WorldWideScience

Sample records for cd40l dna combined

  1. CD40L-adjuvanted DNA/modified vaccinia virus Ankara simian immunodeficiency virus SIV239 vaccine enhances SIV-specific humoral and cellular immunity and improves protection against a heterologous SIVE660 mucosal challenge.

    Science.gov (United States)

    Kwa, Suefen; Lai, Lilin; Gangadhara, Sailaja; Siddiqui, Mariam; Pillai, Vinod B; Labranche, Celia; Yu, Tianwei; Moss, Bernard; Montefiori, David C; Robinson, Harriet L; Kozlowski, Pamela A; Amara, Rama Rao

    2014-09-01

    It remains a challenge to develop a successful human immunodeficiency virus (HIV) vaccine that is capable of preventing infection. Here, we utilized the benefits of CD40L, a costimulatory molecule that can stimulate both dendritic cells (DCs) and B cells, as an adjuvant for our simian immunodeficiency virus (SIV) DNA vaccine in rhesus macaques. We coexpressed the CD40L with our DNA/SIV vaccine such that the CD40L is anchored on the membrane of SIV virus-like particle (VLP). These CD40L containing SIV VLPs showed enhanced activation of DCs in vitro. We then tested the potential of DNA/SIV-CD40L vaccine to adjuvant the DNA prime of a DNA/modified vaccinia virus Ankara (MVA) vaccine in rhesus macaques. Our results demonstrated that the CD40L adjuvant enhanced the functional quality of anti-Env antibody response and breadth of anti-SIV CD8 and CD4 T cell responses, significantly delayed the acquisition of heterologous mucosal SIV infection, and improved viral control. Notably, the CD40L adjuvant enhanced the control of viral replication in the gut at the site of challenge that was associated with lower mucosal CD8 immune activation, one of the strong predictors of disease progression. Collectively, our results highlight the benefits of CD40L adjuvant for enhancing antiviral humoral and cellular immunity, leading to enhanced protection against a pathogenic SIV. A single adjuvant that enhances both humoral and cellular immunity is rare and thus underlines the importance and practicality of CD40L as an adjuvant for vaccines against infectious diseases, including HIV-1. Despite many advances in the field of AIDS research, an effective AIDS vaccine that can prevent infection remains elusive. CD40L is a key stimulator of dendritic cells and B cells and can therefore enhance T cell and antibody responses, but its overly potent nature can lead to adverse effects unless used in small doses. In order to modulate local expression of CD40L at relatively lower levels, we expressed

  2. Mechanisms of Nifedipine-Downregulated CD40L/sCD40L Signaling in Collagen Stimulated Human Platelets.

    Directory of Open Access Journals (Sweden)

    Tso-Hsiao Chen

    Full Text Available The platelet-derived soluble CD40L (sCD40L release plays a critical role in the development of atherosclerosis. Nifedipine, a dihydropyridine-based L-type calcium channel blocker (CCB, has been reported to have an anti-atherosclerotic effect beyond its blood pressure-lowering effect, but the molecular mechanisms remain unclear. The present study was designed to investigate whether nifedipine affects sCD40L release from collagen-stimulated human platelets and to determine the potential role of peroxisome proliferator-activated receptor-β/-γ (PPAR-β/-γ. We found that treatment with nifedipine significantly inhibited the platelet surface CD40L expression and sCD40L release in response to collagen, while the inhibition was markedly reversed by blocking PPAR-β/-γ activity with specific antagonist such as GSK0660 and GW9662. Meanwhile, nifedipine also enhanced nitric oxide (NO and cyclic GMP formation in a PPAR-β/-γ-dependent manner. When the NO/cyclic GMP pathway was suppressed, nifedipine-mediated inhibition of sCD40L release was abolished significantly. Collagen-induced phosphorylation of p38MAPK, ERK1/2 and HSP27, matrix metalloproteinase-2 (MMP-2 expression/activity and reactive oxygen species (ROS formation were significantly inhibited by nifedipine, whereas these alterations were all attenuated by co-treatment with PPAR-β/-γ antagonists. Collectively, these results demonstrate that PPAR-β/-γ-dependent pathways contribute to nifedipine-mediated downregulation of CD40L/sCD40L signaling in activated platelets through regulation of NO/ p38MAPK/ERK1/2/HSP27/MMP-2 signalings and provide a novel mechanism regarding the anti-atherosclerotic effect of nifedipine.

  3. The multi-functionality of CD40L and its receptor CD40 in atherosclerosis

    NARCIS (Netherlands)

    Lievens, Dirk; Eijgelaar, Wouter J.; Biessen, Erik A. L.; Daemen, Mat J. A. P.; Lutgens, Esther

    2009-01-01

    Disrupting the CD40-CD40L co-stimulatory pathway reduces atherosclerosis and induces a stable atherosclerotic plaque phenotype that is low in inflammation and high in fibrosis. Therefore, inhibition of the CD40-CD40L pathway is an attractive therapeutic target to reduce clinical complications of

  4. The CD40-CD40L Dyad in Experimental Autoimmune Encephalomyelitis and Multiple Sclerosis

    NARCIS (Netherlands)

    Aarts, Suzanne A. B. M.; Seijkens, Tom T. P.; van Dorst, Koos J. F.; Dijkstra, Christine D.; Kooij, Gijs; Lutgens, Esther

    2017-01-01

    The CD40-CD40L dyad is an immune checkpoint regulator that promotes both innate and adaptive immune responses and has therefore an essential role in the development of inflammatory diseases, including multiple sclerosis (MS). In MS, CD40 and CD40L are expressed on immune cells present in blood and

  5. The role of CD40 in CD40L- and antibody-mediated platelet activation.

    Science.gov (United States)

    Langer, Florian; Ingersoll, Susan B; Amirkhosravi, Ali; Meyer, Todd; Siddiqui, Farooq A; Ahmad, Sarfraz; Walker, Jamie M; Amaya, Mildred; Desai, Hina; Francis, John L

    2005-06-01

    Our initial finding that CD40- and CD40 ligand (CD40L)-deficient mice displayed prolonged tail bleeding and platelet function analyzer (PFA-100) closure times prompted us to further investigate the role of the CD40-CD40L dyad in primary hemostasis and platelet function. Recombinant human soluble CD40L (rhsCD40L), chemical cross-linking of which suggested a trimeric structure of the protein in solution, activated platelets in a CD40-dependent manner as evidenced by increased CD62P expression. CD40 monoclonal antibody (mAb) M3, which completely blocked rhsCD40L-induced platelet activation, also prolonged PFA-100 closure times of normal human blood. In contrast, CD40 mAb G28-5 showed less potential in blocking rhsCD40L-induced CD62P expression and did not affect PFA-100 closure times. However, when added to the platelets after rhsCD40L, G28-5 significantly enhanced the platelet response by causing clustering of, and signaling through, FcgammaRII. Similarly, higher order multimeric immune complexes formed at a 1/3 molar ratio of M90, a CD40L mAb, to rhsCD40L induced strong Fcgamma RII-mediated platelet activation when translocated to the platelet surface in a CD40-dependent manner, including the induction of morphological shape changes, fibrinogen binding, platelet aggregation, dense granule release, microparticle generation and monocyte-platelet-conjugate formation. The results suggest that CD40 may play a role in primary hemostasis and platelet biology by two independent mechanisms: First, by functioning as a primary signaling receptor for CD40L and, second, by serving as a docking molecule for CD40L immune complexes. The latter would also provide a potential mechanistic explanation for the unexpected high incidence of CD40L mAb-associated thrombotic events in recent human and animal studies.

  6. CD40-CD40L interactions partly participate in the endothelial cel

    African Journals Online (AJOL)

    Jane

    2011-10-17

    Oct 17, 2011 ... (mAb) in vitro. On ECs, blockade of CD40/CD40L decreased the expression of IL (interleukin)-6, IL-8 and intercellular adhesion molecule (ICAM) in adenovirus vector-induced ..... Possible reflection of T lymphocyte and platelet involvement ... nuclear factor-kappaB activation by tumor necrosis factor-alpha,.

  7. CD40L Expression Allows CD8+ T Cells to Promote Their Own Expansion and Differentiation through Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Neil Q. Tay

    2017-11-01

    Full Text Available CD8+ T cells play an important role in providing protective immunity against a wide range of pathogens, and a number of different factors control their activation. Although CD40L-mediated CD40 licensing of dendritic cells (DCs by CD4+ T cells is known to be necessary for the generation of a robust CD8+ T cell response, the contribution of CD8+ T cell-expressed CD40L on DC licensing is less clear. We have previously shown that CD8+ T cells are able to induce the production of IL-12 p70 by DCs in a CD40L-dependent manner, providing some evidence that CD8+ T cell-mediated activation of DCs is possible. To better understand the role of CD40L on CD8+ T cell responses, we generated and characterized CD40L-expressing CD8+ T cells both in vitro and in vivo. We found that CD40L was expressed on 30–50% of effector CD8+ T cells when stimulated and that this expression was transient. The expression of CD40L on CD8+ T cells promoted the proliferation and differentiation of both the CD40L-expressing CD8+ T cells and the bystander effector CD8+ T cells. This process occurred via a cell-extrinsic manner and was mediated by DCs. These data demonstrate the existence of a mechanism where CD8+ T cells and DCs cooperate to maximize CD8+ T cell responses.

  8. CD40L Expression Allows CD8+T Cells to Promote Their Own Expansion and Differentiation through Dendritic Cells.

    Science.gov (United States)

    Tay, Neil Q; Lee, Debbie C P; Chua, Yen Leong; Prabhu, Nayana; Gascoigne, Nicholas R J; Kemeny, David M

    2017-01-01

    CD8 + T cells play an important role in providing protective immunity against a wide range of pathogens, and a number of different factors control their activation. Although CD40L-mediated CD40 licensing of dendritic cells (DCs) by CD4 + T cells is known to be necessary for the generation of a robust CD8 + T cell response, the contribution of CD8 + T cell-expressed CD40L on DC licensing is less clear. We have previously shown that CD8 + T cells are able to induce the production of IL-12 p70 by DCs in a CD40L-dependent manner, providing some evidence that CD8 + T cell-mediated activation of DCs is possible. To better understand the role of CD40L on CD8 + T cell responses, we generated and characterized CD40L-expressing CD8 + T cells both in vitro and in vivo . We found that CD40L was expressed on 30-50% of effector CD8 + T cells when stimulated and that this expression was transient. The expression of CD40L on CD8 + T cells promoted the proliferation and differentiation of both the CD40L-expressing CD8 + T cells and the bystander effector CD8 + T cells. This process occurred via a cell-extrinsic manner and was mediated by DCs. These data demonstrate the existence of a mechanism where CD8 + T cells and DCs cooperate to maximize CD8 + T cell responses.

  9. Genetic adjuvantation of recombinant MVA with CD40L potentiates CD8 T cell mediated immunity

    Directory of Open Access Journals (Sweden)

    Henning eLauterbach

    2013-08-01

    Full Text Available Modified vaccinia Ankara (MVA is a safe and promising viral vaccine vector that is currently investigated in several clinical and pre-clinical trials. In contrast to inactivated or sub-unit vaccines, MVA is able to induce strong humoral as well as cellular immune responses. In order to further improve its CD8 T cell inducing capacity, we genetically adjuvanted MVA with the coding sequence of murine CD40L, a member of the tumor necrosis factor (TNF superfamily. Immunization of mice with this new vector led to strongly enhanced primary and memory CD8 T cell responses. Concordant with the enhanced CD8 T cell response, we could detect stronger activation of dendritic cells and higher systemic levels of innate cytokines (including IL-12p70 early after immunization. Interestingly, acquisition of memory characteristics (i.e., IL-7R expression was accelerated after immunization with MVA-CD40L in comparison to non-adjuvanted MVA. Furthermore, the generated CTLs also showed improved functionality as demonstrated by intracellular cytokine staining and in vivo killing activity. Importantly, the superior CTL response after a single MVA-CD40L immunization was able to protect B cell deficient mice against a fatal infection with ectromelia virus. Taken together, we show that genetic adjuvantation of MVA can change strength, quality and functionality of innate and adaptive immune responses. These data should facilitate a rational vaccine design with a focus on rapid induction of large numbers of CD8 T cells able to protect against specific diseases.

  10. The role of CD40L, IL-10 and IL-17 in radioprotection

    International Nuclear Information System (INIS)

    Li Ting

    2003-01-01

    CD40L/CD40 interaction is central to the control of thymus-dependent humoral immunity and cell mediated immune responses. IL-17 has been shown to induce the production of IL-6 and G-CSF, which can induce proliferation and differentiation of CD34 + hematopoietic progenitors. IL-10 can interfere with up-regulation of costimulatory molecules, thus suppressing the production of costimulatory cytokines, such as IL-12. IL-10 has been implicated as an essential mediator in the induction of systemic immune suppression following ultraviolet (UV) exposure. Treating UV-irradiated mice with anti-IL-10 blocks the induction of immune suppression

  11. Impaired CD40L signaling is a cause of defective IL-12 and TNF-alpha production in Sézary syndrome: circumvention by hexameric soluble CD40L.

    Science.gov (United States)

    French, Lars E; Huard, Bertrand; Wysocka, Maria; Shane, Ryan; Contassot, Emmanuel; Arrighi, Jean-François; Piguet, Vincent; Calderara, Silvio; Rook, Alain H

    2005-01-01

    Sézary syndrome (SzS) is an advanced form of cutaneous T-cell lymphoma characterized by peripheral blood involvement, impaired cell-mediated immunity, and T-helper 1 (TH1) cytokine production. To understand the mechanism of these defects, we studied the expression and function of CD40L in peripheral blood mononuclear cells (PBMCs) of patients with SzS. We found that PBMCs of patients with SzS have a defect in interleukin-12 (IL-12) and tumor necrosis factor-alpha (TNF-alpha) production upon anti-CD3 stimulation and that tumor CD4+ T lymphocytes have a specific defect in CD40L induction after anti-CD3 ligation in vitro. This defect may explain the poor IL-12 production, because IL-12 production by anti-CD3-stimulated PBMCs was dependent on CD40L in healthy donors. The observed defect in tumor cell CD40L expression appears to be due to inappropriate T-cell signaling upon CD3 ligation, because expression of other T-cell activation antigens such as CD25, and to a lesser extent CD69, are also impaired on tumor cells. Importantly however, the inability of SzS PBMCs to appropriately produce IL-12 and TNF-alpha could be restored by recombinant hexameric CD40L. Taken together, our results demonstrate that impaired IL-12 and TNF-alpha production in SzS is associated with defective CD4+ T lymphocyte CD40L induction and indicate that CD40L may have therapeutic potential in SzS.

  12. Expression of CD40 and CD40L in Gastric Cancer Tissue and Its Clinical Significance

    Directory of Open Access Journals (Sweden)

    Rui Li

    2009-09-01

    Full Text Available To study expression of CD40 and CD40L in gastric cancer tissue we assessed gastric cancer patients admitted to the Department of Gastroenterology of The First Affiliated Hospital of Soochow University and control subjects. Gastric cancer and normal (from around tumours tissue samples were obtained from patients. Venous blood samples (gastric cancer and ulcer groups were drawn on the morning of the day before surgery for the measurement of peripheral sCD40L. The expression of CD40 in gastric carcinoma specimens was examined immuno-histochemically. The clinicopathological factors, including age, sex, tumor size, gross appearance, degree of cellular differentiation, histological classification, depth of tumor invasion, lymph node metastasis, peritoneal dissemination, and TNM stage were analyzed according to the different expression of CD40. The results indicated a high CD40 expression in gastric cancer tissues. This positive expression of CD40 revealed a significant (P < 0.05 correlation with lymphatic metastasis and tumor TNM stage in gastric cancer patients. It is concluded that higher CD40 expression existed in expanding type tumors and could play an important role in clinical diagnosis of gastric cancer patients.

  13. CD40L and TNF both activate the classical NF-κB pathway, which is not required for the CD40L induced alternative pathway in endothelial cells.

    Science.gov (United States)

    Seigner, J; Basilio, J; Resch, U; de Martin, R

    2018-01-01

    CD40L and TNF signal through engagement of their respective receptors, which are both members of the TNF receptor family. They use partially common signaling molecules leading, among others, to activation of the NF-κB pathway. However, whereas TNF activates the classical, CD40L has been reported to activate the alternative NF-κB pathway, leading to the anticipation that differences in the pattern of inflammatory gene expression would occur. Here, we have compared the gene expression repertoire of CD40L (CD154) and TNF stimulated HUVEC and report that unexpectedly, apart from a stronger response to TNF, no major qualitative differences could be observed. This applies for the period of up to 6 h, a time where the alternative pathway has already been activated. Analysis of the early events after receptor engagement revealed that both TNF and CD40L activate the classical NF-κB pathway, and confirm activation of the alternative by the latter. Furthermore, using genetic and pharmacological inhibition of the classical pathway we show that activation of the alternative occurs independently of the former. This reveals novel insights into NF-κB signaling by CD40L and TNF in endothelial cells. Copyright © 2017. Published by Elsevier Inc.

  14. CD40L induces multidrug resistance to apoptosis in breast carcinoma and lymphoma cells through caspase independent and dependent pathways

    International Nuclear Information System (INIS)

    Voorzanger-Rousselot, Nathalie; Alberti, Laurent; Blay, Jean-Yves

    2006-01-01

    CD40L was found to reduce doxorubicin-induced apoptosis in non Hodgkin's lymphoma cell lines through caspase-3 dependent mechanism. Whether this represents a general mechanism for other tumor types is unknown. The resistance induced by CD40L against apoptosis induced by a panel of cytotoxic chemotherapeutic drugs in non Hodgkin's lymphoma and breast carcinoma cell lines was investigated. Doxorubicin, cisplatyl, etoposide, vinblastin and paclitaxel increased apoptosis in a dose-dependent manner in breast carcinoma as well as in non Hodgkin's lymphoma cell lines. Co-culture with irradiated L cells expressing CD40L significantly reduced the percentage of apoptotic cells in breast carcinoma and non Hodgkin's lymphoma cell lines treated with these drugs. In breast carcinoma cell lines, these 5 drugs induced an inconsistent increase of caspase-3/7 activity, while in non Hodgkin's lymphoma cell lines all 5 drugs increased caspase-3/7 activity up to 28-fold above baseline. Co-culture with CD40L L cells reduced (-39% to -89%) the activation of caspase-3/7 induced by these agents in all 5 non Hodgkin's lymphoma cell lines, but in none of the 2 breast carcinoma cell lines. Co culture with CD40L L cells also blocked the apoptosis induced by exogenous ceramides in breast carcinoma and non Hodgkin's lymphoma cell lines through a caspase-3-like, 8-like and 9-like dependent pathways. These results indicate that CD40L expressed on adjacent non tumoral cells induces multidrug resistance to cytotoxic agents and ceramides in both breast carcinoma and non Hodgkin's lymphoma cell lines, albeit through a caspase independent and dependent pathway respectively

  15. Excess soluble CD40L contributes to blood brain barrier permeability in vivo: implications for HIV-associated neurocognitive disorders.

    Directory of Open Access Journals (Sweden)

    Donna C Davidson

    Full Text Available Despite the use of anti-retroviral therapies, a majority of HIV-infected individuals still develop HIV-Associated Neurocognitive Disorders (HAND, indicating that host inflammatory mediators, in addition to viral proteins, may be contributing to these disorders. Consistently, we have previously shown that levels of the inflammatory mediator soluble CD40L (sCD40L are elevated in the circulation of HIV-infected, cognitively impaired individuals as compared to their infected, non-impaired counterparts. Recent studies from our group suggest a role for the CD40/CD40L dyad in blood brain barrier (BBB permeability and interestingly, sCD40L is thought to regulate BBB permeability in other inflammatory disorders of the CNS. Using complementary multiphoton microscopy and quantitative analyses in wild-type and CD40L deficient mice, we now reveal that the HIV transactivator of transcription (Tat can induce BBB permeability in a CD40L-dependent manner. This permeability of the BBB was found to be the result of aberrant platelet activation induced by Tat, since depletion of platelets prior to treatment reversed Tat-induced BBB permeability. Furthermore, Tat treatment led to an increase in granulocyte antigen 1 (Gr1 positive monocytes, indicating an expansion of the inflammatory subset of cells in these mice, which were found to adhere more readily to the brain microvasculature in Tat treated animals. Exploring the mechanisms by which the BBB becomes compromised during HIV infection has the potential to reveal novel therapeutic targets, thereby aiding in the development of adjunct therapies for the management of HAND, which are currently lacking.

  16. Despite disorganized synapse structure, Th2 cells maintain directional delivery of CD40L to antigen-presenting B cells.

    Directory of Open Access Journals (Sweden)

    Jennifer L Gardell

    Full Text Available Upon recognition of peptide displayed on MHC molecules, Th1 and Th2 cells form distinct immunological synapse structures. Th1 cells have a bull's eye synapse structure with TCR/ MHC-peptide interactions occurring central to a ring of adhesion molecules, while Th2 cells have a multifocal synapse with small clusters of TCR/MHC interactions throughout the area of T cell/antigen-presenting cell interaction. In this study, we investigated whether this structural difference in the immunological synapse affects delivery of T cell help. The immunological synapse is thought to ensure antigen-specific delivery of cytolytic granules and killing of target cells by NK cells and cytolytic T cells. In helper T cells, it has been proposed that the immunological synapse may direct delivery of other effector molecules including cytokines. CD40 ligand (CD40L is a membrane-bound cytokine essential for antigen-specific T cell help for B cells in the antibody response. We incubated Th1 and Th2 cells overnight with a mixture of antigen-presenting and bystander B cells, and the delivery of CD40L to B cells and subsequent B cell responses were compared. Despite distinct immunological synapse structures, Th1 and Th2 cell do not differ in their ability to deliver CD40L and T cell help in an antigen-specific fashion, or in their susceptibility to inhibition of help by a blocking anti-CD40L antibody.

  17. Despite disorganized synapse structure, Th2 cells maintain directional delivery of CD40L to antigen-presenting B cells.

    Science.gov (United States)

    Gardell, Jennifer L; Parker, David C

    2017-01-01

    Upon recognition of peptide displayed on MHC molecules, Th1 and Th2 cells form distinct immunological synapse structures. Th1 cells have a bull's eye synapse structure with TCR/ MHC-peptide interactions occurring central to a ring of adhesion molecules, while Th2 cells have a multifocal synapse with small clusters of TCR/MHC interactions throughout the area of T cell/antigen-presenting cell interaction. In this study, we investigated whether this structural difference in the immunological synapse affects delivery of T cell help. The immunological synapse is thought to ensure antigen-specific delivery of cytolytic granules and killing of target cells by NK cells and cytolytic T cells. In helper T cells, it has been proposed that the immunological synapse may direct delivery of other effector molecules including cytokines. CD40 ligand (CD40L) is a membrane-bound cytokine essential for antigen-specific T cell help for B cells in the antibody response. We incubated Th1 and Th2 cells overnight with a mixture of antigen-presenting and bystander B cells, and the delivery of CD40L to B cells and subsequent B cell responses were compared. Despite distinct immunological synapse structures, Th1 and Th2 cell do not differ in their ability to deliver CD40L and T cell help in an antigen-specific fashion, or in their susceptibility to inhibition of help by a blocking anti-CD40L antibody.

  18. Treatment efficacy and immune stimulation by AdCD40L gene therapy of spontaneous canine malignant melanoma.

    Science.gov (United States)

    Westberg, Sara; Sadeghi, Arian; Svensson, Emma; Segall, Thomas; Dimopoulou, Maria; Korsgren, Olle; Hemminki, Akseli; Loskog, Angelica S I; Tötterman, Thomas H; von Euler, Henrik

    2013-01-01

    Malignant melanoma is a serious disease in both humans and dogs, and the high metastatic potential results in poor prognosis for many patients. Its similarities with human melanoma make spontaneous canine melanoma an excellent model for comparative studies of novel therapies and tumor biology. We report a pilot study of local adenovector CD40L (AdCD40L) immunogene treatment in 19 cases of canine melanoma (14 oral, 4 cutaneous, and 1 conjunctival). Three patients were World Health Organization stage I, 2 were stage II, 10 stage III, and 4 stage IV. One to 6 intratumoral injections of AdCD40L were given every 7 days, followed by cytoreductive surgery in 9 cases and only immunotherapy in 10 cases. Tumor tissue was infiltrated with T and B lymphocytes after treatment, suggesting immune stimulation. The best overall response included 5 complete responses, 8 partial responses, and 4 stable and 2 progressive disease statuses according to the World Health Organization response criteria. Median survival was 160 days (range, 20-1141 d), with 3 dogs still alive at submission. Our results suggest that local AdCD40L therapy is safe and could have beneficial effects in dogs, supporting further treatment development. Clinical translation to human patients is in progress.

  19. CD40L induces functional tunneling nanotube networks exclusively in dendritic cells programmed by mediators of type 1 immunity.

    Science.gov (United States)

    Zaccard, Colleen R; Watkins, Simon C; Kalinski, Pawel; Fecek, Ronald J; Yates, Aarika L; Salter, Russell D; Ayyavoo, Velpandi; Rinaldo, Charles R; Mailliard, Robbie B

    2015-02-01

    The ability of dendritic cells (DC) to mediate CD4(+) T cell help for cellular immunity is guided by instructive signals received during DC maturation, as well as the resulting pattern of DC responsiveness to the Th signal, CD40L. Furthermore, the professional transfer of antigenic information from migratory DC to lymph node-residing DC is critical for the effective induction of cellular immune responses. In this study we report that, in addition to their enhanced IL-12p70 producing capacity, human DC matured in the presence of inflammatory mediators of type 1 immunity are uniquely programmed to form networks of tunneling nanotube-like structures in response to CD40L-expressing Th cells or rCD40L. This immunologic process of DC reticulation facilitates intercellular trafficking of endosome-associated vesicles and Ag, but also pathogens such HIV-1, and is regulated by the opposing roles of IFN-γ and IL-4. The initiation of DC reticulation represents a novel helper function of CD40L and a superior mechanism of intercellular communication possessed by type 1 polarized DC, as well as a target for exploitation by pathogens to enhance direct cell-to-cell spread. Copyright © 2015 by The American Association of Immunologists, Inc.

  20. Functional B cell abnormalities in HIV type 1 infection: role of CD40L and CD70

    NARCIS (Netherlands)

    Wolthers, K. C.; Otto, S. A.; Lens, S. M.; van Lier, R. A.; Miedema, F.; Meyaard, L.

    1997-01-01

    Early in HIV-1 infection, B cell responses to T cell-dependent antigens are impaired. In addition to the receptor-ligand pair CD40/CD40L, CD27/CD70 also appears to be involved in T cell-dependent B cell stimulation. We have shown that CD70+ B cells are the main producers of Ig when stimulated in a T

  1. A GM-CSF and CD40L bystander vaccine is effective in a murine breast cancer model

    Directory of Open Access Journals (Sweden)

    Soliman H

    2015-12-01

    -γ secreting T-cells on ELISPOT for BCG treated groups, and a trend for higher numbers of tumor infiltrating CD3+ lymphocytes. Some tumors in the 4T1-BCG demonstrated organized lymphoid structures within the tumor microenvironment as well. Conclusion: The use of BCG bystander cell lines demonstrates proof of concept for anti-tumor activity and immunogenicity in an immunocompetent murine model of breast cancer. This vaccine is being evaluated in lung cancer and should be explored further in clinical trials of breast cancer patients at high risk of recurrence or in combination with other immunomodulatory agents. Keywords: breast cancer, immunotherapy, bystander vaccine, CD40L, GM-CSF

  2. IL-12-mediated STAT4 signaling and TCR signal strength cooperate in the induction of CD40L in human and mouse CD8+ T cells.

    Science.gov (United States)

    Stark, Regina; Hartung, Anett; Zehn, Dietmar; Frentsch, Marco; Thiel, Andreas

    2013-06-01

    CD40L is one of the key molecules bridging the activation of specific T cells and the maturation of professional and nonprofessional antigen-presenting cells including B cells. CD4(+) T cells have been regarded as the major T-cell subset that expresses CD40L upon cognate activation; however, we demonstrate here that a putative CD8(+) helper T-cell subset expressing CD40L is induced in human and murine CD8(+) T cells in vitro and in mice immunized with antigen-pulsed dendritic cells. IL-12 and STAT4-mediated signaling was the major instructive cytokine signal boosting the ability of CD8(+) T cells to express CD40L both in vitro and in vivo. Additionally, TCR signaling strength modulated CD40L expression in CD8(+) T cells after primary differentiation in vitro as well as in vivo. The induction of CD40L in CD8(+) T cells regulated by IL-12 and TCR signaling may enable CD8(+) T cells to respond autonomously of CD4(+) T cells. Thus, we propose that under proinflammatory conditions, a self-sustaining positive feedback loop could facilitate the efficient priming of T cells stimulated by high affinity peptide displaying APCs. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Intraperitoneal administration of a tumor-associated antigen SART3, CD40L, and GM-CSF gene-loaded polyplex micelle elicits a vaccine effect in mouse tumor models.

    Directory of Open Access Journals (Sweden)

    Kouichi Furugaki

    Full Text Available Polyplex micelles have demonstrated biocompatibility and achieve efficient gene transfection in vivo. Here, we investigated a polyplex micelle encapsulating genes encoding the tumor-associated antigen squamous cell carcinoma antigen recognized by T cells-3 (SART3, adjuvant CD40L, and granulocyte macrophage colony-stimulating factor (GM-CSF as a DNA vaccine platform in mouse tumor models with different types of major histocompatibility antigen complex (MHC. Intraperitoneally administrated polyplex micelles were predominantly found in the lymph nodes, spleen, and liver. Compared with mock controls, the triple gene vaccine significantly prolonged the survival of mice harboring peritoneal dissemination of CT26 colorectal cancer cells, of which long-term surviving mice showed complete rejection when re-challenged with CT26 tumors. Moreover, the DNA vaccine inhibited the growth and metastasis of subcutaneous CT26 and Lewis lung tumors in BALB/c and C57BL/6 mice, respectively, which represent different MHC haplotypes. The DNA vaccine highly stimulated both cytotoxic T lymphocyte and natural killer cell activities, and increased the infiltration of CD11c+ DCs and CD4+/CD8a+ T cells into tumors. Depletion of CD4+ or CD8a+ T cells by neutralizing antibodies deteriorated the anti-tumor efficacy of the DNA vaccine. In conclusion, a SART3/CD40L+GM-CSF gene-loaded polyplex micelle can be applied as a novel vaccine platform to elicit tumor rejection immunity regardless of the recipient MHC haplotype.

  4. Anti-inflammatory and anti-thrombotic intervention strategies using atorvastatin, clopidogrel and knock-down of CD40L do not modify radiation-induced atherosclerosis in ApoE null mice

    International Nuclear Information System (INIS)

    Hoving, Saske; Heeneman, Sylvia; Gijbels, Marion J.J.; Poele, Johannes A.M. te; Pol, Jeffrey F.C.; Gabriels, Karen; Russell, Nicola S.; Daemen, Mat J.A.P.; Stewart, Fiona A.

    2011-01-01

    Background and purpose: We previously showed that irradiating the carotid arteries of ApoE −/− mice accelerated the development of macrophage-rich, inflammatory and thrombotic atherosclerotic lesions. In this study we investigated the potential of anti-inflammatory (atorvastatin, CD40L knockout) and anti-thrombotic (clopidogrel) intervention strategies to inhibit radiation-induced atherosclerosis. Material and methods: ApoE −/− mice were given 0 or 14 Gy to the neck and the carotid arteries were harvested at 4 or 28 weeks after irradiation. Atorvastatin (15 mg/kg/day) or clopidogrel (20 mg/kg/day) was given in the chow; control groups received regular chow. Clopidogrel inhibited platelet aggregation by 50%. CD40L −/− /ApoE −/− and ApoE −/− littermates were also given 0 or 14 Gy to the neck and the carotid arteries were harvested after 30 weeks. Results: Clopidogrel decreased MCP-1 expression in the carotid artery at 4 weeks after irradiation. Expression of VCAM-1, ICAM-1, thrombomodulin, tissue factor and eNOS was unchanged in atorvastatin and clopidogrel-treated mice. Neither drug inhibited either age-related or radiation-induced atherosclerosis. Furthermore, loss of the inflammatory mediator CD40L did not influence the development of age-related and radiation-induced atherosclerosis. Conclusions: The effects of radiation-induced atherosclerosis could not be circumvented by these specific anti-inflammatory and anti-coagulant therapies. This suggests that more effective drug combinations may be required to overcome the radiation stimulus, or that other underlying mechanistic pathways are involved compared to age-related atherosclerosis.

  5. Expanding the clinical and genetic spectrum of human CD40L deficiency: the occurrence of paracoccidioidomycosis and other unusual infections in Brazilian patients.

    Science.gov (United States)

    Cabral-Marques, Otavio; Schimke, Lena-Friederike; Pereira, Paulo Vítor Soeiro; Falcai, Angela; de Oliveira, João Bosco; Hackett, Mary J; Errante, Paolo Ruggero; Weber, Cristina Worm; Ferreira, Janaíra Fernandes; Kuntze, Gisele; Rosário-Filho, Nelson Augusto; Ochs, Hans D; Torgerson, Troy R; Carvalho, Beatriz Tavares Costa; Condino-Neto, Antonio

    2012-04-01

    CD40 ligand (CD40L) deficiency or X-linked hyper-IgM syndrome (X-HIGM) is a well-described primary immunodeficiency in which Pneumocystis jiroveci pneumonia is a common clinical feature. We have identified an unusual high incidence of fungal infections and other not yet described infections in a cohort of 11 X-HIGM patients from nine unrelated Brazilian families. Among these, we describe the first case of paracoccidioidomycosis (PCM) in X-HIGM. The molecular genetic analysis of CD40L was performed by gene sequencing and evaluation of CD40L protein expression. Nine of these 11 patients (82%) had fungal infections. These included fungal species common to CD40L deficiency (P. jiroveci and Candida albicans) as well as Paracoccidioides brasiliensis. One patient presented with PCM at age 11 years and is now doing well at 18 years of age. Additionally, one patient presented with a simultaneous infection with Klebsiella and Acinetobacter, and one with condyloma caused by human papilloma virus. Molecular analysis revealed four previously described CD40L mutations, two novel missense mutations (c.433 T > G and c.476 G > C) resulting in the absence of CD40L protein expression by activated CD4(+) cells and one novel insertion (c.484_485insAA) within the TNFH domain leading to a frame shift and premature stop codon. These observations demonstrated that the susceptibility to fungal infections in X-HIGM extends beyond those typically associated with X-HIGM (P. jiroveci and C. albicans) and that these patients need to be monitored for those pathogens.

  6. Earlier low-dose TBI or DST overcomes CD8+ T-cell-mediated alloresistance to allogeneic marrow in recipients of anti-CD40L.

    Science.gov (United States)

    Takeuchi, Yasuo; Ito, Hiroshi; Kurtz, Josef; Wekerle, Thomas; Ho, Leon; Sykes, Megan

    2004-01-01

    Treatment with a single injection of anti-CD40L (CD154) monoclonal antibody (mAb) and fully mismatched allogeneic bone marrow transplant (BMT) allows rapid tolerization of CD4+ T cells to the donor. The addition of in vivo CD8 T-cell depletion leads to permanent mixed hematopoietic chimerism and tolerance. We now describe two approaches that obviate the requirement for CD8 T-cell depletion by rapidly tolerizing recipient CD8 T cells in addition to CD4 cells. Administration of donor-specific transfusion (DST) to mice receiving 3 Gy total body irradiation (TBI), BMT and anti-CD40L mAb on day 0 uniformly led to permanent mixed chimerism and tolerance, compared with only 40% of mice receiving similar treatment without DST. In the absence of DST, moving the timing of 3 Gy TBI to day -1 or day -2 instead of day 0 led to rapid (by 2 weeks) induction of CD8+ cell tolerance, and also permitted uniform achievement of permanent mixed chimerism and donor-specific tolerance in recipients of anti-CD40L and BMT on day 0. These nontoxic regimens overcome CD8+ and CD4+ T-cell-mediated alloresistance without requiring host T-cell depletion, permitting the induction of permanent mixed chimerism and tolerance.

  7. Use of CD40L immunoconjugates to overcome the defective immune response to vaccines for infections and cancer in the aged.

    Science.gov (United States)

    Tang, Yu Cheng; Thoman, Marilyn; Linton, Phyllis-Jean; Deisseroth, Albert

    2009-12-01

    :147-164, 1998; Ben-Yehuda and Weksler In: Cancer Investigation 10:525-531, 1992]. One of the more interesting examples of the functional defects in the cells of the adaptive immune response is a reduced level of expression in the surface cytoadhesion and activation receptor molecules on CD4 helper T cells undergoing activation during vaccination. Upon infection or vaccination, CD40L is typically increased on the surface of CD4 helper T cells during activation, and this increased expression is absolutely essential to the CD40L promotion of expansion of antigen-specific B cells and CD 8 effector T cells in response to infection or vaccination [Singh et al. In: Protein Sci 7:1124-1135, 1998; Grewal and Flavell In: Immunol Res 16: 59-70, 1997; Kornbluth In: J Hematother Stem Cell Res 11:787-801, 2002; Garcia de Vinuesa et al. In: Eur J Immunol 29:3216-3224, 1999]. In aged human beings and mice, the reduced levels of expression of CD40 ligand (CD40L) in activated CD4 helper T cells is dramatically reduced [Eaton et al. In: J Exp Med 200:1613-1622, 2004; Dong et al. In: J Gen Virol 84:1623-1628, 2003]. To circumvent the reduction in CD40L expression and the subsequent reduction in immune response in the elderly, we have developed a chimeric vaccine comprised of the CD40L linked to the target antigen, in a replication incompetent adenoviral vector and in booster protein. This review will discuss the implementation the potential use of this approach for the vaccination of the older populations for cancer and infection.

  8. Anti-inflammatory and anti-thrombotic intervention strategies using atorvastatin, clopidogrel and knock-down of CD40L do not modify radiation-induced atherosclerosis in ApoE null mice

    NARCIS (Netherlands)

    Hoving, Saske; Heeneman, Sylvia; Gijbels, Marion J. J.; te Poele, Johannes A. M.; Pol, Jeffrey F. C.; Gabriels, Karen; Russell, Nicola S.; Daemen, Mat J. A. P.; Stewart, Fiona A.

    2011-01-01

    We previously showed that irradiating the carotid arteries of ApoE(-/-) mice accelerated the development of macrophage-rich, inflammatory and thrombotic atherosclerotic lesions. In this study we investigated the potential of anti-inflammatory (atorvastatin, CD40L knockout) and anti-thrombotic

  9. Maturation of dendritic cells by recombinant human CD40L-trimer leads to a homogeneous cell population with enhanced surface marker expression and increased cytokine production

    DEFF Research Database (Denmark)

    Würtzen, P A; Nissen, Mogens Holst; Claesson, M H

    2001-01-01

    -cell activating capacity of the DC. We studied DC phenotype and cytokine production as well as the T-cell proliferation and cytotoxic T lympocyte (CTL) activation induced by DC generated in vitro. In addition, the effect of exposure to recombinant human CD40L-trimer (huCD40LT) on these parameters was investigated...... enhanced by exposure to huCD40LT even compared to TNF-alpha exposure. Only a moderate cytokine production was observed initially, while TNF-alpha addition or CD40 triggering, especially, induced enhanced production of IL-6 and IL-12 p40. Surprisingly, comparable induction of T-cell proliferation by a DC......Dendritic cells (DC) have been shown to be potent inducers of specific cytotoxic T-cell responses both in vivo and in vitro. Furthermore, exposure to cytokines such as tumour necrosis factor (TNF)-alpha or CD40 triggering changes DC phenotype and cytokine production and may enhance the T...

  10. Maturation of dendritic cells by recombinant human CD40L-trimer leads to a homogeneous cell population with enhanced surface marker expression and increased cytokine production

    DEFF Research Database (Denmark)

    Würtzen, P A; Nissen, Mogens Holst; Claesson, M H

    2001-01-01

    Dendritic cells (DC) have been shown to be potent inducers of specific cytotoxic T-cell responses both in vivo and in vitro. Furthermore, exposure to cytokines such as tumour necrosis factor (TNF)-alpha or CD40 triggering changes DC phenotype and cytokine production and may enhance the T-cell act...... marker expression and high production of pro-inflammatory cytokines. In addition, the induction of responses to allo or recall antigens presented by huCD40LT maturated DC was comparable to the responses obtained with the DC maturated through TNF-alpha exposure.......Dendritic cells (DC) have been shown to be potent inducers of specific cytotoxic T-cell responses both in vivo and in vitro. Furthermore, exposure to cytokines such as tumour necrosis factor (TNF)-alpha or CD40 triggering changes DC phenotype and cytokine production and may enhance the T......-cell activating capacity of the DC. We studied DC phenotype and cytokine production as well as the T-cell proliferation and cytotoxic T lympocyte (CTL) activation induced by DC generated in vitro. In addition, the effect of exposure to recombinant human CD40L-trimer (huCD40LT) on these parameters was investigated...

  11. Induction of IL-12 Production in Human Peripheral Monocytes by Trypanosoma cruzi Is Mediated by Glycosylphosphatidylinositol-Anchored Mucin-Like Glycoproteins and Potentiated by IFN-γ and CD40-CD40L Interactions

    Directory of Open Access Journals (Sweden)

    Lúcia Cristina Jamli Abel

    2014-01-01

    Full Text Available Chagas disease, caused by the protozoan parasite Trypanosoma cruzi (T. cruzi, is characterized by immunopathology driven by IFN-γ secreting Th1-like T cells. T. cruzi has a thick coat of mucin-like glycoproteins covering its surface, which plays an important role in parasite invasion and host immunomodulation. It has been extensively described that T. cruzi or its products—like GPI anchors isolated from GPI-anchored mucins from the trypomastigote life cycle stage (tGPI-mucins—are potent inducers of proinflammatory responses (i.e., cytokines and NO production by IFN-γ primed murine macrophages. However, little is known about whether T. cruzi or GPI-mucins exert a similar action in human cells. We therefore decided to further investigate the in vitro cytokine production profile from human mononuclear cells from uninfected donors exposed to T. cruzi as well as tGPI-mucins. We observed that both living T. cruzi trypomastigotes and tGPI-mucins are potent inducers of IL-12 by human peripheral blood monocytes and this effect depends on CD40-CD40L interaction and IFN-γ. Our findings suggest that the polarized T1-type cytokine profile seen in T. cruzi infected patients might be a long-term effect of IL-12 production induced by lifelong exposure to T. cruzi tGPI-mucins.

  12. Th cells promote CTL survival and memory via acquired pMHC-I and endogenous IL-2 and CD40L signaling and by modulating apoptosis-controlling pathways.

    Directory of Open Access Journals (Sweden)

    Channakeshava Sokke Umeshappa

    Full Text Available Involvement of CD4(+ helper T (Th cells is crucial for CD8(+ cytotoxic T lymphocyte (CTL-mediated immunity. However, CD4(+ Th's signals that govern CTL survival and functional memory are still not completely understood. In this study, we assessed the role of CD4(+ Th cells with acquired antigen-presenting machineries in determining CTL fates. We utilized an adoptive co-transfer into CD4(+ T cell-sufficient or -deficient mice of OTI CTLs and OTII Th cells or Th cells with various gene deficiencies pre-stimulated in vitro by ovalbumin (OVA-pulsed dendritic cell (DCova. CTL survival was kinetically assessed in these mice using FITC-anti-CD8 and PE-H-2K(b/OVA257-264 tetramer staining by flow cytometry. We show that by acting via endogenous CD40L and IL-2, and acquired peptide-MHC-I (pMHC-I complex signaling, CD4(+ Th cells enhance survival of transferred effector CTLs and their differentiation into the functional memory CTLs capable of protecting against highly-metastasizing tumor challenge. Moreover, RT-PCR, flow cytometry and Western blot analysis demonstrate that increased survival of CD4(+ Th cell-helped CTLs is matched with enhanced Akt1/NF-κB activation, down-regulation of TRAIL, and altered expression profiles with up-regulation of prosurvival (Bcl-2 and down-regulation of proapoptotic (Bcl-10, Casp-3, Casp-4, Casp-7 molecules. Taken together, our results reveal a previously unexplored mechanistic role for CD4(+ Th cells in programming CTL survival and memory recall responses. This knowledge could also aid in the development of efficient adoptive CTL cancer therapy.

  13. Novel exosome-targeted T-cell-based vaccine counteracts T-cell anergy and converts CTL exhaustion in chronic infection via CD40L signaling through the mTORC1 pathway.

    Science.gov (United States)

    Wang, Rong; Xu, Aizhang; Zhang, Xueying; Wu, Jie; Freywald, Andrew; Xu, Jianqing; Xiang, Jim

    2017-06-01

    CD8 + cytotoxic T lymphocyte (CTL) exhaustion is a chief issue for ineffective virus elimination in chronic infectious diseases. We generated novel ovalbumin (OVA)-specific OVA-Texo and HIV-specific Gag-Texo vaccines inducing therapeutic immunity. To assess their therapeutic effect in chronic infection, we developed a new chronic infection model by i.v. infecting C57BL/6 mice with the OVA-expressing adenovirus AdVova. During chronic AdVova infection, mouse CTLs were found to express the inhibitory molecules programmed cell-death protein-1 (PD-1) and lymphocyte-activation gene-3 (LAG-3) and to be functionally exhausted, showing a significant deficiency in T-cell proliferation, IFN-γ production and cytolytic effects. Naive CD8 + T cells upregulated inhibitory PD-ligand 1 (PD-L1), B- and T-lymphocyte attenuator and T-cell anergy-associated molecules (Grail and Itch) while down-regulating the proliferative response upon stimulation in mice with chronic infection. Remarkably, the OVA-Texo vaccine counteracted T-cell anergy and converted CTL exhaustion. The latter was associated with (i) the upregulation of a marker for CTL functionality, diacetylated histone-H3 (diAcH3), (ii) a fourfold increase in CTLs, occurring independent of host DCs or CD4 + T cells, and (iii) the restoration of CTL IFN-γ production and cytotoxicity. In vivo OVA-Texo-stimulated CTLs upregulated the activities of the mTORC1 pathway-related molecules Akt, S6, eIF4E and T-bet, and treatment of the CTLs with an mTORC1 inhibitor, rapamycin, significantly reduced the OVA-Texo-induced increase in CTLs. Interestingly, OVA-Texo-mediated CD40L signaling played a critical role in the observed immunological effects. Importantly, the Gag-Texo vaccine induced Gag-specific therapeutic immunity in chronic infection. Therefore, this study should have a serious impact on the development of new therapeutic vaccines for human immunodeficiency virus (HIV-1) infection.

  14. Combination of monoclonal antibodies with DST inhibits accelerated rejection mediated by memory T cells to induce long-lived heart allograft acceptance in mice.

    Science.gov (United States)

    Shao, Wei; Chen, Jibing; Dai, Helong; Peng, Yuanzheng; Wang, Feng; Xia, Junjie; Thorlacius, Henrik; Zhu, Qi; Qi, Zhongquan

    2011-08-30

    Donor-reactive memory T cells mediated accelerated rejection is known as a barrier to the survival of transplanted organs. We investigated the combination of different monoclonal antibodies (mAbs) and donor-specific transfusion (DST) in memory T cells-based adoptive mice model. In the presence of donor-reactive memory T cells, the mean survival time (MST) of grafts in the anti-CD40L/LFA-1/DST group was 49.8d. Adding anti-CD44/CD70 mAbs to anti-CD40L/LFA-1/DST treatment. The MST was more than 100 d (MST>100 d). Compared with anti-CD40L/LFA-1/DST group, anti-CD40L/LFA-1/CD44/CD70/DST group notably reduced the expansion of memory T cells, enhanced the proportion of CD4+Foxp3+ regulatory T cells (Tregs) and suppressed donor-specific responses. Our data suggest that anti-CD40L/LFA-1/CD44/CD70mAbs and DST can synergistically inhibit accelerated rejection mediated by memory T cells to induce long-lived heart allograft acceptance in mice. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. DNA Profiling of Convicted Offender Samples for the Combined DNA Index System

    Science.gov (United States)

    Millard, Julie T

    2011-01-01

    The cornerstone of forensic chemistry is that a perpetrator inevitably leaves trace evidence at a crime scene. One important type of evidence is DNA, which has been instrumental in both the implication and exoneration of thousands of suspects in a wide range of crimes. The Combined DNA Index System (CODIS), a network of DNA databases, provides…

  16. Design and Discovery of New Combinations of Mutant DNA Polymerases and Modified DNA Substrates.

    Science.gov (United States)

    Rosenblum, Sydney L; Weiden, Aurora G; Lewis, Eliza L; Ogonowsky, Alexie L; Chia, Hannah E; Barrett, Susanna E; Liu, Mira D; Leconte, Aaron M

    2017-04-18

    Chemical modifications can enhance the properties of DNA by imparting nuclease resistance and generating more-diverse physical structures. However, native DNA polymerases generally cannot synthesize significant lengths of DNA with modified nucleotide triphosphates. Previous efforts have identified a mutant of DNA polymerase I from Thermus aquaticus DNA (SFM19) as capable of synthesizing a range of short, 2'-modified DNAs; however, it is limited in the length of the products it can synthesize. Here, we rationally designed and characterized ten mutants of SFM19. From this, we identified enzymes with substantially improved activity for the synthesis of 2'F-, 2'OH-, 2'OMe-, and 3'OMe-modified DNA as well as for reverse transcription of 2'OMe DNA. We also evaluated mutant DNA polymerases previously only tested for synthesis for 2'OMe DNA and showed that they are capable of an expanded range of modified DNA synthesis. This work significantly expands the known combinations of modified DNA and Taq DNA polymerase mutants. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  18. A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation

    Directory of Open Access Journals (Sweden)

    Tierling Sascha

    2010-06-01

    Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.

  19. Combining bleach and mild predigestion improves ancient DNA recovery from bones

    DEFF Research Database (Denmark)

    Boessenkool, Sanne; Hanghøj, Kristian Ebbesen; Nistelberger, Heidi M.

    2017-01-01

    aimed to improve ancient DNA recovery before library amplification have recently been developed. Here, we test the effects of combining two of such protocols, a bleach wash and a predigestion step, on 12 bone samples of Atlantic cod and domestic horse aged 750-1350 cal. years before present. Using high......-throughput sequencing, we show that combined together, bleach wash and predigestion consistently yield DNA libraries with higher endogenous content than either of these methods alone. Additionally, the molecular complexity of these libraries is improved and endogenous DNA templates show larger size distributions. Other...... library characteristics, such as DNA damage profiles or the composition of microbial communities, are little affected by the pre-extraction protocols. Application of the combined protocol presented in this study will facilitate the genetic analysis of an increasing number of ancient remains...

  20. Combined beta-galactosidase and immunogold/silver staining for immunohistochemistry and DNA in situ hybridization

    NARCIS (Netherlands)

    van den Brink, W.; van der Loos, C.; Volkers, H.; Lauwen, R.; van den Berg, F.; Houthoff, H. J.; Das, P. K.

    1990-01-01

    A combination of beta-galactosidase enzyme and the immunogold/silver staining method was studied for evaluation of double-staining experiments. Applications are shown for immunohistochemical double staining using two monoclonal antibodies and for combined immunohistochemistry and DNA in situ

  1. Novel vaccine against Venezuelan equine encephalitis combines advantages of DNA immunization and a live attenuated vaccine.

    Science.gov (United States)

    Tretyakova, Irina; Lukashevich, Igor S; Glass, Pamela; Wang, Eryu; Weaver, Scott; Pushko, Peter

    2013-02-04

    DNA vaccines combine remarkable genetic and chemical stability with proven safety and efficacy in animal models, while remaining less immunogenic in humans. In contrast, live-attenuated vaccines have the advantage of inducing rapid, robust, long-term immunity after a single-dose vaccination. Here we describe novel iDNA vaccine technology that is based on an infectious DNA platform and combines advantages of DNA and live attenuated vaccines. We applied this technology for vaccination against infection with Venezuelan equine encephalitis virus (VEEV), an alphavirus from the Togaviridae family. The iDNA vaccine is based on transcription of the full-length genomic RNA of the TC-83 live-attenuated virus from plasmid DNA in vivo. The in vivo-generated viral RNA initiates limited replication of the vaccine virus, which in turn leads to efficient immunization. This technology allows the plasmid DNA to launch a live-attenuated vaccine in vitro or in vivo. Less than 10 ng of pTC83 iDNA encoding the full-length genomic RNA of the TC-83 vaccine strain initiated replication of the vaccine virus in vitro. In order to evaluate this approach in vivo, BALB/c mice were vaccinated with a single dose of pTC83 iDNA. After vaccination, all mice seroconverted with no adverse reactions. Four weeks after immunization, animals were challenged with the lethal epidemic strain of VEEV. All iDNA-vaccinated mice were protected from fatal disease, while all unvaccinated controls succumbed to infection and died. To our knowledge, this is the first example of launching a clinical live-attenuated vaccine from recombinant plasmid DNA in vivo. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Efficient vaccine against pandemic influenza: combining DNA vaccination and targeted delivery to MHC class II molecules.

    Science.gov (United States)

    Grødeland, Gunnveig; Bogen, Bjarne

    2015-06-01

    There are two major limitations to vaccine preparedness in the event of devastating influenza pandemics: the time needed to generate a vaccine and rapid generation of sufficient amounts. DNA vaccination could represent a solution to these problems, but efficacy needs to be enhanced. In a separate line of research, it has been established that targeting of vaccine molecules to antigen-presenting cells enhances immune responses. We have combined the two principles by constructing DNA vaccines that encode bivalent fusion proteins; these target hemagglutinin to MHC class II molecules on antigen-presenting cells. Such DNA vaccines rapidly induce hemagglutinin-specific antibodies and T cell responses in immunized mice. Responses are long-lasting and protect mice against challenge with influenza virus. In a pandemic situation, targeted DNA vaccines could be produced and tested within a month. The novel DNA vaccines could represent a solution to pandemic preparedness in the advent of novel influenza pandemics.

  3. Combining crystallography and EPR: crystal and solution structures of the multidomain cochaperone DnaJ

    Energy Technology Data Exchange (ETDEWEB)

    Barends, Thomas R. M., E-mail: thomas.barends@mpimf-heidelberg.mpg.de [MPI for Medical Research, Heidelberg (Germany); Brosi, Richard W. W. [Freie Universitat Berlin, Berlin (Germany); Steinmetz, Andrea; Scherer, Anna; Hartmann, Elisabeth; Eschenbach, Jessica; Lorenz, Thorsten [MPI for Medical Research, Heidelberg (Germany); Seidel, Ralf [MPI for Molecular Physiology, Dortmund (Germany); Shoeman, Robert L.; Zimmermann, Sabine [MPI for Medical Research, Heidelberg (Germany); Bittl, Robert [Freie Universitat Berlin, Berlin (Germany); Schlichting, Ilme; Reinstein, Jochen [MPI for Medical Research, Heidelberg (Germany)

    2013-08-01

    The crystal structure of the N-terminal part of T. thermophilus DnaJ unexpectedly showed an ordered GF domain and guided the design of a construct enabling the first structure determination of a complete DnaJ cochaperone molecule. By combining the crystal structures with spin-labelling EPR and cross-linking in solution, a dynamic view of this flexible molecule was developed. Hsp70 chaperones assist in a large variety of protein-folding processes in the cell. Crucial for these activities is the regulation of Hsp70 by Hsp40 cochaperones. DnaJ, the bacterial homologue of Hsp40, stimulates ATP hydrolysis by DnaK (Hsp70) and thus mediates capture of substrate protein, but is also known to possess chaperone activity of its own. The first structure of a complete functional dimeric DnaJ was determined and the mobility of its individual domains in solution was investigated. Crystal structures of the complete molecular cochaperone DnaJ from Thermus thermophilus comprising the J, GF and C-terminal domains and of the J and GF domains alone showed an ordered GF domain interacting with the J domain. Structure-based EPR spin-labelling studies as well as cross-linking results showed the existence of multiple states of DnaJ in solution with different arrangements of the various domains, which has implications for the function of DnaJ.

  4. Cell-free DNA testing after combined test: factors affecting the uptake.

    Science.gov (United States)

    Maiz, Nerea; Alzola, Irune; Murua, Emerson J; Rodríguez Santos, Javier

    2016-11-01

    First, to assess what was the uptake of cell free DNA (cfDNA) testing after a combined test and the maternal and fetal factors that influenced this decision, and second, to assess the uptake and factors that influence the choice of invasive testing. This observational retrospective study included 1083 singleton pregnancies who had a combined test for screening for Down syndrome between 11 (+) (0) and 13 (+) (6) weeks. Multivariate logistic regression analysis was used to determine which factors affected the uptake of cfDNA test and invasive testing among risk for trisomies 21, 18, and 13, maternal characteristics and fetal nuchal translucency (NT) thickness. Two-hundred fifty-seven (23.7%) women had a cfDNA test, 89 (8.2%) had an invasive test, and 737 (68.1%) had no further test. The uptake of cfDNA increased with the risk for trisomies (p < 0.001), maternal age (p = 0.013), and was higher in nulliparous women (p = 0.004). The uptake of invasive test increased with the risk for trisomies (p < 0.001) and NT thickness (p < 0.001). This study shows that the uptake of cfDNA testing increases with the risk for trisomies, maternal age, and is higher in nulliparous, whereas the uptake of invasive testing increases with the risk for trisomies and NT thickness.

  5. A Preclinical Study Combining the DNA Repair Inhibitor Dbait with Radiotherapy for the Treatment of Melanoma

    Directory of Open Access Journals (Sweden)

    Julian Biau

    2014-10-01

    Full Text Available Melanomas are highly radioresistant tumors, mainly due to efficient DNA double-strand break (DSB repair. Dbait (which stands for DNA strand break bait molecules mimic DSBs and trap DNA repair proteins, thereby inhibiting repair of DNA damage induced by radiation therapy (RT. First, the cytotoxic efficacy of Dbait in combination with RT was evaluated in vitro in SK28 and 501mel human melanoma cell lines. Though the extent of RT-induced damage was not increased by Dbait, it persisted for longer revealing a repair defect. Dbait enhanced RT efficacy independently of RT doses. We further assayed the capacity of DT01 (clinical form of Dbait to enhance efficacy of “palliative” RT (10 × 3 Gy or “radical” RT (20 × 3 Gy, in an SK28 xenografted model. Inhibition of repair of RT-induced DSB by DT01 was revealed by the significant increase of micronuclei in tumors treated with combined treatment. Mice treated with DT01 and RT combination had significantly better tumor growth control and longer survival compared to RT alone with the “palliative” protocol [tumor growth delay (TGD by 5.7-fold; median survival: 119 vs 67 days] or the “radical” protocol (TGD by 3.2-fold; median survival: 221 vs 109 days. Only animals that received the combined treatment showed complete responses. No additional toxicity was observed in any DT01-treated groups. This preclinical study provides encouraging results for a combination of a new DNA repair inhibitor, DT01, with RT, in the absence of toxicity. A first-in-human phase I study is currently under way in the palliative management of melanoma in-transit metastases (DRIIM trial.

  6. In vitro DNA binding studies of lenalidomide using spectroscopic in combination with molecular docking techniques

    Science.gov (United States)

    Xu, Liang; Hu, Yan-Xi; Li, Yan-Cheng; Zhang, Li; Ai, Hai-Xin; Liu, Yu-Feng; Liu, Hong-Sheng

    2018-02-01

    In the present work, the binding interaction between lenalidomide (LEN) and calf thymus DNA (ct-DNA) was systematically studied by using fluorescence, ultraviolet-visible (UV-vis) absorption, circular dichroism (CD) spectroscopies under imitated physiological conditions (pH = 7.4) coupled with molecular docking. It was found that LEN was bound to ct-DNA with high binding affinity (Ka = 2.308 × 105 M-1 at 283 K) through groove binding as evidenced by a slight decrease in the absorption intensity in combination with CD spectra. Thermodynamic parameters (ΔG 0 and ΔS interaction. Furthermore, competitive binding experiments with ethidium bromide and 4‧, 6-dia-midino-2-phenylindoleas probes showed that LEN could preferentially bind in the minor groove of double-stranded DNA. The average lifetime of LEN was calculated to be 7.645 ns. The φ of LEN was measured as 0.09 and non-radiation energy transfer between LEN and DNA had occurred. The results of the molecular docking were consistent with the experimental results. This study explored the potential applicability of the spectroscopic properties of LEN and also investigated its interactions with relevant biological targets. In addition, it will provide some theoretical references for the deep research of simultaneous administration of LEN with other drugs.

  7. [Combining SSH and cDNA microarray for identification of lung cancer related genes].

    Science.gov (United States)

    Fan, Baoxing; Zhang, Kaitai; Da, Jiping; Xie, Ling; Wang, Shengqi; Wu, Dechang

    2003-04-20

    To screen and identify differentially expressed genes among lung cancer tissues, paracancerous pulmonary tissues and some other kinds of tumor tissues using suppression subtractive hybridization (SSH) and cDNA Microarray. One cDNA chip was made by gathering clones of three differentially expressed cDNA libraries which came from BEP2D cell lines during three different malignant transformed phases. Then the clones were hybridizated with cDNA probes which extracted from 15 cases of lung cancer tissues, 5 cases of paracancerous pulmonary tissues and 24 cases of other 8 kinds of tumor tissues respectively. Twenty-six cDNAs were obtained which expressed higher in lung cancer tissues than that in paracancerous pulmonary tissues. Thirty-one cDNAs expressed remarkably higher in paracancerous tissues than those in cancer tissues. Compared with other 8 kinds of tumors, paracancerous tissues had 63 overexpressed cDNAs and lung cancer tissues had 87 overexpressed cDNAs. The combination of SSH and cDNA microarray is rapid and effective for screening and identification of differentially expressed genes in different samples. It may be potentially useful for diagnosis of lung cancer to further study the differentially expressed genes among lung cancer tissues, paracancerous pulmonary tissues and other tumor tissues.

  8. Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

    Directory of Open Access Journals (Sweden)

    Kornbluth Richard S

    2009-08-01

    Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

  9. Augmentation of French grunt diet description using combined visual and DNA-based analyses

    Science.gov (United States)

    Hargrove, John S.; Parkyn, Daryl C.; Murie, Debra J.; Demopoulos, Amanda W.J.; Austin, James D.

    2012-01-01

    Trophic linkages within a coral-reef ecosystem may be difficult to discern in fish species that reside on, but do not forage on, coral reefs. Furthermore, dietary analysis of fish can be difficult in situations where prey is thoroughly macerated, resulting in many visually unrecognisable food items. The present study examined whether the inclusion of a DNA-based method could improve the identification of prey consumed by French grunt, Haemulon flavolineatum, a reef fish that possesses pharyngeal teeth and forages on soft-bodied prey items. Visual analysis indicated that crustaceans were most abundant numerically (38.9%), followed by sipunculans (31.0%) and polychaete worms (5.2%), with a substantial number of unidentified prey (12.7%). For the subset of prey with both visual and molecular data, there was a marked reduction in the number of unidentified sipunculans (visual – 31.1%, combined &ndash 4.4%), unidentified crustaceans (visual &ndash 15.6%, combined &ndash 6.7%), and unidentified taxa (visual &ndash 11.1%, combined &ndash 0.0%). Utilising results from both methodologies resulted in an increased number of prey placed at the family level (visual &ndash 6, combined &ndash 33) and species level (visual &ndash 0, combined &ndash 4). Although more costly than visual analysis alone, our study demonstrated the feasibility of DNA-based identification of visually unidentifiable prey in the stomach contents of fish.

  10. Designing and constructing an 100 bp DNA Ladder by combining PCR and enzyme digestion methods

    Directory of Open Access Journals (Sweden)

    Saidijam M

    2011-05-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Molecular DNA markers are one of the most important tools in molecular biology labs. The size of DNA molecules is determined by comparing them with known bands of markers during gel electrophoresis. There are many different protocols to produce these kinds of molecular markers. In this study we have suggested an efficient strategy to produce molecular weight markers in industrial proportions."n"nMethods : To achieve the desired sizes of DNA fragments, a combination of two previously known methods, restriction enzyme digestion and polymerase chain reaction (PCR, were used. The enzymatic digestion process was based on designing and constructing plasmids which equaled in size with the desired length of DNA fragments and produced the desired DNA fragment upon linearization. In the PCR method, the desired length of DNA fragments were cloned in multiple cloning sites of pTZ57R plasmid and in a PCR reaction, the new constructed plasmid was used as a template to produce the final fragment."n"nResults : Upon application of this strategy, 2000 and 3000 bp DNA fragments were produced by enzymatic digestion of plasmids of the same size. Moreover, 100 to 1500 bp fragments were produced during PCR using only a set of

  11. Combining polyethylenimine and Fe(III) for mediating pDNA transfection.

    Science.gov (United States)

    Jorge, Andreia F; Röder, Ruth; Kos, Petra; Dias, Rita S; Wagner, Ernst; Pais, Alberto A C C

    2015-06-01

    The potential use of Fe(III) ions in biomedical applications may predict the interest of its combination with pDNA-PEI polyplexes. The present work aims at assessing the impact of this metal on pDNA complex properties. Variations in the formation of complexes were imposed by using two types of biological buffers at different salt conditions. The incorporation of pDNA in complexes was characterised by gel electrophoresis and dynamic light scattering. Transfection efficiency and cytotoxicity were evaluated in HeLa and HUH-7 cell lines, supported by flow cytometry assays. Fe(III) enhances pDNA incorporation in the complex, irrespective of the buffer used. Transfection studies reveal that the addition of Fe(III) to complexes at low ionic strength reduces gene transfection, while those prepared under high salt content do not affect or, in a specific case, increase gene transfection up to 5 times. This increase may be a consequence of a favoured interaction of polyplexes with cell membrane and uptake. At low salt conditions, results attained with chloroquine indicate that the metal may inhibit polyplex endosomal escape. A reduction on the amount of PEI (N/P 5) formed at intermediary ionic strength, complemented by Fe(III), reduces the size of complexes while maintaining a transfection efficiency similar to that obtained to N/P 6. Fe(III) emerges as a good supporting condensing agent to modulate pDNA-PEI properties, including condensation, size and cytotoxicity, without a large penalty on gene transfection. This study highlights important aspects that govern pDNA transfection and elucidates the benefits of incorporating the versatile Fe(III) in a gene delivery system. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Microdosimetry calculations for monoenergetic electrons using Geant4-DNA combined with a weighted track sampling algorithm.

    Science.gov (United States)

    Famulari, Gabriel; Pater, Piotr; Enger, Shirin A

    2017-07-07

    The aim of this study was to calculate microdosimetric distributions for low energy electrons simulated using the Monte Carlo track structure code Geant4-DNA. Tracks for monoenergetic electrons with kinetic energies ranging from 100 eV to 1 MeV were simulated in an infinite spherical water phantom using the Geant4-DNA extension included in Geant4 toolkit version 10.2 (patch 02). The microdosimetric distributions were obtained through random sampling of transfer points and overlaying scoring volumes within the associated volume of the tracks. Relative frequency distributions of energy deposition f(>E)/f(>0) and dose mean lineal energy ([Formula: see text]) values were calculated in nanometer-sized spherical and cylindrical targets. The effects of scoring volume and scoring techniques were examined. The results were compared with published data generated using MOCA8B and KURBUC. Geant4-DNA produces a lower frequency of higher energy deposits than MOCA8B. The [Formula: see text] values calculated with Geant4-DNA are smaller than those calculated using MOCA8B and KURBUC. The differences are mainly due to the lower ionization and excitation cross sections of Geant4-DNA for low energy electrons. To a lesser extent, discrepancies can also be attributed to the implementation in this study of a new and fast scoring technique that differs from that used in previous studies. For the same mean chord length ([Formula: see text]), the [Formula: see text] calculated in cylindrical volumes are larger than those calculated in spherical volumes. The discrepancies due to cross sections and scoring geometries increase with decreasing scoring site dimensions. A new set of [Formula: see text] values has been presented for monoenergetic electrons using a fast track sampling algorithm and the most recent physics models implemented in Geant4-DNA. This dataset can be combined with primary electron spectra to predict the radiation quality of photon and electron beams.

  13. Detection of genetically modified crops by combination of multiplex PCR and low-density DNA microarray.

    Science.gov (United States)

    Zhou, Ping-Ping; Zhang, Jian-Zhong; You, Yuan-Hai; Wu, Yong-Ning

    2008-02-01

    To develop a technique for simultaneous detection of various target genes in Roundup Ready soybean by combining multiplex PCR and low-density DNA microarray. Two sets of the multiplex PCR system were used to amplify the target genes in genetically modified (GM) soybean. Seventeen capture probes (PCR products) and 17 pairs of corresponding primers were designed according to the genetic characteristics of Rroundup Ready soybean (GTS40-3-2), maize (Mon810, Nk603, GA21), canola (T45, MS1/RF1), and rice (SCK) in many identified GM crops. All of the probes were categorized and identified as species-specific probes. One negative probe and one positive control probe were used to assess the efficiency of all reactions, and therefore eliminate any false positive and negative results. After multiplex PCR reaction, amplicons were adulterated with Cy5-dUTP and hybridized with DNA microarray. The array was then scanned to display the specific hybridization signals of target genes. The assay was applied to the analysis of sample of certified transgenic soybean (Roundup Ready GTS40-3-2) and canola (MS1/RF1). A combination technique of multiplex PCR and DNA microarray was successfully developed to identify multi-target genes in Roundup Ready soybean and MS1/RF1 canola with a great specificity and reliability. Reliable identification of genetic characteristics of Roundup Ready of GM soybean from genetically modified crops was achieved at 0.5% transgenic events, indicating a high sensitivity. A combination technique of multiplex PCR and low-density DNA microarray can reliably detect and identify the genetically modified crops.

  14. Peptidomics combined with cDNA library unravel the diversity of centipede venom

    DEFF Research Database (Denmark)

    Rong, Mingqiang; Yang, Shilong; Wen, Bo

    2015-01-01

    the extensive diversity of centipede toxins and provide powerful tools to understand the capture and defense weapon of centipede. BIOLOGICAL SIGNIFICANCE: Peptide toxins from venomous animal have attracted increasing attentions due to their extraordinary chemical and pharmacological diversity. Centipedes......UNLABELLED: Centipedes are one of the oldest venomous arthropods using toxin as their weapon to capture prey. But little attention was focused on them and only few centipede toxins were demonstrated with activity on ion channels. Therefore, more deep works are needed to understand the diversity...... of centipede venom. In the present study, we use peptidomics combined with cDNA library to uncover the diversity of centipede Scolopendra subspinipes mutilans L. Koch. 192 peptides were identified by LC-MS/MS and 79 precursors were deduced by cDNA library. Surprisingly, the signal peptides of centipede toxins...

  15. GANN: Genetic algorithm neural networks for the detection of conserved combinations of features in DNA

    Directory of Open Access Journals (Sweden)

    Beiko Robert G

    2005-02-01

    Full Text Available Abstract Background The multitude of motif detection algorithms developed to date have largely focused on the detection of patterns in primary sequence. Since sequence-dependent DNA structure and flexibility may also play a role in protein-DNA interactions, the simultaneous exploration of sequence- and structure-based hypotheses about the composition of binding sites and the ordering of features in a regulatory region should be considered as well. The consideration of structural features requires the development of new detection tools that can deal with data types other than primary sequence. Results GANN (available at http://bioinformatics.org.au/gann is a machine learning tool for the detection of conserved features in DNA. The software suite contains programs to extract different regions of genomic DNA from flat files and convert these sequences to indices that reflect sequence and structural composition or the presence of specific protein binding sites. The machine learning component allows the classification of different types of sequences based on subsamples of these indices, and can identify the best combinations of indices and machine learning architecture for sequence discrimination. Another key feature of GANN is the replicated splitting of data into training and test sets, and the implementation of negative controls. In validation experiments, GANN successfully merged important sequence and structural features to yield good predictive models for synthetic and real regulatory regions. Conclusion GANN is a flexible tool that can search through large sets of sequence and structural feature combinations to identify those that best characterize a set of sequences.

  16. Methyl-binding domain protein-based DNA isolation from human blood serum combines DNA analyses and serum-autoantibody testing

    Directory of Open Access Journals (Sweden)

    Jungbauer Christof

    2011-09-01

    Full Text Available Abstract Background Circulating cell free DNA in serum as well as serum-autoantibodies and the serum proteome have great potential to contribute to early cancer diagnostics via non invasive blood tests. However, most DNA preparation protocols destroy the protein fraction and therefore do not allow subsequent protein analyses. In this study a novel approach based on methyl binding domain protein (MBD is described to overcome the technical difficulties of combining DNA and protein analysis out of one single serum sample. Methods Serum or plasma samples from 98 control individuals and 54 breast cancer patients were evaluated upon silica membrane- or MBD affinity-based DNA isolation via qPCR targeting potential DNA methylation markers as well as by protein-microarrays for tumor-autoantibody testing. Results In control individuals, an average DNA level of 22.8 ± 25.7 ng/ml was detected applying the silica membrane based protocol and 8.5 ± 7.5 ng/ml using the MBD-approach, both values strongly dependent on the serum sample preparation methods used. In contrast to malignant and benign tumor serum samples, cell free DNA concentrations were significantly elevated in sera of metastasizing breast cancer patients. Technical evaluation revealed that serum upon MBD-based DNA isolation is suitable for protein-array analyses when data are consistent to untreated serum samples. Conclusion MBD affinity purification allows DNA isolations under native conditions retaining the protein function, thus for example enabling combined analyses of DNA methylation and autoantigene-profiles from the same serum sample and thereby improving minimal invasive diagnostics.

  17. Clinical variability in neurohepatic syndrome due to combined mitochondrial DNA depletion and Gaucher disease

    Directory of Open Access Journals (Sweden)

    Julie Harvengt

    2014-01-01

    Full Text Available A 1-year-old girl born to consanguineous parents presented with unexplained liver failure, leading to transplantation at 19 months. Subsequent partial splenectomy for persistent cytopenia showed the presence of foamy cells, and Gaucher disease was confirmed by homozygosity for the p.Leu483Pro mutation in the GBA gene. She was treated by enzyme replacement therapy (ERT. Clinical follow-up showed mild developmental delay, strabismus, nystagmus and oculomotor apraxia. Biochemical studies revealed multiple respiratory chain deficiencies and a mosaic pattern of deficient complex IV immunostaining in liver and fibroblast. Molecular analysis identified a mtDNA depletion syndrome due to the homozygous p.Pro98Leu mutation in MPV17. A younger sister unaffected by mtDNA depletion, presented with pancytopenia and hepatosplenomegaly. ERT for Gaucher disease resulted in visceral normalization without any neurological symptom. A third sister, affected by both conditions, had marked developmental delay, strabismus and ophthalmoplegia but no liver cirrhosis. In conclusion, intrafamilal variability occurs in MPV17-related disease. The combined pathological effect of Gaucher and mitochondrial diseases can negatively impact neurological and liver functions and influence the outcome in consanguineous families. The immunocytochemical staining of OXPHOS protein in tissues and cultured cells is a powerful tool revealing mosaic pattern of deficiency pointing to mtDNA-related mitochondrial disorders.

  18. Combined sequencing of mRNA and DNA from human embryonic stem cells.

    Science.gov (United States)

    Mertes, Florian; Kuhl, Heiner; Wruck, Wasco; Lehrach, Hans; Adjaye, James

    2016-06-01

    Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells) derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A) mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO) database under accession number GSE69471.

  19. Combining natural and man-made DNA tracers to advance understanding of hydrologic flow pathway evolution

    Science.gov (United States)

    Dahlke, H. E.; Walter, M. T.; Lyon, S. W.; Rosqvist, G. N.

    2014-12-01

    Identifying and characterizing the sources, pathways and residence times of water and associated constituents is critical to developing improved understanding of watershed-stream connections and hydrological/ecological/biogeochemical models. To date the most robust information is obtained from integrated studies that combine natural tracers (e.g. isotopes, geochemical tracers) with controlled chemical tracer (e.g., bromide, dyes) or colloidal tracer (e.g., carboxilated microspheres, tagged clay particles, microorganisms) applications. In the presented study we explore how understanding of sources and flow pathways of water derived from natural tracer studies can be improved and expanded in space and time by simultaneously introducing man-made, synthetic DNA-based microtracers. The microtracer used were composed of polylactic acid (PLA) microspheres into which short strands of synthetic DNA and paramagnetic iron oxide nanoparticles are incorporated. Tracer experiments using both natural tracers and the DNA-based microtracers were conducted in the sub-arctic, glacierized Tarfala (21.7 km2) catchment in northern Sweden. Isotopic hydrograph separations revealed that even though storm runoff was dominated by pre-event water the event water (i.e. rainfall) contributions to streamflow increased throughout the summer season as glacial snow cover decreased. This suggests that glaciers are a major source of the rainwater fraction in streamflow. Simultaneous injections of ten unique DNA-based microtracers confirmed this hypothesis and revealed that the transit time of water traveling from the glacier surface to the stream decreased fourfold over the summer season leading to instantaneous rainwater contributions during storm events. These results highlight that integrating simultaneous tracer injections (injecting tracers at multiple places at one time) with traditional tracer methods (sampling multiple times at one place) rather than using either approach in isolation can

  20. [Combined first trimester screening and cell-free fetal DNA - “next generation screening”].

    Science.gov (United States)

    Kagan, K O; Eiben, B; Kozlowski, P

    2014-06-01

    In the last decades, prenatal screening for aneuploidy has become increasingly effective. While first trimester combined screening is considered to be the current gold standard, the use of cell-free fetal DNA (cffDNA), which is also called noninvasive prenatal testing (NIPT), will result in a change of paradigm. Respective studies indicate that in screening for trisomy 21, the detection and false-positive rates are 99 % and 0.1 %, respectively. For trisomies 18 and 13, there is less evidence but recent studies report detection rates of 98 % and 86 %. Despite the excellent results in screening for trisomy 21, NIPT should not be considered as a diagnostic test. Due to the costs of NIPT, it is unlikely that NIPT will be applied in the near future in population-based screening for trisomy. In addition, the scope of the current approach in first trimester screening exceeds the screening for aneuploidy as it is possible to assess the risk for various pregnancy complications. Therefore, a combination of both NIPT and first trimester combined screening seems reasonable. Both examinations could be applied in a contingent model where the latter is offered to everyone and NIPT is restricted to women with an intermediate risk after first trimester combined screening. Such a policy would result in a detection rate of about 97 % for a false-positive rate of about 1 %. While NIPT currently focuses on screening for trisomy 21, 18, 13 and sex chromosomal abnormalities, the scope of NIPT will soon become broader. In this respect, some study groups have managed to examine the whole fetal genome within the course of the pregnancy. However, moral and ethical considerations need to be taken into account. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Combination probes with intercalating anchors and proximal fluorophores for DNA and RNA detection.

    Science.gov (United States)

    Qiu, Jieqiong; Wilson, Adam; El-Sagheer, Afaf H; Brown, Tom

    2016-09-30

    A new class of modified oligonucleotides (combination probes) has been designed and synthesised for use in genetic analysis and RNA detection. Their chemical structure combines an intercalating anchor with a reporter fluorophore on the same thymine nucleobase. The intercalator (thiazole orange or benzothiazole orange) provides an anchor, which upon hybridisation of the probe to its target becomes fluorescent and simultaneously stabilizes the duplex. The anchor is able to communicate via FRET to a proximal reporter dye (e.g. ROX, HEX, ATTO647N, FAM) whose fluorescence signal can be monitored on a range of analytical devices. Direct excitation of the reporter dye provides an alternative signalling mechanism. In both signalling modes, fluorescence in the unhybridised probe is switched off by collisional quenching between adjacent intercalator and reporter dyes. Single nucleotide polymorphisms in DNA and RNA targets are identified by differences in the duplex melting temperature, and the use of short hybridization probes, made possible by the stabilisation provided by the intercalator, enhances mismatch discrimination. Unlike other fluorogenic probe systems, placing the fluorophore and quencher on the same nucleobase facilitates the design of short probes containing multiple modifications. The ability to detect both DNA and RNA sequences suggests applications in cellular imaging and diagnostics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Rapid Salmonella detection using an acoustic wave device combined with the RCA isothermal DNA amplification method

    Directory of Open Access Journals (Sweden)

    Antonis Kordas

    2016-12-01

    Full Text Available Salmonella enterica serovar Typhimurium is a major foodborne pathogen that causes Salmonellosis, posing a serious threat for public health and economy; thus, the development of fast and sensitive methods is of paramount importance for food quality control and safety management. In the current work, we are presenting a new approach where an isothermal amplification method is combined with an acoustic wave device for the development of a label free assay for bacteria detection. Specifically, our method utilizes a Love wave biosensor based on a Surface Acoustic Wave (SAW device combined with the isothermal Rolling Circle Amplification (RCA method; various protocols were tested regarding the DNA amplification and detection, including off-chip amplification at two different temperatures (30 °C and room temperature followed by acoustic detection and on-chip amplification and detection at room temperature, with the current detection limit being as little as 100 Bacteria Cell Equivalents (BCE/sample. Our acoustic results showed that the acoustic ratio, i.e., the amplitude over phase change observed during DNA binding, provided the only sensitive means for product detection while the measurement of amplitude or phase alone could not discriminate positive from negative samples. The method's fast analysis time together with other inherent advantages i.e., portability, potential for multi-analysis, lower sample volumes and reduced power consumption, hold great promise for employing the developed assay in a Lab on Chip (LoC platform for the integrated analysis of Salmonella in food samples. Keywords: Foodborne pathogen detection, Salmonella analysis, Rolling Circle Amplification, DNA biosensor, Lab-on-a-chip

  3. Laser microtreatment for genetic manipulations and DNA diagnostics by a combination of microbeam and photonic tweezers (laser microbeam trap)

    Science.gov (United States)

    Greulich, Karl-Otto; Monajembashi, Shamci; Celeda, D.; Endlich, N.; Eickhoff, Holger; Hoyer, Carsten; Leitz, G.; Weber, Gerd; Scheef, J.; Rueterjans, H.

    1994-12-01

    Genomes of higher organisms are larger than one typically expects. For example, the DNA of a single human cell is almost two meters long, the DNA in the human body covers the distance Earth-Sun approximately 140 times. This is often not considered in typical molecular biological approaches for DNA diagnostics, where usually only DNA of the length of a gene is investigated. Also, one basic aspect of sequencing the human genome is not really solved: the problem how to prepare the huge amounts of DNA required. Approaches from biomedical optics combined with new developments in single molecule biotechnology may at least contribute some parts of the puzzle. A large genome can be partitioned into portions comprising approximately 1% of the whole DNA using a laser microbeam. The single DNA fragment can be amplified by the polymerase chain reaction in order to obtain a sufficient amount of molecules for conventional DNA diagnostics or for analysis by octanucleotide hybridization. When not amplified by biotechnological processes, the individual DNA molecule can be visualized in the light microscope and can be manipulated and dissected with the laser microbeam trap. The DNA probes obtained by single molecule biotechnology can be employed for fluorescence in situ introduced into plant cells and subcellular structures even when other techniques fail. Since the laser microbeam trap allows to work in the interior of a cell without opening it, subcellular structures can be manipulated. For example, in algae, such structures can be moved out of their original position and used to study intracellular viscosities.

  4. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Directory of Open Access Journals (Sweden)

    Pamornpathomkul B

    2017-01-01

    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  5. [Extraction of sperm DNA from mixed stain by the modified differential lysis method combined with silicon bead method].

    Science.gov (United States)

    Han, Hai-Jun; Zhang, Yu-Hong; Yang, Min; Yi, Hai; Yang, Geng-Ye; Jia, Dong-Tao; Lu, Da-Ru

    2014-02-01

    To extract sperm DNA from mixed stain by the modified differential lysis method combined with silicon bead method and to evaluate its application value. Fifty-two mixed stains containing female STR genotypes detected by differential lysis method were collected. The sperm DNA was extracted by the modified method combined with silicon bead method, then genotyped with the Identifiler Kit, and compared with the results of genotyping by the conventional differential lysis method as control. Of the 52 samples, 38 samples with sole male STR genotypes in all loci were detected. The detection rate of male STR genotypes was 98.08% through the modified method combined with silicon bead method. The modified differential lysis method combined with silicon bead method can be used in extraction of sperm DNA from mixed stain.

  6. Combined effect of radiation and environmental contaminants on DNA repair mechanisms

    International Nuclear Information System (INIS)

    Altmann, H.

    1975-11-01

    Investigations on the influence of various environmental contamination agents on DNA repair (in combination with irradiation) were reviewed. The agents tested were: detergents (Tween 80, Nonidel P40, Cremophor), aflatoxin B 1 , furocumarines, drugs (indometacin, cyclophosphamide, vincristine, vinblastine, procarbacine), fluorides, irradiated food constituents, food additives (saccharin), metal ions (Cd, Hg), pesticides (2,4,5-trichlorophenoxyethanol) and infective agents (mycoplasmas). Most of the tests were carried out in vitro with γ-irradiated mouse spleen cells. The detergents and aflatoxin were tested also on E. coli, and irradiated glucose solutions were tested in vivo on Swiss albino mice injected with Salmonella typhimurium TA 1530. Most of the tested agents showed some kind of inhibitory or mutagenic effect. The experiments and results are explained briefly with references to earlier investigations

  7. Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

    Science.gov (United States)

    Leal, Ricardo M F; Callow, Shirley; Callow, Phil; Blakeley, Matthew P; Cardin, Christine J; Denny, William A; Teixeira, Susana C M; Mitchell, Edward P; Forsyth, V Trevor

    2010-11-01

    Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

  8. Determination of chromium combined with DNA, RNA and proteins in chromium-rich brewer's yeast by NAA

    International Nuclear Information System (INIS)

    Ding, W.J.; Qian, Q.F.; Hou, X.L.; Feng, W.Y.; Chai, Z.F.

    2000-01-01

    The content of chromium in the DNA, RNA and protein fractions separated from chromium-rich and normal brewer's yeast was determined by neutron activation analysis (NAA). Our results show that the extracted relative amounts and concentrations of DNA, RNA and proteins have no significant difference for two types of yeast, but the chromium content in DNA, RNA and proteins fractions extracted from the chromium-rich yeast are substantially higher than those from the normal. In addition, the concentration of chromium in DNA is much higher than that in RNA and proteins. It is evident that the inorganic chromium compounds can enter the yeast cell during the yeast cultivation in the chromium-containing culture medium and are converted into organic chromium species, which are combined with DNA, RNA and proteins. (author)

  9. Combination of native and denaturing PAGE for the detection of protein binding regions in long fragments of genomic DNA

    Directory of Open Access Journals (Sweden)

    Metsis Madis

    2008-06-01

    Full Text Available Abstract Background In a traditional electrophoresis mobility shift assay (EMSA a 32P-labeled double-stranded DNA oligonucleotide or a restriction fragment bound to a protein is separated from the unbound DNA by polyacrylamide gel electrophoresis (PAGE in nondenaturing conditions. An extension of this method uses the large population of fragments derived from long genomic regions (approximately 600 kb for the identification of fragments containing protein binding regions. With this method, genomic DNA is fragmented by restriction enzymes, fragments are amplified by PCR, radiolabeled, incubated with nuclear proteins and the resulting DNA-protein complexes are separated by two-dimensional PAGE. Shifted DNA fragments containing protein binding sites are identified by using additional procedures, i. e. gel elution, PCR amplification, cloning and sequencing. Although the method allows simultaneous analysis of a large population of fragments, it is relatively laborious and can be used to detect only high affinity protein binding sites. Here we propose an alternative and straightforward strategy which is based on a combination of native and denaturing PAGE. This strategy allows the identification of DNA fragments containing low as well as high affinity protein binding regions, derived from genomic DNA ( Results We have combined an EMSA-based selection step with subsequent denaturing PAGE for the localization of protein binding regions in long (up to10 kb fragments of genomic DNA. Our strategy consists of the following steps: digestion of genomic DNA with a 4-cutter restriction enzyme (AluI, BsuRI, TruI, etc, separation of low and high molecular weight fractions of resultant DNA fragments, 32P-labeling with Klenow polymerase, traditional EMSA, gel elution and identification of the shifted bands (or smear by denaturing PAGE. The identification of DNA fragments containing protein binding sites is carried out by running the gel-eluted fragments alongside

  10. Exogenous DNA internalisation by sperm cells is improved by combining lipofection and restriction enzyme mediated integration.

    Science.gov (United States)

    Churchil, R R; Gupta, J; Singh, A; Sharma, D

    2011-06-01

    1. Three types of exogenous DNA inserts, i.e. complete linearised pVIVO2-GFP/LacZ vector (9620 bp), the LacZ gene (5317 bp) and the GFP gene (2152 bp) were used to transfect chicken spermatozoa through simple incubation of sperm cells with insert. 2. PCR assay, Dot Blot hybridisation and Southern hybridisation showed the successful internalisation of exogenous DNA by chicken sperm cells. 3. Lipofection and Restriction Enzyme Mediated Integration (REMI) were used to improve the rate of internalisation of exogenous DNA by sperm cells. 4. Results from dot blot as well as Southern hybridisation were semi-quantified and improved exogenous DNA uptake by sperm cells through lipofection and REMI. Stronger signals were observed from hybridisation of LacZ as well as GFP specific probe with the DNA from lipofected exogenous DNA transfected sperm DNA in comparison with those transfected with nude exogenous DNA.

  11. Combined Triplex/Duplex Invasion of Double-Stranded DNA by "Tail-Clamp" Peptide Nucleic Acid

    DEFF Research Database (Denmark)

    Bentin, Thomas; Larsen, H. J.; Nielsen, Peter E.

    2003-01-01

    "Tail-clamp" PNAs composed of a short (hexamer) homopyrimidine triplex forming domain and a (decamer) mixed sequence duplex forming extension have been designed. Tail-clamp PNAs display significantly increased binding to single-stranded DNA compared with PNAs lacking a duplex-forming extension...... as determined by T-m measurements. Binding to double-stranded (ds) DNA occurred by combined triplex and duplex invasion as analyzed by permanganate probing. Furthermore, C-50 measurements revealed that tail-clamp PNAs consistently bound the dsDNA target more efficiently, and kinetics experiments revealed...... to five residues was feasible, but four bases were not sufficient to yield detectable dsDNA binding. The results validate the tail-clamp PNA concept and expand the applications of the P-loop technology....

  12. Sperm DNA fragmentation and mitochondrial membrane potential combined are better for predicting natural conception than standard sperm parameters.

    Science.gov (United States)

    Malić Vončina, Slađana; Golob, Barbara; Ihan, Alojz; Kopitar, Andreja Nataša; Kolbezen, Mojca; Zorn, Branko

    2016-03-01

    To evaluate whether DNA fragmentation and/or mitochondrial membrane potential (MMP) predict natural conception better than standard sperm parameters. Prospective cross-sectional study. University medical center. Eighty-five infertile and 51 fertile men. Assessment of sperm DNA fragmentation, MMP, and standard semen parameters over a 6- to 12-month observation period. Comparison between the results of DNA fragmentation, MMP, and standard sperm parameters alone or combined and achievement of natural conception. Twenty-six of the 85 (31%) men from infertile couples conceived naturally. The median values of DNA fragmentation and MMP in the men who conceived within the observation period were similar to those in the fertile controls. Optimal threshold values of DNA fragmentation and MMP were 25% as determined by receiver operating characteristic analysis (area under the curve [AUC], 0.70; 95% confidence interval (CI) 0.58-0.82) and 62.5% (AUC, 0.68, 95% CI 0.56-0.80), respectively. The men in the infertile group with values of DNA fragmentation ≤25% and with MMP values ≥62.5% had significantly higher odds for conception (odds ratio [OR], 5.22; 95% CI 1.82-14.93] and OR, 4.67; 95% CI 1.74-12.5, respectively). Normal semen analysis alone had no predictive value for natural conception (OR, 1.84; 95% CI 0.67-5.07]). Both sperm function tests combined had significant odds for natural conception (OR, 8.24; 95% CI 2.91-23.33]), with a probability of 0.607 (60.7%) for both normal values and 0.158 (15.8%) for abnormal values. Sperm DNA fragmentation and MMP combined may be superior to standard semen parameters for the prediction of natural conception. Copyright © 2016. Published by Elsevier Inc.

  13. DNA methylation markers in combination with skeletal and dental ages to improve age estimation in children.

    Science.gov (United States)

    Shi, Lei; Jiang, Fan; Ouyang, Fengxiu; Zhang, Jun; Wang, Zhimin; Shen, Xiaoming

    2018-03-01

    Age estimation is critical in forensic science, in competitive sports and games and in other age-related fields, but the current methods are suboptimal. The combination of age-associated DNA methylation markers with skeletal age (SA) and dental age (DA) may improve the accuracy and precision of age estimation, but no study has examined this topic. In the current study, we measured SA (GP, TW3-RUS, and TW3-Carpal methods) and DA (Demirjian and Willems methods) by X-ray examination in 124 Chinese children (78 boys and 46 girls) aged 6-15 years. To identify age-associated CpG sites, we analyzed methylome-wide DNA methylation profiling by using the Illumina HumanMethylation450 BeadChip system in 48 randomly selected children. Five CpG sites were identified as associated with chronologic age (CA), with an absolute value of Pearson's correlation coefficient (r)>0.5 (page-associated CpG sites was performed using droplet digital PCR techniques in all 124 children. After validation, four CpG sites for boys and five CpG sites for girls were further adopted to build the age estimation model with SA and DA using multivariate linear stepwise regressions. These CpG sites were located at 4 known genes: DDO, PRPH2, DHX8, and ITGA2B and at one unknown gene with the Illumina ID number of 22398226. The accuracy of age estimation methods was compared according to the mean absolute error (MAE) and root mean square error (RMSE). The best single measure for SA was the TW3-RUS method (MAE=0.69years, RMSE=0.95years) in boys, and the GP method (MAE=0.74years, RMSE=0.94years) in girls. For DA, the Willems method was the best single measure for both boys (MAE=0.63years, RMSE=0.78years) and girls (MAE=0.54years, RMSE=0.68years). The models that incorporated SA and DA with the methylation levels of age-associated CpG sites provided the highest accuracy of age estimation in both boys (MAE=0.47years, R 2 =0.886) and girls (MAE=0.33years, R 2 =0.941). Cross validation of the results confirmed the

  14. Identifying cis-regulatory modules by combining comparative and compositional analysis of DNA.

    Science.gov (United States)

    Pierstorff, Nora; Bergman, Casey M; Wiehe, Thomas

    2006-12-01

    Predicting cis-regulatory modules (CRMs) in higher eukaryotes is a challenging computational task. Commonly used methods to predict CRMs based on the signal of transcription factor binding sites (TFBS) are limited by prior information about transcription factor specificity. More general methods that bypass the reliance on TFBS models are needed for comprehensive CRM prediction. We have developed a method to predict CRMs called CisPlusFinder that identifies high density regions of perfect local ungapped sequences (PLUSs) based on multiple species conservation. By assuming that PLUSs contain core TFBS motifs that are locally overrepresented, the method attempts to capture the expected features of CRM structure and evolution. Applied to a benchmark dataset of CRMs involved in early Drosophila development, CisPlusFinder predicts more annotated CRMs than all other methods tested. Using the REDfly database, we find that some 'false positive' predictions in the benchmark dataset correspond to recently annotated CRMs. Our work demonstrates that CRM prediction methods that combine comparative genomic data with statistical properties of DNA may achieve reasonable performance when applied genome-wide in the absence of an a priori set of known TFBS motifs. The program CisPlusFinder can be downloaded at http://jakob.genetik.uni-koeln.de/bioinformatik/people/nora/nora.html. All software is licensed under the Lesser GNU Public License (LGPL).

  15. A Synthetic Lethal Screen Identifies DNA Repair Pathways that Sensitize Cancer Cells to Combined ATR Inhibition and Cisplatin Treatments

    Science.gov (United States)

    Mohni, Kareem N.; Thompson, Petria S.; Luzwick, Jessica W.; Glick, Gloria G.; Pendleton, Christopher S.; Lehmann, Brian D.; Pietenpol, Jennifer A.; Cortez, David

    2015-01-01

    The DNA damage response kinase ATR may be a useful cancer therapeutic target. ATR inhibition synergizes with loss of ERCC1, ATM, XRCC1 and DNA damaging chemotherapy agents. Clinical trials have begun using ATR inhibitors in combination with cisplatin. Here we report the first synthetic lethality screen with a combination treatment of an ATR inhibitor (ATRi) and cisplatin. Combination treatment with ATRi/cisplatin is synthetically lethal with loss of the TLS polymerase ζ and 53BP1. Other DNA repair pathways including homologous recombination and mismatch repair do not exhibit synthetic lethal interactions with ATRi/cisplatin, even though loss of some of these repair pathways sensitizes cells to cisplatin as a single-agent. We also report that ATRi strongly synergizes with PARP inhibition, even in homologous recombination-proficient backgrounds. Lastly, ATR inhibitors were able to resensitize cisplatin-resistant cell lines to cisplatin. These data provide a comprehensive analysis of DNA repair pathways that exhibit synthetic lethality with ATR inhibitors when combined with cisplatin chemotherapy, and will help guide patient selection strategies as ATR inhibitors progress into the cancer clinic. PMID:25965342

  16. Optimal non-invasive diagnosis of fetal achondroplasia combining ultrasonography and circulating cell-free fetal DNA analysis.

    Science.gov (United States)

    Vivanti, Alexandre J; Costa, Jean-Marc; Rosefort, Audrey; Kleinfinger, Pascale; Lohmann, Laurence; Cordier, Anne-Gael; Benachi, Alexandra

    2018-01-30

    To assess the performance of non-invasive prenatal testing of achondroplasia using high-resolution melting (HRM) analysis. To propose an optimal diagnosis strategy combining ultrasound scan and cell-free fetal DNA (cffDNA) analysis. Prospective multicenter study. CffDNA was extracted from maternal blood from women at risk for fetal achondroplasia (paternal achondroplasia, previous affected child or suspected rhizomelic shortening). The presence of one of the two main FGFR3 mutations was determined by HRM combined with confirmation by SNaPshot minisequencing. Results were compared with phenotypes obtained by 3D computed tomography, post-natal examination and/or molecular diagnosis by an invasive procedure. Fetal biometry was also analyzed (head circumference and femur length) in order to offer cffDNA for achondroplasia in selected cases. Eighty-six blood samples from women at risk were collected (and sixty-five from control women). The overall sensitivity and specificity of the test were respectively 1.00 (95% CI [0.87-1.00]) and 1.00 (95% CI [0.96-1.00]). Critical reduction of femur length for affected fetuses can be observed from 26 weeks of gestation. HRM combined with SNaPshot minisequencing is a reliable method for non-invasive prenatal testing of achondroplasia. Its implementation in routine clinical care combined with ultrasonography is an efficient strategy for non-invasive diagnosis of achondroplasia. This article is protected by copyright. All rights reserved.

  17. Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhenbao [Central South University, School of Pharmaceutical Sciences (China); Zhou, Bo, E-mail: zhoubo1771@163.com [The Affiliated Zhongda Hospital of Southeast University, Department of Gerontology (China); Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang, E-mail: lengxigyky@163.com [Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College (China)

    2013-09-15

    A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 {mu}m in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL{sup -1} to 10 ng mL{sup -1}. This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples.

  18. Combination of DNA isolation and RP-HPLC analysis method for bark samples of Saraca asoca and its adulterant.

    Science.gov (United States)

    Hegde, Satisha; Pai, Sandeep Ramchandra; Roy, Subarna

    2017-07-01

    DNA fingerprinting singly or in combination with phytochemical analysis is ideal for quality control of crude plant-based drugs. However, when the source material is tannin rich stem bark, extraction of DNA by conventional methods becomes challenging. In such cases, phytochemical profiling serves as very useful tool for its identification. The work herein described a method for simultaneous DNA isolation and phytochemical extraction for downstream analysis and applications from dried bark powder of Saraca asoca and commercial samples of this crude drug as well as from those of Polyalthia longifolia, its most common adulterant. It is a modified CTAB-based method which involves a pre-extraction step by soaking samples overnight in de-ionized water followed by filtration. The residues in the filter paper were used for DNA isolation and dried filtrate was used for Reverse Phase-High-Performance Liquid Chromatography analysis. Results revealed that genomic DNA isolated was PCR amplifiable with Inter Simple Sequence Repeat and Start Codon Targeted markers. Phenolic compounds of catechin, epicatechin, and gallic acid were detected from the above dried filtrate. The method is simple, reliable and it requires small amount of sample with an option of integrating both phytochemical and DNA-based profiling, from the same starting material. Therefore, the present method could be useful for further potential applications such as quality control assessment of S. asoca products.

  19. A DNA-based system for selecting and displaying the combined result of two input variables

    DEFF Research Database (Denmark)

    Liu, Huajie; Wang, Jianbang; Song, S

    2015-01-01

    demonstrate this capability in a DNA-based system that takes two input numbers, represented in DNA strands, and returns the result of their multiplication, writing this as a number in a display. Unlike a conventional calculator, this system operates by selecting the result from a library of solutions rather...

  20. Combining ligation reaction and capillary gel electrophoresis to obtain reliable long DNA probes.

    Science.gov (United States)

    García-Cañas, Virginia; Mondello, Monica; Cifuentes, Alejandro

    2011-05-01

    New DNA amplification methods are continuously developed for sensitive detection and quantification of specific DNA target sequences for, e.g. clinical, environmental or food applications. These new applications often require the use of long DNA oligonucleotides as probes for target sequences hybridization. Depending on the molecular technique, the length of DNA probes ranges from 40 to 450 nucleotides, solid-phase chemical synthesis being the strategy generally used for their production. However, the fidelity of chemical synthesis of DNA decreases for larger DNA probes. Defects in the oligonucleotide sequence result in the loss of hybridization efficiency, affecting the sensitivity and selectivity of the amplification method. In this work, an enzymatic procedure has been developed as an alternative to solid-phase chemical synthesis for the production of long oligonucleotides. The enzymatic procedure for probe production was based on ligation of short DNA sequences. Long DNA probes were obtained from smaller oligonucleotides together with a short sequence that acts as bridge stabilizing the molecular complex for DNA ligation. The ligation reactions were monitored by capillary gel electrophoresis with laser-induced fluorescence detection (CGE-LIF) using a bare fused-silica capillary. The capillary gel electrophoresis-LIF method demonstrated to be very useful and informative for the characterization of the ligation reaction, providing important information about the nature of some impurities, as well as for the fine optimization of the ligation conditions (i.e. ligation cycles, oligonucleotide and enzyme concentration). As a result, the yield and quality of the ligation product were highly improved. The in-lab prepared DNA probes were used in a novel multiplex ligation-dependent genome amplification (MLGA) method for the detection of genetically modified maize in samples. The great possibilities of the whole approach were demonstrated by the specific and sensitive

  1. A Combinational Clustering Based Method for cDNA Microarray Image Segmentation.

    Directory of Open Access Journals (Sweden)

    Guifang Shao

    Full Text Available Microarray technology plays an important role in drawing useful biological conclusions by analyzing thousands of gene expressions simultaneously. Especially, image analysis is a key step in microarray analysis and its accuracy strongly depends on segmentation. The pioneering works of clustering based segmentation have shown that k-means clustering algorithm and moving k-means clustering algorithm are two commonly used methods in microarray image processing. However, they usually face unsatisfactory results because the real microarray image contains noise, artifacts and spots that vary in size, shape and contrast. To improve the segmentation accuracy, in this article we present a combination clustering based segmentation approach that may be more reliable and able to segment spots automatically. First, this new method starts with a very simple but effective contrast enhancement operation to improve the image quality. Then, an automatic gridding based on the maximum between-class variance is applied to separate the spots into independent areas. Next, among each spot region, the moving k-means clustering is first conducted to separate the spot from background and then the k-means clustering algorithms are combined for those spots failing to obtain the entire boundary. Finally, a refinement step is used to replace the false segmentation and the inseparable ones of missing spots. In addition, quantitative comparisons between the improved method and the other four segmentation algorithms--edge detection, thresholding, k-means clustering and moving k-means clustering--are carried out on cDNA microarray images from six different data sets. Experiments on six different data sets, 1 Stanford Microarray Database (SMD, 2 Gene Expression Omnibus (GEO, 3 Baylor College of Medicine (BCM, 4 Swiss Institute of Bioinformatics (SIB, 5 Joe DeRisi's individual tiff files (DeRisi, and 6 University of California, San Francisco (UCSF, indicate that the improved

  2. A Combinational Clustering Based Method for cDNA Microarray Image Segmentation.

    Science.gov (United States)

    Shao, Guifang; Li, Tiejun; Zuo, Wangda; Wu, Shunxiang; Liu, Tundong

    2015-01-01

    Microarray technology plays an important role in drawing useful biological conclusions by analyzing thousands of gene expressions simultaneously. Especially, image analysis is a key step in microarray analysis and its accuracy strongly depends on segmentation. The pioneering works of clustering based segmentation have shown that k-means clustering algorithm and moving k-means clustering algorithm are two commonly used methods in microarray image processing. However, they usually face unsatisfactory results because the real microarray image contains noise, artifacts and spots that vary in size, shape and contrast. To improve the segmentation accuracy, in this article we present a combination clustering based segmentation approach that may be more reliable and able to segment spots automatically. First, this new method starts with a very simple but effective contrast enhancement operation to improve the image quality. Then, an automatic gridding based on the maximum between-class variance is applied to separate the spots into independent areas. Next, among each spot region, the moving k-means clustering is first conducted to separate the spot from background and then the k-means clustering algorithms are combined for those spots failing to obtain the entire boundary. Finally, a refinement step is used to replace the false segmentation and the inseparable ones of missing spots. In addition, quantitative comparisons between the improved method and the other four segmentation algorithms--edge detection, thresholding, k-means clustering and moving k-means clustering--are carried out on cDNA microarray images from six different data sets. Experiments on six different data sets, 1) Stanford Microarray Database (SMD), 2) Gene Expression Omnibus (GEO), 3) Baylor College of Medicine (BCM), 4) Swiss Institute of Bioinformatics (SIB), 5) Joe DeRisi's individual tiff files (DeRisi), and 6) University of California, San Francisco (UCSF), indicate that the improved approach is

  3. The design and synthesis of novel heterodinuclear complexes combining a DNA-cleaving agent and a DNA-targeting moiety

    NARCIS (Netherlands)

    Hoog, Paul de

    2008-01-01

    Cancer is a leading cause of death worldwide. Nowadays, the treatment of cancer by chemotherapy can consist of a combination of antitumor drugs. Nevertheless, chemotherapy is accompanied by serious side effects and intrinsic and acquired resistance to the drugs. This thesis describes the design and

  4. Anonymous letters? DNA and fingerprints technologies combined to solve a case.

    Science.gov (United States)

    Barbaro, A; Cormaci, P; Teatino, A; La Marca, A; Barbaro, A

    2004-12-02

    Two brothers, living in two different cities, received two different anonymous letters. We performed latent prints development and DNA research on the letters and also on a glass used by a cousin suspected to be the letters' sender.

  5. Dihydroisotanshinone I combined with radiation inhibits the migration ability of prostate cancer cells through DNA damage and CCL2 pathway.

    Science.gov (United States)

    Lee, I-Yun; Lin, Yin-Yin; Yang, Yao-Hsu; Lin, Yu-Shin; Lin, Chun-Liang; Lin, Wei-Yu; Cheng, Yu-Ching; Shu, Li-Hsin; Wu, Ching-Yuan

    2018-01-31

    Radiotherapy plays an important role in the treatment of prostate cancer. Despite that sophisticated techniques of radiotherapy and radiation combined with chemotherapy were applied to the patients, some tumors may recur. Therefore, the study investigated the effect of dihydroisotanshinone I (DT) and the combination treatment of 5 μM DT and 5Gy irradiation (IR) against the migration ability of prostate cancer cells. DT and the combination treatment were studied for its biological activity against migration ability of prostate cancer cells with transwell migration assay. Subsequently, we tried to explore the underlying mechanism with ELISA, flow cytometry and Western's blotting assay. The results showed that DT and the combination treatment substantially inhibited the migration ability of prostate cancer cells. DT and the combined treatment can decrease the ability of macrophages to recruit prostate cancer cells. Mechanistically, DT and the combination treatment reduced the secretion of chemokine (C-C Motif) Ligand 2 (CCL2) from prostate cancer cells. We also found that DT treatment induced the cell cycle of prostate cancer cells entering S phase and increased the protein expression of DNA damage response proteins (rH2AX and phosphorylated ataxia telangiectasia-mutated [ATM]) in DU145 cells and PC-3 cells. DT displays radiosensitization and antimigration effects in prostate cancer cells by inducing DNA damage and inhibiting CCL2 secretion. We suggest that DT can be used as a novel antimetastatic cancer drug or radiosensitizer in the armamentarium of prostate cancer management.

  6. MALS: an efficient strategy for multiple site-directed mutagenesis employing a combination of DNA amplification, ligation and suppression PCR

    Directory of Open Access Journals (Sweden)

    Drayna Dennis T

    2009-09-01

    Full Text Available Abstract Background Multiple approaches for the site-directed mutagenesis (SDM have been developed. However, only several of them are designed for simultaneous introduction of multiple nucleotide alterations, and these are time consuming. In addition, many of the existing multiple SDM methods have technical limitations associated with type and number of mutations that can be introduced, or are technically demanding and require special chemical reagents. Results In this study we developed a quick and efficient strategy for introduction of multiple complex mutations in a target DNA without intermediate subcloning by using a combination of connecting SDM and suppression PCR. The procedure consists of sequential rounds, with each individual round including PCR amplification of target DNA with two non-overlapping pairs of oligonucleotides. The desired mutation is incorporated at the 5' end of one or both internal oligonucleotides. DNA fragments obtained during amplification are mixed and ligated. The resulting DNA mixture is amplified with external oligonucleotides that act as suppression adapters. Suppression PCR limits amplification to DNA molecules representing full length target DNA, while amplification of other types of molecules formed during ligation is suppressed. To create additional mutations, an aliquot of the ligation mixture is then used directly for the next round of mutagenesis employing internal oligonucleotides specific for another region of target DNA. Conclusion A wide variety of complex multiple mutations can be generated in a short period of time. The procedure is rapid, highly efficient and does not require special chemical reagents. Thus, MALS represents a powerful alternative to the existing methods for multiple SDM.

  7. COMBINED EFFECT OF ELECTROMAGNETIC RADIATION, DNA-INTERCALATORS, C60-FULLERENE AND CAFFEINE ON HUMAN BUCCAL EPITHELIUM CELLS

    Directory of Open Access Journals (Sweden)

    G. B. Skamrova

    2014-04-01

    Full Text Available Now the number of physical and chemical biologically active damage factors dramatically increased. The ways to neutralize such effects have not been studied enough. In this work the techniques of visual assessment of chromatin granulation and of electronegativity of human buccal epithelium cell nuclei were used in order to study the combined effects of the exposure to low-intensity electromagnetic radiation of the millimeter range electromagnetic radiation and to the DNA-binding compounds, such as: antibiotic doxorubicin, mutagens ethidium bromide and proflavine, as well as to caffeine and C60 -fullerene which are not directly interact with DNA. When the action of electromagnetic radiation and DNA-binding compounds is combined, a synergistic effect of reducing the cell response was observed in contrast to the effects caused by electromagnetic radiation and drugs separately. When cells were irradiated in the presence of C60 -fullerene or caffeine, a protective effect of compounds against electromagnetic radiation influence was observed. The obtained results may provide perspectives in the use of the C60 fullerene and caffeine as DNA-protectors under the action of electromagnetic radiation.

  8. Combining Electro-Osmotic Flow and FTA® Paper for DNA Analysis on Microfluidic Devices

    Directory of Open Access Journals (Sweden)

    Ryan Wimbles

    2016-07-01

    Full Text Available FTA® paper can be used to protect a variety of biological samples prior to analysis, facilitating ease-of-transport to laboratories or long-term archive storage. The use of FTA® paper as a solid phase eradicates the need to elute the nucleic acids from the matrix prior to DNA amplification, enabling both DNA purification and polymerase chain reaction (PCR-based DNA amplification to be performed in a single chamber on the microfluidic device. A disc of FTA® paper, containing a biological sample, was placed within the microfluidic device on top of wax-encapsulated DNA amplification reagents. The disc containing the biological sample was then cleaned up using Tris-EDTA (TE buffer, which was passed over the disc, via electro-osmotic flow, in order to remove any potential inhibitors of downstream processes. DNA amplification was successfully performed (from buccal cells, whole blood and semen using a Peltier thermal cycling system, whereupon the stored PCR reagents were released during the initial denaturing step due to the wax barrier melting between the FTA® disc and PCR reagents. Such a system offers advantages in terms of a simple sample introduction interface and the ability to process archived samples in an integrated microfluidic environment with minimal risk of contamination.

  9. Combined immunotherapy of breast cancer with EGF and VEGF vaccines from DNA shuffling in a mouse model.

    Science.gov (United States)

    Jin, Dong; Yu, Xin; Chen, Bing; Li, Zhitao; Ding, Jia; Zhao, Xiuyun; Qi, Gaofu

    2017-06-01

    Development of EGF and VEGF vaccines with high antigenicity for combined immunotherapy of EGF-EGFR signaling-dependent epithelial tumors such as breast cancer. EGF genes from mouse, human and chicken were randomly assembled to chimeric genes by DNA shuffling, then a chimeric EGF was selected out by PCR, SDS-PAGE and immunization for combined immunotherapy of breast cancer with a previously constructed chimeric VEGF vaccine from shuffling. Combined vaccination with chimeric EGF and VEGF from shuffling could induce high titer of antibodies against EGF and VEGF to inhibit tumor growth and angiogenesis, and improve the survival rate of mice with breast cancer. Combined vaccination with EGF and VEGF from shuffling showed better immunotherapy on EGF-EGFR signaling-dependent epithelial tumors such as breast cancer than the single-agent EGF vaccination.

  10. Different combinations of atomic interactions predict protein-small molecule and protein-DNA/RNA affinities with similar accuracy.

    Science.gov (United States)

    Dias, Raquel; Kolazckowski, Bryan

    2015-11-01

    Interactions between proteins and other molecules play essential roles in all biological processes. Although it is widely held that a protein's ligand specificity is determined primarily by its three-dimensional structure, the general principles by which structure determines ligand binding remain poorly understood. Here we use statistical analyses of a large number of protein-ligand complexes with associated binding-affinity measurements to quantitatively characterize how combinations of atomic interactions contribute to ligand affinity. We find that there are significant differences in how atomic interactions determine ligand affinity for proteins that bind small chemical ligands, those that bind DNA/RNA and those that interact with other proteins. Although protein-small molecule and protein-DNA/RNA binding affinities can be accurately predicted from structural data, models predicting one type of interaction perform poorly on the others. Additionally, the particular combinations of atomic interactions required to predict binding affinity differed between small-molecule and DNA/RNA data sets, consistent with the conclusion that the structural bases determining ligand affinity differ among interaction types. In contrast to what we observed for small-molecule and DNA/RNA interactions, no statistical models were capable of predicting protein-protein affinity with >60% correlation. We demonstrate the potential usefulness of protein-DNA/RNA binding prediction as a possible tool for high-throughput virtual screening to guide laboratory investigations, suggesting that quantitative characterization of diverse molecular interactions may have practical applications as well as fundamentally advancing our understanding of how molecular structure translates into function. © 2015 The Authors. Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc.

  11. DNA bases assembled on the Au(110)/electrolyte interface: A combined experimental and theoretical study

    DEFF Research Database (Denmark)

    Salvatore, Princia; Nazmutdinov, Renat R.; Ulstrup, Jens

    2015-01-01

    , accompanied by a pair of strong voltammetry peaks in the double-layer region in acid solutions. Adsorption of the DNA bases gives featureless voltammograms with lower double-layer capacitance, suggesting that all the bases are chemisorbed on the Au(110) surface. Further investigation of the surface structures...... of the adlayers of the four DNA bases by EC-STM disclosed lifting of the Au(110) reconstruction, specific molecular packing in dense monolayers, and pH dependence of the A and G adsorption. DFT computations based on a cluster model for the Au(110) surface were performed to investigate the adsorption energy...... and geometry of the DNA bases in different adsorbate orientations. The optimized geometry is further used to compute models for STM images which are compared with the recorded STM images. This has provided insight into the physical nature of the adsorption. The specific orientations of A, C, G, and T on Au(110...

  12. The combination of gold nanorods and nanoparticles with DNA nanodevices for logic gates construction

    International Nuclear Information System (INIS)

    Yao, Dongbao; Song, Tingjie; Xiao, Shiyan; Huang, Fujian; Liang, Haojun; Zheng, Bin

    2015-01-01

    In this work, two DNA nanodevices were constructed utilizing a DNA strand displacement reaction. With the assistance of gold nanoparticles (AuNPs) and gold nanorods (AuNRs), the autonomous reactions can be reflected from the aggregation states of nanoparticles. By sequence design and the two non-overlapping double hump-like UV–vis spectral peaks of AuNPs and AuNRs, two logic gates with multiple inputs and outputs were successfully run with expected outcomes. This method not only shows how to achieve computing with multiple logic calculations but also has great potential for multiple targets detection. (paper)

  13. Combination of gefitinib and DNA methylation inhibitor decitabine exerts synergistic anti-cancer activity in colon cancer cells.

    Directory of Open Access Journals (Sweden)

    Yun-feng Lou

    Full Text Available Despite recent advances in the treatment of human colon cancer, the chemotherapy efficacy against colon cancer is still unsatisfactory. In the present study, effects of concomitant inhibition of the epidermal growth factor receptor (EGFR and DNA methyltransferase were examined in human colon cancer cells. We demonstrated that decitabine (a DNA methyltransferase inhibitor synergized with gefitinib (an EGFR inhibitor to reduce cell viability and colony formation in SW1116 and LOVO cells. However, the combination of the two compounds displayed minimal toxicity to NCM460 cells, a normal human colon mucosal epithelial cell line. The combination was also more effective at inhibiting the AKT/mTOR/S6 kinase pathway. In addition, the combination of decitabine with gefitinib markedly inhibited colon cancer cell migration. Furthermore, gefitinib synergistically enhanced decitabine-induced cytotoxicity was primarily due to apoptosis as shown by Annexin V labeling that was attenuated by z-VAD-fmk, a pan caspase inhibitor. Concomitantly, cell apoptosis resulting from the co-treatment of gefitinib and decitabine was accompanied by induction of BAX, cleaved caspase 3 and cleaved PARP, along with reduction of Bcl-2 compared to treatment with either drug alone. Interestingly, combined treatment with these two drugs increased the expression of XIAP-associated factor 1 (XAF1 which play an important role in cell apoptosis. Moreover, small interfering RNA (siRNA depletion of XAF1 significantly attenuated colon cancer cells apoptosis induced by the combination of the two drugs. Our findings suggested that gefitinib in combination with decitabine exerted enhanced cell apoptosis in colon cancer cells were involved in mitochondrial-mediated pathway and induction of XAF1 expression. In conclusion, based on the observations from our study, we suggested that the combined administration of these two drugs might be considered as a novel therapeutic regimen for treating colon

  14. Barcoding the major Mediterranean leguminous crops by combining universal chloroplast and nuclear DNA sequence targets.

    Science.gov (United States)

    Madesis, P; Ganopoulos, I; Ralli, P; Tsaftaris, A

    2012-08-16

    The ability to discriminate all species is the ultimate target in barcoding. The Mediterranean basin is a center of origin for legumes and thus they have played a key role in feeding the Mediterranean population. It is also a region with important protected designation of origin and protected geographical indication legumes that provide income in rural areas. We evaluated the use of two chloroplast regions, trnL and rpoC1, and a nuclear internal transcriber region, ITS2, for their efficiency to barcode the main Mediterranean leguminous crops. Twenty-five legume species were studied. Plant material of pasture and legumes was obtained from the Greek GenBank and the Fodder Crops and Pastures Institute (National Agricultural Research Foundation). DNA was extracted with the Qiagen DNeasy plant mini-kit and PCR amplification was performed using the Kapa Taq DNA polymerase using primers amplifying the chloroplast trnL and rpoC1 regions or the nuclear region ITS2. PCR products were sequenced and the sequences were aligned using CLUSTAL W. Species identification based on the sequence similarity approach was performed using the GenBank database. In order to evaluate intraspecific and interspecific divergence in legumes we used Molecular Evolutionary Genetics Analysis 5 and for pairwise Kimura 2-parameter distance calculations for all 3 DNA regions (2 chloroplast regions, trnL and rpoC1, and the nuclear region ITS2). Four tree-based methods (neighbor joining and maximum parsimony, maximum likelihood, and Bayesian inference analyses) were used to exhibit the molecular identification results to represent differences as an uprooted dendrogram. Additionally, the sequence character-based method was used with DnaSP and the information from each site was treated as a character to distinguish the species from one another. The DNA regions trnL and ITS2 successfully (100%) discriminated the Mediterranean crop legume species used, while rpoC1 identified only 72% of them. Furthermore

  15. MAXIMIZATION OF DNA DAMAGE TO MGMT(+ EGFR(+ GBM CELLS USING OPTIMAL COMBINATION OF TEMOZOLOMIDE-ANTI EGFR MONOCLONAL ANTIBODY NIMOTUZUMAB

    Directory of Open Access Journals (Sweden)

    M. A. M. Inggas

    2015-09-01

    Full Text Available Background: Glioblastoma multiforme (GBM is the most aggressive primary brain tumor in adultswith dismal prognosis due to the unavailability of an effective therapy. Up to now, there had been no definitive studies published on EGFR inhibition therapy as a chemosensitizer for GBM therapy using Temozolomide (TMZ. This study aims to reveal the most effective method and timing to administer TMZ-anti EGFR targeted therapy which causes maximal DNA damage on GBM cells.Methods: Various regimens of anti EGFR monoclonal antibody Nimotuzumab (NMZ was administered in different combinations with TMZ, performed on U87MG MGMT(+ EGFR(+ cells. The effectiveness of the combinations were evaluated by measuring yH2AX levels which reflects the degree of DNA damage. One-way Anova and LSD tests were performed to determine the effects of each treatment with p<0.05. Results and discussion: the mean SD of yH2AX of each treatment was: 11,90±1,25 for the control group; 29.33±1.91 for NMZ alone; 28.13±1.58 for TMZ alone; 41.53±3.51 for concurrent use; 35.67 ±2.65 for NMZ after 24 hours TMZ; 31.87±2.94 for NMZ after 48 hours TMZ; 39.57±4.2 for TMZ after 24 hours NMZ; and 35.93 ±3.56 for TMZ after 48 hours NMZ. The administration of TMZ concurrent with or after 24 hours NMZ gives the highest amount of DNA damage to GBM cells. Conclusion: The administration of Nimotuzumab targeted therapy up to 24 hours before Temozolomide chemotherapy has been proven to be effective in maximizing the amount of DNA damage done to GBM cells in vitro. 

  16. Quantitation of DNA methyltransferase activity via chronocoulometry in combination with rolling chain amplification.

    Science.gov (United States)

    Ji, Jingjing; Liu, Yuanjian; Wei, Wei; Zhang, Yuanjian; Liu, Songqin

    2016-11-15

    In this paper, a rolling chain amplification (RCA) strategy was proposed for chronocoulometric detection of DNA methyltransferase (MTase) activity. Briefly, after the double DNA helix structure was assembled on the surface of gold electrode, it was first methylated by M. SssI MTase and then RCA was realized in the presence of E. coli and phi29 DNA polymerase. Successively, numerous hexaammineruthenium (III) chloride ([Ru(NH3)6)(3+), RuHex) were adsorbed on replicons by electrostatic interaction and generated a large electrochemical readout, the signal was "on". On the contrary, in the absence of M. SssI MTase, the methylated CpG site in the unmethylated double DNA helix structure could be specifically recognized and cleaved by HpaII, resulting in a disconnection of RCA from the electrode. This led seldom RuHex to be absorbed onto the surface of electrode, the signal was "off". Based on the proposed strategy, the activity of M. SssI MTase was assayed in the range of 0.5-60U/mL with a detection limit of 0.09U/mL (S/N=3). In addition, the inhibition of procaine and epicatechin on M. SssI MTase activity was evaluated. When the proposed method was applied in complex matrix such as human serum samples, acceptable accuracy, precision and high sensitivity were achieved. Therefore, the proposed method was a potential useful mean for clinical diagnosis and drug development. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Mitochondrial DNA deletion in a patient with combined features of Leigh and Pearson syndromes

    Energy Technology Data Exchange (ETDEWEB)

    Blok, R.B.; Thorburn, D.R.; Danks, D.M. [Royal Children`s Hospital, Melbourne (Australia)] [and others

    1994-09-01

    We describe a heteroplasmic 4237 bp mitochondrial DNA (mtDNA) deletion in an 11 year old girl who has suffered from progressive illness since birth. She has some features of Leigh syndrome (global developmental delay with regression, brainstem dysfunction and lactic acidosis), together with other features suggestive of Pearson syndrome (history of pancytopenia and failure to thrive). The deletion was present at a level greater than 50% in skeletal muscle, but barely detectable in skin fibroblasts following Southern blot analysis, and only observed in blood following PCR analysis. The deletion spanned nt 9498 to nt 13734, and was flanked by a 12 bp direct repeat. Genes for cytochrome c oxidase subunit III, NADH dehydrogenase subunits 3, 4L, 4 and 5, and tRNAs for glycine, arginine, histidine, serine({sup AGY}) and leucine({sup CUN}) were deleted. Southern blotting also revealed an altered Apa I restriction site which was shown by sequence analysis to be caused by G{r_arrow}A nucleotide substitution at nt 1462 in the 12S rRNA gene. This was presumed to be a polymorphism. No abnormalities of mitochondrial ultrastructure, distribution or of respiratory chain enzyme complexes I-IV in skeletal muscle were observed. Mitochondrial disorders with clinical features overlapping more than one syndrome have been reported previously. This case further demonstrates the difficulty in correlating observed clinical features with a specific mitochondrial DNA mutation.

  18. Effects of combinations of ROS scavengers on oxidative DNA damage caused by visible-light-activated camphorquinone/N,N-dimethyl-p-toluidine.

    Science.gov (United States)

    Lee, Seungbum; Pagoria, Dustin; Raigrodski, Ariel; Geurtsen, Werner

    2007-11-01

    The objective of this investigation was to analyze whether various combinations of the ROS scavengers glutathione (GSH), N-acetyl-cysteine (NAC), and vitamins C and E decrease DNA damage due to visible-light-irradiated (VL-irradiated) camphorquinone/N,N-dimethyl-p-toluidine (CQ/DMT) compared with individual vitamin C or E. PhiX-174 RF plasmid DNA was used to determine single and double strand breaks as parameters of DNA damage. Individual ROS scavengers and combinations of the antioxidants were added to plasmid DNA treated with VL-irradiated CQ/DMT/Cu (II). After incubation, DNA was loaded into a 1% agarose gel. Following electrophoresis, gels stained with 0.5 microg/mL ethidium bromide were photographed under ultraviolet illumination and analyzed with NIH ImageJ software. Results were evaluated between groups for statistical significance using Student's paired t-test (p < 0.05). Glutathione significantly reduced oxidative DNA damage at all test concentrations when combined with vitamin C or vitamin E. The concentration of damaged DNA observed in the presence of combinations of GSH with vitamin C or vitamin E was significantly lower compared with all other combinations of antioxidants investigated in our study (p < 0.05). In contrast to GSH, NAC was not able to compensate the pro-oxidative effects of vitamin C and vitamin E. Only at a concentration of 2 mM, NAC combined with vitamin C efficiently prevented CQ/DMT/Cu (II)-associated DNA damage. Our data indicate that solely the combinations of GSH with vitamin C or vitamin E significantly reduce the severity of oxidative DNA damage caused by CQ/DMT, whereas NAC may even increase the pro-oxidant activity of vitamin C and vitamin E.

  19. Formulation and in vitro/in vivo evaluation of combining DNA repair and immune enhancing nutritional supplements.

    Science.gov (United States)

    Pero, R W; Amiri, A; Sheng, Y; Welther, M; Rich, M

    2005-04-01

    Combining nutritional supplements to achieve synergistic benefit is a common practice in the nutraceutical industry. However, establishing added health benefit from a combination of natural ingredients is often assumed, untested and without regard to the principle of metabolic competition between the active components. Here, we report on the combination of a cat's claw water extract (C-Med-100, carboxy alkyl esters = active ingredients) + medicinal mushroom extracts (Cordyceps sinensis, Grifola blazei, Grifolafrondosa, Trametes versicolor and Ganoderma lucidum, polysaccharides = active ingredients) + nicotinamide + zinc into a formulation designed to optimize different modes of immunostimulatory action, and yet that would avoid metabolic antioxidant competition yielding less than expected efficacious effects. Isobole curve analyses of these two active classes of ingredients determined by growth inhibition of HL-60 human leukemic cells in vitro confirmed they were indeed synergistic when in combination, and not metabolically competitive. Furthermore, an in vivo study showed significant health benefit for 14 subjects treated for 4 weeks with the unique C-Med-100/mushroom extract formulation in that they had reduced pain, reduced fatigue, weight loss and a reduced presence of DNA damage in peripheral blood assessed by (8-OH) guanine DNA adducts and elevation in serum protein thiols. Because this broad-based panel of clinical parameters indicating clinical efficacy has never been demonstrated before for either of the active ingredients evaluated alone in humans, these data were taken as strong evidence that the combination of C-Med-100 + mushroom extracts + nicotinamide + zinc gave additive or synergistic effects to health benefit, and thus supported no efficacious limits from metabolic competition regarding this particular formulation.

  20. Personal identification of cold case remains through combined contribution from anthropological, mtDNA, and bomb-pulse dating analyses.

    Science.gov (United States)

    Speller, Camilla F; Spalding, Kirsty L; Buchholz, Bruce A; Hildebrand, Dean; Moore, Jason; Mathewes, Rolf; Skinner, Mark F; Yang, Dongya Y

    2012-09-01

    In 1968, a child's cranium was recovered from the banks of a northern Canadian river and held in a trust until the "cold case" was reopened in 2005. The cranium underwent reanalysis at the Centre for Forensic Research, Simon Fraser University, using recently developed anthropological analysis, "bomb-pulse" radiocarbon analysis, and forensic DNA techniques. Craniometrics, skeletal ossification, and dental formation indicated an age-at-death of 4.4 ± 1 year. Radiocarbon analysis of enamel from two teeth indicated a year of birth between 1958 and 1962. Forensic DNA analysis indicated the child was a male, and the obtained mitochondrial profile matched a living maternal relative to the presumed missing child. These multidisciplinary analyses resulted in a legal identification 41 years after the discovery of the remains, highlighting the enormous potential of combining radiocarbon analysis with anthropological and mtDNA analyses in producing confident personal identifications for forensic cold cases dating to within the last 60 years. © 2012 American Academy of Forensic Sciences.

  1. Analysis of first-trimester combined test results in preparation for a cell-free fetal DNA era.

    Science.gov (United States)

    Kose, Semir; Cımrın, Dilek; Yıldırım, Nuri; Aksel, Ozge; Keskinoglu, Pembe; Bora, Elcin; Cankaya, Tufan; Altunyurt, Sabahattin

    2016-11-01

    To survey experience with the first-trimester combined test (FCT) for trisomy 21 (T21) in different risk score groups to determine the most useful clinical application of cell-free fetal DNA (cffDNA) screening. In a retrospective study, the records of FCT results obtained at a center in Turkey between January 2009 and January 2014 were reviewed. The FCT results and rates of uptake of invasive diagnostic testing were compared among different risk score groups. FCT results were available for 4804 pregnancies; 276 (5.7%) had IDT results. Ten (72.7%) of 11 cases of T21 had a risk score of 1:300 or more. The IDT uptake rates were 54.5%, 51.9%, and 47.4% at risk scores of 1:100 or more, 1:200 or more, and 1:300 or more, respectively. In the group at intermediate risk (1:1001-1:3000), no pregnancy had an FCT result of both low pregnancy-associated plasma protein A and high free β-human chorionic gonadotropin, but 30 (3.9%) of 766 pregnancies had both advanced maternal age and high β-human chorionic gonadotropin. cffDNA screening should be used to optimize IDT uptake in pregnancies with a risk score of 1:101-1:1000. The selective power of the FCT diminishes beyond the 1:1001 score and cffDNA screening cannot yet be recommended routinely. Copyright © 2016 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.

  2. Combined DNA, toxicological and heavy metal analyses provides an auditing toolkit to improve pharmacovigilance of traditional Chinese medicine (TCM)

    Science.gov (United States)

    Coghlan, Megan L.; Maker, Garth; Crighton, Elly; Haile, James; Murray, Dáithí C.; White, Nicole E.; Byard, Roger W.; Bellgard, Matthew I.; Mullaney, Ian; Trengove, Robert; Allcock, Richard J. N.; Nash, Christine; Hoban, Claire; Jarrett, Kevin; Edwards, Ross; Musgrave, Ian F.; Bunce, Michael

    2015-12-01

    Globally, there has been an increase in the use of herbal remedies including traditional Chinese medicine (TCM). There is a perception that products are natural, safe and effectively regulated, however, regulatory agencies are hampered by a lack of a toolkit to audit ingredient lists, adulterants and constituent active compounds. Here, for the first time, a multidisciplinary approach to assessing the molecular content of 26 TCMs is described. Next generation DNA sequencing is combined with toxicological and heavy metal screening by separation techniques and mass spectrometry (MS) to provide a comprehensive audit. Genetic analysis revealed that 50% of samples contained DNA of undeclared plant or animal taxa, including an endangered species of Panthera (snow leopard). In 50% of the TCMs, an undeclared pharmaceutical agent was detected including warfarin, dexamethasone, diclofenac, cyproheptadine and paracetamol. Mass spectrometry revealed heavy metals including arsenic, lead and cadmium, one with a level of arsenic >10 times the acceptable limit. The study showed 92% of the TCMs examined were found to have some form of contamination and/or substitution. This study demonstrates that a combination of molecular methodologies can provide an effective means by which to audit complementary and alternative medicines.

  3. The effects of silver nanoparticles and doxorubicin combination on DNA structure and its antiproliferative effect against T47D and MCF7 cell lines.

    Science.gov (United States)

    Hekmat, Azadeh; Saboury, Ali Akbar; Divsalar, Adeleh

    2012-12-01

    The structural changes in DNA caused by the combined effects of silver nanoparticles (Ag NPs) and doxorubicin (DOX) was investigated along with their corresponding inhibitory roles in the growth of T47D and MCF7 cells. The UV-visible titration studies showed that DOX + AgNPs could form a novel complex with DNA and this interaction is in the interface between the value induced by electrostatic and intercalative binding. The values of binding constants revealed that DOX + AgNPs interact more strongly with DNA as compared to Ag NPs or DOX alone. Our CD data revealed that although Ag NPs and DOX alone could alter DNA structure, this combination leads to transition of DNA conformation to an ordered and compact molecular form so called psi-type, considering that DNA is relatively thermally stable in the condition used. Thus, we observed that DOX + AgNPs induces conformational change on DNA. The anticancer property of DOX + AgNPs by MTT assay, DAPI stain and flow cytometry analyses demonstrated that this combination can tremendously diminish proliferation of T47D and MCF7 cells compared to DOX or Ag NPs alone. Furthermore, this combination was comparatively non-toxic towards the human endometrial stem cells proliferation. Collectively, these results reveal that DOX + AgNPs could proffer a novel strategy for the development of promising and efficient chemotherapy agents.

  4. First-trimester risk assessment based on ultrasound and cell-free DNA vs combined screening: a randomized controlled trial.

    Science.gov (United States)

    Kagan, K O; Sroka, F; Sonek, J; Abele, H; Lüthgens, K; Schmid, M; Wagner, P; Brucker, S; Wallwiener, D; Hoopmann, M

    2017-09-19

    This was a randomized controlled trial to compare risk assessment by first-trimester combined screening (FTCS) with an approach that combines a detailed ultrasound examination at 11-13 weeks' gestation and cell-free DNA (cfDNA) analysis. Pregnant women with a normal first-trimester ultrasound examination at 11-13 weeks' gestation (fetal nuchal translucency (NT) ≤ 3.5 mm and no fetal defects) were randomized into one of two groups. In the first group, risk of aneuploidy was assessed using FTCS based on the most recent UK Fetal Medicine Foundation algorithm. In the second group, risk assessment was based on ultrasound findings and cfDNA analysis. An additional tube of blood was collected for FTCS in case the cfDNA analysis was uninformative. Primary outcome was false-positive rate in screening for trisomy 21. A case was considered false positive if the karyotype was not trisomy 21 and if the risk for trisomy 21 was >1:100, irrespective of the method of risk calculation. Results were compared using 95% CIs using the Clopper-Pearson method. Between October 2015 and December 2016, 1518 women with singleton pregnancy underwent first-trimester screening. Thirty-one (2.0%) pregnancies were not eligible for randomization due to increased NT (> 3.5 mm) and/or fetal defect. After exclusion of women who declined randomization (n = 87) and cases of fetal death and loss to follow-up (n = 24), 688 pregnancies were randomized into the FTCS arm and 688 into the ultrasound + cfDNA analysis arm. There were no differences in maternal and gestational age, maternal weight and BMI, ethnicity, use of assisted reproduction and cigarette smoking between the two arms. In the ultrasound + cfDNA analysis arm, median risk for trisomy 21 was 1 in 10 000. None of the cases had a risk above 1: 100 (95% CI, 0.0-0.5%). In the FTCS arm, the median risk for trisomy 21 was 1 in 3787 and in 17 cases, the risk was higher than 1:100, which corresponds to 2.5% (95% CI, 1.5-3.9%) of

  5. Classification of Breast Cancer Subtypes by combining Gene Expression and DNA Methylation Data

    Directory of Open Access Journals (Sweden)

    List Markus

    2014-06-01

    Full Text Available Selecting the most promising treatment strategy for breast cancer crucially depends on determining the correct subtype. In recent years, gene expression profiling has been investigated as an alternative to histochemical methods. Since databases like TCGA provide easy and unrestricted access to gene expression data for hundreds of patients, the challenge is to extract a minimal optimal set of genes with good prognostic properties from a large bulk of genes making a moderate contribution to classification. Several studies have successfully applied machine learning algorithms to solve this so-called gene selection problem. However, more diverse data from other OMICS technologies are available, including methylation. We hypothesize that combining methylation and gene expression data could already lead to a largely improved classification model, since the resulting model will reflect differences not only on the transcriptomic, but also on an epigenetic level. We compared so-called random forest derived classification models based on gene expression and methylation data alone, to a model based on the combined features and to a model based on the gold standard PAM50. We obtained bootstrap errors of 10-20% and classification error of 1-50%, depending on breast cancer subtype and model. The gene expression model was clearly superior to the methylation model, which was also reflected in the combined model, which mainly selected features from gene expression data. However, the methylation model was able to identify unique features not considered as relevant by the gene expression model, which might provide deeper insights into breast cancer subtype differentiation on an epigenetic level.

  6. Chromosome damage induced by DNA topoisomerase II inhibitors combined with g-radiation in vitro

    Directory of Open Access Journals (Sweden)

    Maria Cristina P. Araújo

    1998-09-01

    Full Text Available Combined radiation and antineoplastic drug treatment have important applications in cancer therapy. In the present work, an evaluation was made of two known topoisomerase II inhibitors, doxorubicin (DXR and mitoxantrone (MXN, with g-radiation. The effects of DXR or MXN on g-radiation-induced chromosome aberrations in Chinese hamster ovary (CHO cells were analyzed. Two concentrations of each drug, 0.5 and 1.0 µg/ml DXR, and 0.02 and 0.04 µg/ml MXN, were applied in combination with two doses of g-radiation (20 and 40 cGy. A significant potentiating effect on chromosomal aberrations was observed in CHO cells exposed to 1.0 µg/ml DXR plus 40 cGy. In the other tests, the combination of g-radiation with DXR or MXN gave approximately additive effects. Reduced mitotic indices reflected higher toxicity of the drugs when combined with radiation.A associação de radiação ionizante com drogas antineoplásicas tem importante aplicação na terapia do câncer. No presente trabalho, foram avaliados os efeitos de dois inibidores de topoisomerase II, doxorubicina (DXR e mitoxantrona (MXN, sobre as aberrações cromossômicas induzidas pelas radiações-g em células do ovário de hamster chinês (CHO. Foram usadas as concentrações 0,5 e 1,0 mg/ml de DXR e 0,02 e 0,04 mg/ml de MXN, combinadas com duas doses de radiações gama (20 e 40 cGy. Um significativo efeito potenciador das aberrações cromossômicas foi observado em células CHO tratadas com 1,0 mg/ml de DXR e expostas a 40 cGy de radiação. Nos outros testes, a combinação da radiação-g com a DXR ou MXN apresentou um efeito próximo ao aditivo. A redução dos índices mitóticos refletiu a alta citotoxicidade das drogas quando combinadas às radiações-g.

  7. Classification of Breast Cancer Subtypes by combining Gene Expression and DNA Methylation Data

    DEFF Research Database (Denmark)

    List, Markus; Hauschild, Anne-Christin; Tan, Qihua

    2014-01-01

    expression data for hundreds of patients, the challenge is to extract a minimal optimal set of genes with good prognostic properties from a large bulk of genes making a moderate contribution to classification. Several studies have successfully applied machine learning algorithms to solve this so-called gene...... on the transcriptomic, but also on an epigenetic level. We compared so-called random forest derived classification models based on gene expression and methylation data alone, to a model based on the combined features and to a model based on the gold standard PAM50. We obtained bootstrap errors of 10...

  8. Systems-Level Analysis of EGFR Inhibition-DNA Damage Combination Treatment in Breast Cancer

    Science.gov (United States)

    2012-09-01

    rewired’’ using drugs individually and in combination ( Sachs et al., 2005). In many forms of breast cancer, aberrant hormonal and/or growth factor...medicine. FEBS Lett. 582, 1266–1270. Perou, C.M., Sørlie, T., Eisen, M.B., van de Rijn, M., Jeffrey , S.S., Rees, C.A., Pollack, J.R., Ross, D.T., Johnsen...panel of human normal and tumour cell lines. Cell Prolif. 40, 580–594. Sachs , K., Perez, O., Pe’er, D., Lauffenburger, D.A., and Nolan, G.P. (2005

  9. Potential DNA barcodes for Melilotus species based on five single loci and their combinations.

    Directory of Open Access Journals (Sweden)

    Fan Wu

    Full Text Available Melilotus, an annual or biennial herb, belongs to the tribe Trifolieae (Leguminosae and consists of 19 species. As an important green manure crop, diverse Melilotus species have different values as feed and medicine. To identify different Melilotus species, we examined the efficiency of five candidate regions as barcodes, including the internal transcribed spacer (ITS and two chloroplast loci, rbcL and matK, and two non-coding loci, trnH-psbA and trnL-F. In total, 198 individuals from 98 accessions representing 18 Melilotus species were sequenced for these five potential barcodes. Based on inter-specific divergence, we analysed sequences and confirmed that each candidate barcode was able to identify some of the 18 species. The resolution of a single barcode and its combinations ranged from 33.33% to 88.89%. Analysis of pairwise distances showed that matK+rbcL+trnL-F+trnH-psbA+ITS (MRTPI had the greatest value and rbcL the least. Barcode gap values and similarity value analyses confirmed these trends. The results indicated that an ITS region, successfully identifying 13 of 18 species, was the most appropriate single barcode and that the combination of all five potential barcodes identified 16 of the 18 species. We conclude that MRTPI is the most effective tool for Melilotus species identification. Taking full advantage of the barcode system, a clear taxonomic relationship can be applied to identify Melilotus species and enhance their practical production.

  10. Identification of velvet antler by random amplified polymorphism DNA combined with non-gel sieving capillary electrophoresis.

    Science.gov (United States)

    Yuan, Guangxin; Sun, Jiyan; Li, Hongyu; Fu, Guilian; Xu, Guangyu; Li, Mingcheng; Zhang, Lihua; Fan, Xintian

    2016-01-01

    Mitochondrial DNA of velvet antler was amplified with random amplified polymorphic DNA (RAPD) technique and the PCR products were detected with non-gel sieving capillary electrophoresis to establish a RAPD-HPCE method used for identifying the authenticity of velvet antler or it counterfeits. Factors that could affect the PCR amplification and capillary electrophoresis were optimized. Under the optimized conditions, namely, 20 mmol L(-1) NaH2PO4-Na2HPO4-2 mmol L(-1) EDTA buffer solution [0.8% (W/V) HPMC, 15 mmol L(-1) TBAP and pH 7.3], -10 kV injection voltage and -8 kV separation voltage, Cervus nippon Temminck antler, Cervus elaphus Linnaeus antler, Rangifer tarandus antler, Cervus canadensis antler and Elaphurus davidianus antler were analyzed. The analysis on the similarity of obtained elctrophoretograms showed that there were significant differences in similarities of different velvet antlers, which could be used for the quick identification of the authenticity of velvet antler samples. It can be found that the technique of RAPD combined with HPCE is advantageous in rich polymorphism, high detection rate, simple and convenient performance, high efficiency, rapidness and sensitivity, indicating that it should be suitable for the quick identification of the authenticity of velvet antler samples.

  11. Combined NMR and DFT studies for the absolute configuration elucidation of the spore photoproduct, a UV-induced DNA lesion.

    Science.gov (United States)

    Mantel, Claire; Chandor, Alexia; Gasparutto, Didier; Douki, Thierry; Atta, Mohamed; Fontecave, Marc; Bayle, Pierre-Alain; Mouesca, Jean-Marie; Bardet, Michel

    2008-12-17

    By irradiation of bacterial spores under UV radiation, a photoproduct (SP) bearing a covalent methylene link between two adjacent thymines is formed in DNA. Because of the presence of an asymmetric carbon on the aglycone and of two possible orientations for the formation of the cross-link, four isomers could in principle be obtained. Currently, no conclusive structural information of this photoproduct is available. The structure of the isolated SPTpT dinucleotide was revisited in order to determine the type of cross-link and the absolute configuration of the C5a carbon. For this purpose, a study combining NMR spectroscopy and DFT calculations was pursued on the spore photoproduct of the dinucleoside TpT since its structure was previously shown to be identical to the one produced in DNA. A full characterization of SPTpT by NMR analyses was performed in D2O and DMSO. 2D NMR measurements (1H-13C, 1H-31P, COSY, NOESY, and ROESY) and DFT calculations (geometries optimization of R and S isomers and theoretical chemical shifts) lead us to conclude without ambiguity that the absolute configuration of the C5a carbon is R and that the methylene bridge of the photoproduct corresponds to the methyl group of the thymine located on the 3'-end of the dinucleoside monophosphate.

  12. [Combined use of irradiation and DNA tumor vaccine to treat canine oral malignant melanoma: a pilot study].

    Science.gov (United States)

    Herzog, A; Buchholz, J; Ruess-Melzer, K; Lang, J; Kaser-Hotz, B

    2013-02-01

    Melanoma is the most common oral tumor in dogs, characterized by rapid growth, local invasion, and high metastatic rate. The goal of this study was to evaluate the combination of radiation therapy and DNA tumor vaccine. We hypothesized, that the concurrent use would not increase toxicity. Nine dogs with oral melanoma were treated with 4 fractions of 8 Gray at 7-day intervals. The vaccine was given 4 times every 14 days, beginning at the first radiation fraction. Local acute radiation toxicities were assessed according to the VRTOG toxicity scoring scheme over a time period of 7 weeks. In none of the evaluated dogs, mucositis, dermatitis and conjunctivitis exceeded grade 2. In 3 dogs mild fever, lethargy, and local swelling at the injection site were seen after vaccine application. In conclusion, the concurrent administration of radiation therapy and vaccine was well tolerated in all dogs.

  13. Effect of probucol combined with atorvastatin adjuvant therapy on serum indexes of acute cerebral infarction patients during rehabilitation period

    Directory of Open Access Journals (Sweden)

    Li Zhang

    2016-06-01

    Full Text Available Objective: To analyze the effect of probucol combined with atorvastatin adjuvant therapy on serum indexes of acute cerebral infarction patients in rehabilitation period. Methods: A total of 102 patients with acute cerebral infarction were treated in our hospital from August 2011 to June 2015, were confirmed by magnetic resonance imaging and were randomly divided into observation group 51 cases and control group 51 cases according to the order of hospitalization. Control group received atorvastatin treatment alone, observation group received probucol combined with atorvastatin adjuvant therapy, and then differences in levels of serum CXCL16, HMGB1, CD40L and Fibulin-5, P-selectin, NPY, CGRP, visfatin and others, chemokines and inflammation-related factors, vascular endothelial cells and fibrinolytic function, etc were compared between two groups after treatment. Results: Serum CXCL16, HMGB1, CD40L and Fibulin-5 levels of observation group after treatment were lower than those of control group; serum P-selectin, NPY, visfatin, UCH-L1, sVCAM-1 and SAA levels of observation group after treatment were lower than those of control group while CGRP level was higher than that of control group; serum CCL-19, CCL-21, YKL-40, IL-33 and IL- 18 values of observation group after treatment were lower than those of control group; serum vWF, PAI-1 and plasminogen levels of observation group after treatment were lower than those of control group while 6-K-PGF1α and tPA levels were higher than those of control group. Conclusions: Probucol combined with atorvastatin adjuvant therapy for acute cerebral infarction patients in rehabilitation period can effectively optimize patients’ general status and avoid re-infarction in recovery period, and it has positive clinical significance.

  14. Combination of PDT and a DNA demethylating agent produces anti-tumor immune response in a mouse tumor model

    Science.gov (United States)

    Mroz, Pawel; Hamblin, Michael R.

    2009-06-01

    Epigenetic mechanisms, which involve DNA methylation and histone modifications, result in the heritable silencing of genes without a change in their coding sequence. However, these changes must be actively maintained after each cell division rendering them a promising target for pharmacologic inhibition. DNA methyltransferase inhibitors like 5-aza-deoxycytidine (5-aza-dC) induce and/or up-regulate the expression of MAGE-type antigens in human and mice cancer cells. Photodynamic therapy (PDT) has been shown to be an effective locally ablative anti-cancer treatment that has the additional advantage of stimulating tumor-directed immune response. We studied the effects of a new therapy that combined the demethylating agent 5-aza-dC with PDT in the breast cancer model 4T1 syngenic to immunocompetent BALB/c mice. PDT was used as a locally ablating tumor treatment that is capable of eliciting strong and tumor directed immune response while 5-aza-dC pretreatment was used promote de novo induction of the expression of P1A.protein. This is the mouse homolog of human MAGE family antigens and is reported to function as a tumor rejection antigen in certain mouse tumors. This strategy led to an increase in PDT-mediated immune response and better treatment outcome. These results strongly suggest that the MAGE family antigens are important target for PDT mediated immune response but that their expression can be silenced by epigenetic mechanisms. Therefore the possibility that PDT can be combined with epigenetic strategies to elicit anti-tumor immunity in MAGE-positive tumor models is highly clinically significant and should be studied in detail.

  15. DNA methylation combinations in adjacent normal colon tissue predict cancer recurrence: evidence from a clinical cohort study.

    Directory of Open Access Journals (Sweden)

    Jen Chun Kuan

    Full Text Available Accumulating evidence has suggested the requirement for further stratification of patients in the same tumor stage according to molecular factors. We evaluate the combination of cancer stage and DNA methylation status as an indicator of the risk of recurrence and mortality among patients with colorectal cancer (CRC. A cohort study of 215 patients with CRC (mean age 64.32 years; 50.5% of men from Tri-Service General Hospital in Taiwan examined the association between cancer stage and risk of CRC recurrence and mortality. A Cox proportional hazard model was used to analyze patient methylation status and clinical information at study entry, and their associations with CRC recurrence and mortality during follow-up. The advanced stage patients with p16, hMLH1, and MGMT methylation were associated with higher risk of CRC recurrence compared with the local stage patients with unmethylation status in tumor tissues, with adjusted hazard ratios (HRs (95% confidence interval [CI] of 9.64 (2.92-31.81, 8.29 (3.40-20.22, and 11.83 (3.49-40.12, respectively. When analyzing normal tissues, we observed similar risk of CRC recurrence with adjusted HRs (95% CI of 10.85 (4.06-28.96, 9.04 (3.79-21.54, and 12.61 (4.90-32.44, respectively. For combined analyses, the risk of recurrence in the patients in advanced stage with DNA methylation in both normal and tumor tissues, compared with local stage with unmethylation, was increased with adjusted HR (95% CI of 9.37 (3.36-26.09. In the advanced stage patients, methylation status and tissue subtype were associated with increased risk of 5-year cumulative CRC recurrence (p < 0.001. This study demonstrates that clustering DNA methylation status according to cancer stage and tissue subtype is critical for the assessment of risk of recurrence in CRC patients and also indicated an underlying mechanism.

  16. Combined ultrasound-targeted microbubble destruction and polyethylenimine-mediated plasmid DNA delivery to the rat retina: enhanced efficiency and accelerated expression.

    Science.gov (United States)

    Li, Hongli; Qian, Jin; Yao, Chunfang; Wan, Caifeng; Li, Fenghua

    2016-04-01

    Gene therapy has potential in the treatment of refractory retinal diseases. It is important to develop an effective delivery system in the retina. The present study aimed to investigate the efficacy and safety of ultrasound (US)-targeted microbubble destruction (UTMD)-mediated polyethylenimine (PEI) to the rat retina. Gene transfer was examined by injecting PEI/plasmid DNA (pDNA) with or without microbubbles (MBs) into the subretinal space of rats that were then exposed to US. We investigated enhanced green fluorescent protein (eGFP) expression on flat fundus oculi and performed quantitative analysis. Hematoxylin and eosin staining was used to observe tissue damage. UTMD significantly enhanced PEI/pDNA transfection efficiency safely by increasing both the transgene expression per cell and the percentage of transfected cells of the retina. PEI/pDNA combined with UTMD significantly increased the number of DNA gene copies and the mRNA level in the retinal pigment epithelium (RPE) and neural retina, respectively, compared to PEI/pDNA alone. The present study demonstrates that enhanced and accelerated pDNA expression can be achieved in the retina/RPE cells in vivo by UTMD physical techniques combined with a PEI chemical vector. Our study provides useful information for further in vivo retinal gene therapy work. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  17. Determining the Architecture of a Protein-DNA Complex by Combining FeBABE Cleavage Analyses, 3-D Printed Structures, and the ICM Molsoft Program.

    Science.gov (United States)

    James, Tamara; Hsieh, Meng-Lun; Knipling, Leslie; Hinton, Deborah

    2015-01-01

    Determining the structure of a protein-DNA complex can be difficult, particularly if the protein does not bind tightly to the DNA, if there are no homologous proteins from which the DNA binding can be inferred, and/or if only portions of the protein can be crystallized. If the protein comprises just a part of a large multi-subunit complex, other complications can arise such as the complex being too large for NMR studies, or it is not possible to obtain the amounts of protein and nucleic acids needed for crystallographic analyses. Here, we describe a technique we used to map the position of an activator protein relative to the DNA within a large transcription complex. We determined the position of the activator on the DNA from data generated using activator proteins that had been conjugated at specific residues with the chemical cleaving reagent, iron bromoacetamidobenzyl-EDTA (FeBABE). These analyses were combined with 3-D models of the available structures of portions of the activator protein and B-form DNA to obtain a 3-D picture of the protein relative to the DNA. Finally, the Molsoft program was used to refine the position, revealing the architecture of the protein-DNA within the transcription complex.

  18. Combination of pentafluorophenylhydrazine derivatization and isotope dilution LC-MS/MS techniques for the quantification of apurinic/apyrimidinic sites in cellular DNA.

    Science.gov (United States)

    Li, Jie; Leung, Elvis M K; Choi, Martin M F; Chan, Wan

    2013-05-01

    Apurinic/apyrimidinic (AP) sites are common DNA lesions arising from spontaneous hydrolysis of the N-glycosidic bond and base-excision repair mechanisms of the modified bases. Due to the strong association of AP site formation with physically/chemically induced DNA damage, quantifying AP sites provides important information for risk assessment of exposure to genotoxins and oxidative stress. However, rigorous quantification of AP sites in DNA has been hampered by technical problems relating to the sensitivity and selectivity of existing analytical methods. We have developed a new isotope dilution liquid chromatography-coupled tandem mass spectrometry (LC-MS/MS) method for the rigorous quantification of AP sites in genomic DNA. The method entails enzymatic digestion of AP site-containing DNA by endo- and exonucleases, derivatization with pentafluorophenylhydrazine (PFPH), addition of an isotopically labeled PFPH derivative as internal standard, and quantification by LC-MS/MS. The combination of PFPH derivatization with LC-MS/MS analysis on a triple quadrupole mass spectrometer allows for sensitive and selective quantification of AP sites in DNA at a detection limit of 6.5 fmol, corresponding to 4 AP sites/10(9) nt in 5 μg of DNA, which is at least ten times more sensitive than existing analytical methods. The protocol was validated by AP site-containing oligonucleotides and applied in quantifying methyl methanesulfonate-induced formation of AP sites in cellular DNA.

  19. Revealing the uncultivated majority: combining DNA stable-isotope probing, multiple displacement amplification and metagenomic analyses of uncultivated Methylocystis in acidic peatlands.

    Science.gov (United States)

    Chen, Yin; Dumont, Marc G; Neufeld, Josh D; Bodrossy, Levente; Stralis-Pavese, Nancy; McNamara, Niall P; Ostle, Nick; Briones, Maria J I; Murrell, J Colin

    2008-10-01

    Peatlands represent an enormous carbon reservoir and have a potential impact on the global climate because of the active methanogenesis and methanotrophy in these soils. Uncultivated methanotrophs from seven European peatlands were studied using a combination of molecular methods. Screening for methanotroph diversity using a particulate methane monooxygenase-based diagnostic gene array revealed that Methylocystis-related species were dominant in six of the seven peatlands studied. The abundance and methane oxidation activity of Methylocystis spp. were further confirmed by DNA stable-isotope probing analysis of a sample taken from the Moor House peatland (England). After ultracentrifugation, (13)C-labelled DNA, containing genomic DNA of these Methylocystis spp., was separated from (12)C DNA and subjected to multiple displacement amplification (MDA) to generate sufficient DNA for the preparation of a fosmid metagenomic library. Potential bias of MDA was detected by fingerprint analysis of 16S rRNA using denaturing gradient gel electrophoresis for low-template amplification (0.01 ng template). Sufficient template (1-5 ng) was used in MDA to circumvent this bias and chimeric artefacts were minimized by using an enzymatic treatment of MDA-generated DNA with S1 nuclease and DNA polymerase I. Screening of the metagenomic library revealed one fosmid containing methanol dehydrogenase and two fosmids containing 16S rRNA genes from these Methylocystis-related species as well as one fosmid containing a 16S rRNA gene related to that of Methylocella/Methylocapsa. Sequencing of the 14 kb methanol dehydrogenase-containing fosmid allowed the assembly of a gene cluster encoding polypeptides involved in bacterial methanol utilization (mxaFJGIRSAC). This combination of DNA stable-isotope probing, MDA and metagenomics provided access to genomic information of a relatively large DNA fragment of these thus far uncultivated, predominant and active methanotrophs in peatland soil.

  20. Combined analysis of O6-methylguanine-DNA methyltransferase protein expression and promoter methylation provides optimized prognostication of glioblastoma outcome

    Science.gov (United States)

    Lalezari, Shadi; Chou, Arthur P.; Tran, Anh; Solis, Orestes E.; Khanlou, Negar; Chen, Weidong; Li, Sichen; Carrillo, Jose A.; Chowdhury, Reshmi; Selfridge, Julia; Sanchez, Desiree E.; Wilson, Ryan W.; Zurayk, Mira; Lalezari, Jonathan; Lou, Jerry J.; Ormiston, Laurel; Ancheta, Karen; Hanna, Robert; Miller, Paul; Piccioni, David; Ellingson, Benjamin M.; Buchanan, Colin; Mischel, Paul S.; Nghiemphu, Phioanh L.; Green, Richard; Wang, He-Jing; Pope, Whitney B.; Liau, Linda M.; Elashoff, Robert M.; Cloughesy, Timothy F.; Yong, William H.; Lai, Albert

    2013-01-01

    Background Promoter methylation of the DNA repair gene, O-6-methylguanine-DNA methyltransferase (MGMT), is associated with improved treatment outcome for newly diagnosed glioblastoma (GBM) treated with standard chemoradiation. To determine the prognostic significance of MGMT protein expression as assessed by immunohistochemistry (IHC) and its relationship with methylation, we analyzed MGMT expression and promoter methylation with survival in a retrospective patient cohort. Methods We identified 418 patients with newly diagnosed GBM at University of California Los Angeles Kaiser Permanente Los Angeles, nearly all of whom received chemoradiation, and determined MGMT expression by IHC, and MGMT promoter methylation by methylation-specific PCR (MSP) and bisulfite sequencing (BiSEQ) of 24 neighboring CpG sites. Results With use of the median percentage of cells staining by IHC as the threshold, patients with <30% staining had progression-free survival (PFS) of 10.9 months and overall survival (OS) of 20.5 months, compared with PFS of 7.8 months (P < .0001) and OS of 16.7 months (P < .0001) among patients with ≥30% staining. Inter- and intrareader correlation of IHC staining was high. Promoter methylation status by MSP was correlated with IHC staining. However, low IHC staining was frequently observed in the absence of promoter methylation. Increased methylation density determined by BiSEQ correlated with both decreased IHC staining and increased survival, providing a practical semiquantitative alternative to MSP. On the basis of multivariate analysis validated by bootstrap analysis, patients with tandem promoter methylation and low expression demonstrated improved OS and PFS, compared with the other combinations. Conclusions Optimal assessment of MGMT status as a prognostic biomarker for patients with newly diagnosed GBM treated with chemoradiation requires determination of both promoter methylation and IHC protein expression. PMID:23328811

  1. A universal protocol for the combined isolation of metabolites, DNA, long RNAs, small RNAs, and proteins from plants and microorganisms.

    Science.gov (United States)

    Valledor, Luis; Escandón, Mónica; Meijón, Mónica; Nukarinen, Ella; Cañal, María Jesús; Weckwerth, Wolfram

    2014-07-01

    Here, we describe a method for the combined metabolomic, proteomic, transcriptomic and genomic analysis from one single sample as a major step for multilevel data integration strategies in systems biology. While extracting proteins and DNA, this protocol also allows the separation of metabolites into polar and lipid fractions, as well as RNA fractionation into long and small RNAs, thus allowing a broad range of transcriptional studies. The isolated biomolecules are suitable for analysis with different methods that range from electrophoresis and blotting to state-of-the-art procedures based on mass spectrometry (accurate metabolite profiling, shot-gun proteomics) or massive sequencing technologies (transcript analysis). The low amount of starting tissue, its cost-efficiency compared with the utilization of commercial kits, and its performance over a wide range of plant, microbial, and algal species such as Chlamydomonas, Arabidopsis, Populus, or Pinus, makes this method a universal alternative for multiple molecular isolation from plant tissues. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  2. Activity of levofloxacin alone and in combination with a DnaK inhibitor against gram-negative rods, including levofloxacin-resistant strains.

    Science.gov (United States)

    Credito, Kim; Lin, Gengrong; Koeth, Laura; Sturgess, Michael A; Appelbaum, Peter C

    2009-02-01

    Synergy time-kill testing of levofloxacin alone and in combination with CHP-105, a representative DnaK inhibitor, against 50 gram-negative rods demonstrated that 34 of the 50 strains tested showed significant synergy between levofloxacin and CHP-105 after 12 h and 24 h. Fourteen of these 34 organisms were quinolone resistant (levofloxacin MICs of > or =4 microg/ml).

  3. Combination of MIDGE-Th1 DNA vaccines with the cationic lipid SAINT-18 : Studies on formulation, biodistribution and vector clearance

    NARCIS (Netherlands)

    Endmann, Anne; Oswald, Detlef; Riede, Oliver; Talman, Eduard G.; Vos, Roelien E.; Schroff, Matthias; Kleuss, Christiane; Ruiters, Marcel H. J.; Juhls, Christiane

    2014-01-01

    We have previously shown that the combination of MIDGE-Th1 DNA vectors with the cationic lipid SAINT-18 increases the immune response to the encoded antigen in mice. Here, we report on experiments to further optimize and characterize this approach. We evaluated different formulations of MIDGE-Th1

  4. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    International Nuclear Information System (INIS)

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  5. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  6. Pre-clinical toxicity & immunobiological evaluation of DNA rabies vaccine & combination rabies vaccine in rhesus monkeys (Macaca mulatta).

    Science.gov (United States)

    Kumar, B Dinesh; Kumar, P Uday; Krishna, T Prasanna; Kalyanasundaram, S; Suresh, P; Jagadeesan, V; Hariharan, S; Naidu, A Nadamuni; Krishnaswamy, Kamala; Rangarajan, P N; Srinivasan, V A; Reddy, G S; Sesikeran, B

    2013-06-01

    Pre-clinical toxicology evaluation of biotechnology products is a challenge to the toxicologist. The present investigation is an attempt to evaluate the safety profile of the first indigenously developed recombinant DNA anti-rabies vaccine [DRV (100 μg)] and combination rabies vaccine [CRV (100 μg DRV and 1.25 IU of cell culture-derived inactivated rabies virus vaccine)], which are intended for clinical use by intramuscular route in Rhesus monkeys. As per the regulatory requirements, the study was designed for acute (single dose - 14 days), sub-chronic (repeat dose - 28 days) and chronic (intended clinical dose - 120 days) toxicity tests using three dose levels, viz. therapeutic, average (2x therapeutic dose) and highest dose (10 x therapeutic dose) exposure in monkeys. The selection of the model i.e. monkey was based on affinity and rapid higher antibody response during the efficacy studies. An attempt was made to evaluate all parameters which included physical, physiological, clinical, haematological and histopathological profiles of all target organs, as well as Tiers I, II, III immunotoxicity parameters. In acute toxicity there was no mortality in spite of exposing the monkeys to 10XDRV. In sub chronic and chronic toxicity studies there were no abnormalities in physical, physiological, neurological, clinical parameters, after administration of test compound in intended and 10 times of clinical dosage schedule of DRV and CRV under the experimental conditions. Clinical chemistry, haematology, organ weights and histopathology studies were essentially unremarkable except the presence of residual DNA in femtogram level at site of injection in animal which received 10X DRV in chronic toxicity study. No Observational Adverse Effects Level (NOAEL) of DRV is 1000 ug/dose (10 times of therapeutic dose) if administered on 0, 4, 7, 14, 28 th day. The information generated by this study not only draws attention to the need for national and international regulatory

  7. Identification of differential expression of genes in hepatocellular carcinoma by suppression subtractive hybridization combined cDNA microarray.

    Science.gov (United States)

    Liu, Yuefang; Zhu, Xiaojing; Zhu, Jin; Liao, Shibing; Tang, Qi; Liu, Kaikun; Guan, Xiaohong; Zhang, Jianping; Feng, Zhenqing

    2007-10-01

    The genetic background of hepatocellular carcinoma (HCC) has yet to be completely understood. Here, we describe the application of suppression subtractive hybridization (SSH) coupled with cDNA microarray analysis for the isolation and identification of differential expression of genes in HCC. Twenty-six known genes were validated as up-regulated and 19 known genes as down-regulated in HCC. The known genes identified were found to have diverse functions. In addition to the overexpression of AFP, these genes (increased in the presence of HCC) are involved in many processes, such as transcription and protein biosynthesis (HNRPDL, PABPC1, POLR2K, SRP9, SNRPA, and six ribosomal protein genes including RPL8, RPL14, RPL41, RPS5, RPS17, RPS24), the metabolism of lipids and proteins (FADS1, ApoA-II, ApoM, FTL), cell proliferation (Syndecan-2, and Annexin A2), and signal transduction (LRRC28 and FMR1). Additionally, a glutathione-binding protein involved in the detoxification of methylglyoxal known as GLO1 and an enzyme which increases the formation of prostaglandin E(2) known as PLA2G10 were up-regulated in HCC. Among the underexpressed genes discovered in HCC, most were responsible for liver-synthesized proteins (fibrinogen, complement species, amyloid, albumin, haptoglobin, hemopexin and orosomucoid). The enzyme implicated in the biotransformation of CYP family members (LOC644587) was decreased. The genes coding enzymes ADH1C, ALDH6A1, ALDOB, Arginase and CES1 were also found. Additionally, we isolated a zinc transporter (Zip14) and a function-unknown gene named ZBTB11 (Zinc finger and BTB domain containing 11) which were underexpressed, and seven expression sequence tags deregulated in HCC without significant homology reported in the public database. Essentially, by using SSH combined with a cDNA microarray we have identified a number of genes associated with HCC, most of which have not been previously reported. Further characterization of these differentially expressed

  8. Effects of combined exposure to thaliblastine and gamma rays on DNA, RNA, and protein synthesis in leukocytes from rat peripheral blood

    International Nuclear Information System (INIS)

    Khadzhidekova, V.; Marinova, Ts.

    1987-01-01

    The action of the alkaloid thaliblastine (a Bulgarian potential antitumor drug) upon macromolecule synthesis has been studied in vitro by treating rat peripheral leukocytes with the agent solely or combined with irradiation. The concentration tested were 1, 5, 10, 15, and 20 μg/ml blood, which are sublethal to the cells. A 137 Cs gamma source was used to deliver a single dose of 1, 2, 3, or 4 Gy. For combined exposures, the blood was exposed to a 2 Gy dose and simultaneously treated with thaliblastine. The changes in macromolecule synthesis were judged by recording incorporation of labelled precursors relative to that in non-treated controls taken as 100%. With sole thaliblastine treatments, most markedly suppressed was protein synthesis. Radiation alone inhibited to the largest extent the synthesis of DNA. With combined treatments, DNA synthesis was again the most markedly affected of the three synthesis types; the inhibitory effect proved additive, with a tendency to potentiation in the case of higher thaliblastine concentrations. Suppression of protein synthesis was less pronounced that expected on a hypothetic additivity basis. The changes observed in macromolecule synthesis under sole or combined action of thaliblastine and gamma rays indicated the two types of cytostatics to differ in mechanisms of action. For radiation, the target was DNA, whereas for thaliblastine the cell division spindle appeared to be the most likely target. The evidence obtained with combined exposure pointed to the determining role of radiation as a factor interfering with macromolecule synthesis. (author)

  9. Combining Low Temperature Fluorescence DNA-Hybridization, Immunostaining, and Super-Resolution Localization Microscopy for Nano-Structure Analysis of ALU Elements and Their Influence on Chromatin Structure.

    Science.gov (United States)

    Krufczik, Matthias; Sievers, Aaron; Hausmann, Annkathrin; Lee, Jin-Ho; Hildenbrand, Georg; Schaufler, Wladimir; Hausmann, Michael

    2017-05-07

    Immunostaining and fluorescence in situ hybridization (FISH) are well established methods for specific labelling of chromatin in the cell nucleus. COMBO-FISH (combinatorial oligonucleotide fluorescence in situ hybridization) is a FISH method using computer designed oligonucleotide probes specifically co-localizing at given target sites. In combination with super resolution microscopy which achieves spatial resolution far beyond the Abbe Limit, it allows new insights into the nano-scaled structure and organization of the chromatin of the nucleus. To avoid nano-structural changes of the chromatin, the COMBO-FISH labelling protocol was optimized omitting heat treatment for denaturation of the target. As an example, this protocol was applied to ALU elements-dispersed short stretches of DNA which appear in different kinds in large numbers in primate genomes. These ALU elements seem to be involved in gene regulation, genomic diversity, disease induction, DNA repair, etc. By computer search, we developed a unique COMBO-FISH probe which specifically binds to ALU consensus elements and combined this DNA-DNA labelling procedure with heterochromatin immunostainings in formaldehyde-fixed cell specimens. By localization microscopy, the chromatin network-like arrangements of ALU oligonucleotide repeats and heterochromatin antibody labelling sites were simultaneously visualized and quantified. This novel approach which simultaneously combines COMBO-FISH and immunostaining was applied to chromatin analysis on the nanoscale after low-linear-energy-transfer (LET) radiation exposure at different doses. Dose-correlated curves were obtained from the amount of ALU representing signals, and the chromatin re-arrangements during DNA repair after irradiation were quantitatively studied on the nano-scale. Beyond applications in radiation research, the labelling strategy of immunostaining and COMBO-FISH with localization microscopy will also offer new potentials for analyses of subcellular

  10. New flexible origination technology based on electron-beam lithography and its integration into security devices in combination with covert features based on DNA authentication

    Science.gov (United States)

    Drinkwater, John K.; Ryzi, Zbynek; Outwater, Chris S.

    2002-04-01

    Embossed diffractive optically variable devices are becoming increasingly familiar security items on plastic cards, banknotes, security documents and on branded goods and media to protect against counterfeit, protect copyright and to evidence tamper. Equally as this devices become both more widely available there is a pressing requirement for security technology upgrades to keep ahead of technology advances available to potential counterfeiters. This paper describes a new generation electron beam DOVID origination technology particularly suitable for high security applications. Covert marking of security devices is provided using the DNA matrix by creating and verifying unique DNA sequences. This integration of this into practical security features in combination with covert features based on DNA matrix authentication and other more straightforwardly authenticable features to provide multi- technology security solutions will be described.

  11. [PrepFiler Express BTATM Lysis Buffer Combined with Silicon Microbeads for Rapid DNA Extraction from Bone].

    Science.gov (United States)

    Ding, S C; Zhang, H C; Gao, L L

    2017-10-01

    To establish a convenient and rapid method for extracting DNA from bone. Fifteen long bone samples were washed and sterilized. The skeletal fragments were obtained by electric drill, and lysed by PrepFiler Express BTA™ lysis buffer. DNA was then manually extracted by silicon microbeads for further analysis. STR genotyping was successfully obtained in 14 out of the 15 samples, and the detection rate was 93.33%. The method for DNA extraction from bone established in present study is convenient, quick, effective, and with a strong applicability, which is worth spreading and applying. Copyright© by the Editorial Department of Journal of Forensic Medicine

  12. Clinical implementation of routine screening for fetal trisomies in the UK NHS: cell-free DNA test contingent on results from first-trimester combined test.

    Science.gov (United States)

    Gil, M M; Revello, R; Poon, L C; Akolekar, R; Nicolaides, K H

    2016-01-01

    Cell-free DNA (cfDNA) analysis of maternal blood for detection of trisomies 21, 18 and 13 is superior to other methods of screening but is expensive. One strategy to maximize performance at reduced cost is to offer cfDNA testing contingent on the results of the first-trimester combined test that is used currently. The objectives of this study were to report the feasibility of implementing such screening, to examine the factors affecting patient decisions concerning their options for screening and decisions on the management of affected pregnancies and to report the prenatal diagnosis of fetal trisomies and outcome of affected pregnancies following the introduction of contingent screening. We examined routine clinical implementation of contingent screening in 11,692 singleton pregnancies in two National Health Service (NHS) hospitals in the UK. Women with a risk ≥ 1 in 100 (high-risk group) were offered options of invasive testing, cfDNA testing or no further testing, and those with a risk between 1 in 101 and 1 in 2500 (intermediate-risk group) were offered cfDNA testing or no further testing. The trisomic status of the pregnancies was determined by prenatal or postnatal karyotyping or by examination of the neonates. In the study population of 11,692 pregnancies, there were 47 cases of trisomy 21 and 28 of trisomies 18 or 13. Screening with the combined test followed by invasive testing for all patients in the high-risk group potentially could have detected 87% of trisomy 21 and 93% of trisomies 18 or 13, at a false-positive rate of 3.4%; the respective values for cfDNA testing in the high- and intermediate-risk groups were 98%, 82% and 0.25%. However, in the high-risk group, 38% of women chose invasive testing and 60% chose cfDNA testing; in the intermediate-risk group 92% opted for cfDNA testing. A prenatal diagnosis was made in 43 (91.5%) pregnancies with trisomy 21 and all pregnancies with trisomies 18 or 13. In many affected pregnancies the parents chose

  13. One simple DNA extraction device and its combination with modified visual loop-mediated isothermal amplification for rapid on-field detection of genetically modified organisms.

    Science.gov (United States)

    Zhang, Miao; Liu, Yinan; Chen, Lili; Quan, Sheng; Jiang, Shimeng; Zhang, Dabing; Yang, Litao

    2013-01-02

    Quickness, simplicity, and effectiveness are the three major criteria for establishing a good molecular diagnosis method in many fields. Herein we report a novel detection system for genetically modified organisms (GMOs), which can be utilized to perform both on-field quick screening and routine laboratory diagnosis. In this system, a newly designed inexpensive DNA extraction device was used in combination with a modified visual loop-mediated isothermal amplification (vLAMP) assay. The main parts of the DNA extraction device included a silica gel membrane filtration column and a modified syringe. The DNA extraction device could be easily operated without using other laboratory instruments, making it applicable to an on-field GMO test. High-quality genomic DNA (gDNA) suitable for polymerase chain reaction (PCR) and isothermal amplification could be quickly isolated from plant tissues using this device within 15 min. In the modified vLAMP assay, a microcrystalline wax encapsulated detection bead containing SYBR green fluorescent dye was introduced to avoid dye inhibition and cross-contaminations from post-LAMP operation. The system was successfully applied and validated in screening and identification of GM rice, soybean, and maize samples collected from both field testing and the Grain Inspection, Packers, and Stockyards Administration (GIPSA) proficiency test program, which demonstrated that it was well-adapted to both on-field testing and/or routine laboratory analysis of GMOs.

  14. The effect of two pre-cryopreservation single layer colloidal centrifugation protocols in combination with different freezing extenders on the fragmentation dynamics of thawed equine sperm DNA.

    Science.gov (United States)

    Gutiérrez-Cepeda, Luna; Fernández, Alvaro; Crespo, Francisco; Ramírez, Miguel Ángel; Gosálvez, Jaime; Serres, Consuelo

    2012-12-05

    Variability among stallions in terms of semen cryopreservation quality renders it difficult to arrive at a standardized cryopreservation method. Different extenders and processing techniques (such us colloidal centrifugation) are used in order to optimize post-thaw sperm quality. Sperm chromatin integrity analysis is an effective tool for assessing such quality. The aim of the present study was to compare the effect of two single layer colloidal centrifugation protocols (prior to cryopreservation) in combination with three commercial freezing extenders on the post-thaw chromatin integrity of equine sperm samples at different post-thaw incubation (37°C) times (i.e., their DNA fragmentation dynamics). Post-thaw DNA fragmentation levels in semen samples subjected to either of the colloidal centrifugation protocols were significantly lower (pcentrifugation. The use of InraFreeze® extender was associated with significantly less DNA fragmentation than the use of Botu-Crio® extender at 6 h of incubation, and than the use of either Botu-Crio® or Gent® extender at 24 h of incubation (pcentrifugation performed with extended or raw semen prior to cryopreservation reduces DNA fragmentation during the first four hours after thawing. Further studies are needed to determine the influence of freezing extenders on equine sperm DNA fragmentation dynamics.

  15. SMART amplification combined with cDNA size fractionation in order to obtain large full-length clones

    Directory of Open Access Journals (Sweden)

    Poustka Annemarie

    2004-06-01

    Full Text Available Abstract Background cDNA libraries are widely used to identify genes and splice variants, and as a physical resource for full-length clones. Conventionally-generated cDNA libraries contain a high percentage of 5'-truncated clones. Current library construction methods that enrich for full-length mRNA are laborious, and involve several enzymatic steps performed on mRNA, which renders them sensitive to RNA degradation. The SMART technique for full-length enrichment is robust but results in limited cDNA insert size of the library. Results We describe a method to construct SMART full-length enriched cDNA libraries with large insert sizes. Sub-libraries were generated from size-fractionated cDNA with an average insert size of up to seven kb. The percentage of full-length clones was calculated for different size ranges from BLAST results of over 12,000 5'ESTs. Conclusions The presented technique is suitable to generate full-length enriched cDNA libraries with large average insert sizes in a straightforward and robust way. The representation of full-coding clones is high also for large cDNAs (70%, 4–10 kb, when high-quality starting mRNA is used.

  16. Activity of Levofloxacin Alone and in Combination with a DnaK Inhibitor against Gram-Negative Rods, Including Levofloxacin-Resistant Strains▿

    Science.gov (United States)

    Credito, Kim; Lin, Gengrong; Koeth, Laura; Sturgess, Michael A.; Appelbaum, Peter C.

    2009-01-01

    Synergy time-kill testing of levofloxacin alone and in combination with CHP-105, a representative DnaK inhibitor, against 50 gram-negative rods demonstrated that 34 of the 50 strains tested showed significant synergy between levofloxacin and CHP-105 after 12 h and 24 h. Fourteen of these 34 organisms were quinolone resistant (levofloxacin MICs of ≥4 μg/ml). PMID:19015359

  17. The Synergistic Effect of Combined Immunization with a DNA Vaccine and Chimeric Yellow Fever/Dengue Virus Leads to Strong Protection against Dengue

    Science.gov (United States)

    Azevedo, Adriana S.; Gonçalves, Antônio J. S.; Archer, Marcia; Freire, Marcos S.; Galler, Ricardo; Alves, Ada M. B.

    2013-01-01

    The dengue envelope glycoprotein (E) is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2) and a chimeric yellow fever/dengue 2 virus (YF17D-D2). The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes. PMID:23472186

  18. The synergistic effect of combined immunization with a DNA vaccine and chimeric yellow fever/dengue virus leads to strong protection against dengue.

    Science.gov (United States)

    Azevedo, Adriana S; Gonçalves, Antônio J S; Archer, Marcia; Freire, Marcos S; Galler, Ricardo; Alves, Ada M B

    2013-01-01

    The dengue envelope glycoprotein (E) is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2) and a chimeric yellow fever/dengue 2 virus (YF17D-D2). The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes.

  19. The synergistic effect of combined immunization with a DNA vaccine and chimeric yellow fever/dengue virus leads to strong protection against dengue.

    Directory of Open Access Journals (Sweden)

    Adriana S Azevedo

    Full Text Available The dengue envelope glycoprotein (E is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2 and a chimeric yellow fever/dengue 2 virus (YF17D-D2. The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes.

  20. In-frame cDNA library combined with protein complementation assay identifies ARL11-binding partners.

    Directory of Open Access Journals (Sweden)

    Sangkyou Lee

    Full Text Available The cDNA expression libraries that produce correct proteins are essential in facilitating the identification of protein-protein interactions. The 5'-untranslated regions (UTRs that are present in the majority of mammalian and non-mammalian genes are predicted to alter the expression of correct proteins from cDNA libraries. We developed a novel cDNA expression library from which 5'-UTRs were removed using a mixture of polymerase chain reaction primers that complement the Kozak sequences we refer to as an "in-frame cDNA library." We used this library with the protein complementation assay to identify two novel binding partners for ras-related ADP-ribosylation factor-like 11 (ARL11, cellular retinoic acid binding protein 2 (CRABP2, and phosphoglycerate mutase 1 (PGAM1. Thus, the in-frame cDNA library without 5'-UTRs we describe here increases the chance of correctly identifying protein interactions and will have wide applications in both mammalian and non-mammalian detection systems.

  1. Arsenic-Induced Antioxidant Depletion, Oxidative DNA Breakage, and Tissue Damages are Prevented by the Combined Action of Folate and Vitamin B12.

    Science.gov (United States)

    Acharyya, Nirmallya; Deb, Bimal; Chattopadhyay, Sandip; Maiti, Smarajit

    2015-11-01

    Arsenic is a grade I human carcinogen. It acts by disrupting one-carbon (1C) metabolism and cellular methyl (-CH3) pool. The -CH3 group helps in arsenic disposition and detoxification of the biological systems. Vitamin B12 and folate, the key promoters of 1C metabolism were tested recently (daily 0.07 and 4.0 μg, respectively/100 g b.w. of rat for 28 days) to evaluate their combined efficacy in the protection from mutagenic DNA-breakage and tissue damages. The selected tissues like intestine (first-pass site), liver (major xenobiotic metabolizer) and lung (major arsenic accumulator) were collected from arsenic-ingested (0.6 ppm/same schedule) female rats. The hemo-toxicity and liver and kidney functions were monitored. Our earlier studies on arsenic-exposed humans can correlate carcinogenesis with DNA damage. Here, we demonstrate that the supplementation of physiological/therapeutic dose of vitamin B12 and folate protected the rodents significantly from arsenic-induced DNA damage (DNA fragmentation and comet assay) and hepatic and renal tissue degeneration (histo-architecture, HE staining). The level of arsenic-induced free-radical products (TBARS and conjugated diene) was significantly declined by the restored actions of several antioxidants viz. urate, thiol, catalase, xanthine oxidase, lactoperoxidase, and superoxide dismutase in the tissues of vitamin-supplemented group. The alkaline phosphatase, transaminases, urea and creatinine (hepatic and kidney toxicity marker), and lactate dehydrogenase (tissue degeneration marker) were significantly impaired in the arsenic-fed group. But a significant protection was evident in the vitamin-supplemented group. In conclusion, the combined action of folate and B12 results in the restitution in the 1C metabolic pathway and cellular methyl pool. The cumulative outcome from the enhanced arsenic methylation and antioxidative capacity was protective against arsenic induced mutagenic DNA breakages and tissue damages.

  2. Rapid detection of periprosthetic joint infection using a combination of 16s rDNA polymerase chain reaction and lateral flow immunoassay: A Pilot Study.

    Science.gov (United States)

    Janz, V; Schoon, J; Morgenstern, C; Preininger, B; Reinke, S; Duda, G; Breitbach, A; Perka, C F; Geissler, S

    2018-01-01

    The objective of this study was to develop a test for the rapid (within 25 minutes) intraoperative detection of bacteria from synovial fluid to diagnose periprosthetic joint infection (PJI). The 16s rDNA test combines a polymerase chain reaction (PCR) for amplification of 16s rDNA with a lateral flow immunoassay in one fully automated system. The synovial fluid of 77 patients undergoing joint aspiration or primary or revision total hip or knee surgery was prospectively collected. The cohort was divided into a proof-of-principle cohort (n = 17) and a validation cohort (n = 60). Using the proof-of-principle cohort, an optimal cut-off for the discrimination between PJI and non-PJI samples was determined. PJI was defined as detection of the same bacterial species in a minimum of two microbiological samples, positive histology, and presence of a sinus tract or intra-articular pus. The 16s rDNA test proved to be very robust and was able to provide a result in 97% of all samples within 25 minutes. The 16s rDNA test was able to diagnose PJI with a sensitivity of 87.5% and 82%, and a specificity of 100% and 89%, in the proof-of-principle and validation cohorts, respectively. The microbiological culture of synovial fluid achieved a sensitivity of 80% and a specificity of 93% in the validation cohort. The 16s rDNA test offers reliable intraoperative detection of all bacterial species within 25 minutes with a sensitivity and specificity comparable with those of conventional microbiological culture of synovial fluid for the detection of PJI. The 16s rDNA test performance is independent of possible blood contamination, culture time and bacterial species. Cite this article : V. Janz, J. Schoon, C. Morgenstern, B. Preininger, S. Reinke, G. Duda, A. Breitbach, C. F. Perka, S. Geissler. Rapid detection of periprosthetic joint infection using a combination of 16s rDNA polymerase chain reaction and lateral flow immunoassay: A Pilot Study. Bone Joint Res 2018;7:12-19. DOI: 10

  3. Membrane Destruction and DNA Binding of Staphylococcus aureus Cells Induced by Carvacrol and Its Combined Effect with a Pulsed Electric Field.

    Science.gov (United States)

    Wang, Lang-Hong; Wang, Man-Sheng; Zeng, Xin-An; Zhang, Zhi-Hong; Gong, De-Ming; Huang, Yan-Bo

    2016-08-17

    Carvacrol (5-isopropyl-2-methylphenol, CAR) is an antibacterial ingredient that occurs naturally in the leaves of the plant Origanum vulgare. The antimicrobial mechanism of CAR against Staphylococcus aureus ATCC 43300 was investigated in the study. Analysis of the membrane fatty acids by gas chromatography-mass spectrometry (GC-MS) showed that exposure to CAR at low concentrations induced a marked increase in the level of unbranched fatty acids (from 34.90 ± 1.77% to 62.37 ± 4.26%). Moreover, CAR at higher levels severely damaged the integrity and morphologies of the S. aureus cell membrane. The DNA-binding properties of CAR were also investigated using fluorescence, circular dichroism, molecular modeling, and atomic-force microscopy. The results showed that CAR bound to DNA via the minor-groove mode, mildly perturbed the DNA secondary structure, and induced DNA molecules to be aggregated. Furthermore, a combination of CAR with a pulsed-electric field was found to exhibit strong synergistic effects on S. aureus.

  4. Inhibition of the synthesis of polyamines and DNA in activated lymphocytes by a combination of alpha-methylornithine and methylglyoxal bis(guanylhydrazone).

    Science.gov (United States)

    Morris, D R; Jorstad, C M; Seyfried, C E

    1977-09-01

    The cancer chemotherapeutic drug, methylglyoxal bis(guanylhydrazone), inhibits the synthesis of spermidine and spermine, but allows continued putrescine production in small lymphocytes stimulated by concanavalin A. DNA replication in these cells is inhibited 50% while the synthesis of protein and RNA continues normally. When excess putrescine accumulation in the presence of methylglyoxal bis(guanylhydrazone) was inhibited with alpha-methylornithine, a competitive inhibitor of ornithine decarboxylase, the inhibition of DNA replication was accentuated, with still no effect on protein or RNA synthesis. No inhibition of DNA synthesis by the combination of alpha-methylornithine and methylglyoxal bis(guanylhydrazone) was observed when the inhibitors were added after accumulation of cellular polyamines. In addition, inhibition was reversed by exogenous putrescine, spermidine, or spermine. We conclude that putrescine can fulfill in part the role normally played by spermidine and spermine in DNA replication, and that blocking putrescine synthesis in the presence of methylglyoxal bis(guanylhydrazone) amplifies the polyamine requirement. The implications of this with regard to polyamine synthesis as a site of chemotherapy are discussed.

  5. Vaccination with Combination DNA and Virus-Like Particles Enhances Humoral and Cellular Immune Responses upon Boost with Recombinant Modified Vaccinia Virus Ankara Expressing Human Immunodeficiency Virus Envelope Proteins

    Directory of Open Access Journals (Sweden)

    Sailaja Gangadhara

    2017-12-01

    Full Text Available Heterologous prime boost with DNA and recombinant modified vaccinia virus Ankara (rMVA vaccines is considered as a promising vaccination approach against human immunodeficiency virus (HIV-1. To further enhance the efficacy of DNA-rMVA vaccination, we investigated humoral and cellular immune responses in mice after three sequential immunizations with DNA, a combination of DNA and virus-like particles (VLP, and rMVA expressing HIV-1 89.6 gp120 envelope proteins (Env. DNA prime and boost with a combination of VLP and DNA vaccines followed by an rMVA boost induced over a 100-fold increase in Env-specific IgG antibody titers compared to three sequential immunizations with DNA and rMVA. Cellular immune responses were induced by VLP-DNA and rMVA vaccinations at high levels in CD8 T cells, CD4 T cells, and peripheral blood mononuclear cells secreting interferon (IFN-γ, and spleen cells producing interleukin (IL-2, 4, 5 cytokines. This study suggests that a DNA and VLP combination vaccine with MVA is a promising strategy in enhancing the efficacy of DNA-rMVA vaccination against HIV-1.

  6. Effects of GST Polymorphism on Ameliorative Effect of Curcumin and Carvacrol against DNA Damage Induced by Combined Treatment of Malathion and Parathion

    Directory of Open Access Journals (Sweden)

    Neeraj Kumar

    2016-04-01

    Full Text Available Background: Organophosphorus pesticides has been widely used in agriculture fields to control various crop insects and their extensive use pose human life at threat because of their adverse effects on human health. In this study, we checked the effects of GST polymorphism on ameliorative effect of curcumin and carvacrol against DNA damages. Methods: Comet assay was used to assess the DNA damage and results were expressed as Tail moment. Heparinised fresh blood from healthy individuals was treated with combined concentration of malathion and parathion (i.e. 30 µg/ml of malathion and 2.5 µg/ml of parathion in presence of combination of curcumin and carvacrol (25 µg/ml curcumin + 2.5 µg/ml carvacrol and 50 µg/ml curcumin + 5.0 µg/ml carvacrol in order to observe the ameliorative role of curcumin and carvacrol. Multiplex PCR was performed for GSTM1 and GSTT1 genotyping. Results: Curcumin in combination with carvacrol (i.e. 25 µg/ml curcumin + 2.5 µg/ml carvacrol and 50 µg/ml curcumin + 5.0 µg/ml carvacrol significantly reduced the DNA damage caused by combined action of malathion and parathion which supports their antigenotoxic property. No significant relationship of GSTT1 and GSTM1 polymorphism with genotoxicity of both the pesticides and antigenotoxic potential of curcumin and carvacrol was observed. Conclusion: Malathion and parathion were genotoxic in human PBL. Curcumin and carvacrol had an antigenotoxic effect against the malathion and parathion while there was not any significant effect of GSTT1 and GSTM1 polymorphism on genotoxicity of these pesticides and antigenotoxicity of curcumin and carvacrol.

  7. Enhanced anti-tumor effect of zoledronic acid combined with temozolomide against human malignant glioma cell expressing O6-methylguanine DNA methyltransferase.

    Directory of Open Access Journals (Sweden)

    Junya Fukai

    Full Text Available Temozolomide (TMZ, a DNA methylating agent, is widely used in the adjuvant treatment of malignant gliomas. O6-methylguanine-DNA methyltranferase (MGMT, a DNA repair enzyme, is frequently discussed as the main factor that limits the efficacy of TMZ. Zoledronic acid (ZOL, which is clinically applied to treat cancer-induced bone diseases, appears to possess direct anti-tumor activity through apoptosis induction by inhibiting mevalonate pathway and prenylation of intracellular small G proteins. In this study, we evaluated whether ZOL can be effectively used as an adjuvant to TMZ in human malignant glioma cells that express MGMT. Malignant glioma cell lines, in which the expression of MGMT was detected, did not exhibit growth inhibition by TMZ even at a longer exposure. However, combination experiment of TMZ plus ZOL revealed that a supra-additive effect resulted in a significant decrease in cell growth. In combined TMZ/ZOL treatment, an increased apoptotic rate was apparent and significant activation of caspase-3 and cleavage of poly-(ADP-ribose polymerase were observed compared with each single drug exposure. There were decreased amounts of Ras-GTP, MAPK and Akt phosphorylation and MGMT expression in the ZOL-treated cells. Subcutanous xenograft models showed significant decrease of tumor growth with combined TMZ/ZOL treatment. These results suggest that ZOL efficaciously inhibits activity of Ras in malignant glioma cells and potentiates TMZ-mediated cytotoxicity, inducing growth inhibition and apoptosis of malignant glioma cells that express MGMT and resistant to TMZ. Based on this work, combination of TMZ with ZOL might be a potential therapy in malignant gliomas that receive less therapeutic effects of TMZ due to cell resistance.

  8. Combination of DNA prime--adenovirus boost immunization with entecavir elicits sustained control of chronic hepatitis B in the woodchuck model.

    Directory of Open Access Journals (Sweden)

    Anna D Kosinska

    Full Text Available A potent therapeutic T-cell vaccine may be an alternative treatment of chronic hepatitis B virus (HBV infection. Previously, we developed a DNA prime-adenovirus (AdV boost vaccination protocol that could elicit strong and specific CD8+ T-cell responses to woodchuck hepatitis virus (WHV core antigen (WHcAg in mice. In the present study, we first examined whether this new prime-boost immunization could induce WHcAg-specific T-cell responses and effectively control WHV replication in the WHV-transgenic mouse model. Secondly, we evaluated the therapeutic effect of this new vaccination strategy in chronically WHV-infected woodchucks in combination with a potent antiviral treatment. Immunization of WHV-transgenic mice by DNA prime-AdV boost regimen elicited potent and functional WHcAg-specific CD8+ T-cell response that consequently resulted in the reduction of the WHV load below the detection limit in more than 70% of animals. The combination therapy of entecavir (ETV treatment and DNA prime-AdV boost immunization in chronic WHV carriers resulted in WHsAg- and WHcAg-specific CD4+ and CD8+ T-cell responses, which were not detectable in ETV-only treated controls. Woodchucks receiving the combination therapy showed a prolonged suppression of WHV replication and lower WHsAg levels compared to controls. Moreover, two of four immunized carriers remained WHV negative after the end of ETV treatment and developed anti-WHs antibodies. These results demonstrate that the combined antiviral and vaccination approach efficiently elicited sustained immunological control of chronic hepadnaviral infection in woodchucks and may be a new promising therapeutic strategy in patients.

  9. Predictive microbiology combined with metagenomic analysis targeted on the 16S rDNA : A new approach for food quality

    OpenAIRE

    Delhalle, Laurent; Taminiau, Bernard; Ellouze, Mariem; Nezer, Carine; Daube, Georges

    2013-01-01

    OBJECTIVES The food spoilage process is mainly caused by alteration micro-organisms and classical culture-based methods have therefore been used to assess the microbiological quality of food. These techniques are simple to implement but may not be relevant to understand the modifications of the microbial ecology which occur in the food product in response to different changes in the environmental conditions. Metagenomic analysis targeted on 16S ribosomal DNA can bring about a solution to t...

  10. Combination of the immunization with the sequence close to the consensus sequence and two DNA prime plus one VLP boost generate H5 hemagglutinin specific broad neutralizing antibodies.

    Directory of Open Access Journals (Sweden)

    Guiqin Wang

    Full Text Available Hemagglutinin (HA head has long been considered to be able to elicit only a narrow, strain-specific antibody response as it undergoes rapid antigenic drift. However, we previously showed that a heterologous prime-boost strategy, in which mice were primed twice with DNA encoding HA and boosted once with virus-like particles (VLP from an H5N1 strain A/Thailand/1(KAN-1/2004 (noted as TH DDV, induced anti-head broad cross-H5 neutralizing antibody response. To explain why TH DDV immunization could generate such breadth, we systemically compared the neutralization breadth and potency between TH DDV sera and immune sera elicited by TH DDD (three times of DNA immunizations, TH VVV (three times of VLP immunizations, TH DV (one DNA prime plus one VLP boost and TK DDV (plasmid DNA and VLP derived from another H5N1 strain, A/Turkey/65596/2006. Then we determined the antigenic sites (AS on TH HA head and the key residues of the main antigenic site. Through the comparison of different regiments, we found that the combination of the immunization with the sequence close to the consensus sequence and two DNA prime plus one VLP boost caused that TH DDV immunization generate broad neutralizing antibodies. Antigenic analysis showed that TH DDV, TH DV, TH DDD and TH VVV sera recognize the common antigenic site AS1. Antibodies directed to AS1 contribute to the largest proportion of the neutralizing activity of these immune sera. Residues 188 and 193 in AS1 are the key residues which are responsible for neutralization breadth of the immune sera. Interestingly, residues 188 and 193 locate in classical antigen sites but are relatively conserved among the 16 tested strains and 1,663 HA sequences from NCBI database. Thus, our results strongly indicate that it is feasible to develop broad cross-H5 influenza vaccines against HA head.

  11. Efficient Maturation and Cytokine Production of Neonatal DCs Requires Combined Proinflammatory Signals

    Directory of Open Access Journals (Sweden)

    Doreen Krumbiegel

    2005-01-01

    Full Text Available Specific functional properties of dendritic cells (DCs have been suspected as being responsible for the impaired specific immune responses observed in human neonates. To analyze stimulatory requirements for the critical transition from immature, antigen-processing DCs to mature, antigen-presenting DCs, we investigated the effect of different proinflammatory mediators and antigens on phenotype and cytokine secretion of human neonatal DCs derived from hematopoietic progenitor cells (HPCs. Whereas single proinflammatory mediators were unable to induce the maturation of neonatal DCs, various combinations of IFNγ, CD40L, TNFα, LPS and antigens, induced the maturation of neonatal DCs documented by up-regulation of HLA-DR, CD83 and CD86. Combinations of proinflammatory mediators also increased cytokine secretion by neonatal DCs. Especially combined stimulation with LPS and IFNγ proved to be very efficient in inducing maturation and cytokine synthesis of neonatal DCs. In conclusion, neonatal DCs can be stimulated to express maturation as well as costimulatory surface molecules. However, induction of maturation requires combined stimulation with multiple proinflammatory signals.

  12. Combining reactive triblock copolymers with functional cross-linkers: A versatile pathway to disulfide stabilized-polyplex libraries and their application as pDNA vaccines.

    Science.gov (United States)

    Heller, Philipp; Hobernik, Dominika; Lächelt, Ulrich; Schinnerer, Meike; Weber, Benjamin; Schmidt, Manfred; Wagner, Ernst; Bros, Matthias; Barz, Matthias

    2017-07-28

    Therapeutic nucleic acids such as pDNA hold great promise for the treatment of multiple diseases. These therapeutic interventions are, however, compromised by the lack of efficient and safe non-viral delivery systems, which guarantee stability during blood circulation together with high transfection efficiency. To provide these desired properties within one system, we propose the use of reactive triblock copolypept(o)ides, which include a stealth-like block for efficient shielding, a hydrophobic block based on reactive disulfides for cross-linking and a cationic block for complexation of pDNA. After the complexation step, bifunctional cross-linkers can be employed to bio-reversibly stabilize derived polyplexes by disulfide bond formation and to introduce endosomolytic moieties at the same time. Cross-linked polyplexes show no aggregation in human blood serum. Upon cellular uptake and cleavage of disulfide bonds, the cross-linkers can interact with the endosomal membrane, leading to lysis and efficient endosomal translocation. In principal, the approach allows for the combination of one polymer with various different cross-linkers and thus enables the fast forward creation of a polyplex library. Here, we provide a first insight into the potential of this concept and use a screening strategy to identify a lead candidate, which is able to transfect dendritic cells with a model DNA vaccine. Copyright © 2017. Published by Elsevier B.V.

  13. Sulforaphane Alone and in Combination with Clofarabine Epigenetically Regulates the Expression of DNA Methylation-Silenced Tumour Suppressor Genes in Human Breast Cancer Cells.

    Science.gov (United States)

    Lubecka-Pietruszewska, Katarzyna; Kaufman-Szymczyk, Agnieszka; Stefanska, Barbara; Cebula-Obrzut, Barbara; Smolewski, Piotr; Fabianowska-Majewska, Krystyna

    2015-01-01

    Sporadic breast cancer is frequently associated with aberrant DNA methylation patterns that are reversible and responsive to environmental factors, including diet. In the present study, we investigated the effects of sulforaphane (SFN), a phytochemical from cruciferous vegetables, on the methylation and expression of PTEN and RARbeta2 tumour suppressor genes as well as on the expression of regulators of DNA methylation reaction, DNMT1 , p53 , and p21 , in MCF-7 and MDA-MB-231 human breast cancer cells with different invasive potential. We also evaluate the role of SFN epigenetic effects in support of therapy with clofarabine (ClF) that was recently shown to modulate the epigenome as well. Promoter methylation and gene expression were estimated using methylation-sensitive restriction analysis and real-time PCR, respectively. In both MCF-7 and MDA-MB-231 cells, SFN at IC 50 (22 and 46 μ M , respectively) and a physiologically relevant 10 μ M concentration lead to hypomethylation of PTEN and RARbeta2 promoters with concomitant gene upregulation. The combination of SFN and ClF enhances these effects, resulting in an increase in cell growth arrest and apoptosis at a non-invasive breast cancer stage. Our findings provide evidence that SFN activates DNA methylation-silenced tumour suppressor genes in breast cancer cells and may contribute to SFN-mediated support of therapy with an anti-cancer drug, ClF, increasing its applications in solid tumours.

  14. Novel compound heterozygous DNA ligase IV mutations in an adolescent with a slowly-progressing radiosensitive-severe combined immunodeficiency.

    Science.gov (United States)

    Tamura, Shinobu; Higuchi, Kohei; Tamaki, Masaharu; Inoue, Chizuko; Awazawa, Ryoko; Mitsuki, Noriko; Nakazawa, Yuka; Mishima, Hiroyuki; Takahashi, Kenzo; Kondo, Osamu; Imai, Kohsuke; Morio, Tomohiro; Ohara, Osamu; Ogi, Tomoo; Furukawa, Fukumi; Inoue, Masami; Yoshiura, Koh-ichiro; Kanazawa, Nobuo

    2015-10-01

    We herein describe a case of a 17-year-old boy with intractable common warts, short stature, microcephaly and slowly-progressing pancytopenia. Simultaneous quantification of T-cell receptor recombination excision circles (TREC) and immunoglobulin κ-deleting recombination excision circles (KREC) suggested very poor generation of both T-cells and B-cells. By whole exome sequencing, novel compound heterozygous mutations were identified in the patient's DNA ligase IV (LIG4) gene. The diagnosis of LIG4 syndrome was confirmed by delayed DNA double-strand break repair kinetics in γ-irradiated fibroblasts from the patient and their restoration by an introduction of wild-type LIG4. Although the patient received allogeneic hematopoietic stem cell transplantation from his haploidentical mother, he unfortunately expired due to an insufficiently reconstructed immune system. An earlier definitive diagnosis using TREC/KREC quantification and whole exome sequencing would thereby allow earlier intervention, which would be essential for improving long-term survival in similar cases with slowly-progressing LIG4 syndrome masked in adolescents. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Construction of a laser combiner for dual fluorescent single molecule imaging of pRNA of phi29 DNA packaging motor.

    Science.gov (United States)

    Zhang, Hui; Shu, Dan; Browne, Mark; Guo, Peixuan

    2010-02-01

    A customized laser combiner was designed and constructed for dual channel single molecule imaging. The feasibility of a combiner-incorporated imaging system was demonstrated in studies of single molecule FRET. Distance rulers made of dual-labeled dsDNA were used to evaluate the system by determining the distance between one FRET pair. The results showed that the system is sensitive enough to distinguish between distances differing by two base pair and the distances calculated from FRET efficiencies are close to those documented in the literature. The single molecule FRET with the dual-color imaging system was also applied to reconstructed phi29 motor pRNA monomers. Finally, techniques for dual laser alignment and tuning of laser power for dual-color excitation are discussed.

  16. X-linked Hyper IgM Syndrome Presenting as Pulmonary Alveolar Proteinosis.

    Science.gov (United States)

    Gallagher, Joel; Adams, Juan; Hintermeyer, Mary; Torgerson, Troy R; Lopez-Guisa, Jesus; Ochs, Hans D; Szabo, Sara; Salib, Mina; Verbsky, James; Routes, John

    2016-08-01

    X-linked hyper IgM syndrome (XHIGM) is a combined immunodeficiency caused by mutations in the CD40 ligand (CD40L) gene that typically results in decreased or absent CD40L expression on activated T cells, leading to defective class switching and somatic hypermutation. We describe an infant who presented with respiratory failure due to pulmonary alveolar proteinosis (PAP) with a novel damaging missense mutation in the CD40L gene. Whole exome sequencing (WES) was used to identify a mutation in the CD40L gene. CD40L expression and function were determined by flow cytometry. A 5-month-old previously-healthy male presented with respiratory failure and diffuse pulmonary ground glass opacities on CT scan of the chest. Laboratory evaluation revealed an undetectable IgG, normal IgA, and elevated IgM. A bronchoalveolar lavage demonstrated pulmonary alveolar proteinosis. WES demonstrated a c.608G > C mutation in the CD40L gene resulting in p.R203T. Flow cytometry demonstrated normal CD40L expression on activated T cells but absent binding of CD40-Ig to CD40L on activated patient T cells. The clinical manifestations of XHIGM in our patient had several unique features, including the presentation with PAP, normal serum IgA, and expression of non-functional CD40L on activated T cells. To our knowledge, this is the first published case of PAP in a patient with XHIGM.

  17. Selective identification of somatic mutations in pancreatic cancer cells through a combination of next-generation sequencing of plasma DNA using molecular barcodes and a bioinformatic variant filter.

    Science.gov (United States)

    Kukita, Yoji; Ohkawa, Kazuyoshi; Takada, Ryoji; Uehara, Hiroyuki; Katayama, Kazuhiro; Kato, Kikuya

    2018-01-01

    The accuracy of next-generation sequencing (NGS) for detecting tumor-specific mutations in plasma DNA is hindered by errors introduced during PCR/sequencing, base substitutions caused by DNA damage, and pre-existing mutations in normal cells that are present at a low frequency. Here, we performed NGS of genes related to pancreatic cancer (comprising 2.8 kb of genomic DNA) in plasma DNA (average 4.5 ng) using molecular barcodes. The average number of sequenced molecules was 900, and the sequencing depth per molecule was 100 or more. We also developed a bioinformatic variant filter, called CV78, to remove variants that were not considered to be tumor-specific, i.e., those that are either absent or occur at low frequencies in the Catalogue of Somatic Mutations in Cancer database. In a cohort comprising 57 pancreatic cancer patients and 12 healthy individuals, sequencing initially identified variants in 31 (54%) and 5 (42%), respectively, whereas after applying the CV78 filter, 19 (33%) and zero were variant-positive. In a validation cohort consisting of 86 patients with pancreatic cancer and 20 patients with intraductal papillary mucinous neoplasm (IPMN), 62 (72%) with pancreatic cancer patients and 10 (50%) IPMN patients were initially variant positive. After CV78 filtering, these values were reduced to 32 (37%) and 1 (5%), respectively. The variant allele frequency of filtered variants in plasma ranged from 0.25% to 76.1%. Therefore, combining NGS and molecular barcodes with subsequent filtering is likely to eliminate most non-tumor-specific mutations.

  18. Effect of alprostadil combined with conventional therapy on serum markers in patients with acute cerebral infarction

    Directory of Open Access Journals (Sweden)

    Li-Lan Chen

    2016-01-01

    Full Text Available Objective: To study the effect of alprostadil combined with conventional therapy on serum markers in patients with acute cerebral infarction. Methods: Patients with acute cerebral infarction treated in our hospital from May 2012 to August 2014 were enrolled and randomly divided into two groups. Observation group received alprostadil combined with conventional therapy and control group received conventional treatment. Then serum markers of both groups were compared. Results: (1 contents of serum nerve function related molecules: serum NSE and S100β contents of observation group showed a decreasing trend, and BDNF and NGF contents showed an increasing trend; (2 contents of atherosclerosis related enzymes: serum GGT, iNOS and MPO contents of observation group showed a decreasing trend, and PON1 and PON2 contents showed an increasing trend; (3 platelet activation related molecules: serum PPARγ, CD62p, YKL-40, sCD40L and Fibulin-5 contents of observation group all showed a decreasing trend. Conclusions: Alprostadil combined with conventional treatment is helpful to alleviate neuronal damage and inhibit the processes of atherosclerosis and platelet activation; it’s an ideal method for treating acute cerebral infarction.

  19. Inhibition of DNA and protein synthesis in UV-irradiated mouse skin by 2-difluoromethylornithine, methylglyoxal bis(guanylhydrazone), and their combination

    International Nuclear Information System (INIS)

    Kaepyaho, K.; Lauharanta, J.; Jaenne, J.

    1983-01-01

    Exposure of mouse skin to UVB irradiation greatly enhanced the biosynthesis and accumulation of putrescine and spermidine before or concomitantly with stimulation of epidermal macromolecular (DNA and protein) synthesis. Topical treatment of UV-exposed skin with 2 inhibitors of polyamine biosynthesis, 2-difluoromethylornithine (DFMO) and methylglyoxal bis(guanylhydrazone) (MGBG) prevented the enhanced epidermal accumulation of polyamines, especially spermidine, and also inhibited the incorporation of radioactive precursors into DNA and protein. When applied in combination, these 2 antimetabolites of polyamines produced an inhibition of macromolecular synthesis that was at least additive: [ 3 H]thymidine incorporation decreased by 80% and [ 14 C]leucine incorporation by 44% as compared with the UVB-irradiated control mice. A slight decrease in the ratio of [ 3 H]histidine/[ 14 C]leucine incorporation indicated that protein synthesis of the differentiating cell layers was also affected by the inhibitors. The effects of the combined DFMO and MGBG treatment were partially reversed by concomitant topical application of spermidine

  20. Inhibition of DNA and protein synthesis in UV-irradiated mouse skin by 2-difluoromethylornithine, methylglyoxal bis(guanylhydrazone), and their combination

    Energy Technology Data Exchange (ETDEWEB)

    Kaepyaho, K.; Lauharanta, J.; Jaenne, J.

    1983-08-01

    Exposure of mouse skin to UVB irradiation greatly enhanced the biosynthesis and accumulation of putrescine and spermidine before or concomitantly with stimulation of epidermal macromolecular (DNA and protein) synthesis. Topical treatment of UV-exposed skin with 2 inhibitors of polyamine biosynthesis, 2-difluoromethylornithine (DFMO) and methylglyoxal bis(guanylhydrazone) (MGBG) prevented the enhanced epidermal accumulation of polyamines, especially spermidine, and also inhibited the incorporation of radioactive precursors into DNA and protein. When applied in combination, these 2 antimetabolites of polyamines produced an inhibition of macromolecular synthesis that was at least additive: (/sup 3/H)thymidine incorporation decreased by 80% and (/sup 14/C)leucine incorporation by 44% as compared with the UVB-irradiated control mice. A slight decrease in the ratio of (/sup 3/H)histidine/(/sup 14/C)leucine incorporation indicated that protein synthesis of the differentiating cell layers was also affected by the inhibitors. The effects of the combined DFMO and MGBG treatment were partially reversed by concomitant topical application of spermidine.

  1. Fusion of antigen to a dendritic cell targeting chemokine combined with adjuvant yields a malaria DNA vaccine with enhanced protective capabilities.

    Science.gov (United States)

    Luo, Kun; Zhang, Hong; Zavala, Fidel; Biragyn, Arya; Espinosa, Diego A; Markham, Richard B

    2014-01-01

    Although sterilizing immunity to malaria can be elicited by irradiated sporozoite vaccination, no clinically practical subunit vaccine has been shown to be capable of preventing the approximately 600,000 annual deaths attributed to this infection. DNA vaccines offer several potential advantages for a disease that primarily affects the developing world, but new approaches are needed to improve the immunogenicity of these vaccines. By using a novel, lipid-based adjuvant, Vaxfectin, to attract immune cells to the immunization site, in combination with an antigen-chemokine DNA construct designed to target antigen to immature dendritic cells, we elicited a humoral immune response that provided sterilizing immunity to malaria challenge in a mouse model system. The chemokine, MIP3αCCL20, did not significantly enhance the cellular infiltrate or levels of cytokine or chemokine expression at the immunization site but acted with Vaxfectin to reduce liver stage malaria infection by orders of magnitude compared to vaccine constructs lacking the chemokine component. The levels of protection achieved were equivalent to those observed with irradiated sporozoites, a candidate vaccine undergoing development for further large scale clinical trial. Only vaccination with the combined regimen of adjuvant and chemokine provided 80-100% protection against the development of bloodstream infection. Treating the immunization process as requiring the independent steps of 1) attracting antigen-presenting cells to the site of immunization and 2) specifically directing vaccine antigen to the immature dendritic cells that initiate the adaptive immune response may provide a rational strategy for the development of a clinically applicable malaria DNA vaccine.

  2. DNA biosensor combining single-wavelength colorimetry and a digital lock-in amplifier within a smartphone.

    Science.gov (United States)

    Wu, Tzu-Heng; Chang, Chia-Chen; Vaillant, Julien; Bruyant, Aurélien; Lin, Chii-Wann

    2016-11-15

    Smartphone camera based gold nanoparticle colorimetry (SCB-AuNP colorimetry) has shown good potential for point-of-care applications. However, due to the use of a camera as a photo-detector, there are major limitations to this technique such as a low bit resolution (∼8 bits mainstream) and a low data acquisition rate. These issues have limited the ultimate sensitivity of smartphone based colorimetry as well as the possibility to integrate efficiently a more sensitive approach such as detection based on a lock-in amplifier (LIA). In this paper, we improve the metrological performance of the smartphone to overcome existing issues by adding the LIA capability to AuNP sensing. In this work, instead of using the camera as a photo-detector, the audio jack is used as a photo-detector reader and function generator for driving a laser diode in order to achieve a smartphone based digital lock-in amplifier AuNP colorimetric (SBLIA-AuNP colorimetry) system. A full investigation on the SBLIA design, parameters and performance is comprehensively provided. It is found that the SBLIA can reduce most of the noise and provides a detection noise-to-signal ratio down to -63 dB, which is much better than the -49 dB of the state-of-the-art SCB based method. A DNA detection experiment is demonstrated to reveal the efficacy of the proposed metrological method. The results are compared to UV-visible spectrometry, which is the gold standard for colorimetric measurement. Based on our results, the SBLIA-AuNP colorimetric system has a detection limit of 0.77 nM on short strand DNA detection, which is 5.7 times better than the 4.36 nM limit of a commercial UV-visible spectrometer. Judging from the results, we believe that the sensitive SBLIA would be further extended to other optical diagnostic tools in the near future.

  3. A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta

    Directory of Open Access Journals (Sweden)

    Coupland George

    2005-08-01

    Full Text Available Abstract Background Many established PCR-based approaches in plant molecular biology rely on lengthy and expensive methods for isolation of nucleic acids. Although several rapid DNA isolation protocols are available, they have not been tested for simultaneous RNA isolation for RT-PCR applications. In addition, traditional map-based cloning technologies often use ill-proportioned marker regions even when working with the model plant Arabidopsis thaliana, where the availability of the full genome sequence can now be exploited for the creation of a high-density marker systems. Results We designed a high-density polymorphic marker set between two frequently used ecotypes. This new polymorphic marker set allows size separation of PCR products on agarose gels and provides an initial resolution of 10 cM in linkage mapping experiments, facilitated by a rapid plant nucleic acid extraction protocol using minimal amounts of A. thaliana tissue. Using this extraction protocol, we have also characterized segregating T-DNA insertion mutations. In addition, we have shown that our rapid nucleic acid extraction protocol can also be used for monitoring transcript levels by RT-PCR amplification. Finally we have demonstrated that our nucleic acid isolation method is also suitable for other plant species, such as tobacco and barley. Conclusion To facilitate high-throughput linkage mapping and other genomic applications, our nucleic acid isolation protocol yields sufficient quality of DNA and RNA templates for PCR and RT-PCR reactions, respectively. This new technique requires considerably less time compared to other purification methods, and in combination with a new polymorphic PCR marker set dramatically reduces the workload required for linkage mapping of mutations in A. thaliana utilizing crosses between Col-0 and Landsberg erecta (Ler ecotypes.

  4. A universal protocol for the combined isolation of metabolites, DNA, long RNAs, small RNAs, and proteins from plants and microorganisms

    Czech Academy of Sciences Publication Activity Database

    Valledor, Luis; Escandón, M.; Meijón, M.; Nukarinen, E.; Jesús Cañal, M.; Weckwerth, W.

    2014-01-01

    Roč. 79, č. 1 (2014), s. 173-180 ISSN 0960-7412 R&D Projects: GA MŠk(CZ) EE2.3.20.0256 Institutional support: RVO:67179843 Keywords : systems biology * combined isolation * RNA * small RNA * proteins * metabolites * Chlamydomonas reinhardtii * Arabidopsis thaliana * Populus sp. * Pinus sp. * technical advance Subject RIV: EI - Biotechnology ; Bionics Impact factor: 5.972, year: 2014

  5. Combining real-time PCR and next-generation DNA sequencing to provide quantitative comparisons of fungal aerosol populations

    Science.gov (United States)

    Dannemiller, Karen C.; Lang-Yona, Naama; Yamamoto, Naomichi; Rudich, Yinon; Peccia, Jordan

    2014-02-01

    We examined fungal communities associated with the PM10 mass of Rehovot, Israel outdoor air samples collected in the spring and fall seasons. Fungal communities were described by 454 pyrosequencing of the internal transcribed spacer (ITS) region of the fungal ribosomal RNA encoding gene. To allow for a more quantitative comparison of fungal exposure in humans, the relative abundance values of specific taxa were transformed to absolute concentrations through multiplying these values by the sample's total fungal spore concentration (derived from universal fungal qPCR). Next, the sequencing-based absolute concentrations for Alternaria alternata, Cladosporium cladosporioides, Epicoccum nigrum, and Penicillium/Aspergillus spp. were compared to taxon-specific qPCR concentrations for A. alternata, C. cladosporioides, E. nigrum, and Penicillium/Aspergillus spp. derived from the same spring and fall aerosol samples. Results of these comparisons showed that the absolute concentration values generated from pyrosequencing were strongly associated with the concentration values derived from taxon-specific qPCR (for all four species, p 0.70). The correlation coefficients were greater for species present in higher concentrations. Our microbial aerosol population analyses demonstrated that fungal diversity (number of fungal operational taxonomic units) was higher in the spring compared to the fall (p = 0.02), and principal coordinate analysis showed distinct seasonal differences in taxa distribution (ANOSIM p = 0.004). Among genera containing allergenic and/or pathogenic species, the absolute concentrations of Alternaria, Aspergillus, Fusarium, and Cladosporium were greater in the fall, while Cryptococcus, Penicillium, and Ulocladium concentrations were greater in the spring. The transformation of pyrosequencing fungal population relative abundance data to absolute concentrations can improve next-generation DNA sequencing-based quantitative aerosol exposure assessment.

  6. On-Chip Evaluation of DNA Methylation with Electrochemical Combined Bisulfite Restriction Analysis Utilizing a Carbon Film Containing a Nanocrystalline Structure.

    Science.gov (United States)

    Kurita, Ryoji; Yanagisawa, Hiroyuki; Kamata, Tomoyuki; Kato, Dai; Niwa, Osamu

    2017-06-06

    This paper reports an on-chip electrochemical assessment of the DNA methylation status in genomic DNA on a conductive nanocarbon film electrode realized with combined bisulfite restriction analysis (COBRA). The film electrode consists of sp 2 and sp 3 hybrid bonds and is fabricated with an unbalanced magnetron (UBM) sputtering method. First, we studied the effect of the sp 2 /sp 3 ratio of the UBM nanocarbon film electrode with p-aminophenol, which is a major electro-active product of the labeling enzyme from p-aminophenol phosphate. The signal current for p-aminophenol increases as the sp 2 content in the UBM nanocarbon film electrode increases because of the π-π interaction between aromatic p-aminophenol and the graphene-like sp 2 structure. Furthermore, the capacitative current at the UBM nanocarbon film electrode was successfully reduced by about 1 order of magnitude thanks to the angstrom-level surface flatness. Therefore, a high signal-to-noise ratio was achieved compared with that of conventional electrodes. Then, after performing an ELISA-like hybridization assay with a restriction enzyme, we undertook an electrochemical evaluation of the cytosine methylation status in DNA by measuring the oxidation current derived from p-aminophenol. When the target cytosine in the analyte sequence is methylated (unmethylated), the restriction enzyme of HpyCH4IV is able (unable) to cleave the sequence, that is, the detection probe cannot (can) hybridize. We succeeded in estimating the methylation ratio at a site-specific CpG site from the peak current of a cyclic voltammogram obtained from a PCR product solution ranging from 0.01 to 1 nM.

  7. Rapid classification of turmeric based on DNA fingerprint by near-infrared spectroscopy combined with moving window partial least squares-discrimination analysis

    International Nuclear Information System (INIS)

    Kasemsumran, Sumaporn; Suttiwijitpukdee, Nattaporn; Keeratinijakal, Vichein

    2017-01-01

    In this research, near-infrared (NIR) spectroscopy in combination with moving window partial least squares-discrimination analysis (MWPLS-DA) was utilized to discriminate the variety of turmeric based on DNA markers, which correlated to the quantity of curcuminoid. Curcuminoid was used as a marker compound in variety identification due to the most pharmacological properties of turmeric possessed from it. MWPLS-DA optimized informative NIR spectral regions for the fitting and prediction to {-1/1}-coded turmeric varieties, indicating variables in the development of latent variables in discrimination analysis. Consequently, MWPLS-DA benefited in the selection of combined informative NIR spectral regions of 1100 – 1260, 1300 – 1500 and 1880 – 2500 nm for classification modeling of turmeric variety with 148 calibration samples, and yielded the results better than that obtained from a partial least squares-discrimination analysis (PLS-DA) model built by using the whole NIR spectral region. An effective and rapid strategy of using NIR in combination with MWPLS-DA provided the best variety identification results of 100% in both specificity and total accuracy for 48 test samples. (author)

  8. Molecular Beacon Enables Combination of Highly Processive and Highly Sensitive Rolling Circle Amplification Readouts for Detection of DNA-Modifying Enzymes

    DEFF Research Database (Denmark)

    Kristoffersen, Emil Laust; Gonzales, Maria; Stougaard, Magnus

    2015-01-01

    Here we present an optimized readout format for detection of the circularized products from a DNA-based sensor for measurement of DNA-modifying enzymes including DNA Topoisomerase I. The basic design of the DNA-sensor relies on the use of a substrate that can be circularized by the activity of DN...

  9. Droplet digital PCR combined with minisequencing, a new approach to analyze fetal DNA from maternal blood: application to the non-invasive prenatal diagnosis of achondroplasia.

    Science.gov (United States)

    Orhant, Lucie; Anselem, Olivia; Fradin, Mélanie; Becker, Pierre Hadrien; Beugnet, Caroline; Deburgrave, Nathalie; Tafuri, Gilles; Letourneur, Franck; Goffinet, François; Allach El Khattabi, Laïla; Leturcq, France; Bienvenu, Thierry; Tsatsaris, Vassilis; Nectoux, Juliette

    2016-05-01

    Achondroplasia is generally detected by abnormal prenatal ultrasound findings in the third trimester of pregnancy and then confirmed by molecular genetic testing of fetal genomic DNA obtained by aspiration of amniotic fluid. This invasive procedure presents a small but significant risk for both the fetus and mother. Therefore, non-invasive procedures using cell-free fetal DNA in maternal plasma have been developed for the detection of the fetal achondroplasia mutations. To determine whether the fetus carries the de novo mis-sense genetic mutation at nucleotide 1138 in FGFR3 gene involved in >99% of achondroplasia cases, we developed two independent methods: digital-droplet PCR combined with minisequencing, which are very sensitive methods allowing detection of rare alleles. We collected 26 plasmatic samples from women carrying fetus at risk of achondroplasia and diagnosed to date a total of five affected fetuses in maternal blood. The sensitivity and specificity of our test are respectively 100% [95% confidence interval, 56.6-100%] and 100% [95% confidence interval, 84.5-100%]. This novel, original strategy for non-invasive prenatal diagnosis of achondroplasia is suitable for implementation in routine clinical testing and allows considering extending the applications of these technologies in non-invasive prenatal diagnosis of many other monogenic diseases. © 2016 John Wiley & Sons, Ltd. © 2016 John Wiley & Sons, Ltd.

  10. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  11. Defining combined immunodeficiency.

    Science.gov (United States)

    Roifman, Chaim M; Somech, Raz; Kavadas, Fotini; Pires, Linda; Nahum, Amit; Dalal, Ilan; Grunebaum, Eyal

    2012-07-01

    responses, patients with the p.R222C mutation in the IL-2 receptor γ(IL2RG) gene as well as IL-10 receptor and CD40 ligand deficiencies had normal or near-normal mitogen responses. Finally, 51 patients had TREC levels measured. All patients with typical SCID, Omenn syndrome, and ZAP70 deficiency had low TREC levels. In contrast, patients with mutations in forkhead box protein 3 (FOXP3), CD40 ligand (CD40L), and IL-10 receptor α(IL10RA), as well as patients with the p.R222C mutation in the IL2RG gene, had normal TREC levels. Patients with typical SCID can be defined as having fewer than 500 circulating CD3(+) T cells. Most patients with autologous T cells still have profound TD, as defined by reduced in vitro function and thymus output. Some patients with conditions including TD have normal TREC levels and will therefore not be detected in a TREC-based newborn screening program. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  12. HIV DNA Is Frequently Present within Pathologic Tissues Evaluated at Autopsy from Combined Antiretroviral Therapy-Treated Patients with Undetectable Viral Loads.

    Science.gov (United States)

    Lamers, Susanna L; Rose, Rebecca; Maidji, Ekaterina; Agsalda-Garcia, Melissa; Nolan, David J; Fogel, Gary B; Salemi, Marco; Garcia, Debra L; Bracci, Paige; Yong, William; Commins, Deborah; Said, Jonathan; Khanlou, Negar; Hinkin, Charles H; Sueiras, Miguel Valdes; Mathisen, Glenn; Donovan, Suzanne; Shiramizu, Bruce; Stoddart, Cheryl A; McGrath, Michael S; Singer, Elyse J

    2016-10-15

    HIV infection treatment strategies have historically defined effectiveness through measuring patient plasma HIV RNA. While combined antiretroviral therapy (cART) can reduce plasma viral load (pVL) to undetectable levels, the degree that HIV is eliminated from other anatomical sites remains unclear. We investigated the HIV DNA levels in 229 varied autopsy tissues from 20 HIV-positive (HIV(+)) cART-treated study participants with low or undetectable plasma VL and cerebrospinal fluid (CSF) VL prior to death who were enrolled in the National Neurological AIDS Bank (NNAB) longitudinal study and autopsy cohort. Extensive medical histories were obtained for each participant. Autopsy specimens, including at least six brain and nonbrain tissues per participant, were reviewed by study pathologists. HIV DNA, measured in tissues by quantitative and droplet digital PCR, was identified in 48/87 brain tissues and 82/142 nonbrain tissues at levels >200 HIV copies/million cell equivalents. No participant was found to be completely free of tissue HIV. Parallel sequencing studies from some tissues recovered intact HIV DNA and RNA. Abnormal histological findings were identified in all participants, especially in brain, spleen, lung, lymph node, liver, aorta, and kidney. All brain tissues demonstrated some degree of pathology. Ninety-five percent of participants had some degree of atherosclerosis, and 75% of participants died with cancer. This study assists in characterizing the anatomical locations of HIV, in particular, macrophage-rich tissues, such as the central nervous system (CNS) and testis. Additional studies are needed to determine if the HIV recovered from tissues promotes the pathogenesis of inflammatory diseases, such as HIV-associated neurocognitive disorders, cancer, and atherosclerosis. It is well-known that combined antiretroviral therapy (cART) can reduce plasma HIV to undetectable levels; however, cART cannot completely clear HIV infection. An ongoing question is

  13. Phylogenetic relationships of Middle American cichlids (Cichlidae, Heroini) based on combined evidence from nuclear genes, mtDNA, and morphology.

    Science.gov (United States)

    Rícan, Oldrich; Zardoya, Rafael; Doadrio, Ignacio

    2008-12-01

    Heroine cichlids are the second largest and very diverse tribe of Neotropical cichlids, and the only cichlid group that inhabits Mesoamerica. The taxonomy of heroines is complex because monophyly of most genera has never been demonstrated, and many species groups are without applicable generic names after their removal from the catch-all genus Cichlasoma (sensu Regan, 1905). Hence, a robust phylogeny for the group is largely wanting. A rather complete heroine phylogeny based on cytb sequence data is available [Concheiro Pérez, G.A., Rícan O., Ortí G., Bermingham, E., Doadrio, I., Zardoya, R. 2007. Phylogeny and biogeography of 91 species of heroine cichlids (Teleostei: Cichlidae) based on sequences of the cytochrome b gene. Mol. Phylogenet. Evol. 43, 91-110], and in the present study, we have added and analyzed independent data sets (nuclear and morphological) to further confirm and strengthen the cytb-phylogenetic hypothesis. We have analyzed a combined cytb-nuclear (RAG1 and two S7 introns) data set of 48 species representing main heroine lineages to achieve further resolution of heroine higher taxonomic levels and a combined cytb-morphological data set of 92 species to stabilize generic taxonomy. The recovered phylogenies supported the circumamazonian--CAM--Heroini (sensu Concheiro Peréz et al., 2007) as a monophyletic group, that could be divided into six main clades: (1) australoheroines (the southernmost heroine genus Australoheros), (2) nandopsines (the Antillean genus Nandopsis), (3) caquetaines (including the north western Amazonian genera Caquetaia and Heroina), (4) astatheroines (including Astatheros, Herotilapia and Rocio), (5) amphilophines (including Amphilophus and related genera), and (6) herichthyines (including Herichthyis and related genera). Nuclear and mitochondrial data partitions arrived at highly congruent topologies. Suprageneric relationships were influenced mainly by the nuclear signal, as well as the most basal phylogenetic position

  14. Absence of DNA damage after 60-Hz electromagnetic field exposure combined with ionizing radiation, hydrogen peroxide, or c-Myc overexpression.

    Science.gov (United States)

    Jin, Yeung Bae; Choi, Seo-Hyun; Lee, Jae Seon; Kim, Jae-Kyung; Lee, Ju-Woon; Hong, Seung-Cheol; Myung, Sung Ho; Lee, Yun-Sil

    2014-03-01

    The principal objective of this study was to assess the DNA damage in a normal cell line system after exposure to 60 Hz of extremely low frequency magnetic field (ELF-MF) and particularly in combination with various external factors, via comet assays. NIH3T3 mouse fibroblast cells, WI-38 human lung fibroblast cells, L132 human lung epithelial cells, and MCF10A human mammary gland epithelial cells were exposed for 4 or 16 h to a 60-Hz, 1 mT uniform magnetic field in the presence or absence of ionizing radiation (IR, 1 Gy), H(2)O(2) (50 μM), or c-Myc oncogenic activation. The results obtained showed no significant differences between the cells exposed to ELF-MF alone and the unexposed cells. Moreover, no synergistic or additive effects were observed after 4 or 16 h of pre-exposure to 1 mT ELF-MF or simultaneous exposure to ELF-MF combined with IR, H(2)O(2), or c-Myc activation.

  15. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Jong Seok [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); National Institute of Biological Resources, Incheon (Korea, Republic of); Kim, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Yu-Na; Kim, Min-Chul [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Animal and Plant Quarantine Agency, Gyeonggi-do, Gimcheon, Gyeongsangbukdo (Korea, Republic of); Cho, Minkyoung [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Kang, Sang-Moo, E-mail: skang24@gsu.edu [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States)

    2016-07-15

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  16. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    International Nuclear Information System (INIS)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin; Lee, Jong Seok; Kim, Yu-Jin; Lee, Yu-Na; Kim, Min-Chul; Cho, Minkyoung; Kang, Sang-Moo

    2016-01-01

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  17. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  18. Live-cell imaging combined with immunofluorescence, RNA, or DNA FISH to study the nuclear dynamics and expression of the X-inactivation center.

    Science.gov (United States)

    Pollex, Tim; Piolot, Tristan; Heard, Edith

    2013-01-01

    Differentiation of embryonic stem cells is accompanied by changes of gene expression and chromatin and chromosome dynamics. One of the most impressive examples for these changes is inactivation of one of the two X chromosomes occurring upon differentiation of mouse female embryonic stem cells. With a few exceptions, these events have been mainly studied in fixed cells. In order to better understand the dynamics, kinetics, and order of events during differentiation, one needs to employ live-cell imaging techniques. Here, we describe a combination of live-cell imaging with techniques that can be used in fixed cells (e.g., RNA FISH) to correlate locus dynamics or subnuclear localization with, e.g., gene expression. To study locus dynamics in female ES cells, we generated cell lines containing TetO arrays in the X-inactivation center, the locus on the X chromosome regulating X-inactivation, which can be visualized upon expression of TetR fused to fluorescent proteins. We will use this system to elaborate on how to generate ES cell lines for live-cell imaging of locus dynamics, how to culture ES cells prior to live-cell imaging, and to describe typical live-cell imaging conditions for ES cells using different microscopes. Furthermore, we will explain how RNA, DNA FISH, or immunofluorescence can be applied following live-cell imaging to correlate gene expression with locus dynamics.

  19. Identification of human DNA in forensic evidence by loop-mediated isothermal amplification combined with a colorimetric gold nanoparticle hybridization probe.

    Science.gov (United States)

    Watthanapanpituck, Khanistha; Kiatpathomchai, Wansika; Chu, Eric; Panvisavas, Nathinee

    2014-11-01

    A DNA test based on loop-mediated isothermal amplification (LAMP) and colorimetric gold nanoparticle (AuNP) hybridization probe to detect the presence of human DNA in forensic evidence was developed. The LAMP primer set targeted eight regions of the human cytochrome b, and its specificity was verified against the DNA of 11 animal species, which included animals closely related to humans, such as chimpanzee and orangutan. By using the AuNP probe, sequence-specific LAMP product could be detected and the test result could be visualized through the change in color. The limit of detection was demonstrated with reproducibility to be as low as 718 fg of genomic DNA, which is equivalent to approximately 100 plasmid DNA copies containing the cytochrome b DNA target region. A simple DNA extraction method for the commonly found forensic biological samples was also devised to streamline the test process. This LAMP-AuNP human DNA test showed to be a robust, specific, and cost-effective tool for the forensic identification of human specimens without requiring sophisticated laboratory instruments.

  20. Combining combing and secondary ion mass spectrometry to study DNA on chips using 13C and 15N labeling [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Armelle Cabin-Flaman

    2016-06-01

    Full Text Available Dynamic secondary ion mass spectrometry (D-SIMS imaging of combed DNA – the combing, imaging by SIMS or CIS method – has been developed previously using a standard NanoSIMS 50 to reveal, on the 50 nm scale, individual DNA fibers labeled with different, non-radioactive isotopes in vivo and to quantify these isotopes. This makes CIS especially suitable for determining the times, places and rates of DNA synthesis as well as the detection of the fine-scale re-arrangements of DNA and of molecules associated with combed DNA fibers. Here, we show how CIS may be extended to 13C-labeling via the detection and quantification of the 13C14N- recombinant ion and the use of the 13C:12C ratio, we discuss how CIS might permit three successive labels, and we suggest ideas that might be explored using CIS.

  1. Establishment and Identification of Chinese Hamster Ovary Cell Lines with Stable Expression of Soluble CD40 Ligands

    Directory of Open Access Journals (Sweden)

    JIANG Hua-wei

    2014-09-01

    Full Text Available Objective: To establish the Chinese Hamster Ovary (CHO cell lines with stable expression of soluble CD40 ligands (sCD40L. Methods: Recombinant plasmid pIRES2-EGFP-sCD40L, enzyme digestion and sequencing identification were obtained by cloning sCD40L coding sequences into eukaryotic expression vector pIRES2-EGFP from carrier pDC316-sCD40 containing sCD40L. CHO cells were transfected by electroporation, followed by screening of resistant clones with G418, after which monoclones were obtained by limited dilution assay and multiply cultured. Flow cytometer and reverted fluorescence microscope were applied to observe the expression of green fluorescent protein, while sCD40L expression was detected by polymerase chain reaction (PCR, reverse transcription-polymerase chain reaction (RT-PCR and enzyme-linked immunosorbent assay (ELISA from aspects of deoxyribose nucleic acid (DNA, messenger ribonucleic acid (mRNA and protein, respectively. CHO-sCD40L was cultured together with MDA-MB-231 cells to compare the expression changes of surface molecule fatty acid synthase (Fas by flow cytometer and observe the apoptosis of MDA-MB-231 cells after Fas activated antibodies (CH-11 were added 24 h later. Results: Plasmid pIRES2-EGFP-sCD40L was successfully established, and cell lines with stable expression of sCD40L were obtained with cloned culture after CHO cell transfection, which was named as B11. Flow cytometer and reverted fluorescence microscope showed >90% expression of green fluorescent protein, while PCR, RT-PCR and ELISA suggested integration of sCD40L genes into cell genome DNA, transcription of sCD40L mRNA and sCD40L protein expression being (4.5±2.1 ng/mL in the supernatant of cell culture, respectively. After co-culture of B11 and MDA-MB-231 cells, the surface Fas expression of MDA-MB-231 cells was increased from (3±1.02 % to (34.8±8.75%, while the apoptosis rate 24 h after addition of CH11 from (5.4±1.32% to (20.7±5.24%, and the differences

  2. Modeling and time-dependent dynamics of processes of stimulated depolymerization, auto-repairing, degradation and radiation curing of DNA macromolecules and biopolymers at separated and combined actions of ionizing irradiation

    Science.gov (United States)

    Vysotskii, Vladimir I.; Pinchuk, Anatoliy O.; Kornilova, Alla A.; Samoylenko, Igor I.

    2001-12-01

    The time-dependent dynamics of the formation, relaxation and auto-repairing of double breaks of DNA macromolecules at the combined radiation action and non-radiation processes of degradation (e.g. by free radicals) were considered. The auto-repairing of DNA double breaks is connected with the peculiarities of long-range interaction of nucleotide charges, atoms and molecules in the intracellular milieu. The properties of intracellular liquid and the characteristics of force interaction between the end-pairs of nucleotides in the area of DNA break in response to radiation are changed. Each kind of radiation is characterized by a certain effectiveness of the double DNA break formation but simultaneously one creates the conditions for their liquidation. On the basis of the analysis and correlation of these processes the time-dependent theory for DNA degradation was created, including hormesis phenomenon, radiation antagonism, the validity of anomaly influence of low and large doses at sharp and chronic radiation and other effects. The qualitative and quantitative correspondences of the theory and experimental results of radiation biology were obtained.

  3. Identification on the content of micronuclei and nature of DNA damaging agent using cytokinesis blocked micronucleus assay in combined with fluorescent in situ hybridization

    International Nuclear Information System (INIS)

    Tamizh Selvan, G.; Bhavani, M.; Venkatachalam, P.

    2014-01-01

    Human beings are continuously exposed to many types of DNA damaging agents which could affect normal function of the cells. While many biomarkers are available to monitor the exposed individuals, limited tools have the ability to discriminate the nature of genotoxic agents. Such identification is an important measure in case of lack of information on the nature of exposure during accidents where many peoples can be exposed. Hence, we aimed to study the capability of cytokinesis blocked micronucleus (CBMN) assay in combination with centeromere specific fluorescent in situ hybridization (FISH) technique to discriminate the radiation from chemicals. Peripheral blood was exposed to γ radiation (0.25 and 2Gy), bleomycin (40 and 80 μg/ml), mitomycin-C (4 and 8 μg/ml) and colchicine (0.05 and 0.1 μg/ml); then cultured for 72 hours to prepare the binucleated cells (BN). The BN were hybridized with pan-centromeric FISH probe and counter stained with DAPI to count the MN with centromere (MNCN + ) and without centromere (MNCN - ) using fluorescence microscope. The unexposed cells showed 0.014±0.004 (MNCN - ) and exposed cells showed both MNCN + and MNCN - . The obtained total MN frequencies were 0.050±0.007 (0.25 Gy) and 0.188±0.017 (2 Gy) for γ irradiated cells, 0.072±0.011 (40 μg/ml) and 0.112±0.012 (80 μg/ml) for bleomycin, 0.029±0.006 (21 μg/ml) and 0.066±0.009 (4 μg/ml) for MMC, 0.072±0.004 (0.05 μg/ml) and 0.106±0.005 (0.1 μg/ml) for colchicine exposed cells. The γ-irradiated cells exhibited dose dependent decrease of MNCN + (32.6 and 16.7%); however, bleomycin exposed cells showed 20.5 and 20.7%; whereas, colchicine exposed cells showed 79.6 and 82.4% and MMC exposed cells exhibited MNCN + of 18.5 and 26.7% for the different concentrations. The obtained results suggest that colchicine alone induced more CNMN + and differences in the induction of MNCN + by using different chemicals as compare to ionizing radiation. Hence, CBMN assay using

  4. Sensitive and selective amplification of methylated DNA sequences using helper-dependent chain reaction in combination with a methylation-dependent restriction enzymes.

    Science.gov (United States)

    Rand, Keith N; Young, Graeme P; Ho, Thu; Molloy, Peter L

    2013-01-07

    We have developed a novel technique for specific amplification of rare methylated DNA fragments in a high background of unmethylated sequences that avoids the need of bisulphite conversion. The methylation-dependent restriction enzyme GlaI is used to selectively cut methylated DNA. Then targeted fragments are tagged using specially designed 'helper' oligonucleotides that are also used to maintain selection in subsequent amplification cycles in a process called 'helper-dependent chain reaction'. The process uses disabled primers called 'drivers' that can only prime on each cycle if the helpers recognize specific sequences within the target amplicon. In this way, selection for the sequence of interest is maintained throughout the amplification, preventing amplification of unwanted sequences. Here we show how the method can be applied to methylated Septin 9, a promising biomarker for early diagnosis of colorectal cancer. The GlaI digestion and subsequent amplification can all be done in a single tube. A detection sensitivity of 0.1% methylated DNA in a background of unmethylated DNA was achieved, which was similar to the well-established Heavy Methyl method that requires bisulphite-treated DNA.

  5. Maternal T and B cell engraftment in two cases of X-linked severe combined immunodeficiency with IgG1 gammopathy.

    Science.gov (United States)

    Okano, Tsubasa; Nishikawa, Takuro; Watanabe, Eri; Watanabe, Takashi; Takashima, Takehiro; Yeh, Tzu-Wen; Yamashita, Motoi; Tanaka-Kubota, Mari; Miyamoto, Satoshi; Mitsuiki, Noriko; Takagi, Masatoshi; Kawano, Yoshifumi; Mochizuki, Yoshiki; Imai, Kohsuke; Kanegane, Hirokazu; Morio, Tomohiro

    2017-10-01

    X-linked severe combined immunodeficiency (X-SCID), caused by defects in the common gamma chain, is typically characterized by T and NK cell defects with the presence of B cells. T cell dysfunction and impaired class-switch recombination of B cells mean that patients typically have defects in class-switched immunoglobulins (IgG, IgA, and IgE) with detectable IgM. Here, we describe two patients with X-SCID with IgG1 gammopathy, in whom we identified maternal T and B cell engraftment. Exclusively, maternal B cells were found among the IgD - CD27 + class-switched memory B cells, whereas the patients' B cells remained naïve. In vitro stimulation with CD40L+IL-21 revealed that peripheral blood cells from both patients produced only IgG1. Class-switched maternal B cells had restricted receptor repertoires with various constant regions and few somatic hypermutations. In conclusion, engrafted maternal B cells underwent class-switch recombination and produced immunoglobulin, causing hypergammaglobulinemia in patients with X-SCID. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Using the ubiquitous pH meter combined with a loop mediated isothermal amplification method for facile and sensitive detection of Nosema bombycis genomic DNA PTP1.

    Science.gov (United States)

    Xie, Shunbi; Yuan, Yali; Song, Yue; Zhuo, Ying; Li, Tian; Chai, Yaqin; Yuan, Ruo

    2014-12-28

    Here we show an amplification-coupled detection method for directly measuring released hydrogen ions during the loop mediated isothermal amplification (LAMP) procedure by using a pH meter. The genomic DNA of Nosema bombycis (N. bombycis) was amplified and detected by employing this LAMP-pH meter platform for the first time.

  7. A combined DNA-microsatellite and isozyme analysis of the population structure of the harbour porpoise in Danish waters and west Greenland

    DEFF Research Database (Denmark)

    Andersen, L W; Holm, L E; Siegismund, Hans Redlef

    1997-01-01

    One hundred and twenty-four specimens of the harbour porpoise, Phocoena phocoena, occurring in inner Danish waters (IDW), the North Sea and West Greenland were analysed to study subdivision into genetically differentiated subpopulations using PCR-amplified DNA-microsatellites and isozyme markers....

  8. Aberrant DNA Methylation of P16, MGMT, and hMLH1 Genes in Combination with MTHFR C677T Genetic Polymorphism in gastric cancer.

    Science.gov (United States)

    Song, Binbin; Ai, Jiang; Kong, Xianghong; Liu, Dexin; Li, Jun

    2013-11-01

    We aimed to explore the association of P16, MGMT and HMLH1 with gastric cancer and their relation with Methylenetetrahydrofolate reductase (MTHFR). 322 gastric patients who were confirmed with pathological diagnosis were included in our study. Aberrant DNA methylation of P16, MGMT and HMLH1 and polymorphisms of MTHFR C677T and A1298C were detected using PCR-RFLP. The proportions of DNA hypermethylation in P16, MGMT and hMLH1 genes in gastric cancer tissues were 75.2% (242/322), 27.6% (89/322) and 5.3% (17/322), respectively. In the remote normal-appearing tissues, 29.5% (95/322) and 16.1%(52/322) showed hypermethylation in P16 and MGMT genes, respectively. We found a significantly higher proportion of DNA hypermethylation of P16 in patients with N1 TNM stage in cancer tissues and remote normal-appearing tissues (P<0.05). Similarly, we found DNA hypermethylation of MGMT had significantly higher proportion in N1 and M1 TNM stage (P<0.05). Individuals with homozygotes (TT) of MTHFR C677T had significant risk of DNA hypermethylation of MGMT in cancer tissues [OR (95% CI)=4.27(1.76-7.84)], and a significant risk was also found in those carrying MTHFR 677CT/TT genotype [OR (95% CI)= 3.27(1.21-4.77)]. We found the aberrant hypermethylation of cancer-related genes, such as P16, MGMT and HMLH1, could be predictive biomarkers for detection of gastric cancer.

  9. Recent progress in DNA origami technology.

    Science.gov (United States)

    Endo, Masayuki; Sugiyama, Hiroshi

    2011-06-01

    DNA origami is an emerging technology for designing defined two-dimensional DNA nanostructures. In this review, we focus on and describe several types of DNA origami-related studies, as follows: (1) programmed DNA origami assembly, (2) DNA origami-templated molecular assembly, (3) design and construction of various three-dimensional DNA origami structures, (4) programmed functionalization of DNA origami and combination with top-down nanotechnology, (5) single molecular observation on a designed DNA origami, and (6) DNA nanomachines working on a DNA origami. © 2011 by John Wiley & Sons, Inc.

  10. Feasibility of a subcutaneously administered block/homo-mixed polyplex micelle as a carrier for DNA vaccination in a mouse tumor model.

    Science.gov (United States)

    Cui, Lin; Osada, Kensuke; Imaizumi, Akira; Kataoka, Kazunori; Nakano, Kenji

    2015-05-28

    In this study, the potential of DNA vaccine by subcutaneously (s.c.) administered block/homo-mixed (B/H) polyplex micelles carrying genes encoding tumor-associated antigen SART3 as well as CD40L and GM-CSF was compared with the intraperitoneal (i.p.) and intravenous (i.v.) administrations or electroporation method. Confocal laser microscopy revealed high localization of polyplexes in groin lymph nodes and local skin tissues after s.c. administration, and in the mesenteric lymph nodes, liver, and spleen after i.p. administration, but not after i.v. administration. Real-time RT-PCR and immunohistochemistry showed transgene expression in the above organs by s.c. and i.p. administered B/H polyplex micelles, but not by the i.v. administration or electroporation. Polyplex-carried DNA vaccines significantly decreased the weight of subcutaneous CT26 tumors in mice compared to the mock (2.9±0.8 vs 6.4±2.6 g, P<0.05 for s.c.; 3.2±1.1 vs 4.7±2.1 g, P<0.05 for i.p. administration). The survival rate was improved by s.c. administration of the DNA vaccine (P<0.05) and by the i.p. administered DNA vaccine (P<0.01) compared with that of the mock controls in mice with peritoneally disseminated CT26 cancer. Such therapeutic effects were not observed by the naked DNA, i.v. administered DNA vaccine or electroporation. CTL and NK cell activities of splenocytes and infiltration of CD11c(+) DCs, and CD4(+) and CD8a(+) T cells into tumor tissues were upregulated in the s.c. administered DNA vaccine group (P<0.05), which was consistent with i.p. administration. No abnormal findings in local injection sites, body weight, or blood examinations were observed by s.c. or i.p. administration of polyplex micelles, whereas proinflammatory cytokine production was minimized in visceral organs with the s.c. administered polyplex-carried DNA vaccine. In conclusion, s.c. administration of B/H polyplex micelles may be a safe and useful modality for DNA vaccination. Copyright © 2015 Elsevier B

  11. Ribonucleotide triggered DNA damage and RNA-DNA damage responses.

    Science.gov (United States)

    Wallace, Bret D; Williams, R Scott

    2014-01-01

    Research indicates that the transient contamination of DNA with ribonucleotides exceeds all other known types of DNA damage combined. The consequences of ribose incorporation into DNA, and the identity of protein factors operating in this RNA-DNA realm to protect genomic integrity from RNA-triggered events are emerging. Left unrepaired, the presence of ribonucleotides in genomic DNA impacts cellular proliferation and is associated with chromosome instability, gross chromosomal rearrangements, mutagenesis, and production of previously unrecognized forms of ribonucleotide-triggered DNA damage. Here, we highlight recent findings on the nature and structure of DNA damage arising from ribonucleotides in DNA, and the identification of cellular factors acting in an RNA-DNA damage response (RDDR) to counter RNA-triggered DNA damage.

  12. Genetic diversity of the pampas deer (Ozotoceros bezoarticus) population in the Brazilian Pantanal assessed by combining fresh fecal DNA analysis and a set of heterologous microsatellite loci.

    Science.gov (United States)

    Mantellatto, Aline Meira Bonfim; Caparroz, Renato; Christofoletti, Maurício Durante; Piovezan, Ubiratan; Duarte, José Maurício Barbanti

    2017-01-01

    The pampas deer (Ozotoceros bezoarticus) is close to being classified as 'globally threatened', with the largest population occurring in the Brazilian Pantanal. Since capture is stressful to these animals, non-invasive sampling methods such as the use of feces can provide reliable sources of DNA. The aim of this study was to use fecal samples to evaluate the genetic variability of the Brazilian Pantanal population of pampas deer. Six heterologous microsatellite markers were used to screen 142 stool specimens. Seventy-four deer were identified, of which 50 adults were used to determine the genetic characteristics of the population. The Pantanal population showed high genetic diversity (mean number of alleles per locus = 11.5, expected heterozygosity = 0.75). This is the first investigation to characterize a South American deer species using fecal DNA and demonstrates the usefulness and efficiency of this approach, as well as the feasibility of obtaining information that could not have been easily obtained by traditional DNA sampling. Our findings suggest that management strategies for this species may be much more effective if applied now when the population still shows high genetic variability.

  13. Soluble CD40 ligands sensitize the epithelial ovarian cancer cells to cisplatin treatment.

    Science.gov (United States)

    Qin, Lijun; Qiu, Hongbing; Zhang, Minjie; Zhang, Fenghua; Yang, Hongfang; Yang, Liu; Jia, Li; Qin, Kaiyun; Jia, Ling; Dou, Xiaomeng; Cheng, Lili; Sang, Meixiang; Zhang, Chao; Shan, Baoen; Zhang, Zhengmao

    2016-04-01

    CD154 (CD40L) is a protein that is primarily expressed on activated T cells and is a member of the TNF superfamily of molecules. It binds to CD40 on antigen-presenting cells (APC), which leads to many effects depending on the target cell type. Being an activator of immune cells, CD40L has also been shown to directly induce apoptosis in tumor cells by multiple mechanisms. To understand the role of sCD40L in regulating the proliferation of epithelial ovarian cancer cells treated or untreated with cisplatin. Epithelial ovarian cancer cells: SKOV3 and its cisplatin-resistant strain SKOV3/DDP cells were used to test the effect of sCD40L and cisplatin. The proliferation of SKOV3 and SKOV3/DDP cells were measured by MTT. Cell cycle was assessed by flow cytometry. The mRNA expressions of targeted genes were detected by qRT-PCR. The protein expressions were detected by Western blotting. sCD40L showed a significant dose-dependence inhibitory effect on the proliferation of ovarian cancer cell lines. sCD40L in combination with cisplatin could sensitized SKOV3/DDP cells to cisplatin treatment and reversed the drug resistance of SKOV3/DDP cells. The reversal ratios of 1 μg/ml sCD40L combined with cisplatin in SKOV3 and SKOV3/DDP cells were 2.11, 2.71, while the reversal ratios of 2 μg/ml sCD40L combined with cisplatin in SKOV3 and SKOV3/DDP cells were 3.78, 5.20, respectively. sCD40L or sCD40L combined cisplatin increased tumor cells in G0/G1 phase. sCD40L in combination with cisplatin decreased the expression levels of GST-π, LRP, Survivin, p53 and Bcl-2 in both epithelial ovarian cancer cell lines. The protein expression level of GST-π, LRP and P53 protein was also decreased upon sCD40L in combination with cisplatin although the expression level of Bcl-2 and survivin protein had no significant difference. sCD40L inhibits the proliferation of SKOV3 and SKOV3/DDP cells. The combined application of sCD40L and cisplatin can strength the inhibitory effect of cisplatin, and to a

  14. DNA nanomechanical devices for molecular biology and DNA nanotechnology

    Science.gov (United States)

    Gu, Hongzhou

    The aim of nanotechnology is to put specific atomic and molecular species where we want them, when we want them there. Achieving such a dynamic and functional control could lead to molecular programming. Structural DNA nanotechnology offers a powerful route to this goal by combining stable branched DNA motifs with cohesive ends to produce objects, programmed nanomechanical devices and fixed or modified patterned lattices. In Chapter II, a two-armed nanorobotic device is built based on a DNA origami substrate. The arms face each other, ready to capture different DNA nanostructures into distinguishable nanopatterns. Combining with a simple error-correction protocol, we are able to achieve this goal in a nearly flawless fashion. In Chapter III, a DNA-based programmable assembly line is developed by combining three PX/JX2 cassettes and a novel DNA walker on a DNA origami substrate. This programmable assembly line can generate eight products by switching the cassettes to PX (ON) or JX2 (OFF) state when the DNA walker passes by. DNA nanomechanical devices hold the promise of controlling structure and performing exquisitely fine measurements on the molecular scale. Several DNA nanomechanical devices based on different biochemistry phenomena have been reported before. In Chapter IV, a scissors-based DNA device is built to measure the work that can be done by a DNA-bending protein (MutS) when it binds to DNA.

  15. Human DNA polymerase alpha uses a combination of positive and negative selectivity to polymerize purine dNTPs with high fidelity

    Czech Academy of Sciences Publication Activity Database

    Beckman, J.; Kincaid, K.; Hocek, Michal; Spratt, T.; Engels, J.; Cosstick, R.; Kuchta, R. D.

    2007-01-01

    Roč. 46, č. 2 (2007), s. 448-460 ISSN 0006-2960 R&D Projects: GA MŠk LC512 Grant - others:NIH(US) GM54194; NIH(US) TW007372-01; Army Research Office(US) W911NF-05-1-0172; DFG(DE) SFB 579 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA polymerase * nucleoside triphosphates * modified nucleobases Subject RIV: CC - Organic Chemistry Impact factor: 3.368, year: 2007

  16. Combining a nanosensor and ELISA for measurement of tyrosyl-dna phosphodiesterase 1 (tdp1) activity and protein amount in cell and tissue extract

    DEFF Research Database (Denmark)

    Jakobsen, Ann-Katrine; Stougaard, Magnus

    2015-01-01

    radiation and free radical-based genotoxins. TDP1 has been reported to be posttranslational regulated, and in nonsmall cell lung cancer (NSCLC) it has been reported that the enzyme activity of TDP1 can be upregulated without detectable upregulation in protein amount. Activity and protein analyses...... are normally performed sequentially using radioactively labeled DNA substrates analyzed using gel-electrophoresis for the activity measurement and western blot or ELISA for protein measurement. We demonstrate here that our previously developed TDP1 nanosensor due to the optical real-time readout can...

  17. A combined approach of DNA probe and RFLP for family and species identification of larval stages of commercially important aquatic species: A study on the surfclam Spisula solidissima

    Digital Repository Service at National Institute of Oceanography (India)

    Achuthankutty, C.T.

    /T ATTACCGCGGC G/T GCTG- 3'))- In 100 ?l reactions, the reagent con- centrations used were as follows. Each reaction contained, 1-2 ?l of template DNA, 10 ?l of l0x PCR buffer (Boehringer Mannheim, Germany), 0.2 mM dNTP, 0.2 (M of each primer, 40 ?g of bovine...- nal extension at 72? C for 7 m. The pres- ence of PCR products was confirmed by electrophoresis on a 2% agarose gel con- taining ethidium bromide. Probe Hybridization PCR products from the larvae and controls were tested with mactrid-spe- cific...

  18. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  19. Combined effects of okadaic acid and cadmium on lipid peroxidation and DNA bases modifications (m{sup 5}dC and 8-(OH)-dG) in Caco-2 cells

    Energy Technology Data Exchange (ETDEWEB)

    Traore, A.; Baudrimont, I.; Creppy, E.E. [Dept. of Toxicology, Univ. Victor Segalen Bordeaux-2 (France); Ruiz, S.; Guarigues, P.; Narbonne, J.F. [Toxicology Lab., Bordeaux (France); Sanni, A. [Dept. de Biochimie et de Biologie Cellulaire, Univ. Nationale du Benin, Cotonou (Benin); Dano, S.D. [Faculty of Pharmacy, University of Abidjan, Abidjan (Ivory Coast)

    2000-04-01

    Okadaic acid (OA) is a marine toxin, a tumour promoter and an inducer of apoptosis. It mainly inhibits protein-phosphatases, protein synthesis and enhances lipid peroxidation. Cadmium (Cd) is known to be carcinogenic in animals and humans (group 1 according to the International Agency for Research on Cancer (IARC) classification). Cd also induces oxidative stress in living organisms. Since they are sometimes found simultaneously in mussels, we have evaluated in the present investigation, the lipid peroxidation, as malondialdehyde (MDA) production, in the variation of the ratios of 8-(OH)-dG/10{sup 5}dG and m{sup 5}dC/ (dC + m{sup 5}dC) induced by OA and/or Cd in Caco-2 cells. When cells were treated exclusively by OA (15 ng/ml) or Cd (0.625 and 5{mu}g/ml) for 24 h, protein synthesis was inhibited (by 42 {+-} 5%, 18 {+-} 13%, and 90 {+-} 4% respectively) while MDA production was 2235 {+-} 129, 1710 {+-} 20, and 11496 {+-} 1624 pmol/mg protein respectively. In addition, each toxicant induced modified bases in DNA; increases in oxidised bases and methylated dC. The combination of OA and cadmium was more cytotoxic and caused more DNA base modifications; the ratio m{sup 5}dC/(m{sup 5}dC+dC) was increased from 3 {+-} 0.15 to 9 {+-} 0.15 and the ratio 8-(OH)-dG/10{sup 5} dG also (from 36 {+-} 2 to 76 {+-} 6). The combination of OA and Cd also increased the level of MDA (16874 {+-} 2189 pmole/mg protein). The present results strongly suggest that DNA damage resulting from the oxidative stress induced by these two toxicants may significantly contribute to increasing their carcinogenicity via epigenetic processes. (orig.)

  20. Present to future: what the reasons for declining first-trimester combined testing tell us about accepting or declining cell-free DNA testing.

    NARCIS (Netherlands)

    Crombag, N.M.; Schendel, R.V. van; Schielen, P.C.; Bensing, J.M.; Henneman, L.

    2016-01-01

    What's Already Known About This Topic? •Women include their attitudes towards Down syndrome and termination of pregnancy, as well as adverse test characteristics, in their considerations about participation in first-trimester combined testing (FCT). •Concerns have been raised about the

  1. A combined DNA-microarray and mechanism-specific toxicity approach with zebrafish embryos to investigate the pollution of river sediments

    NARCIS (Netherlands)

    Kosmehl, Thomas; Otte, Jens C.; Yang, Lixin; Legradi, J.B.; Bluhm, Kerstin; Zinsmeister, Christian; Keiter, Steffen H.; Reifferscheid, Georg; Manz, Werner; Braunbeck, Thomas; Strähle, Uwe; Hollert, Henner

    2012-01-01

    The zebrafish embryo has repeatedly proved to be a useful model for the analysis of effects by environmental toxicants. This proof-of-concept study was performed to investigate if an approach combining mechanism-specific bioassays with microarray techniques can obtain more in-depth insights into the

  2. Phylogenetics of tribe Orchideae (Orchidaceae: Orchidoideae) based on combined DNA matrices: inferences regarding timing of diversification and evolution of pollination syndromes.

    Science.gov (United States)

    Inda, Luis A; Pimentel, Manuel; Chase, Mark W

    2012-07-01

    Tribe Orchideae (Orchidaceae: Orchidoideae) comprises around 62 mostly terrestrial genera, which are well represented in the Northern Temperate Zone and less frequently in tropical areas of both the Old and New Worlds. Phylogenetic relationships within this tribe have been studied previously using only nuclear ribosomal DNA (nuclear ribosomal internal transcribed spacer, nrITS). However, different parts of the phylogenetic tree in these analyses were weakly supported, and integrating information from different plant genomes is clearly necessary in orchids, where reticulate evolution events are putatively common. The aims of this study were to: (1) obtain a well-supported and dated phylogenetic hypothesis for tribe Orchideae, (ii) assess appropriateness of recent nomenclatural changes in this tribe in the last decade, (3) detect possible examples of reticulate evolution and (4) analyse in a temporal context evolutionary trends for subtribe Orchidinae with special emphasis on pollination systems. The analyses included 118 samples, belonging to 103 species and 25 genera, for three DNA regions (nrITS, mitochondrial cox1 intron and plastid rpl16 intron). Bayesian and maximum-parsimony methods were used to construct a well-supported and dated tree. Evolutionary trends in the subtribe were analysed using Bayesian and maximum-likelihood methods of character evolution. The dated phylogenetic tree strongly supported the recently recircumscribed generic concepts of Bateman and collaborators. Moreover, it was found that Orchidinae have diversified in the Mediterranean basin during the last 15 million years, and one potential example of reticulate evolution in the subtribe was identified. In Orchidinae, pollination systems have shifted on numerous occasions during the last 23 million years. The results indicate that ancestral Orchidinae were hymenopteran-pollinated, food-deceptive plants and that these traits have been dominant throughout the evolutionary history of the

  3. DNA-Controlled Assembly of Soft Nanoparticles

    DEFF Research Database (Denmark)

    Vogel, Stefan

    2015-01-01

    This book covers the emerging topic of DNA nanotechnology and DNA supramolecular chemistry in its broader sense. By taking DNA out of its biological role, this biomolecule has become a very versatile building block in materials chemistry, supramolecular chemistry and bio-nanotechnology. Many nove......-covalent systems, DNA origami, DNA based switches, DNA machines, and alternative structures and templates. This broad coverage is very appealing since it combines both the synthesis of modified DNA as well as designer concepts to successfully plan and make DNA nanostructures....

  4. A new method for species identification via protein-coding and non-coding DNA barcodes by combining machine learning with bioinformatic methods.

    Directory of Open Access Journals (Sweden)

    Ai-bing Zhang

    Full Text Available Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish and two representing non-coding ITS barcodes (rust fungi and brown algae. Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ and Maximum likelihood (ML methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40% for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37% for 1094 brown algae queries, both using ITS barcodes.

  5. Effects of low-dose rate γ-irradiation combined with simulated microgravity on markers of oxidative stress, DNA methylation potential, and remodeling in the mouse heart.

    Science.gov (United States)

    Seawright, John W; Samman, Yusra; Sridharan, Vijayalakshmi; Mao, Xiao Wen; Cao, Maohua; Singh, Preeti; Melnyk, Stepan; Koturbash, Igor; Nelson, Gregory A; Hauer-Jensen, Martin; Boerma, Marjan

    2017-01-01

    Space travel is associated with an exposure to low-dose rate ionizing radiation and the microgravity environment, both of which may lead to impairments in cardiac function. We used a mouse model to determine short- and long-term cardiac effects to simulated microgravity (hindlimb unloading; HU), continuous low-dose rate γ-irradiation, or a combination of HU and low-dose rate γ-irradiation. Cardiac tissue was obtained from female, C57BL/6J mice 7 days, 1 month, 4 months, and 9 months following the completion of a 21 day exposure to HU or a 21 day exposure to low-dose rate γ-irradiation (average dose rate of 0.01 cGy/h to a total of 0.04 Gy), or a 21 day simultaneous exposure to HU and low-dose rate γ-irradiation. Immunoblot analysis, rt-PCR, high-performance liquid chromatography, and histology were used to assess inflammatory cell infiltration, cardiac remodeling, oxidative stress, and the methylation potential of cardiac tissue in 3 to 6 animals per group. The combination of HU and γ-irradiation demonstrated the strongest increase in reduced to oxidized glutathione ratios 7 days and 1 month after treatment, but a difference was no longer apparent after 9 months. On the other hand, no significant changes in 4-hydroxynonenal adducts was seen in any of the groups, at the measured endpoints. While manganese superoxide dismutase protein levels decreased 9 months after low-dose γ-radiation, no changes were observed in expression of catalase or Nrf2, a transcription factor that determines the expression of several antioxidant enzymes, at the measured endpoints. Inflammatory marker, CD-2 protein content was significantly decreased in all groups 4 months after treatment. No significant differences were observed in α-smooth muscle cell actin protein content, collagen type III protein content or % total collagen. This study has provided the first and relatively broad analysis of small molecule and protein markers of oxidative stress, T-lymphocyte infiltration, and

  6. Mitochondrial DNA.

    Science.gov (United States)

    Wright, Russell G.; Bottino, Paul J.

    1986-01-01

    Provides background information for teachers on mitochondrial DNA, pointing out that it may have once been a free-living organism. Includes a ready-to-duplicate exercise titled "Using Microchondrial DNA to Measure Evolutionary Distance." (JN)

  7. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  8. Human DNA Ligase III Recognizes DNA Ends by Dynamic Switching Between Two DNA Bound States†

    OpenAIRE

    Cotner-Gohara, Elizabeth; Kim, In-Kwon; Hammel, Michal; Tainer, John A.; Tomkinson, Alan E.; Ellenberger, Tom

    2010-01-01

    Human DNA ligase III has essential functions in nuclear and mitochondrial DNA replication and repair and contains a PARP-like zinc finger (ZnF) that increases DNA nick-joining and intermolecular DNA ligation. Yet, the bases for ligase III specificity and structural variation among human ligases are not understood. Here combined crystal structure and small angle x-ray scattering results reveal dynamic switching between two nick-binding components of ligase III: the ZnF-DNA binding domain (DBD)...

  9. Use of vibrational spectroscopy to study protein and DNA structure, hydration, and binding of biomolecules: A combined theoretical and experimental approach

    DEFF Research Database (Denmark)

    Jalkanen, Karl J.; Jürgensen, Vibeke Würtz; Claussen, Anetta

    2006-01-01

    and experimental approach. The systems we have studied systematically are the amino acids (L-alanine, L-tryptophan, and L-histidine), peptides (N-acetyl L-alanine N'-methyl amide, N-acetyl L-tryptophan N'-methyl amide, N-acetyl L-histidine N'-methyl amide, L-alanyl L-alanine, tri-L-serine, N-acetyl L-alanine L......-ploline L-tyrosine N'-methyl amide, Leu-enkephalin, cyclo-(gly-L-pro), N-acetyl (L-alanine)(n) N'-methyl amide), 3-methyl indole, and a variety of small molecules (dichlobenil and 2,6-dochlorobenzamide) of relevance to the protein systems under study. We have used molecular mechanics, the SCC-DFTB, SCCDFTB......+disp, RHF, MP2, and DFT methodologies for the modeling studies with the goal of interpreting the experimentally measured vibrational spectra for these molecules to the greatest extent possible and to use this combined approach to understand the structure, function, and electronic properties...

  10. [8-oxo-7,8-dihydro-2'-deoxyguanosine as a marker of DNA oxidative stress in individuals with combined familiar hyperlipidemia].

    Science.gov (United States)

    Ferri, Jordi; Martínez-Hervás, Sergio; Espinosa, Olga; Fandos, Marta; Pedro, Teresa; Real, José Tomás; Chaves, Felipe Javier; Cerdá, Concha; Sáez, Guillermo; Ascaso, Juan Francisco

    2008-06-07

    To compare 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dG) value as an indicator of oxidative stress situation between healthy and familial combined hyperlipidemic (FCH) subjects as a mixed dislipidemia with insulin resistance model and early coronary heart disease, and to study its relationship with clinical-biologic parameters of insulin resistance. 40 non-related FCH patients (15 women) and 20 normolipidemic and nondiabetic healthy subjects (8 women) were studied. Clinical, anthropometric and biochemical parameters (lipidic profile, glucemia, insulinemia and 8-oxo-dG) were measured in fasting state in all. Both groups had similar age, body mass index blood pressure and waist perimeter values. Insulin and 8-oxo-dG values were significantly higher in FHC subjects. These differences were maintained after correcting by waist perimeter. 8-oxo-dG correlated positively with insulin and trygliceride; and negatively with high density lipoprotein cholesterol in FCH subjects. Insulin values are independently correlated with oxidative stress degree measured as 8-oxo-dG.

  11. Close linkage of the locus for X chromosome-linked severe combined immunodeficiency to polymorphic DNA markers in Xq11-q13

    Energy Technology Data Exchange (ETDEWEB)

    de Saint Basile, G.; Arveiler, B.; Oberle, I.; Malcolm, S.; Levinsky, R.J.; Lau, Y.L.; Hofker, M.; Debre, M.; Fischer, A.; Griscelli, C.; Mandel, J.L.

    1987-11-01

    The gene for X chromosome-linked severe combined immunodeficiency (SCID), a disease characterized by a block in early T-cell differentiation, has been mapped to the region Xq11-q13 by linkage analysis with restriction fragment length polymorphisms. High logarithm of odds (lod) scores were obtained with the marker 19.2 (DXS3) and with the marker cpX73 (DXS159) that showed complete cosegregation with the disease locus in the informative families analyzed. Other significant linkages were obtained with several markers from Xq11 to q22. With the help of a recently developed genetic map of the region, it was possible to perform multipoint linkage analysis, and the most likely genetic order is DXS1-(SCID, DXS159)-DXYS1-DXYS12-DXS3, with a maximum multipoint logarithm of odds score of 11.0. The results demonstrate that the SCID locus (gene symbol IMD4) is not closely linked to the locus of Bruton's agammaglobulinemia (a defect in B-cell maturation). They also provide a way for a better estimation of risk for carrier and antenatal diagnosis.

  12. Close linkage of the locus for X chromosome-linked severe combined immunodeficiency to polymorphic DNA markers in Xq11-q13

    International Nuclear Information System (INIS)

    de Saint Basile, G.; Arveiler, B.; Oberle, I.

    1987-01-01

    The gene for X chromosome-linked severe combined immunodeficiency (SCID), a disease characterized by a block in early T-cell differentiation, has been mapped to the region Xq11-q13 by linkage analysis with restriction fragment length polymorphisms. High logarithm of odds (lod) scores were obtained with the marker 19.2 (DXS3) and with the marker cpX73 (DXS159) that showed complete cosegregation with the disease locus in the informative families analyzed. Other significant linkages were obtained with several markers from Xq11 to q22. With the help of a recently developed genetic map of the region, it was possible to perform multipoint linkage analysis, and the most likely genetic order is DXS1-(SCID, DXS159)-DXYS1-DXYS12-DXS3, with a maximum multipoint logarithm of odds score of 11.0. The results demonstrate that the SCID locus (gene symbol IMD4) is not closely linked to the locus of Bruton's agammaglobulinemia (a defect in B-cell maturation). They also provide a way for a better estimation of risk for carrier and antenatal diagnosis

  13. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  14. Processive DNA demethylation via DNA deaminase-induced lesion resolution.

    Directory of Open Access Journals (Sweden)

    Don-Marc Franchini

    Full Text Available Base modifications of cytosine are an important aspect of chromatin biology, as they can directly regulate gene expression, while DNA repair ensures that those modifications retain genome integrity. Here we characterize how cytosine DNA deaminase AID can initiate DNA demethylation. In vitro, AID initiated targeted DNA demethylation of methyl CpGs when in combination with DNA repair competent extracts. Mechanistically, this is achieved by inducing base alterations at or near methyl-cytosine, with the lesion being resolved either via single base substitution or a more efficient processive polymerase dependent repair. The biochemical findings are recapitulated in an in vivo transgenic targeting assay, and provide the genetic support of the molecular insight into DNA demethylation. This targeting approach supports the hypothesis that mCpG DNA demethylation can proceed via various pathways and mCpGs do not have to be targeted to be demethylated.

  15. Combining Push Pull Tracer Tests and Microbial DNA and mRNA Analysis to Assess In-Situ Groundwater Nitrate Transformations

    Science.gov (United States)

    Henson, W.; Graham, W. D.; Huang, L.; Ogram, A.

    2015-12-01

    Nitrogen transformation mechanisms in the Upper Floridan Aquifer (UFA) are still poorly understood because of karst aquifer complexity and spatiotemporal variability in nitrate and carbon loading. Transformation rates have not been directly measured in the aquifer. This study quantifies nitrate-nitrogen transformation potential in the UFA using single well push-pull tracer injection (PPT) experiments combined with microbial characterization of extracted water via qPCR and RT-qPCR of selected nitrate reduction genes. Tracer tests with chloride and nitrate ± carbon were executed in two wells representing anoxic and oxic geochemical end members in a spring groundwater contributing area. A significant increase in number of microbes with carbon addition suggests stimulated growth. Increases in the activities of denitrification genes (nirK and nirS) as measured by RT-qPCR were not observed. However, only microbes suspended in the tracer were obtained, ignoring effects of aquifer material biofilms. Increases in nrfA mRNA and ammonia concentrations were observed, supporting Dissimilatory Reduction of Nitrate to Ammonia (DNRA) as a reduction mechanism. In the oxic aquifer, zero order nitrate loss rates ranged from 32 to 89 nmol /L*hr with no added carbon and 90 to 240 nmol /L*hr with carbon. In the anoxic aquifer, rates ranged from 18 to 95 nmol /L*hr with no added carbon and 34 to 207 nmol /L*hr with carbon. These loss rates are low; 13 orders of magnitude less than the loads applied in the contributing area each year, however they do indicate that losses can occur in oxic and anoxic aquifers with and without carbon. These rates may include, ammonia adsorption, uptake, or denitrification in aquifer material biofilms. Rates with and without carbon addition for both aquifers were similar, suggesting aquifer redox state and carbon availability alone are insufficient to predict response to nutrient additions without characterization of microbial response. Surprisingly, these

  16. Biosensors for DNA sequence detection

    Science.gov (United States)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  17. DNA-PK assay

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Carl W.; Connelly, Margery A.

    2004-10-12

    The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

  18. Tomato protoplast DNA transformation : physical linkage and recombination of exogenous DNA sequences

    NARCIS (Netherlands)

    Jongsma, Maarten; Koornneef, Maarten; Zabel, Pim; Hille, Jacques

    1987-01-01

    Tomato protoplasts have been transformed with plasmid DNA's, containing a chimeric kanamycin resistance gene and putative tomato origins of replication. A calcium phosphate-DNA mediated transformation procedure was employed in combination with either polyethylene glycol or polyvinyl alcohol. There

  19. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  20. DNA Vaccines

    Indian Academy of Sciences (India)

    DNA vaccine, immune response, antibodies, infectious diseases. GENERAL I ARTICLE. DNA Vaccines. P N Rangarajan. History of Vaccine Development. The year 1996 marked the 200th anniversary of the first vaccine developed against smallpox by Edward Jenner. In the now- famous 1796 experiment, Jenner scratched ...

  1. Hyperstretching DNA

    NARCIS (Netherlands)

    Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

    2017-01-01

    The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

  2. Individual and Combined Expression of DNA Damage Response Molecules PARP1, γH2AX, BRCA1, and BRCA2 Predict Shorter Survival of Soft Tissue Sarcoma Patients.

    Directory of Open Access Journals (Sweden)

    Kyoung Min Kim

    Full Text Available DNA damage response (DDR molecules are protective against genotoxic stresses. DDR molecules are also involved in the survival of cancer cells in patients undergoing anti-cancer therapies. Therefore, DDR molecules are potential markers of cancer progression in addition to being potential therapeutic targets. In this study, we evaluated the immunohistochemical expression of PARP1, γH2AX, BRCA1, and BRCA2 and their prognostic significance in 112 cases of soft tissue sarcoma (STS. The expression of PARP1, γH2AX, BRCA1, and BRCA2 were significantly associated with each other and were associated with higher tumor stage and presence of distant metastasis. The expression of PARP1, γH2AX, and BRCA2 were significantly associated with shorter disease-specific survival (DSS and event-free survival (EFS by univariate analysis. BRCA1 expression was associated with shorter DSS. Multivariate analysis revealed the expression of PARP1 and γH2AX to be independent indicators of poor prognosis of DSS and EFS. BRCA2 expression was an independent indicator of poor prognosis of DSS. In addition, the combined expressional patterns of PARP1, γH2AX, BRCA1, and BRCA2 (CSddrm were independent prognostic predictors of DSS (P < 0.001 and EFS (P = 0.016. The ten-year DSS rate of the CSddrm-low, CSddrm-intermediate, and CSddrm-high subgroups were 81%, 26%, and 0%, respectively. In conclusion, this study demonstrates that the individual and combined expression patterns of the DDR molecules PARP1, γH2AX, BRCA1, and BRCA2 could be predictive of the prognosis of STS patients and suggests that controlling the activity of these DDR molecules could be employed in new therapeutic stratagems for the treatment of STS.

  3. LNA effects on DNA binding and conformation

    DEFF Research Database (Denmark)

    Pabon-Martinez, Y Vladimir; Xu, You; Villa, Alessandra

    2017-01-01

    The anti-gene strategy is based on sequence-specific recognition of double-strand DNA by triplex forming (TFOs) or DNA strand invading oligonucleotides to modulate gene expression. To be efficient, the oligonucleotides (ONs) should target DNA selectively, with high affinity. Here we combined hybr...

  4. PDA: Pooled DNA analyzer

    Directory of Open Access Journals (Sweden)

    Lin Chin-Yu

    2006-04-01

    Full Text Available Abstract Background Association mapping using abundant single nucleotide polymorphisms is a powerful tool for identifying disease susceptibility genes for complex traits and exploring possible genetic diversity. Genotyping large numbers of SNPs individually is performed routinely but is cost prohibitive for large-scale genetic studies. DNA pooling is a reliable and cost-saving alternative genotyping method. However, no software has been developed for complete pooled-DNA analyses, including data standardization, allele frequency estimation, and single/multipoint DNA pooling association tests. This motivated the development of the software, 'PDA' (Pooled DNA Analyzer, to analyze pooled DNA data. Results We develop the software, PDA, for the analysis of pooled-DNA data. PDA is originally implemented with the MATLAB® language, but it can also be executed on a Windows system without installing the MATLAB®. PDA provides estimates of the coefficient of preferential amplification and allele frequency. PDA considers an extended single-point association test, which can compare allele frequencies between two DNA pools constructed under different experimental conditions. Moreover, PDA also provides novel chromosome-wide multipoint association tests based on p-value combinations and a sliding-window concept. This new multipoint testing procedure overcomes a computational bottleneck of conventional haplotype-oriented multipoint methods in DNA pooling analyses and can handle data sets having a large pool size and/or large numbers of polymorphic markers. All of the PDA functions are illustrated in the four bona fide examples. Conclusion PDA is simple to operate and does not require that users have a strong statistical background. The software is available at http://www.ibms.sinica.edu.tw/%7Ecsjfann/first%20flow/pda.htm.

  5. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  6. Radiation response and regulation of apoptosis induced by a combination of TRAIL and CHX in cells lacking mitochondrial DNA: A role for NF-{kappa}B-STAT3-directed gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, Vladimir N., E-mail: vni3@columbia.edu; Ghandhi, Shanaz A.; Zhou, Hongning; Huang, Sarah X.; Chai, Yunfei; Amundson, Sally A.; Hei, Tom K.

    2011-07-01

    Mitochondrial DNA depleted ({rho}{sup 0}) human skin fibroblasts (HSF) with suppressed oxidative phosphorylation were characterized by significant changes in the expression of 2100 nuclear genes, encoding numerous protein classes, in NF-{kappa}B and STAT3 signaling pathways, and by decreased activity of mitochondrial death pathway, compared to the parental {rho}{sup +} HSF. In contrast, the extrinsic TRAIL/TRAIL-Receptor mediated death pathway remained highly active, and exogenous TRAIL in a combination with cycloheximide (CHX) induced higher levels of apoptosis in {rho}{sup 0} cells compared to {rho}{sup +} HSF. Global gene expression analysis using microarray and qRT-PCR demonstrated that mRNA expression levels of many growth factors and their adaptor proteins (FGF13, HGF, IGFBP4, IGFBP6, and IGFL2), cytokines (IL6, {Oota}L17{Beta}, {Oota}L18, {Oota}L19, and {Oota}L28{Beta}) and cytokine receptors (IL1R1, IL21R, and IL31RA) were substantially decreased after mitochondrial DNA depletion. Some of these genes were targets of NF-{kappa}B and STAT3, and their protein products could regulate the STAT3 signaling pathway. Alpha-irradiation further induced expression of several NF-{kappa}B/STAT3 target genes, including IL1A, IL1B, IL6, PTGS2/COX2 and MMP12, in {rho}{sup +} HSF, but this response was substantially decreased in {rho}{sup 0} HSF. Suppression of the IKK-NF-{kappa}B pathway by the small molecular inhibitor BMS-345541 and of the JAK2-STAT3 pathway by AG490 dramatically increased TRAIL-induced apoptosis in the control and irradiated {rho}{sup +} HSF. Inhibitory antibodies against IL6, the main activator of JAK2-STAT3 pathway, added into the cell media, also increased TRAIL-induced apoptosis in HSF, especially after alpha-irradiation. Collectively, our results indicated that NF-{kappa}B activation was partially lost in {rho}{sup 0} HSF resulting in downregulation of the basal or radiation-induced expression of numerous NF-{kappa}B targets, further suppressing IL6

  7. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  8. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  9. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  10. Human DNA Ligase III Recognizes DNA Ends by Dynamic Switching between Two DNA-Bound States

    Energy Technology Data Exchange (ETDEWEB)

    Cotner-Gohara, Elizabeth; Kim, In-Kwon; Hammel, Michal; Tainer, John A.; Tomkinson, Alan E.; Ellenberger, Tom (Scripps); (Maryland-MED); (WU-MED); (LBNL)

    2010-09-13

    Human DNA ligase III has essential functions in nuclear and mitochondrial DNA replication and repair and contains a PARP-like zinc finger (ZnF) that increases the extent of DNA nick joining and intermolecular DNA ligation, yet the bases for ligase III specificity and structural variation among human ligases are not understood. Here combined crystal structure and small-angle X-ray scattering results reveal dynamic switching between two nick-binding components of ligase III: the ZnF-DNA binding domain (DBD) forms a crescent-shaped surface used for DNA end recognition which switches to a ring formed by the nucleotidyl transferase (NTase) and OB-fold (OBD) domains for catalysis. Structural and mutational analyses indicate that high flexibility and distinct DNA binding domain features in ligase III assist both nick sensing and the transition from nick sensing by the ZnF to nick joining by the catalytic core. The collective results support a 'jackknife model' in which the ZnF loads ligase III onto nicked DNA and conformational changes deliver DNA into the active site. This work has implications for the biological specificity of DNA ligases and functions of PARP-like zinc fingers.

  11. Current developments in forensic interpretation of mixed DNA samples (Review)

    OpenAIRE

    HU, NA; CONG, BIN; LI, SHUJIN; MA, CHUNLING; FU, LIHONG; ZHANG, XIAOJING

    2014-01-01

    A number of recent improvements have provided contemporary forensic investigations with a variety of tools to improve the analysis of mixed DNA samples in criminal investigations, producing notable improvements in the analysis of complex trace samples in cases of sexual assult and homicide. Mixed DNA contains DNA from two or more contributors, compounding DNA analysis by combining DNA from one or more major contributors with small amounts of DNA from potentially numerous minor contributors. T...

  12. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  13. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  14. Quantification and presence of human ancient DNA in burial place ...

    African Journals Online (AJOL)

    For reliable and sensitive DNA quantitation, the application of real time PCR is described. A published real-time PCR assay, which allows for the combined analysis of nuclear or ancient DNA and mitochondrial DNA, was modified. This approach can be used for recovering DNA from the surface of fossil bone remains in ...

  15. Structural organization of DNA in chlorella viruses.

    Directory of Open Access Journals (Sweden)

    Timo Wulfmeyer

    Full Text Available Chlorella viruses have icosahedral capsids with an internal membrane enclosing their large dsDNA genomes and associated proteins. Their genomes are packaged in the particles with a predicted DNA density of ca. 0.2 bp nm(-3. Occasionally infection of an algal cell by an individual particle fails and the viral DNA is dynamically ejected from the capsid. This shows that the release of the DNA generates a force, which can aid in the transfer of the genome into the host in a successful infection. Imaging of ejected viral DNA indicates that it is intimately associated with proteins in a periodic fashion. The bulk of the protein particles detected by atomic force microscopy have a size of ∼60 kDa and two proteins (A278L and A282L of about this size are among 6 basic putative DNA binding proteins found in a proteomic analysis of DNA binding proteins packaged in the virion. A combination of fluorescence images of ejected DNA and a bioinformatics analysis of the DNA reveal periodic patterns in the viral DNA. The periodic distribution of GC rich regions in the genome provides potential binding sites for basic proteins. This DNA/protein aggregation could be responsible for the periodic concentration of fluorescently labeled DNA observed in ejected viral DNA. Collectively the data indicate that the large chlorella viruses have a DNA packaging strategy that differs from bacteriophages; it involves proteins and share similarities to that of chromatin structure in eukaryotes.

  16. DNA nanotechnology

    OpenAIRE

    Nadrian C Seeman

    2003-01-01

    Since Watson and Crick’s determination of its structure nearly 50 years ago, DNA has come to fill our lives in many areas, from genetic counseling to forensics, from genomics to gene therapy. These, and other ways in which DNA affects human activities, are related to its function as genetic material, not just our genetic material, but the genetic material of all living organisms. Here, we will ignore DNA’s biological role; rather, we will discuss how the properties that make it so successful ...

  17. A DNA 3′-phosphatase functions in active DNA demethylation in Arabidopsis

    OpenAIRE

    Martínez-Macías, María Isabel; Qian, Weiqiang; Miki, Daisuke; Pontes, Olga; Liu, Yunhua; Tang, Kai; Liu, Renyi; Morales-Ruiz, Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa; Zhu, Jian-Kang

    2012-01-01

    DNA methylation is an important epigenetic mark established by the combined actions of methylation and demethylation reactions. Plants use a base excision repair pathway for active DNA demethylation. After 5-methylcytosine removal, the Arabidopsis DNA glycosylase/lyase ROS1 incises the DNA backbone and part of the product has a single-nucleotide gap flanked by 3′- and 5′-phosphate termini. Here we show that the DNA phosphatase ZDP removes the blocking 3′-phosphate, allowing subsequent DNA pol...

  18. DNA Investigations.

    Science.gov (United States)

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  19. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  20. Efficacy of the Combination of a PARP Inhibitor and UVC on Cancer Cells as Imaged by Focus Formation by the DNA Repair-related Protein 53BP1 Linked to Green Fluorescent Protein.

    Science.gov (United States)

    Tome, Yasunori; Uehara, Fuminari; Miwa, Shinji; Yano, Shuya; Mii, Sumiyuki; Efimova, Elena V; Bouvet, Michael; Kimura, Hiroaki; Tsuchiya, Hiroyuki; Kanaya, Fuminori; Hoffman, Robert M

    2016-08-01

    The ability to image DNA repair in cancer cells after irradiation, as well as its inhibition by potential therapeutic agents, is important for the further development of effective cancer therapy. 53BP1 is a DNA repair protein that is overexpressed and forms foci when double-stranded DNA breaks occur in DNA. The re-localization of green fluorescent protein (GFP) fused to the chromatin-binding domain of 53BP1 to form foci was imaged after UVC irradiation of breast and pancreatic cancer cells expressing 53BP1-GFP using confocal microscopy. During live-cell imaging, 53BP1-GFP focus formation was observed within 10 minutes after UVC irradiation. Most 53BP1 foci resolved by 100 minutes. To block UVC-induced double-strand break repair in cancer cells, poly(ADP-ribose) polymerase (PARP) was targeted with ABT-888 (veliparib). PARP inhibition markedly enhanced UVC-irradiation-induced persistence of 53BP1-foci, even beyond 100 minutes after UVC irradiation, and reduced proliferation of breast and pancreatic cancer cells. Confocal microscopy of 53BP1-GFP is a powerful method for imaging UVC-induced DNA damage and repair, as well as inhibition of repair. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  1. Combined Targeted DNA Sequencing in Non-Small Cell Lung Cancer (NSCLC) Using UNCseq and NGScopy, and RNA Sequencing Using UNCqeR for the Detection of Genetic Aberrations in NSCLC

    Science.gov (United States)

    Walter, Vonn; Patel, Nirali M.; Eberhard, David A.; Hayward, Michele C.; Salazar, Ashley H.; Jo, Heejoon; Soloway, Matthew G.; Wilkerson, Matthew D.; Parker, Joel S.; Yin, Xiaoying; Zhang, Guosheng; Siegel, Marni B.; Rosson, Gary B.; Earp, H. Shelton; Sharpless, Norman E.; Gulley, Margaret L.; Weck, Karen E.

    2015-01-01

    The recent FDA approval of the MiSeqDx platform provides a unique opportunity to develop targeted next generation sequencing (NGS) panels for human disease, including cancer. We have developed a scalable, targeted panel-based assay termed UNCseq, which involves a NGS panel of over 200 cancer-associated genes and a standardized downstream bioinformatics pipeline for detection of single nucleotide variations (SNV) as well as small insertions and deletions (indel). In addition, we developed a novel algorithm, NGScopy, designed for samples with sparse sequencing coverage to detect large-scale copy number variations (CNV), similar to human SNP Array 6.0 as well as small-scale intragenic CNV. Overall, we applied this assay to 100 snap-frozen lung cancer specimens lacking same-patient germline DNA (07–0120 tissue cohort) and validated our results against Sanger sequencing, SNP Array, and our recently published integrated DNA-seq/RNA-seq assay, UNCqeR, where RNA-seq of same-patient tumor specimens confirmed SNV detected by DNA-seq, if RNA-seq coverage depth was adequate. In addition, we applied the UNCseq assay on an independent lung cancer tumor tissue collection with available same-patient germline DNA (11–1115 tissue cohort) and confirmed mutations using assays performed in a CLIA-certified laboratory. We conclude that UNCseq can identify SNV, indel, and CNV in tumor specimens lacking germline DNA in a cost-efficient fashion. PMID:26076459

  2. Combined Targeted DNA Sequencing in Non-Small Cell Lung Cancer (NSCLC Using UNCseq and NGScopy, and RNA Sequencing Using UNCqeR for the Detection of Genetic Aberrations in NSCLC.

    Directory of Open Access Journals (Sweden)

    Xiaobei Zhao

    Full Text Available The recent FDA approval of the MiSeqDx platform provides a unique opportunity to develop targeted next generation sequencing (NGS panels for human disease, including cancer. We have developed a scalable, targeted panel-based assay termed UNCseq, which involves a NGS panel of over 200 cancer-associated genes and a standardized downstream bioinformatics pipeline for detection of single nucleotide variations (SNV as well as small insertions and deletions (indel. In addition, we developed a novel algorithm, NGScopy, designed for samples with sparse sequencing coverage to detect large-scale copy number variations (CNV, similar to human SNP Array 6.0 as well as small-scale intragenic CNV. Overall, we applied this assay to 100 snap-frozen lung cancer specimens lacking same-patient germline DNA (07-0120 tissue cohort and validated our results against Sanger sequencing, SNP Array, and our recently published integrated DNA-seq/RNA-seq assay, UNCqeR, where RNA-seq of same-patient tumor specimens confirmed SNV detected by DNA-seq, if RNA-seq coverage depth was adequate. In addition, we applied the UNCseq assay on an independent lung cancer tumor tissue collection with available same-patient germline DNA (11-1115 tissue cohort and confirmed mutations using assays performed in a CLIA-certified laboratory. We conclude that UNCseq can identify SNV, indel, and CNV in tumor specimens lacking germline DNA in a cost-efficient fashion.

  3. A ranking index for quality assessment of forensic DNA profiles forensic DNA profiles

    Directory of Open Access Journals (Sweden)

    Ansell Ricky

    2010-11-01

    Full Text Available Abstract Background Assessment of DNA profile quality is vital in forensic DNA analysis, both in order to determine the evidentiary value of DNA results and to compare the performance of different DNA analysis protocols. Generally the quality assessment is performed through manual examination of the DNA profiles based on empirical knowledge, or by comparing the intensities (allelic peak heights of the capillary electrophoresis electropherograms. Results We recently developed a ranking index for unbiased and quantitative quality assessment of forensic DNA profiles, the forensic DNA profile index (FI (Hedman et al. Improved forensic DNA analysis through the use of alternative DNA polymerases and statistical modeling of DNA profiles, Biotechniques 47 (2009 951-958. FI uses electropherogram data to combine the intensities of the allelic peaks with the balances within and between loci, using Principal Components Analysis. Here we present the construction of FI. We explain the mathematical and statistical methodologies used and present details about the applied data reduction method. Thereby we show how to adapt the ranking index for any Short Tandem Repeat-based forensic DNA typing system through validation against a manual grading scale and calibration against a specific set of DNA profiles. Conclusions The developed tool provides unbiased quality assessment of forensic DNA profiles. It can be applied for any DNA profiling system based on Short Tandem Repeat markers. Apart from crime related DNA analysis, FI can therefore be used as a quality tool in paternal or familial testing as well as in disaster victim identification.

  4. A polarized view on DNA under tension

    Science.gov (United States)

    van Mameren, Joost; Vermeulen, Karen; Wuite, Gijs J. L.; Peterman, Erwin J. G.

    2018-03-01

    In the past decades, sensitive fluorescence microscopy techniques have contributed significantly to our understanding of the dynamics of DNA. The specific labeling of DNA using intercalating dyes has allowed for quantitative measurement of the thermal fluctuations the polymers undergo. On the other hand, recent advances in single-molecule manipulation techniques have unraveled the mechanical and elastic properties of this intricate polymer. Here, we have combined these two approaches to study the conformational dynamics of DNA under a wide range of tensions. Using polarized fluorescence microscopy in conjunction with optical-tweezers-based manipulation of YOYO-intercalated DNA, we controllably align the YOYO dyes using DNA tension, enabling us to disentangle the rapid dynamics of the dyes from that of the DNA itself. With unprecedented control of the DNA alignment, we resolve an inconsistency in reports about the tilted orientation of intercalated dyes. We find that intercalated dyes are on average oriented perpendicular to the long axis of the DNA, yet undergo fast dynamics on the time scale of absorption and fluorescence emission. In the overstretching transition of double-stranded DNA, we do not observe changes in orientation or orientational dynamics of the dyes. Only beyond the overstretching transition, a considerable depolarization is observed, presumably caused by an average tilting of the DNA base pairs. Our combined approach thus contributes to the elucidation of unique features of the molecular dynamics of DNA.

  5. DNA Chip

    Indian Academy of Sciences (India)

    Imagine a world without identity cards; no I-cards for the college or office or bank account or anything! All you are carrying is a small (say, 2cm x 2cm) 'DNA-chip', which has the whole of your genetic profile on it. Your identity cannot get more authentic than that. Imagine a world where marriages are not decided by matching ...

  6. DNA repair

    International Nuclear Information System (INIS)

    Setlow, R.

    1978-01-01

    Some topics discussed are as follows: difficulty in extrapolating data from E. coli to mammalian systems; mutations caused by UV-induced changes in DNA; mutants deficient in excision repair; other postreplication mechanisms; kinds of excision repair systems; detection of repair by biochemical or biophysical means; human mutants deficient in repair; mutagenic effects of UV on XP cells; and detection of UV-repair defects among XP individuals

  7. Stool DNA Test

    Science.gov (United States)

    ... The stool DNA test is a noninvasive laboratory test that identifies DNA changes in the cells of a stool sample. ... the presence of cancer. If a stool DNA test detects abnormal DNA, additional testing may be used to investigate the ...

  8. Environmental DNA reflects spatial and temporal jellyfish distribution

    OpenAIRE

    Minamoto, Toshifumi; Fukuda, Miho; Katsuhara, Koki R.; Fujiwara, Ayaka; Hidaka, Shunsuke; Yamamoto, Satoshi; Takahashi, Kohji; Masuda, Reiji

    2017-01-01

    Recent development of environmental DNA (eDNA) analysis allows us to survey underwater macro-organisms easily and cost effectively; however, there have been no reports on eDNA detection or quantification for jellyfish. Here we present the first report on an eDNA analysis of marine jellyfish using Japanese sea nettle (Chrysaora pacifica) as a model species by combining a tank experiment with spatial and temporal distribution surveys. We performed a tank experiment monitoring eDNA concentration...

  9. Charge transfer through DNA/DNA duplexes and DNA/RNA hybrids: complex theoretical and experimental studies.

    Science.gov (United States)

    Kratochvílová, Irena; Vala, Martin; Weiter, Martin; Špérová, Miroslava; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    2013-01-01

    Oligonucleotides conduct electric charge via various mechanisms and their characterization and understanding is a very important and complicated task. In this work, experimental (temperature dependent steady state fluorescence spectroscopy, time-resolved fluorescence spectroscopy) and theoretical (Density Functional Theory) approaches were combined to study charge transfer processes in short DNA/DNA and RNA/DNA duplexes with virtually equivalent sequences. The experimental results were consistent with the theoretical model - the delocalized nature of HOMO orbitals and holes, base stacking, electronic coupling and conformational flexibility formed the conditions for more effective short distance charge transfer processes in RNA/DNA hybrids. RNA/DNA and DNA/DNA charge transfer properties were strongly connected with temperature affected structural changes of molecular systems - charge transfer could be used as a probe of even tiny changes of molecular structures and settings. © 2013. Published by Elsevier B.V. All rights reserved.

  10. Combination of intratumoral injections of vaccinia virus MVA expressing GM-CSF and immunization with DNA vaccine prolongs the survival of mice bearing HPV16 induced tumors with downregulated expression of MHC class I molecules

    Czech Academy of Sciences Publication Activity Database

    Němečková, Š.; Šmahel, M.; Hainz, P.; Macková, J.; Zurková, K.; Gabriel, P.; Indrová, Marie; Kutinová, L.

    2007-01-01

    Roč. 54, č. 4 (2007), s. 326-333 ISSN 0028-2685 R&D Projects: GA MZd NR8004 Institutional research plan: CEZ:AV0Z50520514 Keywords : vaccinia virus MVA expressing GM-CSF * DNA vaccine * HPV16 induced tumors Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.208, year: 2007

  11. Combined theoretical and computational study of interstrand DNA guanine-guanine cross-linking by trans-[Pt(pyridine)2] derived from the photoactivated prodrug trans,trans,trans-[Pt(N3)2(OH)2(pyridine)2

    Czech Academy of Sciences Publication Activity Database

    Tai, H.-Ch.; Brodbeck, R.; Kašpárková, Jana; Farrer, N.J.; Brabec, Viktor; Sadler, P.J.; Deeth, R.J.

    2012-01-01

    Roč. 51, č. 12 (2012), s. 6830-6841 ISSN 0020-1669 R&D Projects: GA ČR(CZ) GAP301/10/0598 Institutional research plan: CEZ:AV0Z50040702 Keywords : platinum * photoactivation * DNA Subject RIV: BO - Biophysics Impact factor: 4.593, year: 2012

  12. Crystal structure of Deep Vent DNA polymerase.

    Science.gov (United States)

    Hikida, Yasushi; Kimoto, Michiko; Hirao, Ichiro; Yokoyama, Shigeyuki

    2017-01-29

    DNA polymerases are useful tools in various biochemical experiments. We have focused on the DNA polymerases involved in DNA replication including the unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px). Many reports have described the different combinations between unnatural base pairs and DNA polymerases. As an example, for the replication of the Ds-Px pair, Deep Vent DNA polymerase exhibits high efficiency and fidelity, but Taq DNA polymerase shows much lower efficiency and fidelity. In the present study, we determined the crystal structure of Deep Vent DNA polymerase in the apo form at 2.5 Å resolution. Using this structure, we constructed structural models of Deep Vent DNA polymerase complexes with DNA containing an unnatural or natural base in the replication position. The models revealed that the unnatural Ds base in the template-strand DNA clashes with the side-chain oxygen of Thr664 in Taq DNA polymerase, but not in Deep Vent DNA polymerase. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Sorting fluorescent nanocrystals with DNA

    Energy Technology Data Exchange (ETDEWEB)

    Gerion, Daniele; Parak, Wolfgang J.; Williams, Shara C.; Zanchet, Daniela; Micheel, Christine M.; Alivisatos, A. Paul

    2001-12-10

    Semiconductor nanocrystals with narrow and tunable fluorescence are covalently linked to oligonucleotides. These biocompounds retain the properties of both nanocrystals and DNA. Therefore, different sequences of DNA can be coded with nanocrystals and still preserve their ability to hybridize to their complements. We report the case where four different sequences of DNA are linked to four nanocrystal samples having different colors of emission in the range of 530-640 nm. When the DNA-nanocrystal conjugates are mixed together, it is possible to sort each type of nanoparticle using hybridization on a defined micrometer -size surface containing the complementary oligonucleotide. Detection of sorting requires only a single excitation source and an epifluorescence microscope. The possibility of directing fluorescent nanocrystals towards specific biological targets and detecting them, combined with their superior photo-stability compared to organic dyes, opens the way to improved biolabeling experiments, such as gene mapping on a nanometer scale or multicolor microarray analysis.

  14. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    Science.gov (United States)

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  15. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  16. DNA Microarrays

    Science.gov (United States)

    Nguyen, C.; Gidrol, X.

    Genomics has revolutionised biological and biomedical research. This revolution was predictable on the basis of its two driving forces: the ever increasing availability of genome sequences and the development of new technology able to exploit them. Up until now, technical limitations meant that molecular biology could only analyse one or two parameters per experiment, providing relatively little information compared with the great complexity of the systems under investigation. This gene by gene approach is inadequate to understand biological systems containing several thousand genes. It is essential to have an overall view of the DNA, RNA, and relevant proteins. A simple inventory of the genome is not sufficient to understand the functions of the genes, or indeed the way that cells and organisms work. For this purpose, functional studies based on whole genomes are needed. Among these new large-scale methods of molecular analysis, DNA microarrays provide a way of studying the genome and the transcriptome. The idea of integrating a large amount of data derived from a support with very small area has led biologists to call these chips, borrowing the term from the microelectronics industry. At the beginning of the 1990s, the development of DNA chips on nylon membranes [1, 2], then on glass [3] and silicon [4] supports, made it possible for the first time to carry out simultaneous measurements of the equilibrium concentration of all the messenger RNA (mRNA) or transcribed RNA in a cell. These microarrays offer a wide range of applications, in both fundamental and clinical research, providing a method for genome-wide characterisation of changes occurring within a cell or tissue, as for example in polymorphism studies, detection of mutations, and quantitative assays of gene copies. With regard to the transcriptome, it provides a way of characterising differentially expressed genes, profiling given biological states, and identifying regulatory channels.

  17. Impaired NFAT and NFκB activation are involved in suppression of CD40 ligand expression by Δ9-tetrahydrocannabinol in human CD4+ T cells

    International Nuclear Information System (INIS)

    Ngaotepprutaram, Thitirat; Kaplan, Barbara L.F.; Kaminski, Norbert E.

    2013-01-01

    We have previously reported that Δ 9 -tetrahydrocannabinol (Δ 9 -THC), the main psychoactive cannabinoid in marijuana, suppresses CD40 ligand (CD40L) expression by activated mouse CD4 + T cells. CD40L is involved in pathogenesis of many autoimmune and inflammatory diseases. In the present study, we investigated the molecular mechanism of Δ 9 -THC-mediated suppression of CD40L expression using peripheral blood human T cells. Pretreatment with Δ 9 -THC attenuated CD40L expression in human CD4 + T cells activated by anti-CD3/CD28 at both the protein and mRNA level, as determined by flow cytometry and quantitative real-time PCR, respectively. Electrophoretic mobility shift assays revealed that Δ 9 -THC suppressed the DNA-binding activity of both NFAT and NFκB to their respective response elements within the CD40L promoter. An assessment of the effect of Δ 9 -THC on proximal T cell-receptor (TCR) signaling induced by anti-CD3/CD28 showed significant impairment in the rise of intracellular calcium, but no significant effect on the phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β. Collectively, these findings identify perturbation of the calcium-NFAT and NFκB signaling cascade as a key mechanistic event by which Δ 9 -THC suppresses human T cell function. - Highlights: • Δ 9 -THC attenuated CD40L expression in activated human CD4+ T cells. • Δ 9 -THC suppressed DNA-binding activity of NFAT and NFκB. • Δ 9 -THC impaired elevation of intracellular Ca2+. • Δ 9 -THC did not affect phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β

  18. Impaired NFAT and NFκB activation are involved in suppression of CD40 ligand expression by Δ{sup 9}-tetrahydrocannabinol in human CD4{sup +} T cells

    Energy Technology Data Exchange (ETDEWEB)

    Ngaotepprutaram, Thitirat [Department of Pharmacology and Toxicology, Michigan State University (United States); Center for Integrative Toxicology, Michigan State University (United States); Kaplan, Barbara L.F. [Department of Pharmacology and Toxicology, Michigan State University (United States); Center for Integrative Toxicology, Michigan State University (United States); Neuroscience Program, Michigan State University (United States); Kaminski, Norbert E., E-mail: kamins11@msu.edu [Department of Pharmacology and Toxicology, Michigan State University (United States); Center for Integrative Toxicology, Michigan State University (United States)

    2013-11-15

    We have previously reported that Δ{sup 9}-tetrahydrocannabinol (Δ{sup 9}-THC), the main psychoactive cannabinoid in marijuana, suppresses CD40 ligand (CD40L) expression by activated mouse CD4{sup +} T cells. CD40L is involved in pathogenesis of many autoimmune and inflammatory diseases. In the present study, we investigated the molecular mechanism of Δ{sup 9}-THC-mediated suppression of CD40L expression using peripheral blood human T cells. Pretreatment with Δ{sup 9}-THC attenuated CD40L expression in human CD4{sup +} T cells activated by anti-CD3/CD28 at both the protein and mRNA level, as determined by flow cytometry and quantitative real-time PCR, respectively. Electrophoretic mobility shift assays revealed that Δ{sup 9}-THC suppressed the DNA-binding activity of both NFAT and NFκB to their respective response elements within the CD40L promoter. An assessment of the effect of Δ{sup 9}-THC on proximal T cell-receptor (TCR) signaling induced by anti-CD3/CD28 showed significant impairment in the rise of intracellular calcium, but no significant effect on the phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β. Collectively, these findings identify perturbation of the calcium-NFAT and NFκB signaling cascade as a key mechanistic event by which Δ{sup 9}-THC suppresses human T cell function. - Highlights: • Δ{sup 9}-THC attenuated CD40L expression in activated human CD4+ T cells. • Δ{sup 9}-THC suppressed DNA-binding activity of NFAT and NFκB. • Δ{sup 9}-THC impaired elevation of intracellular Ca2+. • Δ{sup 9}-THC did not affect phosphorylation of ZAP70, PLCγ1/2, Akt, and GSK3β.

  19. Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

    International Nuclear Information System (INIS)

    Verebová, Valéria; Adamcik, Jozef; Danko, Patrik; Podhradský, Dušan; Miškovský, Pavol; Staničová, Jana

    2014-01-01

    Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode

  20. Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA

    Energy Technology Data Exchange (ETDEWEB)

    Verebová, Valéria [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia); Adamcik, Jozef [Food and Soft Materials Science, Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 9, CH-8092 Zürich (Switzerland); Danko, Patrik; Podhradský, Dušan [Department of Biochemistry, Institute of Chemistry, Faculty of Sciences, P.J. Šafárik University, Moyzesova 11, 041 54 Košice (Slovakia); Miškovský, Pavol [Department of Biophysics, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Center for Interdisciplinary Biosciences, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Staničová, Jana, E-mail: jana.stanicova@uvlf.sk [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia)

    2014-01-31

    Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.

  1. Winning Combinations

    DEFF Research Database (Denmark)

    Criscuolo, Paola; Laursen, Keld; Reichstein, Toke

    2018-01-01

    Searching for the most rewarding sources of innovative ideas remains a key challenge in management of technological innovation. Yet, little is known about which combinations of internal and external knowledge sources are triggers for innovation. Extending theories about searching for innovation, we...... examine the effectiveness of different combinations of knowledge sources for achieving innovative performance. We suggest that combinations involving integrative search strategies – combining internal and external knowledge – are the most likely to generate product and process innovation. In this context...

  2. DNA displacement assay integrated into microfluidic channels.

    Science.gov (United States)

    Zangmeister, Rebecca A; Tarlov, Michael J

    2004-07-01

    This paper describes the development of a unique fluorescence-based DNA diagnostic microfluidic assay that does not require labeling of the target sequence prior to analysis. The assay is based on the displacement of a short sacrificial fluorescent-tagged indicator oligomer by a longer untagged target sequence as it is electrophoresed through a DNA-containing hydrogel plug immobilized in a microfluidic channel. The distinct advantages of this assay are the short sensing times, as a result of directed electrophoretic transport of target DNA to the sensing element, combined with the ability to detect nonlabeled target DNA.

  3. DNA-scaffolded nanoparticle structures

    International Nuclear Information System (INIS)

    Hoegberg, Bjoern; Olin, Haakan

    2007-01-01

    DNA self-assembly is a powerful route to the production of very small, complex structures. When used in combination with nanoparticles it is likely to become a key technology in the production of nanoelectronics in the future. Previously, demonstrated nanoparticle assemblies have mainly been periodic and highly symmetric arrays, unsuited as building blocks for any complex circuits. With the invention of DNA-scaffolded origami reported earlier this year (Rothemund P W K 2006 Nature 440 (7082) 297-302), a new route to complex nanostructures using DNA has been opened. Here, we give a short review of the field and present the current status of our experiments were DNA origami is used in conjunction with nanoparticles. Gold nanoparticles are functionalized with thiolated single stranded DNA. Strands that are complementary to the gold particle strands can be positioned on the self-assembled DNA-structure in arbitrary patterns. This property should allow an accurate positioning of the particles by letting them hybridize on the lattice. We report on our recent experiments on this system and discuss open problems and future applications

  4. Synthesis and structure elucidation of new μ-oxamido-bridged dicopper(II) complex with in vitro anticancer activity: A combined study from experiment verification and docking calculation on DNA/protein-binding property.

    Science.gov (United States)

    Zhu, Ling; Zheng, Kang; Li, Yan-Tuan; Wu, Zhi-Yong; Yan, Cui-Wei

    2016-02-01

    A new oxamido-bridged dicopper(II) complex with formula of [Cu2(deap)(pic)2], where H2deap and pic represent N,N'-bis[3-(diethylamino)propyl]oxamide and picrate, respectively, was synthesized and characterized by elemental analyses, molar conductance measurements, IR and electronic spectral study, and single-crystal X-ray diffraction. The crystal structure analyses revealed that the two copper(II) atoms in the dicopper(II) complex are bridged by the trans-deap(2-) ligand with the distances of 5.2116(17)Å, and the coordination environment around the copper(II) atoms can be described as a square-planar geometry. Hydrogen bonding and π-π stacking interactions link the dicopper(II) complex into a three-dimensional infinite network. The DNA/protein-binding properties of the complex are investigated by molecular docking and experimental assays. The results indicate that the dicopper(II) complex can interact with HS-DNA in the mode of intercalation and effectively quench the intrinsic fluorescence of protein BSA by 1:1 binding with the most possible binding site in the proximity of Trp134. The in vitro anticancer activities suggest that the complex is active against the selected tumor cell lines, and IC50 values for SMMC-7721 and HepG2 are lower than cisplatin. The effects of the electron density distribution of the terminal ligand and the chelate ring arrangement around copper(II) ions bridged by symmetric N,N'-bis(substituted)oxamides on DNA/BSA-binding ability and in vitro anticancer activity are preliminarily discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. DNA hairpins as temperature switches, thermometers and ionic detectors

    DEFF Research Database (Denmark)

    Jonstrup, Anette Thyssen; Fredsøe, Jacob Christian; Andersen, Anni Hangaard

    2013-01-01

    created. Here we describe how DNA molecules can be used as nanoscale sensors to meet these requirements. We illustrate how the hybridization kinetics between bases in DNA molecules combined with conformational changes of the DNA backbone can be exploited in the construction of simple but versatile...

  6. HPV DNA test

    Science.gov (United States)

    ... HPV testing in women; Cervical cancer - HPV DNA test; Cancer of cervix - HPV DNA test ... The HPV DNA test may be done during a Pap smear . You lie on a table and place your feet in stirrups. The ...

  7. DNA recovery from soils of diverse composition.

    Science.gov (United States)

    Zhou, J; Bruns, M A; Tiedje, J M

    1996-02-01

    A simple, rapid method for bacterial lysis and direct extraction of DNA from soils with minimal shearing was developed to address the risk of chimera formation from small template DNA during subsequent PCR. The method was based on lysis with a high-salt extraction buffer (1.5 M NaCl) and extended heating (2 to 3 h) of the soil suspension in the presence of sodium dodecyl sulfate (SDS), hexadecyltrimethylammonium bromide, and proteinase K. The extraction method required 6 h and was tested on eight soils differing in organic carbon, clay content, and pH, including ones from which DNA extraction is difficult. The DNA fragment size in crude extracts from all soils was > 23 kb. Preliminary trials indicated that DNA recovery from two soils seeded with gram-negative bacteria was 92 to 99%. When the method was tested on all eight unseeded soils, microscopic examination of indigenous bacteria in soil pellets before and after extraction showed variable cell lysis efficiency (26 to 92%). Crude DNA yields from the eight soils ranged from 2.5 to 26.9 micrograms of DNA g-1, and these were positively correlated with the organic carbon content in the soil (r = 0.73). DNA yields from gram-positive bacteria from pure cultures were two to six times higher when the high-salt-SDS-heat method was combined with mortar-and-pestle grinding and freeze-thawing, and most DNA recovered was of high molecular weight. Four methods for purifying crude DNA were also evaluated for percent recovery, fragment size, speed, enzyme restriction, PCR amplification, and DNA-DNA hybridization. In general, all methods produced DNA pure enough for PCR amplification. Since soil type and microbial community characteristics will influence DNA recovery, this study provides guidance for choosing appropriate extraction and purification methods on the basis of experimental goals.

  8. Stimulation of IgY responses in gene gun immunized laying hens by combined administration of vector DNA coding for the target antigen Botulinum toxin A1 and for avian cytokine adjuvants.

    Science.gov (United States)

    Niederstadt, Lars; Hohn, Oliver; Dorner, Brigitte G; Schade, Rüdiger; Bannert, Norbert

    2012-08-31

    DNA immunization is a convenient and effective way of inducing a specific antibody response. In mammals, co-administration of vectors encoding immunostimulatory cytokines can enhance the humoral response resulting in elevated antibody titers. We therefore set out to investigate the effect using avian interleukin 1β (IL-1β) and avian interleukin 6 (IL-6) as genetic adjuvants when immunizing laying hens. A BoNT A1 holotoxoid DNA immunogen carrying two inactivating mutations was evaluated for its ability to induce a specific and sustained IgY antibody response. Both the holotoxoid and the cytokine sequences were codon-optimized. In vitro, the proteins were efficiently expressed in transfected HEK 293T cells and the cytokines were secreted into the culture supernatants. Whereas eggs from hens immunized via gene gun using a prime boost strategy showed no differences in their total IgY content, the specific αBoNT A1 response was slightly elevated up to 1.4× by the IL-1β adjuvant vector and increased by 3.8× by the IL-6 vector. Finally, although hens receiving the IL-1β adjuvant had laying capacities above the average, hens receiving the IL-6 adjuvant experienced laying problems. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Roles of 1,25(OH2D3 and Vitamin D Receptor in the Pathogenesis of Rheumatoid Arthritis and Systemic Lupus Erythematosus by Regulating the Activation of CD4+ T Cells and the PKCδ/ERK Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Xiao-Jie He

    2016-12-01

    Full Text Available Background/Aims: The study aims to elucidate the roles of 1,25(OH2D3 and vitamin D receptor (VDR in the pathogenesis of rheumatoid arthritis (RA and systemic lupus erythematosus (SLE by regulating the activation of CD4+ T cells and the PKCδ/ERK signaling pathway. Methods: From January 2013 to December 2015, a total of 130 SLE patients, 137 RA patients and 130 healthy controls were selected in this study. Serum levels of 1,25(OH2D3 and VDR mRNA expression were detected by ELISA and real-time fluorescence quantitative PCR (RT-qPCR. Density gradient centrifugation was performed to separate peripheral blood mononuclear cells (PBMCs. CD4+ T cells were separated using magnetic activated cell sorting (MACS. CD4+T cells in logarithmic growth phase were collected and assigned into 9 groups: the normal control group, the normal negative control (NC group, the VDR siRNA group, the RA control group, the RA NC group, the VDR over-expressed RA group, the SLE control group, the SLE NC group, and the VDR over-expressed SLE group. The mRNA and protein expressions of VDR, PKCδ, ERK1/2, CD11a, CD70 and CD40L were detected by RT-qPCR and Western blotting. Bisulfite genomic sequencing was conducted to monitor the methylation status of CD11a, CD70 and CD40L. Results: Compared with healthy controls, serum 1,25(OH2D3 level and VDR mRNA expression in peripheral blood were decreased in SLE patients and RA patients. With the increase of concentrations of 1,25(OH2D3 treatment, the VDR mRNA expression and DNA methylation levels of CD11a, CD70 and CD40L were declined, while the expressions of PKCδ, ERK1/2, CD11a, CD70 and CD40L were elevated in SLE, RA and normal CD4+T cells. Compared with the SLE contro, RA control, SLE NC and RA NC groups, the expressions of PKCδ, ERK1/2, CD11a, CD70 and CD40L decreased but DNA methylation levels of CD11a, CD70 and CD40L increased in the VDR over-expressed SLE group and VDR over-expressed RA group. However, compared with the normal

  10. Combination vaccines

    Directory of Open Access Journals (Sweden)

    David AG Skibinski

    2011-01-01

    Full Text Available The combination of diphtheria, tetanus, and pertussis vaccines into a single product has been central to the protection of the pediatric population over the past 50 years. The addition of inactivated polio, Haemophilus influenzae, and hepatitis B vaccines into the combination has facilitated the introduction of these vaccines into recommended immunization schedules by reducing the number of injections required and has therefore increased immunization compliance. However, the development of these combinations encountered numerous challenges, including the reduced response to Haemophilus influenzae vaccine when given in combination; the need to consolidate the differences in the immunization schedule (hepatitis B; and the need to improve the safety profile of the diphtheria, tetanus, and pertussis combination. Here, we review these challenges and also discuss future prospects for combination vaccines.

  11. Synthesis of DNA

    Science.gov (United States)

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  12. DNA-Protected Silver Clusters for Nanophotonics

    Directory of Open Access Journals (Sweden)

    Elisabeth Gwinn

    2015-02-01

    Full Text Available DNA-protected silver clusters (AgN-DNA possess unique fluorescence properties that depend on the specific DNA template that stabilizes the cluster. They exhibit peak emission wavelengths that range across the visible and near-IR spectrum. This wide color palette, combined with low toxicity, high fluorescence quantum yields of some clusters, low synthesis costs, small cluster sizes and compatibility with DNA are enabling many applications that employ AgN-DNA. Here we review what is known about the underlying composition and structure of AgN-DNA, and how these relate to the optical properties of these fascinating, hybrid biomolecule-metal cluster nanomaterials. We place AgN-DNA in the general context of ligand-stabilized metal clusters and compare their properties to those of other noble metal clusters stabilized by small molecule ligands. The methods used to isolate pure AgN-DNA for analysis of composition and for studies of solution and single-emitter optical properties are discussed. We give a brief overview of structurally sensitive chiroptical studies, both theoretical and experimental, and review experiments on bringing silver clusters of distinct size and color into nanoscale DNA assemblies. Progress towards using DNA scaffolds to assemble multi-cluster arrays is also reviewed.

  13. DNA repair in human bronchial epithelial cells

    International Nuclear Information System (INIS)

    Fornace, A.J. Jr.; Lechner, J.F.; Grafstrom, R.C.; Harris, C.C.

    1982-01-01

    The purpose of this investigation was to compare the response of human cell types (bronchial epithelial cells and fibroblasts and skin fibroblasts) to various DNA damaging agents. Repair of DNA single strand breaks (SSB) induced by 5 krads of X-ray was similar for all cell types; approximately 90% of the DNA SSB were rejoined within one hour. During excision repair of DNA damage from u.v.-radiation, the frequencies of DNA SSB as estimated by the alkaline elution technique, were similar in all cell types. Repair replication as measured by BND cellulose chromatography was also similar in epithelial and fibroblastic cells after u.v.-irradiation. Similar levels of SSB were also observed in epithelial and fibroblastic cells after exposure to chemical carcinogens: 7,12-dimethylbenz[a]anthracene; benzo[a]pyrene diol epoxide (BPDE); or N-methyl-N-nitro-N-nitrosoguanidine. Significant repair replication of BPDE-induced DNA damage was detected in both bronchial epithelial and fibroblastic cells, although the level in fibroblasts was approximately 40% of that in epithelial cells. The pulmonary carcinogen asbestos did not damage DNA. DNA-protein crosslinks induced by formaldehyde were rapidly removed in bronchial cells. Further, epithelial and fibroblastic cells, which were incubated with formaldehyde and the polymerase inhibitor combination of cytosine arabinoside and hydroxyurea, accumulated DNA SSB at approximately equal frequencies. These results should provide a useful background for further investigations of the response of human bronchial cells to various DNA damaging agents

  14. Trapping and manipulating single molecules of DNA

    Science.gov (United States)

    Shon, Min Ju

    This thesis presents the development and application of nanoscale techniques to trap and manipulate biomolecules, with a focus on DNA. These methods combine single-molecule microscopy and nano- and micro-fabrication to study biophysical properties of DNA and proteins. The Dimple Machine is a lab-on-a-chip device that can isolate and confine a small number of molecules from a bulk solution. It traps molecules in nanofabricated chambers, or "dimples", and the trapped molecules are then studied on a fluorescence microscope at the single-molecule level. The sampling of bulk solution by dimples is representative, reproducible, and automated, enabling highthroughput single-molecule experiments. The device was applied to study hybridization of oligonucleotides, particularly in the context of reaction thermodynamics and kinetics in nanoconfinement. The DNA Pulley is a system to study protein binding and the local mechanical properties of DNA. A molecule of DNA is tethered to a surface on one end, and a superparamagnetic bead is attached to the other. A magnet pulls the DNA taut, and a silicon nitride knife with a nanoscale blade scans the DNA along its contour. Information on the local properties of the DNA is extracted by tracking the bead with nanometer precision in a white-light microscope. The system can detect proteins bound to DNA and localize their recognition sites, as shown with a model protein, EcoRI restriction enzyme. Progress on the measurements of nano-mechanical properties of DNA is included.

  15. The minus of a plus is a minus. Mass death of selected neuron populations in sporadic late-onset neurodegenerative disease may be due to a combination of subtly decreased capacity to repair oxidative DNA damage and increased propensity for damage-related apoptosis

    Directory of Open Access Journals (Sweden)

    Rumena Petkova

    2016-07-01

    Full Text Available Neurons in the adult central nervous system (CNS are subjected to high levels of oxidative damage that is usually promptly repaired. Transcribed genomic regions are repaired with priority over untranscribed regions. The prioritization of DNA repair in neurons results in modification of the input into the assessment of genomic integrity in order to delay or avoid damage-related apoptosis unless the damage interferes directly with the functioning of the neuron. CNS neurons may be replaced, albeit rarely. Over-stimulation of adult neural progenitor niche caused by accelerated neuronal loss may result in its premature depletion. The combination of the two pathologic mechanisms (increased rates of neuronal death and depletion of the progenitor niche may eventually result in irreversible loss of specific cell populations in the CNS and/or generalized neuronal loss. Here we propose that the risk of developing sporadic late-onset neurodegenerative disease (LONDD may be modulated by the individual capacity for detection and repair of DNA damage and the genetic propensity to repair moderate-degree damage or to assess it as irreparable and route the cell towards apoptosis. Thus, subtly deficient DNA damage repair coupled with a tendency to repair the damage rather than kill the damaged cell may be associated with increased risk of cancer, whereas deficient DNA repair coupled with a propensity to destroy damaged cells may increase the risk of LONDD. Extensive studies of individual repair capacity may be needed to test this hypothesis and, potentially, use the results in the assessment of the risk of common late-onset disease.

  16. A Phase I Double Blind, Placebo-Controlled, Randomized Study of the Safety and Immunogenicity of Electroporated HIV DNA with or without Interleukin 12 in Prime-Boost Combinations with an Ad35 HIV Vaccine in Healthy HIV-Seronegative African Adults.

    Directory of Open Access Journals (Sweden)

    Juliet Mpendo

    Full Text Available Strategies to enhance the immunogenicity of DNA vaccines in humans include i co-administration of molecular adjuvants, ii intramuscular administration followed by in vivo electroporation (IM/EP and/or iii boosting with a different vaccine. Combining these strategies provided protection of macaques challenged with SIV; this clinical trial was designed to mimic the vaccine regimen in the SIV study.Seventy five healthy, HIV-seronegative adults were enrolled into a phase 1, randomized, double-blind, placebo-controlled trial. Multi-antigenic HIV (HIVMAG plasmid DNA (pDNA vaccine alone or co-administered with pDNA encoding human Interleukin 12 (IL-12 (GENEVAX IL-12 given by IM/EP using the TriGrid Delivery System was tested in different prime-boost regimens with recombinant Ad35 HIV vaccine given IM.All local reactions but one were mild or moderate. Systemic reactions and unsolicited adverse events including laboratory abnormalities did not differ between vaccine and placebo recipients. No serious adverse events (SAEs were reported. T cell and antibody response rates after HIVMAG (x3 prime-Ad35 (x1 boost were independent of IL-12, while the magnitude of interferon gamma (IFN-γ ELISPOT responses was highest after HIVMAG (x3 without IL-12. The quality and phenotype of T cell responses shown by intracellular cytokine staining (ICS were similar between groups. Inhibition of HIV replication by autologous T cells was demonstrated after HIVMAG (x3 prime and was boosted after Ad35. HIV specific antibodies were detected only after Ad35 boost, although there was a priming effect with 3 doses of HIVMAG with or without IL-12. No anti-IL-12 antibodies were detected.The vaccines were safe, well tolerated and moderately immunogenic. Repeated administration IM/EP was well accepted. An adjuvant effect of co-administered plasmid IL-12 was not detected.ClinicalTrials.gov NCT01496989.

  17. Stretching, twisting and supercoiling in short, single DNA molecules

    Science.gov (United States)

    Lam, Pui-Man; Zhen, Yi

    2018-02-01

    We had combined the Neukirch-Marko model that describes the extension, torque and supercoiling in single, stretched and twisted DNA of infinite contour length, with a form of the free energy suggested by Sinha and Samuels to describe short DNA, with contour length only a few times the persistence length. We find that the free energy of the stretched but untwisted DNA, is significantly modified from its infinitely length value and this in turn modifies significantly the torque and supercoiling. We show that this is consistent with short DNA being more flexible than infinitely long DNA. We hope our results will stimulate experimental investigation of torque and supercoiling in short DNA.

  18. Protection against SHIV-KB9 Infection by Combining rDNA and rFPV Vaccines Based on HIV Multiepitope and p24 Protein in Chinese Rhesus Macaques

    Directory of Open Access Journals (Sweden)

    Chang Li

    2012-01-01

    Full Text Available Developing an effective vaccine against HIV infection remains an urgent goal. We used a DNA prime/fowlpox virus boost regimen to immunize Chinese rhesus macaques. The animals were challenged intramuscularly with pathogenic molecularly cloned SHIV-KB9. Immunogenicity and protective efficacy of vaccines were investigated by measuring IFN-γ levels, monitoring HIV-specific binding antibodies, examining viral load, and analyzing CD4/CD8 ratio. Results show that, upon challenge, the vaccine group can induce a strong immune response in the body, represented by increased expression of IFN-γ, slow and steady elevated antibody production, reduced peak value of acute viral load, and increase in the average CD4/CD8 ratio. The current research suggests that rapid reaction speed, appropriate response strength, and long-lasting immune response time may be key protection factors for AIDS vaccine. The present study contributes significantly to AIDS vaccine and preclinical research.

  19. Transient generation of hydrogen peroxide is responsible for carcinostatic effects of hydrogen combined with platinum nanocolloid, together with increases intracellular ROS, DNA cleavages, and proportion of G2/M-phase.

    Science.gov (United States)

    Saitoh, Yasukazu; Ikeshima, Minoru; Kawasaki, Naho; Masumoto, Aoi; Miwa, Nobuhiko

    2016-01-01

    In our previous study, we demonstrated that combined treatment with hydrogen (H2) and platinum nanocolloid (Pt-nc) exerted markedly antiproliferative effects on cancer cells compared with each treatment alone. However, because the related mechanisms remain unclear, we investigated carcinostatic mechanisms of the combined treatment with H2 + Pt-nc. Significant suppression of cell proliferation was confirmed at 52 h following combined treatment, and the similar effect was also observed by the 30- or 40-min transient treatment with H2 + Pt-nc. The transient treatments led to changes in cell size and morphology, loss of microvilli, and apoptosis-like cell death at 120 h after treatment. Moreover, transient combined treatment with H2 + Pt-nc induced cell-cycle arrest, as reflected by decreased proportions of G1-phase cells and accumulation of G2/M-phase cells. In contrast, intracellular peroxide levels were temporarily and significantly increased immediately after H2 + Pt-nc treatment but not after treatment with H2 or Pt-nc alone. Additionally, combined treatment-induced carcinostatic effects were significantly diminished in the presence of catalase, and marked hydrogen peroxide (H2O2) generation was confirmed after mixing Pt-nc into cell culture media containing a high concentration of H2. These changes are in agreement with the results that carcinostatic effects were induced after only 40 min of treatment with H2 + Pt-nc. Thus, transient and marked generation of H2O2 is responsible for the carcinostatic effects of combined treatment with H2 + Pt-nc.

  20. Methods to maximise recovery of environmental DNA from water samples.

    Directory of Open Access Journals (Sweden)

    Rheyda Hinlo

    Full Text Available The environmental DNA (eDNA method is a detection technique that is rapidly gaining credibility as a sensitive tool useful in the surveillance and monitoring of invasive and threatened species. Because eDNA analysis often deals with small quantities of short and degraded DNA fragments, methods that maximize eDNA recovery are required to increase detectability. In this study, we performed experiments at different stages of the eDNA analysis to show which combinations of methods give the best recovery rate for eDNA. Using Oriental weatherloach (Misgurnus anguillicaudatus as a study species, we show that various combinations of DNA capture, preservation and extraction methods can significantly affect DNA yield. Filtration using cellulose nitrate filter paper preserved in ethanol or stored in a -20°C freezer and extracted with the Qiagen DNeasy kit outperformed other combinations in terms of cost and efficiency of DNA recovery. Our results support the recommendation to filter water samples within 24hours but if this is not possible, our results suggest that refrigeration may be a better option than freezing for short-term storage (i.e., 3-5 days. This information is useful in designing eDNA detection of low-density invasive or threatened species, where small variations in DNA recovery can signify the difference between detection success or failure.

  1. Augmentation of protein production by a combination of the T7 RNA polymerase system and ubiquitin fusion: Overproduction of the human DNA repair protein, ERCC1, as a ubiquitin fusion protein in Escherichia coli.

    NARCIS (Netherlands)

    M.H.M. Koken (Marcel); J.H. Odijk; M. van Duin (Mark); M.W.J. Fornerod (Maarten); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractThis article presents the development of a set of new expression vectors for overproduction of proteins in Escherichia coli. The vectors, pETUBI-ES1, 2 and 3, allow in-frame cloning of any sequence with the ubiquitin gene driven by the strong T7f10 promoter. Combination of the T7

  2. Mutagenic DNA repair in enterobacteria

    International Nuclear Information System (INIS)

    Sedgwick, S.G.; Chao Ho; Woodgate, R.

    1991-01-01

    Sixteen species of enterobacteria have been screened for mutagenic DNA repair activity. In Escherichia coli, mutagenic DNA repair is encoded by the umuDC operon. Synthesis of UmuD and UmuC proteins is induced as part of the SOS response to DNA damage, and after induction, the UmuD protein undergoes an autocatalytic cleavage to produce the carboxy-terminal UmuD' fragment needed for induced mutagenesis. The presence of a similar system in other species was examined by using a combined approach of inducible-mutagenesis assays, cross-reactivity to E. coli UmuD and UmuD' antibodies to test for induction and cleavage of UmuD-like proteins, and hybridization with E. coli and Salmonella typhimurium u mu DNA probes to map umu-like genes. The results indicate a more widespread distribution of mutagenic DNA repair in other species than was previously thought. They also show that umu loci can be more complex in other species than in E. coli. Differences in UV-induced mutability of more than 200-fold were seen between different species of enteric bacteria and even between multiple natural isolates of E. coli, and yet some of the species which display a poorly mutable phenotype still have umu-like genes and proteins. It is suggested that umuDC genes can be curtailed in their mutagenic activities but that they may still participate in some other, unknown process which provides the continued stimulus for their retention

  3. DESIGN OF ELECTROPHORESIS DEVICE FOR OPTIMATION OF DNA VISUALIZATION AND DNA CONCENTRATION USING SOFTWARE

    Directory of Open Access Journals (Sweden)

    H.P. Kusumaningrum

    2014-07-01

    Full Text Available Molekul DNA menunjukkan polarisasi yang kuat sehingga memungkinkan baik gerak elektroforesis berdasarkan muatan negatifnya maupun gerak dielektroforesis berdasarkan induksi polarisasi. Perancangan alat menggunakan kombinasi prinsip elektroforesis dan dielektroforesis dilengkapi perangkat lunak untuk mengukur konsentrasinya sangat diperlukan. Utamanya mengingat uji kualitatif DNA berbasis visualisasi pada gel elektroforesis bersifat sangat subyektif dan kurang terukur. Pengukuran konsentrasi DNA menggunakan spektrofotometer UV/VIS sangat tergantung oleh ketersediaannya di laboratorium. Penelitian bertujuan untuk mendesain piranti untuk mengukur konsentrasi DNA berdasarkan visualisasinya pada gel elektroforesis menggunakan perangkat lunak berbasis MatLab. Pengukuran konsentrasi DNA didasarkan visualisasinya pada gel elektroforesis lalu dibandingkan dengan hasil penghitungan spektrofotometer UV/VIS. Hasil penelitian menggunakan piranti tersebut memperlihatkan visualisasi DNA yang lebih optimal. Hasil pengukuran jumlah DNA menggunakan spektrofotometer memiliki kecenderungan yang sama dengan hasil pengukuran menggunakan perangkat lunak berbasis MatLab meskipun terdapat perbedaan nilai kuantitatif.ABSTRACTMolecules of deoxyribo nucleic acid (DNA show a strong polarization allowing for both motions of the dielectrophoresis induced by polarization and electrophoresis based on its negative charge. Considering high subjective and less quantifiable result of the visualization based qualitative test of DNA on gel electrophoresis, designing the tool using a combination of the principles of electrophoresis and dielectrophoresis completed with a software for optimization of DNA visualization and to measure the concentration of small and large–sized DNA fragment is very needed. Accuracy of measurement of DNA concentration using a spectrophotometer UV /VIS is depend on its availability in the laboratory. The aim of this study was to design device for

  4. Salt-Dependent DNA-DNA Spacings in Intact Bacteriophage lambda Reflect Relative Importance of DNA Self-Repulsion and Bending Energies

    Energy Technology Data Exchange (ETDEWEB)

    X Qiu; D Rau; V Parsegian; L Fang; C Knobler; W Gelbart

    2011-12-31

    Using solution synchrotron x-ray scattering, we measure the variation of DNA-DNA d spacings in bacteriophage {lambda} with mono-, di-, and polyvalent salt concentrations, for wild-type [48.5 x 10{sup 3} base pairs (bp)] and short-genome-mutant (37.8 kbp) strains. From the decrease in d spacings with increasing salt, we deduce the relative contributions of DNA self-repulsion and bending to the energetics of packaged phage genomes. We quantify the DNA-DNA interaction energies within the intact phage by combining the measured d spacings in the capsid with measurements of osmotic pressure in DNA assemblies under the same salt conditions in bulk solution. In the commonly used Tris-Mg buffer, the DNA-DNA interaction energies inside the phage capsids are shown to be about 1 kT/bp, an order of magnitude larger than the bending energies.

  5. Combination Vaccines

    OpenAIRE

    Skibinski, David AG; Baudner, Barbara C; Singh, Manmohan; O’Hagan, Derek T

    2011-01-01

    The combination of diphtheria, tetanus, and pertussis vaccines into a single product has been central to the protection of the pediatric population over the past 50 years. The addition of inactivated polio, Haemophilus influenzae, and hepatitis B vaccines into the combination has facilitated the introduction of these vaccines into recommended immunization schedules by reducing the number of injections required and has therefore increased immunization compliance. However, the development of th...

  6. Enzyme-guided DNA Sewing Architecture

    Science.gov (United States)

    Song, In Hyun; Shin, Seung Won; Park, Kyung Soo; Lansac, Yves; Jang, Yun Hee; Um, Soong Ho

    2015-12-01

    With the advent of nanotechnology, a variety of nanoarchitectures with varied physicochemical properties have been designed. Owing to the unique characteristics, DNAs have been used as a functional building block for novel nanoarchitecture. In particular, a self-assembly of long DNA molecules via a piece DNA staple has been utilized to attain such constructs. However, it needs many talented prerequisites (e.g., complicated computer program) with fewer yields of products. In addition, it has many limitations to overcome: for instance, (i) thermal instability under moderate environments and (ii) restraint in size caused by the restricted length of scaffold strands. Alternatively, the enzymatic sewing linkage of short DNA blocks is simply designed into long DNA assemblies but it is more error-prone due to the undeveloped sequence data. Here, we present, for the first time, a comprehensive study for directly combining DNA structures into higher DNA sewing constructs through the 5‧-end cohesive ligation of T4 enzyme. Inspired by these achievements, the synthesized DNA nanomaterials were also utilized for effective detection and real-time diagnosis of cancer-specific and cytosolic RNA markers. This generalized protocol for generic DNA sewing is expected to be useful in several DNA nanotechnology as well as any nucleic acid-related fields.

  7. Kinetic mechanism of DNA polymerase I (Klenow)

    International Nuclear Information System (INIS)

    Kuchta, R.D.; Mizrahi, V.; Benkovic, P.A.; Johnson, K.A.; Benkovic, S.J.

    1987-01-01

    The minimal kinetic scheme for DNA polymerization catalyzed by the Klenow fragment of DNA polymerase I (KF) from Escherichia coli has been determined with short DNA oligomers of defined sequence, labeled with [ 32 P]-nucleotides. A key feature of this scheme is a minimal two-step sequence that interconverts the ternary KF-DNA/sub n/-dNTP and KF-DNA/sub n+1/-PP/sub i/ complexes. The rate is not limited by the actual polymerization but by a separate step, possibly important in ensuring fidelity. Evidence for this sequence is supplied by the observation of biphasic kinetics in single-turnover pyrophosphorolysis experiments (the microscopic reverse of polymerization). Data analysis then provides an estimate of the internal equilibrium constant. The dissociations of DNA, dNTP, and PP/sub i/ from the various binary and ternary complexes were measured by partitioning (isotope-trapping) experiments. The rate constant for DNA dissociation from KF is sequence dependent and is rate limiting during nonprocessive DNA synthesis. The combination of single-turnover (both directions) and isotope-trapping experiments provides sufficient information to permit a quantitative evaluation of the kinetic scheme for specific DNA sequences

  8. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior

    Science.gov (United States)

    Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.

    2016-01-01

    DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

  9. DNA Damage, DNA Repair, Aging, and Neurodegeneration

    Science.gov (United States)

    Maynard, Scott; Fang, Evandro Fei; Scheibye-Knudsen, Morten; Croteau, Deborah L.; Bohr, Vilhelm A.

    2015-01-01

    Aging in mammals is accompanied by a progressive atrophy of tissues and organs, and stochastic damage accumulation to the macromolecules DNA, RNA, proteins, and lipids. The sequence of the human genome represents our genetic blueprint, and accumulating evidence suggests that loss of genomic maintenance may causally contribute to aging. Distinct evidence for a role of imperfect DNA repair in aging is that several premature aging syndromes have underlying genetic DNA repair defects. Accumulation of DNA damage may be particularly prevalent in the central nervous system owing to the low DNA repair capacity in postmitotic brain tissue. It is generally believed that the cumulative effects of the deleterious changes that occur in aging, mostly after the reproductive phase, contribute to species-specific rates of aging. In addition to nuclear DNA damage contributions to aging, there is also abundant evidence for a causative link between mitochondrial DNA damage and the major phenotypes associated with aging. Understanding the mechanistic basis for the association of DNA damage and DNA repair with aging and age-related diseases, such as neurodegeneration, would give insight into contravening age-related diseases and promoting a healthy life span. PMID:26385091

  10. Instructing cells with programmable peptide DNA hybrids

    Science.gov (United States)

    Freeman, Ronit; Stephanopoulos, Nicholas; Álvarez, Zaida; Lewis, Jacob A; Sur, Shantanu; Serrano, Chris M; Boekhoven, Job; Lee, Sungsoo S.; Stupp, Samuel I.

    2017-01-01

    The native extracellular matrix is a space in which signals can be displayed dynamically and reversibly, positioned with nanoscale precision, and combined synergistically to control cell function. Here we describe a molecular system that can be programmed to control these three characteristics. In this approach we immobilize peptide-DNA (P-DNA) molecules on a surface through complementary DNA tethers directing cells to adhere and spread reversibly over multiple cycles. The DNA can also serve as a molecular ruler to control the distance-dependent synergy between two peptides. Finally, we use two orthogonal DNA handles to regulate two different bioactive signals, with the ability to independently up- or downregulate each over time. This enabled us to discover that neural stem cells, derived from the murine spinal cord and organized as neurospheres, can be triggered to migrate out in response to an exogenous signal but then regroup into a neurosphere as the signal is removed. PMID:28691701

  11. DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

    Science.gov (United States)

    Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

    2012-01-01

    DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

  12. Eupolybothrus cavernicolus Komerički & Stoev sp. n. (Chilopoda: Lithobiomorpha: Lithobiidae: the first eukaryotic species description combining transcriptomic, DNA barcoding and micro-CT imaging data

    Directory of Open Access Journals (Sweden)

    Pavel Stoev

    2016-10-01

    Full Text Available We demonstrate how a classical taxonomic description of a new species can be enhanced by applying new generation molecular methods, and novel computing and imaging technologies. A cave-dwelling centipede, Eupolybothrus cavernicolus Komerički & Stoev sp. n. (Chilopoda: Lithobiomorpha: Lithobiidae, found in a remote karst region in Knin, Croatia, is the first eukaryotic species for which, in addition to the traditional morphological description, we provide a fully sequenced transcriptome, a DNA barcode, detailed anatomical X-ray microtomography (micro-CT scans, and a movie of the living specimen to document important traits of its ex-situ behaviour. By employing micro-CT scanning in a new species for the first time, we create a high-resolution morphological and anatomical dataset that allows virtual reconstructions of the specimen and subsequent interactive manipulation to test the recently introduced ‘cybertype’ notion. In addition, the transcriptome was recorded with a total of 67,785 scaffolds, having an average length of 812 bp and N50 of 1,448 bp (see GigaDB. Subsequent annotation of 22,866 scaffolds was conducted by tracing homologs against current available databases, including Nr, SwissProt and COG. This pilot project illustrates a workflow of producing, storing, publishing and disseminating large data sets associated with a description of a new taxon. All data have been deposited in publicly accessible repositories, such as GigaScience GigaDB, NCBI, BOLD, Morphbank and Morphosource, and the respective open licenses used ensure their accessibility and re-usability.

  13. ex vivo DNA assembly

    Directory of Open Access Journals (Sweden)

    Adam B Fisher

    2013-10-01

    Full Text Available Even with decreasing DNA synthesis costs there remains a need for inexpensive, rapid and reliable methods for assembling synthetic DNA into larger constructs or combinatorial libraries. Advances in cloning techniques have resulted in powerful in vitro and in vivo assembly of DNA. However, monetary and time costs have limited these approaches. Here, we report an ex vivo DNA assembly method that uses cellular lysates derived from a commonly used laboratory strain of Escherichia coli for joining double-stranded DNA with short end homologies embedded within inexpensive primers. This method concurrently shortens the time and decreases costs associated with current DNA assembly methods.

  14. Regulation of DNA repair processes in mammalian cell

    International Nuclear Information System (INIS)

    Bil'din, V.N.; Sergina, T.B.; Zhestyanikov, V.D.

    1992-01-01

    A study was made of the repair of ionizing radiation-induced DNA single-strand breaks (SSB) in proliferating and quiescent mouse Swiss 3T6 cells and in those stimulated from the quiet status by epidermal growth factor in combination with insulin, in the presence of specific inhibitors of DNA polymerase α and β (aphidicolin) and DNA polymerase β (2', 3'-dideoxythjymidine-5'-triphosphate). The repair of DNA SSB induced by X-ray-irradiation (10 Gy) or by γ-ray irradiation (150 Gy) is more sensitive to aphidicolin and mitogen-simulated cells three times stronger than in proliferating cells. The influence of 2', 3'-dideoxythymidine-5'-triphosphate on the rate of DNA SSB repair in cells of all the three types does not differ. Thus, the decrease in DNA repair efficiency in quiescent cells is connected with a decrease in the activity of aphidicolin-sensitive DNA polymerase, apparently DNA polymerase α

  15. DNA damage and autophagy

    International Nuclear Information System (INIS)

    Rodriguez-Rocha, Humberto; Garcia-Garcia, Aracely; Panayiotidis, Mihalis I.; Franco, Rodrigo

    2011-01-01

    Both exogenous and endogenous agents are a threat to DNA integrity. Exogenous environmental agents such as ultraviolet (UV) and ionizing radiation, genotoxic chemicals and endogenous byproducts of metabolism including reactive oxygen species can cause alterations in DNA structure (DNA damage). Unrepaired DNA damage has been linked to a variety of human disorders including cancer and neurodegenerative disease. Thus, efficient mechanisms to detect DNA lesions, signal their presence and promote their repair have been evolved in cells. If DNA is effectively repaired, DNA damage response is inactivated and normal cell functioning resumes. In contrast, when DNA lesions cannot be removed, chronic DNA damage triggers specific cell responses such as cell death and senescence. Recently, DNA damage has been shown to induce autophagy, a cellular catabolic process that maintains a balance between synthesis, degradation, and recycling of cellular components. But the exact mechanisms by which DNA damage triggers autophagy are unclear. More importantly, the role of autophagy in the DNA damage response and cellular fate is unknown. In this review we analyze evidence that supports a role for autophagy as an integral part of the DNA damage response.

  16. Electrokinetic acceleration of DNA hybridization in microsystems.

    Science.gov (United States)

    Lei, Kin Fong; Wang, Yun-Hsiang; Chen, Huai-Yi; Sun, Jia-Hong; Cheng, Ji-Yen

    2015-06-01

    In this work, electrokinetic acceleration of DNA hybridization was investigated by different combinations of frequencies and amplitudes of actuating electric signals. Because the frequencies from low to high can induce different kinds of electrokinetic forces, i.e., electroosmotic to electrothermal forces, this work provides an in-depth investigation of electrokinetic enhanced hybridization. Concentric circular Cr/Au microelectrodes of 350 µm in diameter were fabricated on a glass substrate and probe DNA was immobilized on the electrode surface. Target DNA labeled with fluorescent dyes suspending in solution was then applied to the electrode. Different electrokinetic forces were induced by the application of different electric signals to the circular microelectrodes. Local microfluidic vortexes were generated to increase the collision efficiency between the target DNA suspending in solution and probe DNA immobilized on the electrode surface. DNA hybridization on the electrode surface could be accelerated by the electrokinetic forces. The level of hybridization was represented by the fluorescent signal intensity ratio. Results revealed that such 5-min dynamic hybridization increased 4.5 fold of signal intensity ratio as compared to a 1-h static hybridization. Moreover, dynamic hybridization was found to have better differentiation ability between specific and non-specific target DNA. This study provides a strategy to accelerate DNA hybridization in microsystems. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Subcloning of DNA fragments.

    Science.gov (United States)

    Struhl, K

    2001-05-01

    The essence of recombinant DNA technology is the joining of two or more separate segments of DNA to generate a single DNA molecule that is capable of autonomous replication in a given host. The simplest constructions of hybrid DNA molecules involve the cloning of insert sequences into plasmid or bacteriophage cloning vectors. The insert sequences can derive from essentially any organism, and they may be isolated directly from the genome, from mRNA, or from previously cloned DNA segments (in which case, the procedure is termed subcloning). Alternatively, insert DNAs can be created directly by DNA synthesis. This unit provides protocols for the subcloning of DNA fragments and ligation of DNA fragments in gels.

  18. DNA tagged microparticles

    Science.gov (United States)

    Farquar, George Roy; Leif, Roald N; Wheeler, Elizabeth

    2015-05-05

    A simulant that includes a carrier and DNA encapsulated in the carrier. Also a method of making a simulant including the steps of providing a carrier and encapsulating DNA in the carrier to produce the simulant.

  19. DNA computing models

    CERN Document Server

    Ignatova, Zoya; Zimmermann, Karl-Heinz

    2008-01-01

    In this excellent text, the reader is given a comprehensive introduction to the field of DNA computing. The book emphasizes computational methods to tackle central problems of DNA computing, such as controlling living cells, building patterns, and generating nanomachines.

  20. DNA Repair Systems

    Indian Academy of Sciences (India)

    exogenous damage). Endogenous damage ... of spontaneous DNA-damage due to endogenous factors. He es- timated that around 10,000 potentially mutagenic .... 3 –5 direction is defined as. 'upstream'. A single DNA strand is synthesized in a.

  1. Preparation of Phi29 DNA Polymerase Free of Amplifiable DNA Using Ethidium Monoazide, an Ultraviolet-Free Light-Emitting Diode Lamp and Trehalose

    Science.gov (United States)

    Takahashi, Hirokazu; Yamazaki, Hiroyuki; Akanuma, Satoshi; Kanahara, Hiroko; Saito, Toshiyuki; Chimuro, Tomoyuki; Kobayashi, Takayoshi; Ohtani, Toshio; Yamamoto, Kimiko; Sugiyama, Shigeru; Kobori, Toshiro

    2014-01-01

    We previously reported that multiply-primed rolling circle amplification (MRPCA) using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3′-5′ exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents. PMID:24505243

  2. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

    Directory of Open Access Journals (Sweden)

    Hirokazu Takahashi

    Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

  3. Combined homicide

    Directory of Open Access Journals (Sweden)

    Slović Živana

    2017-01-01

    Full Text Available Introduction: Combined homicide is a combination of two or more different modes of killing. These homicides occur when multiple perpetrators have different mode of killing, to hide the true manner of death, or when an initially unsuccessful attack with one weapon is abandoned and changed by another mode which is more successful, or due to availability of weapons at the scene of homicide, or unexpected appearance of possible eyewitness, or else. Case report: This case report is about 65-year old woman who was found in her residence on the floor next to the bed lying on her back with two kitchen knives in her neck. Autopsy revealed an abrasion on the frontal part of the neck and a bruise of the soft tissues of the neck with a double fracture of both greater horns of the hyoid bone and a fracture of both superior horns of the thyroid cartilage. The cause of death was exsanguination into right half of the thoracic cavity from the left subclavian artery which was cut, on the spot of stab wound in the neck. Conclusion: Hemorrhage in the soft tissue near broken hyoid bone and thyroid cartilage indicate that the victim was first strangulated and then stabbed with kitchen knives. Combined homicides are caused by one or more killers in order to accelerate the killing, or to be sure to provide the fatal outcome. This case is also interesting because the killer left weapon in the victim's neck.

  4. Periodicity of DNA in exons

    Directory of Open Access Journals (Sweden)

    Kinghorn Brian

    2004-08-01

    Full Text Available Abstract Background The periodic pattern of DNA in exons is a known phenomenon. It was suggested that one of the initial causes of periodicity could be the universal (RNYnpattern (R = A or G, Y = C or U, N = any base of ancient RNA. Two major questions were addressed in this paper. Firstly, the cause of DNA periodicity, which was investigated by comparisons between real and simulated coding sequences. Secondly, quantification of DNA periodicity was made using an evolutionary algorithm, which was not previously used for such purposes. Results We have shown that simulated coding sequences, which were composed using codon usage frequencies only, demonstrate DNA periodicity very similar to the observed in real exons. It was also found that DNA periodicity disappears in the simulated sequences, when the frequencies of codons become equal. Frequencies of the nucleotides (and the dinucleotide AG at each location along phase 0 exons were calculated for C. elegans, D. melanogaster and H. sapiens. Two models were used to fit these data, with the key objective of describing periodicity. Both of the models showed that the best-fit curves closely matched the actual data points. The first dynamic period determination model consistently generated a value, which was very close to the period equal to 3 nucleotides. The second fixed period model, as expected, kept the period exactly equal to 3 and did not detract from its goodness of fit. Conclusions Conclusion can be drawn that DNA periodicity in exons is determined by codon usage frequencies. It is essential to differentiate between DNA periodicity itself, and the length of the period equal to 3. Periodicity itself is a result of certain combinations of codons with different frequencies typical for a species. The length of period equal to 3, instead, is caused by the triplet nature of genetic code. The models and evolutionary algorithm used for characterising DNA periodicity are proven to be an effective tool

  5. Animal Mitochondrial DNA Replication

    Science.gov (United States)

    Ciesielski, Grzegorz L.; Oliveira, Marcos T.; Kaguni, Laurie S.

    2016-01-01

    Recent advances in the field of mitochondrial DNA (mtDNA) replication highlight the diversity of both the mechanisms utilized and the structural and functional organization of the proteins at mtDNA replication fork, despite the simplicity of the animal mtDNA genome. DNA polymerase γ, mtDNA helicase and mitochondrial single-stranded DNA-binding protein- the key replisome proteins, have evolved distinct structural features and biochemical properties. These appear to be correlated with mtDNA genomic features in different metazoan taxa and with their modes of DNA replication, although a substantial integrative research is warranted to establish firmly these links. To date, several modes of mtDNA replication have been described for animals: rolling circle, theta, strand-displacement, and RITOLS/bootlace. Resolution of a continuing controversy relevant to mtDNA replication in mammals/vertebrates will have a direct impact on the mechanistic interpretation of mtDNA-related human diseases. Here we review these subjects, integrating earlier and recent data to provide a perspective on the major challenges for future research. PMID:27241933

  6. Replicating animal mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Emily A. McKinney

    2013-01-01

    Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.

  7. DNA barcoding of vouchered xylarium wood specimens of nine endangered Dalbergia species

    Science.gov (United States)

    Min Yu; Lichao Jiao; Juan Guo; Alex C. Wiedenhoeft; Tuo He; Xiaomei Jiang; Yafang Yin

    2017-01-01

    ITS2+trnH-psbA was the best combination of DNA barcode to resolve the Dalbergia wood species studied. We demonstrate the feasibility of building a DNA barcode reference database using xylarium wood specimens.

  8. Eukaryotic transcriptomics in silico: Optimizing cDNA-AFLP efficiency

    Directory of Open Access Journals (Sweden)

    Wüst Christian

    2009-11-01

    Full Text Available Abstract Background Complementary-DNA based amplified fragment length polymorphism (cDNA-AFLP is a commonly used tool for assessing the genetic regulation of traits through the correlation of trait expression with cDNA expression profiles. In spite of the frequent application of this method, studies on the optimization of the cDNA-AFLP assay design are rare and have typically been taxonomically restricted. Here, we model cDNA-AFLPs on all 92 eukaryotic species for which cDNA pools are currently available, using all combinations of eight restriction enzymes standard in cDNA-AFLP screens. Results In silco simulations reveal that cDNA pool coverage is largely determined by the choice of individual restriction enzymes and that, through the choice of optimal enzyme combinations, coverage can be increased from Conclusion The insights gained from in silico screening of cDNA-AFLPs from a broad sampling of eukaryotes provide a set of guidelines that should help to substantially increase the efficiency of future cDNA-AFLP experiments in eukaryotes. In silico simulations also suggest a novel use of cDNA-AFLP screens to determine the number of transcripts expressed in a target tissue, an application that should be invaluable as next-generation sequencing technologies are adapted for differential display.

  9. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...... for a long period of time before its information is accessed by the cell. Although DNA plays a critical role as an informational storage molecule, it is by no means as unexciting as a computer tape or disk drive. The structure of the DNA described by Watson and Crick in 1953 is a right handed helix of two...

  10. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  11. DNA Sequencing apparatus

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1992-01-01

    An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

  12. Electrochemical DNA biosensor for detection of DNA damage induced by hydroxyl radicals.

    Science.gov (United States)

    Hájková, Andrea; Barek, Jiří; Vyskočil, Vlastimil

    2017-08-01

    A simple electrochemical DNA biosensor based on a glassy carbon electrode (GCE) was prepared by adsorbing double-stranded DNA (dsDNA) onto the GCE surface and subsequently used for the detection of dsDNA damage induced by hydroxyl radicals. Investigation of the mutual interaction between hydroxyl radicals and dsDNA was conducted using a combination of several electrochemical detection techniques: square-wave voltammetry for direct monitoring the oxidation of dsDNA bases, and cyclic voltammetry and electrochemical impedance spectroscopy as indirect electrochemical methods making use of the redox-active indicator [Fe(CN) 6 ] 4-/3- . Hydroxyl radicals were generated electrochemically on the surface of a boron-doped diamond electrode and chemically (via the Fenton's reaction or the auto-oxidation of Fe(II)). The extent of dsDNA damage by electrochemically generated hydroxyl radicals depended on the current density applied to the generating electrode: by applying 5, 10, and 50mAcm -2 , selected relative biosensor responses decreased after 3min incubation from 100% to 38%, 27%, and 3%, respectively. Chemically generated hydroxyl radicals caused less pronounced dsDNA damage, and their damaging activity depended on the form of Fe(II) ions: decreases to 49% (Fenton's reaction; Fe(II) complexed with EDTA) and 33% (auto-oxidation of Fe(II); Fe(II) complexed with dsDNA) were observed after 10min incubation. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

    Science.gov (United States)

    Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

    2016-05-19

    Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

  14. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning.

    Science.gov (United States)

    Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L

    2016-10-31

    Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  15. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning

    Directory of Open Access Journals (Sweden)

    Masudur Rahman

    2016-10-01

    Full Text Available Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  16. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  17. Biophysics of DNA

    CERN Document Server

    Vologodskii, Alexander

    2015-01-01

    Surveying the last sixty years of research, this book describes the physical properties of DNA in the context of its biological functioning. It is designed to enable both students and researchers of molecular biology, biochemistry and physics to better understand the biophysics of DNA, addressing key questions and facilitating further research. The chapters integrate theoretical and experimental approaches, emphasising throughout the importance of a quantitative knowledge of physical properties in building and analysing models of DNA functioning. For example, the book shows how the relationship between DNA mechanical properties and the sequence specificity of DNA-protein binding can be analyzed quantitatively by using our current knowledge of the physical and structural properties of DNA. Theoretical models and experimental methods in the field are critically considered to enable the reader to engage effectively with the current scientific literature on the physical properties of DNA.

  18. Design and Assembly of DNA Nano-Objects and 2D DNA Origami Arrays

    Science.gov (United States)

    Liu, Wenyan

    DNA, which plays a central role in biology as the carrier of genetic information, is also an excellent candidate for structural nanotechnology. Researches have proven that a variety of complicated DNA assemblies, such as objects, 2D & 3D crystals, and nanomechanical devices, can be fabricated through the combination of robust branched DNA motifs and sticky ends. This dissertation focuses on the design and construction of DNA nano--objects and 2D DNA origami arrays. In this dissertation, we first describe the formation of a triangular species that has four strands per edge, held together by PX interactions. We demonstrate by nondenaturing gel electrophoresis and by atomic force microscopy (AFM) that we can combine a partial triangle with other strands to form a robust four--stranded molecule. By combining them with a novel three--domain molecule, we also demonstrate by AFM that these triangles can be self--assembled into a linear array. Second, we demonstrate our attempts to design and self--assemble 2D DNA origami arrays using several different strategies. Specifically, we introduce the self--assembly of 2D DNA origami lattices using a symmetric cross--like design. This design strategy resulted in a well--ordered woven latticework array with edge dimensions of 2--3 mum. This size is likely to be large enough to connect bottom-up methods of patterning with top--down approaches. Third, we illustrate the design and construction of DNA nano--objects for exploring the substrate preferences of topoisomerase (topo) II. We designed and fabricated four double rhombus--like DNA molecules, each of which contains a different conformation of crossover in the middle, as possible substrates to establish the structural preferences for topo II. We characterized the formation of each substrate molecule by gel electrophoresis. Finally, we study the effect of M13 DNA knotting on the formation of the DNA origami tiles. We demonstrate by atomic force microscopy (AFM) that knotted M13

  19. Radiation damage to DNA constituents

    International Nuclear Information System (INIS)

    Bergene, R.

    1977-01-01

    The molecular changes of the DNA molecule, in various systems exposed to inoizing radiation, have been the subject of a great number of studies. In the present work electron spin resonance spectroscopy (ESR) has been applied to irradiated crystalline systems, in particular single crystals of DNA subunits and their derivatives. The main conclusions about the molecular damage are based on this technique in combination with molecular orbital calculations. It should be emphasized that the ESR technique is restricted to damage containing unpaired electrons. These unstable intermediates called free radicals seem, however, to be involved in all molecular models describing the action of radiation on DNA. One of the premises for a detailed theory of the radiation induced reactions at the physico-chemical level seems to involve exact knowledge of the induced free radicals as well as the modes of their formation and fate. For DNA, as such, it is hardly possible to arrive at such a level of knowledge since the molecular complexity prevents selective studies of the many different radiation induced products. One possible approach is to study the free radicals formed in the constituents of DNA. In the present work three lines of approach should be mentioned. The first is based on the observation that radical formation in general causes only minor structural alterations to the molecule in question. The use of isotopes with different spin and magnetic moment (in particular deuterium) may also serve a source of information. Deuteration leads to a number of protons, mainly NH - and OH, becoming substituted, and if any of these are involved in interactions with unpaired protons the resonance pattern is influeneed. The third source of information is molecular orbital calculation. The electron spin density distribution is a function in the three dimensional space based on the system's electronic wave functions. This constitutes the basis for the idea that ESR data can be correlated with

  20. Oxidation of DNA: damage to nucleobases.

    Science.gov (United States)

    Kanvah, Sriram; Joseph, Joshy; Schuster, Gary B; Barnett, Robert N; Cleveland, Charles L; Landman, Uzi

    2010-02-16

    All organisms store the information necessary to maintain life in their DNA. Any process that damages DNA, causing a loss or corruption of that information, jeopardizes the viability of the organism. One-electron oxidation is such a process. In this Account, we address three of the central features of one-electron oxidation of DNA: (i) the migration of the radical cation away from the site of its formation; (ii) the electronic and structural factors that determine the nucleobases at which irreversible reactions most readily occur; (iii) the mechanism of reaction for nucleobase radical cations. The loss of an electron (ionization) from DNA generates an electron "hole" (a radical cation), located most often on its nucleobases, that migrates reversibly through duplex DNA by hopping until it is trapped in an irreversible chemical reaction. The particular sequence of nucleobases in a DNA oligomer determines both the efficiency of hopping and the specific location and nature of the damaging chemical reaction. In aqueous solution, DNA is a polyanion because of the negative charge carried by its phosphate groups. Counterions to the phosphate groups (typically Na(+)) play an important role in facilitating both hopping and the eventual reaction of the radical cation with H(2)O. Irreversible reaction of a radical cation with H(2)O in duplex DNA occurs preferentially at the most reactive site. In normal DNA, comprising the four common DNA nucleobases G, C, A, and T, reaction occurs most commonly at a guanine, resulting in its conversion primarily to 8-oxo-7,8-dihydroguanine (8-OxoG). Both electronic and steric effects control the outcome of this process. If the DNA oligomer does not contain a suitable guanine, then reaction of the radical cation occurs at the thymine of a TT step, primarily by a tandem process. The oxidative damage of DNA is a complex process, influenced by charge transport and reactions that are controlled by a combination of enthalpic, entropic, steric, and

  1. T3: Targeted Proteomics of DNA-Binding Proteins

    OpenAIRE

    Nagore, Linda I.; Jarrett, Harry W.

    2015-01-01

    A technique that allows the inclusion of a specific DNA to enrich and direct proteomic identification of transcription factors (TF) while providing a route for high throughput screening on a single platform would be valuable in investigations of gene expression and regulation. Polyvinylpyrrolidone binds DNA avidly while binding negligible amounts of protein. This observation is used in a proof-of-concept method to enrich for TF by combining nuclear extract with a specific DNA sequence and imm...

  2. Multiplexed Sequence Encoding: A Framework for DNA Communication

    Science.gov (United States)

    Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

    2016-01-01

    Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

  3. DNA-nanostructure-assembly by sequential spotting

    Directory of Open Access Journals (Sweden)

    Breitenstein Michael

    2011-11-01

    Full Text Available Abstract Background The ability to create nanostructures with biomolecules is one of the key elements in nanobiotechnology. One of the problems is the expensive and mostly custom made equipment which is needed for their development. We intended to reduce material costs and aimed at miniaturization of the necessary tools that are essential for nanofabrication. Thus we combined the capabilities of molecular ink lithography with DNA-self-assembling capabilities to arrange DNA in an independent array which allows addressing molecules in nanoscale dimensions. Results For the construction of DNA based nanostructures a method is presented that allows an arrangement of DNA strands in such a way that they can form a grid that only depends on the spotted pattern of the anchor molecules. An atomic force microscope (AFM has been used for molecular ink lithography to generate small spots. The sequential spotting process allows the immobilization of several different functional biomolecules with a single AFM-tip. This grid which delivers specific addresses for the prepared DNA-strand serves as a two-dimensional anchor to arrange the sequence according to the pattern. Once the DNA-nanoarray has been formed, it can be functionalized by PNA (peptide nucleic acid to incorporate advanced structures. Conclusions The production of DNA-nanoarrays is a promising task for nanobiotechnology. The described method allows convenient and low cost preparation of nanoarrays. PNA can be used for complex functionalization purposes as well as a structural element.

  4. Targeting DNA Replication Stress for Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Jun Zhang

    2016-08-01

    Full Text Available The human cellular genome is under constant stress from extrinsic and intrinsic factors, which can lead to DNA damage and defective replication. In normal cells, DNA damage response (DDR mediated by various checkpoints will either activate the DNA repair system or induce cellular apoptosis/senescence, therefore maintaining overall genomic integrity. Cancer cells, however, due to constitutive growth signaling and defective DDR, may exhibit “replication stress” —a phenomenon unique to cancer cells that is described as the perturbation of error-free DNA replication and slow-down of DNA synthesis. Although replication stress has been proven to induce genomic instability and tumorigenesis, recent studies have counterintuitively shown that enhancing replicative stress through further loosening of the remaining checkpoints in cancer cells to induce their catastrophic failure of proliferation may provide an alternative therapeutic approach. In this review, we discuss the rationale to enhance replicative stress in cancer cells, past approaches using traditional radiation and chemotherapy, and emerging approaches targeting the signaling cascades induced by DNA damage. We also summarize current clinical trials exploring these strategies and propose future research directions including the use of combination therapies, and the identification of potential new targets and biomarkers to track and predict treatment responses to targeting DNA replication stress.

  5. DNA hydration studied by neutron fiber diffraction

    International Nuclear Information System (INIS)

    Fuller, W.; Forsyth, V.T.; Mahendrasingam, A.; Langan, P.; Pigram, W.J.

    1994-01-01

    The development of neutron high angle fiber diffraction to investigate the location of water around the deoxyribonucleic acid (DNA) double-helix is described. The power of the technique is illustrated by its application to the D and A conformations of DNA using the single crystal diffractometer, D19, at the Institute Laue-Langevin, Grenoble and the time of flight diffractometer, SXD, at the Rutherford Appleton ISIS Spallation Neutron Source. These studies show the existence of bound water closely associated with the DNA. The patterns of hydration in these two DNA conformations are quite distinct and are compared to those observed in X-ray single crystal studies of two-stranded oligodeoxynucleotides. Information on the location of water around the DNA double-helix from the neutron fiber diffraction studies is combined with that on the location of alkali metal cations from complementary X-ray high angle fiber diffraction studies at the Daresbury Laboratory SRS using synchrotron radiation. These analyses emphasize the importance of viewing DNA, water and ions as a single system with specific interactions between the three components and provide a basis for understanding the effect of changes in the concentration of water and ions in inducing conformations] transitions in the DNA double-helix

  6. Paleo-Environmental Reconstruction Using Ancient DNA

    DEFF Research Database (Denmark)

    Pedersen, Mikkel Winther

    The aim of this thesis has been to investigate and expand the methodology and applicability for using ancient DNA deposited in lake sediments to detect and determine its genetic sources for paleo-environmental reconstruction. The aim was furthermore to put this tool into an applicable context...... research on ancient and modern environmental DNA (Paper 1), secondly by setting up a comparative study (Paper 2) to investigate how an ancient plant DNA (mini)-barcode can reflect other traditional methods (e.g. pollen and macrofossils) for reconstructing floristic history. In prolongation of the results...... obtained in paper 2 we developed a holistic metagenomic method combined with shotgun sequencing of ancient DNA in lake sediment samples to reconstruct organismal assemblages in addition to the flora e.g. micro-, meso- and megafauna, fungi and microbial communities (Paper 3). Fundamental processes were...

  7. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.

    2011-01-01

    Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano......Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ...... a method to determining DNA size. The results of this work prove that the developed fabrication process is a good alternative for the fabrication of single molecule DNA biochips and it allows developing a variety of innovative bio/chemical sensors based on single-molecule DNA sequencing devices....

  8. DNA nanotechnology from the test tube to the cell.

    Science.gov (United States)

    Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A; Seelig, Georg

    2015-09-01

    The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology - applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems - lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

  9. DNA nanotechnology from the test tube to the cell

    Science.gov (United States)

    Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A.; Seelig, Georg

    2015-09-01

    The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology -- applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems -- lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

  10. Geant4-DNA: overview and recent developments

    Science.gov (United States)

    Štěpán, Václav

    Space travel and high altitude flights are inherently associated with prolonged exposure to cosmic and solar radiation. Understanding and simulation of radiation action on cellular and subcellular level contributes to precise assessment of the associated health risks and remains a challenge of today’s radiobiology research. The Geant4-DNA project (http://geant4-dna.org) aims at developing an experimentally validated simulation platform for modelling of the damage induced by ionizing radiation at DNA level. The platform is based on the Geant4 Monte Carlo simulation toolkit. This project extends specific functionalities of Geant4 in following areas: The step-by-step single scattering modelling of elementary physical interactions of electrons, protons, alpha particles and light ions with liquid water and DNA bases, for the so-called “physical” stage. The modelling of the “physico-chemical and chemical” stages corresponding to the production, the diffusion, the chemical reactions occurring between chemical species produced by water radiolysis, and to the radical attack on the biological targets. Physical and chemical stage simulations are combined with biological target models on several scales, from DNA double helix, through nucleosome, to chromatin segments and cell geometries. In addition, data mining clustering algorithms have been developed and optimised for the purpose of DNA damage scoring in simulated tracks. Experimental measurements on pBR322 plasmid DNA are being carried out in order to validate the Geant4-DNA models. The plasmid DNA has been irradiated in dry conditions by protons with energies from 100 keV to 30 MeV and in aqueous conditions, with and without scavengers, by 30 MeV protons, 290 MeV/u carbon and 500 MeV/u iron ions. Agarose gel electrophoresis combined with enzymatic treatment has been used to measure the resulting DNA damage. An overview of the developments undertaken by the Geant4-DNA collaboration including a description of

  11. Evaluation of Filtration and DNA Extraction Methods for Environmental DNA Biodiversity Assessments across Multiple Trophic Levels

    Directory of Open Access Journals (Sweden)

    Anni Djurhuus

    2017-10-01

    Full Text Available Metabarcoding of marine environmental DNA (eDNA, originating from tissue, cells, or extracellular DNA, offers the opportunity to survey the biological composition of communities across multiple trophic levels from a non-invasive seawater sample. Here we compare results of eDNA metabarcoding of multiple trophic levels from individual seawater samples collected from a kelp forest in Monterey Bay, California in order to establish methods for future cross-trophic level eDNA analysis. Triplicate 1 L water samples were filtered using five different 47 mm diameter membrane filters (PVDF, PES, GFF, PCTE, and NC and DNA was extracted from triplicates of each filter-type using three widely-used extraction methods (the DNeasy Blood and Tissue kit, the MoBio PowerWater DNA Isolation kit, and standard phenol/chloroform methods resulting in 45 individual eDNA samples prepared with 15 workflow combinations. Each DNA extract was amplified using PCR primers for the 16S rRNA gene (microorganisms; Bacteria and Archaea, 18S rRNA gene (phytoplankton, and the 12S rRNA gene (vertebrates, and PCR products were sequenced on an Illumina MiSeq platform. The richness and community composition of microbial, phytoplankton, and vertebrate OTUs were not significantly different between any of the 0.2 μm pore-size filter types extracted with the DNeasy or MoBio kits. However, phenol/chloroform extraction resulted in significantly different community structures. This study provides insight into multiple choices for extraction and filtration methods to use eDNA metabarcoding for biodiversity assessment of multiple trophic levels from a single sample. We recommend any combination of either DNeasy or MoBio with PES, PCTE, PVDF, or NC filters for a cross trophic level comparison.

  12. Detection and characterization of 1,2-dibromoethane-derived DNA crosslinks formed with O(6) -alkylguanine-DNA alkyltransferase.

    Science.gov (United States)

    Chowdhury, Goutam; Cho, Sung-Hee; Pegg, Anthony E; Guengerich, F Peter

    2013-12-02

    A combination of chemical modifications and LC-tandem MS was used for the structure elucidation of various ethylene crosslinks of DNA with O(6) -alkylguanine-DNA alkyltransferase (AGT, see picture). The elucidation of the chemical structures of such DNA-protein crosslinks is necessary to understand mechanisms of mutagenesis. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Beyond DNA repair: DNA-PK function in cancer

    OpenAIRE

    Goodwin, Jonathan F.; Knudsen, Karen E.

    2014-01-01

    The DNA-dependent protein kinase (DNA-PK) is a pivotal component of the DNA repair machinery that governs the response to DNA damage, serving to maintain genome integrity. However, the DNA-PK kinase component was initially isolated with transcriptional complexes, and recent findings have illuminated the impact of DNA-PK-mediated transcriptional regulation on tumor progression and therapeutic response. DNA-PK expression has also been correlated with poor outcome in selected tumor types, furthe...

  14. A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly

    Science.gov (United States)

    Godonoga, Maia; Lin, Ting-Yu; Oshima, Azusa; Sumitomo, Koji; Tang, Marco S. L.; Cheung, Yee-Wai; Kinghorn, Andrew B.; Dirkzwager, Roderick M.; Zhou, Cunshan; Kuzuya, Akinori; Tanner, Julian A.; Heddle, Jonathan G.

    2016-01-01

    DNA aptamers have potential for disease diagnosis and as therapeutics, particularly when interfaced with programmable molecular technology. Here we have combined DNA aptamers specific for the malaria biomarker Plasmodium falciparum lactate dehydrogenase (PfLDH) with a DNA origami scaffold. Twelve aptamers that recognise PfLDH were integrated into a rectangular DNA origami and atomic force microscopy demonstrated that the incorporated aptamers preserve their ability to specifically bind target protein. Captured PfLDH retained enzymatic activity and protein-aptamer binding was observed dynamically using high-speed AFM. This work demonstrates the ability of DNA aptamers to recognise a malaria biomarker whilst being integrated within a supramolecular DNA scaffold, opening new possibilities for malaria diagnostic approaches based on DNA nanotechnology. PMID:26891622

  15. Detection of DNA damage by comet fluorescence in situ hybridization.

    Science.gov (United States)

    Schlörmann, Wiebke; Glei, Michael

    2012-01-01

    Comet fluorescence in situ hybridization (Comet-FISH) is a useful method to detect overall and region-specific DNA damage in individual cells. Two well-established methods are combined, the Comet assay (single cell gel electrophoresis) and fluorescence in situ hybridization (FISH). The Comet assay is the method of choice for the detection of DNA damage. With the alkaline version the influence of specific substances such as water pollutants or ingredients of food on individual cells can be easily measured. The Comet assay involves the embedding of cells in agarose on microscopic slides, lysis of cells, and separation of DNA via electrophoresis. Damaged DNA migrates from the nucleus (head of the comet) forming a tail. The percentage of DNA in the tail correlates with the degree of DNA strand breaks (DNA damage). The combination of FISH with the Comet assay uses labeled probes which hybridize specifically to selected DNA sequences. This allows the detection of specific DNA damage or repair capacity in single cells. Here we present exemplarily the Comet-FISH method by detection of DNA damage using hydrogen peroxide as a genotoxic model substrate.

  16. Natural history of eukaryotic DNA methylation systems.

    Science.gov (United States)

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2011-01-01

    Methylation of cytosines and adenines in DNA is a widespread epigenetic mark in both prokaryotes and eukaryotes. In eukaryotes, it has a profound influence on chromatin structure and dynamics. Recent advances in genomics and biochemistry have considerably elucidated the functions and provenance of these DNA modifications. DNA methylases appear to have emerged first in bacterial restriction-modification (R-M) systems from ancient RNA-modifying enzymes, in transitions that involved acquisition of novel catalytic residues and DNA-recognition features. DNA adenine methylases appear to have been acquired by ciliates, heterolobosean amoeboflagellates, and certain chlorophyte algae. Six distinct clades of cytosine methylases, including the DNMT1, DNMT2, and DNMT3 clades, were acquired by eukaryotes through independent lateral transfer of their precursors from bacteria or bacteriophages. In addition to these, multiple adenine and cytosine methylases were acquired by several families of eukaryotic transposons. In eukaryotes, the DNA-methylase module was often combined with distinct modified and unmodified peptide recognition domains and other modules mediating specialized interactions, for example, the RFD module of DNMT1 which contains a permuted Sm domain linked to a helix-turn-helix domain. In eukaryotes, the evolution of DNA methylases appears to have proceeded in parallel to the elaboration of histone-modifying enzymes and the RNAi system, with functions related to counter-viral and counter-transposon defense, and regulation of DNA repair and differential gene expression being their primary ancestral functions. Diverse DNA demethylation systems that utilize base-excision repair via DNA glycosylases and cytosine deaminases appear to have emerged in multiple eukaryotic lineages. Comparative genomics suggests that the link between cytosine methylation and DNA glycosylases probably emerged first in a novel R-M system in bacteria. Recent studies suggest that the 5mC is not

  17. Epigenetics: Making your mark on DNA

    Science.gov (United States)

    Harada, Bryan T.; He, Chuan

    2017-11-01

    Understanding the biological roles of modifications to DNA, RNA and proteins is critical to revealing how cells regulate gene expression in development and disease. Two papers now present a combination of new tools and discoveries that could enable biologists and chemical biologists to better study epigenetic regulation in mammals.

  18. DNA Electrical Overstress - Hardness Assurance Data Volume.

    Science.gov (United States)

    1980-07-28

    following sections provide a brief overview of the program and the goals of the experimental work. The DNA electrical overstress phenomenology program...by a combination of the parasitic capacitance and inductance in the pulser circuit and some instability of the impe- dance in the device under test

  19. DNA Methylation Alterations in Breast Cancer

    National Research Council Canada - National Science Library

    Yamamoto, Fumiichiro

    2000-01-01

    .... We performed NotI-MseI MS-AFLP using clinical specimens of normal and tumor breast DNA. We used both combinations of four NotI and four MseI primers with an additional selective residue at the 3' end (4x4 format...

  20. DNA replication and cancer

    DEFF Research Database (Denmark)

    Boyer, Anne-Sophie; Walter, David; Sørensen, Claus Storgaard

    2016-01-01

    A dividing cell has to duplicate its DNA precisely once during the cell cycle to preserve genome integrity avoiding the accumulation of genetic aberrations that promote diseases such as cancer. A large number of endogenous impacts can challenge DNA replication and cells harbor a battery of pathways...... to promote genome integrity during DNA replication. This includes suppressing new replication origin firing, stabilization of replicating forks, and the safe restart of forks to prevent any loss of genetic information. Here, we describe mechanisms by which oncogenes can interfere with DNA replication thereby...... causing DNA replication stress and genome instability. Further, we describe cellular and systemic responses to these insults with a focus on DNA replication restart pathways. Finally, we discuss the therapeutic potential of exploiting intrinsic replicative stress in cancer cells for targeted therapy....

  1. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    Science.gov (United States)

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  2. DNA repair and cancer

    International Nuclear Information System (INIS)

    Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha

    2012-01-01

    DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

  3. DNA-based machines.

    Science.gov (United States)

    Wang, Fuan; Willner, Bilha; Willner, Itamar

    2014-01-01

    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

  4. MITOCHONDRIAL DNA- REVOLUTIONARY EVOLUTION

    Directory of Open Access Journals (Sweden)

    Vaidhehi Narayan Nayak

    2017-07-01

    Full Text Available BACKGROUND Mitochondrion, the sausage-shaped organelle residing in the cytoplasm of all eukaryotic cells, apart from being the power house, represents endosymbiotic evolution of a free living organism to intracellular structure. Anthropologically, mitochondrial DNA is the fossilised source to trace the human ancestry particularly of maternal lineage. This article attempts to highlight the various biological functions of mitochondrial DNA (mtDNA with a note on its forensic application.

  5. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that

  6. Hysteresis in pressure-driven DNA denaturation.

    Directory of Open Access Journals (Sweden)

    Enrique Hernández-Lemus

    Full Text Available In the past, a great deal of attention has been drawn to thermal driven denaturation processes. In recent years, however, the discovery of stress-induced denaturation, observed at the one-molecule level, has revealed new insights into the complex phenomena involved in the thermo-mechanics of DNA function. Understanding the effect of local pressure variations in DNA stability is thus an appealing topic. Such processes as cellular stress, dehydration, and changes in the ionic strength of the medium could explain local pressure changes that will affect the molecular mechanics of DNA and hence its stability. In this work, a theory that accounts for hysteresis in pressure-driven DNA denaturation is proposed. We here combine an irreversible thermodynamic approach with an equation of state based on the Poisson-Boltzmann cell model. The latter one provides a good description of the osmotic pressure over a wide range of DNA concentrations. The resulting theoretical framework predicts, in general, the process of denaturation and, in particular, hysteresis curves for a DNA sequence in terms of system parameters such as salt concentration, density of DNA molecules and temperature in addition to structural and configurational states of DNA. Furthermore, this formalism can be naturally extended to more complex situations, for example, in cases where the host medium is made up of asymmetric salts or in the description of the (helical-like charge distribution along the DNA molecule. Moreover, since this study incorporates the effect of pressure through a thermodynamic analysis, much of what is known from temperature-driven experiments will shed light on the pressure-induced melting issue.

  7. Primary Amine-Clustered DNA Aptamer for DNA-Protein Conjugation Catalyzed by Microbial Transglutaminase.

    Science.gov (United States)

    Takahara, Mari; Wakabayashi, Rie; Minamihata, Kosuke; Goto, Masahiro; Kamiya, Noriho

    2017-12-20

    DNA-protein conjugates are promising biomolecules for use in areas ranging from therapeutics to analysis because of the dual functionalities of DNA and protein. Conjugation requires site-specific and efficient covalent bond formation without impairing the activity of both biomolecules. Herein, we have focused on the use of a microbial transglutaminase (MTG) that catalyzes the cross-linking reaction between a glutamine residue and a primary amine. In a model bioconjugation, a highly MTG-reactive Gln (Q)-donor peptide (FYPLQMRG, FQ) was fused to enhanced green fluorescent protein (FQ-EGFP) and a primary amine-clustered DNA aptamer was enzymatically synthesized as a novel acyl-acceptor substrate of MTG, whose combination leads to efficient and convenient preparation of DNA-protein conjugates with high purity. Dual functionality of the obtained DNA-EGFP conjugate was evaluated by discrimination of cancer cells via c-Met receptor recognition ability of the DNA aptamer. The DNA aptamer-EGFP conjugate only showed fluorescence toward cells with c-Met overexpression, indicating the retention of the biochemical properties of the DNA and EGFP in the conjugated form.

  8. Isothermal hybridization kinetics of DNA assembly of two-dimensional DNA origami.

    Science.gov (United States)

    Song, Jie; Zhang, Zhao; Zhang, Shuai; Liu, Lei; Li, Qiang; Xie, Erqing; Gothelf, Kurt Vesterager; Besenbacher, Flemming; Dong, Mingdong

    2013-09-09

    The Watson-Crick base-pairing with specificity and predictability makes DNA molecules suitable for building versatile nanoscale structures and devices, and the DNA origami method enables researchers to incorporate more complexities into DNA-based devices. Thermally controlled atomic force microscopy in combination with nanomechanical spectroscopy with forces controlled in the pico Newton (pN) range as a novel technique is introduced to directly investigate the kinetics of multistrand DNA hybridization events on DNA origami nanopores under defined isothermal conditions. For the synthesis of DNA nanostructures under isothermal conditions at 60 °C, a higher hybridization rate, fewer defects, and a higher stability are achieved compared to room-temperature studies. By quantifying the assembly times for filling pores in origami structures at several constant temperatures, the fill factors show a consistent exponential increase over time. Furthermore, the local hybridization rate can be accelerated by adding a higher concentration of the staples. The new insight gained on the kinetics of staple-scaffold hybridization on the synthesis of two dimensional DNA origami structures may open up new routes and ideas for designing DNA assembly systems with increased potential for their application. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Nonisotopic DNA probe techniques

    National Research Council Canada - National Science Library

    Kricka, Larry J

    1992-01-01

    The objective of this book is to bring together descriptions of the principal nonisotopic methods for DNA hybridization assays, together with experimental details of the methods, including labelling...

  10. DNA ELECTROPHORESIS AT SURFACES

    Energy Technology Data Exchange (ETDEWEB)

    RAFAILOVICH, MIRIAM; SOKOLOV, JONATHAN; GERSAPPE, DILIP

    2003-09-01

    During this year we performed two major projects: I. We developed a detailed theoretical model which complements our experiments on surface DNA electrophoresis. We found that it was possible to enhance the separation of DNA chains by imposing a chemical nanoscale pattern on the surface. This approach utilized the surface interaction effect of the DNA chains with the substrate and is a refinement to our previous method in which DNA chains were separated on homogeneous flat surfaces. By introducing the nano-patterns on the surface, the conformational changes of DNA chains of different lengths can be amplified, which results in the different friction strengths with the substrate surface. Our results also show that, when compared to the DNA electrophoresis performed on homogeneous flat surfaces, nanopatterned surfaces offer a larger window in choosing different surface interactions to achieve separation. II. In collaboration with a large international manufacturer of skin care products we also embarked on a project involving photo toxicity of titanium dioxide nanoparticles, which are a key ingredient in sunscreen and cosmetic lotions. The results clearly implicated the nanoparticles in catalyzing damage to chromosomal DNA. We then used this knowledge to develop a polymer/anti-oxidant coating which prevented the photocatalytic reaction on DNA while still retaining the UV absorptive properties of the nanoparticles. The standard gel electrophoresis was not sufficient in determining the extent of the DNA damage. The conclusions of this study were based predominantly on analysis obtained with the surface electrophoresis method.

  11. DNA Computing Systems Activated by Electrochemically-triggered DNA Release from a Polymer-brush-modified Electrode Array

    Science.gov (United States)

    Gamella, Maria; Zakharchenko, Andrey; Guz, Nataliia; Masi, Madeline; Minko, Sergiy; Kolpashchikov, Dmitry M.; Iken, Heiko; Poghossian, Arshak; Schöning, Michael J.; Katz, Evgeny

    2017-01-01

    An array of four independently wired indium tin oxide (ITO) electrodes was used for electrochemically stimulated DNA release and activation of DNA-based Identity, AND and XOR logic gates. Single-stranded DNA molecules were loaded on the mixed poly(N,N-di-methylaminoethyl methacrylate) (PDMAEMA)/poly-(methacrylic acid) (PMAA) brush covalently attached to the ITO electrodes. The DNA deposition was performed at pH 5.0 when the polymer brush is positively charged due to protonation of tertiary amino groups in PDMAE-MA, thus resulting in electrostatic attraction of the negatively charged DNA. By applying electrolysis at −1.0 V(vs. Ag/AgCl reference) electrochemical oxygen reduction resulted in the consumption of hydrogen ions and local pH increase near the electrode surface. The process resulted in recharging the polymer brush to the negative state due to dissociation of carboxylic groups of PMAA, thus repulsing the negatively charged DNA and releasing it from the electrode surface. The DNA release was performed in various combinations from different electrodes in the array assembly. The released DNA operated as input signals for activation of the Boolean logic gates. The developed system represents a step forward in DNA computing, combining for the first time DNA chemical processes with electronic input signals. PMID:29379265

  12. Mechanochemical regulations of RPA's binding to ssDNA

    Science.gov (United States)

    Chen, Jin; Le, Shimin; Basu, Anindita; Chazin, Walter J.; Yan, Jie

    2015-03-01

    Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein that serves to protect ssDNA from degradation and annealing, and as a template for recruitment of many downstream factors in virtually all DNA transactions in cell. During many of these transactions, DNA is tethered and is likely subject to force. Previous studies of RPA's binding behavior on ssDNA were conducted in the absence of force; therefore the RPA-ssDNA conformations regulated by force remain unclear. Here, using a combination of atomic force microscopy imaging and mechanical manipulation of single ssDNA tethers, we show that force mediates a switch of the RPA bound ssDNA from amorphous aggregation to a much more regular extended conformation. Further, we found an interesting non-monotonic dependence of the binding affinity on monovalent salt concentration in the presence of force. In addition, we discovered that zinc in micromolar concentrations drives ssDNA to a unique, highly stiff and more compact state. These results provide new mechanochemical insights into the influences and the mechanisms of action of RPA on large single ssDNA.

  13. Radiation Combined Injury: DNA Damage, Apoptosis, and Autophagy

    Science.gov (United States)

    2010-01-01

    potential for nuclear accidents and accidental exposures will become greater with the expected proliferation of nuclear power plant construction to meet...radiological weapons poses a seri- ous risk of mass casualties. The fact that more than 50% of cancer patients receive radiotherapy at some point during...alone. It is unrealistic however to assume that accidental radiation injury will occur in the absence of other injuries—especially when considering

  14. Mitochondrial DNA, restoring Beethovens music.

    Science.gov (United States)

    Merheb, Maxime; Vaiedelich, Stéphane; Maniguet, Thiérry; Hänni, Catherine

    2016-01-01

    Great ancient composers have endured many obstacles and constraints which are very difficult to understand unless we perform the restoration process of ancient music. Species identification in leather used during manufacturing is the key step to start such a restoration process in order to produce a facsimile of a museum piano. Our study reveals the species identification in the leather covering the hammer head in a piano created by Erard in 1802. This is the last existing piano similar to the piano that Beethoven used with its leather preserved in its original state. The leather sample was not present in a homogeneous piece, yet combined with glue. Using a DNA extraction method that avoids PCR inhibitors; we discovered that sheep and cattle are the origin of the combination. To identify the species in the leather, we focused on the amounts of mitochondrial DNA in both leather and glue and results have led us to the conclusion that the leather used to cover the hammer head in this piano was made of cattle hide.

  15. DNA Repair Systems

    Indian Academy of Sciences (India)

    Thanks to the pioneering research work of Lindahl, Sancar, Modrich and their colleagues, we now have an holistic awareness of how DNA damage occurs and how the damage is rectified in bacteria as well as in higher organisms including human beings. A comprehensive understanding of DNA repair has proven crucial ...

  16. DNA-cell conjugates

    Science.gov (United States)

    Hsiao, Shih-Chia; Francis, Matthew B.; Bertozzi, Carolyn; Mathies, Richard; Chandra, Ravi; Douglas, Erik; Twite, Amy; Toriello, Nicholas; Onoe, Hiroaki

    2016-05-03

    The present invention provides conjugates of DNA and cells by linking the DNA to a native functional group on the cell surface. The cells can be without cell walls or can have cell walls. The modified cells can be linked to a substrate surface and used in assay or bioreactors.

  17. DNA Repair Systems

    Indian Academy of Sciences (India)

    D N Rao is a professor at the. Department of Biochemistry,. Indian Institute of Science,. Bengaluru. His research work primarily focuses on. DNA interacting proteins in prokaryotes. This includes restriction-modification systems, DNA repair proteins from pathogenic bacteria and and proteins involved in horizontal gene ...

  18. Human Mitochondrial DNA Replication

    Science.gov (United States)

    Holt, Ian J.; Reyes, Aurelio

    2012-01-01

    Elucidation of the process of DNA replication in mitochondria is in its infancy. For many years, maintenance of the mitochondrial genome was regarded as greatly simplified compared to the nucleus. Mammalian mitochondria were reported to lack all DNA repair systems, to eschew DNA recombination, and to possess but a single DNA polymerase, polymerase γ. Polγ was said to replicate mitochondrial DNA exclusively via one mechanism, involving only two priming events and a handful of proteins. In this “strand-displacement model,” leading strand DNA synthesis begins at a specific site and advances approximately two-thirds of the way around the molecule before DNA synthesis is initiated on the “lagging” strand. Although the displaced strand was long-held to be coated with protein, RNA has more recently been proposed in its place. Furthermore, mitochondrial DNA molecules with all the features of products of conventional bidirectional replication have been documented, suggesting that the process and regulation of replication in mitochondria is complex, as befits a genome that is a core factor in human health and longevity. PMID:23143808

  19. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  20. Characterization of muntjac DNA

    International Nuclear Information System (INIS)

    Davis, R.C.

    1981-01-01

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange

  1. Characterization of muntjac DNA

    Energy Technology Data Exchange (ETDEWEB)

    Davis, R.C.

    1981-05-27

    Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.

  2. DNA Microarray Technology

    Science.gov (United States)

    ... this page. En Español: Tecnología de micromatriz de ADN DNA Microarray Technology What is a DNA microarray? ... this page. En Español: Tecnología de micromatriz de ADN Get Email Updates Privacy Copyright Contact Accessibility Plug- ...

  3. Differential Nuclear and Mitochondrial DNA Preservation in Post-Mortem Teeth with Implications for Forensic and Ancient DNA Studies

    Science.gov (United States)

    Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.

    2015-01-01

    Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard

  4. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  5. Whose DNA is this?

    DEFF Research Database (Denmark)

    Taroni, Franco; Biedermann, Alex; Vuille, Joëlle

    2013-01-01

    This communication seeks to draw the attention of researchers and practitioners dealing with forensic DNA profiling analyses to the following question: is a scientist's report, offering support to a hypothesis according to which a particular individual is the source of DNA detected during...... evoked during the international conference "The hidden side of DNA profiles. Artifacts, errors and uncertain evidence" held in Rome (April 27th to 28th, 2012). Indeed, despite the fact that this conference brought together some of the world's leading forensic DNA specialists, it appeared clearly...... talk considerably different languages. It thus is fundamental to address this issue of communication about results of forensic DNA analyses, and open a dialogue with practicing non-scientists at large who need to make meaningful use of scientific results to approach and help solve judicial cases...

  6. Racemic DNA crystallography.

    Science.gov (United States)

    Mandal, Pradeep K; Collie, Gavin W; Kauffmann, Brice; Huc, Ivan

    2014-12-22

    Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Study on a hidden protein-DNA binding in salmon sperm DNA sample by dynamic kinetic capillary isoelectric focusing

    Energy Technology Data Exchange (ETDEWEB)

    Liang Liang; Dou Peng; Dong Mingming; Ke Xiaokang; Bian Ningsheng [School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China); Liu Zhen, E-mail: zhenliu@nju.edu.cn [School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China)

    2009-09-14

    Nuclease P1 is an important enzyme that hydrolyzes RNA or single-stranded DNA into nucleotides, and complete digestion is an essential basis for assays based on this enzyme. To digest a doubled-stranded DNA, the enzyme is usually combined with heat denaturing, which breaks doubled-stranded DNA into single strands. This paper presents an un-expected phenomenon that nuclease P1, in combination with heat denaturing, fails to completely digest a DNA sample extracted from salmon sperm. Under the experimental conditions used, at which nuclease P1 can completely digest calf thymus DNA, the digestion yield of salmon sperm DNA was only 89.5%. Spectrometric measurement indicated that a total protein of 4.7% is present in the DNA sample. To explain the reason for this phenomenon, the dynamic kinetic capillary isoelectric focusing (DK-CIEF) approach proposed previously, which allows for the discrimination of different types of protein-DNA interactions and the measurement of the individual dissociation rate constants, was modified and applied to examine possible protein-DNA interactions involved. It was found that a non-specific DNA-protein binding occurs in the sample, the dissociation rate constant for which was measured to be 7.05 {+-} 0.83 x 10{sup -3} s{sup -1}. The formation of DNA-protein complex was suggested to be the main reason for the incomplete digestion of the DNA sample. The modified DK-CIEF approach can be applied as general DNA samples, with the advantages of fast speed and low sample consumption.

  8. The cutting edges in DNA repair, licensing, and fidelity: DNA and RNA repair nucleases sculpt DNA to measure twice, cut once.

    Science.gov (United States)

    Tsutakawa, Susan E; Lafrance-Vanasse, Julien; Tainer, John A

    2014-07-01

    To avoid genome instability, DNA repair nucleases must precisely target the correct damaged substrate before they are licensed to incise. Damage identification is a challenge for all DNA damage response proteins, but especially for nucleases that cut the DNA and necessarily create a cleaved DNA repair intermediate, likely more toxic than the initial damage. How do these enzymes achieve exquisite specificity without specific sequence recognition or, in some cases, without a non-canonical DNA nucleotide? Combined structural, biochemical, and biological analyses of repair nucleases are revealing their molecular tools for damage verification and safeguarding against inadvertent incision. Surprisingly, these enzymes also often act on RNA, which deserves more attention. Here, we review protein-DNA structures for nucleases involved in replication, base excision repair, mismatch repair, double strand break repair (DSBR), and telomere maintenance: apurinic/apyrimidinic endonuclease 1 (APE1), Endonuclease IV (Nfo), tyrosyl DNA phosphodiesterase (TDP2), UV Damage endonuclease (UVDE), very short patch repair endonuclease (Vsr), Endonuclease V (Nfi), Flap endonuclease 1 (FEN1), exonuclease 1 (Exo1), RNase T and Meiotic recombination 11 (Mre11). DNA and RNA structure-sensing nucleases are essential to life with roles in DNA replication, repair, and transcription. Increasingly these enzymes are employed as advanced tools for synthetic biology and as targets for cancer prognosis and interventions. Currently their structural biology is most fully illuminated for DNA repair, which is also essential to life. How DNA repair enzymes maintain genome fidelity is one of the DNA double helix secrets missed by James Watson and Francis Crick, that is only now being illuminated though structural biology and mutational analyses. Structures reveal motifs for repair nucleases and mechanisms whereby these enzymes follow the old carpenter adage: measure twice, cut once. Furthermore, to measure

  9. Spermine attenuates the action of the DNA intercalator, actinomycin D, on DNA binding and the inhibition of transcription and DNA replication.

    Science.gov (United States)

    Wang, Sheng-Yu; Lee, Alan Yueh-Luen; Lee, Yueh-Luen; Lai, Yi-Hua; Chen, Jeremy J W; Wu, Wen-Lin; Yuann, Jeu-Ming P; Su, Wang-Lin; Chuang, Show-Mei; Hou, Ming-Hon

    2012-01-01

    The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular) are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD) as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone) (MGBG) enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion.

  10. Spermine attenuates the action of the DNA intercalator, actinomycin D, on DNA binding and the inhibition of transcription and DNA replication.

    Directory of Open Access Journals (Sweden)

    Sheng-Yu Wang

    Full Text Available The anticancer activity of DNA intercalators is related to their ability to intercalate into the DNA duplex with high affinity, thereby interfering with DNA replication and transcription. Polyamines (spermine in particular are almost exclusively bound to nucleic acids and are involved in many cellular processes that require nucleic acids. Until now, the effects of polyamines on DNA intercalator activities have remained unclear because intercalation is the most important mechanism employed by DNA-binding drugs. Herein, using actinomycin D (ACTD as a model, we have attempted to elucidate the effects of spermine on the action of ACTD, including its DNA-binding ability, RNA and DNA polymerase interference, and its role in the transcription and replication inhibition of ACTD within cells. We found that spermine interfered with the binding and stabilization of ACTD to DNA. The presence of increasing concentrations of spermine enhanced the transcriptional and replication activities of RNA and DNA polymerases, respectively, in vitro treated with ActD. Moreover, a decrease in intracellular polyamine concentrations stimulated by methylglyoxal-bis(guanylhydrazone (MGBG enhanced the ACTD-induced inhibition of c-myc transcription and DNA replication in several cancer cell lines. The results indicated that spermine attenuates ACTD binding to DNA and its inhibition of transcription and DNA replication both in vitro and within cells. Finally, a synergistic antiproliferative effect of MGBG and ACTD was observed in a cell viability assay. Our findings will be of significant relevance to future developments in combination with cancer therapy by enhancing the anticancer activity of DNA interactors through polyamine depletion.

  11. DNA-based asymmetric catalysis : Sequence-dependent rate acceleration and enantioselectivity

    NARCIS (Netherlands)

    Boersma, Arnold J.; Klijn, Jaap E.; Feringa, Ben L.; Roelfes, Gerard

    2008-01-01

    This study shows that the role of DNA in the DNA-based enantioselective Diels-Alder reaction of azachalcone with cyclopentadiene is not limited to that of a chiral scaffold. DNA in combination with the copper complex of 4,4'-dimethyl-2,2'-bipyridine (Cu-L1) gives rise to a rate acceleration of up to

  12. The roles of adenoviral vectors and donor DNA structures on genome editing

    NARCIS (Netherlands)

    Holkers, Maarten

    2016-01-01

    Accurate and efficient genome editing is primarily dependent on the generation of a sequence-specific, genomic double-stranded DNA break (DSB) combined with the introduction of an exogenous DNA template into target cells. The exogenous template, called donor DNA, normally contains the foreign

  13. Scintillating optical fiber detectors for DNA sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Bendali, M.; Mastrippolito, R.; Charon, Y.; Leblanc, M.; Tricoire, H.; Valentin, L. (Inst. de Physique Nucleaire, 91 - Orsay (France) Lab. de Physique Nucleaire, Univ. Paris 7, 75 (France)); Martin, B. (Lab. de Neurobiologie Cellulaire et Moleculaire, 91 - Gif-sur-Yvette (France))

    1991-12-01

    We have developed a two-dimensional detector (SOFI) for {sup 32}P emitting molecules used in molecular biology by combining scinitillating optical fibers (SOFs) and a multianode photomultiplier (MAPM). A good efficiency (15%) was obtained by suppressing the internal cross talk of the MAPM with a new electronic device. Using this improvement we are developing two new detectors using SOFs for DNA sequencing. We shall present the basic principle of these detectors and the results in efficiency and position accuracy obtained with the first prototypes. The advantage of these detectors over currently available DNA sequencers will be discussed. (orig.).

  14. Pig transgenesis by Sleeping Beauty DNA transposition

    DEFF Research Database (Denmark)

    Jakobsen, Jannik E.; Li, Juan; Kragh, Peter M.

    2011-01-01

    disease models. In this report, we present transgenic pigs created by Sleeping Beauty DNA transposition in primary porcine fibroblasts in combination with somatic cell nuclear transfer by handmade cloning. Göttingen minipigs expressing green fluorescent protein are produced by transgenesis with DNA...... transposon vectors carrying the transgene driven by the human ubiquitin C promoter. These animals carry multiple copies (from 8 to 13) of the transgene and show systemic transgene expression. Transgene-expressing pigs carry both transposase-catalyzed insertions and at least one copy of randomly inserted...

  15. ThreaDNA: predicting DNA mechanics' contribution to sequence selectivity of proteins along whole genomes.

    Science.gov (United States)

    Cevost, Jasmin; Vaillant, Cédric; Meyer, Sam; Rost, Burkhard

    2018-02-15

    Many DNA-binding proteins recognize their target sequences indirectly, by sensing DNA's response to mechanical distortion. ThreaDNA estimates this response based on high-resolution structures of the protein-DNA complex of interest. Implementing an efficient nanoscale modeling of DNA deformations involving essentially no adjustable parameters, it returns the profile of deformation energy along whole genomes, at base-pair resolution, within minutes on usual laptop/desktop computers. Our predictions can also be easily combined with estimations of direct selectivity through a generalized form of position-weight-matrices. The formalism of ThreaDNA is accessible to a wide audience. We demonstrate the importance of indirect readout for the nucleosome as well as the bacterial regulators Fis and CRP. Combined with the direct contribution provided by usual sequence motifs, it significantly improves the prediction of sequence selectivity, and allows quantifying the two distinct physical mechanisms underlying it. Python software available at bioinfo.insa-lyon.fr, natively executable on Linux/MacOS systems with a user-friendly graphical interface. Galaxy webserver version available. sam.meyer@insa-lyon.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  16. Diverse Applications of Environmental DNA Methods in Parasitology.

    Science.gov (United States)

    Bass, David; Stentiford, Grant D; Littlewood, D T J; Hartikainen, Hanna

    2015-10-01

    Nucleic acid extraction and sequencing of genes from organisms within environmental samples encompasses a variety of techniques collectively referred to as environmental DNA or 'eDNA'. The key advantages of eDNA analysis include the detection of cryptic or otherwise elusive organisms, large-scale sampling with fewer biases than specimen-based methods, and generation of data for molecular systematics. These are particularly relevant for parasitology because parasites can be difficult to locate and are morphologically intractable and genetically divergent. However, parasites have rarely been the focus of eDNA studies. Focusing on eukaryote parasites, we review the increasing diversity of the 'eDNA toolbox'. Combining eDNA methods with complementary tools offers much potential to understand parasite communities, disease risk, and parasite roles in broader ecosystem processes such as food web structuring and community assembly. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  17. Environmental DNA reflects spatial and temporal jellyfish distribution.

    Science.gov (United States)

    Minamoto, Toshifumi; Fukuda, Miho; Katsuhara, Koki R; Fujiwara, Ayaka; Hidaka, Shunsuke; Yamamoto, Satoshi; Takahashi, Kohji; Masuda, Reiji

    2017-01-01

    Recent development of environmental DNA (eDNA) analysis allows us to survey underwater macro-organisms easily and cost effectively; however, there have been no reports on eDNA detection or quantification for jellyfish. Here we present the first report on an eDNA analysis of marine jellyfish using Japanese sea nettle (Chrysaora pacifica) as a model species by combining a tank experiment with spatial and temporal distribution surveys. We performed a tank experiment monitoring eDNA concentrations over a range of time intervals after the introduction of jellyfish, and quantified the eDNA concentrations by quantitative real-time PCR. The eDNA concentrations peaked twice, at 1 and 8 h after the beginning of the experiment, and became stable within 48 h. The estimated release rates of the eDNA in jellyfish were higher than the rates previously reported in fishes. A spatial survey was conducted in June 2014 in Maizuru Bay, Kyoto, in which eDNA was collected from surface water and sea floor water samples at 47 sites while jellyfish near surface water were counted on board by eye. The distribution of eDNA in the bay corresponded with the distribution of jellyfish inferred by visual observation, and the eDNA concentration in the bay was ~13 times higher on the sea floor than on the surface. The temporal survey was conducted from March to November 2014, in which jellyfish were counted by eye every morning while eDNA was collected from surface and sea floor water at three sampling points along a pier once a month. The temporal fluctuation pattern of the eDNA concentrations and the numbers of observed individuals were well correlated. We conclude that an eDNA approach is applicable for jellyfish species in the ocean.

  18. Environmental DNA reflects spatial and temporal jellyfish distribution.

    Directory of Open Access Journals (Sweden)

    Toshifumi Minamoto

    Full Text Available Recent development of environmental DNA (eDNA analysis allows us to survey underwater macro-organisms easily and cost effectively; however, there have been no reports on eDNA detection or quantification for jellyfish. Here we present the first report on an eDNA analysis of marine jellyfish using Japanese sea nettle (Chrysaora pacifica as a model species by combining a tank experiment with spatial and temporal distribution surveys. We performed a tank experiment monitoring eDNA concentrations over a range of time intervals after the introduction of jellyfish, and quantified the eDNA concentrations by quantitative real-time PCR. The eDNA concentrations peaked twice, at 1 and 8 h after the beginning of the experiment, and became stable within 48 h. The estimated release rates of the eDNA in jellyfish were higher than the rates previously reported in fishes. A spatial survey was conducted in June 2014 in Maizuru Bay, Kyoto, in which eDNA was collected from surface water and sea floor water samples at 47 sites while jellyfish near surface water were counted on board by eye. The distribution of eDNA in the bay corresponded with the distribution of jellyfish inferred by visual observation, and the eDNA concentration in the bay was ~13 times higher on the sea floor than on the surface. The temporal survey was conducted from March to November 2014, in which jellyfish were counted by eye every morning while eDNA was collected from surface and sea floor water at three sampling points along a pier once a month. The temporal fluctuation pattern of the eDNA concentrations and the numbers of observed individuals were well correlated. We conclude that an eDNA approach is applicable for jellyfish species in the ocean.

  19. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  20. Near-atomic structural model for bacterial DNA replication initiation complex and its functional insights.

    Science.gov (United States)

    Shimizu, Masahiro; Noguchi, Yasunori; Sakiyama, Yukari; Kawakami, Hironori; Katayama, Tsutomu; Takada, Shoji

    2016-12-13

    Upon DNA replication initiation in Escherichia coli, the initiator protein DnaA forms higher-order complexes with the chromosomal origin oriC and a DNA-bending protein IHF. Although tertiary structures of DnaA and IHF have previously been elucidated, dynamic structures of oriC-DnaA-IHF complexes remain unknown. Here, combining computer simulations with biochemical assays, we obtained models at almost-atomic resolution for the central part of the oriC-DnaA-IHF complex. This complex can be divided into three subcomplexes; the left and right subcomplexes include pentameric DnaA bound in a head-to-tail manner and the middle subcomplex contains only a single DnaA. In the left and right subcomplexes, DnaA ATPases associated with various cellular activities (AAA+) domain III formed helices with specific structural differences in interdomain orientations, provoking a bend in the bound DNA. In the left subcomplex a continuous DnaA chain exists, including insertion of IHF into the DNA looping, consistent with the DNA unwinding function of the complex. The intervening spaces in those subcomplexes are crucial for DNA unwinding and loading of DnaB helicases. Taken together, this model provides a reasonable near-atomic level structural solution of the initiation complex, including the dynamic conformations and spatial arrangements of DnaA subcomplexes.

  1. A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering

    Directory of Open Access Journals (Sweden)

    Nørholm Morten HH

    2010-03-01

    Full Text Available Abstract Background The combined use of restriction enzymes with PCR has revolutionized molecular cloning, but is inherently restricted by the content of the manipulated DNA sequences. Uracil-excision based cloning is ligase and sequence independent and allows seamless fusion of multiple DNA sequences in simple one-tube reactions, with higher accuracy than overlapping PCR. Results Here, the addition of a highly efficient DNA polymerase and a low-background-, large-insertion- compatible site-directed mutagenesis protocol is described, largely expanding the versatility of uracil-excision DNA engineering. Conclusions The different uracil-excision based molecular tools that have been developed in an open-source fashion, constitute a comprehensive, yet simple and inexpensive toolkit for any need in molecular cloning.

  2. A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering.

    Science.gov (United States)

    Nørholm, Morten H H

    2010-03-16

    The combined use of restriction enzymes with PCR has revolutionized molecular cloning, but is inherently restricted by the content of the manipulated DNA sequences. Uracil-excision based cloning is ligase and sequence independent and allows seamless fusion of multiple DNA sequences in simple one-tube reactions, with higher accuracy than overlapping PCR. Here, the addition of a highly efficient DNA polymerase and a low-background-, large-insertion- compatible site-directed mutagenesis protocol is described, largely expanding the versatility of uracil-excision DNA engineering. The different uracil-excision based molecular tools that have been developed in an open-source fashion, constitute a comprehensive, yet simple and inexpensive toolkit for any need in molecular cloning.

  3. Regulating DNA Self-assembly by DNA-Surface Interactions.

    Science.gov (United States)

    Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde

    2017-12-14

    DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. DNA Bending elasticity

    Science.gov (United States)

    Sivak, David Alexander

    DNA bending elasticity on length scales of tens of basepairs is of critical importance in numerous biological contexts. Even the simplest models of DNA bending admit of few simple analytic results, thus there is a need for numerical methods to calculate experimental observables, such as distance distributions, forces, FRET efficiencies, and timescales of particular large-scale motions. We have implemented and helped develop a coarse-grained representation of DNA and various other covalently-linked groups that allows simple calculation of such observables for varied experimental systems. The simple freely-jointed chain (FJC) model and extremely coarse resolution proved useful in understanding DNA threading through nanopores, identifying steric occlusion by other parts of the chain as a prime culprit for slower capture as distance to the pore decreased. Enhanced sampling techniques of a finer resolution discrete wormlike chain (WLC) model permitted calculation of cyclization rates for small chains and identified the ramifications of a thermodynamically-sound treatment of thermal melts. Adding treatment of double-stranded DNA's helical nature and single-stranded DNA provided a model system that helped demonstrate the importance of statistical fluctuations in even highly-stressed DNA mini-loops, and allowed us to verify that even these constructs show no evidence of excitation-induced softening. Additional incorporation of salt-sensitivity to the model allowed us to calculate forces and FRET efficiencies for such mini-loops and their uncircularized precursors, thereby furthering the understanding of the nature of IHF binding and bending of its recognition sequence. Adding large volume-excluding spheres linked to the ends of the dsDNA permits calculation of distance distributions and thus small-angle X-ray scattering, whereby we demonstrated the validity of the WLC in describing bending fluctuations in DNA chains as short as 42 bp. We also make important connections

  5. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    Science.gov (United States)

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  6. Visualization of complex DNA damage along accelerated ions tracks

    Science.gov (United States)

    Kulikova, Elena; Boreyko, Alla; Bulanova, Tatiana; Ježková, Lucie; Zadneprianetc, Mariia; Smirnova, Elena

    2018-04-01

    The most deleterious DNA lesions induced by ionizing radiation are clustered DNA double-strand breaks (DSB). Clustered or complex DNA damage is a combination of a few simple lesions (single-strand breaks, base damage etc.) within one or two DNA helix turns. It is known that yield of complex DNA lesions increases with increasing linear energy transfer (LET) of radiation. For investigation of the induction and repair of complex DNA lesions, human fibroblasts were irradiated with high-LET 15N ions (LET = 183.3 keV/μm, E = 13MeV/n) and low-LET 60Co γ-rays (LET ≈ 0.3 keV/μm) radiation. DNA DSBs (γH2AX and 53BP1) and base damage (OGG1) markers were visualized by immunofluorecence staining and high-resolution microscopy. The obtained results showed slower repair kinetics of induced DSBs in cells irradiated with accelerated ions compared to 60Co γ-rays, indicating induction of more complex DNA damage. Confirming previous assumptions, detailed 3D analysis of γH2AX/53BP1 foci in 15N ions tracks revealed more complicated structure of the foci in contrast to γ-rays. It was shown that proteins 53BP1 and OGG1 involved in repair of DNA DSBs and modified bases, respectively, were colocalized in tracks of 15N ions and thus represented clustered DNA DSBs.

  7. DNA-PKcs is critical for telomere capping

    Energy Technology Data Exchange (ETDEWEB)

    Gilley, David; Tanaka, Hiromi; Hande, M. Prakash; Kurimasa,Akihiro; Li, Gloria C.; Chen, David J.

    2001-04-10

    The DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is critical for DNA repair via the non-homologous end joining (NHEJ) pathway. Previously, it was reported that bone marrow cells and spontaneously transformed fibroblasts from SCID (severe combined immunodeficiency) mice have defects in telomere maintenance. The genetically defective SCID mouse arose spontaneously from its parental strain CB17. One known genomic alteration in SCID mice is a truncation of the extreme carboxyl-terminus of DNA-PKcs, but other as yet unidentified alterations may also exist. We have used a defined system, the DNA-PKcs knockout mouse, to investigate specifically the role DNA-PKcs specifically plays in telomere maintenance. We report that primary mouse embryonic fibroblasts (MEFs) and primary cultured kidney cells from 6-8 month old DNA-PKcs deficient mice accumulate a large number of telomere fusions, yet still retain wildtype telomere length. Thus, the phenotype of this defect separates the two-telomere related phenotypes, capping and length maintenance. DNA-PKcs deficient MEFs also exhibit elevated levels of chromosome fragments and breaks, which correlate with increased telomere fusions. Based on the high levels of telomere fusions observed in DNA-PKcs deficient cells, we conclude that DNA-PKcs plays an important capping role at the mammalian telomere.

  8. Rapid cleanup of bacterial DNA from samples containing aerosol contaminants

    Science.gov (United States)

    Menking, Darrell E.; Kracke, Suzanne K.; Emanuel, Peter A.; Valdes, James J.

    1999-01-01

    Polymerase Chain Reaction (PCR) is an in vitro enzymatic, synthetic method used to amplify specific DNA sequences from organisms. Detection of DNA using gene probes allows for absolute identification not only of specific organisms, but also of genetic material in recombinant organisms. PCR is an exquisite biological method for detecting bacteria in aerosol samples. A major challenge facing detection of DNA from field samples is that they are almost sure to contain impurities, especially impurities that inhibit amplification through PCR. DNA is being extracted from air, sewage/stool samples, food, sputum, a water and sediment; however, multi- step, time consuming methods are required to isolate the DNA from the surrounding contamination. This research focuses on developing a method for rapid cleanup of DNA which combines extraction and purification of DNA while, at the same time, removing inhibitors from 'dirty samples' to produce purified, PCR-ready DNA. GeneReleaser produces PCR-ready DNA in a rapid five-minute protocol. GeneReleaser resin was able to clean up sample contain micrograms of typical aerosol and water contaminants. The advantages of using GR are that it is rapid, inexpensive, requires one-step, uses no hazardous material and produces PCR-ready DNA.

  9. Solvent-free Liquid Crystals and Liquids from DNA.

    Science.gov (United States)

    Liu, Kai; Shuai, Min; Chen, Dong; Tuchband, Michael; Gerasimov, Jennifer Y; Su, Juanjuan; Liu, Qing; Zajaczkowski, Wojciech; Pisula, Wojciech; Müllen, Klaus; Clark, Noel A; Herrmann, Andreas

    2015-03-23

    As DNA exhibits persistent structures with dimensions that exceed the range of their intermolecular forces, solid-state DNA undergoes thermal degradation at elevated temperatures. Therefore, the realization of solvent-free DNA fluids, including liquid crystals and liquids, still remains a significant challenge. To address this intriguing issue, we demonstrate that combining DNA with suitable cationic surfactants, followed by dehydration, can be a simple generic scheme for producing these solvent-free DNA fluid systems. In the anhydrous smectic liquid crystalline phase, DNA sublayers are intercalated between aliphatic hydrocarbon sublayers. The lengths of the DNA and surfactant are found to be extremely important in tuning the physical properties of the fluids. Stable liquid-crystalline and liquid phases are obtained in the -20 °C to 200 °C temperature range without thermal degradation of the DNA. Thus, a new type of DNA-based soft biomaterial has been achieved, which will promote the study and application of DNA in a much broader context. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. DNA Mismatch Repair

    Science.gov (United States)

    MARINUS, M. G.

    2014-01-01

    DNA mismatch repair functions to correct replication errors in newly synthesized DNA and to prevent recombination between related, but not identical (homeologous), DNA sequences. The mechanism of mismatch repair is best understood in Escherichia coli and is the main focus of this review. The early genetic studies of mismatch repair are described as a basis for the subsequent biochemical characterization of the system. The effects of mismatch repair on homologous and homeologous recombination are described. The relationship of mismatch repair to cell toxicity induced by various drugs is included. The VSP (Very Short Patch) repair system is described in detail. PMID:26442827

  11. "Artifactual" arsenate DNA

    DEFF Research Database (Denmark)

    Nielsen, Peter E

    2012-01-01

    The recent claim by Wolfe-Simon et al. that the Halomonas bacterial strain GFAJ-1 when grown in arsenate-containing medium with limiting phosphate is able to substitute phosphate with arsenate in biomolecules including nucleic acids and in particular DNA(1) arose much skepticism, primarily due...... to the very limited chemical stability of arsenate esters (see ref. 2 and references therein). A major part of the criticisms was concerned with the insufficient (bio)chemical evidence in the Wolfe-Simon study for the actual chemical incorporation of arsenate in DNA (and/or RNA). Redfield et al. now present...... evidence that the identification of arsenate DNA was artifactual....

  12. Apoptosis and DNA Methylation

    International Nuclear Information System (INIS)

    Meng, Huan X.; Hackett, James A.; Nestor, Colm; Dunican, Donncha S.; Madej, Monika; Reddington, James P.; Pennings, Sari; Harrison, David J.; Meehan, Richard R.

    2011-01-01

    Epigenetic mechanisms assist in maintaining gene expression patterns and cellular properties in developing and adult tissues. The molecular pathology of disease states frequently includes perturbation of DNA and histone methylation patterns, which can activate apoptotic pathways associated with maintenance of genome integrity. This perspective focuses on the pathways linking DNA methyltransferases and methyl-CpG binding proteins to apoptosis, and includes new bioinformatic analyses to characterize the evolutionary origin of two G/T mismatch-specific thymine DNA glycosylases, MBD4 and TDG

  13. Developing DNA nanotechnology using single-molecule fluorescence.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  14. The influence of 5-fluorouracil, metronidazole, caffeine and radiation of DNA synthesis in Pliss lymphosarcoma

    International Nuclear Information System (INIS)

    Ermekova, S.A.; Esel'baeva, G.O.; Urunbaev, S.U.

    1989-01-01

    Injection of 5-fluorouracil or caffeine or a combination of each of them with metronidazole removes partially or wholly the postirradiation arrest of DNA synthesis in Pliss lymphosarcoma and increases the label and (or) the rate of its incorporation in nuclei of DNA - synthesizing cells compared to irradiated controls. The administartion of the three agents arrests almost completely the DNA synthesis during the very first hours following irradiation, then prematurely removes partially the synthesis block in most DNA-synthesizing cells

  15. Critical threshold levels of DNA methyltransferase 1 are required to maintain DNA methylation across the genome in human cancer cells.

    Science.gov (United States)

    Cai, Yi; Tsai, Hsing-Chen; Yen, Ray-Whay Chiu; Zhang, Yang W; Kong, Xiangqian; Wang, Wei; Xia, Limin; Baylin, Stephen B

    2017-04-01

    Reversing DNA methylation abnormalities and associated gene silencing, through inhibiting DNA methyltransferases (DNMTs) is an important potential cancer therapy paradigm. Maximizing this potential requires defining precisely how these enzymes maintain genome-wide, cancer-specific DNA methylation. To date, there is incomplete understanding of precisely how the three DNMTs, 1, 3A, and 3B, interact for maintaining DNA methylation abnormalities in cancer. By combining genetic and shRNA depletion strategies, we define not only a dominant role for DNA methyltransferase 1 (DNMT1) but also distinct roles of 3A and 3B in genome-wide DNA methylation maintenance. Lowering DNMT1 below a threshold level is required for maximal loss of DNA methylation at all genomic regions, including gene body and enhancer regions, and for maximally reversing abnormal promoter DNA hypermethylation and associated gene silencing to reexpress key genes. It is difficult to reach this threshold with patient-tolerable doses of current DNMT inhibitors (DNMTIs). We show that new approaches, like decreasing the DNMT targeting protein, UHRF1, can augment the DNA demethylation capacities of existing DNA methylation inhibitors for fully realizing their therapeutic potential. © 2017 Cai et al.; Published by Cold Spring Harbor Laboratory Press.

  16. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  17. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with these modifications, it is likely that the primary use of DNA vaccines may be as primers for viral-vectored vaccines, rather than as single agents. This review discusses the approaches used to enhance DNA vaccine immunogenicity, with a primary focus on fusion strategies that enhance antigen presentation....

  18. Close encounters with DNA

    Science.gov (United States)

    Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.

    2014-01-01

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena and we review the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560

  19. DNA from keratinous tissue

    DEFF Research Database (Denmark)

    Bengtsson, Camilla F.; Olsen, Maja E.; Brandt, Luise Ørsted

    2011-01-01

    Keratinous tissues such as nail, hair, horn, scales and feather have been used as a source of DNA for over 20 years. Particular benefits of such tissues include the ease with which they can be sampled, the relative stability of DNA in such tissues once sampled, and, in the context of ancient...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle – although little...... systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...

  20. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...

  1. Gomphid DNA sequence data

    Data.gov (United States)

    U.S. Environmental Protection Agency — DNA sequence data for several genetic loci. This dataset is not publicly accessible because: It's already publicly available on GenBank. It can be accessed through...

  2. DNA damage and carcinogenesis

    International Nuclear Information System (INIS)

    Stelow, R.B.

    1980-01-01

    Although cancer may arise as a result of many different types of molecular changes, there is little reason to doubt that changes to DNA are one of the more important ones in cancer initiation. Although DNA repair mechanisms seem able to eliminate a very large fraction of deleterious changes to DNA, we not only have little insight into the molecular mechanisms involved in such repair, but have a negligible amount of information to permit us to estimate the shape of dose response relations at low doses. The case of skin cancer is a special one, in that the average population is exposed to sufficient solar uv so that the effects of small increments in uv dose may be estimated. An approximate 85% reduction in DNA repair increases skin cancer incidence 10 4 fold

  3. Experimental DNA computing

    NARCIS (Netherlands)

    Henkel, Christiaan

    2005-01-01

    Because of their information storing and processing capabilities, nucleic acids are interesting building blocks for molecular scale computers. Potential applications of such DNA computers range from massively parallel computation to computational gene therapy. In this thesis, several implementations

  4. DNA Vaccines Against Anthrax

    National Research Council Canada - National Science Library

    Galloway, Darrell R; Baillie, Les

    2004-01-01

    DNA vaccination is vaccination at its simplest. Due to renewed interest in vaccination against anthrax and other biothreat agents, a genetic immunisation approach offers attractive possibilities for rapid, responsive vaccine development...

  5. DNA Sampling Hook

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The DNA Sampling Hook is a significant improvement on a method of obtaining a tissue sample from a live fish in situ from an aquatic environment. A tissue sample...

  6. Retroviral DNA Integration

    Science.gov (United States)

    2016-01-01

    The integration of a DNA copy of the viral RNA genome into host chromatin is the defining step of retroviral replication. This enzymatic process is catalyzed by the virus-encoded integrase protein, which is conserved among retroviruses and LTR-retrotransposons. Retroviral integration proceeds via two integrase activities: 3′-processing of the viral DNA ends, followed by the strand transfer of the processed ends into host cell chromosomal DNA. Herein we review the molecular mechanism of retroviral DNA integration, with an emphasis on reaction chemistries and architectures of the nucleoprotein complexes involved. We additionally discuss the latest advances on anti-integrase drug development for the treatment of AIDS and the utility of integrating retroviral vectors in gene therapy applications. PMID:27198982

  7. Radiation damage in DNA

    International Nuclear Information System (INIS)

    Lafleur, V.

    1978-01-01

    A number of experiments are described with the purpose to obtain a better insight in the chemical nature and the biological significance of radiation-induced damage in DNA, with some emphasis on the significance of alkali-labile sites. It is shown that not only reactions of OH radicals but also of H radicals introduce breaks and other inactivating damage in single-standed phiX174 DNA. It is found that phosphate buffer is very suitable for the study of the reactions of H radicals with DNA, as the H 2 PO 4 - ions convert the hydrated electrons into H radicals. The hydrated electron, which does react with DNA, does not cause a detectable inactivation. (Auth.)

  8. DNA-Origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Gothelf, Kurt Vesterager

    2010-01-01

    DNA-nanostrukturer giver nye muligheder for studier af individuelle molekyler. Ved at udnytte DNAs unikke selvsamlende egenskaber kan man designe systemer, hvorpå der kan studeres kemiske reaktioner, fluoroforer og biiomolekyler på enkeltmolekyle-niveau....

  9. Patterning nanocrystals using DNA

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Shara Carol [Univ. of California, Berkeley, CA (United States)

    2003-01-01

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices

  10. Celebrating DNA's Repair Crew.

    Science.gov (United States)

    Kunkel, Thomas A

    2015-12-03

    This year, the Nobel Prize in Chemistry has been awarded to Tomas Lindahl, Aziz Sancar, and Paul Modrich for their seminal studies of the mechanisms by which cells from bacteria to man repair DNA damage that is generated by normal cellular metabolism and stress from the environment. These studies beautifully illustrate the remarkable power of DNA repair to influence life from evolution through disease susceptibility. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Das DNA-Puzzle

    Science.gov (United States)

    Kirchner, Stefan

    Im Jahre 1953 wurde von James Watson und Francis Crick erstmalig der strukturelle Aufbau der sogenannten DNA (Desoxyribonukleinsäure) beschrieben, welche das Erbgut jedes Lebewesens enthält. Der wesentliche Teil des Erbguts wird dabei durch eine sehr lange Folge der vier Basen Adenin (A), Cytosin (C), Guanin (G) und Thymin (T) codiert. Seit einigen Jahren ist es möglich, die Folge der vier Basen zu einer gegebenen DNA zu bestimmen. Biologen bezeichnen diesen Vorgang als Sequenzierung.

  12. Variations in brain DNA

    Directory of Open Access Journals (Sweden)

    Jesus eAvila

    2014-11-01

    Full Text Available It is assumed that DNA sequences are conserved in the diverse cell types present in a multicellular organism like the human being. Thus, in order to compare the sequences in the genome of DNA from different individuals, nucleic acid is commonly isolated from a single tissue. In this regard, blood cells are widely used for this purpose because of their availability. Thus blood DNA has been used to study genetic familiar diseases that affect other tissues and organs, such as the liver, heart, and brain. While this approach is valid for the identification of familial diseases in which mutations are present in parental germinal cells and, therefore, in all the cells of a given organism, it is not suitable to identify sporadic diseases in which mutations might occur in specific somatic cells. This review addresses somatic DNA variations in different tissues or cells (mainly in the brain of single individuals and discusses whether the dogma of DNA invariance between cell types is indeed correct. We will also discuss how single nucleotide somatic variations arise, focusing on the presence of specific DNA mutations in the brain.

  13. Introduction to DNA methods

    International Nuclear Information System (INIS)

    Delincee, H.

    1991-01-01

    The purpose of this session is to discuss the various possibilities for detecting modifications in DNA after irradiation and whether these changes can be utilized as an indicator for the irradiation treatment of foods. The requirement to be fulfilled is that the method be able to distinguish irradiated food without the presence of a control sample, thus the measured response after irradiation must be large enough to supersede background levels from other treatments. Much work has been performed on the effects of radiation on DNA, particularly due to its importance in radiation biology. The main lesions of DNA as a result of irradiation are base damage, damage of the sugar moiety, single strand and double strand breaks. Crosslinking between bases also occurs, e.g. production of thymine dimers, or between DNA and protein. A valuable review on how to utilize these DNA changes for detection purposes has already appeared. Tables 1, 2 and 3 list the proposed methods of detecting changes in irradiated DNA, some identified products as examples for a possible irradiation indicator, in the case of immunoassay the substance used as antigen, and some selected literature references. In this short review, it is not intended to provide a complete literature survey

  14. Toward larger DNA origami.

    Science.gov (United States)

    Marchi, Alexandria N; Saaem, Ishtiaq; Vogen, Briana N; Brown, Stanley; LaBean, Thomas H

    2014-10-08

    Structural DNA nanotechnology, and specifically scaffolded DNA origami, is rapidly developing as a versatile method for bottom-up fabrication of novel nanometer-scale materials and devices. However, lengths of conventional single-stranded scaffolds, for example, 7,249-nucleotide circular genomic DNA from the M13mp18 phage, limit the scales of these uniquely addressable structures. Additionally, increasing DNA origami size generates the cost burden of increased staple-strand synthesis. We addressed this 2-fold problem by developing the following methods: (1) production of the largest to-date biologically derived single-stranded scaffold using a λ/M13 hybrid virus to produce a 51 466-nucleotide DNA in a circular, single-stranded form and (2) inexpensive DNA synthesis via an inkjet-printing process on a chip embossed with functionalized micropillars made from cyclic olefin copolymer. We have experimentally demonstrated very efficient assembly of a 51-kilobasepair origami from the λ/M13 hybrid scaffold folded by chip-derived staple strands. In addition, we have demonstrated two-dimensional, asymmetric origami sheets with controlled global curvature such that they land on a substrate in predictable orientations that have been verified by atomic force microscopy.

  15. Isolation and enrichment of Cryptosporidium DNA and verification of DNA purity for whole-genome sequencing.

    Science.gov (United States)

    Guo, Yaqiong; Li, Na; Lysén, Colleen; Frace, Michael; Tang, Kevin; Sammons, Scott; Roellig, Dawn M; Feng, Yaoyu; Xiao, Lihua

    2015-02-01

    Whole-genome sequencing of Cryptosporidium spp. is hampered by difficulties in obtaining sufficient, highly pure genomic DNA from clinical specimens. In this study, we developed procedures for the isolation and enrichment of Cryptosporidium genomic DNA from fecal specimens and verification of DNA purity for whole-genome sequencing. The isolation and enrichment of genomic DNA were achieved by a combination of three oocyst purification steps and whole-genome amplification (WGA) of DNA from purified oocysts. Quantitative PCR (qPCR) analysis of WGA products was used as an initial quality assessment of amplified genomic DNA. The purity of WGA products was assessed by Sanger sequencing of cloned products. Next-generation sequencing tools were used in final evaluations of genome coverage and of the extent of contamination. Altogether, 24 fecal specimens of Cryptosporidium parvum, C. hominis, C. andersoni, C. ubiquitum, C. tyzzeri, and Cryptosporidium chipmunk genotype I were processed with the procedures. As expected, WGA products with low (sequences in Sanger sequencing. The cloning-sequencing analysis, however, showed significant contamination in 5 WGA products (proportion of positive colonies derived from Cryptosporidium genomic DNA, ≤25%). Following this strategy, 20 WGA products from six Cryptosporidium species or genotypes with low (mostly sequencing, generating sequence data covering 94.5% to 99.7% of Cryptosporidium genomes, with mostly minor contamination from bacterial, fungal, and host DNA. These results suggest that the described strategy can be used effectively for the isolation and enrichment of Cryptosporidium DNA from fecal specimens for whole-genome sequencing. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. DNA Polymerase Gamma in Mitochondrial DNA Replication and Repair

    Directory of Open Access Journals (Sweden)

    William C. Copeland

    2003-01-01

    Full Text Available Mutations in mitochondrial DNA (mtDNA are associated with aging, and they can cause tissue degeneration and neuromuscular pathologies known as mitochondrial diseases. Because DNA polymerase γ (pol γ is the enzyme responsible for replication and repair of mitochondrial DNA, the burden of faithful duplication of mitochondrial DNA, both in preventing spontaneous errors and in DNA repair synthesis, falls on pol γ. Investigating the biological functions of pol γ and its inhibitors aids our understanding of the sources of mtDNA mutations. In animal cells, pol γ is composed of two subunits, a larger catalytic subunit of 125–140 kDa and second subunit of 35–55 kDa. The catalytic subunit contains DNA polymerase activity, 3’-5’ exonuclease activity, and a 5’-dRP lyase activity. The accessory subunit is required for highly processive DNA synthesis and increases the affinity of pol gamma to the DNA.

  17. Typing DNA profiles from previously enhanced fingerprints using direct PCR.

    Science.gov (United States)

    Templeton, Jennifer E L; Taylor, Duncan; Handt, Oliva; Linacre, Adrian

    2017-07-01

    Fingermarks are a source of human identification both through the ridge patterns and DNA profiling. Typing nuclear STR DNA markers from previously enhanced fingermarks provides an alternative method of utilising the limited fingermark deposit that can be left behind during a criminal act. Dusting with fingerprint powders is a standard method used in classical fingermark enhancement and can affect DNA data. The ability to generate informative DNA profiles from powdered fingerprints using direct PCR swabs was investigated. Direct PCR was used as the opportunity to generate usable DNA profiles after performing any of the standard DNA extraction processes is minimal. Omitting the extraction step will, for many samples, be the key to success if there is limited sample DNA. DNA profiles were generated by direct PCR from 160 fingermarks after treatment with one of the following dactyloscopic fingerprint powders: white hadonite; silver aluminium; HiFi Volcano silk black; or black magnetic fingerprint powder. This was achieved by a combination of an optimised double-swabbing technique and swab media, omission of the extraction step to minimise loss of critical low-template DNA, and additional AmpliTaq Gold ® DNA polymerase to boost the PCR. Ninety eight out of 160 samples (61%) were considered 'up-loadable' to the Australian National Criminal Investigation DNA Database (NCIDD). The method described required a minimum of working steps, equipment and reagents, and was completed within 4h. Direct PCR allows the generation of DNA profiles from enhanced prints without the need to increase PCR cycle numbers beyond manufacturer's recommendations. Particular emphasis was placed on preventing contamination by applying strict protocols and avoiding the use of previously used fingerprint brushes. Based on this extensive survey, the data provided indicate minimal effects of any of these four powders on the chance of obtaining DNA profiles from enhanced fingermarks. Copyright © 2017

  18. Current developments in forensic interpretation of mixed DNA samples (Review).

    Science.gov (United States)

    Hu, Na; Cong, Bin; Li, Shujin; Ma, Chunling; Fu, Lihong; Zhang, Xiaojing

    2014-05-01

    A number of recent improvements have provided contemporary forensic investigations with a variety of tools to improve the analysis of mixed DNA samples in criminal investigations, producing notable improvements in the analysis of complex trace samples in cases of sexual assult and homicide. Mixed DNA contains DNA from two or more contributors, compounding DNA analysis by combining DNA from one or more major contributors with small amounts of DNA from potentially numerous minor contributors. These samples are characterized by a high probability of drop-out or drop-in combined with elevated stutter, significantly increasing analysis complexity. At some loci, minor contributor alleles may be completely obscured due to amplification bias or over-amplification, creating the illusion of additional contributors. Thus, estimating the number of contributors and separating contributor genotypes at a given locus is significantly more difficult in mixed DNA samples, requiring the application of specialized protocols that have only recently been widely commercialized and standardized. Over the last decade, the accuracy and repeatability of mixed DNA analyses available to conventional forensic laboratories has greatly advanced in terms of laboratory technology, mathematical models and biostatistical software, generating more accurate, rapid and readily available data for legal proceedings and criminal cases.

  19. Covalent DNA-protein crosslinking occurs after hyperthermia and radiation

    International Nuclear Information System (INIS)

    Cress, A.E.; Bowden, G.T.

    1983-01-01

    Covalent DNA-protein crosslinks occur in exponentially growing mouse leukemia cells (L1210) after exposure to ionizing radiation. The amount of DNA-protein crosslinks as measured by a filter binding assay is dose dependent upon X irradiation. Although hyperthermia and radiation in combination are synergistic with respect to cell lethality, the combination does not result in an increase of DNA-protein crosslinks when assayed immediately following treatments. Hyperthermia (43 degrees C/15 min) given prior to radiation does not alter the radiation dose dependency of the amount of initial crosslinking. In addition, the amount of DNA-protein crosslinking produced by heat plus radiation is independent of the length of heating the cells at 43 degrees C. The DNA-protein crosslinks produced by 50-Gy X ray alone are removed after 2 hr at 37 degrees C. However, if hyperthermia (43 degrees C/15 min) is given prior to 100-Gy X ray, the removal of DNA-protein crosslinks is delayed until 4.0 hr after radiation. Phospho-serine and phospho-threonine bonds are not produced with either radiation or the combination of hyperthermia plus radiation as judged by the resistance of the bonds to guanidine hydrochloride. However, hyperthermia plus radiation causes an increase in phosphate to nitrogen type bonding. These results show that radiation alone causes covalent DNA-protein crosslinks. Hyperthermia in combination with radiation does not increase the total amount of the crosslinks but delays the removal of the crosslinks and alters the distribution of the types of chemical bonding. These data suggest that the synergistic action on hyperthermia with radiation is more related to the rate of removal and the type of chemical bonding involved in the covalent DNA-protein crosslinks rather than the amount of DNA-protein crosslinks

  20. A robust assay to measure DNA topology-dependent protein binding affinity.

    Science.gov (United States)

    Litwin, Tamara R; Solà, Maria; Holt, Ian J; Neuman, Keir C

    2015-04-20

    DNA structure and topology pervasively influence aspects of DNA metabolism including replication, transcription and segregation. However, the effects of DNA topology on DNA-protein interactions have not been systematically explored due to limitations of standard affinity assays. We developed a method to measure protein binding affinity dependence on the topology (topological linking number) of supercoiled DNA. A defined range of DNA topoisomers at equilibrium with a DNA binding protein is separated into free and protein-bound DNA populations using standard nitrocellulose filter binding techniques. Electrophoretic separation and quantification of bound and free topoisomers combined with a simple normalization procedure provide the relative affinity of the protein for the DNA as a function of linking number. Employing this assay we measured topology-dependent DNA binding of a helicase, a type IB topoisomerase, a type IIA topoisomerase, a non-specific mitochondrial DNA binding protein and a type II restriction endonuclease. Most of the proteins preferentially bind negatively supercoiled DNA but the details of the topology-dependent affinity differ among proteins in ways that expose differences in their interactions with DNA. The topology-dependent binding assay provides a robust and easily implemented method to probe topological influences on DNA-protein interactions for a wide range of DNA binding proteins. Published by Oxford University Press on behalf of Nucleic Acids Research 2014. This work is written by US Government employees and is in the public domain in the US.

  1. A new structural framework for integrating replication protein A into DNA processing machinery

    Energy Technology Data Exchange (ETDEWEB)

    Brosey, Chris; Yan, Chunli; Tsutakawa, Susan; Heller, William; Rambo, Robert; Tainer, John; Ivanov, Ivaylo; Chazin, Walter

    2013-01-17

    By coupling the protection and organization of single-stranded DNA (ssDNA) with recruitment and alignment of DNA processing factors, replication protein A (RPA) lies at the heart of dynamic multi-protein DNA processing machinery. Nevertheless, how RPA coordinates biochemical functions of its eight domains remains unknown. We examined the structural biochemistry of RPA's DNA-binding activity, combining small-angle X-ray and neutron scattering with all-atom molecular dynamics simulations to investigate the architecture of RPA's DNA-binding core. The scattering data reveal compaction promoted by DNA binding; DNA-free RPA exists in an ensemble of states with inter-domain mobility and becomes progressively more condensed and less dynamic on binding ssDNA. Our results contrast with previous models proposing RPA initially binds ssDNA in a condensed state and becomes more extended as it fully engages the substrate. Moreover, the consensus view that RPA engages ssDNA in initial, intermediate and final stages conflicts with our data revealing that RPA undergoes two (not three) transitions as it binds ssDNA with no evidence for a discrete intermediate state. These results form a framework for understanding how RPA integrates the ssDNA substrate into DNA processing machinery, provides substrate access to its binding partners and promotes the progression and selection of DNA processing pathways.

  2. Supramolecular Complexes of DNA

    Science.gov (United States)

    Zuber, G.; Scherman, D.

    Deoxyribose nucleic acid or DNA is a linear polymer in the form of a double strand, synthesised by sequential polymerisation of a large number of units chosen from among the nucleic bases called purines (adenosine A and guanosine G) and pyrimidines (cytosine C and thymidine T). DNA contains all the genetic information required for life. It exists in the form of a limited number (a few dozen) of very big molecules, called chromosomes. This genetic information is first of all transcribed. In this process, a restricted fragment of the DNA called a gene is copied in the form of ribonucleic acid, or RNA. This RNA is itself a polymer, but with a single strand in which the sequence of nucleic acids is schematically analogous to the sequence on one of the two strands of the transcribed DNA. Finally, this RNA is translated into a protein, yet another linear polymer. The proteins make up the main part of the active constituents ensuring the survival of the cell. Any loss of information, either by mutation or by deletion of the DNA, will cause an imbalance in the cell's metabolism that may in turn lead to incurable pathologies. Several strategies have been developed to reduce the consequences of such genetic deficiencies or, more generally, to act, by amplifying or suppressing them, on the mechanisms leading from the reading of the genetic information to the production of proteins: Strategies aiming to introduce synthetic DNA or RNA, which selectively block the expression of certain genes, are now being studied by an increasing number of research scientists and pharmacologists. They use antisense oligodeoxyribonucleotides or interfering oligoribonucleotides and they already have clinical applications. This kind of therapy is often called gene pharmacology. Other, more ambitious strategies aim to repair in situ mutated or incomplete DNA within the chromosomes themselves, by introducing short sequences of DNA or RNA which recognise and take the place of mutations. This is the

  3. Metric representation of DNA sequences.

    Science.gov (United States)

    Wu, Z B

    2000-07-01

    A metric representation of DNA sequences is borrowed from symbolic dynamics. In view of this method, the pattern seen in the chaos game representation of DNA sequences is explained as the suppression of certain nucleotide strings in the DNA sequences. Frequencies of short nucleotide strings and suppression of the shortest ones in the DNA sequences can be determined by using the metric representation.

  4. Blood extracellular DNA after irradiation

    International Nuclear Information System (INIS)

    Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.

    1993-01-01

    It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action

  5. Correlation of iris biometrics and DNA

    DEFF Research Database (Denmark)

    Harder, Stine; Clemmensen, Line Katrine Harder; Dahl, Anders Bjorholm

    2013-01-01

    The presented work concerns prediction of complex human phenotypes from genotypes. We were interested in correlating iris color and texture with DNA. Our data consist of 212 eye images along with DNA: 32 single-nucleotide polymorphisms (SNPs). We used two types of biometrics to describe the eye...... images: One for iris color and one for iris texture. Both biometrics were high dimensional and a sparse principle component analysis (SPCA) reduced the dimensions and resulted in a representation of data with good interpretability. The correlations between the sparse principal components (SPCs......) and the 32 SNPs were found using a canonical correlation analysis (CCA). The result was a single significant canonical correlation (CC) for both biometrics. Each CC comprised two correlated canonical variables, consisting of a linear combination of SPCs and a linear combination of SNPs, respectively...

  6. DNA triplex structures in neurodegenerative disorder, Friedreich's ...

    Indian Academy of Sciences (India)

    canonical B-DNA structure or 'unusual' DNA structure. The unusual DNA structures like DNA-hairpin, cruciform, Z-DNA, triplex and tetraplex are represented as hotspots of chromosomal breaks, homologous recombination and gross ...

  7. Defects of mitochondrial DNA replication.

    Science.gov (United States)

    Copeland, William C

    2014-09-01

    Mitochondrial DNA is replicated by DNA polymerase γ in concert with accessory proteins such as the mitochondrial DNA helicase, single-stranded DNA binding protein, topoisomerase, and initiating factors. Defects in mitochondrial DNA replication or nucleotide metabolism can cause mitochondrial genetic diseases due to mitochondrial DNA deletions, point mutations, or depletion, which ultimately cause loss of oxidative phosphorylation. These genetic diseases include mitochondrial DNA depletion syndromes such as Alpers or early infantile hepatocerebral syndromes, and mitochondrial DNA deletion disorders, such as progressive external ophthalmoplegia, ataxia-neuropathy, or mitochondrial neurogastrointestinal encephalomyopathy. This review focuses on our current knowledge of genetic defects of mitochondrial DNA replication (POLG, POLG2, C10orf2, and MGME1) that cause instability of mitochondrial DNA and mitochondrial disease. © The Author(s) 2014.

  8. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  9. Eukaryotic DNA Replicases

    KAUST Repository

    Zaher, Manal S.

    2014-11-21

    The current model of the eukaryotic DNA replication fork includes three replicative DNA polymerases, polymerase α/primase complex (Pol α), polymerase δ (Pol δ), and polymerase ε (Pol ε). The primase synthesizes 8–12 nucleotide RNA primers that are extended by the DNA polymerization activity of Pol α into 30–35 nucleotide RNA-DNA primers. Replication factor C (RFC) opens the polymerase clamp-like processivity factor, proliferating cell nuclear antigen (PCNA), and loads it onto the primer-template. Pol δ utilizes PCNA to mediate highly processive DNA synthesis, while Pol ε has intrinsic high processivity that is modestly stimulated by PCNA. Pol ε replicates the leading strand and Pol δ replicates the lagging strand in a division of labor that is not strict. The three polymerases are comprised of multiple subunits and share unifying features in their large catalytic and B subunits. The remaining subunits are evolutionarily not related and perform diverse functions. The catalytic subunits are members of family B, which are distinguished by their larger sizes due to inserts in their N- and C-terminal regions. The sizes of these inserts vary among the three polymerases, and their functions remain largely unknown. Strikingly, the quaternary structures of Pol α, Pol δ, and Pol ε are arranged similarly. The catalytic subunits adopt a globular structure that is linked via its conserved C-terminal region to the B subunit. The remaining subunits are linked to the catalytic and B subunits in a highly flexible manner.

  10. DNA repair synthesis in human fibroblasts requires DNA polymerase delta

    International Nuclear Information System (INIS)

    Nishida, C.; Reinhard, P.; Linn, S.

    1988-01-01

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

  11. Site accessibility tailors DNA cleavage by restriction enzymes in DNA confined monolayers.

    Science.gov (United States)

    Rotella, Chiara; Doni, Giovanni; Bosco, Alessandro; Castronovo, Matteo; De Vita, Alessandro; Casalis, Loredana; Pavan, Giovanni M; Parisse, Pietro

    2017-05-18

    Density-tunable nanografted monolayers (NAMs) of short oligonucleotide sequences on gold surfaces show novel properties that make them suitable for advanced biosensing applications, and in particular to study the effects of crowding and confinement on biomolecular interactions. Here, combining atomic force microscopy nanolithography, topography measurements and coarse-grained molecular dynamics simulations, we investigated restriction enzyme reaction mechanisms within confined DNA brushes highlighting the role played by the DNA sequence conformation and restriction site position along the chain, respectively, in determining the accessibility of the enzyme, and its consequent cleavage efficiency.

  12. DNA methylation in obesity

    Directory of Open Access Journals (Sweden)

    Małgorzata Pokrywka

    2014-11-01

    Full Text Available The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes, have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described.

  13. DNA Topoisomerases in Transcription

    DEFF Research Database (Denmark)

    Rødgaard, Morten Terpager

    2015-01-01

    This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most of the ex......This Ph.D. thesis summarizes the main results of my studies on the interplay between DNA topoisomerases and transcription. The work was performed from 2011 to 2015 at Aarhus University in the Laboratory of Genome Research, and was supervised by associate professor Anni H. Andersen. Most...... topoisomerase-DNA cleavage complex. The second study is an investigation of how topoisomerases influence gene regulation by keeping the genome in an optimal topological state....

  14. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  15. Principles of DNA architectonics: design of DNA-based nanoobjects

    International Nuclear Information System (INIS)

    Vinogradova, O A; Pyshnyi, D V

    2012-01-01

    The methods of preparation of monomeric DNA blocks that serve as key building units for the construction of complex DNA objects are described. Examples are given of the formation of DNA blocks based on native and modified oligonucleotide components using hydrogen bonding and nucleic acid-specific types of bonding and also some affinity interactions with RNA, proteins, ligands. The static discrete and periodic two- and three-dimensional DNA objects reported to date are described systematically. Methods used to prove the structures of DNA objects and the prospects for practical application of nanostructures based on DNA and its analogues in biology, medicine and biophysics are considered. The bibliography includes 195 references.

  16. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  17. Topological Linkage of DNA Tiles Bonded by Paranemic Cohesion.

    Science.gov (United States)

    Ohayon, Yoel P; Sha, Ruojie; Flint, Ortho; Chandrasekaran, Arun Richard; Abdallah, Hatem O; Wang, Tong; Wang, Xing; Zhang, Xiaoping; Seeman, Nadrian C

    2015-10-27

    Catenation is the process by which cyclic strands are combined like the links of a chain, whereas knotting changes the linking properties of a single strand. In the cell, topoisomerases catalyzing strand passage operations enable the knotting and catenation of DNA so that single- or double-stranded segments can be passed through each other. Here, we use a system of closed DNA structures involving a paranemic motif, called PX-DNA, to bind double strands of DNA together. These PX-cohesive closed molecules contain complementary loops whose linking by Escherichia coli topoisomerase 1 (Topo 1) leads to various types of catenated and knotted structures. We were able to obtain specific DNA topological constructs by varying the lengths of the complementary tracts between the complementary loops. The formation of the structures was analyzed by denaturing gel electrophoresis, and the various topologies of the constructs were characterized using the program Knotilus.

  18. Metabolism, Genomics, and DNA Repair in the Mouse Aging Liver

    Directory of Open Access Journals (Sweden)

    Michel Lebel

    2011-01-01

    Full Text Available The liver plays a pivotal role in the metabolism of nutrients, drugs, hormones, and metabolic waste products, thereby maintaining body homeostasis. The liver undergoes substantial changes in structure and function within old age. Such changes are associated with significant impairment of many hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions, such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper covers some of the DNA repair pathways affecting liver homeostasis with age using rodents as model systems.

  19. Hydration induced stress on DNA monolayers grafted on microcantilevers.

    Science.gov (United States)

    Domínguez, Carmen M; Kosaka, Priscila M; Mokry, Guillermo; Pini, Valerio; Malvar, Oscar; del Rey, Mercedes; Ramos, Daniel; San Paulo, Alvaro; Tamayo, Javier; Calleja, Montserrat

    2014-09-16

    Surface tethered single-stranded DNA films are relevant biorecognition layers for oligonucleotide sequence identification. Also, hydration induced effects on these films have proven useful for the nanomechanical detection of DNA hybridization. Here, we apply nanomechanical sensors and atomic force microscopy to characterize in air and upon varying relative humidity conditions the swelling and deswelling of grafted single stranded and double stranded DNA films. The combination of these techniques validates a two-step hybridization process, where complementary strands first bind to the surface tethered single stranded DNA probes and then slowly proceed to a fully zipped configuration. Our results also demonstrate that, despite the slow hybridization kinetics observed for grafted DNA onto microcantilever surfaces, ex situ sequence identification does not require hybridization times typically longer than 1 h, while quantification is a major challenge.

  20. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  1. DNA templated magnetic nanoparticles

    Science.gov (United States)

    Kinsella, Joseph M.

    Recent discoveries in nanoscience are predicted to potentially revolutionize future technologies in an extensive number of fields. These developments are contingent upon discovering new and often unconventional methods to synthesize and control nanoscale components. Nature provides several examples of working nanotechnology such as the use of programmed self assembly to build and deconstruct complex molecular systems. We have adopted a method to control the one dimensional assembly of magnetic nanoparticles using DNA as a scaffold molecule. With this method we have demonstrated the ability to organize 5 nm particles into chains that stretch up to ˜20 mum in length. One advantage of using DNA compared is the ability of the molecule to interact with other biomolecules. After assembling particles onto DNA we have been able to cleave the molecule into smaller fragments using restriction enzymes. Using ligase enzymes we have re-connected these fragments, coated with either gold or iron oxide, to form long one-dimensional arrangements of the two different types of nanoparticles on a single molecular guide. We have also created a sensitive magnetic field sensor by incorporating magnetic nanoparticle coated DNA strands with microfabricated electrodes. The IV characteristics of the aligned nanoparticles are dependant on the magnitude of an externally applied magnetic field. This transport phenomenon known as tunneling magnetoresistance (TMR) shows room temperature resistance of our devices over 80% for cobalt ferrite coated DNA when a field of 20 kOe is applied. In comparison, studies using two dimensional nanoparticle films of irox oxides xii only exhibit a 35% MR effect. Confinement into one dimension using the DNA guide produces a TMR mechanism which produces significant increases in magnetoresistance. This property can be utilized for applications in magnetic field sensing, data storage, and logic elements.

  2. Electrochemical DNA sensor-based strategy for sensitive detection of DNA demethylation and DNA demethylase activity.

    Science.gov (United States)

    Shen, Qingming; Fan, Mengxing; Yang, Yin; Zhang, Hui

    2016-08-31

    DNA demethylation and demethylase activity play important roles in DNA self-repair, and their detection is key to early diagnosis of fatal diseases. Herein, a facile electrochemical DNA (E-DNA) sensor was developed for the sensitive detection of DNA demethylation and demethylase activity based on an enzyme cleavage strategy. The thiol modified hemi-methylated hairpin probe DNA (pDNA) was self-assembled on a Au electrode surface through the formation of AuS bonds. The hemi-methylated pDNA served as the substrate of DNA demethylase (using methyl-CpG-binding domain protein 2 (MBD2) as an example). Following demethylation, the hairpin stem was then recognized and cleaved by BstUI endonuclease. The ferrocene carboxylic acid (FcA)-tagged pDNA strands were released into the buffer solution from the electrode surface, resulting in a significant decrease of electrochemical signal and providing a means to observe DNA demethylation. The activity of DNA demethylase was analyzed in the concentration ranging from 0.5 to 500 ng mL(-1) with a limit of detection as low as 0.17 ng mL(-1). With high specificity and sensitivity, rapid response, and low cost, this simple E-DNA sensor provides a unique platform for the sensitive detection of DNA demethylation, DNA demethylase activity, and related molecular diagnostics and drug screening. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Only one ATP-binding DnaX subunit is required for initiation complex formation by the Escherichia coli DNA polymerase III holoenzyme.

    Science.gov (United States)

    Wieczorek, Anna; Downey, Christopher D; Dallmann, H Garry; McHenry, Charles S

    2010-09-17

    The DnaX complex (DnaX(3)δδ'χ psi) within the Escherichia coli DNA polymerase III holoenzyme serves to load the dimeric sliding clamp processivity factor, β(2), onto DNA. The complex contains three DnaX subunits, which occur in two forms: τ and the shorter γ, produced by translational frameshifting. Ten forms of E. coli DnaX complex containing all possible combinations of wild-type or a Walker A motif K51E variant τ or γ have been reconstituted and rigorously purified. DnaX complexes containing three DnaX K51E subunits do not bind ATP. Comparison of their ability to support formation of initiation complexes, as measured by processive replication by the DNA polymerase III holoenzyme, indicates a minimal requirement for one ATP-binding DnaX subunit. DnaX complexes containing two mutant DnaX subunits support DNA synthesis at about two-thirds the level of their wild-type counterparts. β(2) binding (determined functionally) is diminished 12-30-fold for DnaX complexes containing two K51E subunits, suggesting that multiple ATPs must be bound to place the DnaX complex into a conformation with maximal affinity for β(2). DNA synthesis activity can be restored by increased concentrations of β(2). In contrast, severe defects in ATP hydrolysis are observed upon introduction of a single K51E DnaX subunit. Thus, ATP binding, hydrolysis, and the ability to form initiation complexes are not tightly coupled. These results suggest that although ATP hydrolysis likely enhances β(2) loading, it is not absolutely required in a mechanistic sense for formation of functional initiation complexes.

  4. Radiation damage to DNA in aqueous solution: effects of radiosensitizers

    International Nuclear Information System (INIS)

    Ward, J.F.

    1977-01-01

    Systems are described for examining the molecular mode of action of anoxic radiosensitizers with DNA--OH radicals. Pulse radiolysis showed that NPPN reacts with these radicals even in the presence of 0.5mM oxygen. Analysis of low molecular weight products liberated from DNA by irradiation showed that NPPN does not act in an oxygen-like way but that misonidazole does. Thus a molecular rationale exists for the use of combinations of radiosensitizers

  5. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  6. A Novel Image Encryption Algorithm Based on DNA Subsequence Operation

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2012-01-01

    Full Text Available We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc. combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack.

  7. Statistical assignment of DNA sequences using Bayesian phylogenetics

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Huelsenbeck, John P.

    2008-01-01

    We provide a new automated statistical method for DNA barcoding based on a Bayesian phylogenetic analysis. The method is based on automated database sequence retrieval, alignment, and phylogenetic analysis using a custom-built program for Bayesian phylogenetic analysis. We show on real data......-analysis of previously published ancient DNA data and show that, with high statistical confidence, most of the published sequences are in fact of Neanderthal origin. However, there are several cases of chimeric sequences that are comprised of a combination of both Neanderthal and modern human DNA....

  8. Modification of cytogenetic effect of radiation using DNA synthesis inhibitors

    International Nuclear Information System (INIS)

    Fesenko, Eh.V.; Ovchinnikova, V.G.; Luchnik, N.V.

    1984-01-01

    It is shown that on the basis of results obtained when studying cytoigenetic and modfying effect of DNA synthesis inhibitors two new concepts can be formulated: the concept of pseudomutagenes and hypothesis of existence of two periods in the cell cycle considerable for chromosome aberration formations and not correlating with the stage of replicative DNA synthesis. Results of experiments performed on the combined effect permit to suppose that the mechanism of ''regular'' repair is damaged by inhibitors of DNA synthesis while the mechanism of ''emergency'' repair is resistant to these effects

  9. Extracting DNA of nematodes communities from Argentine Pampas agricultural soils

    Directory of Open Access Journals (Sweden)

    Eduardo A. Mondino

    2015-06-01

    Full Text Available We examined four strategies (Tris/EDTA, sodium dodecyl sulfate, Chelex 100 resin and cetyltrimethylammonium bromide -CTAB- for extracting nucleic acid (DNA from communities of nematodes. Nematodes were isolated from an agricultural area under different management of long-term crop rotation experiment from Argentina during three seasons. After DNA extraction, Polymerase Chain Reaction-amplifications were performed and considered as indicators of successful DNA extraction. The CTAB combined with proteinase K and phenol-chloroform-isoamyl alcohol was the unique successful method because positive amplifications were obtained by using both eukaryotic and nematode specific primers. This work could contribute to biodiversity studies of nematodes on agroecosystems.

  10. Structures of DNA containing psoralen crosslink and thymine dimer

    International Nuclear Information System (INIS)

    Kim, S.H.; Pearlman, D.A.; Holbrook, S.R.; Pirkle, D.

    1985-01-01

    UV irradiation by itself or in conjunction with other chemicals can cause covalent damages to DNA in living cells. To overcome the detrimental effect of DNA damage, cells developed a repair mechanism by which damaged DNA is repaired. In the absence of such repair, cell malfunction or cell death can occur. Two most studied radiation-induced DNA damage are thymine dimer formation by UV irradiation and psoralen crosslink by combination of psoralens and UV: In the former, two adjacent thymine bases on a strand of DNA are fused by forming cyclobutane ring, and in the latter, one pyrimidine on one DNA strand is crosslinked to another pyrimidine on the other strand via a psoralen. The authors' objective is to deduce the structure of DNA segment which contains a psoralen crosslink or a thymine dimer using the combination of results of X-ray crystallographic studies, molecular model building, and energy minimization. These structural features may be important for understanding the biological effects of such damages and for the recognition by the repair enzymes

  11. Identifying Fishes through DNA Barcodes and Microarrays.

    Science.gov (United States)

    Kochzius, Marc; Seidel, Christian; Antoniou, Aglaia; Botla, Sandeep Kumar; Campo, Daniel; Cariani, Alessia; Vazquez, Eva Garcia; Hauschild, Janet; Hervet, Caroline; Hjörleifsdottir, Sigridur; Hreggvidsson, Gudmundur; Kappel, Kristina; Landi, Monica; Magoulas, Antonios; Marteinsson, Viggo; Nölte, Manfred; Planes, Serge; Tinti, Fausto; Turan, Cemal; Venugopal, Moleyur N; Weber, Hannes; Blohm, Dietmar

    2010-09-07

    International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection. This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S), cytochrome b (cyt b), and cytochrome oxidase subunit I (COI) for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ) phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90%) renders the DNA barcoding marker as rather unsuitable for this high-throughput technology. Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.

  12. Identifying Fishes through DNA Barcodes and Microarrays.

    Directory of Open Access Journals (Sweden)

    Marc Kochzius

    Full Text Available BACKGROUND: International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection. METHODOLOGY/PRINCIPAL FINDINGS: This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S, cytochrome b (cyt b, and cytochrome oxidase subunit I (COI for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90% renders the DNA barcoding marker as rather unsuitable for this high-throughput technology. CONCLUSIONS/SIGNIFICANCE: Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.

  13. EGNAS: an exhaustive DNA sequence design algorithm

    Directory of Open Access Journals (Sweden)

    Kick Alfred

    2012-06-01

    Full Text Available Abstract Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at http://www.chm.tu-dresden.de/pc6/EGNAS.

  14. DNA Nanotechnology for Cancer Therapy.

    Science.gov (United States)

    Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

    2016-01-01

    DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients.

  15. DNA Nanotechnology for Cancer Therapy

    Science.gov (United States)

    Kumar, Vinit; Palazzolo, Stefano; Bayda, Samer; Corona, Giuseppe; Toffoli, Giuseppe; Rizzolio, Flavio

    2016-01-01

    DNA nanotechnology is an emerging and exciting field, and represents a forefront frontier for the biomedical field. The specificity of the interactions between complementary base pairs makes DNA an incredible building material for programmable and very versatile two- and three-dimensional nanostructures called DNA origami. Here, we analyze the DNA origami and DNA-based nanostructures as a drug delivery system. Besides their physical-chemical nature, we dissect the critical factors such as stability, loading capability, release and immunocompatibility, which mainly limit in vivo applications. Special attention was dedicated to highlighting the boundaries to be overcome to bring DNA nanostructures closer to the bedside of patients. PMID:27022418

  16. DNA polymerase having modified nucleotide binding site for DNA sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles

    1997-01-01

    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  17. Cytotoxic, DNA binding, DNA cleavage and antibacterial studies of ...

    Indian Academy of Sciences (India)

    fluoroquinolone complexes. Mohan N ... DNA-binding properties of Ru complexes have been studied by means of absorption spectrophotometry and viscosity measurements as well as their HS DNA cleavage properties by means of agarose gel ...

  18. DNA qualification workflow for next generation sequencing of histopathological samples.

    Directory of Open Access Journals (Sweden)

    Michele Simbolo

    workflow for qualification of DNA preparations should include the sequential combination of NanoDrop and Qubit to assess the purity and quantity of dsDNA, respectively.

  19. DNA Qualification Workflow for Next Generation Sequencing of Histopathological Samples

    Science.gov (United States)

    Simbolo, Michele; Gottardi, Marisa; Corbo, Vincenzo; Fassan, Matteo; Mafficini, Andrea; Malpeli, Giorgio; Lawlor, Rita T.; Scarpa, Aldo

    2013-01-01

    qualification of DNA preparations should include the sequential combination of NanoDrop and Qubit to assess the purity and quantity of dsDNA, respectively. PMID:23762227

  20. Relaciones filogenéticas de la subtribu Oncidiinae (Orchidaceae inferidas a partir de caracteres estructurales y secuencias de ADN (ITS y matK: un enfoque combinado Phylogenetic relationships of the subtribe Oncidiinae (Orchidaceae inferred from structural and DNA sequences (matK, ITS: a combined approach

    Directory of Open Access Journals (Sweden)

    Estela Sandoval-Zapotitla

    2010-08-01

    Full Text Available Para conocer el valor que los caracteres estructurales tienen para la reconstrucción filogenética de la subtribu Oncidiinae se realizó un análisis de parsimonia combinado con base en datos anatómico foliares, morfológicos y secuencias de ADN de las regiones matK e ITS. Se obtuvieron 2 árboles igualmente parsimoniosos que difieren entre sí sólo en la posición de 1 taxon. Oncidiinae se recobró como monofilética, caracterizada por la presencia de papilas adaxiales y abaxiales en la hoja. Siete sinapomorfías estructurales definen 5 clados con soporte alto, incluyendo: 1 clado Lockhartia, definido por una lámina foliar conduplicada; 2 clado Trichocentrum, definido por una hoja anfistomática y 2 o más estratos de haces vasculares; 3 clado compuesto por los géneros Fernandezia, Ornithocephalus y Telipogon, agrupados por la ausencia de estégmatos en haces vasculares y su crecimiento monopodial; 4 un gran clado compuesto por la mayoría de los clados derivados de Oncidiinae, definido por la presencia de 2 estratos en la hipodermis adaxial; 5 clado Tolumnia, definido por una hoja con lámina sólo conduplicada marginalmente. La mayoría de los clados adicionales están apoyados por combinaciones de caracteres estructurales; los clados Trichopilia y Miltonia, al igual que las ramas terminales de algunos de los clados con posición intermedia no están apoyados por caracteres estructurales. Los clados más derivados están apoyados por caracteres estructurales resueltos como reversiones.With the aim of exploring the significance of structural characters in phylogeny estimation of subtribe Oncidiinae, a combined parsimony analysis based on leaf foliar-anatomical, morphological and DNA sequence data of the matK and ITS regions was carried out. Two equally parsimonious trees were obtained which differ only in the position of 1 taxon. Oncidiinae was recovered as monophyletic and characterized by the presence of abaxial and adaxial leaf

  1. Analysis of Protein-DNA Interaction by Chromatin Immunoprecipitation and DNA Tiling Microarray (ChIP-on-chip).

    Science.gov (United States)

    Gao, Hui; Zhao, Chunyan

    2018-01-01

    Chromatin immunoprecipitation (ChIP) has become the most effective and widely used tool to study the interactions between specific proteins or modified forms of proteins and a genomic DNA region. Combined with genome-wide profiling technologies, such as microarray hybridization (ChIP-on-chip) or massively parallel sequencing (ChIP-seq), ChIP could provide a genome-wide mapping of in vivo protein-DNA interactions in various organisms. Here, we describe a protocol of ChIP-on-chip that uses tiling microarray to obtain a genome-wide profiling of ChIPed DNA.

  2. DNA-dependent protein kinase (DAN-PK), a key enzyme in the re-ligation of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Hennequin, C.; Averbeck, D.

    1999-01-01

    Repair pathways of DNA are now defined and some important findings have been discovered in the last few years. DNA non-homologous end-joining (NEH) is a crucial process in the repair of radiation-induced double-strand breaks (DSBs). NHEj implies at least three steps: the DNA free-ends must get closer, preparation of the free-ends by exonucleases and then a transient hybridization in a region of DNA with weak homology. DNA-dependent protein kinase (DNA-PK) is the key enzyme in this process. DNA-PK is a nuclear serine/threonine kinase that comprises three components: a catalytic subunit (DNA-PK cs ) and two regulatory subunits, DNA-binding proteins, Ku80 and Ku70. The severe combined immuno-deficient (scid) mice are deficient in DNA-PK cs : this protein is involved both in DNA repair and in the V(D)J recombination of immunoglobulin and T-cell receptor genes. It is a protein-kinase of the P13-kinase family and which can phosphorylate Ku proteins, p53 and probably some other proteins still unknown. DNA-PK is an important actor of DSBs repair (induced by ionising radiations or by drugs like etoposide), but obviously it is not the only mechanism existing in the cell for this function. Some others, like homologous recombination, seem also to have a great importance for cell survival. (authors)

  3. Validated methodology for quantifying infestation levels of dreissenid mussels in environmental DNA (eDNA) samples.

    Science.gov (United States)

    Peñarrubia, Luis; Alcaraz, Carles; Vaate, Abraham Bij de; Sanz, Nuria; Pla, Carles; Vidal, Oriol; Viñas, Jordi

    2016-12-14

    The zebra mussel (Dreissena polymorpha Pallas, 1771) and the quagga mussel (D. rostriformis Deshayes, 1838) are successful invasive bivalves with substantial ecological and economic impacts in freshwater systems once they become established. Since their eradication is extremely difficult, their detection at an early stage is crucial to prevent spread. In this study, we optimized and validated a qPCR detection method based on the histone H2B gene to quantify combined infestation levels of zebra and quagga mussels in environmental DNA samples. Our results show specific dreissenid DNA present in filtered water samples for which microscopic diagnostic identification for larvae failed. Monitoring a large number of locations for invasive dreissenid species based on a highly specific environmental DNA qPCR assay may prove to be an essential tool for management and control plans focused on prevention of establishment of dreissenid mussels in new locations.

  4. Fungal DNA barcoding.

    Science.gov (United States)

    Xu, Jianping

    2016-11-01

    Fungi are ubiquitous in both natural and human-made environments. They play important roles in the health of plants, animals, and humans, and in broad ecosystem functions. Thus, having an efficient species-level identification system could significantly enhance our ability to treat fungal diseases and to monitor the spatial and temporal patterns of fungal distributions and migrations. DNA barcoding is a potent approach for rapid identification of fungal specimens, generating novel species hypothesis, and guiding biodiversity and ecological studies. In this mini-review, I briefly summarize (i) the history of DNA sequence-based fungal identification; (ii) the emergence of the ITS region as the consensus primary fungal barcode; (iii) the use of the ITS barcodes to address a variety of issues on fungal diversity from local to global scales, including generating a large number of species hypothesis; and (iv) the problems with the ITS barcode region and the approaches to overcome these problems. Similar to DNA barcoding research on plants and animals, significant progress has been achieved over the last few years in terms of both the questions being addressed and the foundations being laid for future research endeavors. However, significant challenges remain. I suggest three broad areas of research to enhance the usefulness of fungal DNA barcoding to meet the current and future challenges: (i) develop a common set of primers and technologies that allow the amplification and sequencing of all fungi at both the primary and secondary barcode loci; (ii) compile a centralized reference database that includes all recognized fungal species as well as species hypothesis, and allows regular updates from the research community; and (iii) establish a consensus set of new species recognition criteria based on barcode DNA sequences that can be applied across the fungal kingdom.

  5. The dynamic interplay between DNA topoisomerases and DNA topology.

    Science.gov (United States)

    Seol, Yeonee; Neuman, Keir C

    2016-11-01

    Topological properties of DNA influence its structure and biochemical interactions. Within the cell, DNA topology is constantly in flux. Transcription and other essential processes, including DNA replication and repair, not only alter the topology of the genome but also introduce additional complications associated with DNA knotting and catenation. These topological perturbations are counteracted by the action of topoisomerases, a specialized class of highly conserved and essential enzymes that actively regulate the topological state of the genome. This dynamic interplay among DNA topology, DNA processing enzymes, and DNA topoisomerases is a pervasive factor that influences DNA metabolism in vivo. Building on the extensive structural and biochemical characterization over the past four decades that has established the fundamental mechanistic basis of topoisomerase activity, scientists have begun to explore the unique roles played by DNA topology in modulating and influencing the activity of topoisomerases. In this review we survey established and emerging DNA topology-dependent protein-DNA interactions with a focus on in vitro measurements of the dynamic interplay between DNA topology and topoisomerase activity.

  6. Electrochemical DNA Sensors for Detection of DNA Damage

    Directory of Open Access Journals (Sweden)

    Ana Maria Oliveira Brett

    2005-11-01

    Full Text Available Electrochemical devices have received particular attention due to their rapiddetection and great sensitivity for the evaluation of DNA-hazard compounds interactionmechanisms. Several types of bioanalytical method use nucleic acids probes to detect DNAdamage. This article reviews current directions and strategies in the development andapplications of electrochemical DNA sensors for the detection of DNA damage.

  7. The influence of radio- and chemotherapy on DNA repair of peripheral lymphocytes of tumor patients

    International Nuclear Information System (INIS)

    Klein, W.; Alth, G.; Klein, H.; Koren, H.

    1979-07-01

    The influence of radiotherapy and chemotherapy, respectively, on DNA excision repair was investigated in lymphocytes of the peripheral blood of 10 and 5 patients with malignancies. No effects on DNA repair were found using only betatrone of 60 Co-irradiation under normal conditions. Combination of both irradiation schedules over a longer period of therapy provoked an inhibition of DNA repair. Chemotherapy inhibits DNA repair immediately after starting therapy, but after relatively short time, the extent of DNA repair increases above normal level. (author)

  8. Perspective on the pipeline of drugs being developed with modulation of DNA damage as a target.

    Science.gov (United States)

    Plummer, Ruth

    2010-09-15

    Inhibitors of various elements of the DNA repair pathways have entered clinical development or are in late preclinical stages of drug development. It was initially considered that agents targeting DNA repair would act to overcome tumor resistance to chemotherapy and radiotherapy. More recent data have shown that targeting DNA repair pathways can be effective in selected tumors via a synthetically lethal route, with single agent activity having been shown with poly-ADP ribose polymerase (PARP) inhibitors. An increased understanding of the biology and interaction of the DNA repair pathways also means that rational combination of DNA repair inhibitors may also give great benefit in the clinic. ©2010 AACR.

  9. Automated Robotic Liquid Handling Assembly of Modular DNA Devices.

    Science.gov (United States)

    Ortiz, Luis; Pavan, Marilene; McCarthy, Lloyd; Timmons, Joshua; Densmore, Douglas M

    2017-12-01

    Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available "design space" represented by "devices" created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction. Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols. The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA

  10. Charge-transfer interactions of Cr species with DNA.

    Science.gov (United States)

    Nowicka, Anna M; Matysiak-Brynda, Edyta; Hepel, Maria

    2017-10-01

    Interactions of Cr species with nucleic acids in living organisms depend strongly on Cr oxidation state and the environmental conditions. As the effects of these interactions range from benign to pre-mutagenic to carcinogenic, careful assessment of the hazard they pose to human health is necessary. We have investigated methods that would enable quantifying the DNA damage caused by Cr species under varying environmental conditions, including UV, O 2 , and redox potential, using simple instrumental techniques which could be in future combined into a field-deployable instrumentation. We have employed electrochemical quartz crystal nanogravimetry (EQCN), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS) to evaluate the extent of DNA damage expressed in terms of guanine oxidation yield (η) and changes in specific characteristics provided by these techniques. The effects of the interactions of Cr species with DNA were analyzed using a model calf thymus DNA (ctDNA) film on a gold electrode (Au@ctDNA) in different media, including: (i) Cr(VI), (ii) Cr(VI) reduced at -0.2V, (iii) Cr(III)+UV radiation+O 2 , and Cr(III), obtaining the η values: 7.4±1.4, 1.5±0.4, 1.1±0.31%, and 0%, respectively, thus quantifying the hazard posed. The EIS measurements have enabled utilizing the decrease in charge-transfer resistance (R ct ) for ferri/ferrocyanide redox probe at an Au@ctDNA electrode to assess the oxidative ctDNA damage by Cr(VI) species. In this case, circular dichroism indicates an extensive damage to the ctDNA hydrogen bonding. On the other hand, Cr(III) species have not induced any damage to ctDNA, although the EQCN measurements show an electrostatic binding to DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. DNA damage and repair in age-related macular degeneration

    International Nuclear Information System (INIS)

    Szaflik, Jacek P.; Janik-Papis, Katarzyna; Synowiec, Ewelina; Ksiazek, Dominika; Zaras, Magdalena; Wozniak, Katarzyna; Szaflik, Jerzy; Blasiak, Janusz

    2009-01-01

    Age-related macular degeneration (AMD) is a retinal degenerative disease that is the main cause of vision loss in individuals over the age of 55 in the Western world. Clinically relevant AMD results from damage to the retinal pigment epithelial (RPE) cells thought to be mainly caused by oxidative stress. The stress also affects the DNA of RPE cells, which promotes genome instability in these cells. These effects may coincide with the decrease in the efficacy of DNA repair with age. Therefore individuals with DNA repair impaired more than average for a given age may be more susceptible to AMD if oxidative stress affects their RPE cells. This may be helpful in AMD risk assessment. In the present work we determined the level of basal (measured in the alkaline comet assay) endogenous and endogenous oxidative DNA damage, the susceptibility to exogenous mutagens and the efficacy of DNA repair in lymphocytes of 100 AMD patients and 110 age-matched individuals without visual disturbances. The cells taken from AMD patients displayed a higher extent of basal endogenous DNA damage without differences between patients of dry and wet forms of the disease. DNA double-strand breaks did not contribute to the observed DNA damage as checked by the neutral comet assay and pulsed field gel electrophoresis. The extent of oxidative modification to DNA bases was grater in AMD patients than in the controls, as probed by DNA repair enzymes NTH1 and Fpg. Lymphocytes from AMD patients displayed a higher sensitivity to hydrogen peroxide and UV radiation and repaired lesions induced by these factors less effectively than the cells from the control individuals. We postulate that the impaired efficacy of DNA repair may combine with enhanced sensitivity of RPE cells to blue and UV lights, contributing to the pathogenesis of AMD.

  12. DNA damage and repair in age-related macular degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Szaflik, Jacek P. [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Janik-Papis, Katarzyna; Synowiec, Ewelina; Ksiazek, Dominika [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Zaras, Magdalena [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Wozniak, Katarzyna [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Szaflik, Jerzy [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Blasiak, Janusz, E-mail: januszb@biol.uni.lodz.pl [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland)

    2009-10-02

    Age-related macular degeneration (AMD) is a retinal degenerative disease that is the main cause of vision loss in individuals over the age of 55 in the Western world. Clinically relevant AMD results from damage to the retinal pigment epithelial (RPE) cells thought to be mainly caused by oxidative stress. The stress also affects the DNA of RPE cells, which promotes genome instability in these cells. These effects may coincide with the decrease in the efficacy of DNA repair with age. Therefore individuals with DNA repair impaired more than average for a given age may be more susceptible to AMD if oxidative stress affects their RPE cells. This may be helpful in AMD risk assessment. In the present work we determined the level of basal (measured in the alkaline comet assay) endogenous and endogenous oxidative DNA damage, the susceptibility to exogenous mutagens and the efficacy of DNA repair in lymphocytes of 100 AMD patients and 110 age-matched individuals without visual disturbances. The cells taken from AMD patients displayed a higher extent of basal endogenous DNA damage without differences between patients of dry and wet forms of the disease. DNA double-strand breaks did not contribute to the observed DNA damage as checked by the neutral comet assay and pulsed field gel electrophoresis. The extent of oxidative modification to DNA bases was grater in AMD patients than in the controls, as probed by DNA repair enzymes NTH1 and Fpg. Lymphocytes from AMD patients displayed a higher sensitivity to hydrogen peroxide and UV radiation and repaired lesions induced by these factors less effectively than the cells from the control individuals. We postulate that the impaired efficacy of DNA repair may combine with enhanced sensitivity of RPE cells to blue and UV lights, contributing to the pathogenesis of AMD.

  13. Application of Gold Nanoparticles for Electrochemical DNA Biosensor

    Directory of Open Access Journals (Sweden)

    Ahmed Mishaal Mohammed

    2014-01-01

    Full Text Available An electrochemical DNA biosensor was successfully fabricated by using (3-aminopropyltriethoxysilane (APTES as a linker molecule combined with the gold nanoparticles (GNPs on thermally oxidized SiO2 thin films. The SiO2 thin films surface was chemically modified with a mixture of APTES and GNPs for DNA detection in different time periods of 30 min, 1 hour, 2 hours, and 4 hours, respectively. The DNA immobilization and hybridization were conducted by measuring the differences of the capacitance value within the frequency range of 1 Hz to 1 MHz. The capacitance values for DNA immobilization were 160 μF, 77.8 μF, 70 μF, and 64.6 μF, respectively, with the period of time from 30 min to 4 hours. Meanwhile the capacitance values for DNA hybridization were 44 μF, 54 μF, 55 μF, and 61.5 μF, respectively. The capacitance value of bare SiO2 thin film was 0.42 μF, which was set as a base line for a reference in DNA detection. The differences of the capacitance value between the DNA immobilization and hybridization revealed that the modified SiO2 thin films using APTES and GNPs were successfully developed for DNA detection.

  14. [Genetic transformation and fate of heterological DNA in bacterial cells].

    Science.gov (United States)

    Piechowska, Mirosława

    2015-01-01

    Secretion of a metabolite enabling Streptococci to undergo genetic transformation was discovered. The metabolite combined with an optimization process were applied to increase the transformation yield about 20-fold. It was observed that large amounts of DNA exert a bactericidal effect, indicating the ability of at least 70% of cells to uptake the polymer. While studying the molecular mechanism of transformation of Bacillus subtilis it was shown that the uptaken DNA forms complexes with bacterial proteins, which hinders determination of its structure. A method was found to dissociate these complexes which enabled to determine the single-stranded structure of the uptaken DNA. Donor DNA fragments incorporated into the host DNA were of about 10 Da. Non-transforming DNA can be uptaken similarly but does not undergo incorporation into the host DNA. The selectivity of Bacillus subtilis receptors was determined towards DNA of phages containing modified bases: uracil, putrescinyl-thymine and its acetylated derivative, 5'-hydroxymethylcytosine and its glycosylated derivative and also towards double-stranded RNA of f2 phage. All these modifications were tolerated by the cellular receptors, with the exception of glycosylation and the 2'-OH group in RNA.

  15. Genome-wide mapping of DNA strand breaks.

    Directory of Open Access Journals (Sweden)

    Frédéric Leduc

    Full Text Available Determination of cellular DNA damage has so far been limited to global assessment of genome integrity whereas nucleotide-level mapping has been restricted to specific loci by the use of specific primers. Therefore, only limited DNA sequences can be studied and novel regions of genomic instability can hardly be discovered. Using a well-characterized yeast model, we describe a straightforward strategy to map genome-wide DNA strand breaks without compromising nucleotide-level resolution. This technique, termed "damaged DNA immunoprecipitation" (dDIP, uses immunoprecipitation and the terminal deoxynucleotidyl transferase-mediated dUTP-biotin end-labeling (TUNEL to capture DNA at break sites. When used in combination with microarray or next-generation sequencing technologies, dDIP will allow researchers to map genome-wide DNA strand breaks as well as other types of DNA damage and to establish a clear profiling of altered genes and/or intergenic sequences in various experimental conditions. This mapping technique could find several applications for instance in the study of aging, genotoxic drug screening, cancer, meiosis, radiation and oxidative DNA damage.

  16. Segrosome complex formation during DNA trafficking in bacterial cell division

    Directory of Open Access Journals (Sweden)

    Maria A. Oliva

    2016-09-01

    Full Text Available Bacterial extrachromosomal DNAs often contribute to virulence in pathogenic organisms or facilitate adaptation to particular environments. The transmission of genetic information from one generation to the next requires sufficient partitioning of DNA molecules to ensure that at least one copy reaches each side of the division plane and is inherited by the daughter cells. Segregation of the bacterial chromosome occurs during or after replication and probably involves a strategy in which several protein complexes participate to modify the folding pattern and distribution first of the origin domain and then of the rest of the chromosome. Low-copy number plasmids rely on specialised partitioning systems, which in some cases use a mechanism that show striking similarity to eukaryotic DNA segregation. Overall, there have been multiple systems implicated in the dynamic transport of DNA cargo to a new cellular position during the cell cycle but most seem to share a common initial DNA partitioning step, involving the formation of a nucleoprotein complex called the segrosome. The particular features and complex topologies of individual segrosomes depend on both the nature of the DNA binding protein involved and on the recognized centromeric DNA sequence, both of which vary across systems. The combination of in vivo and in vitro approaches, with structural biology has significantly furthered our understanding of the mechanisms underlying DNA trafficking in bacteria. Here, I discuss recent advances and the molecular details of the DNA segregation machinery, focusing on the formation of the segrosome complex.

  17. VirE2: a unique ssDNA-compacting molecular machine.

    Directory of Open Access Journals (Sweden)

    Wilfried Grange

    2008-02-01

    Full Text Available The translocation of single-stranded DNA (ssDNA across membranes of two cells is a fundamental biological process occurring in both bacterial conjugation and Agrobacterium pathogenesis. Whereas bacterial conjugation spreads antibiotic resistance, Agrobacterium facilitates efficient interkingdom transfer of ssDNA from its cytoplasm to the host plant cell nucleus. These processes rely on the Type IV secretion system (T4SS, an active multiprotein channel spanning the bacterial inner and outer membranes. T4SSs export specific proteins, among them relaxases, which covalently bind to the 5' end of the translocated ssDNA and mediate ssDNA export. In Agrobacterium tumefaciens, another exported protein-VirE2-enhances ssDNA transfer efficiency 2000-fold. VirE2 binds cooperatively to the transferred ssDNA (T-DNA and forms a compact helical structure, mediating T-DNA import into the host cell nucleus. We demonstrated-using single-molecule techniques-that by cooperatively binding to ssDNA, VirE2 proteins act as a powerful molecular machine. VirE2 actively pulls ssDNA and is capable of working against 50-pN loads without the need for external energy sources. Combining biochemical and cell biology data, we suggest that, in vivo, VirE2 binding to ssDNA allows an efficient import and pulling of ssDNA into the host. These findings provide a new insight into the ssDNA translocation mechanism from the recipient cell perspective. Efficient translocation only relies on the presence of ssDNA binding proteins in the recipient cell that compacts ssDNA upon binding. This facilitated transfer could hence be a more general ssDNA import mechanism also occurring in bacterial conjugation and DNA uptake processes.

  18. Revisit complexation between DNA and polyethylenimine — Effect of length of free polycationic chains on gene transfection

    DEFF Research Database (Denmark)

    Yue, Yanan; Jin, Fan; Deng, Rui

    2011-01-01

    Our revisit of the complexation between DNA and polyethylenimine (PEI) by using a combination of laser light scattering and gel electrophoresis confirms that nearly all the DNA chains are complexed with PEI to form polyplexes when the molar ratio of nitrogen from PEI to phosphate from DNA (N:P) r...

  19. Establishment of Cre-mediated HBV recombinant cccDNA (rcccDNA) cell line for cccDNA biology and antiviral screening assays.

    Science.gov (United States)

    Wu, Min; Li, Jin; Yue, Lei; Bai, Lu; Li, Yaming; Chen, Jieliang; Zhang, Xiaonan; Yuan, Zhenghong

    2018-04-01

    Hepatitis B virus (HBV) covalently closed circular DNA (cccDNA), existing in hepatocyte nuclei as a stable minichromosome, plays a central role in the life cycle of the virus and permits the persistence of infection. Despite being essential for HBV infection, little is known about the molecular mechanisms of cccDNA formation, regulation and degradation, and there is no therapeutic agents directly targeting cccDNA, fore mostly due to the lack of robust, reliable and quantifiable HBV cccDNA models. In this study, combined the Cre/loxP and sleeping beauty transposons system, we established HepG2-derived cell lines integrated with 2-60 copies of monomeric HBV genome flanked by loxP sites (HepG2-HBV/loxP). After Cre expression via adenoviral transduction, 3.3-kb recombinant cccDNA (rcccDNA) bearing a chimeric intron can be produced in the nuclei of these HepG2-HBV/loxP cells. The rcccDNA could be accurately quantified by quantitative PCR using specific primers and cccDNA pool generated in this model could be easily detected by Southern blotting using the digoxigenin probe system. We demonstrated that the rcccDNA was epigenetically organized as the natural minichromosome and served as the template supporting pgRNA transcription and viral replication. As the expression of HBV S antigen (HBsAg) is dependent on the newly generated cccDNA, HBsAg is the surrogate marker of cccDNA. Additionally, the efficacies of 3 classes of anti-HBV agents were evaluated in HepG2-HBV/loxP cells and antiviral activities with different mechanisms were confirmed. These data collectively suggested that HepG2-HBV/loxP cell system will be powerful platform for studying cccDNA related biological mechanisms and developing novel cccDNA targeting drugs. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  20. DNA Damage Induced Neuronal Death

    National Research Council Canada - National Science Library

    Kisby, Glen

    1999-01-01

    ... (nitrogen mustard or HN2) and the neurotoxic DNA-damaging agent methylazoxymethanol (MAM) using neuronal and astrocyte cell cultures from different brain regions of mice with perturbed DNA repair...

  1. The Dynamics of DNA Sequencing.

    Science.gov (United States)

    Morvillo, Nancy

    1997-01-01

    Describes a paper-and-pencil activity that helps students understand DNA sequencing and expands student understanding of DNA structure, replication, and gel electrophoresis. Appropriate for advanced biology students who are familiar with the Sanger method. (DDR)

  2. An Introduction to DNA Fingerprinting.

    Science.gov (United States)

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  3. Esitleti kakskeelset luulekogu "Luule DNA"

    Index Scriptorium Estoniae

    2007-01-01

    Magrelli, Valerio. Luule DNA = Il DNA della poesia / tõlkinud [ja saatesõna:] Maarja Kangro ja Kalju Kruusa. Tallinn : Koma, 2006. Sisaldab autori teksti. Esitlus 24. jaan. Kirjanike majas Tallinnas

  4. Pig transgenesis by Sleeping Beauty DNA transposition.

    Science.gov (United States)

    Jakobsen, Jannik E; Li, Juan; Kragh, Peter M; Moldt, Brian; Lin, Lin; Liu, Ying; Schmidt, Mette; Winther, Kjeld Dahl; Schyth, Brian Dall; Holm, Ida E; Vajta, Gábor; Bolund, Lars; Callesen, Henrik; Jørgensen, Arne Lund; Nielsen, Anders Lade; Mikkelsen, Jacob Giehm

    2011-06-01

    Modelling of human disease in genetically engineered pigs provides unique possibilities in biomedical research and in studies of disease intervention. Establishment of methodologies that allow efficient gene insertion by non-viral gene carriers is an important step towards development of new disease models. In this report, we present transgenic pigs created by Sleeping Beauty DNA transposition in primary porcine fibroblasts in combination with somatic cell nuclear transfer by handmade cloning. Göttingen minipigs expressing green fluorescent protein are produced by transgenesis with DNA transposon vectors carrying the transgene driven by the human ubiquitin C promoter. These animals carry multiple copies (from 8 to 13) of the transgene and show systemic transgene expression. Transgene-expressing pigs carry both transposase-catalyzed insertions and at least one copy of randomly inserted plasmid DNA. Our findings illustrate critical issues related to DNA transposon-directed transgenesis, including coincidental plasmid insertion and relatively low Sleeping Beauty transposition activity in porcine fibroblasts, but also provide a platform for future development of porcine disease models using the Sleeping Beauty gene insertion technology.

  5. Analysis of G-5x Quadruplex DNA

    Science.gov (United States)

    Weglarz, Meredith; Vesenka, James; Fritzsche, Wolfgang; Yerkes, Sarah; Kmiec, Eric

    2008-10-01

    Pure guanine-rich oligonucleotide (GRO) DNA will self-assemble into quadruplex "G-wire" DNA in the absence of stabilizing monovalent cations. Atomic force microscopy of GRO G-wires bound to freshly cleaved mica and imaged in air reveal extensive networks of connected quadruplex DNA auto-oriented on the next nearest neighbor spacing of the mica substrate. Electrical measurements of GRO G-wires across micro-fabricated gold electrodes on silicon oxide indicate the GRO G-wire networks are electrical insulators. The suspected random nature of the GRO incorporation into quadruplex DNA suggested an alternative mechanism of incorporating metal ions into G-wires: through direct weak ionic binding to the extensive phosphate backbone exposure of both the quadruplex and partially assembled oligonucelotide sequences. High densities of GRO mixed with CuCl2 or AgNO3 produced dramatically wider wires that we believe are combinations of weakly interacting metal ions and GRO. After reduction by exposure to light the Ag+ doped structures appear to be electrically conductive. This process provides a simpler method for the creation of nanometer-scale conductive wires.

  6. All-Electrical Graphene DNA Sensor Array.

    Science.gov (United States)

    Abbott, Jeffrey; Ham, Donhee; Xu, Guangyu

    2017-01-01

    Electrical sensing of biomolecules has been an important pursuit due to the label-free operation and chip-scale construct such sensing modality can enable. In particular, electrical biomolecular sensors based on nanomaterials such as semiconductor nanowires, carbon nanotubes, and graphene have demonstrated high sensitivity, which in the case of nanowires and carbon nanotubes can surpass typical optical detection sensitivity. Among these nanomaterials, graphene is well suited for a practical candidate for implementing a large-scale array of biomolecular sensors, as its two-dimensional morphology is readily compatible with industry standard top-down fabrication techniques. In our recent work published in 2014 Nature Communications, we demonstrated these benefits by creating DNA sensor arrays from chemical vapor deposition (CVD) graphene. The present chapter, which is a review of this recent work, outlines procedures demonstrating the use of individual graphene sites of the array in dual roles--electrophoretic electrodes for site specific probe DNA immobilization and field effect transistor (FET) sensors for detection of target DNA hybridization. The 100 fM detection sensitivity achieved in 7 out of 8 graphene FET sensors in the array combined with the alternative use of the graphene channels as electrophoretic electrodes for probe deposition represent steps toward creating an all-electrical multiplexed DNA array.

  7. Programmable chemical controllers made from DNA

    Science.gov (United States)

    Chen, Yuan-Jyue; Dalchau, Neil; Srinivas, Niranjan; Phillips, Andrew; Cardelli, Luca; Soloveichik, David; Seelig, Georg

    2013-10-01

    Biological organisms use complex molecular networks to navigate their environment and regulate their internal state. The development of synthetic systems with similar capabilities could lead to applications such as smart therapeutics or fabrication methods based on self-organization. To achieve this, molecular control circuits need to be engineered to perform integrated sensing, computation and actuation. Here we report a DNA-based technology for implementing the computational core of such controllers. We use the formalism of chemical reaction networks as a 'programming language' and our DNA architecture can, in principle, implement any behaviour that can be mathematically expressed as such. Unlike logic circuits, our formulation naturally allows complex signal processing of intrinsically analogue biological and chemical inputs. Controller components can be derived from biologically synthesized (plasmid) DNA, which reduces errors associated with chemically synthesized DNA. We implement several building-block reaction types and then combine them into a network that realizes, at the molecular level, an algorithm used in distributed control systems for achieving consensus between multiple agents.

  8. Alterations of ultraviolet irradiated DNA

    International Nuclear Information System (INIS)

    Davila, C.; Garces, F.

    1980-01-01

    Thymine dimers production has been studied in several DNA- 3 H irradiated at various wave lenght of U.V. Light. The influence of dimers on the hydrodynamic and optic properties, thermal structural stability and transformant capacity of DNA have been studied too. At last the recognition and excision of dimers by the DNA-UV-Endonuclease and DNA-Polimerase-I was also studied. (author)

  9. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Small DNA circles as probes of DNA topology.

    Science.gov (United States)

    Bates, Andrew D; No