WorldWideScience

Sample records for cdna sequence analysis

  1. Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

    International Nuclear Information System (INIS)

    Ghaffari, S.H.; Olson, M.O.J.

    1986-01-01

    Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

  2. The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

    International Nuclear Information System (INIS)

    Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue

    2013-01-01

    Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

  3. Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background Microarray analysis and 454 cDNA sequencing were used to investigate a centuries-old problem in regenerative biology: the basis of nerve-dependent limb regeneration in salamanders. Innervated (NR and denervated (DL forelimbs of Mexican axolotls were amputated and transcripts were sampled after 0, 5, and 14 days of regeneration. Results Considerable similarity was observed between NR and DL transcriptional programs at 5 and 14 days post amputation (dpa. Genes with extracellular functions that are critical to wound healing were upregulated while muscle-specific genes were downregulated. Thus, many processes that are regulated during early limb regeneration do not depend upon nerve-derived factors. The majority of the transcriptional differences between NR and DL limbs were correlated with blastema formation; cell numbers increased in NR limbs after 5 dpa and this yielded distinct transcriptional signatures of cell proliferation in NR limbs at 14 dpa. These transcriptional signatures were not observed in DL limbs. Instead, gene expression changes within DL limbs suggest more diverse and protracted wound-healing responses. 454 cDNA sequencing complemented the microarray analysis by providing deeper sampling of transcriptional programs and associated biological processes. Assembly of new 454 cDNA sequences with existing expressed sequence tag (EST contigs from the Ambystoma EST database more than doubled (3935 to 9411 the number of non-redundant human-A. mexicanum orthologous sequences. Conclusion Many new candidate gene sequences were discovered for the first time and these will greatly enable future studies of wound healing, epigenetics, genome stability, and nerve-dependent blastema formation and outgrowth using the axolotl model.

  4. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    Science.gov (United States)

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  5. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

    1991-01-01

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  6. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Janeth Silva Pinheiro

    2008-01-01

    Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

  7. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  8. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  9. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  10. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

    Science.gov (United States)

    Pietrowski, D; Förster, M

    2000-01-01

    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  11. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas

    2009-03-17

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a model cartilaginous fish genome because of its relatively small genome size (910 Mb). The whole genome of C. milii is being sequenced (first cartilaginous fish genome to be sequenced completely). To characterize the transcriptome of C. milii and to assist in annotating exon-intron boundaries, transcriptional start sites and alternatively spliced transcripts, we are generating full-length cDNA sequences from C. milii.

  12. Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

    Science.gov (United States)

    Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

    2010-01-01

    In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

  13. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    Directory of Open Access Journals (Sweden)

    Wallis James G

    2007-07-01

    Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

  14. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  15. Molecular cloning and sequence analysis of hamster CENP-A cDNA

    Directory of Open Access Journals (Sweden)

    Valdivia Manuel M

    2002-05-01

    Full Text Available Abstract Background The centromere is a specialized locus that mediates chromosome movement during mitosis and meiosis. This chromosomal domain comprises a uniquely packaged form of heterochromatin that acts as a nucleus for the assembly of the kinetochore a trilaminar proteinaceous structure on the surface of each chromatid at the primary constriction. Kinetochores mediate interactions with the spindle fibers of the mitotic apparatus. Centromere protein A (CENP-A is a histone H3-like protein specifically located to the inner plate of kinetochore at active centromeres. CENP-A works as a component of specialized nucleosomes at centromeres bound to arrays of repeat satellite DNA. Results We have cloned the hamster homologue of human and mouse CENP-A. The cDNA isolated was found to contain an open reading frame encoding a polypeptide consisting of 129 amino acid residues with a C-terminal histone fold domain highly homologous to those of CENP-A and H3 sequences previously released. However, significant sequence divergence was found at the N-terminal region of hamster CENP-A that is five and eleven residues shorter than those of mouse and human respectively. Further, a human serine 7 residue, a target site for Aurora B kinase phosphorylation involved in the mechanism of cytokinesis, was not found in the hamster protein. A human autoepitope at the N-terminal region of CENP-A described in autoinmune diseases is not conserved in the hamster protein. Conclusions We have cloned the hamster cDNA for the centromeric protein CENP-A. Significant differences on protein sequence were found at the N-terminal tail of hamster CENP-A in comparison with that of human and mouse. Our results show a high degree of evolutionary divergence of kinetochore CENP-A proteins in mammals. This is related to the high diverse nucleotide repeat sequences found at the centromere DNA among species and support a current centromere model for kinetochore function and structural

  16. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    Directory of Open Access Journals (Sweden)

    Bendahmane Abdelhafid

    2011-05-01

    Full Text Available Abstract Background Melon (Cucumis melo, an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs and 3,073 single nucleotide polymorphisms (SNPs in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but

  17. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  18. Analysis of xylem formation in pine by cDNA sequencing

    Science.gov (United States)

    Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.; hide

    1998-01-01

    Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.

  19. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  20. cDNA sequence and tissue expression analysis of glucokinase from ...

    African Journals Online (AJOL)

    Yomi

    2012-01-10

    Jan 10, 2012 ... distribution of GK mRNA in brain, mesenteric adipose tissue, spleen, white muscle and liver of grass ... expression profile of GK mRNA in liver normalized with β-actin level was 31, 454 and 649-fold compared .... Primers and expected products used for GK gene cDNA RT-PCR, RACE and real-time PCR.

  1. Full-length cDNA sequences from Rhesus monkey placenta tissue: analysis and utility for comparative mapping

    Directory of Open Access Journals (Sweden)

    Lee Sang-Rae

    2010-07-01

    Full Text Available Abstract Background Rhesus monkeys (Macaca mulatta are widely-used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as cynomolgus monkeys (Macaca fascicularis, and to humans, sharing a last common ancestor from about 25 million years ago. Although rhesus monkeys have been studied extensively under field and laboratory conditions, research has been limited by the lack of genetic resources. The present study generated placenta full-length cDNA libraries, characterized the resulting expressed sequence tags, and described their utility for comparative mapping with human RefSeq mRNA transcripts. Results From rhesus monkey placenta full-length cDNA libraries, 2000 full-length cDNA sequences were determined and 1835 rhesus placenta cDNA sequences longer than 100 bp were collected. These sequences were annotated based on homology to human genes. Homology search against human RefSeq mRNAs revealed that our collection included the sequences of 1462 putative rhesus monkey genes. Moreover, we identified 207 genes containing exon alterations in the coding region and the untranslated region of rhesus monkey transcripts, despite the highly conserved structure of the coding regions. Approximately 10% (187 of all full-length cDNA sequences did not represent any public human RefSeq mRNAs. Intriguingly, two rhesus monkey specific exons derived from the transposable elements of AluYRa2 (SINE family and MER11B (LTR family were also identified. Conclusion The 1835 rhesus monkey placenta full-length cDNA sequences described here could expand genomic resources and information of rhesus monkeys. This increased genomic information will greatly contribute to the development of evolutionary biology and biomedical research.

  2. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  3. Molecular cloning of chicken metallothionein. Deduction of the complete amino acid sequence and analysis of expression using cloned cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Wei, D; Andrews, G K

    1988-01-25

    A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.

  4. An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries

    Science.gov (United States)

    Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M

    2004-01-01

    Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051

  5. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    International Nuclear Information System (INIS)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E.; Flores, B.M.; Hagen, F.S.

    1990-01-01

    A λgt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically 35 S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface- 125 I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4 degree C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested

  6. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    Energy Technology Data Exchange (ETDEWEB)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E. (Univ. of Washington, Seattle (USA)); Flores, B.M. (Louisiana State Univ. Medical Center, New Orleans (USA)); Hagen, F.S. (Zymogenetics Incorporated, Seattle, WA (USA))

    1990-08-01

    A {lambda}gt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically {sup 35}S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface-{sup 125}I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4{degree}C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested.

  7. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    International Nuclear Information System (INIS)

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-01-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

  8. Generation and analysis of large-scale expressed sequence tags (ESTs from a full-length enriched cDNA library of porcine backfat tissue

    Directory of Open Access Journals (Sweden)

    Lee Hae-Young

    2006-02-01

    Full Text Available Abstract Background Genome research in farm animals will expand our basic knowledge of the genetic control of complex traits, and the results will be applied in the livestock industry to improve meat quality and productivity, as well as to reduce the incidence of disease. A combination of quantitative trait locus mapping and microarray analysis is a useful approach to reduce the overall effort needed to identify genes associated with quantitative traits of interest. Results We constructed a full-length enriched cDNA library from porcine backfat tissue. The estimated average size of the cDNA inserts was 1.7 kb, and the cDNA fullness ratio was 70%. In total, we deposited 16,110 high-quality sequences in the dbEST division of GenBank (accession numbers: DT319652-DT335761. For all the expressed sequence tags (ESTs, approximately 10.9 Mb of porcine sequence were generated with an average length of 674 bp per EST (range: 200–952 bp. Clustering and assembly of these ESTs resulted in a total of 5,008 unique sequences with 1,776 contigs (35.46% and 3,232 singleton (65.54% ESTs. From a total of 5,008 unique sequences, 3,154 (62.98% were similar to other sequences, and 1,854 (37.02% were identified as having no hit or low identity (Sus scrofa. Gene ontology (GO annotation of unique sequences showed that approximately 31.7, 32.3, and 30.8% were assigned molecular function, biological process, and cellular component GO terms, respectively. A total of 1,854 putative novel transcripts resulted after comparison and filtering with the TIGR SsGI; these included a large percentage of singletons (80.64% and a small proportion of contigs (13.36%. Conclusion The sequence data generated in this study will provide valuable information for studying expression profiles using EST-based microarrays and assist in the condensation of current pig TCs into clusters representing longer stretches of cDNA sequences. The isolation of genes expressed in backfat tissue is the

  9. Sequence of human protamine 2 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

  10. Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense.

    Science.gov (United States)

    Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S

    2015-10-19

    Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.

  11. Ferritin from the Pacific abalone Haliotis discus hannai: Analysis of cDNA sequence, expression, and activity.

    Science.gov (United States)

    Qiu, Reng; Kan, Yunchao; Li, Dandan

    2016-02-01

    Ferritin plays an important role in iron homeostasis due to its ability to bind and sequester large amounts of iron. In this study, the gene encoding a ferritin (HdhFer2) was cloned from Pacific abalone (Haliotis discus hannai). The full-length cDNA of HdhFer2 contains a 5'-UTR of 121 bp, an ORF of 516 bp, and a 3'-UTR of 252 bp with a polyadenylation signal sequence of AATAAA and a poly(A) tail. It also contains a 31 bp iron-responsive element (IRE) in the 5'-UTR position, which is conserved in many ferritins. HdhFer2 consists of 171 amino acid residues with a predicted molecular weight (MW) ∼19.8 kDa and a theoretical isoelectric point (PI) of 4.84. The deduced amino acid sequence of HdhFer2 contains two ferritin iron-binding region signatures (IBRSs). HdhFer2 mRNA was detected in a wide range of tissues and was dominantly expressed in the gill. Infection with the bacterial pathogen Vibrio anguillarum significantly upregulated HdhFer2 expression in a time-dependent manner. Recombinant HdhFer2 (rHdhFer2) purified from Escherichia coli was able to bind ferrous iron in a concentration-dependent manner. In summary, these results suggest that HdhFer2 is a crucial protein in the iron-withholding defense system, and plays an important role in the innate immune response of abalone. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. cDNA sequences of two apolipoproteins from lamprey

    International Nuclear Information System (INIS)

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.

    1987-01-01

    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point

  13. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    Science.gov (United States)

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  14. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  15. Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

    DEFF Research Database (Denmark)

    Ibaraki, K; Kozak, C A; Wewer, U M

    1995-01-01

    regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

  16. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I

    1988-01-11

    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  17. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  18. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  19. The cDNA sequence of a neutral horseradish peroxidase.

    Science.gov (United States)

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

    1991-02-16

    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  20. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

    2009-01-01

    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  1. Whitefly (Bemisia tabaci genome project: analysis of sequenced clones from egg, instar, and adult (viruliferous and non-viruliferous cDNA libraries

    Directory of Open Access Journals (Sweden)

    Czosnek Henryk

    2006-04-01

    Full Text Available Abstract Background The past three decades have witnessed a dramatic increase in interest in the whitefly Bemisia tabaci, owing to its nature as a taxonomically cryptic species, the damage it causes to a large number of herbaceous plants because of its specialized feeding in the phloem, and to its ability to serve as a vector of plant viruses. Among the most important plant viruses to be transmitted by B. tabaci are those in the genus Begomovirus (family, Geminiviridae. Surprisingly, little is known about the genome of this whitefly. The haploid genome size for male B. tabaci has been estimated to be approximately one billion bp by flow cytometry analysis, about five times the size of the fruitfly Drosophila melanogaster. The genes involved in whitefly development, in host range plasticity, and in begomovirus vector specificity and competency, are unknown. Results To address this general shortage of genomic sequence information, we have constructed three cDNA libraries from non-viruliferous whiteflies (eggs, immature instars, and adults and two from adult insects that fed on tomato plants infected by two geminiviruses: Tomato yellow leaf curl virus (TYLCV and Tomato mottle virus (ToMoV. In total, the sequence of 18,976 clones was determined. After quality control, and removal of 5,542 clones of mitochondrial origin 9,110 sequences remained which included 3,843 singletons and 1,017 contigs. Comparisons with public databases indicated that the libraries contained genes involved in cellular and developmental processes. In addition, approximately 1,000 bases aligned with the genome of the B. tabaci endosymbiotic bacterium Candidatus Portiera aleyrodidarum, originating primarily from the egg and instar libraries. Apart from the mitochondrial sequences, the longest and most abundant sequence encodes vitellogenin, which originated from whitefly adult libraries, indicating that much of the gene expression in this insect is directed toward the production

  2. CDNA encoding a polypeptide including a hevein sequence

    Science.gov (United States)

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  3. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  4. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  5. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  6. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  7. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  8. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Science.gov (United States)

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

  9. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Directory of Open Access Journals (Sweden)

    Changqing Liu

    2013-05-01

    Full Text Available In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

  10. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

    1987-01-01

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  11. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  12. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  13. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  14. Fiscal 2000 report on result of the full-length cDNA structure analysis; 2000 nendo kanzen cho cDNA kozo kaiseki seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    This paper explains the results of research on full-length cDNA structure analysis for the period from April, 2000 to March, 2001. The outline of human genome sequence was published in June, 2000. In Japan, human gene analysis was such that, as the basic technology of the bio industry, a millennium project was decided in the budget of fiscal 2000. The full-length cDNA structure analysis is the core of the project. The libraries of cDNA were prepared using full-length and more than 4-5kbp-long cDNAs by oligo-capping method. It began from determining partial sequence data at end cDNA, and then, with new clones selected therefrom, full-length human cDNA sequence data were determined. The partial sequence data determined by fiscal 2000 were 1,035,000 clones while the full-length sequence data were 12,144 clones. The sequence data obtained were analyzed by homology search and translated into amino acid coding sequences, with predictions conducted on protein functions. A clustering method was examined that selects new clones from partial sequences. Database was constructed on gene expression profiles and disease-related gene sequence data. (NEDO)

  15. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jacob

    2007-01-01

    public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. RESULTS: Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which...... with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression...

  16. Full-length cDNA sequence cloning and analysis of Ghrelin in Cervus nippon%梅花鹿Ghrelin全长cDNA克隆及其序列分析

    Institute of Scientific and Technical Information of China (English)

    张曼; 金鑫; 田巧珍; 刘骄; 王云鹤; 杨银凤

    2017-01-01

    为获得梅花鹿Ghrelin eDNA全序列,以梅花鹿皱胃黏膜上皮组织提取的总RNA为模板,通过RT-PCR和RACE法克隆了梅花鹿皱胃中Ghrelin基因eDNA的全序列.结果表明梅花鹿Ghrelin eDNA序列全长为539 bp,其中5’非翻译区(5'UTR)为46 bp,3'UTR为128 bp,开放阅读框(ORF)为351 bp,该ORF编码116个氨基酸残基.将梅花鹿Ghrelin基因的eDNA与人和其他动物的Ghrelin相比,发现:梅花鹿Ghrelin与驯鹿、山羊、绵羊和牛的同源性达90.4%~99.1%;与恒河猴、人、猪、犬的同源性达76.6%~66.9%;与鸡和野鸽的同源性分别为36.4%和35.4%.研究表明Ghrelin的结构具有明显的种属特异性,因此Ghrelin在反刍动物体内可能有着重要的生理功能.%In order to obtain the full-length cDNA of Ghrelin in Cervus nippon,RT-PCR and RACE methods were used by using total RNA of abomasus tissue in C.nippon as template.The results of sequence analysis revealed a 539 bp length cDNA containing 46 bp 5'-untranslated region (5'UTR),128 bp 3'-untranslated region (3'UTR) and 351 bp open reading frame (ORF) encoding 116 amino acids.The cDNA sequence alignments of C.nippon Ghrelin gene with human and other animals showed that the cDNA sequence homology of C.nippon Ghrelin was 90.4%-99.1% to reindeer,goat,sheep and cattle,66.9%-76.6% with rhesus monkey,human,pig and dog,only 36.4% with chicken and C.livia.These results indicated that the structure of Ghrelin displayed an obvious varietal specificity,suggesting that Ghrelin might play an important physiological function role in ruminants.

  17. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  18. Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

    International Nuclear Information System (INIS)

    Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

    1988-01-01

    cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

  19. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    Science.gov (United States)

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  20. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  1. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  2. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

    2011-01-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  3. Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

    Energy Technology Data Exchange (ETDEWEB)

    Mankoo, B S; Dalgleish, R

    1988-03-25

    The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

  4. Cloning, sequencing, and expression of cDNA for human β-glucuronidase

    International Nuclear Information System (INIS)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-01-01

    The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

  5. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  6. Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes

    International Nuclear Information System (INIS)

    Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.

    1988-01-01

    Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity

  7. Budding yeast cDNA sequencing project: S03036-05_I15 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available EST - Link to UCSC Genome Browser - Sequence >S03036-05_I15.phd NNNTNNTNNNNCNCTCACATANAAGACGGANNAGNNNGCTGGGC...CAATGCGTTCCATATGCG AAAATTCTTGGNCAATGTATTCTCTAGCAATCTNTNCTTTTGTACANTCGGAGGNTTNTC ATGNTCCTTTCATANATTATANAAANNG

  8. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  9. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    International Nuclear Information System (INIS)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.; Goldberg, E.

    1987-01-01

    The sequence and structure of human testis-specific L-lactate dehydrogenase [LDHC 4 , LDHX; (L)-lactate:NAD + oxidoreductase, EC 1.1.1.27] has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC 4 is as different from rodent LDHC 4 (73% homology) as it is from human LDHA 4 (76% homology) and porcine LDHB 4 (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC 4 and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC 4 reveals significant differences. Knowledge of the human LDHC 4 sequence will help design human-specific peptides useful in the development of a contraceptive vaccine

  10. Human tissue factor: cDNA sequence and chromosome localization of the gene

    International Nuclear Information System (INIS)

    Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.

    1987-01-01

    A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes

  11. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  12. Characterization of full-length sequenced cDNA inserts (FLIcs from Atlantic salmon (Salmo salar

    Directory of Open Access Journals (Sweden)

    Lunner Sigbjørn

    2009-10-01

    Full Text Available Abstract Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP, the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91% of the transcripts were annotated using Gene Ontology (GO terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS. The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS. This

  13. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    Science.gov (United States)

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA

  14. cDNA sequences of two inducible T-cell genes

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))

    1989-03-01

    The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

  15. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  16. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

    Science.gov (United States)

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

    2014-01-01

    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  17. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    International Nuclear Information System (INIS)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-01-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary λgt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/β-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of 125 I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene

  18. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-07-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary lambdagt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/..beta..-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of /sup 125/I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene.

  19. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project License to Use This Database Last updated : 2010/02/15 You may use this databas...ional License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additiona...n the Standard License. Standard License The Standard License for this database is the license specified in ...the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  20. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    Science.gov (United States)

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-08-24

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

  1. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  2. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  3. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  4. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  5. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  6. Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries in a small scale sequencing project

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2003-09-01

    Full Text Available Abstract Background Subtractive hybridization methods are valuable tools for identifying differentially regulated genes in a given tissue avoiding redundant sequencing of clones representing the same expressed genes, maximizing detection of low abundant transcripts and thus, affecting the efficiency and cost effectiveness of small scale cDNA sequencing projects aimed to the specific identification of useful genes for breeding purposes. The objective of this work is to evaluate alternative strategies to high-throughput sequencing projects for the identification of novel genes differentially expressed in sunflower as a source of organ-specific genetic markers that can be functionally associated to important traits. Results Differential organ-specific ESTs were generated from leaf, stem, root and flower bud at two developmental stages (R1 and R4. The use of different sources of RNA as tester and driver cDNA for the construction of differential libraries was evaluated as a tool for detection of rare or low abundant transcripts. Organ-specificity ranged from 75 to 100% of non-redundant sequences in the different cDNA libraries. Sequence redundancy varied according to the target and driver cDNA used in each case. The R4 flower cDNA library was the less redundant library with 62% of unique sequences. Out of a total of 919 sequences that were edited and annotated, 318 were non-redundant sequences. Comparison against sequences in public databases showed that 60% of non-redundant sequences showed significant similarity to known sequences. The number of predicted novel genes varied among the different cDNA libraries, ranging from 56% in the R4 flower to 16 % in the R1 flower bud library. Comparison with sunflower ESTs on public databases showed that 197 of non-redundant sequences (60% did not exhibit significant similarity to previously reported sunflower ESTs. This approach helped to successfully isolate a significant number of new reported sequences

  7. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  8. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  9. Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data

    Directory of Open Access Journals (Sweden)

    Zhou Sun

    2012-05-01

    Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/ using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned

  10. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    Science.gov (United States)

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  11. Cloning and Sequencing of Protein Kinase cDNA from Harbor Seal (Phoca vitulina Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jennifer C. C. Neale

    2004-01-01

    Full Text Available Protein kinases (PKs play critical roles in signal transduction and activation of lymphocytes. The identification of PK genes provides a tool for understanding mechanisms of immunotoxic xenobiotics. As part of a larger study investigating persistent organic pollutants in the harbor seal and their possible immunomodulatory actions, we sequenced harbor seal cDNA fragments encoding PKs. The procedure, using degenerate primers based on conserved motifs of human protein tyrosine kinases (PTKs, successfully amplified nine phocid PK gene fragments with high homology to human and rodent orthologs. We identified eight PTKs and one dual (serine/threonine and tyrosine kinase. Among these were several PKs important in early signaling events through the B- and T-cell receptors (FYN, LYN, ITK and SYK and a MAP kinase involved in downstream signal transduction. V-FGR, RET and DDR2 were also expressed. Sequential activation of protein kinases ultimately induces gene transcription leading to the proliferation and differentiation of lymphocytes critical to adaptive immunity. PKs are potential targets of bioactive xenobiotics, including persistent organic pollutants of the marine environment; characterization of these molecules in the harbor seal provides a foundation for further research illuminating mechanisms of action of contaminants speculated to contribute to large-scale die-offs of marine mammals via immunosuppression.

  12. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

  13. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  14. Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

    International Nuclear Information System (INIS)

    Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D.

    1988-01-01

    The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a λgt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with 32 P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of 32 P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats

  15. Large-scale Identification of Expressed Sequence Tags (ESTs from Nicotianatabacum by Normalized cDNA Library Sequencing

    Directory of Open Access Journals (Sweden)

    Alvarez S Perez

    2014-12-01

    Full Text Available An expressed sequence tags (EST resource for tobacco plants (Nicotianatabacum was established using high-throughput sequencing of randomly selected clones from one cDNA library representing a range of plant organs (leaf, stem, root and root base. Over 5000 ESTs were generated from the 3’ ends of 8000 clones, analyzed by BLAST searches and categorized functionally. All annotated ESTs were classified into 18 functional categories, unique transcripts involved in energy were the largest group accounting for 831 (32.32% of the annotated ESTs. After excluding 2450 non-significant tentative unique transcripts (TUTs, 100 unique sequences (1.67% of total TUTs were identified from the N. tabacum database. In the array result two genes strongly related to the tobacco mosaic virus (TMV were obtained, one basic form of pathogenesis-related protein 1 precursor (TBT012G08 and ubiquitin (TBT087G01. Both of them were found in the variety Hongda, some other important genes were classified into two groups, one of these implicated in plant development like those genes related to a photosynthetic process (chlorophyll a-b binding protein, photosystem I, ferredoxin I and III, ATP synthase and a further group including genes related to plant stress response (ubiquitin, ubiquitin-like protein SMT3, glycine-rich RNA binding protein, histones and methallothionein. The interesting finding in this study is that two of these genes have never been reported before in N. tabacum (ubiquitin-like protein SMT3 and methallothionein. The array results were confirmed using quantitative PCR.

  16. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  17. cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

    International Nuclear Information System (INIS)

    Aris, J.P.; Blobel, G.

    1991-01-01

    The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is ∼1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain ∼75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis

  18. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  19. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    International Nuclear Information System (INIS)

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

    1988-01-01

    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  20. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    Directory of Open Access Journals (Sweden)

    Adam D. Hargreaves

    2015-11-01

    Full Text Available Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete and Sanger-based ESTs (15/29. We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  1. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

    Science.gov (United States)

    Hargreaves, Adam D; Mulley, John F

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  2. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    Science.gov (United States)

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  3. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    Science.gov (United States)

    Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

    2002-11-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

  4. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  5. Characterization and sequence analysis of cysteine and glycine-rich ...

    African Journals Online (AJOL)

    Primers specific for CSRP3 were designed using known cDNA sequences of Bos taurus published in database with different accession numbers. Polymerase chain reaction (PCR) was performed and products were purified and sequenced. Sequence analysis and alignment were carried out using CLUSTAL W (1.83).

  6. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-03

    Dec 3, 2008 ... First strand cDNA was synthesized by RT-PCR with Oligo(dT)15 using mRNA isolated ... 4°C. Single colonies were picked into 5 mL BMGY medium for preculture, and incubated ... to fold properly into a native conformation. Without the .... polymorphism is often used in taxonomy, but now, it is being well ...

  7. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  8. Use of Non-Normalized, Non-Amplified cDNA for 454-Based RNA Sequencing of Fleshy Melon Fruit

    Directory of Open Access Journals (Sweden)

    Vitaly Portnoy

    2011-03-01

    Full Text Available The melon ( L. fruit is an important crop and model system for the genomic study of both fleshy fruit development and the Cucurbitaceae family. To obtain an accurate representation of the melon fruit transcriptome based on expressed sequence tag (EST abundance in 454-pyrosequencing data, we prepared double-stranded complementary DNA (cDNA of melon without the usual amplification and normalization steps. A purification step was also included to eliminate small fragments. Complementary DNAs were obtained from 14 individual fruit libraries derived from two genotypes, separated into flesh and peel tissues, and sampled throughout fruit development. Pyrosequencing was performed using Genome Sequencer FLX (GS FLX technology, resulting in 1,215,359 reads, with mean length of >200 nucleotides. The global digital expression data was validated by comparative reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR of 40 selected genes and expression patterns were similar for the two methods. The results indicate that high-quality, nonbiased cDNA for next-generation sequencing can be prepared from mature, fleshy fruit, which are notorious for difficulties in ribonucleic acid (RNA preparation.

  9. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  10. Cloning and analysis of the mouse Fanconi anemia group A cDNA and an overlapping penta zinc finger cDNA.

    Science.gov (United States)

    Wong, J C; Alon, N; Norga, K; Kruyt, F A; Youssoufian, H; Buchwald, M

    2000-08-01

    Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a model system, we cloned and characterized the mouse homolog of the human FANCA cDNA. The mouse cDNA (Fanca) encodes a 161-kDa protein that shares 65% amino acid sequence identity with human FANCA. Fanca is located at the distal region of mouse chromosome 8 and has a ubiquitous pattern of expression in embryonic and adult tissues. Expression of the mouse cDNA in human FA-A cells restores the cellular drug sensitivity to normal levels. Thus, the expression pattern, protein structure, chromosomal location, and function of FANCA are conserved in the mouse. We also isolated a novel zinc finger protein, Zfp276, which has five C(2)H(2) domains. Interestingly, Zfp276 is situated in the Fanca locus, and the 3'UTR of its cDNA overlaps with the last four exons of Fanca in a tail-to-tail manner. Zfp276 is expressed in the same tissues as Fanca, but does not complement the mitomycin C (MMC)-sensitive phenotype of FA-A cells. The overlapping genomic organization between Zfp276 and Fanca may have relevance to the disease phenotype of FA. Copyright 2000 Academic Press.

  11. In vitro and in silico cloning of Xenopus laevis SOD2 cDNA and its phylogenetic analysis.

    Science.gov (United States)

    Purrello, Michele; Di Pietro, Cinzia; Ragusa, Marco; Pulvirenti, Alfredo; Giugno, Rosalba; Di Pietro, Valentina; Emmanuele, Giovanni; Travali, Salvo; Scalia, Marina; Shasha, Dennis; Ferro, Alfredo

    2005-02-01

    By using the methodology of both wet and dry biology (i.e., RT-PCR and cycle sequencing, and biocomputational technology, respectively) and the data obtained through the Genome Projects, we have cloned Xenopus laevis SOD2 (MnSOD) cDNA and determined its nucleotide sequence. These data and the deduced protein primary structure were compared with all the other SOD2 nucleotide and amino acid sequences from eukaryotes and prokaryotes, published in public databases. The analysis was performed by using both Clustal W, a well known and widely used program for sequence analysis, and AntiClustAl, a new algorithm recently created and implemented by our group. Our results demonstrate a very high conservation of the enzyme amino acid sequence during evolution, which proves a close structure-function relationship. This is to be expected for very ancient molecules endowed with critical biological functions, performed through a specific structural organization. The nucleotide sequence conservation is less pronounced: this too was foreseeable, due to neutral mutations and to the species-specific codon usage. The data obtained by using AntiClustAl are comparable with those produced with Clustal W, which validates this algorithm as an important new tool for biocomputational analysis. Finally, it is noteworthy that evolutionary trees, drawn by using all the available data on SOD2 nucleotide sequences and amino acid and either Clustal W or AntiClustAl, are comparable to those obtained through phylogenetic analysis based on fossil records.

  12. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    Science.gov (United States)

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  13. cDNA cloning and sequence determination of the pheromone biosynthesis activating neuropeptide from the seabuckthorn carpenterworm, Holcocerus hippophaecolus (Lepidoptera: Cossidae).

    Science.gov (United States)

    Li, Juan; Zhou, Jiao; Sun, Rongbo; Zhang, Haolin; Zong, Shixiang; Luo, Youqing; Sheng, Xia; Weng, Qiang

    2013-04-01

    The PBAN (pheromone biosynthesis activating neuropeptide)/pyrokinin peptides comprise a major neuropeptide family characterized by a common FXPRL amide at the C-terminus. These peptides are actively involved in many essential endocrine functions. For the first time, we reported the cDNA cloning and sequence determination of the PBAN from the seabuckthorn carpenterworm, Holcocerus hippophaecolus, by using rapid amplification of cDNA ends. The full-length cDNA of Hh-DH-PBAN contained five peptides: diapause hormone (DH) homolog, α-neuropeptide (NP), β-NP, PBAN, and γ-NP. All of the peptides were amidated at their C-terminus and shared a conserved motif, FXPR (or K) L. Moreover, Hh-DH-PBAN had high homology to the other members of the PBAN peptide family: 56% with Manduca sexta, 66% with Bombyx mori, 77% with Helicoverpa zea, and 47% with Plutella xylostella. Phylogenetic analysis revealed that Hh-DH-PBAN was closely related to PBANs from Noctuidae, demonstrated by the relatively higher similarity compared with H. zea. In addition, real-time quantitative PCR (qRT-PCR) analysis showed that Hh-DH-PBAN mRNA expression peaked in the brain-subesophageal ganglion (Br-SOG) complex, and was also detected at high levels during larval and adult stages. The expression decreased significantly after pupation. These results provided information concerning molecular structure characteristics of Hh-DH-PBAN, whose expression profile suggested that the Hh-DH-PBAN gene might be correlated with larval development and sex pheromone biosynthesis in females of the H. hippophaecolus. 2013 Wiley Periodicals, Inc

  14. cDNA cloning and primary structure analysis of invariant chain in ...

    African Journals Online (AJOL)

    cDNA cloning and primary structure analysis of invariant chain in Chinese Pengze crucian carp. X Liu, W Yu, J Li, F Chen, S Liu, C Wu, J Xu. Abstract. Invariant chain (Ii) plays an important role in MHC class II molecules assembly and exogenous peptide presentation in vertebrates. Although mammalian Ii has been ...

  15. Transcription profiling of the model cyanobacterium Synechococcus sp. strain PCC 7002 by NextGen (SOLiD™ Sequencing of cDNA

    Directory of Open Access Journals (Sweden)

    Marcus eLudwig

    2011-03-01

    Full Text Available The genome of the unicellular, euryhaline cyanobacterium Synechococcus sp. PCC 7002 encodes about 3200 proteins. Transcripts were detected for nearly all annotated open reading frames by a global transcriptomic analysis by Next-Generation (SOLiDTM sequencing of cDNA. In the cDNA samples sequenced, ~90% of the mapped sequences were derived from the 16S and 23S ribosomal RNAs and ~10% of the sequences were derived from mRNAs. In cells grown photoautotrophically under standard conditions (38 °C, 1% (v/v CO2 in air, 250 µmol photons m-2 s-1, the highest transcript levels (up to 2% of the total mRNA for the most abundantly transcribed genes (e. g., cpcAB, psbA, psaA were generally derived from genes encoding structural components of the photosynthetic apparatus. High light exposure for one hour caused changes in transcript levels for genes encoding proteins of the photosynthetic apparatus, Type-1 NADH dehydrogenase complex and ATP synthase, whereas dark incubation for one hour resulted in a global decrease in transcript levels for photosynthesis-related genes and an increase in transcript levels for genes involved in carbohydrate degradation. Transcript levels for pyruvate kinase and the pyruvate dehydrogenase complex decreased sharply in cells incubated in the dark. Under dark anoxic (fermentative conditions, transcript changes indicated a global decrease in transcripts for respiratory proteins and suggested that cells employ an alternative phosphoenolpyruvate degradation pathway via phosphoenolpyruvate synthase (ppsA and the pyruvate:ferredoxin oxidoreductase (nifJ. Finally, the data suggested that an apparent operon involved in tetrapyrrole biosynthesis and fatty acid desaturation, acsF2-ho2-hemN2-desF, may be regulated by oxygen concentration.

  16. Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

    Science.gov (United States)

    Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

    2009-07-01

    Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

  17. Growth hormone and prolactin in Andrias davidianus: cDNA cloning, tissue distribution and phylogenetic analysis.

    Science.gov (United States)

    Yang, Liping; Meng, Zining; Liu, Yun; Zhang, Yong; Liu, Xiaochun; Lu, Danqi; Huang, Junhai; Lin, Haoran

    2010-01-15

    The Chinese giant salamander (Andrias davidianus) is one of the largest and 'living fossil' species of amphibian. To obtain genetic information for this species, the cDNAs encoding growth hormone (adGH) and prolactin (adPRL) were cloned from a pituitary cDNA library. The isolated adGH cDNA consisted of 864 bp and encoded a propeptide of 215 amino acids, while the cDNA of adPRL was 1106 bp in length and encoded a putative peptide of 229 amino acids. Expression of the GH and PRL mRNA was only detected in the pituitary. Phylogenetic analyses were performed based on the isolated pituitary hormone sequences using maximum parsimony and neighbor-joining algorithms. The clustering results are similar to that based on the morphological characteristics or the rRNA genes, which indicate that the two orders (Anura and Caudata) of amphibian were monophyletic, and that A. davidianus was diverged early in the Caudate clade. These results indicated that both the GH and PRL sequence might be useful to study the phylogenies of relatively moderate evolved groups.

  18. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  19. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  20. Gene discovery from Jatropha curcas by sequencing of ESTs from normalized and full-length enriched cDNA library from developing seeds

    Directory of Open Access Journals (Sweden)

    Sugantham Priyanka Annabel

    2010-10-01

    Full Text Available Abstract Background Jatropha curcas L. is promoted as an important non-edible biodiesel crop worldwide. Jatropha oil, which is a triacylglycerol, can be directly blended with petro-diesel or transesterified with methanol and used as biodiesel. Genetic improvement in jatropha is needed to increase the seed yield, oil content, drought and pest resistance, and to modify oil composition so that it becomes a technically and economically preferred source for biodiesel production. However, genetic improvement efforts in jatropha could not take advantage of genetic engineering methods due to lack of cloned genes from this species. To overcome this hurdle, the current gene discovery project was initiated with an objective of isolating as many functional genes as possible from J. curcas by large scale sequencing of expressed sequence tags (ESTs. Results A normalized and full-length enriched cDNA library was constructed from developing seeds of J. curcas. The cDNA library contained about 1 × 106 clones and average insert size of the clones was 2.1 kb. Totally 12,084 ESTs were sequenced to average high quality read length of 576 bp. Contig analysis revealed 2258 contigs and 4751 singletons. Contig size ranged from 2-23 and there were 7333 ESTs in the contigs. This resulted in 7009 unigenes which were annotated by BLASTX. It showed 3982 unigenes with significant similarity to known genes and 2836 unigenes with significant similarity to genes of unknown, hypothetical and putative proteins. The remaining 191 unigenes which did not show similarity with any genes in the public database may encode for unique genes. Functional classification revealed unigenes related to broad range of cellular, molecular and biological functions. Among the 7009 unigenes, 6233 unigenes were identified to be potential full-length genes. Conclusions The high quality normalized cDNA library was constructed from developing seeds of J. curcas for the first time and 7009 unigenes coding

  1. cDNA cloning and transcriptional controlling of a novel low dose radiation-induced gene and its function analysis

    International Nuclear Information System (INIS)

    Zhou Pingkun; Sui Jianli

    2002-01-01

    Objective: To clone a novel low dose radiation-induced gene (LRIGx) and study its function as well as its transcriptional changes after irradiation. Methods: Its cDNA was obtained by DDRT-PCR and RACE techniques. Northern blot hybridization was used to investigate the gene transcription. Bioinformatics was employed to analysis structure and function of this gene. Results: LRIGx cDNA was cloned. The sequence of LRIGx was identical to a DNA clone located in human chromosome 20 q 11.2-12 Bioinformatics analysis predicted an encoded protein with a conserved helicase domain. Northern analysis revealed a ∼8.5 kb transcript which was induced after 0.2 Gy as well as 0.02 Gy irradiation, and the transcript level was increased 5 times at 4 h after 0.2 Gy irradiation. The induced level of LRIGx transcript by 2.0 Gy high dose was lower than by 0.2 Gy. Conclusion: A novel low dose radiation-induced gene has been cloned. It encodes a protein with a conserved helicase domain that could involve in DNA metabolism in the cellular process of radiation response

  2. Amino acid sequence of bovine muzzle epithelial desmocollin derived from cloned cDNA: a novel subtype of desmosomal cadherins.

    Science.gov (United States)

    Koch, P J; Goldschmidt, M D; Walsh, M J; Zimbelmann, R; Schmelz, M; Franke, W W

    1991-05-01

    Desmosomes are cell-type-specific intercellular junctions found in epithelium, myocardium and certain other tissues. They consist of assemblies of molecules involved in the adhesion of specific cell types and in the anchorage of cell-type-specific cytoskeletal elements, the intermediate-size filaments, to the plasma membrane. To explore the individual desmosomal components and their functions we have isolated DNA clones encoding the desmosomal glycoprotein, desmocollin, using antibodies and a cDNA expression library from bovine muzzle epithelium. The cDNA-deduced amino-acid sequence of desmocollin (presently we cannot decide to which of the two desmocollins, DC I or DC II, this clone relates) defines a polypeptide with a calculated molecular weight of 85,000, with a single candidate sequence of 24 amino acids sufficiently long for a transmembrane arrangement, and an extracellular aminoterminal portion of 561 amino acid residues, compared to a cytoplasmic part of only 176 amino acids. Amino acid sequence comparisons have revealed that desmocollin is highly homologous to members of the cadherin family of cell adhesion molecules, including the previously sequenced desmoglein, another desmosome-specific cadherin. Using riboprobes derived from cDNAs for Northern-blot analyses, we have identified an mRNA of approximately 6 kb in stratified epithelia such as muzzle epithelium and tongue mucosa but not in two epithelial cell culture lines containing desmosomes and desmoplakins. The difference may indicate drastic differences in mRNA concentration or the existence of cell-type-specific desmocollin subforms. The molecular topology of desmocollin(s) is discussed in relation to possible functions of the individual molecular domains.

  3. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  4. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

  5. Isolation of a cDNA clone complementary to sequences for a 34-kilodalton protein which is a pp60v-src substrate.

    OpenAIRE

    Tomasiewicz, H G; Cook-Deegan, R; Chikaraishi, D M

    1984-01-01

    We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined that the size of the 34-kilodalton mRNA was 1,100 nucleotides and the level of the 34-kilodalton RNA was the same in various tissues of mature chickens but was significantly higher in chicken embryo fibroblast cells.

  6. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  7. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    International Nuclear Information System (INIS)

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  8. Evaluation and Adaptation of a Laboratory-Based cDNA Library Preparation Protocol for Retrospective Sequencing of Archived MicroRNAs from up to 35-Year-Old Clinical FFPE Specimens.

    Science.gov (United States)

    Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J; Rohan, Thomas; Ben-Dov, Iddo Z

    2017-03-14

    Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens.

  9. PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

    Science.gov (United States)

    Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

    1992-06-01

    Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

  10. CDNA Microarray Based Comparative Gene Expression Analysis of Primary Breast Tumors Versus In Vitro Transformed Neoplastic Breast Epithelium

    National Research Council Canada - National Science Library

    Szallasi, Zoltan

    2001-01-01

    .... The first group of clones is being sorted by their ability to form tumors. We are currently performing cDNA microarray analysis quantifying the expression level of about 15,000 genes in these cell lines...

  11. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution.

    Science.gov (United States)

    Modahl, Cassandra M; Mackessy, Stephen P

    2016-06-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  12. Construction and evaluation of normalized cDNA libraries enriched with full-length sequences for rapid discovery of new genes from Sisal (Agave sisalana Perr.) different developmental stages.

    Science.gov (United States)

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-10-12

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing.

  13. Characterization and phylogenetic analysis of lectin gene cDNA isolated from sea cucumber ( Apostichopus japonicus) body wall

    Science.gov (United States)

    Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli

    2017-12-01

    As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.

  14. High-throughput screening of suppression subtractive hybridization cDNA libraries using DNA microarray analysis

    CSIR Research Space (South Africa)

    Van den Berg, N

    2004-11-01

    Full Text Available Efficient construction of cDNA libraries enriched for differentially expressed transcripts is an important first step in many biological investigations. We present a quantitative procedure for screening cDNA libraries constructed by suppression...

  15. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    Science.gov (United States)

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs

    International Nuclear Information System (INIS)

    Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.

    1987-01-01

    Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2

  17. cDNA cloning, mRNA distribution and heterogeneity, chromosomal location, and RFLP analysis of human osteopontin (OPN)

    DEFF Research Database (Denmark)

    Young, M F; Kerr, J M; Termine, J D

    1990-01-01

    A human osteopontin (OP) cDNA was isolated from a library made from primary cultures of human bone cells. The distribution of osteopontin mRNA in human tissues was investigated by Northern analysis and showed that the human message was predominant in cultures of bone cells and in decidua cells...... osteopontin cDNA indicated that the gene is a single copy with an approximate length of 5.4-8.2 kb....

  18. Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

    NARCIS (Netherlands)

    Lücker, J.; Tamer, El M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

    2002-01-01

    Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the

  19. Cu,Zn superoxide dismutase: cloning and analysis of the Taenia solium gene and Taenia crassiceps cDNA.

    Science.gov (United States)

    Parra-Unda, Ricardo; Vaca-Paniagua, Felipe; Jiménez, Lucia; Landa, Abraham

    2012-01-01

    Cytosolic Cu,Zn superoxide dismutase (Cu,Zn-SOD) catalyzes the dismutation of superoxide (O(2)(-)) to oxygen and hydrogen peroxide (H(2)O(2)) and plays an important role in the establishment and survival of helminthes in their hosts. In this work, we describe the Taenia solium Cu,Zn-SOD gene (TsCu,Zn-SOD) and a Taenia crassiceps (TcCu,Zn-SOD) cDNA. TsCu,Zn-SOD gene that spans 2.841 kb, and has three exons and two introns; the splicing junctions follow the GT-AG rule. Analysis in silico of the gene revealed that the 5'-flanking region has three putative TATA and CCAAT boxes, and transcription factor binding sites for NF1 and AP1. The transcription start site was a C, located at 22 nucleotides upstream of the translation start codon (ATG). Southern blot analysis showed that TcCu,Zn-SOD and TsCu,Zn-SOD genes are encoded by a single copy. The deduced amino acid sequences of TsCu,Zn-SOD gene and TcCu,Zn-SOD cDNA reveal 98.47% of identity, and the characteristic motives, including the catalytic site and β-barrel structure of the Cu,Zn-SOD. Proteomic and immunohistochemical analysis indicated that Cu,Zn-SOD does not have isoforms, is distributed throughout the bladder wall and is concentrated in the tegument of T. solium and T. crassiceps cysticerci. Expression analysis revealed that TcCu,Zn-SOD mRNA and protein expression levels do not change in cysticerci, even upon exposure to O(2)(-) (0-3.8 nmol/min) and H(2)O(2) (0-2mM), suggesting that this gene is constitutively expressed in these parasites. Published by Elsevier Inc.

  20. Biological sequence analysis

    DEFF Research Database (Denmark)

    Durbin, Richard; Eddy, Sean; Krogh, Anders Stærmose

    This book provides an up-to-date and tutorial-level overview of sequence analysis methods, with particular emphasis on probabilistic modelling. Discussed methods include pairwise alignment, hidden Markov models, multiple alignment, profile searches, RNA secondary structure analysis, and phylogene...

  1. Localization of the human fibromodulin gene (FMOD) to chromosome 1q32 and completion of the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Sztrolovics, R.; Grover, J.; Roughley, P.J. [McGill Univ., Montreal (Canada)] [and others

    1994-10-01

    This report describes the cloning of the 3{prime}-untranslated region of the human fibromodulin cDNA and its use to map the gene. For somatic cell hybrids, the generation of the PCR product was concordant with the presence of chromosome 1 and discordant with the presence of all other chromosomes, confirming that the fibromodulin gene is located within region q32 of chromosome 1. The physical mapping of genes is a critical step in the process of identifying which genes may be responsible for various inherited disorders. Specifically, the mapping of the fibromodulin gene now provides the information necessary to evaluate its potential role in genetic disorders of connective tissues. The analysis of previously reported diseases mapped to chromosome 1 reveals two genes located in the proximity of the fibromodulin locus. These are Usher syndrome type II, a recessive disorder characterized by hearing loss and retinitis pigmentosa, and Van der Woude syndrome, a dominant condition associated with abnormalities such as cleft lip and palate and hyperdontia. The genes for both of these disorders have been projected to be localized to 1q32 of a physical map that integrates available genetic linkage and physical data. However, it seems improbable that either of these disorders, exhibiting restricted tissue involvement, could be linked to the fibromodulin gene, given the wide tissue distribution of the encoded proteoglycan, although it remains possible that the relative importance of the quantity and function of the proteoglycan may avry between tissues. 11 refs., 1 fig.

  2. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  3. Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba (L. Taub

    Directory of Open Access Journals (Sweden)

    Dixon Richard A

    2007-11-01

    Full Text Available Abstract Background Guar, Cyamopsis tetragonoloba (L. Taub, is a member of the Leguminosae (Fabaceae family and is economically the most important of the four species in the genus. The endosperm of guar seed is a rich source of mucilage or gum, which forms a viscous gel in cold water, and is used as an emulsifier, thickener and stabilizer in a wide range of foods and industrial applications. Guar gum is a galactomannan, consisting of a linear (1→4-β-linked D-mannan backbone with single-unit, (1→6-linked, α-D-galactopyranosyl side chains. To better understand regulation of guar seed development and galactomannan metabolism we created cDNA libraries and a resulting EST dataset from different developmental stages of guar seeds. Results A database of 16,476 guar seed ESTs was constructed, with 8,163 and 8,313 ESTs derived from cDNA libraries I and II, respectively. Library I was constructed from seeds at an early developmental stage (15–25 days after flowering, DAF, and library II from seeds at 30–40 DAF. Quite different sets of genes were represented in these two libraries. Approximately 27% of the clones were not similar to known sequences, suggesting that these ESTs represent novel genes or may represent non-coding RNA. The high flux of energy into carbohydrate and storage protein synthesis in guar seeds was reflected by a high representation of genes annotated as involved in signal transduction, carbohydrate metabolism, chaperone and proteolytic processes, and translation and ribosome structure. Guar unigenes involved in galactomannan metabolism were identified. Among the seed storage proteins, the most abundant contig represented a conglutin accounting for 3.7% of the total ESTs from both libraries. Conclusion The present EST collection and its annotation provide a resource for understanding guar seed biology and galactomannan metabolism.

  4. Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli

    International Nuclear Information System (INIS)

    Satyanarayana, Tatineni; Gowda, Siddarame; Ayllon, Maria A.; Dawson, William O.

    2003-01-01

    The advent of reverse genetics revolutionized the study of positive-stranded RNA viruses that were amenable for cloning as cDNAs into high-copy-number plasmids of Escherichia coli. However, some viruses are inherently refractory to cloning in high-copy-number plasmids due to toxicity of viral sequences to E. coli. We report a strategy that is a compromise between infectivity of the RNA transcripts and toxicity to E. coli effected by introducing frameshift mutations into 'slippery sequences' near the viral 'toxicity sequences' in the viral cDNA. Citrus tristeza virus (CTV) has cDNA sequences that are toxic to E. coli. The original full-length infectious cDNA of CTV and a derivative replicon, CTV-ΔCla, cloned into pUC119, resulted in unusually limited E. coli growth. However, upon sequencing of these cDNAs, an additional uridinylate (U) was found in a stretch of U's between nts 3726 and 3731 that resulted in a change to a reading frame with a stop codon at nt 3734. Yet, in vitro produced RNA transcripts from these clones infected protoplasts, and the resulting progeny virus was repaired. Correction of the frameshift mutation in the CTV cDNA constructs resulted in increased infectivity of in vitro produced RNA transcripts, but also caused a substantial increase of toxicity to E. coli, now requiring 3 days to develop visible colonies. Frameshift mutations created in sequences not suspected to facilitate reading frame shifting and silent mutations introduced into oligo(U) regions resulted in complete loss of infectivity, suggesting that the oligo(U) region facilitated the repair of the frameshift mutation. Additional frameshift mutations introduced into other oligo(U) regions also resulted in transcripts with reduced infectivity similarly to the original clones with the +1 insertion. However, only the frameshift mutations introduced into oligo(U) regions that were near and before the toxicity region improved growth and stability in E. coli. These data demonstrate that

  5. Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

    Science.gov (United States)

    Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

    2011-10-01

    Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

  6. Cloning and analysis of the mouse Fanconi anemia group a cDNA and an overlapping penta zinc finger cDNA

    NARCIS (Netherlands)

    Wong, JCY; Alon, N; Norga, K; Kruyt, FAE; Youssoufian, H; Buchwald, M

    2000-01-01

    Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a mode I system, we cloned and characterized the mouse homolog of the human FANCA cDNA, The mouse cDNA

  7. [cDNA library construction from panicle meristem of finger millet].

    Science.gov (United States)

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  8. Image sequence analysis

    CERN Document Server

    1981-01-01

    The processing of image sequences has a broad spectrum of important applica­ tions including target tracking, robot navigation, bandwidth compression of TV conferencing video signals, studying the motion of biological cells using microcinematography, cloud tracking, and highway traffic monitoring. Image sequence processing involves a large amount of data. However, because of the progress in computer, LSI, and VLSI technologies, we have now reached a stage when many useful processing tasks can be done in a reasonable amount of time. As a result, research and development activities in image sequence analysis have recently been growing at a rapid pace. An IEEE Computer Society Workshop on Computer Analysis of Time-Varying Imagery was held in Philadelphia, April 5-6, 1979. A related special issue of the IEEE Transactions on Pattern Anal­ ysis and Machine Intelligence was published in November 1980. The IEEE Com­ puter magazine has also published a special issue on the subject in 1981. The purpose of this book ...

  9. Human pro. cap alpha. 1)(I) collagen: cDNA sequence for the C-propeptide domain

    Energy Technology Data Exchange (ETDEWEB)

    Maekelae, J K; Raassina, M; Virta, A; Vuorio, E

    1988-01-11

    The authors have previously constructed a cDNA clone pHCAL1, covering most of the C-terminal propeptide domain of human pro..cap alpha..1(I) collagen mRNA,by inserting a 678 bp EcoRI-XhoI fragment of cDNA into pBR322. Since the XhoI/SalI ligation prevented removal of the insert, they used the same strategy to obtain a similar clone in pUC8. RNA was isolated from fetal calvarial bones. The cDNA was digested with EcoRI and XhoI and fractionated on a 1 % agarose gel. Fragments of 650-700 bp were cloned in pUC8 at the polylinker site, which now permits easy removal of the insert. The new clone was named pHCAL1U since the RNA was isolated from another individual. The approach outlined is useful for studies on individual variation which is important to recognize when searching for disease-related mutations in type I collagen.

  10. Transcriptomic identification of candidate genes involved in sunflower responses to chilling and salt stresses based on cDNA microarray analysis

    Directory of Open Access Journals (Sweden)

    Paniego Norma

    2008-01-01

    Full Text Available Abstract Background Considering that sunflower production is expanding to arid regions, tolerance to abiotic stresses as drought, low temperatures and salinity arises as one of the main constrains nowadays. Differential organ-specific sunflower ESTs (expressed sequence tags were previously generated by a subtractive hybridization method that included a considerable number of putative abiotic stress associated sequences. The objective of this work is to analyze concerted gene expression profiles of organ-specific ESTs by fluorescence microarray assay, in response to high sodium chloride concentration and chilling treatments with the aim to identify and follow up candidate genes for early responses to abiotic stress in sunflower. Results Abiotic-related expressed genes were the target of this characterization through a gene expression analysis using an organ-specific cDNA fluorescence microarray approach in response to high salinity and low temperatures. The experiment included three independent replicates from leaf samples. We analyzed 317 unigenes previously isolated from differential organ-specific cDNA libraries from leaf, stem and flower at R1 and R4 developmental stage. A statistical analysis based on mean comparison by ANOVA and ordination by Principal Component Analysis allowed the detection of 80 candidate genes for either salinity and/or chilling stresses. Out of them, 50 genes were up or down regulated under both stresses, supporting common regulatory mechanisms and general responses to chilling and salinity. Interestingly 15 and 12 sequences were up regulated or down regulated specifically in one stress but not in the other, respectively. These genes are potentially involved in different regulatory mechanisms including transcription/translation/protein degradation/protein folding/ROS production or ROS-scavenging. Differential gene expression patterns were confirmed by qRT-PCR for 12.5% of the microarray candidate sequences. Conclusion

  11. cDNA cloning, expression and immune function analysis of a novel Rac1 gene (AjRac1) in the sea cucumber Apostichopus japonicus.

    Science.gov (United States)

    Li, Kaiquan; Liu, Lin; Shang, Shengnan; Wang, Yi; Zhan, Yaoyao; Song, Jian; Zhang, Xiangxiang; Chang, Yaqing

    2017-10-01

    The ras-related C3 botulinum toxin substrate 1 (Rac1) belongs to Ras homolog (Rho) small GTPases subfamily. As an important molecular switch, Rac1 regulates various processes in the cell, especially in cellular immune response. With attempt to clarify characters and functions of Rac1 in sea cucumbers, full length cDNA of a Rac1 homolog in the sea cucumber Apostichopus japonicus (AjRac1) was cloned by transcriptome database mining and rapid amplification of cDNA ends (RACE) techniques. The open reading frame of AjRac1 is 579 bp encoding a protein with a length of 192 aa. Sequence analysis showed that AjRac1 is highly conserved as compared to those from other eukaryotic species. Phylogenetic analysis revealed that amino acid sequence of AjRac1 closely related to those from Strongylocentrotus purpuratus. Results of expression analysis showed that AjRac1 exhibited a relative high expression in blastula stage, adult coelomocytes and respiratory tree in A. japonicus. The transcription of AjRac1 in adult coelomocytes altered significantly at 4 h- and 12 h-after Vibrio splendidus infection, respectively, which indicated that AjRac1 involved in sea cucumber innate immunity. All data presented in this study will deepen our understanding of characterizations and immunological functions of Rac1 in sea cucumbers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

    Science.gov (United States)

    Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

    2017-08-01

    Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Gene organization in rice revealed by full-length cDNA mapping and gene expression analysis through microarray.

    Directory of Open Access Journals (Sweden)

    Kouji Satoh

    Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.

  14. Cloning and sequence analysis of serine proteinase of Gloydius ussuriensis venom gland

    International Nuclear Information System (INIS)

    Sun Dejun; Liu Shanshan; Yang Chunwei; Zhao Yizhuo; Chang Shufang; Yan Weiqun

    2005-01-01

    Objective: To construct a cDNA library by using mRNA from Gloydius ussuriensis (G. Ussuriensis) venom gland, to clone and analyze serine proteinase gene from the cDNA library. Methods: Total RNA was isolated from venom gland of G. ussuriensis, mRNA was purified by using mRNA isolation Kit. The whole length cDNA was synthesized by means of smart cDNA synthesis strategy, and amplified by long distance PCR procedure, lately cDAN was cloned into vector pBluescrip-sk. The recombinant cDNA was transformed into E. coli DH5α. The cDNA of serine proteinase gene in the venom gland of G. ussuriensis was detected and amplified using the in situ hybridization. The cDNA fragment was inserted into pGEMT vector, cloned and its nucleotide sequence was determined. Results: The capacity of cDNA library of venom gland was above 2.3 x 10 6 . Its open reading frame was composed of 702 nucleotides and coded a protein pre-zymogen of 234 amino acids. It contained 12 cysteine residues. The sequence analysis indicated that the deduced amino acid sequence of the cDNA fragment shared high identity with the thrombin-like enzyme genes of other snakes in the GenBank. the query sequence exhibited strong amino acid sequence homology of 85% to the serine proteas of T. gramineus, thrombin-like serine proteinase I of D. acutus and serine protease catroxase II of C. atrox respectively. Based on the amino acid sequences of other thrombin-like enzymes, the catalytic residues and disulfide bridges of this thrombin-like enzyme were deduced as follows: catalytic residues, His 41 , Asp 86 , Ser 180 ; and six disulfide bridges Cys 7 -Cys 139 , Cys 26 -Cys 42 , Cys 74 -Cys 232 , Cys 118 -Cys 186 , Cys 150 -Cys 165 , Cys 176 -Cys 201 . Conclusion: The capacity of cDNA library of venom gland is above 2.3 x 10 6 , overtop the level of 10 5 capicity. The constructed cDNA library of G. ussuriensis venom gland would be helpful platform to detect new target genes and further gene manipulate. The cloned serine

  15. Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale

    Directory of Open Access Journals (Sweden)

    Liu He

    2017-10-01

    Full Text Available Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS and single-molecule real-time (SMRT sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET and one sucrose transporter (SUT are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT and four cellulose synthase (Ces genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.

  16. Cloning of cDNA sequences of a progestin-regulated mRNA from MCF7 human breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Chalbos, D; Westley, B; Alibert, C; Rochefort, H

    1986-01-24

    A cDNA clone corresponding to an mRNA regulated by the progestin R5020, has been isolated by differential screening of a cDNA library from the MCF7 breast cancer cell line, which contains estrogen and progesterone receptors. This probe hybridized with a single species of poly A + RNA of 8-kb molecular weight as shown by Northern blot analysis and could also be used to total RNA preparation. This recombinant cone hybridized specifically to an mRNA coding for a 250,000 daltons protein when translated in vitro. This protein was identical to the 250 kDa progestin-regulated protein that the authors previously described as shown by immunoprecipitation with specific rabbit polyclonal antibodies. Dose-response curve and specificity studies show that the accumulation of the Pg8 mRNA and that of the 250-kDa protein was increased by 5 to 30-fold following progestin treatment and that this effect was mediated by the progesterone receptor. Time course of induction indicated that the accumulation of mRNA was rapid and preceded that of the protein. This is the first report on a cloned cDNA probe of progestin-regulated mRNA in human cell lines.

  17. Assessment of adaptive evolution between wheat and rice as deduced from full-length common wheat cDNA sequence data and expression patterns

    Directory of Open Access Journals (Sweden)

    Hayashizaki Yoshihide

    2009-06-01

    Full Text Available Abstract Background Wheat is an allopolyploid plant that harbors a huge, complex genome. Therefore, accumulation of expressed sequence tags (ESTs for wheat is becoming particularly important for functional genomics and molecular breeding. We prepared a comprehensive collection of ESTs from the various tissues that develop during the wheat life cycle and from tissues subjected to stress. We also examined their expression profiles in silico. As full-length cDNAs are indispensable to certify the collected ESTs and annotate the genes in the wheat genome, we performed a systematic survey and sequencing of the full-length cDNA clones. This sequence information is a valuable genetic resource for functional genomics and will enable carrying out comparative genomics in cereals. Results As part of the functional genomics and development of genomic wheat resources, we have generated a collection of full-length cDNAs from common wheat. By grouping the ESTs of recombinant clones randomly selected from the full-length cDNA library, we were able to sequence 6,162 independent clones with high accuracy. About 10% of the clones were wheat-unique genes, without any counterparts within the DNA database. Wheat clones that showed high homology to those of rice were selected in order to investigate their expression patterns in various tissues throughout the wheat life cycle and in response to abiotic-stress treatments. To assess the variability of genes that have evolved differently in wheat and rice, we calculated the substitution rate (Ka/Ks of the counterparts in wheat and rice. Genes that were preferentially expressed in certain tissues or treatments had higher Ka/Ks values than those in other tissues and treatments, which suggests that the genes with the higher variability expressed in these tissues is under adaptive selection. Conclusion We have generated a high-quality full-length cDNA resource for common wheat, which is essential for continuation of the

  18. A cDNA Cloning of a Novel Alpha-Class Tyrosinase of Pinctada fucata: Its Expression Analysis and Characterization of the Expressed Protein

    Directory of Open Access Journals (Sweden)

    Ryousuke Takgi

    2014-01-01

    Full Text Available Tyrosinase plays an important role in the formation of the shell matrix and melanin synthesis in mollusks shells. A cDNA clone encoding a 47 kDa protein was isolated from the pearl oyster Pinctada fucata. The cDNA was 1,957 base pairs long and encodes a 417 residue protein that has extensive sequence identity with tyrosinase (polyphenol oxidase: EC 1.14.18.1. This tyrosinase-like protein, termed PfTy, contains an N-terminal signal sequence and the two copper-binding domain signatures (CuA and CuB, suggesting that PfTy belongs to the α-subclass of type-3 copper proteins. Enzyme activity of PfTy was examined by a spectrophotometric method using the translation product derived from an S30 T7 high-yield protein expression system. Tyrosinase activity was seen in this recombinant product. RT-PCR analysis showed that PfTy mRNA was expressed in the mantle pallial, but not in the mantle edge. Therefore, PfTy may participate in insoluble shell matrix formation of the nacreous layer. PfTy expression was also observed in the foot, liver, and adductor muscle, suggesting that PfTy participates in the synthesis of melanins, which are effective scavengers of free radicals formed in multiple intracellular oxidative processes. This is the first report of a novel α-class tyrosinase from the pearl oyster P. fucata.

  19. Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

    1989-05-01

    Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

  20. Cloning and Expression Analysis of a Giant Gourami Vasa-Like cDNA

    Directory of Open Access Journals (Sweden)

    ALIMUDDIN

    2011-09-01

    Full Text Available Molecular marker is useful in the development of testicular cells transplantation for detecting donor-derived germ cells in the recipient gonad. In this study, a giant gourami (Osphronemus goramy vasa-like gene (GgVLG was cloned and characterized for use as a molecular marker for germ cells in this species. Nucleotide sequence analysis revealed that GgVLG comprises 2,340 bps with an open reading frame of 1,962 bps encoding 653 amino acids. The deduced amino acid sequence contained 17 arginine-glycine or arginine-glycine-glycine motifs and eight conserved motifs belonging to the DEAD-box protein family. The GgVLG sequence showed high similarity to Drosophila vasa, common carp vasa homolog and tilapia vasa homolog for 66.2, 85.9, and 90.7%, respectively. In adult tissues, the GgVLG transcripts were specifically detected in ovary and testis. In situ hybridization analysis showed that GgVLG mRNA was detected in oocytes of the ovary and spermatogonia of the testis. There was no signal detected in the spermatocytes, spermatids and other gonadal somatic cells. Thus, consensus sequences, specific localization of GgVLG mRNA in the germ cells, amino acid sequence similarity and phylogenic analysis all suggest that GgVLG is the giant gourami vasa-like gene. Further, GgVLG can be used as a molecular marker for giant gourami germ cells.

  1. Construction of a full-length cDNA library and analysis of expressed ...

    African Journals Online (AJOL)

    ... in the GenBank databases. Cluster analysis allowed the identification of 61 unique sequences. These genes were classified into six types by Gene Ontology (GO) annotation. The results also indicated that unigenes of C. capsularis have higher homology to Populus trichocarpa, Ricinus communis and Corchorus olitorius.

  2. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    NARCIS (Netherlands)

    Vanhoutte, K.J.A.; Eggen, B.J.L.; Janssen, J.J.M.; Stavenga, D.G.

    2002-01-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  3. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana

    NARCIS (Netherlands)

    Vanhoutte, Kürt; Eggen, BJL; Janssen, JJM; Stavenga, DG

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  4. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  5. Transcription analysis of apple fruit development using cDNA microarrays

    NARCIS (Netherlands)

    Soglio, V.; Costa, F.; Molthoff, J.W.; Weemen-Hendriks, M.; Schouten, H.J.; Gianfranceschi, L.

    2009-01-01

    The knowledge of the molecular mechanisms underlying fruit quality traits is fundamental to devise efficient marker-assisted selection strategies and to improve apple breeding. In this study, cDNA microarray technology was used to identify genes whose expression changes during fruit development and

  6. Multiplex preamplification of specific cDNA targets prior to gene expression analysis by TaqMan Arrays

    Directory of Open Access Journals (Sweden)

    Ribal María

    2008-06-01

    Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.

  7. cDNA cloning and expression analysis of two distinct Sox8 genes in Paramisgurnus dabryanus (Cypriniformes).

    Science.gov (United States)

    Xia, Xiaohua; Zhao, Jie; Du, Qiyan; Chang, Zhongjie

    2010-08-01

    The Sox9 gene attracts a lot of attention because of its connection with gonadal development and differentiation. However, Sox8, belonging to the same subgroup SoxE, has rarely been studied. To investigate the function as well as the evolutionary origin of SOXE subgroup, we amplified the genomic DNA of Paramisgurnus dabryanu using a pair of degenerate primers. Using rapid amplification of the cDNA ends (RACE), it was discovered that P. dabryanu has two duplicates: Sox8a and Sox8b. Each has an intron of different length in the conserved HMG-box region. The overall sequence similarity of the deduced amino acid of PdSox8a and PdSox8b was 46.26%, and only two amino acids changed in the HMG-box. This is the first evidence showing that there are two distinct duplications of Sox8 genes in Cypriniformes. Southern blot analysis showed only one hybrid band, with lengths 7.4 or 9.2 kb. Both semi-quantitative RT-PCR and real-time quantitative PCR assay displayed that both PdSox8a and PdSox8b are downregulated during early embryonic development. In adult tissues, the two Sox8 genes expressed ubiquitously, and expression levels are particularly high in the gonads and brain. In gonads, both PdSox8a and PdSox8b are expressed at a higher level in the tesis than in the ovary. PdSox8a and PdSox8b may have functional overlaps and are essential for the neuronal development and differentiation of gonads.

  8. Monitoring expression profiles of rice (Oryza sativa L.) genes under abiotic stresses using cDNA Microarray Analysis (abstract)

    International Nuclear Information System (INIS)

    Rabbani, M.A.

    2005-01-01

    Transcript regulation in response to cold, drought, high salinity and ABA application was investigated in rice (Oryza sativa L., Nipponbare) with microarray analysis including approx. 1700 independent DNA elements derived from three cDNA libraries constructed from 15-day old rice seedlings stressed with drought, cold and high salinity. A total of 141 non-redundant genes were identified, whose expression ratios were more than three-fold compared with the control genes for at least one of stress treatments in microarray analysis. However, after RNA gel blot analysis, a total of 73 genes were identified, among them the transcripts of 36, 62, 57 and 43 genes were found increased after cold, drought, high salinity and ABA application, respectively. Sixteen of these identified genes have been reported previously to be stress inducible in rice, while 57 of which are novel that have not been reported earlier as stress responsive in rice. We observed a strong association in the expression patterns of stress responsive genes and found 15 stress inducible genes that responded to all four treatments. Based on Venn diagram analysis, 56 genes were induced by both drought and high salinity, whereas 22 genes were upregulated by both cold and high salinity stress. Similarly 43 genes were induced by both drought stress and ABA application, while only 17 genes were identified as cold and ABA inducible genes. These results indicated the existence of greater cross talk between drought, ABA and high salinity stress signaling processes than those between cold and ABA, and cold and high salinity stress signaling pathways. The cold, drought, high salinity and ABA inducible genes were classified into four gene groups from their expression profiles. Analysis of data enabled us to identify a number of promoters and possible cis-acting DNA elements of several genes induced by a variety of abiotic stresses by combining expression data with genomic sequence data of rice. Comparative analysis of

  9. Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

    International Nuclear Information System (INIS)

    Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

    1987-01-01

    Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

  10. Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

    Science.gov (United States)

    Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

    1999-09-01

    We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

  11. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

    Science.gov (United States)

    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

    2010-07-01

    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  12. cDNA cloning, genomic organization and expression analysis during somatic embryogenesis of the translationally controlled tumor protein (TCTP) gene from Japanese larch (Larix leptolepis).

    Science.gov (United States)

    Zhang, Li-Feng; Li, Wan-Feng; Han, Su-Ying; Yang, Wen-Hua; Qi, Li-Wang

    2013-10-15

    A full-length cDNA and genomic sequences of a translationally controlled tumor protein (TCTP) gene were isolated from Japanese larch (Larix leptolepis) and designated LaTCTP. The length of the cDNA was 1, 043 bp and contained a 504 bp open reading frame that encodes a predicted protein of 167 amino acids, characterized by two signature sequences of the TCTP protein family. Analysis of the LaTCTP gene structure indicated four introns and five exons, and it is the largest of all currently known TCTP genes in plants. The 5'-flanking promoter region of LaTCTP was cloned using an improved TAIL-PCR technique. In this region we identified many important potential cis-acting elements, such as a Box-W1 (fungal elicitor responsive element), a CAT-box (cis-acting regulatory element related to meristem expression), a CGTCA-motif (cis-acting regulatory element involved in MeJA-responsiveness), a GT1-motif (light responsive element), a Skn-1-motif (cis-acting regulatory element required for endosperm expression) and a TGA-element (auxin-responsive element), suggesting that expression of LaTCTP is highly regulated. Expression analysis demonstrated ubiquitous localization of LaTCTP mRNA in the roots, stems and needles, high mRNA levels in the embryonal-suspensor mass (ESM), browning embryogenic cultures and mature somatic embryos, and low levels of mRNA at day five during somatic embryogenesis. We suggest that LaTCTP might participate in the regulation of somatic embryo development. These results provide a theoretical basis for understanding the molecular regulatory mechanism of LaTCTP and lay the foundation for artificial regulation of somatic embryogenesis. © 2013.

  13. Complete cDNA sequence of the preproform of human pregnancy-associated plasma protein-A. Evidence for expression in the brain and induction by cAMP

    DEFF Research Database (Denmark)

    Haaning, Jesper; Oxvig, Claus; Overgaard, Michael Toft

    1996-01-01

    A cDNA that encodes the prepropeptide of pregnancy-associated plasma protein-A (preproPAPP-A), a putative metalloproteinase, has been cloned and sequenced. PAPP-A is synthesized in the placenta as a 1627-residue precursor preproprotein with a putative 22-residue signal peptide and a highly basic...

  14. cDNA sequence and tissue distribution of the mRNA for bovine and murine p11, the S100-related light chain of the protein-tyrosine kinase substrate p36 (calpactin I)

    DEFF Research Database (Denmark)

    Saris, Chris J M; Kristensen, Torsten; D’Eustachio, Peter

    1987-01-01

    We have isolated and sequenced cDNA clones of bovine nd murine pl 1 mRNAs. The nonpolyadenylated mRNAs are predicted to be 614 and 600 nucleotides, respectively. The p l l mRNAs both contain a 291 nucleotide open reading frame, preceded by a 5”untranslated region of 73 nucleotides in bovine p l l m...

  15. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Directory of Open Access Journals (Sweden)

    Pattana Srifah Huehne

    2013-08-01

    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  16. Characterization of gonadotrophin-releasing hormone precursor cDNA in the Old World mole-rat Cryptomys hottentotus pretoriae: high degree of identity with the New World guinea pig sequence.

    Science.gov (United States)

    Kalamatianos, T; du Toit, L; Hrabovszky, E; Kalló, I; Marsh, P J; Bennett, N C; Coen, C W

    2005-05-01

    Regulation of pituitary gonadotrophins by the decapeptide gonadotrophin-releasing hormone 1 (GnRH1) is crucial for the development and maintenance of reproductive functions. A common amino acid sequence for this decapeptide, designated as 'mammalian' GnRH, has been identified in all mammals thus far investigated with the exception of the guinea pig, in which there are two amino acid substitutions. Among hystricognath rodents, the members of the family Bathyergidae regulate reproduction in response to diverse cues. Thus, highveld mole-rats (Cryptomys hottentotus pretoriae) are social bathyergids in which breeding is restricted to a particular season in the dominant female, but continuously suppressed in subordinate colony members. Elucidation of reproductive control in these animals will be facilitated by characterization of their GnRH1 gene. A partial sequence of GnRH1 precursor cDNA was isolated and characterized. Comparative analysis revealed the highest degree of identity (86%) to guinea pig GnRH1 precursor mRNA. Nevertheless, the deduced amino acid sequence of the mole-rat decapeptide is identical to the 'mammalian' sequence rather than that of guinea pigs. Successful detection of GnRH1-synthesizing neurones using either a guinea pig GnRH1 riboprobe or an antibody against the 'mammalian' decapeptide is consistent with the guinea pig-like sequence for the precursor and the classic 'mammalian' form for the decapeptide. The high degree of identity in the GnRH1 precursor sequence between this Old World mole-rat and the New World guinea pig is consistent with the theory that caviomorphs and phiomorphs originated from a common ancestral line in the Palaeocene to mid Eocene, some 63-45 million years ago.

  17. Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

    DEFF Research Database (Denmark)

    Vorum, H; Liu, X; Madsen, Peder

    1998-01-01

    By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

  18. Combined histochemical staining, RNA amplification, regional, and single cell cDNA analysis within the hippocampus.

    Science.gov (United States)

    Ginsberg, Stephen D; Che, Shaoli

    2004-08-01

    The use of five histochemical stains (cresyl violet, thionin, hematoxylin & eosin, silver stain, and acridine orange) was evaluated in combination with an expression profiling paradigm that included regional and single cell analyses within the hippocampus of post-mortem human brains and adult mice. Adjacent serial sections of human and mouse hippocampus were labeled by histochemistry or neurofilament immunocytochemistry. These tissue sections were used as starting material for regional and single cell microdissection followed by a newly developed RNA amplification procedure (terminal continuation (TC) RNA amplification) and subsequent hybridization to custom-designed cDNA arrays. Results indicated equivalent levels of global hybridization signal intensity and relative expression levels for individual genes for hippocampi stained by cresyl violet, thionin, and hematoxylin & eosin, and neurofilament immunocytochemistry. Moreover, no significant differences existed between the Nissl stains and neurofilament immunocytochemistry for individual CA1 neurons obtained via laser capture microdissection. In contrast, a marked decrement was observed in adjacent hippocampal sections stained for silver stain and acridine orange, both at the level of the regional dissection and at the CA1 neuron population level. Observations made on the cDNA array platform were validated by real-time qPCR using primers directed against beta-actin and glyceraldehyde-3 phosphate dehydrogenase. Thus, this report demonstrated the utility of using specific Nissl stains, but not stains that bind RNA species directly, in both human and mouse brain tissues at the regional and cellular level for state-of-the-art molecular fingerprinting studies.

  19. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  20. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    Science.gov (United States)

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

    2018-05-27

    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  1. Salmo salar and Esox lucius full-length cDNA sequences reveal changes in evolutionary pressures on a post-tetraploidization genome

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2010-04-01

    Full Text Available Abstract Background Salmonids are one of the most intensely studied fish, in part due to their economic and environmental importance, and in part due to a recent whole genome duplication in the common ancestor of salmonids. This duplication greatly impacts species diversification, functional specialization, and adaptation. Extensive new genomic resources have recently become available for Atlantic salmon (Salmo salar, but documentation of allelic versus duplicate reference genes remains a major uncertainty in the complete characterization of its genome and its evolution. Results From existing expressed sequence tag (EST resources and three new full-length cDNA libraries, 9,057 reference quality full-length gene insert clones were identified for Atlantic salmon. A further 1,365 reference full-length clones were annotated from 29,221 northern pike (Esox lucius ESTs. Pairwise dN/dS comparisons within each of 408 sets of duplicated salmon genes using northern pike as a diploid out-group show asymmetric relaxation of selection on salmon duplicates. Conclusions 9,057 full-length reference genes were characterized in S. salar and can be used to identify alleles and gene family members. Comparisons of duplicated genes show that while purifying selection is the predominant force acting on both duplicates, consistent with retention of functionality in both copies, some relaxation of pressure on gene duplicates can be identified. In addition, there is evidence that evolution has acted asymmetrically on paralogs, allowing one of the pair to diverge at a faster rate.

  2. Arginine kinase in the cladoceran Daphnia magna: cDNA sequencing and expression is associated with resistance to toxic Microcystis.

    Science.gov (United States)

    Lyu, Kai; Zhang, Lu; Zhu, Xuexia; Cui, Guilian; Wilson, Alan E; Yang, Zhou

    2015-03-01

    Nutrient loading derived from anthropogenic activities into lakes have increased the frequency, severity and duration of toxic cyanobacterial blooms around the world. Although herbivorous zooplankton are generally considered to be unable to control toxic cyanobacteria, populations of some zooplankton, including Daphnia, have been shown to locally adapt to toxic cyanobacteria and suppress cyanobacterial bloom formation. However, little is known about the physiology of zooplankton behind this phenomenon. One possible explanation is that some zooplankton may induce more tolerance by elevating energy production, thereby adding more energy allocation to detoxification expenditure. It is assumed that arginine kinase (AK) serves as a core in temporal and spatial adenosine triphosphate (ATP) buffering in cells with high fluctuating energy requirements. To test this hypothesis, we studied the energetic response of a single Daphnia magna clone exposed to a toxic strain of Microcystis aeruginosa, PCC7806. Arginine kinase of D. magna (Dm-AK) was successfully cloned. An ATP-gua PtransN domain which was described as a guanidine substrate specificity domain and an ATP-gua Ptrans domain which was responsible for binding ATP were both identified in the Dm-AK. Phylogenetic analysis of AKs in a range of arthropod taxa suggested that Dm-AK was as dissimilar to other crustaceans as it was to insects. Dm-AK transcript level and ATP content in the presence of M. aeruginosa were significantly lower than those in the control diet containing only the nutritious chlorophyte, Scenedesmus obliquus, whereas the two parameters in the neonates whose mothers had been previously exposed to M. aeruginosa were significantly higher than those of mothers fed with pure S. obliquus. These findings suggest that Dm-AK might play an essential role in the coupling of energy production and utilization and the tolerance of D. magna to toxic cyanobacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Integrated sequence analysis. Final report

    International Nuclear Information System (INIS)

    Andersson, K.; Pyy, P.

    1998-02-01

    The NKS/RAK subprojet 3 'integrated sequence analysis' (ISA) was formulated with the overall objective to develop and to test integrated methodologies in order to evaluate event sequences with significant human action contribution. The term 'methodology' denotes not only technical tools but also methods for integration of different scientific disciplines. In this report, we first discuss the background of ISA and the surveys made to map methods in different application fields, such as man machine system simulation software, human reliability analysis (HRA) and expert judgement. Specific event sequences were, after the surveys, selected for application and testing of a number of ISA methods. The event sequences discussed in the report were cold overpressure of BWR, shutdown LOCA of BWR, steam generator tube rupture of a PWR and BWR disturbed signal view in the control room after an external event. Different teams analysed these sequences by using different ISA and HRA methods. Two kinds of results were obtained from the ISA project: sequence specific and more general findings. The sequence specific results are discussed together with each sequence description. The general lessons are discussed under a separate chapter by using comparisons of different case studies. These lessons include areas ranging from plant safety management (design, procedures, instrumentation, operations, maintenance and safety practices) to methodological findings (ISA methodology, PSA,HRA, physical analyses, behavioural analyses and uncertainty assessment). Finally follows a discussion about the project and conclusions are presented. An interdisciplinary study of complex phenomena is a natural way to produce valuable and innovative results. This project came up with structured ways to perform ISA and managed to apply the in practice. The project also highlighted some areas where more work is needed. In the HRA work, development is required for the use of simulators and expert judgement as

  4. cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

    Science.gov (United States)

    Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

    2018-01-01

    Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

  5. Fractals in DNA sequence analysis

    Institute of Scientific and Technical Information of China (English)

    Yu Zu-Guo(喻祖国); Vo Anh; Gong Zhi-Min(龚志民); Long Shun-Chao(龙顺潮)

    2002-01-01

    Fractal methods have been successfully used to study many problems in physics, mathematics, engineering, finance,and even in biology. There has been an increasing interest in unravelling the mysteries of DNA; for example, how can we distinguish coding and noncoding sequences, and the problems of classification and evolution relationship of organisms are key problems in bioinformatics. Although much research has been carried out by taking into consideration the long-range correlations in DNA sequences, and the global fractal dimension has been used in these works by other people, the models and methods are somewhat rough and the results are not satisfactory. In recent years, our group has introduced a time series model (statistical point of view) and a visual representation (geometrical point of view)to DNA sequence analysis. We have also used fractal dimension, correlation dimension, the Hurst exponent and the dimension spectrum (multifractal analysis) to discuss problems in this field. In this paper, we introduce these fractal models and methods and the results of DNA sequence analysis.

  6. Integrated sequence analysis. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Andersson, K.; Pyy, P

    1998-02-01

    The NKS/RAK subprojet 3 `integrated sequence analysis` (ISA) was formulated with the overall objective to develop and to test integrated methodologies in order to evaluate event sequences with significant human action contribution. The term `methodology` denotes not only technical tools but also methods for integration of different scientific disciplines. In this report, we first discuss the background of ISA and the surveys made to map methods in different application fields, such as man machine system simulation software, human reliability analysis (HRA) and expert judgement. Specific event sequences were, after the surveys, selected for application and testing of a number of ISA methods. The event sequences discussed in the report were cold overpressure of BWR, shutdown LOCA of BWR, steam generator tube rupture of a PWR and BWR disturbed signal view in the control room after an external event. Different teams analysed these sequences by using different ISA and HRA methods. Two kinds of results were obtained from the ISA project: sequence specific and more general findings. The sequence specific results are discussed together with each sequence description. The general lessons are discussed under a separate chapter by using comparisons of different case studies. These lessons include areas ranging from plant safety management (design, procedures, instrumentation, operations, maintenance and safety practices) to methodological findings (ISA methodology, PSA,HRA, physical analyses, behavioural analyses and uncertainty assessment). Finally follows a discussion about the project and conclusions are presented. An interdisciplinary study of complex phenomena is a natural way to produce valuable and innovative results. This project came up with structured ways to perform ISA and managed to apply the in practice. The project also highlighted some areas where more work is needed. In the HRA work, development is required for the use of simulators and expert judgement as

  7. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  8. Bioinformatics and expressional analysis of cDNA clones from floral buds

    Science.gov (United States)

    Pawełkowicz, Magdalena Ewa; Skarzyńska, Agnieszka; Cebula, Justyna; Hincha, Dirck; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

    2017-08-01

    The application of genomic approaches may serve as an initial step in understanding the complexity of biochemical network and cellular processes responsible for regulation and execution of many developmental tasks. The molecular mechanism of sex expression in cucumber is still not elucidated. A study of differential expression was conducted to identify genes involved in sex determination and floral organ morphogenesis. Herein, we present generation of expression sequence tags (EST) obtained by differential hybridization (DH) and subtraction technique (cDNA-DSC) and their characteristic features such as molecular function, involvement in biology processes, expression and mapping position on the genome.

  9. Cloning and expression of human deoxycytidine kinase cDNA

    International Nuclear Information System (INIS)

    Chottiner, E.G.; Shewach, D.S.; Datta, N.S.; Ashcraft, E.; Gribbin, D.; Ginsburg, D.; Fox, I.H.; Mitchell, B.S.

    1991-01-01

    Deoxycytidine (dCyd) kinase is required for the phosphorylation of several deoxyribonucleosides and certain nucleoside analogs widely employed as antiviral and chemotherapeutic agents. Detailed analysis of this enzyme has been limited, however, by its low abundance and instability. Using oligonucleotides based on primary amino acid sequence derived from purified dCyd kinase, the authors have screened T-lymphoblast cDNA libraries and identified a cDNA sequence that encodes a 30.5-kDa protein corresponding to the subunit molecular mass of the purified protein. Expression of the cDNA in Escherichia coli results in a 40-fold increase in dCyd kinase activity over control levels. Northern blot analysis reveals a single 2.8-kilobase mRNA expressed in T lymphoblasts at 5- to 10-fold higher levels than in B lymphoblasts, and decreased dCyd kinase mRNA levels are present in T-lymphoblast cell lines resistant to arabinofuranosylcytosine and dideoxycytidine. These findings document that this cDNA encodes the T-lymphoblast dCyd kinase responsible for the phosphorylation of dAdo and dGuo as well as dCyd and arabinofuranosylcytosine

  10. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas; Tay, Boon-Hui; Tan, Yue Ying; Brenner, Sydney; Venkatesh, Byrappa

    2009-01-01

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a

  11. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  12. Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

    2013-11-01

    Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

  13. De novo transcriptome sequencing and sequence analysis of the malaria vector Anopheles sinensis (Diptera: Culicidae)

    Science.gov (United States)

    2014-01-01

    Background Anopheles sinensis is the major malaria vector in China and Southeast Asia. Vector control is one of the most effective measures to prevent malaria transmission. However, there is little transcriptome information available for the malaria vector. To better understand the biological basis of malaria transmission and to develop novel and effective means of vector control, there is a need to build a transcriptome dataset for functional genomics analysis by large-scale RNA sequencing (RNA-seq). Methods To provide a more comprehensive and complete transcriptome of An. sinensis, eggs, larvae, pupae, male adults and female adults RNA were pooled together for cDNA preparation, sequenced using the Illumina paired-end sequencing technology and assembled into unigenes. These unigenes were then analyzed in their genome mapping, functional annotation, homology, codon usage bias and simple sequence repeats (SSRs). Results Approximately 51.6 million clean reads were obtained, trimmed, and assembled into 38,504 unigenes with an average length of 571 bp, an N50 of 711 bp, and an average GC content 51.26%. Among them, 98.4% of unigenes could be mapped onto the reference genome, and 69% of unigenes could be annotated with known biological functions. Homology analysis identified certain numbers of An. sinensis unigenes that showed homology or being putative 1:1 orthologues with genomes of other Dipteran species. Codon usage bias was analyzed and 1,904 SSRs were detected, which will provide effective molecular markers for the population genetics of this species. Conclusions Our data and analysis provide the most comprehensive transcriptomic resource and characteristics currently available for An. sinensis, and will facilitate genetic, genomic studies, and further vector control of An. sinensis. PMID:25000941

  14. cDNA Microarray Analysis of Serially Sampled Cervical Cancer Specimens From Patients Treated With Thermochemoradiotherapy

    International Nuclear Information System (INIS)

    Borkamo, Erling Dahl; Schem, Baard-Christian; Fluge, Oystein; Bruland, Ove; Dahl, Olav; Mella, Olav

    2009-01-01

    Purpose: To elucidate changes in gene expression after treatment with regional thermochemoradiotherapy in locally advanced squamous cell cervical cancer. Methods and Materials: Tru-Cut biopsy specimens were serially collected from 16 patients. Microarray gene expression levels before and 24 h after the first and second trimodality treatment sessions were compared. Pathway and network analyses were conducted by use of Ingenuity Pathways Analysis (IPA; Ingenuity Systems, Redwood City, CA). Single gene expressions were analyzed by quantitative real-time reverse transcription-polymerase chain reaction. Results: We detected 53 annotated genes that were differentially expressed after trimodality treatment. Central in the three top networks detected by IPA were interferon alfa, interferon beta, and interferon gamma receptor; nuclear factor κB; and tumor necrosis factor, respectively. These genes encode proteins that are important in regulation cell signaling, proliferation, gene expression, and immune stimulation. Biological processes over-represented among the 53 genes were fibrosis, tumorigenesis, and immune response. Conclusions: Microarrays showed minor changes in gene expression after thermochemoradiotherapy in locally advanced cervical cancer. We detected 53 differentially expressed genes, mainly involved in fibrosis, tumorigenesis, and immune response. A limitation with the use of serial biopsy specimens was low quality of ribonucleic acid from tumors that respond to highly effective therapy. Another 'key limitation' is timing of the post-treatment biopsy, because 24 h may be too late to adequately assess the impact of hyperthermia on gene expression.

  15. Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs

    Directory of Open Access Journals (Sweden)

    Sebastian Boltaña

    2017-02-01

    Full Text Available This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS and peptidoglycan (PGN. Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs, carrier proteins/membrane transport (approximately 15%, effectors/modulators and cell communication (approximately 11%, nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5% and intracellular transducers/signal transduction (approximately 5%. Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ that provides a platform enriched for the study

  16. Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs.

    Science.gov (United States)

    Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon

    2017-02-03

    This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene

  17. Radioactive cDNA microarray in neurospsychiatry

    International Nuclear Information System (INIS)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon

    2003-01-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  18. Radioactive cDNA microarray in neurospsychiatry

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon [Korea University Medical School, Seoul (Korea, Republic of)

    2003-02-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  19. Molecular characterization, sequence analysis and tissue expression of a porcine gene – MOSPD2

    Directory of Open Access Journals (Sweden)

    Yang Jie

    2017-01-01

    Full Text Available The full-length cDNA sequence of a porcine gene, MOSPD2, was amplified using the rapid amplification of cDNA ends method based on a pig expressed sequence tag sequence which was highly homologous to the coding sequence of the human MOSPD2 gene. Sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 491 amino acids that has high homology with the motile sperm domain-containing protein 2 (MOSPD2 of five species: horse (89%, human (90%, chimpanzee (89%, rhesus monkey (89% and mouse (85%; thus, it could be defined as a porcine MOSPD2 gene. This novel porcine gene was assigned GeneID: 100153601. This gene is structured in 15 exons and 14 introns as revealed by computer-assisted analysis. The phylogenetic analysis revealed that the porcine MOSPD2 gene has a closer genetic relationship with the MOSPD2 gene of horse. Tissue expression analysis indicated that the porcine MOSPD2 gene is generally and differentially expressed in the spleen, muscle, skin, kidney, lung, liver, fat and heart. Our experiment is the first to establish the primary foundation for further research on the porcine MOSPD2 gene.

  20. Characterization of the porcine carboxypeptidase E cDNA

    DEFF Research Database (Denmark)

    Hreidarsdôttir, G.E.; Cirera, Susanna; Fredholm, Merete

    2007-01-01

    the sequence of the cDNA for the porcine CPE gene including all the coding region and the 3'-UTR region was generated. Comparisons with bovine, human, mouse, and rat CPE cDNA sequences showed that the coding regions of the gene are highly conserved both at the nucleotide and at the amino acid level. A very low...

  1. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  2. Analysis of expressed sequence tags from Prunus mume flower and fruit and development of simple sequence repeat markers

    Directory of Open Access Journals (Sweden)

    Gao Zhihong

    2010-07-01

    Full Text Available Abstract Background Expressed Sequence Tag (EST has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. Results In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST sequences with high quality. The ESTs were assembled into 4,473 unigenes composed of 1,492 contigs and 2,981 singletons and that have been deposited in NCBI (accession IDs: GW868575 - GW873047, among which 1,294 unique ESTs were with known or putative functions. Furthermore, we found 1,233 putative simple sequence repeats (SSRs in the P. mume unigene dataset. We randomly tested 42 pairs of PCR primers flanking potential SSRs, and 14 pairs were identified as true-to-type SSR loci and could amplify polymorphic bands from 20 individual plants of P. mume. We further used the 14 EST-SSR primer pairs to test the transferability on peach and plum. The result showed that nearly 89% of the primer pairs produced target PCR bands in the two species. A high level of marker polymorphism was observed in the plum species (65% and low in the peach (46%, and the clustering analysis of the three species indicated that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the Prunus species. Conclusions We have constructed the first cDNA library of P. mume flower and fruit, and our data provide sets of molecular biology resources for P. mume and other Prunus species. These resources will be useful for further study such as genome annotation, new gene discovery, gene functional analysis, molecular breeding, evolution and comparative genomics between Prunus species.

  3. Heterogeneity of rat tropoelastin mRNA revealed by cDNA cloning

    International Nuclear Information System (INIS)

    Pierce, R.A.; Deak, S.B.; Stolle, C.A.; Boyd, C.D.

    1990-01-01

    A λgt11 library constructed from poly(A+) RNA isolated from aortic tissue of neonatal rats was screened for rat tropoelastin cDNAs. The first, screen, utilizing a human tropoelastin cDNA clone, provided rat tropoelastin cDNAs spanning 2.3 kb of carboxy-terminal coding sequence and extended into the 3'-untranslated region. A subsequent screen using a 5' rat tropoelastin cDNA clone yielded clones extending into the amino-terminal signal sequence coding region. Sequence analysis of these clones has provided the complete derived amino acid sequence of rat tropoelastin and allowed alignment and comparison with published bovine cDNA sequence. While the overall structure of rat tropoelastin is similar to bovine sequence, numerous substitutions, deletions, and insertions demonstrated considerable heterogeneity between species. In particular, the pentapeptide repeat VPGVG, characteristic of all tropoelastins analyzed to date, is replaced in rat tropoelastin by a repeating pentapeptide, IPGVG. The hexapeptide repeat VGVAPG, the bovine elastin receptor binding peptide, is not encoded by rat tropoelastin cDNAs. Variations in coding sequence between rat tropoelastin CDNA clones were also found which may represent mRNA heterogeneity produced by alternative splicing of the rat tropoelastin pre-mRNA

  4. Development of a porcine skeletal muscle cDNA microarray: analysis of differential transcript expression in phenotypically distinct muscles

    Directory of Open Access Journals (Sweden)

    Stear Michael

    2003-03-01

    Full Text Available Abstract Background Microarray profiling has the potential to illuminate the molecular processes that govern the phenotypic characteristics of porcine skeletal muscles, such as hypertrophy or atrophy, and the expression of specific fibre types. This information is not only important for understanding basic muscle biology but also provides underpinning knowledge for enhancing the efficiency of livestock production. Results We report on the de novo development of a composite skeletal muscle cDNA microarray, comprising 5500 clones from two developmentally distinct cDNA libraries (longissimus dorsi of a 50-day porcine foetus and the gastrocnemius of a 3-day-old pig. Clones selected for the microarray assembly were of low to moderate abundance, as indicated by colony hybridisation. We profiled the differential expression of genes between the psoas (red muscle and the longissimus dorsi (white muscle, by co-hybridisation of Cy3 and Cy5 labelled cDNA derived from these two muscles. Results from seven microarray slides (replicates correctly identified genes that were expected to be differentially expressed, as well as a number of novel candidate regulatory genes. Quantitative real-time RT-PCR on selected genes was used to confirm the results from the microarray. Conclusion We have developed a porcine skeletal muscle cDNA microarray and have identified a number of candidate genes that could be involved in muscle phenotype determination, including several members of the casein kinase 2 signalling pathway.

  5. Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

    Science.gov (United States)

    Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

    2013-04-01

    The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

  6. cDNA cloning, characterization and expression analysis of a novel antimicrobial peptide gene penaeidin-3 (Fi-Pen3) from the haemocytes of Indian white shrimp Fenneropenaeus indicus.

    Science.gov (United States)

    Shanthi, S; Vaseeharan, B

    2012-03-20

    A new member of antimicrobial peptide genes of the penaeidin family, penaeidin 3, was cloned from the haemocytes of Indian white shrimp Fenneropeneaus indicus (F. indicus), by reverse transcription PCR (RT-PCR) and rapid amplification of cDNA end (RACE-PCR) methods. The complete nucleotide sequence of cDNA clone of Indian white shrimp F. indicus Penaeidin 3 (Fi-Pen3) was 243bp long and has an open reading frame which encodes 80 amino acid peptide. The homology analysis of Fi-Pen3 sequence with other Penaeidins 3 shows higher similarity with Penaeus monodon (92%). The theoretical 3D structure generated through ab initio modelling indicated the presence of two-disulphide bridges in the alpha-helix. The signal peptide sequence of Fi-Pen3 is almost entirely homologous to that of other Penaeidin 3 of crustaceans, while differing relatively in the N-terminal domain of the mature peptide. The mature peptide has a predicted molecular weight of 84.9kDa, and a theoretical pI of 9.38. Phylogenetic analysis of Fi-Pen3 shows high resemblance with other Pen-3 from P. monodon, Litopenaeus stylirostris, Litopenaeus vannamei and Litopenaeus setiferus. Fi-Pen3 found to be expressed in haemocytes, heart, hepatopancreas, muscles, gills, intestine, and eyestalk with higher expression in haemocytes. Microbial challenge resulted in mRNA up-regulation, up to 6h post injection of Vibrio parahemolyticus. The Fi-Pen3 mRNA expression of F. indicus in the premolt stage (D(01) and D(02)) was significantly up-regulated than the postmolt (A and B) and intermolt stages (C). The findings of the present paper underline the involvement of Fi-Pen3 in innate immune system of F. indicus. Copyright © 2011 Elsevier GmbH. All rights reserved.

  7. Sequence analysis of Leukemia DNA

    Science.gov (United States)

    Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa

    2018-03-01

    Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.

  8. The midgut transcriptome of Lutzomyia longipalpis: comparative analysis of cDNA libraries from sugar-fed, blood-fed, post-digested and Leishmania infantum chagasi-infected sand flies

    Directory of Open Access Journals (Sweden)

    Elnaiem Dia-Eldin

    2008-01-01

    Full Text Available Abstract Background In the life cycle of Leishmania within the alimentary canal of sand flies the parasites have to survive the hostile environment of blood meal digestion, escape the blood bolus and attach to the midgut epithelium before differentiating into the infective metacyclic stages. The molecular interactions between the Leishmania parasites and the gut of the sand fly are poorly understood. In the present work we sequenced five cDNA libraries constructed from midgut tissue from the sand fly Lutzomyia longipalpis and analyzed the transcripts present following sugar feeding, blood feeding and after the blood meal has been processed and excreted, both in the presence and absence of Leishmania infantum chagasi. Results Comparative analysis of the transcripts from sugar-fed and blood-fed cDNA libraries resulted in the identification of transcripts differentially expressed during blood feeding. This included upregulated transcripts such as four distinct microvillar-like proteins (LuloMVP1, 2, 4 and 5, two peritrophin like proteins, a trypsin like protein (Lltryp1, two chymotrypsin like proteins (LuloChym1A and 2 and an unknown protein. Downregulated transcripts by blood feeding were a microvillar-like protein (LuloMVP3, a trypsin like protein (Lltryp2 and an astacin-like metalloprotease (LuloAstacin. Furthermore, a comparative analysis between blood-fed and Leishmania infected midgut cDNA libraries resulted in the identification of the transcripts that were differentially expressed due to the presence of Leishmania in the gut of the sand fly. This included down regulated transcripts such as four microvillar-like proteins (LuloMVP1,2, 4 and 5, a Chymotrypsin (LuloChym1A and a carboxypeptidase (LuloCpepA1, among others. Upregulated midgut transcripts in the presence of Leishmania were a peritrophin like protein (LuloPer1, a trypsin-like protein (Lltryp2 and an unknown protein. Conclusion This transcriptome analysis represents the largest set

  9. GenEST, a powerful bidirectional link between cDNA sequence data and gene expression profiles generated by cDNA-AFLP

    NARCIS (Netherlands)

    Qin Ling,; Prins, P.; Jones, J.T.; Popeijus, H.; Smant, G.; Bakker, J.; Helder, J.

    2001-01-01

    The release of vast quantities of DNA sequence data by large-scale genome and expressed sequence tag (EST) projects underlines the necessity for the development of efficient and inexpensive ways to link sequence databases with temporal and spatial expression profiles. Here we demonstrate the power

  10. RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

    Science.gov (United States)

    Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

    1990-07-01

    The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

  11. Genome Sequencing and Analysis Conference IV

    Energy Technology Data Exchange (ETDEWEB)

    1993-12-31

    J. Craig Venter and C. Thomas Caskey co-chaired Genome Sequencing and Analysis Conference IV held at Hilton Head, South Carolina from September 26--30, 1992. Venter opened the conference by noting that approximately 400 researchers from 16 nations were present four times as many participants as at Genome Sequencing Conference I in 1989. Venter also introduced the Data Fair, a new component of the conference allowing exchange and on-site computer analysis of unpublished sequence data.

  12. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    Science.gov (United States)

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  13. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  14. [Whole cDNA sequence cloning and expression of chicken L-FABP gene and its relationship with lipid deposition of hybrid chickens].

    Science.gov (United States)

    Yu, Ying; Wang, Dong; Sun, Dong-Xiao; Xu, Gui-Yun; Li, Jun-Ying; Zhang, Yuan

    2011-07-01

    Liver fatty acid-binding protein (L-FABP) is closely related to intracellular transportation and deposition of lipids. A positive differential displayed fragment was found in the liver tissue among Silkie (CC), CAU-brown chicken (CD), and their reciprocal hybrids (CD and DC) at 8 weeks-old using differential display RT-PCR techniques (DDRT-PCR). Through recycling, sequencing, and alignment analysis, the fragment was identified as chicken liver fatty acid-binding protein gene (L-FABP, GenBank accession number AY321365). Reverse Northern dot blot and semi-quantitative RT-PCR revealed that the avian L-FABP gene was over-expressed in the liver tissue of the reciprocal hybrids (CD and DC) compared to their parental lines (CC and DD), which was consistent with the fact that higher abdomen fat weight and wider inter-muscular fat width observed in the reciprocal hybrids. Considering the higher expression of L-FABP may contribute to the increased lipid deposition in the hybrid chickens, the functional study of avian L-FABP is warranted in future.

  15. Characteristics of the Lotus japonicus gene repertoire deduced from large-scale expressed sequence tag (EST) analysis.

    Science.gov (United States)

    Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi

    2004-02-01

    To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.

  16. The Pekin duck programmed death-ligand 1: cDNA cloning, genomic structure, molecular characterization and mRNA expression analysis.

    Science.gov (United States)

    Yao, Q; Fischer, K P; Tyrrell, D L; Gutfreund, K S

    2015-04-01

    Programmed death ligand-1 (PD-L1) plays an important role in the attenuation of adaptive immune responses in higher vertebrates. Here, we describe the identification of the Pekin duck PD-L1 orthologue (duPD-L1) and its gene structure. The duPD-L1 cDNA encodes a 311-amino acid protein that has an amino acid identity of 78% and 42% with chicken and human PD-L1, respectively. Mapping of the duPD-L1 cDNA with duck genomic sequences revealed an exonic structure of its coding sequence similar to those of other vertebrates but lacked a noncoding exon 1. Homology modelling of the duPD-L1 extracellular domain was compatible with the tandem IgV-like and IgC-like IgSF domain structure of human PD-L1 (PDB ID: 3BIS). Residues known to be important for receptor binding of human PD-L1 were mostly conserved in duPD-L1 within the N-terminus and the G sheet, and partially conserved within the F sheet but not within sheets C and C'. DuPD-L1 mRNA was constitutively expressed in all tissues examined with highest expression levels in lung and spleen and very low levels of expression in muscle, kidney and brain. Mitogen stimulation of duck peripheral blood mononuclear cells transiently increased duPD-L1 mRNA expression. Our observations demonstrate evolutionary conservation of the exonic structure of its coding sequence, the extracellular domain structure and residues implicated in receptor binding, but the role of the longer cytoplasmic tail in avian PD-L1 proteins remains to be determined. © 2014 John Wiley & Sons Ltd.

  17. Molecular cloning of lupin leghemoglobin cDNA

    DEFF Research Database (Denmark)

    Konieczny, A; Jensen, E O; Marcker, K A

    1987-01-01

    Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

  18. cDNA cloning and immunological characterization of the rye grass allergen Lol p I.

    Science.gov (United States)

    Perez, M; Ishioka, G Y; Walker, L E; Chesnut, R W

    1990-09-25

    The complete amino acid sequence of two "isoallergenic" forms of Lol p I, the major rye grass (Lolium perenne) pollen allergen, was deduced from cDNA sequence analysis. cDNA clones isolated from a Lolium perenne pollen library contained an open reading frame coding for a 240-amino acid protein. Comparison of the nucleotide and deduced amino acid sequence of two of these clones revealed four changes at the amino acid level and numerous nucleotide differences. Both clones contained one possible asparagine-linked glycosylation site. Northern blot analysis shows one RNA species of 1.2 kilobases. Based on the complete amino acid sequence of Lol p I, overlapping peptides covering the entire molecule were synthesized. Utilizing these peptides we have identified a determinant within the Lol p I molecule that is recognized by human leukocyte antigen class II-restricted T cells obtained from persons allergic to rye grass pollen.

  19. [Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

    Science.gov (United States)

    Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

    2006-05-01

    Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

  20. Alternative splicing of human elastin mRNA indicated by sequence analysis of cloned genomic and complementary DNA

    International Nuclear Information System (INIS)

    Indik, Z.; Yeh, H.; Ornstein-goldstein, N.; Sheppard, P.; Anderson, N.; Rosenbloom, J.C.; Peltonen, L.; Rosenbloom, J.

    1987-01-01

    Poly(A) + RNA, isolated from a single 7-mo fetal human aorta, was used to synthesize cDNA by the RNase H method, and the cDNA was inserted into λgt10. Recombinant phage containing elastin sequences were identified by hybridization with cloned, exon-containing fragments of the human elastin gene. Three clones containing inserts of 3.3, 2.7, and 2.3 kilobases were selected for further analysis. Three overlapping clones containing 17.8 kilobases of the human elastin gene were also isolated from genomic libraries. Complete sequence analysis of the six clones demonstrated that: (i) the cDNA encompassed the entire translated portion of the mRNA encoding 786 amino acids, including several unusual hydrophilic amino acid sequences not previously identified in porcine tropoelastin, (ii) exons encoding either hydrophobic or crosslinking domains in the protein alternated in the gene, and (iii) a great abundance of Alu repetitive sequences occurred throughout the introns. The data also indicated substantial alternative splicing of the mRNA. These results suggest the potential for significant variation in the precise molecular structure of the elastic fiber in the human population

  1. Robustness analysis of chiller sequencing control

    International Nuclear Information System (INIS)

    Liao, Yundan; Sun, Yongjun; Huang, Gongsheng

    2015-01-01

    Highlights: • Uncertainties with chiller sequencing control were systematically quantified. • Robustness of chiller sequencing control was systematically analyzed. • Different sequencing control strategies were sensitive to different uncertainties. • A numerical method was developed for easy selection of chiller sequencing control. - Abstract: Multiple-chiller plant is commonly employed in the heating, ventilating and air-conditioning system to increase operational feasibility and energy-efficiency under part load condition. In a multiple-chiller plant, chiller sequencing control plays a key role in achieving overall energy efficiency while not sacrifices the cooling sufficiency for indoor thermal comfort. Various sequencing control strategies have been developed and implemented in practice. Based on the observation that (i) uncertainty, which cannot be avoided in chiller sequencing control, has a significant impact on the control performance and may cause the control fail to achieve the expected control and/or energy performance; and (ii) in current literature few studies have systematically addressed this issue, this paper therefore presents a study on robustness analysis of chiller sequencing control in order to understand the robustness of various chiller sequencing control strategies under different types of uncertainty. Based on the robustness analysis, a simple and applicable method is developed to select the most robust control strategy for a given chiller plant in the presence of uncertainties, which will be verified using case studies

  2. Characterization of a molt-inhibiting hormone (MIH) of the crayfish, Orconectes limosus, by cDNA cloning and mass spectrometric analysis.

    Science.gov (United States)

    Bulau, Patrick; Okuno, Atsuro; Thome, Elke; Schmitz, Tina; Peter-Katalinic, Jasna; Keller, Rainer

    2005-11-01

    The structure of the precursor of a molt-inhibiting hormone (MIH) of the American crayfish, Orconectes limosus was determined by cloning of a cDNA based on RNA from the neurosecretory perikarya of the X-organ in the eyestalk ganglia. The open reading frame includes the complete precursor sequence, consisting of a signal peptide of 29, and the MIH sequence of 77 amino acids. In addition, the mature peptide was isolated by HPLC from the neurohemal sinus gland and analyzed by ESI-MS and MALDI-TOF-MS peptide mapping. This showed that the mature peptide (Mass 8664.29 Da) consists of only 75 amino acids, having Ala75-NH2 as C-terminus. Thus, C-terminal Arg77 of the precursor is removed during processing, and Gly76 serves as an amide donor. Sequence comparison confirms this peptide as a novel member of the large family, which includes crustacean hyperglycaemic hormone (CHH), MIH and gonad (vitellogenesis)-inhibiting hormone (GIH/VIH). The lack of a CPRP (CHH-precursor related peptide) in the hormone precursor, the size and specific sequence characteristics show that Orl MIH belongs to the MIH/GIH(VIH) subgroup of this larger family. Comparison with the MIH of Procambarus clarkii, the only other MIH that has thus far been identified in freshwater crayfish, shows extremely high sequence conservation. Both MIHs differ in only one amino acid residue ( approximately 99% identity), whereas the sequence identity to several other known MIHs is between 40 and 46%.

  3. Probabilistic accident sequence recovery analysis

    International Nuclear Information System (INIS)

    Stutzke, Martin A.; Cooper, Susan E.

    2004-01-01

    Recovery analysis is a method that considers alternative strategies for preventing accidents in nuclear power plants during probabilistic risk assessment (PRA). Consideration of possible recovery actions in PRAs has been controversial, and there seems to be a widely held belief among PRA practitioners, utility staff, plant operators, and regulators that the results of recovery analysis should be skeptically viewed. This paper provides a framework for discussing recovery strategies, thus lending credibility to the process and enhancing regulatory acceptance of PRA results and conclusions. (author)

  4. Characteristics of MHC class I genes in house sparrows Passer domesticus as revealed by long cDNA transcripts and amplicon sequencing.

    Science.gov (United States)

    Karlsson, Maria; Westerdahl, Helena

    2013-08-01

    In birds the major histocompatibility complex (MHC) organization differs both among and within orders; chickens Gallus gallus of the order Galliformes have a simple arrangement, while many songbirds of the order Passeriformes have a more complex arrangement with larger numbers of MHC class I and II genes. Chicken MHC genes are found at two independent loci, classical MHC-B and non-classical MHC-Y, whereas non-classical MHC genes are yet to be verified in passerines. Here we characterize MHC class I transcripts (α1 to α3 domain) and perform amplicon sequencing using a next-generation sequencing technique on exon 3 from house sparrow Passer domesticus (a passerine) families. Then we use phylogenetic, selection, and segregation analyses to gain a better understanding of the MHC class I organization. Trees based on the α1 and α2 domain revealed a distinct cluster with short terminal branches for transcripts with a 6-bp deletion. Interestingly, this cluster was not seen in the tree based on the α3 domain. 21 exon 3 sequences were verified in a single individual and the average numbers within an individual were nine and five for sequences with and without a 6-bp deletion, respectively. All individuals had exon 3 sequences with and without a 6-bp deletion. The sequences with a 6-bp deletion have many characteristics in common with non-classical MHC, e.g., highly conserved amino acid positions were substituted compared with the other alleles, low nucleotide diversity and just a single site was subject to positive selection. However, these alleles also have characteristics that suggest they could be classical, e.g., complete linkage and absence of a distinct cluster in a tree based on the α3 domain. Thus, we cannot determine for certain whether or not the alleles with a 6-bp deletion are non-classical based on our present data. Further analyses on segregation patterns of these alleles in combination with dating the 6-bp deletion through MHC characterization across the

  5. Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

    Science.gov (United States)

    Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

    2017-08-01

    Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Analysis of expressed sequence tags from the Ulva prolifera (Chlorophyta)

    Science.gov (United States)

    Niu, Jianfeng; Hu, Haiyan; Hu, Songnian; Wang, Guangce; Peng, Guang; Sun, Song

    2010-01-01

    In 2008, a green tide broke out before the sailing competition of the 29th Olympic Games in Qingdao. The causative species was determined to be Enteromorpha prolifera ( Ulva prolifera O. F. Müller), a familiar green macroalga along the coastline of China. Rapid accumulation of a large biomass of floating U. prolifera prompted research on different aspects of this species. In this study, we constructed a nonnormalized cDNA library from the thalli of U. prolifera and acquired 10 072 high-quality expressed sequence tags (ESTs). These ESTs were assembled into 3 519 nonredundant gene groups, including 1 446 clusters and 2 073 singletons. After annotation with the nr database, a large number of genes were found to be related with chloroplast and ribosomal protein, GO functional classification showed 1 418 ESTs participated in photosynthesis and 1 359 ESTs were responsible for the generation of precursor metabolites and energy. In addition, rather comprehensive carbon fixation pathways were found in U. prolifera using KEGG. Some stress-related and signal transduction-related genes were also found in this study. All the evidences displayed that U. prolifera had substance and energy foundation for the intense photosynthesis and the rapid proliferation. Phylogenetic analysis of cytochrome c oxidase subunit I revealed that this green-tide causative species is most closely affiliated to Pseudendoclonium akinetum (Ulvophyceae).

  7. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    Science.gov (United States)

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss

  8. Characterization of shark complement factor I gene(s): genomic analysis of a novel shark-specific sequence.

    Science.gov (United States)

    Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L

    2009-07-01

    Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1-3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent.

  9. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    Science.gov (United States)

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  10. Developmental and Subcellular Organization of Single-Cell C₄ Photosynthesis in Bienertia sinuspersici Determined by Large-Scale Proteomics and cDNA Assembly from 454 DNA Sequencing.

    Science.gov (United States)

    Offermann, Sascha; Friso, Giulia; Doroshenk, Kelly A; Sun, Qi; Sharpe, Richard M; Okita, Thomas W; Wimmer, Diana; Edwards, Gerald E; van Wijk, Klaas J

    2015-05-01

    Kranz C4 species strictly depend on separation of primary and secondary carbon fixation reactions in different cell types. In contrast, the single-cell C4 (SCC4) species Bienertia sinuspersici utilizes intracellular compartmentation including two physiologically and biochemically different chloroplast types; however, information on identity, localization, and induction of proteins required for this SCC4 system is currently very limited. In this study, we determined the distribution of photosynthesis-related proteins and the induction of the C4 system during development by label-free proteomics of subcellular fractions and leaves of different developmental stages. This was enabled by inferring a protein sequence database from 454 sequencing of Bienertia cDNAs. Large-scale proteome rearrangements were observed as C4 photosynthesis developed during leaf maturation. The proteomes of the two chloroplasts are different with differential accumulation of linear and cyclic electron transport components, primary and secondary carbon fixation reactions, and a triose-phosphate shuttle that is shared between the two chloroplast types. This differential protein distribution pattern suggests the presence of a mRNA or protein-sorting mechanism for nuclear-encoded, chloroplast-targeted proteins in SCC4 species. The combined information was used to provide a comprehensive model for NAD-ME type carbon fixation in SCC4 species.

  11. Molecular characterization of a Leishmania donovani cDNA clone with similarity to human 20S proteasome a-type subunit

    DEFF Research Database (Denmark)

    Christensen, C B; Jørgensen, L; Jensen, A T

    2000-01-01

    Using plasma from patients infected or previously infected with Leishmania donovanii, we isolated a L. donovanii cDNA clone with similarity to the proteasome a-type subunit from humans and other eukaryotes. The cDNA clone, designated LePa, was DNA sequenced and Northern blot analysis of L....... donovanii poly(A(+))mRNA indicated the isolation of a full length cDNA clone with a transcript size of 1.9 kb. The expressed recombinant LePa fusion protein induced proliferation of peripheral blood mononuclear cells in one out of seven patients who had suffered from visceral leishmaniasis. Plasma from 16...

  12. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  13. Sequence analysis by iterated maps, a review.

    Science.gov (United States)

    Almeida, Jonas S

    2014-05-01

    Among alignment-free methods, Iterated Maps (IMs) are on a particular extreme: they are also scale free (order free). The use of IMs for sequence analysis is also distinct from other alignment-free methodologies in being rooted in statistical mechanics instead of computational linguistics. Both of these roots go back over two decades to the use of fractal geometry in the characterization of phase-space representations. The time series analysis origin of the field is betrayed by the title of the manuscript that started this alignment-free subdomain in 1990, 'Chaos Game Representation'. The clash between the analysis of sequences as continuous series and the better established use of Markovian approaches to discrete series was almost immediate, with a defining critique published in same journal 2 years later. The rest of that decade would go by before the scale-free nature of the IM space was uncovered. The ensuing decade saw this scalability generalized for non-genomic alphabets as well as an interest in its use for graphic representation of biological sequences. Finally, in the past couple of years, in step with the emergence of BigData and MapReduce as a new computational paradigm, there is a surprising third act in the IM story. Multiple reports have described gains in computational efficiency of multiple orders of magnitude over more conventional sequence analysis methodologies. The stage appears to be now set for a recasting of IMs with a central role in processing nextgen sequencing results.

  14. Identification and expression analysis of peroxisome proliferator-activated receptors cDNA in a reptile, the leopard gecko (Eublepharis macularius).

    Science.gov (United States)

    Kato, Keisuke; Oka, Yoshitaka; Park, Min Kyun

    2008-05-01

    Despite the physiological and evolutionary significance of lipid metabolism in amniotes, the molecular mechanisms involved have been unclear in reptiles. To elucidate this, we investigated peroxisome proliferators-activated receptors (PPARs) in the leopard gecko (Eublepharis macularius). PPARs belong to a nuclear hormone-receptor family mainly involved in lipid metabolism. Although PPARs have been widely studied in mammals, little information about them is yet available from reptiles. We identified in the leopard gecko partial cDNA sequences of PPARalpha and beta, and full sequences of two isoforms of PPARgamma. This is the first report of reptilian PPARgamma mRNA isoforms. We also evaluated the organ distribution of expression of these genes by using RT-PCR and competitive PCR. The expression level of PPARalpha mRNA was highest in the large intestine, and moderate in the liver and kidney. The expression level of PPARbeta mRNA was highest in the kidney and large intestine, and moderate in the liver. Similarly to the expression of human PPARgamma isoforms, PPARgammaa was expressed ubiquitously, whereas the expression of PPARgammab was restricted. The highest levels of their expression, however, were observed in the large intestine, rather than in the adipose tissue as in mammals. Taken together, these results showed that the profile of PPARbeta mRNA expression in the leopard gecko is similar to that in mammals, and that those of PPAR alpha and gamma are species specific. This may reflect adaptation to annual changes in lipid storage due to seasonal food availability.

  15. Display of a Maize cDNA library on baculovirus infected insect cells

    Directory of Open Access Journals (Sweden)

    Jones Ian M

    2008-08-01

    Full Text Available Abstract Background Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. Results We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 × 105 independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1, was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. Conclusion The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

  16. Preliminary hazard analysis using sequence tree method

    International Nuclear Information System (INIS)

    Huang Huiwen; Shih Chunkuan; Hung Hungchih; Chen Minghuei; Yih Swu; Lin Jiinming

    2007-01-01

    A system level PHA using sequence tree method was developed to perform Safety Related digital I and C system SSA. The conventional PHA is a brainstorming session among experts on various portions of the system to identify hazards through discussions. However, this conventional PHA is not a systematic technique, the analysis results strongly depend on the experts' subjective opinions. The analysis quality cannot be appropriately controlled. Thereby, this research developed a system level sequence tree based PHA, which can clarify the relationship among the major digital I and C systems. Two major phases are included in this sequence tree based technique. The first phase uses a table to analyze each event in SAR Chapter 15 for a specific safety related I and C system, such as RPS. The second phase uses sequence tree to recognize what I and C systems are involved in the event, how the safety related systems work, and how the backup systems can be activated to mitigate the consequence if the primary safety systems fail. In the sequence tree, the defense-in-depth echelons, including Control echelon, Reactor trip echelon, ESFAS echelon, and Indication and display echelon, are arranged to construct the sequence tree structure. All the related I and C systems, include digital system and the analog back-up systems are allocated in their specific echelon. By this system centric sequence tree based analysis, not only preliminary hazard can be identified systematically, the vulnerability of the nuclear power plant can also be recognized. Therefore, an effective simplified D3 evaluation can be performed as well. (author)

  17. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor

    International Nuclear Information System (INIS)

    Antalis, T.M.; Clark, M.A.; Barnes, T.; Lehrbach, P.R.; Devine, P.L.; Schevzov, G.; Goss, N.H.; Stephens, R.W.; Tolstoshev, P.

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A) + RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the λ P/sub L/ promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated M/sub r/ of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators

  18. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

    Science.gov (United States)

    Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

    2015-10-01

    Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

  19. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  20. Cloning of gibberellin 3 beta-hydroxylase cDNA and analysis of endogenous gibberellins in the developing seeds in watermelon.

    Science.gov (United States)

    Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Joonyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung

    2002-02-01

    We have isolated Cv3h, a cDNA clone from the developing seeds of watermelon, and have demonstrated significant amino acid homology with gibberellin (GA) 3 beta-hydroxylases. This cDNA clone was expressed in Escherichia coli as a fusion protein that oxidized GA(9) and GA(12) to GA(4) and GA(14), respectively. The Cv3h protein had the highest similarity with pumpkin GA 2 beta,3 beta-hydroxylase, but did not possess 2 beta-hydroxylation function. RNA blot analysis showed that the gene was expressed primarily in the inner parts of developing seeds, up to 10 d after pollination (DAP). In the parthenocarpic fruits induced by treatment with 1-(2-chloro-4-pyridyl)-3-phenylurea (CPPU), the embryo and endosperm of the seeds were undeveloped, whereas the integumental tissues, of maternal origin, showed nearly normal development. Cv3h mRNA was undetectable in the seeds of CPPU-treated fruits, indicating that the GA 3 beta-hydroxylase gene was expressed in zygotic cells. In our analysis of endogenous GAs from developing seeds, GA(9) and GA(4) were detected at high levels but those of GA(20) and GA(1) were very low. This demonstrates that GA biosynthesis in seeds prefers a non-13-hydroxylation pathway over an early 13-hydroxylation pathway. We also analyzed endogenous GAs from seeds of the parthenocarpic fruits. The level of bioactive GA(4 )was much lower there than in normal seeds, indicating that bioactive GAs, unconnected with Cv3h, exist in integumental tissues during early seed development.

  1. Digital image sequence processing, compression, and analysis

    CERN Document Server

    Reed, Todd R

    2004-01-01

    IntroductionTodd R. ReedCONTENT-BASED IMAGE SEQUENCE REPRESENTATIONPedro M. Q. Aguiar, Radu S. Jasinschi, José M. F. Moura, andCharnchai PluempitiwiriyawejTHE COMPUTATION OF MOTIONChristoph Stiller, Sören Kammel, Jan Horn, and Thao DangMOTION ANALYSIS AND DISPLACEMENT ESTIMATION IN THE FREQUENCY DOMAINLuca Lucchese and Guido Maria CortelazzoQUALITY OF SERVICE ASSESSMENT IN NEW GENERATION WIRELESS VIDEO COMMUNICATIONSGaetano GiuntaERROR CONCEALMENT IN DIGITAL VIDEOFrancesco G.B. De NataleIMAGE SEQUENCE RESTORATION: A WIDER PERSPECTIVEAnil KokaramVIDEO SUMMARIZATIONCuneyt M. Taskiran and Edward

  2. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...

  3. [Complete genome sequencing and sequence analysis of BCG Tice].

    Science.gov (United States)

    Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli

    2012-10-04

    The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.

  4. OTU analysis using metagenomic shotgun sequencing data.

    Directory of Open Access Journals (Sweden)

    Xiaolin Hao

    Full Text Available Because of technological limitations, the primer and amplification biases in targeted sequencing of 16S rRNA genes have veiled the true microbial diversity underlying environmental samples. However, the protocol of metagenomic shotgun sequencing provides 16S rRNA gene fragment data with natural immunity against the biases raised during priming and thus the potential of uncovering the true structure of microbial community by giving more accurate predictions of operational taxonomic units (OTUs. Nonetheless, the lack of statistically rigorous comparison between 16S rRNA gene fragments and other data types makes it difficult to interpret previously reported results using 16S rRNA gene fragments. Therefore, in the present work, we established a standard analysis pipeline that would help confirm if the differences in the data are true or are just due to potential technical bias. This pipeline is built by using simulated data to find optimal mapping and OTU prediction methods. The comparison between simulated datasets revealed a relationship between 16S rRNA gene fragments and full-length 16S rRNA sequences that a 16S rRNA gene fragment having a length >150 bp provides the same accuracy as a full-length 16S rRNA sequence using our proposed pipeline, which could serve as a good starting point for experimental design and making the comparison between 16S rRNA gene fragment-based and targeted 16S rRNA sequencing-based surveys possible.

  5. Fiscal 1998 achievement report. Industrial technology research and development project. (Strategic human cDNA genome application technology development); 1998 nendo senryakuteki hito cDNA genome oyo gijutsu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    A human genome related project named above was started, and studies were conducted for base sequence determination and function analysis for approximately 10,000 kinds of full-length or long-chain human cDNA clones owned by research organizations in this country. The Institute of Medical Science of University of Tokyo and Helix Research Institute dealt with a full-length human cDNA library constructed by oligo-capping, and determined the base sequences of all specimens in the library. The Kazusa DNA Research Institute determined partial sequences for long-chain clones which are not shorter than 4-5kbp, and determined entire sequences for some bases. The obtained base sequence data were subjected to homology analysis, the base sequences were converted into amino acid sequences, and functions of proteins were predicted. In the analysis of gene functions, ATAC-PCR (adaptor tagged competitive-polymerase chain reaction) was applied to the clones covered by this project, and a database was prepared by use of the results of analyses of frequency-related information. For the preparation of a comprehensive gene expression profile, technologies for cDNA microarray construction were established. (NEDO)

  6. Construction and analysis of an SSH cDNA library of early heat-induced genes of Vigna aconitifolia variety RMO-40.

    Science.gov (United States)

    Rampuria, Sakshi; Joshi, Uma; Palit, Paramita; Deokar, Amit A; Meghwal, Raju R; Mohapatra, T; Srinivasan, R; Bhatt, K V; Sharma, Ramavtar

    2012-11-01

    Moth bean ( Vigna aconitifolia (Jacq.) Marechal) is an important grain legume crop grown in rain fed areas of hot desert regions of Thar, India, under scorching sun rays with very little supplementation of water. An SSH cDNA library was generated from leaf tissues of V. aconitifolia var. RMO-40 exposed to an elevated temperature of 42 °C for 5 min to identify early-induced genes. A total of 488 unigenes (114 contigs and 374 singletons) were derived by cluster assembly and sequence alignment of 738 ESTs; out of 206 ESTs (28%) of unknown proteins, 160 ESTs (14%) were found to be novel to moth bean. Only 578 ESTs (78%) showed significant BLASTX similarity (pathways. Four hundred and fifty-two ESTs were further annotated with InterProScan (IPS), and no IPS was assigned to 153 ESTs. In addition, the expression level of 27 ESTs in response to heat stress was evaluated through semiquantitative RT-PCR assay. Approximately 20 different signaling genes and 16 different transcription factors have been shown to be associated with heat stress in moth bean for the first time.

  7. Generation and analysis of expressed sequence tags from the ciliate protozoan parasite Ichthyophthirius multifiliis

    Directory of Open Access Journals (Sweden)

    Arias Covadonga

    2007-06-01

    Full Text Available Abstract Background The ciliate protozoan Ichthyophthirius multifiliis (Ich is an important parasite of freshwater fish that causes 'white spot disease' leading to significant losses. A genomic resource for large-scale studies of this parasite has been lacking. To study gene expression involved in Ich pathogenesis and virulence, our goal was to generate expressed sequence tags (ESTs for the development of a powerful microarray platform for the analysis of global gene expression in this species. Here, we initiated a project to sequence and analyze over 10,000 ESTs. Results We sequenced 10,368 EST clones using a normalized cDNA library made from pooled samples of the trophont, tomont, and theront life-cycle stages, and generated 9,769 sequences (94.2% success rate. Post-sequencing processing led to 8,432 high quality sequences. Clustering analysis of these ESTs allowed identification of 4,706 unique sequences containing 976 contigs and 3,730 singletons. These unique sequences represent over two million base pairs (~10% of Plasmodium falciparum genome, a phylogenetically related protozoan. BLASTX searches produced 2,518 significant (E-value -5 hits and further Gene Ontology (GO analysis annotated 1,008 of these genes. The ESTs were analyzed comparatively against the genomes of the related protozoa Tetrahymena thermophila and P. falciparum, allowing putative identification of additional genes. All the EST sequences were deposited by dbEST in GenBank (GenBank: EG957858–EG966289. Gene discovery and annotations are presented and discussed. Conclusion This set of ESTs represents a significant proportion of the Ich transcriptome, and provides a material basis for the development of microarrays useful for gene expression studies concerning Ich development, pathogenesis, and virulence.

  8. Sequence Matching Analysis for Curriculum Development

    Directory of Open Access Journals (Sweden)

    Liem Yenny Bendatu

    2015-06-01

    Full Text Available Many organizations apply information technologies to support their business processes. Using the information technologies, the actual events are recorded and utilized to conform with predefined model. Conformance checking is an approach to measure the fitness and appropriateness between process model and actual events. However, when there are multiple events with the same timestamp, the traditional approach unfit to result such measures. This study attempts to develop a sequence matching analysis. Considering conformance checking as the basis of this approach, this proposed approach utilizes the current control flow technique in process mining domain. A case study in the field of educational process has been conducted. This study also proposes a curriculum analysis framework to test the proposed approach. By considering the learning sequence of students, it results some measurements for curriculum development. Finally, the result of the proposed approach has been verified by relevant instructors for further development.

  9. Gene structure, cDNA characterization and RNAi-based functional analysis of a myeloid differentiation factor 88 homolog in Tenebrio molitor larvae exposed to Staphylococcus aureus infection.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Patnaik, Hongray Howrelia; Seo, Gi Won; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Han, Yeon Soo

    2014-10-01

    Myeloid differentiation factor 88 (MyD88), an intracellular adaptor protein involved in Toll/Toll-like receptor (TLR) signal processing, triggers activation of nuclear factor-kappaB (NF-κB) transcription factors. In the present study, we analyzed the gene structure and biological function of MyD88 in a coleopteran insect, Tenebrio molitor (TmMyD88). The TmMyD88 gene was 1380 bp in length and consisted of five exons and four introns. The 5'-flanking sequence revealed several putative transcription factor binding sites, such as STAT-4, AP-1, cJun, cfos, NF-1 and many heat shock factor binding elements. The cDNA contained a typical death domain, a conservative Toll-like interleukin-1 receptor (TIR) domain, and a C-terminal extension (CTE). The TmMyD88 TIR domain showed three significantly conserved motifs for interacting with the TIR domain of TLRs. TmMyD88 was grouped within the invertebrate cluster of the phylogenetic tree and shared 75% sequence identity with the TIR domain of Tribolium castaneum MyD88. Homology modeling of the TmMyD88 TIR domain revealed five parallel β-strands surrounded by five α-helices that adopted loop conformations to function as an adaptor. TmMyD88 expression was upregulated 7.3- and 4.79-fold after 12 and 6h, respectively, of challenge with Staphylococcus aureus and fungal β-1,3 glucan. Silencing of the TmMyD88 transcript by RNA interference led to reduced resistance of the host to infection by S. aureus. These results indicate that TmMyD88 is required for survival against Staphylococcus infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    International Nuclear Information System (INIS)

    Chen, J.; Varner, J.E.

    1985-01-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) + RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) + RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) + RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding

  11. Automation of cDNA Synthesis and Labelling Improves Reproducibility

    Directory of Open Access Journals (Sweden)

    Daniel Klevebring

    2009-01-01

    Full Text Available Background. Several technologies, such as in-depth sequencing and microarrays, enable large-scale interrogation of genomes and transcriptomes. In this study, we asses reproducibility and throughput by moving all laboratory procedures to a robotic workstation, capable of handling superparamagnetic beads. Here, we describe a fully automated procedure for cDNA synthesis and labelling for microarrays, where the purification steps prior to and after labelling are based on precipitation of DNA on carboxylic acid-coated paramagnetic beads. Results. The fully automated procedure allows for samples arrayed on a microtiter plate to be processed in parallel without manual intervention and ensuring high reproducibility. We compare our results to a manual sample preparation procedure and, in addition, use a comprehensive reference dataset to show that the protocol described performs better than similar manual procedures. Conclusions. We demonstrate, in an automated gene expression microarray experiment, a reduced variance between replicates, resulting in an increase in the statistical power to detect differentially expressed genes, thus allowing smaller differences between samples to be identified. This protocol can with minor modifications be used to create cDNA libraries for other applications such as in-depth analysis using next-generation sequencing technologies.

  12. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  13. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  14. Sequencing and analysis of full-length cDNAs, 5'-ESTs and 3'-ESTs from a cartilaginous fish, the elephant shark (Callorhinchus milii).

    KAUST Repository

    Brenner, Sydney; Kodzius, Rimantas; Tan, Yue Ying; Tay, Alice; Tay, Boon-Hui; Venkatesh, Byrappa

    2012-01-01

    Cartilaginous fishes are the most ancient group of living jawed vertebrates (gnathostomes) and are, therefore, an important reference group for understanding the evolution of vertebrates. The elephant shark (Callorhinchus milii), a holocephalan cartilaginous fish, has been identified as a model cartilaginous fish genome because of its compact genome (∼910 Mb) and a genome project has been initiated to obtain its whole genome sequence. In this study, we have generated and sequenced full-length enriched cDNA libraries of the elephant shark using the 'oligo-capping' method and Sanger sequencing. A total of 6,778 full-length protein-coding cDNA and 10,701 full-length noncoding cDNA were sequenced from six tissues (gills, intestine, kidney, liver, spleen, and testis) of the elephant shark. Analysis of their polyadenylation signals showed that polyadenylation usage in elephant shark is similar to that in mammals. Furthermore, both coding and noncoding transcripts of the elephant shark use the same proportion of canonical polyadenylation sites. Besides BLASTX searches, protein-coding transcripts were annotated by Gene Ontology, InterPro domain, and KEGG pathway analyses. By comparing elephant shark genes to bony vertebrate genes, we identified several ancient genes present in elephant shark but differentially lost in tetrapods or teleosts. Only ∼6% of elephant shark noncoding cDNA showed similarity to known noncoding RNAs (ncRNAs). The rest are either highly divergent ncRNAs or novel ncRNAs. In addition to full-length transcripts, 30,375 5'-ESTs and 41,317 3'-ESTs were sequenced and annotated. The clones and transcripts generated in this study are valuable resources for annotating transcription start sites, exon-intron boundaries, and UTRs of genes in the elephant shark genome, and for the functional characterization of protein sequences. These resources will also be useful for annotating genes in other cartilaginous fishes whose genomes have been targeted for whole

  15. Sequencing and analysis of full-length cDNAs, 5'-ESTs and 3'-ESTs from a cartilaginous fish, the elephant shark (Callorhinchus milii).

    KAUST Repository

    Brenner, Sydney

    2012-10-08

    Cartilaginous fishes are the most ancient group of living jawed vertebrates (gnathostomes) and are, therefore, an important reference group for understanding the evolution of vertebrates. The elephant shark (Callorhinchus milii), a holocephalan cartilaginous fish, has been identified as a model cartilaginous fish genome because of its compact genome (∼910 Mb) and a genome project has been initiated to obtain its whole genome sequence. In this study, we have generated and sequenced full-length enriched cDNA libraries of the elephant shark using the \\'oligo-capping\\' method and Sanger sequencing. A total of 6,778 full-length protein-coding cDNA and 10,701 full-length noncoding cDNA were sequenced from six tissues (gills, intestine, kidney, liver, spleen, and testis) of the elephant shark. Analysis of their polyadenylation signals showed that polyadenylation usage in elephant shark is similar to that in mammals. Furthermore, both coding and noncoding transcripts of the elephant shark use the same proportion of canonical polyadenylation sites. Besides BLASTX searches, protein-coding transcripts were annotated by Gene Ontology, InterPro domain, and KEGG pathway analyses. By comparing elephant shark genes to bony vertebrate genes, we identified several ancient genes present in elephant shark but differentially lost in tetrapods or teleosts. Only ∼6% of elephant shark noncoding cDNA showed similarity to known noncoding RNAs (ncRNAs). The rest are either highly divergent ncRNAs or novel ncRNAs. In addition to full-length transcripts, 30,375 5\\'-ESTs and 41,317 3\\'-ESTs were sequenced and annotated. The clones and transcripts generated in this study are valuable resources for annotating transcription start sites, exon-intron boundaries, and UTRs of genes in the elephant shark genome, and for the functional characterization of protein sequences. These resources will also be useful for annotating genes in other cartilaginous fishes whose genomes have been targeted for

  16. Cloning of the cDNA for human 12-lipoxygenase

    International Nuclear Information System (INIS)

    Izumi, T.; Hoshiko, S.; Radmark, O.; Samuelsson, B.

    1990-01-01

    A full-length cDNA clone encoding 12-lipoxygenase was isolated from a human platelet cDNA library by using a cDNA for human reticulocyte 15-lipoxygenase as probe for the initial screening. The cDNA had an open reading frame encoding 662 amino acid residues with a calculated molecular weight of 75,590. Three independent clones revealed minor heterogeneities in their DNA sequences. Thus, in three positions of the deduced amino acid sequence, there is a choice between two different amino acids. The deduced sequence from the clone plT3 showed 65% identity with human reticulocyte 15-lipoxygenase and 42% identity with human leukocyte 5-lipoxygenase. The 12-lipoxygenase cDNA recognized a 3.0-kilobase mRNA species in platelets and human erythroleukemia cells (HEL cells). Phorbol 12-tetradecanoyl 13-acetate induced megakaryocytic differentiation of HEL cells and 12-lipoxygenase activity and increased mRNA for 12-lipoxygenase. The identity of the cloned 12-lipoxygenase was assured by expression in a mammalian cell line (COS cells). Human platelet 12-lipoxygenase has been difficult to purify to homogeneity. The cloning of this cDNA will increase the possibilities to elucidate the structure and function of this enzyme

  17. Cloning and expression of cDNA coding for bouganin.

    Science.gov (United States)

    den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

    2002-03-01

    Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

  18. Biomarker-Based Analysis for Contaminants in Sediments/Soil: Review of Cell-Based Assays and cDNA Arrays

    National Research Council Canada - National Science Library

    Inouye, Laura

    2000-01-01

    This technical note reviews the existing technology for cell-based biomarker assays and cDNA arrays and explores their potential as rapid, sensitive, and low-cost tools for sediment/soil toxicity screening...

  19. Assignment of casein kinase 2 alpha sequences to two different human chromosomes

    DEFF Research Database (Denmark)

    Boldyreff, B; Klett, C; Göttert, E

    1992-01-01

    Human casein kinase 2 alpha gene (CK-2-alpha) sequences have been localized within the human genome by in situ hybridization and somatic cell hybrid analysis using a CK-2 alpha cDNA as a probe. By in situ hybridization, the CK-2 alpha cDNA could be assigned to two different loci, one on 11p15.1-ter...

  20. Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

    Science.gov (United States)

    Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

    2014-01-25

    Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Constructing and detecting a cDNA library for mites.

    Science.gov (United States)

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  2. Cloning the human lysozyme cDNA: Inverted Alu repeat in the mRNA and in situ hybridization for macrophages and Paneth cells

    International Nuclear Information System (INIS)

    Chung, L.P.; Keshav, S.; Gordon, S.

    1988-01-01

    Lysozyme is a major secretory product of human and rodent macrophages and a useful marker for myelomonocytic cells. Based on the known human lysozyme amino acid sequence, oligonucleotides were synthesized and used as probes to screen a phorbol 12-myristate 13-acetate-treated U937 cDNA library. A full-length human lysozyme cDNA clone, pHL-2, was obtained and characterized. Sequence analysis shows that human lysozyme, like chicken lysozyme, has in 18-amino-acid-long signal peptide, but unlike the chicken lysozyme cDNA, the human lysozyme cDNA has a >1-kilobase-long 3' nontranslated sequence. Interestingly, within this 3' region, an inverted repeat of the Alu family of repetitive sequences was discovered. In RNA blot analyses, DNA probes prepared from pHL-2 can be used to detect lysozyme mRNA not only from human but also from mouse and rat. Moreover, by in situ hybridization, complementary RNA transcripts have been used as probes to detect lysozyme mRNA in mouse macrophages and Paneth cells. This human lysozyme cDNA clone is therefore likely to be a useful molecular probe for studying macrophage distribution and gene expression

  3. FAST: FAST Analysis of Sequences Toolbox

    Directory of Open Access Journals (Sweden)

    Travis J. Lawrence

    2015-05-01

    Full Text Available FAST (FAST Analysis of Sequences Toolbox provides simple, powerful open source command-line tools to filter, transform, annotate and analyze biological sequence data. Modeled after the GNU (GNU’s Not Unix Textutils such as grep, cut, and tr, FAST tools such as fasgrep, fascut, and fastr make it easy to rapidly prototype expressive bioinformatic workflows in a compact and generic command vocabulary. Compact combinatorial encoding of data workflows with FAST commands can simplify the documentation and reproducibility of bioinformatic protocols, supporting better transparency in biological data science. Interface self-consistency and conformity with conventions of GNU, Matlab, Perl, BioPerl, R and GenBank help make FAST easy and rewarding to learn. FAST automates numerical, taxonomic, and text-based sorting, selection and transformation of sequence records and alignment sites based on content, index ranges, descriptive tags, annotated features, and in-line calculated analytics, including composition and codon usage. Automated content- and feature-based extraction of sites and support for molecular population genetic statistics makes FAST useful for molecular evolutionary analysis. FAST is portable, easy to install and secure thanks to the relative maturity of its Perl and BioPerl foundations, with stable releases posted to CPAN. Development as well as a publicly accessible Cookbook and Wiki are available on the FAST GitHub repository at https://github.com/tlawrence3/FAST. The default data exchange format in FAST is Multi-FastA (specifically, a restriction of BioPerl FastA format. Sanger and Illumina 1.8+ FastQ formatted files are also supported. FAST makes it easier for non-programmer biologists to interactively investigate and control biological data at the speed of thought.

  4. Bayesian Correlation Analysis for Sequence Count Data.

    Directory of Open Access Journals (Sweden)

    Daniel Sánchez-Taltavull

    Full Text Available Evaluating the similarity of different measured variables is a fundamental task of statistics, and a key part of many bioinformatics algorithms. Here we propose a Bayesian scheme for estimating the correlation between different entities' measurements based on high-throughput sequencing data. These entities could be different genes or miRNAs whose expression is measured by RNA-seq, different transcription factors or histone marks whose expression is measured by ChIP-seq, or even combinations of different types of entities. Our Bayesian formulation accounts for both measured signal levels and uncertainty in those levels, due to varying sequencing depth in different experiments and to varying absolute levels of individual entities, both of which affect the precision of the measurements. In comparison with a traditional Pearson correlation analysis, we show that our Bayesian correlation analysis retains high correlations when measurement confidence is high, but suppresses correlations when measurement confidence is low-especially for entities with low signal levels. In addition, we consider the influence of priors on the Bayesian correlation estimate. Perhaps surprisingly, we show that naive, uniform priors on entities' signal levels can lead to highly biased correlation estimates, particularly when different experiments have widely varying sequencing depths. However, we propose two alternative priors that provably mitigate this problem. We also prove that, like traditional Pearson correlation, our Bayesian correlation calculation constitutes a kernel in the machine learning sense, and thus can be used as a similarity measure in any kernel-based machine learning algorithm. We demonstrate our approach on two RNA-seq datasets and one miRNA-seq dataset.

  5. Cloning and characterization of the human colipase cDNA

    International Nuclear Information System (INIS)

    Lowe, M.E.; Rosenblum, J.L.; McEwen, P.; Strauss, A.W.

    1990-01-01

    Pancreatic lipase hydrolyzes dietary triglycerides to monoglycerides and fatty acids. In the presence of bile salts, the activity of pancreatic lipase is markedly decreased. The activity can be restored by the addition of colipase, a low molecular weight protein secreted by the pancreas. The action of pancreatic lipase in the gut lumen is dependent upon its interaction with colipase. As a first step in elucidating the molecular events governing the interaction of lipase and colipase with each other and with fatty acids, a cDNA encoding human colipase was isolated from a λgt11 cDNA library with a rabbit polyclonal anti-human colipase antibody. The full-length 525 bp cDNA contained an open reading frame encoding 112 amino acids, including a 17 amino acid signal peptide. The predicted sequence contains 100% of the published protein sequence for human colipase determined by chemical methods, but predicts the presence of five additional NH 2 -terminal amino acids and four additional COOH-terminal amino acids. Comparison of the predicted protein sequence with the known sequences of colipase from other species reveals regions of extensive identity. The authors report, for the first time, a cDNA for colipase. The cDNA predicts a human procolipase an suggests that there may also be processing at the COOH-terminus. The regions of identity with colipase from other species will aid in defining the interaction with lipase and lipids through site-specific mutagenesis

  6. Construction and analysis of the cDNA subtraction library of yeast and mycelial phases of Sporothrix globosa isolated in China: identification of differentially expressed genes*

    Science.gov (United States)

    Hu, Qing-bi; He, Yu; Zhou, Xun

    2015-01-01

    Species included in the Sporothrix schenckii complex are temperature-dependent with dimorphic growth and cause sporotrichosis that is characterized by chronic and fatal lymphocutaneous lesions. The putative species included in the Sporothrix complex are S. brasiliensis, S. globosa, S. mexicana, S. pallida, S. schenckii, and S. lurei. S. globosa is the causal agent of sporotrichosis in China, and its pathogenicity appears to be closely related to the dimorphic transition, i.e. from the mycelial to the yeast phase, it adapts to changing environmental conditions. To determine the molecular mechanisms of the switching process that mediates the dimorphic transition of S. globosa, suppression subtractive hybridization (SSH) was used to prepare a complementary DNA (cDNA) subtraction library from the yeast and mycelial phases. Bioinformatics analysis was performed to profile the relationship between differently expressed genes and the dimorphic transition. Two genes that were expressed at higher levels by the yeast form were selected, and their differential expression levels were verified using a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR). It is believed that these differently expressed genes are involved in the pathogenesis of S. globosa infection in China. PMID:26642182

  7. A basic analysis toolkit for biological sequences

    Directory of Open Access Journals (Sweden)

    Siragusa Enrico

    2007-09-01

    Full Text Available Abstract This paper presents a software library, nicknamed BATS, for some basic sequence analysis tasks. Namely, local alignments, via approximate string matching, and global alignments, via longest common subsequence and alignments with affine and concave gap cost functions. Moreover, it also supports filtering operations to select strings from a set and establish their statistical significance, via z-score computation. None of the algorithms is new, but although they are generally regarded as fundamental for sequence analysis, they have not been implemented in a single and consistent software package, as we do here. Therefore, our main contribution is to fill this gap between algorithmic theory and practice by providing an extensible and easy to use software library that includes algorithms for the mentioned string matching and alignment problems. The library consists of C/C++ library functions as well as Perl library functions. It can be interfaced with Bioperl and can also be used as a stand-alone system with a GUI. The software is available at http://www.math.unipa.it/~raffaele/BATS/ under the GNU GPL.

  8. Method for construction of normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  9. Whole genome sequence analysis of Mycobacterium suricattae

    KAUST Repository

    Dippenaar, Anzaan; Parsons, Sven David Charles; Sampson, Samantha Leigh; Van Der Merwe, Ruben Gerhard; Drewe, Julian Ashley; Abdallah, Abdallah; Siame, Kabengele Keith; Gey Van Pittius, Nicolaas Claudius; Van Helden, Paul David; Pain, Arnab; Warren, Robin Mark

    2015-01-01

    Tuberculosis occurs in various mammalian hosts and is caused by a range of different lineages of the Mycobacterium tuberculosis complex (MTBC). A recently described member, Mycobacterium suricattae, causes tuberculosis in meerkats (Suricata suricatta) in Southern Africa and preliminary genetic analysis showed this organism to be closely related to an MTBC pathogen of rock hyraxes (Procavia capensis), the dassie bacillus. Here we make use of whole genome sequencing to describe the evolution of the genome of M. suricattae, including known and novel regions of difference, SNPs and IS6110 insertion sites. We used genome-wide phylogenetic analysis to show that M. suricattae clusters with the chimpanzee bacillus, previously isolated from a chimpanzee (Pan troglodytes) in West Africa. We propose an evolutionary scenario for the Mycobacterium africanum lineage 6 complex, showing the evolutionary relationship of M. africanum and chimpanzee bacillus, and the closely related members M. suricattae, dassie bacillus and Mycobacterium mungi.

  10. Whole genome sequence analysis of Mycobacterium suricattae

    KAUST Repository

    Dippenaar, Anzaan

    2015-10-21

    Tuberculosis occurs in various mammalian hosts and is caused by a range of different lineages of the Mycobacterium tuberculosis complex (MTBC). A recently described member, Mycobacterium suricattae, causes tuberculosis in meerkats (Suricata suricatta) in Southern Africa and preliminary genetic analysis showed this organism to be closely related to an MTBC pathogen of rock hyraxes (Procavia capensis), the dassie bacillus. Here we make use of whole genome sequencing to describe the evolution of the genome of M. suricattae, including known and novel regions of difference, SNPs and IS6110 insertion sites. We used genome-wide phylogenetic analysis to show that M. suricattae clusters with the chimpanzee bacillus, previously isolated from a chimpanzee (Pan troglodytes) in West Africa. We propose an evolutionary scenario for the Mycobacterium africanum lineage 6 complex, showing the evolutionary relationship of M. africanum and chimpanzee bacillus, and the closely related members M. suricattae, dassie bacillus and Mycobacterium mungi.

  11. Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

    International Nuclear Information System (INIS)

    Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

    1987-01-01

    Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis

  12. Sequence features and phylogenetic analysis of the stress protein Hsp90α in chinook salmon Oncorhynchus tshawytscha, a poikilothermic vertebrate

    Science.gov (United States)

    Palmisano, Aldo N.; Winton, James R.; Dickhoff, Walton W.

    1999-01-01

    We cloned and sequenced a chinook salmon Hsp90 cDNA; sequence analysis shows it to be Hsp90??. Phylogenetic analysis supports the hypothesis that ?? and ?? paralogs of Hsp90 arose as a result of a gene duplication event and that they diverged early in the evolution of vertebrates, before tetrapods separated from the teleost lineage. Among several differences distinguishing poikilothermic Hsp90?? sequences from their bird and mammal orthologs, the teleost versions specifically lack a characteristic QTQDQP phosphorylation site near the N-terminus. We used the cDNA to develop an RNA (Northern) blot to quantify cellular Hsp90 mRNA levels. Chinook salmon embryonic (CHSE-214) cells responded to heat shock with a rapid rise in Hsp90 mRNA through 4 h, followed by a gradual decline over the next 20 h. Hsp90 mRNA level may be useful as a stress indicator, especially in a laboratory setting or in response to acute heat stress.

  13. Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

    Energy Technology Data Exchange (ETDEWEB)

    Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

    1987-12-01

    Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis.

  14. Identification of late O{sub 3}-responsive genes in Arabidopsis thaliana by cDNA microarray analysis

    Energy Technology Data Exchange (ETDEWEB)

    D' Haese, D. [Univ. of Antwerp, Dept. of Biology, Antwerp (BE) and Univ. of Newcastle, School of Biology and Psychology, Div. of Biology, Newcastle-Upon-Tyne (United Kingdom); Horemans, N.; Coen, W. De; Guisez, Y. [Univ. of Antwerp, Dept. of Biology, Antwerp (Belgium)

    2006-09-15

    To better understand the response of a plant to 0{sub 3} stress, an integrated microarray analysis was performed on Arabidopsis plants exposed during 2 days to purified air or 150 nl l{sup -1} O{sub 3}, 8 h day-l. Agilent Arabidopsis 2 Oligo Microarrays were used of which the reliability was confirmed by quantitative real-time PCR of nine randomly selected genes. We confirmed the O{sub 3} responsiveness of heat shock proteins (HSPs), glutathione-S-tranferases and genes involved in cell wall stiffening and microbial defence. Whereas, a previous study revealed that during an early stage of the O{sub 3} stress response, gene expression was strongly dependent on jasmonic acid and ethylene, we report that at a later stage (48 h) synthesis of jasrnonic acid and ethylene was downregulated. In addition, we observed the simultaneous induction of salicylic acid synthesis and genes involved in programmed cell death and senescence. Also typically, the later stage of the response to O{sub 3} appeared to be the induction of the complete pathway leading to the biosynthesis of anthocyanin diglucosides and the induction of thioredoxin-based redox control. Surprisingly absent in the list of induced genes were genes involved in ASC-dependent antioxidation, few of which were found to be induced after 12 h of 0{sub 3} exposure in another study. We discuss these and other particular results of the microarray analysis and provide a map depicting significantly affected genes and their pathways highlighting their interrelationships and subcellular localization. (au)

  15. Analysis of the effects of sex hormone background on the rat choroid plexus transcriptome by cDNA microarrays.

    Directory of Open Access Journals (Sweden)

    Telma Quintela

    Full Text Available The choroid plexus (CP are highly vascularized branched structures that protrude into the ventricles of the brain, and form a unique interface between the blood and the cerebrospinal fluid (CSF, the blood-CSF barrier, that are the main site of production and secretion of CSF. Sex hormones are widely recognized as neuroprotective agents against several neurodegenerative diseases, and the presence of sex hormones cognate receptors suggest that it may be a target for these hormones. In an effort to provide further insight into the neuroprotective mechanisms triggered by sex hormones we analyzed gene expression differences in the CP of female and male rats subjected to gonadectomy, using microarray technology. In gonadectomized female and male animals, 3045 genes were differentially expressed by 1.5-fold change, compared to sham controls. Analysis of the CP transcriptome showed that the top-five pathways significantly regulated by the sex hormone background are olfactory transduction, taste transduction, metabolism, steroid hormone biosynthesis and circadian rhythm pathways. These results represent the first overview of global expression changes in CP of female and male rats induced by gonadectomy and suggest that sex hormones are implicated in pathways with central roles in CP functions and CSF homeostasis.

  16. Generation and analysis of expressed sequence tags from Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    EVELYN SILVA

    2006-01-01

    Full Text Available Botrytis cinerea is a filamentous plant pathogen of a wide range of plant species, and its infection may cause enormous damage both during plant growth and in the post-harvest phase. We have constructed a cDNA library from an isolate of B. cinerea and have sequenced 11,482 expressed sequence tags that were assembled into 1,003 contigs sequences and 3,032 singletons. Approximately 81% of the unigenes showed significant similarity to genes coding for proteins with known functions: more than 50% of the sequences code for genes involved in cellular metabolism, 12% for transport of metabolites, and approximately 10% for cellular organization. Other functional categories include responses to biotic and abiotic stimuli, cell communication, cell homeostasis, and cell development. We carried out pair-wise comparisons with fungal databases to determine the B. cinerea unisequence set with relevant similarity to genes in other fungal pathogenic counterparts. Among the 4,035 non-redundant B. cinerea unigenes, 1,338 (23% have significant homology with Fusarium verticillioides unigenes. Similar values were obtained for Saccharomyces cerevisiae and Aspergillus nidulans (22% and 24%, respectively. The lower percentages of homology were with Magnaporthe grisae and Neurospora crassa (13% and 19%, respectively. Several genes involved in putative and known fungal virulence and general pathogenicity were identified. The results provide important information for future research on this fungal pathogen

  17. CpGAVAS, an integrated web server for the annotation, visualization, analysis, and GenBank submission of completely sequenced chloroplast genome sequences

    Science.gov (United States)

    2012-01-01

    Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR) are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas. PMID:23256920

  18. CpGAVAS, an integrated web server for the annotation, visualization, analysis, and GenBank submission of completely sequenced chloroplast genome sequences

    Directory of Open Access Journals (Sweden)

    Liu Chang

    2012-12-01

    Full Text Available Abstract Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas.

  19. Computational analysis of sequence selection mechanisms.

    Science.gov (United States)

    Meyerguz, Leonid; Grasso, Catherine; Kleinberg, Jon; Elber, Ron

    2004-04-01

    Mechanisms leading to gene variations are responsible for the diversity of species and are important components of the theory of evolution. One constraint on gene evolution is that of protein foldability; the three-dimensional shapes of proteins must be thermodynamically stable. We explore the impact of this constraint and calculate properties of foldable sequences using 3660 structures from the Protein Data Bank. We seek a selection function that receives sequences as input, and outputs survival probability based on sequence fitness to structure. We compute the number of sequences that match a particular protein structure with energy lower than the native sequence, the density of the number of sequences, the entropy, and the "selection" temperature. The mechanism of structure selection for sequences longer than 200 amino acids is approximately universal. For shorter sequences, it is not. We speculate on concrete evolutionary mechanisms that show this behavior.

  20. Comparative analysis of sequences from PT 2013

    DEFF Research Database (Denmark)

    Mikkelsen, Susie Sommer

    Sheatfish and not EHNV. Generally, mistakes occurred at the ends of the sequences. This can be due to several factors. One is that the sequence has not been trimmed of the sequence primer sites. Another is the lack of quality control of the chromatogram. Finally, sequencing in just one direction can result...... diseases in Europe. As part of the EURL proficiency test for fish diseases it is required to sequence any RANA virus isolates found in any of the samples. It is also highly recommended to sequence the ISA virus to determine whether it be HPRΔ or HPR0. Furthermore, it is recommended that any VHSV and IHNV...... isolates be genotyped. As part of the evaluation of the proficiency results it was decided this year to look into the quality and similarity of the sequence results for selected viruses. Ampoule III in the proficiency test 2013 contained an EHNV isolate. The EURL received 43 sequences from 41 laboratories...

  1. Time fluctuation analysis of forest fire sequences

    Science.gov (United States)

    Vega Orozco, Carmen D.; Kanevski, Mikhaïl; Tonini, Marj; Golay, Jean; Pereira, Mário J. G.

    2013-04-01

    Forest fires are complex events involving both space and time fluctuations. Understanding of their dynamics and pattern distribution is of great importance in order to improve the resource allocation and support fire management actions at local and global levels. This study aims at characterizing the temporal fluctuations of forest fire sequences observed in Portugal, which is the country that holds the largest wildfire land dataset in Europe. This research applies several exploratory data analysis measures to 302,000 forest fires occurred from 1980 to 2007. The applied clustering measures are: Morisita clustering index, fractal and multifractal dimensions (box-counting), Ripley's K-function, Allan Factor, and variography. These algorithms enable a global time structural analysis describing the degree of clustering of a point pattern and defining whether the observed events occur randomly, in clusters or in a regular pattern. The considered methods are of general importance and can be used for other spatio-temporal events (i.e. crime, epidemiology, biodiversity, geomarketing, etc.). An important contribution of this research deals with the analysis and estimation of local measures of clustering that helps understanding their temporal structure. Each measure is described and executed for the raw data (forest fires geo-database) and results are compared to reference patterns generated under the null hypothesis of randomness (Poisson processes) embedded in the same time period of the raw data. This comparison enables estimating the degree of the deviation of the real data from a Poisson process. Generalizations to functional measures of these clustering methods, taking into account the phenomena, were also applied and adapted to detect time dependences in a measured variable (i.e. burned area). The time clustering of the raw data is compared several times with the Poisson processes at different thresholds of the measured function. Then, the clustering measure value

  2. SVAMP: Sequence variation analysis, maps and phylogeny

    KAUST Repository

    Naeem, Raeece

    2014-04-03

    Summary: SVAMP is a stand-alone desktop application to visualize genomic variants (in variant call format) in the context of geographical metadata. Users of SVAMP are able to generate phylogenetic trees and perform principal coordinate analysis in real time from variant call format (VCF) and associated metadata files. Allele frequency map, geographical map of isolates, Tajima\\'s D metric, single nucleotide polymorphism density, GC and variation density are also available for visualization in real time. We demonstrate the utility of SVAMP in tracking a methicillin-resistant Staphylococcus aureus outbreak from published next-generation sequencing data across 15 countries. We also demonstrate the scalability and accuracy of our software on 245 Plasmodium falciparum malaria isolates from three continents. Availability and implementation: The Qt/C++ software code, binaries, user manual and example datasets are available at http://cbrc.kaust.edu.sa/svamp. © The Author 2014.

  3. Statistical analysis of next generation sequencing data

    CERN Document Server

    Nettleton, Dan

    2014-01-01

    Next Generation Sequencing (NGS) is the latest high throughput technology to revolutionize genomic research. NGS generates massive genomic datasets that play a key role in the big data phenomenon that surrounds us today. To extract signals from high-dimensional NGS data and make valid statistical inferences and predictions, novel data analytic and statistical techniques are needed. This book contains 20 chapters written by prominent statisticians working with NGS data. The topics range from basic preprocessing and analysis with NGS data to more complex genomic applications such as copy number variation and isoform expression detection. Research statisticians who want to learn about this growing and exciting area will find this book useful. In addition, many chapters from this book could be included in graduate-level classes in statistical bioinformatics for training future biostatisticians who will be expected to deal with genomic data in basic biomedical research, genomic clinical trials and personalized med...

  4. Sequencing and analysis of the Mediterranean amphioxus (Branchiostoma lanceolatum transcriptome.

    Directory of Open Access Journals (Sweden)

    Silvan Oulion

    Full Text Available BACKGROUND: The basally divergent phylogenetic position of amphioxus (Cephalochordata, as well as its conserved morphology, development and genetics, make it the best proxy for the chordate ancestor. Particularly, studies using the amphioxus model help our understanding of vertebrate evolution and development. Thus, interest for the amphioxus model led to the characterization of both the transcriptome and complete genome sequence of the American species, Branchiostoma floridae. However, recent technical improvements allowing induction of spawning in the laboratory during the breeding season on a daily basis with the Mediterranean species Branchiostoma lanceolatum have encouraged European Evo-Devo researchers to adopt this species as a model even though no genomic or transcriptomic data have been available. To fill this need we used the pyrosequencing method to characterize the B. lanceolatum transcriptome and then compared our results with the published transcriptome of B. floridae. RESULTS: Starting with total RNA from nine different developmental stages of B. lanceolatum, a normalized cDNA library was constructed and sequenced on Roche GS FLX (Titanium mode. Around 1.4 million of reads were produced and assembled into 70,530 contigs (average length of 490 bp. Overall 37% of the assembled sequences were annotated by BlastX and their Gene Ontology terms were determined. These results were then compared to genomic and transcriptomic data of B. floridae to assess similarities and specificities of each species. CONCLUSION: We obtained a high-quality amphioxus (B. lanceolatum reference transcriptome using a high throughput sequencing approach. We found that 83% of the predicted genes in the B. floridae complete genome sequence are also found in the B. lanceolatum transcriptome, while only 41% were found in the B. floridae transcriptome obtained with traditional Sanger based sequencing. Therefore, given the high degree of sequence conservation

  5. Movement Pattern Analysis Based on Sequence Signatures

    Directory of Open Access Journals (Sweden)

    Seyed Hossein Chavoshi

    2015-09-01

    Full Text Available Increased affordability and deployment of advanced tracking technologies have led researchers from various domains to analyze the resulting spatio-temporal movement data sets for the purpose of knowledge discovery. Two different approaches can be considered in the analysis of moving objects: quantitative analysis and qualitative analysis. This research focuses on the latter and uses the qualitative trajectory calculus (QTC, a type of calculus that represents qualitative data on moving point objects (MPOs, and establishes a framework to analyze the relative movement of multiple MPOs. A visualization technique called sequence signature (SESI is used, which enables to map QTC patterns in a 2D indexed rasterized space in order to evaluate the similarity of relative movement patterns of multiple MPOs. The applicability of the proposed methodology is illustrated by means of two practical examples of interacting MPOs: cars on a highway and body parts of a samba dancer. The results show that the proposed method can be effectively used to analyze interactions of multiple MPOs in different domains.

  6. Direct chloroplast sequencing: comparison of sequencing platforms and analysis tools for whole chloroplast barcoding.

    Directory of Open Access Journals (Sweden)

    Marta Brozynska

    Full Text Available Direct sequencing of total plant DNA using next generation sequencing technologies generates a whole chloroplast genome sequence that has the potential to provide a barcode for use in plant and food identification. Advances in DNA sequencing platforms may make this an attractive approach for routine plant identification. The HiSeq (Illumina and Ion Torrent (Life Technology sequencing platforms were used to sequence total DNA from rice to identify polymorphisms in the whole chloroplast genome sequence of a wild rice plant relative to cultivated rice (cv. Nipponbare. Consensus chloroplast sequences were produced by mapping sequence reads to the reference rice chloroplast genome or by de novo assembly and mapping of the resulting contigs to the reference sequence. A total of 122 polymorphisms (SNPs and indels between the wild and cultivated rice chloroplasts were predicted by these different sequencing and analysis methods. Of these, a total of 102 polymorphisms including 90 SNPs were predicted by both platforms. Indels were more variable with different sequencing methods, with almost all discrepancies found in homopolymers. The Ion Torrent platform gave no apparent false SNP but was less reliable for indels. The methods should be suitable for routine barcoding using appropriate combinations of sequencing platform and data analysis.

  7. Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

    Science.gov (United States)

    Li, Chao; Chang, Wei Shan

    2014-01-01

    Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

  8. Genome-wide SNP discovery in tetraploid alfalfa using 454 sequencing and high resolution melting analysis

    Directory of Open Access Journals (Sweden)

    Zhao Patrick X

    2011-07-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common type of sequence variation among plants and are often functionally important. We describe the use of 454 technology and high resolution melting analysis (HRM for high throughput SNP discovery in tetraploid alfalfa (Medicago sativa L., a species with high economic value but limited genomic resources. Results The alfalfa genotypes selected from M. sativa subsp. sativa var. 'Chilean' and M. sativa subsp. falcata var. 'Wisfal', which differ in water stress sensitivity, were used to prepare cDNA from tissue of clonally-propagated plants grown under either well-watered or water-stressed conditions, and then pooled for 454 sequencing. Based on 125.2 Mb of raw sequence, a total of 54,216 unique sequences were obtained including 24,144 tentative consensus (TCs sequences and 30,072 singletons, ranging from 100 bp to 6,662 bp in length, with an average length of 541 bp. We identified 40,661 candidate SNPs distributed throughout the genome. A sample of candidate SNPs were evaluated and validated using high resolution melting (HRM analysis. A total of 3,491 TCs harboring 20,270 candidate SNPs were located on the M. truncatula (MT 3.5.1 chromosomes. Gene Ontology assignments indicate that sequences obtained cover a broad range of GO categories. Conclusions We describe an efficient method to identify thousands of SNPs distributed throughout the alfalfa genome covering a broad range of GO categories. Validated SNPs represent valuable molecular marker resources that can be used to enhance marker density in linkage maps, identify potential factors involved in heterosis and genetic variation, and as tools for association mapping and genomic selection in alfalfa.

  9. Cloning of the cDNA and gene for a human D2 dopamine receptor

    International Nuclear Information System (INIS)

    Grady, D.K.; Makam, H.; Stofko, R.E.; Bunzow, J.R.; Civelli, O.; Marchionni, M.A.; Alfano, M.; Frothingham, L.; Fischer, J.B.; Burke-Howie, K.J.; Server, A.C.

    1989-01-01

    A clone encoding a human D 2 dopamine receptor was isolated from a pituitary cDNA library and sequenced. The deduced protein sequence is 96% identical with that of the cloned rat receptor with one major difference: the human receptor contains an additional 29 amino acids in its putative third cytoplasmic loop. Southern blotting demonstrated the presence of only one human D 2 receptor gene. Two overlapping phage containing the gene were isolated and characterized. DNA sequence analysis of these clones showed that the coding sequence is interrupted by six introns and that the additional amino acids present in the human pituitary receptor are encoded by a single exon of 87 base pairs. The involvement of this sequence in alternative splicing and its biological significance are discussed

  10. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  11. Noncoding sequence classification based on wavelet transform analysis: part I

    Science.gov (United States)

    Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

    2017-09-01

    DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

  12. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    International Nuclear Information System (INIS)

    Safford, R.; de Silva, J.; Lucas, C.

    1987-01-01

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  13. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    Energy Technology Data Exchange (ETDEWEB)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng [National Yang Ming Univ., Taipei, Taiwan (China). Inst. of Radiological Sciences] (and others)

    2001-12-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  14. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    International Nuclear Information System (INIS)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng

    2001-01-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  15. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  16. Image sequence analysis workstation for multipoint motion analysis

    Science.gov (United States)

    Mostafavi, Hassan

    1990-08-01

    This paper describes an application-specific engineering workstation designed and developed to analyze motion of objects from video sequences. The system combines the software and hardware environment of a modem graphic-oriented workstation with the digital image acquisition, processing and display techniques. In addition to automation and Increase In throughput of data reduction tasks, the objective of the system Is to provide less invasive methods of measurement by offering the ability to track objects that are more complex than reflective markers. Grey level Image processing and spatial/temporal adaptation of the processing parameters is used for location and tracking of more complex features of objects under uncontrolled lighting and background conditions. The applications of such an automated and noninvasive measurement tool include analysis of the trajectory and attitude of rigid bodies such as human limbs, robots, aircraft in flight, etc. The system's key features are: 1) Acquisition and storage of Image sequences by digitizing and storing real-time video; 2) computer-controlled movie loop playback, freeze frame display, and digital Image enhancement; 3) multiple leading edge tracking in addition to object centroids at up to 60 fields per second from both live input video or a stored Image sequence; 4) model-based estimation and tracking of the six degrees of freedom of a rigid body: 5) field-of-view and spatial calibration: 6) Image sequence and measurement data base management; and 7) offline analysis software for trajectory plotting and statistical analysis.

  17. Cloning of the human androgen receptor cDNA

    International Nuclear Information System (INIS)

    Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

    1988-01-01

    The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

  18. Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

    Science.gov (United States)

    Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

    2010-01-01

    A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

  19. Comparative analysis of expressed sequence tags from three castes and two life stages of the termite Reticulitermes flavipes

    Directory of Open Access Journals (Sweden)

    Steller Matthew M

    2010-08-01

    Full Text Available Abstract Background Termites (Isoptera are eusocial insects whose colonies consist of morphologically and behaviorally specialized castes of sterile workers and soldiers, and reproductive alates. Previous studies on eusocial insects have indicated that caste differentiation and behavior are underlain by differential gene expression. Although much is known about gene expression in the honey bee, Apis mellifera, termites remain relatively understudied in this regard. Therefore, our objective was to assemble an expressed sequence tag (EST data base for the eastern subterranean termite, Reticulitermes flavipes, for future gene expression studies. Results Soldier, worker, and alate caste and two larval cDNA libraries were constructed, and approximately 15,000 randomly chosen clones were sequenced to compile an EST data base. Putative gene functions were assigned based on a BLASTX Swissprot search. Categorical in silico expression patterns for each library were compared using the R-statistic. A significant proportion of the ESTs of each caste and life stages had no significant similarity to those in existing data bases. All cDNA libraries, including those of non-reproductive worker and soldier castes, contained sequences with putative reproductive functions. Genes that showed a potential expression bias among castes included a putative antibacterial humoral response and translation elongation protein in soldiers and a chemosensory protein in alates. Conclusions We have expanded upon the available sequences for R. flavipes and utilized an in silico method to compare gene expression in different castes of an eusocial insect. The in silico analysis allowed us to identify several genes which may be differentially expressed and involved in caste differences. These include a gene overrepresented in the alate cDNA library with a predicted function of neurotransmitter secretion or cholesterol absorption and a gene predicted to be involved in protein

  20. Brain cDNA clone for human cholinesterase

    International Nuclear Information System (INIS)

    McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.

    1987-01-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase

  1. Novel algorithms for protein sequence analysis

    NARCIS (Netherlands)

    Ye, Kai

    2008-01-01

    Each protein is characterized by its unique sequential order of amino acids, the so-called protein sequence. Biology”s paradigm is that this order of amino acids determines the protein”s architecture and function. In this thesis, we introduce novel algorithms to analyze protein sequences. Chapter 1

  2. Pig genome sequence - analysis and publication strategy

    DEFF Research Database (Denmark)

    Archibald, Alan L.; Bolund, Lars; Churcher, Carol

    2010-01-01

    preferentially selected for sequencing. In accordance with the Bermuda and Fort Lauderdale agreements and the more recent Toronto Statement the data have been released into public sequence repositories (Genbank/EMBL, NCBI/Ensembl trace repositories) in a timely manner and in advance of publication. CONCLUSIONS...

  3. Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

    2013-08-01

    Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

  4. Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

    Science.gov (United States)

    Cai, Yongping; Lin, Yi

    2013-01-01

    In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

  5. Molecular cloning and sequence analysis of a phenylalanine ammonia-lyase gene from dendrobium.

    Directory of Open Access Journals (Sweden)

    Qing Jin

    Full Text Available In this study, a phenylalanine ammonia-lyase (PAL gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748 has 2,458 bps and contains a complete open reading frame (ORF of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum.

  6. High-resolution analysis of the 5'-end transcriptome using a next generation DNA sequencer.

    Directory of Open Access Journals (Sweden)

    Shin-ichi Hashimoto

    Full Text Available Massively parallel, tag-based sequencing systems, such as the SOLiD system, hold the promise of revolutionizing the study of whole genome gene expression due to the number of data points that can be generated in a simple and cost-effective manner. We describe the development of a 5'-end transcriptome workflow for the SOLiD system and demonstrate the advantages in sensitivity and dynamic range offered by this tag-based application over traditional approaches for the study of whole genome gene expression. 5'-end transcriptome analysis was used to study whole genome gene expression within a colon cancer cell line, HT-29, treated with the DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine (5Aza. More than 20 million 25-base 5'-end tags were obtained from untreated and 5Aza-treated cells and matched to sequences within the human genome. Seventy three percent of the mapped unique tags were associated with RefSeq cDNA sequences, corresponding to approximately 14,000 different protein-coding genes in this single cell type. The level of expression of these genes ranged from 0.02 to 4,704 transcripts per cell. The sensitivity of a single sequence run of the SOLiD platform was 100-1,000 fold greater than that observed from 5'end SAGE data generated from the analysis of 70,000 tags obtained by Sanger sequencing. The high-resolution 5'end gene expression profiling presented in this study will not only provide novel insight into the transcriptional machinery but should also serve as a basis for a better understanding of cell biology.

  7. Incident sequence analysis; event trees, methods and graphical symbols

    International Nuclear Information System (INIS)

    1980-11-01

    When analyzing incident sequences, unwanted events resulting from a certain cause are looked for. Graphical symbols and explanations of graphical representations are presented. The method applies to the analysis of incident sequences in all types of facilities. By means of the incident sequence diagram, incident sequences, i.e. the logical and chronological course of repercussions initiated by the failure of a component or by an operating error, can be presented and analyzed simply and clearly

  8. Computer-aided visualization and analysis system for sequence evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Chee, Mark S.; Wang, Chunwei; Jevons, Luis C.; Bernhart, Derek H.; Lipshutz, Robert J.

    2004-05-11

    A computer system for analyzing nucleic acid sequences is provided. The computer system is used to perform multiple methods for determining unknown bases by analyzing the fluorescence intensities of hybridized nucleic acid probes. The results of individual experiments are improved by processing nucleic acid sequences together. Comparative analysis of multiple experiments is also provided by displaying reference sequences in one area and sample sequences in another area on a display device.

  9. Analysis of cellular responses to aflatoxin B1 in yeast expressing human cytochrome P450 1A2 using cDNA microarrays

    International Nuclear Information System (INIS)

    Guo Yingying; Breeden, Linda L.; Fan, Wenhong; Zhao Lueping; Eaton, David L.; Zarbl, Helmut

    2006-01-01

    Aflatoxin B1 (AFB 1 ) is a potent human hepatotoxin and hepatocarcinogen produced by the mold Aspergillus flavus. In human, AFB 1 is bioactivated by cytochrome P450 (CYP450) enzymes, primarily CYP1A2, to the genotoxic epoxide that forms N 7 -guanine DNA adducts. To characterize the transcriptional responses to genotoxic insults from AFB 1 , a strain of Saccharomyces cerevisiae engineered to express human CYP1A2 was exposed to doses of AFB 1 that resulted in minimal lethality, but substantial genotoxicity. Flow cytometric analysis demonstrated a dose and time dependent S phase delay under the same treatment conditions, indicating a checkpoint response to DNA damage. Replicate cDNA microarray analyses of AFB 1 treated cells showed that about 200 genes were significantly affected by the exposure. The genes activated by AFB 1 -treatment included RAD51, DUN1 and other members of the DNA damage response signature reported in a previous study with methylmethane sulfonate and ionizing radiation [A.P. Gasch, M. Huang, S. Metzner, D. Botstein, S.J. Elledge, P.O. Brown, Genomic expression responses to DNA-damaging agents and the regulatory role of the yeast ATR homolog Mec1p, Mol. Biol. Cell 12 (2001) 2987-3003]. However, unlike previous studies using highly cytotoxic doses, environmental stress response genes [A.P. Gasch, P.T. Spellman, C.M. Kao, O. Carmel-Harel, M.B. Eisen, G. Storz, D. Botstein, P.O. Brown, Genomic expression programs in the response of yeast cells to environmental changes, Mol. Biol. Cell 11 (2000) 4241-4257] were largely unaffected by our dosing regimen. About half of the transcripts affected are also known to be cell cycle regulated. The most strongly repressed transcripts were those encoding the histone genes and a group of genes that are cell cycle regulated and peak in M phase and early G1. These include most of the known daughter-specific genes. The rapid and coordinated repression of histones and M/G1-specific transcripts cannot be explained by

  10. Analysis of cellular responses to aflatoxin B{sub 1} in yeast expressing human cytochrome P450 1A2 using cDNA microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Guo Yingying [Departmental of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA (United States); Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Breeden, Linda L. [Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Fan, Wenhong [Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Zhao Lueping [Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Eaton, David L. [Departmental of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA (United States); Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Zarbl, Helmut [Departmental of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA (United States) and Fred Hutchinson Cancer Research Center, Seattle, WA (United States)]. E-mail: hzarbl@fhcrc.org

    2006-01-29

    Aflatoxin B1 (AFB{sub 1}) is a potent human hepatotoxin and hepatocarcinogen produced by the mold Aspergillus flavus. In human, AFB{sub 1} is bioactivated by cytochrome P450 (CYP450) enzymes, primarily CYP1A2, to the genotoxic epoxide that forms N{sup 7}-guanine DNA adducts. To characterize the transcriptional responses to genotoxic insults from AFB{sub 1}, a strain of Saccharomyces cerevisiae engineered to express human CYP1A2 was exposed to doses of AFB{sub 1} that resulted in minimal lethality, but substantial genotoxicity. Flow cytometric analysis demonstrated a dose and time dependent S phase delay under the same treatment conditions, indicating a checkpoint response to DNA damage. Replicate cDNA microarray analyses of AFB{sub 1} treated cells showed that about 200 genes were significantly affected by the exposure. The genes activated by AFB{sub 1}-treatment included RAD51, DUN1 and other members of the DNA damage response signature reported in a previous study with methylmethane sulfonate and ionizing radiation [A.P. Gasch, M. Huang, S. Metzner, D. Botstein, S.J. Elledge, P.O. Brown, Genomic expression responses to DNA-damaging agents and the regulatory role of the yeast ATR homolog Mec1p, Mol. Biol. Cell 12 (2001) 2987-3003]. However, unlike previous studies using highly cytotoxic doses, environmental stress response genes [A.P. Gasch, P.T. Spellman, C.M. Kao, O. Carmel-Harel, M.B. Eisen, G. Storz, D. Botstein, P.O. Brown, Genomic expression programs in the response of yeast cells to environmental changes, Mol. Biol. Cell 11 (2000) 4241-4257] were largely unaffected by our dosing regimen. About half of the transcripts affected are also known to be cell cycle regulated. The most strongly repressed transcripts were those encoding the histone genes and a group of genes that are cell cycle regulated and peak in M phase and early G1. These include most of the known daughter-specific genes. The rapid and coordinated repression of histones and M/G1-specific

  11. Expressed sequence tag analysis of adult human optic nerve for NEIBank: Identification of cell type and tissue markers

    Directory of Open Access Journals (Sweden)

    Peterson Katherine

    2009-09-01

    Full Text Available Abstract Background The optic nerve is a pure white matter central nervous system (CNS tract with an isolated blood supply, and is widely used in physiological studies of white matter response to various insults. We examined the gene expression profile of human optic nerve (ON and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST analysis. Location of an abundant oligodendrocyte marker was examined by immunofluorescence. Quantitative real time polymerase chain reaction (qRT-PCR and Western analysis were used to compare levels of expression for key calcium channel protein genes and protein product in primate and rodent ON. Results Our analyses revealed a profile similar in many respects to other white matter related tissues, but significantly different from previously available ON cDNA libraries. The previous libraries were found to include specific markers for other eye tissues, suggesting contamination. Immune/inflammatory markers were abundant in the new ON library. The oligodendrocyte marker QKI was abundant at the EST level. Immunofluorescence revealed that this protein is a useful oligodendrocyte cell-type marker in rodent and primate ONs. L-type calcium channel EST abundance was found to be particularly low. A qRT-PCR-based comparative mammalian species analysis reveals that L-type calcium channel expression levels are significantly lower in primate than in rodent ON, which may help account for the class-specific difference in responsiveness to calcium channel blocking agents. Several known eye disease genes are abundantly expressed in ON. Many genes associated with normal axonal function, mRNAs associated with axonal transport, inflammation and neuroprotection are observed. Conclusion We conclude that the new cDNA library is a faithful representation of human ON and EST data

  12. Establishing a framework for comparative analysis of genome sequences

    Energy Technology Data Exchange (ETDEWEB)

    Bansal, A.K.

    1995-06-01

    This paper describes a framework and a high-level language toolkit for comparative analysis of genome sequence alignment The framework integrates the information derived from multiple sequence alignment and phylogenetic tree (hypothetical tree of evolution) to derive new properties about sequences. Multiple sequence alignments are treated as an abstract data type. Abstract operations have been described to manipulate a multiple sequence alignment and to derive mutation related information from a phylogenetic tree by superimposing parsimonious analysis. The framework has been applied on protein alignments to derive constrained columns (in a multiple sequence alignment) that exhibit evolutionary pressure to preserve a common property in a column despite mutation. A Prolog toolkit based on the framework has been implemented and demonstrated on alignments containing 3000 sequences and 3904 columns.

  13. Characterization of cDNA for PMT: a Partial Nicotine Biosynthesis-Related Gene Isolated from Indonesian Local Tobacco (Nicotiana tabacum cv. Sindoro1

    Directory of Open Access Journals (Sweden)

    SESANTI BASUKI

    2013-12-01

    Full Text Available Nicotine is the major alkaloid compound in cultivated tobacco (Nicotiana tabacum that could potentially be converted into carcinogenic compound (nor-nicotine. The PMT gene encoding putrescine N-methyltransferase (PMT is one of the two key genes that play a prominent role in nicotine biosynthesis. The aimed of this study was to isolate and characterize the cDNA sequence originated from Indonesian local tobacco cv. Sindoro1 (Ntpmt_Sindoro1. The results showed that the Ntpmt_Sindoro1 was 1124 bp in length. This cDNA fragment encodes for 374 amino acid residues. The predicted polypeptide from the cDNA is a hidrophilic protein, and has a predicted molecular weight of 40.95 kDa. The predicted amino acids sequence also showed high similarity to the PMT gene product Nicotiana sp. available in the GenBank data base. The amino acid sequences also exert conserved residues specifically exhibited only by PMT gene originated from N. tabacum. Clustering analysis revealed that Ntpmt_Sindoro1 belongs to the same clade as the PMT3 gene, a member of the N. tabacum PMT gene family. The Ntpmt_Sindoro1 cDNA sequence covering exon1-exon8 of the PMT gene fragment has been registered in the GenBank data base, under the accession number JX978277.

  14. Chromosomal Localization of DNA Amplifications in Neuroblastoma Tumors Using cDNA Microarray Comparative Genomic Hybridization

    Directory of Open Access Journals (Sweden)

    Ben Beheshti

    2003-01-01

    Full Text Available Conventional comparative genomic hybridization (CGH profiling of neuroblastomas has identified many genomic aberrations, although the limited resolution has precluded a precise localization of sequences of interest within amplicons. To map high copy number genomic gains in clinically matched stage IV neuroblastomas, CGH analysis using a 19,200-feature cDNA microarray was used. A dedicated (freely available algorithm was developed for rapid in silico determination of chromosomal localizations of microarray cDNA targets, and for generation of an ideogram-type profile of copy number changes. Using these methodologies, novel gene amplifications undetectable by chromosome CGH were identified, and larger MYCN amplicon sizes (in one tumor up to 6 Mb than those previously reported in neuroblastoma were identified. The genes HPCAL1, LPIN1/KIAA0188, NAG, and NSE1/LOC151354 were found to be coamplified with MYCN. To determine whether stage IV primary tumors could be further subclassified based on their genomic copy number profiles, hierarchical clustering was performed. Cluster analysis of microarray CGH data identified three groups: 1 no amplifications evident, 2 a small MYCN amplicon as the only detectable imbalance, and 3 a large MYCN amplicon with additional gene amplifications. Application of CGH to cDNA microarray targets will help to determine both the variation of amplicon size and help better define amplification-dependent and independent pathways of progression in neuroblastoma.

  15. Scalable Kernel Methods and Algorithms for General Sequence Analysis

    Science.gov (United States)

    Kuksa, Pavel

    2011-01-01

    Analysis of large-scale sequential data has become an important task in machine learning and pattern recognition, inspired in part by numerous scientific and technological applications such as the document and text classification or the analysis of biological sequences. However, current computational methods for sequence comparison still lack…

  16. cDNA library construction of two human Demodexspecies.

    Science.gov (United States)

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  17. Recurrence plot analysis of DNA sequences

    Energy Technology Data Exchange (ETDEWEB)

    Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn

    2004-11-15

    Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.

  18. Expressed sequence tag analysis of functional genes associated with adventitious rooting in Liriodendron hybrids.

    Science.gov (United States)

    Zhong, Y D; Sun, X Y; Liu, E Y; Li, Y Q; Gao, Z; Yu, F X

    2016-06-24

    Liriodendron hybrids (Liriodendron chinense x L. tulipifera) are important landscaping and afforestation hardwood trees. To date, little genomic research on adventitious rooting has been reported in these hybrids, as well as in the genus Liriodendron. In the present study, we used adventitious roots to construct the first cDNA library for Liriodendron hybrids. A total of 5176 expressed sequence tags (ESTs) were generated and clustered into 2921 unigenes. Among these unigenes, 2547 had significant homology to the non-redundant protein database representing a wide variety of putative functions. Homologs of these genes regulated many aspects of adventitious rooting, including those for auxin signal transduction and root hair development. Results of quantitative real-time polymerase chain reaction showed that AUX1, IRE, and FB1 were highly expressed in adventitious roots and the expression of AUX1, ARF1, NAC1, RHD1, and IRE increased during the development of adventitious roots. Additionally, 181 simple sequence repeats were identified from 166 ESTs and more than 91.16% of these were dinucleotide and trinucleotide repeats. To the best of our knowledge, the present study reports the identification of the genes associated with adventitious rooting in the genus Liriodendron for the first time and provides a valuable resource for future genomic studies. Expression analysis of selected genes could allow us to identify regulatory genes that may be essential for adventitious rooting.

  19. Analysis of Neuronal Sequences Using Pairwise Biases

    Science.gov (United States)

    2015-08-27

    semantic memory (knowledge of facts) and implicit memory (e.g., how to ride a bike ). Evidence for the participation of the hippocampus in the formation of...hippocampal formation in an attempt to be cured of severe epileptic seizures. Although the surgery was successful in regards to reducing the frequency and...very different from each other in many ways including duration and number of spikes. Still, these sequences share a similar trend in the general order

  20. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    OpenAIRE

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding t...

  1. Google matrix analysis of DNA sequences.

    Science.gov (United States)

    Kandiah, Vivek; Shepelyansky, Dima L

    2013-01-01

    For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW). At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.

  2. Google matrix analysis of DNA sequences.

    Directory of Open Access Journals (Sweden)

    Vivek Kandiah

    Full Text Available For DNA sequences of various species we construct the Google matrix [Formula: see text] of Markov transitions between nearby words composed of several letters. The statistical distribution of matrix elements of this matrix is shown to be described by a power law with the exponent being close to those of outgoing links in such scale-free networks as the World Wide Web (WWW. At the same time the sum of ingoing matrix elements is characterized by the exponent being significantly larger than those typical for WWW networks. This results in a slow algebraic decay of the PageRank probability determined by the distribution of ingoing elements. The spectrum of [Formula: see text] is characterized by a large gap leading to a rapid relaxation process on the DNA sequence networks. We introduce the PageRank proximity correlator between different species which determines their statistical similarity from the view point of Markov chains. The properties of other eigenstates of the Google matrix are also discussed. Our results establish scale-free features of DNA sequence networks showing their similarities and distinctions with the WWW and linguistic networks.

  3. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-01-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  4. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1993-01-01

    AMP (Bt2cAMP), dibutyryl cGMP (Bt2cGMP)] and compounds known to affect keratinocytes [4 beta-phorbol 12-myristate 13-acetate (PMA), retinoic acid, Ca2+, dexamethasone, lipopolysaccharides, foetal calf serum]. Protein IGUP I-5111 was selected for further studies as its level is affected by simian-virus-40......, which migrated with the AMA variant of keratinocyte protein IEF SSP 5111, is novel although it exhibits weak similarity to cytoskeletal proteins. IGUP I-5111 contains the RGD sequence found in many extracellular glycoprotein ligands of the integrin receptor family and it is found at least partially...... in the culture supernatant. Considering the presence of IFN-gamma in psoriatic plaques as well as its putative involvement in the pathophysiology of the disease it was of interest to determine whether the set of proteins was upregulated in these cells. Two-dimensional gel analysis of the protein phenotype of non-cultured...

  5. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

    1991-01-01

    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

  6. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  7. Error Analysis of Deep Sequencing of Phage Libraries: Peptides Censored in Sequencing

    Directory of Open Access Journals (Sweden)

    Wadim L. Matochko

    2013-01-01

    Full Text Available Next-generation sequencing techniques empower selection of ligands from phage-display libraries because they can detect low abundant clones and quantify changes in the copy numbers of clones without excessive selection rounds. Identification of errors in deep sequencing data is the most critical step in this process because these techniques have error rates >1%. Mechanisms that yield errors in Illumina and other techniques have been proposed, but no reports to date describe error analysis in phage libraries. Our paper focuses on error analysis of 7-mer peptide libraries sequenced by Illumina method. Low theoretical complexity of this phage library, as compared to complexity of long genetic reads and genomes, allowed us to describe this library using convenient linear vector and operator framework. We describe a phage library as N×1 frequency vector n=ni, where ni is the copy number of the ith sequence and N is the theoretical diversity, that is, the total number of all possible sequences. Any manipulation to the library is an operator acting on n. Selection, amplification, or sequencing could be described as a product of a N×N matrix and a stochastic sampling operator (Sa. The latter is a random diagonal matrix that describes sampling of a library. In this paper, we focus on the properties of Sa and use them to define the sequencing operator (Seq. Sequencing without any bias and errors is Seq=Sa IN, where IN is a N×N unity matrix. Any bias in sequencing changes IN to a nonunity matrix. We identified a diagonal censorship matrix (CEN, which describes elimination or statistically significant downsampling, of specific reads during the sequencing process.

  8. Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

    International Nuclear Information System (INIS)

    Han, J.H.; Stratowa, C.; Rutter, W.J.

    1987-01-01

    The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

  9. Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

    Science.gov (United States)

    Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

    1992-01-01

    We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

  10. Cloning and sequence analysis of benzo-a-pyreneinducible ...

    African Journals Online (AJOL)

    The phylogenetic tree based on the amino acid sequences clearly shows tilapia CYP1A and killifish CYP1A to be more closely related to each other than to the other CYP1A subfamilies. Sequence analysis of 3727 bp of genomic DNA showed that the clone obtained was the structural gene of CYP1A which consists of ...

  11. Biological sequence analysis: probabilistic models of proteins and nucleic acids

    National Research Council Canada - National Science Library

    Durbin, Richard

    1998-01-01

    ... analysis methods are now based on principles of probabilistic modelling. Examples of such methods include the use of probabilistically derived score matrices to determine the significance of sequence alignments, the use of hidden Markov models as the basis for profile searches to identify distant members of sequence families, and the inference...

  12. Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences

    DEFF Research Database (Denmark)

    Svitashev, S.; Bryngelsson, T.; Vershinin, A.

    1994-01-01

    A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...

  13. Construction of C35 gene bait recombinants and T47D cell cDNA library.

    Science.gov (United States)

    Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

    2017-11-20

    C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

  14. Cloning and expression of a cDNA coding for the human platelet-derived growth factor receptor: Evidence for more than one receptor class

    International Nuclear Information System (INIS)

    Gronwald, R.G.K.; Grant, F.J.; Haldeman, B.A.; Hart, C.E.; O'Hara, P.J.; Hagen, F.S.; Ross, R.; Bowen-Pope, D.F.; Murray, M.J.

    1988-01-01

    The complete nucleotide sequence of a cDNA encoding the human platelet-derived growth factor (PDGF) receptor is presented. The cDNA contains an open reading frame that codes for a protein of 1106 amino acids. Comparison to the mouse PDGF receptor reveals an overall amino acid sequence identity of 86%. This sequence identity rises to 98% in the cytoplasmic split tyrosine kinase domain. RNA blot hybridization analysis of poly(A) + RNA from human dermal fibroblasts detects a major and a minor transcript using the cDNA as a probe. Baby hamster kidney cells, transfected with an expression vector containing the receptor cDNA, express an ∼ 190-kDa cell surface protein that is recognized by an anti-human PDGF receptor antibody. The recombinant PDGF receptor is functional in the transfected baby hamster kidney cells as demonstrated by ligand-induced phosphorylation of the receptor. Binding properties of the recombinant PDGF receptor were also assessed with pure preparations of BB and AB isoforms of PDGF. Unlike human dermal fibroblasts, which bind both isoforms with high affinity, the transfected baby hamster kidney cells bind only the BB isoform of PDGF with high affinity. This observation is consistent with the existence of more than one PDGF receptor class

  15. cDNA and deduced primary structure of basic phospholipase A2 with neurotoxic activity from the venom secretion of the Crotalus durissus collilineatus rattlesnake

    Directory of Open Access Journals (Sweden)

    F.H.R. Fagundes

    2010-03-01

    Full Text Available To illustrate the construction of precursor complementary DNAs, we isolated mRNAs from whole venom samples. After reverse transcription polymerase chain reaction (RT-PCR, we amplified the cDNA coding for a neurotoxic protein, phospholipase A2 D49 (PLA2 D49, from the venom of Crotalus durissus collilineatus (Cdc PLA2. The cDNA encoding Cdc PLA2 from whole venom was sequenced. The deduced amino acid sequence of this cDNA has high overall sequence identity with the group II PLA2 protein family. Cdc PLA2 has 14 cysteine residues capable of forming seven disulfide bonds that characterize this group of PLA2 enzymes. Cdc PLA2 was isolated using conventional Sephadex G75 column chromatography and reverse-phase high performance liquid chromatography (RP-HPLC. The molecular mass was estimated using matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF mass spectrometry. We tested the neuromuscular blocking activities on chick biventer cervicis neuromuscular tissue. Phylogenetic analysis of Cdc PLA2 showed the existence of two lines of N6-PLA2, denominated F24 and S24. Apparently, the sequences of the New World’s N6-F24-PLA2 are similar to those of the agkistrodotoxin from the Asian genus Gloydius. The sequences of N6-S24-PLA2 are similar to the sequence of trimucrotoxin from the genus Protobothrops, found in the Old World.

  16. Parametric inference for biological sequence analysis.

    Science.gov (United States)

    Pachter, Lior; Sturmfels, Bernd

    2004-11-16

    One of the major successes in computational biology has been the unification, by using the graphical model formalism, of a multitude of algorithms for annotating and comparing biological sequences. Graphical models that have been applied to these problems include hidden Markov models for annotation, tree models for phylogenetics, and pair hidden Markov models for alignment. A single algorithm, the sum-product algorithm, solves many of the inference problems that are associated with different statistical models. This article introduces the polytope propagation algorithm for computing the Newton polytope of an observation from a graphical model. This algorithm is a geometric version of the sum-product algorithm and is used to analyze the parametric behavior of maximum a posteriori inference calculations for graphical models.

  17. Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

    Science.gov (United States)

    Cao, Yinhe; Tung, Wen-Wen; Gao, J B

    2004-01-01

    With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

  18. RESEARCH NOTE Genome-based exome-sequencing analysis ...

    Indian Academy of Sciences (India)

    Navya

    2017-02-22

    Feb 22, 2017 ... Genome-based exome-sequencing analysis identifies GYG1, DIS3L, DDRGK1 genes ... Cardiology Division, Department of Internal Medicine, Severance .... with p values of <0.05 byanalyzing differences in allele distribution.

  19. Editorial: Special Issue on Algorithms for Sequence Analysis and Storage

    Directory of Open Access Journals (Sweden)

    Veli Mäkinen

    2014-03-01

    Full Text Available This special issue of Algorithms is dedicated to approaches to biological sequence analysis that have algorithmic novelty and potential for fundamental impact in methods used for genome research.

  20. Searching for cellular partners of hantaviral nonstructural protein NSs: Y2H screening of mouse cDNA library and analysis of cellular interactome.

    Science.gov (United States)

    Rönnberg, Tuomas; Jääskeläinen, Kirsi; Blot, Guillaume; Parviainen, Ville; Vaheri, Antti; Renkonen, Risto; Bouloy, Michele; Plyusnin, Alexander

    2012-01-01

    Hantaviruses (Bunyaviridae) are negative-strand RNA viruses with a tripartite genome. The small (S) segment encodes the nucleocapsid protein and, in some hantaviruses, also the nonstructural protein (NSs). The aim of this study was to find potential cellular partners for the hantaviral NSs protein. Toward this aim, yeast two-hybrid (Y2H) screening of mouse cDNA library was performed followed by a search for potential NSs protein counterparts via analyzing a cellular interactome. The resulting interaction network was shown to form logical, clustered structures. Furthermore, several potential binding partners for the NSs protein, for instance ACBD3, were identified and, to prove the principle, interaction between NSs and ACBD3 proteins was demonstrated biochemically.

  1. Tools for integrated sequence-structure analysis with UCSF Chimera

    Directory of Open Access Journals (Sweden)

    Huang Conrad C

    2006-07-01

    Full Text Available Abstract Background Comparing related structures and viewing the structures in the context of sequence alignments are important tasks in protein structure-function research. While many programs exist for individual aspects of such work, there is a need for interactive visualization tools that: (a provide a deep integration of sequence and structure, far beyond mapping where a sequence region falls in the structure and vice versa; (b facilitate changing data of one type based on the other (for example, using only sequence-conserved residues to match structures, or adjusting a sequence alignment based on spatial fit; (c can be used with a researcher's own data, including arbitrary sequence alignments and annotations, closely or distantly related sets of proteins, etc.; and (d interoperate with each other and with a full complement of molecular graphics features. We describe enhancements to UCSF Chimera to achieve these goals. Results The molecular graphics program UCSF Chimera includes a suite of tools for interactive analyses of sequences and structures. Structures automatically associate with sequences in imported alignments, allowing many kinds of crosstalk. A novel method is provided to superimpose structures in the absence of a pre-existing sequence alignment. The method uses both sequence and secondary structure, and can match even structures with very low sequence identity. Another tool constructs structure-based sequence alignments from superpositions of two or more proteins. Chimera is designed to be extensible, and mechanisms for incorporating user-specific data without Chimera code development are also provided. Conclusion The tools described here apply to many problems involving comparison and analysis of protein structures and their sequences. Chimera includes complete documentation and is intended for use by a wide range of scientists, not just those in the computational disciplines. UCSF Chimera is free for non-commercial use and is

  2. Sequencing and Analysis of Neanderthal Genomic DNA

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, James P.; Coop, Graham; Kudaravalli, Sridhar; Smith,Doug; Krause, Johannes; Alessi, Joe; Chen, Feng; Platt, Darren; Paabo,Svante; Pritchard, Jonathan K.; Rubin, Edward M.

    2006-06-13

    Recovery and analysis of multiple Neanderthal autosomalsequences using a metagenomic approach reveals that modern humans andNeanderthals split ~;400,000 years ago, without significant evidence ofsubsequent admixture.

  3. SVAMP: Sequence variation analysis, maps and phylogeny

    KAUST Repository

    Naeem, Raeece; Hidayah, Lailatul; Preston, Mark D.; Clark, Taane G.; Pain, Arnab

    2014-01-01

    Summary: SVAMP is a stand-alone desktop application to visualize genomic variants (in variant call format) in the context of geographical metadata. Users of SVAMP are able to generate phylogenetic trees and perform principal coordinate analysis

  4. Molecular cloning and mammalian expression of human beta 2-glycoprotein I cDNA

    DEFF Research Database (Denmark)

    Kristensen, Torsten; Schousboe, Inger; Boel, Espen

    1991-01-01

    Human β2-glycoprotein (β2gpI) cDNA was isolated from a liver cDNA library and sequenced. The cDNA encoded a 19-residue hydrophobic signal peptide followed by the mature β2gpI of 326 amino acid residues. In liver and in the hepatoma cell line HepG2 there are two mRNA species of about 1.4 and 4.3 kb......, respectively, hybridizing specifically with the β2gpI cDNA. Upon isoelectric focusing, recombinant β2gpI obtained from expression of β2gpI cDNA in baby hamster kidney cells showed the same pattern of bands as β2gpI isolated from plasma, and at least 5 polypeptides were visible...

  5. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  6. Quantiprot - a Python package for quantitative analysis of protein sequences.

    Science.gov (United States)

    Konopka, Bogumił M; Marciniak, Marta; Dyrka, Witold

    2017-07-17

    The field of protein sequence analysis is dominated by tools rooted in substitution matrices and alignments. A complementary approach is provided by methods of quantitative characterization. A major advantage of the approach is that quantitative properties defines a multidimensional solution space, where sequences can be related to each other and differences can be meaningfully interpreted. Quantiprot is a software package in Python, which provides a simple and consistent interface to multiple methods for quantitative characterization of protein sequences. The package can be used to calculate dozens of characteristics directly from sequences or using physico-chemical properties of amino acids. Besides basic measures, Quantiprot performs quantitative analysis of recurrence and determinism in the sequence, calculates distribution of n-grams and computes the Zipf's law coefficient. We propose three main fields of application of the Quantiprot package. First, quantitative characteristics can be used in alignment-free similarity searches, and in clustering of large and/or divergent sequence sets. Second, a feature space defined by quantitative properties can be used in comparative studies of protein families and organisms. Third, the feature space can be used for evaluating generative models, where large number of sequences generated by the model can be compared to actually observed sequences.

  7. Generation and analysis of expressed sequence tags from six developing xylem libraries in Pinus radiata D. Don

    Directory of Open Access Journals (Sweden)

    Dillon Shannon K

    2009-01-01

    Full Text Available Abstract Background Wood is a major renewable natural resource for the timber, fibre and bioenergy industry. Pinus radiata D. Don is the most important commercial plantation tree species in Australia and several other countries; however, genomic resources for this species are very limited in public databases. Our primary objective was to sequence a large number of expressed sequence tags (ESTs from genes involved in wood formation in radiata pine. Results Six developing xylem cDNA libraries were constructed from earlywood and latewood tissues sampled at juvenile (7 yrs, transition (11 yrs and mature (30 yrs ages, respectively. These xylem tissues represent six typical development stages in a rotation period of radiata pine. A total of 6,389 high quality ESTs were collected from 5,952 cDNA clones. Assembly of 5,952 ESTs from 5' end sequences generated 3,304 unigenes including 952 contigs and 2,352 singletons. About 97.0% of the 5,952 ESTs and 96.1% of the unigenes have matches in the UniProt and TIGR databases. Of the 3,174 unigenes with matches, 42.9% were not assigned GO (Gene Ontology terms and their functions are unknown or unclassified. More than half (52.1% of the 5,952 ESTs have matches in the Pfam database and represent 772 known protein families. About 18.0% of the 5,952 ESTs matched cell wall related genes in the MAIZEWALL database, representing all 18 categories, 91 of all 174 families and possibly 557 genes. Fifteen cell wall-related genes are ranked in the 30 most abundant genes, including CesA, tubulin, AGP, SAMS, actin, laccase, CCoAMT, MetE, phytocyanin, pectate lyase, cellulase, SuSy, expansin, chitinase and UDP-glucose dehydrogenase. Based on the PlantTFDB database 41 of the 64 transcription factor families in the poplar genome were identified as being involved in radiata pine wood formation. Comparative analysis of GO term abundance revealed a distinct transcriptome in juvenile earlywood formation compared to other stages of

  8. Isolation and preliminary function analysis of a Na + /H + antiporter ...

    African Journals Online (AJOL)

    A full-length cDNA Na+/H+ antiporter gene (MzNHX1) was isolated from Malus zumi according to the homologous Na+/H+ antiporter gene region in plants. Sequence analysis indicated that the cDNA was 2062 bp in length, including an open reading frame (ORF) of 1629 bp, which encoded a predicted polypeptide of 542 ...

  9. Molecular characterization and expression analysis of fat mass and ...

    Indian Academy of Sciences (India)

    Keywords. fat mass and obesity-associated gene (FTO); rabbit; mRNA expression patterns; sequence analysis; Oryctolagus cuniculus. ... In this work, the molecular characterization and expression features of rabbit (Oryctolagus cuniculus) FTO cDNA were analysed. The rabbit FTO cDNA with a size of 2158 bp was cloned, ...

  10. Comparative analysis of protein coding sequences from human, mouse and the domesticated pig

    DEFF Research Database (Denmark)

    Jørgensen, Frank Grønlund; Hobolth, Asger; Hornshøj, Henrik

    2005-01-01

    Background: The availability of abundant sequence data from key model organisms has made large scale studies of mulecular evolution an exciting possibility. Here we use full length cDNA alignments comprising more than 700,000 nucleotides from human, mouse, pig and the Japanese pufferfish Fugu rub...... rubrices in order to investigate 1) the relationships between three major lineages of mammals: rodents, artiodactys and primates, and 2) the rate of evolution and the occurrence of positive Darwinian selection using codon based models of sequence evolution. Results: We provide evidence...

  11. Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

    Science.gov (United States)

    Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

    1998-08-01

    An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

  12. Sequence analysis and molecular characterization of Wnt4 gene in metacestodes of Taenia solium.

    Science.gov (United States)

    Hou, Junling; Luo, Xuenong; Wang, Shuai; Yin, Cai; Zhang, Shaohua; Zhu, Xueliang; Dou, Yongxi; Cai, Xuepeng

    2014-04-01

    Wnt proteins are a family of secreted glycoproteins that are evolutionarily conserved and considered to be involved in extensive developmental processes in metazoan organisms. The characterization of wnt genes may improve understanding the parasite's development. In the present study, a wnt4 gene encoding 491amino acids was amplified from cDNA of metacestodes of Taenia solium using reverse transcription PCR (RT-PCR). Bioinformatics tools were used for sequence analysis. The conserved domain of the wnt gene family was predicted. The expression profile of Wnt4 was investigated using real-time PCR. Wnt4 expression was found to be dramatically increased in scolex evaginated cysticerci when compared to invaginated cysticerci. In situ hybridization showed that wnt4 gene was distributed in the posterior end of the worm along the primary body axis in evaginated cysticerci. These findings indicated that wnt4 may take part in the process of cysticerci evagination and play a role in scolex/bladder development of cysticerci of T. solium.

  13. Cloning and functional expression of a human pancreatic islet glucose-transporter cDNA

    International Nuclear Information System (INIS)

    Permutt, M.A.; Koranyi, L.; Keller, K.; Lacy, P.E.; Scharp, D.W.; Mueckler, M.

    1989-01-01

    Previous studies have suggested that pancreatic islet glucose transport is mediated by a high-K m , low-affinity facilitated transporter similar to that expressed in liver. To determine the relationship between islet and liver glucose transporters, liver-type glucose-transporter cDNA clones were isolated from a human liver cDNA library. The liver-type glucose-transporter cDNA clone hybridized to mRNA transcripts of the same size in human liver and pancreatic islet RNA. A cDNA library was prepared from purified human pancreatic islet tissue and screened with human liver-type glucose-transporter cDNA. The authors isolated two overlapping cDNA clones encompassing 2600 base pairs, which encode a pancreatic islet protein identical in sequence to that of the putative liver-type glucose-transporter protein. Xenopus oocytes injected with synthetic mRNA transcribed from a full-length cDNA construct exhibited increased uptake of 2-deoxyglucose, confirming the functional identity of the clone. These cDNA clones can now be used to study regulation of expression of the gene and to assess the role of inherited defects in this gene as a candidate for inherited susceptibility to non-insulin-dependent diabetes mellitus

  14. Next generation sequencing (NGS)technologies and applications

    Energy Technology Data Exchange (ETDEWEB)

    Vuyisich, Momchilo [Los Alamos National Laboratory

    2012-09-11

    NGS technology overview: (1) NGS library preparation - Nucleic acids extraction, Sample quality control, RNA conversion to cDNA, Addition of sequencing adapters, Quality control of library; (2) Sequencing - Clonal amplification of library fragments, (except PacBio), Sequencing by synthesis, Data output (reads and quality); and (3) Data analysis - Read mapping, Genome assembly, Gene expression, Operon structure, sRNA discovery, and Epigenetic analyses.

  15. Nonlinear analysis of river flow time sequences

    Science.gov (United States)

    Porporato, Amilcare; Ridolfi, Luca

    1997-06-01

    Within the field of chaos theory several methods for the analysis of complex dynamical systems have recently been proposed. In light of these ideas we study the dynamics which control the behavior over time of river flow, investigating the existence of a low-dimension deterministic component. The present article follows the research undertaken in the work of Porporato and Ridolfi [1996a] in which some clues as to the existence of chaos were collected. Particular emphasis is given here to the problem of noise and to nonlinear prediction. With regard to the latter, the benefits obtainable by means of the interpolation of the available time series are reported and the remarkable predictive results attained with this nonlinear method are shown.

  16. Accident sequence analysis of human-computer interface design

    International Nuclear Information System (INIS)

    Fan, C.-F.; Chen, W.-H.

    2000-01-01

    It is important to predict potential accident sequences of human-computer interaction in a safety-critical computing system so that vulnerable points can be disclosed and removed. We address this issue by proposing a Multi-Context human-computer interaction Model along with its analysis techniques, an Augmented Fault Tree Analysis, and a Concurrent Event Tree Analysis. The proposed augmented fault tree can identify the potential weak points in software design that may induce unintended software functions or erroneous human procedures. The concurrent event tree can enumerate possible accident sequences due to these weak points

  17. Laser capture microdissection and cDNA array analysis of endometrium identify CCL16 and CCL21 as epithelial-derived inflammatory mediators associated with endometriosis

    Directory of Open Access Journals (Sweden)

    Jones Rebecca L

    2007-05-01

    Full Text Available Abstract Background Understanding the pathophysiology of chemokine secretion in endometriosis may offer a novel area of therapeutic intervention. This study aimed to identify chemokines differentially expressed in epithelial glands in eutopic endometrium from normal women and those with endometriosis, and to establish the expression profiles of key chemokines in endometriotic lesions. Methods Laser capture microdissection isolated epithelial glands from endometrial eutopic tissue from women with and without endometriosis in the mid-secretory phase of their menstrual cycles. Gene profiling of the excised glands used a human chemokine and receptor cDNA array. Selected chemokines were further examined using real-time PCR and immunohistochemistry. Results 22 chemokine/receptor genes were upregulated and two downregulated in pooled endometrial epithelium of women with endometriosis compared with controls. CCL16 and CCL21 mRNA was confirmed as elevated in some women with endometriosis compared to controls on individual samples. Immunoreactive CCL16 and CCL21 were predominantly confined to glands in eutopic and ectopic endometrium: leukocytes also stained. Immunoreactive CCL16 was overall higher in glands in ectopic vs. eutopic endometrium from the same woman (P Conclusion This study provides novel candidate molecules and suggests a potential local role for CCL16 and CCL21 as mediators contributing to the inflammatory events associated with endometriosis.

  18. Food Fish Identification from DNA Extraction through Sequence Analysis

    Science.gov (United States)

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  19. Analysis and Visualization Tool for Targeted Amplicon Bisulfite Sequencing on Ion Torrent Sequencers.

    Directory of Open Access Journals (Sweden)

    Stephan Pabinger

    Full Text Available Targeted sequencing of PCR amplicons generated from bisulfite deaminated DNA is a flexible, cost-effective way to study methylation of a sample at single CpG resolution and perform subsequent multi-target, multi-sample comparisons. Currently, no platform specific protocol, support, or analysis solution is provided to perform targeted bisulfite sequencing on a Personal Genome Machine (PGM. Here, we present a novel tool, called TABSAT, for analyzing targeted bisulfite sequencing data generated on Ion Torrent sequencers. The workflow starts with raw sequencing data, performs quality assessment, and uses a tailored version of Bismark to map the reads to a reference genome. The pipeline visualizes results as lollipop plots and is able to deduce specific methylation-patterns present in a sample. The obtained profiles are then summarized and compared between samples. In order to assess the performance of the targeted bisulfite sequencing workflow, 48 samples were used to generate 53 different Bisulfite-Sequencing PCR amplicons from each sample, resulting in 2,544 amplicon targets. We obtained a mean coverage of 282X using 1,196,822 aligned reads. Next, we compared the sequencing results of these targets to the methylation level of the corresponding sites on an Illumina 450k methylation chip. The calculated average Pearson correlation coefficient of 0.91 confirms the sequencing results with one of the industry-leading CpG methylation platforms and shows that targeted amplicon bisulfite sequencing provides an accurate and cost-efficient method for DNA methylation studies, e.g., to provide platform-independent confirmation of Illumina Infinium 450k methylation data. TABSAT offers a novel way to analyze data generated by Ion Torrent instruments and can also be used with data from the Illumina MiSeq platform. It can be easily accessed via the Platomics platform, which offers a web-based graphical user interface along with sample and parameter storage

  20. Multilocus Sequence Analysis and rpoB Sequencing of Mycobacterium abscessus (Sensu Lato) Strains▿

    Science.gov (United States)

    Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

    2011-01-01

    Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536T, M. massiliense CIP 108297T, and M. bolletii CIP 108541T) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the clustering

  1. Multilocus sequence analysis and rpoB sequencing of Mycobacterium abscessus (sensu lato) strains.

    Science.gov (United States)

    Macheras, Edouard; Roux, Anne-Laure; Bastian, Sylvaine; Leão, Sylvia Cardoso; Palaci, Moises; Sivadon-Tardy, Valérie; Gutierrez, Cristina; Richter, Elvira; Rüsch-Gerdes, Sabine; Pfyffer, Gaby; Bodmer, Thomas; Cambau, Emmanuelle; Gaillard, Jean-Louis; Heym, Beate

    2011-02-01

    Mycobacterium abscessus, Mycobacterium bolletii, and Mycobacterium massiliense (Mycobacterium abscessus sensu lato) are closely related species that currently are identified by the sequencing of the rpoB gene. However, recent studies show that rpoB sequencing alone is insufficient to discriminate between these species, and some authors have questioned their current taxonomic classification. We studied here a large collection of M. abscessus (sensu lato) strains by partial rpoB sequencing (752 bp) and multilocus sequence analysis (MLSA). The final MLSA scheme developed was based on the partial sequences of eight housekeeping genes: argH, cya, glpK, gnd, murC, pgm, pta, and purH. The strains studied included the three type strains (M. abscessus CIP 104536(T), M. massiliense CIP 108297(T), and M. bolletii CIP 108541(T)) and 120 isolates recovered between 1997 and 2007 in France, Germany, Switzerland, and Brazil. The rpoB phylogenetic tree confirmed the existence of three main clusters, each comprising the type strain of one species. However, divergence values between the M. massiliense and M. bolletii clusters all were below 3% and between the M. abscessus and M. massiliense clusters were from 2.66 to 3.59%. The tree produced using the concatenated MLSA gene sequences (4,071 bp) also showed three main clusters, each comprising the type strain of one species. The M. abscessus cluster had a bootstrap value of 100% and was mostly compact. Bootstrap values for the M. massiliense and M. bolletii branches were much lower (71 and 61%, respectively), with the M. massiliense cluster having a fuzzy aspect. Mean (range) divergence values were 2.17% (1.13 to 2.58%) between the M. abscessus and M. massiliense clusters, 2.37% (1.5 to 2.85%) between the M. abscessus and M. bolletii clusters, and 2.28% (0.86 to 2.68%) between the M. massiliense and M. bolletii clusters. Adding the rpoB sequence to the MLSA-concatenated sequence (total sequence, 4,823 bp) had little effect on the

  2. An optimum analysis sequence for environmental gamma-ray spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    De la Torre, F.; Rios M, C.; Ruvalcaba A, M. G.; Mireles G, F.; Saucedo A, S.; Davila R, I.; Pinedo, J. L., E-mail: fta777@hotmail.co [Universidad Autonoma de Zacatecas, Centro Regional de Estudis Nucleares, Calle Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)

    2010-10-15

    This work aims to obtain an optimum analysis sequence for environmental gamma-ray spectroscopy by means of Genie 2000 (Canberra). Twenty different analysis sequences were customized using different peak area percentages and different algorithms for: 1) peak finding, and 2) peak area determination, and with or without the use of a library -based on evaluated nuclear data- of common gamma-ray emitters in environmental samples. The use of an optimum analysis sequence with certified nuclear information avoids the problems originated by the significant variations in out-of-date nuclear parameters of commercial software libraries. Interference-free gamma ray energies with absolute emission probabilities greater than 3.75% were included in the customized library. The gamma-ray spectroscopy system (based on a Ge Re-3522 Canberra detector) was calibrated both in energy and shape by means of the IAEA-2002 reference spectra for software intercomparison. To test the performance of the analysis sequences, the IAEA-2002 reference spectrum was used. The z-score and the reduced {chi}{sup 2} criteria were used to determine the optimum analysis sequence. The results show an appreciable variation in the peak area determinations and their corresponding uncertainties. Particularly, the combination of second derivative peak locate with simple peak area integration algorithms provides the greater accuracy. Lower accuracy comes from the combination of library directed peak locate algorithm and Genie's Gamma-M peak area determination. (Author)

  3. An optimum analysis sequence for environmental gamma-ray spectrometry

    International Nuclear Information System (INIS)

    De la Torre, F.; Rios M, C.; Ruvalcaba A, M. G.; Mireles G, F.; Saucedo A, S.; Davila R, I.; Pinedo, J. L.

    2010-10-01

    This work aims to obtain an optimum analysis sequence for environmental gamma-ray spectroscopy by means of Genie 2000 (Canberra). Twenty different analysis sequences were customized using different peak area percentages and different algorithms for: 1) peak finding, and 2) peak area determination, and with or without the use of a library -based on evaluated nuclear data- of common gamma-ray emitters in environmental samples. The use of an optimum analysis sequence with certified nuclear information avoids the problems originated by the significant variations in out-of-date nuclear parameters of commercial software libraries. Interference-free gamma ray energies with absolute emission probabilities greater than 3.75% were included in the customized library. The gamma-ray spectroscopy system (based on a Ge Re-3522 Canberra detector) was calibrated both in energy and shape by means of the IAEA-2002 reference spectra for software intercomparison. To test the performance of the analysis sequences, the IAEA-2002 reference spectrum was used. The z-score and the reduced χ 2 criteria were used to determine the optimum analysis sequence. The results show an appreciable variation in the peak area determinations and their corresponding uncertainties. Particularly, the combination of second derivative peak locate with simple peak area integration algorithms provides the greater accuracy. Lower accuracy comes from the combination of library directed peak locate algorithm and Genie's Gamma-M peak area determination. (Author)

  4. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  5. Validation of Genotyping-By-Sequencing Analysis in Populations of Tetraploid Alfalfa by 454 Sequencing

    Science.gov (United States)

    Rocher, Solen; Jean, Martine; Castonguay, Yves; Belzile, François

    2015-01-01

    Genotyping-by-sequencing (GBS) is a relatively low-cost high throughput genotyping technology based on next generation sequencing and is applicable to orphan species with no reference genome. A combination of genome complexity reduction and multiplexing with DNA barcoding provides a simple and affordable way to resolve allelic variation between plant samples or populations. GBS was performed on ApeKI libraries using DNA from 48 genotypes each of two heterogeneous populations of tetraploid alfalfa (Medicago sativa spp. sativa): the synthetic cultivar Apica (ATF0) and a derived population (ATF5) obtained after five cycles of recurrent selection for superior tolerance to freezing (TF). Nearly 400 million reads were obtained from two lanes of an Illumina HiSeq 2000 sequencer and analyzed with the Universal Network-Enabled Analysis Kit (UNEAK) pipeline designed for species with no reference genome. Following the application of whole dataset-level filters, 11,694 single nucleotide polymorphism (SNP) loci were obtained. About 60% had a significant match on the Medicago truncatula syntenic genome. The accuracy of allelic ratios and genotype calls based on GBS data was directly assessed using 454 sequencing on a subset of SNP loci scored in eight plant samples. Sequencing depth in this study was not sufficient for accurate tetraploid allelic dosage, but reliable genotype calls based on diploid allelic dosage were obtained when using additional quality filtering. Principal Component Analysis of SNP loci in plant samples revealed that a small proportion (<5%) of the genetic variability assessed by GBS is able to differentiate ATF0 and ATF5. Our results confirm that analysis of GBS data using UNEAK is a reliable approach for genome-wide discovery of SNP loci in outcrossed polyploids. PMID:26115486

  6. Expressed Sequence Tag-Simple Sequence Repeat (EST-SSR Marker Resources for Diversity Analysis of Mango (Mangifera indica L.

    Directory of Open Access Journals (Sweden)

    Natalie L. Dillon

    2014-01-01

    Full Text Available In this study, a collection of 24,840 expressed sequence tags (ESTs generated from five mango (Mangifera indica L. cDNA libraries was mined for EST-based simple sequence repeat (SSR markers. Over 1,000 ESTs with SSR motifs were detected from more than 24,000 EST sequences with di- and tri-nucleotide repeat motifs the most abundant. Of these, 25 EST-SSRs in genes involved in plant development, stress response, and fruit color and flavor development pathways were selected, developed into PCR markers and characterized in a population of 32 mango selections including M. indica varieties, and related Mangifera species. Twenty-four of the 25 EST-SSR markers exhibited polymorphisms, identifying a total of 86 alleles with an average of 5.38 alleles per locus, and distinguished between all Mangifera selections. Private alleles were identified for Mangifera species. These newly developed EST-SSR markers enhance the current 11 SSR mango genetic identity panel utilized by the Australian Mango Breeding Program. The current panel has been used to identify progeny and parents for selection and the application of this extended panel will further improve and help to design mango hybridization strategies for increased breeding efficiency.

  7. Cloning, Expression, Sequence Analysis and Homology Modeling of the Prolyl Endoprotease from Eurygaster integriceps Puton

    Directory of Open Access Journals (Sweden)

    Ravi Chandra Yandamuri

    2014-10-01

    Full Text Available eurygaster integriceps Puton, commonly known as sunn pest, is a major pest of wheat in Northern Africa, the Middle East and Eastern Europe. This insect injects a prolyl endoprotease into the wheat, destroying the gluten. The purpose of this study was to clone the full length cDNA of the sunn pest prolyl endoprotease (spPEP for expression in E. coli and to compare the amino acid sequence of the enzyme to other known PEPs in both phylogeny and potential tertiary structure. Sequence analysis shows that the 5ꞌ UTR contains several putative transcription factor binding sites for transcription factors known to be expressed in Drosophila that might be useful targets for inhibition of the enzyme. The spPEP was first identified as a prolyl endoprotease by Darkoh et al., 2010. The enzyme is a unique serine protease of the S9A family by way of its substrate recognition of the gluten proteins, which are greater than 30 kD in size. At 51% maximum identity to known PEPs, homology modeling using SWISS-MODEL, the porcine brain PEP (PDB: 2XWD was selected in the database of known PEP structures, resulting in a predicted tertiary structure 99% identical to the porcine brain PEP structure. A Km for the recombinant spPEP was determined to be 210 ± 53 µM for the zGly-Pro-pNA substrate in 0.025 M ethanolamine, pH 8.5, containing 0.1 M NaCl at 37 °C with a turnover rate of 172 ± 47 µM Gly-Pro-pNA/s/µM of enzyme.

  8. Rescue of infectious rift valley fever virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a foreign gene.

    Science.gov (United States)

    Ikegami, Tetsuro; Won, Sungyong; Peters, C J; Makino, Shinji

    2006-03-01

    Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) has a tripartite negative-strand genome, causes a mosquito-borne disease that is endemic in sub-Saharan African countries and that also causes large epidemics among humans and livestock. Furthermore, it is a bioterrorist threat and poses a risk for introduction to other areas. In spite of its danger, neither veterinary nor human vaccines are available. We established a T7 RNA polymerase-driven reverse genetics system to rescue infectious clones of RVFV MP-12 strain entirely from cDNA, the first for any phlebovirus. Expression of viral structural proteins from the protein expression plasmids was not required for virus rescue, whereas NSs protein expression abolished virus rescue. Mutants of MP-12 partially or completely lacking the NSs open reading frame were viable. These NSs deletion mutants replicated efficiently in Vero and 293 cells, but not in MRC-5 cells. In the latter cell line, accumulation of beta interferon mRNA occurred after infection by these NSs deletion mutants, but not after infection by MP-12. The NSs deletion mutants formed larger plaques than MP-12 did in Vero E6 cells and failed to shut off host protein synthesis in Vero cells. An MP-12 mutant carrying a luciferase gene in place of the NSs gene replicated as efficiently as MP-12 did, produced enzymatically active luciferase during replication, and stably retained the luciferase gene after 10 virus passages, representing the first demonstration of foreign gene expression in any bunyavirus. This reverse genetics system can be used to study the molecular virology of RVFV, assess current vaccine candidates, produce new vaccines, and incorporate marker genes into animal vaccines.

  9. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  10. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    Directory of Open Access Journals (Sweden)

    Alamar Santiago

    2009-09-01

    Full Text Available Abstract Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new

  11. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    Science.gov (United States)

    Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

    2009-01-01

    Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an

  12. Utility of RNA Sequencing for Analysis of Maize Reproductive Transcriptomes

    Directory of Open Access Journals (Sweden)

    Rebecca M. Davidson

    2011-11-01

    Full Text Available Transcriptome sequencing is a powerful method for studying global expression patterns in large, complex genomes. Evaluation of sequence-based expression profiles during reproductive development would provide functional annotation to genes underlying agronomic traits. We generated transcriptome profiles for 12 diverse maize ( L. reproductive tissues representing male, female, developing seed, and leaf tissues using high throughput transcriptome sequencing. Overall, ∼80% of annotated genes were expressed. Comparative analysis between sequence and hybridization-based methods demonstrated the utility of ribonucleic acid sequencing (RNA-seq for expression determination and differentiation of paralagous genes (∼85% of maize genes. Analysis of 4975 gene families across reproductive tissues revealed expression divergence is proportional to family size. In all pairwise comparisons between tissues, 7 (pre- vs. postemergence cobs to 48% (pollen vs. ovule of genes were differentially expressed. Genes with expression restricted to a single tissue within this study were identified with the highest numbers observed in leaves, endosperm, and pollen. Coexpression network analysis identified 17 gene modules with complex and shared expression patterns containing many previously described maize genes. The data and analyses in this study provide valuable tools through improved gene annotation, gene family characterization, and a core set of candidate genes to further characterize maize reproductive development and improve grain yield potential.

  13. Construction and characterization of cDNA library for IRM-2 mice

    International Nuclear Information System (INIS)

    Wang Qin; Li Jin; Song Li; Liu Qiang; Yue Jingyin; Mu Chuanjie; Tang Weisheng; Fan Feiyue

    2010-01-01

    Objective: To screen and isolate the radioresistance related genes of IRM-2 mice. Methods: cDNA library of IRM-2 mice was constructed by SMART technique. Total RNA was isolated from spleens of IRM-2 male mice. The first-strand cDNA was synthesized by using PowerScript reverse transcriptase, and double-strand cDNA was synthesized and amplified by long PCR. The PCR products were purified, digested with restriction enzyme Sfi I. The ds-cDNA fragment less than 500 bp was fractionated and ligated to the Sfi I-digested pDNR-LIB vector. The ligation mixture was transformed into E. coil DH5 α by electroporation transformation to generate the unamplified cDNA library. The quality of cDNA library was identified by PCR technique. 130 clones from cDNA library were sequenced and compared with GenBank database. Results: The cDNA library contained 2.25 x 10 6 independent clones with an average insert size of 1.2 kb. The ratio of recombination and full-length was 95% and 55%, respectively. 21 pieces of EST sequences from cDNA library were not the same as the known mice genes and registered into GenBank EST database, with registered number DW474856-DW474876. Conclusions: cDNA library of IRM-2 mice has been constructed successfully. 21 pieces of EST implies that radioresistance correlative genes may be in IRM-2 mice, which will lay a foundation for isolating and identifying radioresistance related genes in further study. (authors)

  14. De novo sequencing and analysis of the transcriptome during the browning of fresh-cut Luffa cylindrica 'Fusi-3' fruits

    Science.gov (United States)

    Chen, Mindong; Wang, Bin; Zhang, Qianrong; Xue, Zhuzheng

    2017-01-01

    Fresh-cut luffa (Luffa cylindrica) fruits commonly undergo browning. However, little is known about the molecular mechanisms regulating this process. We used the RNA-seq technique to analyze the transcriptomic changes occurring during the browning of fresh-cut fruits from luffa cultivar ‘Fusi-3’. Over 90 million high-quality reads were assembled into 58,073 Unigenes, and 60.86% of these were annotated based on sequences in four public databases. We detected 35,282 Unigenes with significant hits to sequences in the NCBInr database, and 24,427 Unigenes encoded proteins with sequences that were similar to those of known proteins in the Swiss-Prot database. Additionally, 20,546 and 13,021 Unigenes were similar to existing sequences in the Eukaryotic Orthologous Groups of proteins and Kyoto Encyclopedia of Genes and Genomes databases, respectively. Furthermore, 27,301 Unigenes were differentially expressed during the browning of fresh-cut luffa fruits (i.e., after 1–6 h). Moreover, 11 genes from five gene families (i.e., PPO, PAL, POD, CAT, and SOD) identified as potentially associated with enzymatic browning as well as four WRKY transcription factors were observed to be differentially regulated in fresh-cut luffa fruits. With the assistance of rapid amplification of cDNA ends technology, we obtained the full-length sequences of the 15 Unigenes. We also confirmed these Unigenes were expressed by quantitative real-time polymerase chain reaction analysis. This study provides a comprehensive transcriptome sequence resource, and may facilitate further studies aimed at identifying genes affecting luffa fruit browning for the exploitation of the underlying mechanism. PMID:29145430

  15. De novo sequencing and analysis of the transcriptome during the browning of fresh-cut Luffa cylindrica 'Fusi-3' fruits.

    Directory of Open Access Journals (Sweden)

    Haisheng Zhu

    Full Text Available Fresh-cut luffa (Luffa cylindrica fruits commonly undergo browning. However, little is known about the molecular mechanisms regulating this process. We used the RNA-seq technique to analyze the transcriptomic changes occurring during the browning of fresh-cut fruits from luffa cultivar 'Fusi-3'. Over 90 million high-quality reads were assembled into 58,073 Unigenes, and 60.86% of these were annotated based on sequences in four public databases. We detected 35,282 Unigenes with significant hits to sequences in the NCBInr database, and 24,427 Unigenes encoded proteins with sequences that were similar to those of known proteins in the Swiss-Prot database. Additionally, 20,546 and 13,021 Unigenes were similar to existing sequences in the Eukaryotic Orthologous Groups of proteins and Kyoto Encyclopedia of Genes and Genomes databases, respectively. Furthermore, 27,301 Unigenes were differentially expressed during the browning of fresh-cut luffa fruits (i.e., after 1-6 h. Moreover, 11 genes from five gene families (i.e., PPO, PAL, POD, CAT, and SOD identified as potentially associated with enzymatic browning as well as four WRKY transcription factors were observed to be differentially regulated in fresh-cut luffa fruits. With the assistance of rapid amplification of cDNA ends technology, we obtained the full-length sequences of the 15 Unigenes. We also confirmed these Unigenes were expressed by quantitative real-time polymerase chain reaction analysis. This study provides a comprehensive transcriptome sequence resource, and may facilitate further studies aimed at identifying genes affecting luffa fruit browning for the exploitation of the underlying mechanism.

  16. Transcriptome sequencing and metabolite analysis reveals the role of delphinidin metabolism in flower colour in grape hyacinth.

    Science.gov (United States)

    Lou, Qian; Liu, Yali; Qi, Yinyan; Jiao, Shuzhen; Tian, Feifei; Jiang, Ling; Wang, Yuejin

    2014-07-01

    Grape hyacinth (Muscari) is an important ornamental bulbous plant with an extraordinary blue colour. Muscari armeniacum, whose flowers can be naturally white, provides an opportunity to unravel the complex metabolic networks underlying certain biochemical traits, especially colour. A blue flower cDNA library of M. armeniacum and a white flower library of M. armeniacum f. album were used for transcriptome sequencing. A total of 89 926 uni-transcripts were isolated, 143 of which could be identified as putative homologues of colour-related genes in other species. Based on a comprehensive analysis relating colour compounds to gene expression profiles, the mechanism of colour biosynthesis was studied in M. armeniacum. Furthermore, a new hypothesis explaining the lack of colour phenotype of the grape hyacinth flower is proposed. Alteration of the substrate competition between flavonol synthase (FLS) and dihydroflavonol 4-reductase (DFR) may lead to elimination of blue pigmentation while the multishunt from the limited flux in the cyanidin (Cy) synthesis pathway seems to be the most likely reason for the colour change in the white flowers of M. armeniacum. Moreover, mass sequence data obtained by the deep sequencing of M. armeniacum and its white variant provided a platform for future function and molecular biological research on M. armeniacum. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  17. Sequence analysis of the genome of carnation (Dianthus caryophyllus L.).

    Science.gov (United States)

    Yagi, Masafumi; Kosugi, Shunichi; Hirakawa, Hideki; Ohmiya, Akemi; Tanase, Koji; Harada, Taro; Kishimoto, Kyutaro; Nakayama, Masayoshi; Ichimura, Kazuo; Onozaki, Takashi; Yamaguchi, Hiroyasu; Sasaki, Nobuhiro; Miyahara, Taira; Nishizaki, Yuzo; Ozeki, Yoshihiro; Nakamura, Noriko; Suzuki, Takamasa; Tanaka, Yoshikazu; Sato, Shusei; Shirasawa, Kenta; Isobe, Sachiko; Miyamura, Yoshinori; Watanabe, Akiko; Nakayama, Shinobu; Kishida, Yoshie; Kohara, Mitsuyo; Tabata, Satoshi

    2014-06-01

    The whole-genome sequence of carnation (Dianthus caryophyllus L.) cv. 'Francesco' was determined using a combination of different new-generation multiplex sequencing platforms. The total length of the non-redundant sequences was 568,887,315 bp, consisting of 45,088 scaffolds, which covered 91% of the 622 Mb carnation genome estimated by k-mer analysis. The N50 values of contigs and scaffolds were 16,644 bp and 60,737 bp, respectively, and the longest scaffold was 1,287,144 bp. The average GC content of the contig sequences was 36%. A total of 1050, 13, 92 and 143 genes for tRNAs, rRNAs, snoRNA and miRNA, respectively, were identified in the assembled genomic sequences. For protein-encoding genes, 43 266 complete and partial gene structures excluding those in transposable elements were deduced. Gene coverage was ∼ 98%, as deduced from the coverage of the core eukaryotic genes. Intensive characterization of the assigned carnation genes and comparison with those of other plant species revealed characteristic features of the carnation genome. The results of this study will serve as a valuable resource for fundamental and applied research of carnation, especially for breeding new carnation varieties. Further information on the genomic sequences is available at http://carnation.kazusa.or.jp. © The Author 2013. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. Next generation sequencing based transcriptome analysis of septic-injury responsive genes in the beetle Tribolium castaneum.

    Directory of Open Access Journals (Sweden)

    Boran Altincicek

    Full Text Available Beetles (Coleoptera are the most diverse animal group on earth and interact with numerous symbiotic or pathogenic microbes in their environments. The red flour beetle Tribolium castaneum is a genetically tractable model beetle species and its whole genome sequence has recently been determined. To advance our understanding of the molecular basis of beetle immunity here we analyzed the whole transcriptome of T. castaneum by high-throughput next generation sequencing technology. Here, we demonstrate that the Illumina/Solexa sequencing approach of cDNA samples from T. castaneum including over 9.7 million reads with 72 base pairs (bp length (approximately 700 million bp sequence information with about 30× transcriptome coverage confirms the expression of most predicted genes and enabled subsequent qualitative and quantitative transcriptome analysis. This approach recapitulates our recent quantitative real-time PCR studies of immune-challenged and naïve T. castaneum beetles, validating our approach. Furthermore, this sequencing analysis resulted in the identification of 73 differentially expressed genes upon immune-challenge with statistical significance by comparing expression data to calculated values derived by fitting to generalized linear models. We identified up regulation of diverse immune-related genes (e.g. Toll receptor, serine proteinases, DOPA decarboxylase and thaumatin and of numerous genes encoding proteins with yet unknown functions. Of note, septic-injury resulted also in the elevated expression of genes encoding heat-shock proteins or cytochrome P450s supporting the view that there is crosstalk between immune and stress responses in T. castaneum. The present study provides a first comprehensive overview of septic-injury responsive genes in T. castaneum beetles. Identified genes advance our understanding of T. castaneum specific gene expression alteration upon immune-challenge in particular and may help to understand beetle immunity

  19. Sequence analysis corresponding to the PPE and PE proteins in ...

    Indian Academy of Sciences (India)

    Unknown

    AB repeats; Mycobacterium tuberculosis genome; PE-PPE domain; PPE, PE proteins; sequence analysis; surface antigens. J. Biosci. | Vol. ... bacterium tuberculosis genomes resulted in the identification of a previously uncharacterized 225 amino acid- ...... Vega Lopez F, Brooks L A, Dockrell H M, De Smet K A,. Thompson ...

  20. Molecular cloning, expression analysis and sequence prediction of ...

    African Journals Online (AJOL)

    CCAAT/enhancer-binding protein beta as an essential transcriptional factor, regulates the differentiation of adipocytes and the deposition of fat. Herein, we cloned the whole open reading frame (ORF) of bovine C/EBPβ gene and analyzed its putative protein structures via DNA cloning and sequence analysis. Then, the ...

  1. Multilocus sequence analysis of phytopathogenic species of the genus Streptomyces

    Science.gov (United States)

    The identification and classification of species within the genus Streptomyces is difficult because there are presently 576 validly described species and this number increases every year. The value of the application of multilocus sequence analysis scheme to the systematics of Streptomyces species h...

  2. Sequence symmetry analysis in pharmacovigilance and pharmacoepidemiologic studies

    DEFF Research Database (Denmark)

    Lai, Edward Chia Cheng; Pratt, Nicole; Hsieh, Cheng Yang

    2017-01-01

    Sequence symmetry analysis (SSA) is a method for detecting adverse drug events by utilizing computerized claims data. The method has been increasingly used to investigate safety concerns of medications and as a pharmacovigilance tool to identify unsuspected side effects. Validation studies have i...

  3. DNAApp: a mobile application for sequencing data analysis.

    Science.gov (United States)

    Nguyen, Phi-Vu; Verma, Chandra Shekhar; Gan, Samuel Ken-En

    2014-11-15

    There have been numerous applications developed for decoding and visualization of ab1 DNA sequencing files for Windows and MAC platforms, yet none exists for the increasingly popular smartphone operating systems. The ability to decode sequencing files cannot easily be carried out using browser accessed Web tools. To overcome this hurdle, we have developed a new native app called DNAApp that can decode and display ab1 sequencing file on Android and iOS. In addition to in-built analysis tools such as reverse complementation, protein translation and searching for specific sequences, we have incorporated convenient functions that would facilitate the harnessing of online Web tools for a full range of analysis. Given the high usage of Android/iOS tablets and smartphones, such bioinformatics apps would raise productivity and facilitate the high demand for analyzing sequencing data in biomedical research. The Android version of DNAApp is available in Google Play Store as 'DNAApp', and the iOS version is available in the App Store. More details on the app can be found at www.facebook.com/APDLab; www.bii.a-star.edu.sg/research/trd/apd.php The DNAApp user guide is available at http://tinyurl.com/DNAAppuser, and a video tutorial is available on Google Play Store and App Store, as well as on the Facebook page. samuelg@bii.a-star.edu.sg. © The Author 2014. Published by Oxford University Press.

  4. DNAApp: a mobile application for sequencing data analysis

    Science.gov (United States)

    Nguyen, Phi-Vu; Verma, Chandra Shekhar; Gan, Samuel Ken-En

    2014-01-01

    Summary: There have been numerous applications developed for decoding and visualization of ab1 DNA sequencing files for Windows and MAC platforms, yet none exists for the increasingly popular smartphone operating systems. The ability to decode sequencing files cannot easily be carried out using browser accessed Web tools. To overcome this hurdle, we have developed a new native app called DNAApp that can decode and display ab1 sequencing file on Android and iOS. In addition to in-built analysis tools such as reverse complementation, protein translation and searching for specific sequences, we have incorporated convenient functions that would facilitate the harnessing of online Web tools for a full range of analysis. Given the high usage of Android/iOS tablets and smartphones, such bioinformatics apps would raise productivity and facilitate the high demand for analyzing sequencing data in biomedical research. Availability and implementation: The Android version of DNAApp is available in Google Play Store as ‘DNAApp’, and the iOS version is available in the App Store. More details on the app can be found at www.facebook.com/APDLab; www.bii.a-star.edu.sg/research/trd/apd.php The DNAApp user guide is available at http://tinyurl.com/DNAAppuser, and a video tutorial is available on Google Play Store and App Store, as well as on the Facebook page. Contact: samuelg@bii.a-star.edu.sg PMID:25095882

  5. Long-read sequencing data analysis for yeasts.

    Science.gov (United States)

    Yue, Jia-Xing; Liti, Gianni

    2018-06-01

    Long-read sequencing technologies have become increasingly popular due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast Saccharomyces cerevisiae has many isolates currently being sequenced with long reads. However, analyzing long-read sequencing data to produce high-quality genome assembly and annotation remains challenging. Here, we present a modular computational framework named long-read sequencing data analysis for yeasts (LRSDAY), the first one-stop solution that streamlines this process. Starting from the raw sequencing reads, LRSDAY can produce chromosome-level genome assembly and comprehensive genome annotation in a highly automated manner with minimal manual intervention, which is not possible using any alternative tool available to date. The annotated genomic features include centromeres, protein-coding genes, tRNAs, transposable elements (TEs), and telomere-associated elements. Although tailored for S. cerevisiae, we designed LRSDAY to be highly modular and customizable, making it adaptable to virtually any eukaryotic organism. When applying LRSDAY to an S. cerevisiae strain, it takes ∼41 h to generate a complete and well-annotated genome from ∼100× Pacific Biosciences (PacBio) running the basic workflow with four threads. Basic experience working within the Linux command-line environment is recommended for carrying out the analysis using LRSDAY.

  6. [beta]-hexosaminidase isozymes from cells cotransfected with [alpha] and [beta] cDNA constructs: Analysis of the [alpha]-subunit missense mutation associated with the adult form of Tay-Sachs disease

    Energy Technology Data Exchange (ETDEWEB)

    Brown, C.A.; Mahuran, D.J. (Univ. of Toronto (Canada))

    1993-08-01

    In vitro mutagenesis and transient expression in COS cells has been used to associate a missense mutation with a clinical or biochemical phenotype. Mutations affecting the [alpha]-subunit of [beta]-hexosaminidase A ([alpha][beta]) (E.C.3.2.1.52) result in Tay-Sachs disease. Because hexosaminidase A is heterodimeric, analysis of [alpha]-chain mutations is not straightforward. The authors examine three approaches utilizing previously identified mutations affecting [alpha]-chain folding. These involve transfection of (1) the [alpha] cDNA alone; (2) a [beta] cDNA construct encoding a [beta]-subunit substituted at a position homologous to that of the [alpha]-subunit, and (3) both [alpha] and [beta] cDNAs. The latter two procedures amplified residual activity levels over that of patient samples, an effect not previously found with mutations affecting an [open quotes]active[close quotes] [alpha]Arg residue. This effect may help to discriminate between protein-folding and active-site mutations. The authors conclude that, with proper controls, the latter method of cotransfection can be used to evaluate the effects and perhaps to predict the clinical course of some [alpha]-chain mutations. Using this technique, they demonstrate that the adult-onset Tay-Sachs mutation, [alpha]Gly[yields]Ser[sup 269], does not directly affect [alpha][beta] dimerization but exerts an indirect effect on the dimer through destabilizing the folded [alpha]-subunit at physiological temperatures. Two other [alpha] mutations linked to more severe phenotypes appear to inhibit the initial folding of the subunit. 36 refs., 2 figs., 5 tabs.

  7. Comparative genomic mapping of the bovine Fragile Histidine Triad (FHIT tumour suppressor gene: characterization of a 2 Mb BAC contig covering the locus, complete annotation of the gene, analysis of cDNA and of physiological expression profiles

    Directory of Open Access Journals (Sweden)

    Boussaha Mekki

    2006-05-01

    Full Text Available Abstract Background The Fragile Histidine Triad gene (FHIT is an oncosuppressor implicated in many human cancers, including vesical tumors. FHIT is frequently hit by deletions caused by fragility at FRA3B, the most active of human common fragile sites, where FHIT lays. Vesical tumors affect also cattle, including animals grazing in the wild on bracken fern; compounds released by the fern are known to induce chromosome fragility and may trigger cancer with the interplay of latent Papilloma virus. Results The bovine FHIT was characterized by assembling a contig of 78 BACs. Sequence tags were designed on human exons and introns and used directly to select bovine BACs, or compared with sequence data in the bovine genome database or in the trace archive of the bovine genome sequencing project, and adapted before use. FHIT is split in ten exons like in man, with exons 5 to 9 coding for a 149 amino acids protein. VISTA global alignments between bovine genomic contigs retrieved from the bovine genome database and the human FHIT region were performed. Conservation was extremely high over a 2 Mb region spanning the whole FHIT locus, including the size of introns. Thus, the bovine FHIT covers about 1.6 Mb compared to 1.5 Mb in man. Expression was analyzed by RT-PCR and Northern blot, and was found to be ubiquitous. Four cDNA isoforms were isolated and sequenced, that originate from an alternative usage of three variants of exon 4, revealing a size very close to the major human FHIT cDNAs. Conclusion A comparative genomic approach allowed to assemble a contig of 78 BACs and to completely annotate a 1.6 Mb region spanning the bovine FHIT gene. The findings confirmed the very high level of conservation between human and bovine genomes and the importance of comparative mapping to speed the annotation process of the recently sequenced bovine genome. The detailed knowledge of the genomic FHIT region will allow to study the role of FHIT in bovine cancerogenesis

  8. Comparative genomic mapping of the bovine Fragile Histidine Triad (FHIT) tumour suppressor gene: characterization of a 2 Mb BAC contig covering the locus, complete annotation of the gene, analysis of cDNA and of physiological expression profiles.

    Science.gov (United States)

    Uboldi, Cristina; Guidi, Elena; Roperto, Sante; Russo, Valeria; Roperto, Franco; Di Meo, Giulia Pia; Iannuzzi, Leopoldo; Floriot, Sandrine; Boussaha, Mekki; Eggen, André; Ferretti, Luca

    2006-05-23

    The Fragile Histidine Triad gene (FHIT) is an oncosuppressor implicated in many human cancers, including vesical tumors. FHIT is frequently hit by deletions caused by fragility at FRA3B, the most active of human common fragile sites, where FHIT lays. Vesical tumors affect also cattle, including animals grazing in the wild on bracken fern; compounds released by the fern are known to induce chromosome fragility and may trigger cancer with the interplay of latent Papilloma virus. The bovine FHIT was characterized by assembling a contig of 78 BACs. Sequence tags were designed on human exons and introns and used directly to select bovine BACs, or compared with sequence data in the bovine genome database or in the trace archive of the bovine genome sequencing project, and adapted before use. FHIT is split in ten exons like in man, with exons 5 to 9 coding for a 149 amino acids protein. VISTA global alignments between bovine genomic contigs retrieved from the bovine genome database and the human FHIT region were performed. Conservation was extremely high over a 2 Mb region spanning the whole FHIT locus, including the size of introns. Thus, the bovine FHIT covers about 1.6 Mb compared to 1.5 Mb in man. Expression was analyzed by RT-PCR and Northern blot, and was found to be ubiquitous. Four cDNA isoforms were isolated and sequenced, that originate from an alternative usage of three variants of exon 4, revealing a size very close to the major human FHIT cDNAs. A comparative genomic approach allowed to assemble a contig of 78 BACs and to completely annotate a 1.6 Mb region spanning the bovine FHIT gene. The findings confirmed the very high level of conservation between human and bovine genomes and the importance of comparative mapping to speed the annotation process of the recently sequenced bovine genome. The detailed knowledge of the genomic FHIT region will allow to study the role of FHIT in bovine cancerogenesis, especially of vesical papillomavirus-associated cancers of

  9. Molecular cloning of a cDNA and chromosomal localization of a human theta-class glutathione S-transferase gene (GSTT2) to chromosome 22

    Energy Technology Data Exchange (ETDEWEB)

    Tan, K.L.; Baker, R.T.; Board, P.G. [Australian National Univ., Canberra (Australia)] [and others

    1995-01-20

    Until recently the Theta-class glutathione S-transferases (GSTs) were largely overlooked due to their low activity with the model substrate 1-chloro-2,4-dinitrobenzene (CDNB) and their failure to bind to immobilized glutathione affinity matrices. Little is known about the number of genes in this class. Recently, Pemble et al. reported the cDNA cloning of a human Theta-class GST, termed GSTT1. In this study, we describe the molecular cloning of a cDNA encoding a second human Theta-class GST (GSTT2) from a {lambda}gt11 human liver 5{prime}-stretch cDNA library. The encoded protein contains 244 amino acids and has 78.3% sequence identity with the rat subunit 12 and only 55.0% identity with human GSTT1. GSTT2 has been mapped to chromosome 22 by somatic cell hybrid analysis. The precise position of the gene was localized to subband 22q11.2 by in situ hybridization. The absence of other regions of hybridization suggests that there are no closely related sequences (e.g., reverse transcribed pseudogenes) scattered throughout the genome and that if there are closely related genes, they must be clustered near GSTT2. Southern blot analysis of human DNA digested with BamHI shows that the size of the GSTT2 gene is relatively small, as the coding sequence falls within a 3.6-kb BamHI fragment. 35 refs., 6 figs.

  10. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

    International Nuclear Information System (INIS)

    Mangin, M.; Webb, A.C.; Dreyer, B.E.

    1988-01-01

    Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

  11. Construction of an integrated database to support genomic sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, W.; Overbeek, R.

    1994-11-01

    The central goal of this project is to develop an integrated database to support comparative analysis of genomes including DNA sequence data, protein sequence data, gene expression data and metabolism data. In developing the logic-based system GenoBase, a broader integration of available data was achieved due to assistance from collaborators. Current goals are to easily include new forms of data as they become available and to easily navigate through the ensemble of objects described within the database. This report comments on progress made in these areas.

  12. Analysis of Sequence Diagram Layout in Advanced UML Modelling Tools

    Directory of Open Access Journals (Sweden)

    Ņikiforova Oksana

    2016-05-01

    Full Text Available System modelling using Unified Modelling Language (UML is the task that should be solved for software development. The more complex software becomes the higher requirements are stated to demonstrate the system to be developed, especially in its dynamic aspect, which in UML is offered by a sequence diagram. To solve this task, the main attention is devoted to the graphical presentation of the system, where diagram layout plays the central role in information perception. The UML sequence diagram due to its specific structure is selected for a deeper analysis on the elements’ layout. The authors research represents the abilities of modern UML modelling tools to offer automatic layout of the UML sequence diagram and analyse them according to criteria required for the diagram perception.

  13. Network clustering coefficient approach to DNA sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gerhardt, Guenther J.L. [Universidade Federal do Rio Grande do Sul-Hospital de Clinicas de Porto Alegre, Rua Ramiro Barcelos 2350/sala 2040/90035-003 Porto Alegre (Brazil); Departamento de Fisica e Quimica da Universidade de Caxias do Sul, Rua Francisco Getulio Vargas 1130, 95001-970 Caxias do Sul (Brazil); Lemke, Ney [Programa Interdisciplinar em Computacao Aplicada, Unisinos, Av. Unisinos, 950, 93022-000 Sao Leopoldo, RS (Brazil); Corso, Gilberto [Departamento de Biofisica e Farmacologia, Centro de Biociencias, Universidade Federal do Rio Grande do Norte, Campus Universitario, 59072 970 Natal, RN (Brazil)]. E-mail: corso@dfte.ufrn.br

    2006-05-15

    In this work we propose an alternative DNA sequence analysis tool based on graph theoretical concepts. The methodology investigates the path topology of an organism genome through a triplet network. In this network, triplets in DNA sequence are vertices and two vertices are connected if they occur juxtaposed on the genome. We characterize this network topology by measuring the clustering coefficient. We test our methodology against two main bias: the guanine-cytosine (GC) content and 3-bp (base pairs) periodicity of DNA sequence. We perform the test constructing random networks with variable GC content and imposed 3-bp periodicity. A test group of some organisms is constructed and we investigate the methodology in the light of the constructed random networks. We conclude that the clustering coefficient is a valuable tool since it gives information that is not trivially contained in 3-bp periodicity neither in the variable GC content.

  14. Evolutionary analysis of hepatitis C virus gene sequences from 1953

    Science.gov (United States)

    Gray, Rebecca R.; Tanaka, Yasuhito; Takebe, Yutaka; Magiorkinis, Gkikas; Buskell, Zelma; Seeff, Leonard; Alter, Harvey J.; Pybus, Oliver G.

    2013-01-01

    Reconstructing the transmission history of infectious diseases in the absence of medical or epidemiological records often relies on the evolutionary analysis of pathogen genetic sequences. The precision of evolutionary estimates of epidemic history can be increased by the inclusion of sequences derived from ‘archived’ samples that are genetically distinct from contemporary strains. Historical sequences are especially valuable for viral pathogens that circulated for many years before being formally identified, including HIV and the hepatitis C virus (HCV). However, surprisingly few HCV isolates sampled before discovery of the virus in 1989 are currently available. Here, we report and analyse two HCV subgenomic sequences obtained from infected individuals in 1953, which represent the oldest genetic evidence of HCV infection. The pairwise genetic diversity between the two sequences indicates a substantial period of HCV transmission prior to the 1950s, and their inclusion in evolutionary analyses provides new estimates of the common ancestor of HCV in the USA. To explore and validate the evolutionary information provided by these sequences, we used a new phylogenetic molecular clock method to estimate the date of sampling of the archived strains, plus the dates of four more contemporary reference genomes. Despite the short fragments available, we conclude that the archived sequences are consistent with a proposed sampling date of 1953, although statistical uncertainty is large. Our cross-validation analyses suggest that the bias and low statistical power observed here likely arise from a combination of high evolutionary rate heterogeneity and an unstructured, star-like phylogeny. We expect that attempts to date other historical viruses under similar circumstances will meet similar problems. PMID:23938759

  15. Using SQL Databases for Sequence Similarity Searching and Analysis.

    Science.gov (United States)

    Pearson, William R; Mackey, Aaron J

    2017-09-13

    Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  16. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    Directory of Open Access Journals (Sweden)

    Ju-Yeon Yoon

    2014-03-01

    Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

  17. Now And Next Generation Sequencing Techniques: Future of Sequence Analysis using Cloud Computing

    Directory of Open Access Journals (Sweden)

    Radhe Shyam Thakur

    2012-12-01

    Full Text Available Advancements in the field of sequencing techniques resulted in the huge sequenced data to be produced at a very faster rate. It is going cumbersome for the datacenter to maintain the databases. Data mining and sequence analysis approaches needs to analyze the databases several times to reach any efficient conclusion. To cope with such overburden on computer resources and to reach efficient and effective conclusions quickly, the virtualization of the resources and computation on pay as you go concept was introduced and termed as cloud computing. The datacenter’s hardware and software is collectively known as cloud which when available publicly is termed as public cloud. The datacenter’s resources are provided in a virtual mode to the clients via a service provider like Amazon, Google and Joyent which charges on pay as you go manner. The workload is shifted to the provider which is maintained by the required hardware and software upgradation. The service provider manages it by upgrading the requirements in the virtual mode. Basically a virtual environment is created according to the need of the user by taking permission from datacenter via internet, the task is performed and the environment is deleted after the task is over. In this discussion, we are focusing on the basics of cloud computing, the prerequisites and overall working of clouds. Furthermore, briefly the applications of cloud computing in biological systems, especially in comparative genomics, genome informatics and SNP detection with reference to traditional workflow are discussed.

  18. Now and next-generation sequencing techniques: future of sequence analysis using cloud computing.

    Science.gov (United States)

    Thakur, Radhe Shyam; Bandopadhyay, Rajib; Chaudhary, Bratati; Chatterjee, Sourav

    2012-01-01

    Advances in the field of sequencing techniques have resulted in the greatly accelerated production of huge sequence datasets. This presents immediate challenges in database maintenance at datacenters. It provides additional computational challenges in data mining and sequence analysis. Together these represent a significant overburden on traditional stand-alone computer resources, and to reach effective conclusions quickly and efficiently, the virtualization of the resources and computation on a pay-as-you-go concept (together termed "cloud computing") has recently appeared. The collective resources of the datacenter, including both hardware and software, can be available publicly, being then termed a public cloud, the resources being provided in a virtual mode to the clients who pay according to the resources they employ. Examples of public companies providing these resources include Amazon, Google, and Joyent. The computational workload is shifted to the provider, which also implements required hardware and software upgrades over time. A virtual environment is created in the cloud corresponding to the computational and data storage needs of the user via the internet. The task is then performed, the results transmitted to the user, and the environment finally deleted after all tasks are completed. In this discussion, we focus on the basics of cloud computing, and go on to analyze the prerequisites and overall working of clouds. Finally, the applications of cloud computing in biological systems, particularly in comparative genomics, genome informatics, and SNP detection are discussed with reference to traditional workflows.

  19. SEQUENCING AND SEQUENCE ANALYSIS OF MYOSTATIN GENE IN THE EXON 1 OF THE CAMEL (CAMELUS DROMEDARIUS

    Directory of Open Access Journals (Sweden)

    M. G. SHAH, A. S. QURESHI1, M. REISSMANN2 AND H. J. SCHWARTZ3

    2006-10-01

    Full Text Available Myostatin, also called growth differentiation factor-8 (GDF-8, is a member of the mammalian growth transforming family (TGF-beta superfamily, which is expressed specifically in developing an adult skeletal muscle. Muscular hypertrophy allele (mh allele in the double muscle breeds involved mutation within the myostatin gene. Genomic DNA was isolated from the camel hair using NucleoSpin Tissue kit. Two animals of each of the six breeds namely, Marecha, Dhatti, Larri, Kohi, Sakrai and Cambelpuri were used for sequencing. For PCR amplification of the gene, a primer pair was designed from homolog regions of already published sequences of farm animals from GenBank. Results showed that camel myostatin possessed more than 90% homology with that of cattle, sheep and pig. Camel formed separate cluster from the pig in spite of having high homology (98% and showed 94% homology with cattle and sheep as reported in literature. Sequence analysis of the PCR amplified part of exon 1 (256 bp of the camel myostatin was identical among six camel breeds.

  20. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  1. Cloning and expression of a human kidney cDNA for an α2-adrenergic receptor subtype

    International Nuclear Information System (INIS)

    Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

    1988-01-01

    An α 2 -adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet α 2 -adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet α 2 -adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the α 2 -adrenergic ligand [ 3 H]rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the α 2 B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet α 2 -adrenergic receptor (α 2 A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective α-adrenergic ligands

  2. Characterization of a pollen-specific cDNA clone from Nicotiana tabacum expressed during microgametogenesis and germination.

    Science.gov (United States)

    Weterings, K; Reijnen, W; van Aarssen, R; Kortstee, A; Spijkers, J; van Herpen, M; Schrauwen, J; Wullems, G

    1992-04-01

    This report describes the isolation and characterization of a cDNA clone representing a gene specifically expressed in pollen. A cDNA library was constructed against mRNA from mature pollen of Nicotiana tabacum. It was screened differentially against cDNA from mRNA of leaf and of pollen. One clone, NTPc303, was further characterized. On northern blot this clone hybridizes to a transcript 2100 nucleotides in length. NTPc303 is abundant in pollen. Expression of the corresponding gene is restricted to pollen, because no other generative or vegetative tissue contains transcripts hybridizing to NTPc303. Expression of NTP303 is evolutionarily conserved: homologous transcripts are present in pollen from various plant species. The first NTP303 transcripts are detectable on northern blot at the early bi-nucleate stage and accumulate until the pollen has reached maturity. During germination and pollen tube growth in vitro new NTP303 transcripts appear. This transcription has been proved by northern blots as well as by pulse labelling experiments. Nucleotide sequence analysis revealed that NTPc303 has an open reading frame coding for a predicted protein of 62 kDa. This protein shares homology to ascorbate oxidase and other members of the blue copper oxidase family. A possible function for this clone during pollen germination is discussed.

  3. An Imaging And Graphics Workstation For Image Sequence Analysis

    Science.gov (United States)

    Mostafavi, Hassan

    1990-01-01

    This paper describes an application-specific engineering workstation designed and developed to analyze imagery sequences from a variety of sources. The system combines the software and hardware environment of the modern graphic-oriented workstations with the digital image acquisition, processing and display techniques. The objective is to achieve automation and high throughput for many data reduction tasks involving metric studies of image sequences. The applications of such an automated data reduction tool include analysis of the trajectory and attitude of aircraft, missile, stores and other flying objects in various flight regimes including launch and separation as well as regular flight maneuvers. The workstation can also be used in an on-line or off-line mode to study three-dimensional motion of aircraft models in simulated flight conditions such as wind tunnels. The system's key features are: 1) Acquisition and storage of image sequences by digitizing real-time video or frames from a film strip; 2) computer-controlled movie loop playback, slow motion and freeze frame display combined with digital image sharpening, noise reduction, contrast enhancement and interactive image magnification; 3) multiple leading edge tracking in addition to object centroids at up to 60 fields per second from both live input video or a stored image sequence; 4) automatic and manual field-of-view and spatial calibration; 5) image sequence data base generation and management, including the measurement data products; 6) off-line analysis software for trajectory plotting and statistical analysis; 7) model-based estimation and tracking of object attitude angles; and 8) interface to a variety of video players and film transport sub-systems.

  4. Multilocus sequence analysis of Treponema denticola strains of diverse origin

    Directory of Open Access Journals (Sweden)

    Mo Sisu

    2013-02-01

    Full Text Available Abstract Background The oral spirochete bacterium Treponema denticola is associated with both the incidence and severity of periodontal disease. Although the biological or phenotypic properties of a significant number of T. denticola isolates have been reported in the literature, their genetic diversity or phylogeny has never been systematically investigated. Here, we describe a multilocus sequence analysis (MLSA of 20 of the most highly studied reference strains and clinical isolates of T. denticola; which were originally isolated from subgingival plaque samples taken from subjects from China, Japan, the Netherlands, Canada and the USA. Results The sequences of the 16S ribosomal RNA gene, and 7 conserved protein-encoding genes (flaA, recA, pyrH, ppnK, dnaN, era and radC were successfully determined for each strain. Sequence data was analyzed using a variety of bioinformatic and phylogenetic software tools. We found no evidence of positive selection or DNA recombination within the protein-encoding genes, where levels of intraspecific sequence polymorphism varied from 18.8% (flaA to 8.9% (dnaN. Phylogenetic analysis of the concatenated protein-encoding gene sequence data (ca. 6,513 nucleotides for each strain using Bayesian and maximum likelihood approaches indicated that the T. denticola strains were monophyletic, and formed 6 well-defined clades. All analyzed T. denticola strains appeared to have a genetic origin distinct from that of ‘Treponema vincentii’ or Treponema pallidum. No specific geographical relationships could be established; but several strains isolated from different continents appear to be closely related at the genetic level. Conclusions Our analyses indicate that previous biological and biophysical investigations have predominantly focused on a subset of T. denticola strains with a relatively narrow range of genetic diversity. Our methodology and results establish a genetic framework for the discrimination and phylogenetic

  5. Sirius PSB: a generic system for analysis of biological sequences.

    Science.gov (United States)

    Koh, Chuan Hock; Lin, Sharene; Jedd, Gregory; Wong, Limsoon

    2009-12-01

    Computational tools are essential components of modern biological research. For example, BLAST searches can be used to identify related proteins based on sequence homology, or when a new genome is sequenced, prediction models can be used to annotate functional sites such as transcription start sites, translation initiation sites and polyadenylation sites and to predict protein localization. Here we present Sirius Prediction Systems Builder (PSB), a new computational tool for sequence analysis, classification and searching. Sirius PSB has four main operations: (1) Building a classifier, (2) Deploying a classifier, (3) Search for proteins similar to query proteins, (4) Preliminary and post-prediction analysis. Sirius PSB supports all these operations via a simple and interactive graphical user interface. Besides being a convenient tool, Sirius PSB has also introduced two novelties in sequence analysis. Firstly, genetic algorithm is used to identify interesting features in the feature space. Secondly, instead of the conventional method of searching for similar proteins via sequence similarity, we introduced searching via features' similarity. To demonstrate the capabilities of Sirius PSB, we have built two prediction models - one for the recognition of Arabidopsis polyadenylation sites and another for the subcellular localization of proteins. Both systems are competitive against current state-of-the-art models based on evaluation of public datasets. More notably, the time and effort required to build each model is greatly reduced with the assistance of Sirius PSB. Furthermore, we show that under certain conditions when BLAST is unable to find related proteins, Sirius PSB can identify functionally related proteins based on their biophysical similarities. Sirius PSB and its related supplements are available at: http://compbio.ddns.comp.nus.edu.sg/~sirius.

  6. Transcriptome analysis of the model protozoan, Tetrahymena thermophila, using Deep RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Jie Xiong

    Full Text Available BACKGROUND: The ciliated protozoan Tetrahymena thermophila is a well-studied single-celled eukaryote model organism for cellular and molecular biology. However, the lack of extensive T. thermophila cDNA libraries or a large expressed sequence tag (EST database limited the quality of the original genome annotation. METHODOLOGY/PRINCIPAL FINDINGS: This RNA-seq study describes the first deep sequencing analysis of the T. thermophila transcriptome during the three major stages of the life cycle: growth, starvation and conjugation. Uniquely mapped reads covered more than 96% of the 24,725 predicted gene models in the somatic genome. More than 1,000 new transcribed regions were identified. The great dynamic range of RNA-seq allowed detection of a nearly six order-of-magnitude range of measurable gene expression orchestrated by this cell. RNA-seq also allowed the first prediction of transcript untranslated regions (UTRs and an updated (larger size estimate of the T. thermophila transcriptome: 57 Mb, or about 55% of the somatic genome. Our study identified nearly 1,500 alternative splicing (AS events distributed over 5.2% of T. thermophila genes. This percentage represents a two order-of-magnitude increase over previous EST-based estimates in Tetrahymena. Evidence of stage-specific regulation of alternative splicing was also obtained. Finally, our study allowed us to completely confirm about 26.8% of the genes originally predicted by the gene finder, to correct coding sequence boundaries and intron-exon junctions for about a third, and to reassign microarray probes and correct earlier microarray data. CONCLUSIONS/SIGNIFICANCE: RNA-seq data significantly improve the genome annotation and provide a fully comprehensive view of the global transcriptome of T. thermophila. To our knowledge, 5.2% of T. thermophila genes with AS is the highest percentage of genes showing AS reported in a unicellular eukaryote. Tetrahymena thus becomes an excellent unicellular

  7. Identification of candidates for cyclotide biosynthesis and cyclisation by expressed sequence tag analysis of Oldenlandia affinis

    Directory of Open Access Journals (Sweden)

    Suda Jan

    2010-02-01

    Full Text Available Abstract Background Cyclotides are a family of circular peptides that exhibit a range of biological activities, including anti-bacterial, cytotoxic, anti-HIV activities, and are proposed to function in plant defence. Their high stability has motivated their development as scaffolds for the stabilisation of peptide drugs. Oldenlandia affinis is a member of the Rubiaceae (coffee family from which 18 cyclotides have been sequenced to date, but the details of their processing from precursor proteins have only begun to be elucidated. To increase the speed at which genes involved in cyclotide biosynthesis and processing are being discovered, an expressed sequence tag (EST project was initiated to survey the transcript profile of O. affinis and to propose some future directions of research on in vivo protein cyclisation. Results Using flow cytometry the holoploid genome size (1C-value of O. affinis was estimated to be 4,210 - 4,284 Mbp, one of the largest genomes of the Rubiaceae family. High-quality ESTs were identified, 1,117 in total, from leaf cDNAs and assembled into 502 contigs, comprising 202 consensus sequences and 300 singletons. ESTs encoding the cyclotide precursors for kalata B1 (Oak1 and kalata B2 (Oak4 were among the 20 most abundant ESTs. In total, 31 ESTs encoded cyclotide precursors, representing a distinct commitment of 2.8% of the O. affinis transcriptome to cyclotide biosynthesis. The high expression levels of cyclotide precursor transcripts are consistent with the abundance of mature cyclic peptides in O. affinis. A new cyclotide precursor named Oak5 was isolated and represents the first cDNA for the bracelet class of cyclotides in O. affinis. Clones encoding enzymes potentially involved in processing cyclotides were also identified and include enzymes involved in oxidative folding and proteolytic processing. Conclusion The EST library generated in this study provides a valuable resource for the study of the cyclisation of plant

  8. Construction and characterization of the alpha form of a cardiac myosin heavy chain cDNA clone and its developmental expression in the Syrian hamster.

    OpenAIRE

    Liew, C C; Jandreski, M A

    1986-01-01

    A cDNA clone, pVHC1, was isolated from a Syrian hamster heart cDNA library and was compared to the rat alpha (pCMHC21) and beta (pCMHC5) ventricular myosin heavy chain cDNA clones. The DNA sequence and amino acid sequence deducted from the DNA show more homology with pCMHC21 than pCMHC5. This indicates that pVHC1 is an alpha ventricular myosin heavy chain cDNA clone. However, even though pVHC1 shows a high degree of nucleotide and amino acid conservation with the rat myosin heavy chain sequen...

  9. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

    Science.gov (United States)

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-12-01

    A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

  10. Molecular characterization of Giardia psittaci by multilocus sequence analysis.

    Science.gov (United States)

    Abe, Niichiro; Makino, Ikuko; Kojima, Atsushi

    2012-12-01

    Multilocus sequence analyses targeting small subunit ribosomal DNA (SSU rDNA), elongation factor 1 alpha (ef1α), glutamate dehydrogenase (gdh), and beta giardin (β-giardin) were performed on Giardia psittaci isolates from three Budgerigars (Melopsittacus undulates) and four Barred parakeets (Bolborhynchus lineola) kept in individual households or imported from overseas. Nucleotide differences and phylogenetic analyses at four loci indicate the distinction of G. psittaci from the other known Giardia species: Giardia muris, Giardia microti, Giardia ardeae, and Giardia duodenalis assemblages. Furthermore, G. psittaci was related more closely to G. duodenalis than to the other known Giardia species, except for G. microti. Conflicting signals regarded as "double peaks" were found at the same nucleotide positions of the ef1α in all isolates. However, the sequences of the other three loci, including gdh and β-giardin, which are known to be highly variable, from all isolates were also mutually identical at every locus. They showed no double peaks. These results suggest that double peaks found in the ef1α sequences are caused not by mixed infection with genetically different G. psittaci isolates but by allelic sequence heterogeneity (ASH), which is observed in diplomonad lineages including G. duodenalis. No sequence difference was found in any G. psittaci isolates at the gdh and β-giardin, suggesting that G. psittaci is indeed not more diverse genetically than other Giardia species. This report is the first to provide evidence related to the genetic characteristics of G. psittaci obtained using multilocus sequence analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. CISAPS: Complex Informational Spectrum for the Analysis of Protein Sequences

    Directory of Open Access Journals (Sweden)

    Charalambos Chrysostomou

    2015-01-01

    Full Text Available Complex informational spectrum analysis for protein sequences (CISAPS and its web-based server are developed and presented. As recent studies show, only the use of the absolute spectrum in the analysis of protein sequences using the informational spectrum analysis is proven to be insufficient. Therefore, CISAPS is developed to consider and provide results in three forms including absolute, real, and imaginary spectrum. Biologically related features to the analysis of influenza A subtypes as presented as a case study in this study can also appear individually either in the real or imaginary spectrum. As the results presented, protein classes can present similarities or differences according to the features extracted from CISAPS web server. These associations are probable to be related with the protein feature that the specific amino acid index represents. In addition, various technical issues such as zero-padding and windowing that may affect the analysis are also addressed. CISAPS uses an expanded list of 611 unique amino acid indices where each one represents a different property to perform the analysis. This web-based server enables researchers with little knowledge of signal processing methods to apply and include complex informational spectrum analysis to their work.

  12. Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

    Science.gov (United States)

    Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

    1996-02-01

    There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

  13. Flavonoid Biosynthesis Genes Putatively Identified in the Aromatic Plant Polygonum minus via Expressed Sequences Tag (EST Analysis

    Directory of Open Access Journals (Sweden)

    Zamri Zainal

    2012-02-01

    Full Text Available P. minus is an aromatic plant, the leaf of which is widely used as a food additive and in the perfume industry. The leaf also accumulates secondary metabolites that act as active ingredients such as flavonoid. Due to limited genomic and transcriptomic data, the biosynthetic pathway of flavonoids is currently unclear. Identification of candidate genes involved in the flavonoid biosynthetic pathway will significantly contribute to understanding the biosynthesis of active compounds. We have constructed a standard cDNA library from P. minus leaves, and two normalized full-length enriched cDNA libraries were constructed from stem and root organs in order to create a gene resource for the biosynthesis of secondary metabolites, especially flavonoid biosynthesis. Thus, large‑scale sequencing of P. minus cDNA libraries identified 4196 expressed sequences tags (ESTs which were deposited in dbEST in the National Center of Biotechnology Information (NCBI. From the three constructed cDNA libraries, 11 ESTs encoding seven genes were mapped to the flavonoid biosynthetic pathway. Finally, three flavonoid biosynthetic pathway-related ESTs chalcone synthase, CHS (JG745304, flavonol synthase, FLS (JG705819 and leucoanthocyanidin dioxygenase, LDOX (JG745247 were selected for further examination by quantitative RT-PCR (qRT-PCR in different P. minus organs. Expression was detected in leaf, stem and root. Gene expression studies have been initiated in order to better understand the underlying physiological processes.

  14. Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Knudsen, Steen

    2002-01-01

    PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end.......PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....

  15. Isolation and expression of a pea vicilin cDNA in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Watson, M D; Lambert, N; Delauney, A; Yarwood, J N; Croy, R R; Gatehouse, J A; Wright, D J; Boulter, D

    1988-01-01

    A cDNA clone containing the complete coding sequence for vicilin from pea (Pisum sativum L.) was isolated. It specifies a 50,000-Mr protein that in pea is neither post-translationally processed nor glycosylated. The cDNA clone was expressed in yeast from a 2 micron plasmid by using the yeast phosphoglycerate kinase promoter and initiator codon. The resultant fusion protein, which contains the first 16 amino acid residues of phosphoglycerate kinase in addition to the vicilin sequence, was puri...

  16. CAFE: aCcelerated Alignment-FrEe sequence analysis.

    Science.gov (United States)

    Lu, Yang Young; Tang, Kujin; Ren, Jie; Fuhrman, Jed A; Waterman, Michael S; Sun, Fengzhu

    2017-07-03

    Alignment-free genome and metagenome comparisons are increasingly important with the development of next generation sequencing (NGS) technologies. Recently developed state-of-the-art k-mer based alignment-free dissimilarity measures including CVTree, $d_2^*$ and $d_2^S$ are more computationally expensive than measures based solely on the k-mer frequencies. Here, we report a standalone software, aCcelerated Alignment-FrEe sequence analysis (CAFE), for efficient calculation of 28 alignment-free dissimilarity measures. CAFE allows for both assembled genome sequences and unassembled NGS shotgun reads as input, and wraps the output in a standard PHYLIP format. In downstream analyses, CAFE can also be used to visualize the pairwise dissimilarity measures, including dendrograms, heatmap, principal coordinate analysis and network display. CAFE serves as a general k-mer based alignment-free analysis platform for studying the relationships among genomes and metagenomes, and is freely available at https://github.com/younglululu/CAFE. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Construction and sequencing analysis of scFv antibody fragment derived from monoclonal antibody against norfloxacin (Nor155

    Directory of Open Access Journals (Sweden)

    J. Mala

    2017-06-01

    Full Text Available Norfloxacin belongs to the group of fluoroquinolone antibiotics which has been approved for treatment in animals. However, its residues in animal products can pose adverse side effects to consumer. Therefore, detection of the residue in different food matrices must be concerned. In this study, a single chain variable fragment (scFv that recognizes norfloxacin antibiotic was constructed. The cDNA was synthesized from total RNA of hybridoma cells against norfloxacin. Genes encoding VH and VL regions of monoclonal antibody against norfloxacin (Nor155 were amplified and size of VH and VL fragments was 402 bp and 363 bp, respectively. The scFv of Nor155 was constructed by an addition of (Gly4Ser3 as a linker between VH and VL regions and subcloned into pPICZαA, an expression vector of Pichia pastoris. The sequence of scFv Nor155 (GenBank No. AJG06891.1 was confirmed by sequencing analysis. The complementarity determining regions (CDR I, II, and III of VH and VL were specified by Kabat method. The obtained recombinant plasmid will be useful for production of scFv antibody against norfloxacin in P. pastoris and further engineer scFv antibody against fluoroquinolone antibiotics.

  18. Human α2-HS-glycoprotein: the A and B chains with a connecting sequence are encoded by a single mRNA transcript

    International Nuclear Information System (INIS)

    Lee, C.C.; Bowman, B.H.; Yang, F.

    1987-01-01

    The α 2 -HS-glycoprotein (AHSG) is a plasma protein reported to play roles in bone mineralization and in the immune response. It is composed of two subunits, the A and B chains. Recombinant plasmids containing human cDNA AHSG have been isolated by screening an adult human liver library with a mixed oligonucleotide probe. The cDNA clones containing AHSG inserts span approximately 1.5 kilobase pairs and include the entire AHSG coding sequence, demonstrating that the A and B chains are encoded by a single mRNA transcript. The cDNA sequence predicts an 18-amino-acid signal peptide, followed by the A-chain sequence of AHSG. A heretofore unseen connecting sequence of 40 amino acids was deduced between the A- and B-chain sequences. The connecting sequence demonstrates the unique amino acid doublets and collagen triplets found in the A and B chains; it is not homologous with other reported amino acid sequences. The connecting sequence may be cleaved in a posttranslational step by limited proteolysis before mature AHSG is released into the circulation or may vary in its presence because of alternative processing. The AHSG cDNA was utilized for mapping the AHSG gene to the 3q21→qter region of human chromosome 3. The availability of the AHSG cDNA clone will facilitate the analysis of its genetic control and gene expression during development and bone formation

  19. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    Directory of Open Access Journals (Sweden)

    Garg Neha

    2012-10-01

    Full Text Available Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac. Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was

  20. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

    Science.gov (United States)

    Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

    2012-10-23

    Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200

  1. Environmental impact analysis for the main accidental sequences of ignitor

    International Nuclear Information System (INIS)

    Carpignano, A.; Francabandiera, S.; Vella, R.; Zucchetti, M.

    1996-01-01

    A safety analysis study has been applied to the Ignitor machine using Probabilistic Safety Assessment. The main initiating events have been identified, and accident sequences have been studied by means of traditional methods such as Failure Mode and Effect Analysis (FMEA), Fault Trees (FT) and Event Trees (ET). The consequences of the radioactive environmental releases have been assessed in terms of Effective Dose Equivalent (EDEs) to the Most Exposed Individuals (MEI) of the chosen site, by means of a population dose code. Results point out the low enviromental impact of the machine. 13 refs., 1 fig., 3 tabs

  2. ISOLATION OF A CYTOCHROME P450 3A CDNA SEQUENCE (CYP3A30) FROM THE MARINE TELEOST AND PHYLOGENETIC ANALYSIS OF CYP3A GENES. (R827102)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  3. RiceFOX: a database of Arabidopsis mutant lines overexpressing rice full-length cDNA that contains a wide range of trait information to facilitate analysis of gene function.

    Science.gov (United States)

    Sakurai, Tetsuya; Kondou, Youichi; Akiyama, Kenji; Kurotani, Atsushi; Higuchi, Mieko; Ichikawa, Takanari; Kuroda, Hirofumi; Kusano, Miyako; Mori, Masaki; Saitou, Tsutomu; Sakakibara, Hitoshi; Sugano, Shoji; Suzuki, Makoto; Takahashi, Hideki; Takahashi, Shinya; Takatsuji, Hiroshi; Yokotani, Naoki; Yoshizumi, Takeshi; Saito, Kazuki; Shinozaki, Kazuo; Oda, Kenji; Hirochika, Hirohiko; Matsui, Minami

    2011-02-01

    Identification of gene function is important not only for basic research but also for applied science, especially with regard to improvements in crop production. For rapid and efficient elucidation of useful traits, we developed a system named FOX hunting (Full-length cDNA Over-eXpressor gene hunting) using full-length cDNAs (fl-cDNAs). A heterologous expression approach provides a solution for the high-throughput characterization of gene functions in agricultural plant species. Since fl-cDNAs contain all the information of functional mRNAs and proteins, we introduced rice fl-cDNAs into Arabidopsis plants for systematic gain-of-function mutation. We generated >30,000 independent Arabidopsis transgenic lines expressing rice fl-cDNAs (rice FOX Arabidopsis mutant lines). These rice FOX Arabidopsis lines were screened systematically for various criteria such as morphology, photosynthesis, UV resistance, element composition, plant hormone profile, metabolite profile/fingerprinting, bacterial resistance, and heat and salt tolerance. The information obtained from these screenings was compiled into a database named 'RiceFOX'. This database contains around 18,000 records of rice FOX Arabidopsis lines and allows users to search against all the observed results, ranging from morphological to invisible traits. The number of searchable items is approximately 100; moreover, the rice FOX Arabidopsis lines can be searched by rice and Arabidopsis gene/protein identifiers, sequence similarity to the introduced rice fl-cDNA and traits. The RiceFOX database is available at http://ricefox.psc.riken.jp/.

  4. Analysis of sequence diversity through internal transcribed spacers and simple sequence repeats to identify Dendrobium species.

    Science.gov (United States)

    Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y

    2014-04-08

    The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.

  5. Using Behavior Sequence Analysis to Map Serial Killers' Life Histories.

    Science.gov (United States)

    Keatley, David A; Golightly, Hayley; Shephard, Rebecca; Yaksic, Enzo; Reid, Sasha

    2018-03-01

    The aim of the current research was to provide a novel method for mapping the developmental sequences of serial killers' life histories. An in-depth biographical account of serial killers' lives, from birth through to conviction, was gained and analyzed using Behavior Sequence Analysis. The analyses highlight similarities in behavioral events across the serial killers' lives, indicating not only which risk factors occur, but the temporal order of these factors. Results focused on early childhood environment, indicating the role of parental abuse; behaviors and events surrounding criminal histories of serial killers, showing that many had previous convictions and were known to police for other crimes; behaviors surrounding their murders, highlighting differences in victim choice and modus operandi; and, finally, trial pleas and convictions. The present research, therefore, provides a novel approach to synthesizing large volumes of data on criminals and presenting results in accessible, understandable outcomes.

  6. Swab-to-Sequence: Real-time Data Analysis Platform for the Biomolecule Sequencer

    Data.gov (United States)

    National Aeronautics and Space Administration — DNA was successfully sequenced on the ISS in 2016, but the DNA sequenced was prepared on the ground. With FY’16 IRAD funds, the same team developed a...

  7. LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

    Science.gov (United States)

    Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

    2017-09-15

    Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

  8. Identification of stress-induced genes from the drought-tolerant plant Prosopis juliflora (Swartz) DC. through analysis of expressed sequence tags.

    Science.gov (United States)

    George, Suja; Venkataraman, Gayatri; Parida, Ajay

    2007-05-01

    Abiotic stresses such as cold, salinity, drought, wounding, and heavy metal contamination adversely affect crop productivity throughout the world. Prosopis juliflora is a phreatophyte that can tolerate severe adverse environmental conditions such as drought, salinity, and heavy metal contamination. As a first step towards the characterization of genes that contribute to combating abiotic stress, construction and analysis of a cDNA library of P. juliflora genes is reported here. Random expressed sequence tag (EST) sequencing of 1750 clones produced 1467 high-quality reads. These clones were classified into functional categories, and BLAST comparisons revealed that 114 clones were homologous to genes implicated in stress response(s) and included heat shock proteins, metallothioneins, lipid transfer proteins, and late embryogenesis abundant proteins. Of the ESTs analyzed, 26% showed homology to previously uncharacterized genes in the databases. Fifty-two clones from this category were selected for reverse Northern analysis: 21 were shown to be upregulated and 16 downregulated. The results obtained by reverse Northern analysis were confirmed by Northern analysis. Clustering of the 1467 ESTs produced a total of 295 contigs encompassing 790 ESTs, resulting in a 54.2% redundancy. Two of the abundant genes coding for a nonspecific lipid transfer protein and late embryogenesis abundant protein were sequenced completely. Northern analysis (after polyethylene glycol stress) of the 2 genes was carried out. The implications of the analyzed genes in abiotic stress tolerance are also discussed.

  9. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-07-19

    Jul 19, 2010 ... and antisense primers, a single band of 573 base pairs .... Amino acid sequence alignment of Cluster I and Cluster II of phylogenetic tree. First ten sequences ... sequence weighting, postion-spiecific gap penalties and weight.

  10. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  11. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  12. Linear discriminant analysis of character sequences using occurrences of words

    KAUST Repository

    Dutta, Subhajit; Chaudhuri, Probal; Ghosh, Anil

    2014-01-01

    Classification of character sequences, where the characters come from a finite set, arises in disciplines such as molecular biology and computer science. For discriminant analysis of such character sequences, the Bayes classifier based on Markov models turns out to have class boundaries defined by linear functions of occurrences of words in the sequences. It is shown that for such classifiers based on Markov models with unknown orders, if the orders are estimated from the data using cross-validation, the resulting classifier has Bayes risk consistency under suitable conditions. Even when Markov models are not valid for the data, we develop methods for constructing classifiers based on linear functions of occurrences of words, where the word length is chosen by cross-validation. Such linear classifiers are constructed using ideas of support vector machines, regression depth, and distance weighted discrimination. We show that classifiers with linear class boundaries have certain optimal properties in terms of their asymptotic misclassification probabilities. The performance of these classifiers is demonstrated in various simulated and benchmark data sets.

  13. Planarian homeobox genes: cloning, sequence analysis, and expression.

    Science.gov (United States)

    Garcia-Fernàndez, J; Baguñà, J; Saló, E

    1991-01-01

    Freshwater planarians (Platyhelminthes, Turbellaria, and Tricladida) are acoelomate, triploblastic, unsegmented, and bilaterally symmetrical organisms that are mainly known for their ample power to regenerate a complete organism from a small piece of their body. To identify potential pattern-control genes in planarian regeneration, we have isolated two homeobox-containing genes, Dth-1 and Dth-2 [Dugesia (Girardia) tigrina homeobox], by using degenerate oligonucleotides corresponding to the most conserved amino acid sequence from helix-3 of the homeodomain. Dth-1 and Dth-2 homeodomains are closely related (68% at the nucleotide level and 78% at the protein level) and show the conserved residues characteristic of the homeodomains identified to data. Similarity with most homeobox sequences is low (30-50%), except with Drosophila NK homeodomains (80-82% with NK-2) and the rodent TTF-1 homeodomain (77-87%). Some unusual amino acid residues specific to NK-2, TTF-1, Dth-1, and Dth-2 can be observed in the recognition helix (helix-3) and may define a family of homeodomains. The deduced amino acid sequences from the cDNAs contain, in addition to the homeodomain, other domains also present in various homeobox-containing genes. The expression of both genes, detected by Northern blot analysis, appear slightly higher in cephalic regions than in the rest of the intact organism, while a slight increase is detected in the central period (5 days) or regeneration. Images PMID:1714599

  14. Analysis of correlations between sites in models of protein sequences

    International Nuclear Information System (INIS)

    Giraud, B.G.; Lapedes, A.; Liu, L.C.

    1998-01-01

    A criterion based on conditional probabilities, related to the concept of algorithmic distance, is used to detect correlated mutations at noncontiguous sites on sequences. We apply this criterion to the problem of analyzing correlations between sites in protein sequences; however, the analysis applies generally to networks of interacting sites with discrete states at each site. Elementary models, where explicit results can be derived easily, are introduced. The number of states per site considered ranges from 2, illustrating the relation to familiar classical spin systems, to 20 states, suitable for representing amino acids. Numerical simulations show that the criterion remains valid even when the genetic history of the data samples (e.g., protein sequences), as represented by a phylogenetic tree, introduces nonindependence between samples. Statistical fluctuations due to finite sampling are also investigated and do not invalidate the criterion. A subsidiary result is found: The more homogeneous a population, the more easily its average properties can drift from the properties of its ancestor. copyright 1998 The American Physical Society

  15. Linear discriminant analysis of character sequences using occurrences of words

    KAUST Repository

    Dutta, Subhajit

    2014-02-01

    Classification of character sequences, where the characters come from a finite set, arises in disciplines such as molecular biology and computer science. For discriminant analysis of such character sequences, the Bayes classifier based on Markov models turns out to have class boundaries defined by linear functions of occurrences of words in the sequences. It is shown that for such classifiers based on Markov models with unknown orders, if the orders are estimated from the data using cross-validation, the resulting classifier has Bayes risk consistency under suitable conditions. Even when Markov models are not valid for the data, we develop methods for constructing classifiers based on linear functions of occurrences of words, where the word length is chosen by cross-validation. Such linear classifiers are constructed using ideas of support vector machines, regression depth, and distance weighted discrimination. We show that classifiers with linear class boundaries have certain optimal properties in terms of their asymptotic misclassification probabilities. The performance of these classifiers is demonstrated in various simulated and benchmark data sets.

  16. Sequence analysis of PROTEOLYSIS 6 from Solanum lycopersicum

    Science.gov (United States)

    Roslan, Nur Farhana; Chew, Bee Lyn; Goh, Hoe-Han; Isa, Nurulhikma Md

    2018-04-01

    The N-end rule pathway is a protein degradation pathway that relates the protein half-life with the identity of its N-terminal residues. A destabilizing N-terminal residues is created by enzymatic reaction or chemical modifications. This destabilized substrate will be recognized by PROTEOLYSIS 6 (PRT6) protein, which encodes an E3 ligase enzyme and resulted in substrate degradation by proteasome. PRT6 has been studied in Arabidopsis thaliana and barley but not yet been studied in fleshy fruit plants. Hence, this study was carried out in tomato that is known as the model for fleshy fruit plants. BLASTX analysis identified that Solyc09g010830 which encodes for a PRT6 gene in tomato based on its sequence similarity with PRT6 in A. thaliana. In silico gene expression analysis shows that PRT6 gene was highly expressed in tomato fruits breaker +5. Co-expression analysis shows that PRT6 may not only involved in abiotic stresses but also in biotic stresses. The objective is to analyze the sequence and characterize PRT6 gene in tomato.

  17. Transcriptome sequencing and metabolite analysis reveals the role of delphinidin metabolism in flower colour in grape hyacinth

    OpenAIRE

    Lou, Qian; Liu, Yali; Qi, Yinyan; Jiao, Shuzhen; Tian, Feifei; Jiang, Ling; Wang, Yuejin

    2014-01-01

    Grape hyacinth (Muscari) is an important ornamental bulbous plant with an extraordinary blue colour. Muscari armeniacum, whose flowers can be naturally white, provides an opportunity to unravel the complex metabolic networks underlying certain biochemical traits, especially colour. A blue flower cDNA library of M. armeniacum and a white flower library of M. armeniacum f. album were used for transcriptome sequencing. A total of 89 926 uni-transcripts were isolated, 143 of which could be identi...

  18. Determining physical constraints in transcriptional initiationcomplexes using DNA sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Shultzaberger, Ryan K.; Chiang, Derek Y.; Moses, Alan M.; Eisen,Michael B.

    2007-07-01

    Eukaryotic gene expression is often under the control ofcooperatively acting transcription factors whose binding is limited bystructural constraints. By determining these structural constraints, wecan understand the "rules" that define functional cooperativity.Conversely, by understanding the rules of binding, we can inferstructural characteristics. We have developed an information theory basedmethod for approximating the physical limitations of cooperativeinteractions by comparing sequence analysis to microarray expressiondata. When applied to the coordinated binding of the sulfur amino acidregulatory protein Met4 by Cbf1 and Met31, we were able to create acombinatorial model that can correctly identify Met4 regulatedgenes.

  19. Isolation of cDNA clones coding for human tissue factor: primary structure of the protein and cDNA

    International Nuclear Information System (INIS)

    Spicer, E.K.; Horton, R.; Bloem, L.

    1987-01-01

    Tissue factor is a membrane-bound procoagulant protein that activates the extrinsic pathway of blood coagulation in the presence of factor VII and calcium. λ Phage containing the tissue factor gene were isolated from a human placental cDNA library. The amino acid sequence deduced from the nucleotide sequence of the cDNAs indicates that tissue factor is synthesized as a higher molecular weight precursor with a leader sequence of 32 amino acids, while the mature protein is a single polypeptide chain composed of 263 residues. The derived primary structure of tissue factor has been confirmed by comparison to protein and peptide sequence data. The sequence of the mature protein suggests that there are three distinct domains: extracellular, residues 1-219; hydrophobic, residues 220-242; and cytoplasmic, residues 243-263. Three potential N-linked carbohydrate attachment sites occur in the extracellular domain. The amino acid sequence of tissue factor shows no significant homology with the vitamin K-dependent serine proteases, coagulation cofactors, or any other protein in the National Biomedical Research Foundation sequence data bank (Washington, DC)

  20. Molecular cloning of cDNA for the human tumor-associated antigen CO-029 and identification of related transmembrane antigens

    International Nuclear Information System (INIS)

    Szala, S.; Kasai, Yasushi; Steplewski, Z.; Rodeck, U.; Koprowski, H.; Linnenbach, A.J.

    1990-01-01

    The human tumor-associated antigen CO-029 is a monoclonal antibody-defined cell surface glycoprotein of 27-34 kDa. By using the high-efficiency COS cell expression system, a full-length cDNA clone for CO-029 was isolated. When transiently expressed in COS cells, the cDNA clone directed the synthesis of an antigen reactive to monoclonal antibody CO-029 in mixed hemadsorption and immunoblot assays. Sequence analysis revealed that CO-029 belongs to a family of cell surface antigens that includes the melanoma-associated antigen ME491, the leukocyte cell surface antigen CD37, and the Sm23 antigen of the parasitic helminth Schistosoma mansoni. CO-029 and ME491 antigen expression and the effect of their corresponding monoclonal antibodies on cell growth were compared in human tumor cell lines of various histologic origins

  1. Comparative analysis of transcriptomes in aerial stems and roots of Ephedra sinica based on high-throughput mRNA sequencing

    Directory of Open Access Journals (Sweden)

    Taketo Okada

    2016-12-01

    Full Text Available Ephedra plants are taxonomically classified as gymnosperms, and are medicinally important as the botanical origin of crude drugs and as bioresources that contain pharmacologically active chemicals. Here we show a comparative analysis of the transcriptomes of aerial stems and roots of Ephedra sinica based on high-throughput mRNA sequencing by RNA-Seq. De novo assembly of short cDNA sequence reads generated 23,358, 13,373, and 28,579 contigs longer than 200 bases from aerial stems, roots, or both aerial stems and roots, respectively. The presumed functions encoded by these contig sequences were annotated by BLAST (blastx. Subsequently, these contigs were classified based on gene ontology slims, Enzyme Commission numbers, and the InterPro database. Furthermore, comparative gene expression analysis was performed between aerial stems and roots. These transcriptome analyses revealed differences and similarities between the transcriptomes of aerial stems and roots in E. sinica. Deep transcriptome sequencing of Ephedra should open the door to molecular biological studies based on the entire transcriptome, tissue- or organ-specific transcriptomes, or targeted genes of interest.

  2. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...

  3. Single-Cell RNA Sequencing of Glioblastoma Cells.

    Science.gov (United States)

    Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

    2018-01-01

    Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

  4. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  5. Streaming support for data intensive cloud-based sequence analysis.

    Science.gov (United States)

    Issa, Shadi A; Kienzler, Romeo; El-Kalioby, Mohamed; Tonellato, Peter J; Wall, Dennis; Bruggmann, Rémy; Abouelhoda, Mohamed

    2013-01-01

    Cloud computing provides a promising solution to the genomics data deluge problem resulting from the advent of next-generation sequencing (NGS) technology. Based on the concepts of "resources-on-demand" and "pay-as-you-go", scientists with no or limited infrastructure can have access to scalable and cost-effective computational resources. However, the large size of NGS data causes a significant data transfer latency from the client's site to the cloud, which presents a bottleneck for using cloud computing services. In this paper, we provide a streaming-based scheme to overcome this problem, where the NGS data is processed while being transferred to the cloud. Our scheme targets the wide class of NGS data analysis tasks, where the NGS sequences can be processed independently from one another. We also provide the elastream package that supports the use of this scheme with individual analysis programs or with workflow systems. Experiments presented in this paper show that our solution mitigates the effect of data transfer latency and saves both time and cost of computation.

  6. Streaming Support for Data Intensive Cloud-Based Sequence Analysis

    Directory of Open Access Journals (Sweden)

    Shadi A. Issa

    2013-01-01

    Full Text Available Cloud computing provides a promising solution to the genomics data deluge problem resulting from the advent of next-generation sequencing (NGS technology. Based on the concepts of “resources-on-demand” and “pay-as-you-go”, scientists with no or limited infrastructure can have access to scalable and cost-effective computational resources. However, the large size of NGS data causes a significant data transfer latency from the client’s site to the cloud, which presents a bottleneck for using cloud computing services. In this paper, we provide a streaming-based scheme to overcome this problem, where the NGS data is processed while being transferred to the cloud. Our scheme targets the wide class of NGS data analysis tasks, where the NGS sequences can be processed independently from one another. We also provide the elastream package that supports the use of this scheme with individual analysis programs or with workflow systems. Experiments presented in this paper show that our solution mitigates the effect of data transfer latency and saves both time and cost of computation.

  7. Next-generation sequence analysis of cancer xenograft models.

    Directory of Open Access Journals (Sweden)

    Fernando J Rossello

    Full Text Available Next-generation sequencing (NGS studies in cancer are limited by the amount, quality and purity of tissue samples. In this situation, primary xenografts have proven useful preclinical models. However, the presence of mouse-derived stromal cells represents a technical challenge to their use in NGS studies. We examined this problem in an established primary xenograft model of small cell lung cancer (SCLC, a malignancy often diagnosed from small biopsy or needle aspirate samples. Using an in silico strategy that assign reads according to species-of-origin, we prospectively compared NGS data from primary xenograft models with matched cell lines and with published datasets. We show here that low-coverage whole-genome analysis demonstrated remarkable concordance between published genome data and internal controls, despite the presence of mouse genomic DNA. Exome capture sequencing revealed that this enrichment procedure was highly species-specific, with less than 4% of reads aligning to the mouse genome. Human-specific expression profiling with RNA-Seq replicated array-based gene expression experiments, whereas mouse-specific transcript profiles correlated with published datasets from human cancer stroma. We conclude that primary xenografts represent a useful platform for complex NGS analysis in cancer research for tumours with limited sample resources, or those with prominent stromal cell populations.

  8. Streaming Support for Data Intensive Cloud-Based Sequence Analysis

    Science.gov (United States)

    Issa, Shadi A.; Kienzler, Romeo; El-Kalioby, Mohamed; Tonellato, Peter J.; Wall, Dennis; Bruggmann, Rémy; Abouelhoda, Mohamed

    2013-01-01

    Cloud computing provides a promising solution to the genomics data deluge problem resulting from the advent of next-generation sequencing (NGS) technology. Based on the concepts of “resources-on-demand” and “pay-as-you-go”, scientists with no or limited infrastructure can have access to scalable and cost-effective computational resources. However, the large size of NGS data causes a significant data transfer latency from the client's site to the cloud, which presents a bottleneck for using cloud computing services. In this paper, we provide a streaming-based scheme to overcome this problem, where the NGS data is processed while being transferred to the cloud. Our scheme targets the wide class of NGS data analysis tasks, where the NGS sequences can be processed independently from one another. We also provide the elastream package that supports the use of this scheme with individual analysis programs or with workflow systems. Experiments presented in this paper show that our solution mitigates the effect of data transfer latency and saves both time and cost of computation. PMID:23710461

  9. SSH analysis of endosperm transcripts and characterization of heat stress regulated expressed sequence tags in bread wheat

    Directory of Open Access Journals (Sweden)

    Suneha Goswami

    2016-08-01

    Full Text Available Heat stress is one of the major problems in agriculturally important cereal crops, especially wheat. Here, we have constructed a subtracted cDNA library from the endosperm of HS-treated (42°C for 2 h wheat cv. HD2985 by suppression subtractive hybridization (SSH. We identified ~550 recombinant clones ranging from 200 to 500 bp with an average size of 300 bp. Sanger’s sequencing was performed with 205 positive clones to generate the differentially expressed sequence tags (ESTs. Most of the ESTs were observed to be localized on the long arm of chromosome 2A and associated with heat stress tolerance and metabolic pathways. Identified ESTs were BLAST search using Ensemble, TriFLD and TIGR databases and the predicted CDS were translated and aligned with the protein sequences available in pfam and InterProScan 5 databases to predict the differentially expressed proteins (DEPs. We observed eight different types of post-translational modifications (PTMs in the DEPs corresponds to the cloned ESTs—147 sites with phosphorylation, 21 sites with sumoylation, 237 with palmitoylation, 96 sites with S-nitrosylation, 3066 calpain cleavage sites, and 103 tyrosine nitration sites, predicted to sense the heat stress and regulate the expression of stress genes. Twelve DEPs were observed to have transmembrane helixes (TMH in their structure, predicted to play the role of sensors of HS. Quantitative Real-Time PCR of randomly selected ESTs showed very high relative expression of HSP17 under HS; up-regulation was observed more in wheat cv. HD2985 (thermotolerant, as compared to HD2329 (thermosusceptible during grain-filling. The abundance of transcripts was further validated through northern blot analysis. The ESTs and their corresponding DEPs can be used as molecular marker for screening or targeted precision breeding program. PTMs identified in the DEPs can be used to elucidate the thermotolerance mechanism of wheat – a novel step towards the development of

  10. Extended -Regular Sequence for Automated Analysis of Microarray Images

    Directory of Open Access Journals (Sweden)

    Jin Hee-Jeong

    2006-01-01

    Full Text Available Microarray study enables us to obtain hundreds of thousands of expressions of genes or genotypes at once, and it is an indispensable technology for genome research. The first step is the analysis of scanned microarray images. This is the most important procedure for obtaining biologically reliable data. Currently most microarray image processing systems require burdensome manual block/spot indexing work. Since the amount of experimental data is increasing very quickly, automated microarray image analysis software becomes important. In this paper, we propose two automated methods for analyzing microarray images. First, we propose the extended -regular sequence to index blocks and spots, which enables a novel automatic gridding procedure. Second, we provide a methodology, hierarchical metagrid alignment, to allow reliable and efficient batch processing for a set of microarray images. Experimental results show that the proposed methods are more reliable and convenient than the commercial tools.

  11. Sequence Quality Analysis Tool for HIV Type 1 Protease and Reverse Transcriptase

    OpenAIRE

    DeLong, Allison K.; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W.; Kantor, Rami

    2012-01-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802...

  12. Transcriptome analysis of carnation (Dianthus caryophyllus L.) based on next-generation sequencing technology.

    Science.gov (United States)

    Tanase, Koji; Nishitani, Chikako; Hirakawa, Hideki; Isobe, Sachiko; Tabata, Satoshi; Ohmiya, Akemi; Onozaki, Takashi

    2012-07-02

    Carnation (Dianthus caryophyllus L.), in the family Caryophyllaceae, can be found in a wide range of colors and is a model system for studies of flower senescence. In addition, it is one of the most important flowers in the global floriculture industry. However, few genomics resources, such as sequences and markers are available for carnation or other members of the Caryophyllaceae. To increase our understanding of the genetic control of important characters in carnation, we generated an expressed sequence tag (EST) database for a carnation cultivar important in horticulture by high-throughput sequencing using 454 pyrosequencing technology. We constructed a normalized cDNA library and a 3'-UTR library of carnation, obtaining a total of 1,162,126 high-quality reads. These reads were assembled into 300,740 unigenes consisting of 37,844 contigs and 262,896 singlets. The contigs were searched against an Arabidopsis sequence database, and 61.8% (23,380) of them had at least one BLASTX hit. These contigs were also annotated with Gene Ontology (GO) and were found to cover a broad range of GO categories. Furthermore, we identified 17,362 potential simple sequence repeats (SSRs) in 14,291 of the unigenes. We focused on gene discovery in the areas of flower color and ethylene biosynthesis. Transcripts were identified for almost every gene involved in flower chlorophyll and carotenoid metabolism and in anthocyanin biosynthesis. Transcripts were also identified for every step in the ethylene biosynthesis pathway. We present the first large-scale sequence data set for carnation, generated using next-generation sequencing technology. The large EST database generated from these sequences is an informative resource for identifying genes involved in various biological processes in carnation and provides an EST resource for understanding the genetic diversity of this plant.

  13. Transcriptome analysis of carnation (Dianthus caryophyllus L. based on next-generation sequencing technology

    Directory of Open Access Journals (Sweden)

    Tanase Koji

    2012-07-01

    Full Text Available Abstract Background Carnation (Dianthus caryophyllus L., in the family Caryophyllaceae, can be found in a wide range of colors and is a model system for studies of flower senescence. In addition, it is one of the most important flowers in the global floriculture industry. However, few genomics resources, such as sequences and markers are available for carnation or other members of the Caryophyllaceae. To increase our understanding of the genetic control of important characters in carnation, we generated an expressed sequence tag (EST database for a carnation cultivar important in horticulture by high-throughput sequencing using 454 pyrosequencing technology. Results We constructed a normalized cDNA library and a 3’-UTR library of carnation, obtaining a total of 1,162,126 high-quality reads. These reads were assembled into 300,740 unigenes consisting of 37,844 contigs and 262,896 singlets. The contigs were searched against an Arabidopsis sequence database, and 61.8% (23,380 of them had at least one BLASTX hit. These contigs were also annotated with Gene Ontology (GO and were found to cover a broad range of GO categories. Furthermore, we identified 17,362 potential simple sequence repeats (SSRs in 14,291 of the unigenes. We focused on gene discovery in the areas of flower color and ethylene biosynthesis. Transcripts were identified for almost every gene involved in flower chlorophyll and carotenoid metabolism and in anthocyanin biosynthesis. Transcripts were also identified for every step in the ethylene biosynthesis pathway. Conclusions We present the first large-scale sequence data set for carnation, generated using next-generation sequencing technology. The large EST database generated from these sequences is an informative resource for identifying genes involved in various biological processes in carnation and provides an EST resource for understanding the genetic diversity of this plant.

  14. Budding yeast cDNA sequencing project: S03052-78_H01 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GGTTCAGTC ACCCCAGCTTTAAACNATTGTTAATACAGAAGTGAATGCTTCCGTTTTCCAATTTTTCGC TTCCCTCCGCCGCNCCNNACCGNTTCTTCCGANCATTTAGATATNNATTCATANA...TGCTT ATTTNNGGGTCATANAGGAAANAATTTTCGATTGNAANGACTGAATATANATTGTTNTAT ANTTANATTGAANANGNTANNAN

  15. Budding yeast cDNA sequencing project: S03036-21_O21 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available NANAAGAGNATATGATATANNNNCATANATAN AGATAAATANANNAACAANCACNCACATANATNTAGACAANNANGANGNTNACTATANAN TTTATTCTATTAAA...CTTTTNNNNAAGAATANA AAAAANAAAAACCACCCCCCNTCCCCCTATGAGAGAGGAGGAGGAGANNNNNACNNTNTT TTTATTTANTANATANGNAAANGANAGC

  16. Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

  17. Sequencing Infrastructure Investments under Deep Uncertainty Using Real Options Analysis

    Directory of Open Access Journals (Sweden)

    Nishtha Manocha

    2018-02-01

    Full Text Available The adaptation tipping point and adaptation pathway approach developed to make decisions under deep uncertainty do not shed light on which among the multiple available pathways should be chosen as the preferred pathway. This creates the need to extend these approaches by means of suitable tools that can help sequence actions and subsequently enable the outlining of relevant policies. This paper presents two sequencing approaches, namely, the “Build to Target” and “Build Up” approach, to aid in sub-selecting a set of preferred pathways. Both approaches differ in the levels of flexibility they offer. They are exemplified by means of two case studies wherein the Net Present Valuation and the Real Options Analysis are employed as selection criterions. The results demonstrate the benefit of these two approaches when used in conjunction with the adaptation pathways and show how the pathways selected by means of a Build to Target approach generally have a value greater than, or at least the same as, the pathways selected by the Build Up approach. Further, this paper also demonstrates the capacity of Real Options to quantify and capture the economic value of flexibility, which cannot be done by traditional valuation approaches such as Net Present Valuation.

  18. Reverse transcriptase sequences from mulberry LTR retrotransposons: characterization analysis

    Directory of Open Access Journals (Sweden)

    Ma Bi

    2017-10-01

    Full Text Available Copia and Gypsy play important roles in structural, functional and evolutionary dynamics of plant genomes. In this study, a total of 106 and 101, Copia and Gypsy reverse transcriptase (rt were amplified respectively in the Morus notabilis genome using degenerate primers. All sequences exhibited high levels of heterogeneity, were rich in AT and possessed higher sequence divergence of Copia rt in comparison to Gypsy rt. Two reasons are likely to account for this phenomenon: a these elements often experience deletions or fragmentation by illegitimate or unequal homologous recombination in the transposition process; b strong purifying selective pressure drives the evolution of these elements through “selective silencing” with random mutation and eventual deletion from the host genome. Interestingly, mulberry rt clustered with other rt from distantly related taxa according to the phylogenetic analysis. This phenomenon did not result from horizontal transposable element transfer. Results obtained from fluorescence in situ hybridization revealed that most of the hybridization signals were preferentially concentrated in pericentromeric and distal regions of chromosomes, and these elements may play important roles in the regions in which they are found. Results of this study support the continued pursuit of further functional studies of Copia and Gypsy in the mulberry genome.

  19. Analysis and functional annotation of expressed sequence tags from the fall armyworm Spodoptera frugiperda

    Science.gov (United States)

    Deng, Youping; Dong, Yinghua; Thodima, Venkata; Clem, Rollie J; Passarelli, A Lorena

    2006-01-01

    Background Little is known about the genome sequences of lepidopteran insects, although this group of insects has been studied extensively in the fields of endocrinology, development, immunity, and pathogen-host interactions. In addition, cell lines derived from Spodoptera frugiperda and other lepidopteran insects are routinely used for baculovirus foreign gene expression. This study reports the results of an expressed sequence tag (EST) sequencing project in cells from the lepidopteran insect S. frugiperda, the fall armyworm. Results We have constructed an EST database using two cDNA libraries from the S. frugiperda-derived cell line, SF-21. The database consists of 2,367 ESTs which were assembled into 244 contigs and 951 singlets for a total of 1,195 unique sequences. Conclusion S. frugiperda is an agriculturally important pest insect and genomic information will be instrumental for establishing initial transcriptional profiling and gene function studies, and for obtaining information about genes manipulated during infections by insect pathogens such as baculoviruses. PMID:17052344

  20. PEX12, the pathogenic gene of group III Zellweger syndrome: cDNA cloning by functional complementation on a CHO cell mutant, patient analysis, and characterization of PEX12p

    NARCIS (Netherlands)

    Okumoto, K.; Shimozawa, N.; Kawai, A.; Tamura, S.; Tsukamoto, T.; Osumi, T.; Moser, H.; Wanders, R. J.; Suzuki, Y.; Kondo, N.; Fujiki, Y.

    1998-01-01

    Rat PEX12 cDNA was isolated by functional complementation of peroxisome deficiency of a mutant CHO cell line, ZP109 (K. Okumoto, A. Bogaki, K. Tateishi, T. Tsukamoto, T. Osumi, N. Shimozawa, Y. Suzuki, T. Orii, and Y. Fujiki, Exp. Cell Res. 233:11-20, 1997), using a transient transfection assay and

  1. Three human alcohol dehydrogenase subunits: cDNA structure and molecular and evolutionary divergence

    International Nuclear Information System (INIS)

    Ikuta, T.; Szeto, S.; Yoshida, A.

    1986-01-01

    Class I human alcohol dehydrogenase (ADH; alcohol:NAD + oxidoreductase, EC 1.1.1.1) consists of several homo- and heterodimers of α, β, and γ subunits that are governed by the ADH1, ADH2, and ADH3 loci. The authors previously cloned a full length of cDNA for the β subunit, and the complete sequence of 374 amino acid residues was established. cDNAs for the α and γ subunits were cloned and characterized. A human liver cDNA library, constructed in phage λgt11, was screened by using a synthetic oligonucleotide probe that was matched to the γ but not to the β sequence. Clone pUCADHγ21 and clone pUCADHα15L differed from β cDNA with respect to restriction sites and hybridization with the nucleotide probe. Clone pUCADHγ21 contained an insertion of 1.5 kilobase pairs (kbp) and encodes 374 amino acid residues compatible with the reported amino acid sequence of the γ subunit. Clone pUCADHα15L contained an insertion of 2.4 kbp and included nucleotide sequences that encode 374 amino acid residues for another subunit, the γ subunit. In addition, this clone contained the sequences that encode the COOH-terminal part of the β subunit at its extended 5' region. The amino acid sequences and coding regions of the cDNAs of the three subunits are very similar. A high degree of resemblance is observed also in their 3' noncoding regions. However, distinctive differences exist in the vicinity of the Zn-binding cysteine residue at position 46. Based on the cDNA sequences and the deduced amino acid sequences of the three subunits, their structural and evolutionary relationships are discussed

  2. Identification of salt-induced genes from Salicornia brachiata, an extreme halophyte through expressed sequence tags analysis.

    Science.gov (United States)

    Jha, Bhavanath; Agarwal, Pradeep K; Reddy, Palakolanu Sudhakar; Lal, Sanjay; Sopory, Sudhir K; Reddy, Malireddy K

    2009-04-01

    Salinity severely affects plant growth and development causing crop loss worldwide. We have isolated a large number of salt-induced genes as well as unknown and hypothetical genes from Salicornia brachiata Roxb. (Amaranthaceae). This is the first description of identification of genes in response to salinity stress in this extreme halophyte plant. Salicornia accumulates salt in its pith and survives even at 2 M NaCl under field conditions. For isolating salt responsive genes, cDNA subtractive hybridization was performed between control and 500 mM NaCl treated plants. Out of the 1200 recombinant clones, 930 sequences were submitted to the NCBI database (GenBank accession: EB484528 to EB485289 and EC906125 to EC906292). 789 ESTs showed matching with different genes in NCBI database. 4.8% ESTs belonged to stress-tolerant gene category and approximately 29% ESTs showed no homology with known functional gene sequences, thus classified as unknown or hypothetical. The detection of a large number of ESTs with unknown putative function in this species makes it an interesting contribution. The 90 unknown and hypothetical genes were selected to study their differential regulation by reverse Northern analysis for identifying their role in salinity tolerance. Interestingly, both up and down regulation at 500 mM NaCl were observed (21 and 10 genes, respectively). Northern analysis of two important salt tolerant genes, ASR1 (Abscisic acid stress ripening gene) and plasma membrane H+ATPase, showed the basal level of transcripts in control condition and an increase with NaCl treatment. ASR1 gene is made full length using 5' RACE and its potential role in imparting salt tolerance is being studied.

  3. Nonlinear analysis of sequence repeats of multi-domain proteins

    Energy Technology Data Exchange (ETDEWEB)

    Huang Yanzhao [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Li Mingfeng [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Xiao Yi [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China)]. E-mail: lmf_bill@sina.com

    2007-11-15

    Many multi-domain proteins have repetitive three-dimensional structures but nearly-random amino acid sequences. In the present paper, by using a modified recurrence plot proposed by us previously, we show that these amino acid sequences have hidden repetitions in fact. These results indicate that the repetitive domain structures are encoded by the repetitive sequences. This also gives a method to detect the repetitive domain structures directly from amino acid sequences.

  4. Human factors review for Severe Accident Sequence Analysis (SASA)

    International Nuclear Information System (INIS)

    Krois, P.A.; Haas, P.M.; Manning, J.J.; Bovell, C.R.

    1984-01-01

    The paper will discuss work being conducted during this human factors review including: (1) support of the Severe Accident Sequence Analysis (SASA) Program based on an assessment of operator actions, and (2) development of a descriptive model of operator severe accident management. Research by SASA analysts on the Browns Ferry Unit One (BF1) anticipated transient without scram (ATWS) was supported through a concurrent assessment of operator performance to demonstrate contributions to SASA analyses from human factors data and methods. A descriptive model was developed called the Function Oriented Accident Management (FOAM) model, which serves as a structure for bridging human factors, operations, and engineering expertise and which is useful for identifying needs/deficiencies in the area of accident management. The assessment of human factors issues related to ATWS required extensive coordination with SASA analysts. The analysis was consolidated primarily to six operator actions identified in the Emergency Procedure Guidelines (EPGs) as being the most critical to the accident sequence. These actions were assessed through simulator exercises, qualitative reviews, and quantitative human reliability analyses. The FOAM descriptive model assumes as a starting point that multiple operator/system failures exceed the scope of procedures and necessitates a knowledge-based emergency response by the operators. The FOAM model provides a functionally-oriented structure for assembling human factors, operations, and engineering data and expertise into operator guidance for unconventional emergency responses to mitigate severe accident progression and avoid/minimize core degradation. Operators must also respond to potential radiological release beyond plant protective barriers. Research needs in accident management and potential uses of the FOAM model are described. 11 references, 1 figure

  5. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  6. Chimera: construction of chimeric sequences for phylogenetic analysis

    NARCIS (Netherlands)

    Leunissen, J.A.M.

    2003-01-01

    Chimera allows the construction of chimeric protein or nucleic acid sequence files by concatenating sequences from two or more sequence files in PHYLIP formats. It allows the user to interactively select genes and species from the input files. The concatenated result is stored to one single output

  7. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  8. Accident Sequence Evaluation Program: Human reliability analysis procedure

    Energy Technology Data Exchange (ETDEWEB)

    Swain, A.D.

    1987-02-01

    This document presents a shortened version of the procedure, models, and data for human reliability analysis (HRA) which are presented in the Handbook of Human Reliability Analysis With emphasis on Nuclear Power Plant Applications (NUREG/CR-1278, August 1983). This shortened version was prepared and tried out as part of the Accident Sequence Evaluation Program (ASEP) funded by the US Nuclear Regulatory Commission and managed by Sandia National Laboratories. The intent of this new HRA procedure, called the ''ASEP HRA Procedure,'' is to enable systems analysts, with minimal support from experts in human reliability analysis, to make estimates of human error probabilities and other human performance characteristics which are sufficiently accurate for many probabilistic risk assessments. The ASEP HRA Procedure consists of a Pre-Accident Screening HRA, a Pre-Accident Nominal HRA, a Post-Accident Screening HRA, and a Post-Accident Nominal HRA. The procedure in this document includes changes made after tryout and evaluation of the procedure in four nuclear power plants by four different systems analysts and related personnel, including human reliability specialists. The changes consist of some additional explanatory material (including examples), and more detailed definitions of some of the terms. 42 refs.

  9. Accident Sequence Evaluation Program: Human reliability analysis procedure

    International Nuclear Information System (INIS)

    Swain, A.D.

    1987-02-01

    This document presents a shortened version of the procedure, models, and data for human reliability analysis (HRA) which are presented in the Handbook of Human Reliability Analysis With emphasis on Nuclear Power Plant Applications (NUREG/CR-1278, August 1983). This shortened version was prepared and tried out as part of the Accident Sequence Evaluation Program (ASEP) funded by the US Nuclear Regulatory Commission and managed by Sandia National Laboratories. The intent of this new HRA procedure, called the ''ASEP HRA Procedure,'' is to enable systems analysts, with minimal support from experts in human reliability analysis, to make estimates of human error probabilities and other human performance characteristics which are sufficiently accurate for many probabilistic risk assessments. The ASEP HRA Procedure consists of a Pre-Accident Screening HRA, a Pre-Accident Nominal HRA, a Post-Accident Screening HRA, and a Post-Accident Nominal HRA. The procedure in this document includes changes made after tryout and evaluation of the procedure in four nuclear power plants by four different systems analysts and related personnel, including human reliability specialists. The changes consist of some additional explanatory material (including examples), and more detailed definitions of some of the terms. 42 refs

  10. A Quantitative Accident Sequence Analysis for a VHTR

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jintae; Lee, Joeun; Jae, Moosung [Hanyang University, Seoul (Korea, Republic of)

    2016-05-15

    In Korea, the basic design features of VHTR are currently discussed in the various design concepts. Probabilistic risk assessment (PRA) offers a logical and structured method to assess risks of a large and complex engineered system, such as a nuclear power plant. It will be introduced at an early stage in the design, and will be upgraded at various design and licensing stages as the design matures and the design details are defined. Risk insights to be developed from the PRA are viewed as essential to developing a design that is optimized in meeting safety objectives and in interpreting the applicability of the existing demands to the safety design approach of the VHTR. In this study, initiating events which may occur in VHTRs were selected through MLD method. The initiating events were then grouped into four categories for the accident sequence analysis. Initiating events frequency and safety systems failure rate were calculated by using reliability data obtained from the available sources and fault tree analysis. After quantification, uncertainty analysis was conducted. The SR and LR frequency are calculated respectively 7.52E- 10/RY and 7.91E-16/RY, which are relatively less than the core damage frequency of LWRs.

  11. Genome-wide cloning and sequence analysis of leucine-rich repeat receptor-like protein kinase genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Yuan Tong

    2010-01-01

    Full Text Available Abstract Background Transmembrane receptor kinases play critical roles in both animal and plant signaling pathways regulating growth, development, differentiation, cell death, and pathogenic defense responses. In Arabidopsis thaliana, there are at least 223 Leucine-rich repeat receptor-like kinases (LRR-RLKs, representing one of the largest protein families. Although functional roles for a handful of LRR-RLKs have been revealed, the functions of the majority of members in this protein family have not been elucidated. Results As a resource for the in-depth analysis of this important protein family, the complementary DNA sequences (cDNAs of 194 LRR-RLKs were cloned into the GatewayR donor vector pDONR/ZeoR and analyzed by DNA sequencing. Among them, 157 clones showed sequences identical to the predictions in the Arabidopsis sequence resource, TAIR8. The other 37 cDNAs showed gene structures distinct from the predictions of TAIR8, which was mainly caused by alternative splicing of pre-mRNA. Most of the genes have been further cloned into GatewayR destination vectors with GFP or FLAG epitope tags and have been transformed into Arabidopsis for in planta functional analysis. All clones from this study have been submitted to the Arabidopsis Biological Resource Center (ABRC at Ohio State University for full accessibility by the Arabidopsis research community. Conclusions Most of the Arabidopsis LRR-RLK genes have been isolated and the sequence analysis showed a number of alternatively spliced variants. The generated resources, including cDNA entry clones, expression constructs and transgenic plants, will facilitate further functional analysis of the members of this important gene family.

  12. Lectin cDNA and transgenic plants derived therefrom

    Science.gov (United States)

    Raikhel, Natasha V.

    2000-10-03

    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  13. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    Science.gov (United States)

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  14. Purification of a jojoba embryo wax synthase, cloning of its cDNA, and production of high levels of wax in seeds of transgenic arabidopsis.

    Science.gov (United States)

    Lardizabal, K D; Metz, J G; Sakamoto, T; Hutton, W C; Pollard, M R; Lassner, M W

    2000-03-01

    Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a beta-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. (13)C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds.

  15. Comparing methods of classifying life courses: Sequence analysis and latent class analysis

    NARCIS (Netherlands)

    Elzinga, C.H.; Liefbroer, Aart C.; Han, Sapphire

    2017-01-01

    We compare life course typology solutions generated by sequence analysis (SA) and latent class analysis (LCA). First, we construct an analytic protocol to arrive at typology solutions for both methodologies and present methods to compare the empirical quality of alternative typologies. We apply this

  16. Comparing methods of classifying life courses: sequence analysis and latent class analysis

    NARCIS (Netherlands)

    Han, Y.; Liefbroer, A.C.; Elzinga, C.

    2017-01-01

    We compare life course typology solutions generated by sequence analysis (SA) and latent class analysis (LCA). First, we construct an analytic protocol to arrive at typology solutions for both methodologies and present methods to compare the empirical quality of alternative typologies. We apply this

  17. Genome-wide detection and analysis of hippocampus core promoters using DeepCAGE

    DEFF Research Database (Denmark)

    Valen, Eivind; Pascarella, Giovanni; Chalk, Alistair

    2009-01-01

    in a given tissue. Here, we present a new method for high-throughput sequencing of 5' cDNA tags-DeepCAGE: merging the Cap Analysis of Gene Expression method with ultra-high-throughput sequence technology. We apply DeepCAGE to characterize 1.4 million sequenced TSS from mouse hippocampus and reveal a wealth...

  18. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

    Science.gov (United States)

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

    2016-08-02

    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  19. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    Science.gov (United States)

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  20. RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

    Science.gov (United States)

    Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

    2012-01-01

    RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

  1. Sequencing, mapping, and analysis of 27,455 maize full-length cDNAs.

    Directory of Open Access Journals (Sweden)

    Carol Soderlund

    2009-11-01

    Full Text Available Full-length cDNA (FLcDNA sequencing establishes the precise primary structure of individual gene transcripts. From two libraries representing 27 B73 tissues and abiotic stress treatments, 27,455 high-quality FLcDNAs were sequenced. The average transcript length was 1.44 kb including 218 bases and 321 bases of 5' and 3' UTR, respectively, with 8.6% of the FLcDNAs encoding predicted proteins of fewer than 100 amino acids. Approximately 94% of the FLcDNAs were stringently mapped to the maize genome. Although nearly two-thirds of this genome is composed of transposable elements (TEs, only 5.6% of the FLcDNAs contained TE sequences in coding or UTR regions. Approximately 7.2% of the FLcDNAs are putative transcription factors, suggesting that rare transcripts are well-enriched in our FLcDNA set. Protein similarity searching identified 1,737 maize transcripts not present in rice, sorghum, Arabidopsis, or poplar annotated genes. A strict FLcDNA assembly generated 24,467 non-redundant sequences, of which 88% have non-maize protein matches. The FLcDNAs were also assembled with 41,759 FLcDNAs in GenBank from other projects, where semi-strict parameters were used to identify 13,368 potentially unique non-redundant sequences from this project. The libraries, ESTs, and FLcDNA sequences produced from this project are publicly available. The annotated EST and FLcDNA assemblies are available through the maize FLcDNA web resource (www.maizecdna.org.

  2. Complementation of radiation-sensitive Ataxia telangiectasia cells after transfection of cDNA expression libraries and cosmid clones from wildtype cells

    International Nuclear Information System (INIS)

    Fritz, E.

    1994-06-01

    In this Ph.D.-thesis, phenotypic complementation of AT-cells (AT5BIVA) by transfection of cDNA-expression-libraries was adressed: After stable transfection of cDNA-expression-libraries G418 resistant clones were selected for enhanced radioresistance by a fractionated X-ray selection. One surviving transfectant clone (clone 514) exhibited enhanced radiation resistance in dose-response experiments and further X-ray selections. Cell cycle analysis revealed complementation of untreated and irradiated 514-cells in cell cycle progression. The rate of DNA synthesis, however, is not diminished after irradiation but shows the reverse effect. A transfected cDNA-fragment (AT500-cDNA) was isolated from the genomic DNA of 514-cells and proved to be an unknown DNA sequence. A homologous sequence could be detected in genomic DNA from human cell lines, but not in DNA from other species. The cDNA-sequence could be localized to human chromosome 11. In human cells the cDNA sequence is part of two large mRNAs. 4 different cosmid clones containing high molecular genomic DNA from normal human cells could be isolated from a library, each hybridizing to the AT500-cDNA. After stable transfection into AT-cells, one cosmid-clone was able to confer enhanced radiation resistance both in X-ray selections and dose-response experiments. The results indicate that the cloned cDNA-fragment is based on an unknown gene from human chromosome 11 which partially complements the radiosensitivity and the defective cell cycle progression in AT5BIVA cells. (orig.) [de

  3. Frame sequences analysis technique of linear objects movement

    Science.gov (United States)

    Oshchepkova, V. Y.; Berg, I. A.; Shchepkin, D. V.; Kopylova, G. V.

    2017-12-01

    Obtaining data by noninvasive methods are often needed in many fields of science and engineering. This is achieved through video recording in various frame rate and light spectra. In doing so quantitative analysis of movement of the objects being studied becomes an important component of the research. This work discusses analysis of motion of linear objects on the two-dimensional plane. The complexity of this problem increases when the frame contains numerous objects whose images may overlap. This study uses a sequence containing 30 frames at the resolution of 62 × 62 pixels and frame rate of 2 Hz. It was required to determine the average velocity of objects motion. This velocity was found as an average velocity for 8-12 objects with the error of 15%. After processing dependencies of the average velocity vs. control parameters were found. The processing was performed in the software environment GMimPro with the subsequent approximation of the data obtained using the Hill equation.

  4. Transcriptome sequencing and positive selected genes analysis of Bombyx mandarina.

    Directory of Open Access Journals (Sweden)

    Tingcai Cheng

    Full Text Available The wild silkworm Bombyx mandarina is widely believed to be an ancestor of the domesticated silkworm, Bombyx mori. Silkworms are often used as a model for studying the mechanism of species domestication. Here, we performed transcriptome sequencing of the wild silkworm using an Illumina HiSeq2000 platform. We produced 100,004,078 high-quality reads and assembled them into 50,773 contigs with an N50 length of 1764 bp and a mean length of 941.62 bp. A total of 33,759 unigenes were identified, with 12,805 annotated in the Nr database, 8273 in the Pfam database, and 9093 in the Swiss-Prot database. Expression profile analysis found significant differential expression of 1308 unigenes between the middle silk gland (MSG and posterior silk gland (PSG. Three sericin genes (sericin 1, sericin 2, and sericin 3 were expressed specifically in the MSG and three fibroin genes (fibroin-H, fibroin-L, and fibroin/P25 were expressed specifically in the PSG. In addition, 32,297 Single-nucleotide polymorphisms (SNPs and 361 insertion-deletions (INDELs were detected. Comparison with the domesticated silkworm p50/Dazao identified 5,295 orthologous genes, among which 400 might have experienced or to be experiencing positive selection by Ka/Ks analysis. These data and analyses presented here provide insights into silkworm domestication and an invaluable resource for wild silkworm genomics research.

  5. Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant perioxidases

    DEFF Research Database (Denmark)

    Kjærsgård, I.V.H.; Jespersen, H.M.; Rasmussen, Søren Kjærsgård

    1997-01-01

    cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP la and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid...

  6. Next-generation sequencing-based transcriptome analysis of Helicoverpa armigera Larvae immune-primed with Photorhabdus luminescens TT01.

    Directory of Open Access Journals (Sweden)

    Zengyang Zhao

    Full Text Available Although invertebrates are incapable of adaptive immunity, immunal reactions which are functionally similar to the adaptive immunity of vertebrates have been described in many studies of invertebrates including insects. The phenomenon was termed immune priming. In order to understand the molecular mechanism of immune priming, we employed Illumina/Solexa platform to investigate the transcriptional changes of the hemocytes and fat body of Helicoverpa armigera larvae immune-primed with the pathogenic bacteria Photorhabdus luminescens TT01. A total of 43.6 and 65.1 million clean reads with 4.4 and 6.5 gigabase sequence data were obtained from the TT01 (the immune-primed and PBS (non-primed cDNA libraries and assembled into 35,707 all-unigenes (non-redundant transcripts, which has a length varied from 201 to 16,947 bp and a N50 length of 1,997 bp. For 35,707 all-unigenes, 20,438 were functionally annotated and 2,494 were differentially expressed after immune priming. The differentially expressed genes (DEGs are mainly related to immunity, detoxification, development and metabolism of the host insect. Analysis on the annotated immune related DEGs supported a hypothesis that we proposed previously: the immune priming phenomenon observed in H. armigera larvae was achieved by regulation of key innate immune elements. The transcriptome profiling data sets (especially the sequences of 1,022 unannotated DEGs and the clues (such as those on immune-related signal and