WorldWideScience

Sample records for cd28 blockade promotes

  1. CD28 Blockade Ex Vivo Induces Alloantigen-Specific Immune Tolerance but Preserves T-Cell Pathogen Reactivity

    Directory of Open Access Journals (Sweden)

    Barbara Dillinger

    2017-09-01

    Full Text Available Donor T-cells contribute to reconstitution of protective immunity after allogeneic hematopoietic stem cell transplantation (HSCT but must acquire specific tolerance against recipient alloantigens to avoid life-threatening graft-versus-host disease (GvHD. Systemic immunosuppressive drugs may abrogate severe GvHD, but this also impedes memory responses to invading pathogens. Here, we tested whether ex vivo blockade of CD28 co-stimulation can enable selective T-cell tolerization to alloantigens by facilitating CD80/86-cytotoxic T-lymphocyte-associated protein 4 (CTLA-4 signaling. Treatment of human allogeneic dendritic cell/T-cell co-cultures with a human CD28 blocking antibody fragment (α-huCD28 significantly abrogated subsequent allospecific immune responses, seen by decreased T-cell proliferation and of type 1 cytokine (IFN-γ and IL-2 expression. Allo-tolerization persisted after discontinuation of CD28 blockade and secondary alloantigen stimulation, as confirmed by enhanced CTLA-4 and PD-1 immune checkpoint signaling. However, T-cells retained reactivity to pathogens, supported by clonotyping of neo-primed and cross-reactive T-cells specific for Candida albicans or third-party antigens using deep sequencing analysis. In an MHC-mismatched murine model, we tolerized C57BL/6 T-cells by ex vivo exposure to a murine single chain Fv specific for CD28 (α-muCD28. Infusion of these cells, after α-muCD28 washout, into bone marrow-transplanted BALB/c mice caused allo-tolerance and did not induce GvHD-associated hepatic pathology. We conclude that selective CD28 blockade ex vivo can allow the generation of stably allo-tolerized T-cells that in turn do not induce graft-versus-host reactions while maintaining pathogen reactivity. Hence, CD28 co-stimulation blockade of donor T-cells may be a useful therapeutic approach to support the immune system after HSCT.

  2. CD28 family of receptors on T cells in chronic HBV infection: Expression characteristics, clinical significance and correlations with PD-1 blockade.

    Science.gov (United States)

    Tang, Zong-Sheng; Hao, You-Hua; Zhang, E-Juan; Xu, Chun-Li; Zhou, Yun; Zheng, Xin; Yang, Dong-Liang

    2016-08-01

    The aim of the present study was to investigate the overall clinical expression characteristics of the cluster of differentiation (CD)28 family receptors [CD28, inducible T-cell co-stimulator, programmed cell death protein 1 (PD‑1), cytotoxic T-lymphocyte-associated protein 4 and B‑ and T-lymphocyte attenuator] on T cells in patients with chronic hepatitis B (CHB), analyze the correlations among these receptors and the clinical parameters, and to investigate the effects of PD‑1 blockade on the receptor expression profiles, T‑cell function and other biological effects. The expression characteristics of the CD28 family of receptors, the effects of PD‑1 blockade on the receptor expression profiles and the levels of interferon (IFN)‑γ were investigated in the T cells of patients with CHB. In addition, the transcription factor, T‑box 21 (T‑bet) and GATA binding protein 3 (GATA‑3) mRNA expression levels were investigated in the peripheral blood mononuclear cells (PBMCs) of patients with CHB. The expression levels of the CD28 family receptors in the T cells of patients with CHB demonstrated distinct characteristics , for example levels of PD‑1 and CTLA‑4 on CD4 T cells and ICOS, PD‑1, and BTLA on CD8 T cells were increased in cells from patients with CHB compared with those from the healthy individuals. A significant positive correlation was demonstrated among the serum HBV DNA titers and the levels of PD‑1 on CD8+ T cells with the highest expression of PD‑1 corresponding to viral levels >106 IU/ml. A significant positive correlation was observed between the serum HBV DNA titers and the expression levels of BTLA on CD8+ T cells with the highest expression of BTLA corresponding to viral levels >106 IU/ml. PD‑1 blockade altered the expression profiles of CD28 family receptors in the T cells of patients with CHB, partly enhanced T cell function and increased the ratio of T‑bet/GATA‑3 mRNA in PBMCs. Thus, CD28 family receptors

  3. CD28 controls the development of innate-like CD8+ T cells by promoting the functional maturation of NKT cells.

    Science.gov (United States)

    Yousefi, Mitra; Duplay, Pascale

    2013-11-01

    NK T cells(NKT cells) share functional characteristics and homing properties that are distinct from conventional T cells. In this study, we investigated the contribution of CD28 in the functional development of γδ NKT and αβ NKT cells in mice. We show that CD28 promotes the thymic maturation of promyelocytic leukemia zinc finger(+) IL-4(+) NKT cells and upregulation of LFA-1 expression on NKT cells. We demonstrate that the developmental defect of γδ NKT cells in CD28-deficient mice is cell autonomous. Moreover, we show in both wild-type C57BL/6 mice and in downstream of tyrosine kinase-1 transgenic mice, a mouse model with increased numbers of γδ NKT cells, that CD28-mediated regulation of thymic IL-4(+) NKT cells promotes the differentiation of eomesodermin(+) CD44(high) innate-like CD8(+) T cells. These findings reveal a previously unappreciated mechanism by which CD28 controls NKT-cell homeostasis and the size of the innate-like CD8(+) T-cell pool. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. BAFF upregulates CD28/B7 and CD40/CD154 expression and promotes mouse T and B cell interaction in vitro via BAFF receptor.

    Science.gov (United States)

    Zhang, Feng; Song, Shan-Shan; Shu, Jin-Ling; Li, Ying; Wu, Yu-Jing; Wang, Qing-Tong; Chen, Jing-Yu; Chang, Yan; Wu, Hua-Xun; Zhang, Ling-Ling; Wei, Wei

    2016-08-01

    B cell-activating factor belonging to the TNF family (BAFF) is a member of TNF family and required for peripheral B cell survival and homeostasis. BAFF has been shown to promote the proliferation of T and B cells. In this study we examined whether and how BAFF mediated the interaction between mouse T and B cells in vitro. BAFF-stimulated B or T cells were co-cultured with T or B cells. The interactions between T and B cells were analyzed by measuring the expression of co-stimulatory molecules (CD28/CD80 or CD40/CD154), the proliferation and secretion of T and B cells and other factors. Two siRNAs against the transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI) and BAFF receptor (BAFF-R) were used to identify the receptors responsible for the actions of BAFF. BAFF-stimulated B cells significantly promoted the proliferation and activity of co-cultured T cells, and increased the percentages of CD4(+)CD28(+) and CD4(+)CD154(+) T cells. Similarly, BAFF-stimulated T cells significantly promoted the proliferation and activity of co-cultured B cells, and increased CD19(+)CD80(+) and CD19(+)CD40(+)B cell subpopulations. BAFF-R siRNA-silenced B cells showed significantly lower expression of CD40 and CD80 than the control B cells. When the BAFF-R siRNA-silenced B cells were stimulated with BAFF, then co-cultured with T cells, the expression of CD28 and CD154 on T cells was not increased. TACI siRNA-silenced B cells exhibited higher expression of CD40 and CD80 than the control B cells. When the TACI siRNA-silenced B cells were stimulated with BAFF, then co-cultured with T cells, the expression of CD28 and CD154 on T cells was significantly increased. BAFF upregulates CD28/B7 and CD40/CD154 expression, and promotes the interactions between T and B cells in a BAFF-R-dependent manner.

  5. Evidence implicating the Ras pathway in multiple CD28 costimulatory functions in CD4+ T cells.

    Directory of Open Access Journals (Sweden)

    Sujit V Janardhan

    Full Text Available CD28 costimulation is a critical event in the full activation of CD4(+ T cells that augments cytokine gene transcription, promotes cytokine mRNA stability, prevents induction of anergy, increases cellular metabolism, and increases cell survival. However, despite extensive biochemical analysis of the signaling events downstream of CD28, molecular pathways sufficient to functionally replace the diverse aspects of CD28-mediated costimulation in normal T cells have not been identified. Ras/MAPK signaling is a critical pathway downstream of T cell receptor stimulation, but its role in CD28-mediated costimulation has been controversial. We observed that physiologic CD28 costimulation caused a relocalization of the RasGEF RasGRP to the T cell-APC interface by confocal microscopy. In whole cell biochemical analysis, CD28 cross-linking with either anti-CD28 antibody or B7.1-Ig augmented TCR-induced Ras activation. To determine whether Ras signaling was sufficient to functionally mimic CD28 costimulation, we utilized an adenoviral vector encoding constitutively active H-Ras (61L to transduce normal, Coxsackie-Adenovirus Receptor (CAR transgenic CD4(+ T cells. Like costimulation via CD28, active Ras induced AKT, JNK and ERK phosphorylation. In addition, constitutive Ras signaling mimicked the ability of CD28 to costimulate IL-2 protein secretion, prevent anergy induction, increase glucose uptake, and promote cell survival. Importantly, we also found that active Ras mimicked the mechanism by which CD28 costimulates IL-2 production: by increasing IL-2 gene transcription, and promoting IL-2 mRNA stability. Finally, active Ras was able to induce IL-2 production when combined with ionomycin stimulation in a MEK-1-dependent fashion. Our results are consistent with a central role for Ras signaling in CD28-mediated costimulation.

  6. The Story of CD4+CD28− T Cells Revisited: Solved or Still Ongoing?

    Directory of Open Access Journals (Sweden)

    Kathrin Maly

    2015-01-01

    Full Text Available CD4+CD28− T cells are a unique type of proinflammatory T cells characterised by blockade of costimulatory CD28 receptor expression at the transcriptional level, which is still reversible by IL-12. In healthy individuals older than 65 years, these cells may accumulate to up to 50% of total CD4+ T lymphocytes as in many immune-mediated diseases, immunodeficiency, and specific infectious diseases. Here we focus on CD4+CD28− T cells in chronic immune-mediated diseases, summarizing various phenotypic and functional characteristics, which vary depending on the underlying disease, disease activity, and concurrent treatment. CD4+CD28− T cells present as effector/memory cells with increased replicative history and oligoclonality but reduced apoptosis. As an alternative costimulatory signal instead of CD28, not only natural killer cell receptors and Toll-like receptors, but also CD47, CTLA-4, OX40, and 4-1BB have to be considered. The proinflammatory and cytotoxic capacities of these cells indicate an involvement in progression and maintenance of chronic immune-mediated disease. So far it has been shown that treatment with TNF-α blockers, abatacept, statins, and polyclonal antilymphocyte globulins (ATG mediates reduction of the CD4+CD28− T cell level. The clinical relevance of targeting CD4+CD28− T cells as a therapeutic option has not been examined so far.

  7. Association of CD28 IVS3 +17T/C Polymorphism with Soluble CD28 in Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    I. Y. Ledezma-Lozano

    2011-01-01

    Full Text Available Objective: Rheumatoid arthritis (RA is an autoimmune disease of unknown etiology in which inflammatory pathology involves T cell activation and the CD28 costimulatory molecule involved in T cell presentation. The gene includes the CD28 IVS3 +17T/C polymorphism that could be associated with susceptibility to RA whereas the soluble concentrations of CD28 (sCD28 could be related to clinical activity.

  8. Temporal kinetics of CD8+CD28+and CD8+CD28-T lymphocytes in the injured rat spinal cord.

    Science.gov (United States)

    Wu, Yan; Lin, Yu-Hong; Shi, Ling-Ling; Yao, Zong-Feng; Xie, Xiu-Mei; Jiang, Zheng-Song; Tang, Jie; Hu, Jian-Guo; Lü, He-Zuo

    2017-08-01

    This study aims to explore the temporal changes of cytotoxic CD8 + CD28 + and regulatory CD8 + CD28 - T-cell subsets in the lesion microenvironment after spinal cord injury (SCI) in rats, by combination of immunohistochemistry (IHC) and flow cytometry (FCM). In the sham-opened spinal cord, few CD8 + T cells were found. After SCI, the CD8 + T cells were detected at one day post-injury (dpi), then markedly increased and were significantly higher at 3, 7, and 14 dpi compared with one dpi (p CD8 + T cells, more than 90% were CD28 + , and there were only small part of CD28 - ( CD8 + T cells were significantly decreased, and few could be found in good condition at 21 and 28 dpi. Annexin V and propidium iodide (PI) staining showed that the percentages of apoptotic/necrotic CD8 + cells at 14 dpi and 21 dpi were significantly higher than those of the other early time-points (p CD8 + T cells could rapidly infiltrate into the injured spinal cords and survive two weeks, however, cytotoxic CD8 + T cells were dominant. Therefore, two weeks after injury might be the "time window" for treating SCI by prolonging survival times and increasing the fraction of CD8 + regulatory T-cells. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. CD28 Family and Chronic Rejection: “To Belatacept...and Beyond!”

    Directory of Open Access Journals (Sweden)

    Marcos V. Silva

    2012-01-01

    Full Text Available Kidneys are one of the most frequently transplanted human organs. Immunosuppressive agents may prevent or reverse most acute rejection episodes; however, the graft may still succumb to chronic rejection. The immunological response involved in the chronic rejection process depends on both innate and adaptive immune response. T lymphocytes have a pivotal role in chronic rejection in adaptive immune response. Meanwhile, we aim to present a general overview on the state-of-the-art knowledge of the strategies used for manipulating the lymphocyte activation mechanisms involved in allografts, with emphasis on T-lymphocyte costimulatory and coinhibitory molecules of the B7-CD28 superfamily. A deeper understanding of the structure and function of these molecules improves both the knowledge of the immune system itself and their potential action as rejection inducers or tolerance promoters. In this context, the central role played by CD28 family, especially the relationship between CD28 and CTLA-4, becomes an interesting target for the development of immune-based therapies aiming to increase the survival rate of allografts and to decrease autoimmune phenomena. Good results obtained by the recent development of abatacept and belatacept with potential clinical use aroused better expectations concerning the outcome of transplanted patients.

  10. Targeting CD28, CTLA-4 and PD-L1 costimulation differentially controls immune synapses and function of human regulatory and conventional T-cells.

    Directory of Open Access Journals (Sweden)

    Nahzli Dilek

    Full Text Available CD28, CTLA-4 and PD-L1, the three identified ligands for CD80/86, are pivotal positive and negative costimulatory molecules that, among other functions, control T cell motility and formation of immune synapse between T cells and antigen-presenting cells (APCs. What remains incompletely understood is how CD28 leads to the activation of effector T cells (Teff but inhibition of suppression by regulatory T cells (Tregs, while CTLA-4 and PD-L1 inhibit Teff function but are crucial for the suppressive function of Tregs. Using alloreactive human T cells and blocking antibodies, we show here by live cell dynamic microscopy that CD28, CTLA-4, and PD-L1 differentially control velocity, motility and immune synapse formation in activated Teff versus Tregs. Selectively antagonizing CD28 costimulation increased Treg dwell time with APCs and induced calcium mobilization which translated in increased Treg suppressive activity, in contrast with the dampening effect on Teff responses. The increase in Treg suppressive activity after CD28 blockade was also confirmed with polyclonal Tregs. Whereas CTLA-4 played a critical role in Teff by reversing TCR-induced STOP signals, it failed to affect motility in Tregs but was essential for formation of the Treg immune synapse. Furthermore, we identified a novel role for PD-L1-CD80 interactions in suppressing motility specifically in Tregs. Thus, our findings reveal that the three identified ligands of CD80/86, CD28, CTLA-4 and PD-L1, differentially control immune synapse formation and function of the human Teff and Treg cells analyzed here. Individually targeting CD28, CTLA-4 and PD-L1 might therefore represent a valuable therapeutic strategy to treat immune disorders where effector and regulatory T cell functions need to be differentially targeted.

  11. Costimulatory signal blockade in murine relapsing experimental autoimmune encephalomyelitis

    DEFF Research Database (Denmark)

    Schaub, M; Issazadeh-Navikas, Shohreh; Stadlbauer, T H

    1999-01-01

    Blockade of the CD28-B7 or CD40L-CD40 T cell costimulatory signals prevents induction of experimental autoimmune encephalomyelitis (EAE). However, the effect of simultaneous blockade of these signals in EAE is unknown. We show that administration of either MR1 (to block CD40L) or CTLA4Ig (to block...

  12. CD8+CD28+/CD8+CD28-T cell equilibrium can predict the active stage for patients with inflammatory bowel disease.

    Science.gov (United States)

    Dai, Shi-Xue; Gu, Hong-Xiang; Lin, Qian-Yi; Huang, Shao-Zhuo; Xing, Tiao-Si; Zhang, Qing-Fang; Wu, Gang; Chen, Min-Hua; Tan, Wan-Er; Jian, Hong-Jian; Zheng, Zhong-Wen; Zhong, Tao; Zhang, Min-Hai; Cheng, Xing-Fang; Huang, Peng; Liao, Guang-Jie; Sha, Wei-Hong

    2017-12-01

    The balance of blood CD8 + CD28 + /CD8 + CD28 - T cells has been verified to be vital for patients with ulcerative colitis (UC), but their role in inflammatory bowel disease (IBD) remains unknown. This investigation aimed to evaluate the efficiency of the balance in predicting the active stage in IBD patients. Fifty-three IBD subjects, including 31 UC and 22 Crohn's disease (CD) patients, were enrolled, and their peripheral blood CD8 + CD28 + and CD8 + CD28 - T cell levels were tested using flow cytometry. The risk factors related to prognosis were compared between UC and CD patients. A 1-year follow-up was performed for all the IBD patients, and the CD8 + T cells and their ratio were compared at the 3rd, 6th, 9th, and 12th months during follow-up. The sensitivity and specificity of the CD8 + T cell level and balance were analyzed through receiver operator characteristic (ROC) curves. The cumulative remission lasting rates (CRLRs) under the different factors were analyzed using the Kaplan-Meier method. Higher prescription rates of immunosuppressants, steroids, probiotics, and biological agents (BAs) were found in CD subjects in comparison to UC subjects (P=0.005, 0.024, 0.034, and 0.001), as was a higher active rate during follow-up (95.5% of CD patients vs 67.7% of UC patients, P=0.035). The CD8 + CD28 + T cell level and the CD8 + CD28 + /CD8 + CD28 - T cell ratio were significantly higher in UC patients than in CD patients, but the reverse was true for CD8 + CD28 - T cells during follow-up at the 9th and 12th month (all PCD8 + CD28 + and CD8 + CD28 - T cell numbers and the CD8 + CD28 + /CD8 + CD28 - T cell ratio in predicting the active stage were found to be significant, with areas under the curves (AUCs) of 0.883, 0.098, and 0.913 for UC subjects (with 95% CI: 0.709-0.940, 0.009-0.188, and 0.842-1.003; P=0.001, 0.00, and 0.000) and 0.812, 0.078, and 0.898 for CD subjects (with 95% CI: 0.683-0.957, 0.003-0.158, and 0.837-0.998; P=0.003, 0.00, and 0.000). The cut

  13. Decreased CD8+CD28+/CD8+CD28– T cell ratio can sensitively predict poor outcome for patients with complicated Crohn disease

    Science.gov (United States)

    Dai, Shi-xue; Gu, Hong-xiang; Lin, Qian-yi; Wu, Yan-kun; Wang, Xiao-yan; Huang, Shao-zhuo; Xing, Tiao-si; Chen, Min-hua; Zhang, Qing-fang; Zheng, Zhong-wen; Sha, Wei-hong

    2017-01-01

    Abstract Crohn disease (CD) with complications such as penetrating, stricturing, and perianal disease is called complicated CD. The aim of this study is to test the efficiency with which the CD8+CD28+/CD8+CD28– cell balance can predict a subsequent active stage in patients with newly diagnosed complicated CD. Seventeen patients with complicated CD and 48 CD patients with no complications were enrolled. Blood CD8+ T cells were tested from all of the 65 newly diagnosed CD patients upon enrollment. The potential risk factors were compared between the 2 groups. A 30-week follow-up was performed, and the efficiency of the CD8+ cell balance at predicting active CD was analyzed using receiver-operating characteristic curves. The cumulative remission lasting rates (CRLRs) were analyzed using the Kaplan–Meier method. Compared with the control CD group, patients with complicated CD were predominantly male and younger in age; they also had lower body mass indices (BMIs), higher Crohn disease activity indices (CDAIs), higher immunosuppressant and steroid prescription rates, and significantly higher surgical rates. The CD8+CD28+/CD8+CD28– balance was associated with BMI, CDAI, steroids, and surgery. The CD8+CD28+/CD8+CD28– ratios were significantly lower at week 0 and on the 6th, 22nd, and 30th week during follow-up with a shorter lasting time of remission for the complicated CD patients. The CD8+CD28+/CD8+CD28– ratio could accurately predict the active stage for the patients with complicated CD, and the highest sensitivity (89.2%) and specificity (85.3%) were found when the ratio was 1.03. Treatment with steroids and surgery, along with a significantly lower CD8+CD28+/CD8+CD28– ratio and lower CRLRs, was closely related to a worse outcome for the patients with complicated CD. Patients requiring steroids and surgery experience more severe disease activity and thus a disequilibrated immunological balance, which could be the main reason for a decreased CD8+CD28+/CD8

  14. Regulatory function of cytomegalovirus-specific CD4+CD27-CD28- T cells

    International Nuclear Information System (INIS)

    Tovar-Salazar, Adriana; Patterson-Bartlett, Julie; Jesser, Renee; Weinberg, Adriana

    2010-01-01

    CMV infection is characterized by high of frequencies of CD27 - CD28 - T cells. Here we demonstrate that CMV-specific CD4 + CD27 - CD28 - cells are regulatory T cells (T R ). CD4 + CD27 - CD28 - cells sorted from CMV-stimulated PBMC of CMV-seropositive donors inhibited de novo CMV-specific proliferation of autologous PBMC in a dose-dependent fashion. Compared with the entire CMV-stimulated CD4 + T-cell population, higher proportions of CD4 + CD27 - CD28 - T R expressed FoxP3, TGFβ, granzyme B, perforin, GITR and PD-1, lower proportions expressed CD127 and PD1-L and similar proportions expressed CD25, CTLA4, Fas-L and GITR-L. CMV-CD4 + CD27 - CD28 - T R expanded in response to IL-2, but not to CMV antigenic restimulation. The anti-proliferative effect of CMV-CD4 + CD27 - CD28 - T R significantly decreased after granzyme B or TGFβ inhibition. The CMV-CD4 + CD27 - CD28 - T R of HIV-infected and uninfected donors had similar phenotypes and anti-proliferative potency, but HIV-infected individuals had higher proportions of CMV-CD4 + CD27 - CD28 - T R . The CMV-CD4 + CD27 - CD28 - T R may contribute to the downregulation of CMV-specific and nonspecific immune responses of CMV-infected individuals.

  15. Association of CTLA4, CD28 and ICOS gene polymorphisms with ...

    Indian Academy of Sciences (India)

    we tested single nucleotide polymorphisms (SNPs) of. CTLA4/CD28/ICOS genes, and they were found to be asso- ciated with pathophisipology of paediatric IgAN in Korean population. The best-characterized T-cell co-stimulatory pathway involves receptors such as the CD28 and CTLA4 (also known as CD152). In addition ...

  16. CD28 expression is required after T cell priming for helper T cell responses and protective immunity to infection.

    Science.gov (United States)

    Linterman, Michelle A; Denton, Alice E; Divekar, Devina P; Zvetkova, Ilona; Kane, Leanne; Ferreira, Cristina; Veldhoen, Marc; Clare, Simon; Dougan, Gordon; Espéli, Marion; Smith, Kenneth G C

    2014-10-27

    The co-stimulatory molecule CD28 is essential for activation of helper T cells. Despite this critical role, it is not known whether CD28 has functions in maintaining T cell responses following activation. To determine the role for CD28 after T cell priming, we generated a strain of mice where CD28 is removed from CD4(+) T cells after priming. We show that continued CD28 expression is important for effector CD4(+) T cells following infection; maintained CD28 is required for the expansion of T helper type 1 cells, and for the differentiation and maintenance of T follicular helper cells during viral infection. Persistent CD28 is also required for clearance of the bacterium Citrobacter rodentium from the gastrointestinal tract. Together, this study demonstrates that CD28 persistence is required for helper T cell polarization in response to infection, describing a novel function for CD28 that is distinct from its role in T cell priming.

  17. CD28 deletion improves obesity-induced liver steatosis but increases adiposity in mice.

    Science.gov (United States)

    Poggi, M; Morin, S O; Bastelica, D; Govers, R; Canault, M; Bernot, D; Georgelin, O; Verdier, M; Burcelin, R; Olive, D; Alessi, M-C; Peiretti, F; Nunès, J A

    2015-06-01

    Lymphocytes have a critical role in visceral adipose tissue (AT) inflammation. The CD28 costimulatory molecule is required for lymphocyte activation and for the development of a functional regulatory T cells (Tregs) compartment; however, its role during obesity is unknown. During diet-induced obesity, we investigated the effects of selective interference with CD28 signaling using knockout mice (Cd28KO) and a CTLA4-Ig fusion protein inhibiting CD28-B7 interactions. Cd28 deficiency decreased pathogenic T cells and Treg content within AT without changing the macrophages number. Cd28KO epididymal but not subcutaneous fat was characterized by enlarged adipocytes, reduced levels of inflammatory cytokines and increased Glut4, adiponectin and lipogenic enzyme mRNA levels. This was associated with reduced inflammation, fat accumulation and enhanced glucose metabolism in liver. Weight gain and fasting glucose tolerance were not affected. CTLA4-Ig injections reduced the number of T cells in epididymal AT (epiAT) but not the inflammatory cytokines levels and failed to improve liver fat accumulation. Deletion of CD28 creates a new pro/anti-inflammatory balance in epiAT and liver and exerts a protective effect against hepatic steatosis.

  18. Elevated level of peripheral CD8(+)CD28(-) T lymphocytes are an independent predictor of progression-free survival in patients with metastatic breast cancer during the course of chemotherapy.

    Science.gov (United States)

    Song, Guohong; Wang, Xiaoli; Jia, Jun; Yuan, Yanhua; Wan, Fengling; Zhou, Xinna; Yang, Huabing; Ren, Jun; Gu, Jiezhun; Lyerly, Herbert Kim

    2013-06-01

    Suppression of cellular immunity resulting from tumorigenesis and/or therapy might promote cancer cells' growth, progression and invasion. Here, we explored whether T lymphocyte subtypes from peripheral blood of metastatic breast cancer (MBC) female patients could be used as alternative surrogate markers for cancer progress. Additionally, plasma levels of interleukin (IL)-2, IL-4, IL-6, IL-10, IFN-γ, and transforming growth factor-β1 were quantitated from MBC and healthy volunteers. This study included 89 female MBC patients during the post-salvage chemotherapy follow-up and 50 age- and sex-matched healthy volunteers as control. The percentages of T lymphocyte subpopulations from peripheral blood and plasma levels of cytokines were measured. Both CD8(+)CD28(-) and CD4(+)CD25(+) were elevated in MBC patients compared to the control cohort (P < 0.05). In contrast, CD3(+) and CD8(+)CD28(+)cells were significantly lower in MBC patients (P < 0.0001, P = 0.045, respectively). MBC patients had elevated levels of immunosuppressive cytokines IL-6 and IL-10. Patients with elevated CD8(+)CD28(-) and CD4(+)CD25(+) cells showed increased levels of IL-6, and only patients with elevated CD8(+)CD28(-) had decreased interferon-γ. Univariate analysis indicated increased CD3(+)CD4(+) or CD8(+)CD28(+)correlated with prolonged progression-free survival (PFS), while elevated CD8(+)CD28(-)associated with shorten PFS. The percent of CD8(+)CD28(-) T lymphocytes is an independent predictor for PFS through multivariate analysis. This study suggests that progressive elevated levels of CD8(+)CD28(-) suppressor T lymphocytes represent a novel independent predictor of PFS during post-chemotherapy follow-up.

  19. Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

    Science.gov (United States)

    Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

    2017-11-01

    CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective

  20. Association of CD28 and CTLA-4 gene polymorphisms with aggressive periodontitis in Brazilians.

    Science.gov (United States)

    e Silva, M R M A; Moreira, P R; da Costa, G C; Saraiva, A M; de Souza, P E A; Amormino, S A F; da Costa, J E; Gollob, K J; Dutra, W O

    2013-09-01

    Susceptibility to and severity of periodontal disease is influenced by gene polymorphisms related to the immune response. Co-stimulatory molecules, such as CD28 and CTLA-4, are critical in the development of such responses. Our hypothesis is that polymorphisms in genes that code for these molecules may be associated with periodontitis. The aim of the study was to investigate the association between +17 (T/C) CD28 and +49 (A/G) CTLA-4 gene polymorphisms and periodontitis in Brazilians. Genomic DNA was obtained from oral swabs of 424 individuals categorized into three groups (control group, aggressive, and chronic periodontitis) considering clinical parameters such as probing depth and clinical attachment loss. The genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism. There was an association between the T(-) genotype of the CD28 polymorphism and aggressive periodontitis (P = 0.04). Moreover, the A(+) genotype for CTLA-4 was associated with greater clinical attachment loss in non-smokers with aggressive periodontitis (P = 0.006, OR = 16.25, CI = 2.25-117.11). These findings show that T(-) in CD28 + 17 (T/C) and the A(+) in CTLA-4 +49 (A/G) genotypes are associated with susceptibility to aggressive periodontal disease. Thus, our study highlights these polymorphisms as potential genetic susceptibility markers of periodontitis in Brazilians. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Supplementary data: Association of CTLA4, CD28 and ICOS gene ...

    Indian Academy of Sciences (India)

    with clinicopathologic characteristics of childhood IgA nephropathy in Korean population. Hak-Jae Kim, Joo-Ho Chung, Sungwook Kang, Su-Kang Kim, Byoung-Soo Cho, Sung-Do Kim and Won-Ho Hahn. J. Genet. 90, 151–155. Table 1. Primer sequence for the SNPs of CTLA4, CD28 and ICOS genes. Gene. SNP. Function.

  2. The role of CD154-CD40 versus CD28-B7 costimulatory pathways in regulating allogeneic Th1 and Th2 responses in vivo

    DEFF Research Database (Denmark)

    Kishimoto, K; Dong, V M; Issazadeh-Navikas, Shohreh

    2000-01-01

    We used signal transducer and activator of transcription 4 (STAT4) and STAT6 gene knockout (-/-) mice as recipients of fully mismatched cardiac allografts to study the role of T-cell costimulatory pathways in regulating allogeneic T-helper 1 (Th1) versus Th2 responses in vivo. STAT4(-/-) mice have...... impaired Th1 responses, whereas STAT6(-/-) mice do not generate normal Th2 responses. Cardiac allografts from C57BL/6 mice were transplanted into normal wild-type (WT), STAT4(-/-), and STAT6(-/-) BALB/c recipients. STAT4(-/-) and STAT6(-/-) mice rejected their grafts with the same tempo as untreated WT....... Furthermore, there was a similar differential effect of CD28-B7 versus CD154-CD40 blockade in inhibiting immune responses in animals immunized with ovalbumin and complete Freund's adjuvant. These novel data indicate that Th1 and Th2 cells are differentially regulated by CD28-B7 versus CD154-CD40 costimulation...

  3. T cell receptor-mediated activation is a potent inducer of macroautophagy in human CD8(+)CD28(+) T cells but not in CD8(+)CD28(-) T cells

    NARCIS (Netherlands)

    Arnold, Christoph R; Pritz, Theresa; Brunner, Stefan; Knabb, Carina; Salvenmoser, Willi; Holzwarth, Birgit; Thedieck, Kathrin; Grubeck-Loebenstein, Beatrix

    A key feature of the aged human immune system is the accumulation of highly differentiated CD8(+)CD28(-) T cells, a phenomenon that negatively influences immune function in the elderly. However, the mechanisms that regulate survival or death of CD8(+)CD28(-) T cells remain incompletely understood.

  4. Human mesenchymal stromal cells enhance the immunomodulatory function of CD8+CD28− regulatory T cells

    Science.gov (United States)

    Liu, Qiuli; Zheng, Haiqing; Chen, Xiaoyong; Peng, Yanwen; Huang, Weijun; Li, Xiaobo; Li, Gang; Xia, Wenjie; Sun, Qiquan; Xiang, Andy Peng

    2015-01-01

    One important aspect of mesenchymal stromal cells (MSCs)-mediated immunomodulation is the recruitment and induction of regulatory T (Treg) cells. However, we do not yet know whether MSCs have similar effects on the other subsets of Treg cells. Herein, we studied the effects of MSCs on CD8+CD28− Treg cells and found that the MSCs could not only increase the proportion of CD8+CD28− T cells, but also enhance CD8+CD28−T cells' ability of hampering naive CD4+ T-cell proliferation and activation, decreasing the production of IFN-γ by activated CD4+ T cells and inducing the apoptosis of activated CD4+ T cells. Mechanistically, the MSCs affected the functions of the CD8+CD28− T cells partially through moderate upregulating the expression of IL-10 and FasL. The MSCs had no distinct effect on the shift from CD8+CD28+ T cells to CD8+CD28− T cells, but did increase the proportion of CD8+CD28− T cells by reducing their rate of apoptosis. In summary, this study shows that MSCs can enhance the regulatory function of CD8+CD28− Treg cells, shedding new light on MSCs-mediated immune regulation. PMID:25482073

  5. T helper-independent activation of human CD8+ cells: the role of CD28 costimulation.

    Science.gov (United States)

    Van Gool, S W; Zhang, Y; Kasran, A; de Boer, M; Ceuppens, J L

    1996-07-01

    The concept that activation of MHC class I-restricted CD8+ cells entirely depends on help from MHC class II-restricted CD4+ T cells has recently been supplemented with an alternative model in which CD8+ cells can directly be activated by MHC class I-expressing professional antigen-presenting cells (APC), which are able to deliver an accessory signal. The authors analysed the role of CD28-mediated costimulation for T helper cell-independent activation of purified human CD8+ T cells in two different in vitro models. Freshly isolated CD8+ cells could be activated (proliferation, IL-2 production and cytotoxic activity) by anti-CD3-presenting Fc gamma R+ mouse cells transfected with the human CD28 ligand, CD80, as the only accessory signal. On the other hand, activation of CD8+ cells by allogeneic MHC class I on EBV-transformed B cells, which express two different CD28 ligands, CD80 and CD86, also proceeded very efficiently (proliferation, cytotoxic activity and CD25 expression), but was either not, or only partially, blocked by anti-CD80 and anti-CD86 MoAb or CTLA-4Ig. This indicates that other costimulatory signals are also effective, and that CD28 triggering is not absolutely required for initial T-cell activation. CsA and CD80/CD86-blocking agents were synergistic in completely inhibiting activation of CD8+ cells in the MLR with allogeneic B-cell lines. This combination also induced non-responsiveness of CD8+ cells upon restimulation in the absence of blocking agents. Therefore, although professional APC can apparently provide multiple costimulatory signals for direct activation of CD8+ T cells, the signal derived from CD80/CD86 is unique in providing CsA-resistance.

  6. Differential effects of B7-1 blockade in the rat experimental autoimmune encephalomyelitis model

    DEFF Research Database (Denmark)

    Gallon, L; Chandraker, A; Issazadeh-Navikas, Shohreh

    1997-01-01

    Blocking the CD28-B7 T cell costimulatory activation pathway protects animals from developing experimental autoimmune encephalomyelitis (EAE). In the mouse EAE model, selective blockade of B7-1 by specific mAbs has been shown to protect animals from EAE. In the Lewis rat model, we have shown that...

  7. Advantages of Papio anubis for preclinical testing of immunotoxicity of candidate therapeutic antagonist antibodies targeting CD28

    Science.gov (United States)

    Poirier, Nicolas; Mary, Caroline; Le Bas-Bernardet, Stephanie; Daguin, Veronique; Belarif, Lyssia; Chevalier, Melanie; Hervouet, Jeremy; Minault, David; Ville, Simon; Charpy, Vianney; Blancho, Gilles; Vanhove, Bernard

    2014-01-01

    Antagonist anti-CD28 antibodies prevent T-cell costimulation and are functionally different from CTLA4Ig since they cannot block CTLA-4 and PDL-1 co-inhibitory signals. They demonstrated preclinical efficacy in suppressing effector T cells while enhancing immunoregulatory mechanisms. Because a severe cytokine release syndrome was observed during the Phase 1 study with the superagonist anti-CD28 TGN1412, development of other anti-CD28 antibodies requires careful preclinical evaluation to exclude any potential immunotoxicity side-effects. The failure to identify immunological toxicity of TGN1412 using macaques led us to investigate more relevant preclinical models. We report here that contrary to macaques, and like in man, all baboon CD4-positive T lymphocytes express CD28 in their effector memory cells compartment, a lymphocyte subtype that is the most prone to releasing cytokines after reactivation. Baboon lymphocytes are able to release pro-inflammatory cytokines in vitro in response to agonist or superagonist anti-CD28 antibodies. Furthermore, we compared the reactivity of human and baboon lymphocytes after transfer into non obese diabetic/severe combined immunodeficiency (NOD/SCID) interleukin-2rγ knockout mice and confirmed that both cell types could release inflammatory cytokines in situ after injection of agonistic anti-CD28 antibodies. In contrast, FR104, a monovalent antagonistic anti-CD28 antibody, did not elicit T cell activation in these assays, even in the presence of anti-drug antibodies. Infusion to baboons also resulted in an absence of cytokine release. In conclusion, the baboon represents a suitable species for preclinical immunotoxicity evaluation of anti-CD28 antibodies because their effector memory T cells do express CD28 and because cytokine release can be assessed in vitro and trans vivo. PMID:24598534

  8. Frequent CTLA4-CD28 gene fusion in diverse types of T-cell lymphoma.

    Science.gov (United States)

    Yoo, Hae Yong; Kim, Pora; Kim, Won Seog; Lee, Seung Ho; Kim, Sangok; Kang, So Young; Jang, Hye Yoon; Lee, Jong-Eun; Kim, Jaesang; Kim, Seok Jin; Ko, Young Hyeh; Lee, Sanghyuk

    2016-06-01

    CTLA4 and CD28 are co-regulatory receptors with opposite roles in T-cell signaling. By RNA sequencing, we identified a fusion between the two genes from partial gene duplication in a case of angioimmunoblastic T-cell lymphoma. The fusion gene, which codes for the extracellular domain of CTLA4 and the cytoplasmic region of CD28, is likely capable of transforming inhibitory signals into stimulatory signals for T-cell activation. Ectopic expression of the fusion transcript in Jurkat and H9 cells resulted in enhanced proliferation and AKT and ERK phosphorylation, indicating activation of downstream oncogenic pathways. To estimate the frequency of this gene fusion in mature T-cell lymphomas, we examined 115 T-cell lymphoma samples of diverse subtypes using reverse transcriptase polymerase chain reaction analysis and Sanger sequencing. We identified the fusion in 26 of 45 cases of angioimmunoblastic T-cell lymphomas (58%), nine of 39 peripheral T-cell lymphomas, not otherwise specified (23%), and nine of 31 extranodal NK/T cell lymphomas (29%). We further investigated the mutation status of 70 lymphoma-associated genes using ultra-deep targeted resequencing for 74 mature T-cell lymphoma samples. The mutational landscape we obtained suggests that T-cell lymphoma results from diverse combinations of multiple gene mutations. The CTLA4-CD28 gene fusion is likely a major contributor to the pathogenesis of T-cell lymphomas and represents a potential target for anti-CTLA4 cancer immunotherapy. Copyright© Ferrata Storti Foundation.

  9. Differential proliferative responses in subsets of human CD28+ cells delineated by BB27 mAb.

    Science.gov (United States)

    Gouttefangeas, C; Jacquot, S; Meffre, E; Schmid, M; Boumsell, L; Bensussan, A

    1994-03-01

    We report the identification of a novel 140 kDa disulfide-linked dimer expressed by a subset of peripheral blood T lymphocytes. This molecule, which is recognized by mAb BB27, is also detected on cells of the myelomonocytic lineage. In the T cell lineage, its expression is positively modulated after lymphocyte activation. A series of double-labeling experiments revealed that BB27 mAb identifies new CD4 and CD8 cell subsets different from those defined by CD45RA, CD45RO, CD26, CD29, CD31, and CD38. Finally, BB27 mAb also subdivides the CD28 subset. Of the utmost interest is the finding that a proliferative response to CD28 mAb and phorbol myristate acetate stimulation is exclusively obtained in the CD28+BB27+ cell subset, whereas the CD28+BB27- subset fails to proliferate.

  10. Friends not foes: CTLA-4 blockade and mTOR inhibition cooperate during CD8+ T cell priming to promote memory formation and metabolic readiness.

    Science.gov (United States)

    Pedicord, Virginia A; Cross, Justin R; Montalvo-Ortiz, Welby; Miller, Martin L; Allison, James P

    2015-03-01

    During primary Ag encounter, T cells receive numerous positive and negative signals that control their proliferation, function, and differentiation, but how these signals are integrated to modulate T cell memory has not been fully characterized. In these studies, we demonstrate that combining seemingly opposite signals, CTLA-4 blockade and rapamycin-mediated mammalian target of rapamycin inhibition, during in vivo T cell priming leads to both an increase in the frequency of memory CD8(+) T cells and improved memory responses to tumors and bacterial challenges. This enhanced efficacy corresponds to increased early expansion and memory precursor differentiation of CD8(+) T cells and increased mitochondrial biogenesis and spare respiratory capacity in memory CD8(+) T cells in mice treated with anti-CTLA-4 and rapamycin during immunization. Collectively, these results reveal that mammalian target of rapamycin inhibition cooperates with rather than antagonizes blockade of CTLA-4, promoting unrestrained effector function and proliferation, and an optimal metabolic program for CD8(+) T cell memory. Copyright © 2015 by The American Association of Immunologists, Inc.

  11. Apoptotic effects of antilymphocyte globulins on human pro-inflammatory CD4+CD28- T-cells.

    Directory of Open Access Journals (Sweden)

    Christina Duftner

    Full Text Available BACKGROUND: Pro-inflammatory, cytotoxic CD4(+CD28(- T-cells with known defects in apoptosis have been investigated as markers of premature immuno-senescence in various immune-mediated diseases. In this study we evaluated the influence of polyclonal antilymphocyte globulins (ATG-Fresenius, ATG-F on CD4(+CD28(- T-cells in vivo and in vitro. PRINCIPAL FINDINGS: Surface and intracellular three colour fluorescence activated cell sorting analyses of peripheral blood mononuclear cells from 16 consecutive transplant recipients and short-term cell lines were performed. In vivo, peripheral levels of CD3(+CD4(+CD28(- T-cells decreased from 3.7 ± 7.1% before to 0 ± 0% six hours after ATG-F application (P = 0.043 in 5 ATG-F treated but not in 11 control patients (2.9 ± 2.9% vs. 3.9 ± 3.0%. In vitro, ATG-F induced apoptosis even in CD4(+CD28(- T-cells, which was 4.3-times higher than in CD4(+CD28(+ T-cells. ATG-F evoked apoptosis was partially reversed by the broad-spectrum caspase inhibitor benzyloxycarbonyl (Cbz-Val-Ala-Asp(OMe-fluoromethylketone (zVAD-fmk and prednisolon-21-hydrogensuccinate. ATG-F triggered CD25 expression and production of pro-inflammatory cytokines, and induced down-regulation of the type 1 chemokine receptors CXCR-3, CCR-5, CX3CR-1 and the central memory adhesion molecule CD62L predominately in CD4(+CD28(- T-cells. CONCLUSION: In summary, in vivo depletion of peripheral CD3(+CD4(+CD28(- T-cells by ATG-F in transplant recipients was paralleled in vitro by ATG-F induced apoptosis. CD25 expression and chemokine receptor down-regulation in CD4(+CD28(- T-cells only partly explain the underlying mechanism.

  12. Initial evidence that GLP-1 receptor blockade fails to suppress postprandial satiety or promote food intake in humans.

    Science.gov (United States)

    Melhorn, Susan J; Tyagi, Vidhi; Smeraglio, Anne; Roth, Christian L; Schur, Ellen A

    2014-11-01

    Glucagon-like peptide 1 (GLP-1) has incretin effects that are well-documented, but the independent role of GLP-1 action in human satiety perception is debated. We hypothesized that blockade of GLP-1 receptors would suppress postprandial satiety and increase voluntary food intake. After an overnight fast, eight normal weight participants (seven men, BMI 19-24.7 kg/m(2), age 19-29 year) were enrolled in a double-blind, placebo-controlled, randomized crossover study of the GLP-1 antagonist Exendin-[9-39] (Ex-9) to determine if the satiating effects of a meal are dependent on GLP-1 signaling in humans. Following a fasting blood draw, iv infusion of Ex-9 (600-750 pmol/kg/min) or saline began. Thirty minutes later, subjects consumed a standardized breakfast followed 90 min later (at the predicted time of maximal endogenous circulating GLP-1) by an ad libitum buffet meal to objectively measure satiety. Infusions ended once the buffet meal was complete. Visual analog scale ratings of hunger and fullness and serial assessments of plasma glucose, insulin, and GLP-1 concentrations were done throughout the experiment. Contrary to the hypothesis, during Ex-9 infusion subjects reported a greater decrease in hunger due to consumption of the breakfast (Ex-9 -62 ± 5; placebo -41 ± 9; P=0.01) than during placebo. There were no differences in ad libitum caloric intake between Ex-9 and placebo. Ex-9 increased glucose, insulin, and endogenous GLP-1, which may have counteracted any effects of Ex-9 infusion to block satiety signaling. Blockade of GLP-1 receptors failed to suppress subjective satiety following a standardized meal or increase voluntary food intake in healthy, normal-weight subjects. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Interactive Effects of Snps Located Within CD28/B7Pathway and Environment on Susceptibility to Recurrent Spontaneous Abortion

    Directory of Open Access Journals (Sweden)

    Guiling Wang

    2017-10-01

    Full Text Available Aims: This study was aimed to explore the interaction between environment and CD28/B7 pathway to provide the potential epidemiology for prevention and treatment of recurrent spontaneous abortion (RSA. Methods: The retrospective study included 630 RSA cases and 1320 healthy women during their middle and late prenatal care. Their living environment was investigated, and the influence of environmental factors on pregnancy abortion was analyzed. The genomic DNAs were extracted from the study subjects, and the polymorphisms of CD28 and B7 were analyzed. Finally, the interaction of gene and environment on RSA was analyzed with the logistic regression analyses. Results: The multi-variate regression analysis indicated that vitamin supplement, intake of fresh fruits or vegetables, night shift, staying up late, history miscarriage, as well as history induced abortion were, independently, risk factors for RSA (all P< 0.05. Moreover, rs3116496 (T>C, rs3181098 (G>A and rs3181100 (G>C of CD28, rs1915087 (C>T of B7-2, as well as rs6804441 (A>G and rs41271391 (G>T of B7-1 were correlated with modified RSA risk (all P< 0.05. The haplotypes TGT and TAG could also regulate the risk of RSA (both P< 0.05. The synthetic influences of the aforementioned SNPs and environmental factors could also significantly affect the susceptibility to RSA (all P< 0.05. Conclusion: The interaction of environment and SNPs of CD28/B7 pathway on RSA risk was distinct from CD28/B7 pathway or environment alone.

  14. Interactive Effects of Snps Located Within CD28/B7Pathway and Environment on Susceptibility to Recurrent Spontaneous Abortion.

    Science.gov (United States)

    Wang, Guiling; Sun, Jing

    2017-01-01

    This study was aimed to explore the interaction between environment and CD28/B7 pathway to provide the potential epidemiology for prevention and treatment of recurrent spontaneous abortion (RSA). The retrospective study included 630 RSA cases and 1320 healthy women during their middle and late prenatal care. Their living environment was investigated, and the influence of environmental factors on pregnancy abortion was analyzed. The genomic DNAs were extracted from the study subjects, and the polymorphisms of CD28 and B7 were analyzed. Finally, the interaction of gene and environment on RSA was analyzed with the logistic regression analyses. The multi-variate regression analysis indicated that vitamin supplement, intake of fresh fruits or vegetables, night shift, staying up late, history miscarriage, as well as history induced abortion were, independently, risk factors for RSA (all PC), rs3181098 (G>A) and rs3181100 (G>C) of CD28, rs1915087 (C>T) of B7-2, as well as rs6804441 (A>G) and rs41271391 (G>T) of B7-1 were correlated with modified RSA risk (all P< 0.05). The haplotypes TGT and TAG could also regulate the risk of RSA (both P< 0.05). The synthetic influences of the aforementioned SNPs and environmental factors could also significantly affect the susceptibility to RSA (all P< 0.05). The interaction of environment and SNPs of CD28/B7 pathway on RSA risk was distinct from CD28/B7 pathway or environment alone. © 2017 The Author(s). Published by S. Karger AG, Basel.

  15. Loss of CD28 on Peripheral T Cells Decreases the Risk for Early Acute Rejection after Kidney Transplantation.

    Directory of Open Access Journals (Sweden)

    Burç Dedeoglu

    Full Text Available End-stage renal disease patients have a dysfunctional, prematurely aged peripheral T-cell system. Here we hypothesized that the degree of premature T-cell ageing before kidney transplantation predicts the risk for early acute allograft rejection (EAR.222 living donor kidney transplant recipients were prospectively analyzed. EAR was defined as biopsy proven acute allograft rejection within 3 months after kidney transplantation. The differentiation status of circulating T cells, the relative telomere length and the number of CD31+ naive T cells were determined as T-cell ageing parameters.Of the 222 patients analyzed, 30 (14% developed an EAR. The donor age and the historical panel reactive antibody score were significantly higher (p = 0.024 and p = 0.039 respectively and the number of related donor kidney transplantation was significantly lower (p = 0.018 in the EAR group. EAR-patients showed lower CD4+CD28null T-cell numbers (p<0.01 and the same trend was observed for CD8+CD28null T-cell numbers (p = 0.08. No differences regarding the other ageing parameters were found. A multivariate Cox regression analysis showed that higher CD4+CD28null T-cell numbers was associated with a lower risk for EAR (HR: 0.65, p = 0.028. In vitro, a significant lower percentage of alloreactive T cells was observed within CD28null T cells (p<0.001.Immunological ageing-related expansion of highly differentiated CD28null T cells is associated with a lower risk for EAR.

  16. Inducible deletion of CD28 prior to secondary nippostrongylus brasiliensis infection impairs worm expulsion and recall of protective memory CD4⁺ T cell responses.

    Directory of Open Access Journals (Sweden)

    Hlumani Ndlovu

    2014-02-01

    Full Text Available IL-13 driven Th2 immunity is indispensable for host protection against infection with the gastrointestinal nematode Nippostronglus brasiliensis. Disruption of CD28 mediated costimulation impairs development of adequate Th2 immunity, showing an importance for CD28 during the initiation of an immune response against this pathogen. In this study, we used global CD28⁻/⁻ mice and a recently established mouse model that allows for inducible deletion of the cd28 gene by oral administration of tamoxifen (CD28(-/loxCre⁺/⁻+TM to resolve the controversy surrounding the requirement of CD28 costimulation for recall of protective memory responses against pathogenic infections. Following primary infection with N. brasiliensis, CD28⁻/⁻ mice had delayed expulsion of adult worms in the small intestine compared to wild-type C57BL/6 mice that cleared the infection by day 9 post-infection. Delayed expulsion was associated with reduced production of IL-13 and reduced serum levels of antigen specific IgG1 and total IgE. Interestingly, abrogation of CD28 costimulation in CD28(-/loxCre⁺/⁻ mice by oral administration of tamoxifen prior to secondary infection with N. brasiliensis resulted in impaired worm expulsion, similarly to infected CD28⁻/⁻ mice. This was associated with reduced production of the Th2 cytokines IL-13 and IL-4, diminished serum titres of antigen specific IgG1 and total IgE and a reduced CXCR5⁺ T(FH cell population. Furthermore, total number of CD4⁺ T cells and B220⁺ B cells secreting Th1 and Th2 cytokines were significantly reduced in CD28⁻/⁻ mice and tamoxifen treated CD28(-/loxCre⁺/⁻ mice compared to C57BL/6 mice. Importantly, interfering with CD28 costimulatory signalling before re-infection impaired the recruitment and/or expansion of central and effector memory CD4⁺ T cells and follicular B cells to the draining lymph node of tamoxifen treated CD28(-/loxCre⁺/⁻ mice. Therefore, it can be concluded that CD28

  17. Blockade of interleukin-6 signaling inhibits the classic pathway and promotes an alternative pathway of macrophage activation after spinal cord injury in mice

    Directory of Open Access Journals (Sweden)

    Guerrero Alexander

    2012-02-01

    predominant phenotype in the injured SC of non-treated control mice, MR16-1 treatment promoted arginase 1-positive, CD206-positive M2 macrophages, with preferential localization of these cells at the injury site. MR16-1 treatment suppressed the number of IFN-γ-positive neutrophils, and increased the number of microglia present and their positivity for IL-4. Among the arginase 1-positive M2 macrophages, MR16-1 treatment increased positivity for Mac-2 and Mac-3, suggestive of increased phagocytic behavior. Conclusion The results suggest that temporal blockade of IL-6 signaling after SCI abrogates damaging inflammatory activity and promotes functional recovery by promoting the formation of alternatively activated M2 macrophages.

  18. Acute P. falciparum malaria induces a loss of CD28- T IFN-¿ producing cells

    DEFF Research Database (Denmark)

    Kemp, Kåre; Akanmori, Bartholomew D; Kurtzhals, Jørgen A L

    2002-01-01

    P. falciparum malaria is associated with increased activation among peripheral lymphocytes. In the present study, we investigated markers of susceptibility to apoptosis and expression of IFN-gamma and IL-4 by CD28-and CD28+T cells in West African children with acute P. falciparum malaria. The stu...... are sequestered away from the peripheral blood during P. falciparum malaria....

  19. Tumor-Targeted Human T Cells Expressing CD28-Based Chimeric Antigen Receptors Circumvent CTLA-4 Inhibition.

    Directory of Open Access Journals (Sweden)

    Maud Condomines

    Full Text Available Adoptive T cell therapy represents a promising treatment for cancer. Human T cells engineered to express a chimeric antigen receptor (CAR recognize and kill tumor cells in a MHC-unrestricted manner and persist in vivo when the CAR includes a CD28 costimulatory domain. However, the intensity of the CAR-mediated CD28 activation signal and its regulation by the CTLA-4 checkpoint are unknown. We investigated whether T cells expressing an anti-CD19, CD3 zeta and CD28-based CAR (19-28z displayed the same proliferation and anti-tumor abilities than T cells expressing a CD3 zeta-based CAR (19z1 costimulated through the CD80/CD28, ligand/receptor pathway. Repeated in vitro antigen-specific stimulations indicated that 19-28z+ T cells secreted higher levels of Th1 cytokines and showed enhanced proliferation compared to those of 19z1+ or 19z1-CD80+ T cells. In an aggressive pre-B cell leukemia model, mice treated with 19-28z+ T cells had 10-fold reduced tumor progression compared to those treated with 19z1+ or 19z1-CD80+ T cells. shRNA-mediated CTLA-4 down-regulation in 19z1-CD80+ T cells significantly increased their in vivo expansion and anti-tumor properties, but had no effect in 19-28z+ T cells. Our results establish that CTLA-4 down-regulation may benefit human adoptive T cell therapy and demonstrate that CAR design can elude negative checkpoints to better sustain T cell function.

  20. Role of CD40 ligand and CD28 in induction and maintenance of antiviral CD8+ effector T cell responses

    DEFF Research Database (Denmark)

    Andreasen, Susanne; Christensen, Jeanette Erbo; Marker, O

    2000-01-01

    and extensively, whereas vesicular stomatitis virus (VSV) spreads poorly. We found that the primary response of CD40L-/- mice toward VSV is significantly impaired; proliferation of both CD4+ and CD8+ cells is reduced 2- to 3-fold, few CD8+ cells acquire an activated phenotype, and little functional activity...... is induced. Very similar results were obtained in VSV-infected, CD28-deficient mice. In contrast, neither CD40L nor CD28 was required for induction of a primary CD8+ response toward LCMV. Surprisingly, lack of CD4+ T cells had no impact on the primary immune response toward any of the viruses, even though...... the CD40 ligand dependence demonstrated for VSV would be expected to be associated with CD4 dependence. Upon coinfection of VSV-infected mice with LCMV, the requirement for CD40 ligand (but not CD28) could be partially bypassed, as evidenced by a 3-fold increase in the frequency of VSV-specific CD8+ T...

  1. Circulating CD4+CD28null T Cells May Increase the Risk of an Atherosclerotic Vascular Event Shortly after Kidney Transplantation

    Directory of Open Access Journals (Sweden)

    Michiel G. H. Betjes

    2013-01-01

    Full Text Available Proinflammatory CD4+ T cells without the costimulatory molecule CD28 (CD4+CD28null T cells are expanded in patients with end-stage renal disease (ESRD and associated with atherosclerotic vascular events (AVE. In a prospective study, the number of circulating CD4+CD28null T cells was established in 295 ESRD patients prior to receiving a kidney allograft. Within the first year after transplantation, an AVE occurred in 20 patients. Univariate analysis showed that besides a history of cardiovascular disease (CVDpos, HR 8.1, , age (HR 1.04, , dyslipidaemia (HR 8.8, , and the % of CD4+CD28null T cells (HR 1.04 per % increase, 95% CI 1.00–1.09, were significantly associated with the occurrence of a posttransplantation AVE. In a multivariate analysis, only CVDpos remained a significant risk factor with a significant and positive interaction between the terms CVDpos and the % of CD4+CD28null T cells (HR 1.05, 95% CI 1.03–1.11, . Within the CVDpos group, the incidence of an AVE was 13% in the lowest tertile compared to 25% in the highest tertile of % of CD4+CD28null T cells. In conclusion, the presence of circulating CD4+CD28null T cells is associated with an increased risk for a cardiovascular event shortly after kidney transplantation.

  2. Protection of Mice from Acute Graft-versus-Host Disease Requires CD28 Co-stimulation on Donor CD4+ Foxp3+ Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Anna Uri

    2017-06-01

    Full Text Available Acute graft-versus-host disease (aGvHD is a major cause of morbidity and mortality after allogeneic hematopoietic stem cell plus T cell transplantation (allo-HSCT. In this study, we investigated the requirement for CD28 co-stimulation of donor CD4+ conventional (CD4+CD25−Foxp3−, Tconv and regulatory (CD4+CD25+Foxp3+, Treg T cells in aGvHD using tamoxifen-inducible CD28 knockout (iCD28KO or wild-type (wt littermates as donors of CD4+ Tconv and Treg. In the highly inflammatory C57BL/6 into BALB/c allo-HSCT transplantation model, CD28 depletion on donor CD4+ Tconv reduced clinical signs of aGvHD, but did not significantly prolong survival of the recipient mice. Selective depletion of CD28 on donor Treg did not abrogate protection of recipient mice from aGvHD until about day 20 after allo-HSCT. Later, however, the pool of CD28-depleted Treg drastically declined as compared to wt Treg. Consequently, only wt, but not CD28-deficient, Treg were able to continuously suppress aGvHD and induce long-term survival of the recipient mice. To our knowledge, this is the first study that specifically evaluates the impact of CD28 expression on donor Treg in aGvHD. Moreover, the delayed kinetics of aGvHD lethality after transplantation of iCD28KO Treg provides a novel animal model for similar disease courses found in patients after allo-HSCT.

  3. Blocking C5aR signaling promotes the anti-tumor efficacy of PD-1/PD-L1 blockade.

    Science.gov (United States)

    Zha, Haoran; Han, Xiao; Zhu, Ying; Yang, Fei; Li, Yongsheng; Li, Qijing; Guo, Bo; Zhu, Bo

    2017-01-01

    Anti-PD-1/PD-L1 therapy has achieved great success in the clinic; however, only a small fraction of cancer patient benefit from PD-1/PD-L1 blockade therapy, and overcoming resistance to PD-1/PD-L1 blockade has thus become a primary priority. In this study, we demonstrated that administration of PD-1/PD-L1 antibodies resulted in the activation of the complement system and massive generation of C5a. Generation of C5a did not change the accumulation of MDSCs in either the tumor or spleen but enhanced their inhibitory potential. In addition, blockade of C5a-C5aR signaling in combination with PD-1/PD-L1 antibodies greatly enhanced the anti-tumor efficacy of PD-1/PD-L1 antibodies. Overall, these data indicate an immunosuppressive role of C5a in the context of PD-1/PD-L1 blockade therapy and provide a strong incentive to clinically explore combination therapies using a C5a antagonist.

  4. Clinical Trials Using Anti-CD19/CD28/CD3zeta CAR Gammaretroviral Vector-transduced Autologous T Lymphocytes KTE-C19

    Science.gov (United States)

    NCI supports clinical trials that test new and more effective ways to treat cancer. Find clinical trials studying anti-cd19/cd28/cd3zeta car gammaretroviral vector-transduced autologous t lymphocytes kte-c19.

  5. CD25, CD28 and CD38 expression in peripheral blood lymphocytes as a tool to predict acute rejection after liver transplantation.

    Science.gov (United States)

    Boleslawski, Emmanuel; BenOthman, Samia; Grabar, Sophie; Correia, Leonor; Podevin, Philippe; Chouzenoux, Sandrine; Soubrane, Olivier; Calmus, Yvon; Conti, Filomena

    2008-01-01

    The aim of this study was to determine whether the expression of CD25, CD28 and CD38 (which reflects the degree of T-cell activation) by peripheral blood mononuclear cells constitutes a useful means of measuring the immune status of liver transplant recipients. Fifty-two patients enrolled in a prospective randomized study comparing cyclosporine and tacrolimus as the principal immunosuppressive drugs were monitored prospectively. The expression of CD25, CD28 and CD38 was analyzed on CD3-, CD4- and CD8-positive cells from whole blood using flow cytometry. The prognostic value of baseline and day 14 measurements regarding acute rejection was examined using Kaplan-Meier estimates for univariate analyses and the Cox model for multivariate analyses. The mean frequencies of CD28 and CD38-expressing T cells were significantly higher in patients with acute rejection (p = 0.01 and p = 0.001, respectively), whereas the frequency CD25-expressing T cells did not differ significantly. Under univariate analysis, baseline CD25 levels, the type of calcineurin inhibitor, as well as the CD28 and CD38 frequencies obtained at day 14 were associated with the subsequent development of acute rejection. Under multivariate analysis, only CD28 and CD38 frequencies obtained at day 14 were independently associated with acute rejection. The evaluation of CD28 and CD38 expression in peripheral blood lymphocytes is a simple marker that could be used routinely in clinical practice to assess the level of immunosuppression.

  6. HIV-1 transgenic rat CD4+ T cells develop decreased CD28 responsiveness and suboptimal Lck tyrosine dephosphorylation following activation

    International Nuclear Information System (INIS)

    Yadav, Anjana; Pati, Shibani; Nyugen, Anhthu; Barabitskaja, Oxana; Mondal, Prosanta; Anderson, Michael; Gallo, Robert C.; Huso, David L.; Reid, William

    2006-01-01

    Impaired CD4+ T cell responses, resulting in dysregulated T-helper 1 (Th1) effector and memory responses, are a common result of HIV-1 infection. These defects are often preceded by decreased expression and function of the α/β T cell receptor (TCR)-CD3 complex and of co-stimulatory molecules including CD28, resulting in altered T cell proliferation, cytokine secretion and cell survival. We have previously shown that HIV Tg rats have defective development of T cell effector function and generation of specific effector/memory T cell subsets. Here we identify abnormalities in activated HIV-1 Tg rat CD4+ T cells that include decreased pY505 dephosphorylation of Lck (required for Lck activation), decreased CD28 function, reduced expression of the anti-apoptotic molecule Bcl-xL, decreased secretion of the mitogenic lympokine interleukin-2 (IL-2) and increased activation induced apoptosis. These events likely lead to defects in antigen-specific signaling and may help explain the disruption of Th1 responses and the generation of specific effector/memory subsets in transgenic CD4+ T cells

  7. Autoimmune regulator (AIRE)-deficient CD8+CD28low regulatory T lymphocytes fail to control experimental colitis.

    Science.gov (United States)

    Pomié, Céline; Vicente, Rita; Vuddamalay, Yirajen; Lundgren, Brita Ardesjö; van der Hoek, Mark; Enault, Geneviève; Kagan, Jérémy; Fazilleau, Nicolas; Scott, Hamish S; Romagnoli, Paola; van Meerwijk, Joost P M

    2011-07-26

    Mutations in the gene encoding the transcription factor autoimmune regulator (AIRE) are responsible for autoimmune polyendocrinopathy candidiasis ectodermal dystrophy syndrome. AIRE directs expression of tissue-restricted antigens in the thymic medulla and in lymph node stromal cells and thereby substantially contributes to induction of immunological tolerance to self-antigens. Data from experimental mouse models showed that AIRE deficiency leads to impaired deletion of autospecific T-cell precursors. However, a potential role for AIRE in the function of regulatory T-cell populations, which are known to play a central role in prevention of immunopathology, has remained elusive. Regulatory T cells of CD8(+)CD28(low) phenotype efficiently control immune responses in experimental autoimmune and colitis models in mice. Here we show that CD8(+)CD28(low) regulatory T lymphocytes from AIRE-deficient mice are transcriptionally and phenotypically normal and exert efficient suppression of in vitro immune responses, but completely fail to prevent experimental colitis in vivo. Our data therefore demonstrate that AIRE plays an important role in the in vivo function of a naturally occurring regulatory T-cell population.

  8. [Residual neuromuscular blockade].

    Science.gov (United States)

    Fuchs-Buder, T; Schmartz, D

    2017-06-01

    Even small degrees of residual neuromuscular blockade, i. e. a train-of-four (TOF) ratio >0.6, may lead to clinically relevant consequences for the patient. Especially upper airway integrity and the ability to swallow may still be markedly impaired. Moreover, increasing evidence suggests that residual neuromuscular blockade may affect postoperative outcome of patients. The incidence of these small degrees of residual blockade is relatively high and may persist for more than 90 min after a single intubating dose of an intermediately acting neuromuscular blocking agent, such as rocuronium and atracurium. Both neuromuscular monitoring and pharmacological reversal are key elements for the prevention of postoperative residual blockade.

  9. Human CAR T cells with cell-intrinsic PD-1 checkpoint blockade resist tumor-mediated inhibition

    Science.gov (United States)

    Cherkassky, Leonid; Morello, Aurore; Villena-Vargas, Jonathan; Feng, Yang; Dimitrov, Dimiter S.; Jones, David R.; Sadelain, Michel; Adusumilli, Prasad S.

    2016-01-01

    Following immune attack, solid tumors upregulate coinhibitory ligands that bind to inhibitory receptors on T cells. This adaptive resistance compromises the efficacy of chimeric antigen receptor (CAR) T cell therapies, which redirect T cells to solid tumors. Here, we investigated whether programmed death-1–mediated (PD-1–mediated) T cell exhaustion affects mesothelin-targeted CAR T cells and explored cell-intrinsic strategies to overcome inhibition of CAR T cells. Using an orthotopic mouse model of pleural mesothelioma, we determined that relatively high doses of both CD28- and 4-1BB–based second-generation CAR T cells achieved tumor eradication. CAR-mediated CD28 and 4-1BB costimulation resulted in similar levels of T cell persistence in animals treated with low T cell doses; however, PD-1 upregulation within the tumor microenvironment inhibited T cell function. At lower doses, 4-1BB CAR T cells retained their cytotoxic and cytokine secretion functions longer than CD28 CAR T cells. The prolonged function of 4-1BB CAR T cells correlated with improved survival. PD-1/PD-1 ligand [PD-L1] pathway interference, through PD-1 antibody checkpoint blockade, cell-intrinsic PD-1 shRNA blockade, or a PD-1 dominant negative receptor, restored the effector function of CD28 CAR T cells. These findings provide mechanistic insights into human CAR T cell exhaustion in solid tumors and suggest that PD-1/PD-L1 blockade may be an effective strategy for improving the potency of CAR T cell therapies. PMID:27454297

  10. Treatment of acute lymphoblastic leukaemia with the second generation of CD19 CAR-T containing either CD28 or 4-1BB.

    Science.gov (United States)

    Li, Shiqi; Zhang, Jiasi; Wang, Meiling; Fu, Gang; Li, Yunyan; Pei, Li; Xiong, Zhouxing; Qin, Dabing; Zhang, Rui; Tian, Xiaobo; Wei, Zhihao; Chen, Run; Chen, Xuejiao; Wan, Jia; Chen, Jun; Wei, Xia; Xu, Yanmin; Zhang, Pei; Wang, Ping; Peng, Xi; Yang, Sainan; Shen, Junjie; Yang, Zhi; Chen, Jieping; Qian, Cheng

    2018-04-10

    T cells modified with anti-CD19 chimeric antigen receptor (CAR) containing either CD28 or 4-1BB (also termed TNFRSF9, CD137) costimulatory signalling have shown great potential in the treatment of acute lymphoblastic leukaemia (ALL). However, the difference between CD28 and 4-1BB costimulatory signalling in CAR-T treatment has not been well elucidated in clinical trials. In this study, we treated 10 relapsed or refractory ALL patients with the second generation CD19 CAR-T. The first 5 patients were treated with CD28-CAR and the other 5 patients were treated with 4-1BB CAR-T. All the 10 patients were response-evaluable. Three patients achieved complete remission and 1 patient with extramedullary disease achieved partial response after CD28-CAR-T treatment. In the 4-1BB CAR-T treatment group, 3 patients achieved complete remission. Furthermore, FLT-3 ligand (FLT3LG) was highly correlated with response time and may serve as a prognosis factor. No severe adverse events were observed in these 10 treated patients. Our study showed that both CD28 CAR-T and 4-1BB CAR-T both worked for response but they differed in response pattern (peak reaction time, reaction lasting time and reaction degree), adverse events, cytokine secretion and immune-suppressive factor level. © 2018 John Wiley & Sons Ltd.

  11. Differential effects of B7-1 blockade in the rat experimental autoimmune encephalomyelitis model

    DEFF Research Database (Denmark)

    Gallon, L; Chandraker, A; Issazadeh-Navikas, Shohreh

    1997-01-01

    Blocking the CD28-B7 T cell costimulatory activation pathway protects animals from developing experimental autoimmune encephalomyelitis (EAE). In the mouse EAE model, selective blockade of B7-1 by specific mAbs has been shown to protect animals from EAE. In the Lewis rat model, we have shown...... and either CTLA4Ig or CTLA4IgY100F protected recipients from disease. In vitro studies confirmed the in vivo observations and showed that primed lymph node cells from protected animals had decreased proliferative responses to myelin basic protein as compared with controls, while lymphocytes from animals...

  12. Circulating CD8+CD28- suppressor T cells tied to poorer prognosis among metastatic breast cancer patients receiving adoptive T-cell therapy: A cohort study.

    Science.gov (United States)

    Song, Qingkun; Ren, Jun; Zhou, Xinna; Wang, Xiaoli; Song, Guohong; Hobeika, Amy; Yuan, Yanhua; Lyerly, Herbert Kim

    2018-01-01

    This study aimed to determine the prognostic value of circulating CD8 + CD28 - T lymphocytes among breast cancer patients treated with adoptive T-lymphocyte immunotherapy after chemotherapy. Two hundred and thirty-two breast cancer patients underwent adoptive T-cell immunotherapy. Circulating CD8 + CD28 - proportion was measured by flow cytometry. Median proportion of CD8 + CD28 - was 24.2% and set as the categorical cutoff value for further analysis. The median survival was estimated by Kaplan-Meier curve, with difference detection and hazard ratio estimation by log-rank test and Cox hazard proportion regression model. With adoptive T-cell therapy, patients with higher CD8 + CD28 - levels experienced median progression-free and overall survival of 7.1 months and 26.9 months, respectively-significantly shorter than patients with lower levels (11.8 and 36.2 months). CD8 + CD28 - proportion >24.2% demonstrated a hazard ratio (HR) of 2.06 (95% confidence interval [CI] 1.31-3.12) for progression and an HR of 1.97 (95% CI 1.06-3.67) for death. Among patients who had received previous first-line chemotherapy, CD8 + CD28 - proportion >24.2% demonstrated an HR of 2.66 (95% CI 1.45-4.88) for progression. Among patients exposed to previous second-line or higher chemotherapy, CD8 + CD28 - proportion >24.2% demonstrated a 486% higher risk for death (HR = 5.86, 95% CI 1.77-19.39). A 1% increase in suppressive T cells was associated with a 5% increased risk of death. Elevated peripheral blood CD8 + CD28 - was associated with poorer prognosis for metastatic breast cancer, especially for higher risk of progression among patients with first-line chemotherapy and higher risk of death among patients with more than second-line chemotherapy. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  13. Coulomb Blockade Plasmonic Switch.

    Science.gov (United States)

    Xiang, Dao; Wu, Jian; Gordon, Reuven

    2017-04-12

    Tunnel resistance can be modulated with bias via the Coulomb blockade effect, which gives a highly nonlinear response current. Here we investigate the optical response of a metal-insulator-nanoparticle-insulator-metal structure and show switching of a plasmonic gap from insulator to conductor via Coulomb blockade. By introducing a sufficiently large charging energy in the tunnelling gap, the Coulomb blockade allows for a conductor (tunneling) to insulator (capacitor) transition. The tunnelling electrons can be delocalized over the nanocapacitor again when a high energy penalty is added with bias. We demonstrate that this has a huge impact on the plasmonic resonance of a 0.51 nm tunneling gap with ∼70% change in normalized optical loss. Because this structure has a tiny capacitance, there is potential to harness the effect for high-speed switching.

  14. The regulation of protein synthesis and translation factors by CD3 and CD28 in human primary T lymphocytes

    Directory of Open Access Journals (Sweden)

    Proud Christopher G

    2002-05-01

    Full Text Available Abstract Background Activation of human resting T lymphocytes results in an immediate increase in protein synthesis. The increase in protein synthesis after 16–24 h has been linked to the increased protein levels of translation initiation factors. However, the regulation of protein synthesis during the early onset of T cell activation has not been studied in great detail. We studied the regulation of protein synthesis after 1 h of activation using αCD3 antibody to stimulate the T cell receptor and αCD28 antibody to provide the co-stimulus. Results Activation of the T cells with both antibodies led to a sustained increase in the rate of protein synthesis. The activities and/or phosphorylation states of several translation factors were studied during the first hour of stimulation with αCD3 and αCD28 to explore the mechanism underlying the activation of protein synthesis. The initial increase in protein synthesis was accompanied by activation of the guanine nucleotide exchange factor, eukaryotic initiation factor (eIF 2B, and of p70 S6 kinase and by dephosphorylation of eukaryotic elongation factor (eEF 2. Similar signal transduction pathways, as assessed using signal transduction inhibitors, are involved in the regulation of protein synthesis, eIF2B activity and p70 S6 kinase activity. A new finding was that the p38 MAPK α/β pathway was involved in the regulation of overall protein synthesis in primary T cells. Unexpectedly, no changes were detected in the phosphorylation state of the cap-binding protein eIF4E and the eIF4E-binding protein 4E-BP1, or the formation of the cap-binding complex eIF4F. Conclusions Both eIF2B and p70 S6 kinase play important roles in the regulation of protein synthesis during the early onset of T cell activation.

  15. Enhancing Brain Pregnenolone May Protect Cannabis Intoxication but Should Not Be Considered as an Anti-addiction Therapeutic: Hypothesizing Dopaminergic Blockade and Promoting Anti-Reward

    Science.gov (United States)

    Blum, Kenneth; Oscar-Berman, Marlene; Braverman, Eric R.; Febo, Marcelo; Li, Mona; Gold, Mark S.

    2015-01-01

    Many US states now embrace the medical and recreational use of Cannabis. Changes in the laws have heightened interest and encouraged research into both cannabinoid products and the potential harms of Cannabis use, addiction, and intoxication. Some research into those harms will be reviewed here and misgivings about the use of Pregnenolone, to treat cannabis addiction and intoxication explained. Pregnenolone considered the inactive precursor of all steroid hormones, has recently been shown to protect the brain from Cannabis intoxication. The major active ingredient of Cannabis sativa (marijuana), Δ9-tetrahydrocannabinol (THC) enhances Pregnenolone synthesis in the brain via stimulation of the type-1 cannabinoid (CB1) receptor. This steroid has been shown to inhibit the activity of the CB1 receptor thereby reducing many of the effects of THC. While this mechanism seems correct, in our opinion, Vallee et al., incorrectly suggest that blocking CB1 receptors could open unforeseen approaches to the treatment of cannabis intoxication and addiction. In this hypothesis, we caution the scientific community that, other CB1 receptor blockers, such as, Rimonabant (SR141718) have been pulled off the market in Europe. In addition, CB1 receptor blockers were rejected by the FDA due to mood changes including suicide ideation. Blocking CB1 receptors would result in reduced neuronal release of Dopamine by disinhibition of GABA signaling. Long-term blockade of cannabinoid receptors could occur with raising Pregnenolone brain levels, may induce a hypodopaminergic state, and lead to aberrant substance and non-substance (behavioral) addictions. PMID:26306328

  16. The phosphoproteome of human Jurkat T cell clones upon costimulation with anti-CD3/anti-CD28 antibodies.

    Science.gov (United States)

    Nguyen, Tien Dung; Carrascal, Montserrat; Vidal-Cortes, Oriol; Gallardo, Oscar; Casas, Vanessa; Gay, Marina; Phan, Van Chi; Abian, Joaquin

    2016-01-10

    Phosphorylation is a reversible post-translational modification, playing a vital role in protein function. In T cells, protein phosphorylation is the key mechanism regulating T cell receptor-driven signaling pathways. In order to gain insights into the phosphoproteome evolution of T cell activation, we performed a large-scale quantitative phosphoproteomics study of Jurkat E6.1 (wild type) and Jurkat gamma1 (Phospholipase gamma1 null) cell clones upon costimulation with anti-CD3 and anti-CD28 antibodies at times ranging from 15min to as long as 120min. In total, we identified 5585 phosphopeptides belonging to 2008 phosphoproteins from both cell clones. We detected 130 and 114 novel phosphopeptides in Jurkat E6.1 and Jurkat gamma1 clones, respectively. A significantly lower number of proteins containing regulated phosphorylation sites were identified in Jurkat gamma1 in comparison to Jurkat E6.1, reflecting the vital role of Phospholipase gamma1 in T cell signaling. Several new phosphorylation sites from lymphocyte-specific protein tyrosine kinase (Lck) were identified. Of these, serine-121 showed significant changes in JE6.1 while only small changes in the Jgamma1 clone. Our data may contribute to the current human T cell phosphoproteome and provide a better understanding on T cell receptor signaling. Data are available via ProteomeXchange with identifier PXD002871. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. A low level of CD4+CD28+ T cells is an independent predictor of high mortality in human immunodeficiency virus type 1-infected patients

    DEFF Research Database (Denmark)

    Ostrowski, Sisse R; Gerstoft, Jan; Pedersen, Bente K

    2003-01-01

    This study investigated coexpression of CD28, CD45RA, and CD45RO on CD4(+) and CD8(+) cells in 107 human immunodeficiency virus (HIV) type 1-infected patients, who were followed-up prospectively and were not treated with highly active antiretroviral therapy, and 65 control subjects. The most...

  18. Decreased Expression of T-Cell Costimulatory Molecule CD28 on CD4 and CD8 T Cells of Mexican Patients with Pulmonary Tuberculosis

    Directory of Open Access Journals (Sweden)

    German Bernal-Fernandez

    2010-01-01

    Full Text Available Patients with tuberculosis frequently develop anergy, a state of T-cell hyporesponsiveness in which defective T-cell costimulation could be a factor. To know if the expression of T-cell costimulatory molecules was altered in tuberculosis, we analyzed the peripheral blood T-cell phenotype of 23 Mexican patients with pulmonary tuberculosis. There was severe CD4 (P<.001 and CD8 (P<.01 lymphopenia and upregulation of costimulatory molecule CD30 on CD4 and CD8 T cells (P<.05; this increase was higher in relapsing tuberculosis. The main finding was severe downregulation of the major costimulatory molecule CD28 on both CD8 and CD4 T cells (P<.001. Depletion of the CD4/CD28 subset, a hitherto undescribed finding, is relevant because CD4 T cells constitute the main arm of the cell-mediated antimycobacterial immune response.

  19. Differences in allergen-induced T cell activation between allergic asthma and rhinitis: Role of CD28, ICOS and CTLA-4

    Directory of Open Access Journals (Sweden)

    Lacoeuille Yannick

    2011-02-01

    Full Text Available Abstract Background Th2 cell activation and T regulatory cell (Treg deficiency are key features of allergy. This applies for asthma and rhinitis. However with a same atopic background, some patients will develop rhinitis and asthma, whereas others will display rhinitis only. Co-receptors are pivotal in determining the type of T cell activation, but their role in allergic asthma and rhinitis has not been explored. Our objective was to assess whether allergen-induced T cell activation differs from allergic rhinitis to allergic rhinitis with asthma, and explore the role of ICOS, CD28 and CTLA-4. Methods T cell co-receptor and cytokine expressions were assessed by flow cytometry in PBMC from 18 house dust mite (HDM allergic rhinitics (R, 18 HDM allergic rhinitics and asthmatics (AR, 13 non allergic asthmatics (A and 20 controls, with or without anti-co-receptors antibodies. Results In asthmatics (A+AR, a constitutive decrease of CTLA-4+ and of CD4+CD25+Foxp3+ cells was found, with an increase of IFN-γ+ cells. In allergic subjects (R + AR, allergen stimulation induced CD28 together with IL-4 and IL-13, and decreased the proportion of CTLA-4+, IL-10+ and CD4+CD25+Foxp3+ cells. Anti-ICOS and anti-CD28 antibodies blocked allergen-induced IL-4 and IL-13. IL-13 production also involved CTLA-4. Conclusions T cell activation differs between allergic rhinitis and asthma. In asthma, a constitutive, co-receptor independent, Th1 activation and Treg deficiency is found. In allergic rhinitis, an allergen-induced Treg cell deficiency is seen, as well as an ICOS-, CD28- and CTLA-4-dependent Th2 activation. Allergic asthmatics display both characteristics.

  20. The roles of urine interleukin-13, CD80, CD28, matrix metalloproteinase-2 and granzyme B in the pathogenesis of childhood minimal change nephrotic syndrome

    Directory of Open Access Journals (Sweden)

    Cengiz Zeybek

    2014-09-01

    Full Text Available Objective: Minimal change disease (MCD is the most common cause of nephrotic syndrome in childhood but its pathogenesis remains poorly understood. A T-cell-derived factor or factors were initially alleged as contributing to the disease pathogenesis. However, podocyte CD80 expression is now a commonly discussed theory. The aim of this study was to investigate the pathogenesis of MCD by determining urine interleukin-13, CD80, CD28, matrix metalloproteinase-2 (MMP-2, and granzyme B levels. Methods: Thirty patients and thirty healthy children were evaluated in this study. Six patients had biopsy proven MCD. The remaining patients were considered to have MCD because of their age at time of diagnosis; response to steroid treatment, absence of gross hematuria, hypocomplementemia or renal failure; and normal blood pressures in the active stage. The nephrotic-phase urine interleukin-13, CD80, CD28, MMP-2, and granzyme B levels of all patients were compared with the remission-stage urine levels of the same patients and control subjects. The urine samples were collected immediately before the application of immunosuppressive drugs or other treatment modalities. Results: Significantly higher interleukin-13, CD80, CD28, and MMP-2 levels were observed in the relapse period compared with both the remission period and control subjects. There was a significant positive correlation between the active-stage urine interleukin-13 and CD80 levels (r=0.619, p<0.001. Conclusion: Interleukin-13, CD80, CD28, and MMP-2 seem to have roles in the pathogenesis of MCD and using inhibitors of these molecules in treatment of steroid and immunosuppressive-resistant MCD cases can be thought. J Clin Exp Invest 2014; 5 (3: 354-361

  1. Molecular pathway profiling of T lymphocyte signal transduction pathways; Th1 and Th2 genomic fingerprints are defined by TCR and CD28-mediated signaling

    Directory of Open Access Journals (Sweden)

    Smeets Ruben L

    2012-03-01

    Full Text Available Abstract Background T lymphocytes are orchestrators of adaptive immunity. Naïve T cells may differentiate into Th1, Th2, Th17 or iTreg phenotypes, depending on environmental co-stimulatory signals. To identify genes and pathways involved in differentiation of Jurkat T cells towards Th1 and Th2 subtypes we performed comprehensive transcriptome analyses of Jurkat T cells stimulated with various stimuli and pathway inhibitors. Results from these experiments were validated in a human experimental setting using whole blood and purified CD4+ Tcells. Results Calcium-dependent activation of T cells using CD3/CD28 and PMA/CD3 stimulation induced a Th1 expression profile reflected by increased expression of T-bet, RUNX3, IL-2, and IFNγ, whereas calcium-independent activation via PMA/CD28 induced a Th2 expression profile which included GATA3, RXRA, CCL1 and Itk. Knock down with siRNA and gene expression profiling in the presence of selective kinase inhibitors showed that proximal kinases Lck and PKCθ are crucial signaling hubs during T helper cell activation, revealing a clear role for Lck in Th1 development and for PKCθ in both Th1 and Th2 development. Medial signaling via MAPkinases appeared to be less important in these pathways, since specific inhibitors of these kinases displayed a minor effect on gene expression. Translation towards a primary, whole blood setting and purified human CD4+ T cells revealed that PMA/CD3 stimulation induced a more pronounced Th1 specific, Lck and PKCθ dependent IFNγ production, whereas PMA/CD28 induced Th2 specific IL-5 and IL-13 production, independent of Lck activation. PMA/CD3-mediated skewing towards a Th1 phenotype was also reflected in mRNA expression of the master transcription factor Tbet, whereas PMA/CD28-mediated stimulation enhanced GATA3 mRNA expression in primary human CD4+ Tcells. Conclusions This study identifies stimulatory pathways and gene expression profiles for in vitro skewing of T helper cell

  2. Daidzein prevents the increase in CD4+CD28null T cells and B lymphopoesis in ovariectomized mice: a key mechanism for anti-osteoclastogenic effect.

    Directory of Open Access Journals (Sweden)

    Abdul Malik Tyagi

    Full Text Available Estrogen deficiency leads to an upregulation of TNF-α producing T cells and B-lymphopoesis which augments osteoclastogenesis. Estrogen deficiency also increases the population of premature senescent CD4⁺ CD28null T cells which secrete a higher amount of TNF-α thus leading to enhanced osteoclastogenesis. Isoflavonoids like daidzein and genistein are found mostly in soybeans, legumes, and peas. These share structural similarity with 17β-stradiol (E2 and have osteoprotective role. This study explores the effect of daidzein (Daid on the proliferation of TNF-α producing T cells, premature senescent T cells and B cell lymphopoesis under estrogen deficient conditions. For this study adult Balb/c mice were treated with Daid at 10 mg/kg body weight dose by oral gavage daily post ovariectomy (Ovx. After six weeks animals were autopsied and bone marrow and spleen cells were collected for FACS analysis. Blood serum was collected for ELISA. It was observed that Ovx mice treated with Daid for six weeks show reduction in Ovx induced expansion of CD4⁺ T cells in bone marrow and spleen when analysed by flow cytometry. Estrogen deficiency led to increased prevalence of TNF-α secreting CD4⁺CD28null T cells, however, treatment with Daid increased the percentage of CD4⁺CD28⁺ T cells. Co-culture of CD4⁺CD28null T cells and bone marrow resulted in enhanced osteoclastogenesis as evident by increased tartarate resistant acid phosphatase (TRAP expression, an osteoclast marker. However, treatment with Daid resulted in reduced osteoclastogenesis in CD4⁺CD28null T cells and bone marrow cell co-culture. Daid also regulated B lymphopoesis and decreased mRNA levels of RANKL in B220⁺ cells. Taken together, we propose that one of the mechanisms by which Daid prevents bone loss is by reversing the detrimental immune changes as a result of estrogen deficiency.

  3. p56Lck and p59Fyn Regulate CD28 Binding to Phosphatidylinositol 3-Kinase, Growth Factor Receptor-Bound Protein GRB-2, and T Cell-Specific Protein-Tyrosine Kinase ITK: Implications for T-Cell Costimulation

    Science.gov (United States)

    Raab, Monika; Cai, Yun-Cai; Bunnell, Stephen C.; Heyeck, Stephanie D.; Berg, Leslie J.; Rudd, Christopher E.

    1995-09-01

    T-cell activation requires cooperative signals generated by the T-cell antigen receptor ξ-chain complex (TCRξ-CD3) and the costimulatory antigen CD28. CD28 interacts with three intracellular proteins-phosphatidylinositol 3-kinase (PI 3-kinase), T cell-specific protein-tyrosine kinase ITK (formerly TSK or EMT), and the complex between growth factor receptor-bound protein 2 and son of sevenless guanine nucleotide exchange protein (GRB-2-SOS). PI 3-kinase and GRB-2 bind to the CD28 phosphotyrosine-based Tyr-Met-Asn-Met motif by means of intrinsic Src-homology 2 (SH2) domains. The requirement for tyrosine phosphorylation of the Tyr-Met-Asn-Met motif for SH2 domain binding implicates an intervening protein-tyrosine kinase in the recruitment of PI 3-kinase and GRB-2 by CD28. Candidate kinases include p56Lck, p59Fyn, ξ-chain-associated 70-kDa protein (ZAP-70), and ITK. In this study, we demonstrate in coexpression studies that p56Lck and p59Fyn phosphorylate CD28 primarily at Tyr-191 of the Tyr-Met-Asn-Met motif, inducing a 3- to 8-fold increase in p85 (subunit of PI 3-kinase) and GRB-2 SH2 binding to CD28. Phosphatase digestion of CD28 eliminated binding. In contrast to Src kinases, ZAP-70 and ITK failed to induce these events. Further, ITK binding to CD28 was dependent on the presence of p56Lck and is thus likely to act downstream of p56Lck/p59Fyn in a signaling cascade. p56Lck is therefore likely to be a central switch in T-cell activation, with the dual function of regulating CD28-mediated costimulation as well as TCR-CD3-CD4 signaling.

  4. Neuromuscular blockade in children

    Directory of Open Access Journals (Sweden)

    Almeida João Fernando Lourenço de

    2000-01-01

    Full Text Available Neuromuscular blocking agents (NMBAs have been widely used to control patients who need to be immobilized for some kind of medical intervention, such as an invasive procedure or synchronism with mechanical ventilation. The purpose of this monograph is to review the pharmacology of the NMBAs, to compare the main differences between the neuromuscular junction in neonates, infants, toddlers and adults, and moreover to discuss their indications in critically ill pediatric patients. Continuous improvement of knowledge about NMBAs pharmacology, adverse effects, and the many other remaining unanswered questions about neuromuscular junction and neuromuscular blockade in children is essential for the correct use of these drugs. Therefore, the indication of these agents in pediatrics is determined with extreme judiciousness. Computorized (Medline 1990-2000 and active search of articles were the mechanisms used in this review.

  5. Gold- and silver-induced murine autoimmunity--requirement for cytokines and CD28 in murine heavy metal-induced autoimmunity.

    Science.gov (United States)

    Havarinasab, S; Pollard, K M; Hultman, P

    2009-03-01

    Treatment with gold in the form of aurothiomaleate, silver or mercury (Hg) in genetically susceptible mouse strains (H-2(s)) induces a systemic autoimmune condition characterized by anti-nuclear antibodies targeting the 34-kDa nucleolar protein fibrillarin, as well as lymphoproliferation and systemic immune-complex (IC) deposits. In this study we have examined the effect of single-gene deletions for interferon (IFN)-gamma, interleukin (IL)-4, IL-6 or CD28 in B10.S (H-2(s)) mice on heavy metal-induced autoimmunity. Targeting of the genes for IFN-gamma, IL-6 or CD28 abrogated the development of both anti-fibrillarin antibodies (AFA) and IC deposits using a modest dose of Hg (130 microg Hg/kg body weight/day). Deletion of IL-4 severely reduced the IgG1 AFA induced by all three metals, left the total IgG AFA response intact, but abrogated the Hg-induced systemic IC deposits. In conclusion, intact IFN-gamma and CD28 genes are necessary for induction of AFA with all three metals and systemic IC deposits using Hg, while lack of IL-4 distinctly skews the metal-induced AFA response towards T helper type 1. In a previous study using a higher dose of Hg (415 microg Hg/kg body weight/day), IC deposits were preserved in IL-4(-/-) and IL-6(-/-) mice, and also AFA in the latter mice. Therefore, the attenuated autoimmunity following loss of IL-4 and IL-6 is dose-dependent, as higher doses of Hg are able to override the attenuation observed using lower doses.

  6. Generation of autologous tumor-specific T cells for adoptive transfer based on vaccination, in vitro restimulation and CD3/CD28 dynabead-induced T cell expansion

    DEFF Research Database (Denmark)

    Brimnes, Marie Klinge; Gang, Anne Ortved; Donia, Marco

    2012-01-01

    , for optimized expansion of tumor-specific T cells. A ratio of 1:3 of Dynabeads® CD3/CD28 T-cell expander to T cells resulted in the maximum number of tumor-specific T cells. The addition of CD137 did not improve functionality or fold expansion. Both T-cell expansion systems could generate tumor-specific T cells...... that were both cytotoxic and effective cytokine producers upon antigen recognition. Dynabeads®-expanded T-cell cultures shows phenotypical characteristics of memory T cells with potential to migrate and expand in vivo. In addition, they possess longer telomeres compared to TIL cultures. Taken together, we...

  7. IL-21 promotes the expansion of CD27+CD28+ tumor infiltrating lymphocytes with high cytotoxic potential and low collateral expansion of regulatory T cells

    NARCIS (Netherlands)

    Santegoets, S.J.; Turksma, A.W.; Suhoski, M.M.; Stam, A.G.; Albelda, S.M.; Hooijberg, E.; Scheper, R.J.; Eertwegh, A.J. van den; Gerritsen, W.R.; Powell Jr., D.J.; June, C.H.; Gruijl, T.D. de

    2013-01-01

    BACKGROUND: Adoptive cell transfer of tumor infiltrating lymphocytes has shown clinical efficacy in the treatment of melanoma and is now also being explored in other tumor types. Generation of sufficient numbers of effector T cells requires extensive ex vivo expansion, often at the cost of T cell

  8. MHC class I cross-talk with CD2 and CD28 induces specific intracellular signalling and leads to growth retardation and apoptosis via a p56(lck)-dependent mechanism

    DEFF Research Database (Denmark)

    Ruhwald, M; Pedersen, Anders Elm; Claesson, M H

    1999-01-01

    Ligation of the major histocompatibility complex class I molecules (MHC-I) on human T lymphoma cells (Jurkat) initiates p56(lck)-dependent intracellular signalling events (phosphotyrosine kinase activity; [Ca(2+)](i)) and leads to augmented growth inhibition and apoptosis. MHC-I ligation in concert...... of apoptosis. In parallel experiments with the p56(lck)-negative Jurkat mutant cell, JCaM1.6, cross-linking neither influenced cell signalling nor cellular growth functions, indicating a cardinal role of the src kinases in signal transduction via MHC-I, CD2 and CD28 molecules. The results presented here...... with ligation of CD2 or CD28 augments, changes or modifies the pattern of activation. Ligation of MHC-I and CD2 alone resulted in growth inhibition, whereas CD28 ligation alone had no effect on cell proliferation. Ligation of MHC-I together with CD2 augmented growth inhibition and enhanced the level...

  9. A Combination of CD28 (rs1980422 and IRF5 (rs10488631 Polymorphisms Is Associated with Seropositivity in Rheumatoid Arthritis: A Case Control Study.

    Directory of Open Access Journals (Sweden)

    Lucia Vernerova

    Full Text Available The aim of the study was to analyse genetic architecture of RA by utilizing multiparametric statistical methods such as linear discriminant analysis (LDA and redundancy analysis (RDA.A total of 1393 volunteers, 499 patients with RA and 894 healthy controls were included in the study. The presence of shared epitope (SE in HLA-DRB1 and 11 SNPs (PTPN22 C/T (rs2476601, STAT4 G/T (rs7574865, CTLA4 A/G (rs3087243, TRAF1/C5 A/G (rs3761847, IRF5 T/C (rs10488631, TNFAIP3 C/T (rs5029937, AFF3 A/T (rs11676922, PADI4 C/T (rs2240340, CD28 T/C (rs1980422, CSK G/A (rs34933034 and FCGR3A A/C (rs396991, rheumatoid factor (RF, anti-citrullinated protein antibodies (ACPA and clinical status was analysed using the LDA and RDA.HLA-DRB1, PTPN22, STAT4, IRF5 and PADI4 significantly discriminated between RA patients and healthy controls in LDA. The correlation between RA diagnosis and the explanatory variables in the model was 0.328 (Trace = 0.107; F = 13.715; P = 0.0002. The risk variants of IRF5 and CD28 genes were found to be common determinants for seropositivity in RDA, while positivity of RF alone was associated with the CTLA4 risk variant in heterozygous form. The correlation between serologic status and genetic determinants on the 1st ordinal axis was 0.468, and 0.145 on the 2nd one (Trace = 0.179; F = 6.135; P = 0.001. The risk alleles in AFF3 gene together with the presence of ACPA were associated with higher clinical severity of RA.The association among multiple risk variants related to T cell receptor signalling with seropositivity may play an important role in distinct clinical phenotypes of RA. Our study demonstrates that multiparametric analyses represent a powerful tool for investigation of mutual relationships of potential risk factors in complex diseases such as RA.

  10. Preclinical Testing of Antihuman CD28 Fab' Antibody in a Novel Nonhuman Primate Small Animal Rodent Model of Xenogenic Graft-Versus-Host Disease.

    Science.gov (United States)

    Hippen, Keli L; Watkins, Benjamin; Tkachev, Victor; Lemire, Amanda M; Lehnen, Charles; Riddle, Megan J; Singh, Karnail; Panoskaltsis-Mortari, Angela; Vanhove, Bernard; Tolar, Jakub; Kean, Leslie S; Blazar, Bruce R

    2016-12-01

    Graft-versus-host disease (GVHD) is a severe complication of hematopoietic stem cell transplantation. Current therapies to prevent alloreactive T cell activation largely cause generalized immunosuppression and may result in adverse drug, antileukemia and antipathogen responses. Recently, several immunomodulatory therapeutics have been developed that show efficacy in maintaining antileukemia responses while inhibiting GVHD in murine models. To analyze efficacy and better understand immunological tolerance, escape mechanisms, and side effects of clinical reagents, testing of species cross-reactive human agents in large animal GVHD models is critical. We have previously developed and refined a nonhuman primate (NHP) large animal GVHD model. However, this model is not readily amenable to semi-high throughput screening of candidate clinical reagents. Here, we report a novel, optimized NHP xenogeneic GVHD (xeno-GVHD) small animal model that recapitulates many aspects of NHP and human GVHD. This model was validated using a clinically available blocking, monovalent anti-CD28 antibody (FR104) whose effects in a human xeno-GVHD rodent model are known. Because human-reactive reagents may not be fully cross-reactive or effective in vivo on NHP immune cells, this NHP xeno-GVHD model provides immunological insights and direct testing on NHP-induced GVHD before committing to the intensive NHP studies that are being increasingly used for detailed evaluation of new immune therapeutic strategies before human trials.

  11. Limited density of an antigen presented by RMA-S cells requires B7-1/CD28 signaling to enhance T-cell immunity at the effector phase.

    Directory of Open Access Journals (Sweden)

    Xiao-Lin Li

    Full Text Available The association of B7-1/CD28 between antigen presenting cells (APCs and T-cells provides a second signal to proliferate and activate T-cell immunity at the induction phase. Many reports indicate that tumor cells transfected with B7-1 induced augmented antitumor immunity at the induction phase by mimicking APC function; however, the function of B7-1 on antitumor immunity at the effector phase is unknown. Here, we report direct evidence of enhanced T-cell antitumor immunity at the effector phase by the B7-1 molecule. Our experiments in vivo and in vitro indicated that reactivity of antigen-specific monoclonal and polyclonal T-cell effectors against a Lass5 epitope presented by RMA-S cells is increased when the cells expressed B7-1. Use of either anti-B7-1 or anti-CD28 antibodies to block the B7-1/CD28 association reduced reactivity of the T effectors against B7-1 positive RMA-S cells. Transfection of Lass5 cDNA into or pulse of Lass5 peptide onto B7-1 positive RMA-S cells overcomes the requirement of the B7-1/CD28 signal for T effector response. To our knowledge, the data offers, for the first time, strong evidence that supports the requirement of B7-1/CD28 secondary signal at the effector phase of antitumor T-cell immunity being dependent on the density of an antigenic peptide.

  12. Coulomb blockade induced by magnetic field

    International Nuclear Information System (INIS)

    Kusmartsev, F.V.

    1992-01-01

    In this paper, the authors found that a Coulomb blockade can be induced by magnetic field. The authors illustrated this effect on the example of a ring consisting of two and many Josephson junctions. For the ring with two junctions we present an exact solution. The transition into Coulomb blockade state on a ring transforms into a linear array of Josephson junctions, although in latter case the effect of magnetic field disappears. In the state of Coulomb blockade the magnetization may be both diamagnetic and paramagnetic. The Coulomb blockade may also be removed by external magnetic field

  13. Neuromuscular blockade during laparoscopic ventral herniotomy

    DEFF Research Database (Denmark)

    Medici, Roar; Madsen, Matias V; Asadzadeh, Sami

    2015-01-01

    INTRODUCTION: Laparoscopic herniotomy is the preferred technique for some ventral hernias. Several factors may influence the surgical conditions, one being the depth of neuromuscular blockade (NMB) applied. We hypothesised that deep neuromuscular blockade defined as a post-tetanic count below eight...

  14. Neuromuscular blockade during laparoscopic ventral herniotomy

    DEFF Research Database (Denmark)

    Medici, Roar; Madsen, Matias V; Asadzadeh, Sami

    2015-01-01

    INTRODUCTION: Laparoscopic herniotomy is the preferred technique for some ventral hernias. Several factors may influence the surgical conditions, one being the depth of neuromuscular blockade (NMB) applied. We hypothesised that deep neuromuscular blockade defined as a post-tetanic count below eig...

  15. CD4+CD28+KIR+CD11ahiT cells correlate with disease activity and are characterized by a pro-inflammatory epigenetic and transcriptional profile in lupus patients.

    Science.gov (United States)

    Gensterblum, Elizabeth; Renauer, Paul; Coit, Patrick; Strickland, Faith M; Kilian, Nathan C; Miller, Shaylynn; Ognenovski, Mikhail; Wren, Jonathan D; Tsou, Pei-Suen; Lewis, Emily E; Maksimowicz-McKinnon, Kathleen; McCune, W Joseph; Richardson, Bruce C; Sawalha, Amr H

    2018-01-01

    The goal of this study was to comprehensively characterize CD4+CD28+ T cells overexpressing CD11a and KIR genes, and examine the relationship between this T cell subset, genetic risk, and disease activity in lupus. The size of the CD4+CD28+KIR+CD11a hi T cell subset was determined by flow cytometry, and total genetic risk for lupus was calculated in 105 female patients using 43 confirmed genetic susceptibility loci. Primary CD4+CD28+KIR+CD11a hi T cells were isolated from lupus patients or were induced from healthy individuals using 5-azacytidine. Genome-wide DNA methylation was analyzed using an array-based approach, and the transcriptome was assessed by RNA sequencing. Transcripts in the CDR3 region were used to assess the TCR repertoire. Chromatin accessibility was determined using ATAC-seq. A total of 31,019 differentially methylated sites were identified in induced KIR+CD11a hi T cells with >99% being hypomethylated. RNA sequencing revealed a clear pro-inflammatory transcriptional profile. TCR repertoire analysis suggests less clonotype diversity in KIR+CD11a hi compared to autologous KIR-CD11a low T cells. Similarly, primary KIR+CD11a hi T cells isolated from lupus patients were hypomethylated and characterized by a pro-inflammatory chromatin structure. We show that the genetic risk for lupus was significantly higher in African-American compared to European-American lupus patients. The demethylated CD4+CD28+KIR+CD11a hi T cell subset size was a better predictor of disease activity in young (age ≤ 40) European-American patients independent of genetic risk. CD4+CD28+KIR+CD11a hi T cells are demethylated and characterized by pro-inflammatory epigenetic and transcriptional profiles in lupus. Eliminating these cells or blocking their pro-inflammatory characteristics might present a novel therapeutic approach for lupus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Deep Neuromuscular Blockade Improves Laparoscopic Surgical Conditions

    DEFF Research Database (Denmark)

    Rosenberg, Jacob; Herring, W Joseph; Blobner, Manfred

    2017-01-01

    INTRODUCTION: Sustained deep neuromuscular blockade (NMB) during laparoscopic surgery may facilitate optimal surgical conditions. This exploratory study assessed whether deep NMB improves surgical conditions and, in doing so, allows use of lower insufflation pressures during laparoscopic cholecys...

  17. Atomic Fock State Preparation Using Rydberg Blockade

    OpenAIRE

    Ebert, Matthew; Gill, Alexander; Gibbons, Michael; Zhang, Xianli; Saffman, Mark; Walker, Thad G.

    2013-01-01

    We use coherent excitation of 3-16 atom ensembles to demonstrate collective Rabi flopping mediated by Rydberg blockade. Using calibrated atom number measurements, we quantitatively confirm the expected $\\sqrt{N}$ Rabi frequency enhancement to within 4%. The resulting atom number distributions are consistent with essentially perfect blockade. We then use collective Rabi $\\pi$ pulses to produce ${\\cal N}=1,2$ atom number Fock states with fidelities of 62% and 48% respectively. The ${\\cal N}=2$ ...

  18. Deep Neuromuscular Blockade Improves Laparoscopic Surgical Conditions

    DEFF Research Database (Denmark)

    Rosenberg, Jacob; Herring, W Joseph; Blobner, Manfred

    2017-01-01

    INTRODUCTION: Sustained deep neuromuscular blockade (NMB) during laparoscopic surgery may facilitate optimal surgical conditions. This exploratory study assessed whether deep NMB improves surgical conditions and, in doing so, allows use of lower insufflation pressures during laparoscopic cholecys......INTRODUCTION: Sustained deep neuromuscular blockade (NMB) during laparoscopic surgery may facilitate optimal surgical conditions. This exploratory study assessed whether deep NMB improves surgical conditions and, in doing so, allows use of lower insufflation pressures during laparoscopic...

  19. Greater occipital nerve blockade in cervicogenic headache

    Directory of Open Access Journals (Sweden)

    VINCENT MAURICE B.

    1998-01-01

    Full Text Available Cervicocogenic headache (CeH is a relatively common disorder. Although no ideal treatment is available so far, blockades in different structures and nerves may be temporarily effective. We studied the effects of 1-2 mL 0.5% bupivacaine injection at the ipsilateral greater occipital nerve (GON in 41 CeH patients. The pain is significantly reduced both immediately and as long as 7 days after the blockade. The improvement is less marked during the first two days, a phenomenon we called "tilde pattern". GON blockades may reduce the pool of exaggerated sensory input and antagonize a putative "wind-up-like effect" which may explain the headache improvement.

  20. Atomic Fock State Preparation Using Rydberg Blockade

    Science.gov (United States)

    Ebert, Matthew; Gill, Alexander; Gibbons, Michael; Zhang, Xianli; Saffman, Mark; Walker, Thad G.

    2014-01-01

    We use coherent excitation of 3-16 atom ensembles to demonstrate collective Rabi flopping mediated by Rydberg blockade. Using calibrated atom number measurements, we quantitatively confirm the expected √N Rabi frequency enhancement to within 4%. The resulting atom number distributions are consistent with an essentially perfect blockade. We then use collective Rabi π pulses to produce N =1, 2 atom number Fock states with fidelities of 62% and 48%, respectively. The N=2 Fock state shows the collective Rabi frequency enhancement without corruption from atom number fluctuations.

  1. Neuromuscular blockade in the elderly.

    Science.gov (United States)

    Stankiewicz-Rudnicki, Michał

    2016-01-01

    The aim of the presented review is to highlight the clinical problem of postoperative residual curarization (PORC) following general anaesthesia in the elderly. Possible complications of PORC are described along with age-induced changes in pharmacokinetics of long and intermediate-acting neuromuscular blocking agents. This is intended to facilitate the selection and to promote appropriate intraoperative use of muscle relaxants in patients over the age of 65 years.

  2. Single administration of p2TA (AB103, a CD28 antagonist peptide, prevents inflammatory and thrombotic reactions and protects against gastrointestinal injury in total-body irradiated mice.

    Directory of Open Access Journals (Sweden)

    Salida Mirzoeva

    Full Text Available The goal of this study was to elucidate the action of the CD28 mimetic peptide p2TA (AB103 that attenuates an excessive inflammatory response in mitigating radiation-induced inflammatory injuries. BALB/c and A/J mice were divided into four groups: Control (C, Peptide (P; 5 mg/kg of p2TA peptide, Radiation (R; total body irradiation with 8 Gy γ-rays, and Radiation + Peptide (RP; irradiation followed by p2TA peptide 24 h later. Gastrointestinal tissue damage was evaluated by analysis of jejunum histopathology and immunohistochemistry for cell proliferation (Cyclin D1 and inflammation (COX-2 markers, as well as the presence of macrophages (F4/80. Pro-inflammatory cytokines IL-6 and KC as well as fibrinogen were quantified in plasma samples obtained from the same mice. Our results demonstrated that administration of p2TA peptide significantly reduced the irradiation-induced increase of IL-6 and fibrinogen in plasma 7 days after exposure. Seven days after total body irradiation with 8 Gy of gamma rays numbers of intestinal crypt cells were reduced and villi were shorter in irradiated animals compared to the controls. The p2TA peptide delivery 24 h after irradiation led to improved morphology of villi and crypts, increased Cyclin D1 expression, decreased COX-2 staining and decreased numbers of macrophages in small intestine of irradiated mice. Our study suggests that attenuation of CD28 signaling is a promising therapeutic approach for mitigation of radiation-induced tissue injury.

  3. In Vivo Expansion and Antitumor Activity of Coinfused CD28- and 4-1BB-Engineered CAR-T Cells in Patients with B Cell Leukemia.

    Science.gov (United States)

    Cheng, Zhi; Wei, Runhong; Ma, Qiuling; Shi, Lin; He, Feng; Shi, Zixiao; Jin, Tao; Xie, Ronglin; Wei, Baofeng; Chen, Jing; Fang, Hongliang; Han, Xiaolu; Rohrs, Jennifer A; Bryson, Paul; Liu, Yarong; Li, Qi-Jing; Zhu, Bo; Wang, Pin

    2018-04-04

    Several recent clinical trials have successfully incorporated a costimulatory domain derived from either CD28 or 4-1BB with the original CD3ζ T cell activating domain to form second-generation chimeric antigen receptors (CARs) that can increase the responsiveness and survival of CAR-engineered T (CAR-T) cells. However, a rigorous assessment of the individual benefits of these costimulatory components relative to the in vivo performance of infused T cells in patients is still lacking. Therefore, we have designed a study that allows us to investigate and compare the impact of different costimulatory signal domains on CAR-T cells in vivo. Patients with B cell leukemia were infused with a mixture of two types of CD19-specific CAR-T cells, individually bearing CD28 (28ζ) and 4-1BB (BBζ) costimulatory signaling domains. We found that such a clinical procedure was feasible and safe. Complete remission (CR) was observed in five of seven enrolled patients, with two patients exhibiting durable CR lasting more than 15 months. The in vivo expansion pattern of 28ζ and BBζ CAR-T cells varied significantly among individual patients. These results confirm a feasible method of comparing different CAR designs within individual patients, potentially offering objective insights that may facilitate the development of optimal CAR-T cell-based immunotherapies. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  4. Efficient Multiparticle Entanglement via Asymmetric Rydberg Blockade

    DEFF Research Database (Denmark)

    Saffman, Mark; Mølmer, Klaus

    2009-01-01

    We present an efficient method for producing N particle entangled states using Rydberg blockade interactions. Optical excitation of Rydberg states that interact weakly, yet have a strong coupling to a second control state is used to achieve state dependent qubit rotations in small ensembles. On t....... On the basis of quantitative calculations, we predict that an entangled quantum superposition state of eight atoms can be produced with a fidelity of 84% in cold Rb atoms.......We present an efficient method for producing N particle entangled states using Rydberg blockade interactions. Optical excitation of Rydberg states that interact weakly, yet have a strong coupling to a second control state is used to achieve state dependent qubit rotations in small ensembles...

  5. Increasing the ex vivo antigen-specific IFN-γ production in subpopulations of T cells and NKp46+ cells by anti-CD28, anti-CD49d and recombinant IL-12 costimulation in cattle vaccinated with recombinant proteins from Mycobacterium avium subspecies paratuberculosis

    DEFF Research Database (Denmark)

    Thakur, Aneesh; Riber, Ulla; Davis, William C.

    2013-01-01

    -γ secretion by CD4, CD8, γδ T cells and NK cells. Age matched male jersey calves, experimentally infected with Mycobacterium avium subsp. paratuberculosis (MAP), were vaccinated with a cocktail of recombinant MAP proteins or left unvaccinated. Vaccine induced ex vivo recall responses were measured through Ag......T cells, which encounter specific antigen (Ag), require additional signals to mount a functional immune response. Here, we demonstrate activation of signal 2, by anti-CD28 mAb (aCD28) and other costimulatory molecules (aCD49d, aCD5), and signal 3, by recombinant IL-12, enhance Ag-specific IFN...

  6. Blockade of the intermediate-conductance calcium-activated potassium channel as a new therapeutic strategy for restenosis

    DEFF Research Database (Denmark)

    Köhler, Ralf; Wulff, Heike; Eichler, Ines

    2003-01-01

    hyperplasia was accompanied by decreased neointimal cell content, with no change in the rate of apoptosis or collagen content. CONCLUSIONS: The switch toward IKCa1 expression may promote excessive neointimal VSMC proliferation. Blockade of IKCa1 could therefore represent a new therapeutic strategy to prevent...

  7. Effects of sugammadex on incidence of postoperative residual neuromuscular blockade

    DEFF Research Database (Denmark)

    Brueckmann, B; Sasaki, N; Grobara, P

    2015-01-01

    BACKGROUND: This study aimed to investigate whether reversal of rocuronium-induced neuromuscular blockade with sugammadex reduced the incidence of residual blockade and facilitated operating room discharge readiness. METHODS: Adult patients undergoing abdominal surgery received rocuronium, followed...... by randomized allocation to sugammadex (2 or 4 mg kg(-1)) or usual care (neostigmine/glycopyrrolate, dosing per usual care practice) for reversal of neuromuscular blockade. Timing of reversal agent administration was based on the providers' clinical judgement. Primary endpoint was the presence of residual...... neuromuscular blockade at PACU admission, defined as a train-of-four (TOF) ratio

  8. Checkpoint Blockade in Lung Cancer and Mesothelioma.

    Science.gov (United States)

    Lievense, Lysanne A; Sterman, Daniel H; Cornelissen, Robin; Aerts, Joachim G

    2017-08-01

    In the last decade, immunotherapy has emerged as a new treatment modality in cancer. The most success has been achieved with the class of checkpoint inhibitors (CPIs), antibodies that unleash the antitumor immune response. After the success in melanoma, numerous clinical trials are being conducted investigating CPIs in lung cancer and mesothelioma. The programmed death protein (PD) 1-PD ligand 1/2 pathway and cytotoxic T lymphocyte-associated protein 4 are currently the most studied immunotherapeutic targets in these malignancies. In non-small cell lung cancer, anti-PD-1 antibodies have become part of the approved treatment arsenal. In small cell lung cancer and mesothelioma, the efficacy of checkpoint inhibition has not yet been proven. In this Concise Clinical Review, an overview of the landmark clinical trials investigating checkpoint blockade in lung cancer and mesothelioma is provided. Because response rates are around 20% in the majority of clinical trials, there is much room for improvement. Predictive biomarkers are therefore essential to fully develop the potential of CPIs. To increase efficacy, multiple clinical trials investigating the combination of cytotoxic T lymphocyte-associated protein 4 inhibitors and PD-1/PD ligand 1 blockade in lung cancer and mesothelioma are being conducted. Given the potential benefit of immunotherapy, implementation of current and new knowledge in trial designs and interpretation of results is essential for moving forward.

  9. Antilocalization of Coulomb Blockade in a Ge-Si Nanowire

    DEFF Research Database (Denmark)

    Higginbotham, Andrew P.; Kuemmeth, Ferdinand; Larsen, Thorvald Wadum

    2014-01-01

    The distribution of Coulomb blockade peak heights as a function of magnetic field is investigated experimentally in a Ge-Si nanowire quantum dot. Strong spin-orbit coupling in this hole-gas system leads to antilocalization of Coulomb blockade peaks, consistent with theory. In particular, the peak...

  10. The impact of acute preoperative beta-blockade on perioperative ...

    African Journals Online (AJOL)

    To determine the impact of acute preoperative β-blockade on the incidence of perioperative cardiovascular morbidity and all- ... Our findings suggest that acute preoperative β-blockade is associated with an increased risk of perioperative cardiac ..... Shammash JB, Trost JC, Gold JM, Berlin JA, Golden MA, Kimmel SE.

  11. Quantitative Proteomics of Gut-Derived Th1 and Th1/Th17 Clones Reveal the Presence of CD28+ NKG2D- Th1 Cytotoxic CD4+ T cells.

    Science.gov (United States)

    Riaz, Tahira; Sollid, Ludvig Magne; Olsen, Ingrid; de Souza, Gustavo Antonio

    2016-03-01

    T-helper cells are differentiated from CD4+ T cells and are traditionally characterized by inflammatory or immunosuppressive responses in contrast to cytotoxic CD8+ T cells. Mass-spectrometry studies on T-helper cells are rare. In this study, we aimed to identify the proteomes of human Th1 and Th1/Th17 clones derived from intestinal biopsies of Crohn's disease patients and to identify differentially expressed proteins between the two phenotypes. Crohn's disease is an inflammatory bowel disease, with predominantly Th1- and Th17-mediated response where cells of the "mixed" phenotype Th1/Th17 have also been commonly found. High-resolution mass spectrometry was used for protein identification and quantitation. In total, we identified 7401 proteins from Th1 and Th1/Th17 clones, where 334 proteins were differentially expressed. Major differences were observed in cytotoxic proteins that were overrepresented in the Th1 clones. The findings were validated by flow cytometry analyses using staining with anti-granzyme B and anti-perforin and by a degranulation assay, confirming higher cytotoxic features of Th1 compared with Th1/Th17 clones. By testing a larger panel of T-helper cell clones from seven different Crohn's disease patients, we concluded that only a subgroup of the Th1 cell clones had cytotoxic features, and these expressed the surface markers T-cell-specific surface glycoprotein CD28 and were negative for expression of natural killer group 2 member D. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Pauli Spin Blockade and the Ultrasmall Magnetic Field Effect

    KAUST Repository

    Danon, Jeroen

    2013-08-06

    Based on the spin-blockade model for organic magnetoresistance, we present an analytic expression for the polaron-bipolaron transition rate, taking into account the effective nuclear fields on the two sites. We reveal the physics behind the qualitatively different magnetoconductance line shapes observed in experiment, as well as the ultrasmall magnetic field effect (USFE). Since our findings agree in detail with recent experiments, they also indirectly provide support for the spin-blockade interpretation of organic magnetoresistance. In addition, we predict the existence of a similar USFE in semiconductor double quantum dots tuned to the spin-blockade regime.

  13. Activity blockade and GABAA receptor blockade produce synaptic scaling through chloride accumulation in embryonic spinal motoneurons and interneurons.

    Directory of Open Access Journals (Sweden)

    Casie Lindsly

    Full Text Available Synaptic scaling represents a process whereby the distribution of a cell's synaptic strengths are altered by a multiplicative scaling factor. Scaling is thought to be a compensatory response that homeostatically controls spiking activity levels in the cell or network. Previously, we observed GABAergic synaptic scaling in embryonic spinal motoneurons following in vivo blockade of either spiking activity or GABAA receptors (GABAARs. We had determined that activity blockade triggered upward GABAergic scaling through chloride accumulation, thus increasing the driving force for these currents. To determine whether chloride accumulation also underlies GABAergic scaling following GABAAR blockade we have developed a new technique. We expressed a genetically encoded chloride-indicator, Clomeleon, in the embryonic chick spinal cord, which provides a non-invasive fast measure of intracellular chloride. Using this technique we now show that chloride accumulation underlies GABAergic scaling following blockade of either spiking activity or the GABAAR. The finding that GABAAR blockade and activity blockade trigger scaling via a common mechanism supports our hypothesis that activity blockade reduces GABAAR activation, which triggers synaptic scaling. In addition, Clomeleon imaging demonstrated the time course and widespread nature of GABAergic scaling through chloride accumulation, as it was also observed in spinal interneurons. This suggests that homeostatic scaling via chloride accumulation is a common feature in many neuronal classes within the embryonic spinal cord and opens the possibility that this process may occur throughout the nervous system at early stages of development.

  14. TNF Blockade Maintains an IL-10+Phenotype in Human Effector CD4+and CD8+T Cells.

    Science.gov (United States)

    Roberts, Ceri A; Durham, Lucy E; Fleskens, Veerle; Evans, Hayley G; Taams, Leonie S

    2017-01-01

    CD4 + and CD8 + effector T cell subpopulations can display regulatory potential characterized by expression of the prototypically anti-inflammatory cytokine IL-10. However, the underlying cellular mechanisms that regulate expression of IL-10 in different T cell subpopulations are not yet fully elucidated. We recently showed that TNF inhibitors (TNFi) promote IL-10 expression in human CD4 + T cells, including IL-17 + CD4 + T cells. Here, we further characterized the regulation of IL-10 expression via blockade of TNF signaling or other cytokine/co-stimulatory pathways, in human T cell subpopulations. Addition of the TNFi drug adalimumab to anti-CD3-stimulated human CD4 + T cell/monocyte cocultures led to increased percentages of IL-10 + cells in pro-inflammatory IL-17 + , IFNγ + , TNFα + , GM-CSF + , and IL-4 + CD4 + T cell subpopulations. Conversely, exogenous TNFα strongly decreased IL-10 + cell frequencies. TNF blockade also regulated IL-10 expression in CD4 + T cells upon antigenic stimulation. Using time course experiments in whole peripheral blood mononuclear cell (PBMC) cultures, we show that TNF blockade maintained, rather than increased, IL-10 + cell frequencies in both CD4 + and CD8 + T cells following in vitro stimulation in a dose- and time-dependent manner. Blockade of IL-17, IFNγ, IL-6R, or CD80/CD86-mediated co-stimulation did not significantly regulate IL-10 expression within CD4 + or CD8 + T cell subpopulations. We show that TNF blockade acts directly on effector CD4 + T cells, in the absence of monocytes or CD4 + CD25 high CD127 low regulatory T cells and independently of IL-27, resulting in higher IL-10 + frequencies after 3 days in culture. IL-10/IL-10R blockade reduced the frequency of IL-10-expressing cells both in the presence and absence of TNF blockade. Addition of recombinant IL-10 alone was insufficient to drive an increase in IL-10 + CD4 + T cell frequencies in 3-day CD4 + T cell/monocyte cocultures, but resulted in increased IL-10

  15. Selective tumor necrosis factor receptor I blockade is antiinflammatory and reveals immunoregulatory role of tumor necrosis factor receptor II in collagen-induced arthritis.

    Science.gov (United States)

    McCann, Fiona E; Perocheau, Dany P; Ruspi, Gerhard; Blazek, Katrina; Davies, Marie L; Feldmann, Marc; Dean, Jonathan L E; Stoop, A Allart; Williams, Richard O

    2014-10-01

    Tumor necrosis factor (TNF) signals via 2 receptors, TNFR type I (TNFRI) and TNFRII, with distinct cellular distribution and signaling functions. In rheumatoid arthritis (RA), the net effect of TNFR signaling favors inflammatory responses while inhibiting the activity of regulatory T cells. TNFRII signaling has been shown to promote Treg cell function. To assess the relative contributions of TNFRI and TNFRII signaling to inflammatory and regulatory responses in vivo, we compared the effect of TNF blockade, hence TNFRI/II, versus TNFRI alone in collagen-induced arthritis (CIA) as a model of RA. Mice with established arthritis were treated for 10 days with anti-mouse TNFRI domain antibody (dAb; DMS5540), an isotype control dAb (DMS5538), or murine TNFRII genetically fused with mouse IgG1 Fc domain (mTNFRII-Fc) beginning on the day of arthritis onset, and disease progression was monitored. Systemic cytokine concentrations and numbers of T cell subsets in lymph nodes and spleens were measured, and intrinsic Treg cell function was determined by ex vivo suppression assays. Progression of CIA was suppressed similarly by TNFRI (DMS5540) and TNFRI/II (mTNFRII-Fc) blockade. However, blockade of TNFRI/II led to increased effector T cell activity, which was not observed after selective TNFRI blockade, suggesting an immunoregulatory role of TNFRII. In support of this, TNFRI blockade, but not TNFRI/II blockade, expanded and activated Treg cells. Furthermore, a dramatic increase in expression of the Treg cell signature genes FoxP3 and TNFRII was observed in joints undergoing remission, which supports the notion that these molecules have a physiologic role in the resolution of inflammation. We propose that a therapeutic strategy that targets TNFRI while sparing TNFRII has the potential to both inhibit inflammation and promote Treg cell activity, which might be superior to TNF blockade. Copyright © 2014 by the American College of Rheumatology.

  16. Radiotherapy and immune checkpoint blockades: a snapshot in 2016

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Tae Yool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of)

    2016-12-15

    Immune checkpoint blockades including monoclonal antibodies (mAbs) of cytotoxic T-lymphocyte antigen-4 (CTLA-4), programmed death-1 (PD-1), and programmed death-ligand 1 (PD-L1) have been emerged as a promising anticancer therapy. Several immune checkpoint blockades have been approved by US Food and Drug Administration (FDA), and have shown notable success in clinical trials for patients with advanced melanoma and non-small cell lung cancer. Radiotherapy is a promising combination partner of immune checkpoint blockades due to its potent pro-immune effect. This review will cover the current issue and the future perspectives for combined with radiotherapy and immune checkpoint blockades based upon the available preclinical and clinical data.

  17. Residual Neuromuscular Blockade in the Critical Care Setting.

    Science.gov (United States)

    Stawicki, Nicole; Gessner, Patty

    2018-01-01

    Residual neuromuscular blockade is a widespread challenge for providers in the acute care setting that, if left unrecognized or untreated, places patients at higher risk for morbidity and mortality. The condition is estimated to occur in 26% to 88% of patients undergoing general anesthesia. The role of the advanced practice nurse in the acute care setting is to facilitate a safe recovery process by identifying early signs of deterioration and supporting the patient until full muscular strength has returned. This article discusses the prevalence of residual neuromuscular blockade and associated complications and patient risk factors. A review is included of the current uses for neuromuscular blockade, pathophysiology of the neuromuscular junction, pharmacologic characteristics of neuromuscular blocking agents (including drug-drug interactions), monitoring modalities, and effectiveness of reversal agents. Treatment recommendations pertinent to residual neuromuscular blockade are outlined. ©2018 American Association of Critical-Care Nurses.

  18. Opioid Receptors Blockade Modulates Apoptosis in a Rat Model of ...

    African Journals Online (AJOL)

    of endogenous opioids in the apoptosis process in a rat model of cirrhotic cardiomyopathy. Materials and Methods: Cirrhosis was ... Conclusion: Apoptosis occurs during cirrhotic cardiomyopathy and endogenous opioid receptors blockade using naltrexone ..... Further research would define the responsible pathways.

  19. Heat Coulomb blockade of one ballistic channel

    Science.gov (United States)

    Sivre, E.; Anthore, A.; Parmentier, F. D.; Cavanna, A.; Gennser, U.; Ouerghi, A.; Jin, Y.; Pierre, F.

    2018-02-01

    Quantum mechanics and Coulomb interaction dictate the behaviour of small circuits. The thermal implications cover fundamental topics from quantum control of heat to quantum thermodynamics, with prospects of novel thermal machines and an ineluctably growing influence on nanocircuit engineering. Experimentally, the rare observations thus far include the universal thermal conductance quantum and heat interferometry. However, evidence for many-body thermal effects paving the way to markedly different heat and electrical behaviours in quantum circuits remains wanting. Here we report on the observation of the Coulomb blockade of electronic heat flow from a small metallic circuit node, beyond the widespread Wiedemann-Franz law paradigm. We demonstrate this thermal many-body phenomenon for perfect (ballistic) conduction channels to the node, where it amounts to the universal suppression of precisely one quantum of conductance for the transport of heat, but none for electricity. The inter-channel correlations that give rise to such selective heat current reduction emerge from local charge conservation, in the floating node over the full thermal frequency range (<~temperature × kB/h). This observation establishes the different nature of the quantum laws for thermal transport in nanocircuits.

  20. Transport Through a Coulomb Blockaded Majorana Nanowire

    Science.gov (United States)

    Zazunov, Alex; Egger, Reinhold; Yeyati, Alfredo Levy; Hützen, Roland; Braunecker, Bernd

    In one-dimensional (1D) quantum wires with strong spin-orbit coupling and a Zeeman field, a superconducting substrate can induce zero-energy Majorana bound states located near the ends of the wire. We study electronic properties when such a wire is contacted by normal metallic or superconducting electrodes. A special attention is devoted to Coulomb blockade effects. We analyze the "Majorana single-charge transistor" (MSCT), i.e., a floating Majorana wire contacted by normal metallic source and drain contacts, where charging effects are important. We describe Coulomb oscillations in this system and predict that Majorana fermions could be unambiguously detected by the emergence of sideband peaks in the nonlinear differential conductance. We also study a superconducting variant of the MSCT setup with s-wave superconducting (instead of normal-conducting) leads. In the noninteracting case, we derive the exact current-phase relation (CPR) and find π-periodic behavior with negative critical current for weak tunnel couplings. Charging effects then cause the anomalous CPR I(\\varphi ) = Ic\\cos \\varphi, where the parity-sensitive critical current I c provides a signature for Majorana states.

  1. Checkpoint blockade in combination with cancer vaccines.

    Science.gov (United States)

    Morse, Michael A; Lyerly, H Kim

    2015-12-16

    Checkpoint blockade, prevention of inhibitory signaling that limits activation or function of tumor antigen-specific T cells responses, is revolutionizing the treatment of many poor prognosis malignancies. Indeed monoclonal antibodies that modulate signaling through the inhibitory molecules CTLA-4 and PD-1 are now clinically available; however, many tumors, demonstrate minimal response suggesting the need for combinations with other therapeutic strategies. Because an inadequate frequency of activated tumor antigen-specific T cells in the tumor environment, the so-called non-inflamed phenotype, is observed in some malignancies, other rationale partners are modalities that lead to enhanced T cell activation (vaccines, cytokines, toll-like receptor agonists, and other anticancer therapies such as chemo-, radio- or targeted therapies that lead to release of antigen from tumors). This review will focus on preclinical and clinical data supporting the use of cancer vaccines with anti-CTLA-4 and anti-PD-1/PD-L1 antibodies. Preliminary preclinical data demonstrate enhanced antitumor activity although the results in human studies are less clear. Broader combinations of multiple immune modulators are now under study. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. All-trans retinoic acid promotes TGF-β-induced Tregs via histone modification but not DNA demethylation on Foxp3 gene locus.

    Science.gov (United States)

    Lu, Ling; Ma, Jilin; Li, Zhiyuan; Lan, Qin; Chen, Maogen; Liu, Ya; Xia, Zanxian; Wang, Julie; Han, Yuanping; Shi, Wei; Quesniaux, Valerie; Ryffel, Bernhard; Brand, David; Li, Bin; Liu, Zhongmin; Zheng, Song Guo

    2011-01-01

    It has been documented all-trans retinoic acid (atRA) promotes the development of TGF-β-induced CD4(+)Foxp3(+) regulatory T cells (iTreg) that play a vital role in the prevention of autoimmune responses, however, molecular mechanisms involved remain elusive. Our objective, therefore, was to determine how atRA promotes the differentiation of iTregs. Addition of atRA to naïve CD4(+)CD25(-) cells stimulated with anti-CD3/CD28 antibodies in the presence of TGF-β not only increased Foxp3(+) iTreg differentiation, but maintained Foxp3 expression through apoptosis inhibition. atRA/TGF-β-treated CD4(+) cells developed complete anergy and displayed increased suppressive activity. Infusion of atRA/TGF-β-treated CD4(+) cells resulted in the greater effects on suppressing symptoms and protecting the survival of chronic GVHD mice with typical lupus-like syndromes than did CD4(+) cells treated with TGF-β alone. atRA did not significantly affect the phosphorylation levels of Smad2/3 and still promoted iTreg differentiation in CD4(+) cells isolated from Smad3 KO and Smad2 conditional KO mice. Conversely, atRA markedly increased ERK1/2 activation, and blockade of ERK1/2 signaling completely abolished the enhanced effects of atRA on Foxp3 expression. Moreover, atRA significantly increased histone methylation and acetylation within the promoter and conserved non-coding DNA sequence (CNS) elements at the Foxp3 gene locus and the recruitment of phosphor-RNA polymerase II, while DNA methylation in the CNS3 was not significantly altered. We have identified the cellular and molecular mechanism(s) by which atRA promotes the development and maintenance of iTregs. These results will help to enhance the quantity and quality of development of iTregs and may provide novel insights into clinical cell therapy for patients with autoimmune diseases and those needing organ transplantation.

  3. All-trans retinoic acid promotes TGF-β-induced Tregs via histone modification but not DNA demethylation on Foxp3 gene locus.

    Directory of Open Access Journals (Sweden)

    Ling Lu

    Full Text Available It has been documented all-trans retinoic acid (atRA promotes the development of TGF-β-induced CD4(+Foxp3(+ regulatory T cells (iTreg that play a vital role in the prevention of autoimmune responses, however, molecular mechanisms involved remain elusive. Our objective, therefore, was to determine how atRA promotes the differentiation of iTregs.Addition of atRA to naïve CD4(+CD25(- cells stimulated with anti-CD3/CD28 antibodies in the presence of TGF-β not only increased Foxp3(+ iTreg differentiation, but maintained Foxp3 expression through apoptosis inhibition. atRA/TGF-β-treated CD4(+ cells developed complete anergy and displayed increased suppressive activity. Infusion of atRA/TGF-β-treated CD4(+ cells resulted in the greater effects on suppressing symptoms and protecting the survival of chronic GVHD mice with typical lupus-like syndromes than did CD4(+ cells treated with TGF-β alone. atRA did not significantly affect the phosphorylation levels of Smad2/3 and still promoted iTreg differentiation in CD4(+ cells isolated from Smad3 KO and Smad2 conditional KO mice. Conversely, atRA markedly increased ERK1/2 activation, and blockade of ERK1/2 signaling completely abolished the enhanced effects of atRA on Foxp3 expression. Moreover, atRA significantly increased histone methylation and acetylation within the promoter and conserved non-coding DNA sequence (CNS elements at the Foxp3 gene locus and the recruitment of phosphor-RNA polymerase II, while DNA methylation in the CNS3 was not significantly altered.We have identified the cellular and molecular mechanism(s by which atRA promotes the development and maintenance of iTregs. These results will help to enhance the quantity and quality of development of iTregs and may provide novel insights into clinical cell therapy for patients with autoimmune diseases and those needing organ transplantation.

  4. Blockade of mast cell activation reduces cutaneous scar formation.

    Directory of Open Access Journals (Sweden)

    Lin Chen

    Full Text Available Damage to the skin initiates a cascade of well-orchestrated events that ultimately leads to repair of the wound. The inflammatory response is key to wound healing both through preventing infection and stimulating proliferation and remodeling of the skin. Mast cells within the tissue are one of the first immune cells to respond to trauma, and upon activation they release pro-inflammatory molecules to initiate recruitment of leukocytes and promote a vascular response in the tissue. Additionally, mast cells stimulate collagen synthesis by dermal fibroblasts, suggesting they may also influence scar formation. To examine the contribution of mast cells in tissue repair, we determined the effects the mast cell inhibitor, disodium cromoglycate (DSCG, on several parameters of dermal repair including, inflammation, re-epithelialization, collagen fiber organization, collagen ultrastructure, scar width and wound breaking strength. Mice treated with DSCG had significantly reduced levels of the inflammatory cytokines IL-1α, IL-1β, and CXCL1. Although DSCG treatment reduced the production of inflammatory mediators, the rate of re-epithelialization was not affected. Compared to control, inhibition of mast cell activity caused a significant decrease in scar width along with accelerated collagen re-organization. Despite the reduced scar width, DSCG treatment did not affect the breaking strength of the healed tissue. Tryptase β1 exclusively produced by mast cells was found to increase significantly in the course of wound healing. However, DSCG treatment did not change its level in the wounds. These results indicate that blockade of mast cell activation reduces scar formation and inflammation without further weakening the healed wound.

  5. Is deep neuromuscular blockade beneficial in laparoscopic surgery?

    DEFF Research Database (Denmark)

    Madsen, M. V.; Staehr-Rye, A K; Claudius, C

    2016-01-01

    BACKGROUND: Deep neuromuscular blockade during laparoscopic surgery may provide some clinical benefit. We present the 'Pro-' argument in this paired position paper. METHODS: We reviewed recent evidence from a basic database of references which we agreed on with the 'Con-' side, and present...... this in narrative form. We have shared our analysis and text with the authors of the 'Con-' side of these paired position papers during the preparation of the manuscripts. RESULTS: There are a few low risk of bias studies indicating that use of deep neuromuscular blockade improve surgical conditions and improve...... patient outcomes such as post-operative pain in laparoscopic surgery. CONCLUSION: Our interpretation of recent findings is that there is reason to believe that there may be some patient benefit of deep neuromuscular blockade in this context, and more detailed study is needed....

  6. Stellate ganglion blockade for analgesia following upper limb surgery.

    LENUS (Irish Health Repository)

    McDonnell, J G

    2012-01-31

    We report the successful use of a stellate ganglion block as part of a multi-modal postoperative analgesic regimen. Four patients scheduled for orthopaedic surgery following upper limb trauma underwent blockade of the stellate ganglion pre-operatively under ultrasound guidance. Patients reported excellent postoperative analgesia, with postoperative VAS pain scores between 0 and 2, and consumption of morphine in the first 24 h ranging from 0 to 14 mg. While these are preliminary findings, and must be confirmed in a clinical trial, they highlight the potential for stellate ganglion blockade to provide analgesia following major upper limb surgery.

  7. Quantum fluctuations and the single-junction Coulomb blockade

    Energy Technology Data Exchange (ETDEWEB)

    Girvin, S.M. (Department of Physics, Indiana University, Bloomington, IN (USA)); Glazman, L.I. (Institute of Microelectronics Technology and High Purity Materials, U.S.S.R. Academy of Science, Moscow District (U.S.S.R.)); Jonson, M. (Solid State Division, Oak Ridge National Laboratory, P.O. Box 2008, Oak Ridge, TN (USA)); Penn, D.R.; Stiles, M.D. (National Institute of Standards and Technology, Gaithersburg, MD (USA))

    1990-06-25

    We investigate the effect of quantum fluctuations on the Coulomb blockade in a single tunnel junction coupled to its environment by a transmission line of arbitrary impedance {ital Z}({omega}). The quantized oscillation modes of the transmission line are suddenly displaced when an electron tunnels through the junction. For small {ital Z} (relative to the quantum of resitance), a weak power-law zero-bias anomaly occurs associated with the infrared-divergent shakeup of low-frequency transmission-line modes. For large {ital Z}, the full blockade is recovered. Comparison with recent experiments is made.

  8. Combination approaches with immune checkpoint blockade in cancer therapy

    Directory of Open Access Journals (Sweden)

    Maarten Swart

    2016-11-01

    Full Text Available In healthy individuals, immune checkpoint molecules prevent autoimmune responses and limit immune cell-mediated tissue damage. Tumors frequently exploit these molecules to evade eradication by the immune system. Over the past years, immune checkpoint blockade of cytotoxic T lymphocyte antigen-4 (CTLA-4 and programmed death-1 (PD-1 emerged as promising strategies to activate anti-tumor cytotoxic T cell responses. Although complete regression and long-term survival is achieved in some patients, not all patients respond. This review describes promising, novel combination approaches involving immune checkpoint blockade, aimed at increasing response-rates to the single treatments.

  9. Neural Blockade for Persistent Pain After Breast Cancer Surgery

    DEFF Research Database (Denmark)

    Wijayasinghe, Nelun; Andersen, Kenneth Geving; Kehlet, Henrik

    2014-01-01

    involved in neuropathic pain syndromes or to be used as a treatment in its own right. The purpose of this review was to examine the evidence for neural blockade as a potential diagnostic tool or treatment for persistent pain after breast cancer surgery. In this systematic review, we found only 7 studies (n......Persistent pain after breast cancer surgery is predominantly a neuropathic pain syndrome affecting 25% to 60% of patients and related to injury of the intercostobrachial nerve, intercostal nerves, and other nerves in the region. Neural blockade can be useful for the identification of nerves...

  10. Effect of epidural blockade and oxygen therapy on changes in subcutaneous oxygen tension after abdominal surgery

    DEFF Research Database (Denmark)

    Rosenberg, J; Pedersen, U; Erichsen, C J

    1994-01-01

    The effect of oxygen therapy (37% by face mask) and epidural local anesthetic blockade (9 ml 0.5% bupivacaine at Th9-11 level) on wound oxygenation was evaluated in eight otherwise healthy patients undergoing elective colorectal resection. The patients were monitored continuously for subcutaneous...... without epidural blockade and 15 (10-20) min with blockade (P surgery....

  11. Ultrasound-guided neural blockade in Proteus syndrome

    African Journals Online (AJOL)

    anatomy, a young patient with Proteus syndrome requiring forearm surgery successfully received a supraclavicular block, using an ultrasound-guided technique for needle placement. We recommend that practitioners experienced in ultrasound- guided neural blockade perform regional anaesthesia in selected patients with ...

  12. Why not treat human cancer with interleukin-1 blockade?

    NARCIS (Netherlands)

    Dinarello, C.A.

    2010-01-01

    The clinical successes of targeting angiogenesis provide a basis for trials of interleukin-1 (IL-1) blockade and particularly anti-IL-1beta as an add-on therapy in human metastatic disease. In animal studies for over 20 years, IL-1 has been demonstrated to increase adherence of tumor cells to the

  13. Topological matter with collective encoding and Rydberg blockade

    DEFF Research Database (Denmark)

    Nielsen, Anne E. B.; Mølmer, Klaus

    2010-01-01

    We propose to use a permutation symmetric sample of multilevel atoms to simulate the properties of topologically ordered states. The Rydberg blockade interaction is used to prepare states of the sample which are equivalent to resonating valence bond states, Laughlin states, and string...

  14. blockade therapy in patient with left ventricular systolic dysfunction ...

    African Journals Online (AJOL)

    Assessment of tolerability of β- blockade therapy in patient with left ventricular systolic dysfunction heart failure. SMI Mohammed. Abstract. Back ground: Little data exist to demonstrate the tolerability of β-blocker therapy in an unselected community heart failure population already treated with the clinical trial or higher dose ...

  15. Acute peri-operative beta-blockade in South Africa

    African Journals Online (AJOL)

    Adele

    This paper considers the effect of physiochemical and/or pharmacokinetic properties on the cardioprotective efficacy of acute peri-operative beta-blockade, indications for peri- operative beta-blockers and economic viability in South. Africa. 1. Is there a preferable peri-operative beta-blocker based on physiochemical and ...

  16. Effect of Dual Blockade of Renin-Angiotensin Aldosterone System ...

    African Journals Online (AJOL)

    Original Research Article. Effect of Dual Blockade of Renin-Angiotensin Aldosterone. System on Proteinuria in Patients with Diabetic. Nephropathy and Advanced Azotemia. Hatice Odabas1, İlyas Capoglu2, Ramazan Cetinkaya3, Ali Riza Odabas3,. Abdullah Uyanik3 and Mustafa Keles3*. 1Department of Internal Medicine, ...

  17. Effect of Dual Blockade of Renin-Angiotensin Aldosterone System ...

    African Journals Online (AJOL)

    Purpose: To investigate the dual effect of angiotensin blockade by irbesartan and enalapril on proteinuria in diabetic patients with azotemia. Methods: Patients with diabetes of > 5 years duration, proteinuria at a nephrotic level and serum creatinine > 1.5 mg/dL were enrolled in the study. Forty-five enrolled patients were ...

  18. CARDIOVASCULAR ENDOCRINOLOGY Dual RAAS blockade has dual effects on outcome

    NARCIS (Netherlands)

    Heerspink, Hiddo J. Lambers; de Zeeuw, Dick

    Makani and colleagues report that dual blockade of the renin-angiotensin-aldosterone system is associated with harm despite previous studies showing that this approach decreases blood pressure and albuminuria. Do these results imply that we should abandon surrogate markers? Or should we become more

  19. Effective dermatomal blockade after subcostal transversus abdominis plane block

    DEFF Research Database (Denmark)

    Mitchell, Anja Ulrike; Torup, Henrik; Hansen, Egon G

    2012-01-01

    . Sensory assessment of a TAP block may guide the decision on the extent of the block. The purpose of this study was to investigate if the dermatomal extent of sensory blockade after injection of 20 ml 0.5% ropivacaine bilaterally into the TAP can be assessed using cold and pinprick sensation....

  20. Entanglement of two ground state neutral atoms using Rydberg blockade

    DEFF Research Database (Denmark)

    Miroshnychenko, Yevhen; Browaeys, Antoine; Evellin, Charles

    2011-01-01

    We report on our recent progress in trapping and manipulation of internal states of single neutral rubidium atoms in optical tweezers. We demonstrate the creation of an entangled state between two ground state atoms trapped in separate tweezers using the effect of Rydberg blockade. The quality...... of the entanglement is measured using global rotations of the internal states of both atoms....

  1. Axillary Brachial Plexus Blockade for the Reflex Sympathetic Dystrophy Syndrome.

    Science.gov (United States)

    Ribbers, G. M.; Geurts, A. C. H.; Rijken, R. A. J.; Kerkkamp, H. E. M.

    1997-01-01

    Reflex sympathetic dystrophy syndrome (RSD) is a neurogenic pain syndrome characterized by pain, vasomotor and dystrophic changes, and often motor impairments. This study evaluated the effectiveness of brachial plexus blockade with local anaesthetic drugs as a treatment for this condition. Three patients responded well; three did not. (DB)

  2. Predictors of responses to immune checkpoint blockade in advanced melanoma

    DEFF Research Database (Denmark)

    Jacquelot, N; Roberti, M P; Enot, D P

    2017-01-01

    stage III MMel patients after adjuvant ipilimumab + nivolumab (but not nivolumab alone). These biomarkers should be validated in prospective trials in MMel.The clinical management of metastatic melanoma requires predictors of the response to checkpoint blockade. Here, the authors use immunological...

  3. PD-1 Blockade Expands Intratumoral Memory T Cells

    DEFF Research Database (Denmark)

    Ribas, Antoni; Shin, Daniel Sanghoon; Zaretsky, Jesse

    2016-01-01

    Tumor responses to programmed cell death protein 1 (PD-1) blockade therapy are mediated by T cells, which we characterized in 102 tumor biopsies obtained from 53 patients treated with pembrolizumab, an antibody to PD-1. Biopsies were dissociated, and single-cell infiltrates were analyzed by multi...

  4. Coulomb blockade due to quantum phase slips illustrated with devices

    NARCIS (Netherlands)

    Hriscu, A.M.; Nazarov, Y.V.

    2011-01-01

    To illustrate the emergence of Coulomb blockade from coherent quantum phase-slip processes in thin superconducting wires, we propose and theoretically investigate two elementary setups, or devices. The setups are derived from the Cooper-pair box and Cooper-pair transistor, so we refer to them as the

  5. Conductance of a proximitized nanowire in the Coulomb blockade regime

    Science.gov (United States)

    van Heck, B.; Lutchyn, R. M.; Glazman, L. I.

    2016-06-01

    We identify the leading processes of electron transport across finite-length segments of proximitized nanowires and build a quantitative theory of their two-terminal conductance. In the presence of spin-orbit interaction, a nanowire can be tuned across the topological transition point by an applied magnetic field. Due to a finite segment length, electron transport is controlled by the Coulomb blockade. Upon increasing of the field, the shape and magnitude of the Coulomb blockade peaks in the linear conductance are defined, respectively, by Andreev reflection, single-electron tunneling, and resonant tunneling through the Majorana modes emerging after the topological transition. Our theory provides the framework for the analysis of experiments with proximitized nanowires [such as reported in S. M. Albrecht et al., Nature (London) 531, 206 (2016), 10.1038/nature17162] and identifies the signatures of the topological transition in the two-terminal conductance.

  6. Berry-phase blockade in single-molecule magnets

    OpenAIRE

    Gonzalez, Gabriel; Leuenberger, Michael N.

    2006-01-01

    We formulate the problem of electron transport through a single-molecule magnet (SMM) in the Coulomb blockade regime taking into account topological interference effects for the tunneling of the large spin of a SMM. The interference originates from spin Berry phases associated with different tunneling paths. We show that in the case of incoherent spin states it is essential to place the SMM between oppositely spin-polarized source and drain leads in order to detect the spin tunneling in the s...

  7. A mean field approach to Coulomb blockade for a disordered ...

    Indian Academy of Sciences (India)

    CB is the energy price paid in adding an electron to a QD. Classically, this price is ≈e2/C, where e is the electron charge and C is the capacitance of the QD. In many-body quantum mechanics, this price is given a name, namely Hubbard U. The Coulomb blockade is the model led by an effective Hubbard U which in the.

  8. Mismatch Repair Deficiency and Response to Immune Checkpoint Blockade.

    Science.gov (United States)

    Lee, Valerie; Murphy, Adrian; Le, Dung T; Diaz, Luis A

    2016-10-01

    : More than 1.6 million new cases of cancer will be diagnosed in the U.S. in 2016, resulting in more than 500,000 deaths. Although chemotherapy has been the mainstay of treatment in advanced cancers, immunotherapy development, particularly with PD-1 inhibitors, has changed the face of treatment for a number of tumor types. One example is the subset of tumors characterized by mismatch repair deficiency and microsatellite instability that are highly sensitive to PD-1 blockade. Hereditary forms of cancer have been noted for more than a century, but the molecular changes underlying mismatch repair-deficient tumors and subsequent microsatellite unstable tumors was not known until the early 1990s. In this review article, we discuss the history and pathophysiology of mismatch repair, the process of testing for mismatch repair deficiency and microsatellite instability, and the role of immunotherapy in this subset of cancers. Mismatch repair deficiency has contributed to our understanding of carcinogenesis for the past 2 decades and now identifies a subgroup of traditionally chemotherapy-insensitive solid tumors as sensitive to PD-1 blockade. This article seeks to educate oncologists regarding the nature of mismatch repair deficiency, its impact in multiple tumor types, and its implications for predicting the responsiveness of solid tumors to immune checkpoint blockade. ©AlphaMed Press.

  9. Blockade of Death Ligand TRAIL Inhibits Renal Ischemia Reperfusion Injury

    International Nuclear Information System (INIS)

    Adachi, Takaomi; Sugiyama, Noriyuki; Gondai, Tatsuro; Yagita, Hideo; Yokoyama, Takahiko

    2013-01-01

    Renal ischemia-reperfusion injury (IRI) is a leading cause of acute kidney injury (AKI). Many investigators have reported that cell death via apoptosis significantly contributed to the pathophysiology of renal IRI. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a member of the tumor necrosis factor superfamily, and induces apoptosis and inflammation. However, the role of TRAIL in renal IRI is unclear. Here, we investigated whether TRAIL contributes to renal IRI and whether TRAIL blockade could attenuate renal IRI. AKI was induced by unilateral clamping of the renal pedicle for 60 min in male FVB/N mice. We found that the expression of TRAIL and its receptors were highly upregulated in renal tubular cells in renal IRI. Neutralizing anti-TRAIL antibody or its control IgG was given 24 hr before ischemia and a half-dose booster injection was administered into the peritoneal cavity immediately after reperfusion. We found that TRAIL blockade inhibited tubular apoptosis and reduced the accumulation of neutrophils and macrophages. Furthermore, TRAIL blockade attenuated renal fibrosis and atrophy after IRI. In conclusion, our study suggests that TRAIL is a critical pathogenic factor in renal IRI, and that TRAIL could be a new therapeutic target for the prevention of renal IRI

  10. Effects of alpha-adrenoceptor and of combined sympathetic and parasympathetic blockade on cardiac performance and vascular resistance

    DEFF Research Database (Denmark)

    Kelbaek, H; Frandsen, Henrik Lund; Hilsted, J

    1992-01-01

    1. Cardiac performance and vascular resistance was studied in seven healthy men by radionuclide cardiography and venous plethysmography before and after alpha-adrenoceptor blockade with phentolamine and after combined alpha-adrenoceptor, beta-adrenoceptor (propranolol) and parasympathetic (atropine......) blockade. 2. During alpha-adrenoceptor blockade heart rate and cardiac output increased considerably and left ventricular ejection fraction increased because of increased contractility. Systemic vascular resistance fell both during alpha-adrenoceptor blockade alone and during combined blockade...

  11. Antitumoral actions of the anti-obesity drug orlistat (XenicalTM) in breast cancer cells: blockade of cell cycle progression, promotion of apoptotic cell death and PEA3-mediated transcriptional repression of Her2/neu (erbB-2) oncogene.

    Science.gov (United States)

    Menendez, J A; Vellon, L; Lupu, R

    2005-08-01

    Orlistat (Xenicaltrade mark), a US Food and Drug Administration (FDA)-approved drug for bodyweight loss, has recently been demonstrated to exhibit antitumor properties towards prostate cancer cells by virtue of its ability to block the lipogenic activity of fatty acid synthase (FAS). FAS (oncogenic antigen-519) is up-regulated in about 50% of breast cancers, is an indicator of poor prognosis, and has recently been functionally associated with the Her2/neu (erbB-2) oncogene. We assessed the antitumoral effects of orlistat against the human breast cancer cell line SK-Br3, an in vitro paradigm of FAS and Her2/neu overexpression in breast cancer. Cell cycle analyses revealed that micromolar concentrations of orlistat induced, in a time- and dose-dependent manner, significant changes in the distribution of cell populations including a complete loss of G2-M phase, S-phase accumulation and a concomitant increase in the emerging sub-G1 (apoptotic) cells. Poly (ADP-ribose) polymerase (PARP) cleavage, an early event required for cells committed to apoptosis, was more predominant in orlistat-treated G1 phase cells. When we characterized signaling molecules participating in the cellular events following orlistat-induced inhibition of FAS activity and preceded inhibition of breast cancer cell proliferation, a dramatic down-regulation of Her2/neu-coded p185(Her2/neu) oncoprotein was found in orlistat-treated SK-Br3 cells (>90% reduction). Interestingly, a significant accumulation of the DNA-binding protein PEA3, a member of the Ets transcription factor family that specifically targets a PEA3-binding motif present on the Her2/neu gene promoter and down-regulates its activity, was observed in orlistat-treated SK-Br3 cells. When a Luciferase reporter gene driven by the Her2/neu promoter was transiently transfected in SK-Br3 cells, orlistat exposure was found to dramatically repress the promoter activity of Her2/neu gene, whereas a Her2/neu promoter bearing a mutated binding DNA

  12. Mineralocorticoid receptor blockade prevents stress-induced modulation of multiple memory systems in the human brain.

    Science.gov (United States)

    Schwabe, Lars; Tegenthoff, Martin; Höffken, Oliver; Wolf, Oliver T

    2013-12-01

    Accumulating evidence suggests that stress may orchestrate the engagement of multiple memory systems in the brain. In particular, stress is thought to favor dorsal striatum-dependent procedural over hippocampus-dependent declarative memory. However, the neuroendocrine mechanisms underlying these modulatory effects of stress remain elusive, especially in humans. Here, we targeted the role of the mineralocorticoid receptor (MR) in the stress-induced modulation of dorsal striatal and hippocampal memory systems in the human brain using a combination of event-related functional magnetic resonance imaging and pharmacologic blockade of the MR. Eighty healthy participants received the MR antagonist spironolactone (300 mg) or a placebo and underwent a stressor or control manipulation before they performed, in the scanner, a classification task that can be supported by the hippocampus and the dorsal striatum. Stress after placebo did not affect learning performance but reduced explicit task knowledge and led to a relative increase in the use of more procedural learning strategies. At the neural level, stress promoted striatum-based learning at the expense of hippocampus-based learning. Functional connectivity analyses showed that this shift was associated with altered coupling of the amygdala with the hippocampus and dorsal striatum. Mineralocorticoid receptor blockade before stress prevented the stress-induced shift toward dorsal striatal procedural learning, same as the stress-induced alterations of amygdala connectivity with hippocampus and dorsal striatum, but resulted in significantly impaired performance. Our findings indicate that the stress-induced shift from hippocampal to dorsal striatal memory systems is mediated by the amygdala, required to preserve performance after stress, and dependent on the MR. © 2013 Society of Biological Psychiatry.

  13. Effects of adductor-canal-blockade on pain and ambulation after total knee arthroplasty

    DEFF Research Database (Denmark)

    Jenstrup, M T; Jæger, P; Lund, J

    2012-01-01

    Total knee arthroplasty (TKA) is associated with intense post-operative pain. Besides providing optimal analgesia, reduction in side effects and enhanced mobilization are important in this elderly population. The adductor-canal-blockade is theoretically an almost pure sensory blockade. We...... hypothesized that the adductor-canal-blockade may reduce morphine consumption (primary endpoint), improve pain relief, enhance early ambulation ability, and reduce side effects (secondary endpoints) after TKA compared with placebo....

  14. Berry-Phase Blockade in Single-Molecule Magnets

    Science.gov (United States)

    González, Gabriel; Leuenberger, Michael N.

    2007-06-01

    We formulate the problem of electron transport through a single-molecule magnet (SMM) in the Coulomb blockade regime taking into account topological interference effects for the tunneling of the large spin of a SMM. The interference originates from spin Berry phases associated with different tunneling paths. We show that, in the case of incoherent spin states, it is essential to place the SMM between oppositely spin-polarized source and drain leads in order to detect the spin tunneling in the stationary current, which exhibits topological zeros as a function of the transverse magnetic field.

  15. Precipitated withdrawal during maintenance opioid blockade with extended release naltrexone.

    Science.gov (United States)

    Fishman, Marc

    2008-08-01

    Background There has been increasing interest in the use of extended release injectable naltrexone for the treatment of opioid dependence. Case description We report a case of precipitated withdrawal in a 17-year-old adolescent female receiving extended release naltrexone (Vivitrol) for opioid dependence, following her third serial monthly dose of the medication, several days after using oxycodone with mild intoxication. Conclusions This case suggests that, in some circumstances, the opioid blockade may be overcome when naltrexone levels drop towards the end of the dosing interval, producing vulnerability to subsequent naltrexone-induced withdrawal. This may provide cautionary guidance for clinical management and dosing strategies.

  16. Partial neuromuscular blockade in humans enhances muscle blood flow during exercise independently of muscle oxygen uptake and acetylcholine receptor blockade

    DEFF Research Database (Denmark)

    Hellsten, Ylva; Krustrup, Peter; Iaia, F Marcello

    2009-01-01

    This study examined the role of acetylcholine for skeletal muscle blood flow during exercise by use of the competitive neuromuscular blocking agent cisatracurium in combination with the acetylcholine receptor blocker glycopyrrone. Nine healthy male subjects performed a 10-min bout of one...... conductance during exercise, events that are not associated with either acetylcholine or an increased oxygen demand. The results do not support an essential role for acetylcholine, released form the neuromuscular junction, in exercise hyperaemia or for the enhanced blood flow during neuromuscular blockade...

  17. Quantitative assessment of differential sensory blockade after lumbar epidural lidocaine.

    Science.gov (United States)

    Tay, B; Wallace, M S; Irving, G

    1997-05-01

    A cutaneous current perception threshold (CPT) sensory testing device measures both large and small diameter sensory nerve fiber function and may be useful in evaluating differential neural blockade. Eight subjects received both lumbar epidural saline and lumbar epidural lidocaine. Five milliliters of normal saline was administered and the CPTs were measured. After the saline, 10 mL of 2% plain lidocaine was administered. CPTs, and sensation to touch, pinprick, and cold were subsequently measured. Saline had no effect on any measurements. Lidocaine caused an increase in all CPTs at the umbilicus and the knee reaching a statistical significance at 5 Hz for the umbilicus only. The great toe showed a slight increase of the 5 Hz stimulus and no increase of the 2000 or 250 Hz stimulus. There was a significant decrease in touch, pinprick, and cold sensation at the umbilicus and knee and a significant decrease in the cold sensation at the great toe. There was no effect on any measurements made at the mastoid. Epidural lidocaine resulted in a differential neural blockade as measured by a CPT monitor but not with crude sensory measurements.

  18. Interleukin-6 blockade Improves Autonomic Dysfunction in Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Ashit Syngle

    2015-01-01

    Full Text Available Autonomic nervous system (ANS involvement in rheumatoid arthritis (RA is well recognised and contributes to arrhythmia and sudden death. However, there is no study documented the therapeutic efficacy on autonomic neuropathy (AN in RA. This is the first reported observation of improvement in AN with interleukin-6 (IL-6 blockade with tocilizumab in RA. We report a case of 61-year old female with seropositive RA with severe disease activity, investigated for autonomic neuropathy. A battery of non invasive tests was used for accurate assessment of AN function based on assessment of peripheral sympathetic autonomic function and cardiovascular reflex tests. Tocilizumab 8mg/kg intravenous infusion at weeks 0, 4 and 8 was added to her treatment regimen. Cardiovascular autonomic function tests at baseline showed marked abnormalities of parasympathetic cardiovascular reflexes. After the first dose of tocilizumab there was a rapid improvement with normalization of parasympathetic autonomic activity with subsequent doses. IL-6 blockade with tocilizumab seems to have the potential to improve the vagus nerve mediated parasympathetic neuropathy and hence has the potential to restore cholinergic anti-inflammatory pathway.

  19. Localized CD47 blockade enhances immunotherapy for murine melanoma.

    Science.gov (United States)

    Ingram, Jessica R; Blomberg, Olga S; Sockolosky, Jonathan T; Ali, Lestat; Schmidt, Florian I; Pishesha, Novalia; Espinosa, Camilo; Dougan, Stephanie K; Garcia, K Christopher; Ploegh, Hidde L; Dougan, Michael

    2017-09-19

    CD47 is an antiphagocytic ligand broadly expressed on normal and malignant tissues that delivers an inhibitory signal through the receptor signal regulatory protein alpha (SIRPα). Inhibitors of the CD47-SIRPα interaction improve antitumor antibody responses by enhancing antibody-dependent cellular phagocytosis (ADCP) in xenograft models. Endogenous expression of CD47 on a variety of cell types, including erythrocytes, creates a formidable antigen sink that may limit the efficacy of CD47-targeting therapies. We generated a nanobody, A4, that blocks the CD47-SIRPα interaction. A4 synergizes with anti-PD-L1, but not anti-CTLA4, therapy in the syngeneic B16F10 melanoma model. Neither increased dosing nor half-life extension by fusion of A4 to IgG2a Fc (A4Fc) overcame the issue of an antigen sink or, in the case of A4Fc, systemic toxicity. Generation of a B16F10 cell line that secretes the A4 nanobody showed that an enhanced response to several immune therapies requires near-complete blockade of CD47 in the tumor microenvironment. Thus, strategies to localize CD47 blockade to tumors may be particularly valuable for immune therapy.

  20. Immunomodulation by gadolinium chloride-induced Kupffer cell phagocytosis blockade

    International Nuclear Information System (INIS)

    Lazar, G.; Husztik, E.; Kiss, I.; Szakacs, J.; Olah, J.

    1998-01-01

    Gadolinium chloride (GdCl 3 ), a rare earth metal salt, depresses macrophage activity, and is commonly used to study the physiology of the reticuloendothelial system. In the present work, the effect of GdCl 3 -induced Kupffer cell blockade on the humoral immune response in mice to sheep red blood cells (SRBC) was investigated. Kupffer cell phagocytosis blockade was found to increase both the primary and secondary immune responses to SRBC. The primary immune response was significantly augmented in animals injected intravenously with GdCl 3 2, 3 or 4 days before injection of the cellular antigen, but GdCl 3 injected 7 days before the antigen did not modify the immune response. Increased secondary humoral immune responses were also observed. When GdCl 3 was injected 2 days before the second dose of antigen, the numbers of both IgM and IgG-producing plaque forming cells were augmented. GdCl 3 injected 2 days before the first dose of SRBC did not modify the humoral immune response. Earlier studies with 51 Cr-labelled foreign red blood cells suggested that the augmentation of the humoral immune response in GdCl 3 -pretreated mice is a consequence of the spillover of the antigen from the liver into the spleen and other extrahepatic reticuloendothelial organs. (orig.)

  1. Improving the efficacy of RAAS blockade in patients with chronic kidney disease

    NARCIS (Netherlands)

    Lambers Heerspink, Hiddo J.; de Borst, Martin H.; Bakker, Stephan J. L.; Navis, Gerjan J.

    I Reduction of blood pressure and proteinuria by blockade of the renin-angiotensin-aldosterone system (RAAS) has been the cornerstone of renoprotective intervention for patients with chronic kidney disease (CKD) for many years. Despite the proven efficacy of RAAS blockade, however, the reduction in

  2. Effects of axillary blockade on regional cerebral blood flow during dynamic hand contractions

    DEFF Research Database (Denmark)

    Friedman, D B; Friberg, L; Payne, G

    1992-01-01

    Regional cerebral blood flow (rCBF) was measured at orbitomeatal (OM) plane +5.0 and +9.0 cm in 10 subjects at rest and during dynamic hand contractions before and after axillary blockade. Handgrip strength was significantly reduced, and rating of perceived exertion increased after blockade. During...

  3. Epidural anaesthesia with levobupivacaine and ropivacaine : effects of age on the pharmacokinetics, neural blockade and haemodynamics

    NARCIS (Netherlands)

    Simon, Mischa J.G.

    2006-01-01

    Epidural neural blockade results from processes after the administration of a local anaesthetic in the epidural space until the uptake in neural tissue. The pharmacokinetics, neural blockade and haemodynamics after epidural anaesthesia may be influenced by several factors, with age as the most

  4. Glucagon and plasma catecholamines during beta-receptor blockade in exercising man

    DEFF Research Database (Denmark)

    Galbo, H; Holst, Janett; Christensen, N J

    1976-01-01

    Seven men ran at 60% of individual maximal oxygen uptake to exhaustion during beta-adrenergic blockade with propranolol (P), during lipolytic blockade with nicotinic acid (N), or without drugs (C). The total work times (83 +/- 9 (P), 122 +/- 8 (N), 166 +/- 10 (C) min, mean and SE) differed...

  5. Glucagon and plasma catecholamines during beta-receptor blockade in exercising man

    DEFF Research Database (Denmark)

    Galbo, H; Holst, Janett; Christensen, N J

    1976-01-01

    Seven men ran at 60% of individual maximal oxygen uptake to exhaustion during beta-adrenergic blockade with propranolol (P), during lipolytic blockade with nicotinic acid (N), or without drugs (C). The total work times (83 +/- 9 (P), 122 +/- 8 (N), 166 +/- 10 (C) min, mean and SE) differed signif...

  6. Deep neuromuscular blockade leads to a larger intraabdominal volume during laparoscopy

    DEFF Research Database (Denmark)

    Lindekaer, Astrid Listov; Halvor Springborg, Henrik; Istre, Olav

    2013-01-01

    for measuring the intra-abdominal space available to the surgeon during laproscopy, in order to examine whether the relaxation produced by deep neuromuscular blockade can increase the working surgical space sufficiently to permit a reduction in the CO2 insufflation pressure. Using the laproscopic grasper......, the distance from the promontory to the skin is measured at two different insufflation pressures: 8 mm Hg and 12 mm Hg. After the initial measurements, a neuromuscular blocking agent (rocuronium) is administered to the patient and the intra-abdominal volume is measured again. Pilot data collected from 15...... patients shows that the intra-abdominal space at 8 mm Hg with blockade is comparable to the intra-abdominal space measured at 12 mm Hg without blockade. The impact of neuromuscular blockade was not correlated with patient height, weight, BMI, and age. Thus, using neuromuscular blockade to maintain a steady...

  7. Low-strength T-cell activation promotes Th17 responses.

    Science.gov (United States)

    Purvis, Harriet A; Stoop, Jeroen N; Mann, Jelena; Woods, Steven; Kozijn, Anne E; Hambleton, Sophie; Robinson, John H; Isaacs, John D; Anderson, Amy E; Hilkens, Catharien M U

    2010-12-02

    We show that the strength of T-cell stimulation determines the capability of human CD4(+) T cells to become interleukin-17 (IL-17) producers. CD4(+) T cells received either high- (THi) or low (TLo)-strength stimulation via anti-CD3/CD28 beads or dendritic cells pulsed with superantigen in the presence of pro-Th17 cytokines IL-1β, transforming growth factor β, and IL-23. We found that TLo, but not THi, stimulation profoundly promoted Th17 responses by enhancing both the relative proportion and total number of Th17 cells. Titration of anti-CD3 revealed that low TCR signaling promoted Th17 cells, but only in the presence of anti-CD28. Impaired IL-17 production in THi cells could not be explained by high levels of Foxp3 or transforming growth factor β-latency-associated peptide expressed by THi cells. Nuclear factor of activated T cells was translocated to the nucleus in both THi and TLo cells, but only bound to the proximal region of the IL-17 promoter in TLo cells. The addition of a Ca(2+) ionophore under TLo conditions reversed the pro-Th17 effect, suggesting that high Ca(2+) signaling impairs Th17 development. Although our data do not distinguish between priming of naive T cells versus expansion/differentiation of memory T cells, our results clearly establish an important role for the strength of T-cell activation in regulating Th17 responses.

  8. Renin-angiotensin system blockade therapy after transcatheter aortic valve implantation.

    Science.gov (United States)

    Ochiai, Tomoki; Saito, Shigeru; Yamanaka, Futoshi; Shishido, Koki; Tanaka, Yutaka; Yamabe, Tsuyoshi; Shirai, Shinichi; Tada, Norio; Araki, Motoharu; Naganuma, Toru; Watanabe, Yusuke; Yamamoto, Masanori; Hayashida, Kentaro

    2018-04-01

    The persistence of left ventricular (LV) hypertrophy is associated with poor clinical outcomes after transcatheter aortic valve implantation (TAVI) for aortic stenosis. However, the optimal medical therapy after TAVI remains unknown. We investigated the effect of renin-angiotensin system (RAS) blockade therapy on LV hypertrophy and mortality in patients undergoing TAVI. Between October 2013 and April 2016, 1215 patients undergoing TAVI were prospectively enrolled in the Optimized CathEter vAlvular iNtervention (OCEAN)-TAVI registry. This cohort was stratified according to the postoperative usage of RAS blockade therapy with angiotensin-converting enzyme (ACE) inhibitors or angiotensin-receptor blockers (ARBs). Patients with at least two prescriptions dispensed 180 days apart after TAVI and at least a 6-month follow-up constituted the RAS blockade group (n=371), while those not prescribed any ACE inhibitors or ARBs after TAVI were included in the no RAS blockade group (n=189). At 6 months postoperatively, the RAS blockade group had significantly greater LV mass index regression than the no RAS blockade group (-9±24% vs -2±25%, p=0.024). Kaplan-Meier analysis revealed a significantly lower cumulative 2-year mortality in the RAS blockade than that in the no RAS blockade group (7.5% vs 12.5%; log-rank test, p=0.031). After adjusting for confounding factors, RAS blockade therapy was associated with significantly lower all-cause mortality (HR, 0.45; 95% CI 0.22 to 0.91; p=0.025). Postoperative RAS blockade therapy is associated with greater LV mass index regression and reduced all-cause mortality. These data need to be confirmed by a prospective randomised controlled outcome trial. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  9. Amelioration Strategies Fail To Prevent Tobacco Smoke Effects On Neurodifferentiation: Nicotinic Receptor Blockade, Antioxidants, Methyl Donors

    Science.gov (United States)

    Slotkin, Theodore A.; Skavicus, Samantha; Card, Jennifer; Levin, Edward D.; Seidler, Frederic J.

    2015-01-01

    Tobacco smoke exposure is associated with neurodevelopmental disorders. We used neuronotypic PC12 cells to evaluate the mechanisms by which tobacco smoke extract (TSE) affects neurodifferentiation. In undifferentiated cells, TSE impaired DNA synthesis and cell numbers to a much greater extent than nicotine alone; TSE also impaired cell viability to a small extent. In differentiating cells, TSE enhanced cell growth at the expense of cell numbers and promoted emergence of the dopaminergic phenotype. Nicotinic receptor blockade with mecamylamine was ineffective in preventing the adverse effects of TSE and actually enhanced the effect of TSE on the dopamine phenotype. A mixture of antioxidants (Vitamin C, Vitamin E, N-acetyl-L-cysteine) provided partial protection against cell loss but also promoted loss of the cholinergic phenotype in response to TSE. Notably, the antioxidants themselves altered neurodifferentiation, reducing cell numbers and promoting the cholinergic phenotype at the expense of the dopaminergic phenotype, an effect that was most prominent for N-acetyl-L-cysteine. Treatment with methyl donors (Vitamin B12, folic acid, choline) had no protectant effect and actually enhanced the cell loss evoked by TSE; they did have a minor, synergistic interaction with antioxidants protecting against TSE effects on growth. Thus, components of tobacco smoke perturb neurodifferentiation through mechanisms that cannot be attributed to the individual effects of nicotine, oxidative stress or interference with one-carbon metabolism. Consequently, attempted amelioration strategies may be partially effective at best, or, as seen here, can actually aggravate injury interfering with normal developmental signals and/or by sensitizing cells to TSE effects on neurodifferentiation. PMID:25891525

  10. Coulomb blockade in turnstile with multiple tunnel junctions

    CERN Document Server

    Lee, S C; Kang, D S; Kim, D C; Choi, C K; Ryu, J Y

    1999-01-01

    On the basis of the analytic solutions to the electrostatic problem of the multi-grated-small-junction systems, the stable domain for the Coulomb blockade of turnstile with multiple tunnel junctions at zero temperature has been analyzed as a function of the number of tunnel junction, the ratio of the gate capacitance to the junction capacitance, and the asymmetric factor. Our results show that domains form various shaped regions according to the asymmetric factor and their size depends on the number of junction and the ratio of the gate capacitance to the junction capacitance. In particular, it is shown that electrons can be transferred in positive and/or negative bias voltage depending on the asymmetric factor when an appropriate gate cycle is applied. Thus, the asymmetric factor plays an important role in determining the turnstile operation.

  11. Neuromuscular blockade for improvement of surgical conditions during laparotomy

    DEFF Research Database (Denmark)

    Madsen, Matias Vested; Scheppan, Susanne; Kissmeyer, Peter

    2015-01-01

    INTRODUCTION: During laparotomy, surgeons frequently experience difficult surgical conditions if the patient's abdominal wall or diaphragm is tense. This issue is particularly pertinent while closing the fascia and placing the intestines into the abdominal cavity. Establishment of a deep neuromus......INTRODUCTION: During laparotomy, surgeons frequently experience difficult surgical conditions if the patient's abdominal wall or diaphragm is tense. This issue is particularly pertinent while closing the fascia and placing the intestines into the abdominal cavity. Establishment of a deep...... neuromuscular blockade (NMB), defined as a post-tetanic-count (PTC) of 0-1, paralyses the abdominal wall muscles and the diaphragm. We hypothesised that deep NMB (PTC 0-1) would improve surgical conditions during upper laparotomy as compared to standard NMB with bolus administration. METHODS...

  12. Ultra-high-ohmic microstripline resistors for Coulomb blockade devices

    International Nuclear Information System (INIS)

    Lotkhov, Sergey V

    2013-01-01

    In this paper, we report on the fabrication and low-temperature characterization of ultra-high-ohmic microstripline resistors made of a thin film of weakly oxidized titanium. Nearly linear voltage–current characteristics were measured at temperatures down to T ∼ 20 mK for films with sheet resistivities as high as ∼7 kΩ, i.e. about an order of magnitude higher than our previous findings for weakly oxidized Cr. Our analysis indicates that such an improvement can help to create an advantageous high-impedance environment for different Coulomb blockade devices. Further properties of the Ti film addressed in this work show the promise of low-noise behavior of the resistors when applied in different realizations of the quantum standard of current. (paper)

  13. Chirality blockade of Andreev reflection in a magnetic Weyl semimetal

    Science.gov (United States)

    Bovenzi, N.; Breitkreiz, M.; Baireuther, P.; O'Brien, T. E.; Tworzydło, J.; Adagideli, I.; Beenakker, C. W. J.

    2017-07-01

    A Weyl semimetal with broken time-reversal symmetry has a minimum of two species of Weyl fermions, distinguished by their opposite chirality, in a pair of Weyl cones at opposite momenta ±K that are displaced in the direction of the magnetization. Andreev reflection at the interface between a Weyl semimetal in the normal state (N) and a superconductor (S) that pairs ±K must involve a switch of chirality, otherwise it is blocked. We show that this "chirality blockade" suppresses the superconducting proximity effect when the magnetization lies in the plane of the NS interface. A Zeeman field at the interface can provide the necessary chirality switch and activate Andreev reflection.

  14. Abdominal compartment syndrome successfully treated with neuromuscular blockade

    Directory of Open Access Journals (Sweden)

    Kris T Chiles

    2011-01-01

    Full Text Available A 48 year old male admitted to the intensive care unit after a cardiac arrest complicated by a stroke intra-operatively during automatic implantable cardioverter defibrillator placement. He post-operatively developed a rigid abdomen, elevated peak and plateau pressures, hypoxia and renal insufficiency. He was diagnosed with abdominal compartment syndrome with an intra-abdominal compartment pressure of 40mmHg. The patient was administered 10 mg of intravenous cisatracuriumbesylate in preparation for bedside surgical abdominal decompression. Cisatracurium eliminated the patients need for surgical intervention by reducing his abdominal compartment pressures to normal and improving his hypoxia and renal function. This case illustrates that neuromuscular blockade should be attempted in patients with abdominal compartment syndrome prior to surgical intervention.

  15. Ultra-high-ohmic microstripline resistors for Coulomb blockade devices

    Science.gov (United States)

    Lotkhov, Sergey V.

    2013-06-01

    In this paper, we report on the fabrication and low-temperature characterization of ultra-high-ohmic microstripline resistors made of a thin film of weakly oxidized titanium. Nearly linear voltage-current characteristics were measured at temperatures down to T ˜ 20 mK for films with sheet resistivities as high as ˜7 kΩ, i.e. about an order of magnitude higher than our previous findings for weakly oxidized Cr. Our analysis indicates that such an improvement can help to create an advantageous high-impedance environment for different Coulomb blockade devices. Further properties of the Ti film addressed in this work show the promise of low-noise behavior of the resistors when applied in different realizations of the quantum standard of current.

  16. Coulomb blockade transport across lateral (Ga,Mn)As nanoconstrictions

    Science.gov (United States)

    Schlapps, Markus; Geissler, Stefan; Lermer, Teresa; Sadowski, Janusz; Wegscheider, Werner; Weiss, Dieter

    2010-09-01

    We report on magnetotransport measurements of nanoconstricted (Ga,Mn)As devices showing very large resistance changes that can be controlled by both an electric and a magnetic field. Based on the bias voltage and temperature dependent measurements down to the millikelvin range we compare the models currently used to describe transport through (Ga,Mn)As nanoconstrictions. We provide an explanation for the observed spin-valve like behavior during a magnetic field sweep by means of the magnetization configurations in the device. Furthermore, we prove that Coulomb blockade plays a decisive role for the transport mechanism and show that modeling the constriction as a granular metal describes the temperature and bias dependence of the conductance correctly and allows to estimate the number of participating islands located in the constriction.

  17. Investigation of uncertainty components in Coulomb blockade thermometry

    Energy Technology Data Exchange (ETDEWEB)

    Hahtela, O. M.; Heinonen, M.; Manninen, A. [MIKES Centre for Metrology and Accreditation, Tekniikantie 1, 02150 Espoo (Finland); Meschke, M.; Savin, A.; Pekola, J. P. [Low Temperature Laboratory, Aalto University, Tietotie 3, 02150 Espoo (Finland); Gunnarsson, D.; Prunnila, M. [VTT Technical Research Centre of Finland, Tietotie 3, 02150 Espoo (Finland); Penttilä, J. S.; Roschier, L. [Aivon Oy, Tietotie 3, 02150 Espoo (Finland)

    2013-09-11

    Coulomb blockade thermometry (CBT) has proven to be a feasible method for primary thermometry in every day laboratory use at cryogenic temperatures from ca. 10 mK to a few tens of kelvins. The operation of CBT is based on single electron charging effects in normal metal tunnel junctions. In this paper, we discuss the typical error sources and uncertainty components that limit the present absolute accuracy of the CBT measurements to the level of about 1 % in the optimum temperature range. Identifying the influence of different uncertainty sources is a good starting point for improving the measurement accuracy to the level that would allow the CBT to be more widely used in high-precision low temperature metrological applications and for realizing thermodynamic temperature in accordance to the upcoming new definition of kelvin.

  18. Investigation of uncertainty components in Coulomb blockade thermometry

    International Nuclear Information System (INIS)

    Hahtela, O. M.; Heinonen, M.; Manninen, A.; Meschke, M.; Savin, A.; Pekola, J. P.; Gunnarsson, D.; Prunnila, M.; Penttilä, J. S.; Roschier, L.

    2013-01-01

    Coulomb blockade thermometry (CBT) has proven to be a feasible method for primary thermometry in every day laboratory use at cryogenic temperatures from ca. 10 mK to a few tens of kelvins. The operation of CBT is based on single electron charging effects in normal metal tunnel junctions. In this paper, we discuss the typical error sources and uncertainty components that limit the present absolute accuracy of the CBT measurements to the level of about 1 % in the optimum temperature range. Identifying the influence of different uncertainty sources is a good starting point for improving the measurement accuracy to the level that would allow the CBT to be more widely used in high-precision low temperature metrological applications and for realizing thermodynamic temperature in accordance to the upcoming new definition of kelvin

  19. Effect of on-chip filter on Coulomb blockade thermometer

    International Nuclear Information System (INIS)

    Roschier, L; Penttilä, J S; Gunnarsson, D; Prunnila, M; Meschke, M; Savin, A

    2012-01-01

    Coulomb Blockade Thermometer (CBT) is a primary thermometer based on electric conductance of normal tunnel junction arrays. One limitation for CBT use at the lowest temperatures has been due to environmental noise heating. To improve on this limitation, we have done measurements on CBT sensors fabricated with different on-chip filtering structures in a dilution refrigerator with a base temperature of 10 mK. The CBT sensors were produced with a wafer scale tunnel junction process. We present how the different on-chip filtering schemes affect the limiting saturation temperatures and show that CBT sensors with proper on-chip filtering work at temperatures below 20 mK and are tolerant to noisy environment.

  20. Wnt/beta-catenin signaling blockade promotes neuronal induction and dopaminergic differentiation in embryonic stem cells

    Czech Academy of Sciences Publication Activity Database

    Čajánek, L.; Ribeiro, D.; Liste, I.; Parish, C.L.; Bryja, Vítězslav; Arenas, E.

    2009-01-01

    Roč. 27, č. 12 (2009), s. 2917-2927 ISSN 1066-5099 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : embryonic stem cells * Wnt pathway * dopaminergic neurons Subject RIV: BO - Biophysics Impact factor: 7.747, year: 2009

  1. Interleukin-7 receptor blockade suppresses adaptive and innate inflammatory responses in experimental colitis

    Directory of Open Access Journals (Sweden)

    Willis Cynthia R

    2012-10-01

    Full Text Available Abstract Background Interleukin-7 (IL-7 acts primarily on T cells to promote their differentiation, survival, and homeostasis. Under disease conditions, IL-7 mediates inflammation through several mechanisms and cell types. In humans, IL-7 and its receptor (IL-7R are increased in diseases characterized by inflammation such as atherosclerosis, rheumatoid arthritis, psoriasis, multiple sclerosis, and inflammatory bowel disease. In mice, overexpression of IL-7 results in chronic colitis, and T-cell adoptive transfer studies suggest that memory T cells expressing high amounts of IL-7R drive colitis and are maintained and expanded with IL-7. The studies presented here were undertaken to better understand the contribution of IL-7R in inflammatory bowel disease in which colitis was induced with a bacterial trigger rather than with adoptive transfer. Methods We examined the contribution of IL-7R on inflammation and disease development in two models of experimental colitis: Helicobacter bilis (Hb-induced colitis in immune-sufficient Mdr1a−/− mice and in T- and B-cell-deficient Rag2−/− mice. We used pharmacological blockade of IL-7R to understand the mechanisms involved in IL-7R-mediated inflammatory bowel disease by analyzing immune cell profiles, circulating and colon proteins, and colon gene expression. Results Treatment of mice with an anti-IL-7R antibody was effective in reducing colitis in Hb-infected Mdr1a−/− mice by reducing T-cell numbers as well as T-cell function. Down regulation of the innate immune response was also detected in Hb-infected Mdr1a−/− mice treated with an anti-IL-7R antibody. In Rag2−/− mice where colitis was triggered by Hb-infection, treatment with an anti-IL-7R antibody controlled innate inflammatory responses by reducing macrophage and dendritic cell numbers and their activity. Conclusions Results from our studies showed that inhibition of IL-7R successfully ameliorated inflammation and disease development

  2. Long-term Benefit of PD-L1 Blockade in Lung Cancer Associated with JAK3 Activation.

    Science.gov (United States)

    Van Allen, Eliezer M; Golay, Hadrien G; Liu, Yan; Koyama, Shohei; Wong, Karrie; Taylor-Weiner, Amaro; Giannakis, Marios; Harden, Maegan; Rojas-Rudilla, Vanesa; Chevalier, Aaron; Thai, Tran; Lydon, Christine; Mach, Stacy; Avila, Ada G; Wong, Joshua A; Rabin, Alexandra R; Helmkamp, Joshua; Sholl, Lynette; Carter, Scott L; Oxnard, Geoffrey; Janne, Pasi; Getz, Gad; Lindeman, Neal; Hammerman, Peter S; Garraway, Levi A; Hodi, F Stephen; Rodig, Scott J; Dranoff, Glenn; Wong, Kwok-Kin; Barbie, David A

    2015-08-01

    PD-1 immune checkpoint blockade occasionally results in durable clinical responses in advanced metastatic cancers. However, mechanism-based predictors of response to this immunotherapy remain incompletely characterized. We performed comprehensive genomic profiling on a tumor and germline sample from a patient with refractory lung adenocarcinoma who achieved marked long-term clinical benefit from anti-PD-L1 therapy. We discovered activating somatic and germline amino acid variants in JAK3 that promoted PD-L1 induction in lung cancer cells and in the tumor immune microenvironment. These findings suggest that genomic alterations that deregulate cytokine receptor signal transduction could contribute to PD-L1 activation and engagement of the PD-1 immune checkpoint in lung cancer. ©2015 American Association for Cancer Research.

  3. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency.

    Science.gov (United States)

    Le, Dung T; Uram, Jennifer N; Wang, Hao; Bartlett, Bjarne R; Kemberling, Holly; Eyring, Aleksandra D; Skora, Andrew D; Luber, Brandon S; Azad, Nilofer S; Laheru, Dan; Biedrzycki, Barbara; Donehower, Ross C; Zaheer, Atif; Fisher, George A; Crocenzi, Todd S; Lee, James J; Duffy, Steven M; Goldberg, Richard M; de la Chapelle, Albert; Koshiji, Minori; Bhaijee, Feriyl; Huebner, Thomas; Hruban, Ralph H; Wood, Laura D; Cuka, Nathan; Pardoll, Drew M; Papadopoulos, Nickolas; Kinzler, Kenneth W; Zhou, Shibin; Cornish, Toby C; Taube, Janis M; Anders, Robert A; Eshleman, James R; Vogelstein, Bert; Diaz, Luis A

    2015-06-25

    Somatic mutations have the potential to encode "non-self" immunogenic antigens. We hypothesized that tumors with a large number of somatic mutations due to mismatch-repair defects may be susceptible to immune checkpoint blockade. We conducted a phase 2 study to evaluate the clinical activity of pembrolizumab, an anti-programmed death 1 immune checkpoint inhibitor, in 41 patients with progressive metastatic carcinoma with or without mismatch-repair deficiency. Pembrolizumab was administered intravenously at a dose of 10 mg per kilogram of body weight every 14 days in patients with mismatch repair-deficient colorectal cancers, patients with mismatch repair-proficient colorectal cancers, and patients with mismatch repair-deficient cancers that were not colorectal. The coprimary end points were the immune-related objective response rate and the 20-week immune-related progression-free survival rate. The immune-related objective response rate and immune-related progression-free survival rate were 40% (4 of 10 patients) and 78% (7 of 9 patients), respectively, for mismatch repair-deficient colorectal cancers and 0% (0 of 18 patients) and 11% (2 of 18 patients) for mismatch repair-proficient colorectal cancers. The median progression-free survival and overall survival were not reached in the cohort with mismatch repair-deficient colorectal cancer but were 2.2 and 5.0 months, respectively, in the cohort with mismatch repair-proficient colorectal cancer (hazard ratio for disease progression or death, 0.10 [Pmismatch repair-deficient noncolorectal cancer had responses similar to those of patients with mismatch repair-deficient colorectal cancer (immune-related objective response rate, 71% [5 of 7 patients]; immune-related progression-free survival rate, 67% [4 of 6 patients]). Whole-exome sequencing revealed a mean of 1782 somatic mutations per tumor in mismatch repair-deficient tumors, as compared with 73 in mismatch repair-proficient tumors (P=0.007), and high somatic

  4. Myths and facts in neuromuscular pharmacology - New developments in reversing neuromuscular blockade

    NARCIS (Netherlands)

    Fink, H.; Hollmann, M. W.

    2012-01-01

    Pharmacologic reversal of neuromuscular blockade is a topic nor very well acknowledged and controversially discussed. Reasons for this are numerous and include missing perception of the potential complications of residual neuromuscular paralysis including an increased morbidity and mortality, as

  5. Fano effect dominance over Coulomb blockade in transport properties of parallel coupled quantum dot system

    Energy Technology Data Exchange (ETDEWEB)

    Brogi, Bharat Bhushan, E-mail: brogi-221179@yahoo.in; Ahluwalia, P. K. [Department of Physics, Himachal Pradesh University, Shimla-171005 (India); Chand, Shyam [University Institute of Information Technology, H.P. University Shimla-171005 (India)

    2015-06-24

    Theoretical study of the Coulomb blockade effect on transport properties (Transmission Probability and I-V characteristics) for varied configuration of coupled quantum dot system has been studied by using Non Equilibrium Green Function(NEGF) formalism and Equation of Motion(EOM) method in the presence of magnetic flux. The self consistent approach and intra-dot Coulomb interaction is being taken into account. As the key parameters of the coupled quantum dot system such as dot-lead coupling, inter-dot tunneling and magnetic flux threading through the system can be tuned, the effect of asymmetry parameter and magnetic flux on this tuning is being explored in Coulomb blockade regime. The presence of the Coulomb blockade due to on-dot Coulomb interaction decreases the width of transmission peak at energy level ε + U and by adjusting the magnetic flux the swapping effect in the Fano peaks in asymmetric and symmetric parallel configuration sustains despite strong Coulomb blockade effect.

  6. Effects of dual renin-angiotensin system blockade on proteinuria in a ...

    African Journals Online (AJOL)

    Kidney diseases manifesting as proteinuria or elevated creatinine are increasingly prevalent complications of HIV infection. We report the effects of dual renin-angiotensin system blockade on proteinuria in a hypertensive black African HIV-infected patient.

  7. Combined blockade of vascular endothelial growth factor and programmed death 1 pathways in advanced kidney cancer.

    Science.gov (United States)

    Einstein, David J; McDermott, David F

    2017-06-01

    Targeted and immune-based therapies have improved outcomes in advanced kidney cancer, yet novel strategies are needed to extend the duration of these benefits and expand them to more patients. Combined inhibition of vascular endothelial growth factor (VEGF) and the programmed death 1 (PD-1)/programmed death ligand 1 (PD-L1) pathways with therapeutic agents already in clinical use may offer such a strategy. Here, we describe the development and clinical evaluation of VEGF inhibitors and, separately, PD-1/PD-L1 inhibitors. We present preclinical evidence of interaction between these pathways and the rationale for combined blockade. Beyond well-known effects on pathologic angiogenesis, VEGF blockade also may decrease immune tolerance and enhance PD-1/PD-L1 blockade. We conclude with the results of several early trials of combined VEGF and PD-1/PD-L1 blockade, which demonstrate encouraging antitumor activity, and we pose questions for future study.

  8. Blockade of Metallothioneins 1 and 2 Increases Skeletal Muscle Mass and Strength

    Science.gov (United States)

    Summermatter, Serge; Bouzan, Anais; Pierrel, Eliane; Melly, Stefan; Stauffer, Daniela; Gutzwiller, Sabine; Nolin, Erin; Dornelas, Christina; Fryer, Christy; Leighton-Davies, Juliet; Glass, David J.

    2016-01-01

    ABSTRACT Metallothioneins are proteins that are involved in intracellular zinc storage and transport. Their expression levels have been reported to be elevated in several settings of skeletal muscle atrophy. We therefore investigated the effect of metallothionein blockade on skeletal muscle anabolism in vitro and in vivo. We found that concomitant abrogation of metallothioneins 1 and 2 results in activation of the Akt pathway and increases in myotube size, in type IIb fiber hypertrophy, and ultimately in muscle strength. Importantly, the beneficial effects of metallothionein blockade on muscle mass and function was also observed in the setting of glucocorticoid addition, which is a strong atrophy-inducing stimulus. Given the blockade of atrophy and the preservation of strength in atrophy-inducing settings, these results suggest that blockade of metallothioneins 1 and 2 constitutes a promising approach for the treatment of conditions which result in muscle atrophy. PMID:27956698

  9. Conformational Occlusion of Blockade Antibody Epitopes, a Novel Mechanism of GII.4 Human Norovirus Immune Evasion.

    Science.gov (United States)

    Lindesmith, Lisa C; Mallory, Michael L; Debbink, Kari; Donaldson, Eric F; Brewer-Jensen, Paul D; Swann, Excel W; Sheahan, Timothy P; Graham, Rachel L; Beltramello, Martina; Corti, Davide; Lanzavecchia, Antonio; Baric, Ralph S

    2018-01-01

    Extensive antigenic diversity within the GII.4 genotype of human norovirus is a major driver of pandemic emergence and a significant obstacle to development of cross-protective immunity after natural infection and vaccination. However, human and mouse monoclonal antibody studies indicate that, although rare, antibodies to conserved GII.4 blockade epitopes are generated. The mechanisms by which these epitopes evade immune surveillance are uncertain. Here, we developed a new approach for identifying conserved GII.4 norovirus epitopes. Utilizing a unique set of virus-like particles (VLPs) representing the in vivo -evolved sequence diversity within an immunocompromised person, we identify key residues within epitope F, a conserved GII.4 blockade antibody epitope. The residues critical for antibody binding are proximal to evolving blockade epitope E. Like epitope F, antibody blockade of epitope E was temperature sensitive, indicating that particle conformation regulates antibody access not only to the conserved GII.4 blockade epitope F but also to the evolving epitope E. These data highlight novel GII.4 mechanisms to protect blockade antibody epitopes, map essential residues of a GII.4 conserved epitope, and expand our understanding of how viral particle dynamics may drive antigenicity and antibody-mediated protection by effectively shielding blockade epitopes. Our data support the notion that GII.4 particle breathing may well represent a major mechanism of humoral immune evasion supporting cyclic pandemic virus persistence and spread in human populations. IMPORTANCE In this study, we use norovirus virus-like particles to identify key residues of a conserved GII.4 blockade antibody epitope. Further, we identify an additional GII.4 blockade antibody epitope to be occluded, with antibody access governed by temperature and particle dynamics. These findings provide additional support for particle conformation-based presentation of binding residues mediated by a particle

  10. Zeeman splitting spin filter in a single quantum dot electron transport with Coulomb blockade effect

    OpenAIRE

    Lai, Wenxi

    2014-01-01

    Electron spin filter induced by Zeeman splitting in a few-electron quantum dot coupled to two normal electrodes is studied considering Coulomb blockade effect. Based on the Anderson model and Liouville-von Neumann equation, equation of motion of the system is derived and analytical solutions are achieved. Transport windows for perfectly polarized current, partially polarized current and non-polarized current induced by the Zeeman splitting energy and Coulomb blockade potential are exploited. ...

  11. Dual Blockade of the Renin-angiotensin-aldosterone System in Type 2 Diabetic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Yan-Huan Feng

    2016-01-01

    Full Text Available Objective: To examine the efficacy and safety of dual blockade of the renin-angiotensin-aldosterone system (RAAS among patients with type 2 diabetic kidney disease. Data Sources: We searched the major literature repositories, including the Cochrane Central Register of Controlled Trials, MEDLINE and EMBASE, for randomized clinical trials published between January 1990 and October 2015 that compared the efficacy and safety of the use of dual blockade of the RAAS versus the use of monotherapy, without applying any language restrictions. Keywords for the searches included "diabetic nephropathy," "chronic kidney disease," "chronic renal insufficiency," "diabetes mellitus," "dual therapy," "combined therapy," "dual blockade," "renin-angiotensin system," "angiotensin-converting enzyme inhibitor," "angiotensin-receptor blocker," "aldosterone blockade," "selective aldosterone blockade," "renin inhibitor," "direct renin inhibitor," "mineralocorticoid receptor blocker," etc. Study Selection: The selected articles were carefully reviewed. We excluded randomized clinical trials in which the kidney damage of patients was related to diseases other than diabetes mellitus. Results: Combination treatment with an angiotensin-converting enzyme inhibitor supplemented by an angiotensin II receptor blocking agent is expected to provide a more complete blockade of the RAAS and a better control of hypertension. However, existing literature has presented mixed results, in particular, related to patient safety. In view of this, we conducted a comprehensive literature review in order to explain the rationale for dual blockade of the RAAS, and to discuss the pros and cons. Conclusions: Despite the negative results of some recent large-scale studies, it may be immature to declare that the dual blockade is a failure because of the complex nature of the RAAS surrounding its diversified functions and utility. Further trials are warranted to study the combination therapy as an

  12. Why CCR2 and CCR5 blockade failed and why CCR1 blockade might still be effective in the treatment of rheumatoid arthritis

    OpenAIRE

    Lebre, M.C.; Vergunst, C.E.; Choi, I.Y.K.; Aarrass, S.; Oliveira, A.S.F.; Wyant, T.; Horuk, R.; Reedquist, K.A.; Tak, P.P.

    2011-01-01

    BACKGROUND: The aim of this study was to provide more insight into the question as to why blockade of CCR1, CCR2, and CCR5 may have failed in clinical trials in rheumatoid arthritis (RA) patients, using an in vitro monocyte migration system model. METHODOLOGY/PRINCIPAL FINDINGS: Monocytes from healthy donors (HD; n = 8) or from RA patients (for CCR2 and CCR5 antibody n = 8; for CCR1 blockade n = 13) were isolated from peripheral blood and pre-incubated with different concentrations of either ...

  13. Coulomb blockade and transfer of electrons one by one

    International Nuclear Information System (INIS)

    Pothier, Hugues

    1991-01-01

    Zero point fluctuations of the charge on the capacitance of a tunnel junction connected to a bias circuit are in almost all experimental situations larger than the electron charge. As a consequence, the effects of charge granularity are hidden, but in circuits with 'islands', which are electrodes connected to the rest of the circuit only through tunnel junctions and capacitors. The island charge being quantized, its fluctuations are blocked. If the island capacitance is sufficiently small, no electron can enter the island because of the increase of electrostatic energy that would occur. We have observed this effect, called 'Coulomb blockade', in the 'single electron box', where an island is formed between a tunnel junction and a capacitor. A bias voltage source coupled to the island through the capacitor allows to control the number of electrons. We have designed and operated two devices with nano-scale tunnel junctions based on this principle, the 'turnstile' and the 'pump', through which the current is controlled electron by electron. In our experiments, the precision of the transfer is of the order of one percent. It should be a million time better in versions of these devices with more junctions. One could then use them for a new measurement of the fine structure constant alpha. (author) [fr

  14. Mefloquine gap junction blockade and risk of pregnancy loss.

    Science.gov (United States)

    Nevin, Remington Lee

    2012-09-01

    Obstetric use of the antimalarial drug mefloquine has historically been discouraged during the first trimester and immediately before conception owing to concerns of potential fetal harm. With the rise of resistance to the antimalarial drug sulfadoxine-pyrimethamine (SP), mefloquine is now being considered as a replacement for SP for universal antenatal administration to women from malaria-endemic regions. Recent recommendations have also suggested that mefloquine may be used cautiously among pregnant travelers who cannot otherwise avoid visiting these areas. Mefloquine has been demonstrated to cause blockade of gap junction protein alpha 1 (GJA1) gap junction intercellular communication (GJIC), and recent evidence suggests that GJA1 GJIC is critical to successful embryonic implantation and early placental development. During routine use, mefloquine accumulates in organ and peripheral tissue, crosses the blood-placental barrier, and may plausibly accumulate in developing decidua and trophoblast at concentrations sufficient to interfere with GJA1 GJIC and, thus, cause deleterious effects on fetal outcomes. This conclusion is supported by epidemiological evidence that demonstrates use of the drug during early development is associated with an increased risk of miscarriage and stillbirth. Confirmatory studies are pending, but the available experimental and epidemiological evidence support renewed adherence, where feasible, to existing mefloquine package insert guidance that women avoid the drug during the periconceptional period.

  15. Immune-Checkpoint Blockade and Active Immunotherapy for Glioma

    Directory of Open Access Journals (Sweden)

    Brian J. Ahn

    2013-11-01

    Full Text Available Cancer immunotherapy has made tremendous progress, including promising results in patients with malignant gliomas. Nonetheless, the immunological microenvironment of the brain and tumors arising therein is still believed to be suboptimal for sufficient antitumor immune responses for a variety of reasons, including the operation of “immune-checkpoint” mechanisms. While these mechanisms prevent autoimmunity in physiological conditions, malignant tumors, including brain tumors, actively employ these mechanisms to evade from immunological attacks. Development of agents designed to unblock these checkpoint steps is currently one of the most active areas of cancer research. In this review, we summarize recent progresses in the field of brain tumor immunology with particular foci in the area of immune-checkpoint mechanisms and development of active immunotherapy strategies. In the last decade, a number of specific monoclonal antibodies designed to block immune-checkpoint mechanisms have been developed and show efficacy in other cancers, such as melanoma. On the other hand, active immunotherapy approaches, such as vaccines, have shown encouraging outcomes. We believe that development of effective immunotherapy approaches should ultimately integrate those checkpoint-blockade agents to enhance the efficacy of therapeutic approaches. With these agents available, it is going to be quite an exciting time in the field. The eventual success of immunotherapies for brain tumors will be dependent upon not only an in-depth understanding of immunology behind the brain and brain tumors, but also collaboration and teamwork for the development of novel trials that address multiple layers of immunological challenges in gliomas.

  16. Immune-Checkpoint Blockade and Active Immunotherapy for Glioma

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Brian J. [Department of Immunology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213 (United States); Brain Tumor Program, University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Pollack, Ian F. [Brain Tumor Program, University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Neurological Surgery, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213 (United States); Okada, Hideho, E-mail: okadah@upmc.edu [Department of Immunology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213 (United States); Brain Tumor Program, University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Neurological Surgery, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213 (United States); Department of Surgery, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213 (United States)

    2013-11-01

    Cancer immunotherapy has made tremendous progress, including promising results in patients with malignant gliomas. Nonetheless, the immunological microenvironment of the brain and tumors arising therein is still believed to be suboptimal for sufficient antitumor immune responses for a variety of reasons, including the operation of “immune-checkpoint” mechanisms. While these mechanisms prevent autoimmunity in physiological conditions, malignant tumors, including brain tumors, actively employ these mechanisms to evade from immunological attacks. Development of agents designed to unblock these checkpoint steps is currently one of the most active areas of cancer research. In this review, we summarize recent progresses in the field of brain tumor immunology with particular foci in the area of immune-checkpoint mechanisms and development of active immunotherapy strategies. In the last decade, a number of specific monoclonal antibodies designed to block immune-checkpoint mechanisms have been developed and show efficacy in other cancers, such as melanoma. On the other hand, active immunotherapy approaches, such as vaccines, have shown encouraging outcomes. We believe that development of effective immunotherapy approaches should ultimately integrate those checkpoint-blockade agents to enhance the efficacy of therapeutic approaches. With these agents available, it is going to be quite an exciting time in the field. The eventual success of immunotherapies for brain tumors will be dependent upon not only an in-depth understanding of immunology behind the brain and brain tumors, but also collaboration and teamwork for the development of novel trials that address multiple layers of immunological challenges in gliomas.

  17. Immune-Checkpoint Blockade and Active Immunotherapy for Glioma

    International Nuclear Information System (INIS)

    Ahn, Brian J.; Pollack, Ian F.; Okada, Hideho

    2013-01-01

    Cancer immunotherapy has made tremendous progress, including promising results in patients with malignant gliomas. Nonetheless, the immunological microenvironment of the brain and tumors arising therein is still believed to be suboptimal for sufficient antitumor immune responses for a variety of reasons, including the operation of “immune-checkpoint” mechanisms. While these mechanisms prevent autoimmunity in physiological conditions, malignant tumors, including brain tumors, actively employ these mechanisms to evade from immunological attacks. Development of agents designed to unblock these checkpoint steps is currently one of the most active areas of cancer research. In this review, we summarize recent progresses in the field of brain tumor immunology with particular foci in the area of immune-checkpoint mechanisms and development of active immunotherapy strategies. In the last decade, a number of specific monoclonal antibodies designed to block immune-checkpoint mechanisms have been developed and show efficacy in other cancers, such as melanoma. On the other hand, active immunotherapy approaches, such as vaccines, have shown encouraging outcomes. We believe that development of effective immunotherapy approaches should ultimately integrate those checkpoint-blockade agents to enhance the efficacy of therapeutic approaches. With these agents available, it is going to be quite an exciting time in the field. The eventual success of immunotherapies for brain tumors will be dependent upon not only an in-depth understanding of immunology behind the brain and brain tumors, but also collaboration and teamwork for the development of novel trials that address multiple layers of immunological challenges in gliomas

  18. Selective Blockade of Periostin Exon 17 Preserves Cardiac Performance in Acute Myocardial Infarction.

    Science.gov (United States)

    Taniyama, Yoshiaki; Katsuragi, Naruto; Sanada, Fumihiro; Azuma, Junya; Iekushi, Kazuma; Koibuchi, Nobutaka; Okayama, Keita; Ikeda-Iwabu, Yuka; Muratsu, Jun; Otsu, Rei; Rakugi, Hiromi; Morishita, Ryuichi

    2016-02-01

    We previously reported that overexpression of full-length periostin, Pn-1, resulted in ventricular dilation with enhanced interstitial collagen deposition in a rat model. However, other reports have documented that the short-form splice variants Pn-2 (lacking exon 17) and Pn-4 (lacking exons 17 and 21) promoted cardiac repair by angiogenesis and prevented cardiac rupture after acute myocardial infarction. The apparently differing findings from those reports prompted us to use a neutralizing antibody to selectively inhibit Pn-1 by blockade of exon 17 in a rat acute myocardial infarction model. Administration of Pn neutralizing antibody resulted in a significant decrease in the infarcted and fibrotic areas of the myocardium, which prevented ventricular wall thinning and dilatation. The inhibition of fibrosis by Pn neutralizing antibody was associated with a significant decrease in gene expression of fibrotic markers, including collagen I, collagen III, and transforming growth factor-β1. Importantly, the number of α-smooth muscle actin-positive myofibroblasts was significantly reduced in the hearts of animals treated with Pn neutralizing antibody, whereas cardiomyocyte proliferation and angiogenesis were comparable in the IgG and neutralizing antibody groups. Moreover, the level of Pn-1 expression was significantly correlated with the severity of myocardial infarction. In addition, Pn-1, but not Pn-2 or Pn-4, inhibited fibroblast and myocyte attachment, which might account for the cell slippage observed during cardiac remodeling. Collectively, these results indicate that therapeutics that specifically inhibit Pn exon-17, via a neutralizing antibody or drug, without suppressing other periostin variants might offer a new class of medication for the treatment of acute myocardial infarction patients. © 2015 American Heart Association, Inc.

  19. Association of the pattern of use of perioperative β-blockade and postoperative mortality.

    Science.gov (United States)

    Wallace, Arthur W; Au, Selwyn; Cason, Brian A

    2010-10-01

    The 1996 atenolol study provided evidence that perioperative β-adrenergic receptor blockade (β-blockade) reduced postsurgical mortality. In 1998, the indications for perioperative β-blockade were codified as the Perioperative Cardiac Risk Reduction protocol and implemented at the San Francisco Veterans Administration Medical Center, San Francisco, California. The present study analyzed the association of the pattern of use of perioperative β-blockade with perioperative mortality since introduction of the Perioperative Cardiac Risk Reduction protocol. Epidemiologic analysis of the operations undertaken since 1996 at the San Francisco Veterans Administration Medical Center was performed. The pattern of use of perioperative β-blockade was divided into four groups: None, Addition, Withdrawal, and Continuous. Logistic regression, survival analysis, and propensity analysis were performed. A total of 38,779 operations were performed between 1996 and 2008. In patients meeting Perioperative Cardiac Risk Reduction indications for perioperative β-blockade, Addition is associated with a reduction in 30-day (odds ratio [OR], 0.52; 95% confidence interval [CI], 0.33 to 0.83; P = 0.006) and 1-yr mortality (OR, 0.64; 95%, CI 0.51 to 0.79; P < 0.0001). Continuous is associated with a reduction in 30-day (OR, 0.68; 95% CI, 0.47 to 0.98; P = 0.04) and 1-yr mortality (OR, 0.82; 95% CI, 0.67 to 1.0; P = 0.05). Withdrawal is associated with an increase in 30-day (OR 3.93, 95% CI, 2.57 to 6.01; P less than 0.0001) and 1-yr mortality (OR, 1.96; 95% CI, 1.49 to 2.58; P < 0.0001). Perioperative β-blockade administered according to the Perioperative Cardiac Risk Reduction protocol is associated with a reduction in 30-day and 1-yr mortality. Perioperative withdrawal of β-blockers is associated with increased mortality.

  20. NGF blockade at early times during bone cancer development attenuates bone destruction and increases limb use.

    Science.gov (United States)

    McCaffrey, Gwen; Thompson, Michelle L; Majuta, Lisa; Fealk, Michelle N; Chartier, Stephane; Longo, Geraldine; Mantyh, Patrick W

    2014-12-01

    Studies in animals and humans show that blockade of nerve growth factor (NGF) attenuates both malignant and nonmalignant skeletal pain. While reduction of pain is important, a largely unanswered question is what other benefits NGF blockade might confer in patients with bone cancer. Using a mouse graft model of bone sarcoma, we demonstrate that early treatment with an NGF antibody reduced tumor-induced bone destruction, delayed time to bone fracture, and increased the use of the tumor-bearing limb. Consistent with animal studies in osteoarthritis and head and neck cancer, early blockade of NGF reduced weight loss in mice with bone sarcoma. In terms of the extent and time course of pain relief, NGF blockade also reduced pain 40% to 70%, depending on the metric assessed. Importantly, this analgesic effect was maintained even in animals with late-stage disease. Our results suggest that NGF blockade immediately upon detection of tumor metastasis to bone may help preserve the integrity and use, delay the time to tumor-induced bone fracture, and maintain body weight. ©2014 American Association for Cancer Research.

  1. Evaluation of epidural blockade as therapy for patients with sciatica secondary to lumbar disc herniation

    Directory of Open Access Journals (Sweden)

    Rogerio Carlos Sanfelice Nunes

    2016-08-01

    Full Text Available ABSTRACT OBJECTIVE: Sciatic pain secondary to lumbar disc herniation is a complex condition that is often highly limiting. The causes of pain in disc herniation are multifactorial. Two physiopathological mechanisms are involved in discogenic pain: mechanical deformation of nerve roots and a biochemical inflammatory component resulting from contact between the intervertebral disc and neural tissue, by way of the nucleus pulposus. The aim of this study was to evaluate the efficacy and safety of epidural blockade as therapy for bulging lumbar disc herniation. METHODS: A clinical study was conducted based on a retrospective and prospective survey. The blockade consisted of interlaminar puncture and bolus drug delivery. The number of procedures varied according to the clinical response, as determined through weekly evaluations and then 30, 90, and 180 days after the final session. A total of 124 patients who received one to five blockades were evaluated. RESULTS: The success rate (defining success as a reduction in sciatic pain of at least 80% was 75.8%. CONCLUSION: The results demonstrated the therapeutic action of epidural blockade over the short term, i.e. in cases of acute pain, thus showing that intense and excruciating sciatic pain can be relieved through this technique. Because of the multifactorial genesis of sciatica and the difficulties encountered by healthcare professionals in treating this condition, epidural blockade can become part of therapeutic arsenal available. This procedure is situated between conservative treatment with an eminently clinical focus and surgical approaches.

  2. Profile of sugammadex for reversal of neuromuscular blockade in the elderly: current perspectives.

    Science.gov (United States)

    Carron, Michele; Bertoncello, Francesco; Ieppariello, Giovanna

    2018-01-01

    The number of elderly patients is increasing worldwide. This will have a significant impact on the practice of anesthesia in future decades. Anesthesiologists must provide care for an increasing number of elderly patients, who have an elevated risk of perioperative morbidity and mortality. Complications related to postoperative residual neuromuscular blockade, such as muscle weakness, airway obstruction, hypoxemia, atelectasis, pneumonia, and acute respiratory failure, are more frequent in older than in younger patients. Therefore, neuromuscular blockade in the elderly should be carefully monitored and completely reversed before awakening patients at the end of anesthesia. Acetylcholinesterase inhibitors are traditionally used for reversal of neuromuscular blockade. Although the risk of residual neuromuscular blockade is reduced by reversal with neostigmine, it continues to complicate the postoperative course. Sugammadex represents an innovative approach to reversal of neuromuscular blockade induced by aminosteroid neuromuscular-blocking agents, particularly rocuronium, with useful applications in clinical practice. However, aging is associated with certain changes in the pharmacokinetics of sugammadex, and to date there has been no thorough evaluation of the use of sugammadex in elderly patients. The aim of this review was to perform an analysis of the use of sugammadex in older adults based on the current literature. Major issues surrounding the physiologic and pharmacologic effects of aging in elderly patients and how these may impact the routine use of sugammadex in elderly patients are discussed.

  3. Improvement of Chicken Primordial Germ Cell Maintenance In Vitro by Blockade of the Aryl Hydrocarbon Receptor Endogenous Activity.

    Science.gov (United States)

    Pérez Sáez, Juan M; Bussmann, Leonardo E; Barañao, J Lino; Bussmann, Ursula A

    2016-06-01

    Primordial germ cells (PGCs) are the undifferentiated progenitors of gametes. Germline competent PGCs can be developed as a cell-based system for genetic modification in chickens, which provides a valuable tool for transgenic technology with both research and industrial applications. This implies manipulation of PGCs, which, in recent years, encouraged a lot of research focused on the study of PGCs and the way of improving their culture. The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that besides mediating toxic responses to environmental contaminants plays pivotal physiological roles in various biological processes. Since a novel compound that acts as an antagonist of this receptor has been reported to promote expansion of hematopoietic stem cells, we conducted the present study with the aim of determining whether addition of an established AHR antagonist to the standard culture medium used nowadays for in vitro chicken PGCs culture improves ex vivo expansion. We have found that addition of α-naphthoflavone in culture medium promotes the amplification of undifferentiated cells and that this effect is exerted by the blockade of AHR action. Our results constitute the first report of the successful use of a readily available AHR antagonist to improve avian PGCs expansion, and they further extend the knowledge of the effects of AHR modulation in undifferentiated cells.

  4. Effect of TIM-3 Blockade on the Immunophenotype and Cytokine Profile of Murine Uterine NK Cells.

    Directory of Open Access Journals (Sweden)

    Sudipta Tripathi

    Full Text Available NK cells are the most abundant lymphocyte population in the feto-maternal interface during gestation. The uterine NK cells (uNK are transient, have a unique immunophenotype and produce a number of cytokines. These cytokines play an important role in establishment and maintenance of vascular remodeling and tolerance associated with successful pregnancy. The uNK cells also express TIM-3 during gestation and blockade of TIM-3 expression results in fetal loss in mice. In this study we determined the effect of TIM-3 blockade on uNK cells. Specifically we observed surface receptor phenotype and cytokine production by uNK cells following TIM-3 blockade. Our results show that TIM-3 plays a role in regulating the uNK cells and contributes to the maintenance of tolerance at the feto-maternal interface.

  5. Ultrasound guided intercostobrachial nerve blockade in patients with persistent pain after breast cancer surgery

    DEFF Research Database (Denmark)

    Wijayasinghe, Nelun; Duriaud, Helle M; Kehlet, Henrik

    2016-01-01

    BACKGROUND: Persistent pain after breast cancer surgery (PPBCS) affects 25 - 60% of breast cancer survivors and damage to the intercostobrachial nerve (ICBN) has been implicated as the cause of this predominantly neuropathic pain. Local anesthetic blockade of the ICBN could provide clues...... determined the sonoanatomy of the ICBN and part 2 examined effects of the ultrasound-guided ICBN blockade in patients with PPBCS. SETTING: Section for Surgical Pathophysiology at Rigshospitalet, Copenhagen, Denmark. METHODS: Part 1: Sixteen unoperated, pain free breast cancer patients underwent systematic...... to pathophysiological mechanisms as well as aiding diagnosis and treatment of PPBCS but has never been attempted. OBJECTIVES: To assess the feasibility of ICBN blockade and assess its effects on pain and sensory function in patients with PPBCS. STUDY DESIGN: This prospective pilot study was performed in 2 parts: Part 1...

  6. The effect of beta-adrenoceptor antagonists on the alpha-adrenoceptor blockade produced by phenoxybenzamine.

    Science.gov (United States)

    Sankaranarayanan, A; Sharma, P L

    1977-05-01

    The effect of beta-adrenoceptor antagonists on the irreversible alpha-adrenoceptor blockade produced by phenoxybenzamine was studied in dogs. The pressor effects of adrenaline were revived after the inhibition by the alpha-receptor block by (+/-) propranolol, (-) INPEA, (+/-) MJ 1999 and (+/-) butoxamine. The enantiomers (+) propranolol and (+) INPEA were ineffective in this regard. (+/-) Practolol also did not revive the pressor effect of the amines. The alpha-receptor mediated effect of the amines, in the nictitating membrana-receptor blockade. It is concluded that (1) blockade of the peripheral (beta-2) receptors is essential for the revival of the pressor effects, (2) local anesthetic effect of the beta-antagonists is not involved. Further work using a series of doses of agonists and antagonists of alpha-and beta-receptors is indicated to clarify the nature of this drug-interaction.

  7. Ultrasound Guided Intercostobrachial Nerve Blockade in Patients with Persistent Pain after Breast Cancer Surgery

    DEFF Research Database (Denmark)

    Wijayasinghe, Nelun; Duriaud, Helle M; Kehlet, Henrik

    2016-01-01

    to pathophysiological mechanisms as well as aiding diagnosis and treatment of PPBCS but has never been attempted. OBJECTIVES: To assess the feasibility of ICBN blockade and assess its effects on pain and sensory function in patients with PPBCS. STUDY DESIGN: This prospective pilot study was performed in 2 parts: Part 1......BACKGROUND: Persistent pain after breast cancer surgery (PPBCS) affects 25 - 60% of breast cancer survivors and damage to the intercostobrachial nerve (ICBN) has been implicated as the cause of this predominantly neuropathic pain. Local anesthetic blockade of the ICBN could provide clues...... determined the sonoanatomy of the ICBN and part 2 examined effects of the ultrasound-guided ICBN blockade in patients with PPBCS. SETTING: Section for Surgical Pathophysiology at Rigshospitalet, Copenhagen, Denmark. METHODS: Part 1: Sixteen unoperated, pain free breast cancer patients underwent systematic...

  8. Current hot spot in the spin-valley blockade in carbon nanotubes

    Science.gov (United States)

    Széchenyi, Gábor; Pályi, András

    2013-12-01

    We present a theoretical study of the spin-valley blockade transport effect in a double quantum dot defined in a straight carbon nanotube. We find that intervalley scattering due to short-range impurities completely lifts the spin-valley blockade and induces a large leakage current in a certain confined range of the external magnetic field vector. This current hot spot emerges due to different effective magnetic fields acting on the spin-valley qubit states of the two quantum dots. Our predictions are compared to a recent measurement [F. Pei , Nat. Nanotech.1748-338710.1038/nnano.2012.160 7, 630 (2012)]. We discuss the implications for blockade-based schemes for qubit initialization/readout and motion sensing of nanotube-based mechanical resonators.

  9. Endothelin-A receptor blockade slows the progression of renal injury in experimental renovascular disease.

    Science.gov (United States)

    Kelsen, Silvia; Hall, John E; Chade, Alejandro R

    2011-07-01

    Endothelin (ET)-1, a potent renal vasoconstrictor with mitogenic properties, is upregulated by ischemia and has been shown to induce renal injury via the ET-A receptor. The potential role of ET-A blockade in chronic renovascular disease (RVD) has not, to our knowledge, been previously reported. We hypothesized that chronic ET-A receptor blockade would preserve renal hemodynamics and slow the progression of injury of the stenotic kidney in experimental RVD. Renal artery stenosis, a major cause of chronic RVD, was induced in 14 pigs and observed for 6 wk. In half of the pigs, chronic ET-A blockade was initiated (RVD+ET-A, 0.75 mg·kg(-1)·day(-1)) at the onset of RVD. Single-kidney renal blood flow, glomerular filtration rate, and perfusion were quantified in vivo after 6 wk using multidetector computer tomography. Renal microvascular density was quantified ex vivo using three-dimensional microcomputer tomography, and growth factors, inflammation, apoptosis, and fibrosis were determined in renal tissue. The degree of stenosis and increase in blood pressure were similar in RVD and RVD+ET-A pigs. Renal hemodynamics, function, and microvascular density were decreased in the stenotic kidney but preserved by ET-A blockade, accompanied by increased renal expression of vascular endothelial growth factor, hepatocyte growth factor, and downstream mediators such as phosphorilated-Akt, angiopoietins, and endothelial nitric oxide synthase. ET-A blockade also reduced renal apoptosis, inflammation, and glomerulosclerosis. This study shows that ET-A blockade slows the progression of renal injury in experimental RVD and preserves renal hemodynamics, function, and microvascular density in the stenotic kidney. These results support a role for ET-1/ET-A as a potential therapeutic target in chronic RVD.

  10. Intralipid Therapy for Inadvertent Peripheral Nervous System Blockade Resulting from Local Anesthetic Overdose

    Directory of Open Access Journals (Sweden)

    Ihab Kamel

    2015-01-01

    Full Text Available Although local anesthetics have an acceptable safety profile, significant morbidity and mortality have been associated with their use. Inadvertent intravascular injection of local anesthetics and/or the use of excessive doses have been the most frequent causes of local anesthetic systemic toxicity (LAST. Furthermore, excessive doses of local anesthetics injected locally into the tissues may lead to inadvertent peripheral nerve infiltration and blockade. Successful treatment of LAST with intralipid has been reported. We describe a case of local anesthetic overdose that resulted in LAST and in unintentional blockade of peripheral nerves of the lower extremity; both effects completely resolved with administration of intralipid.

  11. Does renin-angiotensin system blockade have a role in preventing diabetic retinopathy? A clinical review

    DEFF Research Database (Denmark)

    Sjølie, A K; Dodson, P; Hobbs, F R R

    2011-01-01

    Diabetes management has increasingly focused on the prevention of macrovascular disease, in particular for type 2 diabetes. Diabetic retinopathy, one of the main microvascular complications of diabetes, is also an important public health problem. Much of the care invested in retinopathy relates...... the primary trial end-points were not met, there was a clear trend to less severe retinopathy with RAS blockade. A smaller trial, RASS, reported reduced retinopathy progression in type 1 diabetes from RAS blockade with both the ARB losartan and the angiotensin converting enzyme (ACE) inhibitor enalapril...

  12. Dynamical Coulomb blockade of the nonlocal conductance in normalmetal/superconductor hybrid structures

    Energy Technology Data Exchange (ETDEWEB)

    Kolenda, Stefan; Wolf, Michael J.; Beckmann, Detlef [Institut fuer Nanotechnologie, KIT, 76021 Karlsruhe (Germany)

    2013-07-01

    In normalmetal/superconductor hybrid structures nonlocal conductance is determined by crossed Andreev reflection (CAR) and elastic cotunneling (EC). This was investigated recently both experimentally and theoretically. Dynamical Coulomb blockade of EC and CAR was predicted theoretically. Here we report on experimental investigations of these effects. We found signatures of dynamical Coulomb blockade in local and nonlocal conductance in the normal state. In the superconducting state, we find s-shaped nonlocal differential conductance curves as a function of bias applied on both contacts. These curves were observed for bias voltages both below and above the gap. We compare our results to theory.

  13. The effect of RAAS blockade on markers of renal tubular damage in diabetic nephropathy

    DEFF Research Database (Denmark)

    Nielsen, Stine; Rossing, Kasper; Hess, Georg

    2012-01-01

    Blockade of the renin-angiotensin-aldosterone system (RAAS) affects both the glomerulus and tubules. We aimed to investigate the effect of irbesartan on the tubular markers: urinary (u) neutrophil gelatinase associated protein (NGAL), Kidney injury molecule 1 (KIM1) and liver-fatty acid-binding p......Blockade of the renin-angiotensin-aldosterone system (RAAS) affects both the glomerulus and tubules. We aimed to investigate the effect of irbesartan on the tubular markers: urinary (u) neutrophil gelatinase associated protein (NGAL), Kidney injury molecule 1 (KIM1) and liver-fatty acid...

  14. Effect of axillary blockade on regional cerebral blood flow during static handgrip

    DEFF Research Database (Denmark)

    Friedman, D B; Friberg, L; Mitchell, J H

    1991-01-01

    Regional cerebral blood flow (rCBF) was determined at rest and during static handgrip before and after regional blockade with lidocaine. A fast rotating single photon emission computer tomograph system with 133Xe inhalation was used at orbitomeatal plane (OM) +2.5 and +6.5 cm in eight subjects. M...... static handgrip, there was no increase in rCBF after partial sensory and motor blockade. Thus bilateral activation occurs in the premotor and motor sensory cortex during static handgrip, and this activation requires neural feedback from the contracting muscles....

  15. Influence of pudendal nerve blockade on stress relaxation in the female urethra

    DEFF Research Database (Denmark)

    Thind, P; Bagi, P; Mieszczak, C

    1996-01-01

    dilatation, P alpha and P beta are pressure decay, and tau alpha and tau beta are time constants. The time constants have previously proved independent of the way the dilatation is performed. The urethral stress relaxation obtained in 10 healthy women before and after pudendal nerve blockade was analysed...... by the mathematical model and the pressure parameters and time constants determined. The fast time constant, tau beta, was reduced by the nerve blockade, whereas tau alpha was unaffected, however, both P alpha and P beta were reduced. No single stress relaxation parameter can therefore be related to the muscle...

  16. Effect of selective blockade of oxygen consumption, glucose transport, and Ca2+ influx on thyroxine action in human mononuclear cells

    DEFF Research Database (Denmark)

    Kvetny, J; Matzen, L E

    1990-01-01

    The effect of selective blockade of cellular glucose transporters, Ca2+ influx, and mitochondrial oxygen consumption on thyroxine (T4)-stimulated oxygen consumption and glucose uptake was examined in human mononuclear blood cells. Blockade of glucose transporters by cytochalasin B (1 x 10(-5) mol...

  17. [Improvement of approach to performance of lumbar sympathetic blockade in patients with tissue ischemia of the lower extremities].

    Science.gov (United States)

    Panov, V M; Fesenko, U A; Kutsyn, V M

    2014-06-01

    New access for performance of sympathic blockade in region of aortal bifurcation, was elaborated, basing on calculations, conducted on 30 spiral computeric tomograms of lumbar and sacral parts of vertebral column. Application of the method permits to escape such complications, as a renal and the main vessels damage, the sympathetic nerves blockade, do not demand roentgenological control.

  18. Effect of adductor-canal-blockade on established, severe post-operative pain after total knee arthroplasty

    DEFF Research Database (Denmark)

    Jaeger, P; Grevstad, Ulrik; Henningsen, Maja

    2012-01-01

    In this proof-of-concept study, we investigated the effect of the predominantly sensory adductor-canal-blockade on established pain in the early post-operative period after total knee arthroplasty (TKA). We hypothesised that the adductor-canal-blockade would reduce pain during flexion of the knee...

  19. GD2-specific CAR T Cells Undergo Potent Activation and Deletion Following Antigen Encounter but can be Protected From Activation-induced Cell Death by PD-1 Blockade.

    Science.gov (United States)

    Gargett, Tessa; Yu, Wenbo; Dotti, Gianpietro; Yvon, Eric S; Christo, Susan N; Hayball, John D; Lewis, Ian D; Brenner, Malcolm K; Brown, Michael P

    2016-06-01

    Chimeric antigen receptor (CAR) T cells have shown great promise in the treatment of hematologic malignancies but more variable results in the treatment of solid tumors and the persistence and expansion of CAR T cells within patients has been identified as a key correlate of antitumor efficacy. Lack of immunological "space", functional exhaustion, and deletion have all been proposed as mechanisms that hamper CAR T-cell persistence. Here we describe the events following activation of third-generation CAR T cells specific for GD2. CAR T cells had highly potent immediate effector functions without evidence of functional exhaustion in vitro, although reduced cytokine production reversible by PD-1 blockade was observed after longer-term culture. Significant activation-induced cell death (AICD) of CAR T cells was observed after repeated antigen stimulation, and PD-1 blockade enhanced both CAR T-cell survival and promoted killing of PD-L1(+) tumor cell lines. Finally, we assessed CAR T-cell persistence in patients enrolled in the CARPETS phase 1 clinical trial of GD2-specific CAR T cells in the treatment of metastatic melanoma. Together, these data suggest that deletion also occurs in vivo and that PD-1-targeted combination therapy approaches may be useful to augment CAR T-cell efficacy and persistence in patients.

  20. Fascia iliaca compartment blockade for acute pain control in hip fracture patients

    DEFF Research Database (Denmark)

    Foss, Nicolai B; Kristensen, Billy B; Bundgaard, Morten

    2007-01-01

    Hip fracture patients are in severe pain upon arrival at the emergency department. Pain treatment is traditionally based on systemic opioids. No study has examined the effect of fascia iliaca compartment blockade (FICB) in acute hip fracture pain management within a double-blind, randomized setup....

  1. Is lumbosacral plexus blockade effective and safe for surgical anesthesia in total hip replacement?

    DEFF Research Database (Denmark)

    Nielsen, Niels Dalsgaard; Larsen, Jens Rolighed; Børglum, Jens

    had lumbosacral plexus blockade (lumbar plexus block, sacral plexus block and fascia transversalis plane block) with ropivacaine. Group 2 had continuous spinal anesthesia with repeated bupivacaine-doses. Group 3 had single-dose spinal anesthesia with bupivacaine. Hemodynamic data were recorded during...

  2. A new approach to anesthesia management in myasthenia gravis: reversal of neuromuscular blockade by sugammadex.

    NARCIS (Netherlands)

    Boer, H.D. de; Egmond, J. van; Driessen, J.J.; Booij, L.H.D.J.

    2010-01-01

    A neuromuscular blocking drug (NMBD) induced neuromuscular blockade (NMB) in patients with myasthenia gravis usually dissipates either spontaneously or by administration of neostigmine. We administered sugammadex to a patient with myasthenia gravis to reverse a rocuronium-induced profound NMB. NMBDs

  3. Photon routing in cavity QED: Beyond the fundamental limit of photon blockade

    Energy Technology Data Exchange (ETDEWEB)

    Rosenblum, Serge; Dayan, Barak [Department of Chemical Physics, Weizmann Institute of Science, Rehovot 76100 (Israel); Parkins, Scott [Department of Physics, University of Auckland, Private Bag 92019, Auckland (New Zealand)

    2011-09-15

    The most simple and seemingly straightforward application of the photon blockade effect, in which the transport of one photon prevents the transport of others, would be to separate two incoming indistinguishable photons to different output ports. We show that time-energy uncertainty relations inherently prevent this ideal situation when the blockade is implemented by a two-level system. The fundamental nature of this limit is revealed in the fact that photon blockade in the strong coupling regime of cavity QED, resulting from the nonlinearity of the Jaynes-Cummings energy level structure, exhibits efficiency and temporal behavior identical to those of photon blockade in the bad cavity regime, where the underlying nonlinearity is that of the atom itself. We demonstrate that this limit can be exceeded, yet not avoided, by exploiting time-energy entanglement between the incident photons. Finally, we show how this limit can be circumvented completely by using a three-level atom coupled to a single-sided cavity, enabling an ideal and robust photon routing mechanism.

  4. Glucose intolerance induced by blockade of central FGF receptors is linked to an acute stress response

    Directory of Open Access Journals (Sweden)

    Jennifer M. Rojas

    2015-08-01

    Conclusions: The effect of acute inhibition of central FGFR signaling to impair glucose tolerance likely involves a stress response associated with pronounced, but transient, sympathoadrenal activation and an associated reduction of insulin secretion. Whether this effect is a true consequence of FGFR blockade or involves an off-target effect of the FGFR inhibitor requires additional study.

  5. Reversal of prolonged rocuronium neuromuscular blockade with sugammadex in an obstetric patient with transverse myelitis.

    LENUS (Irish Health Repository)

    Weekes, G

    2010-07-01

    A 38-year-old wheelchair-bound primigravida with transverse myelitis presented at 38 weeks of gestation for elective caesarean section. Transverse myelitis, which is characterised by bilateral inflammation of the spinal cord and myelin destruction, is associated with myopathy, autonomic dysreflexia and pulmonary aspiration. Regional anaesthesia was contraindicated in this case as the patient had undergone two previous lumbar spinal fusion procedures. Rocuronium 1.2 mg\\/kg was used to facilitate rapid intubating conditions. The caesarean section proceeded uneventfully, but even after administration of neostigmine the patient exhibited prolonged neuromuscular blockade. After 3 h and 15 min sugammadex was obtained to reverse neuromuscular blockade; the drug was not stocked in our hospital. Sugammadex 4 mg\\/kg resulted in complete reversal of blockade after 2 min. We believe that myopathy associated with transverse myelitis led to the prolonged duration of action of rocuronium. Sugammadex is a relatively new drug with few reported side effects. In this case it was used to reverse neuromuscular blockade and prevented prolonged postoperative ventilatory support.

  6. Reversal of prolonged rocuronium neuromuscular blockade with sugammadex in an obstetric patient with transverse myelitis.

    LENUS (Irish Health Repository)

    Weekes, G

    2012-02-01

    A 38-year-old wheelchair-bound primigravida with transverse myelitis presented at 38 weeks of gestation for elective caesarean section. Transverse myelitis, which is characterised by bilateral inflammation of the spinal cord and myelin destruction, is associated with myopathy, autonomic dysreflexia and pulmonary aspiration. Regional anaesthesia was contraindicated in this case as the patient had undergone two previous lumbar spinal fusion procedures. Rocuronium 1.2 mg\\/kg was used to facilitate rapid intubating conditions. The caesarean section proceeded uneventfully, but even after administration of neostigmine the patient exhibited prolonged neuromuscular blockade. After 3 h and 15 min sugammadex was obtained to reverse neuromuscular blockade; the drug was not stocked in our hospital. Sugammadex 4 mg\\/kg resulted in complete reversal of blockade after 2 min. We believe that myopathy associated with transverse myelitis led to the prolonged duration of action of rocuronium. Sugammadex is a relatively new drug with few reported side effects. In this case it was used to reverse neuromuscular blockade and prevented prolonged postoperative ventilatory support.

  7. Blockade of KCa3.1 Attenuates Left Ventricular Remodeling after Experimental Myocardial Infarction

    Directory of Open Access Journals (Sweden)

    Chen-Hui Ju

    2015-07-01

    Full Text Available Background/Aims: After myocardial infarction (MI, cardiac fibrosis greatly contributes to left ventricular remodeling and heart failure. The intermediate-conductance calcium-activated potassium Channel (KCa3.1 has been recently proposed as an attractive target of fibrosis. The present study aimed to detect the effects of KCa3.1 blockade on ventricular remodeling following MI and its potential mechanisms. Methods: Myocardial expression of KCa3.1 was initially measured in a mouse MI model by Western blot and real time-polymerase chain reaction. Then after treatment with TRAM-34, a highly selective KCa3.1 blocker, heart function and fibrosis were evaluated by echocardiography, histology and immunohistochemistry. Furthermore, the role of KCa3.1 in neonatal mouse cardiac fibroblasts (CFs stimulated by angiotensin II (Ang II was tested. Results: Myocardium expressed high level of KCa3.1 after MI. Pharmacological blockade of KCa3.1 channel improved heart function and reduced ventricular dilation and fibrosis. Besides, a lower prevalence of myofibroblasts was found in TRAM-34 treatment group. In vitro studies KCa3.1 was up regulated in CFs induced by Ang II and suppressed by its blocker.KCa3.1 pharmacological blockade attenuated CFs proliferation, differentiation and profibrogenic genes expression and may regulating through AKT and ERK1/2 pathways. Conclusion: Blockade of KCa3.1 is able to attenuate ventricular remodeling after MI through inhibiting the pro-fibrotic effects of CFs.

  8. Postoperative shoulder pain after laparoscopic hysterectomy with deep neuromuscular blockade and low-pressure pneumoperitoneum

    DEFF Research Database (Denmark)

    Madsen, Matias Vested; Istre, Olav; Staehr-Rye, Anne K

    2016-01-01

    indicate that the use of deep neuromuscular blockade (NMB) improves surgical conditions during a low-pressure pneumoperitoneum (8 mmHg). OBJECTIVE: The aim of this study was to investigate whether low-pressure pneumoperitoneum (8 mmHg) and deep NMB (posttetanic count 0 to 1) compared with standard...

  9. Renal and cardiac function during alpha1-beta-blockade in congestive heart failure

    DEFF Research Database (Denmark)

    Heitmann, M; Davidsen, U; Stokholm, K H

    2002-01-01

    The kidney and the neurohormonal systems are essential in the pathogenesis of congestive heart failure (CHF) and the physiologic response. Routine treatment of moderate to severe CHF consists of diuretics, angiotensin-converting enzyme (ACE) inhibition and beta-blockade. The need for control...

  10. Renal and cardiac function during alpha1-beta-blockade in congestive heart failure

    DEFF Research Database (Denmark)

    Heitmann, M; Davidsen, U; Stokholm, K H

    2002-01-01

    of renal function during initiation of ACE-inhibition in patients with CHF is well known. The aim of this study was to investigate whether supplementation by a combined alpha1-beta-blockade to diuretics and ACE-inhibition might improve cardiac function without reducing renal function....

  11. Epigenetic stability of exhausted T cells limits durability of reinvigoration by PD-1 blockade.

    Science.gov (United States)

    Pauken, Kristen E; Sammons, Morgan A; Odorizzi, Pamela M; Manne, Sasikanth; Godec, Jernej; Khan, Omar; Drake, Adam M; Chen, Zeyu; Sen, Debattama R; Kurachi, Makoto; Barnitz, R Anthony; Bartman, Caroline; Bengsch, Bertram; Huang, Alexander C; Schenkel, Jason M; Vahedi, Golnaz; Haining, W Nicholas; Berger, Shelley L; Wherry, E John

    2016-12-02

    Blocking Programmed Death-1 (PD-1) can reinvigorate exhausted CD8 T cells (T EX ) and improve control of chronic infections and cancer. However, whether blocking PD-1 can reprogram T EX into durable memory T cells (T MEM ) is unclear. We found that reinvigoration of T EX in mice by PD-L1 blockade caused minimal memory development. After blockade, reinvigorated T EX became reexhausted if antigen concentration remained high and failed to become T MEM upon antigen clearance. T EX acquired an epigenetic profile distinct from that of effector T cells (T EFF ) and T MEM cells that was minimally remodeled after PD-L1 blockade. This finding suggests that T EX are a distinct lineage of CD8 T cells. Nevertheless, PD-1 pathway blockade resulted in transcriptional rewiring and reengagement of effector circuitry in the T EX epigenetic landscape. These data indicate that epigenetic fate inflexibility may limit current immunotherapies. Copyright © 2016, American Association for the Advancement of Science.

  12. Chronic blockade of angiotensin II action prevents glomerulosclerosis, but induces graft vasculopathy in experimental kidney transplantation

    NARCIS (Netherlands)

    Smit-van Oosten, A; Navis, G; Stegeman, CA; Joles, JA; Klok, PA; Kuipers, F; Tiebosch, ATMG; van Goor, H

    Long-term renin-angiotensin system blockade is beneficial in a variety of renal diseases, This study examines the long-term (34 weeks) effects of the angiotensin-converting enzyme inhibitor lisinopril and the angiotensin II receptor type I blocker L158,809 in the Fisher to Lewis rat model of chronic

  13. Single-photon blockade in a hybrid cavity-optomechanical system via third-order nonlinearity

    Science.gov (United States)

    Sarma, Bijita; Sarma, Amarendra K.

    2018-04-01

    Photon statistics in a weakly driven optomechanical cavity, with Kerr-type nonlinearity, are analyzed both analytically and numerically. The single-photon blockade effect is demonstrated via calculations of the zero-time-delay second-order correlation function g (2)(0). The analytical results obtained by solving the Schrödinger equation are in complete conformity with the results obtained through numerical solution of the quantum master equation. A systematic study on the parameter regime for observing photon blockade in the weak coupling regime is reported. The parameter regime where the photon blockade is not realizable due to the combined effect of nonlinearities owing to the optomechanical coupling and the Kerr-effect is demonstrated. The experimental feasibility with state-of-the-art device parameters is discussed and it is observed that photon blockade could be generated at the telecommunication wavelength. An elaborate analysis of the thermal effects on photon antibunching is presented. The system is found to be robust against pure dephasing-induced decoherences and thermal phonon number fluctuations.

  14. Split-dose atropine versus glycopyrrolate with neostigmine for reversal of gallamine-induced neuromuscular blockade

    DEFF Research Database (Denmark)

    Wetterslev, J; Jarnvig, I; Jørgensen, L N

    1991-01-01

    The effects of a split-dose of atropine sulphate versus a single dose of glycopyrrolate given with neostigmine for the reversal of gallamine-induced neuromuscular blockade were studied in 55 patients undergoing gynaecological surgery. The patients were randomized to receive either a single dose...

  15. Parasympathetic blockade attenuates augmented pancreatic polypeptide but not insulin secretion in Pima Indians

    DEFF Research Database (Denmark)

    de Courten, Barbora; Weyer, Christian; Stefan, Norbert

    2004-01-01

    of pancreatic polypeptide (PP), an islet hormone considered a surrogate marker of parasympathetic nervous system (PNS) drive to the pancreas. To test if hyperinsulinemia in Pima Indians is due to increased vagal input to the beta-cell, we examined the effect of PNS blockade in 17 Caucasian (aged 35 +/- 8 years...

  16. The effect of neuromuscular blockade on canine laparoscopic ovariectomy: A double-blinded, prospective clinical trial

    NARCIS (Netherlands)

    van Goethem, B.; van Nimwegen, S.A.; Akkerdaas, L.C.; Murrell, J.C.; Kirpensteijn, J.

    2012-01-01

    The Effect of Neuromuscular Blockade on Canine Laparoscopic Ovariectomy: A Double-Blinded, Prospective Clinical Trial Bart Van Goethem, Diplomate ECVS, Sebastiaan Alexander van Nimwegen, PhD, Ies Akkerdaas, DVM, Joanna Claire Murrell, BVSc., PhD, Diplomate ECVAA, and Jolle Kirpensteijn, PhD,

  17. Predictors of Pain Relieving Response to Sympathetic Blockade in Complex Regional Pain Syndrome Type 1

    NARCIS (Netherlands)

    van Eijs, F.; Geurts, J.; van Kleef, M.; Faber, C.G.; Perez, R.S.G.M.; Kessels, A.G.; van Zundert, J.

    2012-01-01

    BACKGROUND:: Sympathetic blockade with local anesthetics is used frequently in the management of complex regional pain syndrome type 1(CRPS-1), with variable degrees of success in pain relief. The current study investigated which signs or symptoms of CRPS-1 could be predictive of outcome. The

  18. Optimized surgical space during low-pressure laparoscopy with deep neuromuscular blockade

    DEFF Research Database (Denmark)

    Staehr-Rye, Anne K; Rasmussen, Lars S; Rosenberg, Jacob

    2013-01-01

    Laparoscopic cholecystectomy (LC) can be performed using low intra-abdominal pressure (<12 mmHg), but surgical conditions may not be optimal. The present study aimed at comparing surgical space conditions using either deep, continuous muscle relaxation or moderate blockade during low-pressure (8 ...

  19. Peripheral cannabinoid 1 receptor blockade activates brown adipose tissue and diminishes dyslipidemia and obesity

    NARCIS (Netherlands)

    Boon, M.R.; Kooijman, S.; Dam, A.D. van; Pelgrom, L.R.; Berbée, J.F.P.; Visseren, C.A.R.; Aggele, R.C. van; Hoek, A.M. van den; Sips, H.C.M.; Lombès, M.; Havekes, L.M.; Tamsma, J.T.; Guigas, B.; Meijer, O.C.; Jukema, J.W.; Rensen, P.C.N.

    2014-01-01

    The endocannabinoid system is an important player in energy metabolism by regulating appetite, lipolysis, and energy expenditure. Chronic blockade of the cannabinoid 1 receptor (CB1R) leads to long-term maintenance of weight loss and reduction of dyslipidemia in experimental and human obesity. The

  20. Reversal of neuromuscular blockade by sugammadex in laparoscopic bariatric surgery: In support of dose reduction.

    Science.gov (United States)

    Badaoui, Rachid; Cabaret, Aurélie; Alami, Youssef; Zogheib, Elie; Popov, Ivan; Lorne, Emmanuel; Dupont, Hervé

    2016-02-01

    Sugammadex is the first molecule able to antagonize steroidal muscle relaxants with few adverse effects. Doses are adjusted to body weight and the level of neuromuscular blockade. Sleeve gastrectomy is becoming a very popular form of bariatric surgery. It requires deep muscle relaxation followed by complete and rapid reversal to decrease postoperative and especially post-anaesthetic morbidity. Sugammadex is therefore particularly indicated in this setting. The objective of this study was to evaluate the deep neuromuscular blockade reversal time after administration of various doses of sugammadex (based on real weight or at lower doses). Secondary endpoints were the interval between the sugammadex injection and extubation and transfer from the operating room to the recovery room. We then investigated any complications observed in the recovery room. This pilot, prospective, observational, clinical practice evaluation study was conducted in the Amiens University Hospital. Neuromuscular blockade was induced by rocuronium. At the end of the operation, deep neuromuscular blockade was reversed by sugammadex at the dose of 4mg/kg. Sixty-four patients were included: 31 patients received sugammadex at a dosage based on their real weight (RW) and 33 patients received a lower dose (based on ideal weight [IW]). For identical rocuronium doses calculated based on IBW, sugammadex doses were significantly lower in the IW group: 349 (± 65) mg versus 508 (± 75) mg (Pneuromuscular blockade reversal took 115 (± 69) s in the IW group versus 87 (± 40) s in the RW group, but with no significant difference between the two groups (P=0.08). The intervals between injection of sugammadex and extubation (P=0.07) and transfer from the operating room to the recovery room (P=0.68) were also non-significantly longer in the IW group. The mean dose of sugammadex used by anaesthetists in the IW group was 4mg/kg of ideal weight increased by 35% to 50% (n=20; 351±34mg). No sugammadex adverse

  1. Analgesic efficacy of the ultrasound-guided blockade of the transversus abdominis plane - a systematic review

    Directory of Open Access Journals (Sweden)

    Javier Ripollés

    2015-08-01

    Full Text Available BACKGROUND: The transverse abdominal plan blockade is a block of abdominal wall that has diffused rapidly in the clinical practice as part of a multimodal analgesia for abdominal surgery. The performance of the ultrasound-guided technique has allowed the lowering of potential complications, as well as new approaches that were carried out according to the descriptions, and the prospective studies would make it possible to utilize the transverse abdominal plan blockade in different surgical interventions; however, the results obtained in randomized clinical trials are inconsistent.OBJECTIVES: To prepare a systematic review aiming to determine the efficacy of the ultrasound-guided transverse abdominal plan blockade for different surgical interventions, as well as the indications according to the approaches and their influences.METHODS: Two research approaches, one manual, and the other in Pubmed returned 28 randomized clinical trials where intervention with ultrasound-guided transverse abdominal plan blockades was performed to compare the analgesic efficacy in contrast to another technique in adults, published between 2007 and October 2013, in English or Spanish, with Jadad score > 1, according to the inclusion criteria for this review. The authors analyzed independently all the randomized clinical trials.CONCLUSIONS: The transverse abdominal plan blockades have been shown to be an effective technique in colorectal surgery, cesarean section, cholecystectomy, hysterectomy, appendectomy, donor nephrectomy, retropubic prostatectomy, and bariatric surgery. However, the data found in randomized clinical trial are not conclusive, and as a result, it is necessary to develop new and well designed randomized clinical trial, with enough statistical power to compare different approaches, drugs, doses, and volumes for the same intervention, aiming to answer the current questions and their effects in the habitual clinical practice.

  2. Analgesic efficacy of the ultrasound-guided blockade of the transversus abdominis plane - a systematic review.

    Science.gov (United States)

    Ripollés, Javier; Mezquita, Sandra Marmaña; Abad, Alfredo; Calvo, José

    2015-01-01

    The transverse abdominal plan blockade is a block of abdominal wall that has diffused rapidly in the clinical practice as part of a multimodal analgesia for abdominal surgery. The performance of the ultrasound-guided technique has allowed the lowering of potential complications, as well as new approaches that were carried out according to the descriptions, and the prospective studies would make it possible to utilize the transverse abdominal plan blockade in different surgical interventions; however, the results obtained in randomized clinical trials are inconsistent. To prepare a systematic review aiming to determine the efficacy of the ultrasound-guided transverse abdominal plan blockade for different surgical interventions, as well as the indications according to the approaches and their influences. Two research approaches, one manual, and the other in Pubmed returned 28 randomized clinical trials where intervention with ultrasound-guided transverse abdominal plan blockades was performed to compare the analgesic efficacy in contrast to another technique in adults, published between 2007 and October 2013, in English or Spanish, with Jadad score>1, according to the inclusion criteria for this review. The authors analyzed independently all the randomized clinical trials. The transverse abdominal plan blockades have been shown to be an effective technique in colorectal surgery, cesarean section, cholecystectomy, hysterectomy, appendectomy, donor nephrectomy, retropubic prostatectomy, and bariatric surgery. However, the data found in randomized clinical trial are not conclusive, and as a result, it is necessary to develop new and well designed randomized clinical trial, with enough statistical power to compare different approaches, drugs, doses, and volumes for the same intervention, aiming to answer the current questions and their effects in the habitual clinical practice. Copyright © 2014 Sociedade Brasileira de Anestesiologia. Published by Elsevier Editora Ltda

  3. The suprasacral parallel shift vs lumbar plexus blockade with ultrasound guidance in healthy volunteers - a randomised controlled trial

    DEFF Research Database (Denmark)

    Bendtsen, T F; Pedersen, E M; Haroutounian, S

    2014-01-01

    Surgical anaesthesia with haemodynamic stability and opioid-free analgesia in fragile patients can theoretically be provided with lumbosacral plexus blockade. We compared a novel ultrasound-guided suprasacral technique for blockade of the lumbar plexus and the lumbosacral trunk with ultrasound-gu...... and zero with the lumbar plexus block (p techniques are effective for blockade of the terminal nerves of the lumbar plexus. The suprasacral parallel shift technique is 50% effective for blockade of the lumbosacral trunk.......Surgical anaesthesia with haemodynamic stability and opioid-free analgesia in fragile patients can theoretically be provided with lumbosacral plexus blockade. We compared a novel ultrasound-guided suprasacral technique for blockade of the lumbar plexus and the lumbosacral trunk with ultrasound......-guided blockade of the lumbar plexus. The objective was to investigate whether the suprasacral technique is equally effective for anaesthesia of the terminal lumbar plexus nerves compared with a lumbar plexus block, and more effective for anaesthesia of the lumbosacral trunk. Twenty volunteers were included...

  4. Effects of alpha-adrenoceptor and of combined sympathetic and parasympathetic blockade on cardiac performance and vascular resistance

    DEFF Research Database (Denmark)

    Kelbaek, H; Frandsen, Henrik Lund; Hilsted, J

    1992-01-01

    . The increase in calf blood flow was of the same magnitude after combined blockade and after alpha-adrenoceptor blockade alone, and was considerably higher than the fall in systemic vascular resistance. Plasma catecholamine concentrations increased after phentolamine, but the changes were blunted when...... propranolol and atropine were added. 3. These results indicate that peripheral vasoconstriction especially that exerted by alpha-adrenoceptor nervous tone in skeletal muscle restricts left ventricular emptying of the intact heart. During pharmacologic blockade of the sympathetic and parasympathetic nervous...

  5. The effect of neuromuscular blockade on oxygen consumption in sedated and mechanically ventilated pediatric patients after cardiac surgery.

    NARCIS (Netherlands)

    Lemson, J.; Driessen, J.J.; Hoeven, J.G. van der

    2008-01-01

    OBJECTIVE: To measure the effect of intense neuromuscular blockade (NMB) on oxygen consumption (VO(2)) in deeply sedated and mechanically ventilated children on the first day after complex congenital cardiac surgery. DESIGN: Prospective clinical interventional study. SETTING: Pediatric intensive

  6. Effects of alpha-adrenoceptor and of combined sympathetic and parasympathetic blockade on cardiac performance and vascular resistance

    DEFF Research Database (Denmark)

    Kelbaek, H; Frandsen, Henrik Lund; Hilsted, J

    1992-01-01

    1. Cardiac performance and vascular resistance was studied in seven healthy men by radionuclide cardiography and venous plethysmography before and after alpha-adrenoceptor blockade with phentolamine and after combined alpha-adrenoceptor, beta-adrenoceptor (propranolol) and parasympathetic (atropine...

  7. Continuous positive airway pressure breathing increases the spread of sensory blockade after low-thoracic epidural injection of lidocaine.

    NARCIS (Netherlands)

    Visser, W.A.; Gielen, M.J.M.; Giele, J.L.P.

    2006-01-01

    Factors affecting the distribution of sensory blockade after epidural injection of local anesthetics remain incompletely clarified. To evaluate if increasing intrathoracic pressure affects the spread of thoracic epidural anesthesia, we randomized 20 patients who received an epidural catheter at the

  8. Adipocyte-specific blockade of gamma-secretase, but not inhibition of Notch activity, reduces adipose insulin sensitivity

    Directory of Open Access Journals (Sweden)

    David P. Sparling

    2016-02-01

    Conclusions: Notch signaling is dispensable for normal adipocyte function, but adipocyte-specific γ-secretase blockade reduces adipose insulin sensitivity, suggesting that specific Notch inhibitors would be preferable to GSIs for application in T2D.

  9. [Effect of 1-alpha blockader on maximal oxygen consumption and physical endurance in hypertensive men].

    Science.gov (United States)

    Tomten, S E; Nilsson, S; Kjeldsen, S E; Westheim, A S

    1996-01-10

    The effect of alpha 1 adrenoceptor blockade (doxazosin, 4 mg daily) on maximal oxygen uptake (VO2 max) and physical endurance capacity in 16 mildly hypertensive, athletic men was investigated in a randomized, placebo-controlled, double-blind, two-period of 4 weeks, cross-over study. The maximal work load obtained during graded bicycle ergometer exercise and the VO2 max were reduced by 16 +/- 3 W (mean +/- SE) and 3 +/- 1 ml x kg-1 x min-1 on doxazosin (p track increased by 43 +/- 12 sec (p < 0.05). Thus, alpha 1-blockade moderately reduces VO2 max and physical endurance capacity in mildly hypertensive athletic men. However, lower systolic blood pressure (9 +/- 4 mm Hg, p < 0.05) immediately after running, and unchanged heart rate suggest a safer performance of exercise.

  10. Ultrasonography of the adult thoracic and lumbar spine for central neuraxial blockade.

    Science.gov (United States)

    Chin, Ki Jinn; Karmakar, Manoj Kumar; Peng, Philip

    2011-06-01

    The role of ultrasound in central neuraxial blockade has been underappreciated, partly because of the relative efficacy of the landmark-guided technique and partly because of the perceived difficulty in imaging through the narrow acoustic windows produced by the bony framework of the spine. However, this also is the basis for the utility of ultrasound: an interlaminar window that permits passage of sound waves into the vertebral canal also will permit passage of a needle. In addition, ultrasound aids in identification of intervertebral levels, estimation of the depth to epidural and intrathecal spaces, and location of important landmarks, including the midline and interlaminar spaces. This can facilitate neuraxial blockade, particularly in patients with difficult surface anatomic landmarks. In this review article, the authors summarize the current literature, describe the key ultrasonographic views, and propose a systematic approach to ultrasound imaging for the performance of spinal and epidural anesthesia in the adult patient.

  11. Noninvasive lateral detection of Coulomb blockade in a quantum dot fabricated using atomic force microscopy

    Science.gov (United States)

    Nemutudi, R.; Kataoka, M.; Ford, C. J. B.; Appleyard, N. J.; Pepper, M.; Ritchie, D. A.; Jones, G. A. C.

    2004-03-01

    Atomic force microscope (AFM) lithography is used to fabricate a charge detector. Experimental results are presented showing the lateral detection of Coulomb blockade events using a narrow constriction located in close proximity to a quantum dot. Both the dot and the constriction are patterned by writing oxide lines on a semiconductor surface with a conducting tip of an AFM. On a shallow two-dimensional electron gas (2DEG), the written oxide lifts the bottom of the conduction band above the Fermi level, leaving the 2DEG depleted beneath it. With its inherent ability to draw fine lines, the AFM presents a suitable fabrication technique for noninvasive experiments in which a phenomenon, such as Coulomb blockade, can be detected without necessarily injecting current across the dot.

  12. Equivalent benefit of mTORC1 blockade and combined PI3K-mTOR blockade in a mouse model of tuberous sclerosis

    Directory of Open Access Journals (Sweden)

    Pollizzi Kristen

    2009-06-01

    Full Text Available Abstract Background Tuberous sclerosis (TSC is a hamartoma syndrome in which renal and lung tumors cause the greatest morbidity. Loss of either TSC1 or TSC2 in TSC hamartomas leads to activation of mTORC1 and suppression of AKT. Recent studies indicate that inhibition of mTORC1 with RAD001 (everolimus leads to rebound activation of AKT, which could protect tumors from drug-induced cell death. Here we examine the potential benefit of inhibition of both mTOR and AKT signaling in a mouse model of TSC, using a dual pan class I PI3K/mTOR catalytic small molecule inhibitor NVP-BEZ235. Results Using ENU to enhance Tsc2+- kidney tumor development, both RAD001 (10 mg/kg PO 5 d/week and NVP-BEZ235 (45 mg/kg PO QD had equivalent effects in suppressing tumor development during a 4 week treatment period, with a 99% reduction in tumor cell mass. Marked reduction in activation of mTORC1, induction of cell cycle arrest, and absence of apoptotic cell death was seen in mice treated with either drug. However, when either was discontinued, there was prompt recovery of tumor growth, with extensive proliferation. Conclusion Both mTORC1 blockade alone and combined PI3K-mTOR blockade lead to suppression of tumor development but not tumor elimination in this TSC model.

  13. Pelvic osteotomy under general anaesthesia combined with caudal blockade in children

    OpenAIRE

    Novotny, Milan; Rejholec, Milan

    1987-01-01

    Combined anaesthesia (Local plus General) has been used at the 1 st Clinic of Orthopaedics since 1986. A trial is described involving 21 children and comparing them with a control group of 14 cases having only inhalation anaesthesia. Caudal blockade with Bupivacaine is the local anaesthesia used to decrease stress during pelvic osteotomies. The use of combined anaesthesia provides smoothness and stability with absence of side effects and the doses of anaesthetic and post- operative analgesic ...

  14. Effect of {beta}{sub 1} adrenergic receptor blockade on myocardial blood flow and vasodilatory capacity

    Energy Technology Data Exchange (ETDEWEB)

    Boettcher, M.; Czernin, J.; Sun, K. [Univ. of California, Los Angeles, CA (United States)] [and others

    1997-03-01

    The {beta}{sub 1} receptor blockade reduces cardiac work and may thereby lower myocardial blood flow (MBF) at rest. The effect of {beta}{sub 1} receptor blockade on hyperemic MBF is unknown. To evaluate the effect of selective {beta}{sub 1} receptor blockade on MBF at rest and during dipyridamole induced hyperemia, 10 healthy volunteers (8 men, 2 women, mean age 24 {+-} 5 yr) were studied using {sup 13}N-ammonia PET (two-compartment model) under control conditions and again during metoprolol (50 mg orally 12 hr and 1 hr before the study). The resting rate pressure product (6628 {+-} 504 versus 5225 {+-} 807) and heart rate (63 {+-} 6-54 {plus_minus} 5 bpm) declined during metoprolol (p < 0.05). Similarly, heart rate and rate pressure product declined from the baseline dipyridamole study to dipyridamole plus metoprolol (p < 0.05). Resting MBF declined in proportion to cardiac work by approximately 20% from 0.61 {+-} 0.09-0.51 {+-} 0.10 ml/g/min (p < 0.05). In contrast, hyperemic MBF increased when metoprolol was added to dipyridamole (1.86 {plus_minus} 0.27 {+-} 0.45 ml/g/min; p<0.05). The decrease in resting MBF together with the increase in hyperemic MBF resulted in a significant increase in the myocardial flow reserve during metoprolol (3.14 {+-} 0.80-4.61 {+-} 0.68; p<0.01). The {beta}{sub 1} receptor blockade increases coronary vasodilatory capacity and myocardial flow reserve. However, the mechanisms accounting for this finding remain uncertain. 32 refs., 2 figs., 2 tabs.

  15. Systemic blockade of D2-like dopamine receptors facilitates extinction of conditioned fear in mice

    OpenAIRE

    Ponnusamy, Ravikumar; Nissim, Helen A.; Barad, Mark

    2005-01-01

    Extinction of conditioned fear in animals is the explicit model of behavior therapy for human anxiety disorders, including panic disorder, obsessive-compulsive disorder, and post-traumatic stress disorder. Based on previous data indicating that fear extinction in rats is blocked by quinpirole, an agonist of dopamine D2 receptors, we hypothesized that blockade of D2 receptors might facilitate extinction in mice, while agonists should block extinction, as they do in rats. One day after fear con...

  16. Blockade of store-operated calcium entry alleviates ethanol-induced hepatotoxicity via inhibiting apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Ruibing [Department of Hepatology and Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province 250012 (China); Yan, Lihui [Shandong Normal University, Jinan, Shandong Province 250012 (China); Luo, Zheng; Guo, Xiaolan [Department of Hepatology and Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province 250012 (China); Yan, Ming, E-mail: ymylh@163.com [Department of Hepatology and Gastroenterology, Qilu Hospital of Shandong University, Jinan, Shandong Province 250012 (China)

    2015-08-15

    Extracellular Ca{sup 2+} influx has been suggested to play a role in ethanol-induced hepatocyte apoptosis and necrosis. Previous studies indicated that store-operated Ca{sup 2+} entry (SOCE) was involved in liver injury induced by ethanol in HepG2 cells. However, the mechanisms underlying liver injury caused by SOCE remain unclear. We aimed to investigate the effects and mechanism of SOCE inhibition on liver injury induced by ethanol in BRL cells and Sprague–Dawley rats. Our data demonstrated that ethanol (0–400 mM) dose-dependently increased hepatocyte injury and 100 mM ethanol significantly upregulated the mRNA and protein expression of SOC for at least 72 h in BRL cells. Blockade of SOCE by pharmacological inhibitors and sh-RNA knockdown of STIM1 and Orai1 attenuated intracellular Ca{sup 2+} overload, restored the mitochondrial membrane potential (MMP), decreased cytochrome C release and inhibited ethanol-induced apoptosis. STIM1 and Orai1 expression was greater in ethanol-treated than control rats, and the SOCE inhibitor corosolic acid ameliorated the histopathological findings and alanine transaminase and aspartate transaminase activity as well as decreased cytochrome C release and inhibited alcohol-induced cell apoptosis. These findings suggest that SOCE blockade could alleviate alcohol-induced hepatotoxicity via inhibiting apoptosis. SOCE might be a useful therapeutic target in alcoholic liver diseases. - Highlights: • Blockade of SOCE alleviated overload of Ca{sup 2+} and hepatotoxicity after ethanol application. • Blockade of SOCE inhibited mitochondrial apoptosis after ethanol application. • SOCE might be a useful therapeutic target in alcoholic liver diseases.

  17. Perioperative β-blockade: atenolol is associated with reduced mortality when compared to metoprolol.

    Science.gov (United States)

    Wallace, Arthur W; Au, Selwyn; Cason, Brian A

    2011-04-01

    The Atenolol study of 1996 provided evidence that perioperative β-blockade reduced postsurgical mortality. In 1998, the indications for perioperative β-blockade were codified as the Perioperative Cardiac Risk Reduction protocol and implemented at the San Francisco Veterans Affairs Medical Center. The current study tested the following hypothesis: Is there a difference in mortality rates between patients receiving perioperative atenolol and metoprolol? Epidemiologic analysis of the operations performed at the San Francisco Veterans Affairs Medical Center since 1996 was performed. High-risk inpatients with perioperative β-blockade were divided into two groups: patients who received perioperative atenolol only and those who received metoprolol only. Patients who switched between the two chronic oral β-blocker medications were excluded. IV administration of β-blockers was ignored. Propensity matching analysis was used to correct for population differences in risk factors. There were 38,779 operations performed from 1996 to 2008, with 24,739 inpatient procedures. Based on analysis of inpatient medication use, 3,787 patients received atenolol only (1,011) or metoprolol only (2,776). Thirty-day mortality (atenolol 1% vs. metoprolol 3%, P < 0.0008) and 1-yr mortality (atenolol 7% vs. metoprolol 13%, P < 0.0001) differed between the two β-blockers. Analysis based on inpatient and outpatient β-blocker use showed a similar pattern. Propensity matching that corrected for multiple cardiac risk factors found an odds ratio (OR) of 2.1 [95% CI 1.5-2.9], P < 0.0001 for increased 1-yr mortality with metoprolol for inpatient use. Perioperative β-blockade using atenolol is associated with reduced mortality compared with metoprolol.

  18. Optimized surgical space during low-pressure laparoscopy with deep neuromuscular blockade

    DEFF Research Database (Denmark)

    Staehr-Rye, Anne K; Rasmussen, Lars S; Rosenberg, Jacob

    2013-01-01

    Laparoscopic cholecystectomy (LC) can be performed using low intra-abdominal pressure (<12 mmHg), but surgical conditions may not be optimal. The present study aimed at comparing surgical space conditions using either deep, continuous muscle relaxation or moderate blockade during low-pressure (8 ......Hg) LC. We hypothesized that a deep neuromuscular block would be associated with a higher proportion of optimal surgical space conditions....

  19. PANCREATIC DIGESTIVE ENZYME BLOCKADE IN THE SMALL INTESTINE PREVENTS INSULIN RESISTANCE IN HEMORRHAGIC SHOCK

    Science.gov (United States)

    DeLano, Frank A.; Schmid-Schönbein, Geert W.

    2013-01-01

    Hemorrhagic shock is associated with metabolic defects, including hyperglycemia and insulin resistance but the mechanisms are unknown. We recently demonstrated that reduction of the extracellular domain of the insulin receptor by degrading proteases may lead to a reduced ability to maintain normal plasma glucose values. In shock, transfer of digestive enzymes from the lumen of the intestine into the systemic circulation after breakdown of the intestinal mucosal barrier causes inflammation and organ dysfunction. Suppression of the digestive enzymes in the lumen of the intestine with protease inhibitors is effective in reducing the level of the inflammatory reactions. To determine the degree to which blockade of digestive enzymes affects insulin resistance in shock, rats were exposed to acute hemorrhagic shock (mean arterial pressure of 30 mmHg for 2 hours) at which time all shed blood volume was returned. Digestive proteases in the intestine were blocked with a serine protease inhibitor (tranexamic acid in polyethylene glycol and physiological electrolyte solution) and the density of the insulin receptor was measured with immunohistochemistry in the mesentery microcirculation. The untreated rat without enzyme blockade had significantly attenuated levels of insulin receptor density as compared to control and treated rats. Blockade of the digestive proteases after 60 min of hypotension in the lumen of the small intestine lead to a lesser decrease in insulin receptor density compared to controls without protease blockade. Glucose tolerance test indicates a significant increase in plasma glucose levels two hours after hemorrhagic shock, which are reduced to control values in the presence of protease inhibition in the lumen of the intestine. The transient reduction of the plasma glucose levels after an insulin bolus is significantly attenuated after shock, but is restored in when digestive enzymes in the lumen of the intestine are blocked. These results suggest that in

  20. CT-guided thoracic sympathetic blockade for palmar hyperhidrosis: Immediate results and postoperative quality of life.

    Science.gov (United States)

    Guo, Jian-Guo; Fei, Yong; Huang, Bing; Yao, Ming

    2016-12-01

    The purpose of this study was to evaluate the results, complications, and degree of satisfaction among patients who underwent a CT-guided percutaneous puncture thoracic sympathetic blockade. A total of 186 patients underwent CT-guided thoracic sympathetic blockade based on case histories and a prospective pre- and postoperative questionnaire survey. The study sample was composed of 93 patients with an age range from 18 to 34years and a diagnosis with primary palmar hyperhidrosis (severe in some patients). Percutaneous puncture thoracic sympathetic blockade guided by CT was performed under local anesthesia in all patients. Heart rate (HR), non-invasive blood pressure (NIBP), arterial oxygen saturation (SPO 2 ), perfusion index (PI), and palmar temperature (T) were monitored before and after treatment. Follow-up included a questionnaire on life quality and degree of satisfaction. Ten minutes after treatment, the SPO 2 , PI, and temperature all raised remarkably ([92.75±2.02]% vs. [98.85±1.09]%, [1.55±0.69]% vs. [8.60±0.94]%, [30.95±1.27]°C vs. [35.75±0.55]°C, respectively, Phyperhidrosis, 87.6% reported improvement in their quality of life. CT-guided percutaneous puncture thoracic sympathetic blockade is a safe, effective, and minimally invasive technique for the treatment of palmar hyperhidrosis. Despite the high rate of compensatory hyperhidrosis, it produces a high rate of patient satisfaction. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Genetic basis for clinical response to CTLA-4 blockade in melanoma.

    Science.gov (United States)

    Snyder, Alexandra; Makarov, Vladimir; Merghoub, Taha; Yuan, Jianda; Zaretsky, Jesse M; Desrichard, Alexis; Walsh, Logan A; Postow, Michael A; Wong, Phillip; Ho, Teresa S; Hollmann, Travis J; Bruggeman, Cameron; Kannan, Kasthuri; Li, Yanyun; Elipenahli, Ceyhan; Liu, Cailian; Harbison, Christopher T; Wang, Lisu; Ribas, Antoni; Wolchok, Jedd D; Chan, Timothy A

    2014-12-04

    Immune checkpoint inhibitors are effective cancer treatments, but molecular determinants of clinical benefit are unknown. Ipilimumab and tremelimumab are antibodies against cytotoxic T-lymphocyte antigen 4 (CTLA-4). Anti-CTLA-4 treatment prolongs overall survival in patients with melanoma. CTLA-4 blockade activates T cells and enables them to destroy tumor cells. We obtained tumor tissue from patients with melanoma who were treated with ipilimumab or tremelimumab. Whole-exome sequencing was performed on tumors and matched blood samples. Somatic mutations and candidate neoantigens generated from these mutations were characterized. Neoantigen peptides were tested for the ability to activate lymphocytes from ipilimumab-treated patients. Malignant melanoma exomes from 64 patients treated with CTLA-4 blockade were characterized with the use of massively parallel sequencing. A discovery set consisted of 11 patients who derived a long-term clinical benefit and 14 patients who derived a minimal benefit or no benefit. Mutational load was associated with the degree of clinical benefit (P=0.01) but alone was not sufficient to predict benefit. Using genomewide somatic neoepitope analysis and patient-specific HLA typing, we identified candidate tumor neoantigens for each patient. We elucidated a neoantigen landscape that is specifically present in tumors with a strong response to CTLA-4 blockade. We validated this signature in a second set of 39 patients with melanoma who were treated with anti-CTLA-4 antibodies. Predicted neoantigens activated T cells from the patients treated with ipilimumab. These findings define a genetic basis for benefit from CTLA-4 blockade in melanoma and provide a rationale for examining exomes of patients for whom anti-CTLA-4 agents are being considered. (Funded by the Frederick Adler Fund and others.).

  2. Coulomb Blockade Anisotropic Magnetoresistance Effect in a (Ga,Mn)As Single-Electron Transistor

    Czech Academy of Sciences Publication Activity Database

    Wunderlich, J.; Jungwirth, Tomáš; Kaestner, B.; Irvine, A.C.; Shick, Alexander; Stone, N.; Wang, K. Y.; Rana, U.; Giddings, A.D.; Foxon, C. T.; Campion, R. P.; Williams, D.A.; Gallagher, B. L.

    2006-01-01

    Roč. 97, č. 7 (2006), 077201/1-077201/4 ISSN 0031-9007 R&D Projects: GA ČR GA202/05/0575; GA MŠk LC510 Grant - others:EPSRC(GB) GR/S81407/01 Institutional research plan: CEZ:AV0Z10100521 Keywords : anisotropic magnetoresistance * Coulomb blockade * single electron transistor Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.072, year: 2006

  3. BLOCKADE OF CENTRAL NICOTINE ACETYLCHOLINE RECEPTOR SIGNALING ATTENUATE GHRELIN-INDUCED FOOD INTAKE IN RODENTS

    OpenAIRE

    Dickson, S.L.; Hrabovszky, E.; Hansson, C.; Jerlhag, E.; Alvarez-Crespo, M.; Skibicka, K.P.; Molnar, C.S.; Liposits, Z.; Engel, J.A.; Egecioglu, E.

    2010-01-01

    Here we sought to determine whether ghrelin's central effects on food intake can be interrupted by nicotinic cholinergic receptor (nAChR) blockade. Ghrelin regulates mesolimbic dopamine neurons projecting from the ventral tegmental area (VTA) to the nucleus accumbens (NAcc), partly via cholinergic VTA afferents originating in the laterodorsal tegmental area (LDTg). Given that these cholinergic projections to the VTA have been implicated in natural as well as drug-induced reinforcement, we sou...

  4. Differential Immune Microenvironments and Response to Immune Checkpoint Blockade among Molecular Subtypes of Murine Medulloblastoma.

    Science.gov (United States)

    Pham, Christina D; Flores, Catherine; Yang, Changlin; Pinheiro, Elaine M; Yearley, Jennifer H; Sayour, Elias J; Pei, Yanxin; Moore, Colin; McLendon, Roger E; Huang, Jianping; Sampson, John H; Wechsler-Reya, Robert; Mitchell, Duane A

    2016-02-01

    Despite significant strides in the identification and characterization of potential therapeutic targets for medulloblastoma, the role of the immune system and its interplay with the tumor microenvironment within these tumors are poorly understood. To address this, we adapted two syngeneic animal models of human Sonic Hedgehog (SHH)-driven and group 3 medulloblastoma for preclinical evaluation in immunocompetent C57BL/6 mice. Multicolor flow cytometric analyses were used to phenotype and characterize immune infiltrating cells within established cerebellar tumors. We observed significantly higher percentages of dendritic cells, infiltrating lymphocytes, myeloid-derived suppressor cells, and tumor-associated macrophages in murine SHH model tumors compared with group 3 tumors. However, murine group 3 tumors had higher percentages of CD8(+) PD-1(+) T cells within the CD3 population. PD-1 blockade conferred superior antitumor efficacy in animals bearing intracranial group 3 tumors compared with SHH group tumors, indicating that immunologic differences within the tumor microenvironment can be leveraged as potential targets to mediate antitumor efficacy. Further analysis of anti-PD-1 monoclonal antibody localization revealed binding to PD-1(+) peripheral T cells, but not tumor infiltrating lymphocytes within the brain tumor microenvironment. Peripheral PD-1 blockade additionally resulted in a marked increase in CD3(+) T cells within the tumor microenvironment. This is the first immunologic characterization of preclinical models of molecular subtypes of medulloblastoma and demonstration that response to immune checkpoint blockade differs across subtype classification. Our findings also suggest that effective anti-PD-1 blockade does not require that systemically administered antibodies penetrate the brain tumor microenvironment. ©2015 American Association for Cancer Research.

  5. Minds Under Siege: Rethinking the Soviet Experience inside the Leningrad Blockade, 1941-45

    OpenAIRE

    Peri, Alexis Jean

    2011-01-01

    The Blockade of Leningrad during the Second World War was one of the longest and most devastating sieges in modern history, which claimed the lives of about one million of the city's residents. Rather than invade Leningrad, Hitler vowed to simply "let the city devour itself." For those trapped inside the city, the war became first and foremost an internal struggle against the demands of their own bodies, which, under conditions of severe starvation, literally fed upon themselves. Over the cou...

  6. Combined androgen blockade in the treatment of advanced prostate cancer--an overview. The Scandinavian Prostatic Cancer Group

    DEFF Research Database (Denmark)

    Iversen, P

    1997-01-01

    The value of combined androgen blockade in the treatment of patients with advanced prostate cancer is still controversial. In this review by the Scandinavian Prostatic Cancer Group, the literature addressing the concept and its clinical use is critically reviewed.......The value of combined androgen blockade in the treatment of patients with advanced prostate cancer is still controversial. In this review by the Scandinavian Prostatic Cancer Group, the literature addressing the concept and its clinical use is critically reviewed....

  7. Prevention of atherosclerosis by specific AT1-receptor blockade with candesartan cilexetil

    Directory of Open Access Journals (Sweden)

    Vasilios Papademetriou

    2001-03-01

    Full Text Available Several studies indicate that blockade of the renin-angiotensin-aldosterone system (RAAS can prevent atherosclerosis and vascular events, but the precise mechanisms involved are still unclear. In this study, we investigated the effect of the AT 1-receptor blocker, candesartan, in the prevention of atherosclerosis in Watanabe heritable hyperlipidaemic (WHHL rabbits and also the effect of AT1-receptor blockade in the uptake of oxidised LDL by macrophage cell cultures. In the first set of experiments, 12 WHHL rabbits were randomly assigned to three groups: placebo, atenolol 5 mg/kg daily or candesartan 2 mg/kg daily for six months. Compared with controls and atenolol-treated rabbits, candesartan treatment resulted in a significant 50—60% reduction of atherosclerotic plaque formation and a 66% reduction in cholesterol accumulation in the thoracic aorta.Studies in macrophage cultures indicated that candesartan prevented uptake of oxidised LDL-(oxLDL-cholesterol by cultured macrophages. Candesartan inhibited the uptake of oxLDL in a dose-dependent manner, reaching a maximum inhibition of 70% at concentrations of 5.6 µg/ml. Further studies in other animal models and well-designed trials in humans are warranted to further explore the role of AT1-receptor blockade in the prevention of atherosclerosis.

  8. Room temperature Coulomb blockade mediated field emission via self-assembled gold nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Fei [College of Physics and Electronics, Central South University, Changsha, Hunan 410073 (China); College of Science, National University of Defense Technology, Changsha, Hunan 410073 (China); Fang, Jingyue, E-mail: fjynudt@aliyun.com [College of Science, National University of Defense Technology, Changsha, Hunan 410073 (China); Chang, Shengli; Qin, Shiqiao; Zhang, Xueao [College of Science, National University of Defense Technology, Changsha, Hunan 410073 (China); Xu, Hui, E-mail: cmpxhg@csu.edu.cn [College of Physics and Electronics, Central South University, Changsha, Hunan 410073 (China)

    2017-02-05

    Coulomb blockade mediated field-emission current was observed in single-electron tunneling devices based on self-assembled gold nanoparticles at 300 K. According to Raichev's theoretical model, by fixing a proper geometric distribution of source, island and drain, the transfer characteristics can be well explained through a combination of Coulomb blockade and field emission. Coulomb blockade and field emission alternately happen in our self-assembled devices. The Coulomb island size derived from the experimental data is in good agreement with the average size of the gold nanoparticles used in the device. The integrated tunneling can be adjusted via a gate electrode. - Highlights: • The phenomenon of single-electron field emission in a transistor setting using self-assembled gold nanoparticles was investigated. • The transfer characteristics can be well explained by the model that is a combination of Coulomb blockage and field emission. • This transport mechanism is novel and may be used in many applications in field emission devices.

  9. Effects of mineralocorticoid receptor blockade on empathy in patients with major depressive disorder.

    Science.gov (United States)

    Wingenfeld, Katja; Kuehl, Linn K; Dziobek, Isabel; Roepke, Stefan; Otte, Christian; Hinkelmann, Kim

    2016-10-01

    The mineralocorticoid receptor (MR) is highly expressed in the hippocampus and prefrontal cortex and is involved in social cognition. We recently found that pharmacological stimulation of the MR enhances emotional empathy but does not affect cognitive empathy. In the current study, we examined whether blockade of the MR impairs empathy in patients with major depressive disorder (MDD) and healthy individuals. In a placebo-controlled study, we randomized 28 patients with MDD without psychotropic medication and 43 healthy individuals to either placebo or 300 mg spironolactone, a MR antagonist. Subsequently, all participants underwent two tests of social cognition, the Multifaceted Empathy Test (MET) and the Movie for the Assessment of Social Cognition (MASC), measuring cognitive and emotional facets of empathy. In the MET, we found no significant main effect of treatment or main effect of group for cognitive empathy but a highly significant treatment by group interaction (p empathy scores compared to controls in the placebo condition but not after spironolactone. Furthermore, in the spironolactone condition reduced cognitive empathy was seen in MDD patients but not in controls. Emotional empathy was not affected by MR blockade. In the MASC, no effect of spironolactone could be revealed. Depressed patients appear to exhibit greater cognitive empathy compared to healthy individuals. Blockade of MR reduced cognitive empathy in MDD patients to the level of healthy individuals. Future studies should further clarify the impact of MR functioning on different domains of social cognition in psychiatric patients.

  10. Effect of beta-adrenergic blockade on lactate turnover in exercising dogs.

    Science.gov (United States)

    Issekutz, B

    1984-12-01

    Dogs with indwelling catheters in the jugular vein and in the carotid artery ran on the treadmill (slope: 15%, speed: 133 m/min). Lactate turnover and glucose turnover were measured using [U-14C]lactate and [3-3H]glucose as tracers, according to the primed constant-rate infusion method. In addition, the participation of plasma glucose in lactate production (Ra-L) was measured with [U-14C]glucose. Propranolol was given either (A) before exercise (250 micrograms/kg, iv) or (B) in form of a primed infusion administered to the dog running at a steady rate. Measurements of plasma propranolol concentration showed that in type A experiments plasma propranolol fell in 45 min below the lower limit of the complete beta-blockade. In the first 15 min of work Ra-L rose rapidly; then it fell below that of the control (exercise) values. During steady exercise, the elevated Ra-L was decreased by propranolol infusion close to resting values. beta-Blockade doubled the response of glucose production, utilization, and metabolic clearance rate to exercise. In exercising dogs approximately 40-50% of Ra-L arises from plasma glucose. This value was increased by the blockade to 85-90%. It is concluded that glycogenolysis in the working muscle has a dual control: 1) an intracellular control operating at the beginning of exercise, and 2) a hormonal control involving epinephrine and the beta-adrenergic receptors.

  11. Glucose uptake during centrally induced stress is insulin independent and enhanced by adrenergic blockade.

    Science.gov (United States)

    Lekas, M C; Fisher, S J; El-Bahrani, B; van Delangeryt, M; Vranic, M; Shi, Z Q

    1999-08-01

    Glucose utilization increases markedly in the normal dog during stress induced by the intracerebroventricular (ICV) injection of carbachol. To determine the extent to which insulin, glucagon, and selective (alpha/beta)-adrenergic activation mediate the increment in glucose metabolic clearance rate (MCR) and glucose production (R(a)), we used five groups of normal mongrel dogs: 1) pancreatic clamp (PC; n = 7) with peripheral somatostatin (0.8 microg x kg(-1) x min(-1)) and intraportal replacement of insulin (1,482 +/- 84 pmol x kg(-1) x min(-1)) and glucagon (0.65 ng x kg(-1) x min(-1)) infusions; 2) PC plus combined alpha (phentolamine)- and beta (propranolol)-blockade (7 and 5 microg x kg(-1) x min(-1), respectively; alpha+beta; n = 5); 3) PC plus alpha-blockade (alpha; n = 6); 4) PC plus beta-blockade (beta; n = 5); and 5) a carbachol control group without PC (Con; n = 10). During ICV carbachol stress (0-120 min), catecholamines, ACTH, and cortisol increased in all groups. Baseline insulin and glucagon levels were maintained in all groups except Con, where glucagon rose 33%, and alpha, where insulin increased slightly but significantly. Stress increased (P glycogenolysis, and that R(a) is augmented by glucagon and alpha- and beta-catecholamine effects.

  12. Blockade of Vascular Endothelial Growth Factor Receptor 1 Prevents Inflammation and Vascular Leakage in Diabetic Retinopathy

    Directory of Open Access Journals (Sweden)

    Jianbo He

    2015-01-01

    Full Text Available Diabetic retinopathy (DR is a leading cause of blindness in working age adults. The objective of this study is to investigate the effects of vascular endothelial growth factor receptor 1 (VEGFR1 blockade on the complications of DR. Experimental models of diabetes were induced with streptozotocin (STZ treatment or Insulin2 gene mutation (Akita in mice. Protein expression and localization were examined by western blots (WB and immunofluorescence (IF. mRNA expression was quantified by PCR array and real-time PCR. The activity of VEGFR1 signaling was blocked by a neutralizing antibody called MF1. Vascular leakage was evaluated by measuring the leakage of [3H]-mannitol tracer into the retina and the IF staining of albumin. VEGFR1 blockade significantly inhibited diabetes-related vascular leakage, leukocytes-endothelial cell (EC adhesion (or retinal leukostasis, expression of intercellular adhesion molecule- (ICAM- 1 protein, abnormal localization and degeneration of the tight junction protein zonula occludens- (ZO- 1, and the cell adhesion protein vascular endothelial (VE cadherin. In addition, VEGFR1 blockade interfered with the gene expression of 10 new cytokines and chemokines: cxcl10, il10, ccl8, il1f6, cxcl15, ccl4, il13, ccl6, casp1, and ccr5. These results suggest that VEGFR1 mediates complications of DR and targeting this signaling pathway represents a potential therapeutic strategy for the prevention and treatment of DR.

  13. Transversus abdominis plane blockade in laparoscopic colorectal surgery: a double-blind randomized clinical trial.

    Science.gov (United States)

    Smith, Stephen Ridley; Draganic, Brian; Pockney, Peter; Holz, Phillip; Holmes, Ryan; Mcmanus, Brendan; Carroll, Rosemary

    2015-09-01

    Adequate postoperative analgesia is essential for recovery following colorectal surgery. Transversus abdominis plane (TAP) blocks have been found to be beneficial in improving pain following a variety of abdominal operations. The objective of this study was to determine if TAP blocks are useful in improving postoperative recovery following laparoscopic colorectal surgery. A prospective double-blind randomized clinical trial, involving 226 consecutive patients having laparoscopic colorectal surgery, was performed by a university colorectal surgical department. Patients were randomized to either TAP blockade using ultrasound guidance, or control, with the primary outcome being postoperative pain, as measured by analgesic consumption. Secondary outcomes assessed were pain visual analogue score (VAS), respiratory function, time to return of gut function, length of hospital stay, postoperative complications, and patient satisfaction. A total of 142 patients were followed up to trial completion (74 controls, 68 interventions). Patients were well matched with regard to demographics. No complications occurred as a result of the intervention of TAP blockade. There was no difference between groups with regards to analgesic consumption (161 mEq morphine control vs 175 mEq morphine TAP; p = 0.596). There was no difference between the two groups with regards to the secondary outcomes of daily VAS, respiratory outcome, time to return of gut function, length of hospital stay, postoperative complications, and patient satisfaction. We conclude that TAP blockade appears to be a safe intervention but confers no specific advantage following laparoscopic colorectal surgery.

  14. Blockade of the SNARE protein syntaxin 1 inhibits glioblastoma tumor growth.

    Directory of Open Access Journals (Sweden)

    Fausto Ulloa

    Full Text Available Glioblastoma (GBM is the most prevalent adult brain tumor, with virtually no cure, and with a median overall survival of 15 months from diagnosis despite of the treatment. SNARE proteins mediate membrane fusion events in cells and are essential for many cellular processes including exocytosis and neurotransmission, intracellular trafficking and cell migration. Here we show that the blockade of the SNARE protein Syntaxin 1 (Stx1 function impairs GBM cell proliferation. We show that Stx1 loss-of-function in GBM cells, through ShRNA lentiviral transduction, a Stx1 dominant negative and botulinum toxins, dramatically reduces the growth of GBM after grafting U373 cells into the brain of immune compromised mice. Interestingly, Stx1 role on GBM progression may not be restricted just to cell proliferation since the blockade of Stx1 also reduces in vitro GBM cell invasiveness suggesting a role in several processes relevant for tumor progression. Altogether, our findings indicate that the blockade of SNARE proteins may represent a novel therapeutic tool against GBM.

  15. Blockade of the SNARE Protein Syntaxin 1 Inhibits Glioblastoma Tumor Growth

    Science.gov (United States)

    Ulloa, Fausto; Gonzàlez-Juncà, Alba; Meffre, Delphine; Barrecheguren, Pablo José; Martínez-Mármol, Ramón; Pazos, Irene; Olivé, Núria; Cotrufo, Tiziana; Seoane, Joan; Soriano, Eduardo

    2015-01-01

    Glioblastoma (GBM) is the most prevalent adult brain tumor, with virtually no cure, and with a median overall survival of 15 months from diagnosis despite of the treatment. SNARE proteins mediate membrane fusion events in cells and are essential for many cellular processes including exocytosis and neurotransmission, intracellular trafficking and cell migration. Here we show that the blockade of the SNARE protein Syntaxin 1 (Stx1) function impairs GBM cell proliferation. We show that Stx1 loss-of-function in GBM cells, through ShRNA lentiviral transduction, a Stx1 dominant negative and botulinum toxins, dramatically reduces the growth of GBM after grafting U373 cells into the brain of immune compromised mice. Interestingly, Stx1 role on GBM progression may not be restricted just to cell proliferation since the blockade of Stx1 also reduces in vitro GBM cell invasiveness suggesting a role in several processes relevant for tumor progression. Altogether, our findings indicate that the blockade of SNARE proteins may represent a novel therapeutic tool against GBM. PMID:25803850

  16. PD-1 blockade with nivolumab in relapsed/refractory primary central nervous system and testicular lymphoma.

    Science.gov (United States)

    Nayak, Lakshmi; Iwamoto, Fabio M; LaCasce, Ann; Mukundan, Srinivasan; Roemer, Margaretha G M; Chapuy, Bjoern; Armand, Philippe; Rodig, Scott J; Shipp, Margaret A

    2017-06-08

    Primary central nervous system (CNS) lymphoma (PCNSL) and primary testicular lymphoma (PTL) are rare extranodal large B-cell lymphomas with similar genetic signatures. There are no standard-of-care treatment options for patients with relapsed and refractory PCNSL and PTL, and the overall prognosis is poor. PCNSLs and PTLs exhibit frequent 9p24.1 copy-number alterations and infrequent translocations of 9p24.1 and associated increased expression of the programmed cell death protein 1 (PD-1) ligands, PD-L1 and PD-L2. The activity of PD-1 blockade in other lymphomas with 9p24.1 alterations prompted us to test the efficacy of the anti-PD1 antibody, nivolumab, in 4 patients with relapsed/refractory PCNSL and 1 patient with CNS relapse of PTL. All 5 patients had clinical and radiographic responses to PD-1 blockade, and 3 patients remain progression-free at 13 + to 17 + months. Our data suggest that nivolumab is active in relapsed/refractory PCNSL and PTL and support further investigation of PD-1 blockade in these diseases. © 2017 by The American Society of Hematology.

  17. Surface effects on ionic Coulomb blockade in nanometer-size pores

    Science.gov (United States)

    Tanaka, Hiroya; Iizuka, Hideo; Pershin, Yuriy V.; Di Ventra, Massimiliano

    2018-01-01

    Ionic Coulomb blockade in nanopores is a phenomenon that shares some similarities but also differences with its electronic counterpart. Here, we investigate this phenomenon extensively using all-atom molecular dynamics of ionic transport through nanopores of about one nanometer in diameter and up to several nanometers in length. Our goal is to better understand the role of atomic roughness and structure of the pore walls in the ionic Coulomb blockade. Our numerical results reveal the following general trends. First, the nanopore selectivity changes with its diameter, and the nanopore position in the membrane influences the current strength. Second, the ionic transport through the nanopore takes place in a hopping-like fashion over a set of discretized states caused by local electric fields due to membrane atoms. In some cases, this creates a slow-varying ‘crystal-like’ structure of ions inside the nanopore. Third, while at a given voltage, the resistance of the nanopore depends on its length, the slope of this dependence appears to be independent of the molarity of ions. An effective kinetic model that captures the ionic Coulomb blockade behavior observed in MD simulations is formulated.

  18. Investigation of Prolactin Receptor Activation and Blockade Using Time-Resolved Fluorescence Resonance Energy Transfer

    Directory of Open Access Journals (Sweden)

    Estelle eTallet

    2011-09-01

    Full Text Available The prolactin receptor (PRLR is emerging as a therapeutic target in oncology. Knowledge-based drug design led to the development of a pure PRLR antagonist (Del1-9-G129R-hPRL that was recently shown to prevent PRL-induced mouse prostate tumorogenesis. In humans, the first gain-of-function mutation of the PRLR (PRLRI146L was recently identified in breast tumor patients. At the molecular level, the actual mechanism of action of these two novel players in the PRL system remains elusive. In this study, we addressed whether constitutive PRLR activation (PRLRI146L or PRLR blockade (antagonist involved alteration of receptor oligomerization and/or of inter-chain distances compared to unstimulated and PRL-stimulated PRLR. Using a combination of various biochemical and spectroscopic approaches (co-IP, blue-native electrophoresis, BRET1, we demonstrated that preformed PRLR homodimers are altered neither by PRL- or I146L-induced receptor triggering, nor by antagonist-mediated blockade. These findings were confirmed using a novel time-resolved fluorescence resonance energy transfer (TR-FRET technology that allows monitoring distance changes between cell-surface tagged receptors. This technology revealed that PRLR blockade or activation did not involve detectable distance changes between extracellular domains of receptor chains within the dimer. This study merges with our previous structural investigations suggesting that the mechanism of PRLR activation solely involves intermolecular contact adaptations leading to subtle intramolecular rearrangements.

  19. Metazoan promoters

    DEFF Research Database (Denmark)

    Lenhard, Boris; Sandelin, Albin Gustav; Carninci, Piero

    2012-01-01

    Promoters are crucial for gene regulation. They vary greatly in terms of associated regulatory elements, sequence motifs, the choice of transcription start sites and other features. Several technologies that harness next-generation sequencing have enabled recent advances in identifying promoters ...

  20. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.

    2015-01-01

    , the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986...... - an associate professorship was established with a focus on health promotion. Nevertheless, the concept of health promotion had been integrated with or mentioned in courses run prior to the new post. Subsequently, a wide spectrum of courses in health promotion was introduced, such as Empowerment for Child...

  1. ANTIGENIC PROMOTION

    Science.gov (United States)

    Wu, Chin-Yu; Cinader, Bernard

    1971-01-01

    Rabbits were immunized with p-azobenzene arsonic acid derivatives of human serum albumin (HA-As) or of dissociated keyhole limpet hemocyanin. The IgM response to the hapten was evaluated in terms of the number of hapten-specific plaque-forming cells in the lymph node draining the injection site. In some experiments, antibody was measured by agglutination of tanned and sensitized erythrocytes. The hapten response of animals immunized with HA-As was increased (promoting effect) when the animals were injected with one of several structurally unrelated macromolecules: keyhole limpet hemocyanin (KLH), horse spleen ferritin (HSF), lysozyme (Lys), alum-precipitated human gamma globulin (alum-precipitated HGG). Different macromolecules differed in the magnitude of the promoting effect they induced, e.g., promotion by the associated form of KLH was greater than that by the dissociated form; alum-precipitated HGG was a better promoter than was soluble HGG. The relative magnitude of promotion by different macromolecules (associated vs. dissociated KLH, alum-precipitated vs. soluble HGG) correlated with the relative magnitude of the carrier effect, as judged by the hapten response induced by p-azobenzene arsonic acid conjugated to various proteins. Promotion was detected by agglutination assay of circulating antibody, by plaque assay of cells from the popliteal lymph node draining the site of preinjection, but not by plaque assay of cells from the contralateral lymph node. Promotion was dependent on the dose of the promoting macromolecule and on the dose of the hapten-protein conjugate. It was not observed in animals tolerant to the promoting macromolecule. Inhibition (i.e. antigenic competition), rather than promotion, was observed upon a secondary response to the preinjected macromolecule or when the hapten-protein conjugate was incorporated in Freund's adjuvant. PMID:15776570

  2. Alpha 2-adrenergic receptor turnover in adipose tissue and kidney: irreversible blockade of alpha 2-adrenergic receptors by benextramine

    Energy Technology Data Exchange (ETDEWEB)

    Taouis, M.; Berlan, M.; Lafontan, M.

    1987-01-01

    The recovery of post- and extrasynaptic alpha 2-adrenergic receptor-binding sites was studied in vivo in male golden hamsters after treatment with an irreversible alpha-adrenoceptor antagonist benextramine, a tetramine disulfide that possesses a high affinity for alpha 2-binding sites. The kidney alpha 2-adrenergic receptor number was measured with (/sup 3/H)yohimbine, whereas (/sup 3/H)clonidine was used for fat cell and brain membrane alpha 2-binding site identification. Benextramine treatment of fat cell, kidney, and brain membranes reduced or completely suppressed, in an irreversible manner, (/sup 3/H) clonidine and (/sup 3/H)yohimbine binding without modifying adenosine (A1-receptor) and beta-adrenergic receptor sites. This irreversible binding was also found 1 and 2 hr after intraperitoneal administration of benextramine to the hamsters. Although it bound irreversibly to peripheral and central alpha 2-adrenergic receptors on isolated membranes, benextramine was unable to cross the blood-brain barrier of the hamster at the concentrations used (10-20 mg/kg). After the irreversible blockade, alpha 2-binding sites reappeared in kidney and adipose tissue following a monoexponential time course. Recovery of binding sites was more rapid in kidney than in adipose tissue; the half-lives of the receptor were 31 and 46 hr, respectively in the tissues. The rates of receptor production were 1.5 and 1.8 fmol/mg of protein/hr in kidney and adipose tissue. Reappearance of alpha 2-binding sites was associated with a rapid recovery of function (antilipolytic potencies of alpha 2-agonists) in fat cells inasmuch as occupancy of 15% of (/sup 3/H)clonidine-binding sites was sufficient to promote 40% inhibition of lipolysis. Benextramine is a useful tool to estimate turnover of alpha 2-adrenergic receptors under normal and pathological situations.

  3. Effect of Neurohormonal Blockade Drug Therapy on Outcomes and Left Ventricular Function and Structure After Left Ventricular Assist Device Implantation.

    Science.gov (United States)

    Grupper, Avishay; Zhao, Yanjun M; Sajgalik, Pavol; Joyce, Lyle D; Park, Soon J; Pereira, Naveen L; Stulak, John M; Burnett, John C; Edwards, Brooks S; Daly, Richard C; Kushwaha, Sudhir S; Schirger, John A

    2016-06-01

    Neurohormonal blockade drug therapy (NHBDT) is the cornerstone therapy in heart failure (HF) management for promoting reverse cardiac remodeling and improving outcomes. It's utility in left ventricular assist device (LVAD) supported patients remains undefined. Sixty-four patients who received continuous flow LVAD at our institution were retrospectively reviewed and divided into 2 groups: no-NHBDT group (n = 33) received LVAD support only and NHBDT group (n = 31) received concurrent NHBDT based on the clinical judgment of the attending physicians. Cardiac remodeling (echocardiographic parameters and biomarkers) and clinical outcome (functional status, HF-related hospital readmissions, and mortality) data were collected. A statistically significant increase in ejection fraction, decrease in LV end-diastolic diameter index and LV mass index, and a sustained reduction in N-terminal pro B-type natriuretic peptide (NTproBNP) were observed in the NHBDT group at 6 months after LVAD implant (p <0.05). NHBDT-treated patients experienced significantly greater improvement in New York Heart Association functional classification and 6-minute-walk distance throughout the study. The combined end point of cardiovascular death or HF hospitalization was significantly reduced in patients receiving NHBDT (p = 0.013) associated primarily with a 12.1% absolute reduction in HF-related hospitalizations (p = 0.046). In conclusion, NHBDT in LVAD-supported patients is associated with a significant reversal in adverse cardiac remodeling and a reduction in morbidity and mortality compared with LVAD support alone. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. NMDA receptor blockade alters the intracellular distribution of neuronal nitric oxide synthase in the superficial layers of the rat superior colliculus

    Directory of Open Access Journals (Sweden)

    R.E. de Bittencourt-Navarrete

    2009-02-01

    Full Text Available Nitric oxide (NO is a molecular messenger involved in several events of synaptic plasticity in the central nervous system. Ca2+ influx through the N-methyl-D-aspartate receptor (NMDAR triggers the synthesis of NO by activating the enzyme neuronal nitric oxide synthase (nNOS in postsynaptic densities. Therefore, NMDAR and nNOS are part of the intricate scenario of postsynaptic densities. In the present study, we hypothesized that the intracellular distribution of nNOS in the neurons of superior colliculus (SC superficial layers is an NMDAR activity-dependent process. We used osmotic minipumps to promote chronic blockade of the receptors with the pharmacological agent MK-801 in the SC of 7 adult rats. The effective blockade of NMDAR was assessed by changes in the protein level of the immediate early gene NGFI-A, which is a well-known NMDAR activity-dependent expressing transcription factor. Upon chronic infusion of MK-801, a decrease of 47% in the number of cells expressing NGFI-A was observed in the SC of treated animals. Additionally, the filled dendritic extent by the histochemical product of nicotinamide adenine di-nucleotide phosphate diaphorase was reduced by 45% when compared to the contralateral SC of the same animals and by 64% when compared to the SC of control animals. We conclude that the proper intracellular localization of nNOS in the retinorecipient layers of SC depends on NMDAR activation. These results are consistent with the view that the participation of NO in the physiological and plastic events of the central nervous system might be closely related to an NMDAR activity-dependent function.

  5. Progesterone receptor blockade in human breast cancer cells decreases cell cycle progression through G2/M by repressing G2/M genes

    International Nuclear Information System (INIS)

    Clare, Susan E.; Gupta, Akash; Choi, MiRan; Ranjan, Manish; Lee, Oukseub; Wang, Jun; Ivancic, David Z.; Kim, J. Julie; Khan, Seema A.

    2016-01-01

    The synthesis of specific, potent progesterone antagonists adds potential agents to the breast cancer prevention and treatment armamentarium. The identification of individuals who will benefit from these agents will be a critical factor for their clinical success. We utilized telapristone acetate (TPA; CDB-4124) to understand the effects of progesterone receptor (PR) blockade on proliferation, apoptosis, promoter binding, cell cycle progression, and gene expression. We then identified a set of genes that overlap with human breast luteal-phase expressed genes and signify progesterone activity in both normal breast cells and breast cancer cell lines. TPA administration to T47D cells results in a 30 % decrease in cell number at 24 h, which is maintained over 72 h only in the presence of estradiol. Blockade of progesterone signaling by TPA for 24 h results in fewer cells in G2/M, attributable to decreased expression of genes that facilitate the G2/M transition. Gene expression data suggest that TPA affects several mechanisms that progesterone utilizes to control gene expression, including specific post-translational modifications, and nucleosomal organization and higher order chromatin structure, which regulate access of PR to its DNA binding sites. By comparing genes induced by the progestin R5020 in T47D cells with those increased in the luteal-phase normal breast, we have identified a set of genes that predict functional progesterone signaling in tissue. These data will facilitate an understanding of the ways in which drugs such as TPA may be utilized for the prevention, and possibly the therapy, of human breast cancer. The online version of this article (doi:10.1186/s12885-016-2355-5) contains supplementary material, which is available to authorized users

  6. Activation of the sympathetic nervous system mediates hypophagic and anxiety-like effects of CB₁ receptor blockade.

    Science.gov (United States)

    Bellocchio, Luigi; Soria-Gómez, Edgar; Quarta, Carmelo; Metna-Laurent, Mathilde; Cardinal, Pierre; Binder, Elke; Cannich, Astrid; Delamarre, Anna; Häring, Martin; Martín-Fontecha, Mar; Vega, David; Leste-Lasserre, Thierry; Bartsch, Dusan; Monory, Krisztina; Lutz, Beat; Chaouloff, Francis; Pagotto, Uberto; Guzman, Manuel; Cota, Daniela; Marsicano, Giovanni

    2013-03-19

    Complex interactions between periphery and the brain regulate food intake in mammals. Cannabinoid type-1 (CB1) receptor antagonists are potent hypophagic agents, but the sites where this acute action is exerted and the underlying mechanisms are not fully elucidated. To dissect the mechanisms underlying the hypophagic effect of CB1 receptor blockade, we combined the acute injection of the CB1 receptor antagonist rimonabant with the use of conditional CB1-knockout mice, as well as with pharmacological modulation of different central and peripheral circuits. Fasting/refeeding experiments revealed that CB1 receptor signaling in many specific brain neurons is dispensable for the acute hypophagic effects of rimonabant. CB1 receptor antagonist-induced hypophagia was fully abolished by peripheral blockade of β-adrenergic transmission, suggesting that this effect is mediated by increased activity of the sympathetic nervous system. Consistently, we found that rimonabant increases gastrointestinal metabolism via increased peripheral β-adrenergic receptor signaling in peripheral organs, including the gastrointestinal tract. Blockade of both visceral afferents and glutamatergic transmission in the nucleus tractus solitarii abolished rimonabant-induced hypophagia. Importantly, these mechanisms were specifically triggered by lipid-deprivation, revealing a nutrient-specific component acutely regulated by CB1 receptor blockade. Finally, peripheral blockade of sympathetic neurotransmission also blunted central effects of CB1 receptor blockade, such as fear responses and anxiety-like behaviors. These data demonstrate that, independently of their site of origin, important effects of CB1 receptor blockade are expressed via activation of peripheral sympathetic activity. Thus, CB1 receptors modulate bidirectional circuits between the periphery and the brain to regulate feeding and other behaviors.

  7. A blockade of PD-L1 produced antitumor and antimetastatic effects in an orthotopic mouse pancreatic cancer model via the PI3K/AkT/MTOR signaling pathway

    Directory of Open Access Journals (Sweden)

    Zhao L

    2017-04-01

    Full Text Available Lei Zhao,1 Cheng Li,2 Fei Liu,2 Yonghong Zhao,2 Jun Liu,2 Ye Hua,1 Jinyang Liu,1 Jiapeng Huang,1 Chunlin Ge1 1Department of Pancreatic and Biliary Surgery, The First Hospital of China Medical University, 2Department of Immunology, College of Basic Medical Sciences, China Medical University, Shenyang, Liaoning, People’s Republic of China Background: Pancreatic cancer is one of the most aggressive and intractable malignant tumors, and most deaths from pancreatic cancer are related to metastases. It has been demonstrated in vitro that overexpression of programmed death-ligand 1 (PD-L1 correlates with a lack of phosphatase and tensin homologue (PTEN expression in pancreatic cancer tissue. This loss of PTEN expression may aberrantly activate the phosphatidylinositol 3-kinase (PI3K/Akt/mammalian target of rapamycin (mTOR pathway, and thereby promote tumor cell survival, proliferation, and disease progression. In this study, we investigated the potential therapeutic effect of blockading PD-L1 expression on the progression of pancreatic cancer and its spontaneous liver metastases in vivo by inhibiting the PI3K/Akt/mTOR signaling pathway.Methods: We investigated the effect of blockading PD-L1 in an orthotopic pancreatic cancer mouse model. The pancreatic tumor weights and inhibition ratios were determined after treatment with antimouse PD-L1 antibody for 5 weeks. We used immunohistochemistry methods to investigate PD-L1 expression in pancreatic cancer tissue and spontaneous liver metastasis tissue. The levels of mRNA and protein expression for various components involved in the PI3K/Akt/mTOR signaling pathway as well as for matrix metalloproteinases-2 and -9 (MMP2 and MMP9 were measured by reverse transcription polymerase chain reaction (RT-PCR and Western blot methods, respectively.Results: Blockading PD-L1 significantly inhibited tumor growth and decreased the levels of PD-L1 expression in tumor tissue. Furthermore, the levels of PTEN mRNA and

  8. Endothelin receptor a blockade is an ineffective treatment for adriamycin nephropathy.

    Directory of Open Access Journals (Sweden)

    Roderick J Tan

    Full Text Available Endothelin is a vasoconstricting peptide that plays a key role in vascular homeostasis, exerting its biologic effects via two receptors, the endothelin receptor A (ETA and endothelin receptor B (ETB. Activation of ETA and ETB has opposing actions, in which hyperactive ETA is generally vasoconstrictive and pathologic. Selective ETA blockade has been shown to be beneficial in renal injuries such as diabetic nephropathy and can improve proteinuria. Atrasentan is a selective pharmacologic ETA blocker that preferentially inhibits ETA activation. In this study, we evaluated the efficacy of ETA blockade by atrasentan in ameliorating proteinuria and kidney injury in murine adriamycin nephropathy, a model of human focal segmental glomerulosclerosis. We found that ETA expression was unaltered during the course of adriamycin nephropathy. Whether initiated prior to injury in a prevention protocol (5 mg/kg/day, i.p. or after injury onset in a therapeutic protocol (7 mg/kg or 20 mg/kg three times a week, i.p., atrasentan did not significantly affect the initiation and progression of adriamycin-induced albuminuria (as measured by urinary albumin-to-creatinine ratios. Indices of glomerular damage were also not improved in atrasentan-treated groups, in either the prevention or therapeutic protocols. Atrasentan also failed to improve kidney function as determined by serum creatinine, histologic damage, and mRNA expression of numerous fibrosis-related genes such as collagen-I and TGF-β1. Therefore, we conclude that selective blockade of ETA by atrasentan has no effect on preventing or ameliorating proteinuria and kidney injury in adriamycin nephropathy.

  9. The effectivity of periprostatic nerve blockade for the pain control during transrectal ultrasound guided prostate biopsy

    Directory of Open Access Journals (Sweden)

    Alper Otunctemur

    2013-06-01

    Full Text Available Aim: Transrectal ultrasound (TRUS guided prostete biopsy is accepted as a standard procedure in the diagnosis of prostate cancer. Many different protocoles are applied to reduce the pain during the process. In this study we aimed to the comparison of two procedure with intrarectal lidocaine gel and periprostatice nerve blockade respective- ly in addition to perianal intrarectal lidocaine gel on the pain control in prostate biop- sy by TRUS. Methods: 473 patients who underwent prostate biopsy guided TRUS between 2008-2012 were included in the study. 10-point linear visual analog pain scale(VAS was used to evaluate the pain during biopsy. The patients were divided into two groups according to anesthesia procedure. In Group 1, there were 159 patients who had perianal-intrarectal lidocaine gel, in Group 2 there were 314 patients who had periprostatic nerve blockade in addition to intrarectal lidocain gel. The pain about probe manipulation was aseesed by VAS-1 and during the biopsy needle entries was evalu- ated by VAS-2. Results were compared with Mann-Whitney U and Pearson chi-square test. Results: Mean VAS-2 scores in Group 1 and Group 2 were 4.54 ± 1.02 and 2.06 ± 0.79 respectively. The pain score was determined significantly lower in the Group 2 (p = 0.001. In both groups there was no significant difference in VAS-1 scores, patient’s age, prostate volume, complication rate and PSA level. Conclusion: The combination of periprostatic nerve blockade and intrarectal lidocain gel provides a more meaningful pain relief compared to group of patients undergoing intrarectal lidocaine gel.

  10. On Disruption of Fear Memory by Reconsolidation Blockade: Evidence from Cannabidiol Treatment

    Science.gov (United States)

    Stern, Cristina A J; Gazarini, Lucas; Takahashi, Reinaldo N; Guimarães, Francisco S; Bertoglio, Leandro J

    2012-01-01

    The search for reconsolidation blockers may uncover clinically relevant drugs for disrupting memories of significant stressful life experiences, such as those underlying the posttraumatic stress disorder. Considering the safety of systemically administered cannabidiol (CBD), the major non-psychotomimetic component of Cannabis sativa, to animals and humans, the present study sought to investigate whether and how this phytocannabinoid (3–30 mg/kg intraperitoneally; i.p.) could mitigate an established memory, by blockade of its reconsolidation, evaluated in a contextual fear-conditioning paradigm in rats. We report that CBD is able to disrupt 1- and 7-days-old memories when administered immediately, but not 6 h, after their retrieval for 3 min, with the dose of 10 mg/kg being the most effective. This effect persists in either case for at least 1 week, but is prevented when memory reactivation was omitted, or when the cannabinoid type-1 receptors were antagonized selectively with AM251 (1.0 mg/kg). Pretreatment with the serotonin type-1A receptor antagonist WAY100635, however, failed to block CBD effects. These results highlight that recent and older fear memories are equally vulnerable to disruption induced by CBD through reconsolidation blockade, with a consequent long-lasting relief in contextual fear-induced freezing. Importantly, this CBD effect is dependent on memory reactivation, restricted to time window of <6 h, and is possibly dependent on cannabinoid type-1 receptor-mediated signaling mechanisms. We also observed that the fear memories disrupted by CBD treatment do not show reinstatement or spontaneous recovery over 22 days. These findings support the view that reconsolidation blockade, rather than facilitated extinction, accounts for the aforementioned CBD results in our experimental conditions. PMID:22549120

  11. Dual HER2 blockade in the neoadjuvant and adjuvant treatment of HER2-positive breast cancer

    Directory of Open Access Journals (Sweden)

    Advani P

    2015-09-01

    Full Text Available Pooja Advani,1 Lauren Cornell,2 Saranya Chumsri,1 Alvaro Moreno-Aspitia1 1Division of Hematology and Oncology, 2Department of Internal Medicine, Mayo Clinic, Jacksonville, FL, USA Abstract: Human epidermal growth factor receptor 2 (HER2 is a tyrosine kinase transmembrane receptor that is overexpressed on the surface of 15%–20% of breast tumors and has been associated with poor prognosis. Consistently improved pathologic response and survival rates have been demonstrated with use of trastuzumab in combination with standard chemotherapy in both early and advanced breast cancer. However, resistance to trastuzumab may pose a major problem in the effective treatment of HER2-positive breast cancer. Dual HER2 blockade, using agents that work in a complimentary fashion to trastuzumab, has more recently been explored to evade resistance in both the preoperative (neoadjuvant and adjuvant settings. Increased effectiveness of dual anti-HER2 agents over single blockade has been recently reported in clinical studies. Pertuzumab in combination with trastuzumab and taxane is currently approved in the metastatic and neoadjuvant treatment of HER2-positive breast cancer. Various biomarkers have also been investigated to identify subsets of patients with HER2-positive tumors who would likely respond best to these targeted therapy combinations. In this article, available trial data regarding efficacy and toxicity of treatment with combination HER2 agents in the neoadjuvant and adjuvant setting have been reviewed, and relevant correlative biomarker data from these trials have been discussed. Keywords: HER2, dual blockade, neoadjuvant, adjuvant, breast cancer, trastuzumab

  12. The effects of calcium channel blockade on agouti-induced obesity

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jung Han; Moustaid, N.; Zemel, M.B. [Univ. of Tennessee, Knoxville, TN (United States)] [and others

    1996-12-01

    We have previously observed that obese viable yellow (A{sup vy}/a) mice exhibit increased intracellular Ca{sup 2+} ([Ca{sup 2+}]i) and fatty acid synthase (FAS) gene expression; further, recombinant agouti protein increases in cultured adipocytes and these effects are inhibited by Ca{sup 2+} channel blockade. Accordingly, we determined the effect of Ca{sup 2+} channel blockade (nifedipine for 4 wk) on FAS and obesity in transgenic mice expressing the agouti gene in a ubiquitous manner. The transgenic mice initially were significantly heavier (30.5 {+-} 0.6 vs. 27.3 {+-} 0.3 g; P<0.001) and exhibited a 0.81{degrees}C lower initial core temperature (P<0.0005), an approximately twofold increase in fat pad weights (P=0.002), a sevenfold increase in adipose FAS activity (P=0.009), and a twofold increase in plasma insulin level (P<0.05) compared to control mice. Nifedipine treatment resulted in an 18% decrease in fat pad weights (P<0.007) and a 74% decrease in adipose FAS activity (P=0.03), normalized circulating insulin levels and insulin sensitivity (P,0.05), and transiently elevated core temperature in the transgenic mice, but was without effect in the control mice. These data suggest that agouti regulates FAS, fat storage, and possibly thermogenesis, at least partially, via a [Ca{sup 2+}]{sub i}-dependent mechanism, and that Ca{sup 2+} channel blockade may partially attenuate agouti-induced obesity. 42 refs., 4 figs., 1 tab.

  13. Comparison of paravertebral blockade techniques with and without ultrasound guidance in calves.

    Science.gov (United States)

    Re, Michela; Blanco-Murcia, Javier; Villaescusa, Alejandra; De Gaspar, Ignacio; de Segura, Ignacio A Gómez

    2016-11-01

    OBJECTIVE To compare the effectiveness of an ultrasound-guided paravertebral nerve blockade technique (UGPNB) with distal and proximal paravertebral nerve blockade techniques without ultrasound guidance (DPNB and PPNB, respectively) in calves. ANIMALS 4 calf cadavers and 7 healthy calves. PROCEDURES A suitable acoustic window was identified to facilitate access to the T13, L1, and L2 spinal nerves in cadavers and live calves. In cadavers, nerves were injected with dye under ultrasound guidance. In calves, the UGPNB, DPNB, and PPNB were performed in random order at 10-day intervals by injection of an anesthetic solution containing 2% lidocaine hydrochloride. Nociceptive withdrawal responses were assessed to determine the effects of the blockades. RESULTS In cadavers, nerve staining success rates (ie, ≥ 2-cm-long dye path) achieved with ultrasound guidance were 88% (T13 [ventral branch]), 75% (T13 and L1 [dorsal branches] and L1 and L2 [ventral branches]), and 38% (L2 [dorsal branch]). The nerves were each identified as a hyperechoic band in a longitudinal plane. In calves, the UGPNB, DPNB, and PPNB reduced the withdrawal response to the noxious stimulus, mainly in the dorsal-cranial, dorsal-caudal, and ventral-cranial areas of the flank. Overall, the UGPNB resulted in a better nociceptive cumulative score, administering only one half of the local anaesthetic dose, compared with findings for the DPNB and PPNB. However, time to perform the UGPNB was longer. CONCLUSIONS AND CLINICAL RELEVANCE The UGPNB evaluated may be an improved alternative to the DPNB and PPNB for provision of anesthesia for flank surgery in calves. However, effectiveness of the UGPNB should be evaluated in a clinical setting and in adult cattle.

  14. Nitric oxide synthesis blockade reduced the baroreflex sensitivity in trained rats.

    Science.gov (United States)

    Souza, Hugo C D; De Araújo, João E; Martins-Pinge, Marli C; Cozza, Izabela C; Martins-Dias, Daniel P

    2009-10-05

    The present study has investigated the effect of blockade of nitric oxide synthesis on cardiovascular autonomic adaptations induced by aerobic physical training using different approaches: 1) double blockade with methylatropine and propranolol; 2) systolic arterial pressure (SAP) and heart rate variability (HRV) by means of spectral analysis; and 3) baroreflex sensitivity. Male Wistar rats were divided into four groups: sedentary rats (SR); sedentary rats treated with N(omega)-nitro-l-arginine methyl ester (L-NAME) for one week (SRL); rats trained for eight weeks (TR); and rats trained for eight weeks and treated with L-NAME in the last week (TRL). Hypertension and tachycardia were observed in SRL group. Previous physical training attenuated the hypertension in L-NAME-treated rats. Bradycardia was seen in TR and TRL groups, although such a condition was more prominent in the latter. All trained rats had lower intrinsic heart rates. Pharmacological evaluation of cardiac autonomic tonus showed sympathetic predominance in SRL group, differently than other groups. Spectral analysis of HRV showed smaller low frequency oscillations (LF: 0.2-0.75 Hz) in SRL group compared to other groups. Rats treated with L-NAME presented greater LF oscillations in the SAP compared to non-treated rats, but oscillations were found to be smaller in TRL group. Nitric oxide synthesis inhibition with L-NAME reduced the baroreflex sensitivity in sedentary and trained animals. Our results showed that nitric oxide synthesis blockade impaired the cardiovascular autonomic adaptations induced by previous aerobic physical training in rats that might be, at least in part, ascribed to a decreased baroreflex sensitivity.

  15. Surgical Space Conditions During Low-Pressure Laparoscopic Cholecystectomy with Deep Versus Moderate Neuromuscular Blockade

    DEFF Research Database (Denmark)

    Staehr-Rye, Anne K; Rasmussen, Lars S.; Rosenberg, Jacob

    2014-01-01

    BACKGROUND: Laparoscopic cholecystectomy performed during low intraabdominal pressure (conditions and safety of operating at lower pressures has not been adequately...... described, but deep neuromuscular blockade may be beneficial. We investigated if deep muscle relaxation would be associated with a higher proportion of procedures with "optimal" surgical space conditions compared with moderate relaxation during low-pressure (8 mm Hg) laparoscopic cholecystectomy. METHODS...... (rocuronium repeat bolus only for inadequate surgical conditions with spontaneous recovery of neuromuscular function). Patients received anesthesia with propofol, remifentanil, and rocuronium. The primary outcome was the proportion of procedures with optimal surgical space conditions (assessed by the surgeon...

  16. Coulomb blockade in a Si channel gated by an Al single-electron transistor

    OpenAIRE

    Sun, L.; Brown, K. R.; Kane, B. E.

    2007-01-01

    We incorporate an Al-AlO_x-Al single-electron transistor as the gate of a narrow (~100 nm) metal-oxide-semiconductor field-effect transistor (MOSFET). Near the MOSFET channel conductance threshold, we observe oscillations in the conductance associated with Coulomb blockade in the channel, revealing the formation of a Si single-electron transistor. Abrupt steps present in sweeps of the Al transistor conductance versus gate voltage are correlated with single-electron charging events in the Si t...

  17. Effect of angiotensin II blockade on cardiac hypertrophy and remodelling: a review.

    Science.gov (United States)

    Dahlöf, B

    1995-11-01

    Activation of the renin-angiotensin system both systemically and locally seems to be of importance for cardiovascular hypertrophy and remodelling. The octapeptide angiotensin II definitively plays a central role. In the reversal, for example, of left ventricular hypertrophy, so far the most important independent risk factor for an adverse outcome, blocking of the renin-angiotensin system with ACE inhibition has been shown to be particularly effective. In cardiac tissue, however, ACE inhibition has been suggested to inhibit only a fraction of angiotensin II formed, indicating that other enzymatic pathways can be of importance. From a theoretical point of view a more complete blockade of the angiotensin II type 1 receptor would offer a more effective attenuation of the unfavourable effect of angiotensin II. Experimentally, losartan, a novel selective angiotensin II receptor type 1 antagonist has been shown to decrease cardiac hypertrophic response in models of both hypertension and volume cardiac hypertrophy as well as reverse hypertrophy in spontaneously hypertensive rats. TCV-116, another selective angiotensin II antagonist, also effectively reverses cardiac hypertophy and interstitial fibrosis in the rat. The only report so far regarding the effect of angiotensin II blockade on cardiac hypertrophy in essential hypertension suggests a more favourable short-term effect on cardiac hypertrophy for the same blood pressure reduction with losartan compared with atenolol in a small population of mild to moderate hypertensives. In the perspective of the well-established positive effects of ACE inhibition on the remodelling process in the remaining viable myocardium after myocardial infarction, involving myocyte hypertrophy, interstitial fibrosis and progressive dilatation, it is reassuring that angiotensin II blockade has been shown to perform equally well as ACE inhibition after experimental coronary ligation. In summary, the development of cardiovascular hypertrophy in

  18. Toll-like receptor 3 blockade in rhinovirus-induced experimental asthma exacerbations

    DEFF Research Database (Denmark)

    Silkoff, Philip E; Flavin, Susan; Gordon, Robert

    2017-01-01

    BACKGROUND: Human rhinoviruses (HRVs) commonly precipitate asthma exacerbations. Toll-like receptor 3, an innate pattern recognition receptor, is triggered by HRV, driving inflammation that can worsen asthma. OBJECTIVE: We sought to evaluate an inhibitory mAb to Toll-like receptor 3, CNTO3157......: In summary, CNTO3157 was ineffective in attenuating the effect of HRV-16 challenge on lung function, asthma control, and symptoms in asthmatic patients but suppressed cold symptoms in healthy subjects. Other approaches, including blockade of multiple pathways or antiviral agents, need to be sought...

  19. Bilateral stellate ganglion blockade for recalcitrant oral pain from Burning Mouth Syndrome: a case report.

    Science.gov (United States)

    Walega, David R; Smith, Clark; Epstein, Joel B

    2014-01-01

    Burning Mouth Syndrome (BMS) is a chronic painful disorder characterized by unremitting bilateral burning oral pain often associated with taste abnormalities and complaints of dry mouth. The diagnosis is made by history and symptom presentation in the absence of an identifiable cause or oral lesion. It is commonly seen in perimenopausal women but is also seen in men, and is considered a small-fiber neuropathy. Management can be challenging and few effective treatments are available. This article presents a case report of stellate ganglion blockade as a treatment for recalcitrant pain from BMS.

  20. Improving Neuromuscular Monitoring and Reducing Residual Neuromuscular Blockade With E-Learning

    DEFF Research Database (Denmark)

    Thomsen, Jakob Louis Demant; Mathiesen, Ole; Hägi-Pedersen, Daniel

    2017-01-01

    BACKGROUND: Muscle relaxants facilitate endotracheal intubation under general anesthesia and improve surgical conditions. Residual neuromuscular blockade occurs when the patient is still partially paralyzed when awakened after surgery. The condition is associated with subjective discomfort and an......-learning module can increase anesthetists' use of neuromuscular monitoring. TRIAL REGISTRATION: Clinicaltrials.gov NCT02925143; https://clinicaltrials.gov/ct2/show/NCT02925143 (Archived by WebCite® at http://www.webcitation.org/6s50iTV2x)....

  1. Dual blockade with candesartan cilexetil and lisinopril in hypertensive patients with diabetes mellitus

    DEFF Research Database (Denmark)

    Andersen, Niels H; Knudsen, Søren T; Poulsen, Per L

    2003-01-01

    , active-controlled, parallel-group study, investigating the efficacy and tolerability of candesartan cilexetil in combination with lisinopril, compared with the maximum recommended dose of lisinopril in hypertensive patients with diabetes mellitus. The study design consists of two treatment arms......BACKGROUND: Blood pressure (BP) reduction is the key to risk reduction of cardiovascular disease or renal failure in hypertensive patients with diabetes mellitus. Inhibition of the renin-angiotensin system by an angiotensin-converting enzyme (ACE) inhibitor or an angiotensin II receptor blocker...... to investigate the effects of dual blockade on systolic BP, albuminuria, left ventricular mass and function, and retinopathy in hypertensive patients with diabetes mellitus....

  2. Blockade of Vascular Adhesion Protein-1 Inhibits Lymphocyte Infiltration in Rat Liver Allograft Rejection

    OpenAIRE

    Martelius, Timi; Salaspuro, Ville; Salmi, Marko; Krogerus, Leena; Höckerstedt, Krister; Jalkanen, Sirpa; Lautenschlager, Irmeli

    2004-01-01

    Vascular adhesion protein-1 (VAP-1) has been shown to mediate lymphocyte adhesion to endothelia at sites of inflammation, but its functional role in vivo has not been tested in any rodent model. Here we report the effects of VAP-1 blockade on rat liver allograft rejection. BN recipients of PVG liver allografts (known to develop acute rejection by day 7) were treated with 2 mg/kg anti-VAP-1 (a new anti-rat VAP-1 mAb 174–5) or isotype-matched irrelevant antibody (NS1) every other day (n = 6/gro...

  3. Found in Translation: International initiatives pursuing interleukin-1 blockade for treatment of acute Kawasaki Disease

    Science.gov (United States)

    Burns, Jane C.; Koné-Paut, Isabelle; Kuijpers, Taco; Shimizu, Chisato; Tremoulet, Adriana; Arditi, Moshe

    2016-01-01

    The decision to move forward with three clinical trials of IL-1 blockade for treatment of acute Kawasaki disease is a case study in translational science. These trials were born on the one hand from transcriptome studies of host response during the acute disease coupled with animal model investigations of key immune signaling pathways and, on the other hand, out of clinical desperation to intervene in patients with severe inflammation in the setting of acute Kawasaki disease. The convergence of laboratory science and clinical observations led to the clinical trials described here and serves as a model for how such observations can be translated into new therapies. PMID:27792871

  4. Patient safety incidents involving neuromuscular blockade: analysis of the UK National Reporting and Learning System data from 2006 to 2008.

    Science.gov (United States)

    Arnot-Smith, J; Smith, A F

    2010-11-01

    Neuromuscular blockade is a powerful anaesthetic tool that has the potential for significant adverse outcomes. We sought to explore the national picture by analysing incidents relating to neuromuscular blockade in anaesthesia from the National Reporting and Learning System from England and Wales between 2006 and 2008. We searched the database of incidents using SNOMED CT search terms and reading the free text of relevant incidents. There were 231 incidents arising from the use or reversal of neuromuscular blocking agents. The main themes identified were: non-availability of drugs (45 incidents, 19%), possible unintentional awareness under general anaesthesia (42 incidents, 18%), potential allergic reaction (31 incidents, 13%), problems with reversal of blockade (13 incidents, 6%), storage (13 incidents, 6%) and prolonged apnoea (11 incidents, 5%). We make recommendations to reduce human error in the use of neuromuscular blocking agents and on future incident reporting in anaesthesia. © 2010 The Authors. Anaesthesia © 2010 The Association of Anaesthetists of Great Britain and Ireland.

  5. Metabolic consequences of beta-adrenergic receptor blockade for the acutely ischemic dog myocardium

    Energy Technology Data Exchange (ETDEWEB)

    Westera, G.; Hollander, W. den; Wall, E.E. van der; Eenige, M.J. van; Scholtalbers, S.; Visser, F.C.; Roos, J.P.

    1984-02-01

    In an experimental study in 50 dogs the myocardial uptake of free fatty acids (FFAs) after beta-blockade was determined using radioiodinated heptadecanoic acid as a metabolic tracer. All 4 beta-blockers used (metoprolol, timolol, propranolol and pindolol) lowered the uptake of FFAs in the normal canine heart. Uptake of FFAs was also diminished after coronary artery occlusion per se, but administration of beta-blockers exerted little additional influence on the uptake of FFAs. This observation was qualitatively parallelled by the uptake of /sup 201/Tl in concomitant experiments. Plasma FFA levels were increased by pindolol (non-selective with intrinsic sympathomimetic activity), not changed by metoprolol (a cardioselective betablocking agent) and lowered by timolol and propranolol (both non-selective compounds). The extent of ischemic tissue, as reflected by uptake of iodoheptadecanoic acid and /sup 201/Tl, was diminished by metoprolol but not by other beta-blockers. Regional distribution of both tracers, as shown in the endo-epicardial uptake ratios, was hardly influenced by beta-blockade, except for a small increase of /sup 201/Tl uptake in non-occluded endocardium. Uptake of /sup 201/Tl as well as of iodoheptadecanoic acid in the ischemic area was increased by metoprolol, timolol and propranolol and decreased by pindolol. We conclude that beta-blocking agents confer different effects on myocardial uptake and metabolism of FFAs which might possibly be related to their different inherent properties.

  6. Sex differences in pain and hypothalamic-pituitary-adrenocortical responses to opioid blockade.

    Science.gov (United States)

    al'Absi, Mustafa; Wittmers, Lorentz E; Ellestad, Deanna; Nordehn, Glenn; Kim, Suck Won; Kirschbaum, Clemens; Grant, Jon E

    2004-01-01

    Sex differences in pain sensitivity and stress reactivity have been well documented. Little is known about the role of the endogenous opioid system in these differences. This study was conducted to compare adrenocortical, pain sensitivity, and blood pressure responses to opioid blockade using naltrexone in men and women. Twenty-six participants completed 2 sessions during which placebo or 50 mg of naltrexone was administered, using a double-blind, counterbalanced design. Thermal pain threshold and heat tolerance were assessed. Participants also rated pain during a 90-second cold pressor test (CPT) and completed the McGill Pain Questionnaire (MPQ) after each pain challenge. Blood and saliva samples and cardiovascular and mood measures were obtained throughout the sessions. Plasma cortisol, adrenocorticotropin, beta endorphin, prolactin, and salivary cortisol levels increased similarly in men and women after naltrexone administration compared with placebo. Women reported more pain during both pain procedures and had lower thermal pain tolerance. In response to naltrexone, women exhibited reduced blood pressure responses and reduced MPQ pain ratings after CPT. No effects of naltrexone on these measures were found in men. Although men and women exhibited similar hormonal responses to opioid receptor blockade, women reported less pain and showed smaller blood pressure responses during CPT. Results suggest differential effects of the endogenous opioid system on pain perception and blood pressure in men and women.

  7. Substrate Metabolism and Insulin Sensitivity During Fasting in Obese Human Subjects: Impact of GH Blockade.

    Science.gov (United States)

    Pedersen, Morten Høgild; Svart, Mads Vandsted; Lebeck, Janne; Bidlingmaier, Martin; Stødkilde-Jørgensen, Hans; Pedersen, Steen Bønløkke; Møller, Niels; Jessen, Niels; Jørgensen, Jens O L

    2017-04-01

    Insulin resistance and metabolic inflexibility are features of obesity and are amplified by fasting. Growth hormone (GH) secretion increases during fasting and GH causes insulin resistance. To study the metabolic effects of GH blockade during fasting in obese subjects. Nine obese males were studied thrice in a randomized design: (1) after an overnight fast (control), (2) after 72 hour fasting (fasting), and (3) after 72 hour fasting with GH blockade (pegvisomant) [fasting plus GH antagonist (GHA)]. Each study day consisted of a 4-hour basal period followed by a 2-hour hyperinsulinemic, euglycemic clamp combined with indirect calorimetry, assessment of glucose and palmitate turnover, and muscle and fat biopsies. GH levels increased with fasting (P fasting-induced reduction of serum insulin-like growth factor I was enhanced by GHA (P Fasting increased lipolysis and lipid oxidation independent of GHA, but fasting plus GHA caused a more pronounced suppression of lipid intermediates in response to hyperinsulinemic, euglycemic clamp. Fasting-induced insulin resistance was abrogated by GHA (P Fasting plus GHA also caused elevated glycerol levels and reduced levels of counterregulatory hormones. Fasting significantly reduced the expression of antilipolytic signals in adipose tissue independent of GHA. Suppression of GH activity during fasting in obese subjects reverses insulin resistance and amplifies insulin-stimulated suppression of lipid intermediates, indicating that GH is an important regulator of substrate metabolism, insulin sensitivity, and metabolic flexibility also in obese subjects. Copyright © 2017 by the Endocrine Society

  8. Blockade of NMDA receptors prevents analgesic tolerance to repeated transcutaneous electrical nerve stimulation (TENS) in rats

    Science.gov (United States)

    Hingne, Priyanka M.; Sluka, Kathleen A.

    2008-01-01

    Repeated daily application transcutaneous electrical nerve stimulation (TENS) results in tolerance, at spinal opioid receptors, to the anti-hyperalgesia produced by TENS. Since N-Methyl-D-Aspartate (NMDA) receptor antagonists prevent analgesic tolerance to opioid agonists we hypothesized that blockade of NMDA receptors will prevent tolerance to TENS. In rats with knee joint inflammation, TENS was applied for 20 minute daily at high frequency (100 Hz), low frequency (4 Hz), or sham TENS. Rats were treated with the NMDA antagonist MK-801 (0.01 mg/kg-0.1 mg/kg) or vehicle daily before TENS. Paw withdrawal thresholds were tested before and after inflammation, and before and after TENS treatment for 4 days. On day 1 TENS reversed the decreased mechanical withdrawal threshold induced by joint inflammation. On day 4 TENS had no effect on the decreased withdrawal threshold in the group treated with vehicle demonstrating development of tolerance. However, in the group treated with 0.1 mg/kg MK-801, TENS significantly reversed the mechanical withdrawal thresholds on day 4 demonstrating that tolerance did not develop. Vehicle treated animals developed cross-tolerance at spinal opioid receptors. Treatment with MK-801 reversed this cross-tolerance at spinal opioid receptors. In summary, blockade of NMDA receptors prevents analgesic tolerance to daily TENS by preventing tolerance at spinal opioid receptors. Perspective Tolerance observed to the clinical treatment of TENS could be prevented by administration of pharmaceutical agents with NMDA receptors activity such as ketamine or dextromethorphan. PMID:18061543

  9. Blockade of S100A3 activity inhibits murine hair growth.

    Science.gov (United States)

    Guan, W; Deng, Q; Yu, X L; Yuan, Y S; Gao, J; Li, J J; Zhou, L; Xia, P; Han, G Y Q; Han, W; Yu, Y

    2015-10-28

    Using mouse gene expression microarray analysis, we obtained dynamic expression profiles of the whole genome in a depilation-induced hair growth mouse model. S100A3 expression increased during the anagen phase and returned to normal during the telogen phase. The effects of S100A3 blockade on the hair growth cycle were examined in mice after subcutaneous injection of an anti-mouse S100A3 antibody. Protein localization of S100A3 was confined to the hair shafts during the anagen phase and the sebaceous glands during the telogen phase. S100A3 blockade delayed hair follicle entry into the anagen phase, decreased hair elongation, and reduced the number of hair follicles in the subcutis, which correlated with the downregulated expression of hair growth induction-related genes in vivo. The present study demonstrates that anti-S100A3 antibody inhibits mouse hair growth, suggesting that S100A3 can be used as a target for hair loss treatment.

  10. Expanding role of beta-blockade in the management of chronic heart failure.

    Science.gov (United States)

    Patterson, J Herbert; Rodgers, Jo E

    2003-04-01

    Although recent advances have been made in the treatment of heart failure, this disease continues to result in significant morbidity and mortality. Among the negative effects associated with progression of heart failure are decline in myocardial reserve, decreased exercise tolerance, decreased contractile function, and altered cardiac gene expression. Guidelines recommend neurohormonal antagonists for treatment and stress the importance of angiotensin-converting enzyme inhibition and beta-blockade in reversing the cardiac remodeling process. beta-Blockade slows or reverses the adverse effects resulting from chronic adrenergic stimulation. Traditionally, beta-blockers were reserved for mild-to-moderate heart failure, based on evidence from large, randomized clinical trials showing their positive effects on myocardial function and clinical outcomes. More recently, clinical data reveal that the agents can be expanded to patients with severe heart failure and those with left ventricular systolic dysfunction after myocardial infarction. Individual beta-blocking agents vary in their pharmacology and dosing requirements. These variations may influence treatment decisions and affect clinical measurements of left ventricular function and ventricular remodeling.

  11. Anisotropic Pauli Spin Blockade of Holes in a GaAs Double Quantum Dot

    Science.gov (United States)

    Wang, Qingwen; Klochan, Oleh; Hung, Jo-Tzu; Culcer, Dimitrie; Farrer, Ian; Ritchie, David; Hamilton, Alex

    Electrically defined semiconductor quantum dots are appealing systems for spin manipulation and quantum information processing. Thanks to the weak hyperfine interaction and the strong spin-orbit interaction, heavy-holes in GaAs are promising candidates for all-electrical spin manipulation. However, making stable quantum dots in GaAs has only become possible recently, mainly because of difficulties in device fabrication and device stability. Here we present electrical transport measurements of heavy-holes in a lateral double quantum dot based on a GaAs /AlxGa1 - x As heterostructure. We observe clear Pauli spin blockade and show that the lifting of the spin blockade by an external magnetic field is extremely anisotropic. Numerical calculations of heavy-hole transport through a double quantum dot in the presence of strong spin-orbit interaction demonstrate quantitative agreement with experimental results, which indicates that the observed anisotropy can be explained by the anisotropic hole g-factor and the surface Dresselhaus spin-orbit coupling.

  12. Selective beta-1 receptor blockade with oral practolol in man. A dose-related phenomenon.

    Science.gov (United States)

    Lertora, J J; Mark, A L; Johannsen, J; Wilson, W R; Abboud, F M

    1975-09-01

    The purpose of this study was to test the hypothesis that oral administration of a low dose of practolol in man produces selective beta-1 receptor blockade, whereas oral administration of a high dose blocks both beta-1 and beta-2 receptors. Normal men were studied 2-4 h after a single oral dose of practolol (1.5 or 12 mg/kg) and after placebo. Effects on beta-1 receptors were studied by measuring heart rate responses to exercise. Effects on beta-2 receptors were tested by measuring forearm vascular responses to brachial arterial infusions of isoproterenol. Neither dose of practolol altered base-line heart rate, forearm vascular resistance, and arterial pressure, Both low and high doses significantly attenuated heart rate responses to exercise. Forearm vasodilator responses to isoproterenol were attenuated by the high dose, but not the low dose, of practolol. Serum concentrations of practolol 2 h after administration of the drug and at the time of the studies of forearm vascular responses averaged 0.5+/-0.1 (SE) and 5.9+/-1.0 mug/ml for low and high doses of practolol, respectively. The results indicate that the phenomenon of selective beta-1 receptor blockade in man is related to the dose and serum concentration of practolol selectively block beta-1 receptors; a high dose and serum concentrations block both beta-1 and beta-2 receptors.

  13. Unexpected High Sensory Blockade during Continuous Spinal Anesthesiology (CSA) in an Elderly Patient.

    Science.gov (United States)

    Ketelaars, R; Wolff, A P

    2012-01-01

    A 98-year-old woman presented for a hemiarthroplasty of the left hip. Because of her age and cardiac and pulmonary co-existing diseases we decided to provide adequate regional anesthesia by continuous spinal anesthesia. Fragmented doses of isobaric bupivacaine 0.5% were administered through a system consisting of a spinal catheter connected to an antimicrobial filter. After an uneventful surgical procedure, prior to removal of the catheter, this system was flushed with 10 mL of normal saline in order to try to prevent post-dural-puncture headache. After arrival at the postanesthesia care unit and fifteen minutes after removal of the catheter the patient suffered an unexpected high thoracic sensory blockade and hypotension requiring treatment. The continuous spinal anesthesia technique can be used in selected cases to be able to administer local anesthetic agents in a slow and controlled manner to reach the desired effect. The risk of post-dural-puncture headache using this technique in elderly patients is very low and therefore precludes the need to try to prevent it. We have described a potentially dangerous complication of flushing a bupivacaine-filled system into the spinal canal of an elderly patient resulting in an undesirable high sensory blockade.

  14. Neurolytic blockade of the obturator nerve in the treatment of idiopatic obturator neuralgia

    Directory of Open Access Journals (Sweden)

    Ćulafić Slobodan

    2008-01-01

    Full Text Available Introduction. Idiopathic obturator neuralgia is a rare chronic pain condition. It consists of pain radiating from the obturator nerve territory to the inner thigh. However, the symptomatic obturator neuralgia is commonly caused by the obturator canal bowel hernia that causes painful compressive neuropathy in more than 85% of the cases. Case report. A 61-year-old female who underwent right femoral amputation due to the occlusion of the aortofemoral vascular graft, complained of the pain characterized by its localization in the inguinal region and anterointernal side of the right inner thigh. Computer tomography and MRI findings excluded obturator canal herniation or lumbar plexopathy. A diagnosis of the obturator neuralgia was confirmed by an analgesic block of the obturator nerve. Thereafter, the neurolitic blockade of the right obturator nerve was done. The complete pain relief was achieved. Pain relief was complete in three-month follow-up period. Conclusion. Neurolitic blockade is an efficacious method in treating chronic pain caused by the idiopathic obturator neuralgia.

  15. Pancreatic Digestive Enzyme Blockade in the Intestine Increases Survival After Experimental Shock

    Science.gov (United States)

    DeLano, Frank A.; Hoyt, David B.; Schmid-Schönbein, Geert W.

    2015-01-01

    Shock, sepsis, and multiorgan failure are associated with inflammation, morbidity, and high mortality. The underlying pathophysiological mechanism is unknown, but evidence suggests that pancreatic enzymes in the intestinal lumen autodigest the intestine and generate systemic inflammation. Blocking these enzymes in the intestine reduces inflammation and multiorgan dysfunction. We investigated whether enzymatic blockade also reduces mortality after shock. Three rat shock models were used here: hemorrhagic shock, peritonitis shock induced by placement of cecal material into the peritoneum, and endotoxin shock. One hour after initiation of hemorrhagic, peritonitis, or endotoxin shock, animals were administered one of three different pancreatic enzyme inhibitors—6-amidino-2-naphtyl p-guanidinobenzoate di-methanesulfate, tranexamic acid, or aprotinin—into the lumen of the small intestine. In all forms of shock, blockade of digestive proteases with protease inhibitor attenuated entry of digestive enzymes into the wall of the intestine and subsequent autodigestion and morphological damage to the intestine, lung, and heart. Animals treated with protease inhibitors also survived in larger numbers than untreated controls over a period of 12 weeks. Surviving animals recovered completely and returned to normal weight within 14 days after shock. The results suggest that the active and concentrated digestive enzymes in the lumen of the intestine play a central role in shock and multi-organ failure, which can be treated with protease inhibitors that are currently available for use in the clinic. PMID:23345609

  16. Memantine elicits spinal blockades of motor function, proprioception, and nociception in rats.

    Science.gov (United States)

    Chen, Yu-Wen; Chiu, Chong-Chi; Liu, Kuo-Sheng; Hung, Ching-Hsia; Wang, Jhi-Joung

    2015-12-01

    Although memantine blocks sodium currents and produces local skin anesthesia, spinal anesthesia with memantine is unknown. The purpose of the study was to evaluate the local anesthetic effect of memantine in spinal anesthesia and its comparison with a widely used local anesthetic lidocaine. After intrathecally injecting the rats with five doses of each drug, the dose-response curves of memantine and lidocaine were constructed. The potencies of the drugs and durations of spinal anesthetic effects on motor function, proprioception, and nociception were compared with those of lidocaine. We showed that memantine produced dose-dependent spinal blockades in motor function, proprioception, and nociception. On a 50% effective dose (ED50 ) basis, the rank of potency was lidocaine greater than memantine (P < 0.05 for the differences). At the equipotent doses (ED25 , ED50 , ED75 ), the block duration produced by memantine was longer than that produced by lidocaine (P < 0.05 for the differences). Memantine, but not lidocaine, displayed more sensory/nociceptive block than motor block. The preclinical data demonstrated that memantine is less potent than lidocaine, whereas memantine produces longer duration of spinal anesthesia than lidocaine. Memantine shows a more sensory-selective action over motor blockade. © 2015 Société Française de Pharmacologie et de Thérapeutique.

  17. Unexpected High Sensory Blockade during Continuous Spinal Anesthesiology (CSA in an Elderly Patient

    Directory of Open Access Journals (Sweden)

    R. Ketelaars

    2012-01-01

    Full Text Available A 98-year-old woman presented for a hemiarthroplasty of the left hip. Because of her age and cardiac and pulmonary co-existing diseases we decided to provide adequate regional anesthesia by continuous spinal anesthesia. Fragmented doses of isobaric bupivacaine 0.5% were administered through a system consisting of a spinal catheter connected to an antimicrobial filter. After an uneventful surgical procedure, prior to removal of the catheter, this system was flushed with 10 mL of normal saline in order to try to prevent post-dural-puncture headache. After arrival at the postanesthesia care unit and fifteen minutes after removal of the catheter the patient suffered an unexpected high thoracic sensory blockade and hypotension requiring treatment. The continuous spinal anesthesia technique can be used in selected cases to be able to administer local anesthetic agents in a slow and controlled manner to reach the desired effect. The risk of post-dural-puncture headache using this technique in elderly patients is very low and therefore precludes the need to try to prevent it. We have described a potentially dangerous complication of flushing a bupivacaine-filled system into the spinal canal of an elderly patient resulting in an undesirable high sensory blockade.

  18. Blockade of NR2A-Containing NMDA Receptors Induces Tau Phosphorylation in Rat Hippocampal Slices

    Directory of Open Access Journals (Sweden)

    Julie Allyson

    2010-01-01

    Full Text Available Physiological activation of the N-methyl-D-aspartate (NMDA subtype of glutamate receptors has been proposed to play a key role in both neuronal cell function and dysfunction. In the present study, we used selective NMDA receptor antagonists to investigate the involvement of NR2A and NR2B subunits in the modulatory effect of basal NMDA receptor activity on the phosphorylation of Tau proteins. We observed, in acute hippocampal slice preparations, that blockade of NR2A-containing NMDA receptors by the NR2A antagonist NVP-AAM077 provoked the hyperphosphorylation of a residue located in the proline-rich domain of Tau (i.e., Ser199. This effect seemed to be Ser199 specific as there was no increase in phosphorylation at Ser262 and Ser409 residues located in the microtubule-binding and C-terminal domains of Tau proteins, respectively. From a mechanistic perspective, our study revealed that blockade of NR2A-containing receptors influences Tau phosphorylation probably by increasing calcium influx into neurons, which seems to rely on accumulation of new NR1/NR2B receptors in neuronal membranes and could involve the cyclin-dependent kinase 5 pathway.

  19. Graft-versus-host disease is enhanced by selective CD73 blockade in mice.

    Directory of Open Access Journals (Sweden)

    Long Wang

    Full Text Available CD73 functions as an ecto-5'-nucleotidase to produce extracellular adenosine that has anti-inflammatory and immunosuppressive activity. We here demonstrate that CD73 helps control graft-versus-host disease (GVHD in mouse models. Survival of wild-type (WT recipients of either allogeneic donor naïve CD73 knock-out (KO or WT T cells was similar suggesting that donor naïve T cell CD73 did not contribute to GVHD. By contrast, donor CD73 KO CD4(+CD25(+ regulatory T cells (Treg had significantly impaired ability to mitigate GVHD mortality compared to WT Treg, suggesting that CD73 on Treg is critical for GVHD protection. However, compared to donor CD73, recipient CD73 is more effective in limiting GVHD. Pharmacological blockade of A2A receptor exacerbated GVHD in WT recipients, but not in CD73 KO recipients, suggesting that A2 receptor signaling is primarily implicated in CD73-mediated GVHD protection. Moreover, pharmacological blockade of CD73 enzymatic activity induced stronger alloreactive T cell activity, worsened GVHD and enhanced the graft-versus-leukemia (GVL effect. These findings suggest that both donor and recipient CD73 protects against GVHD but also limits GVL effects. Thus, either enhancing or blocking CD73 activity has great potential clinical application in allogeneic bone marrow transplants.

  20. Collective state synthesis in an optical cavity using Rydberg atom dipole blockade

    International Nuclear Information System (INIS)

    Kumar, Santosh; Sheng, Jiteng; Sedlacek, Jonathon A; Fan, Haoquan; Shaffer, James P

    2016-01-01

    We investigate the coherent manipulation of interacting Rydberg atoms placed inside a high-finesse optical cavity for the deterministic preparation of strongly coupled light-matter systems. We consider a four-level diamond scheme with one common Rydberg level for N interacting atoms. One side of the diamond is used to excite the atoms into a collective ‘superatom’ Rydberg state using either π-pulses or stimulated Raman adiabatic passage (STIRAP) pulses. The upper transition on the other side of the diamond is used to transfer the collective state to one that is coupled to a field mode of an optical cavity. Due to the strong interaction between the atoms in the Rydberg level, the Rydberg blockade mechanism plays a key role in the deterministic quantum state synthesis of the atoms in the cavity. We use numerical simulation to show that non-classical states of light can be generated and that the state that is coupled to the cavity field is a collective one. We also investigate how different decay mechanisms affect this interacting many-body system. We also analyze our system in the case of two Rydberg excitations within the blockade volume. The simulations are carried out with parameters corresponding to realizable high-finesse optical cavities and alkali atoms like rubidium. (paper)

  1. Blockade of vascular adhesion protein-1 inhibits lymphocyte infiltration in rat liver allograft rejection.

    Science.gov (United States)

    Martelius, Timi; Salaspuro, Ville; Salmi, Marko; Krogerus, Leena; Höckerstedt, Krister; Jalkanen, Sirpa; Lautenschlager, Irmeli

    2004-12-01

    Vascular adhesion protein-1 (VAP-1) has been shown to mediate lymphocyte adhesion to endothelia at sites of inflammation, but its functional role in vivo has not been tested in any rodent model. Here we report the effects of VAP-1 blockade on rat liver allograft rejection. BN recipients of PVG liver allografts (known to develop acute rejection by day 7) were treated with 2 mg/kg anti-VAP-1 (a new anti-rat VAP-1 mAb 174-5) or isotype-matched irrelevant antibody (NS1) every other day (n = 6/group) and one group with anti-VAP-1 2 mg/kg daily (n = 7). On day 7, samples were collected for transplant aspiration cytology, histology, and immunohistochemistry. Lymphocyte infiltration to the graft was clearly affected by VAP-blockade. The total inflammation, mainly the number of active lymphoid cells, in transplant aspiration cytology was significantly decreased in animals treated with anti-VAP-1 (4.7 +/- 1.0 and 2.4 +/- 1.0 corrected increment units, respectively) compared to control (6.6 +/- 1.0) (P VAP-1 plays an important role in lymphocyte infiltration to sites of inflammation, and, in particular, liver allograft rejection.

  2. Effects of Mineralocorticoid Receptors Blockade on FearMemory Reconsolidation in Rats

    Directory of Open Access Journals (Sweden)

    Abbas Ali Vafaei

    2011-08-01

    Full Text Available Reconsolidation memory is defined as a process in which the retrieval of a previously consolidated memory returns to a labile state which is then subject to stabilization. Previous studies have shown that mineralocorticoid receptors (MRs modulate distinct phases of learning and memory, which display a high concentration and distinct distribution in the hippocampus. Moreover, we found no studies that examined the role of hippocampal MRs in fear memory reconsolidation. Here, we investigated the effect of MRs blockade on fear memory reconsolidation in rats. Additionally, to test whether blockade of protein synthesis would disrupt fear memory reconsolidation in our paradigm, we tested the effect of cycloheximide, an inhibitor of protein synthesis after memory reactivation. Results indicated that systemic as well as intra-hippocampal administrations of the MR antagonist spironolactone immediately following memory reactivation did not affect on post-retrieval long-term memory. Cycloheximide given after the reactivation treatment produced a strong impairment that persisted over test sessions. These findings indicate that MRs are not required for reconsolidation of fear-based memory.

  3. Age dependence of the rapid antidepressant and synaptic effects of acute NMDA receptor blockade

    Directory of Open Access Journals (Sweden)

    Elena eNosyreva

    2014-12-01

    Full Text Available Ketamine is a NMDA receptor antagonist that produces rapid antidepressant responses in individuals with major depressive disorder. The antidepressant action of ketamine has been linked to blocking NMDA receptor activation at rest, which inhibits eukaryotic elongation factor2 kinase leading to desuppression of protein synthesis and synaptic potentiation in the CA1 region of the hippocampus. Here, we investigated ketamine mediated antidepressant response and the resulting synaptic potentiation in juvenile animals. We found that ketamine did not produce an antidepressant response in juvenile animals in the novelty suppressed feeding or the forced swim test. In addition ketamine application failed to trigger synaptic potentiation in hippocampal slices obtained from juvenile animals, unlike its action in slices from older animals (6-9 weeks old. The inability of ketamine to trigger an antidepressant response or subsequent synaptic plasticity processes suggests a developmental component to ketamine mediated antidepressant efficacy. We also show that the NMDAR antagonist AP5 triggers synaptic potentiation in mature hippocampus similar to the action of ketamine, demonstrating that global competitive blockade of NMDA receptors is sufficient to trigger this effect. These findings suggest that global blockade of NMDA receptors in developmentally mature hippocampal synapses are required for the antidepressant efficacy of ketamine.

  4. Effect of mineralocorticoid receptor blockade on hippocampal-dependent memory in adults with obesity.

    Science.gov (United States)

    Rotenstein, Lisa S; Sheridan, Margaret; Garg, Rajesh; Adler, Gail K

    2015-06-01

    The hippocampus is crucial for paired-associate learning. Obesity is associated with increased mineralocorticoid receptor (MR) activity in peripheral and possibly central tissues, decreased hippocampal size in humans, and impaired hippocampal learning in rodents. The MR is expressed in hippocampal neurons, and MR blockade improves hippocampal learning in obese animals. The goal of the study was to determine whether MR blockade would modulate paired-associate learning in men and women with obesity. Men and women ages 20-61 years with BMI between 30-45 kg/m(2) were randomly assigned to placebo (n = 11; 7 women) or 50 mg spironolactone daily (n = 12; 7 women) for six weeks. At baseline and post-treatment, subjects underwent a clinical and hormonal evaluation. They also underwent a computerized task that assesses paired-associate learning and has been shown by functional magnetic resonance imaging to activate the hippocampus. In an ANCOVA model that adjusted for baseline paired-associate learning, age, and race, spironolactone treatment was associated with a significant (P = 0.043) improvement in hippocampal memory as compared to placebo treatment. Our findings demonstrate, for the first time, that blocking MR with chronic, low-dose spironolactone treatment improves paired-associate learning in individuals with obesity, suggesting that MR activation contributes to hippocampal memory modulation in humans. © 2015 The Obesity Society.

  5. Need for beta-blockade in hypertension reduced with long-term minoxidil.

    Science.gov (United States)

    Brunner, H R; Jaeger, P; Ferguson, R K; Jequier, E; Turini, G; Gavras, H

    1978-01-01

    Sequential changes in plasma renin activity and urinary aldosterone and noradrenaline were assessed in eight patients with severe hypertension after minoxidil had been added to their treatment. Doses of 2.5--27.5 (mean 12.5) mg/day reduced the mean blood pressure from 166/113 +/-6/2 mm Hg to 124/88+/-4/2 mm Hg in one week. Plasma renin activity and urinary aldosterone and noradrenaline increased twofold to threefold initially but returned to baseline values within two to three weeks and remained unchanged during a mean follow-up of 5.1 months. Beta-blocking drugs were then withdrawn slowly in six patients without adverse effects, though blood pressure and heart rate increased in three patients, who required minimal doses of beta-blockers. Plasma renin activity and urinary aldosterone and noradrenaline did not change significantly after beta-blockade had been stopped. We conclude that the need for beta-blockade is greatly reduced with long-term minoxidil treatment and that it may be unnecessary in some patients. PMID:28811

  6. Circulatory and metabolic effects of alpha-adrenergic blockade in the hyperinsulinemic ovine fetus.

    Science.gov (United States)

    Stonestreet, B S; Boyle, L D; Papparella, A; Berard, D J

    1996-01-01

    Fetuses of diabetic women exhibit hypoxemia, elevated catecholamine concentrations at birth, and increased incidence of death. Our previous findings suggested that experimental fetal hyperinsulinemia results in a surge in catecholamines with cardiovascular changes supported by increased beta-adrenergic activity. The present experiments were designed to assess the contribution of alpha-adrenergic stimulation to the hemodynamic changes in the hyperinsulinemic ovine fetus. Combined ventricular output, regional organ blood flow, vascular resistance, metabolism, and catecholamine concentrations were measured before and during an infusion of insulin and during continued infusion with alpha-adrenergic blockade (phentolamine) in eight chronically catheterized fetal sheep. Fetal insulin infusion produced hyperinsulinemic-hypoglycemia, a surge in epinephrine and norepinephrine concentration, and increases in the combined ventricular output (blood flow to the fetus plus placenta) and regional blood flow to the fetus, heart, stomach, gastrointestinal tract, fat, and carcass. In the hyperinsulinemic state, alpha-adrenergic blockade was associated with additional increases in fetal norepinephrine concentration and no major changes in combined ventricular output or blood flow to the body of the fetus, except for decreased blood flow to the stomach and lungs, and a decrease in stroke volume. Because vasodilation characterizes the hyperinsulinemic state, alpha-adrenergic stimulation contributes less to compensatory cardiovascular changes in the hyperinsulinemic fetus than that which we previously have shown for beta-adrenergic stimulation.

  7. Dissipation-induced dipole blockade and antiblockade in driven Rydberg systems

    Science.gov (United States)

    Young, Jeremy T.; Boulier, Thomas; Magnan, Eric; Goldschmidt, Elizabeth A.; Wilson, Ryan M.; Rolston, Steven L.; Porto, James V.; Gorshkov, Alexey V.

    2018-02-01

    We study theoretically and experimentally the competing blockade and antiblockade effects induced by spontaneously generated contaminant Rydberg atoms in driven Rydberg systems. These contaminant atoms provide a source of strong dipole-dipole interactions and play a crucial role in the system's behavior. We study this problem theoretically using two different approaches. The first is a cumulant expansion approximation, in which we ignore third-order and higher connected correlations. Using this approach for the case of resonant drive, a many-body blockade radius picture arises, and we find qualitative agreement with previous experimental results. We further predict that as the atomic density is increased, the Rydberg population's dependence on Rabi frequency will transition from quadratic to linear dependence at lower Rabi frequencies. We study this behavior experimentally by observing this crossover at two different atomic densities. We confirm that the larger density system has a smaller crossover Rabi frequency than the smaller density system. The second theoretical approach is a set of phenomenological inhomogeneous rate equations. We compare the results of our rate-equation model to the experimental observations [E. A. Goldschmidt et al., Phys. Rev. Lett. 116, 113001 (2016), 10.1103/PhysRevLett.116.113001] and find that these rate equations provide quantitatively good scaling behavior of the steady-state Rydberg population for both resonant and off-resonant drives.

  8. Does perioperative tactile evaluation of the train-of-four response influence the frequency of postoperative residual neuromuscular blockade?

    DEFF Research Database (Denmark)

    Pedersen, T; Viby-Mogensen, J; Bang, U

    1990-01-01

    The authors conducted a randomized controlled clinical trial to evaluate the usefulness of perioperative manual evaluation of the response to train-of-four (TOF) nerve stimulation. A total of 80 patients were divided into four groups of 20 each. For two groups (one given vecuronium and one...... pancuronium), the anesthetists assessed the degree of neuromuscular blockade during operation and during recovery from neuromuscular blockade by manual evaluation of the response to TOF nerve stimulation. In the other two groups, one of which received vecuronium and the other pancuronium, the anesthetists...

  9. CT-guided injection for ganglion impar blockade: a radiological approach to the management of coccydynia

    Energy Technology Data Exchange (ETDEWEB)

    Datir, A., E-mail: apdatir@gmail.co [Jackson Memorial Hospital, Miami, FL (United States); Connell, D. [Royal National Orthopaedic Hospital NHS Trust, Stanmore, Middlesex (United Kingdom)

    2010-01-15

    Aim: To evaluate the role of computed tomography (CT) in needle placement for ganglion impar blocks, and to determine the efficacy of CT-guided ganglion impar blocks in the management of coccydynia. Materials and methods: The results of ganglion impar blockade in eight patients with coccydynia secondary to trauma or unknown cause were reviewed. The diagnosis of coccydynia was based on clinical history, location of pain, and response to previous diagnostic and therapeutic procedures. The eight patients were treated with CT-guided ganglion impar blocks to manage their coccyx pain after conservative procedures, including oral medication and cushions, failed to provide relief. All patients were subjected to ganglion impar blocks under a thin-section CT-guided technique for needle placement, using a mixture of bupivacaine and triamcinolone. The patients were followed-up for a period of 6-months. Results: Eight patients were treated in this study with a total of 11 injections. A technical success of 100% was achieved in all cases with accurate needle placement without any complications and all the patients tolerated the procedure well. Out of eight, three patients (37%) had complete relief of pain on the follow-up intervals up to 6 months. Three out of eight patients (37%), had partial relief of symptoms and a second repeat injection was given at the 3 month interval of the follow-up period. At the end of the 6-month follow-up period, six out of eight patients (75%) experienced symptomatic relief (four complete relief and two partial relief) without any additional resort to conventional pain management. Twenty-five percent (two out of eight) did not have any symptomatic improvement. The mean visual analogue score (VAS) pre-procedure was 8 (range 6-10) and had decreased to 2 (range 0-5) in six out of eight patients. Conclusion: CT can be used as an imaging method to identify the ganglion and guide the needle in ganglion impar blockade. The advantages of CT

  10. Muscle-type nicotinic receptor blockade by diethylamine, the hydrophilic moiety of lidocaine

    Directory of Open Access Journals (Sweden)

    Armando eAlberola-Die

    2016-02-01

    Full Text Available Lidocaine bears in its structure both an aromatic ring and a terminal amine, which can be protonated at physiological pH, linked by an amide group. Since lidocaine causes multiple inhibitory actions on nicotinic acetylcholine receptors (nAChRs, this work was aimed to determine the inhibitory effects of diethylamine (DEA, a small molecule resembling the hydrophilic moiety of lidocaine, on Torpedo marmorata nAChRs microtransplanted to Xenopus oocytes. Similarly to lidocaine, DEA reversibly blocked acetylcholine-elicited currents (IACh in a dose-dependent manner (IC50 close to 70 μM, but unlike lidocaine, DEA did not affect IACh desensitization. IACh inhibition by DEA was more pronounced at negative potentials, suggesting an open-channel blockade of nAChRs, although roughly 30% inhibition persisted at positive potentials, indicating additional binding sites outside the pore. DEA block of nAChRs in the resting state (closed channel was confirmed by the enhanced IACh inhibition when pre-applying DEA before its co-application with ACh, as compared with solely DEA and ACh co-application. Virtual docking assays provide a plausible explanation to the experimental observations in terms of the involvement of different sets of drug binding sites. So, at the nAChR transmembrane (TM domain, DEA and lidocaine shared binding sites within the channel pore, giving support to their open-channel blockade; besides, lidocaine, but not DEA, interacted with residues at cavities among the M1, M2, M3 and M4 segments of each subunit and also at intersubunit crevices. At the extracellular (EC domain, DEA and lidocaine binding sites were broadly distributed, which aids to explain the closed channel blockade observed. Interestingly, some DEA clusters were located at the α-γ interphase of the EC domain, in a cavity near the orthosteric binding site pocket; by contrast, lidocaine contacted with all α-subunit loops conforming the ACh binding site, both in α-γ and

  11. Promoting industrialisation

    International Nuclear Information System (INIS)

    Hayfield, F.

    1986-04-01

    When the first nuclear power programme is decided upon, automatically the country has to initiate in parallel a programme to modify or add to its current industrial structure and resources. The extent of this new industrialisation depends upon many factors which both, the Government and the Industries have to consider. The Government has a vital role which includes the setting up of the background against which the industrial promotion should take place and in many cases may have also to play an active role all along this programme. Equally, the existing industries have an important role so as to achieve the most efficient participation in the nuclear programme. Invariably the industrial promotional programme will incur a certain degree of transfer of technology, the extent depending on the policies adopted. For this technology transfer to take place efficiently, both the donor and the receiver have to recognise each other's legitimate ambitions and fears. The transfer of technology is a process having a high human content and both donor and receiver have to take this into account. This can be further complicated when there is a difference in culture between them. Technology transfer is carried out within a contractual and organisational framework which will identify the donor (licensor) and the receiver (licensee). This framework may take various forms from a simple cooperative agreement, through a joint-venture organisation right to a standard contract between two separate entities. Each arrangement has its advantages and drawbacks and requires investment of different degrees. One of the keys to a successful industrial promotion is having it carried out in a timely fashion which will be parallel with the nuclear power programme. Experience in some countries has shown the problems when the industrialisation is out of phase with the programme whilst in other cases this industrialisation was at a level and scale unjustified. (author)

  12. Effects of angiotensin II and angiotensin II type 1 receptor blockade on neointimal formation after stent implantation

    NARCIS (Netherlands)

    Groenewegen, Hendrik C.; van der Harst, Pim; Roks, Anton J. M.; Buikema, Hendrik; Zijlstra, Felix; van Gilst, Wiek H.; de Smet, Bart J. G. L.

    2008-01-01

    Background: To evaluate the effect of supraphysiological levels of angiotensin II and selective angiotensin II type 1 receptor ( AT1-receptor) blockade on neointimal formation and systemic endothelial function after stent implantation in the rat abdominal aorta. Methods: Male Wistar rats were

  13. Blockade of Ca2+-activated K+ channels in T cells: an option for the treatment of multiple sclerosis?

    DEFF Research Database (Denmark)

    Madsen, Lars Siim; Christophersen, Palle; Olesen, Søren-Peter

    2005-01-01

    Voltage- and Ca(2+)-dependent K(+) channels in the membrane of both T and B lymphocytes are important for the cellular immune response. In the current issue of the European Journal of Immunology, Reich et al. demonstrate that selective blockade of the intermediate-conductance Ca(2+)-activated K(+...... of new immune-suppressant drugs for the treatment of autoimmune diseases....

  14. Neuropathogenesis of Zika Virus in a Highly Susceptible Immunocompetent Mouse Model After Antibody Blockade of Type I Interferon

    Science.gov (United States)

    2016-12-12

    46. Sheehan KC, Lazear HM, Diamond MS, Schreiber RD (2015) Selective Blockade of Interferon-alpha and -beta Reveals Their Non-Redundant Functions ...4: 229-237. 49. Ito D, Imai Y, Ohsawa K, Nakajima K, Fukuuchi Y, et al. (1998) Microglia-specific 750 localisation of a novel calcium binding

  15. Individual titration for maximal blockade of the renin-angiotensin system in proteinuric patients: A feasible strategy?

    NARCIS (Netherlands)

    Vogt, Liffert; Navis, Ger Jan; de Zeeuw, Dick

    2005-01-01

    Agents that interfere with the renin-angiotensin system (RAS) reduce proteinuria and afford renal protection. The combination of different measures that serve maximization of RAS blockade is thought to improve the antiproteinuric efficacy. The feasibility and the efficacy of such a combination

  16. Individual titration for maximal blockade of the renin-angiotensin system in proteinuric patients: a feasible strategy?

    NARCIS (Netherlands)

    Vogt, Liffert; Navis, Gerjan; de Zeeuw, Dick

    2005-01-01

    Agents that interfere with the renin-angiotensin system (RAS) reduce proteinuria and afford renal protection. The combination of different measures that serve maximization of RAS blockade is thought to improve the antiproteinuric efficacy. The feasibility and the efficacy of such a combination

  17. Sugammadex 4.0 mg kg-1 reversal of deep rocuronium-induced neuromuscular blockade

    DEFF Research Database (Denmark)

    Yu, Buwei; Wang, Xiangrui; Hansen, Søren Helbo

    2014-01-01

    Objective: Maintenance of deep Neuro Muscular Blockade (NMB) until the end of surgery may be beneficial in some surgical procedures. The selective relaxant binding agent sugammadex rapidly reverses deep levels of rocuronium-induced NMB. The purpose of this study was to evaluate the efficacy and s...

  18. Value of the addition of Amlodipine to atenolol in patients with angina pectoris despite adequate beta blockade

    NARCIS (Netherlands)

    Dunselman, PHJM; Bouwens, LHM; Herweijer, AH; Bernink, PJLM

    1998-01-01

    Anginal patients who remain symptomatic despite optimally dosed beta blockade may also be given dihydropyridine calcium antagonists. This treatment regimen was examined in a double-blind parallel, randomized, controlled study in 147 patients with angina and positive bicycle exercise tests despite

  19. Effects of sodium restriction and hydrochlorothiazide on RAAS blockade efficacy in diabetic nephropathy : a randomised clinical trial

    NARCIS (Netherlands)

    Kwakernaak, Arjan J.; Krikken, Jan A.; Binnenmars, S. Heleen; Visser, Folkert W.; Hemmelder, Marc H.; Woittiez, Arend-Jan; Groen, Henk; Laverman, Gozewijn D.; Navis, Gerjan

    Background Reduction of dietary sodium intake or diuretic treatment increases renin-angiotensin-aldosterone system (RAAS) blockade efficacy in non-diabetic nephropathy. We aimed to investigate the effect of sodium restriction and the diuretic hydrochlorothiazide, separately and in combination, added

  20. Women at Altitude: Effects of Menstrual Cycle Phase and Alpha-Adrenergic Blockade on High Altitude Acclimatization

    Science.gov (United States)

    1999-10-01

    and venous tone. Alpha 1-adrenergic blockade with prazosin attenuated the rise in SNS activity at 4,300 m and prevented the increase in PNS activity in...Physiol 1991;70(3):1129-36. 4. Zamudio S., S.K. Palmer, T.E. Dahms, et al. Blood volume expansion, preeclampsia , and infant birth weight at high altitude

  1. Tissue polypeptide-specific antigen (TPS) determinations before and during intermittent maximal androgen blockade in patients with metastatic prostatic carcinoma

    NARCIS (Netherlands)

    Kil, P. J. M.; Goldschmidt, H. M. J.; Wieggers, B. J. A.; Kariakine, O. B.; Studer, U. E.; Whelan, P.; Hetherington, J.; de Reijke, Th M.; Hoekstra, J. W.; Collette, L.

    2003-01-01

    To evaluate the prognostic significance of serially measured tissue polypeptide-specific antigen (TPS) levels in patients with metastatic prostatic carcinoma treated with intermittent maximal androgen blockade (MAB). To determine its value with respect to predicting response to treatment and time to

  2. Systemic MCP1/CCR2 blockade and leukocyte specific MCP1/CCR2 inhibition affect aortic aneurysm formation differently

    NARCIS (Netherlands)

    de Waard, Vivian; Bot, Ilze; de Jager, Saskia C. A.; Talib, Sara; Egashira, Kensuke; de Vries, Margreet R.; Quax, Paul H. A.; Biessen, Erik A. L.; van Berkel, Theo J. C.

    2010-01-01

    Objective: CCR2, the receptor for monocyte chemoattractant protein 1 (MCP1), is involved in atherosclerosis and abdominal aortic aneurysms (AAAs). Here, we explored the potential beneficial blockade of the MCP1/CCR2 pathway. Methods: We applied an AAA model in aging apolipoprotein E deficient mice

  3. Anti-PD-1 Blockade and Stereotactic Radiation Produce Long-Term Survival in Mice With Intracranial Gliomas

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Jing [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); See, Alfred P.; Phallen, Jillian; Jackson, Christopher M.; Belcaid, Zineb; Ruzevick, Jacob [Department of Neurosurgery, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); Durham, Nicholas [Department of Immunology, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); Meyer, Christian [Department of Oncology, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); Harris, Timothy J. [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); Albesiano, Emilia; Pradilla, Gustavo [Department of Neurosurgery, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); Ford, Eric; Wong, John [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); Hammers, Hans-Joerg [Department of Immunology, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); Mathios, Dimitris; Tyler, Betty; Brem, Henry [Department of Neurosurgery, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); Tran, Phuoc T. [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); Pardoll, Drew; Drake, Charles G. [Department of Immunology, Johns Hopkins Medical Institutes, Baltimore, Maryland (United States); and others

    2013-06-01

    Purpose: Glioblastoma multiforme (GBM) is the most common primary brain tumor in adults, and radiation is one of the main treatment modalities. However, cure rates remain low despite best available therapies. Immunotherapy is a promising modality that could work synergistically with radiation, which has been shown to increase antigen presentation and promote a proinflammatory tumor microenvironment. Programmed-death-1 (PD-1) is a surface receptor expressed on activated and exhausted T cells, which mediate T cell inhibition upon binding with its ligand PD-L1, expressed on many tumor types including human GBMs. We tested the combination of anti-PD-1 immunotherapy with stereotactic radiosurgery in a mouse orthotopic GBM model. Methods and Materials: We performed intracranial implantation of mouse glioma cell line GL261 transfected with luciferase into C57BL/6 mice. Mice were stratified into 4 treatment groups: (1) control; (2) radiation only; (3) anti-PD-1 antibody only; and (4) radiation plus anti-PD-1 antibody. Overall survival was quantified. The mice were killed on day 21 after implantation to assess immunologic parameters in the brain/tumor, cervical lymph nodes, and spleen. Results: Improved survival was demonstrated with combination anti-PD-1 therapy plus radiation compared with either modality alone: median survival was 25 days in the control arm, 27 days in the anti-PD-1 antibody arm, 28 days in the radiation arm, and 53 days in the radiation plus anti-PD-1 therapy arm (P<.05 by log-rank Mantle-Cox). Long-term survival was seen only in the combined treatment arm, with a fraction (15%-40%) of animals alive at day 180+ after treatment. Immunologic data on day 21 after implantation showed increased tumor infiltration by cytotoxic T cells (CD8+/interferon-γ+/tumor necrosis factor-α+) and decreased regulatory T cells (CD4+/FOXP3) in the combined treatment group compared with the single modality arms. Conclusions: The combination of PD-1 blockade and localized

  4. Transition from the Kondo effect to a Coulomb blockade in an electron shuttle

    International Nuclear Information System (INIS)

    Zhang Rong; Chu Wei-Dong; Duan Su-Qing; Yang Ning

    2013-01-01

    We investigate the effect of the mechanical motion of a quantum dot on the transport properties of a quantum dot shuttle. Employing the equation of motion method for the nonequilibrium Green's function, we show that the oscillation of the dot, i.e., the time-dependent coupling between the dot's electron and the reservoirs, can destroy the Kondo effect. With the increase in the oscillation frequency of the dot, the density of states of the quantum dot shuttle changes from the Kondo-like to a Coulomb-blockade pattern. Increasing the coupling between the dot and the electrodes may partly recover the Kondo peak in the spectrum of the density of states. Understanding of the effect of mechanical motion on the transport properties of an electron shuttle is important for the future application of nanoelectromechanical devices

  5. Blockade of leukotriene production by a single oral dose of MK-0591 in active ulcerative colitis

    DEFF Research Database (Denmark)

    Hillingsø, Jens; Kjeldsen, J; Laursen, L S

    1995-01-01

    -ethyl)thio)-5(quinolin+ ++-2ylmethyl-oxy)-1H-indol-2yl)-2,2-dimethyl-propanoate) exerts its effect by binding to the 5-lipoxygenase activating protein, thereby inhibiting the translocation and activation of 5-lipoxygenase. METHODS: Concentrations of leukotriene B4 (LTB4) and prostaglandin E2 (PGE2) in rectal...... that a single oral 250 mg dose of MK-0591 results in nearly complete blockade of systemic leukotriene production and LTB4 formation in the target tissue of inflammation (the rectum). Controlled multiple-dose trials to assess the clinical efficacy of this novel 5-lipoxygenase-activating protein inhibitor seem......BACKGROUND: 5-Lipoxygenase products of arachidonic acid metabolism are thought to play a central role in the secondary amplification of the inflammatory response in a number of human inflammatory diseases, such as ulcerative colitis. MK-0591 (3-(1((4-chlorophenyl)methyl)-3((1,1-dimethyl...

  6. Renoprotective effects of angiotensin II receptor blockade in type 1 diabetic patients with diabetic nephropathy

    DEFF Research Database (Denmark)

    Andersen, S; Tarnow, L; Rossing, P

    2000-01-01

    BACKGROUND: Angiotensin I-converting enzyme (ACE) inhibitors reduce angiotensin II formation and induce bradykinin accumulation. Animal studies suggest that bradykinin may play a role for the effects of ACE inhibition on blood pressure and kidney function. Therefore, we compared the renal and hem...... inhibition is primarily caused by interference in the renin-angiotensin system. Our study suggest that losartan represents a valuable new drug in the treatment of hypertension and proteinuria in type 1 diabetic patients with diabetic nephropathy....... and hemodynamic effects of specific intervention in the renin-angiotensin system by blockade of the angiotensin II subtype-1 receptor to the effect of ACE inhibition. METHODS: A randomized, double-blind, cross-over trial was performed in 16 type 1 diabetic patients (10 men), age 42 +/- 2 years (mean +/- SEM...

  7. Protocol for high-fidelity readout in the photon-blockade regime of circuit QED

    Science.gov (United States)

    Ginossar, E.; Bishop, Lev S.; Schuster, D. I.; Girvin, S. M.

    2010-08-01

    The driven-damped Jaynes-Cummings model in the regime of strong coupling is found to exhibit a coexistence between the quantum photon blockaded state and a quasicoherent bright state. We characterize the slow time scales and the basin of attraction of these metastable states using full quantum simulations. This form of bistability can be useful for implementing a qubit readout scheme that does not require additional circuit elements. We propose a coherent control sequence that makes use of a simple linear chirp of drive amplitude and frequency as well as qubit frequency. By optimizing the parameters of the system and the control pulse, we demonstrate theoretically very high readout fidelities (>98%) and high contrast with experimentally realistic parameters for qubits implemented in the circuit QED architecture.

  8. Multiple logic functions from extended blockade region in a silicon quantum-dot transistor

    International Nuclear Information System (INIS)

    Lee, Youngmin; Lee, Sejoon; Im, Hyunsik; Hiramoto, Toshiro

    2015-01-01

    We demonstrate multiple logic-functions at room temperature on a unit device of the Si single electron transistor (SET). Owing to the formation of the multi-dot system, the device exhibits the enhanced Coulomb blockade characteristics (e.g., large peak-to-valley current ratio ∼200) that can improve the reliability of the SET-based logic circuits. The SET displays a unique feature useful for the logic applications; namely, the Coulomb oscillation peaks are systematically shifted by changing either of only the gate or the drain voltage. This enables the SET to act as a multi-functional one-transistor logic gate with AND, OR, NAND, and XOR functions

  9. Neuromuscular blockade for optimising surgical conditions during abdominal and gynaecological surgery

    DEFF Research Database (Denmark)

    Madsen, M V; Staehr-Rye, A K; Gätke, M R

    2015-01-01

    . There is insufficient evidence to recommend an ideal level of NMB creating optimal surgical condition during laparotomy. CONCLUSION: Use of deep NMB in certain laparoscopic procedures may improve surgical conditions. In open abdominal surgery, use of NMB may optimise surgical conditions under certain circumstances.......BACKGROUND: The level of neuromuscular blockade (NMB) that provides optimal surgical conditions during abdominal surgery has not been well established. The aim of this systematic review was to evaluate current evidence on the use of neuromuscular blocking agents in order to optimise surgical...... conditions during laparoscopic procedures and open abdominal surgery. METHODS: A wide search was performed in PubMed, Cochrane library and Embase with systematic approach including PRISMA recommendations. Individual risk of bias was assessed and systematic data extraction were performed. RESULTS: Fifteen...

  10. Coulomb blockade effects in silicon nanoparticles embedded in thin silicon-rich oxide films.

    Science.gov (United States)

    Morales-Sánchez, A; Barreto, J; Domínguez, C; Aceves, M; Yu, Z; Luna-López, J A

    2008-04-23

    Silicon nanoparticles (Si-nps) embedded in silicon oxide matrix were created using silicon-rich oxide (SRO) films deposited by low pressure chemical vapour deposition (LPCVD) followed by a thermal annealing at 1100 °C. The electrical properties were studied using metal-oxide-semiconductor (MOS) structures with the SRO films as the active layers. Capacitance versus voltage (C-V) exhibited downward and upward peaks in the accumulation region related to charge trapping and de-trapping effects of Si-nps, respectively. Current versus voltage (I-V) measurements showed fluctuations in the form of spike-like peaks and a clear staircase at room temperature. These effects have been related to the Coulomb blockade (CB) effect in the silicon nanoparticles embedded in SRO films. The observed quantum effects are due to 1 nm nanoparticles.

  11. Transport through (Ga,Mn)As nanoislands: Coulomb blockade and temperature dependence of the conductance

    Science.gov (United States)

    Schlapps, Markus; Lermer, Teresa; Geissler, Stefan; Neumaier, Daniel; Sadowski, Janusz; Schuh, Dieter; Wegscheider, Werner; Weiss, Dieter

    2009-09-01

    We report on magnetotransport measurements of nanoconstricted (Ga,Mn)As devices showing very large resistance changes that can be controlled by both an electric and a magnetic field. Based on the bias voltage and temperature-dependent measurements down to the millikelvin range we compare the models currently used to describe transport through (Ga,Mn)As nanoconstrictions. We provide an explanation for the observed spin-valvelike behavior during a magnetic field sweep by means of the magnetization configurations in the device. Furthermore, we prove that Coulomb blockade plays a decisive role for the transport mechanism and show that modeling the constriction as a granular metal describes the temperature and bias dependence of the conductance correctly and allows to estimate the number of participating islands located in the constriction.

  12. Observation of Hopping and Blockade of Bosons in a Trapped Ion Spin Chain

    Science.gov (United States)

    Debnath, S.; Linke, N. M.; Wang, S.-T.; Figgatt, C.; Landsman, K. A.; Duan, L.-M.; Monroe, C.

    2018-02-01

    The local phonon modes in a Coulomb crystal of trapped ions can represent a Hubbard system of coupled bosons. We selectively prepare single excitations at each site and observe free hopping of a boson between sites, mediated by the long-range Coulomb interaction between ions. We then implement phonon blockades on targeted sites by driving a Jaynes-Cummings interaction on individually addressed ions to couple their internal spin to the local phonon mode. The resulting dressed states have energy splittings that can be tuned to suppress phonon hopping into the site. This new experimental approach opens up the possibility of realizing large-scale Hubbard systems from the bottom up with tunable interactions at the single-site level.

  13. Pauli-spin blockade in a vertical double quantum dot holding two to five electrons

    International Nuclear Information System (INIS)

    Kodera, T; Arakawa, Y; Tarucha, S; Ono, K; Amaha, S

    2009-01-01

    We use a vertical double quantum dot (QD) to study spin blockade (SB) for the two-to five-electron states. SB observed for the two- and four-electron states is both assigned to Pauli exclusion with formation of a spin triplet state, and lifted by singlet-triplet admixing due to fluctuating nuclear field. SB observed for the five-electron state is caused by combined Pauli effect and Hund's rule. We observe a hysteretic behavior of the SB leakage current for up and down sweep of magnetic field, and argue that SB and its lifting by hyperfine interaction are subtle with the spin configuration and modified depending on the inter-dot detuning and number of electrons.

  14. Overcoming Barriers in Oncolytic Virotherapy with HDAC Inhibitors and Immune Checkpoint Blockade

    Science.gov (United States)

    Marchini, Antonio; Scott, Eleanor M.; Rommelaere, Jean

    2016-01-01

    Oncolytic viruses (OVs) target and destroy cancer cells while sparing their normal counterparts. These viruses have been evaluated in numerous studies at both pre-clinical and clinical levels and the recent Food and Drug Administration (FDA) approval of an oncolytic herpesvirus-based treatment raises optimism that OVs will become a therapeutic option for cancer patients. However, to improve clinical outcome, there is a need to increase OV efficacy. In addition to killing cancer cells directly through lysis, OVs can stimulate the induction of anti-tumour immune responses. The host immune system thus represents a “double-edged sword” for oncolytic virotherapy: on the one hand, a robust anti-viral response will limit OV replication and spread; on the other hand, the immune-mediated component of OV therapy may be its most important anti-cancer mechanism. Although the relative contribution of direct viral oncolysis and indirect, immune-mediated oncosuppression to overall OV efficacy is unclear, it is likely that an initial period of vigorous OV multiplication and lytic activity will most optimally set the stage for subsequent adaptive anti-tumour immunity. In this review, we consider the use of histone deacetylase (HDAC) inhibitors as a means of boosting virus replication and lessening the negative impact of innate immunity on the direct oncolytic effect. We also discuss an alternative approach, aimed at potentiating OV-elicited anti-tumour immunity through the blockade of immune checkpoints. We conclude by proposing a two-phase combinatorial strategy in which initial OV replication and spread is maximised through transient HDAC inhibition, with anti-tumour immune responses subsequently enhanced by immune checkpoint blockade. PMID:26751469

  15. Blockade of Rennin-Angiotensin system blunts the fibrotic response in experimental acute pyelonephritis

    Directory of Open Access Journals (Sweden)

    Singal A

    2005-01-01

    Full Text Available Aim: To study the impact of Renin-Angiotensin system blockade in experimental acute pyelonephritis, induced by a novel surgical approach via dorsal lumbotomy incision. Materials and Methods : 45 Adult female WISTAR rats aged 8-12 weeks, underwent direct inoculation of 0.1 ml of E.coli suspension into the parenchyma of the surgically exposed kidney. 3 groups of rats were studied: Group A - treated with antibiotics only; Group B- Captopril and antibiotics and Group C- Losartan and antibiotics. Changes of acute inflammation, parenchymal destruction and scarring were compared between the groups on histopathological sections. Kruskal-Wallis test was used for statistical analysis. Results : Changes consistent with acute pyelonephritis were seen in all the kidneys. Mean% scar area in Group A, Group B and Group C was 37.08±1.79, 24.40±1.88 and 24.68±1.32% respectively at end of six weeks. Mean tubular density in Group A, B and C was 17.26±1.92, 47.18±3.00 and 47.00±5.08-tubules/lac mm2 respectively. The differences between the control and the treated animals were significant, though the results did not differ between the losartan and captopril treated rats. Conclusions : Dorsal lumbotomy approach to the kidney provides a good exposure of the kidney. Induction of acute pyelonephritis by direct inoculation of bacteria into renal cortex produced a consistent scar at 6 weeks. Blockade of renin angiotensin system by either captopril or losartan decreased the renal scar area by almost 1/3 at 6 weeks.

  16. Coronary responses to cold air inhalation following afferent and efferent blockade

    Science.gov (United States)

    Gao, Zhaohui; McQuillan, Patrick M.; Leuenberger, Urs A.; Sinoway, Lawrence I.

    2014-01-01

    Cardiac ischemia and angina pectoris are commonly experienced during exertion in a cold environment. In the current study we tested the hypotheses that oropharyngeal afferent blockade (i.e., local anesthesia of the upper airway with lidocaine) as well as systemic β-adrenergic receptor blockade (i.e., intravenous propranolol) would improve the balance between myocardial oxygen supply and demand in response to the combined stimulus of cold air inhalation (−15 to −30°C) and isometric handgrip exercise (Cold + Grip). Young healthy subjects underwent Cold + Grip following lidocaine, propranolol, and control (no drug). Heart rate, blood pressure, and coronary blood flow velocity (CBV, from Doppler echocardiography) were continuously measured. Rate-pressure product (RPP) was calculated, and changes from baseline were compared between treatments. The change in RPP at the end of Cold + Grip was not different between lidocaine (2,441 ± 376) and control conditions (3,159 ± 626); CBV responses were also not different between treatments. With propranolol, heart rate (8 ± 1 vs. 14 ± 3 beats/min) and RPP responses to Cold + Grip were significantly attenuated. However, at peak exercise propranolol also resulted in a smaller ΔCBV (1.4 ± 0.8 vs. 5.3 ± 1.4 cm/s, P = 0.035), such that the relationship between coronary flow and cardiac metabolism was impaired under propranolol (0.43 ± 0.37 vs. 2.1 ± 0.63 arbitrary units). These data suggest that cold air breathing and isometric exercise significantly influence efferent control of coronary blood flow. Additionally, β-adrenergic vasodilation may play a significant role in coronary regulation during exercise. PMID:24816257

  17. Naltrexone treatment for opioid dependence: does its effectiveness depend on testing the blockade?

    Science.gov (United States)

    Sullivan, Maria A; Bisaga, Adam; Mariani, John J; Glass, Andrew; Levin, Frances R; Comer, Sandra D; Nunes, Edward V

    2013-11-01

    FDA approval of long-acting injectable naltrexone (Vivitrol) for opioid dependence highlights the relevance of understanding mechanisms of antagonist treatment. Principles of learning suggest an antagonist works through extinguishing drug-seeking behavior, as episodes of drug use ("testing the blockade") fail to produce reinforcement. We hypothesized that opiate use would moderate the effect of naltrexone, specifically, that opiate-positive urines precede dropout in the placebo group, but not in the active-medication groups. An 8-week, double-blind, placebo-controlled trial (N=57), compared the efficacy of low (192 mg) and high (384 mg) doses of a long-acting injectable naltrexone (Depotrex) with placebo (Comer et al., 2006). A Cox proportional hazard model was fit, modeling time-to-dropout as a function of treatment assignment and urine toxicology during treatment. Interaction of opiate urines with treatment group was significant. Opiate-positive urines predicted dropout on placebo and low-dose, but less so on high-dose naltrexone, where positive urines were more likely followed by sustained abstinence. Among patients with no opiate-positive urines, retention was higher in both low- and high-dose naltrexone conditions, compared to placebo. Findings confirm that injection naltrexone produces extinction of drug-seeking behavior after episodes of opiate use. Adequate dosage appears important, as low-dose naltrexone resembled the placebo group; opiate positive urines were likely to be followed by dropout from treatment. The observation of high treatment retention among naltrexone-treated patients who do not test the blockade, suggests naltrexone may also exert direct effects on opiate-taking behavior that do not depend on extinction, perhaps by attenuating craving or normalizing dysregulated hedonic or neuroendocrine systems. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. Oscillations-free PID control of anesthetic drug delivery in neuromuscular blockade.

    Science.gov (United States)

    Medvedev, Alexander; Zhusubaliyev, Zhanybai T; Rosén, Olov; Silva, Margarida M

    2016-07-25

    The PID-control of drug delivery or the neuromuscular blockade (NMB) in closed-loop anesthesia is considered. The NMB system dynamics portrayed by a Wiener model can exhibit sustained nonlinear oscillations under realistic PID gains and for physiologically feasible values of the model parameters. Such oscillations, also repeatedly observed in clinical trials, lead to under- and over-dosing of the administered drug and undermine patient safety. This paper proposes a tuning policy for the proportional PID gain that via bifurcation analysis ensures oscillations-free performance of the control loop. Online estimates of the Wiener model parameters are needed for the controller implementation and monitoring of the closed-loop proximity to oscillation. The nonlinear dynamics of the PID-controlled NMB system are studied by bifurcation analysis. A database of patient models estimated under PID-controlled neuromuscular blockade during general anesthesia is utilized, along with the corresponding clinical measurements. The performance of three recursive algorithms is compared in the application at hand: an extended Kalman filter, a conventional particle filter (PF), and a PF making use of an orthonormal basis to estimate the probability density function from the particle set. It is shown that with a time-varying proportional PID gain, the type of equilibria of the closed-loop system remains the same as in the case of constant controller gains. The recovery time and frequency of oscillations are also evaluated in simulation over the database of patient models. Nonlinear identification techniques based on model linearization yield biased parameter estimates and thus introduce superfluous uncertainty. The bias and variance of the estimated models are related to the computational complexity of the identification algorithms, highlighting the superiority of the PFs in this safety-critical application. The study demonstrates feasibility of the proposed oscillation-free control

  19. Use of cis-atracurium to maintain moderate neuromuscular blockade in experimental pigs.

    Science.gov (United States)

    Tutunaru, Alexandru; Dupont, Julien; Huberty, Vincent; Ibrahim, Mostafa; Serteyn, Didier; Sandersen, Charlotte

    2017-07-01

    To determine the dose of cis-atracurium needed to produce a moderate neuromuscular blockade (NMB) in pigs. Prospective experimental study. Seven pigs [five females and two males; median (range) body weight: 47 (36-64) kg]. Pigs were premedicated with intramuscular midazolam (0.3 mg kg -1 ) and ketamine (7 mg kg -1 ). Anaesthesia was induced with intravenous (IV) propofol 3 (1-4) mg kg -1 and maintained with isoflurane in oxygen. Based on a preliminary study, the subjects were administered 0.3 mg kg -1 cis-atracurium followed by 0.48 mg kg -1  hour -1 constant rate infusion (CRI) IV. A moderate NMB was defined as a train-of-four (TOF) count of ≤2 by acceleromyography. When the TOF count was >2, 0.1 mg kg -1 cis-atracurium was administered and the CRI was increased. The cis-atracurium CRI was decreased when the TOF count was under 2 for more than 15 minutes. The total dose of cis-atracurium required to maintain a moderate NMB was calculated as the total amount of cis-atracurium used (both CRI and supplementary boluses) divided by the administration time. The cis-atracurium CRI lasted for 87 (76-151) minutes. To induce and maintain a moderate neuromuscular blockade, the initial dose of cis-atracurium was 0.3 (0.3- 0.5) mg kg -1 and the CRI was 0.71 (0.37-0.98) mg kg -1  hour -1 . The doses described in our study may help researchers obtain a moderate NMB using cis-atracurium in pigs. Copyright © 2017 Association of Veterinary Anaesthetists and American College of Veterinary Anesthesia and Analgesia. Published by Elsevier Ltd. All rights reserved.

  20. Objective neuromuscular monitoring of neuromuscular blockade in Denmark: an online-based survey of current practice.

    Science.gov (United States)

    Söderström, C M; Eskildsen, K Z; Gätke, M R; Staehr-Rye, A K

    2017-07-01

    Neuromuscular blocking agents are commonly used during general anaesthesia but can lead to postoperative residual neuromuscular blockade and associated morbidity. With appropriate objective neuromuscular monitoring (objNMM) residual blockade can be avoided. In this survey, we investigated the use of objNMM in Denmark. We conducted an anonymous Internet-based survey distributed through e-mails to Danish public anaesthesia departments. The survey consisted of 15-17 short questions regarding the use of objNMM. A total of 653 (27%) anaesthetists from 90% of the hospitals answered the questionnaire. ObjNMM was always used by 58% of the anaesthetists and 86% used objNMM at least 75% of the times. Despite the frequent use, 75% of the anaesthetists experienced difficulties with objNMM in at least 25% of the cases. The likelihood of using objNMM was higher among nurse anaesthetists vs. anaesthesiologists (odds ratio (OR) 2.24 [95% confidence interval (CI): 1.62-3.08]), if the department had an employee with special interest in objNMM (OR 1.66 [95% CI: 1.12-2.47]), if the anaesthetist had < 5 years of experience (OR 1.88 [95% CI: 1.29-2.73]), or if experiencing difficulties with objNMM < 25% of the cases (OR 1.60 [95% CI: 1.00-2.57]). In this survey, Danish anaesthetists frequently, in an international perspective, use objNMM, but the use is often associated with technical difficulties. © 2017 The Acta Anaesthesiologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  1. Rationale for an early aldosterone blockade in acute myocardial infarction and design of the ALBATROSS trial.

    Science.gov (United States)

    Beygui, Farzin; Vicaut, Eric; Ecollan, Patrick; Machecourt, Jacques; Van Belle, Eric; Zannad, Faiez; Montalescot, Gilles

    2010-10-01

    Aldosterone is at its highest levels at presentation for acute myocardial infarction (AMI). High aldosterone levels are predictive of poor outcome regardless of heart failure. Angiotensin-converting enzyme inhibitors have delayed partial and temporary effects on aldosterone levels. We hypothesize that aldosterone receptor blockade, early after AMI onset on top of standard therapy, may improve clinical outcome. ALBATROSS is a nationwide, multicenter, open-labeled, randomized trial designed to assess the superiority of aldosterone blockade by a 200-mg intravenous bolus of potassium canrenoate followed by a daily 25-mg dose of spirinolactone for 6 months, on top of standard therapy compared to standard therapy alone among 1,600 patients admitted for ST-segment elevation or high risk non-ST-segment elevation acute AMI -TIMI score ≥3-within 72 hours after symptom onset regardless of heart failure and treatment strategy. The primary efficacy end point of the study is the 6-month rate of the composite of death, resuscitated cardiac arrest, significant ventricular arrhythmia, class IA American College of Cardiology/American Heart Association/European Society of Cardiology indication for implantable cardioverter device, and new or worsening heart failure. Secondary end points include each of the components of the primary end point, different combinations of such components, the primary end point assessed at hospital discharge and 30-day follow-up, and rates of acute renal failure. Safety end points include rates of hyperkalemia and premature drug discontinuation. ALBATROSS will assess the cardiovascular benefit of a low-cost aldosterone receptor blocker on top of standard therapy in all-coming AMI patients. Copyright © 2010 Mosby, Inc. All rights reserved.

  2. Tetrandrine induces lipid accumulation through blockade of autophagy in a hepatic stellate cell line

    Energy Technology Data Exchange (ETDEWEB)

    Miyamae, Yusaku, E-mail: ymiyamae@lif.kyoto-u.ac.jp [Graduate School of Biostudies, Kyoto University, Oiwakecho, Kitashirakawa, Sakyo-ku, Kyoto 606-8502 (Japan); Nishito, Yukina; Nakai, Naomi [Graduate School of Biostudies, Kyoto University, Oiwakecho, Kitashirakawa, Sakyo-ku, Kyoto 606-8502 (Japan); Nagumo, Yoko; Usui, Takeo [Faculty of Life and Environmental Sciences, University of Tsukuba, Tennodai, Tsukuba, Ibaraki 305-8572 (Japan); Masuda, Seiji; Kambe, Taiho [Graduate School of Biostudies, Kyoto University, Oiwakecho, Kitashirakawa, Sakyo-ku, Kyoto 606-8502 (Japan); Nagao, Masaya, E-mail: mnagao@kais.kyoto-u.ac.jp [Graduate School of Biostudies, Kyoto University, Oiwakecho, Kitashirakawa, Sakyo-ku, Kyoto 606-8502 (Japan)

    2016-08-12

    Macroautophagy, or autophagy, is a cellular response in which unnecessary cytoplasmic components, including lipids and organelles, are self-degraded. Recent studies closely related autophagy to activation of hepatic stellate cells (HSCs), a process critical in the pathogenesis of liver fibrosis. During HSC activation, cytoplasmic lipid droplets (LDs) are degraded as autophagic cargo, and then cells express fibrogenic genes. Thus, inhibition of autophagy in HSCs is a potential therapeutic approach for attenuating liver fibrosis. We found that tetrandrine, a bisbenzylisoquinoline alkaloid isolated from Stephania tetrandra, induced lipid accumulation, a phenotype associated with quiescent HSCs, through blockade of autophagy in the rat-derived HSC line HSC-T6. Tetrandrine inhibited autophagic flux without affecting lysosomal function. A phenotypic comparison using siRNA knockdown suggested that tetrandrine may target regulators, involved in fusion between autophagosomes and lysosomes (e.g., syntaxin 17). Moreover, perilipin 1, an LD-coated protein, co-localized specifically with LC3, a marker protein for autophagosomes, in tetrandrine-treated HSC-T6 cells. This suggests a potential role for perilipin 1 in autophagy-mediated LD degradation in HSCs. Our results identified tetrandrine as a potential tool for prevention and treatment of HSC activation. - Highlights: • Autophagy is closely related to lipid degradation in hepatic stellate cells. • Tetrandrine (Tet) causes lipid accumulation via blockade of autophagy in HSC-T6 cells. • Tet blocked autophagy without affecting lysosomal function unlike bafilomycin A{sub 1}. • Perilipin 1 was specifically co-localized with LC3 in Tet-treated cells. • Perilipin 1 may play potential roles in autophagy-mediated lipid degradation.

  3. The effect of beta-adrenergic blockade after encoding on memory of an emotional event.

    Science.gov (United States)

    van Stegeren, Anda H; Everaerd, Walter; Gooren, Louis J G

    2002-09-01

    Animal and human studies lend support to the hypothesis that enhanced memory associated with emotional experiences involves activation of the beta-adrenergic system. Evidence for the role of noradrenaline in emotional memory in humans has been gathered from experimental studies where blockade of the beta-adrenergic system with a beta-blocker selectively impaired long-term memory for an emotionally arousing story (a slide show), when the beta-blocker was given before subjects were confronted with the emotional stimuli. The purpose of this study was to test whether effective beta-adrenergic blockade occurring only after the stage of encoding has a similar impairing effect on memory. In a double blind experimental design, 60 healthy adult subjects received randomly one tablet of either propranolol (Inderal, 40 mg) or placebo. Drugs were administered just before the slide show begun and (in view of its pharmacokinetics) propranolol reaches peak levels 1 h after drug intake. Physiological arousal was monitored by heart rate and blood pressure. Half of the beta-blocker and placebo groups watched either a neutral or an arousal version of an 11-slide presentation. Memory performance was tested with a surprise free recall and recognition test 1 week later. Memory performance, specifically for the second phase in which emotional elements were introduced, was better in subjects who viewed the arousal version than subjects who saw the neutral version of the slide show. However, no effect of the beta-blocker condition was found. This experiment does not support a role for noradrenaline in the post-encoding phase and on the later processes of consolidation and retrieval. Although it remains possible that with a different dosage or timing protocol a post-treatment effect of noradrenaline in humans can be found, this experiment could not find support for it.

  4. Adrenaline reveals the torsadogenic effect of combined blockade of potassium channels in anaesthetized guinea pigs.

    Science.gov (United States)

    Michael, G; Kane, K A; Coker, S J

    2008-08-01

    Torsade de pointes (TdP) can be induced in several species by a reduction in cardiac repolarizing capacity. The aim of this study was to assess whether combined I(Kr) and I(Ks) blockade could induce TdP in anaesthetized guinea pigs and whether short-term variability (STV) or triangulation of action potentials could predict TdP. Experiments were performed in open-chest, pentobarbital-anaesthetized, adrenaline-stimulated male Dunkin Hartley guinea pigs, which received three consecutive i.v. infusions of either vehicle, the I(Kr) blocker E-4031 (3, 10 and 30 nmol kg(-1) min(-1)), the I(Ks) blocker HMR1556 (75, 250, 750 nmol kg(-1) min(-1)) or E-4031 and HMR1556 combined. Phenylephrine-stimulated guinea pigs were also treated with the K(+) channel blockers in combination. Arterial blood pressure, ECGs and epicardial monophasic action potential (MAP) were recorded. TdP was observed in 75% of adrenaline-stimulated guinea pigs given the K(+) channel blockers in combination, but was not observed in guinea pigs treated with either I(K) blocker alone, or in phenylephrine-stimulated guinea pigs. Salvos and ventricular tachycardia occurred with adrenaline but not with phenylephrine. No changes in STV or triangulation of the MAP signals were observed before TdP. Combined blockade of both I(Kr) and I(Ks) plus the addition of adrenaline were required to induce TdP in anaesthetized guinea pigs. This suggests that there must be sufficient depletion of repolarization reserve and an appropriate trigger for TdP to occur.

  5. A New Approach: Regional Nerve Blockade for Angioplasty of the Lower Limb

    International Nuclear Information System (INIS)

    Marcus, A.J.; Lotzof, K.; Kamath, B.S.K.; Shanthakumar, R.E.; Munir, N.; Loh, A.; Bird, R.; Howard, A.

    2006-01-01

    Purpose. An audit study investigated the pilot use of regional nerve block analgesia (as an alternative to sedative/opiate, general or central neuraxial anesthesia) performed by radiologists with the assistance of imaging techniques during complex prolonged angiography. Methods. Radiologists were trained by anesthetic consultants to administer and use lower limb peripheral nerve block for difficult prolonged angioplasty procedures for patients with severe lower limb rest pain who were unable to lie in the supine position. In a pilot study 25 patients with limb-threatening ischemia received sciatic and femoral nerve blockade for angioplasty. The technique was developed and perfected in 12 patients and in a subsequent 13 patients the details of the angiography procedures, peripheral anesthesia, supplementary analgesia, complications, and pain assessment scores were recorded. Pain scores were also recorded in 11 patients prior to epidural/spinal anesthesia for critical ischemic leg angioplasty. Results. All patients with peripheral nerve blockade experienced a reduction in their ischemic rest pain to a level that permitted angioplasty techniques to be performed without spinal, epidural or general analgesia. In patients undergoing complex angioplasty intervention, the mean pain score by visual analogue scale was 3.7, out of a maximum score of 10. Conclusions. The successful use of peripheral nerve blocks was safe and effective as an alternative to sedative/opiate, epidural or general anesthesia in patients undergoing complex angiography and has optimized the use of radiological and anesthetic department resources. This has permitted the frequent radiological treatment of patients with limb-threatening ischemia and reduced delays caused by the difficulty in enlisting the help of anesthetists, often at short notice, from the busy operating lists

  6. Effects of blockade of sodium-dependent glutamate transporters on brain metabolism

    International Nuclear Information System (INIS)

    Moussa, C.E.-H.; Rae, C.; Bubb, W.A.; Blacar, V.J.

    2002-01-01

    Full text: L-Glutamic acid is the major excitatory amino acid in the CNS. Termination of the glutamatergic transmission and the clearance of excessive and neurotoxic glutamate are achieved by high affinity Na + -dependent uptake transporters. A number of neurodegenerative diseases have been imputed to failure of the Na + -dependent transport system, including motor neuron disease. In this study we examined the effects of blockade of glutamate transporters on the metabolism of guinea pig cortical brain slices (350 μm thickness). 13 C-NMR spectroscopy revealed a significant decrease (p 13 C label (flux) into individual isotopomers in the presence of LCCGIII (50 μM), a transportable glutamate uptake inhibitor. However, a significant increase in metabolic flux and fractional enrichment of metabolites was observed in the presence of 5 μM LCCG III. This is indicative of a mild stimulatory effect on metabolism due to inhibition of the transporters. A non-transportable blocker of glutamate transport, a,e-MPDC, produced a significant increase in metabolic fluxes and fractional enrichment of isotopomers, but had no effects on total metabolite pool sizes, in the presence of both 5 μM and 50 μM a,e-MPDC. Both 5 μM and 50 μM Lt-PDC increased the total metabolite pool sizes and the metabolic flux. These results suggest that blockade of glutamate transport lead to an increase of metabolic rate, which in turn may increase the rate of the glutamate-glutamine cycle and neurotransmitter release and, thus, produce neurotoxicity. Copyright (2002) Australian Neuroscience Society

  7. Blockade of central nicotine acetylcholine receptor signaling attenuate ghrelin-induced food intake in rodents.

    Science.gov (United States)

    Dickson, S L; Hrabovszky, E; Hansson, C; Jerlhag, E; Alvarez-Crespo, M; Skibicka, K P; Molnar, C S; Liposits, Z; Engel, J A; Egecioglu, E

    2010-12-29

    Here we sought to determine whether ghrelin's central effects on food intake can be interrupted by nicotine acetylcholine receptor (nAChR) blockade. Ghrelin regulates mesolimbic dopamine neurons projecting from the ventral tegmental area (VTA) to the nucleus accumbens, partly via cholinergic VTA afferents originating in the laterodorsal tegmental area (LDTg). Given that these cholinergic projections to the VTA have been implicated in natural as well as drug-induced reinforcement, we sought to investigate the role of cholinergic signaling in ghrelin-induced food intake as well as fasting-induced food intake, for which endogenous ghrelin has been implicated. We found that i.p. treatment with the non-selective centrally active nAChR antagonist, mecamylamine decreased fasting-induced food intake in both mice and rats. Moreover, central administration of mecamylamine decreased fasting-induced food intake in rats. I.c.v. ghrelin-induced food intake was suppressed by mecamylamine i.p. but not by hexamethonium i.p., a peripheral nAChR antagonist. Furthermore, mecamylamine i.p. blocked food intake following ghrelin injection into the VTA. Expression of the ghrelin receptor, the growth hormone secretagogue receptor 1A, was found to co-localize with choline acetyltransferase, a marker of cholinergic neurons, in the LDTg. Finally, mecamylamine treatment i.p. decreased the ability of palatable food to condition a place preference. These data suggest that ghrelin-induced food intake is partly mediated via nAChRs and that nicotinic blockade decreases the rewarding properties of food. Copyright © 2010 IBRO. Published by Elsevier Ltd. All rights reserved.

  8. Viral vector-mediated selective and reversible blockade of the pathway for visual orienting in mice

    Directory of Open Access Journals (Sweden)

    Tadashi eIsa

    2013-10-01

    Full Text Available Recently, by using a combination of two viral vectors, we developed a technique for pathway-selective and reversible synaptic transmission blockade, and successfully induced a behavioral deficit of dexterous hand movements in macaque monkeys by affecting a population of spinal interneurons. To explore the capacity of this technique to work in other pathways and species, and to obtain fundamental methodological information, we tried to block the crossed tecto-reticular pathway, which is known to control orienting responses to visual targets, in mice. A neuron-specific retrograde gene transfer vector with the gene encoding enhanced tetanus neurotoxin (eTeNT tagged with enhanced green fluorescent protein (EGFP under the control of a tetracycline responsive element was injected into the left medial pontine reticular formation. 7–17 days later, an adeno-associated viral vector with a highly efficient Tet-ON sequence, rtTAV16, was injected into the right superior colliculus. 5–9 weeks later, the daily administration of doxycycline (Dox was initiated. Visual orienting responses toward the left side were impaired 1 - 4 days after Dox administration. Anti-GFP immunohistochemistry revealed that a number of neurons in the intermediate and deep layers of the right superior colliculus were positively stained, indicating eTeNT expression. After the termination of Dox administration, the anti-GFP staining returned to the baseline level within 28 days. A second round of Dox administration, starting from 28 days after the termination of the first Dox administration, resulted in the reappearance of the behavioral impairment. These findings showed that pathway-selective and reversible blockade of synaptic transmission causes behavioral effects also in rodents, and that the crossed tecto-reticular pathway surely controls visual orienting behaviors.

  9. Bilateral sphenopalatine ganglion blockade improves postoperative analgesia after endoscopic sinus surgery.

    Science.gov (United States)

    DeMaria, Samuel; Govindaraj, Satish; Chinosorvatana, Nina; Kang, Stanley; Levine, Adam I

    2012-01-01

    Endoscopic sinus surgery (ESS) is a common procedure preferably done with an anesthetic technique ensuring effective postoperative analgesia while speeding discharge home. Although anesthesia administered locally in conjunction with vasoconstricting agents is known to minimize intraoperative bleeding, its usefulness in providing postoperative analgesia has not been well characterized. The results supporting the use of regional anesthesia for sinus surgery have also been limited. Using a randomized, double-blinded and placebo-controlled design, we evaluated recovery times, opioid consumption, and nausea and vomiting after ESS when patients were randomized to either general anesthesia (GA) alone or with regional blockade. Subjects were 70 adults scheduled for sinus surgery. All participants underwent propofol/remifentanil/nitrous oxide anesthesia and similar intraoperative care. Patients received either GA alone or with sphenopalatine ganglion (SPG) blocks in a double-masked study design. Independent observers recorded readiness for discharge, incidence of nausea/vomiting, and pain scores every 15 minutes until discharge. Overall opioid use in the recovery area was also a secondary end point. Twenty-four hours later, patients were called and asked to rate their pain and overall satisfaction with their pain control. Block group participants were considered ready for discharge after 45 minutes and discharged from the hospital ∼40 minutes sooner than GA group participants. The block group required less total fentanyl in the recovery room than did the GA group. The incidences of nausea and vomiting did not differ significantly. Data at 24 hours postoperatively did not differ significantly between groups but trended toward increased satisfaction in the block group. No lasting adverse events were observed. Regional anesthesia using targeted nerve blocks is effective in ESS. The combination of GA and SPG blockade appears to shorten hospital stay and reduce narcotic

  10. Regression of cardiac hypertrophy in the SHR by combined renin-angiotensin system blockade and dietary sodium restriction

    Directory of Open Access Journals (Sweden)

    Emad Abro

    2001-03-01

    Full Text Available Altered operation of the renin-angiotensin-aldosterone system (RAAS and dietary sodium intake have been identified as independent risk factors for cardiac hypertrophy. The way in which sodium intake and the operation of the renin-angiotensin-aldosterone system interact in the pathogenesis of cardiac hypertrophy is poorly understood. The aims of this study were to investigate the cardiac effects of the renin-angiotensin system (RAS blockade in the spontaneously hypertensive rat (SHR, using co-treatment with an angiotensin II receptor blocker (ARB and an angiotensin-converting enzyme (ACE inhibitor with different sodium intakes. Our experiments with SHR show that, at high levels of sodium intake (4.0%, aggressive RAS blockade treatment with candesartan (3 mg/kg and perindopril (6 mg/kg does not result in regression of cardiac hypertrophy. In contrast, RAS blockade coupled with reduced sodium diet (0.2% significantly regresses cardiac hypertrophy, impairs animal growth and is associated with elevated plasma renin and dramatically suppressed plasma angiotensinogen levels. Histological analyses indicate that the differential effect of reduced sodium on heart growth during RAS blockade is not associated with any change in myocardial interstitial collagen, but reflects modification of cellular geometry. Dimensional measurements of enzymatically-isolated ventricular myocytes show that, in the RAS blocked, reduced sodium group, myocyte length and width were decreased by about 16—19% compared with myocytes from the high sodium treatment group. Our findings highlight the importance of `titrating' sodium intake with combined RAS blockade in the clinical setting to optimise therapeutic benefit.

  11. The renin–angiotensin–aldosterone system blockade in patients with advanced diabetic kidney disease

    Directory of Open Access Journals (Sweden)

    Sheila Bermejo

    2018-03-01

    Full Text Available Background and objectives: Diabetic kidney disease is the leading cause of end-stage chronic kidney disease (CKD. The renin–angiotensin–aldosterone system (RAAS blockade has been shown to slow the progression of diabetic kidney disease. Our objectives were: to study the percentage of patients with diabetic kidney disease treated with RAAS blockade, to determine its renal function, safety profile and assess whether its administration is associated with increased progression of CKD after 3 years of follow-up. Materials and methods: Retrospective study. 197 diabetic kidney disease patients were included and divided into three groups according to the treatment: patients who had never received RAAS blockade (non-RAAS blockade, patients who at some point had received RAAS blockade (inconstant-RAAS blockade and patients who received RAAS blockade (constant-RAAS blockade. Clinical characteristics and analytical variables such as renal function, electrolytes, glycosylated hemoglobin and glomerular filtration rate according to CKD-EPI and MDRD formulas were assessed. We also studied their clinical course (baseline, 1 and 3 years follow-up in terms of treatment group, survival, risk factors and renal prognosis. Results: Non-RAAS blockade patients had worse renal function and older age (p < 0.05 at baseline compared to RAAS blockade patients. Patients who received RAAS blockade were not found to have greater toxicity or chronic kidney disease progression and no differences in renal prognosis were identified. Mortality was higher in non-RAAS blockade patients, older patients and patients with worse renal function (p < 0.05. In the multivariate analysis, older age and worse renal function were risk factors for mortality. Conclusions: Treatment with RAAS blockade is more common in diabetic kidney disease patients with eGFR ≥ 30 ml/min/1.73 m2. In our study, there were no differences in the evolution of renal function

  12. Killing two birds with one stone: dual blockade of integrin and FGF signaling through targeting syndecan-4 in postoperative capsular opacification.

    Science.gov (United States)

    Qin, Yingyan; Zhu, Yi; Luo, Furong; Chen, Chuan; Chen, Xiaoyun; Wu, Mingxing

    2017-07-13

    The most common complication after cataract surgery is postoperative capsular opacification, which includes anterior capsular opacification (ACO) and posterior capsular opacification (PCO). Increased adhesion of lens epithelial cells (LECs) to the intraocular lens material surface promotes ACO formation, whereas proliferation and migration of LECs to the posterior capsule lead to the development of PCO. Cell adhesion is mainly mediated by the binding of integrin to extracellular matrix proteins, while cell proliferation and migration are regulated by fibroblast growth factor (FGF). Syndecan-4 (SDC-4) is a co-receptor for both integrin and FGF signaling pathways. Therefore, SDC-4 may be an ideal therapeutic target for the prevention and treatment of postoperative capsular opacification. However, how SDC-4 contributes to FGF-mediated proliferation, migration, and integrin-mediated adhesion of LECs is unclear. Here, we found that downregulation of SDC-4 inhibited FGF signaling through the blockade of ERK1/2 and PI3K/Akt/mTOR activation, thus suppressing cell proliferation and migration. In addition, downregulation of SDC-4 suppressed integrin-mediated cell adhesion through inhibiting focal adhesion kinase (FAK) phosphorylation. Moreover, SDC-4 knockout mice exhibited normal lens morphology, but had significantly reduced capsular opacification after injury. Finally, SDC-4 expression level was increased in the anterior capsule LECs of age-related cataract patients. Taken together, we for the first time characterized the key regulatory role of SDC-4 in FGF and integrin signaling in human LECs, and provided the basis for future pharmacological interventions of capsular opacification.

  13. Intratumoral Infection with Murine Cytomegalovirus Synergizes with PD-L1 Blockade to Clear Melanoma Lesions and Induce Long-term Immunity

    Science.gov (United States)

    Erkes, Dan A; Xu, Guangwu; Daskalakis, Constantine; Zurbach, Katherine A; Wilski, Nicole A; Moghbeli, Toktam; Hill, Ann B; Snyder, Christopher M

    2016-01-01

    Cytomegalovirus is an attractive cancer vaccine platform because it induces strong, functional CD8+ T-cell responses that accumulate over time and migrate into most tissues. To explore this, we used murine cytomegalovirus expressing a modified gp100 melanoma antigen. Therapeutic vaccination by the intraperitoneal and intradermal routes induced tumor infiltrating gp100-specific CD8+ T-cells, but provided minimal benefit for subcutaneous lesions. In contrast, intratumoral infection of established tumor nodules greatly inhibited tumor growth and improved overall survival in a CD8+ T-cell-dependent manner, even in mice previously infected with murine cytomegalovirus. Although murine cytomegalovirus could infect and kill B16F0s in vitro, infection was restricted to tumor-associated macrophages in vivo. Surprisingly, the presence of a tumor antigen in the virus only slightly increased the efficacy of intratumoral infection and tumor-specific CD8+ T-cells in the tumor remained dysfunctional. Importantly, combining intratumoral murine cytomegalovirus infection with anti-PD-L1 therapy was synergistic, resulting in tumor clearance from over half of the mice and subsequent protection against tumor challenge. Thus, while a murine cytomegalovirus-based vaccine was poorly effective against established subcutaneous tumors, direct infection of tumor nodules unexpectedly delayed tumor growth and synergized with immune checkpoint blockade to promote tumor clearance and long-term protection. PMID:27434584

  14. Intratumoral Infection with Murine Cytomegalovirus Synergizes with PD-L1 Blockade to Clear Melanoma Lesions and Induce Long-term Immunity.

    Science.gov (United States)

    Erkes, Dan A; Xu, Guangwu; Daskalakis, Constantine; Zurbach, Katherine A; Wilski, Nicole A; Moghbeli, Toktam; Hill, Ann B; Snyder, Christopher M

    2016-08-01

    Cytomegalovirus is an attractive cancer vaccine platform because it induces strong, functional CD8(+) T-cell responses that accumulate over time and migrate into most tissues. To explore this, we used murine cytomegalovirus expressing a modified gp100 melanoma antigen. Therapeutic vaccination by the intraperitoneal and intradermal routes induced tumor infiltrating gp100-specific CD8(+) T-cells, but provided minimal benefit for subcutaneous lesions. In contrast, intratumoral infection of established tumor nodules greatly inhibited tumor growth and improved overall survival in a CD8(+) T-cell-dependent manner, even in mice previously infected with murine cytomegalovirus. Although murine cytomegalovirus could infect and kill B16F0s in vitro, infection was restricted to tumor-associated macrophages in vivo. Surprisingly, the presence of a tumor antigen in the virus only slightly increased the efficacy of intratumoral infection and tumor-specific CD8(+) T-cells in the tumor remained dysfunctional. Importantly, combining intratumoral murine cytomegalovirus infection with anti-PD-L1 therapy was synergistic, resulting in tumor clearance from over half of the mice and subsequent protection against tumor challenge. Thus, while a murine cytomegalovirus-based vaccine was poorly effective against established subcutaneous tumors, direct infection of tumor nodules unexpectedly delayed tumor growth and synergized with immune checkpoint blockade to promote tumor clearance and long-term protection.

  15. The changes of spontaneous motility in chick embryos after blockade of NO-synthase.

    Science.gov (United States)

    Sedlácek, J

    1996-01-01

    The consequences of the blockade of NO-synthase (NOS) for the development, frequency and reactivity of spontaneous motility were investigated in chick embryos aged 4-19 day of incubation. 1. Acute NOS blockade evoked by N-nitro-L-arginine- methylester (L-NAME) (20 mg/kg egg weight-e.w.) caused on day 17 of incubation the short-lasting depression of spontaneous motility to 50% of resting motor activity. L-NAME was in spinal embryos without any effect. Chronic application of L-NAME (1.70 mg/kg e.w./24 h) from day 4 of incubation led after the first 4 days of continual supply to the development of reduced spontaneous motility on one hand, on the other hand it changed the efficacy of central activatory (NMDA, pentylenetetrazole) and inhibitory drugs (ketamine, glycine). L-NAME and L-arginine in different mutual combinations manifested in 17-day-old embryos their typical effect, though the depressory effect of L-NAME took a swifter course than the activatory effect of L-arginine. 2. Aminoguanidine (AmG) (9.8 and 20 mg/kg e.w.) evoked from day 17 of incubation the significant biphasic change of spontaneous motility only: initial depression was replaced by later activation. AmG was in spinal embryos without effect again. Chronic application of AmG (5.29 +/- 0.51 mg/kg e.w./24 h) showed in 17-day-old embryos a reduction of resting motility dependent on the duration of AmG influence during incubation. Another expression was the changed reactivity of spontaneous motility to some centrally effective drugs (ketamine, NMDA, D-cycloserine, glycine, pentylenetetrazole). 3. 7-nitroindazole (7-NIZ) (15 and 30 mg/kg e.w.) caused the significant decrease of spontaneous motility in chick embryos already from day 15 of incubation; the depression after the lower dosis had an interrupted course, whereas after the higher dosis it was a continuous one. 7-NIZ blocked in 17-day-old embryos the activatory effect of L-arginine, reduced the paroxysmal activation of motility evoked by NMDA and

  16. Determination of the Relationship Between Patient Height Versus Vertebral Column Length and the Level of Subarachnoid Sensory Blockade Produced Using 0.75% Hyperbaric Bupivacaine

    National Research Council Canada - National Science Library

    Bequette, Bonnie

    1996-01-01

    The purpose of this study was to determine the strength of the relationship between patient height versus vertebral column length and the level of subarachniod sensory blockade following administration of 15 mg of 0.75...

  17. [The assessment of therapeutic effectiveness of paravertebral blockades in patients with painful radicular syndromes in discopathy and in lumbar spine spondylosis].

    Science.gov (United States)

    Styczyński, T; Parnarauskiene, R; Zarski, S; Kaubrys, G; Klezys, V; Krzemińska-Dabrowska, I; Lesiak, A; Pasek, A; Piróg, A; Pyskło, B; Sadowski, A

    1997-01-01

    A group of 103 patients were examined for radicular painful syndromes in lumbar discopathy and lumbar spondylosis. Fifty-eight were treated by placing them in spine-decompressing position, traction and therapeutic exercises. The group of 45 patients had additionally paravertebral blockade (steroid + a local anaesthetic). In the blockade group the therapeutic effects were better, with rapid reduction of acute pain, with wellbeing improvement and better comfort, which facilitated further stages of the treatment. This made possible shortening of hospital stay by 20%, on average, as compared with the group without blockade. In patients with shorter lasting radicular pains (below 2 months) the results after paravertebral blockade were significantly better than in cases with longer duration of pains (2-6 months).

  18. Treatment of obstructive hypertrophic cardiomyopathy symptoms and gradient resistant to first-line therapy with β-blockade or verapamil.

    Science.gov (United States)

    Sherrid, Mark V; Shetty, Aneesha; Winson, Glenda; Kim, Bette; Musat, Dan; Alviar, Carlos L; Homel, Peter; Balaram, Sandhya K; Swistel, Daniel G

    2013-07-01

    There is controversy about preferred methods to relieve obstruction in hypertrophic cardiomyopathy patients still symptomatic after β-blockade or verapamil. Of 737 patients prospectively registered at our institution, 299 (41%) required further therapy for obstruction for limiting symptoms, rest gradient 61 ± 45, provoked gradient 115 ± 49 mm Hg, and followed up for 4.8 years. Disopyramide was added in 221 (74%) patients and pharmacological control of symptoms was achieved in 141 (64%) patients. Overall, 138 (46%) patients had surgical relief of obstruction (91% myectomy) and 6 (2%) alcohol septal ablation. At follow-up, resting gradients in the 299 patients had decreased from 61 ± 44 to 10 ± 25 mm Hg (Psymptoms resistant to initial pharmacological therapy with β-blockade or verapamil may realize meaningful symptom relief and low mortality through stepped management, adding disopyramide in appropriately selected patients, and when needed, by surgical myectomy.

  19. Ultrasound guided rectus sheath blockade compared to peri-operative local anesthetic infiltration in infants undergoing supraumbilical pyloromyotomy

    OpenAIRE

    Kumar, Anoop; Wilson, Graham A. M.; Engelhardt, Thomas E.

    2014-01-01

    Background: Provision of appropriate analgesia for supraumbilical pyloromyotomy in infants is limited by concerns about sensitivity to opioids and other medication groups, due to immature metabolism. Local anesthetic infiltration and ultrasound guided rectus sheath blockade are two techniques commonly employed to provide perioperative analgesia. The aim of this review was to compare the quality of post-operative analgesia afforded by these two techniques. Materials and Methods: A retrospectiv...

  20. Human adipose tissue blood flow during prolonged exercise, III. Effect of beta-adrenergic blockade, nicotinic acid and glucose infusion

    DEFF Research Database (Denmark)

    Bülow, J

    1981-01-01

    Subcutaneous adipose tissue blood flow (ATBF) was measured in six male subjects by the 133Xe-washout technique during 3-4 h of exercise at a work load corresponding to an oxygen uptake of about 1.71/min. The measurements were done during control conditions, during blockade of lipolysis by nicotinic...... with the hypothesis that adipose tissue vasodilation during exercise is secondary to metabolic events connected to lipolysis....

  1. Current status and perspectives in translational biomarker research for PD-1/PD-L1 immune checkpoint blockade therapy

    Directory of Open Access Journals (Sweden)

    Weijie Ma

    2016-05-01

    Full Text Available Abstract Modulating immune inhibitory pathways has been a major recent breakthrough in cancer treatment. Checkpoint blockade antibodies targeting cytotoxic T-lymphocyte antigen 4 (CTLA-4 and programed cell-death protein 1 (PD-1 have demonstrated acceptable toxicity, promising clinical responses, durable disease control, and improved survival in some patients with advanced melanoma, non-small cell lung cancer (NSCLC, and other tumor types. About 20 % of advanced NSCLC patients and 30 % of advanced melanoma patients experience tumor responses from checkpoint blockade monotherapy, with better clinical responses seen with the combination of anti-PD-1 and anti-CTLA-4 antibodies. Given the power of these new therapies, it is important to understand the complex and dynamic nature of host immune responses and the regulation of additional molecules in the tumor microenvironment and normal organs in response to the checkpoint blockade therapies. In this era of precision oncology, there remains a largely unmet need to identify the patients who are most likely to benefit from immunotherapy, to optimize the monitoring assays for tumor-specific immune responses, to develop strategies to improve clinical efficacy, and to identify biomarkers so that immune-related adverse events can be avoided. At this time, PD-L1 immunohistochemistry (IHC staining using 22C3 antibody is the only FDA-approved companion diagnostic for patients with NSCLC-treated pembrolizumab, but more are expected to come to market. We here summarize the current knowledge, clinical efficacy, potential immune biomarkers, and associated assays for immune checkpoint blockade therapies in advanced solid tumors.

  2. Continuous adductor-canal-blockade for adjuvant post-operative analgesia after major knee surgery: preliminary results

    DEFF Research Database (Denmark)

    Lund, J; Jenstrup, M T; Jæger, P

    2011-01-01

    Because both the saphenous nerve and in part the obturator nerve are traversing the adductor canal of the thigh, we hypothesised that repeated administration of a local anaesthetic (LA) into this aponeurotic space could be a useful option for post-operative analgesia after knee replacement surgery......-canal-blockade may be a valuable adjunct for post-operative analgesia after major knee surgery. These preliminary results should be confirmed in randomised, controlled trials....

  3. Nicotinic receptor blockade decreases fos immunoreactivity within orexin/hypocretin-expressing neurons of nicotine-exposed rats.

    Science.gov (United States)

    Simmons, Steven J; Gentile, Taylor A; Mo, Lili; Tran, Fionya H; Ma, Sisi; Muschamp, John W

    2016-11-01

    Tobacco smoking is the leading cause of preventable death in the United States. Nicotine is the principal psychoactive ingredient in tobacco that causes addiction. The structures governing nicotine addiction, including those underlying withdrawal, are still being explored. Nicotine withdrawal is characterized by negative affective and cognitive symptoms that enhance relapse susceptibility, and suppressed dopaminergic transmission from ventral tegmental area (VTA) to target structures underlies behavioral symptoms of nicotine withdrawal. Agonist and partial agonist therapies help 1 in 4 treatment-seeking smokers at one-year post-cessation, and new targets are needed to more effectively aid smokers attempting to quit. Hypothalamic orexin/hypocretin neurons send excitatory projections to dopamine (DA)-producing neurons of VTA and modulate mesoaccumbal DA release. The effects of nicotinic receptor blockade, which is commonly used to precipitate withdrawal, on orexin neurons remain poorly investigated and present an attractive target for intervention. The present study sought to investigate the effects of nicotinic receptor blockade on hypothalamic orexin neurons using mecamylamine to precipitate withdrawal in rats. Separate groups of rats were treated with either chronic nicotine or saline for 7-days at which point effects of mecamylamine or saline on somatic signs and anxiety-like behavior were assessed. Finally, tissue from rats was harvested for immunofluorescent analysis of Fos within orexin neurons. Results demonstrate that nicotinic receptor blockade leads to reduced orexin cell activity, as indicated by lowered Fos-immunoreactivity, and suggest that this underlying cellular activity may be associated with symptoms of nicotine withdrawal as effects were most prominently observed in rats given chronic nicotine. We conclude from this study that orexin transmission becomes suppressed in rats upon nicotinic receptor blockade, and that behavioral symptoms associated

  4. Clinical Usefulness of Chlormadinone Acetate as an Alternative Antiandrogen Therapy for Prostate Cancer Relapse after Combined Androgen Blockade Therapy

    OpenAIRE

    江原, 英俊; 加藤, 成一; 中根, 慶太; 加藤, 卓; 高田, 俊彦; 小島, 圭太郎; 亀井, 信吾; 萩原, 徳康; 柚原, 一哉; 高橋, 義人; 藤本, 佳則; 藤広, 茂; 蟹本, 雄右; 出口, 隆

    2009-01-01

    We prospectively studied the usefulness of chlormadinone acetate (CMA) as an alternative therapy for prostate cancer relapse after combined androgen blockade (CAB) therapy. Sixteen patients with relapsed prostate cancer after treatment with CAB, including surgical or medical castration and nonsteroidal antiandrogens, 80 mg bicalutamide daily or 375 mg flutamide daily, were enrolled. After discontinuing the antiandrogen for evaluating the patient for the antiandrogen withdrawal syndrome, we ad...

  5. Trade in medicines and the public's health: a time series analysis of import disruptions during the 2015 India-Nepal border blockade.

    Science.gov (United States)

    Sharma, Abhishek; Mishra, Shiva Raj; Kaplan, Warren A

    2017-08-22

    Nepal was struck by devastating earthquakes in April-May 2015, followed by the India-Nepal border blockade later that year. We used the United Nations Commodity Trade Statistics (UN Comtrade) database to analyse exports of various health commodities from India to Nepal from January 2011-September 2016. We used time-series regressions of trading volume vs. unit price to ask how well Nepal's trading history with India prior to the earthquake and blockade was able to predict unit prices of health commodities imported into Nepal during and after the earthquake and the blockade. Regression residuals were used to quantify the extent to which the blockade impacted the price of healthcare commodities crossing into Nepal. During the blockade period (September 2015-early February 2016), the volume of all retail medicines traded across the India-Nepal border was reduced by 46.5% compared to same months in 2014-2015. For medical dressings, large volumes were exported from India to Nepal during and shortly after the earthquakes (May-June 2015), but decreased soon thereafter. During the earthquake, the difference between observed and predicted values of unit price (residuals) for all commodities show no statistical outliers. However, during the border blockade, Nepal paid USD 22.3 million more for retail medicines than one would have predicted based on its prior trading history with India, enough to provide healthcare to nearly half of Kathmandu's citizens for 1 year. The India-Nepal blockade was a geopolitical natural experiment demonstrating how a land-locked country is vulnerable to the vagaries of its primary trading partner. Although short-lived, the blockade had an immediate impact on traded medicine volumes and prices, and provided a large opportunity cost with implications for public health.

  6. A randomized, dose-response study of sugammadex given for the reversal of deep rocuronium- or vecuronium-induced neuromuscular blockade under sevoflurane anesthesia

    DEFF Research Database (Denmark)

    Duvaldestin, Philippe; Kuizenga, Karel; Saldien, Vera

    2010-01-01

    Sugammadex is the first of a new class of selective muscle relaxant binding drugs developed for the rapid and complete reversal of neuromuscular blockade induced by rocuronium and vecuronium. Many studies have demonstrated a dose-response relationship with sugammadex for reversal of neuromuscular...... blockade in patients induced and maintained under propofol anesthesia. However, sevoflurane anesthesia, unlike propofol, can prolong the effect of neuromuscular blocking drugs (NMBDs) such as rocuronium and vecuronium....

  7. Supplementary data: Association of CTLA4, CD28 and ICOS gene ...

    Indian Academy of Sciences (India)

    CTLA4 (2q33) rs231777. Intron 1. Forward: TGAATACATTTGAGCTGGGTTTC. 710. Reverse: ACTAAATGCGGTCACACTCAACT rs231779. Intron 1. Forward: CATCTCTGATAGGCAGAGGTGAG. 700. Reverse: AGTAGCTGTGTCTTGATGCACTG. ICOS (2q33) rs4270326. Intron 3. Forward: TGAAGTTCTGGTTACCCATAGGA.

  8. Association of CTLA4, CD28 and ICOS gene polymorphisms with ...

    Indian Academy of Sciences (India)

    With lupus nephri- tis and crescentic GN models, ICOS signalling inhibited all subclasses of IgG autoantibody and mesangial hypercellular- ity, and/or reduced the deposition of IgG and C3 in glomeruli, even showing the preventive effect on the both of clinical and pathological progression (Iwai et al. 2003; Odobasic et al.

  9. Cannabinoid Receptor Blockade Reduces the Opportunity Cost at Which Rats Maintain Operant Performance for Rewarding Brain Stimulation

    Science.gov (United States)

    Trujillo-Pisanty, Ivan; Hernandez, Giovanni; Moreau-Debord, Ian; Cossette, Marie-Pierre; Conover, Kent; Cheer, Joseph F.; Shizgal, Peter

    2018-01-01

    There is ample evidence that blockade of CB1 receptors reduces reward seeking. However, the reported effects of CB1 blockade on performance for rewarding electrical brain stimulation stand out as an exception. By applying a novel method for conceptualizing and measuring reward seeking, we show that AM-251, a CB1 receptor antagonist, does indeed decrease performance for rewarding electrical stimulation of the medial forebrain bundle in rats. Reward seeking depends on multiple sets of variables, including the intensity of the reward, its cost, and the value of competing rewards. In turn, reward intensity depends both on the sensitivity and gain of brain reward circuitry. We show that drug-induced changes in sensitivity cannot account for the suppressive effect of AM-251 on reward seeking. Therefore, the role of CB1 receptors must be sought among the remaining determinants of performance. Our analysis provides an explanation of the inconsistencies between prior reports, which likely arose from the following: (1) the averaging of data across subjects showing heterogeneous effects and (2) the use of methods that cannot distinguish between the different determinants of reward pursuit. By means of microdialysis, we demonstrate that blockade of CB1 receptors attenuates nucleus accumbens dopamine release in response to rewarding medial forebrain bundle stimulation, and we propose that this action is responsible for the ability of the drug to decrease performance for the electrical reward. PMID:21471378

  10. Multiplanar wrist joint proprioception: The effect of anesthetic blockade of the posterior interosseous nerve or skin envelope surrounding the joint.

    Science.gov (United States)

    Taylor, Kenneth F; Meyer, Vanessa M; Smith, Laurel B; Lustik, Michael B

    2015-01-01

    Randomized clinical trial. Contribution of the posterior interosseous nerve (PIN) and surrounding skin envelope to wrist proprioception is a topic of debate and the primary focus of this research. We performed a double-blinded, placebo control study in which subjects underwent baseline multiplanar testing of wrist proprioception. They were randomized to receive either anesthetic blockade of the PIN within the fourth dorsal compartment, or circumferential topical anesthetic blockade of skin surrounding the wrist. Corresponding opposite wrists underwent placebo intervention with saline injection or inert ultrasound gel. Subjects repeated proprioceptive testing. Eighty subjects, 45 male and 35 female, mean age 33 years (range, 19-64 years), completed testing. The percentage of measurements falling outside a ±18° range did not differ between pre-treatment and post-treatment PIN blockade or for circumferential skin anesthesia. Wrist proprioception appears to be a multifactorial phenomenon. Surgeons may sacrifice the PIN without concern for effect on joint proprioception. Level I. Copyright © 2015 Hanley & Belfus. All rights reserved.

  11. Sulfur passivation of semi-insulating GaAs: Transition from Coulomb blockade to weak localization regime

    Energy Technology Data Exchange (ETDEWEB)

    Bagraev, N. T., E-mail: Bagraev@mail.ioffe.ru [Ioffe Institute (Russian Federation); Chaikina, E. I. [Centro de Investigacion Cientifica y de Educacion Superior de Ensenada, Division de Fisica Aplicada (Mexico); Danilovskii, E. Yu.; Gets, D. S.; Klyachkin, L. E.; L’vova, T. V.; Malyarenko, A. M. [Ioffe Institute (Russian Federation)

    2016-04-15

    The sulfur passivation of the semi-insulating GaAs bulk (SI GaAs) grown in an excess phase of arsenic is used to observe the transition from the Coulomb blockade to the weak localization regime at room temperature. The I–V characteristics of the SI GaAs device reveal nonlinear behavior that appears to be evidence of the Coulomb blockade process as well as the Coulomb oscillations. The sulfur passivation of the SI GaAs device surface results in enormous transformation of the I–V characteristics that demonstrate the strong increase of the resistance and Coulomb blockade regime is replaced by the electron tunneling processes. The results obtained are analyzed within frameworks of disordering SI GaAs surface that is caused by inhomogeneous distribution of the donor and acceptor anti-site defects which affects the conditions of quantum- mechanical tunneling. Weak localization processes caused by the preservation of the Fermi level pinning are demonstrated by measuring the negative magnetoresistance in weak magnetic fields at room temperature. Finally, the studies of the magnetoresistance at higher magnetic fields reveal the h/2e Aharonov–Altshuler–Spivak oscillations with the complicated behavior due to possible statistical mismatch of the interference paths in the presence of different microdefects.

  12. Relationship between three phase bone scintigram and prognosis after sympathetic blockade in reflex sympathetic dystrophy of the hand

    Energy Technology Data Exchange (ETDEWEB)

    Yokono, Atsuko; Yokono, Satoshi; Oguri, Kenji (Kagawa Medical School, Miki (Japan))

    1990-11-01

    The authors attempted to correlate the changes in three phase bone scintigram (TPBS) with prognosis after sympathetic blockade in reflex sympathetic dystrophy (RSD) of the hand. Subjects were 12 patients of RSD in acute or dystrophic stage, who all had increased images on TPBS. Either intravenous regional sympathectomy with guanethidine or stellate ganglion block was performed repeatedly. We compared TPBS obtained just before and after this series of sympathetic blocks and evaluated the eventual recovery of function of the hand. In 8 patients, blood flow (phase 1) image of TPBS decreased after the blockade. Of these patients, those who showed almost normalized tracer activity not only on flow image but on blood pool (phase 2) and delayed (phase 3) image, returned to normal. But others with normalized blood flow and still increased activity in blood pool and delayed image, remained with mild contracture of the hand. These results suggest that normalization of blood pool and delayed image on TPBS is a predictor of subsequent recovery after sympathetic blockade in RSD. (author).

  13. Blockade of the voltage-gated potassium channel Kv1.3 inhibits immune responses in vivo.

    Science.gov (United States)

    Koo, G C; Blake, J T; Talento, A; Nguyen, M; Lin, S; Sirotina, A; Shah, K; Mulvany, K; Hora, D; Cunningham, P; Wunderler, D L; McManus, O B; Slaughter, R; Bugianesi, R; Felix, J; Garcia, M; Williamson, J; Kaczorowski, G; Sigal, N H; Springer, M S; Feeney, W

    1997-06-01

    The voltage activated K+ channel (Kv1.3) has recently been identified as the molecule that sets the resting membrane potential of peripheral human T lymphoid cells. In vitro studies indicate that blockage of Kv1.3 inhibits T cell activation, suggesting that Kv1.3 may be a target for immunosuppression. However, despite the in vitro evidence, there has been no in vivo demonstration that blockade of Kv1.3 will attenuate an immune response. The difficulty is due to species differences, as the channel does not set the membrane potential in rodent peripheral T cells. In this study, we show that the channel is present on peripheral T cells of miniswine. Using the peptidyl Kv1.3 inhibitor, margatoxin, we demonstrate that Kv1.3 also regulates the resting membrane potential, and that blockade of Kv1.3 inhibits, in vivo, both a delayed-type hypersensitivity reaction and an Ab response to an allogeneic challenge. In addition, prolonged Kv1.3 blockade causes reduced thymic cellularity and inhibits the thymic development of T cell subsets. These results provide in vivo evidence that Kv1.3 is a novel target for immunomodulation.

  14. Uncoupling of the baroreflex by N(N)-cholinergic blockade in dissecting the components of cardiovascular regulation

    Science.gov (United States)

    Shannon, J. R.; Jordan, J.; Black, B. K.; Costa, F.; Robertson, D.

    1998-01-01

    Systemic administration of adrenergic agonists and nitric oxide donors is used extensively to determine cardiovascular receptor sensitivity. Conclusions regarding receptor sensitivity in the presence of the baroreflex may be misleading. In 8 normal volunteers, we determined the heart rate and blood pressure changes after incremental bolus doses of isoproterenol, phenylephrine, and sodium nitroprusside before and during neuronal nicotinic cholinergic (N(N)-cholinergic) blockade with trimethaphan. Results are given as median (25th/75th percentile). With trimethaphan, the baroreflex slope (as determined by bolus doses of nitroprusside and phenylephrine) decreased from 24 (22/26) to 0.00 (0.00/0.09) ms/mm Hg (Pbaroreflex can be completely interrupted with N(N)-cholinergic blockade. Estimation of adrenoreceptor sensitivity and sensitivity to nitric oxide donors by systemic administration of agonists is severely confounded by baroreflexes. Uncoupling of the baroreflex by N(N)-cholinergic blockade may be a useful method to obtain an integrated measure of adrenergic receptor sensitivity and sensitivity to nitric oxide donors in humans. This approach would permit the comparison of normal and abnormal physiological states without the "noise" of baroreflex buffering.

  15. Blockade of glucocorticoid receptors improves cutaneous wound healing in stressed mice.

    Science.gov (United States)

    de Almeida, Taís Fontoura; de Castro Pires, Taiza; Monte-Alto-Costa, Andréa

    2016-02-01

    Stress is an important condition of modern life. The successful wound healing requires the execution of three major overlapping phases: inflammation, proliferation, and remodeling, and stress can disturb this process. Chronic stress impairs wound healing through the activation of the hypothalamic-pituitary-adrenal axis, and the glucocorticoids (GCs) hormones have been shown to delay wound closure. Therefore, the aim of this study was to investigate the effects of a GC receptor antagonist (RU486) treatment on cutaneous healing in chronically stressed mice. Male mice were submitted to rotational stress, whereas control animals were not subjected to stress. Stressed and control animals were treated with RU486. A full-thickness excisional lesion was generated, and seven days later, lesions were recovered. The RU486 treatment improves wound healing since contraction takes place earlier in RU486-treated in comparison to non-treated mice, and the RU486 treatment also improves the angiogenesis in Stress+RU486 mice when compared to stressed animals. The Stress+RU486 group showed a decrease in inflammatory cell infiltration and in hypoxia-inducible factor-1α and inducible nitric oxide synthase expression; meanwhile, there was an increase in myofibroblasts quantity. In conclusion, blockade of GC receptors with RU486 partially ameliorates stress-impaired wound healing, suggesting that stress inhibits healing through more than one functional pathway. © 2016 by the Society for Experimental Biology and Medicine.

  16. Blockade of P2X7 receptors or pannexin-1 channels similarly attenuates postischemic damage.

    Science.gov (United States)

    Cisneros-Mejorado, Abraham; Gottlieb, Miroslav; Cavaliere, Fabio; Magnus, Tim; Koch-Nolte, Friederich; Scemes, Eliana; Pérez-Samartín, Alberto; Matute, Carlos

    2015-05-01

    The role of P2X7 receptors and pannexin-1 channels in ischemic damage remains controversial. Here, we analyzed their contribution to postanoxic depolarization after ischemia in cultured neurons and in brain slices. We observed that pharmacological blockade of P2X7 receptors or pannexin-1 channels delayed the onset of postanoxic currents and reduced their slope, and that simultaneous inhibition did not further enhance the effects of blocking either one. These results were confirmed in acute cortical slices from P2X7 and pannexin-1 knockout mice. Oxygen-glucose deprivation in cortical organotypic cultures caused neuronal death that was reduced with P2X7 and pannexin-1 blockers as well as in organotypic cultures derived from mice lacking P2X7 and pannexin 1. Subsequently, we used transient middle cerebral artery occlusion to monitor the neuroprotective effect of those drugs in vivo. We found that P2X7 and pannexin-1 antagonists, and their ablation in knockout mice, substantially attenuated the motor symptoms and reduced the infarct volume to ~50% of that in vehicle-treated or wild-type animals. These results show that P2X7 receptors and pannexin-1 channels are major mediators of postanoxic depolarization in neurons and of brain damage after ischemia, and that they operate in the same deleterious signaling cascade leading to neuronal and tissue demise.

  17. Antispasmodic and Antidiarrheal Activities of Valeriana hardwickii Wall. Rhizome Are Putatively Mediated through Calcium Channel Blockade

    Science.gov (United States)

    Bashir, Samra; Memon, Raafia; Gilani, Anwar H.

    2011-01-01

    Valeriana hardwickii is indigenous to Pakistan, Burma and Ceylon, where it is traditionally being used as an antispasmodic and antidiarrheal, besides its culinary use as spice. The aim of this paper was to provide pharmacological validation to these medicinal uses. The crude aqueous-methanolic extract of Valeriana hardwickii rhizome (Vh.Cr) was studied on isolated rabbit jejunum and castor oil-induced diarrhea in mice for spasmolytic and antidiarrheal properties, respectively. Vh.Cr caused concentration-dependent (0.01–1 mg/mL) relaxation of spontaneous contractions in isolated rabbit jejunum and inhibited K+-induced contractions (0.01–0.3 mg/mL), similar to verapamil, suggestive of calcium channel blockade (CCB). The CCB effect was confirmed when pretreatment of the jejunum preparations with Vh.Cr produced a concentration-dependent (0.03–0.1 mg/mL) rightward shift in the Ca++ concentration-response curves, as caused by verapamil. Vh.Cr exhibited dose-dependent (100–300 mg/kg) protection against castor oil-induced diarrhea in mice. Loperamide, a standard antidiarrheal drug, similarly prevented the diarrhea. These data indicate the presence of CCB effect in the extract of Valeriana hardwickii rhizome, possibly mediating its antispasmodic and antidiarrheal activities and provide a scientific base for its traditional use in hyperactive gut disorders. PMID:21423691

  18. The effect of opioid receptor blockade on the neural processing of thermal stimuli.

    Directory of Open Access Journals (Sweden)

    Eszter D Schoell

    Full Text Available The endogenous opioid system represents one of the principal systems in the modulation of pain. This has been demonstrated in studies of placebo analgesia and stress-induced analgesia, where anti-nociceptive activity triggered by pain itself or by cognitive states is blocked by opioid antagonists. The aim of this study was to characterize the effect of opioid receptor blockade on the physiological processing of painful thermal stimulation in the absence of cognitive manipulation. We therefore measured BOLD (blood oxygen level dependent signal responses and intensity ratings to non-painful and painful thermal stimuli in a double-blind, cross-over design using the opioid receptor antagonist naloxone. On the behavioral level, we observed an increase in intensity ratings under naloxone due mainly to a difference in the non-painful stimuli. On the neural level, painful thermal stimulation was associated with a negative BOLD signal within the pregenual anterior cingulate cortex, and this deactivation was abolished by naloxone.

  19. Pharmacological blockade of cholesterol trafficking by cepharanthine in endothelial cells suppresses angiogenesis and tumor growth.

    Science.gov (United States)

    Lyu, Junfang; Yang, Eun Ju; Head, Sarah A; Ai, Nana; Zhang, Baoyuan; Wu, Changjie; Li, Ruo-Jing; Liu, Yifan; Yang, Chen; Dang, Yongjun; Kwon, Ho Jeong; Ge, Wei; Liu, Jun O; Shim, Joong Sup

    2017-11-28

    Cholesterol is an important modulator of membrane protein function and signaling in endothelial cells, thus making it an emerging target for anti-angiogenic agents. In this study, we employed a phenotypic screen that detects intracellular cholesterol distribution in endothelial cells (HUVEC) and identified 13 existing drugs as cholesterol trafficking inhibitors. Cepharanthine, an approved drug for anti-inflammatory and cancer management use, was amongst the candidates, which was selected for in-depth mechanistic studies to link cholesterol trafficking and angiogenesis. Cepharanthine inhibited the endolysosomal trafficking of free-cholesterol and low-density lipoprotein in HUVEC by binding to Niemann-Pick disease, type C1 (NPC1) protein and increasing the lysosomal pH. The blockade of cholesterol trafficking led to a cholesterol-dependent dissociation of mTOR from the lysosomes and inhibition of its downstream signaling. Cepharanthine inhibited angiogenesis in HUVEC and in zebrafish in a cholesterol-dependent manner. Furthermore, cepharanthine suppressed tumor growth in vivo by inhibiting angiogenesis and it enhanced the antitumor activity of the standard chemotherapy cisplatin in lung and breast cancer xenografts in mice. Altogether, these results strongly support the idea that cholesterol trafficking is a viable drug target for anti-angiogenesis and that the inhibitors identified among existing drugs, such as cepharanthine, could be potential anti-angiogenic and antitumor agents. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Central but not peripheral opiate receptor blockade prolonged pituitary-adrenal responses to stress.

    Science.gov (United States)

    Odio, M; Brodish, A

    1990-04-01

    Evidence from pharmacological studies suggest that opiate systems may serve either inhibitory or stimulatory functions on stress-induced responses of the hypothalamic-pituitary-adrenocortical (HPA) axis. The objective of these experiments was to determine whether these discrepant findings may result, in part, from differential effects of central or peripheral opiate receptor blockade on HPA axis responses. To this effect, groups of rats received injections of either saline, naltrexone (NHCl) or the quaternary analogue naltrexone methobromide (NMBr). The animals were then exposed to 30 min of a motion stressor and blood samples were obtained from each rat for analysis of ACTH, corticosterone, and prolactin. The data showed that resting and stress-induced levels of prolactin were decreased by NHCl only. Although neither drug affected the magnitude of the stress-induced ACTH and corticosterone responses, treatment with NHCl, but not NMBr, delayed the poststress decline of these responses. Hence, we concluded that central opiate mechanisms may be important for cessation of HPA axis activity, after exposure to stressful situations.

  1. Effects of intraoperative magnetic resonance imaging on the neuromuscular blockade of vecuronium bromide in neurosurgery

    International Nuclear Information System (INIS)

    Guo Ying; Zhang Hong; Sun Li

    2013-01-01

    The effects of intraoperative magnetic resonance (iMR) imaging on the neuromuscular blockade of vecuronium bromide were investigated in neurosurgery. Fifty patients with American Society of Anesthesiologists grades I-II scheduled for craniotomy operation were divided into two groups (n=25 each) with no difference in demographic data: the iMR imaging group and control group. Train-of-four (TOF) stimulation through an accelerometer was used to monitor onset, maintenance, and recovery of muscle relaxation caused by vecuronium. Vecuronium bromide was intravenously injected after anesthesia induction. The dosage of vecuronium bromide in the iMR imaging group was larger than in the control group, but not significantly. Duration of vecuronium bromide administration and operation time were significantly longer in the iMR imaging group than in the control group. Time from drug discontinuation to operation termination, and to return to neurosurgery intensive care unit were not different. Time taken by first twitch (T 1 ) in response to TOF stimulation to recover by 25%, and muscle relaxant recovery index were significantly greater in the control group than in the iMR imaging group. The body temperature of the patients increased gradually in the iMR imaging group but decreased in the control group. iMR imaging can prolong the operation time, increase the body temperature of the patient, and remarkably shorten the clinical action time and muscle relaxation recovery index of vecuronium. (author)

  2. Reversing neuromuscular blockade: inhibitors of the acetylcholinesterase versus the encapsulating agents sugammadex and calabadion.

    Science.gov (United States)

    Haerter, Friederike; Eikermann, Matthias

    2016-01-01

    Acetylcholinesterase inhibitors (neostigmine, edrophonium) and encapsulating agents (sugammadex and calabadion) can be used to reverse residual neuromuscular blockade (NMB). This review provides information about efficacy, effectiveness, and side effects of drugs (acetylcholinesterase inhibitors and encapsulating agents) used to reverse neuromuscular blocking agents (NMBAs). The therapeutic range of acetylcholinesterase-inhibitors is narrow and effectiveness studies demonstrate clinicians don't use these unspecific reversal agents effectively to increase postoperative respiratory safety. The encapsulating drugs sugammadex and calabadion reverse all levels of NMB, and complete recovery of muscle strength can be achieved almost immediately after administration. For this reason encapsulating agents can be used as a solution for "cannot intubate cannot ventilate"- situations. Poor binding selectivity of encapsulating agents carries the risk of displacement of the NMBA by a competitively binding drug, which may lead to recurarization. In order to avoid side-effects, related to unspecific binding of endogenous proteins and drugs administered perioperatively it is prudent to titrate the dose of reversal agents to the minimal effective dose, depending on the depth of neuromuscular transmission block identified by neuromuscular transmission monitoring. Calabadions provide a diversified (increased binding selectivity) and expanded (reversal of benzylisoquinolines) spectrum of possible indications.

  3. Sugammadex ED90 dose to reverse the rocuronium neuromuscular blockade in obese patients

    Directory of Open Access Journals (Sweden)

    MAURO PRADO DA SILVA

    Full Text Available ABSTRACT Objective: to determine the ED90 (minimum effective dose in 90% of patients of sugammadex for the reversal of rocuronium-induced moderate neuromuscular blockade (NMB in patients with grade III obesity undergoing bariatric surgery. Methods: we conducted a prospective study with the biased coin up-and-down sequential design. We chosen the following doses: 2.0mg/Kg, 2.2mg/Kg, 2.4mg/Kg, 2.6mg/Kg, 2.8mg/Kg. The complete reversal of rocuronium-induced NMB considered a T4/T1 ratio ≥0.9 as measured by TOF. After induction of general anesthesia and calibration of the peripheral nerve stimulator and accelerometer, we injected rocuronium 0.6mg/kg. We administered propofol and remifentanil by continuous infusion, and intermittent boluses of rocuronium throughout the procedure. Results: we evaluated 31 patients, of whom 26 had displayed successful reversal of the NMB with sugammadex, and failure in five. The mean time to complete moderate NMB reversal was 213 seconds (172-300, median 25-75%. The ED90 of sugammadex calculated by regression was 2.39mg/kg, with a 95% confidence interval of 2.27-2.46 mg/kg. Conclusion: the ED90 of sugammadex in patients with grade III obesity or higher was 2.39mg/kg.

  4. Immune checkpoint blockade therapy: The 2014 Tang prize in biopharmaceutical science

    Directory of Open Access Journals (Sweden)

    Ya-Shan Chen

    2015-02-01

    Full Text Available The first Tang Prize for Biopharmaceutical Science has been awarded to Prof. James P. Allison and Prof. Tasuku Honjo for their contributions leading to an entirely new way to treat cancer by blocking the molecules cytotoxic T lymphocyte-associated antigen 4 (CTLA-4 and programmed cell death protein 1 (PD-1 that turn off immune response. The treatment, called "immune checkpoint blockade therapy," has opened a new therapeutic era. Here the discoveries of the immune checkpoints and how they contribute to the maintenance of self-tolerance, as well as how to protect tissues from the excess immune responses causing damage are reviewed. The efforts made by Prof. Allison and Prof. Honjo for developing the most promising approaches to activate therapeutic antitumor immunity are also summarized. Since these certain immune checkpoint pathways appear to be one of the major mechanisms resulting in immune escape of tumors, the presence of anti-CTLA-4 and/or anti-PD-1 should contribute to removal of the inhibition signals for T cell activation. Subsequently, it will enhance specific T cell activation and, therefore, strengthen antitumor immunity.

  5. Blockade of TGF-β 1 Signalling Inhibits Cardiac NADPH Oxidase Overactivity in Hypertensive Rats

    Directory of Open Access Journals (Sweden)

    José Luis Miguel-Carrasco

    2012-01-01

    Full Text Available NADPH oxidases constitute a major source of superoxide anion (⋅O2 - in hypertension. Several studies suggest an important role of NADPH oxidases in different effects mediated by TGF-β 1. In this study we show that chronic administration of P144, a peptide synthesized from type III TGF-β 1 receptor, significantly reduced the cardiac NADPH oxidase expression and activity as well as in the nitrotyrosine levels observed in control spontaneously hypertensive rats (V-SHR to levels similar to control normotensive Wistar Kyoto rats. In addition, P144 was also able to reduce the significant increases in the expression of collagen type I protein and mRNA observed in hearts from V-SHR. In addition, positive correlations between collagen expression, NADPH oxidase activity, and nitrotyrosine levels were found in all animals. Finally, TGF-β 1-stimulated Rat-2 exhibited significant increases in NADPH oxidase activity that was inhibited in the presence of P144. It could be concluded that the blockade of TGF-β 1 with P144 inhibited cardiac NADPH oxidase in SHR, thus adding new data to elucidate the involvement of this enzyme in the profibrotic actions of TGF-β 1.

  6. Blockade and reversal of 5-methoxy-N,N-dimethyltryptamine-induced analgesia following noradrenaline depletion.

    Science.gov (United States)

    Archer, T; Minor, B G; Post, C

    1985-04-29

    The acute effects of the 5-hydroxytryptamine agonist, 5-Methoxy-N,N-dimethyltryptamine (5-MeO-DMT), upon pain sensitivity, using shock titration, tail-flick and hot-plate methods, in noradrenaline- and 5-hydroxytryptamine-depleted rats were examined. Noradrenaline depletion, following the systemic administration of N-2-chloroethyl-N-ethyl-2-bromobenzylamine hydrochloride (DSP4, 2 X 50 mg/kg, i.p.), caused a reversal of the analgesic effect of 5-MeO-DMT on shock-titration from hypo- to hypersensitivity, and a total blockade of the antinociceptive effect of 5-MeO-DMT upon pain responses in the hot-plate and tail-flick tests. Pretreatment with either p-chloroamphetamine (2 X 10 mg/kg) or p-chlorophenylalanine (200, 100, 100 mg/kg), that depletes central 5-hydroxytryptamine stores, failed to alter the analgesia caused by acute 5-MeO-DMT. Strong evidence is provided for the effect of central noradrenaline depletion upon the analgesic effect of the 5-HT agonist. These findings suggest an important tonic influence of the noradrenaline system upon the descending spinal 5-HT pathway in rats.

  7. N-Methyl-d-Aspartate (NMDA) Receptor Blockade Prevents Neuronal Death Induced by Zika Virus Infection.

    Science.gov (United States)

    Costa, Vivian V; Del Sarto, Juliana L; Rocha, Rebeca F; Silva, Flavia R; Doria, Juliana G; Olmo, Isabella G; Marques, Rafael E; Queiroz-Junior, Celso M; Foureaux, Giselle; Araújo, Julia Maria S; Cramer, Allysson; Real, Ana Luíza C V; Ribeiro, Lucas S; Sardi, Silvia I; Ferreira, Anderson J; Machado, Fabiana S; de Oliveira, Antônio C; Teixeira, Antônio L; Nakaya, Helder I; Souza, Danielle G; Ribeiro, Fabiola M; Teixeira, Mauro M

    2017-04-25

    Zika virus (ZIKV) infection is a global health emergency that causes significant neurodegeneration. Neurodegenerative processes may be exacerbated by N -methyl-d-aspartate receptor (NMDAR)-dependent neuronal excitoxicity. Here, we have exploited the hypothesis that ZIKV-induced neurodegeneration can be rescued by blocking NMDA overstimulation with memantine. Our results show that ZIKV actively replicates in primary neurons and that virus replication is directly associated with massive neuronal cell death. Interestingly, treatment with memantine or other NMDAR blockers, including dizocilpine (MK-801), agmatine sulfate, or ifenprodil, prevents neuronal death without interfering with the ability of ZIKV to replicate in these cells. Moreover, in vivo experiments demonstrate that therapeutic memantine treatment prevents the increase of intraocular pressure (IOP) induced by infection and massively reduces neurodegeneration and microgliosis in the brain of infected mice. Our results indicate that the blockade of NMDARs by memantine provides potent neuroprotective effects against ZIKV-induced neuronal damage, suggesting it could be a viable treatment for patients at risk for ZIKV infection-induced neurodegeneration. IMPORTANCE Zika virus (ZIKV) infection is a global health emergency associated with serious neurological complications, including microcephaly and Guillain-Barré syndrome. Infection of experimental animals with ZIKV causes significant neuronal damage and microgliosis. Treatment with drugs that block NMDARs prevented neuronal damage both in vitro and in vivo These results suggest that overactivation of NMDARs contributes significantly to the neuronal damage induced by ZIKV infection, and this is amenable to inhibition by drug treatment. Copyright © 2017 Costa et al.

  8. The efficacy of adductor canal blockade after minor arthroscopic knee surgery

    DEFF Research Database (Denmark)

    Espelund, M; Fomsgaard, J S; Haraszuk, J

    2014-01-01

    BACKGROUND: Adductor canal blockade (ACB) has been demonstrated to be effective in the treatment of post-operative pain after major knee surgery. We hypothesised that the ACB would reduce pain and analgesic requirements after minor arthroscopic knee surgery. METHODS: Seventy-two patients scheduled...... for minor knee surgery were enrolled in this placebo-controlled, blinded trial. The patients were randomised to receive an ACB with either 30 ml ropivacaine 7.5 mg/ml (n = 36) or saline (n = 35) in addition to a basic analgesic regimen with paracetamol and ibuprofen. Primary outcome measure was pain during...... standing at 2 h after surgery. Secondary outcomes were pain at rest, while standing and after a 5-m walk; opioid consumption and opioid-related side effects 0-24 h after surgery. RESULTS: Pain scores {median [interquartile range (IQR)]}, regarding primary outcome were 15 (0-26) mm in the ropivacaine vs. 17...

  9. Nicotinic versus muscarinic blockade alters verbal working memory-related brain activity in older women.

    Science.gov (United States)

    Dumas, Julie A; Saykin, Andrew J; McDonald, Brenna C; McAllister, Thomas W; Hynes, Mary L; Newhouse, Paul A

    2008-04-01

    An important aspect of furthering our understanding of the central nervous system function after menopause is to examine the cerebral circuitry that appears to be influenced by cholinergic antagonist drugs in the presence and absence of estrogen. This pilot study investigated the effects of two anticholinergic drugs on brain activation and working memory performance in postmenopausal women not taking estrogen. This approach simulates the effects of age- or disease-related neuroreceptor or neuronal loss by temporarily blocking pre- and postsynaptic muscarinic and nicotinic cholinergic receptors. Six healthy postmenopausal women took part in three drug challenges using the antinicotinic drug mecamylamine (MECA, 20 mg, oral), the antimuscarinic drug scopolamine (SCOP, 2.5 microg/kg, i.v.), and placebo during functional magnetic resonance imaging. The cognitive measure was a visually presented verbal N-back test of working memory. Neither MECA nor SCOP significantly impaired performance on the verbal N-back. Functional magnetic resonance imaging results showed greater increases in frontal lobe activation in the placebo condition relative to each drug condition with different specific regional activation for MECA and SCOP. These preliminary results suggest that brain activation patterns are sensitive to cholinergic modulation in postmenopausal women and that differential effects may be observed following nicotinic versus muscarinic blockade. This approach offers a potentially valuable method for modeling age-related changes in brain function, and the findings may have implications for cholinergic contributions to normal and pathologic aging.

  10. Cytosolic Accumulation of L-Proline Disrupts GABA-Ergic Transmission through GAD Blockade

    Directory of Open Access Journals (Sweden)

    Gregg W. Crabtree

    2016-10-01

    Full Text Available Proline dehydrogenase (PRODH, which degrades L-proline, resides within the schizophrenia-linked 22q11.2 deletion suggesting a role in disease. Supporting this, elevated L-proline levels have been shown to increase risk for psychotic disorders. Despite the strength of data linking PRODH and L-proline to neuropsychiatric diseases, targets of disease-relevant concentrations of L-proline have not been convincingly described. Here, we show that Prodh-deficient mice with elevated CNS L-proline display specific deficits in high-frequency GABA-ergic transmission and gamma-band oscillations. We find that L-proline is a GABA-mimetic and can act at multiple GABA-ergic targets. However, at disease-relevant concentrations, GABA-mimesis is limited to competitive blockade of glutamate decarboxylase leading to reduced GABA production. Significantly, deficits in GABA-ergic transmission are reversed by enhancing net GABA production with the clinically relevant compound vigabatrin. These findings indicate that accumulation of a neuroactive metabolite can lead to molecular and synaptic dysfunction and help to understand mechanisms underlying neuropsychiatric disease.

  11. Noradrenaline transporter blockade increases fronto-parietal functional connectivity relevant for working memory.

    Science.gov (United States)

    Hernaus, Dennis; Casales Santa, Marta Ma; Offermann, Jan Stefan; Van Amelsvoort, Thérèse

    2017-04-01

    Experimental animal work has demonstrated that dopamine and noradrenaline play an essential role in modulating prefrontal cortex-mediated networks underlying working memory performance. Studies of functional connectivity have been instrumental in extending such notions to humans but, so far, have almost exclusively focussed on pharmacological agents with a predominant dopaminergic mechanism of action. Here, we investigate the effect of a single dose of atomoxetine 60mg, a noradrenaline transporter inhibitor, on working memory performance and associated functional connectivity during an n-back task in 19 healthy male volunteers. Atomoxetine increased functional connectivity between right anterior insula and dorsolateral prefrontal cortex, precentral gyrus, posterior parietal cortex and precuneus during the high-working memory load condition of the n-back task. Increased atomoxetine-induced insula-dorsolateral prefrontal cortex functional connectivity during this condition correlated with decreased reaction time variability and was furthermore predicted by working memory capacity. These results show for the first time that noradrenaline transporter blockade-induced increases in cortical catecholamines accentuate fronto-parietal working memory-related network integrity. The observation of significant inter-subject variability in response to atomoxetine has implications for inverted-U frameworks of dopamine and noradrenaline function, which could be useful to predict drug effects in clinical disorders with variable treatment response. Copyright © 2017 Elsevier B.V. and ECNP. All rights reserved.

  12. Oncogenic pathways that affect antitumor immune response and immune checkpoint blockade therapy.

    Science.gov (United States)

    Zhao, Xianda; Subramanian, Subbaya

    2018-01-01

    Mechanistic insights of cancer immunology have led to the development of immune checkpoint blockade therapy (ICBT), which has elicited a remarkable clinical response in some cancer patients. Increasing evidence suggests that activation of oncogenic pathways, such as RAS/RAF/MAPK and PI3K signaling, impairs the antitumor immune response. Such oncogenic signaling, in turn, activates many inhibitory factors, including expression of immune checkpoint genes-allowing active infiltration of immunosuppressive cells into the tumor environment and inducing resistance against T-cell killing. In preclinical tumor models, effective targeting of oncogenic pathways has enhanced the response to ICBT. Ongoing clinical trials are now evaluating combination therapy (i.e., the use of oncogenic pathway inhibitors in combination with ICBT). However, more translational and clinical research is needed, to optimize ICBT doses and sequence, minimize toxicity, and assess the impact on study participants of certain genetic backgrounds. Also, it is crucial to understand whether wild-type tumors with elevated oncogenic signaling will respond to combination therapy. Insights gained through current and future translational studies will provide the scientific premise and rationale to target 1 or more oncogenic pathways in ICBT-resistant tumors, thus enabling more human patients to benefit from combination therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Blockade of advanced glycation end product formation attenuates bleomycin-induced pulmonary fibrosis in rats

    Directory of Open Access Journals (Sweden)

    Liu Dai-Shun

    2009-06-01

    Full Text Available Abstract Background Advanced glycation end products (AGEs have been proposed to be involved in pulmonary fibrosis, but its role in this process has not been fully understood. To investigate the role of AGE formation in pulmonary fibrosis, we used a bleomycin (BLM-stimulated rat model treated with aminoguanidine (AG, a crosslink inhibitor of AGE formation. Methods Rats were intratracheally instilled with BLM (5 mg/kg and orally administered with AG (40, 80, 120 mg/kg once daily for two weeks. AGEs level in lung tissue was determined by ELISA and pulmonary fibrosis was evaluated by Ashcroft score and hydroxyproline assay. The expression of heat shock protein 47 (HSP47, a collagen specific molecular chaperone, was measured with RT-PCR and Western blot. Moreover, TGFβ1 and its downstream Smad proteins were analyzed by Western blot. Results AGEs level in rat lungs, as well as lung hydroxyproline content and Ashcroft score, was significantly enhanced by BLM stimulation, which was abrogated by AG treatment. BLM significantly increased the expression of HSP47 mRNA and protein in lung tissues, and AG treatment markedly decreased BLM-induced HSP47 expression in a dose-dependent manner (p Conclusion These findings suggest AGE formation may participate in the process of BLM-induced pulmonary fibrosis, and blockade of AGE formation by AG treatment attenuates BLM-induced pulmonary fibrosis in rats, which is implicated in inhibition of HSP47 expression and TGFβ/Smads signaling.

  14. Effects of CTGF Blockade on Attenuation and Reversal of Radiation-Induced Pulmonary Fibrosis.

    Science.gov (United States)

    Bickelhaupt, Sebastian; Erbel, Christian; Timke, Carmen; Wirkner, Ute; Dadrich, Monika; Flechsig, Paul; Tietz, Alexandra; Pföhler, Johanna; Gross, Wolfgang; Peschke, Peter; Hoeltgen, Line; Katus, Hugo A; Gröne, Hermann-Josef; Nicolay, Nils H; Saffrich, Rainer; Debus, Jürgen; Sternlicht, Mark D; Seeley, Todd W; Lipson, Kenneth E; Huber, Peter E

    2017-08-01

    Radiotherapy is a mainstay for the treatment of lung cancer that can induce pneumonitis or pulmonary fibrosis. The matricellular protein connective tissue growth factor (CTGF) is a central mediator of tissue remodeling. A radiation-induced mouse model of pulmonary fibrosis was used to determine if transient administration of a human antibody to CTGF (FG-3019) started at different times before or after 20 Gy thoracic irradiation reduced acute and chronic radiation toxicity. Mice (25 mice/group; 10 mice/group in a confirmation study) were examined by computed tomography, histology, gene expression changes, and for survival. In vitro experiments were performed to directly study the interaction of CTGF blockade and radiation. All statistical tests were two-sided. Administration of FG-3019 prevented (∼50%-80%) or reversed (∼50%) lung remodeling, improved lung function, improved mouse health, and rescued mice from lethal irradiation ( P radiation-induced gene expression changes, and reduced myofibroblast abundance and Osteopontin expression. These results indicate that blocking CTGF attenuates radiation-induced pulmonary remodeling and can reverse the process after initiation. CTGF has a central role in radiation-induced fibrogenesis, and FG-3019 may benefit patients with radiation-induced pulmonary fibrosis or patients with other forms or origin of chronic fibrotic diseases. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. An all-silicon single-photon source by unconventional photon blockade.

    Science.gov (United States)

    Flayac, Hugo; Gerace, Dario; Savona, Vincenzo

    2015-06-10

    The lack of suitable quantum emitters in silicon and silicon-based materials has prevented the realization of room temperature, compact, stable, and integrated sources of single photons in a scalable on-chip architecture, so far. Current approaches rely on exploiting the enhanced optical nonlinearity of silicon through light confinement or slow-light propagation, and are based on parametric processes that typically require substantial input energy and spatial footprint to reach a reasonable output yield. Here we propose an alternative all-silicon device that employs a different paradigm, namely the interplay between quantum interference and the third-order intrinsic nonlinearity in a system of two coupled optical cavities. This unconventional photon blockade allows to produce antibunched radiation at extremely low input powers. We demonstrate a reliable protocol to operate this mechanism under pulsed optical excitation, as required for device applications, thus implementing a true single-photon source. We finally propose a state-of-art implementation in a standard silicon-based photonic crystal integrated circuit that outperforms existing parametric devices either in input power or footprint area.

  16. Blockade of cholesterol absorption by ezetimibe reveals a complex homeostatic network in enterocytes[S

    Science.gov (United States)

    Engelking, Luke J.; McFarlane, Matthew R.; Li, Christina K.; Liang, Guosheng

    2012-01-01

    Enterocyte cholesterol homeostasis reflects aggregated rates of sterol synthesis, efflux, and uptake from plasma and gut lumen. Cholesterol synthesis and LDL uptake are coordinately regulated by sterol regulatory element-binding proteins (SREBP), whereas sterol efflux is regulated by liver X receptors (LXR). How these processes are coordinately regulated in enterocytes, the site of cholesterol absorption, is not well understood. Here, we treat mice with ezetimibe to investigate the effect of blocking cholesterol absorption on intestinal SREBPs, LXRs, and their effectors. Ezetimibe increased nuclear SREBP-2 8-fold. HMG-CoA reductase (HMGR) and LDL receptor (LDLR) mRNA levels increased less than 3-fold, whereas their protein levels increased 30- and 10-fold, respectively. Expression of inducible degrader of LDLR (IDOL), an LXR-regulated gene that degrades LDLRs, was reduced 50% by ezetimibe. Coadministration of ezetimibe with the LXR agonist T0901317 abolished the reduction in IDOL and prevented the increase in LDLR protein. Ezetimibe-stimulated LDLR expression was independent of proprotein convertase subtilisin/kexin type 9 (PSCK9), a protein that degrades LDLRs. To maintain cholesterol homeostasis in the face of ezetimibe, enterocytes boost LDL uptake by increasing LDLR number, and they boost sterol synthesis by increasing HMGR and other cholesterologenic genes. These studies reveal a hitherto undescribed homeostatic network in enterocytes triggered by blockade of cholesterol absorption. PMID:22523394

  17. BLOCKADE OF PGE2, PGD2 RECEPTORS CONFERS PROTECTION AGAINST PREPATENT SCHISTOSOMIASIS MANSONI IN MICE.

    Science.gov (United States)

    Abdel-Ghany, Rasha; Rabia, Ibrahim; El-Ahwany, Eman; Saber, Sameh; Gamal, Rasha; Nagy, Faten; Mahmoud, Olaa; Hamad, Rabab Salem; Barakat, Walled

    2015-12-01

    Schistosomiasis is a chronic disease with considerable social impact. Despite the availability of affordable chemotherapy, drug treatment has not significantly reduced the overall number of disease cases. Among other mechanisms, the parasite produces PGE2 and PGD2 to evade host immune defenses. To investigate the role of PGE2 and PGD2 in schistosomiasis, we evaluated the effects of L-161,982, Ah6809 (PGE2 receptor antagonists alone of combined with each other) and MK-0524 (PGD2 receptor antagonist) during prepatent Schistosoma mansoni infection. Drugs were administered intraperitoneally an hour before and 24 hours after infection of C57BL/6 mice with 100 Schistosoma mansoni cercariae. L-161,982, Ah6809, their combination and MK-0524 caused partial protection against pre-patent S. mansoni infection which was mediated by biasing the immune response towards Th1 phenotype. These results showed that blockade of PGE2 and PGD2 receptors confers partial protection against pre-patent S. mansoni infection in mice and that they may be useful as adjunctive therapy to current anti-schistosomal drugs or vaccines.

  18. The Role of Costimulation Blockade in Solid Organ and Islet Xenotransplantation

    Directory of Open Access Journals (Sweden)

    Kannan P. Samy

    2017-01-01

    Full Text Available Pig-to-human xenotransplantation offers a potential bridge to the growing disparity between patients with end-stage organ failure and graft availability. Early studies attempting to overcome cross-species barriers demonstrated robust humoral immune responses to discordant xenoantigens. Recent advances have led to highly efficient and targeted genomic editing, drastically altering the playing field towards rapid production of less immunogenic porcine tissues and even the discussion of human xenotransplantation trials. However, as these humoral immune barriers to cross-species transplantation are overcome with advanced transgenics, cellular immunity to these novel xenografts remains an outstanding issue. Therefore, understanding and optimizing immunomodulation will be paramount for successful clinical xenotransplantation. Costimulation blockade agents have been introduced in xenotransplantation research in 2000 with anti-CD154mAb. Most recently, prolonged survival has been achieved in solid organ (kidney xenograft survival > 400 days with anti-CD154mAb, heart xenograft survival > 900 days, and liver xenograft survival 29 days with anti-CD40mAb and islet xenotransplantation (>600 days with anti-CD154mAb with the use of these potent experimental agents. As the development of novel genetic modifications and costimulation blocking agents converges, we review their impact thus far on preclinical xenotransplantation and the potential for future application.

  19. Blood pressure lowering effect of olive is mediated through calcium channel blockade.

    Science.gov (United States)

    Gilani, Anwarul Hassan; Khan, Arif-Ullah; Shah, Abdul Jabbar; Connor, John; Jabeen, Qaiser

    2005-12-01

    Olive (Olea europea) is used in traditional medicine as a remedy for hypertension. The aqueous-methanolic crude extract of O. europea fruit (OeF.Cr) was studied in anaesthetized rats and its possible mechanism was elucidated using isolated cardiovascular preparations. Intravenous administration of OeF.Cr produced a dose-dependent (30-100 mg/kg) fall in arterial blood pressure in normotensive anaesthetized rats. This effect remained unaltered in atropinized animals. In the in vitro studies OeF.Cr (0.1-3.0 mg/ml) inhibited spontaneously beating guinea-pig atria. Moreover, it relaxed K+ and/or phenylephrine-induced contractions of rabbit aortic preparations over a dose range of 0.1-3.0 mg/ml, suggesting calcium channel blockade (CCB). The CCB effect was confirmed when pretreatment of the vascular preparations with OeF.Cr produced a dose-dependent rightward shift of the Ca2+ dose-response curves, similar to verapamil. These results suggest that the blood pressure lowering effect of olive is mediated through CCB, justifying its use in hypertension.

  20. Dual Mechanism of Interleukin-3 Receptor Blockade by an Anti-Cancer Antibody

    Directory of Open Access Journals (Sweden)

    Sophie E. Broughton

    2014-07-01

    Full Text Available Interleukin-3 (IL-3 is an activated T cell product that bridges innate and adaptive immunity and contributes to several immunopathologies. Here, we report the crystal structure of the IL-3 receptor α chain (IL3Rα in complex with the anti-leukemia antibody CSL362 that reveals the N-terminal domain (NTD, a domain also present in the granulocyte-macrophage colony-stimulating factor (GM-CSF, IL-5, and IL-13 receptors, adopting unique “open” and classical “closed” conformations. Although extensive mutational analyses of the NTD epitope of CSL362 show minor overlap with the IL-3 binding site, CSL362 only inhibits IL-3 binding to the closed conformation, indicating alternative mechanisms for blocking IL-3 signaling. Significantly, whereas “open-like” IL3Rα mutants can simultaneously bind IL-3 and CSL362, CSL362 still prevents the assembly of a higher-order IL-3 receptor-signaling complex. The discovery of open forms of cytokine receptors provides the framework for development of potent antibodies that can achieve a “double hit” cytokine receptor blockade.

  1. Blockade of Drp1 rescues oxidative stress-induced osteoblast dysfunction

    Energy Technology Data Exchange (ETDEWEB)

    Gan, Xueqi; Huang, Shengbin; Yu, Qing [Department of Pharmacology and Toxicology and Higuchi Bioscience Center, University of Kansas, Lawrence, KS, 66047 (United States); State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, 610041 (China); Yu, Haiyang [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, 610041 (China); Yan, Shirley ShiDu, E-mail: shidu@ku.edu [Department of Pharmacology and Toxicology and Higuchi Bioscience Center, University of Kansas, Lawrence, KS, 66047 (United States)

    2015-12-25

    Osteoblast dysfunction, induced by oxidative stress, plays a critical role in the pathophysiology of osteoporosis. However, the underlying mechanisms remain unclarified. Imbalance of mitochondrial dynamics has been closely linked to oxidative stress. Here, we reveal an unexplored role of dynamic related protein 1(Drp1), the major regulator in mitochondrial fission, in the oxidative stress-induced osteoblast injury model. We demonstrate that levels of phosphorylation and expression of Drp1 significantly increased under oxidative stress. Blockade of Drp1, through pharmaceutical inhibitor or gene knockdown, significantly protected against H{sub 2}O{sub 2}-induced osteoblast dysfunction, as shown by increased cell viability, improved cellular alkaline phosphatase (ALP) activity and mineralization and restored mitochondrial function. The protective effects of blocking Drp1 in H{sub 2}O{sub 2}-induced osteoblast dysfunction were evidenced by increased mitochondrial function and suppressed production of reactive oxygen species (ROS). These findings provide new insights into the role of the Drp1-dependent mitochondrial pathway in the pathology of osteoporosis, indicating that the Drp1 pathway may be targetable for the development of new therapeutic approaches in the prevention and the treatment of osteoporosis. - Highlights: • Oxidative stress is an early pathological event in osteoporosis. • Imbalance of mitochondrial dynamics are linked to oxidative stress in osteoporosis. • The role of the Drp1-dependent mitochondrial pathway in osteoporosis.

  2. Antispasmodic and Antidiarrheal Activities of Valeriana hardwickii Wall. Rhizome Are Putatively Mediated through Calcium Channel Blockade.

    Science.gov (United States)

    Bashir, Samra; Memon, Raafia; Gilani, Anwar H

    2011-01-01

    Valeriana hardwickii is indigenous to Pakistan, Burma and Ceylon, where it is traditionally being used as an antispasmodic and antidiarrheal, besides its culinary use as spice. The aim of this paper was to provide pharmacological validation to these medicinal uses. The crude aqueous-methanolic extract of Valeriana hardwickii rhizome (Vh.Cr) was studied on isolated rabbit jejunum and castor oil-induced diarrhea in mice for spasmolytic and antidiarrheal properties, respectively. Vh.Cr caused concentration-dependent (0.01-1 mg/mL) relaxation of spontaneous contractions in isolated rabbit jejunum and inhibited K(+)-induced contractions (0.01-0.3 mg/mL), similar to verapamil, suggestive of calcium channel blockade (CCB). The CCB effect was confirmed when pretreatment of the jejunum preparations with Vh.Cr produced a concentration-dependent (0.03-0.1 mg/mL) rightward shift in the Ca(++) concentration-response curves, as caused by verapamil. Vh.Cr exhibited dose-dependent (100-300 mg/kg) protection against castor oil-induced diarrhea in mice. Loperamide, a standard antidiarrheal drug, similarly prevented the diarrhea. These data indicate the presence of CCB effect in the extract of Valeriana hardwickii rhizome, possibly mediating its antispasmodic and antidiarrheal activities and provide a scientific base for its traditional use in hyperactive gut disorders.

  3. Antispasmodic and Antidiarrheal Activities of Valeriana hardwickii Wall. Rhizome Are Putatively Mediated through Calcium Channel Blockade

    Directory of Open Access Journals (Sweden)

    Samra Bashir

    2011-01-01

    Full Text Available Valeriana hardwickii is indigenous to Pakistan, Burma and Ceylon, where it is traditionally being used as an antispasmodic and antidiarrheal, besides its culinary use as spice. The aim of this paper was to provide pharmacological validation to these medicinal uses. The crude aqueous-methanolic extract of Valeriana hardwickii rhizome (Vh.Cr was studied on isolated rabbit jejunum and castor oil-induced diarrhea in mice for spasmolytic and antidiarrheal properties, respectively. Vh.Cr caused concentration-dependent (0.01–1 mg/mL relaxation of spontaneous contractions in isolated rabbit jejunum and inhibited K+-induced contractions (0.01–0.3 mg/mL, similar to verapamil, suggestive of calcium channel blockade (CCB. The CCB effect was confirmed when pretreatment of the jejunum preparations with Vh.Cr produced a concentration-dependent (0.03–0.1 mg/mL rightward shift in the Ca++ concentration-response curves, as caused by verapamil. Vh.Cr exhibited dose-dependent (100–300 mg/kg protection against castor oil-induced diarrhea in mice. Loperamide, a standard antidiarrheal drug, similarly prevented the diarrhea. These data indicate the presence of CCB effect in the extract of Valeriana hardwickii rhizome, possibly mediating its antispasmodic and antidiarrheal activities and provide a scientific base for its traditional use in hyperactive gut disorders.

  4. Enclosing resources on the islands of Kinmen and Xiamen: From war blockade to financializing natural heritage

    Directory of Open Access Journals (Sweden)

    Huei-Min Tsai

    2014-12-01

    Full Text Available The cultures of the islands of Kinmen and Xiamen, also respectively Quemoy and Amoy, are tightly interwoven with the South China coastal region of Fujian. Both archipelagos played important historical roles in coastal defense and have been home to many Overseas Chinese since the 19th Century. A decisive battle in the Chinese Civil War was fought on Kinmen in 1949, cutting off Kinmen’s connection with Xiamen and Fujian. Positioned on a critical frontier between the ‘free world’ and the ‘communist world’, self-sufficiency became militarily important in the event of a blockade. After 1979, Xiamen was designated as a special economic zone attracting large flows of foreign investment and experiencing rapid urban development. Since 2002 the scheduled ferries between Kinmen and Xiamen reopened connections between Kinmen and its neighbor cities in the People’s Republic of China. Renewed exchange highlighted the remarkable differences between the two archipelagos’ developmental paths that had developed over the course of the 53-year suspension of contact. This paper analyzes these divergent developmental paths through comparative case studies involving forms of enclosure. The wetland conservation at Tzi Lake in Kinmen as well as gentrified residential developments around Yuan-dan Lake in Xiamen are compared; changing relationships, the impact of the sudden re-opening of borders, new forms of enclosure under globalization; and regional flows of capitals are discussed.

  5. Biologic effects of platelet-derived growth factor receptor α blockade in uterine cancer.

    Science.gov (United States)

    Roh, Ju-Won; Huang, Jie; Hu, Wei; Yang, XiaoYun; Jennings, Nicholas B; Sehgal, Vasudha; Sohn, Bo Hwa; Han, Hee Dong; Lee, Sun Joo; Thanapprapasr, Duangmani; Bottsford-Miller, Justin; Zand, Behrouz; Dalton, Heather J; Previs, Rebecca A; Davis, Ashley N; Matsuo, Koji; Lee, Ju-Seog; Ram, Prahlad; Coleman, Robert L; Sood, Anil K

    2014-05-15

    Platelet-derived growth factor receptor α (PDGFRα) expression is frequently observed in many kinds of cancer and is a candidate for therapeutic targeting. This preclinical study evaluated the biologic significance of PDGFRα and PDGFRα blockade (using a fully humanized monoclonal antibody, 3G3) in uterine cancer. Expression of PDGFRα was examined in uterine cancer clinical samples and cell lines, and biologic effects of PDGFRα inhibition were evaluated using in vitro (cell viability, apoptosis, and invasion) and in vivo (orthotopic) models of uterine cancer. PDGFRα was highly expressed and activated in uterine cancer samples and cell lines. Treatment with 3G3 resulted in substantial inhibition of PDGFRα phosphorylation and of downstream signaling molecules AKT and mitogen-activated protein kinase (MAPK). Cell viability and invasive potential of uterine cancer cells were also inhibited by 3G3 treatment. In orthotopic mouse models of uterine cancer, 3G3 monotherapy had significant antitumor effects in the PDGFRα-positive models (Hec-1A, Ishikawa, Spec-2) but not in the PDGFRα-negative model (OVCA432). Greater therapeutic effects were observed for 3G3 in combination with chemotherapy than for either drug alone in the PDGFRα-positive models. The antitumor effects of therapy were related to increased apoptosis and decreased proliferation and angiogenesis. These findings identify PDGFRα as an attractive target for therapeutic development in uterine cancer. ©2014 American Association for Cancer Research.

  6. Blockade of alcohol's amnestic activity in humans by an alpha5 subtype benzodiazepine receptor inverse agonist.

    Science.gov (United States)

    Nutt, David J; Besson, Marie; Wilson, Susan J; Dawson, Gerard R; Lingford-Hughes, Anne R

    2007-12-01

    Alcohol produces many subjective and objective effects in man including pleasure, sedation, anxiolysis, plus impaired eye movements and memory. In human volunteers we have used a newly available GABA-A/benzodiazepine receptor inverse agonist that is selective for the alpha5 subtype (a5IA) to evaluate the role of this subtype in mediating these effects of alcohol on the brain. After pre-treatment with a5IA, we found almost complete blockade of the marked impairment caused by alcohol (mean breath concentration 150mg/100ml) of word list learning and partial but non-significant reversal of subjective sedation without effects on other measures such as intoxication, liking, and slowing of eye movements. This action was not due to alterations in alcohol kinetics and so provides the first proof of concept that selectively decreasing GABA-A receptor function at a specific receptor subtype can offset some actions of alcohol in humans. It also supports growing evidence for a key role of the alpha5 subtype in memory. Inverse agonists at other GABA-A receptor subtypes may prove able to reverse other actions of alcohol, and so offer a new approach to understanding the actions of alcohol in the human brain and in the treatment of alcohol related disorders in humans.

  7. SCIB2, an antibody DNA vaccine encoding NY-ESO-1 epitopes, induces potent antitumor immunity which is further enhanced by checkpoint blockade.

    Science.gov (United States)

    Xue, Wei; Metheringham, Rachael L; Brentville, Victoria A; Gunn, Barbara; Symonds, Peter; Yagita, Hideo; Ramage, Judith M; Durrant, Lindy G

    2016-06-01

    Checkpoint blockade has demonstrated promising antitumor responses in approximately 10-40% of patients. However, the majority of patients do not make a productive immune response to their tumors and do not respond to checkpoint blockade. These patients may benefit from an effective vaccine that stimulates high-avidity T cell responses in combination with checkpoint blockade. We have previously shown that incorporating TRP-2 and gp100 epitopes into the CDR regions of a human IgG1 DNA (ImmunoBody®: IB) results in significant tumor regression both in animal models and patients. This vaccination strategy is superior to others as it targets antigen to antigen-presenting cells and stimulates high-avidity T cell responses. To broaden the application of this vaccination strategy, 16 NY-ESO-1 epitopes, covering over 80% of HLA phenotypes, were incorporated into the IB (SCIB2). They produced higher frequency and avidity T cell responses than peptide vaccination. These T cells were of sufficient avidity to kill NY-ESO-1-expressing tumor cells, and in vivo controlled the growth of established B16-NY-ESO-1 tumors, resulting in long-term survival (35%). When SCIB2 was given in combination with Treg depletion, CTLA-4 blockade or PD-1 blockade, long-term survival from established tumors was significantly enhanced to 56, 67 and 100%, respectively. Translating these responses into the clinic by using a combination of SCIB2 vaccination and checkpoint blockade can only further improve clinical responses.

  8. Efficacy and safety of sugammadex versus neostigmine in reversing neuromuscular blockade in adults.

    Science.gov (United States)

    Hristovska, Ana-Marija; Duch, Patricia; Allingstrup, Mikkel; Afshari, Arash

    2017-08-14

    Acetylcholinesterase inhibitors, such as neostigmine, have traditionally been used for reversal of non-depolarizing neuromuscular blocking agents. However, these drugs have significant limitations, such as indirect mechanisms of reversal, limited and unpredictable efficacy, and undesirable autonomic responses. Sugammadex is a selective relaxant-binding agent specifically developed for rapid reversal of non-depolarizing neuromuscular blockade induced by rocuronium. Its potential clinical benefits include fast and predictable reversal of any degree of block, increased patient safety, reduced incidence of residual block on recovery, and more efficient use of healthcare resources. The main objective of this review was to compare the efficacy and safety of sugammadex versus neostigmine in reversing neuromuscular blockade caused by non-depolarizing neuromuscular agents in adults. We searched the following databases on 2 May 2016: Cochrane Central Register of Controlled Trials (CENTRAL); MEDLINE (WebSPIRS Ovid SP), Embase (WebSPIRS Ovid SP), and the clinical trials registries www.controlled-trials.com, clinicaltrials.gov, and www.centerwatch.com. We re-ran the search on 10 May 2017. We included randomized controlled trials (RCTs) irrespective of publication status, date of publication, blinding status, outcomes published, or language. We included adults, classified as American Society of Anesthesiologists (ASA) I to IV, who received non-depolarizing neuromuscular blocking agents for an elective in-patient or day-case surgical procedure. We included all trials comparing sugammadex versus neostigmine that reported recovery times or adverse events. We included any dose of sugammadex and neostigmine and any time point of study drug administration. Two review authors independently screened titles and abstracts to identify trials for eligibility, examined articles for eligibility, abstracted data, assessed the articles, and excluded obviously irrelevant reports. We resolved

  9. Role of 20-hydroxyeicosatetraenoic acid in mediating hypertension in response to chronic renal medullary endothelin type B receptor blockade.

    Directory of Open Access Journals (Sweden)

    Joshua S Speed

    Full Text Available BACKGROUND: The renal medullary endothelin (ET-1 system plays an important role in the control of sodium excretion and arterial pressure (AP through the activation of renal medullary ET-B receptors. We have previously shown that blockade of endothelin type B receptors (ET-B leads to salt-sensitive hypertension through mechanisms that are not fully understood. One possible mechanism is through a reduction in renal medullary production of 20-hydroxyeicosatetraenoic acid (20-HETE. 20-HETE, a metabolite of arachidonic acid, has natriuretic properties similar to ET-B activation. While these findings suggest a possible interaction between ET-B receptor activation and 20-HETE production, it is unknown whether blockade of medullary ET-B receptors in rats maintained on a high sodium intake leads to reductions in 20-HETE production. METHODOLOGY/PRINCIPAL FINDINGS: The effect of increasing sodium intake from low (NS = .8% to high (HS = 8% on renal medullary production of 20-HETE in the presence and absence of renal medullary ET-B receptor antagonism was examined. Renal medullary blockade of ET-B receptors resulted in salt sensitive hypertension. In control rats, blood pressure rose from 112.8±2.4 mmHg (NS to 120.7±9.3 mmHg (HS. In contrast, when treated with an ET-B receptor blocker, blood pressure was significantly elevated from 123.7±3.2 (NS to 164.2±7.1 (HS. Furthermore, increasing sodium intake was associated with elevated medullary 20-HETE (5.6±.8 in NS vs. 14.3±3.7 pg/mg in HS, an effect that was completely abolished by renal medullary ET-B receptor blockade (4.9±.8 for NS and 4.5±.6 pg/mg for HS. Finally, the hypertensive response to intramedullary ET-B receptor blockade was blunted in rats pretreated with a specific 20-HETE synthesis inhibitor. CONCLUSION: These data suggest that increases in renal medullary production of 20-HETE associated with elevating salt intake may be, in part, due to ET-B receptor activation within the renal

  10. Perceptions of health promoters about health promotion ...

    African Journals Online (AJOL)

    2013-02-11

    Feb 11, 2013 ... Original Research http://www.hsag.co.za doi:10.4102/hsag.v18i1.648. Perceptions of health promoters about health promotion programmes for ... Providing health promotion in the communities is one of the many strategies that were introduced ... will therefore assist in improving and developing health.

  11. Serotonin-dependent maintenance of spatial performance and electroencephalography activation after cholinergic blockade: effects of serotonergic receptor antagonists.

    Science.gov (United States)

    Dringenberg, H C; Zalan, R M

    1999-08-07

    The interaction between acetylcholine (ACh) and serotonin (5-hydroxytryptamine, 5-HT) in the control of behavior such as spatial navigation has received considerable attention over the last years. Previous research indicates that while a selective reduction in cholinergic transmission often produces only mild impairments in spatial and other behavioral tests, additional serotonergic blockade results in the appearance of severe behavioral deficits. Consequently, it has been argued that 5-HT plays a role in the maintenance of behavioral capacities in the face of reduced cholinergic transmission. Here, we examined the effects of 5-HT depletion and receptor blockade, alone and in combination with cholinergic-muscarinic antagonism, on spatial navigation of rats in the Morris water maze. Further, electroencephalographic (EEG) recordings were taken to test the hypothesis that a loss of neocortical activation is related to the behavioral deficits apparent after cholinergic-serotonergic blockade. The muscarinic antagonist, scopolamine (1 mg/kg) produced a moderate impairment in navigational performance. The 5-HT depletor, p-chlorophenylalanine (PCPA; 500 mg kg(-1) day(-1)x2) did not impair performance when given alone but strongly potentiated the scopolamine-induced deficit and completely blocked the acquisition of an escape response in the water maze. This effect was mimicked by the non-selective serotonin(1-2) receptor antagonist, methiothepin (0.3 mg/kg), but not by the selective serotonin(1A) antagonist, WAY 100635 (0.1-0.5 mg/kg) or the serotonin(2) antagonist, ketanserin (2-4 mg/kg). None of the 5-HT antagonists impaired performance when given alone. Electrocorticographic recordings in rats treated with scopolamine and serotonergic receptor antagonists showed that during behavioral immobility, scopolamine (1 mg/kg) increased spectral power in all frequency bands between 0.5 and 20 Hz without significantly affecting cortical activity during movement. None of the 5-HT

  12. Focal radiation therapy combined with 4-1BB activation and CTLA-4 blockade yields long-term survival and a protective antigen-specific memory response in a murine glioma model.

    Directory of Open Access Journals (Sweden)

    Zineb Belcaid

    Full Text Available Glioblastoma (GBM is the most common malignant brain tumor in adults and is associated with a poor prognosis. Cytotoxic T lymphocyte antigen -4 (CTLA-4 blocking antibodies have demonstrated an ability to generate robust antitumor immune responses against a variety of solid tumors. 4-1BB (CD137 is expressed by activated T lymphocytes and served as a co-stimulatory signal, which promotes cytotoxic function. Here, we evaluate a combination immunotherapy regimen involving 4-1BB activation, CTLA-4 blockade, and focal radiation therapy in an immune-competent intracranial GBM model.GL261-luciferace cells were stereotactically implanted in the striatum of C57BL/6 mice. Mice were treated with a triple therapy regimen consisted of 4-1BB agonist antibodies, CTLA-4 blocking antibodies, and focal radiation therapy using a small animal radiation research platform and mice were followed for survival. Numbers of brain-infiltrating lymphocytes were analyzed by FACS analysis. CD4 or CD8 depleting antibodies were administered to determine the relative contribution of T helper and cytotoxic T cells in this regimen. To evaluate the ability of this immunotherapy to generate an antigen-specific memory response, long-term survivors were re-challenged with GL261 glioma en B16 melanoma flank tumors.Mice treated with triple therapy had increased survival compared to mice treated with focal radiation therapy and immunotherapy with 4-1BB activation and CTLA-4 blockade. Animals treated with triple therapy exhibited at least 50% long-term tumor free survival. Treatment with triple therapy resulted in a higher density of CD4+ and CD8+ tumor infiltrating lymphocytes. Mechanistically, depletion of CD4+ T cells abrogated the antitumor efficacy of triple therapy, while depletion of CD8+ T cells had no effect on the treatment response.Combination therapy with 4-1BB activation and CTLA-4 blockade in the setting of focal radiation therapy improves survival in an orthotopic mouse

  13. CD14+ monocytes promote the immunosuppressive effect of human umbilical cord matrix stem cells

    International Nuclear Information System (INIS)

    Wang, Ding; Chen, Ke; Du, Wei Ting; Han, Zhi-Bo; Ren, He; Chi, Ying

    2010-01-01

    Here, the effect of CD14 + monocytes on human umbilical cord matrix stem cell (hUC-MSC)-mediated immunosuppression was studied in vitro. hUC-MSCs exerted a potent inhibitory effect on the proliferation and interferon-γ (IFN-γ) secretion capacities of CD4 + and CD8 + T cells in response to anti-CD3/CD28 stimulation. Transwell co-culture system revealed that the suppressive effect was primarily mediated by soluble factors. Addition of prostaglandin synthesis inhibitors (indomethacin or NS-398) almost completely abrogated the immunosuppression activity of hUC-MSCs, identifying prostaglandin E 2 (PGE 2 ) as an important soluble mediator. CD14 + monocytes were found to be able to enhance significantly the immunosuppressive effect of hUC-MSCs in a dose-dependent fashion. Moreover, the inflammatory cytokine IL-1β, either exogenously added or produced by CD14 + monocytes in culture, could trigger expression of high levels of PGE 2 by hUC-MSCs, whereas inclusion of the IL-1 receptor antagonist (IL-1RA) in the culture down-regulated not only PGE 2 expression, but also reversed the promotional effect of CD14 + monocytes and partially restored CD4 + and CD8 + T cell proliferation and IFN-γ secretion. Our data demonstrate an important role of monocytes in the hUC-MSC-induced immunomodulation, which may have important implications in future efforts to explore the clinical potentials of hUC-MSCs.

  14. TNF-α blockade suppresses pericystic inflammation following anthelmintic treatment in porcine neurocysticercosis.

    Directory of Open Access Journals (Sweden)

    Siddhartha Mahanty

    2017-11-01

    platelet endothelial cell adhesion molecule (PECAM-1. In contrast, transcription was only modestly decreased in the DEX pretreated pigs compared to PZQ alone, and only for TNF-α, IL-6, IFN-γ, TGF-β and Ang1. IL-10 was not affected by either ETN or DEX pretreatments. The degree of inflammation, assessed by semi-quantitative inflammatory scores, was modestly decreased in both ETN and DEX pretreated animals compared to PZQ treated pigs whereas cyst damage scores were moderately decreased only in cysts from DEX pretreated pigs. However, the proportion of cysts with EB extravasation was not significantly changed in ETN and DEX pretreated groups.Overall, TNF-α blockade using ETN treatment modulated expression of a large variety of genes that play a role in induction and control of inflammation and structural changes. In contrast the number of inflammatory cells was only moderately decreased suggesting weaker effects on cell migration into the inflammatory capsules surrounding cysts than on release of modulatory molecules. Taken together, these data suggest that TNF-α blockade may provide a viable strategy to manage post-treatment pericystic inflammation that follows antiparasitic therapy for neurocysticercosis.

  15. Femoral nerve blockade using various concentrations of local anesthetic for knee arthroscopy in the pediatric population

    Directory of Open Access Journals (Sweden)

    Veneziano G

    2016-11-01

    Full Text Available Giorgio Veneziano,1,2 Jennifer Tripi,1 Dmitry Tumin,1 Mumin Hakim,1 David Martin,1,2 Ralph Beltran,1,2 Kevin Klingele,3,4 Tarun Bhalla,1,2 Joseph D Tobias1,2 1Department of Anesthesiology & Pain Medicine, Nationwide Children’s Hospital, 2Department of Anesthesiology & Pain Medicine, The Ohio State University College of Medicine, 3Department of Orthopedic Surgery, Nationwide Children’s Hospital, 4Department of Orthopedic Surgery, The Ohio State University College of Medicine, Columbus, OH, USA Background: Femoral nerve blockade (FNB provides effective postoperative analgesia in children undergoing arthroscopic knee surgery as evidenced by their opioid-sparing effects and decreased postoperative pain scores. Increasing the local anesthetic concentration in peripheral nerve blockade for adults undergoing orthopedic surgery has been shown to be beneficial, increasing block success rate, and providing a longer duration of analgesia. The effect of increasing the concentration of local anesthetic in extremity blocks in children remains largely unexplored.Methods: We retrospectively evaluated the effectiveness of FNB using three concentrations of local anesthetic (ropivacaine 0.2%, bupivacaine 0.25%, and ropivacaine 0.5% in children and adolescents undergoing arthroscopic knee surgery. The primary outcome evaluated was postoperative opioid consumption before discharge. Secondary outcomes included post-anesthesia care unit (PACU and hospital discharge times, first pain score in PACU, and the incidence of adverse events.Results: Two hundred and sixty-nine children and adolescents who received a FNB for arthroscopic knee surgery from January 2010 to December 2013 were included for analysis. Local anesthetic used in FNB was ropivacaine 0.2% in 116 (43% cases, ropivacaine 0.5% in 75 (28% cases, and bupivacaine 0.25% in 78 (29% cases. Median postoperative opioid consumption (mg/kg intravenous morphine equivalents in the ropivacaine 0.5% group was 0

  16. The inotropic actions of N-acetylprocainamide: blockade and reversal by propranolol.

    Science.gov (United States)

    Lertora, J J; King, L W; Donkor, K A

    1986-12-01

    The inotropic actions of N-acetylprocainamide (NAPA) were studied in chloralose-urethane anesthetized dogs. Myocardial contractile force was measured with a Walton-Brodie strain gauge sutured to the right ventricle. A low-dose NAPA infusion (12 mg/kg i.v.) increased myocardial force by a maximum of 11.6 +/- 2.4% (mean +/- SEM), whereas a high dose of NAPA (60 mg/kg i.v.) increased myocardial force by 33.3 +/- 2.6% at the peak of the effect. The high-dose NAPA infusion also caused significant reductions in heart rate and blood pressure, while the low-dose NAPA infusion lacked significant chronotropic or hypotensive actions. Pretreatment with propranolol (0.5 mg/kg i.v. loading, followed by a 10 micrograms/kg/min infusion) did not block the positive inotropic actions of NAPA 12 mg/kg, but these actions were blocked in dogs pretreated with both propranolol and atropine (1 mg/kg). On the other hand, pretreatment with propranolol blocked and reversed the inotropic actions of NAPA 60 mg/kg, and potentiated its negative chronotropic effects. Thus, the positive inotropic actions of NAPA are indirect and more than one mechanism is involved; a component due to direct action related to the lengthening of cardiac repolarization is not discounted. At low doses, the increase in myocardial force seems related to NAPA's vagolytic properties, whereas at high doses the positive inotropic actions appear to be catecholamine-mediated. Furthermore, a negative inotropic action of high-dose NAPA is apparent after beta-adrenergic receptor blockade.

  17. The Effects of K(+) Channel Blockade on Eccentric and Isotonic Twitch and Fatiguing Contractions in situ.

    Science.gov (United States)

    van Lunteren, Erik; Moyer, Michelle

    2012-01-01

    K(+) channel blockers like 3,4-diaminopyridine (DAP) can double isometric muscle force. Functional movements require more complex concentric and eccentric contractions, however the effects of K(+) channel blockade on these types of contractions in situ are unknown. Extensor digitorum longus (EDL) muscles were stimulated in situ with and without DAP in anesthetized rats and fatigability was addressed using a series of either concentric or eccentric contractions. During isotonic protocols (5-100% load), DAP significantly shifted shortening- and maximum shortening velocity-load curves upward and to the right and increased power and work. Maximum shortening, maximum shortening velocity, and power doubled while work increased by ∼250% during isotonic contraction at 50% load. During isotonic fatigue, DAP significantly augmented maximum shortening, work, shortening velocity, and power. During constant velocity eccentric protocols (2-12 mm/s), DAP increased muscle force during eccentric contractions at 6, 8, 10, and 12 mm/s. During eccentric contraction at a constant velocity of 6 mm/s while varying the stimulation frequency, DAP significantly increased muscle force during 20, 40, and 70 Hz. The effects of DAP on muscle contractile performance during eccentric fatigue varied with level of fatigue. DAP-induced contractile increases during isotonic contractions were similar to those produced during previously studied isometric contractions, while the DAP effect during eccentric contractions was more modest. These findings are especially important in attempting to optimize functional electrical stimulation parameters for spinal cord injury patients while also preventing rapid fatigue of those muscles.

  18. Reversible exacerbation of obstructive sleep apnea by α1-adrenergic blockade with tamsulosin: A case report.

    Science.gov (United States)

    Moran, Mark

    2016-01-01

    Obstructive sleep apnea (OSA) is characterized by repeated involuntary closure of the pharyngeal airspace during sleep. Normal activity of the genioglossus (GG) muscle is important in maintaining airway patency, and inhibition of GG activity can contribute to airway closure. Neurons in the hypoglossal motor nucleus (HMN) regulate GG activity. Adrenergic tone is an important regulator of HMN neuronal excitability. In laboratory models α 1 -adrenergic antagonists inhibit HMN neurons and GG activity, suggesting that α 1 -adrenergic antagonism might adversely affect patients with OSA. To date there has been no report of such a case. The patient was a 67-year old man with a 27-month history of obstructive sleep apnea. Diagnostic polysomnography demonstrated a baseline apnea-hypopnea index (AHI) of 21.3 and a trough oxygen saturation of 84%. Treatment with continuous positive airway pressure (CPAP) was initiated. The AHI in year 1 averaged 1.0 ± 0.1 (mean ± SD) and 0.8 ± 0.1 in year 2. Other medical conditions included hypertension controlled with losartan and benign prostatic hypertrophy not well controlled by finasteride monotherapy. The α 1 -adrenergic receptor antagonist tamsulosin 0.4 mg daily was added. Shortly after initiation of tamsulosin, subjective sleep quality deteriorated. Significant surges in obstructive events, apneic episodes, and AHI were also recorded, and nocturnal airway pressure was frequently sustained at the CPAP device maximum of 20 cm H 2 O. Tamsulosin was discontinued. CPAP parameters and sleep quality returned to the pre-tamsulosin baselines within 10 days. These findings suggest that α 1 -adrenergic blockade with tamsulosin may exacerbate sleep-disordered breathing in susceptible patients.

  19. Blockade of Dopamine D4 Receptors Attenuates Reinstatement of Extinguished Nicotine-Seeking Behavior in Rats

    Science.gov (United States)

    Yan, Yijin; Pushparaj, Abhiram; Le Strat, Yann; Gamaleddin, Islam; Barnes, Chanel; Justinova, Zuzana; Goldberg, Steven R; Le Foll, Bernard

    2012-01-01

    Since cloning of the dopamine receptor D4 (DRD4), its role in the brain has remained unclear. It has been reported that polymorphism of the DRD4 gene in humans is associated with reactivity to cues related to tobacco smoking. However, the role of DRD4 in animal models of nicotine addiction has seldom been explored. In our study, male Long-Evans rats learned to intravenously self-administer nicotine under a fixed-ratio (FR) schedule of reinforcement. Effects of the selective DRD4 antagonist L-745,870 were evaluated on nicotine self-administration behavior and on reinstatement of extinguished nicotine-seeking behavior induced by nicotine-associated cues or by priming injections of nicotine. L-745,870 was also tested on reinstatement of extinguished food-seeking behavior as a control. In addition, the selective DRD4 agonist PD 168,077 was tested for its ability to reinstate extinguished nicotine-seeking behavior. Finally, L-745,870 was tested in Sprague Dawley rats trained to discriminate administration of 0.4 mg/kg nicotine from vehicle under an FR schedule of food delivery. L-745,870 significantly attenuated reinstatement of nicotine-seeking induced by both nicotine-associated cues and nicotine priming. In contrast, L-745,870 did not affect established nicotine self-administration behavior or reinstatement of food-seeking behavior induced by food cues or food priming. L-745,870 did not produce nicotine-like discriminative-stimulus effects and did not alter discriminative-stimulus effects of nicotine. PD 168,077 did not reinstate extinguished nicotine-seeking behavior. As DRD4 blockade by L-745,870 selectively attenuated both cue- and nicotine-induced reinstatement of nicotine-seeking behavior, without affecting cue- or food-induced reinstatement of food-seeking behavior, DRD4 antagonists are potential therapeutic agents against tobacco smoking relapse. PMID:22030716

  20. Enhancement of Adipocyte Browning by Angiotensin II Type 1 Receptor Blockade.

    Directory of Open Access Journals (Sweden)

    Kana Tsukuda

    Full Text Available Browning of white adipose tissue (WAT has been highlighted as a new possible therapeutic target for obesity, diabetes and lipid metabolic disorders, because WAT browning could increase energy expenditure and reduce adiposity. The new clusters of adipocytes that emerge with WAT browning have been named 'beige' or 'brite' adipocytes. Recent reports have indicated that the renin-angiotensin system (RAS plays a role in various aspects of adipose tissue physiology and dysfunction. The biological effects of angiotensin II, a major component of RAS, are mediated by two receptor subtypes, angiotensin II type 1 receptor (AT1R and type 2 receptor (AT2R. However, the functional roles of angiotensin II receptor subtypes in WAT browning have not been defined. Therefore, we examined whether deletion of angiotensin II receptor subtypes (AT1aR and AT2R may affect white-to-beige fat conversion in vivo. AT1a receptor knockout (AT1aKO mice exhibited increased appearance of multilocular lipid droplets and upregulation of thermogenic gene expression in inguinal white adipose tissue (iWAT compared to wild-type (WT mice. AT2 receptor-deleted mice did not show miniaturization of lipid droplets or alteration of thermogenic gene expression levels in iWAT. An in vitro experiment using adipose tissue-derived stem cells showed that deletion of the AT1a receptor resulted in suppression of adipocyte differentiation, with reduction in expression of thermogenic genes. These results indicate that deletion of the AT1a receptor might have some effects on the process of browning of WAT and that blockade of the AT1 receptor could be a therapeutic target for the treatment of metabolic disorders.

  1. The effects of K+ channel blockade on eccentric and isotonic twitch and fatiguing contractions in situ

    Directory of Open Access Journals (Sweden)

    Michelle eMoyer

    2012-09-01

    Full Text Available K+ channel blockers like 3,4-diaminopyridine (DAP can double isometric muscle force. Functional movements require more complex concentric and eccentric contractions, however the effects of K+ channel blockade on these types of contractions in situ are unknown. Extensor digitorum longus (EDL muscles were stimulated in situ with and without DAP in anesthetized rats and fatigability was addressed using a series of either concentric or eccentric contractions. During isotonic protocols (5-100% load, DAP significantly shifted shortening- and maximum shortening velocity-load curves upward and to the right and increased power and work. Maximum shortening, maximum shortening velocity and power doubled while work increased by approximately 250% during isotonic contraction at 50% load. During isotonic fatigue, DAP significantly augmented maximum shortening, work, shortening velocity and power. During constant velocity eccentric protocols (2-12 mm/s, DAP increased muscle force during eccentric contractions at 6, 8, 10 and 12 mm/s. During eccentric contraction at a constant velocity of 6mm/s while varying the stimulation frequency, DAP significantly increased muscle force during 20, 40 and 70 Hz . The effects of DAP on muscle contractile performance during eccentric fatigue varied with level of fatigue. DAP-induced contractile increases during isotonic contractions were similar to those produced during previously studied isometric contractions, while the DAP effect during eccentric contractions was more modest. These findings are especially important in attempting to optimize functional electrical stimulation parameters for spinal cord injury patients while also preventing rapid fatigue of those muscles.

  2. Iron overload and apoptosis of HL-1 cardiomyocytes: effects of calcium channel blockade.

    Directory of Open Access Journals (Sweden)

    Mei-pian Chen

    Full Text Available Iron overload cardiomyopathy that prevails in some forms of hemosiderosis is caused by excessive deposition of iron into the heart tissue and ensuing damage caused by a raise in labile cell iron. The underlying mechanisms of iron uptake into cardiomyocytes in iron overload condition are still under investigation. Both L-type calcium channels (LTCC and T-type calcium channels (TTCC have been proposed to be the main portals of non-transferrinic iron into heart cells, but controversies remain. Here, we investigated the roles of LTCC and TTCC as mediators of cardiac iron overload and cellular damage by using specific Calcium channel blockers as potential suppressors of labile Fe(II and Fe(III ingress in cultured cardiomyocytes and ensuing apoptosis.Fe(II and Fe(III uptake was assessed by exposing HL-1 cardiomyocytes to iron sources and quantitative real-time fluorescence imaging of cytosolic labile iron with the fluorescent iron sensor calcein while iron-induced apoptosis was quantitatively measured by flow cytometry analysis with Annexin V. The role of calcium channels as routes of iron uptake was assessed by cell pretreatment with specific blockers of LTCC and TTCC.Iron entered HL-1 cardiomyocytes in a time- and dose-dependent manner and induced cardiac apoptosis via mitochondria-mediated caspase-3 dependent pathways. Blockade of LTCC but not of TTCC demonstrably inhibited the uptake of ferric but not of ferrous iron. However, neither channel blocker conferred cardiomyocytes with protection from iron-induced apoptosis.Our study implicates LTCC as major mediators of Fe(III uptake into cardiomyocytes exposed to ferric salts but not necessarily as contributors to ensuing apoptosis. Thus, to the extent that apoptosis can be considered a biological indicator of damage, the etiopathology of cardiosiderotic damage that accompanies some forms of hemosiderosis would seem to be unrelated to LTCC or TTCC, but rather to other routes of iron ingress present in

  3. Blockade of RAGE ameliorates elastase-induced emphysema development and progressionviaRAGE-DAMP signaling.

    Science.gov (United States)

    Lee, Hanbyeol; Park, Jeong-Ran; Kim, Woo Jin; Sundar, Isaac K; Rahman, Irfan; Park, Sung-Min; Yang, Se-Ran

    2017-05-01

    The receptor for advanced glycan end products (RAGE) has been identified as a susceptibility gene for chronic obstructive pulmonary disease (COPD) in genome-wide association studies (GWASs). However, less is known about how RAGE is involved in the pathogenesis of COPD. To determine the molecular mechanism by which RAGE influences COPD in experimental COPD models, we investigated the efficacy of the RAGE-specific antagonist FPS-ZM1 administration in in vivo and in vitro COPD models. We injected elastase intratracheally and the RAGE antagonist FPS-ZM1 in mice, and the infiltrated inflammatory cells and cytokines were assessed by ELISA. Cellular expression of RAGE was determined in protein, serum, and bronchoalveolar lavage fluid of mice and lungs and serum of human donors and patients with COPD. Downstream damage-associated molecular pattern (DAMP) pathway activation in vivo and in vitro and in patients with COPD was assessed by immunofluorescence staining, Western blot analysis, and ELISA. The expression of membrane RAGE in initiating the inflammatory response and of soluble RAGE acting as a decoy were associated with up-regulation of the DAMP-related signaling pathway via Nrf2. FPS-ZM1 administration significantly reversed emphysema in the lung of mice. Moreover, FPS-ZM1 treatment significantly reduced lung inflammation in Nrf2 +/+ , but not in Nrf2 -/- mice. Thus, our data indicate for the first time that RAGE inhibition has an essential protective role in COPD. Our observation of RAGE inhibition provided novel insight into its potential as a therapeutic target in emphysema/COPD.-Lee, H., Park, J.-R., Kim, W. J., Sundar, I. K., Rahman, I., Park, S.-M., Yang. S.-R. Blockade of RAGE ameliorates elastase-induced emphysema development and progression via RAGE-DAMP signaling. © FASEB.

  4. Portal adrenergic blockade does not inhibit the gluconeogenic effects of circulating catecholamines on the liver.

    Science.gov (United States)

    Chu, C A; Sindelar, D K; Neal, D W; Cherrington, A D

    1997-04-01

    This study was undertaken to determine the impact of portal adrenergic blockade on the gluconeogenic effects of epinephrine (EPI) and norepinephrine (NE). Experiments were performed on 18-hour fasted conscious dogs and consisted of a 100-minute equilibration, a 40-minute basal, and two 90-minute test periods. A pancreatic clamp was used to fix insulin and glucagon levels at basal values. Propranolol (1 microgram/kg.min) and phentolamine (2 micrograms/kg.min) were infused intraportally during both test periods. Portal infusion of alpha- and beta-adrenergic blockers alone (first test period) slightly increased hepatic glucose production from 2.4 +/- 0.4 to 2.8 +/- 0.5 mg/kg.min (nonsignificant [NS]) NE (500 ng/kg.min) and EPI (180 ng/kg.min) were infused peripherally during the second test period. Arterial NE and EPI increased from 186 +/- 63 to 6,725 +/- 913 pg/mL and 76 +/- 25 to 2,674 +/- 344 pg/mL, respectively. Portal NE and EPI increased from 135 +/- 32 to 4,082 +/- 747 pg/mL and 28 +/- 8 to 1,114 +/- 174 pg/mL, respectively. Hepatic glucose production, the maximal gluconeogenic rate, and gluconeogenic efficiency increased from 2.8 +/- 0.5 to 3.8 +/- 0.4 mg/kg.min (P glycogenolysis did not increase during catecholamine infusion. In conclusion, portal delivery of adrenergic blockers selectively inhibits the glycogenolytic effects of EPI and NE on the liver, but allows a marked gluconeogenic response to the catecholamines.

  5. Effects of cholinergic and beta-adrenergic blockade on orthostatic tolerance in healthy subjects

    Science.gov (United States)

    Convertino, V. A.; Sather, T. M.

    2000-01-01

    Cardiovascular responses during a graded lower body negative pressure (LBNP) protocol were compared before and after atropine and propranolol administration to test the hypothesis that both sympathetic and parasympathetic control of cardio-acceleration are associated with syncopal predisposition to orthostatic stress in healthy subjects. Eleven men were categorized into two groups having high (HT, N = 6) or low (LT, N = 5) tolerance based on their total time before the onset of presyncopal symptoms. HT and LT groups were similar in physical characteristics, fitness, and baseline cardiovascular measurements. Atropine treatment had no effect on LBNP tolerance or mean arterial pressure at presyncope, despite an atropine-induced increase in heart rate. Propranolol treatment reduced (p<0.05) LBNP tolerance in both groups. Diminished LBNP tolerance after propranolol administration was associated with reductions in cardiac output, whereas increase in systemic peripheral resistance from baseline to presyncope was unaffected by propranolol. Reduction in cardiac output and LBNP tolerance after beta blockade reflected a chronotropic effect because lower LBNP tolerance for the HT (-50%) and LT (-39%) groups was associated with dramatic reductions (p <0.05) in the magnitude of LBNP-induced tachycardia without significant effects on stroke volume at presyncope. Absence of an atropine-induced difference in cardiac output and systemic peripheral resistance between HT and LT groups failed to support the notion that cardiac vagal withdrawal represents a predominant mechanism that could account for differences in orthostatic tolerance. Because a reduction in LBNP tolerance in both HT and LT groups after propranolol treatment was most closely associated with reduced tachycardia, the data suggest that a primary autonomically mediated mechanism for maintenance of mean arterial pressure and orthostatic tolerance in healthy subjects is beta adrenergic-induced tachycardia.

  6. Blockade of MMP14 Activity in Murine Breast Carcinomas: Implications for Macrophages, Vessels, and Radiotherapy

    Science.gov (United States)

    Ager, Eleanor I.; Kozin, Sergey V.; Kirkpatrick, Nathaniel D.; Seano, Giorgio; Kodack, David P.; Askoxylakis, Vasileios; Huang, Yuhui; Goel, Shom; Snuderl, Matija; Muzikansky, Alona; Finkelstein, Dianne M.; Dransfield, Daniel T.; Devy, Laetitia; Boucher, Yves

    2015-01-01

    Background: Matrix metalloproteinase (MMP) 14 may mediate tumor progression through vascular and immune-modulatory effects. Methods: Orthotopic murine breast tumors (4T1 and E0771 with high and low MMP14 expression, respectively; n = 5–10 per group) were treated with an anti-MMP14 inhibitory antibody (DX-2400), IgG control, fractionated radiation therapy, or their combination. We assessed primary tumor growth, transforming growth factor β (TGFβ) and inducible nitric oxide synthase (iNOS) expression, macrophage phenotype, and vascular parameters. A linear mixed model with repeated observations, with Mann-Whitney or analysis of variance with Bonferroni post hoc adjustment, was used to determine statistical significance. All statistical tests were two-sided. Results: DX-2400 inhibited tumor growth compared with IgG control treatment, increased macrophage numbers, and shifted the macrophage phenotype towards antitumor M1-like. These effects were associated with a reduction in active TGFβ and SMAD2/3 signaling. DX-2400 also transiently increased iNOS expression and tumor perfusion, reduced tissue hypoxia (median % area: control, 20.2%, interquartile range (IQR) = 6.4%-38.9%; DX-2400: 1.2%, IQR = 0.2%-3.2%, P = .044), and synergistically enhanced radiation therapy (days to grow to 800mm3: control, 12 days, IQR = 9–13 days; DX-2400 plus radiation, 29 days, IQR = 26–30 days, P < .001) in the 4T1 model. The selective iNOS inhibitor, 1400W, abolished the effects of DX-2400 on vessel perfusion and radiotherapy. On the other hand, DX-2400 was not capable of inducing iNOS expression or synergizing with radiation in E0771 tumors. Conclusion: MMP14 blockade decreased immunosuppressive TGFβ, polarized macrophages to an antitumor phenotype, increased iNOS, and improved tumor perfusion, resulting in reduced primary tumor growth and enhanced response to radiation therapy, especially in high MMP14-expressing tumors. PMID:25710962

  7. alpha-adrenergic Blockade Unmasks a Greater Compensatory Vasodilation in Hypoperfused Contracting Muscle

    Directory of Open Access Journals (Sweden)

    Darren P. Casey

    2012-07-01

    Full Text Available We previously demonstrated that acute hypoperfusion in exercising human muscle causes an immediate increase in vascular resistance that is followed by a partial restoration (less than 100% recovery of flow. In the current study we examined the contribution of alpha-adrenergic vasoconstriction in the initial changes in vascular resistance at the onset of hypoperfusion as well as in the recovery of flow over time. Nine healthy male subjects (29 ± 2 performed rhythmic forearm exercise (20% of maximum during hypoperfusion evoked by intra-arterial balloon inflation. Each trial included; baseline, exercise prior to inflation, exercise with inflation, and exercise after deflation (3 min each. Forearm blood flow (FBF; ultrasound, local (brachial artery, and systemic arterial pressure (MAP; Finometer were measured. The trial was repeated during phentolamine infusion (alpha-adrenergic receptor blockade. Forearm vascular conductance (FVC; ml min-1 100 mmHg-1 and resistance (mmHg ml min-1 was calculated from BF (ml min-1 and local MAP (mmHg. Recovery of FBF and FVC (steady state inflation plus exercise value – nadir/ [steady state exercise (control value-nadir] with phentolamine was enhanced compared with the respective control (no drug trial (FBF = 97 ± 5% vs. 81 ± 6%, P < 0.05; FVC = 126 ± 9% vs. 91 ± 5%, P < 0.01. However, the absolute (0.05 ± 0.01 vs. 0.06 ± 0.01 mmHg ml min-1; P = 0.17 and relative (35 ± 5% vs. 31 ± 2%; P = 0.41 increase in vascular resistance at the onset of balloon inflation was not different between the alpha-adrenergic receptor inhibition and control (no drug trials. Therefore, our data indicate that alpha-adrenergic mediated vasoconstriction restricts compensatory vasodilation during forearm exercise with hypoperfusion, but is not responsible for the initial increase in vascular resistance at the onset of hypoperfusion.

  8. Recovery from mivacurium-induced neuromuscular blockade is not affected by anticonvulsant therapy.

    Science.gov (United States)

    Jellish, W S; Thalji, Z; Brundidge, P K; Tempelhoff, R

    1996-01-01

    Long-term chronic anticonvulsant therapy produces a resistance to the effects of all nondepolarizing neuromuscular blocking agents studied to date. Since the metabolism of mivacurium is unique among the nondepolarizing neuromuscular blocking agents, the effect of anticonvulsants on its recovery parameters was examined. Forty-five patients were separated into three groups based on the number of chronic anticonvulsant medications the subjects were taking: subjects in group 1, the control group, took no anticonvulsant medication; group 2 subjects took one medication; and group 3 subjects took two medications. Mivacurium, 0.15 mg/kg i.v., was administered after induction of general anesthesia with thiopental sodium, 4-6 mg/kg, and fentanyl 2-4 micrograms/kg i.v. Maintenance anesthesia consisted of N2O in O2. 0.2-0.3% end-tidal isoflurane, and a fentanyl infusion. The evoked compound electromyograph (ECEMG) of the adductor pollicis-brevis muscle was measured for time of onset, T-1 (time at which ECEMG signal reaches 5, 25, 50, and 75% of baseline), TR (TOF ratio), and recovery index. T-1 at 25% was 18.2 +/- 1.8, 20.7 +/- 1.9, and 21.5 +/- 1.4 min for groups 1, 2, and 3, respectively, with TR at 25% being 23.7 +/- 2.3, 26.9 +/- 2.4, and 27.3 +/- 2.3 min. No significant differences were noted in neuromuscular recovery between groups at any time point. These results fail to demonstrate the resistance to the nondepolarizing neuromuscular blockade of mivacurium that has been observed with other nondepolarizing agents.

  9. CTLA4 blockade increases Th17 cells in patients with metastatic melanoma

    Directory of Open Access Journals (Sweden)

    Comin-Anduix Begonya

    2009-05-01

    Full Text Available Abstract Background Th17 cells are CD4+ cells that produce interleukin 17 (IL-17 and are potent inducers of tissue inflammation and autoimmunity. We studied the levels of this T cell subset in peripheral blood of patients treated with the anti-CTLA4 antibody tremelimumab since its major dose limiting toxicities are inflammatory and autoimmune in nature. Methods Peripheral blood mononuclear cells (PBMC were collected before and after receiving tremelimumab within two clinical trials, one with tremelimumab alone (21 patients and another together with autologous dendritic cells (DC pulsed with the melanoma epitope MART-126–35 (6 patients. Cytokines were quantified directly in plasma from patients and after in vitro stimulation of PBMC. We also quantified IL-17 cytokine-producing cells by intracellular cytokine staining (ICS. Results There were no significant changes in 13 assayed cytokines, including IL-17, when analyzing plasma samples obtained from patients before and after administration of tremelimumab. However, when PBMC were activated in vitro, IL-17 cytokine in cell culture supernatant and Th17 cells, detected as IL-17-producing CD4 cells by ICS, significantly increased in post-dosing samples. There were no differences in the levels of Th17 cells between patients with or without an objective tumor response, but samples from patients with inflammatory and autoimmune toxicities during the first cycle of therapy had a significant increase in Th17 cells. Conclusion The anti-CTLA4 blocking antibody tremelimumab increases Th17 cells in peripheral blood of patients with metastatic melanoma. The relation between increases in Th17 cells and severe autoimmune toxicity after CTLA4 blockade may provide insights into the pathogenesis of anti-CTLA4-induced toxicities. Trial Registration Clinical trial registration numbers: NCT0090896 and NCT00471887

  10. Blockade of the N-Methyl-D-Aspartate Glutamate Receptor Ameliorates Lipopolysaccharide-Induced Renal Insufficiency.

    Science.gov (United States)

    Lin, Chian-Shiung; Hung, Shun-Fa; Huang, Ho-Shiang; Ma, Ming-Chieh

    2015-01-01

    N-methyl-D-aspartate (NMDA) receptor activation in rat kidney reduces renal perfusion and ultrafiltration. Hypoperfusion-induced ischemia is the most frequent cause of functional insufficiency in the endotoxemic kidney. Here, we used non-hypotensive rat model of lipopolysaccharide-induced endotoxemia to examine whether NMDA receptor hyperfunction contributes to acute kidney injury. Lipopolysaccharide-induced renal damage via increased enzymuria and hemodynamic impairments were ameliorated by co-treatment with the NMDA receptor blocker, MK-801. The NMDA receptor NR1 subunit in the rat kidney mainly co-localized with serine racemase, an enzyme responsible for synthesizing the NMDA receptor co-agonist, D-serine. The NMDA receptor hyperfunction in lipopolysaccharide-treated kidneys was demonstrated by NR1 and serine racemase upregulation, particularly in renal tubules, and by increased D-serine levels. Lipopolysaccharide also induced cell damage in cultured tubular cell lines and primary rat proximal tubular cells. This damage was mitigated by MK-801 and by small interfering RNA targeting NR1. Lipopolysaccharide increased cytokine release in tubular cell lines via toll-like receptor 4. The release of interleukin-1β from these cells are the most abundant. An interleukin-1 receptor antagonist not only attenuated cell death but also abolished lipopolysaccharide-induced NR1 and serine racemase upregulation and increases in D-serine secretion, suggesting that interleukin-1β-mediated NMDA receptor hyperfunction participates in lipopolysaccharide-induced tubular damage. The results of this study indicate NMDA receptor hyperfunction via cytokine effect participates in lipopolysaccharide-induced renal insufficiency. Blockade of NMDA receptors may represent a promising therapeutic strategy for the treatment of sepsis-associated renal failure.

  11. Programmed Death-1 Blockade With Pembrolizumab in Patients With Classical Hodgkin Lymphoma After Brentuximab Vedotin Failure

    Science.gov (United States)

    Armand, Philippe; Shipp, Margaret A.; Ribrag, Vincent; Michot, Jean-Marie; Zinzani, Pier Luigi; Kuruvilla, John; Snyder, Ellen S.; Ricart, Alejandro D.; Balakumaran, Arun; Rose, Shelonitda

    2016-01-01

    Purpose Classical Hodgkin lymphoma (HL) frequently exhibits genetic alterations leading to overexpression of the programmed death-1 (PD-1) ligands, suggesting a possible vulnerability to PD-1 blockade. The phase Ib study KEYNOTE-013 (NCT01953692) tested the safety and efficacy of the anti–PD-1 antibody pembrolizumab in patients with hematologic malignancies. Based on its genetics, HL was included as an independent cohort. Methods We enrolled patients with relapsed or refractory HL whose disease progressed on or after treatment with brentuximab vedotin. Patients received pembrolizumab, 10 mg/kg every 2 weeks, until disease progression occurred. Response to treatment was assessed at week 12 and every 8 weeks thereafter. Principal end points were safety and complete remission (CR) rate. Results Thirty-one patients were enrolled; 55% had more than four lines of prior therapy, and 71% had relapsed after autologous stem cell transplantation. Five patients (16%) experienced grade 3 drug-related adverse events (AEs); there were no grade 4 AEs or deaths related to treatment. The CR rate was 16% (90% CI, 7% to 31%). In addition, 48% of patients achieved a partial remission, for an overall response rate of 65% (90% CI, 48% to 79%). Most of the responses (70%) lasted longer than 24 weeks (range, 0.14+ to 74+ weeks), with a median follow-up of 17 months. The progression-free survival rate was 69% at 24 weeks and 46% at 52 weeks. Biomarker analyses demonstrated a high prevalence of PD-L1 and PD-L2 expression, treatment-induced expansion of T cells and natural killer cells, and activation of interferon-γ, T-cell receptor, and expanded immune-related signaling pathways. Conclusions Pembrolizumab was associated with a favorable safety profile. Pembrolizumab treatment induced favorable responses in a heavily pretreated patient cohort, justifying further studies. PMID:27354476

  12. [Analgesic efficacy of the ultrasound-guided blockade of the transversus abdominis plane - a systematic review].

    Science.gov (United States)

    Ripollés, Javier; Marmaña Mezquita, Sandra; Abad, Alfredo; Calvo, José

    2015-01-01

    The transverse abdominal plan blockade (TAP) is a block of abdominal wall that has diffused rapidly in the clinical practice as part of a multimodal analgesia for abdominal surgery. The performance of the ultrasound-guided technique has allowed the lowering of potential complications, as well as new approaches that according to the descriptions carried out and the prospective studies would make it possible to utilize the TAP in different surgical interventions; however, the results obtained in randomized clinical trials (RCTs) are inconsistent. To prepare a systematic review aiming to determine the efficacy of the ultrasound-guided TAP for different surgical interventions, as well as the indications according to the approaches and their influences. Two research approaches, one manual, and the other in Pubmed returned 28 RCT where an intervention with ultrasound-guided TAP were performed to compare the analgesic efficacy in contrast to another technique in adults, published between 2007 and October 2013, in English or Spanish, with Jadad score > 1, according to the inclusion criteria for this review. The authors analyzed independently all the RCT. The TAP have been shown to be an effective technique in colorectal surgery, cesarean section, cholecystectomy, hysterectomy, appendectomy, donor nephrectomy, retropubic prostatectomy, and bariatric surgery. However, the data found in RCT are not conclusive, and as a result, it is necessary to develop new and well designed RCT, with enough statistical power to compare different approaches, drugs, doses, and volumes for the same intervention, aiming to answer the current questions and their effects in the habitual clinical practice. Copyright © 2014 Sociedade Brasileira de Anestesiologia. Publicado por Elsevier Editora Ltda. All rights reserved.

  13. New models of pulmonary hypertension based on VEGF receptor blockade-induced endothelial cell apoptosis

    Science.gov (United States)

    Nicolls, Mark R.; Mizuno, Shiro; Taraseviciene-Stewart, Laima; Farkas, Laszlo; Drake, Jennnifer I.; Al Husseini, Aysar; Gomez-Arroyo, Jose G.; Voelkel, Norbert F.; Bogaard, Herman J.

    2012-01-01

    In spite of treatment, severe angioproliferative pulmonary arterial hypertension (PAH) remains a disease characterized by great morbidity and shortened survival. New treatment strategies for patients with PAH are needed, and after drug development, preclinical studies are best conducted in animal models which present with pulmonary angio-obliterative disease and right heart failure. A rat model of severe pulmonary hypertension and right heart failure, described a decade ago, continues to be investigated and provide insight into the nature of the lung vascular lesions and mechanisms of cardiac adaptation to an altered lung circulation. This rat model is based on the combination of VEGF receptor blockade with Su5416 and chronic hypoxia; use of this pulmonary hypertension induction strategy led to developing the concept of apoptosis-dependent compensatory vascular cell growth. Although, often employed in experimental designs, chronic hypoxia is not necessary for the development of angio-obliterative pulmonary hypertension. Left pneumonectomy combined with Su5416 also results in severe pulmonary hypertension in normoxic conditions. Similarly, the immune insufficiency component of severe PAH can be modeled in athymic rats (lacking T-lymphocytes). In these rats housed under normoxic conditions, treatment with the VEGFR receptor blocker results in angioproliferative pulmonary hypertension; cardiopulmonary disease in these animals can be prevented by immune reconstitution of regulatory T-cells (Tregs). Finally, chronic hypoxia can be replaced with another stimulator of HIF-1α: Ovalbumin (Ova). Immunization of rats with Ova increases lung tissue HIF-1α protein expression, and in Su5416-treated rats causes lethal pulmonary hypertension. Finally, we postulate that these models may also be useful for “reverse translation”; that is, the mechanisms of lung vascular cell death and growth and the modifying influences of immune and bone marrow cells that have been identified

  14. Cardiovascular response to beta-adrenergic blockade or activation in 23 inbred mouse strains.

    Directory of Open Access Journals (Sweden)

    Corinne Berthonneche

    Full Text Available We report the characterisation of 27 cardiovascular-related traits in 23 inbred mouse strains. Mice were phenotyped either in response to chronic administration of a single dose of the beta-adrenergic receptor blocker atenolol or under a low and a high dose of the beta-agonist isoproterenol and compared to baseline condition. The robustness of our data is supported by high trait heritabilities (typically H(2>0.7 and significant correlations of trait values measured in baseline condition with independent multistrain datasets of the Mouse Phenome Database. We then focused on the drug-, dose-, and strain-specific responses to beta-stimulation and beta-blockade of a selection of traits including heart rate, systolic blood pressure, cardiac weight indices, ECG parameters and body weight. Because of the wealth of data accumulated, we applied integrative analyses such as comprehensive bi-clustering to investigate the structure of the response across the different phenotypes, strains and experimental conditions. Information extracted from these analyses is discussed in terms of novelty and biological implications. For example, we observe that traits related to ventricular weight in most strains respond only to the high dose of isoproterenol, while heart rate and atrial weight are already affected by the low dose. Finally, we observe little concordance between strain similarity based on the phenotypes and genotypic relatedness computed from genomic SNP profiles. This indicates that cardiovascular phenotypes are unlikely to segregate according to global phylogeny, but rather be governed by smaller, local differences in the genetic architecture of the various strains.

  15. The VEGF rise in blood of bevacizumab patients is not based on tumor escape but a host-blockade of VEGF clearance

    Science.gov (United States)

    Alidzanovic, Lejla; Starlinger, Patrick; Schauer, Dominic; Maier, Thomas; Feldman, Alexandra; Buchberger, Elisabeth; Stift, Judith; Koeck, Ulrike; Pop, Lorand; Gruenberger, Birgit; Gruenberger, Thomas; Brostjan, Christine

    2016-01-01

    Vascular endothelial growth factor (VEGF) has become a major target in cancer treatment as it promotes tumor angiogenesis. Therapy with anti-VEGF antibody bevacizumab reportedly induces high levels of circulating VEGF which may potentially contribute to resistance. Based on animal or computational models, mechanisms of VEGF induction by bevacizumab have been proposed but not verified in the clinical setting. Hence, we evaluated sixty patients with colorectal cancer metastases for changes in plasma VEGF during neoadjuvant/conversion and adjuvant chemotherapy with or without bevacizumab. VEGF expression was assessed in tissue sections of liver metastases. The VEGF source was investigated with in vitro cultures of tumor, endothelial cells, fibroblasts and platelets, and potential protein stabilization due to anti-VEGF therapy was addressed. A VEGF rise was observed in blood of bevacizumab patients but not in chemotherapy controls, and VEGF was found to be largely complexed by the antibody. A comparable VEGF increase occurred in the presence (neoadjuvant) and absence of the tumor (adjuvant). Accordingly, VEGF expression in tumor tissue was not determined by bevacizumab treatment. Investigations with isolated cell types did not reveal VEGF production in response to bevacizumab. However, antibody addition to endothelial cultures led to a dose-dependent blockade of VEGF internalization and hence stabilized VEGF in the supernatant. In conclusion, the VEGF rise in cancer patients treated with bevacizumab is not originating from the tumor. The accumulation of primarily host-derived VEGF in circulation can be explained by antibody interference with receptor-mediated endocytosis and protein degradation. Thus, the VEGF increase in response to bevacizumab therapy should not be regarded as a tumor escape mechanism. PMID:27527865

  16. Recommendations on the use of deep neuromuscular blockade by anaesthesiologists and surgeons. AQUILES (Anestesia QUIrúrgica para Lograr Eficiencia y Seguridad) Consensus.

    Science.gov (United States)

    Errando-Oyonarte, C L; Moreno-Sanz, C; Vila-Caral, P; Ruiz de Adana-Belbel, J C; Vázquez-Alonso, E; Ramírez-Rodríguez, J M; Veiga-Ruiz, G; Guasch-Arévalo, E; Lora-Tamayo D'Ocón, J I

    2017-02-01

    Neuromuscular blockade enables airway management, ventilation and surgical procedures. However there is no national consensus on its routine clinical use. The objective was to establish the degree of agreement among anaesthesiologists and general surgeons on the clinical use of neuromuscular blockade in order to make recommendations to improve its use during surgical procedures. Multidisciplinary consensus study in Spain. Anaesthesiologists experts in neuromuscular blockade management (n=65) and general surgeons (n=36) were included. Delphi methodology was selected. A survey with 17 final questions developed by a dedicated scientific committee was designed. The experts answered the successive questions in two waves. The survey included questions on: type of surgery, type of patient, benefits/harm during and after surgery, impact of objective neuromuscular monitoring and use of reversal drugs, viability of a multidisciplinary and efficient approach to the whole surgical procedure, focussing on the level of neuromuscular blockade. Five recommendations were agreed: 1) deep neuromuscular blockade is very appropriate for abdominal surgery (degree of agreement 94.1%), 2) and in obese patients (76.2%); 3) deep neuromuscular blockade maintenance until end of surgery might be beneficial in terms of clinical aspects, such as as immobility or better surgical access (86.1 to 72.3%); 4) quantitative monitoring and reversal drugs availability is recommended (89.1%); finally 5) anaesthesiologists/surgeons joint protocols are recommended. Collaboration among anaesthesiologists and surgeons has enabled some general recommendations to be established on deep neuromuscular blockade use during abdominal surgery. Copyright © 2016 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Dual hypocretin receptor antagonism is more effective for sleep promotion than antagonism of either receptor alone.

    Directory of Open Access Journals (Sweden)

    Stephen R Morairty

    Full Text Available The hypocretin (orexin system is involved in sleep/wake regulation, and antagonists of both hypocretin receptor type 1 (HCRTR1 and/or HCRTR2 are considered to be potential hypnotic medications. It is currently unclear whether blockade of either or both receptors is more effective for promoting sleep with minimal side effects. Accordingly, we compared the properties of selective HCRTR1 (SB-408124 and SB-334867 and HCRTR2 (EMPA antagonists with that of the dual HCRTR1/R2 antagonist almorexant in the rat. All 4 antagonists bound to their respective receptors with high affinity and selectivity in vitro. Since in vivo pharmacokinetic experiments revealed poor brain penetration for SB-408124, SB-334867 was selected for subsequent in vivo studies. When injected in the mid-active phase, SB-334867 produced small increases in rapid-eye-movement (REM and non-REM (NR sleep. EMPA produced a significant increase in NR only at the highest dose studied. In contrast, almorexant decreased NR latency and increased both NR and REM proportionally throughout the subsequent 6 h without rebound wakefulness. The increased NR was due to a greater number of NR bouts; NR bout duration was unchanged. At the highest dose tested (100 mg/kg, almorexant fragmented sleep architecture by increasing the number of waking and REM bouts. No evidence of cataplexy was observed. HCRTR1 occupancy by almorexant declined 4-6 h post-administration while HCRTR2 occupancy was still elevated after 12 h, revealing a complex relationship between occupancy of HCRT receptors and sleep promotion. We conclude that dual HCRTR1/R2 blockade is more effective in promoting sleep than blockade of either HCRTR alone. In contrast to GABA receptor agonists which induce sleep by generalized inhibition, HCRTR antagonists seem to facilitate sleep by reducing waking "drive".

  18. Impact of endothelin blockade on acute exercise-induced changes in blood flow and endothelial function in type 2 diabetes mellitus.

    Science.gov (United States)

    Schreuder, Tim H A; van Lotringen, Jaap H; Hopman, Maria T E; Thijssen, Dick H J

    2014-09-01

    Positive vascular effects of exercise training are mediated by acute increases in blood flow. Type 2 diabetes patients show attenuated exercise-induced increases in blood flow, possibly mediated by the endothelin pathway, preventing an optimal stimulus for vascular adaptation. We examined the impact of endothelin receptor blockade (bosentan) on exercise-induced blood flow in the brachial artery and on pre- and postexercise endothelial function in type 2 diabetes patients (n = 9, 60 ± 7 years old) and control subjects (n = 10, 60 ± 5 years old). Subjects reported twice to the laboratory to perform hand-grip exercise in the presence of endothelin receptor blockade or placebo. We examined brachial artery endothelial function (via flow-mediated dilatation) before and after exercise, as well as blood flow during exercise. Endothelin receptor blockade resulted in a larger increase in blood flow during exercise in type 2 diabetes patients (P = 0.046), but not in control subjects (P = 0.309). Exercise increased shear rate across the exercise protocol, unaffected by endothelin receptor blockade. Exercise did not alter brachial artery diameter in either group, but endothelin receptor blockade resulted in a larger brachial artery diameter in type 2 diabetes patients (P = 0.033). Exercise significantly increased brachial artery flow-mediated dilatation in both groups, unaffected by endothelin receptor blockade. Endothelin receptor blockade increased exercise-induced brachial artery blood flow in type 2 diabetes patients, but not in control subjects. Despite this effect of endothelin receptor blockade on blood flow, we found no impact on baseline or post-exercise endothelial function in type 2 diabetes patients or control subjects, possibly related to normalization of the shear stimulus during exercise. The successful increase in blood flow during exercise in type 2 diabetes patients through endothelin receptor blockade may have beneficial effects in

  19. N-cadherin and integrin blockade inhibit arteriolar myogenic reactivity but not pressure-induced increases in intracellular Ca2+

    Directory of Open Access Journals (Sweden)

    Teresa Y. Jackson

    2010-12-01

    Full Text Available The vascular myogenic response is characterized by arterial constriction in response to an increase in intraluminal pressure and dilatation to a decrease in pressure. This mechanism is important for the regulation of blood flow, capillary pressure and arterial pressure. The identity of the mechanosensory mechanism(s for this response is incompletely understood but has been shown to include the integrins as cell-extracellular matrix receptors. The possibility that a cell-cell adhesion receptor is involved has not been studied. Thus, we tested the hypothesis that N-cadherin, a cell-cell adhesion molecule in vascular smooth muscle cells (VSMCs, was important for myogenic responsiveness. The purpose of this study was to investigate:
    1. whether cadherin inhibition blocks myogenic responses to increases in intraluminal pressure and 2. the effect of the cadherin or integrin blockade on pressure-induced changes in [Ca2+]i. Cadherin blockade was tested in isolated rat cremaster arterioles on myogenic responses to acute pressure steps from 60 – 100 mmHg and changes in VSMC Ca2+ were measured using fura-2. In the presence of a synthetic cadherin inhibitory peptide or a function blocking antibody, myogenic responses were inhibited. In contrast, during N-cadherin blockade, pressure-induced changes in [Ca2+]i were not altered. Similarly, vessels treated with function-blocking β1- or β3-integrin antibodies maintained pressure-induced [Ca2+]i responses despite inhibition of myogenic constriction. Collectively, these data suggest that both cadherins and integrins play a fundamental role in mediating myogenic constriction but argue against their direct involvement in mediating pressure-induced [Ca2+]i increases.

  20. HMGB1 blockade differentially impacts pulmonary inflammation and defense responses in poly(I:C)/LPS-exposed heart transplant mice.

    Science.gov (United States)

    Ming, Bingxia; Gao, Ming; Zou, Huijuan; Chen, Huoying; Sun, Yan; Xiao, Yifan; Lai, Lin; Xiong, Ping; Xu, Yong; Tan, Zheng; Wang, Jing; Chen, Gang; Gong, Feili; Xia, Jiahong; Zheng, Fang

    2016-08-01

    A large number of recipients are in a compromised immune defense condition because of the routine application of immunosuppressive regimens after heart transplantation. Our previous work demonstrated that blockade of high-mobility group box 1 (HMGB1) prolongs the graft survival. Whether and how HMGB1 blockade impacts respiratory responses against pathogen-like challenge in organ transplant recipients when it improves cardiac graft are not elucidated. At the present study, after abdominal heterotopic heart transplantation, the recipient mice were treated with HMGB1 mAb, and then challenged with poly(I:C) or LPS intratracheally on day 7 post transplantation. We found that the level of bronchoalveolar lavage (BAL) HMGB1 was elevated after heart transplantation, and aggravated responses to respiratory tract poly(I:C)/LPS challenge were observed. HMGB1 neutralizing mAb treatment in poly(I:C)-challenged recipient mice alleviated pulmonary histopathological changes, neutrophil infiltration and inflammatory cytokine release, but unaffected the level of IFN-β, the distribution of CD11b(+)CD27(+)/CD11b(+)CD27(-) NK cell subsets, and CD8(+) T cell responses. In LPS-exposed recipient mice, HMGB1 mAb treatment ameliorated pulmonary inflammatory damage and enhanced the phagocytosis of phagocytic cells. Thus, this study may establish a basis for the application of HMGB1 blockade to improve the outcomes of heart transplant recipients because HMGB1 inhibition ameliorates pulmonary inflammation, but maintains defense-associated responses. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. [Effect of ropivacaine combined with pancuronium on neuromuscular transmission and effectiveness of neostigmine and 4-aminopyridine for blockade reversal: experimental study].

    Science.gov (United States)

    Braga, Angélica de Fátima; Carvalho, Vanessa Henriques; Braga, Franklin Sarmento; Potério, Gloria Maria Braga; Santos, Filipe Nadir Caparica

    2015-01-01

    The local anesthetic effects on neuromuscular junction and its influence on blockade produced by nondepolarizing neuromuscular blockers are still under-investigated; however, this interaction has been described in experimental studies and in humans. The aim of this study was to evaluate in vitro the interaction between ropivacaine and pancuronium, the influence on transmission and neuromuscular blockade, and the effectiveness of neostigmine and 4-aminopyridine to reverse the blockade. Rats were divided into groups (n=5) according to the study drug: ropivacaine (5μgmL(-1)); pancuronium (2μg.mL(-1)); ropivacaine+pancuronium. Neostigmine and 4-aminopyridine were used at concentrations of 2μgmL(-1) and 20μgmL(-1), respectively. The effects of ropivacaine on membrane potential and miniature end-plate potential, the amplitude of diaphragm responses before and 60minutes after the addition of ropivacaine (degree of neuromuscular blockade with pancuronium and with the association of pancuronium-ropivacaine), and the effectiveness of neostigmine and 4-aminopyridine on neuromuscular block reversal were evaluated. Ropivacaine did not alter the amplitude of muscle response (the membrane potential), but decreased the frequency and amplitude of the miniature end-plate potential. Pancuronium blockade was potentiated by ropivacaine, and partially and fully reversed by neostigmine and 4-aminopyridine, respectively. Ropivacaine increased the neuromuscular block produced by pancuronium. The complete antagonism with 4-aminopyridine suggests presynaptic action of ropivacaine. Copyright © 2014 Sociedade Brasileira de Anestesiologia. Publicado por Elsevier Editora Ltda. All rights reserved.

  2. What Is a Promotion?

    Science.gov (United States)

    Pergamit, Michael R.; Veum, Jonathan R.

    1999-01-01

    For a sample of young workers, "promotion" involved no change in position or duties; promotion was more likely for males than females and Whites than Blacks or Hispanics. Company training and prior promotions were important predictors. Promotion did not appear to have a direct impact on job satisfaction. (SK)

  3. Human adipose tissue blood flow during prolonged exercise, III. Effect of beta-adrenergic blockade, nicotinic acid and glucose infusion

    DEFF Research Database (Denmark)

    Bülow, J

    1981-01-01

    of work. No increase in lipolysis and no increase in ATBF were found when lipolysis was blocked by nicotinic acid (0.3 g/h). Propranolol treatment (0.15 mg/kg) reduced lipolysis and nearly abolished the increase in ATBF during exercise. Intravenous administration of glucose (about 0.25 g/min) did......Subcutaneous adipose tissue blood flow (ATBF) was measured in six male subjects by the 133Xe-washout technique during 3-4 h of exercise at a work load corresponding to an oxygen uptake of about 1.71/min. The measurements were done during control conditions, during blockade of lipolysis by nicotinic...

  4. Disposal of atrial natriuretic factor (ANF99-126) in patients with cirrhosis: effect of beta-adrenergic blockade

    DEFF Research Database (Denmark)

    Bendtsen, F; Gerbes, A L; Henriksen, Jens Henrik Sahl

    1993-01-01

    was similar to that of controls (9.4 vs. 10.9 pmol l-1, NS) and was positively correlated to cardiac output (r = 0.49, p 17), hepato-enteric (n = 16), and splanchnic superior...... changes in ANF extraction and a small decrease in azygos and hepato-enteric clearance occurred during beta-adrenergic blockade. Our results show a substantial extraction of ANF in the kidney, in the splanchnic bed drained through superior portosystemic collaterals, and in the hepato-enteric bed. Only...

  5. Antihypertensive and vasorelaxant activities of Laelia autumnalis are mainly through calcium channel blockade.

    Science.gov (United States)

    Vergara-Galicia, Jorge; Ortiz-Andrade, Rolffy; Castillo-España, Patricia; Ibarra-Barajas, Maximiliano; Gallardo-Ortiz, Itzell; Villalobos-Molina, Rafael; Estrada-Soto, Samuel

    2008-07-01

    The aim of the present study was to evaluate the possible mechanism of the vasorelaxant action of methanol extract from Laelia autumnalis (MELa) in isolated rat aortic rings, and to establish its antihypertensive activity in vivo. MELa (0.15-->50 microg/mL) induced relaxation in aortic rings pre-contracted with KCl (80 mM), showing an IC50 value of 34.61+/-1.41 microg/mL and E max value of 85.0+/-4.38% (in endothelium-intact rings) and an IC50 value of 45.11+/-4.17 microg/mL and E max value of 80.0+/-12.1% (in endothelium-denuded rings). Serotonin (5-HT, 1 x 10(-4) M) provoked sustained contraction, which was markedly inhibited by MELa (0.15-->50 microg/mL) in a concentration-dependent and endothelium-independent manner. Pretreatment with MELa (15, 46, 150, 300 and 1500 microg/mL) also inhibited contractile responses to norepinephrine (NE 1 x 10(-11) M to 1 x 10(-5.5) M). In endothelium-denuded rings, the vasorelaxant effect of MELa was reduced partially by ODQ (1 microM), but not by tetraethylammonium (5 microM), glibenclamide (10 microM), and 2-aminopyridine (100 microM). The extract also reduced NE-induced transient contraction in Ca2+-free solution, and inhibited contraction induced by increasing external calcium in Ca2+-free medium plus high KCl (80 mM). The antihypertensive effect of MELa was determined in spontaneously hypertensive rats (SHR). A single oral administration of the extract (100 mg/kg) exhibited a significant decrease in systolic and diastolic blood pressure and heart rate (p<0.05) in SHR rats. Our results suggest that MELa induces relaxation in rat aortic rings through an endothelium-independent pathway, involving blockade of Ca2+ channels and a possible cGMP enhanced concentrations and also causes an antihypertensive effect.

  6. Antibody blockade of IL-17 family cytokines in immunity to acute murine oral mucosal candidiasis.

    Science.gov (United States)

    Whibley, Natasha; Tritto, Elaine; Traggiai, Elisabetta; Kolbinger, Frank; Moulin, Pierre; Brees, Dominique; Coleman, Bianca M; Mamo, Anna J; Garg, Abhishek V; Jaycox, Jillian R; Siebenlist, Ulrich; Kammüller, Michael; Gaffen, Sarah L

    2016-06-01

    Antibodies targeting IL-17A or its receptor, IL-17RA, are approved to treat psoriasis and are being evaluated for other autoimmune conditions. Conversely, IL-17 signaling is critical for immunity to opportunistic mucosal infections caused by the commensal fungus Candida albicans, as mice and humans lacking the IL-17R experience chronic mucosal candidiasis. IL-17A, IL-17F, and IL-17AF bind the IL-17RA-IL-17RC heterodimeric complex and deliver qualitatively similar signals through the adaptor Act1. Here, we used a mouse model of acute oropharyngeal candidiasis to assess the impact of blocking IL-17 family cytokines compared with specific IL-17 cytokine gene knockout mice. Anti-IL-17A antibodies, which neutralize IL-17A and IL-17AF, caused elevated oral fungal loads, whereas anti-IL-17AF and anti-IL-17F antibodies did not. Notably, there was a cooperative effect of blocking IL-17A, IL-17AF, and IL-17F together. Termination of anti-IL-17A treatment was associated with rapid C. albicans clearance. IL-17F-deficient mice were fully resistant to oropharyngeal candidiasis, consistent with antibody blockade. However, IL-17A-deficient mice had lower fungal burdens than anti-IL-17A-treated mice. Act1-deficient mice were much more susceptible to oropharyngeal candidiasis than anti-IL-17A antibody-treated mice, yet anti-IL-17A and anti-IL-17RA treatment caused equivalent susceptibilities. Based on microarray analyses of the oral mucosa during infection, only a limited number of genes were associated with oropharyngeal candidiasis susceptibility. In sum, we conclude that IL-17A is the main cytokine mediator of immunity in murine oropharyngeal candidiasis, but a cooperative relationship among IL-17A, IL-17AF, and IL-17F exists in vivo. Susceptibility displays the following hierarchy: IL-17RA- or Act1-deficiency > anti-IL-17A + anti-IL-17F antibodies > anti-IL-17A or anti-IL-17RA antibodies > IL-17A deficiency. © Society for Leukocyte Biology.

  7. Early Aldosterone Blockade in Acute Myocardial Infarction: The ALBATROSS Randomized Clinical Trial.

    Science.gov (United States)

    Beygui, Farzin; Cayla, Guillaume; Roule, Vincent; Roubille, François; Delarche, Nicolas; Silvain, Johanne; Van Belle, Eric; Belle, Loic; Galinier, Michel; Motreff, Pascal; Cornillet, Luc; Collet, Jean-Philippe; Furber, Alain; Goldstein, Patrick; Ecollan, Patrick; Legallois, Damien; Lebon, Alain; Rousseau, Hélène; Machecourt, Jacques; Zannad, Faiez; Vicaut, Eric; Montalescot, Gilles

    2016-04-26

    Mineralocorticoid receptor antagonists (MRA) improve outcome in the setting of post-myocardial infarction (MI) heart failure (HF). The study sought to assess the benefit of an early MRA regimen in acute MI irrespective of the presence of HF or left ventricular (LV) dysfunction. We randomized 1,603 patients to receive an MRA regimen with a single intravenous bolus of potassium canrenoate (200 mg) followed by oral spironolactone (25 mg once daily) for 6 months in addition to standard therapy or standard therapy alone. The primary outcome of the study was the composite of death, resuscitated cardiac arrest, significant ventricular arrhythmia, indication for implantable defibrillator, or new or worsening HF at 6-month follow-up. Key secondary/safety outcomes included death and other individual components of the primary outcome and rates of hyperkalemia at 6 months. The primary outcome occurred in 95 (11.8%) and 98 (12.2%) patients in the treatment and control groups, respectively (hazard ratio [HR]: 0.97; 95% confidence interval [CI]: 0.73 to 1.28). Death occurred in 11 (1.4%) and 17 (2.1%) patients in the treatment and control groups, respectively (HR: 0.65; 95% CI: 0.30 to 1.38). In a non-pre-specified exploratory analysis, the odds of death were reduced in the treatment group (3 [0.5%] vs. 15 [2.4%]; HR: 0.20; 95% CI: 0.06 to 0.70) in the subgroup of ST-segment elevation MI (n = 1,229), but not in non-ST-segment elevation MI (p for interaction = 0.01). Hyperkalemia >5.5 mmol/l(-1) occurred in 3% and 0.2% of patients in the treatment and standard therapy groups, respectively (p < 0.0001). The study failed to show the benefit of early MRA use in addition to standard therapy in patients admitted for MI. (Aldosterone Lethal effects Blockade in Acute myocardial infarction Treated with or without Reperfusion to improve Outcome and Survival at Six months follow-up; NCT01059136). Copyright © 2016 American College of Cardiology Foundation. Published by Elsevier Inc. All

  8. Vasopressin, renin, and cortisol responses to hemorrhage during acute blockade of cardiac nerves in conscious dogs

    Science.gov (United States)

    O'Donnell, C. P.; Keil, L. C.; Thrasher, T. N.

    1993-01-01

    The effect of acute cardiac nerve blockade (CNB) on the increases in plasma renin activity (PRA), arginine vasopressin (AVP), and cortisol in response to a 30 ml/kg hemorrhage was determined in conscious dogs (n = 9). Procaine was infused into the pericardial space to produce acute reversible CNB, or saline was infused in the control hemorrhage. Blood was removed from the inferior vena cava at a rate of 1 ml.kg-1.min-1. In the control hemorrhage, plasma AVP increased from 1.8 +/- 0.3 to 219 +/- 66 pg/ml, PRA increased from 0.63 +/- 0.20 to 3.08 +/- 0.91 ng angiotensin I (ANG I).ml-1.3 h-1, and cortisol increased from 1.4 +/- 0.2 to 4.0 +/- 0.7 micrograms/dl. When the hemorrhage was repeated during acute CNB, plasma AVP increased from 2.8 +/- 1.6 to 185 +/- 59 pg/ml, PRA increased from 0.44 +/- 0.14 to 2.24 +/- 0.27 ng ANG I.ml-1.3 h-1, and cortisol increased from 1.9 +/- 0.3 to 5.4 +/- 0.6 micrograms/dl, and none of the increases differed significantly from the responses during the control hemorrhage. Left atrial pressure fell significantly after removal of 6 ml/kg of blood, but mean arterial pressure was maintained at control levels until blood loss reached 20 ml/kg during pericardial infusion of either saline or procaine. The declines in MAP at the 30 ml/kg level of hemorrhage in both treatments were similar. These results demonstrate that acutely blocking input from cardiac receptors does not reduce the increases in plasma AVP, cortisol, and PRA in response to a 30 ml/kg hemorrhage. The results of this study do not support the hypothesis that input from cardiac receptors is required for a normal AVP response to hemorrhage and suggest that other receptors, presumably arterial baroreceptors, can stimulate AVP and cortisol secretion in the absence of signals from the heart.

  9. Palpation- and ultrasound-guided brachial plexus blockade in Hispaniolan Amazon parrots (Amazona ventralis).

    Science.gov (United States)

    da Cunha, Anderson F; Strain, George M; Rademacher, Nathalie; Schnellbacher, Rodney; Tully, Thomas N

    2013-01-01

    To compare palpation-guided with ultrasound-guided brachial plexus blockade in Hispaniolan Amazon parrots. Prospective randomized experimental trial. Eighteen adult Hispaniolan Amazon parrots (Amazona ventralis) weighing 252-295 g. After induction of anesthesia with isoflurane, parrots received an injection of lidocaine (2 mg kg(-1)) in a total volume of 0.3 mL at the axillary region. The birds were randomly assigned to equal groups using either palpation or ultrasound as a guide for the brachial plexus block. Nerve evoked muscle potentials (NEMP) were used to monitor effectiveness of brachial plexus block. The palpation-guided group received the local anesthetic at the space between the pectoral muscle, triceps, and supracoracoideus aticimus muscle, at the insertion of the tendons of the caudal coracobrachial muscle, and the caudal scapulohumeral muscle. For the ultrasound-guided group, the brachial plexus and the adjacent vessels were located with B-mode ultrasonography using a 7-15 MHz linear probe. After location, an 8-5 MHz convex transducer was used to guide injections. General anesthesia was discontinued 20 minutes after lidocaine injection and the birds recovered in a padded cage. Both techniques decreased the amplitude of NEMP. Statistically significant differences in NEMP amplitudes, were observed within the ultrasound-guided group at 5, 10, 15, and 20 minutes after injection and within the palpation-guided group at 10, 15, and 20 minutes after injection. There was no statistically significant difference between the two groups. No effect on motor function, muscle relaxation or wing droop was observed after brachial plexus block. The onset of the brachial plexus block tended to be faster when ultrasonography was used. Brachial plexus injection can be performed in Hispaniolan Amazon parrots and nerve evoked muscle potentials were useful to monitor the effects on nerve conduction in this avian species. Neither technique produced an effective block at the

  10. Cognitive and cerebrovascular improvements following kinin B1 receptor blockade in Alzheimer’s disease mice

    Science.gov (United States)

    2013-01-01

    Background Recent evidence suggests that the inducible kinin B1 receptor (B1R) contributes to pathogenic neuroinflammation induced by amyloid-beta (Aβ) peptide. The present study aims at identifying the cellular distribution and potentially detrimental role of B1R on cognitive and cerebrovascular functions in a mouse model of Alzheimer’s disease (AD). Methods Transgenic mice overexpressing a mutated form of the human amyloid precursor protein (APPSwe,Ind, line J20) were treated with a selective and brain penetrant B1R antagonist (SSR240612, 10 mg/kg/day for 5 or 10 weeks) or vehicle. The impact of B1R blockade was measured on i) spatial learning and memory performance in the Morris water maze, ii) cerebral blood flow (CBF) responses to sensory stimulation using laser Doppler flowmetry, and iii) reactivity of isolated cerebral arteries using online videomicroscopy. Aβ burden was quantified by ELISA and immunostaining, while other AD landmarks were measured by western blot and immunohistochemistry. Results B1R protein levels were increased in APP mouse hippocampus and, prominently, in reactive astrocytes surrounding Aβ plaques. In APP mice, B1R antagonism with SSR240612 improved spatial learning, memory and normalized protein levels of the memory-related early gene Egr-1 in the dentate gyrus of the hippocampus. B1R antagonism restored sensory-evoked CBF responses, endothelium-dependent dilations, and normalized cerebrovascular protein levels of endothelial nitric oxide synthase and B2R. In addition, SSR240612 reduced (approximately 50%) microglial, but not astroglial, activation, brain levels of soluble Aβ1-42, diffuse and dense-core Aβ plaques, and it increased protein levels of the Aβ brain efflux transporter lipoprotein receptor-related protein-1 in cerebral microvessels. Conclusion These findings show a selective upregulation of astroglial B1R in the APP mouse brain, and the capacity of the B1R antagonist to abrogate amyloidosis, cerebrovascular and

  11. Recovery from mivacurium-induced neuromuscular blockade after neurosurgical procedures of long duration.

    Science.gov (United States)

    Jellish, W S; Thalji, Z A; Murdoch, J R

    1995-12-01

    To determine if recovery following prolonged (5 hours in length or greater) infusions of mivacurium is different from recovery after single bolus administration. open-labelled, controlled study. Inpatient neurosurgical service at a university hospital. 36 patients between the ages of 18 to 65 without significant history of renal, hepatic, cardiac, or metabolic disease undergoing neurosurgical procedures. 21 patients had craniotomies or skull base procedures of an estimated length of 5 hours or greater; 15 patients (control) underwent short neurosurgical operations (two hours or less). Intravenous (IV) mivacurium 0.15 mg/kg was given with stable general anesthesia with 70% nitrous oxide in oxygen, 0.2% to 0.3% end-tidal isoflurane, and continuous infusion of fentanyl. The control group was allowed to recover spontaneously after single bolus administration while neuromuscular blockade was maintained in the study group with a continuous infusion of mivacurium until 30 minutes before completion of surgery, at which time the infusion was discontinued and neuromuscular function was allowed to recover spontaneously. The evoked compound electromyogram of the adductor pollicis brevis muscle was measured during stimulation of the ulnar nerve at 2 Hz for 2 seconds at 10-second intervals. Measurements included time to 50% and 90% depression of twitch (T1 of the TOF response), time to T1 equal to 25% (T1(25)), 50% (T1(50)), and 75% (T1(75)) of baseline, and TOF ratio (TR) at 10%, 25%, 50%, and 75% recovery. Recovery index (RI), which is T1(75) minus T1(25), was also determined. All mivacurium infusion rates decreased during surgery. Recovery rates were significantly longer in the long infusion (LI) group than the control group. RI was also increased in the LI group compared with the single bolus control (11.3 +/- 1.2 minutes vs. 7.1 +/- 0.8 minutes p < 0.05). Recovery following mivacurium by prolonged continuous infusion was slower than that observed after single bolus

  12. VEGF receptor blockade markedly reduces retinal microglia/macrophage infiltration into laser-induced CNV.

    Directory of Open Access Journals (Sweden)

    Hu Huang

    Full Text Available Although blocking VEGF has a positive effect in wet age-related macular degeneration (AMD, the effect of blocking its receptors remains unclear. This was an investigation of the effect of VEGF receptor (VEGFR 1 and/or 2 blockade on retinal microglia/macrophage infiltration in laser-induced choroidal neovascularization (CNV, a model of wet AMD. CNV lesions were isolated by laser capture microdissection at 3, 7, and 14 days after laser and analyzed by RT-PCR and immunofluorescence staining for mRNA and protein expression, respectively. Neutralizing antibodies for VEGFR1 or R2 and the microglia inhibitor minocycline were injected intraperitoneally (IP. Anti-CD11b, CD45 and Iba1 antibodies were used to confirm the cell identity of retinal microglia/macrophage, in the RPE/choroidal flat mounts or retinal cross sections. CD11b(+, CD45(+ or Iba1(+ cells were counted. mRNA of VEGFR1 and its three ligands, PlGF, VEGF-A (VEGF and VEGF-B, were expressed at all stages, but VEGFR2 were detected only in the late stage. PlGF and VEGF proteins were expressed at 3 and 7 days after laser. Anti-VEGFR1 (MF1 delivered IP 3 days after laser inhibited infiltration of leukocyte populations, largely retinal microglia/macrophage to CNV, while anti-VEGFR2 (DC101 had no effect. At 14 days after laser, both MF1 and DC101 antibodies markedly inhibited retinal microglia/macrophage infiltration into CNV. Therefore, VEGFR1 and R2 play differential roles in the pathogenesis of CNV: VEGFR1 plays a dominant role at 3 days after laser; but both receptors play pivotal roles at 14 days after laser. In vivo imaging demonstrated accumulation of GFP-expressing microglia into CNV in both CX3CR1(gfp/gfp and CX3CR1(gfp/+ mice. Minocycline treatment caused a significant increase in lectin(+ cells in the sub-retinal space anterior to CNV and a decrease in dextran-perfused neovessels compared to controls. Targeting the chemoattractant molecules that regulate trafficking of retinal microglia

  13. The MEK inhibitor selumetinib complements CTLA-4 blockade by reprogramming the tumor immune microenvironment.

    Science.gov (United States)

    Poon, Edmund; Mullins, Stefanie; Watkins, Amanda; Williams, Geoffrey S; Koopmann, Jens-Oliver; Di Genova, Gianfranco; Cumberbatch, Marie; Veldman-Jones, Margaret; Grosskurth, Shaun E; Sah, Vasu; Schuller, Alwin; Reimer, Corrine; Dovedi, Simon J; Smith, Paul D; Stewart, Ross; Wilkinson, Robert W

    2017-08-15

    T-cell checkpoint blockade and MEK inhibitor combinations are under clinical investigation. Despite progress elucidating the immuno-modulatory effects of MEK inhibitors as standalone therapies, the impact of MEK inhibition on the activity of T-cell checkpoint inhibitors remains incompletely understood. Here we sought to characterize the combined effects of MEK inhibition and anti-CTLA-4 mAb (anti-CTLA-4) therapy, examining effects on both T-cells and tumor microenvironment (TME). In mice, the effects of MEK inhibition, via selumetinib, and anti-CTLA-4 on immune responses to keyhole limpet haemocyanin (KLH) immunization were monitored using ex vivo functional assays with splenocytes. In a KRAS-mutant CT26 mouse colorectal cancer model, the impact on the tumor microenvironment (TME) and the spleen were evaluated by flow cytometry. The TME was further examined by gene expression and immunohistochemical analyses. The combination and sequencing of selumetinib and anti-CTLA-4 were also evaluated in efficacy studies using the CT26 mouse syngeneic model. Anti-CTLA-4 enhanced the generation of KLH specific immunity following KLH immunization in vivo; selumetinib was found to reduce, but did not prevent, this enhancement of immune response by anti-CTLA-4 in vivo. In the CT26 mouse model, anti-CTLA-4 treatment led to higher expression levels of the immunosuppressive mediators, Cox-2 and Arg1 in the TME. Combination of anti-CTLA-4 with selumetinib negated this up-regulation of Cox-2 and Arg1, reduced the frequency of CD11 + Ly6G + myeloid cells, and led to the accumulation of differentiating monocytes at the Ly6C + MHC + intermediate state in the tumor. We also report that MEK inhibition had limited impact on anti-CTLA-4-mediated increases in T-cell infiltration and T-cell activation in CT26 tumors. Finally, we show that pre-treatment, but not concurrent treatment, with selumetinib enhanced the anti-tumor activity of anti-CTLA-4 in the CT26 model. These data provide evidence

  14. Enhancement of PSMA-Directed CAR Adoptive Immunotherapy by PD-1/PD-L1 Blockade

    Directory of Open Access Journals (Sweden)

    Inna Serganova

    2017-03-01

    Full Text Available Chimeric antigen receptor (CAR T cell therapy in hematologic malignancies has shown remarkable responses, but the same level of success has not been observed in solid tumors. A new prostate cancer model (Myc-CaP:PSMA(+ and a second-generation anti-hPSMA human CAR T cells expressing a Click Beetle Red luciferase reporter were used to study hPSMA targeting and assess CAR T cell trafficking and persistence by bioluminescence imaging (BLI. We investigated the antitumor efficacy of human CAR T cells targeting human prostate-specific membrane antigen (hPSMA, in the presence and absence of the target antigen; first alone and then combined with a monoclonal antibody targeting the human programmed death receptor 1 (anti-hPD1 mAb. PDL-1 expression was detected in Myc-CaP murine prostate tumors growing in immune competent FVB/N and immune-deficient SCID mice. Endogenous CD3+ T cells were restricted from the centers of Myc-CaP tumor nodules growing in FVB/N mice. Following anti-programmed cell death protein 1 (PD-1 treatment, the restriction of CD3+ T cells was reversed, and a tumor-treatment response was observed. Adoptive hPSMA-CAR T cell immunotherapy was enhanced when combined with PD-1 blockade, but the treatment response was of comparatively short duration, suggesting other immune modulation mechanisms exist and restrict CAR T cell targeting, function, and persistence in hPSMA expressing Myc-CaP tumors. Interestingly, an “inverse pattern” of CAR T cell BLI intensity was observed in control and test tumors, which suggests CAR T cells undergo changes leading to a loss of signal and/or number following hPSMA-specific activation. The lower BLI signal intensity in the hPSMA test tumors (compared with controls is due in part to a decrease in T cell mitochondrial function following T cell activation, which may limit the intensity of the ATP-dependent Luciferin-luciferase bioluminescence signal.

  15. Injection Pressure as a Marker of Intraneural Injection in Procedures of Peripheral Nerves Blockade

    Directory of Open Access Journals (Sweden)

    Ilvana Vučković

    2006-11-01

    Full Text Available The blockade of peripheral nerves carries a certain risk of unwanted complications, which can follow after unintentional intraneural injection of a local anesthetic. Up till today, the research of measuring injection pressure has been based on animal models, even though the histological structure of periphery nerve is different for animal and human population, so the application pressure which presages intraneural injection in human population is still unknown. As material in performing this study there have been used 12 Wistar rats and 12 delivered stillborns. After bilateral access to the median nerve, we applied 3 ml of 2% lidocaine with epinephrine, with the help of automatic syringe charger. The needle was at first placed perineural on one side, and then intraneural on the other side of both examination groups. During every application the pressure values were monitored using the manometer, and then they were analyzed by special software program BioBench. All perineural injections resulted with the pressure < or = 27.92 kPa, while the majority of intraneural injections were combined with the injectionpressure > or = 69.8 kPa. The difference between intraneural and perineural injection pressures for the two different examination groups (rats and delivered stillborns was not statistically significant (P>0.05. As prevention from intraneural injections today are in use two methods: the method of causing paresthesia or the method of using the peripheral nerve stimulator. However the nerve injury can still occur, independent from the technique used. If our results are used in clinical practice on human population, than the high injection pressure could be the markerof intraneural lodging of a needle.

  16. Lumbar paravertebral blockade as intractable pain management method in palliative care

    Directory of Open Access Journals (Sweden)

    Zaporowska-Stachowiak I

    2013-09-01

    Full Text Available Iwona Zaporowska-Stachowiak,1,2 Aleksandra Kotlinska-Lemieszek,3 Grzegorz Kowalski,3 Katarzyna Kosicka,4 Karolina Hoffmann,5 Franciszek Główka,4 Jacek Łuczak2 1Department of Pharmacology, 2Palliative Medicine In-patient Unit, University Hospital of Lord’s Transfiguration, 3Department of Palliative Care, 4Department of Physical Pharmacy and Pharmacokinetics, 5Department of Internal Medicine, Metabolic Disorders and Arterial Hypertension, Poznan University of Medical Sciences, Poznan, Poland Abstract: Optimal symptoms control in advanced cancer disease, with refractory to conventional pain treatment, needs an interventional procedure. This paper presents coadministration of local anesthetic (LA via paravertebral blockade (PVB as the alternative to an unsuccessful subcutaneous fentanyl pain control in a 71-year old cancer patient with pathological fracture of femoral neck, bone metastases, and contraindications to morphine. Bupivacaine in continuous infusion (0.25%, 5 mL · hour-1 or in boluses (10 mL of 0.125%–0.5% solution, used for lumbar PVB, resulted in pain relief, decreased demand for opioids, and led to better social interactions. The factors contributing to an increased risk of systemic toxicity from LA in the patient were: renal impairment; heart failure; hypoalbuminemia; hypocalcemia; and a complex therapy with possible drug–drug interactions. These factors were taken into consideration during treatment. Bupivacaine’s side effects were absent. Coadministered drugs could mask LA’s toxicity. Elevated plasma α1-acid glycoprotein levels were a protective factor. To evaluate the benefit-risk ratio of the PVB treatment in boluses and in constant infusion, bupivacaine serum levels were determined and the drug plasma half-lives were calculated. Bupivacaine’s elimination was slower when administered in constant infusion than in boluses (t½ = 7.80 hours versus 2.64 hours. Total drug serum concentrations remained within the safe

  17. Postoperative analgesia for hemorrhoidectomy with bilateral pudendal blockade on an ambulatory patient: a controlled clinical study

    Directory of Open Access Journals (Sweden)

    Luiz Eduardo Imbelloni

    2012-09-01

    Full Text Available BACKGROUND AND OBJECTIVES: Reducing postoperative pain in hemorrhoidectomy is still a challenge. This prospective, randomized, double-blind study was conducted to compare bilateral pudendal blockade with peripheral nerve stimulator to relieve postoperative pain with the method commonly used. METHOD: 200 patients scheduled for hemorrhoidectomy were randomly divided into Control Group and Pudendal Group. Bilateral pudendal block was performed with levobupivacaine enantiomeric excess (S75:R25 after location with a peripheral nerve stimulator. The parameters evaluated were pain intensity, duration of analgesia, rescue analgesia, complications, patient satisfaction and pain at first defecation. Data were recorded at 6, 12, 18 and 24 hours after the surgery. RESULTS: Bilateral pudendal nerves with mean 23.4±4.4 hours provided better relief of postoperative pain (pJUSTIFICATIVA E OBJETIVOS: A dor pós-operatória em hemorroidectomia ainda é um problema desafiador. Este estudo prospectivo, aleatório, duplamente encoberto, foi realizado para comparar o bloqueio bilateral do pudendo com estimulador de nervos periféricos para alívio da dor pós-operatória ao método habitualmente utilizado. MÉTODO: 200 pacientes escalados para hemorroidectomia foram aleatoriamente separados em Grupo Controle e Grupo Pudendo. O bloqueio bilateral do Grupo Pudendo foi realizado com levobupivacaína em excesso enantiomérico (S75:R25 após localização com estimulador de nervo periférico. Os parâmetros avaliados foram: intensidade da dor, duração da analgesia, resgate de analgésico, complicações, satisfação dos pacientes e dor à primeira defecação. Os dados foram anotados as 6, 12, 18 e 24 horas após a cirurgia. RESULTADO: O bloqueio bilateral dos pudendos, com média de 23,4±4,4 horas proporcionou um melhor alívio da dor pós-operatória (p<0,001, reduzindo a necessidade de analgésicos e com analgesia residual maior de 24 horas em 41% dos pacientes

  18. IL-2-Mediated In Vivo Expansion of Regulatory T Cells Combined with CD154–CD40 Co-Stimulation Blockade but Not CTLA-4 Ig Prolongs Allograft Survival in Naive and Sensitized Mice

    Directory of Open Access Journals (Sweden)

    Dela Golshayan

    2017-04-01

    Full Text Available In recent years, regulatory T cells (Treg-based immunotherapy has emerged as a promising strategy to promote operational tolerance after solid organ transplantation (SOT. However, a main hurdle for the therapeutic use of Treg in transplantation is their low frequency, particularly in non-lymphopenic hosts. We aimed to expand Treg directly in vivo and determine their efficacy in promoting donor-specific tolerance, using a stringent experimental model. Administration of the IL-2/JES6-1 immune complex at the time of transplantation resulted in significant expansion of donor-specific Treg, which suppressed alloreactive T cells. IL-2-mediated Treg expansion in combination with short-term CD154–CD40 co-stimulation blockade, but not CTLA-4 Ig or rapamycin, led to tolerance to MHC-mismatched skin grafts in non-lymphopenic mice, mainly by hindering alloreactive CD8+ effector T cells and the production of alloantibodies. Importantly, this treatment also allowed prolonged survival of allografts in the presence of either donor-specific or cross-reactive memory cells. However, late rejection occurred in sensitized hosts, partly mediated by activated B cells. Overall, these data illustrate the potential but also some important limitations of Treg-based therapy in clinical SOT as well as the importance of concomitant immunomodulatory strategies in particular in sensitized hosts.

  19. Acute non-selective beta-adrenergic blockade reduces prolonged frequency-adjusted Q-T interval (QTc) in patients with cirrhosis

    DEFF Research Database (Denmark)

    Henriksen, Jens Henrik; Bendtsen, Flemming; Hansen, Erik Feldager

    2004-01-01

    received 80 mg propranolol orally during a haemodynamic investigation with measurements at baseline and 90 min after propranolol ingestion. RESULTS: Beta-blockade reduced cardiac output (-21%, P17%, P...BACKGROUND/AIMS: Earlier studies have shown a prolonged frequency-adjusted Q-T interval (QTc>0.440 s(1/2)) in a substantial fraction of patients with cirrhosis. The effect of beta-blockade on QTc is unknown, and its determination was the aim of the study. METHODS: Seventeen patients with cirrhosis......=0.460 s(1/2) was prolonged compared to 0.410 s(1/2) in age-matched controls (Pbeta-blockade in the cirrhotic patients (from 0.460 to 0.440 s(1/2), P

  20. Acute non-selective beta-adrenergic blockade reduces prolonged frequency-adjusted Q-T interval (QTc) in patients with cirrhosis

    DEFF Research Database (Denmark)

    Henriksen, Jens H; Bendtsen, Flemming; Hansen, Erik Feldager

    2004-01-01

    BACKGROUND/AIMS: Earlier studies have shown a prolonged frequency-adjusted Q-T interval (QTc>0.440 s(1/2)) in a substantial fraction of patients with cirrhosis. The effect of beta-blockade on QTc is unknown, and its determination was the aim of the study. METHODS: Seventeen patients with cirrhosis...... received 80 mg propranolol orally during a haemodynamic investigation with measurements at baseline and 90 min after propranolol ingestion. RESULTS: Beta-blockade reduced cardiac output (-21%, P...=0.460 s(1/2) was prolonged compared to 0.410 s(1/2) in age-matched controls (Pbeta-blockade in the cirrhotic patients (from 0.460 to 0.440 s(1/2), P2), ns), and a reduction was seen...

  1. Evaluation of spinal anesthesia blockade time with 0.5% hyperbaric bupivacaine, with or without sufentanil, in chronic opioid users: a randomized clinical trial.

    Science.gov (United States)

    Sadeghi, Mostafa; Yekta, Reza Atef; Azimaraghi, Omid; Barzin, Gilda; Movafegh, Ali

    2016-01-01

    The primary outcome of this study was to evaluate the effect of adding sufentanil to hyperbaric bupivacaine on duration of sensory blockade of spinal anesthesia in chronic opioid users in comparison with non-addicts. Sixty patients scheduled for orthopedic surgery under spinal anesthesia were allocated into four groups: group 1 (no history of opium use who received intrathecal hyperbaric bupivacaine along with 1mL saline as placebo); group 2 (no history of opium use who received intrathecal bupivacaine along with 1mL sufentanil [5μg]); group 3 (positive history of opium use who received intrathecal bupivacaine along with 1mL saline as placebo) and group 4 (positive history of opium use who received intrathecal bupivacaine along with 1mL sufentanil [5μg]). The onset time and duration of sensory and motor blockade were measured. The duration of sensory blockade in group 3 was 120±23.1min which was significantly less than other groups (G1=148±28.7, G2=144±26.4, G4=139±24.7, p=0.007). The duration of motor blockade in group 3 was 145±30.0min which was significantly less than other groups (G1=164±36.0, G2=174±26.8, G4=174±24.9, p=0.03). Addition of 5μg intrathecal sufentanil to hyperbaric bupivacaine in chronic opioid users lengthened the sensory and motor duration of blockade to be equivalent to blockade measured in non-addicts. Copyright © 2015 Sociedade Brasileira de Anestesiologia. Published by Elsevier Editora Ltda. All rights reserved.

  2. Chronic activation of 5-HT4 receptors or blockade of 5-HT6 receptors improve memory performances.

    Science.gov (United States)

    Quiedeville, Anne; Boulouard, Michel; Hamidouche, Katia; Da Silva Costa-Aze, Virginie; Nee, Gerald; Rochais, Christophe; Dallemagne, Patrick; Fabis, Frédéric; Freret, Thomas; Bouet, Valentine

    2015-10-15

    5-HT4 and 5-HT6 serotonergic receptors are located in brain structures involved in memory processes. Neurochemical and behavioural studies have demonstrated that acute activation of 5-HT4 receptors (5-HT4R) or blockade of 5-HT6 receptors (5-HT6R) improves memory. To evaluate the potential of these two receptors as targets in the treatment of memory disorders encountered in several situations (ageing, Alzheimer's disease, schizophrenia, etc.), it is necessary to assess whether their beneficial effects occur after chronic administration, and if such treatment induces adverse effects. The goal of this study was to assess the effects of chronic 5-HT4R or 5-HT6R modulation on recognition memory, and to observe the possible manifestation of side effects (modification of weight gain, locomotor activity or exploratory behaviour, etc.). Mice were treated for 14 days with a 5-HT4R partial agonist (RS-67333) or a 5-HT6R antagonist (SB-271046) at increasing doses. Memory performances, locomotor activity, and exploration were assessed. Both chronic 5-HT4R activation and 5-HT6R blockade extended memory traces in an object recognition test, and were not associated with any adverse effects in the parameters assessed. Chronic modulation of one or both of these receptors thus seems promising as a potential strategy for the treatment memory deficits. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Leptin receptor blockade reduces intrahepatic vascular resistance and portal pressure in an experimental model of rat liver cirrhosis.

    Science.gov (United States)

    Delgado, María Gabriela; Gracia-Sancho, Jordi; Marrone, Giusi; Rodríguez-Vilarrupla, Aina; Deulofeu, Ramon; Abraldes, Juan G; Bosch, Jaume; García-Pagán, Juan Carlos

    2013-10-01

    Increased hepatic vascular resistance mainly due to elevated vascular tone and to fibrosis is the primary factor in the development of portal hypertension in cirrhosis. Leptin, a hormone associated with reduction in nitric oxide bioavailability, vascular dysfunction, and liver fibrosis, is increased in patients with cirrhosis. We aimed at evaluating whether leptin influences the increased hepatic resistance in portal hypertension. CCl4-cirrhotic rats received the leptin receptor-blocker ObR antibody, or its vehicle, every other day for 1 wk. Hepatic and systemic hemodynamics were measured in both groups. Hepatic nitric oxide production and bioavailability, together with oxidative stress, nitrotyrosinated proteins, and liver fibrosis, were evaluated. In cirrhotic rats, leptin-receptor blockade significantly reduced portal pressure without modifying portal blood flow, suggesting a reduction in the intrahepatic resistance. Portal pressure reduction was associated with increased nitric oxide bioavailability and with decreased O2(-) levels and nitrotyrosinated proteins. No changes in systemic hemodynamics and liver fibrosis were observed. In conclusion, the present study shows that blockade of the leptin signaling pathway in cirrhosis significantly reduces portal pressure. This effect is probably due to a nitric oxide-mediated reduction in the hepatic vascular tone.

  4. Effect of alpha 1-adrenoceptor blockade on maximal VO2 and endurance capacity in well-trained athletic hypertensive men.

    Science.gov (United States)

    Tomten, S E; Kjeldsen, S E; Nilsson, S; Westheim, A S

    1994-07-01

    The effect of alpha 1-adrenoceptor blockade (doxazosin, 4 mg daily) on maximal VO2 and physical endurance capacity in 16 mildly hypertensive, athletic men was investigated in a randomized, placebo-controlled, double-blind, two-period of 4 weeks, cross-over study. The maximal workload obtained during graded bicycle ergometer exercise and the corresponding maximal VO2 were reduced by 16 +/- 3 W (mean +/- SE), (P = .00003) and 3 +/- 1 mL/(kg.min) (P = .0004), respectively, on doxazosin compared with placebo. The running time on a 5000 m track increased by 43 +/- 12 sec on doxazosin (P = .04). Heart rate was unchanged during the running session. Systolic blood pressure was reduced by 9 +/- 4.1 mm Hg (P = .04) immediately after finishing 5000 m. Six subjects reported side effects from doxazosin (headache, fatigue, and leg pain). Thus, antihypertensive treatment with alpha 1-selective adrenoceptor blockade moderately, but significantly, reduces maximal O2 consumption and high intensity physical endurance capacity in mildly hypertensive athletic men. Significantly reduced systolic blood pressure and unchanged heart rate immediately after running, combined with unchanged heart rate during the race may, however, suggest a safer exercise performance.

  5. Selective blockade of TRPA1 channel attenuates pathological pain without altering noxious cold sensation or body temperature regulation.

    Science.gov (United States)

    Chen, Jun; Joshi, Shailen K; DiDomenico, Stanley; Perner, Richard J; Mikusa, Joe P; Gauvin, Donna M; Segreti, Jason A; Han, Ping; Zhang, Xu-Feng; Niforatos, Wende; Bianchi, Bruce R; Baker, Scott J; Zhong, Chengmin; Simler, Gricelda H; McDonald, Heath A; Schmidt, Robert G; McGaraughty, Steve P; Chu, Katharine L; Faltynek, Connie R; Kort, Michael E; Reilly, Regina M; Kym, Philip R

    2011-05-01

    Despite the increasing interest in TRPA1 channel as a pain target, its role in cold sensation and body temperature regulation is not clear; the efficacy and particularly side effects resulting from channel blockade remain poorly understood. Here we use a potent, selective, and bioavailable antagonist to address these issues. A-967079 potently blocks human (IC(50): 51 nmol/L, electrophysiology, 67 nmol/L, Ca(2+) assay) and rat TRPA1 (IC(50): 101 nmol/L, electrophysiology, 289 nmol/L, Ca(2+) assay). It is >1000-fold selective over other TRP channels, and is >150-fold selective over 75 other ion channels, enzymes, and G-protein-coupled receptors. Oral dosing of A-967079 produces robust drug exposure in rodents, and exhibits analgesic efficacy in allyl isothiocyanate-induced nocifensive response and osteoarthritic pain in rats (ED(50): 23.2 mg/kg, p.o.). A-967079 attenuates cold allodynia produced by nerve injury but does not alter noxious cold sensation in naive animals, suggesting distinct roles of TRPA1 in physiological and pathological states. Unlike TRPV1 antagonists, A-967079 does not alter body temperature. It also does not produce locomotor or cardiovascular side effects. Collectively, these data provide novel insights into TRPA1 function and suggest that the selective TRPA1 blockade may present a viable strategy for alleviating pain without untoward side effects. Copyright © 2011 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  6. Renal Kallikrein Activation and Renoprotection after Dual Blockade of Renin-Angiotensin System in Diet-Induced Diabetic Nephropathy

    Science.gov (United States)

    Zou, Xia; Zhang, Xiao-xi; Liu, Xin-yu; Li, Rong; Wang, Min; Wu, Wei-jie; Sui, Yi; Zhao, Hai-lu

    2015-01-01

    Purpose. The objective of this study is to investigate the effect of dual blockage of renin-angiotensin system (RAS) on renal kallikrein expression and inflammatory response in diabetic nephropathy (DN). Methods. Rats were randomly divided into 5 groups with 10 rats in each group: normal control; DN model induced by high fat and high sucrose diets; and DN treated with either benazepril 10 mg/kg/d, irbesartan 30 mg/kg/d, or both. After 8-week treatment, we examined changes in the kidney histopathology, function and immunohistochemical stain of kallikrein, macrophage marker CD68, and profibrotic markers transforming growth factor- (TGF-) β and α-smooth muscle action (SMA). Results. DN rats showed enlarged kidneys with glomerulosclerosis, interstitial chronic inflammation and fibrosis, and proteinuria. All the pathological damage and functional impairments were improved after the RAS blockades (all P < 0.05). Compared with monotherapy, combined treatment further alleviated the kidney impairments in parallel to increased tubular immunoreactivity for kallikrein and decreased immunopositive cells for CD68, TGF-β, and α-SMA. Conclusion. The renoprotective effects of the dual RAS blockade in diabetic nephropathy may be attributed to improved tubular kallikrein expression and interstitial inflammatory response. PMID:25918729

  7. Mitochondrial hydroxylation of the cyclohexane ring as a result of beta-oxidation blockade of a cyclohexyl substituted fatty acid.

    Science.gov (United States)

    Tulliez, J E; Durand, E F; Peleran, J C

    1981-12-01

    Among the urinary metabolites of dodecylcyclohexane or cyclohexylacetic acid, the glycine conjugate of 1-hydroxy-cyclohexylacetic acid was identified and its origin studied, using cyclohexylacetic acid as the starting molecule, as it results from beta-oxidation of cyclohexyldodecanoic acid produced by terminal oxidation of the alkyl chain of the cycloparaffin. Three hypotheses were tested: (a) hydroxylation by the liver microsomal mixed-function oxidases involved in detoxication mechanisms; (b) hydroxylation by a cyt. P450-containing mitochondrial hydroxylase; and (c) beta-oxidation blockade after the reaction catalyzed by enoyl-CoA-hydratase. Liver microsomal or mitochondrial fractions were prepared and incubated in the presence of [14C] cyclohexylacetic acid, glucose-6-phosphate dehydrogenase and a NADPH-producing system. On the other hand, mitochondria were incubated in a suitable respiratory medium with or without cofactors required for ATP production. The reaction products were extracted and analyzed by thin layer radiochromatography and radio gas chromatography. Evidence is given that hydroxylation of cyclohexylacetic acid in position 1 is a mitochondrial step requiring activation in the acyl-CoA form and results from beta-oxidation blockade, the cyclohexane ring hindering hydroxyacyl-CoA-dehydrogenase action.

  8. Synergistic effect of CTLA-4 blockade and cancer chemotherapy in the induction of anti-tumor immunity.

    Directory of Open Access Journals (Sweden)

    W Joost Lesterhuis

    Full Text Available Several chemotherapeutics exert immunomodulatory effects. One of these is the nucleoside analogue gemcitabine, which is widely used in patients with lung cancer, ovarian cancer, breast cancer, mesothelioma and several other types of cancer, but with limited efficacy. We hypothesized that the immunopotentiating effects of this drug are partly restrained by the inhibitory T cell molecule CTLA-4 and thus could be augmented by combining it with a blocking antibody against CTLA-4, which on its own has recently shown beneficial clinical effects in the treatment of patients with metastatic melanoma. Here we show, using two non-immunogenic murine tumor models, that treatment with gemcitabine chemotherapy in combination with CTLA-4 blockade results in the induction of a potent anti-tumor immune response. Depletion experiments demonstrated that both CD4(+ and CD8(+ T cells are required for optimal therapeutic effect. Mice treated with the combination exhibited tumor regression and long-term protective immunity. In addition, we show that the efficacy of the combination is moderated by the timing of administration of the two agents. Our results show that immune checkpoint blockade and cytotoxic chemotherapy can have a synergistic effect in the treatment of cancer. These results provide a basis to pursue combination therapies with anti-CTLA-4 and immunopotentiating chemotherapy and have important implications for future studies in cancer patients. Since both drugs are approved for use in patients our data can be immediately translated into clinical trials.

  9. Genetic disassociation of autoimmunity and resistance to costimulation blockade-induced transplantation tolerance in nonobese diabetic mice.

    Science.gov (United States)

    Pearson, Todd; Markees, Thomas G; Serreze, David V; Pierce, Melissa A; Marron, Michele P; Wicker, Linda S; Peterson, Laurence B; Shultz, Leonard D; Mordes, John P; Rossini, Aldo A; Greiner, Dale L

    2003-07-01

    Curing type 1 diabetes by islet transplantation requires overcoming both allorejection and recurrent autoimmunity. This has been achieved with systemic immunosuppression, but tolerance induction would be preferable. Most islet allotransplant tolerance induction protocols have been tested in nonobese diabetic (NOD) mice, and most have failed. Failure has been attributed to the underlying autoimmunity, assuming that autoimmunity and resistance to transplantation tolerance have a common basis. Out of concern that NOD biology could be misleading in this regard, we tested the hypothesis that autoimmunity and resistance to transplantation tolerance in NOD mice are distinct phenotypes. Unexpectedly, we observed that (NOD x C57BL/6)F(1) mice, which have no diabetes, nonetheless resist prolongation of skin allografts by costimulation blockade. Further analyses revealed that the F(1) mice shared the dendritic cell maturation defects and abnormal CD4(+) T cell responses of the NOD but had lost its defects in macrophage maturation and NK cell activity. We conclude that resistance to allograft tolerance induction in the NOD mouse is not a direct consequence of overt autoimmunity and that autoimmunity and resistance to costimulation blockade-induced transplantation tolerance phenotypes in NOD mice can be dissociated genetically. The outcomes of tolerance induction protocols tested in NOD mice may not accurately predict outcomes in human subjects.

  10. Activation of Apoptotic Signal in Endothelial Cells through Intracellular Signaling Molecules Blockade in Tumor-Induced Angiogenesis

    Directory of Open Access Journals (Sweden)

    Hossein Bazmara

    2015-01-01

    Full Text Available Tumor-induced angiogenesis is the bridge between avascular and vascular tumor growth phases. In tumor-induced angiogenesis, endothelial cells start to migrate and proliferate toward the tumor and build new capillaries toward the tumor. There are two stages for sprout extension during angiogenesis. The first stage is prior to anastomosis, when single sprouts extend. The second stage is after anastomosis when closed flow pathways or loops are formed and blood flows in the closed loops. Prior to anastomosis, biochemical and biomechanical signals from extracellular matrix regulate endothelial cell phenotype; however, after anastomosis, blood flow is the main regulator of endothelial cell phenotype. In this study, the critical signaling pathways of each stage are introduced. A Boolean network model is used to map environmental and flow induced signals to endothelial cell phenotype (proliferation, migration, apoptosis, and lumen formation. Using the Boolean network model, blockade of intracellular signaling molecules of endothelial cell is investigated prior to and after anastomosis and the cell fate is obtained in each case. Activation of apoptotic signal in endothelial cell can prevent the extension of new vessels and may inhibit angiogenesis. It is shown that blockade of a few signaling molecules in endothelial cell activates apoptotic signal that are proposed as antiangiogenic strategies.

  11. THE EFFECTS OF ACUTE AND CHRONIC STRESS ON ERYTHROCYTE DYNAMIC IN COMBINATION WITH ß–ADRENERGIC RECEPTORS BLOCKADE IN RATS

    Directory of Open Access Journals (Sweden)

    Lucian Hritcu

    2005-08-01

    Full Text Available : 3 consecutive days propranolol hydrochloride administration (5 mg/kg b.w., subcutaneous injections under acute and chronic stress conditions causes changes of peripheral erythrocyte distribution in rats. The effects of acute stress and its combination with ȕ-adrenergic receptor blockade on erythrocyte dynamic were more pregnant beside the effects of chronic stress and its combination with ȕ-adrenergic receptor blockade, respectively. ȕ-adrenergic mechanisms were shown to be involved in regulation of erythrocyte dynamic in acute and chronic stress response.

  12. Influence of beta blockade on gastric acid secretion and changes in gastric mucosal blood flow before and after parietal cell vagotomy in dogs and man

    DEFF Research Database (Denmark)

    Hovendal, C P; Bech, K; Bekker, C

    1983-01-01

    The aim of the present study was, in paired experiments in dogs, to examine the effect of beta-receptor blockade on gastric acid secretion and mucosal blood flow before and after parietal cell vagotomy (PCV). The secretory response to pentagastrin was reduced after vagotomy. beta-Adrenergic block......The aim of the present study was, in paired experiments in dogs, to examine the effect of beta-receptor blockade on gastric acid secretion and mucosal blood flow before and after parietal cell vagotomy (PCV). The secretory response to pentagastrin was reduced after vagotomy. beta...

  13. Reversal of profound, high-dose rocuronium-induced neuromuscular blockade by sugammadex at two different time points - An international, multicenter, randomized, dose-finding, safety assessor-blinded, phase II trial

    DEFF Research Database (Denmark)

    Puhringer, F.K.; Rex, C.; Sielenkamper, A.W.

    2008-01-01

    Background: Sugammadex (Org 25969), a novel, selective relaxant binding agent, was specifically designed to rapidly reverse rocuronium-induced neuromuscular blockade. The efficacy and safety of sugammadex for the reversal of profound, high-dose rocuronium-induced neuromuscular blockade was evalua...

  14. Sugammadex ED90 dose to reverse the rocuronium neuromuscular blockade in obese patients.

    Science.gov (United States)

    Silva, Mauro Prado DA; Matsui, Christiano; Kim, Daniel Dongiou; Vieira, Joaquim Edson; Malheiros, Carlos Alberto; Mathias, Ligia Andrade Silva Telles

    2017-01-01

    to determine the ED90 (minimum effective dose in 90% of patients) of sugammadex for the reversal of rocuronium-induced moderate neuromuscular blockade (NMB) in patients with grade III obesity undergoing bariatric surgery. we conducted a prospective study with the biased coin up-and-down sequential design. We chosen the following doses: 2.0mg/Kg, 2.2mg/Kg, 2.4mg/Kg, 2.6mg/Kg, 2.8mg/Kg. The complete reversal of rocuronium-induced NMB considered a T4/T1 ratio ≥0.9 as measured by TOF. After induction of general anesthesia and calibration of the peripheral nerve stimulator and accelerometer, we injected rocuronium 0.6mg/kg. We administered propofol and remifentanil by continuous infusion, and intermittent boluses of rocuronium throughout the procedure. we evaluated 31 patients, of whom 26 had displayed successful reversal of the NMB with sugammadex, and failure in five. The mean time to complete moderate NMB reversal was 213 seconds (172-300, median 25-75%). The ED90 of sugammadex calculated by regression was 2.39mg/kg, with a 95% confidence interval of 2.27-2.46 mg/kg. the ED90 of sugammadex in patients with grade III obesity or higher was 2.39mg/kg. determinar a ED90 (dose mínima eficaz em 90% dos pacientes) de sugamadex para a reversão de bloqueio neuromuscular (BNM) moderado induzido pelo rocurônio em pacientes com obesidade grau III submetidos à cirurgia bariátrica. estudo prospectivo com o método de projeção sequencial para cima e para baixo da moeda enviesada. As seguintes doses foram escolhidas: 2,0mg/kg-1, 2,2mg/kg-1, 2,4mg/kg-1, 2,6mg/kg-1, 2,8mg/kg-1. A reversão completa de BNM induzido por rocurônio considerou uma relação T4/T1 ≥0,9 na medida do TOF. Após a indução da anestesia geral e calibração do estimulador de nervo periférico e acelerômetro, rocurônio 0,6mg/kg-1 foi injetado. Infusão contínua de propofol e remifentanil, e bolus intermitente de rocurônio foram injetados durante todo o procedimento. trinta e um pacientes foram

  15. Promoting preschool reading

    OpenAIRE

    Istenič, Vesna

    2013-01-01

    The thesis titled Promoting preschool reading consists of a theoretiral and an empirical part. In the theoretical part I wrote about reading, the importance of reading, types of reading, about reading motivation, promoting reading motivation, internal and external motivation, influence of reading motivation on the child's reading activity, reading and familial literacy, the role of adults in promotion reading literacy, reading to a child and promoting reading in pre-school years, where I ...

  16. Developing a Promotional Video

    Science.gov (United States)

    Epley, Hannah K.

    2014-01-01

    There is a need for Extension professionals to show clientele the benefits of their program. This article shares how promotional videos are one way of reaching audiences online. An example is given on how a promotional video has been used and developed using iMovie software. Tips are offered for how professionals can create a promotional video and…

  17. Role of adenosine and the orexinergic perifornical hypothalamus in sleep-promoting effects of ethanol.

    Science.gov (United States)

    Sharma, Rishi; Sahota, Pradeep; Thakkar, Mahesh M

    2014-03-01

    Strong clinical and preclinical evidence suggests that acute ethanol promotes sleep. However, very little is known about how and where ethanol acts to promote sleep. We hypothesized that ethanol may induce sleep by increasing extracellular levels of adenosine and inhibiting orexin neurons in the perifornical hypothalamus. Experiments 1 and 2: Within-Subject Design; Experiment 3: Between-Subject Design. N/A. N/A. N/A. Using adult male Sprague-Dawley rats as our animal model, we performed three experiments to test our hypothesis. Our first experiment examined the effect of A1 receptor blockade in the orexinergic perifornical hypothalamus on sleep- promoting effects of ethanol. Bilateral microinjection of the selective A1 receptor antagonist 1,3-dipropyl-8-phenylxanthine (500 μM; 250 nL/side) into orexinergic perifornical hypothalamus significantly reduced nonrapid eye movement sleep with a concomitant increase in wakefulness, suggesting that blockade of adenosine A1 receptor attenuates ethanol-induced sleep promotion. Our second experiment examined adenosine release in the orexinergic perifornical hypothalamus during local ethanol infusion. Local infusion of pharmacologically relevant doses of ethanol significantly and dose-dependently increased adenosine release. Our final experiment used c-Fos immunohistochemistry to examine the effects of ethanol on the activation of orexin neurons. Acute ethanol exposure significantly reduced the number of orexin neurons containing c-Fos, suggesting an inhibition of orexin neurons after ethanol intake. Based on our results, we believe that ethanol promotes sleep by increasing adenosine in the orexinergic perifornical hypothalamus, resulting in A1 receptor-mediated inhibition of orexin neurons.

  18. Effects of sodium restriction and hydrochlorothiazide on RAAS blockade efficacy in diabetic nephropathy: a randomised clinical trial.

    Science.gov (United States)

    Kwakernaak, Arjan J; Krikken, Jan A; Binnenmars, S Heleen; Visser, Folkert W; Hemmelder, Marc H; Woittiez, Arend-Jan; Groen, Henk; Laverman, Gozewijn D; Navis, Gerjan

    2014-05-01

    Reduction of dietary sodium intake or diuretic treatment increases renin-angiotensin-aldosterone system (RAAS) blockade efficacy in non-diabetic nephropathy. We aimed to investigate the effect of sodium restriction and the diuretic hydrochlorothiazide, separately and in combination, added to RAAS blockade on residual albuminuria in patients with type 2 diabetic nephropathy. In this multicentre, double-blind, placebo-controlled, crossover randomised trial, we included patients with type 2 diabetic nephropathy. Main entry criteria were microalbuminaria or macroalbuminuria, and creatinine clearance of 30 mL/min or higher with less than 6 mL/min decline in the previous year. We tested the separate and combined effects of sodium restriction (dietary counselling in the outpatient setting) and hydrochlorothiazide (50 mg daily), added to standardised maximal angiotensin-converting enzyme (ACE) inhibition (lisinopril 40 mg daily), on albuminuria (primary endpoint). Patients were given hydrochlorothiazide (50 mg per day) or placebo during four treatment periods of 6 weeks. Both treatments were combined with regular sodium diet or sodium restriction (target sodium intake 50 mmol Na(+) per day). The 6-week treatment periods were done consecutively in a random order. Patients were randomised in blocks of two patients. The trial was analysed by intention to treat. The trial is registered with TrialRegister.nl, number 2366. Of 89 eligible patients, 45 were included in the study. Both sodium restriction and hydrochlorothiazide significantly reduced albuminuria, irrespective of treatment sequence. Residual geometric mean albuminuria with baseline treatment was 711 mg per day (95% CI 485-1043); it was significantly reduced by sodium restriction (393 mg per day [258-599], p=0·0002), by hydrochlorothiazide (434 mg per day [306-618], p=0·0003), and to the greatest extent by their combination (306 mg per day [203-461], ppatients (4%) during baseline treatment, five (11%) during

  19. Efficacy, safety and pharmacokinetics of sugammadex 4 mg kg-1 for reversal of deep neuromuscular blockade in patients with severe renal impairment

    NARCIS (Netherlands)

    Panhuizen, I. F.; Gold, S. J. A.; Buerkle, C.; Snoeck, M. M. J.; Harper, N. J. N.; Kaspers, M. J. G. H.; van den Heuvel, M. W.; Hollmann, M. W.

    2015-01-01

    This study evaluated efficacy and safety of sugammadex 4 mg kg(-1) for deep neuromuscular blockade (NMB) reversal in patients with severe renal impairment (creatinine clearance [CLCR] <30 ml min(-1)) vs those with normal renal function (CLCR ≥80 ml min(-1)). Sugammadex 4 mg kg(-1) was administered

  20. Effects of Dietary Sodium Restriction in Kidney Transplant Recipients Treated With Renin-Angiotensin-Aldosterone System Blockade: A Randomized Clinical Trial

    NARCIS (Netherlands)

    de Vries, Laura V.; Dobrowolski, Linn C.; van den Bosch, Jacqueline J. O. N.; Riphagen, Ineke J.; Krediet, C. T. Paul; Bemelman, Frederike J.; Bakker, Stephan J. L.; Navis, Gerjan

    2016-01-01

    In patients with chronic kidney disease receiving renin-angiotensin-aldosterone system (RAAS) blockade, dietary sodium restriction is an often-used treatment strategy to reduce blood pressure (BP) and albuminuria. Whether these effects extend to kidney transplant recipients is unknown. We therefore

  1. Effects of Dietary Sodium Restriction in Kidney Transplant Recipients Treated With Renin-Angiotensin-Aldosterone System Blockade : A Randomized Clinical Trial

    NARCIS (Netherlands)

    de Vries, Laura V; Dobrowolski, Linn C; van den Bosch, Jacqueline J O N; Riphagen, Ineke J; Krediet, C T Paul; Bemelman, Frederike J; Bakker, Stephan J L; Navis, Gerjan

    BACKGROUND: In patients with chronic kidney disease receiving renin-angiotensin-aldosterone system (RAAS) blockade, dietary sodium restriction is an often-used treatment strategy to reduce blood pressure (BP) and albuminuria. Whether these effects extend to kidney transplant recipients is unknown.

  2. Blockade of CD40-CD154 at the time of donor-specific blood transfusion does not lead to prolonged kidney allograft survival in nonhuman primates

    NARCIS (Netherlands)

    Ringers, J; Haanstra, KG; Kroczek, RA; Kliem, K; Kuhn, EM; Wubben, J; Ossevoort, MA; Volk, HD; Jonker, M

    2002-01-01

    Background. In rodents it has been demonstrated that blockade of the CD40-CD154 (CD40L) pathway at the time of donor-specific blood transfusion (DST) can result in indefinite graft survival. Because it has been reported in the past that DST in monkeys can have a favorable effect on graft outcome and

  3. Peristalsis and propulsion of colonic content can occur after blockade of major neuroneuronal and neuromuscular transmitters in isolated guinea pig colon.

    Science.gov (United States)

    Sia, T C; Brookes, S J; Dinning, P G; Wattchow, D A; Spencer, N J

    2013-12-01

    We recently identified hexamethonium-resistant peristalsis in the guinea pig colon. We showed that, following acute blockade of nicotinic receptors, peristalsis recovers, leading to normal propagation velocities of fecal pellets along the colon. This raises the fundamental question: what mechanisms underlie hexamethonium-resistant peristalsis? We investigated whether blockade of the major receptors that underlie excitatory neuromuscular transmission is required for hexamethonium-resistant peristalsis. Video imaging of colonic wall movements was used to make spatiotemporal maps and determine the velocity of peristalsis. Propagation of artificial fecal pellets in the guinea pig distal colon was studied in hexamethonium, atropine, ω-conotoxin (GVIA), ibodutant (MEN-15596), and TTX. Hexamethonium and ibodutant alone did not retard peristalsis. In contrast, ω-conotoxin abolished peristalsis in some preparations and reduced the velocity of propagation in all remaining specimens. Peristalsis could still occur in some animals in the presence of hexamethonium + atropine + ibodutant + ω-conotoxin. Peristalsis never occurred in the presence of TTX. The major finding of the current study is the unexpected observation that peristalsis can occur after blockade of the major excitatory neuroneuronal and neuromuscular transmitters. Also, the colon retained an intrinsic polarity in the presence of these antagonists and was only able to expel pellets in an aboral direction. The nature of the mechanism(s)/neurotransmitter(s) that generate(s) peristalsis and facilitate(s) natural fecal pellet propulsion, after blockade of major excitatory neurotransmitters, at the neuroneuronal and neuromuscular junction remains to be identified.

  4. Immune Checkpoint Blockade in Cancer Treatment: A Double-Edged Sword Cross-Targeting the Host as an “Innocent Bystander”

    Directory of Open Access Journals (Sweden)

    Lucia Gelao

    2014-03-01

    Full Text Available Targeted immune checkpoint blockade augments anti-tumor immunity and induces durable responses in patients with melanoma and other solid tumors. It also induces specific “immune-related adverse events” (irAEs. IrAEs mainly include gastrointestinal, dermatological, hepatic and endocrinological toxicities. Off-target effects that arise appear to account for much of the toxicity of the immune checkpoint blockade. These unique “innocent bystander” effects are likely a direct result of breaking immune tolerance upon immune check point blockade and require specific treatment guidelines that include symptomatic therapies or systemic corticosteroids. What do we need going forward to limit immune checkpoint blockade-induced toxicity? Most importantly, we need a better understanding of the roles played by these agents in normal tissues, so that we can begin to predict potentially problematic side effects on the basis of their selectivity profile. Second, we need to focus on the predictive factors of the response and toxicity of the host rather than serially focusing on individual agents. Third, rigorous biomarker-driven clinical trials are needed to further elucidate the mechanisms of both the benefit and toxicity. We will summarize the double-edged sword effect of immunotherapeutics in cancer treatment.

  5. Optimizing working space in laparoscopy: CT-measurement of the effect of neuromuscular blockade and its reversal in a porcine model

    NARCIS (Netherlands)

    J. Vlot (John); P. Specht (Patricia); R.M.H. Wijnen (René); J.M. van Rosmalen (Joost); E.G. Mik (Egbert); K.M.A. Bax (Klass M.)

    2015-01-01

    textabstractObjective: The objective of this paper was to determine the effect of neuromuscular blockade (NMB) on working space in a porcine laparoscopy model. Background: Conflicting results on the effect of NMB on laparoscopic working space are found in literature. Almost all studies are limited

  6. Metabolic and vascular effects of tumor necrosis factor-alpha blockade with etanercept in obese patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Dominguez, Helena; Storgaard, Heidi; Rask-Madsen, Christian

    2005-01-01

    OBJECTIVE: The pro-inflammatory cytokine tumor necrosis factor-alpha (TNF-alpha) impairs insulin action in insulin-sensitive tissues, such as fat, muscle and endothelium, and causes endothelial dysfunction. We hypothesized that TNF-alpha blockade with etanercept could reverse vascular and metabolic...... insulin resistance. METHOD AND RESULTS: Twenty obese patients with type 2 diabetes were randomized to etanercept treatment (25 mg subcutaneously twice weekly for 4 weeks) or used as controls in an open parallel study. Forearm blood flow and glucose uptake were measured during intra-arterial infusions...... of serotonin, sodium nitroprusside and insulin co-infused with serotonin. Beta-cell function was assessed with oral and intra-venous glucose tolerance tests and whole-body insulin sensitivity by hyperinsulinemic euglycemic clamps. Plasma levels of C-reactive protein and interleukin-6 decreased significantly...

  7. Reversal of collateral arterial spasm by calcium channel blockade with diltiazem after endothelial injury in the rabbit

    International Nuclear Information System (INIS)

    Janicek, M.; Sandor, T.; Hollenberg, N.K.

    1987-01-01

    Growing collateral vessels are supersensitive to serotonin and thromboxane liberated from platelets activated in vivo by endothelial injury. The effect of diltiazem on normal and collateral arteries, induced by ligation of the femoral artery 2 weeks earlier, was studied after acute endothelial injury to the lower abdominal aorta. Angiographic changes were assessed on a coded basis and through a digitized computer method. Injury led to pronounced vasoconstriction in both normal and collateral dependent limb. Diltiazem (3-100 μg/kg) dilated collateral vessels, with less effect on normal vessels, compared with the combined action of a 5HT2 antagonist, and a thromboxane synthetase inhibitor. In ischemic syndrome, the calcium channel blockade may oppose multiple pathways to vasospasm

  8. Effect of beta-adrenergic blockade on elevated arterial compliance and low systemic vascular resistance in cirrhosis

    DEFF Research Database (Denmark)

    Møller, S; Bendtsen, F; Henriksen, Jens Henrik Sahl

    2001-01-01

    ) of 17.8 mmHg, and responded to beta-blocker treatment with a significant reduction in the HVPG (-16%; P beta-adrenergic blockade (1.27 versus 1.29 ml/mmHg, +2%, ns), whereas...... with beta-blockers, but the effect of this treatment on arterial compliance has not been investigated. The aim of the present study was therefore to assess the effects of propranolol on the arterial compliance of patients with cirrhosis. METHODS: Twenty patients with cirrhosis underwent a haemodynamic...... with beta-blockers increases small vessel (arteriolar) vascular tone towards the normal level, but does not affect the elevated compliance of the larger arteries in patients with cirrhosis....

  9. Integrating Immune Checkpoint Blockade with Anti-Neo/Mutated Antigens Reactivity to Increase the Clinical Outcome of Immunotherapy

    Directory of Open Access Journals (Sweden)

    Giorgio Parmiani

    2015-05-01

    Full Text Available Antibodies to immune checkpoints have entered the clinical arena and have been shown to provide a clinical benefit for metastatic melanoma and, possibly, for other tumors as well. In this review paper we summarize this therapeutic activity and underline the functional mechanisms that may be involved. Among them, we discuss the so far neglected role of tumor-associated antigens (TAAs deriving from tumor somatic mutations and summarize the results of recent trials showing the immunogenic strength of such TAAs which can be specifically targeted by T cells activated by immune checkpoint antibodies. Finally we discuss new immunotherapy approaches that involve the combination of self/shared- or neo-TAAs-based vaccines and immune checkpoint blockade antibodies, to increase the clinical response of metastatic melanoma patients.

  10. Effect of serotonin receptor blockade on endocrine and cardiovascular responses to head-up tilt in humans

    DEFF Research Database (Denmark)

    Matzen, S; Secher, N H; Knigge, U

    1993-01-01

    abolished the adrenomedullary response to hypotension without affecting cardiovascular tolerance or the activity of the pituitary-adrenal axis. The results suggest that serotonergic mechanisms may be involved in the integrated cardiovascular and endocrine responses to central blood volume depletion......Effects of blockade of serotonin (5-HT) receptors on the integrated cardiovascular and endocrine adaptations during head-up tilt were investigated in normal men. In control experiments 50 degrees head-up tilt increased heart rate (HR), total peripheral resistance (TPR), plasma renin activity (PRA...... hormones, cortisol, adrenomedullary (plasma adrenaline; A) as well as vagal activity (plasma pancreatic polypeptide) were markedly increased, whereas sympathetic activity (plasma NA) decreased. The 5-HT1+2 receptor antagonist methysergide did not significantly interfere with cardiovascular variables...

  11. Fabricating a silicon nanowire by using the proximity effect in electron beam lithography for investigation of the Coulomb blockade effect

    International Nuclear Information System (INIS)

    Zhang Xiangao; Fang Zhonghui; Chen Kunji; Xu Jun; Huang Xinfan

    2011-01-01

    We present an approach to fabricate a silicon nanowire relying on the proximity effect in electron beam lithography with a low acceleration voltage system by designing the exposure patterns with a rhombus sandwiched between two symmetric wedges. The reproducibility is investigated by changing the number of rhombuses. A device with a silicon nanowire is constructed on a highly doped silicon-on-insulator wafer to measure the electronic transport characteristics. Significant nonlinear behavior of current-voltage curves is observed at up to 150 K. The dependence of current on the drain voltage and back-gate voltage shows Coulomb blockade oscillations at 5.4 K, revealing a Coulomb island naturally formed in the nanowire. The mechanism of formation of the Coulomb island is discussed.

  12. Quantum phase transition and Coulomb blockade effect in triangular quantum dots with interdot capacitive and tunnel couplings

    International Nuclear Information System (INIS)

    Xiong Yong-Chen; Yang Jun-Tao; Huang Hai-Ming; Wang Wei-Zhong

    2015-01-01

    The quantum phase transition and the electronic transport in a triangular quantum dot system are investigated using the numerical renormalization group method. We concentrate on the interplay between the interdot capacitive coupling V and the interdot tunnel coupling t. For small t, three dots form a local spin doublet. As t increases, due to the competition between V and t, there exist two first-order transitions with phase sequence spin-doublet-magnetic frustration phase-orbital spin singlet. When t is absent, the evolutions of the total charge on the dots and the linear conductance are of the typical Coulomb-blockade features with increasing gate voltage. While for sufficient t, the antiferromagnetic spin correlation between dots is enhanced, and the conductance is strongly suppressed for the bonding state is almost doubly occupied. (paper)

  13. Combination of Id2 Knockdown Whole Tumor Cells and Checkpoint Blockade: A Potent Vaccine Strategy in a Mouse Neuroblastoma Model.

    Directory of Open Access Journals (Sweden)

    Lina Chakrabarti

    Full Text Available Tumor vaccines have held much promise, but to date have demonstrated little clinical success. This lack of success is conceivably due to poor tumor antigen presentation combined with immuno-suppressive mechanisms exploited by the tumor itself. Knock down of Inhibitor of differentiation protein 2 (Id2-kd in mouse neuroblastoma whole tumor cells rendered these cells immunogenic. Id2-kd neuroblastoma (Neuro2a cells (Id2-kd N2a failed to grow in most immune competent mice and these mice subsequently developed immunity against further wild-type Neuro2a tumor cell challenge. Id2-kd N2a cells grew aggressively in immune-compromised hosts, thereby establishing the immunogenicity of these cells. Therapeutic vaccination with Id2-kd N2a cells alone suppressed tumor growth even in established neuroblastoma tumors and when used in combination with immune checkpoint blockade eradicated large established tumors. Mechanistically, immune cell depletion studies demonstrated that while CD8+ T cells are critical for antitumor immunity, CD4+ T cells are also required to induce a sustained long-lasting helper effect. An increase in number of CD8+ T-cells and enhanced production of interferon gamma (IFNγ was observed in tumor antigen stimulated splenocytes of vaccinated mice. More importantly, a massive influx of cytotoxic CD8+ T-cells infiltrated the shrinking tumor following combined immunotherapy. These findings show that down regulation of Id2 induced tumor cell immunity and in combination with checkpoint blockade produced a novel, potent, T-cell mediated tumor vaccine strategy.

  14. Adenosine A2A receptor blockade Prevents Rotenone-Induced Motor Impairment in a Rat Model of Parkinsonism

    Directory of Open Access Journals (Sweden)

    Ahmed M Fathalla

    2016-02-01

    Full Text Available Pharmacological studies implicate the blockade of adenosine receptorsas an effective strategy for reducing Parkinson's disease (PD symptoms. The objective of this study is to elucidate the possible protective effects of ZM241385 and 8-cyclopentyl-1,3-dipropylxanthine, two selective A2Aand A1 receptor antagonists, on a rotenone rat model of PD. Rats were split into four groups: vehicle control (1 ml/kg/48 h, rotenone(1.5 mg/kg/48 h, s.c., ZM241385 (3.3 mg/kg/day, i.p and 8-cyclopentyl-1,3-dipropylxanthine (5 mg/kg/day, i.p. After that, animals were subjected to behavioral (stride length and grid walking and biochemical (measuring concentration of dopamine levels using high performance liquid chromatography. In the rotenone group, rats displayed a reduced motor activity and disturbed movement coordination in the behavioral tests and a decreased dopamine concentration as foundby high performance liquid chromatography. The effect of rotenone was partially preventedin the ZM241385 group, but not with 8-cyclopentyl-1,3-dipropylxanthine administration. The administration of ZM241385 has led toan improvement improved of motor function and movement coordination (a partial increase of stride length and partial decrease in the number of foot slips and an increase in dopamine concentration in the rotenone-injected rats. However, the 8-cyclopentyl-1,3-dipropylxanthine and rotenone groups were not significantly different. These results indicate that selective A2Areceptor blockade by ZM241385, but not A1receptor blockadeby 8-cyclopentyl-1,3-dipropylxanthine, may treat PD motor symptoms. This reinforces the potential use of A2A receptor antagonists as a treatment strategy for PD patients.. This may provide a more selective treatment strategy for PD patients.

  15. Sciatic and femoral nerve blockade using bupivacaine alone, or in combination with dexmedetomidine or buprenorphine in cats.

    Science.gov (United States)

    Evangelista, M C; Doodnaught, G M; Fantoni, D T; Steagall, P V M

    2017-06-17

    The aim of this study was to determine the onset and offset of antinociception after sciatic (ScN) and femoral (FN) nerve blocks. Six healthy adult cats (4.8±1.3years; 4.3±0.4 kg) were included in a randomised, crossover, blinded and controlled study. Following sedation with dexmedetomidine (25 µg/kg, intramuscular), each ScN and FN injection was performed using 0.1 ml/kg of saline (CONTROL), bupivacaine (0.46 per cent, 0.46 mg/kg; BUPI), bupivacaine and dexmedetomidine (1 µg/kg; BUPI-DEX) or bupivacaine and buprenorphine (2.5 µg/kg; BUPI-BUPRE). Atipamezole (250 µg/kg) was administered after injections. Paw withdrawal thresholds (PWT) and motor blockade were evaluated before sedation and up to 24 hours. The PWT were significantly increased at half an hour in CONTROL, from two to four hours in BUPI and BUPI-DEX when compared with baseline. Motor blockade was observed between one and three hours in treatments using bupivacaine. Ability to walk was significantly impaired in BUPI at half an hour to two hours, BUPI-DEX at one to two hours and BUPI-BUPRE at two hours. Antinociception was observed in BUPI between one and eight hours, and in BUPI-DEX and BUPI-BUPRE between one and four hours. This study could not demonstrate a benefit of administering bupivacaine with dexmedetomidine or buprenorphine in cats. Results in BUPI-DEX may have been biased by the administration of atipamezole. British Veterinary Association.

  16. Angiotensin receptor blockade improves cardiac mitochondrial activity in response to an acute glucose load in obese insulin resistant rats

    Directory of Open Access Journals (Sweden)

    Max Thorwald

    2018-04-01

    Full Text Available Hyperglycemia increases the risk of oxidant overproduction in the heart through activation of a multitude of pathways. Oxidation of mitochondrial enzymes may impair their function resulting in accumulation of intermediates and reverse electron transfer, contributing to mitochondrial dysfunction. Furthermore, the renin-angiotensin system (RAS becomes inappropriately activated during metabolic syndrome, increasing oxidant production. To combat excess oxidant production, the transcription factor, nuclear factor erythriod-2- related factor 2 (Nrf2, induces expression of many antioxidant genes. We hypothesized that angiotensin II receptor type 1 (AT1 blockade improves mitochondrial function in response to an acute glucose load via upregulation of Nrf2. To address this hypothesis, an oral glucose challenge was performed in three groups prior to dissection (n = 5–8 animals/group/time point of adult male rats: 1 Long Evans Tokushima Otsuka (LETO; lean strain-control, 2 insulin resistant, obese Otsuka Long Evans Tokushima Fatty (OLETF, and 3 OLETF + angiotensin receptor blocker (ARB; 10 mg olmesartan/kg/d × 6 weeks. Hearts were collected at T0, T60, and T120 minutes post-glucose infusion. ARB increased Nrf2 binding 32% compared to OLETF at T60. Total superoxide dismutase (SOD and catalase (CAT activities were increased 45% and 66% respectively in ARB treated animals compared to OLETF. Mitochondrial enzyme activities of aconitase, complex I, and complex II increased by 135%, 33% and 66%, respectively in ARB compared to OLETF. These data demonstrate the protective effects of AT1 blockade on mitochondrial function during the manifestation of insulin resistance suggesting that the inappropriate activation of AT1 during insulin resistance may impair Nrf2 translocation and subsequent antioxidant activities and mitochondrial function. Keywords: Angiotensin II, Mitochondria, Cardiac, Antioxidant enzymes, TCA cycle

  17. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  18. Sec61 blockade by mycolactone inhibits antigen cross-presentation independently of endosome-to-cytosol export.

    Science.gov (United States)

    Grotzke, Jeff E; Kozik, Patrycja; Morel, Jean-David; Impens, Francis; Pietrosemoli, Natalia; Cresswell, Peter; Amigorena, Sebastian; Demangel, Caroline

    2017-07-18

    Although antigen cross-presentation in dendritic cells (DCs) is critical to the initiation of most cytotoxic immune responses, the intracellular mechanisms and traffic pathways involved are still unclear. One of the most critical steps in this process, the export of internalized antigen to the cytosol, has been suggested to be mediated by Sec61. Sec61 is the channel that translocates signal peptide-bearing nascent polypeptides into the endoplasmic reticulum (ER), and it was also proposed to mediate protein retrotranslocation during ER-associated degradation (a process called ERAD). Here, we used a newly identified Sec61 blocker, mycolactone, to analyze Sec61's contribution to antigen cross-presentation, ERAD, and transport of internalized antigens into the cytosol. As shown previously in other cell types, mycolactone prevented protein import into the ER of DCs. Mycolactone-mediated Sec61 blockade also potently suppressed both antigen cross-presentation and direct presentation of synthetic peptides to CD8 + T cells. In contrast, it did not affect protein export from the ER lumen or from endosomes into the cytosol, suggesting that the inhibition of cross-presentation was not related to either of these trafficking pathways. Proteomic profiling of mycolactone-exposed DCs showed that expression of mediators of antigen presentation, including MHC class I and β2 microglobulin, were highly susceptible to mycolactone treatment, indicating that Sec61 blockade affects antigen cross-presentation indirectly. Together, our data suggest that the defective translocation and subsequent degradation of Sec61 substrates is the cause of altered antigen cross-presentation in Sec61-blocked DCs.

  19. Nilotinib Enhances Tumor Angiogenesis and Counteracts VEGFR2 Blockade in an Orthotopic Breast Cancer Xenograft Model with Desmoplastic Response

    Directory of Open Access Journals (Sweden)

    Sara Zafarnia

    2017-11-01

    Full Text Available Vascular endothelial growth factor (VEGF/VEGF receptor (VEGFR-targeted therapies predominantly affect nascent, immature tumor vessels. Since platelet-derived growth factor receptor (PDGFR blockade inhibits vessel maturation and thus increases the amount of immature tumor vessels, we evaluated whether the combined PDGFR inhibition by nilotinib and VEGFR2 blockade by DC101 has synergistic therapy effects in a desmoplastic breast cancer xenograft model. In this context, besides immunohistological evaluation, molecular ultrasound imaging with BR55, the clinically used VEGFR2-targeted microbubbles, was applied to monitor VEGFR2-positive vessels noninvasively and to assess the therapy effects on tumor angiogenesis. DC101 treatment alone inhibited tumor angiogenesis, resulting in lower tumor growth and in significantly lower vessel density than in the control group after 14 days of therapy. In contrast, nilotinib inhibited vessel maturation but enhanced VEGFR2 expression, leading to markedly increased tumor volumes and a significantly higher vessel density. The combination of both drugs led to an almost similar tumor growth as in the DC101 treatment group, but VEGFR2 expression and microvessel density were higher and comparable to the controls. Further analyses revealed significantly higher levels of tumor cell–derived VEGF in nilotinib-treated tumors. In line with this, nilotinib, especially in low doses, induced an upregulation of VEGF and IL-6 mRNA in the tumor cells in vitro, thus providing an explanation for the enhanced angiogenesis observed in nilotinib-treated tumors in vivo. These findings suggest that nilotinib inhibits vessel maturation but counteracts the effects of antiangiogenic co-therapy by enhancing VEGF expression by the tumor cells and stimulating tumor angiogenesis.

  20. Renin-angiotensin system blockade reduces cardiovascular events in nonheart failure, stable patients with prior coronary intervention.

    Science.gov (United States)

    Choi, Young; Lim, Sungmin; Lee, Kwan Yong; Park, Ha-Wook; Byeon, Jaeho; Hwang, Byung-Hee; Kim, Jin Jin; Oh, Yong-Seog; Youn, Ho-Joong; Jung, Wook Sung; Seung, Ki-Bae; Chang, Kiyuk

    2018-02-27

    The effects of renin-angiotensin system (RAS) blockade on the clinical outcome in patients with stable coronary artery disease (SCAD) are conflicting. We evaluated the long-term effects of RAS blockers (angiotensin-converting enzyme inhibitor or angiotensin receptor blocker) on the clinical outcomes in patients with SCAD without heart failure (HF) who underwent percutaneous coronary intervention (PCI) with drug-eluting stent using a large-scale, multicenter, prospective cohort registry. A total of 5722 patients with SCAD were enrolled and divided into two groups according to the use of RAS blockers after PCI: RAS blocker group included 4070 patients and no RAS blocker group included 1652 patients. Exclusion criteria were left ventricular ejection fraction less than 50% and the history of HF or myocardial infarction. A major adverse cardiovascular event (MACE) was defined as a composite of cardiovascular death, nonfatal myocardial infarction, and stroke. During a median follow-up of 29.7 months, RAS blockers were associated with a significant reduction in the risk of MACE [adjusted hazard ratio (HR): 0.781; 95% confidence interval (CI): 0.626-0.975; P=0.015] and all-cause death (adjusted HR: 0.788; 95% CI: 0.627-0.990; P=0.041) but did not affect the risk of coronary revascularization. In the propensity score matched cohort, overall findings were consistent (MACE: adjusted HR: 0.679; 95% CI: 0.514-0.897; P=0.006; all-cause death: adjusted HR: 0.723; 95% CI: 0.548-0.954; P=0.022), and the benefit of RAS blockade was maintained in all predefined subgroups. This study demonstrated that RAS blockers were effective preventive therapies for reducing long-term cardiovascular events in patients with SCAD without HF who underwent PCI.