offspring. In this study, it suggested that the artificial control of endocrine system in domestic animal might become possible by the genetic modification to anterior pituitary cells.

  13. Increased blastocyst formation of cloned porcine embryos produced with donor cells pre-treated with Xenopus egg extract and/or digitonin

    DEFF Research Database (Denmark)

    Liu, Ying; Østrup, Olga; Li, Juan


    from Xenopus laevis eggs. In Experiment 1, fetal fibroblasts were permeabilized by digitonin, incubated in egg extract and, after re-sealing of cell membranes, cultured for 3 or 5 days before use as donor cells in handmade cloning (HMC). Controls were produced by HMC with non-treated donor cells....... The blastocyst rate for reconstructed embryos increased significantly when digitonin-permeabilized, extract-treated cells were used after 5 days of culture after re-sealing. In Experiment 2, fetal and adult fibroblasts were treated with digitonin alone before re-sealing the cell membranes, then cultured for 3...... cells after pre-treatment with permeabilization/re-sealing and Xenopus egg extract. Interestingly, we observe a similar increase in cloning efficiency by permeabilization/re-sealing of donor cells without extract treatment that seems to depend on choice of donor cell type. Thus, pre-treatment of donor...

  14. Cloning and characterization of rat density-enhanced phosphatase-1, a protein tyrosine phosphatase expressed by vascular cells. (United States)

    Borges, L G; Seifert, R A; Grant, F J; Hart, C E; Disteche, C M; Edelhoff, S; Solca, F F; Lieberman, M A; Lindner, V; Fischer, E H; Lok, S; Bowen-Pope, D F


    We have cloned from cultured vascular smooth muscle cells a protein tyrosine phosphatase, rat density-enhanced phosphatase-1 (rDEP-1), which is a probable rat homologue of DEP-1/HPTP eta. rDEP-1 is encoded by an 8.7-kb transcript and is expressed as a 180- to 220-kD protein. The rDEP-1 gene is located on human chromosome 11 (region p11.2) and on mouse chromosome 2 (region 2E). The cDNA sequence predicts a transmembrane protein consisting of a single phosphatase catalytic domain in the intracellular region, a single transmembrane domain, and eight fibronectin type III repeats in the extracellular region (GenBank accession number U40790). In situ hybridization analysis demonstrates that rDEP-1 is widely expressed in vivo but that expression is highest in cells that form epithelioid monolayers. In cultured cells with epitheliod morphology, including endothelial cells and newborn smooth muscle cells, but not in fibroblast-like cells, rDEP-1 transcript levels are dramatically upregulated as population density increases. In vivo, quiescent endothelial cells in normal arteries express relatively high levels of rDEP-1. During repair of vascular injury, expression of rDEP-1 is downregulated in migrating and proliferating endothelial cells. In vivo, rDEP-1 transcript levels are present in very high levels in megakaryocytes, and circulating plates have high levels of the rDEP-1 protein. In vitro, initiation of differentiation of the human megakaryoblastic cell line CHRF-288-11 with phorbol 12-myristate 13-acetate leads to a very strong upregulation of rDEP-1 transcripts. The deduced structure and the regulation of expression of rDEP-1 suggest that it may play a role in adhesion and/or signaling events involving cell-cell and cell-matrix contact.

  15. Molecular cloning and tissue-specific transcriptional regulation of the first peroxidase family member, Udp1, in stinging nettle (Urtica dioica). (United States)

    Douroupi, Triantafyllia G; Papassideri, Issidora S; Stravopodis, Dimitrios J; Margaritis, Lukas H


    A full-length cDNA clone, designated Udp1, was isolated from Urtica dioica (stinging nettle), using a polymerase chain reaction based strategy. The putative Udp1 protein is characterized by a cleavable N-terminal signal sequence, likely responsible for the rough endoplasmic reticulum entry and a 310 amino acids mature protein, containing all the important residues, which are evolutionary conserved among different members of the plant peroxidase family. A unique structural feature of the Udp1 peroxidase is defined into the short carboxyl-terminal extension, which could be associated with the vacuolar targeting process. Udp1 peroxidase is differentially regulated at the transcriptional level and is specifically expressed in the roots. Interestingly, wounding and ultraviolet radiation stress cause an ectopic induction of the Udp1 gene expression in the aerial parts of the plant. A genomic DNA fragment encoding the Udp1 peroxidase was also cloned and fully sequenced, revealing a structural organization of three exons and two introns. The phylogenetic relationships of the Udp1 protein to the Arabidopsis thaliana peroxidase family members were also examined and, in combination with the homology modelling approach, dictated the presence of distinct structural elements, which could be specifically involved in the determination of substrate recognition and subcellular localization of the Udp1 peroxidase.

  16. The effect of cell passage on the susceptibility of BALB/3T3 clone A31-1-1 cells to 3-methylcholanthrene-induced morphological transformation. (United States)

    Sheu, C W; Moreland, F M; Dunkel, V C


    The response of BALB/3T3 clone A31-1-1 cells to chemically induced morphological transformation was evaluated using 3-methylcholanthrene (MCA). Stock cultures were initiated from cryopreserved cells, grown in T25 flasks containing 5 ml of medium, and replated at subconfluency. Serially transferred cells were then subjected to transformation assay. After 24-hr seeding, cells were incubated 48 hr with MCA in a 5% CO2 incubator. They were then rinsed and incubated for an additional 4 weeks with twice weekly medium change. Type III foci were scored after fixation and staining with Giemsa. With serial passage from the frozen state, cells of passages 3-14 had a low level of spontaneous transformation; zero to 6 type III foci per 20 dishes were counted. In the MCA-treated cultures the number of transformed foci, however, increased with passage. Such passage-related sensitivity to MCA was demonstrated for cells cultured in two batches of sera: one from MA Bioproducts (Lot no. 2E052) and the other from Armour Pharmaceuticals (Lot no. Y65801). The passage-related increase in number of transformed foci was not related to doubling time, cloning efficiency, or MCA-induced growth inhibition.

  17. A cell clone strain from Mythimna separata (Lepidoptera: Noctuidae) highly susceptible to Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and M. separata NPV (MsNPV). (United States)

    Meng, Xiang-Qian; Zheng, Gui-Ling; Zhao, Chuan-De; Wan, Fang-Hao; Li, Chang-You


    In this study, we describe a cell line, Ms-10C, cloned from the line QAU-Ms-E-10 (simplified Ms-10), an embryonic line from Mythimna separata. The cloned cell line was significantly more sensitive to nucleopolyhedrovirus (NPV). Ms-10C cells were mainly spherical with a diameter of 14.42 ± 2.23 μm. DNA amplification fingerprinting (DAF) confirmed the profile of PCR-amplified bands of the cloned cell line was consistent with those of the parental cell line, Ms-10. The sequencing result of the mitochondrial cytochrome c oxidase I (mtCO I) fragment confirmed that the amplified 636-bps mtCOI fragment was 100% identical to that of M. separata. Its chromosomes exhibited the typical characters of lepidopteran cell lines. Its population doubling time was 42.2 h at 27°C. Ms-10C was more sensitive than Ms-10 to both Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and M. separata nucleopolyhedrovirus (MsNPV). At 4 d post infection, the infection rates of two viruses reached 94.2 and 92.3%, respectively. The availability of this cell clone strain will provide a useful tool for the basic research on nucleopolyhedrovirus and for potential application in expression of recombinant proteins with baculovirus expression vector system.

  18. Why Clone? (United States)

    ... than expected. Could we really clone dinosaurs? In theory? Yes. You would need: A well-preserved source ... it raises a number of ethical, legal, and social challenges that need to be considered. The vast ...

  19. Virus-Specific T Cells: Broadening Applicability. (United States)

    Barrett, A John; Prockop, Susan; Bollard, Catherine M


    Virus infection remains an appreciable cause of morbidity and mortality after hematopoietic stem cell transplantation (HSCT). Although pharmacotherapy and/or antibody therapy may help prevent or treat viral disease, these drugs are expensive, toxic, and often ineffective due to primary or secondary resistance. Further, effective treatments are limited for many infections (eg, adenovirus, BK virus), which are increasingly detected after alternative donor transplants. These deficiencies in conventional therapeutics have increased interest in an immunotherapeutic approach to viral disorders, leading to adoptive transfer of virus-specific cytotoxic T lymphocytes (VSTs), which can rapidly reconstitute antiviral immunity post-transplantation without causing graft-versus-host disease. This review will explore how the VST field has improved outcomes for many patients with life-threatening viral infections after HSCT, and how to broaden applicability beyond the "patient-specific" products, as well as extending to other viral diseases even outside the context of HSCT. Copyright © 2017 The American Society for Blood and Marrow Transplantation. All rights reserved.

  20. Cloning and Characterization of Sf9 Cell Lamin and the Lamin Conformational Changes during Autographa californica multiple nucleopolyhedrovirus Infection

    Directory of Open Access Journals (Sweden)

    Wenqiang Wei


    Full Text Available At present, the details of lamina alterations after baculovirus infection remain elusive. In this study, a lamin gene in the Sf9 cell line of Spodoptera frugiperda was cloned. The open reading frame (orf of the Sf9 lamin was 1860 bp and encoded a protein with a molecular weight of 70 kDa. A transfection assay with a red fluorescence protein (rfp-lamin fusion protein indicated that Sf9 lamin was localized in the nuclear rim. Transmission electron microscopy observations indicated that Autographa californica multiple nucleopolyhedrovirus (AcMNPV nucleocapsids may pass through the nuclear envelope. Immunofluorescence assay indicated that the lamina showed a ruffled staining pattern with the formation of invaginations in the Sf9 cells infected with AcMNPV, while it was evenly distributed at the nuclear periphery of mock-infected cells. Western blotting results indicated that the total amount of lamin in the baculovirus-infected Sf9 cells was significantly decreased compared with the mock-infected cells. These results imply that AcMNPV infection induces structural and biochemical rearrangements of lamina of Sf9 cells.

  1. Cloning and expression of porcine Colony Stimulating Factor-1 (CSF-1) and Colony Stimulating Factor-1 Receptor (CSF-1R) and analysis of the species specificity of stimulation by CSF-1 and Interleukin 34 (United States)

    Gow, Deborah J.; Garceau, Valerie; Kapetanovic, Ronan; Sester, David P.; Fici, Greg J.; Shelly, John A.; Wilson, Thomas L.; Hume, David A.


    Macrophage Colony Stimulating Factor (CSF-1) controls the survival, differentiation and proliferation of cells of the mononuclear phagocyte system. A second ligand for the CSF-1R, Interleukin 34 (IL-34), has been described, but its physiological role is not yet known. The domestic pig provides an alternative to traditional rodent models for evaluating potential therapeutic applications of CSF-1R agonists and antagonists. To enable such studies, we cloned and expressed active pig CSF-1. To provide a bioassay, pig CSF-1R was expressed in the factor-dependent Ba/F3 cell line. On this transfected cell line, recombinant porcine CSF-1 and human CSF-1 had identical activity. Mouse CSF-1 does not interact with the human CSF-1 receptor but was active on pig. By contrast, porcine CSF-1 was active on mouse, human, cat and dog cells. IL-34 was previously shown to be species-specific, with mouse and human proteins demonstrating limited cross-species activity. The pig CSF-1R was equally responsive to both mouse and human IL-34. Based upon the published crystal structures of CSF-1/CSF-1R and IL34/CSF-1R complexes, we discuss the molecular basis for the species specificity. PMID:22974529

  2. Handmade Cloned Buffalo (Bubalus bubalis) Embryos Produced from Somatic Cells Isolated from Milk and Ear Skin Differ in Their Developmental Competence, Epigenetic Status, and Gene Expression. (United States)

    Jyotsana, Basanti; Sahare, Amol A; Raja, Anuj K; Singh, Karn P; Singla, Suresh K; Chauhan, Manmohan S; Manik, Radhey S; Palta, Prabhat


    We compared the cloning efficiency of buffalo embryos produced by handmade cloning (HMC) using ear skin- and milk-derived donor cells. The blastocyst rate was lower (p  milk-derived blastocysts and that of NANOG was (p  milk-derived > skin-derived blastocysts. The expression level of all these genes, except NANOG, was lower (p < 0.05) in milk- than in skin-derived or IVF blastocysts. In conclusion, milk-derived cells can be used for producing HMC embryos of quality similar to that of skin-derived embryos, although with a lower blastocyst rate.

  3. Dominant incidence of multidrug and extensively drug-resistant specific Mycobacterium tuberculosis clones in Osaka Prefecture, Japan.

    Directory of Open Access Journals (Sweden)

    Aki Tamaru

    Full Text Available Infection and transmission of multidrug-resistant Mycobacterium tuberculosis (MDR-Mtb and extensively drug-resistant M. tuberculosis (XDR-Mtb is a serious health problem. We analyzed a total of 1,110 Mtb isolates in Osaka Prefecture and neighboring areas from April 2000 to March 2009. A total of 89 MDR-Mtb were identified, 36 (48.5% of which were determined to be XDR-Mtb. Among the 89 MDR-Mtb isolates, 24 (27.0% phylogenetically distributed into six clusters based on mycobacterial interspersed repetitive units-various number of tandem repeats (MIRU-VNTR typing. Among these six clusters, the MIRU-VNTR patterns of four (OM-V02, OM-V03, OM-V04, and OM-V06 were only found for MDR-Mtb. Further analysis revealed that all isolates belonging to OM-V02 and OM-V03, and two isolates from OM-V04 were clonal. Importantly such genotypes were not observed for drug-sensitive isolates. These suggest that few but transmissible clones can transmit after acquiring multidrug resistance and colonize even in a country with a developed, well-organized healthcare system.

  4. O-Linked β-N-Acetylglucosaminylation (O-GlcNAcylation) in Primary and Metastatic Colorectal Cancer Clones and Effect of N-Acetyl-β-d-glucosaminidase Silencing on Cell Phenotype and Transcriptome* (United States)

    Yehezkel, Galit; Cohen, Liz; Kliger, Adi; Manor, Esther; Khalaila, Isam


    O-Linked β-N-acetylglucosamine (O-GlcNAc) glycosylation is a regulatory post-translational modification occurring on the serine or threonine residues of nucleocytoplasmic proteins. O-GlcNAcylation is dynamically regulated by O-GlcNAc transferase and O-GlcNAcase (OGA), which are responsible for O-GlcNAc addition and removal, respectively. Although O-GlcNAcylation was found to play a significant role in several pathologies such as type II diabetes and neurodegenerative diseases, the role of O-GlcNAcylation in the etiology and progression of cancer remains vague. Here, we followed O-GlcNAcylation and its catalytic machinery in metastatic clones of human colorectal cancer and the effect of OGA knockdown on cellular phenotype and on the transcriptome. The colorectal cancer SW620 metastatic clone exhibited increased O-GlcNAcylation and decreased OGA expression compared with its primary clone, SW480. O-GlcNAcylation elevation in SW620 cells, through RNA interference of OGA, resulted in phenotypic alterations that included acquisition of a fibroblast-like morphology, which coincides with epithelial metastatic progression and growth retardation. Microarray analysis revealed that OGA silencing altered the expression of about 1300 genes, mostly involved in cell movement and growth, and specifically affected metabolic pathways of lipids and carbohydrates. These findings support the involvement of O-GlcNAcylation in various aspects of tumor cell physiology and suggest that this modification may serve as a link between metabolic changes and cancer. PMID:22730328

  5. Use of a small molecule cell cycle inhibitor to control cell growth and improve specific productivity and product quality of recombinant proteins in CHO cell cultures. (United States)

    Du, Zhimei; Treiber, David; McCarter, John D; Fomina-Yadlin, Dina; Saleem, Ramsey A; McCoy, Rebecca E; Zhang, Yuling; Tharmalingam, Tharmala; Leith, Matthew; Follstad, Brian D; Dell, Brad; Grisim, Brent; Zupke, Craig; Heath, Carole; Morris, Arvia E; Reddy, Pranhitha


    The continued need to improve therapeutic recombinant protein productivity has led to ongoing assessment of appropriate strategies in the biopharmaceutical industry to establish robust processes with optimized critical variables, that is, viable cell density (VCD) and specific productivity (product per cell, qP). Even though high VCD is a positive factor for titer, uncontrolled proliferation beyond a certain cell mass is also undesirable. To enable efficient process development to achieve consistent and predictable growth arrest while maintaining VCD, as well as improving qP, without negative impacts on product quality from clone to clone, we identified an approach that directly targets the cell cycle G1-checkpoint by selectively inhibiting the function of cyclin dependent kinases (CDK) 4/6 with a small molecule compound. Results from studies on multiple recombinant Chinese hamster ovary (CHO) cell lines demonstrate that the selective inhibitor can mediate a complete and sustained G0/G1 arrest without impacting G2/M phase. Cell proliferation is consistently and rapidly controlled in all recombinant cell lines at one concentration of this inhibitor throughout the production processes with specific productivities increased up to 110 pg/cell/day. Additionally, the product quality attributes of the mAb, with regard to high molecular weight (HMW) and glycan profile, are not negatively impacted. In fact, high mannose is decreased after treatment, which is in contrast to other established growth control methods such as reducing culture temperature. Microarray analysis showed major differences in expression of regulatory genes of the glycosylation and cell cycle signaling pathways between these different growth control methods. Overall, our observations showed that cell cycle arrest by directly targeting CDK4/6 using selective inhibitor compound can be utilized consistently and rapidly to optimize process parameters, such as cell growth, qP, and glycosylation profile in

  6. Somatic Donor Cell Type Correlates with Embryonic, but Not Extra-Embryonic, Gene Expression in Postimplantation Cloned Embryos (United States)

    Inoue, Kimiko; Ogura, Atsuo


    The great majority of embryos generated by somatic cell nuclear transfer (SCNT) display defined abnormal phenotypes after implantation, such as an increased likelihood of death and abnormal placentation. To gain better insight into the underlying mechanisms, we analyzed genome-wide gene expression profiles of day 6.5 postimplantation mouse embryos cloned from three different cell types (cumulus cells, neonatal Sertoli cells and fibroblasts). The embryos retrieved from the uteri were separated into embryonic (epiblast) and extraembryonic (extraembryonic ectoderm and ectoplacental cone) tissues and were subjected to gene microarray analysis. Genotype- and sex-matched embryos produced by in vitro fertilization were used as controls. Principal component analysis revealed that whereas the gene expression patterns in the embryonic tissues varied according to the donor cell type, those in extraembryonic tissues were relatively consistent across all groups. Within each group, the embryonic tissues had more differentially expressed genes (DEGs) (>2-fold vs. controls) than did the extraembryonic tissues (Pcloning efficiency using SCNT. PMID:24146866

  7. Measurement of in vivo HGPRT-deficient mutant cell frequency using a modified method for cloning human peripheral blood T-lymphocytes

    International Nuclear Information System (INIS)

    Hakoda, Masayuki; Akiyama, Mitoshi; Kyoizumi, Seishi; Kobuke, Kyoko; Awa, A.A.


    Approximately 80 % of human peripheral blood T-lymphocytes could be cloned in the presence of crude Interleukin-2, phytohemagglutinin, and X-irradiated autologous lymphocytes and Raji B-cells. This modified cloning method was used to measure the in vivo frequency of HGPRT-deficient mutant T-lymphocytes. Repeated experiments using blood from the same individuals revealed that the frequency of mutant cells was almost constant for each individual even though the cloning efficiency of lymphocytes varied somewhat from experiment to experiment. Approximately 80 % of both wild-type unselected and 6-thioguanine-resistant colonies had helper/inducer and about 20 % had suppressor/cytotoxic T-lymphocyte markers. No difference was observed in the distribution of lymphocyte subsets between wild and mutant lymphocyte colonies. (author)

  8. Characterization of the CDR3 structure of the Vβ21 T cell clone in patients with P210(BCR-ABL)-positive chronic myeloid leukemia and B-cell acute lymphoblastic leukemia. (United States)

    Zha, Xianfeng; Chen, Shaohua; Yang, Lijian; Li, Bo; Chen, Yu; Yan, Xiaojuan; Li, Yangqiu


    The clonally expanded T cells identified in most cancer patients that respond to tumor-associated antigen such as P210(BCR-ABL) protein have definite, specific antitumor cytotoxicity. T cell receptor (TCR) Vβ CDR3 repertoire diversity was analyzed in patients with chronic myeloid leukemia (CML) and BCR-ABL(+) B-cell acute lymphoblastic leukemia (B-ALL) by GeneScan. A high frequency of oligoclonal expansion of the TCR Vβ21 subfamily was observed in the peripheral blood of CML and B-ALL patients. These clonally expanded Vβ21 T cells were correlated with the pathophysiologic process of CML. A conserved amino acid motif (SLxxV) was observed within the CDR3 region in only 3 patients with CML. Preferential usage of the Jβ segments was also observed in a minority of patients. The 3-dimensional structures of the CDR3 region containing the same motif or using the same Jβ segment displayed low similarity; on the contrary, the conformation of the CDR3 region containing no conserved motif in some T cell clones was highly similar. In conclusion, our findings indicate a high frequency of TCR Vβ21 subfamily expansion in p210(BCR-ABL)-positive CML and B-ALL patients. The characterization of the CDR3 structure was complex. Regrettably, at this time it was not possible to confirm that the Vβ21 T cell clones were derived from the stimulation of p210(BCR-ABL) protein. Copyright © 2011 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  9. Developmental fate of hematopoietic stem cells: the study of individual hematopoietic clones at the level of antigen-responsive B lymphocytes. (United States)

    Olovnikova, Natalia I; Drize, Nina J; Ershler, Maxim A; Nifontova, Irina N; Belkina, Elena V; Nikolaeva, Tatiana N; Proskurina, Natalia V; Chertkov, Joseph L


    We have shown previously that hematopoiesis in mice reconstituted with retrovirally marked hematopoietic stem cells (HSCs) is provided by multiple, mainly short-lived clones, as measured by retroviral insertion site analysis of individual spleen colony-forming unit (CFU-S)-derived colonies. However, the CFU-S is the relatively early progenitor and the contribution of each CFU-S in the steady-state hematopoiesis is uncertain. Here, we have studied the fate of individual mature B cells, as well as CFU-S, representing the progeny of retrovirally transduced marrow-repopulating cells (MRC). B-cells-generated hybridomas and CFU-S-derived colonies were used to determine the clonal composition of hematolymphopoiesis at the single-cell level. Bone marrow (BM) cells and splenocytes (approximately 1/3-1/2 of spleen at a time) from mice reconstituted with retrovirally marked syngeneic BM cells were repeatedly collected at 3, 10, and 16 months post-transplant. The percentage of retrovirally marked CFU-S and B-cell-produced hybridomas was about 50% at 3 months and decreased to 10-15% at 10 months after reconstitution in spite of stable degree of chimerism. The clonal origin of BM-derived CFU-S and spleen-derived B-cell hybridomas was detected by Southern blot analysis. Overall, DNA obtained from 159 retrovirally marked spleen colonies, 287 hybridomas and 43 BM samples were studied. Multiple simultaneously functioning clones of MRC-derived B cells were observed. The same individual clones among hybridomas and CFU-S were identified in three out of 11 mice. Thus, hematopoiesis is generated by multiple hematopoietic clones some of which can simultaneously contribute to both mature lymphoid cells and myeloid progenitors. These data establish that the stem cell compartment functions by continuously producing progeny, which fully but transiently repopulate all lineages.

  10. Production of bovine cloned embryos with donor cells frozen at a slow cooling rate in a conventional freezer (20 C) (United States)

    Chacon, L.; Gomez, M.C.; Jenkins, J.A.; Leibo, S.P.; Wirtu, G.; Dresser, B.L.; Pope, C.E.


    Summary Usually, fibroblasts are frozen in dimethyl sulphoxide (DMSO, 10% v/v) at a cooling rate of 1 C/min in a low-temperature (80 C) freezer (LTF) before storage in liquid nitrogen (LN2); however, a LTF is not always available. The purpose of the present study was to evaluate apoptosis and viability of bovine fibroblasts frozen in a LTF or conventional freezer (CF; 20 C) and their subsequent ability for development to blastocyst stage after fusion with enucleated bovine oocytes. Percentages of live cells frozen in LTF (49.5%) and CF (50.6%) were similar, but significantly less than non-frozen control (88%). In both CF and LTF, percentages of live apoptotic cells exposed to LN2 after freezing were lower (4% and 5%, respectively) as compared with unexposed cells (10% and 18%, respectively). Cells frozen in a CF had fewer cell doublings/24 h (0.45) and required more days (9.1) to reach 100% confluence at the first passage (P) after thawing and plating as compared with cells frozen in a LTF (0.96 and 4.0 days, respectively). Hypoploidy at P12 was higher than at P4 in cells frozen in either a CF (37.5% vs. 19.2%) or in a LTF (30.0% vs. 15.4%). A second-generation cryo-solution reduced the incidence of necrosis (29.4%) at 0 h after thawing as compared with that of a first generation cryo-solution (DMEM + DMSO, 60.2%). The percentage of apoptosis in live cells was affected by cooling rate (CF = 1.9% vs. LFT = 0.7%). Development of bovine cloned embryos to the blastocyst stage was not affected by cooling rate or freezer type. ?? 2009 Cambridge University Press.

  11. Latrunculin A treatment prevents abnormal chromosome segregation for successful development of cloned embryos.

    Directory of Open Access Journals (Sweden)

    Yukari Terashita

    Full Text Available Somatic cell nuclear transfer to an enucleated oocyte is used for reprogramming somatic cells with the aim of achieving totipotency, but most cloned embryos die in the uterus after transfer. While modifying epigenetic states of cloned embryos can improve their development, the production rate of cloned embryos can also be enhanced by changing other factors. It has already been shown that abnormal chromosome segregation (ACS is a major cause of the developmental failure of cloned embryos and that Latrunculin A (LatA, an actin polymerization inhibitor, improves F-actin formation and birth rate of cloned embryos. Since F-actin is important for chromosome congression in embryos, here we examined the relation between ACS and F-actin in cloned embryos. Using LatA treatment, the occurrence of ACS decreased significantly whereas cloned embryo-specific epigenetic abnormalities such as dimethylation of histone H3 at lysine 9 (H3K9me2 could not be corrected. In contrast, when H3K9me2 was normalized using the G9a histone methyltransferase inhibitor BIX-01294, the Magea2 gene-essential for normal development but never before expressed in cloned embryos-was expressed. However, this did not increase the cloning success rate. Thus, non-epigenetic factors also play an important role in determining the efficiency of mouse cloning.

  12. Latrunculin A Treatment Prevents Abnormal Chromosome Segregation for Successful Development of Cloned Embryos (United States)

    Terashita, Yukari; Yamagata, Kazuo; Tokoro, Mikiko; Itoi, Fumiaki; Wakayama, Sayaka; Li, Chong; Sato, Eimei; Tanemura, Kentaro; Wakayama, Teruhiko


    Somatic cell nuclear transfer to an enucleated oocyte is used for reprogramming somatic cells with the aim of achieving totipotency, but most cloned embryos die in the uterus after transfer. While modifying epigenetic states of cloned embryos can improve their development, the production rate of cloned embryos can also be enhanced by changing other factors. It has already been shown that abnormal chromosome segregation (ACS) is a major cause of the developmental failure of cloned embryos and that Latrunculin A (LatA), an actin polymerization inhibitor, improves F-actin formation and birth rate of cloned embryos. Since F-actin is important for chromosome congression in embryos, here we examined the relation between ACS and F-actin in cloned embryos. Using LatA treatment, the occurrence of ACS decreased significantly whereas cloned embryo-specific epigenetic abnormalities such as dimethylation of histone H3 at lysine 9 (H3K9me2) could not be corrected. In contrast, when H3K9me2 was normalized using the G9a histone methyltransferase inhibitor BIX-01294, the Magea2 gene—essential for normal development but never before expressed in cloned embryos—was expressed. However, this did not increase the cloning success rate. Thus, non-epigenetic factors also play an important role in determining the efficiency of mouse cloning. PMID:24205216

  13. Lessons learned from cloning dogs. (United States)

    Kim, M J; Oh, H J; Kim, G A; Park, J E; Park, E J; Jang, G; Ra, J C; Kang, S K; Lee, B C


    The aim of this article is to review dog cloning research and to suggest its applications based on a discussion about the normality of cloned dogs. Somatic cell nuclear transfer was successfully used for production of viable cloned puppies despite limited understanding of in vitro dog embryo production. Cloned dogs have similar growth characteristics to those born from natural fertilization, with no evidence of serious adverse effects. The offspring of cloned dogs also have similar growth performance and health to those of naturally bred puppies. Therefore, cloning in domestic dogs can be applied as an assisted reproductive technique to conserve endangered species, to treat sterile canids or aged dogs, to improve reproductive performance of valuable individuals and to generate disease model animals. © 2012 Blackwell Verlag GmbH.

  14. A novel cytochrome P450 gene from Catharanthus roseus cell line C20hi: cloning and characterization of expression

    Directory of Open Access Journals (Sweden)

    Lihong He


    Full Text Available An expressed sequence tag (EST obtained from a subtractive-suppression hybridization cDNA library constructed using Catharanthus roseus cell line C20hi and its parental cell line C20D was used to clone a full-length cytochrome P450 cDNA of cyp71d1. The encoded polypeptide contained 507 amino acids with 39–56% identity to other CYP71D subfamily members at the amino acid level. Expression characteristics of cyp71d1 were determined using semi-quantitative RT-PCR. The cyp71d1 transcript was expressed in all three cell lines with the highest level in the cell line C20hi. In the mature C. roseus plant, the cyp71d1 cDNA was highly expressed in petals, roots and stems, but very weakly expressed in young leaves. Its transcription level increased with the development of flowers. 2,4-D could down-regulate the transcription of cyp71d1, as did KT, but only to a minor degree. Neither light nor yeast elicitor could induce the transcription of cyp71d1.

  15. Effect of roscovitine treated donor cells and different activation methods on development of handmade cloned goat (Capra hircus) embryos. (United States)

    Akshey, Y S; Malakar, D; De, A Kumar; Jena, M Kumar; Pawar, S Kumar; Dutta, R; Sahu, S


    The aim of the present investigation was to find out the effects of roscovitine treatment of donor cells and different activation methods on development of HMC goat embryos. Goat fetal fibroblast cells were cultured and divided into three treatment groups-contact inhibition group, roscovitine treatment group and serum starvation group. There was a significant decrease in blastocyst yield in serum starvation group (6.82%) compared to roscovitine treatment group (19.31%) and contact inhibition group (18.52%), however, no significant difference was found between roscovitine treatment group and contact inhibition group. To see the effect of different methods of activation, the reconstructed embryos were randomly divided into two groups and activated by two methods-one half by 2 μM Ca ionophore and another half by 2.31 kV/cm for 15 μSec electrical pulse. Subsequently, cloned embryos were cultured in TCM-199 based embryo development medium supplemented with 10 mg/mL bovine serum albumin in WOW culture system. There was a significant increase in the rate of cleavage and blastocyst production in electric pulse activation of 78.57% and 21.43% than Ca ionophore activation of 62.63% and 10.61% respectively. In conclusion, treatment of donor cells with roscovitine yields a significantly increased blastocyst than serum starved donor cells but equivalent blastocyst to contact inhibition group and electrical pulse activation (EPA) improves the production of HMC goat embryos. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Basic fibroblast growth factor is pro-adipogenic in rat skeletal muscle progenitor clone, 2G11 cells. (United States)

    Nakano, Shin-ichi; Nakamura, Katsuyuki; Teramoto, Naomi; Yamanouchi, Keitaro; Nishihara, Masugi


    Intramuscular adipose tissue (IMAT) formation is a hallmark of marbling in cattle. IMAT is considered to originate from skeletal muscle progenitor cells with adipogenic potential. However, the mechanism involved in IMAT formation from these progenitor cells in vivo remains unclear. In the present study, among the growth factors tested, which were known to be expressed in skeletal muscle, we found only basic fibroblast growth factor (bFGF) has a pro-adipogenic effect on skeletal muscle derived adipogenic progenitor clone, 2G11 cells. Pre-exposure of 2G11 cells to bFGF did not affect initial gene expressions of CCAAT/enhancer-binding protein (C/EBP)β and C/EBPδ, while resulting in an enhancement of subsequent expressions of C/EBPα and proliferator-activated receptor gamma (PPARγ) during adipogenesis, indicating that bFGF is acting on the transcriptional regulation of C/EBPα and PPARγ. In addition, the effect of bFGF is mediated via two types of FGF receptor (FGFR) isoforms: FGFR1 and FGFR2 IIIc, and both receptors are prerequisite for bFGF to express its pro-adipogenic effect. These results suggest that bFGF plays an important role as a key trigger of IMAT formation in vivo. © 2015 Japanese Society of Animal Science.

  17. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat


    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  18. Complementation of the UV-sensitive phenotype of a xeroderma pigmentosum human cell line by transfection with a cDNA clone library

    International Nuclear Information System (INIS)

    Teitz, T.; Naiman, T.; Avissar, S.S.; Bar, S.; Okayama, H.; Canaani, D.


    In previous work, a xeroderma pigmentosum cell line belonging to complementation group C was established by transformation with origin-defective simian virus 40. We now report the complementation of the UV sensitivity of this cell line by gene transfer. A human cDNA clone library constructed in a mammalian expression vector, and itself incorporated in a lambda phage vector, was introduced into the cells as a calcium phosphate precipitate. Following selection to G418 resistance, provided by the neo gene of the vector, transformants were selected for UV resistance. Twenty-one cell clones were obtained with UV-resistance levels typical of normal human fibroblasts. All transformants contained vector DNA sequences in their nuclei. Upon further propagation in the absence of selection for G418 resistance, about half of the primary transformants remained UV-resistant. Secondary transformants were generated by transfection with a partial digest of total chromosomal DNA from one of these stable transformants. This resulted in 15 G418-resistant clones, 2 of which exhibited a UV-resistant phenotype. The other primary clones lost UV resistance rapidly when subcultured in the absence of G418. Importantly, several retained UV resistance under G418 selection pressure. The acquisition of UV resistance by secondary transformants derived by transfection of DNA from a stable primary transformant, and the linkage between G418 and UV resistances in the unstable primary transformants, strongly suggests that the transformants acquired UV resistance through DNA-mediated gene transfer and not by reversion

  19. Functional cloning of a gp100-reactive T-cell receptor from vitiligo patient skin

    NARCIS (Netherlands)

    Klarquist, Jared; Eby, Jonathan M.; Henning, Steven W.; Li, Mingli; Wainwright, Derek A.; Westerhof, Wiete; Luiten, Rosalie M.; Nishimura, Michael I.; Le Poole, I. Caroline


    We isolated gp100-reactive T cells from perilesional skin of a patient with progressive vitiligo with superior reactivity toward melanoma cells compared with tumor-infiltrating lymphocytes 1520, a melanoma-derived T-cell line reactive with the same cognate peptide. After dimer enrichment and limited

  20. Late post-irradiation phenomena in mammalian cell populations. Pt. 3. Characteristics of the slowly growing clones isolated from X-irradiated L5178Y-S cell cultures

    International Nuclear Information System (INIS)

    Beer, J.Z.; Szumiel, I.


    Populations of murine leukaemic lymphoblasts L5178Y-S irradiated with 300 rads of X-rays in vitro were analysed by serial clonings. It was found that the latent radiation-induced heritable lesions can be revealed by this technique. Approximately 100 slowly growing cell sublines with doubling times varying from 12 to 25 h, obtained by cloning, were assayed for: viability, cloning efficiency, mitotic index, labelling index (1 h and 24 h exposure to 3 H-thymidine), 3 H-thymidine incorporation rate, histone Fl phosphorous content, radiosensitivity, cell cycle disturbances, DNA per cell content, karyotype changes. The slowly-growing clones show normal or almost normal viability but have reduced cloning efficiencies. No correlations were found between the subline's doubling time or time interval between its isolation and determination, on one hand, and mitotic index or 1 h labelling index, on the other hand. 3 H-thymidine incorporation rate and histone Fl phosphorylation degree were inversely related to the subline's doubling time. Increased radiosensitivity of the slowly growing sublines, observed soon after their isolation, indicates that the heritable lesions in the cells studied are radiation-induced rather than selected. Autoradiographic analysis of the cell cycle indicates: heterogeneity of the slowly growing cell lines, occurence of cells with prolonged G2 phase and a possibility that in more severely damaged cells S phase is also affected. (author)

  1. Cloning, identification, and functional analysis of bone marrow stromal cell antigen-2 from sika deer (Cervus nippon). (United States)

    Wang, Jiawen; Bian, Shuai; Liu, Meichun; Zhang, Xin; Wang, Siming; Bai, Xueyuan; Zhao, Daqing; Zhao, Yu


    BST-2(tetherin/CD317/HM1.24) has been identified as a cellular antiviral factor that inhibits the release of a wide range of enveloped viruses from infected cells. Orthologs of BST-2 have been identified in several species including humans, monkeys, cows, sheep, pigs, and mice. In this study, we cloned the gene and characterized the protein of the BST-2 homolog from sika deer (Cervus nippon). cnBST-2 shares 37.8% and 74.2% identity with the BST-2 homologs from Homo sapiens and Ovis aries, respectively. The extracellular domain of cnBST-2 has two putative N-linked glycosylation sites and three potential dimerization sites. cnBST-2 was shown to be expressed on the cell surface, like human BST-2. Exogenous expression of cnBST-2 resulted in potent inhibition of HIV-1 particle release in 293T cells; however, this activity resisted antagonism by HIV-1 Vpu. Moreover, cnBST-2 was not able to activate nuclear factor-κB, in contrast to human BST-2. This study is the first report of the isolation and characterization of BST-2 from C. nippon. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Cloning and characterization of human RTVP-1b, a novel splice variant of RTVP-1 in glioma cells

    International Nuclear Information System (INIS)

    Xiang Cunli; Sarid, Ronit; Cazacu, Simona; Finniss, Susan; Lee, Hae-Kyung; Ziv-Av, Amotz; Mikkelsen, Tom; Brodie, Chaya


    Here, we report the cloning and characterization of RTVP-1b, a novel splice variant of human RTVP-1, which was isolated from the U87 glioma cell line. Sequence analysis revealed that RTVP-1b contains an additional 71 base exon between exons 2 and 3 that is missing in RTVP-1, leading to a frame-shift and a different putative protein. The deduced protein was 237 amino acids in length, sharing the N-terminal 141 amino acids with RTVP-1. RT-PCR analysis demonstrated that RTVP-1b was expressed in a wide range of tissues and that its expression was different from that of RTVP-1. In contrast, RTVP-1 and RTVP-1b showed similar patterns of expression in astrocytic tumors; highly expressed in glioblastomas as compared to normal brains, low-grade astrocytomas and anaplastic oligodendrogliomas. Overexpression of RTVP-1b increased glioma cell proliferation but did not affect cell migration. Our results suggest that RTVP-1b represents a potential prognostic marker and therapeutic target in gliomas

  3. Molecular cloning, purification, and characterization of a novel polyMG-specific alginate lyase responsible for alginate MG block degradation in Stenotrophomas maltophilia KJ-2

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Su In; Kim, Hee Sook [Kyungsung Univ., Busan (Korea, Republic of). Dept. of Food Science and Biotechnology; Choi, Sung Hee; Lee, Eun Yeol [Kyung Hee Univ., Gyeonggi-do (Korea, Republic of). Dept. of Chemical Engineering


    A gene for a polyMG-specific alginate lyase possessing a novel structure was identified and cloned from Stenotrophomas maltophilia KJ-2 by using PCR with homologous nucleotide sequences-based primers. The recombinant alginate lyase consisting of 475 amino acids was purified on Ni-Sepharose column and exhibited the highest activity at pH 8 and 40 C. Interestingly, the recombinant alginate lyase was expected to have a similar catalytic active site of chondroitin B lyase but did not show chondroitin lyase activity. In the test of substrate specificity, the recombinant alginate lyase preferentially degraded the glycosidic bond of polyMG-block than polyM-block and polyG-block. The chemical structures of the degraded alginate oligosaccharides were elucidated to have mannuronate (M) at the reducing end on the basis of NMR analysis, supporting that KJ-2 polyMG-specific alginate lyase preferably degraded the glycosidic bond in M-G linkage than that in G-M linkage. The KJ-2 polyMG-specific alginate lyase can be used in combination with other alginate lyases for a synergistic saccharification of alginate. (orig.)

  4. Regulating stem-cell research and human cloning in an Australian context: an exercise in protecting the status of the human subject. (United States)

    Harvey, Olivia


    Over 12 months prior to the recent United Nations decision to defer a decision about what type of international treaty should be developed in the global stem-cell research and human cloning debate, the Federal Parliament of Australia passed two separate pieces of legislation relating to both these concerns. After a five-year long process of community consultation, media spectacle and parliamentary debate, reproductive cloning has been banned in Australia and only embryos considered to be excess to assisted reproductive technologies in existence on the 5th of April 2002 are currently valid research material. This paper argues that underpinning both pieces of legislation is a profound belief in the disruptive potential of all types of human cloning for the very nature and integrity of human species being. A belief, moreover, that is based on a presumption that it is apparently possible to conceptualise what being human even means for all Australians.

  5. Skin Stem Cell Hypotheses and Long Term Clone Survival - Explored Using Agent-based Modelling


    Li, X.; Upadhyay, A.K.; Bullock, A.J.; Dicolandrea, T.; Xu, J.; Binder, R.L.; Robinson, M.K.; Finlay, D.R.; Mills, K.J.; Bascom, C.C.; Kelling, C.K.; Isfort, R.J.; Haycock, J.W.; MacNeil, S.; Smallwood, R.H.


    Epithelial renewal in skin is achieved by the constant turnover and differentiation of keratinocytes. Three popular hypotheses have been proposed to explain basal keratinocyte regeneration and epidermal homeostasis: 1) asymmetric division (stem-transit amplifying cell); 2) populational asymmetry (progenitor cell with stochastic fate); and 3) populational asymmetry with stem cells. In this study, we investigated lineage dynamics using these hypotheses with a 3D agent-based model of the epiderm...

  6. Molecular cloning of human T-cell lymphotrophic virus type I-like proviral genome from the peripheral lymphocyte DNA of a patient with chronic neurologic disorders

    International Nuclear Information System (INIS)

    Reddy, E.P.; Mettus, R.V.; DeFreitas, E.; Wroblewska, Z.; Cisco, M.; Koprowski, H.


    Human T-cell lymphotropic virus type 1 (HTLV-I), the etiologic agent of human T-cell leukemia, has recently been shown to be associated with neurologic disorders such as tropical spastic paraparesis, HTLV-associated myelopathy, and possibly with multiple sclerosis. In this communication, the authors have examined one specific case of neurologic disorder that can be classified as multiple sclerosis or tropical spastic paraparesis. The patient suffering from chronic neurologic disorder was found to contain antibodies to HTLV-I envelope and gag proteins in his serum and cerebrospinal fluid. Lymphocytes from peripheral blood and cerebrospinal fluid of the patient were shown to express viral RNA sequences by in situ hybridization. Southern blot analysis of the patient lymphocyte DNA revealed the presence of HTLV-I-related sequences. Blot-hybridization analysis of the RNA from fresh peripheral lymphocytes stimulated with interleukin 2 revealed the presence of abundant amounts of genomic viral RNA with little or no subgenomic RNA. They have clones the proviral genome from the DNA of the peripheral lymphocytes and determined its restriction map. This analysis shows that this proviral genome is very similar if not identical to that of the prototype HTLV-I genome

  7. [Scientific ethics of human cloning]. (United States)

    Valenzuela, Carlos Y


    True cloning is fission, budding or other types of asexual reproduction. In humans it occurs in monozygote twinning. This type of cloning is ethically and religiously good. Human cloning can be performed by twinning (TWClo) or nuclear transfer (NTClo). Both methods need a zygote or a nuclear transferred cell, obtained in vitro (IVTec). They are under the IVTec ethics. IVTecs use humans (zygotes, embryos) as drugs or things; increase the risk of malformations; increase development and size of abnormalities and may cause long-term changes. Cloning for preserving extinct (or almost extinct) animals or humans when sexual reproduction is not possible is ethically valid. The previous selection of a phenotype in human cloning violates some ethical principles. NTClo for reproductive or therapeutic purposes is dangerous since it increases the risk for nucleotide or chromosome mutations, de-programming or re-programming errors, aging or malignancy of the embryo cells thus obtained.

  8. Leishmania donovani-reactive Th1- and Th2-like T-cell clones from individuals who have recovered from visceral leishmaniasis

    DEFF Research Database (Denmark)

    Kemp, M; Kurtzhals, J A; Bendtzen, K


    analyzed in a panel of L. donovani-reactive CD4+ human T-cell clones generated from individuals who had recovered from VL after antimonial treatment. Two of the T-cell clones produced large amounts of IL-4 without production of IFN-gamma, seven clones produced both IFN-gamma and IL-4, and eight produced...... by interleukin-4 (IL-4)-producing Th2 cells, or cure may result by Th1 cells secreting gamma interferon (IFN-gamma). The present study examined the potential of human T cells to generate Th1 or Th2 responses to L. donovani. The profiles of IFN-gamma, IL-4, and lymphotoxin secretion after antigen stimulation were...... only IFN-gamma. This is the first report of a Th1- and Th2-type response in human leishmaniasis. These results suggest that in analogy with murine models, there is a dichotomy in the human T-cell response to L. donovani infections. Preferential activation of IL-4-producing Th2-like cells may...

  9. A Versatile System for USER Cloning-Based Assembly of Expression Vectors for Mammalian Cell Engineering

    DEFF Research Database (Denmark)

    Lund, Anne Mathilde; Kildegaard, Helene Faustrup; Petersen, Maja Borup Kjær


    , in addition the system is fully extendable by other users. The vector system is designed to facilitate high-throughput genome-scale studies of mammalian cells, such as the newly sequenced CHO cell lines, through the ability to rapidly generate high-fidelity assembly of customizable gene expression vectors....

  10. Skin Stem Cell Hypotheses and Long Term Clone Survival – Explored Using Agent-based Modelling (United States)

    Li, X.; Upadhyay, A. K.; Bullock, A. J.; Dicolandrea, T.; Xu, J.; Binder, R. L.; Robinson, M. K.; Finlay, D. R.; Mills, K. J.; Bascom, C. C.; Kelling, C. K.; Isfort, R. J.; Haycock, J. W.; MacNeil, S.; Smallwood, R. H.


    Epithelial renewal in skin is achieved by the constant turnover and differentiation of keratinocytes. Three popular hypotheses have been proposed to explain basal keratinocyte regeneration and epidermal homeostasis: 1) asymmetric division (stem-transit amplifying cell); 2) populational asymmetry (progenitor cell with stochastic fate); and 3) populational asymmetry with stem cells. In this study, we investigated lineage dynamics using these hypotheses with a 3D agent-based model of the epidermis. The model simulated the growth and maintenance of the epidermis over three years. The offspring of each proliferative cell was traced. While all lineages were preserved in asymmetric division, the vast majority were lost when assuming populational asymmetry. The third hypothesis provided the most reliable mechanism for self-renewal by preserving genetic heterogeneity in quiescent stem cells, and also inherent mechanisms for skin ageing and the accumulation of genetic mutation. PMID:23712735

  11. Skin stem cell hypotheses and long term clone survival--explored using agent-based modelling. (United States)

    Li, X; Upadhyay, A K; Bullock, A J; Dicolandrea, T; Xu, J; Binder, R L; Robinson, M K; Finlay, D R; Mills, K J; Bascom, C C; Kelling, C K; Isfort, R J; Haycock, J W; MacNeil, S; Smallwood, R H


    Epithelial renewal in skin is achieved by the constant turnover and differentiation of keratinocytes. Three popular hypotheses have been proposed to explain basal keratinocyte regeneration and epidermal homeostasis: 1) asymmetric division (stem-transit amplifying cell); 2) populational asymmetry (progenitor cell with stochastic fate); and 3) populational asymmetry with stem cells. In this study, we investigated lineage dynamics using these hypotheses with a 3D agent-based model of the epidermis. The model simulated the growth and maintenance of the epidermis over three years. The offspring of each proliferative cell was traced. While all lineages were preserved in asymmetric division, the vast majority were lost when assuming populational asymmetry. The third hypothesis provided the most reliable mechanism for self-renewal by preserving genetic heterogeneity in quiescent stem cells, and also inherent mechanisms for skin ageing and the accumulation of genetic mutation.

  12. Evidence for association of the cloned liver growth hormone receptor with a tyrosine kinase

    DEFF Research Database (Denmark)

    Wang, X; Uhler, M D; Billestrup, N


    The ability of the cloned liver growth hormone (GH) receptor, when expressed in mammalian cell lines, to copurify with tyrosine kinase activity and be tyrosyl phosphorylated was examined. 125I-human growth hormone-GH receptor complexes isolated from COS-7 cells transiently expressing high levels...... of tyrosine kinase activity with cloned liver GH receptor. The level of phosphorylation of the GH receptor was very low, as compared with the endogenous GH receptor in 3T3-F442A cells, suggesting that tyrosine kinase activity is not intrinsic to the cloned GH receptor but rather resides with a kinase present...... in a variety of cell types. The finding that the level of phosphorylation of GH receptor appears to vary with cell type is consistent with the cloned liver GH receptor being a substrate for an associated tyrosine kinase and with the amount of such a GH receptor-associated tyrosine kinase being cell type-specific....

  13. The cell wall and cell division gene cluster in the Mra operon of Pseudomonas aeruginosa: cloning, production, and purification of active enzymes. (United States)

    Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M


    We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.

  14. Quantitative discrimination of Aggregatibacter actinomycetemcomitans highly leukotoxic JP2 clone from non-JP2 clones in diagnosis of aggressive periodontitis

    Directory of Open Access Journals (Sweden)

    Yoshida Akihiro


    Full Text Available Abstract Background Aggregatibacter actinomycetemcomitans is the etiological agent of periodontitis, and there is a strong association between clone JP2 and aggressive periodontitis in adolescents of African descent. The JP2 clone has an approximately 530-bp deletion (∆530 in the promoter region of the lkt/ltx gene, which encodes leukotoxin, and this clone has high leukotoxic activity. Therefore, this clone is very important in aggressive periodontitis. To diagnose this disease, culture methods and conventional PCR techniques are used. However, quantitative detection based on qPCR for the JP2 clone has not been developed due to genetic difficulties. In this study, we developed a qPCR-based quantification method specific to the JP2 clone. Methods Based on our analysis of the DNA sequence of the lkt/ltx gene and its flanking region, we designed a reverse primer specific for the ∆530 deletion border sequence and developed a JP2-specific PCR-based quantification method using this primer. We also analyzed the DNA sequence of the ∆530 locus and found it to be highly conserved (97–100% among 17 non-JP2 strains. Using the ∆530 locus, we designed a qPCR primer–probe set specific to non-JP2 clones. Next, we determined the numbers of JP2 and non-JP2 clone cells in the periodontal pockets of patients with aggressive periodontitis. Results The JP2-specific primers specifically amplified the genomic DNA of the A. actinomycetemcomitans JP2 clone and did not react with other bacterial DNA, whereas the non-JP2 specific primers reacted only with A. actinomycetemcomitans non-JP2 clones. Samples from the 88 periodontal sites in the 11 patients with aggressive periodontitis were analyzed. The bacterial cell numbers in 88 periodontal sites ranged from 0 to 4.8 × 108 (mean 1.28 × 107 for JP2 clones and from 0 to 1.6 × 106 for non-JP2 clones (mean 1.84 × 105. There were significant differences in the JP2 cell number between a clinical attachment level

  15. Quantitative discrimination of Aggregatibacter actinomycetemcomitans highly leukotoxic JP2 clone from non-JP2 clones in diagnosis of aggressive periodontitis. (United States)

    Yoshida, Akihiro; Ennibi, Oum-Keltoum; Miyazaki, Hideo; Hoshino, Tomonori; Hayashida, Hideaki; Nishihara, Tatsuji; Awano, Shuji; Ansai, Toshihiro


    Aggregatibacter actinomycetemcomitans is the etiological agent of periodontitis, and there is a strong association between clone JP2 and aggressive periodontitis in adolescents of African descent. The JP2 clone has an approximately 530-bp deletion (∆530) in the promoter region of the lkt/ltx gene, which encodes leukotoxin, and this clone has high leukotoxic activity. Therefore, this clone is very important in aggressive periodontitis. To diagnose this disease, culture methods and conventional PCR techniques are used. However, quantitative detection based on qPCR for the JP2 clone has not been developed due to genetic difficulties. In this study, we developed a qPCR-based quantification method specific to the JP2 clone. Based on our analysis of the DNA sequence of the lkt/ltx gene and its flanking region, we designed a reverse primer specific for the ∆530 deletion border sequence and developed a JP2-specific PCR-based quantification method using this primer. We also analyzed the DNA sequence of the ∆530 locus and found it to be highly conserved (97-100%) among 17 non-JP2 strains. Using the ∆530 locus, we designed a qPCR primer-probe set specific to non-JP2 clones. Next, we determined the numbers of JP2 and non-JP2 clone cells in the periodontal pockets of patients with aggressive periodontitis. The JP2-specific primers specifically amplified the genomic DNA of the A. actinomycetemcomitans JP2 clone and did not react with other bacterial DNA, whereas the non-JP2 specific primers reacted only with A. actinomycetemcomitans non-JP2 clones. Samples from the 88 periodontal sites in the 11 patients with aggressive periodontitis were analyzed. The bacterial cell numbers in 88 periodontal sites ranged from 0 to 4.8 × 10(8) (mean 1.28 × 10(7)) for JP2 clones and from 0 to 1.6 × 10(6) for non-JP2 clones (mean 1.84 × 10(5)). There were significant differences in the JP2 cell number between a clinical attachment level (CAL) ≤6 mm and a level ≥7 mm (p clones. This

  16. Characterization of the neutralization determinants of equine arteritis virus using recombinant chimeric viruses and site-specific mutagenesis of an infectious cDNA clone

    International Nuclear Information System (INIS)

    Balasuriya, Udeni B.R.; Dobbe, Jessika C.; Heidner, Hans W.; Smalley, Victoria L.; Navarrette, Andrea; Snijder, Eric J.; MacLachlan, N. James


    We have used an infectious cDNA clone of equine arteritis virus (EAV) and reverse genetics technology to further characterize the neutralization determinants in the GP5 envelope glycoprotein of the virus. We generated a panel of 20 recombinant viruses, including 10 chimeric viruses that each contained the ORF5 (which encodes GP5) of different laboratory, field, and vaccine strains of EAV, a chimeric virus containing the N-terminal ectodomain of GP5 of a European strain of porcine reproductive and respiratory syndrome virus, and 9 mutant viruses with site-specific substitutions in their GP5 proteins. The neutralization phenotype of each recombinant chimeric/mutant strain of EAV was determined with EAV-specific monoclonal antibodies and EAV strain-specific polyclonal equine antisera and compared to that of their parental viruses from which the substituted ORF5 was derived. The data unequivocally confirm that the GP5 ectodomain contains critical determinants of EAV neutralization. Furthermore, individual neutralization sites are conformationally interactive, and the interaction of GP5 with the unglycosylated membrane protein M is likely critical to expression of individual epitopes in neutralizing conformation. Substitution of individual amino acids within the GP5 ectodomain usually resulted in differences in neutralization phenotype of the recombinant viruses, analogous to differences in the neutralization phenotype of field strains of EAV and variants generated during persistent infection of EAV carrier stallions

  17. Herpes simplex virus (HSV)-specific proliferative and cytotoxic T-cell responses in humans immunized with an HSF type 2 glycoprotein subunit vaccine

    Energy Technology Data Exchange (ETDEWEB)

    Zarling, J.M.; Moran, P.A.; Brewer, L.; Ashley, R.; Corey, L.


    Studies were undertaken to determine whether immunization of humans with a herpes simplex virus type 2 (HSV-2) glycoprotein-subunit vaccine would result in the priming of both HSV-specific proliferating cells and cytotoxic T cells. Peripheral blood lymphocytes (PBL) from all eight vaccinees studied responded by proliferating after stimulation with HSV-2, HSV-1, and glycoprotein gB-1. The PBL of five of these eight vaccinees proliferated following stimulation with gD-2, whereas stimulation with Gd-1 resulted in relatively low or no proliferative responses. T-cell clones were generated from HSV-2-stimulated PBL of three vaccinees who demonstrated strong proliferative responses to HSV-1 and HSV-2. Of 12 clones studied in lymphoproliferative assays, 9 were found to be cross-reactive for HSV-1 and HSV-2. Of the approximately 90 T-cell clones isolated, 14 demonstrated HSV-specific cytotoxic activity. Radioimmunoprecipitation-polyacrylamide gel electrophoresis analyses confirmed that the vaccinees had antibodies only to HSV glycoproteins, not to proteins which are absent in the subunit vaccine, indicating that these vaccinees had not become infected with HSV. Immunization of humans with an HSV-2 glycoprotein-subunit vaccine thus results in the priming of T cells that proliferate in response to stimulation with HSV and its glycoproteins and T cells that have cytotoxic activity against HSV-infected cells. Such HSV-specific memory T cells were detected as late as 2 years following the last boost with the subunit vaccine.

  18. Radiosensitivity of hemopoietic stem cells on cloning in bone marrow and spleen

    International Nuclear Information System (INIS)

    Shvets, V.N.; Shafirkin, A.V.


    It was shown that population of stem cells from bone marrow of mice is heterogenous by radiosensitivity. A 55%-survival of CFU is exponential function of radiation dose (D 0 -9 rad). A dose-effect curve for radioresistant part of the population (D 0 =180 rad) is sygmoid (Dsub(q)=130 rad). Radiosensitive CFU are suggested to represent a primarily committed fraction of half-semi cells, and radioresistant CFU are referable to a pool of pluripotent stem cells. Heterogenous nature of CFU population is proved with different modifications of radiation effect and interactions of CFU with T-lymphocytes

  19. Improved cloning efficiency and developmental potential in bovine somatic cell nuclear transfer with the oosight imaging system. (United States)

    Kim, Eun Young; Park, Min Jee; Park, Hyo Young; Noh, Eun Ji; Noh, Eun Hyung; Park, Kyoung Sik; Lee, Jun Beom; Jeong, Chang Jin; Riu, Key Zung; Park, Se Pill


    In somatic cell nuclear transfer (SCNT) procedures, exquisite enucleation of the recipient oocyte is critical to cloning efficiency. The purpose of this study was to compare the effects of two enucleation systems, Hoechst staining and UV irradiation (hereafter, irradiation group) and Oosight imaging (hereafter, Oosight group), on the in vitro production of bovine SCNT embryos. In the Oosight group, the apoptotic index (2.8 ± 0.5 vs. 7.3 ± 1.2) was lower, and the fusion rate (75.6% vs. 62.9%), cleavage rate (78.0% vs. 63.7%), blastocyst rate (40.2% vs. 29.2%), and total cell number (128.3±4.8 vs. 112.2 ± 7.6) were higher than those in the irradiation group (all p<0.05). The overall efficiency after SCNT was twice as high in the Oosight group as that in the irradiation group (p<0.05). The relative mRNA expression levels of Oct4, Nanog, Interferon-tau, and Dnmt3A were higher and those of Caspase-3 and Hsp70 were lower in the Oosight group compared with the irradiation group (p<0.05). This is the first report to show the positive effect of the Oosight imaging system on molecular gene expression in the SCNT embryo. The Oosight imaging system may become the preferred choice for enucleation because it is less detrimental to the developmental potential of bovine SCNT embryos.

  20. Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells

    Directory of Open Access Journals (Sweden)

    Misako Yajima


    Full Text Available Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.

  1. Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells. (United States)

    Yajima, Misako; Ikuta, Kazufumi; Kanda, Teru


    Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.

  2. Effects of JP-8 Jet Fuel on Homeostasis of Clone 9 Rat Liver Cells (United States)

    Wilson, C. L.; Barhoumi, R.; Burghardt, R.; Miladi, A.; Jung, A.


    Chronic exposure to JP-8 and other kerosene-based petroleum distillates has been associated with hepatic, renal, neurologic, pulmonary, and immune toxicity. However, the effects of kerosene-type jet fuels on cellular homeostasis hitherto have not been reported. Fluorescence imaging using a Meridian Ultima laser scanning fluorescence microscope was used to evaluate the effect of JP-8 jet fuel on a communication competent rat liver cell line. Several endpoints of cellular function were measured including gap junctional intercellular communication (GJIC), mitochondrial and plasma membrane potential (MMP and PMP, respectively), intracellular glutathione (GSH) concentration, glutathione-S-transferase (GST) activity, and reactive oxygen species (ROS) generation. Cells were treated with JP-8 (0.01 to 2% in ethanol (EtOH)) for the following time points: 1 h, 24 h, 48 h, and analysis immediately after addition of jet fuel. GJIC analyzed directly after addition of 1% JP-8 was reduced 4.9-fold relative to EtOH-dosed control groups and further reduction (12.6-fold) was observed in cells treated for 1 h. Moreover, GJIC was not recoverable in cells treated with 1% JP-8 for 1 h and subsequently washed and incubated in fresh medium for 1 h. Significant changes in GSH content and GST activity were observed in cells analyzed directly after addition of 1% JP-8. GSH content increased in cells treated for 1 h with less than 2% JP-8 whereas treatment with 2% JP-8 for 1 h resulted in a 50% reduction in intracellular GSH relative to EtOH-dosed controls. Cells treated with 1% JP-8 for 48 h exhibited changes in GSH levels. However, higher JP-8 concentrations exhibited more pronounced changes in GSH and GST, which led to suppression of GSH synthesis. ROS increased in a dose-responsive fashion at JP-8 concentrations up to 1%, but decreased to 80% of control values at 2% and 3% JP-8. A 25% reduction in PMP was observed in cells treated for 1 h with 1% JP-8. In contrast, cells treated for 48 h

  3. [Ethical aspects of regenerative medicine, with special reference to embryonic stem cells and therapeutic cloning]. (United States)

    Imura, Hiroo


    Regenerative medicine is expected to be new therapeutic means for treating incurable diseases but requires serious bioethical consideration. Embryonic stem(ES) cells, that are pleuripotent cells suitable to regenerative medicine, can be used in Japan for investigative use under a strict control by guide-lines. On the other hand, use of embryo produced by nuclear transfer has not been allowed in Japan and further serious consideration is required. Some other ethical aspects of regenerative medicine are also discussed.

  4. Gene targeting and cloning in pigs using fetal liver derived cells. (United States)

    Waghmare, Sanjeev K; Estrada, Jose; Reyes, Luz; Li, Ping; Ivary, Bess; Sidner, Richard A; Burlak, Chris; Tector, A Joseph


    Since there are no pig embryonic stem cells, pig genetic engineering is done in fetal fibroblasts that remain totipotent for only 3 to 5 wk. Nuclear donor cells that remain totipotent for longer periods of time would facilitate complicated genetic engineering in pigs. The goal of this study was to test the feasibility of using fetal liver-derived cells (FLDC) to perform gene targeting, and create a genetic knockout pig. FLDC were isolated and processed using a human liver stem cell protocol. Single copy α-1,3-galactosyl transferase knockout (GTKO) FLDCs were created using electroporation and neomycin resistant colonies were screened using PCR. Homozygous GTKO cells were created through loss of heterozygosity mutations in single GTKO FLDCs. Double GTKO FLDCs were used in somatic cell nuclear transfer (SCNT) to create GTKO pigs. FLDCs grew for more than 80 population doublings, maintaining normal karyotype. Gene targeting and loss of heterozygosity mutations produced homozygous GTKO FLDCs. FLDCs used in SCNT gave rise to homozygous GTKO pigs. FDLCs can be used in gene targeting and SCNT to produce genetically modified pigs. The increased life span in culture compared to fetal fibroblasts may facilitate genetic engineering in the pig. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. 3T3 fibroblasts induce cloned interleukin 3-dependent mouse mast cells to resemble connective tissue mast cells in granular constituency

    International Nuclear Information System (INIS)

    Dayton, E.T.; Pharr, P.; Ogawa, M.; Serafin, W.E.; Austen, K.F.; Levi-Schaffer, F.; Stevens, R.L.


    As assessed by ultrastructure, histochemical staining, and T-cell dependency, in vitro-differentiated interleukin 3-dependent mouse mast cells are comparable to the mast cells that reside in the gastrointestinal mucosa but not in the skin or the serosal cavity of the mouse. The authors now demonstrate that when cloned interleukin 3-dependent mast cells are cocultured with mouse skin-derived 3T3 fibroblasts in the presence of WEHI-3 conditioned medium for 28 days, the mast cells acquire the ability to stain with safranin, increase their histamine content ∼ 50-fold and their carboxypeptidase. A content ∼ 100-fold, and augment ∼ their biosynthesis of proteoglycans bearing 35 S-labeled haparin relative to 35 S-labeled chondroitin sulfate glycosaminoglycans. Thus, fibroblasts induce interleukin 3-dependent mouse mast cells to change phenotype from mucosal-like to connective tissue-like, indicating that the biochemical and functional characteristics of this mast cell type are strongly influenced by the connective tissue microenvironment

  6. Therapeutic cloning in the mouse (United States)

    Mombaerts, Peter


    Nuclear transfer technology can be applied to produce autologous differentiated cells for therapeutic purposes, a concept termed therapeutic cloning. Countless articles have been published on the ethics and politics of human therapeutic cloning, reflecting the high expectations from this new opportunity for rejuvenation of the aging or diseased body. Yet the research literature on therapeutic cloning, strictly speaking, is comprised of only four articles, all in the mouse. The efficiency of derivation of embryonic stem cell lines via nuclear transfer is remarkably consistent among these reports. However, the efficiency is so low that, in its present form, the concept is unlikely to become widespread in clinical practice. PMID:12949262

  7. Molecular cloning and tissue-specific expression analysis of mouse spinesin, a type II transmembrane serine protease 5

    International Nuclear Information System (INIS)

    Watanabe, Yoshihisa; Okui, Akira; Mitsui, Shinichi; Kawarabuki, Kentaro; Yamaguchi, Tatsuyuki; Uemura, Hidetoshi; Yamaguchi, Nozomi


    We have previously reported novel serine proteases isolated from cDNA libraries of the human and mouse central nervous system (CNS) by PCR using degenerate oligodeoxyribonucleotide primers designed on the basis of the serine protease motifs, AAHC and DSGGP. Here we report a newly isolated serine protease from the mouse CNS. This protease is homologous (77.9% identical) to human spinesin type II transmembrane serine protease 5. Mouse spinesin (m-spinesin) is also composed of (from the N-terminus) a short cytoplasmic domain, a transmembrane domain, a stem region containing a scavenger-receptor-like domain, and a serine protease domain, as is h-spinesin. We also isolated type 1, type 2, and type 3 variant cDNAs of m-spinesin. Full-length spinesin (type 4) and type 3 contain all the domains, whereas type 1 and type 2 variants lack the cytoplasmic, transmembrane, and scavenger-receptor-like domains. Subcellular localization of the variant forms was analyzed using enhanced green fluorescent protein (EGFP) fusion proteins. EGFP-type 4 fusion protein was predominantly localized to the ER, Golgi apparatus, and plasma membrane, whereas EGFP-type 1 was localized to the cytoplasm, reflecting differential classification of m-spinesin variants into transmembrane and cytoplasmic types. We analyzed the distribution of m-spinesin variants in mouse tissues, using RT-PCR with variant-specific primer sets. Interestingly, transmembrane-type spinesin, types 3 and 4, was specifically expressed in the spinal cord, whereas cytoplasmic type, type 1, was expressed in multiple tissues, including the cerebrum and cerebellum. Therefore, m-spinesin variants may have distinct biological functions arising from organ-specific variant expression

  8. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes. (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A


    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  9. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun


    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  10. Cloning and expression analysis of a new anther-specific gene CaMF4 in Capsicum annuum. (United States)

    Hao, Xuefeng; Chen, Changming; Chen, Guoju; Cao, Bihao; Lei, Jianjun


    Our previous study on the genic male sterile-fertile line 114AB of Capsicum annuum indicated a diversity of differentially expressed cDNA fragments in fertile and sterile lines. In this study, a transcript-derived fragment (TDF), male fertile 4 (CaMF4) was chosen for further investigation to observe that this specific fragment accumulates in the flower buds of the fertile line. The full genomic DNA sequence of CaMF4 was 894 bp in length, containing two exons and one intron, and the complete coding sequence encoded a putative 11.53 kDa protein of 109 amino acids. The derived protein of CaMF4 shared similarity with the members of PGPS/D3 protein family. The expression of CaMF4 was detected in both the flower buds at stage 8 and open flowers of the male fertile line. In contrast to this observation, expression of CaMF4 was not detected in any organs of the male sterile line. Further analysis revealed that CaMF4 was expressed particularly in anthers of the fertile line. Our results suggest that CaMF4 is an anther-specific gene and might be indispensable for anther or pollen development in C. annuum.

  11. Brain-specific enhancers for cell-based therapy (United States)

    Visel, Axel; Rubenstein, John L.R.; Chen, Ying-Jiun; Pennacchio, Len A.; Vogt, Daniel; Nicholas, Cory; Kriegstein, Arnold


    Herein are described a set of novel specific human enhancers for specific forebrain cell types used to study and select for human neural progenitor cells. This approach enables the ability to generate interneurons from human ES, iPS and iN cells, making them available for human transplantation and for molecular/cellular analyzes. These approaches are also directly applicable to generating other neuronal cell types, such as cortical and striatal projection neurons, which have implications for many human diseases.

  12. Generation of B-cell chronic lymphocytic leukemia (B-CLL)-reactive T-cell lines and clones from HLA class I-matched donors using modified B-CLL cells as stimulators: implications for adoptive immunotherapy. (United States)

    Hoogendoorn, M; Wolbers, J Olde; Smit, W M; Schaafsma, M R; Barge, R M Y; Willemze, R; Falkenburg, J H F


    Allogeneic stem cell transplantation following reduced-intensity conditioning is being evaluated in patients with advanced B-cell chronic lymphocytic leukemia (B-CLL). The curative potential of this procedure is mediated by donor-derived alloreactive T cells, resulting in a graft-versus-leukemia effect. However, B-CLL may escape T-cell-mediated immune reactivity since these cells lack expression of costimulatory molecules. We examined the most optimal method to transform B-CLL cells into efficient antigen-presenting cells (APC) using activating cytokines, by triggering toll-like receptors (TLRs) using microbial pathogens and by CD40 stimulation with CD40L-transfected fibroblasts. CD40 activation in the presence of IL-4 induced strongest upregulation of costimulatory and adhesion molecules on B-CLL cells and induced the production of high amounts of IL-12 by the leukemic cells. In contrast to primary B-CLL cells as stimulator cells, these malignant APCs were capable of inducing the generation of B-CLL-reactive CD8(+) CTL lines and clones from HLA class I-matched donors. These CTL lines and clones recognized and killed primary B-CLL as well as patient-derived lymphoblasts, but not donor cells. These results show the feasibility of ex vivo generation of B-CLL-reactive CD8(+) CTLs. This opens new perspectives for adoptive immunotherapy, following allogeneic stem cell transplantation in patients with advanced B-CLL.

  13. The use of a cloned bacterial gene to study mutation in mammalian cells

    International Nuclear Information System (INIS)

    Thacker, J.; Debenham, P.G.; Stretch, A.; Webb, M.B.T.


    The recombinant DNA molecule pSV2-gpt, which contains the bacterial gene coding for xanthine-guanine phosphoribosyl transferase (XGPRT) activity, was introduced into a hamster cell line lacking the equivalent mammalian enzyme (HGPRT). Hamster cell sublines were found with stable expression of XGPRT activity and were used to study mutation of the integrated pSV2-gpt DNA sequence. Mutants were selected by their resistance to 6-thioguanine (TG) under optimal conditions which were found to be very similar to those for selection of HGPRT-deficient mutants of mammalian cells. The frequency of XGPRT-deficient mutants was increased by treatment with X-rays, ethyl methanesulphonate and ethyl nitrosourea. X-Ray induction of mutants increased approximately linearly with dose up to about 500 rad, but the frequency of mutants per rad was very much higher than that usually found for 'native' mammalian genes. (orig./AJ)

  14. Transfer of stem cells carrying engineered chromosomes with XY clone laser system. (United States)

    Sinko, Ildiko; Katona, Robert L


    Current transgenic technologies for gene transfer into the germline of mammals cause a random integration of exogenous naked DNA into the host genome that can generate undesirable position effects as well as insertional mutations. The vectors used to generate transgenic animals are limited by the amount of foreign DNA they can carry. Mammalian artificial chromosomes have large DNA-carrying capacity and ability to replicate in parallel with, but without integration into, the host genome. Hence they are attractive vectors for transgenesis, cellular protein production, and gene therapy applications as well. ES cells mediated chromosome transfer by conventional blastocyst injection has a limitation in unpredictable germline transmission. The demonstrated protocol of laser-assisted microinjection of artificial chromosome containing ES cells into eight-cell mouse embryos protocol described here can solve the problem for faster production of germline transchromosomic mice.

  15. In a patient with biclonal Waldenstrom macroglobulinemia only one clone expands in three-dimensional culture and includes putative cancer stem cells. (United States)

    Kirshner, Julia; Thulien, Kyle J; Kriangkum, Jitra; Motz, Sarah; Belch, Andrew R; Pilarski, Linda M


    A small percentage of cases of Waldenstrom macroglobulinemia (WM) present with biclonality, defined here as the rearrangement of two distinct VDJ gene segments. Here we investigated the expansion of two clones from a patient with WM expressing molecularly detectable clonotypic gene rearrangements, one V(H)3 and one V(H)4. Biclonality was determined in blood and bone marrow mononuclear cells using real-time quantitative PCR (RQ-PCR). V(H)4 expressing cells but not V(H)3 expressing cells underwent clonal expansion in 3-D culture of reconstructed WM bone marrow. After 3-D culture, secondary culture in a colony forming unit assay, and RQ-PCR, only the V(H)4 clone was shown to harbor a subpopulation with characteristics of cancer stem cells, including proliferative quiescence, self-regeneration, and the ability to generate clonotypic progeny, suggesting that the V(H)4, but not the V(H)3, clone is clinically significant. Enrichment of potential WM stem cells in 3-D cultures holds promise for monitoring their response to treatment and for testing new therapies.

  16. SENIEUR status of the originating cell donor negates certain 'anti-immunosenescence' effects of ebselen and N-acetyl cysteine in human T cell clone cultures. (United States)

    Marthandan, Shiva; Freeburn, Robin; Steinbrecht, Susanne; Pawelec, Graham; Barnett, Yvonne


    Damage to T cells of the immune system by reactive oxygen species may result in altered cell function or cell death and thereby potentially impact upon the efficacy of a subsequent immune response. Here, we assess the impact of the antioxidants Ebselen and N-acetyl cysteine on a range of biological markers in human T cells derived from a SENIEUR status donor. In addition, the impact of these antioxidants on different MAP kinase pathways in T cells from donors of different ages was also examined. T cell clones were derived from healthy 26, 45 and SENIEUR status 80 year old people and the impact of titrated concentrations of Ebselen or N-acetyl cysteine on their proliferation and in vitro lifespan, GSH:GSSG ratio as well as levels of oxidative DNA damage and on MAP kinase signaling pathways was examined. In this investigation neither Ebselen nor N-acetyl cysteine supplementation had any impact on the biological endpoints examined in the T cells derived from the SENIEUR status 80 year old donor. This is in contrast to the anti-immunosenescent effects of these antioxidants on T cells from donors of 26 or 45 years of age. The analysis of MAP kinases showed that pro-apoptotic pathways become activated in T cells with increasing in vitro age and that Ebselen or N-acetyl cysteine could decrease activation (phosphorylation) in T cells from 26 or 45 year old donors, but not from the SENIEUR status 80 year old donor. The results of this investigation demonstrate that the biological phenotype of SENIEUR status derived human T cells negates the anti-immunosenescence effects of Ebselen and also N-acetyl cysteine. The results highlight the importance of pre-antioxidant intervention evaluation to determine risk-benefit.

  17. Molecular cloning of cDNAs which are highly overexpressed in mitoxantrone-resistant cells

    DEFF Research Database (Denmark)

    Miyake, K; Mickley, L; Litman, Thomas


    mitoxantrone-resistant S1-M1-80 human colon carcinoma cells was screened by differential hybridization. Two cDNAs of different lengths were isolated and designated MXR1 and MXR2. Sequencing revealed a high degree of homology for the cDNAs with Expressed Sequence Tag sequences previously identified as belonging...... to an ATP binding cassette transporter. Homology to the Drosophila white gene and its homologues was found for the predicted amino acid sequence. Using either cDNA as a probe in a Northern analysis demonstrated high levels of expression in the S1-M1-80 cells and in the human breast cancer subline, MCF-7 Ad......Vp3000. Levels were lower in earlier steps of selection, and in partial revertants. The gene is amplified 10-12-fold in the MCF-7 AdVp3000 cells, but not in the S1-M1-80 cells These studies are consistent with the identification of a new ATP binding cassette transporter, which is overexpressed...

  18. Laser Stimulated Genomic Exchange in Stem Cells. Laser Non-cloning Techniques (United States)

    Stefan, V. Alexander


    I propose a novel technique for a pluripotent stem cell generation. Genomic exchange is stimulated by the beat-wave free electron laser, (B-W FEL), frequency matching with the frequencies of the DNAootnotetextJ.D. Watson and F. H. C. Crick, Nature, 171, 737-738 (1953). eigen-oscillations. B-W FEL-1ootnotetextV. Stefan, B.I.Cohen, C. Joshi Science, 243,4890, (Jan 27,1989); Stefan, et al., Bull. APS. 32, No. 9, 1713 (1987); Stefan, APS March-2011, #S1.143; APS- March-2009, #K1.276. scans entire stem cell; B-W FEL-2 probes the chromosomes. The scanning and probing lasers: 300-500nm and 100-300nm, respectively; irradiances: the order-of-10s mW/cm^2 (above the threshold value for a particular gene structure); repetition rate of few-100s Hz. A variety of genetic-matching conditions can be arranged. Genomic glitches, (the cell nucleus transferootnotetextScott Noggle et al. Nature, 478, 70-75 (06 October 2011).), can be hedged by the use of lasers.

  19. Universality of clone dynamics during tissue development (United States)

    Rulands, Steffen; Lescroart, Fabienne; Chabab, Samira; Hindley, Christopher J.; Prior, Nicole; Sznurkowska, Magdalena K.; Huch, Meritxell; Philpott, Anna; Blanpain, Cedric; Simons, Benjamin D.


    The emergence of complex organs is driven by the coordinated proliferation, migration and differentiation of precursor cells. The fate behaviour of these cells is reflected in the time evolution of their progeny, termed clones, which serve as a key experimental observable. In adult tissues, where cell dynamics is constrained by the condition of homeostasis, clonal tracing studies based on transgenic animal models have advanced our understanding of cell fate behaviour and its dysregulation in disease1,2. But what can be learnt from clonal dynamics in development, where the spatial cohesiveness of clones is impaired by tissue deformations during tissue growth? Drawing on the results of clonal tracing studies, we show that, despite the complexity of organ development, clonal dynamics may converge to a critical state characterized by universal scaling behaviour of clone sizes. By mapping clonal dynamics onto a generalization of the classical theory of aerosols, we elucidate the origin and range of scaling behaviours and show how the identification of universal scaling dependences may allow lineage-specific information to be distilled from experiments. Our study shows the emergence of core concepts of statistical physics in an unexpected context, identifying cellular systems as a laboratory to study non-equilibrium statistical physics.

  20. Genetic Correction and Hepatic Differentiation of Hemophilia B-specific Human Induced Pluripotent Stem Cells. (United States)

    He, Qiong; Wang, Hui-Hui; Cheng, Tao; Yuan, Wei-Ping; Ma, Yu-Po; Jiang, Yong-Ping; Ren, Zhi-Hua


    Objective To genetically correct a disease-causing point mutation in human induced pluripotent stem cells (iPSCs) derived from a hemophilia B patient. Methods First, the disease-causing mutation was detected by sequencing the encoding area of human coagulation factor IX (F IX) gene. Genomic DNA was extracted from the iPSCs, and the primers were designed to amplify the eight exons of F IX. Next, the point mutation in those iPSCs was genetically corrected using CRISPR/Cas9 technology in the presence of a 129-nucleotide homologous repair template that contained two synonymous mutations. Then, top 8 potential off-target sites were subsequently analyzed using Sanger sequencing. Finally, the corrected clones were differentiated into hepatocyte-like cells, and the secretion of F IX was validated by immunocytochemistry and ELISA assay. Results The cell line bore a missense mutation in the 6 th coding exon (c.676 C>T) of F IX gene. Correction of the point mutation was achieved via CRISPR/Cas9 technology in situ with a high efficacy at about 22% (10/45) and no off-target effects detected in the corrected iPSC clones. F IX secretion, which was further visualized by immunocytochemistry and quantified by ELISA in vitro, reached about 6 ng/ml on day 21 of differentiation procedure. Conclusions Mutations in human disease-specific iPSCs could be precisely corrected by CRISPR/Cas9 technology, and corrected cells still maintained hepatic differentiation capability. Our findings might throw a light on iPSC-based personalized therapies in the clinical application, especially for hemophilia B.

  1. Identification and cloning of a prethymic precursor T lymphocyte from a population of common acute lymphoblastic leukemia antigen (CALLA)-positive fetal bone marrow cells

    DEFF Research Database (Denmark)

    Hokland, P; Hokland, M; Daley, J


    We have cloned common acute lymphoblastic leukemia (CALLA)-positive cells from human fetal bone marrow containing less than 1 in 10,000 E-RFC in round-bottomed microtiter wells (one cell per well) using the autocloning unit of an EPICS-V cell sorter. Expansion of such cells (with IL-2 and heavily...... irradiated autologous thymocytes as feeder cells) resulted in growth in 6-14% of the wells (mean, 11%) with cells with mature T lymphocyte phenotype. Two-color fluorescence analysis of outgrowing cultures furthermore ascertained that these cells had differentiated through a phase of simultaneous expression...... of T4 and T8 antigens and at the same time expression of the thymocyte-associated T6 antigens. Thus, given the fact that 10-20% of T cell acute lymphoblastic leukemia (T-ALLs) are CALLA+, we have been able to identify a human prethymic T lymphocyte population that might be the normal counterpart...

  2. Transplantations and Cloning of an Immortal Cell Line from Rat SCN (United States)


    8217 NTIS G•A&I DTIC TA• o t I It q 2 EXPERIMENTAL PROCEDURES Animals and Primary Cultures On separate occasions at day 15 and 16 of gestation, fetuses...for 30 minutes, primary antibody in PBS with 0.25% BSA for 48-72 hr at 50C, biotinylated donkey anti-rabbit immunoglobulin (IgG; Jackson Labs...for the first several weeks postinfection; cells were either singly isolated without companions or organized into small aggregates of no more than 4-5

  3. Quantum cloning machines and the applications

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Heng, E-mail: [Beijing National Laboratory for Condensed Matter Physics, Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Collaborative Innovation Center of Quantum Matter, Beijing 100190 (China); Wang, Yi-Nan; Jing, Li [School of Physics, Peking University, Beijing 100871 (China); Yue, Jie-Dong [Beijing National Laboratory for Condensed Matter Physics, Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Shi, Han-Duo; Zhang, Yong-Liang; Mu, Liang-Zhu [School of Physics, Peking University, Beijing 100871 (China)


    No-cloning theorem is fundamental for quantum mechanics and for quantum information science that states an unknown quantum state cannot be cloned perfectly. However, we can try to clone a quantum state approximately with the optimal fidelity, or instead, we can try to clone it perfectly with the largest probability. Thus various quantum cloning machines have been designed for different quantum information protocols. Specifically, quantum cloning machines can be designed to analyze the security of quantum key distribution protocols such as BB84 protocol, six-state protocol, B92 protocol and their generalizations. Some well-known quantum cloning machines include universal quantum cloning machine, phase-covariant cloning machine, the asymmetric quantum cloning machine and the probabilistic quantum cloning machine. In the past years, much progress has been made in studying quantum cloning machines and their applications and implementations, both theoretically and experimentally. In this review, we will give a complete description of those important developments about quantum cloning and some related topics. On the other hand, this review is self-consistent, and in particular, we try to present some detailed formulations so that further study can be taken based on those results.

  4. Quantum cloning machines and the applications

    International Nuclear Information System (INIS)

    Fan, Heng; Wang, Yi-Nan; Jing, Li; Yue, Jie-Dong; Shi, Han-Duo; Zhang, Yong-Liang; Mu, Liang-Zhu


    No-cloning theorem is fundamental for quantum mechanics and for quantum information science that states an unknown quantum state cannot be cloned perfectly. However, we can try to clone a quantum state approximately with the optimal fidelity, or instead, we can try to clone it perfectly with the largest probability. Thus various quantum cloning machines have been designed for different quantum information protocols. Specifically, quantum cloning machines can be designed to analyze the security of quantum key distribution protocols such as BB84 protocol, six-state protocol, B92 protocol and their generalizations. Some well-known quantum cloning machines include universal quantum cloning machine, phase-covariant cloning machine, the asymmetric quantum cloning machine and the probabilistic quantum cloning machine. In the past years, much progress has been made in studying quantum cloning machines and their applications and implementations, both theoretically and experimentally. In this review, we will give a complete description of those important developments about quantum cloning and some related topics. On the other hand, this review is self-consistent, and in particular, we try to present some detailed formulations so that further study can be taken based on those results

  5. Single-cell cloning and expansion of human induced pluripotent stem cells by a microfluidic culture device. (United States)

    Matsumura, Taku; Tatsumi, Kazuya; Noda, Yuichiro; Nakanishi, Naoyuki; Okonogi, Atsuhito; Hirano, Kunio; Li, Liu; Osumi, Takashi; Tada, Takashi; Kotera, Hidetoshi


    The microenvironment of cells, which includes basement proteins, shear stress, and extracellular stimuli, should be taken into consideration when examining physiological cell behavior. Although microfluidic devices allow cellular responses to be analyzed with ease at the single-cell level, few have been designed to recover cells. We herein demonstrated that a newly developed microfluidic device helped to improve culture conditions and establish a clonality-validated human pluripotent stem cell line after tracing its growth at the single-cell level. The device will be a helpful tool for capturing various cell types in the human body that have not yet been established in vitro. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Cloning of two individual cDNAS encoding 9-cis-epoxycarotenoid dioxygenase from Gentiana lutea, their tissue-specific expression and physiological effect in transgenic tobacco. (United States)

    Zhu, Changfu; Kauder, Friedrich; Römer, Susanne; Sandmann, Gerhard


    Two 9-cis-epoxycarotenoid dioxygenase (NCED) cDNAs have been cloned from a petal library of Gentiana lutea. Both cDNAs carry a putative transit sequence for chloroplast import and differ mainly in their length and the 5'-flanking regions. GlNCED1 was evolutionary closely related to Arabidopsis thaliana NCED6 whereas GlNCED2 showed highest homology to tomato NCED1 and A. thaliana NCED3. The amounts of GlNCED2 transcript were below Northern detection in G. lutea. In contrast, GlNCED1 was specifically expressed at higher levels in developing flowers when petals start appearing. By genetic engineering of tobacco with coding regions of either gene under a constitutive promoter, their function was further analyzed. Although mRNA of both genes was detectable in the corresponding transgenic plants, a physiological effect was only found for GlNCED1 but not for GlNCED2. In germination experiments of GlNCED1 transgenic lines, delayed radicle formation and cotyledon appearance were observed. However, the transformants exhibited no improved tolerance against desiccation stress. In contrast to other plants with over-expressed NCEDs, prolonged delay of seed germination is the only abscisic-acid-related phenotypic effect in the GlNCED1 transgenic lines.

  7. Mucorales-Specific T Cells in Patients with Hematologic Malignancies


    Potenza, L; Vallerini, D; Barozzi, P; Riva, G; Gilioli, A; Forghieri, F; Candoni, A; Cesaro, S; Quadrelli, C; Maertens, J; Rossi, G; Morselli, M; Codeluppi, M; Mussini, C; Colaci, E


    Background Invasive mucormycosis (IM) is an emerging life-threatening fungal infection. It is difficult to obtain a definite diagnosis and to initiate timely intervention. Mucorales-specific T cells occur during the course of IM and are involved in the clearance of the infection. We have evaluated the feasibility of detecting Mucorales-specific T cells in hematological patients at risk for IM, and have correlated the detection of such cells with the clinical conditions of the patients. Method...

  8. Cell Type-Specific Contributions to the TSC Neuropathology (United States)


    AWARD NUMBER: W81XWH-16-1-0415 TITLE: Cell Type-Specific Contributions to the TSC Neuropathology PRINCIPAL INVESTIGATOR: Gabriella D’Arcangelo...AND SUBTITLE Cell Type-Specific Contributions to the TSC Neuropathology 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-16-1-0415 5c. heterozygous and homozygous Tsc2 mutations affect the development of mutant excitatory neurons as well as other surrounding brain cells , in vivo

  9. Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis. (United States)

    Lowe, A M; Deresiewicz, R L


    Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.

  10. Cloning, overexpression, purification of bacteriocin enterocin-B and structural analysis, interaction determination of enterocin-A, B against pathogenic bacteria and human cancer cells. (United States)

    Ankaiah, Dasari; Palanichamy, Esakkiraj; Antonyraj, Christian Bharathi; Ayyanna, Repally; Perumal, Venkatesh; Ahamed, Syed Ibrahim Basheer; Arul, Venkatesan


    In this present study, a gene (ent-B) encoding the bacteriocin enterocin-B was cloned, overexpressed and purified from Enterococcus faecium por1. The molecular weight of the bacteriocin enterocin-B was observed around 7.2 kDa and exhibited antimicrobial activity against several human pathogenic bacteria. The antimicrobial activity of cloned enterocin-B was increased effectively by combining with another bacteriocin enterocin-A from the same microorganism. Protein-protein docking and molecular dynamics simulation studies revealed that the bacteriocin enterocin-B is interacting with enterocin-A and formation of a heterodimer (enterocin A + B). The heterodimer of bacteriocin enterocin-A + B exhibited potential anti-bacterial, anti-biofilm activity against Staphylococcus aureus, Acinetobacter baumannii, Listeria monocytogenes and Escherichia coli. The bacteriocin enterocin-B, A and heterodimer of bacteriocin enterocin A + B showed no haemolysis on human RBC cells. This is the first report that the cell growth inhibitory activity of the bacteriocin enterocin B against HeLa, HT-29 and AGS human cancer cells and this cell growth inhibitory activity was significantly increased when cancer cells treated with the heterodimer of bacteriocins enterocin-A + B. The cell growth inhibitory activity of the bacteriocin enterocin-B and the heterodimer of bacteriocin enterocin-A + B were not observed in non-cancerous INT-407 cells (intestinal epithelial cells). Copyright © 2018. Published by Elsevier B.V.

  11. Artificial cloning of domestic animals. (United States)

    Keefer, Carol L


    Domestic animals can be cloned using techniques such as embryo splitting and nuclear transfer to produce genetically identical individuals. Although embryo splitting is limited to the production of only a few identical individuals, nuclear transfer of donor nuclei into recipient oocytes, whose own nuclear DNA has been removed, can result in large numbers of identical individuals. Moreover, clones can be produced using donor cells from sterile animals, such as steers and geldings, and, unlike their genetic source, these clones are fertile. In reality, due to low efficiencies and the high costs of cloning domestic species, only a limited number of identical individuals are generally produced, and these clones are primarily used as breed stock. In addition to providing a means of rescuing and propagating valuable genetics, somatic cell nuclear transfer (SCNT) research has contributed knowledge that has led to the direct reprogramming of cells (e.g., to induce pluripotent stem cells) and a better understanding of epigenetic regulation during embryonic development. In this review, I provide a broad overview of the historical development of cloning in domestic animals, of its application to the propagation of livestock and transgenic animal production, and of its scientific promise for advancing basic research.

  12. Generation of Five Human Lactoferrin Transgenic Cloned Goats Using Fibroblast Cells and Their Methylation Status of Putative Differential Methylation Regions of IGF2R and H19 Imprinted Genes (United States)

    Sun, Yanyan; Zhang, Yanli; Wang, Ziyu; Song, Yang; Wang, Feng


    Background Somatic cell nuclear transfer (SCNT) is a promising technique to produce transgenic cloned mammalian, including transgenic goats which may produce Human Lactoferrin (hLF). However, success percentage of SCNT is low, because of gestational and neonatal failure of transgenic embryos. According to the studies on cattle and mice, DNA methylation of some imprinted genes, which plays a vital role in the reprogramming of embryo in NT maybe an underlying mechanism. Methodology/Principal Findings Fibroblast cells were derived from the ear of a two-month-old goat. The vector expressing hLF was constructed and transfected into fibroblasts. G418 selection, EGFP expression, PCR, and cell cycle distribution were applied sequentially to select transgenic cells clones. After NT and embryo transfer, five transgenic cloned goats were obtained from 240 cloned transgenic embryos. These transgenic goats were identified by 8 microsatellites genotyping and southern blot. Of the five transgenic goats, 3 were lived after birth, while 2 were dead during gestation. We compared differential methylation regions (DMR) pattern of two paternally imprinted genes (H19 and IGF2R) of the ear tissues from the lived transgenic goats, dead transgenic goats, and control goats from natural reproduction. Hyper-methylation pattern appeared in cloned aborted goats, while methylation status was relatively normal in cloned lived goats compared with normal goats. Conclusions/Significance In this study, we generated five hLF transgenic cloned goats by SCNT. This is the first time the DNA methylation of lived and dead transgenic cloned goats was compared. The results demonstrated that the methylation status of DMRs of H19 and IGF2R were different in lived and dead transgenic goats and therefore this may be potentially used to assess the reprogramming status of transgenic cloned goats. Understanding the pattern of gene imprinting may be useful to improve cloning techniques in future. PMID:24204972

  13. Cloning of the gene encoding the δ subunit of the human T-cell receptor reveals its physical organization within the α-subunit locus and its involvement in chromosome translocations in T-cell malignancy

    International Nuclear Information System (INIS)

    Isobe, M.; Russo, G.; Haluska, F.G.; Croce, C.M.


    By taking advantage of chromosomal walking techniques, the authors have obtained clones that encompass the T-cell receptor (TCR) δ-chain gene. They analyzed clones spanning the entire J α region extending 115 kilobases 5' of the TCR α-chain constant region and have shown that the TCR δ-chain gene is located over 80 kilobases 5' of C α . TCR δ-chain gene is rearranged in the γ/δ-expressing T-cell line Peer and is deleted in α/β-expressing T-cell lines. Sequence analysis of portions of this genomic region demonstrates its identity with previously described cDNA clones corresponding to the C δ and J δ segments. Furthermore, they have analyzed a t(8;14)-(q24;q11) chromosome translocation from a T-cell leukemia and have shown that the J δ segment is rearranged in cells deriving from this tumor and probably directly involved in the translocation. Thus, the newly clones TCR δ chain is implicated in the genesis of chromosome translocations in T-cell malignancies carrying cytogenetic abnormalities of band 14q11

  14. Tissue specific heterogeneity in effector immune cell response

    Directory of Open Access Journals (Sweden)

    Saba eTufail


    Full Text Available Post pathogen invasion, migration of effector T-cell subsets to specific tissue locations is of prime importance for generation of robust immune response. Effector T cells are imprinted with distinct ‘homing codes’ (adhesion molecules and chemokine receptors during activation which regulate their targeted trafficking to specific tissues. Internal cues in the lymph node microenvironment along with external stimuli from food (vitamin A and sunlight (vitamin D3 prime dendritic cells, imprinting them to play centrestage in the induction of tissue tropism in effector T cells. B cells as well, in a manner similar to effector T cells, exhibit tissue tropic migration. In this review, we have focused on the factors regulating the generation and migration of effector T cells to various tissues alongwith giving an overview of tissue tropism in B cells.

  15. Mucorales-Specific T Cells in Patients with Hematologic Malignancies. (United States)

    Potenza, Leonardo; Vallerini, Daniela; Barozzi, Patrizia; Riva, Giovanni; Gilioli, Andrea; Forghieri, Fabio; Candoni, Anna; Cesaro, Simone; Quadrelli, Chiara; Maertens, Johan; Rossi, Giulio; Morselli, Monica; Codeluppi, Mauro; Mussini, Cristina; Colaci, Elisabetta; Messerotti, Andrea; Paolini, Ambra; Maccaferri, Monica; Fantuzzi, Valeria; Del Giovane, Cinzia; Stefani, Alessandro; Morandi, Uliano; Maffei, Rossana; Marasca, Roberto; Narni, Franco; Fanin, Renato; Comoli, Patrizia; Romani, Luigina; Beauvais, Anne; Viale, Pier Luigi; Latgè, Jean Paul; Lewis, Russell E; Luppi, Mario


    Invasive mucormycosis (IM) is an emerging life-threatening fungal infection. It is difficult to obtain a definite diagnosis and to initiate timely intervention. Mucorales-specific T cells occur during the course of IM and are involved in the clearance of the infection. We have evaluated the feasibility of detecting Mucorales-specific T cells in hematological patients at risk for IM, and have correlated the detection of such cells with the clinical conditions of the patients. By using an enzyme linked immunospot assay, the presence of Mucorales-specific T cells in peripheral blood (PB) samples has been investigated at three time points during high-dose chemotherapy for hematologic malignancies. Mucorales-specific T cells producing interferon-γ, interleukin-10 and interleukin-4 were analysed in order to detect a correlation between the immune response and the clinical picture. Twenty-one (10.3%) of 204 patients, accounting for 32 (5.3%) of 598 PB samples, tested positive for Mucorales-specific T cells. Two groups could be identified. Group 1, including 15 patients without signs or symptoms of invasive fungal diseases (IFD), showed a predominance of Mucorales-specific T cells producing interferon-gamma. Group 2 included 6 patients with a clinical picture consistent with invasive fungal disease (IFD): 2 cases of proven IM and 4 cases of possible IFD. The proven patients had significantly higher number of Mucorales-specific T cells producing interleukin-10 and interleukin-4 and higher rates of positive samples by using derived diagnostic cut-offs when compared with the 15 patients without IFD. Mucorales-specific T cells can be detected and monitored in patients with hematologic malignancies at risk for IM. Mucorales-specific T cells polarized to the production of T helper type 2 cytokines are associated with proven IM and may be evaluated as a surrogate diagnostic marker for IM.

  16. Mucorales-Specific T Cells in Patients with Hematologic Malignancies.

    Directory of Open Access Journals (Sweden)

    Leonardo Potenza

    Full Text Available Invasive mucormycosis (IM is an emerging life-threatening fungal infection. It is difficult to obtain a definite diagnosis and to initiate timely intervention. Mucorales-specific T cells occur during the course of IM and are involved in the clearance of the infection. We have evaluated the feasibility of detecting Mucorales-specific T cells in hematological patients at risk for IM, and have correlated the detection of such cells with the clinical conditions of the patients.By using an enzyme linked immunospot assay, the presence of Mucorales-specific T cells in peripheral blood (PB samples has been investigated at three time points during high-dose chemotherapy for hematologic malignancies. Mucorales-specific T cells producing interferon-γ, interleukin-10 and interleukin-4 were analysed in order to detect a correlation between the immune response and the clinical picture. Twenty-one (10.3% of 204 patients, accounting for 32 (5.3% of 598 PB samples, tested positive for Mucorales-specific T cells. Two groups could be identified. Group 1, including 15 patients without signs or symptoms of invasive fungal diseases (IFD, showed a predominance of Mucorales-specific T cells producing interferon-gamma. Group 2 included 6 patients with a clinical picture consistent with invasive fungal disease (IFD: 2 cases of proven IM and 4 cases of possible IFD. The proven patients had significantly higher number of Mucorales-specific T cells producing interleukin-10 and interleukin-4 and higher rates of positive samples by using derived diagnostic cut-offs when compared with the 15 patients without IFD.Mucorales-specific T cells can be detected and monitored in patients with hematologic malignancies at risk for IM. Mucorales-specific T cells polarized to the production of T helper type 2 cytokines are associated with proven IM and may be evaluated as a surrogate diagnostic marker for IM.

  17. Induction of specific suppressor T cells in vitro

    International Nuclear Information System (INIS)

    Eardley, D.D.; Gershon, R.K.


    We describe conditions for generating sheep red blood cell-specific suppressor T cells in Mishell-Dutton cultures. The production of specific suppressor cells is favored by increasing antigen dose in the initial culture but can be produced by transferring more cells when lower doses of antigen are used. Transfer of small numbers of cells cultured with low doses of antigen leads to a specific helper effect. Transfer of large numbers of educated cells leads to nonspecific suppression. Suppression can be effected by the effluent cells from nylon wool columns which do not make detectable PFC. A fraction of these cells become resistant to treatment with anti-T cell sera and complement after culture. The suppressor cells are radiation sensitive and must be able to synthesize protein to suppress. They take 2 to 3 days of education to reach maximum suppressive efficiency and will not suppress cultures if added 2 to 3 days after culture initiation. Their production is favored by the absence of mercaptoethanol, suggesting that the observed suppression is not ''too much help.'' The ability to generate specific suppressor cells in vitro should be of great benefit in determining the factors that regulate their appearance in vivo

  18. DNA cloning: a practical approach. Volume 1

    Energy Technology Data Exchange (ETDEWEB)

    Glover, D M [ed.


    This book is written for the advanced molecular biologist who needs a detailed discussion of cloning technology. Topics of discussion include: genomic library cloning (size of a genomic library, screening methods, chromosome walking, host cell genetics, and general features of bacteriophage Iambda); use of gt10 and gt11 cDNA lambda vectors and general cDNA cloning; RNase H-Pol I cDNA synthesis; method of detecting fusion proteins produced in bacteria; pEMBL family of double-stranded plasmid vectors that can be used to generate single strands; Escherichia coli transformation; production of mutations in cloned sequences; and cloning in gram negative bacteria.

  19. Therapeutic and reproductive cloning: a critique. (United States)

    Bowring, Finn


    This article is a critical examination of the science and ethics of human cloning. It summarises the key scientific milestones in the development of nuclear transplantation, explains the importance of cloning to research into the medical potential of embryonic stem cells, and discusses the well-worn distinction between 'therapeutic' and 'reproductive' cloning. Suggesting that this distinction will be impossible to police, it goes on to consider the ethics of full human cloning. It is concluded that it represents an unacceptable form of parental despotism, and that the genetic engineering and cloning of future human beings will fracture the foundations of modern humanism.

  20. RNAi screen reveals host cell kinases specifically involved in Listeria monocytogenes spread from cell to cell.

    Directory of Open Access Journals (Sweden)

    Ryan Chong

    Full Text Available Intracellular bacterial pathogens, such as Listeria monocytogenes and Rickettsia conorii display actin-based motility in the cytosol of infected cells and spread from cell to cell through the formation of membrane protrusions at the cell cortex. Whereas the mechanisms supporting cytosolic actin-based motility are fairly well understood, it is unclear whether specific host factors may be required for supporting the formation and resolution of membrane protrusions. To address this gap in knowledge, we have developed high-throughput fluorescence microscopy and computer-assisted image analysis procedures to quantify pathogen spread in human epithelial cells. We used the approach to screen a siRNA library covering the human kinome and identified 7 candidate kinases whose depletion led to severe spreading defects in cells infected with L. monocytogenes. We conducted systematic validation procedures with redundant silencing reagents and confirmed the involvement of the serine/threonine kinases, CSNK1A1 and CSNK2B. We conducted secondary assays showing that, in contrast with the situation observed in CSNK2B-depleted cells, L. monocytogenes formed wild-type cytosolic tails and displayed wild-type actin-based motility in the cytosol of CSNK1A1-depleted cells. Furthermore, we developed a protrusion formation assay and showed that the spreading defect observed in CSNK1A1-depleted cells correlated with the formation of protrusion that did not resolve into double-membrane vacuoles. Moreover, we developed sending and receiving cell-specific RNAi procedures and showed that CSNK1A was required in the sending cells, but was dispensable in the receiving cells, for protrusion resolution. Finally, we showed that the observed defects were specific to Listeria monocytogenes, as Rickettsia conorii displayed wild-type cell-to-cell spread in CSNK1A1- and CSNK2B-depleted cells. We conclude that, in addition to the specific host factors supporting cytosolic actin

  1. [An experimental study on the Chinese lung adenocarcinoma cell clone CPA-Yang1-BR with brain metastasis potency in nude mice and in vivo imaging research]. (United States)

    Lei, Bei; Cao, Jie; Shen, Jie; Zhao, Lanxiang; Liang, Sheng; Meng, Qinggang; Xie, Wenhui; Yang, Shunfang


    Lung cancer is the leading cause of cancer-related death in men and women. It is also the most common cause of brain metastases. A brain metastasis model is difficult to be established because of the presence of the blood-brain barrier (BBB) and the lack of optimal methods for detecting brain metastasis in nude mice. Thus, the establishment of a Chinese lung adenocarcinoma cell line and its animal model with brain metastasis potency and in vivo research is of great significance. CPA-Yang1 cells were obtained from a patient with human lung adenocarcinoma by lentiviral vector-mediated transfection of green fluorescence protein. Intracardiac inoculation of the cells was performed in nude mice, and brain metastatic lesions were detected using micro ¹⁸F FDG-PET/CT scanners, small animal in vivo imaging system for fluorescence, radionuclide and X ray fused imaging, magnetic resonance imaging (MRI) with sense body detection, and resection. The samples were divided into two parts for cell culture and histological diagnosis. The process was repeated in vivo and in vitro for four cycles to obtain a novel cell clone, CPA-Yang1-BR. A novel cell clone, CPA-Yang1-BR, was obtained with a brain metastatic rate of 50%. The use of MRI for the detection of brain metastases has obvious advantages. An experimental Chinese lung adenocarcinoma cell clone (CPA-Yang1-BR) and its animal model with brain metastasis potency in nude mice were established. MRI with sense body or micro MRI may be used as a sensitive, accurate, and noninvasive method to detect experimental brain metastases in intact live immunodeficient mice. The results of this study may serve as a technical platform for brain metastases from lung adenocarcinoma.

  2. Detailed characterisation of STC-1 cells and the pGIP/Neo sub-clone suggests the incretin hormones are translationally regulated. (United States)

    Gillespie, Anna L; Pan, Xiaobei; Marco-Ramell, Anna; Meharg, Caroline; Green, Brian D


    STC-1 is a heterogeneous plurihormonal cell line producing several prominent gut peptide hormones. pGIP/Neo is a genetically selected sub-clone of STC-1 with augmented levels of glucose-dependent insulinotropic peptide (GIP). Morphometric parameters, hormone concentrations, mRNA transcripts, hormone immunocytochemistry and nutrient utilisation/production of these two cell lines were compared. Proglucagon-derived peptides (Glucagon-like peptide-1 (GLP-1) and - 2(GLP-2)) were lower in sub-clone cells than progenitor cells. High Content Analysis found altered intracellular GLP-1, GIP, cholecystokinin (CCK) and peptide YY (PYY) levels and differing hormone co-localisation. The proportion pGIP/Neo cells containing GIP immunoreactivity (82%) was greater than STC-1 (65%), as were the proportion with 'GIP only', 'GLP-1+GIP' or 'GIP+PYY' immunoreactivity. Most surprisingly mRNA transcripts of the proglucagon and GIP genes were inversely correlated to the levels of their translated peptides. This strongly suggests that proglucagon and GIP are encoded on 'translationally regulated genes' - a characteristic possessed by other endocrine hormones. Metabolomic profiling revealed differences in cellular nutrient utilisation/production and that under normal culture conditions both cell lines exhibit signs of overflow metabolism. These studies provide an insight into the metabolism and properties of these valuable cells, suggesting for the first time that incretin hormone genes are translationally regulated. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Clone-specific MYD88 L265P and CXCR4 mutation status can provide clinical utility in suspected Waldenström macroglobulinemia/lymphoplasmacytic lymphoma. (United States)

    Burnworth, Bettina; Wang, Zhixing; Singleton, Timothy P; Bennington, Angela; Fritschle, Wayne; Bennington, Richard; Brodersen, Lisa Eidenschink; Wells, Denise A; Loken, Michael R; Zehentner, Barbara K


    MYD88 L265P, a diagnostic marker for lymphoplasmacytic lymphoma (LPL)/Waldenström macroglobulinemia (WM) can also be detected in other hematopoietic malignancie