
Sample records for ccrboh gene encoding

  1. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon). (United States)

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K


    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  2. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne


    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  3. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.


    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  4. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  5. Isolation and characterization of the rat gene encoding glutamate dehydrogenase

    NARCIS (Netherlands)

    Das, A. T.; Arnberg, A. C.; Malingré, H.; Moerer, P.; Charles, R.; Moorman, A. F.; Lamers, W. H.


    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  6. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat


    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  7. A deep auto-encoder model for gene expression prediction. (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua


    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  8. Gene cluster encoding cholate catabolism in Rhodococcus spp. (United States)

    Mohn, William W; Wilbrink, Maarten H; Casabon, Israël; Stewart, Gordon R; Liu, Jie; van der Geize, Robert; Eltis, Lindsay D


    Bile acids are highly abundant steroids with important functions in vertebrate digestion. Their catabolism by bacteria is an important component of the carbon cycle, contributes to gut ecology, and has potential commercial applications. We found that Rhodococcus jostii RHA1 grows well on cholate, as well as on its conjugates, taurocholate and glycocholate. The transcriptome of RHA1 growing on cholate revealed 39 genes upregulated on cholate, occurring in a single gene cluster. Reverse transcriptase quantitative PCR confirmed that selected genes in the cluster were upregulated 10-fold on cholate versus on cholesterol. One of these genes, kshA3, encoding a putative 3-ketosteroid-9α-hydroxylase, was deleted and found essential for growth on cholate. Two coenzyme A (CoA) synthetases encoded in the cluster, CasG and CasI, were heterologously expressed. CasG was shown to transform cholate to cholyl-CoA, thus initiating side chain degradation. CasI was shown to form CoA derivatives of steroids with isopropanoyl side chains, likely occurring as degradation intermediates. Orthologous gene clusters were identified in all available Rhodococcus genomes, as well as that of Thermomonospora curvata. Moreover, Rhodococcus equi 103S, Rhodococcus ruber Chol-4 and Rhodococcus erythropolis SQ1 each grew on cholate. In contrast, several mycolic acid bacteria lacking the gene cluster were unable to grow on cholate. Our results demonstrate that the above-mentioned gene cluster encodes cholate catabolism and is distinct from a more widely occurring gene cluster encoding cholesterol catabolism.

  9. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)


    Oct 26, 2016 ... The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the.

  10. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  11. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    Cloning, expression and characterisation of a novel gene encoding a chemosensory protein from Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) ... The BtabCSP amino acid residues deduced from the respective full-length cDNA shares four conserved cysteine motifs with known CSPs from other insects. Homology ...

  12. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)


    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  13. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)


    Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum. XIUHONG YANG, CHAO SUN, YUANLEI HU and ZHONGPING LIN. *. College of Life Sciences, National Key Laboratory of Protein Engineering and Plant Genetic Engineering, Peking.

  14. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway (United States)

    Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus


    Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

  15. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C


    this antigen is a good candidate for development as a vaccine to prevent or control P. carinii infection. We have cloned and sequenced seven related but unique genes encoding the major surface glycoprotein of rat P. carinii. Partial amino acid sequencing confirmed the identity of these genes. Based on Southern...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  16. Identification and use of genes encoding amatoxin and phallotoxin

    Energy Technology Data Exchange (ETDEWEB)

    Hallen, Heather E.; Walton, Jonathan D.; Luo, Hong; Scott-Craig, John S.


    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptide toxins and toxin production in mushrooms. In particular, the present invention relates to using genes and proteins from Amanita species encoding Amanita peptides, specifically relating to amatoxins and phallotoxins. In a preferred embodiment, the present invention also relates to methods for detecting Amanita peptide toxin genes for identifying Amanita peptide-producing mushrooms and for diagnosing suspected cases of mushroom poisoning. Further, the present inventions relate to providing kits for diagnosing and monitoring suspected cases of mushroom poisoning in patients.

  17. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari


    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  18. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica


    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  19. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C


    The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development...... of novel approaches to the control of this pathogen....

  20. Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis. (United States)

    Lee, M M; Schiefelbein, J


    The duplication and divergence of developmental control genes is thought to have driven morphological diversification during the evolution of multicellular organisms. To examine the molecular basis of this process, we analyzed the functional relationship between two paralogous MYB transcription factor genes, WEREWOLF (WER) and GLABROUS1 (GL1), in Arabidopsis. The WER and GL1 genes specify distinct cell types and exhibit non-overlapping expression patterns during Arabidopsis development. Nevertheless, reciprocal complementation experiments with a series of gene fusions showed that WER and GL1 encode functionally equivalent proteins, and their unique roles in plant development are entirely due to differences in their cis-regulatory sequences. Similar experiments with a distantly related MYB gene (MYB2) showed that its product cannot functionally substitute for WER or GL1. Furthermore, an analysis of the WER and GL1 proteins shows that conserved sequences correspond to specific functional domains. These results provide new insights into the evolution of the MYB gene family in Arabidopsis, and, more generally, they demonstrate that novel developmental gene function may arise solely by the modification of cis-regulatory sequences.

  1. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C


    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  2. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU


    Full Text Available Cellobiohydrolases (EC are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC and β-glucosidases (EC Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  3. Organization of the gene encoding human lysosomal beta-galactosidase. (United States)

    Morreau, H; Bonten, E; Zhou, X Y; D'Azzo, A


    Human beta-galactosidase precursor mRNA is alternatively spliced into an abundant 2.5-kb transcript and a minor 2.0-kb species. These templates direct the synthesis of the classic lysosomal beta-D-galactosidase enzyme and of a beta-galactosidase-related protein with no enzymatic activity. Mutations in the beta-galactosidase gene result in the lysosomal storage disorders GM1-gangliosidosis and Morquio B syndrome. To analyze the genetic lesions underlying these syndromes we have isolated the human beta-galactosidase gene and determined its organization. The gene spans greater than 62.5 kb and contains 16 exons. Promoter activity is located on a 236-bp Pst I fragment which works in a direction-independent manner. A second Pst I fragment of 851 bp located upstream from the first negatively regulates initiation of transcription. The promoter has characteristics of a housekeeping gene with GC-rich stretches and five potential SP1 transcription elements on two strands. We identified multiple cap sites of the mRNA, the major of which maps 53 bp upstream from the translation initiation codon. The portion of the human pre-mRNA undergoing alternative splicing is encoded by exons II-VII. Sequence analysis of equivalent mouse exons showed an identical genomic organization. However, translation of the corresponding differentially spliced murine transcript is interrupted in its reading frame. Thus, the mouse gene cannot encode a beta-galactosidase-related protein in a manner similar to the human counterpart. Differential expression of the murine beta-galactosidase transcript is observed in different mouse tissues.

  4. Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia ...

    Indian Academy of Sciences (India)


    Identification of NBS-encodings and gene family classification of kiwi fruit. Kiwi fruit (A. chinensis) assembly and annotation ... There were three criteria to classify gene family. Both the coverage (aligned sequence/gene lengths) and iden- ... Number of identified NBS-encoding genes in kiwi fruit. Predicted protein domain.

  5. Co-transcriptional folding is encoded within RNA genes

    Directory of Open Access Journals (Sweden)

    Miklós István


    Full Text Available Abstract Background Most of the existing RNA structure prediction programs fold a completely synthesized RNA molecule. However, within the cell, RNA molecules emerge sequentially during the directed process of transcription. Dedicated experiments with individual RNA molecules have shown that RNA folds while it is being transcribed and that its correct folding can also depend on the proper speed of transcription. Methods The main aim of this work is to study if and how co-transcriptional folding is encoded within the primary and secondary structure of RNA genes. In order to achieve this, we study the known primary and secondary structures of a comprehensive data set of 361 RNA genes as well as a set of 48 RNA sequences that are known to differ from the originally transcribed sequence units. We detect co-transcriptional folding by defining two measures of directedness which quantify the extend of asymmetry between alternative helices that lie 5' and those that lie 3' of the known helices with which they compete. Results We show with statistical significance that co-transcriptional folding strongly influences RNA sequences in two ways: (1 alternative helices that would compete with the formation of the functional structure during co-transcriptional folding are suppressed and (2 the formation of transient structures which may serve as guidelines for the co-transcriptional folding pathway is encouraged. Conclusions These findings have a number of implications for RNA secondary structure prediction methods and the detection of RNA genes.

  6. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica (United States)

    Jarvis, Eric E.; Roessler, Paul G.


    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  7. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)


    TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...

  8. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang


    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  9. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana. (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi


    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  10. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  11. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V


    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...

  12. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  13. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.


    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  14. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)



    Jun 7, 2010 ... synthase (crtB), phytoene desaturase (crtL) and lycopene cyclase. (crtY). It also retains a chloramphenicol resistance gene. Cells of E. coli containing this plasmid produce and accumulate β-carotene, resulting in yellow colonies. The plasmid, pTrc-ATIPI, retains an ampicillin resistance gene and an IPI gene ...

  15. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)


    Oct 30, 2012 ... Peanut Ubiquitin gene (Luo et al. 2005) was used as the internal control. Expression data of the target gene was normalized with internal control using the 2. –ΔΔCT method (Livak and Schmittgen 2001). Lysophosphatidyl acyltransferase gene from Arachis hypogaea. 1031. J. Biosci. 37(6), December 2012 ...

  16. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.


    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  17. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk. (United States)

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B


    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (pgoat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  18. In silicio search for genes encoding peroxisomal proteins in Saccharomyces cerevisiae. (United States)

    Kal, A J; Hettema, E H; van den Berg, M; Koerkamp, M G; van Ijlst, L; Distel, B; Tabak, H F


    The biogenesis of peroxisomes involves the synthesis of new proteins that after, completion of translation, are targeted to the organelle by virtue of peroxisomal targeting signals (PTS). Two types of PTSs have been well characterized for import of matrix proteins (PTS1 and PTS2). Induction of the genes encoding these matrix proteins takes place in oleate-containing medium and is mediated via an oleate response element (ORE) present in the region preceding these genes. The authors have searched the yeast genome for OREs preceding open reading frames (ORFs), and for ORFs that contain either a PTS1 or PTS2. Of the ORFs containing an ORE, as well as either a PTS1 or a PTS2, many were known to encode bona fide peroxisomal matrix proteins. In addition, candidate genes were identified as encoding putative new peroxisomal proteins. For one case, subcellular location studies validated the in silicio prediction. This gene encodes a new peroxisomal thioesterase.

  19. Effect of salt stress on genes encoding translation-associated proteins in Arabidopsis thaliana. (United States)

    Omidbakhshfard, Mohammad Amin; Omranian, Nooshin; Ahmadi, Farajollah Shahriari; Nikoloski, Zoran; Mueller-Roeber, Bernd


    Salinity negatively affects plant growth and disturbs chloroplast integrity. Here, we aimed at identifying salt-responsive translation-related genes in Arabidopsis thaliana with an emphasis on those encoding plastid-located proteins. We used quantitative real-time PCR to test the expression of 170 genes after short-term salt stress (up to 24 h) and identified several genes affected by the stress including: PRPL11, encoding plastid ribosomal protein L11, ATAB2, encoding a chloroplast-located RNA-binding protein presumably functioning as an activator of translation, and PDF1B, encoding a peptide deformylase involved in N-formyl group removal from nascent proteins synthesized in chloroplasts. These genes were previously shown to have important functions in chloroplast biology and may therefore represent new targets for biotechnological optimization of salinity tolerance.

  20. Distinct Patterns of Gene Gain and Loss: Diverse Evolutionary Modes of NBS-Encoding Genes in Three Solanaceae Crop Species. (United States)

    Qian, Lan-Hua; Zhou, Guang-Can; Sun, Xiao-Qin; Lei, Zhao; Zhang, Yan-Mei; Xue, Jia-Yu; Hang, Yue-Yu


    Plant resistance conferred by nucleotide binding site (NBS)-encoding resistance genes plays a key role in the defense against various pathogens throughout the entire plant life cycle. However, comparative analyses for the systematic evaluation and determination of the evolutionary modes of NBS-encoding genes among Solanaceae species are rare. In this study, 447, 255, and 306 NBS-encoding genes were identified from the genomes of potato, tomato, and pepper, respectively. These genes usually clustered as tandem arrays on chromosomes; few existed as singletons. Phylogenetic analysis indicated that three subclasses [TNLs (TIR-NBS-LRR), CNLs (CC-NBS-LRR), and RNLs (RPW8-NBS-LRR)] each formed a monophyletic clade and were distinguished by unique exon/intron structures and amino acid motif sequences. By comparing phylogenetic and systematic relationships, we inferred that the NBS-encoding genes in the present genomes of potato, tomato, and pepper were derived from 150 CNL, 22 TNL, and 4 RNL ancestral genes, and underwent independent gene loss and duplication events after speciation. The NBS-encoding genes therefore exhibit diverse and dynamic evolutionary patterns in the three Solanaceae species, giving rise to the discrepant gene numbers observed today. Potato shows a "consistent expansion" pattern, tomato exhibits a pattern of "first expansion and then contraction," and pepper presents a "shrinking" pattern. The earlier expansion of CNLs in the common ancestor led to the dominance of this subclass in gene numbers. However, RNLs remained at low copy numbers due to their specific functions. Along the evolutionary process of NBS-encoding genes in Solanaceae, species-specific tandem duplications contributed the most to gene expansions. Copyright © 2017 Qian et al.

  1. Identification of toxin genes encoding Cyt proteins from standard ...

    African Journals Online (AJOL)

    Polymerase chain reaction-restriction fragment length polymorphism methods for identification of cyt subclasses from Bacillus thuringiensis were established. Eight of 68 standard and ten of 107 Argentine B. thuringiensis strains harbor at least one cyt gene. The combination of cyt1Aa/cyt2Ba genes was identified in four ...

  2. Occurrence of enterotoxin-encoding genes in Staphylococcus aureus causing mastitis in lactating goats

    Directory of Open Access Journals (Sweden)

    Daneelly H. Ferreira


    Full Text Available Staphylococcal enterotoxins are the leading cause of human food poisoning worldwide. Staphylococcus spp. are the main mastitis-causing agents in goats and frequently found in high counts in goat milk. This study aimed to investigate the occurrence of enterotoxin-encoding genes in Staphylococcus aureus associated with mastitis in lactating goats in Paraiba State, Brazil. Milk samples (n=2024 were collected from 393 farms. Staphylococcus aureus was isolated in 55 milk samples. Classical (sea, seb, sec, sed, see and novel (seg, seh, sei enterotoxin-encoding genes were investigated by means of polymerase chain reaction (PCR. From thirty-six tested isolates, enterotoxin-encoding genes were detected in 7 (19.5% S. aureus. The gene encoding enterotoxin C (seC was identified in six isolates, while seiwas observed in only one isolate. The genes sea, seb, sed, see, seg and seh were not observed amongst the S. aureus investigated in this study. In summary, S. aureus causing mastitis in goats can harbor enterotoxin-encoding genes and seC was the most frequent gene observed amongst the investigated isolates. This finding is important for surveillance purposes, since enterotoxin C should be investigated in human staphylococcal food poisoning outbreaks caused by consumption of goat milk and dairy products.

  3. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase. (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo


    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  4. Asthma and genes encoding components of the vitamin D pathway

    Directory of Open Access Journals (Sweden)

    Raby Benjamin A


    Full Text Available Abstract Background Genetic variants at the vitamin D receptor (VDR locus are associated with asthma and atopy. We hypothesized that polymorphisms in other genes of the vitamin D pathway are associated with asthma or atopy. Methods Eleven candidate genes were chosen for this study, five of which code for proteins in the vitamin D metabolism pathway (CYP27A1, CYP27B1, CYP2R1, CYP24A1, GC and six that are known to be transcriptionally regulated by vitamin D (IL10, IL1RL1, CD28, CD86, IL8, SKIIP. For each gene, we selected a maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. A total of 87 SNPs were genotyped in a French-Canadian family sample ascertained through asthmatic probands (388 nuclear families, 1064 individuals and evaluated using the Family Based Association Test (FBAT program. We then sought to replicate the positive findings in four independent samples: two from Western Canada, one from Australia and one from the USA (CAMP. Results A number of SNPs in the IL10, CYP24A1, CYP2R1, IL1RL1 and CD86 genes were modestly associated with asthma and atopy (p IL10 and VDR genes as well as in the IL10 and IL1RL1 genes were associated with asthma (p IL10 and CYP24A1 genes were again modestly associated with asthma and atopy (p IL10 and VDR was replicated in CAMP, but not in the other populations. Conclusion A number of genes involved in the vitamin D pathway demonstrate modest levels of association with asthma and atopy. Multilocus models testing genes in the same pathway are potentially more effective to evaluate the risk of asthma, but the effects are not uniform across populations.

  5. Molecular evolution of genes encoding ribonucleases in ruminant species. (United States)

    Confalone, E; Beintema, J J; Sasso, M P; Carsana, A; Palmieri, M; Vento, M T; Furia, A


    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that demonstrate the existence of the orthologues of the bovine pancreatic, seminal, and cerebral ribonucleases coding sequences in the genomes of giraffe and sheep. The "seminal" sequence is a pseudogene in both species. We also report an analysis of the transcriptional expression of ribonuclease genes in sheep tissues. The data presented support a model for positive selection acting on the molecular evolution of ruminant ribonuclease genes.

  6. Characterization of a gene encoding cellulase from uncultured soil bacteria. (United States)

    Kim, Soo-Jin; Lee, Chang-Muk; Han, Bo-Ram; Kim, Min-Young; Yeo, Yun-Soo; Yoon, Sang-Hong; Koo, Bon-Sung; Jun, Hong-Ki


    To detect cellulases encoded by uncultured microorganisms, we constructed metagenomic libraries from Korean soil DNAs. Screenings of the libraries revealed a clone pCM2 that uses carboxymethyl cellulose (CMC) as a sole carbon source. Further analysis of the insert showed two consecutive ORFs (celM2 and xynM2) encoding proteins of 226 and 662 amino acids, respectively. A multiple sequence analysis with the deduced amino acid sequences of celM2 showed 36% sequence identity with cellulase from the Synechococcus sp., while xynM2 had 59% identity to endo-1,4-beta-xylanase A from Cellulomonas pachnodae. The highest enzymatic CMC hydrolysis was observable at pH 4.0 and 45 degrees C with recombinant CelM2 protein. Although the enzyme CelM2 additionally hydrolyzed avicel and xylan, no substrate hydrolysis was observed on oligosaccharides such as cellobiose, pNP-beta-cellobioside, pNP-beta-glucoside, and pNP-beta-xyloside. These results showed that CelM2 is a novel endo-type cellulase.

  7. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)



    families. The recombinant BtabCSP was successfully expressed in Escherichia coli cells. This is the first report on the existence of chemosensory protein-coding gene in whiteflies. It will help us to elucidate the molecular.

  8. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)


    digested with SmaI and SspI and self-ligated to generate. pSAC86 which eliminated the SacI site present in the. Multiple Cloning Site (MCS). Plasmid pBH86 contains a modified version of the erg-3 gene in which the intronic. HindIII site was destroyed (Prakash et al 1999). pMOD86 contains the erg-3 gene of Neurospora in ...

  9. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    Energy Technology Data Exchange (ETDEWEB)

    Parke, D.; Ornston, L.N.


    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.


    NARCIS (Netherlands)



    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  11. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van


    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  12. Isolation and characterization of the rat glutamine synthetase-encoding gene

    NARCIS (Netherlands)

    van de Zande, L.; Labruyère, W. T.; Arnberg, A. C.; Wilson, R. H.; van den Bogaert, A. J.; Das, A. T.; van Oorschot, D. A.; Frijters, C.; Charles, R.; Moorman, A. F.


    From a rat genomic library in phage lambda Charon4A, a complete glutamine synthetase-encoding gene was isolated. The gene is 9.5-10 kb long, consists of seven exons, and codes for two mRNA species of 1375 nucleotides (nt) and 2787 nt, respectively. For both mRNAs, full-length cDNAs containing a

  13. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne


    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...... analysis established the subunit Mr as 43,500. Primer extension analysis indicated the presence of an adequate Pribnow box and suggested that the transcript contained a 110-base leader sequence. Strains harboring the gsk gene on multicopy plasmids overexpressed both guanosine and inosine kinase activities...

  14. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V


    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... is provided by a competitively coamplified DNA standard constructed by point mutation PCR. A single base difference was introduced to achieve a suitable migration difference in TGGE between the original target DNA and the modified standard without altering the PCR amplification efficiency. This competitive...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  15. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.


    Hays, Shan M; Swanson, Johanna; Selker, Eric U


    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  16. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production. (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu


    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  17. Molecular evolution of genes encoding ribonucleases in ruminant species

    NARCIS (Netherlands)

    Confalone, E; Beintema, JJ; Sasso, MP; Carsana, A; Palmieri, M; Vento, MT; Furia, A


    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that

  18. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)


    Environmental stresses such as drought, cold and salinity have an enormous impact on crop productivity. To survive under unfavourable conditions, plants have developed a variety of sophisticated strategies (Bray 1997; Thomashow. 1999). One of the fundamental properties of adaptive mechanisms is that a gene must be ...

  19. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  20. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)



    Apr 6, 2011 ... This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from. Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for.

  1. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  2. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)


    detoxification enzymes (glutathione S-transferase, soluble epoxide hydrolase, catalase and superoxide dismutase). The second group contains protein factors involved in the regulation of signal transduction and gene expression, which probably function in stress responses such as protein kinases, transcription factors and ...

  3. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    Escherichia coli was isolated and identified by standard cultural and biochemical methods. Pathogenicity of environmental and human isolates was determined by amplification of genes associated with virulence of E. coli, using specific primers. Of a total of 228 water and river sediment samples screened, E. coli was ...

  4. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  5. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  6. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins. (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman


    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  7. The first gene in the Escherichia coli secA operon, gene X, encodes a nonessential secretory protein.


    Rajapandi, T; Dolan, K M; Oliver, D B


    TnphoA insertions in the first gene of the Escherichia coli secA operon, gene X, were isolated and analyzed. Studies of the Gene X-PhoA fusion proteins showed that gene X encodes a secretory protein, since the fusion proteins possessed normal alkaline phosphatase activity and a substantial portion of this activity was found in the periplasm. In addition, the Gene X-PhoA fusion proteins were initially synthesized with a cleavable signal peptide. A gene X::TnphoA insertion was used to construct...

  8. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd


    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  9. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus) (United States)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.


    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  10. A neurotransmitter transporter encoded by the Drosophila inebriated gene (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael


    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  11. Transient receptor potential (TRP gene superfamily encoding cation channels

    Directory of Open Access Journals (Sweden)

    Pan Zan


    Full Text Available Abstract Transient receptor potential (TRP non-selective cation channels constitute a superfamily, which contains 28 different genes. In mammals, this superfamily is divided into six subfamilies based on differences in amino acid sequence homology between the different gene products. Proteins within a subfamily aggregate to form heteromeric or homomeric tetrameric configurations. These different groupings have very variable permeability ratios for calcium versus sodium ions. TRP expression is widely distributed in neuronal tissues, as well as a host of other tissues, including epithelial and endothelial cells. They are activated by environmental stresses that include tissue injury, changes in temperature, pH and osmolarity, as well as volatile chemicals, cytokines and plant compounds. Their activation induces, via intracellular calcium signalling, a host of responses, including stimulation of cell proliferation, migration, regulatory volume behaviour and the release of a host of cytokines. Their activation is greatly potentiated by phospholipase C (PLC activation mediated by coupled GTP-binding proteins and tyrosine receptors. In addition to their importance in maintaining tissue homeostasis, some of these responses may involve various underlying diseases. Given the wealth of literature describing the multiple roles of TRP in physiology in a very wide range of different mammalian tissues, this review limits itself to the literature describing the multiple roles of TRP channels in different ocular tissues. Accordingly, their importance to the corneal, trabecular meshwork, lens, ciliary muscle, retinal, microglial and retinal pigment epithelial physiology and pathology is reviewed.

  12. Genes encoding calmodulin-binding proteins in the Arabidopsis genome (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.


    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  13. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A


    Directory of Open Access Journals (Sweden)

    Marjanca Starčič-Erjavec


    Full Text Available Methods 110 uropathogenic Escherichia coli strains (UPEC obtained from the Institute of Microbiology and Immunology of the Medical Faculty in Ljubljana were screened by PCR withprimers specific for the following toxin encoding genes: hlyA (haemolysin, cnf1 (cytotoxicnecrotising factor 1, usp (uropathogenic specific protein USP and ibeA (invasin. Dotblot hybridisation experiments were performed to validate the PCR assays.Results In 44% of the strains usp gene sequences were detected. The prevalence of hlyA and cnf1was 25% and 23%, respectively. Only 9% of the strains harbored ibeA. The majority of thetested toxin encoding genes was found in strains belonging to the B2 phylogenetic group.Conclusions The toxin encoding genes hlyA, cnf1 and usp were strongly co-associated. Further, we founda statistically significant co-association of ibeA and usp. The prevalence of the testedtoxin encoding genes in E. coli strains from urinary tract infections isolated in Slovenia iscomparable to those from studies in other geographic regions.

  15. Identification of a conserved cluster of skin-specific genes encoding secreted proteins. (United States)

    Moffatt, Pierre; Salois, Patrick; St-Amant, Natalie; Gaumond, Marie-Hélène; Lanctôt, Christian


    Terminal differentiation of keratinocytes results in the formation of a cornified layer composed of cross-linked intracellular and extracellular material. Using a signal trap expression screening strategy, we have identified four cDNAs encoding secreted proteins potentially involved in this process. One of the cDNAs is identical to the short isoform of suprabasin, a recently described epidermis-specific protein, which is shown here to contain a functional secretory signal. The second cDNA, sk89, encodes a protein of 493 amino acids, rich in glycine and serine residues. The third cDNA encodes a C-terminal fragment of SK89 (amino acids 410-493). It comprises exons 13 to 18 of the sk89 locus but transcription starts at an isoform-specific exon encoding a distinct secretory signal. The fourth cDNA encodes keratinocyte differentiation-associated protein (KDAP), a precursor protein of 102 amino acids. Subcellular localization by immunofluorescence and detection of the tagged proteins by Western blotting confirmed that the four proteins are secreted. Northern analysis and in situ hybridization revealed that expression of the corresponding genes was restricted to the suprabasal keratinocytes of the epidermis. These genes encoding epidermis-specific secreted products are found in a conserved cluster on human chromosome 19q13.12 and on mouse chromosome 7A3.

  16. LEA (Late Embryogenesis Abundant proteins and their encoding genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Hincha Dirk K


    Full Text Available Abstract Background LEA (late embryogenesis abundant proteins have first been described about 25 years ago as accumulating late in plant seed development. They were later found in vegetative plant tissues following environmental stress and also in desiccation tolerant bacteria and invertebrates. Although they are widely assumed to play crucial roles in cellular dehydration tolerance, their physiological and biochemical functions are largely unknown. Results We present a genome-wide analysis of LEA proteins and their encoding genes in Arabidopsis thaliana. We identified 51 LEA protein encoding genes in the Arabidopsis genome that could be classified into nine distinct groups. Expression studies were performed on all genes at different developmental stages, in different plant organs and under different stress and hormone treatments using quantitative RT-PCR. We found evidence of expression for all 51 genes. There was only little overlap between genes expressed in vegetative tissues and in seeds and expression levels were generally higher in seeds. Most genes encoding LEA proteins had abscisic acid response (ABRE and/or low temperature response (LTRE elements in their promoters and many genes containing the respective promoter elements were induced by abscisic acid, cold or drought. We also found that 33% of all Arabidopsis LEA protein encoding genes are arranged in tandem repeats and that 43% are part of homeologous pairs. The majority of LEA proteins were predicted to be highly hydrophilic and natively unstructured, but some were predicted to be folded. Conclusion The analyses indicate a wide range of sequence diversity, intracellular localizations, and expression patterns. The high fraction of retained duplicate genes and the inferred functional diversification indicate that they confer an evolutionary advantage for an organism under varying stressful environmental conditions. This comprehensive analysis will be an important starting point for

  17. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson


    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  18. A Gene Selection Method for Microarray Data Based on Binary PSO Encoding Gene-to-Class Sensitivity Information. (United States)

    Han, Fei; Yang, Chun; Wu, Ya-Qi; Zhu, Jian-Sheng; Ling, Qing-Hua; Song, Yu-Qing; Huang, De-Shuang


    Traditional gene selection methods for microarray data mainly considered the features' relevance by evaluating their utility for achieving accurate predication or exploiting data variance and distribution, and the selected genes were usually poorly explicable. To improve the interpretability of the selected genes as well as prediction accuracy, an improved gene selection method based on binary particle swarm optimization (BPSO) and prior information is proposed in this paper. In the proposed method, BPSO encoding gene-to-class sensitivity (GCS) information is used to perform gene selection. The gene-to-class sensitivity information, extracted from the samples by extreme learning machine (ELM), is encoded into the selection process in four aspects: initializing particles, updating the particles, modifying maximum velocity, and adopting mutation operation adaptively. Constrained by the gene-to-class sensitivity information, the new method can select functional gene subsets which are significantly sensitive to the samples' classes. With the few discriminative genes selected by the proposed method, ELM, K-nearest neighbor and support vector machine classifiers achieve much high prediction accuracy on five public microarray data, which in turn verifies the efficiency and effectiveness of the proposed gene selection method.

  19. DNA methylation status of nuclear-encoded mitochondrial genes underlies the tissue-dependent mitochondrial functions

    Directory of Open Access Journals (Sweden)

    Takasugi Masaki


    Full Text Available Abstract Background Mitochondria are semi-autonomous, semi-self-replicating organelles harboring their own DNA (mitochondrial DNA, mtDNA, and their dysregulation is involved in the development of various diseases. While mtDNA does not generally undergo epigenetic modifications, almost all mitochondrial proteins are encoded by nuclear DNA. However, the epigenetic regulation of nuclear-encoded mitochondrial genes (nuclear mt genes has not been comprehensively analyzed. Results We analyzed the DNA methylation status of 899 nuclear mt genes in the liver, brain, and heart tissues of mouse, and identified 636 nuclear mt genes carrying tissue-dependent and differentially methylated regions (T-DMRs. These nuclar mt genes are involved in various mitochondrial functions and they also include genes related to human diseases. T-DMRs regulate the expression of nuclear mt genes. Nuclear mt genes with tissue-specific hypomethylated T-DMRs were characterized by enrichment of the target genes of specific transcription factors such as FOXA2 in the liver, and CEBPA and STAT1 in the brain. Conclusions A substantial proportion of nuclear mt genes contained T-DMRs, and the DNA methylation status of numerous T-DMRs should underlie tissue-dependent mitochondrial functions.

  20. The gene encoding topoisomerase I from the human malaria parasite Plasmodium falciparum. (United States)

    Tosh, K; Kilbey, B


    Part of the topoisomerase I (TopoI)-encoding gene from Plasmodium falciparum (Pf) was isolated by PCR from cDNA using oligodeoxyribonucleotides modelled on the highly conserved regions of sequence from other species. The entire TopoI gene was obtained by screening a Pf K1 HindIII-EcoRI genomic library in lambda NM1149 with a random-labeled heterologous probe from the Saccharomyces cerevisiae TopoI gene. DNA sequence analysis revealed an open reading frame of 2520 nt encoding a deduced protein of 839 amino acids (aa) with no detectable introns. The Pf TopoI aa sequence has about 40% identity with most eukaryotic TopoI homologues. The gene is located as a single copy on chromosome 5 and Northern analysis identified a transcript of 3.8 kb.

  1. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki


    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  2. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn AL; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W


    Background Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing

  3. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    Directory of Open Access Journals (Sweden)

    St Clair Dina A


    Full Text Available Abstract Background Nucleotide binding site-leucine rich repeat (NBS-LRR-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST representation, massively parallel signature sequencing (MPSS, microarray analysis, rapid amplification of cDNA ends (RACE PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH, a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for

  4. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis. (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn A L; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W


    Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. We analyzed the expression patterns of approximately 170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing was

  5. Ty3 GAG3 and POL3 genes encode the components of intracellular particles.


    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B


    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposo...

  6. New Integron-Associated Gene Cassette Encoding a 3-N-Aminoglycoside Acetyltransferase


    Levings, Renee S.; Partridge, Sally R.; Lightfoot, Diane; Hall, Ruth M.; Djordjevic, Steven P.


    A fifth gene cassette containing an aacC gene, aacCA5, was found in an aacCA5-aadA7 cassette array in a class 1 integron isolated from a multiply drug resistant Salmonella enterica serovar Kentucky strain. The AacC-A5 or AAC(3)-Ie acetyltransferase encoded by aacCA5 is related to other AAC(3)-I enzymes and confers resistance to gentamicin.

  7. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol


    Kehrenberg, Corinna; Schwarz, Stefan


    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.

  8. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422. (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G


    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  9. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    NARCIS (Netherlands)

    Choorapoikayil, S.; Kuiper, R.V.; de Bruin, A.; den Hertog, J.


    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile.

  10. Pentocin KCA1: a novel circular bacteriocin gene encoded in the ...

    African Journals Online (AJOL)

    We isolated and carried out comprehensive genome sequence analysis of the first Lactobacillus pentosus KCA1 of human origin encoding genes for the biosynthesis of antimicrobial bacteriocin peptide. Due to the growing number of antimicrobial resistance, the need for developing alternatives to traditional antibiotics is ...

  11. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M


    Full Text Available for the efficient hydrolytic kinetic resolution of epoxides, which serve as high-value intermediates in the fine chemicals and pharmaceutical industries. Degenerate primers, based on data from available EH-encoding gene sequences, in conjunction with inverse PCR...

  12. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.

    Directory of Open Access Journals (Sweden)

    Francisco Muñoz-Martínez

    Full Text Available Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF. CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was

  13. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions. (United States)

    Muñoz-Martínez, Francisco; García-Fontana, Cristina; Rico-Jiménez, Miriam; Alfonso, Carlos; Krell, Tino


    Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF). CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR) domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was found to be

  14. BAGE: a new gene encoding an antigen recognized on human melanomas by cytolytic T lymphocytes. (United States)

    Boël, P; Wildmann, C; Sensi, M L; Brasseur, R; Renauld, J C; Coulie, P; Boon, T; van der Bruggen, P


    Several tumor antigens are recognized by autologous cytolytic T lymphocytes (CTL) on human melanoma MZ2-MEL. Some of them are encoded by genes MAGE-1 and MAGE-3, which are not expressed in normal tissues except in testis. Here, we report the identification of a new gene that codes for another of these antigens. This gene, named BAGE, codes for a putative protein of 43 aa and seems to belong to a family of several genes. The antigen recognized by the autologous CTL consists of BAGE-encoded peptide AARAVFLAL bound to an HLA-Cw 1601 molecule. Gene BAGE is expressed in 22% of melanomas, 30% of infiltrating bladder carcinomas, 10% of mammary carcinomas, 8% of head and neck squamous cell carcinomas, and 6% of non-small cell lung carcinomas. Like the MAGE genes, it is silent in normal tissues with the exception of testis. Because of its tumor-specific expression, the BAGE-encoded antigen may prove useful for cancer immunotherapy.

  15. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period. (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping


    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  16. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species. (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto


    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  17. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.


    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  18. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T


    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  19. Cloning of Lab Gene Encoding Bacteriocin From Pediococcus acidilactici Fil Into Escherichia coli DH5a


    Margono, Sebastian; Wijaya, Agus; Rahayu, Endang S.


    Pediococcus acidilactici F11 is able to inhibit the growth of related species of enterobacteriaceae by secreting bacteriocin. Effort to increase bacteriocin production by transforming lab gene encoding bacteriocin from P. acidilactici Fl 1 into E. colt DH5a was carried out. Plasmid pPAF11 (encoding bacteriocin from P. acidilactici F11) and p13C19 as vector which were double-digested with Madill and BamHI, ligated, and transformed into E. colt DH5a. White colonies, as indicator of transformant...

  20. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    Directory of Open Access Journals (Sweden)

    A.V. Karlyshev


    Full Text Available According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection.

  1. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.


    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  2. Differential roles of two SARP-encoding regulatory genes during tylosin biosynthesis. (United States)

    Bate, Neil; Stratigopoulos, George; Cundliffe, Eric


    The tylosin biosynthetic gene cluster of Streptomyces fradiae is remarkable in harbouring at least five regulatory genes, two of which (tylS and tylT) encode proteins of the Streptomyces antibiotic regulatory protein (SARP) family. The aim of the present work was to assess the respective contributions of TylS and TylT to tylosin production. A combination of targeted gene disruption, fermentation studies and gene expression analysis via reverse transcriptase-polymerase chain reaction (RT-PCR) suggests that tylS is essential for tylosin production and controls the expression of tylR (previously shown to be a global activator of the biosynthetic pathway) plus at least one other gene involved in polyketide metabolism or regulation thereof. This is the first demonstration of a SARP acting to control another regulatory gene during antibiotic biosynthesis. In contrast, tylT is not essential for tylosin production.

  3. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O


    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...

  4. A genomic analysis of disease-resistance genes encoding nucleotide binding sites in Sorghum bicolor

    Directory of Open Access Journals (Sweden)

    Xiao Cheng


    Full Text Available A large set of candidate nucleotide-binding site (NBS-encoding genes related to disease resistance was identified in the sorghum (Sorghum bicolor genome. These resistance (R genes were characterized based on their structural diversity, physical chromosomal location and phylogenetic relationships. Based on their N-terminal motifs and leucine-rich repeats (LRR, 50 non-regular NBS genes and 224 regular NBS genes were identified in 274 candidate NBS genes. The regular NBS genes were classified into ten types: CNL, CN, CNLX, CNX, CNXL, CXN, NX, N, NL and NLX. The vast majority (97% of NBS genes occurred in gene clusters, indicating extensive gene duplication in the evolution of S. bicolor NBS genes. Analysis of the S. bicolor NBS phylogenetic tree revealed two major clades. Most NBS genes were located at the distal tip of the long arms of the ten sorghum chromosomes, a pattern significantly different from rice and Arabidopsis, the NBS genes of which have a random chromosomal distribution.

  5. Metagenomic Analysis of Apple Orchard Soil Reveals Antibiotic Resistance Genes Encoding Predicted Bifunctional Proteins▿ (United States)

    Donato, Justin J.; Moe, Luke A.; Converse, Brandon J.; Smart, Keith D.; Berklein, Flora C.; McManus, Patricia S.; Handelsman, Jo


    To gain insight into the diversity and origins of antibiotic resistance genes, we identified resistance genes in the soil in an apple orchard using functional metagenomics, which involves inserting large fragments of foreign DNA into Escherichia coli and assaying the resulting clones for expressed functions. Among 13 antibiotic-resistant clones, we found two genes that encode bifunctional proteins. One predicted bifunctional protein confers resistance to ceftazidime and contains a natural fusion between a predicted transcriptional regulator and a β-lactamase. Sequence analysis of the entire metagenomic clone encoding the predicted bifunctional β-lactamase revealed a gene potentially involved in chloramphenicol resistance as well as a predicted transposase. A second clone that encodes a predicted bifunctional protein confers resistance to kanamycin and contains an aminoglycoside acetyltransferase domain fused to a second acetyltransferase domain that, based on nucleotide sequence, was predicted not to be involved in antibiotic resistance. This is the first report of a transcriptional regulator fused to a β-lactamase and of an aminoglycoside acetyltransferase fused to an acetyltransferase not involved in antibiotic resistance. PMID:20453147

  6. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin


    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  7. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci. (United States)

    Perumal, N; Murugesan, S; Krishnan, P


    The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs) and staphylococcal cassette chromosome mec (SCCmec) elements among clinical isolates of methicillin-resistant staphylococci (MRS). Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6')-Ie-aph (2''), aph (3')-IIIa and ant (4')-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6')-Ie-aph (2'') (55.4%) followed by aph (3')-IIIa (32.3%) and ant (4')-Ia gene (9%). SCCmec type I (34%) was predominant in this study. In conclusion, the aac (6')-Ie-aph (2'') was the most common AME gene and SCCmec type I was most predominant among the MRS isolates.

  8. The insect metalloproteinase inhibitor gene of the lepidopteran Galleria mellonella encodes two distinct inhibitors. (United States)

    Wedde, Marianne; Weise, Christoph; Nuck, Rolf; Altincicek, Boran; Vilcinskas, Andreas


    The insect metalloproteinase inhibitor (IMPI) from the greater wax moth, Galleria mellonella, represents the first and to date only specific inhibitor of microbial metalloproteinases reported from animals. Here, we report on the characterization including carbohydrate analysis of two recombinant constructs encoded by impi cDNA either upstream or downstream of the furin cleavage site identified. rIMPI-1, corresponding to native IMPI purified from hemolymph, is encoded by the N-terminal part of the impi sequence, whereas rIMPI-2 is encoded by its C-terminal part. rIMPI-1 is glycosylated at N48 with GlcNAc2Man3, showing fucosylation to different extents. Similarly, rIMPI-2 is glycosylated at N149 with GlcNAc2Man3, but is fully fucosylated. rIMPI-1 represents a promising template for the design of second-generation antibiotics owing to its specific activity against thermolysin-like metalloproteinases produced by human pathogenic bacteria such as Vibrio vulnificus. In contrast, rIMPI-2 does not inhibit bacterial metalloproteinases, but is moderately active against recombinant human matrix metalloproteinases (MMPs). Both microbial metalloproteinases and MMPs induce expression of the impi gene when injected into G. mellonella larvae. These findings provide evidence that the impi gene encodes two distinct inhibitors, one inhibiting microbial metalloproteinases and contributing to innate immunity, the other putatively mediating regulation of endogenous MMPs during metamorphosis.

  9. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R


    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  10. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter


    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  11. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))


    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  12. Sca1, a previously undescribed paralog from autotransporter protein-encoding genes in Rickettsia species

    Directory of Open Access Journals (Sweden)

    Raoult Didier


    Full Text Available Abstract Background Among the 17 genes encoding autotransporter proteins of the "surface cell antigen" (sca family in the currently sequenced Rickettsia genomes, ompA, sca5 (ompB and sca4 (gene D, have been extensively used for identification and phylogenetic purposes for Rickettsia species. However, none of these genes is present in all 20 currently validated Rickettsia species. Of the remaining 14 sca genes, sca1 is the only gene to be present in all nine sequenced Rickettsia genomes. To estimate whether the sca1 gene is present in all Rickettsia species and its usefulness as an identification and phylogenetic tool, we searched for sca1genes in the four published Rickettsia genomes and amplified and sequenced this gene in the remaining 16 validated Rickettsia species. Results Sca1 is the only one of the 17 rickettsial sca genes present in all 20 Rickettsia species. R. prowazekii and R. canadensis exhibit a split sca1 gene whereas the remaining species have a complete gene. Within the sca1 gene, we identified a 488-bp variable sequence fragment that can be amplified using a pair of conserved primers. Sequences of this fragment are specific for each Rickettsia species. The phylogenetic organization of Rickettsia species inferred from the comparison of sca1 sequences strengthens the classification based on the housekeeping gene gltA and is similar to those obtained from the analyses of ompA, sca5 and sca4, thus suggesting similar evolutionary constraints. We also observed that Sca1 protein sequences have evolved under a dual selection pressure: with the exception of typhus group rickettsiae, the amino-terminal part of the protein that encompasses the predicted passenger domain, has evolved under positive selection in rickettsiae. This suggests that the Sca1 protein interacts with the host. In contrast, the C-terminal portion containing the autotransporter domain has evolved under purifying selection. In addition, sca1 is transcribed in R. conorii

  13. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol (United States)

    Kehrenberg, Corinna; Schwarz, Stefan


    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.   PMID:14742219

  14. Sequencing the Gene Encoding Manganese-Dependent Superoxide Dismutase for Rapid Species Identification of Enterococci


    Poyart, Claire; Quesnes, Gilles; Trieu-Cuot, Patrick


    Simple PCR and sequencing assays that utilize a single pair of degenerate primers were used to characterize a 438-bp-long DNA fragment internal (sodAint) to the sodA gene encoding the manganese-dependent superoxide dismutase in 19 enterococcal type strains (Enterococcus avium, Enterococcus casseliflavus, Enterococcus cecorum, Enterococcus columbae, Enterococcus dispar, Enterococcus durans, Enterococcus faecalis, Enterococcus faecium, Enterococcus flavescens, Enterococcus gallinarum, Enterococ...

  15. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period


    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping


    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  16. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant. (United States)

    da Silva, Sabina Dos Santos Paulino; Cidral, Thiago André; Soares, Maria José dos Santos; de Melo, Maria Celeste Nunes


    Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

  17. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem. (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A


    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  18. Mutations in the gene encoding epsilon-sarcoglycan cause myoclonus-dystonia syndrome. (United States)

    Zimprich, A; Grabowski, M; Asmus, F; Naumann, M; Berg, D; Bertram, M; Scheidtmann, K; Kern, P; Winkelmann, J; Müller-Myhsok, B; Riedel, L; Bauer, M; Müller, T; Castro, M; Meitinger, T; Strom, T M; Gasser, T


    The dystonias are a common clinically and genetically heterogeneous group of movement disorders. More than ten loci for inherited forms of dystonia have been mapped, but only three mutated genes have been identified so far. These are DYT1, encoding torsin A and mutant in the early-onset generalized form, GCH1 (formerly known as DYT5), encoding GTP-cyclohydrolase I and mutant in dominant dopa-responsive dystonia, and TH, encoding tyrosine hydroxylase and mutant in the recessive form of the disease. Myoclonus-dystonia syndrome (MDS; DYT11) is an autosomal dominant disorder characterized by bilateral, alcohol-sensitive myoclonic jerks involving mainly the arms and axial muscles. Dystonia, usually torticollis and/or writer's cramp, occurs in most but not all affected patients and may occasionally be the only symptom of the disease. In addition, patients often show prominent psychiatric abnormalities, including panic attacks and obsessive-compulsive behavior. In most MDS families, the disease is linked to a locus on chromosome 7q21 (refs. 11-13). Using a positional cloning approach, we have identified five different heterozygous loss-of-function mutations in the gene for epsilon-sarcoglycan (SGCE), which we mapped to a refined critical region of about 3.2 Mb. SGCE is expressed in all brain regions examined. Pedigree analysis shows a marked difference in penetrance depending on the parental origin of the disease allele. This is indicative of a maternal imprinting mechanism, which has been demonstrated in the mouse epsilon-sarcoglycan gene.

  19. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger. (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P


    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  20. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli.


    Okada, K; Minehira, M; Zhu, X; Suzuki, K; Nakagawa, T; Matsuda, H; Kawamukai, M


    The Escherichia coli ispB gene encoding octaprenyl diphosphate synthase is responsible for the synthesis of the side chain of isoprenoid quinones. We tried to construct an E. coli ispB-disrupted mutant but could not isolate the chromosomal ispB disrupted mutant unless the ispB gene or its homolog was supplied on a plasmid. The chromosomal ispB disruptants that harbored plasmids carrying the ispB homologs from Haemophilus influenzae and Synechocystis sp. strain PCC6803 produced mainly ubiquino...

  1. PRS1 is a key member of the gene family encoding phosphoribosylpyrophosphate synthetase in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Carter, Andrew T.; Beiche, Flora; Hove-Jensen, Bjarne


    In Saccharomyces cerevisiae the metabolite phosphoribosyl-pyrophosphate (PRPP) is required for purine, pyrimidine, tryptophan and histidine biosynthesis. Enzymes that can synthesize PRPP can be encoded by at least four genes. We have studied 5-phospho-ribosyl-1(α)-pyrophosphate synthetases (PRS......) genetically and biochemically. Each of the four genes, all of which are transcribed, has been disrupted in haploid yeast strains of each mating type and although all disruptants are able to grow on complete medium, differences in growth rate and enzyme activity suggest that disruption of PRS1 or PRS3 has...

  2. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan


    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  3. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat


    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  4. Selection and characterization of forest soil metagenome genes encoding lipolytic enzymes. (United States)

    Hong, Kyung Sik; Lim, He Kyoung; Chung, Eu Jin; Park, Eun Jin; Lee, Myung Hwan; Kim, Jin-Cheol; Choi, Gyung Ja; Cho, Kwang Yun; Lee, Seon-Woo


    A metagenome is a unique resource to search for novel microbial enzymes from the unculturable microorganisms in soil. A forest soil metagenomic library using a fosmid and soil microbial DNA from Gwangneung forest, Korea, was constructed in Escherichia coli and screened to select lipolytic genes. A total of seven unique lipolytic clones were selected by screening of the 31,000-member forest soil metagenome library based on tributyrin hydrolysis. The ORFs for lipolytic activity were subcloned in a high copy number plasmid by screening the secondary shortgun libraries from the seven clones. Since the lipolytic enzymes were well secreted in E. coli into the culture broth, the lipolytic activity of the subclones was confirmed by the hydrolysis of p-nitrophenyl butyrate using culture broth. Deduced amino acid sequence analysis of the identified ORFs for lipolytic activity revealed that 4 genes encode hormone-sensitive lipase (HSL) in lipase family IV. Phylogenetic analysis indicated that 4 proteins were clustered with HSL in the database and other metagenomic HSLs. The other 2 genes and 1 gene encode non-heme peroxidase-like enzymes of lipase family V and a GDSL family esterase/lipase in family II, respectively. The gene for the GDSL enzyme is the first description of the enzyme from metagenomic screening.

  5. Production of cyanophycin in Rhizopus oryzae through the expression of a cyanophycin synthetase encoding gene. (United States)

    Meussen, Bas J; Weusthuis, Ruud A; Sanders, Johan P M; Graaff, Leo H de


    Cyanophycin or cyanophycin granule peptide is a protein that results from non-ribosomal protein synthesis in microorganisms such as cyanobacteria. The amino acids in cyanophycin can be used as a feedstock in the production of a wide range of chemicals such as acrylonitrile, polyacrylic acid, 1,4-butanediamine, and urea. In this study, an auxotrophic mutant (Rhizopus oryzae M16) of the filamentous fungus R. oryzae 99-880 was selected to express cyanophycin synthetase encoding genes. These genes originated from Synechocystis sp. strain PCC6803, Anabaena sp. strain PCC7120, and a codon optimized version of latter gene. The genes were under control of the pyruvate decarboxylase promoter and terminator elements of R. oryzae. Transformants were generated by the biolistic transformation method. In only two transformants both expressing the cyanophycin synthetase encoding gene from Synechocystis sp. strain PCC6803 was a specific enzyme activity detected of 1.5 mU/mg protein. In one of these transformants was both water-soluble and insoluble cyanophycin detected. The water-soluble fraction formed the major fraction and accounted for 0.5% of the dry weight. The water-insoluble CGP was produced in trace amounts. The amino acid composition of the water-soluble form was determined and constitutes of equimolar amounts of arginine and aspartic acid.

  6. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O


    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...... and to the Saccharomyces cerevisiae STE6 gene product, which mediates export of a-factor mating pheromone. We show that STE6 can also mediate secretion of M-factor in S. pombe....

  7. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis

    Directory of Open Access Journals (Sweden)

    González Mauricio


    Full Text Available Abstract Background Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Results Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Conclusion Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we

  8. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis. (United States)

    Zúñiga, Alejandro; Hödar, Christian; Hanna, Patricia; Ibáñez, Freddy; Moreno, Pablo; Pulgar, Rodrigo; Pastenes, Luis; González, Mauricio; Cambiazo, Verónica


    Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we recovered a substantial number of unknown genes encoding

  9. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.


    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  10. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.


    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  11. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi


    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  12. A highly conserved NB-LRR encoding gene cluster effective against Setosphaeria turcica in sorghum

    Directory of Open Access Journals (Sweden)

    Martin Tom


    Full Text Available Abstract Background The fungal pathogen Setosphaeria turcica causes turcicum or northern leaf blight disease on maize, sorghum and related grasses. A prevalent foliar disease found worldwide where the two host crops, maize and sorghum are grown. The aim of the present study was to find genes controlling the host defense response to this devastating plant pathogen. A cDNA-AFLP approach was taken to identify candidate sequences, which functions were further validated via virus induced gene silencing (VIGS, and real-time PCR analysis. Phylogenetic analysis was performed to address evolutionary events. Results cDNA-AFLP analysis was run on susceptible and resistant sorghum and maize genotypes to identify resistance-related sequences. One CC-NB-LRR encoding gene GRMZM2G005347 was found among the up-regulated maize transcripts after fungal challenge. The new plant resistance gene was designated as St referring to S. turcica. Genome sequence comparison revealed that the CC-NB-LRR encoding St genes are located on chromosome 2 in maize, and on chromosome 5 in sorghum. The six St sorghum genes reside in three pairs in one locus. When the sorghum St genes were silenced via VIGS, the resistance was clearly compromised, an observation that was supported by real-time PCR. Database searches and phylogenetic analysis suggest that the St genes have a common ancestor present before the grass subfamily split 50-70 million years ago. Today, 6 genes are present in sorghum, 9 in rice and foxtail millet, respectively, 3 in maize and 4 in Brachypodium distachyon. The St gene homologs have all highly conserved sequences, and commonly reside as gene pairs in the grass genomes. Conclusions Resistance genes to S. turcica, with a CC-NB-LRR protein domain architecture, have been found in maize and sorghum. VIGS analysis revealed their importance in the surveillance to S. turcica in sorghum. The St genes are highly conserved in sorghum, rice, foxtail millet, maize and

  13. Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris. (United States)

    Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro


    Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  14. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique


    The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  15. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    Directory of Open Access Journals (Sweden)

    Dhia Bouktila


    Full Text Available Proteins containing nucleotide binding sites (NBS encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution.

  16. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique


    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  17. A corm-specific gene encodes tarin, a major globulin of taro (Colocasia esculenta L. Schott). (United States)

    Bezerra, I C; Castro, L A; Neshich, G; de Almeida, E R; de Sá, M F; Mello, L V; Monte-Neshich, D C


    A gene encoding a globulin from a major taro (Colocasia esculenta L. Schott) corm protein family, tarin (G1, ca. 28 kDa) was isolated from a lambda Charon 35 library, using a cDNA derived from a highly abundant corm-specific mRNA, as probe. The gene, named tar1, and the corresponding cDNA were characterized and compared. No introns were found. The major transcription start site was determined by primer extension analysis. The gene has an open reading frame (ORF) of 765 bp, and the deduced amino acid sequence indicated a precursor polypeptide of 255 residues that is post-translationally processed into two subunits of about 12.5 kDa each. The deduced protein is 45% homologous to curculin, a sweet-tasting protein found in the fruit pulp of Curculigo latifolia and 40% homologous to a mannose-binding lectin from Galanthus nivalis. Significant similarity was also found at the nucleic acid sequence level with genes encoding lectins from plant species of the Amaryllidaceae and Lilliaceae families.

  18. [Cloning and structure of gene encoded alpha-latrocrustoxin from the Black widow spider venom]. (United States)

    Danilevich, V N; Luk'ianov, S A; Grishin, E V


    The primary structure of the crusta gene encoding alpha-latrocrustoxin (alpha-LCT), a high molecular mass neurotoxin specific to crustaceans, was determined in the black widow spider Latrodectus mactans tredicimguttatus genome. The total length of the sequenced DNA was 4693 bp. The structural part of the black widow spider chromosome gene encoding alpha-LCT does not contain introns. The sequenced DNA contains a single extended open reading frame (4185 bp) and encodes a protein precursor of alpha-LCT, comprising 1395 aa. We assume the Met residue at position -10 relative to the N-terminal residue of Glu1 of the mature toxin to be the first one in the protein precursor. The calculated molecular mass of the precursor (156147 Da) exceeds that of the mature toxin by approximately 30 kDa. These data are in agreement with the notion that over the course of maturation the protein precursor undergoes double processing--cleavage of a decapeptide from the N-terminal part and of a approximately 200-aa fragment from the C-terminal part. alpha-LCT displayed a number of imperfect ankyrin-like repeats and areas of structural homology with earlier studied latrotoxins; the highest homology degree (62%) was revealed with alpha-latroinsectotoxin (alpha-LIT).

  19. The immune gene repertoire encoded in the purple sea urchin genome. (United States)

    Hibino, Taku; Loza-Coll, Mariano; Messier, Cynthia; Majeske, Audrey J; Cohen, Avis H; Terwilliger, David P; Buckley, Katherine M; Brockton, Virginia; Nair, Sham V; Berney, Kevin; Fugmann, Sebastian D; Anderson, Michele K; Pancer, Zeev; Cameron, R Andrew; Smith, L Courtney; Rast, Jonathan P


    Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the vertebrate adaptive immune system. Here we present an initial survey of the purple sea urchin genome for genes associated with immunity. An elaborate repertoire of potential immune receptors, regulators and effectors is present, including unprecedented expansions of innate pathogen recognition genes. These include a diverse array of 222 Toll-like receptor (TLR) genes and a coordinate expansion of directly associated signaling adaptors. Notably, a subset of sea urchin TLR genes encodes receptors with structural characteristics previously identified only in protostomes. A similarly expanded set of 203 NOD/NALP-like cytoplasmic recognition proteins is present. These genes have previously been identified only in vertebrates where they are represented in much lower numbers. Genes that mediate the alternative and lectin complement pathways are described, while gene homologues of the terminal pathway are not present. We have also identified several homologues of genes that function in jawed vertebrate adaptive immunity. The most striking of these is a gene cluster with similarity to the jawed vertebrate Recombination Activating Genes 1 and 2 (RAG1/2). Sea urchins are long-lived, complex organisms and these findings reveal an innate immune system of unprecedented complexity. Whether the presumably intense selective processes that molded these gene families also gave rise to novel immune mechanisms akin to adaptive systems remains to be seen. The genome sequence provides immediate opportunities to apply the advantages of the sea urchin model toward problems in developmental and evolutionary immunobiology.

  20. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.


    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  1. Phylogenetic and evolutionary analysis of NBS-encoding genes in Rosaceae fruit crops. (United States)

    Xu, Qiang; Wen, Xiaopeng; Deng, Xiuxin


    Phylogenetic relationships of the nucleotide binding site (NBS)-encoding resistance gene homologues (RGHs) among 12 species in five genera of Rosaceae fruit crops were evaluated. A total of 228 Rosaceous RGHs were deeply separated into two distinct clades, designated as TIR (sequences within this clade containing a Toll Interleukin-1 Receptor domain) and NonTIR (sequences lacking a TIR domain). Most Rosaceous RGH genes were phylogenetically distinct from Arabidopsis, Rice or Pine genes, except for a few Rosaceous members which grouped closely with Arabidopsis genes. Within Rosaceae, sequences from multiple species were often phylogenetically clustered together, forming heterogenous groups, however, apple- and chestnut rose-specific groups really exist. Gene duplication followed by sequence divergence were proposed as the mode for the evolution of a large number of distantly or closely related RGH genes in Rosaceae, and this mode may play a role in the generation of new resistance specificity. Positively selected sites within NBS-coding region were detected and thus nucleotide variation within NBS domain may function in determining disease resistance specificity. This study also discusses the synteny of a genomic region that encompass powdery mildew resistance locus among Malus, Prunus and Rosa, which may have potential use for fruit tree disease breeding and important gene cloning.

  2. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui


    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  3. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua


    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  4. Isolation and sequence analysis of the gene encoding triose phosphate isomerase from Zygosaccharomyces bailii. (United States)

    Merico, A; Rodrigues, F; Côrte-Real, M; Porro, D; Ranzi, B M; Compagno, C


    The ZbTPI1 gene encoding triose phosphate isomerase (TIM) was cloned from a Zygosaccharomyces bailii genomic library by complementation of the Saccharomyces cerevisiae tpi1 mutant strain. The nucleotide sequence of a 1.5 kb fragment showed an open reading frame (ORF) of 746 bp, encoding a protein of 248 amino acid residues. The deduced amino acid sequence shares a high degree of homology with TIMs from other yeast species, including some highly conserved regions. The analysis of the promoter sequence of the ZbTPI1 revealed the presence of putative motifs known to have regulatory functions in S. cerevisiae. The GenBank Accession No. of ZbTPI1 is AF325852. Copyright 2001 John Wiley & Sons, Ltd.

  5. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes.

    NARCIS (Netherlands)

    Jensen, A.; Magistrado, P.; Sharp, S.; Joergensen, L.; Lavstsen, T.; Chiucchiuini, A.; Salanti, A.; Vestergaard, L.S.; Lusingu, J.P.; Hermsen, R.; Sauerwein, R.W.; Christensen, J.; Nielsen, M.A.; Hviid, L.; Sutherland, C.J.; Staalsoe, T.; Theander, T.G.


    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in

  6. Identification and characterization of the Vibrio anguillarum prtV gene encoding a new metalloprotease (United States)

    Mo, Zhaolan; Guo, Dongsheng; Mao, Yunxiang; Ye, Xuhong; Zou, Yuxia; Xiao, Peng; Hao, Bin


    We cloned and sequenced a prtV-like gene from Vibrio anguillarum M3 strain. This prtV gene encodes a putative protein of 918 amino acids, and is highly homologous to the V. cholerae prtV gene. We found that a prtV insertion mutant strain displayed lower gelatinase activity on gelatin agar, lower protease activity against azocasein, and lower activity for four glycosidases. This prtV mutant strain also had increased activity for two esterases in its extracellular products, as analyzed by the API ZYM system. In addition, the prtV mutant strain exhibited decreased growth in turbot intestinal mucus and reduced hemolytic activity on turbot erythrocytes. Infection experiments showed that the LD50 of the prtV mutant strain increased by at least 1 log compared to the wild-type in turbot fish. We propose that prtV plays an important role in the pathogenesis of V. anguillarum.

  7. Genetic variability in the sable (Martes zibellina L.) with respect to genes encoding blood proteins

    Energy Technology Data Exchange (ETDEWEB)

    Kashtanov, S.N. [Vavilov Institute of General Genetics, Moscow (Russian Federation); Kazakova, T.I. [Afanas`ev Scientific Research Institute for Breeding of Fur-Bearing Animals, Moscow (Russian Federation)


    Electrophoresis of blood proteins was used to determine, for the first time, the level of genetic variability of certain loci in the sable (Martes zibellina L., Mustelidae). Variation of 23 blood proteins encoded by 25 genes was analyzed. Polymorphism was revealed in six genes. The level of heterozygosity was estimated at 0.069; the proportion of polymorphic loci was 24%. Data on the history of the sable population maintained at the farm, on geographical distribution of natural sable populations, and on the number of animals selected for reproduction in captivity is presented. The great number of animals studies and the extensive range of natural sable populations, on the basis of which the population maintained in captivity was obtained, suggest that the results of this work can be used for estimating the variability of the gene pool of sable as a species. 9 refs., 2 figs., 1 tab.

  8. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    NARCIS (Netherlands)

    Dijkman, Ronald; Jebbink, Maarten F.; Wilbrink, Berry; Pyrc, Krzysztof; Zaaijer, Hans L.; Minor, Philip D.; Franklin, Sally; Berkhout, Ben; Thiel, Volker; van der Hoek, Lia


    BACKGROUND: The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV) 229E. The prototype virus has a

  9. A gene encoding phosphatidylethanolamine N-methyltransferase from Acetobacter aceti and some properties of its disruptant. (United States)

    Hanada, T; Kashima, Y; Kosugi, A; Koizumi, Y; Yanagida, F; Udaka, S


    Phosphatidylcholine (PC) is a major component of membranes not only in eukaryotes, but also in several bacteria, including Acetobacter. To identify the PC biosynthetic pathway and its role in Acetobacter sp., we have studied Acetobacter aceti IFO3283, which is characterized by high ethanol oxidizing ability and high resistance to acetic acid. The pmt gene of A. aceti, encoding phosphatidylethanolamine N-methyltransferase (Pmt), which catalyzes methylation of phosphatidylethanolamine (PE) to PC, has been cloned and sequenced. One recombinant plasmid that complemented the PC biosynthesis was isolated from a gene library of the genomic DNA of A. aceti. The pmt gene encodes a polypeptide with molecular mass of either 25125, 26216, or 29052 for an about 27-kDa protein. The sequence of this gene showed significant similarity (44.3% identity in the similar sequence region) with the Rhodobacter sphaeroides pmtA gene which is involved in PE N-methylation. When the pmt gene was expressed in E. coli, which lacks PC, the Pmt activity and PC formation were clearly demonstrated. A. aceti strain harboring an interrupted pmt allele, pmt::Km, was constructed. The pmt disruption was confirmed by loss of Pmt and PC, and by Southern blot analyses. The null pmt mutant contained no PC, but tenfold more PE and twofold more phosphatidylglycerol (PG). The pmt disruptant did not show any dramatic effects on growth in basal medium supplemented with ethanol, but the disruption caused slow growth in basal medium supplemented with acetate. These results suggest that the lack of PC in the A. aceti membrane may be compensated by the increases of PE and PG by an unknown mechanism, and PC in A. aceti membrane is related to its acetic acid tolerance.

  10. Cis and trans interactions between genes encoding PAF1 complex and ESCRT machinery components in yeast. (United States)

    Rodrigues, Joana; Lydall, David


    Saccharomyces cerevisiae is a commonly used model organism for understanding eukaryotic gene function. However, the close proximity between yeast genes can complicate the interpretation of yeast genetic data, particularly high-throughput data. In this study, we examined the interplay between genes encoding components of the PAF1 complex and VPS36, the gene located next to CDC73 on chromosome XII. The PAF1 complex (Cdc73, Paf1, Ctr9, Leo1, and Rtf1, in yeast) affects RNA levels by affecting transcription, histone modifications, and post-transcriptional RNA processing. The human PAF1 complex is linked to cancer, and in yeast, it has been reported to play a role in telomere biology. Vps36, part of the ESCRT-II complex, is involved in sorting proteins for vacuolar/lysosomal degradation. We document a complex set of genetic interactions, which include an adjacent gene effect between CDC73 and VPS36 and synthetic sickness between vps36Δ and cdc73Δ, paf1Δ, or ctr9Δ. Importantly, paf1Δ and ctr9Δ are synthetically lethal with deletions of other components of the ESCRT-II (SNF8 and VPS25), ESCRT-I (STP22), or ESCRT-III (SNF7) complexes. We found that RNA levels of VPS36, but not other ESCRT components, are positively regulated by all components of the PAF1 complex. Finally, we show that deletion of ESCRT components decreases the telomere length in the S288C yeast genetic background, but not in the W303 background. Together, our results outline complex interactions, in cis and in trans, between genes encoding PAF1 and ESCRT-II complex components that affect telomere function and cell viability in yeast.

  11. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John


    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  12. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA. (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B


    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  13. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99. (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans


    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  14. The Lethal Toxin from Australian Funnel-Web Spiders Is Encoded by an Intronless Gene (United States)

    Pineda, Sandy Steffany; Wilson, David; Mattick, John S.; King, Glenn F.


    Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome. PMID:22928020

  15. Cloning and characterization of a gene encoding trehalose phosphorylase (TP) from Pleurotus sajor-caju. (United States)

    Han, Sang-Eun; Kwon, Hawk-Bin; Lee, Seung-Bum; Yi, Bu-Young; Murayama, Ikuo; Kitamoto, Yutaka; Byun, Myung-Ok


    Complementary DNA for a gene encoding trehalose phosphorylase (TP) that reversibly catalyzes trehalose synthesis and degradation from alpha-glucose-1-phosphate (alpha-Glc-1-P) and glucose was cloned from Pleurotus sajor-caju. The cDNA of P. sajor-caju TP (designated PsTP, GenBank Accession No. AF149777) encodes a polypeptide of 751 amino acids with a deduced molecular mass of 83.7 kDa. The PsTP gene is expressed in mycelia, pilei, and stipes of fruiting bodies. Trehalose phosphorylase PsTP was purified from PsTP-transformed Escherichia coli. The enzyme catalyzes both the phosphorolysis of trehalose to produce alpha-Glc-1-P and glucose, and the synthesis of trehalose. The apparent K(m) values for trehalose and Pi in phosphorolytic reaction at pH 7.0 were 74.8 and 5.4 mM, respectively. The PsTP gene complemented Saccharomyces cerevisiae Deltatps1, Deltatps2 double-mutant cells, allowing their growth on glucose medium. Furthermore, yeast transformed with PsTP produced 2-2.5-fold more trehalose than non-transformants or cells transformed with empty vector only.

  16. The lethal toxin from Australian funnel-web spiders is encoded by an intronless gene.

    Directory of Open Access Journals (Sweden)

    Sandy Steffany Pineda

    Full Text Available Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome.

  17. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae. (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro


    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Directory of Open Access Journals (Sweden)

    Silke Roedder


    Full Text Available Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (<21 years and adult (>21 years renal allograft recipients at the point of AR (n = 61 and absence of rejection (n = 94 for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection. Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression.

  19. The Neurospora crassa colonial temperature-sensitive 3 (cot-3) gene encodes protein elongation factor 2. (United States)

    Propheta, O; Vierula, J; Toporowski, P; Gorovits, R; Yarden, O


    At elevated temperatures, the Neurospora crassa mutant colonial, temperature-sensitive 3 (cot-3) forms compact, highly branched colonies. Growth of the cot-3 strain under these conditions also results in the loss of the lower molecular weight (LMW) isoform of the Ser/Thr protein kinase encoded by the unlinked cot-1 gene, whose function is also involved in hyphal elongation. The unique cot-3 gene has been cloned by complementation and shown to encode translation elongation factor 2 (EF-2). As expected for a gene with a general role in protein synthesis, cot-3 mRNA is abundantly expressed throughout all asexual phases of the N. crassa life cycle. The molecular basis of the cot-3 mutation was determined to be an ATT to AAT transversion, which causes an Ile to Asn substitution at residue 278. Treatment with fusidic acid (a specific inhibitor of EF-2) inhibits hyphal elongation and induces hyperbranching in a manner which mimics the cot-3 phenotype, and also leads to a decrease in the abundance of the LMW isoform of COT1. This supports our conclusion that the mutation in cot-3 which results in abnormal hyphal elongation/branching impairs EF-2 function and confirms that the abundance of a LMW isoform of COT1 kinase is dependent on the function of this general translation factor.

  20. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods. (United States)

    Jung, Yangjin; Matthews, Karl R


    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. The ROOT HAIRLESS 1 gene encodes a nuclear protein required for root hair initiation in Arabidopsis. (United States)

    Schneider, K; Mathur, J; Boudonck, K; Wells, B; Dolan, L; Roberts, K


    The epidermis of Arabidopsis wild-type primary roots, in which some cells grow hairs and others remain hairless in a position-dependent manner, has become an established model system to study cell differentiation. Here we present a molecular analysis of the RHL1 (ROOT HAIRLESS 1) gene that, if mutated, prevents the formation of hairs on primary roots and causes a seedling lethal phenotype. We have cloned the RHL1 gene by use of a T-DNA-tagged mutant and found that it encodes a protein that appears to be plant specific. The predicted RHL1 gene product is a small hydrophilic protein (38.9 kD) containing putative nuclear localization signals and shows no significant homology to any known amino acid sequence. We demonstrate that a 78-amino-acid sequence at its amino terminus is capable of directing an RHL1-GFP fusion protein to the nucleus. The RHL1 transcript is present throughout the wild-type plant and in suspension culture cells, but in very low amounts, suggesting a regulatory function for the RHL1 protein. Structural evidence suggests a role for the RHL1 gene product in the nucleolus. We have examined the genetic relationship between RHL1 and GL2, an inhibitor of root hair initiation in non-hair cells. Our molecular and genetic data with double mutants, together with the expression analysis of a GL2 promoter-GUS reporter gene construct, indicate that the RHL1 gene acts independently of GL2.

  2. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum. (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane


    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  3. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  4. Phytochrome-regulated expression of the genes encoding the small GTP-binding proteins in peas.


    Yoshida, K; Nagano, Y; Murai, N; Sasaki, Y


    We examined the effect of light on the mRNA levels of 11 genes (pra1-pra9A, pra9B, and pra9C) encoding the small GTP-binding proteins that belong to the ras superfamily in Pisum sativum. When the dark-grown seedlings were exposed to continuous white light for 24 hr, the levels of several pra mRNAs in the pea buds decreased: pra2 and pra3 mRNAs decreased markedly; pra4, pra6, and pra9A mRNAs decreased slightly; the other 6 pra mRNAs did not decrease. We studied the kinetics of mRNA accumulatio...

  5. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy


    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  6. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  7. Molecular cloning and characterization of a glutathione S-transferase encoding gene from Opisthorchis viverrini. (United States)

    Eursitthichai, Veerachai; Viyanant, Vithoon; Vichasri-Grams, Suksiri; Sobhon, Prasert; Tesana, Smarn; Upatham, Suchart Edward; Hofmann, Annemarie; Korge, Günter; Grams, Rudi


    An adult stage Opisthorchis viverrini cDNA library was constructed and screened for abundant transcripts. One of the isolated cDNAs was found by sequence comparison to encode a glutathione S-transferase (GST) and was further analyzed for RNA expression, encoded protein function, tissue distribution and cross-reactivity of the encoded protein with other trematode protein counterparts. The cDNA has a size of 893 bp and encodes a GST of 213 amino acids length (OV28GST). The most closely-related GST of OV28GST among those published for trematodes is a 28 kDa GST of Clonorchis sinensis as shown by multiple sequence alignment and phylogenetic analysis. Northern analysis of total RNA with a gene-specific probe revealed a 900 nucleotide OV28GST transcriptional product in the adult parasite. Through RNA in situ hybridization OV28GST RNA was detected in the parenchymal cells of adult parasites. This result was confirmed by immunolocalization of OV28GST with an antiserum generated in a mouse against bacterially-produced recombinant OV28GST. Both, purified recombinant and purified native OV28GST were resolved as 28 kDa proteins by SDS-PAGE. Using the anti-recOV28GST antiserum, no or only weak cross-reactivity was observed in an immunoblot of crude worm extracts against the GSTs of Schistosoma mansoni, S. japonicum, S. mekongi, Eurytrema spp. and Fasciola gigantica. The enzyme activity of the purified recombinant OV28GST was verified by a standard 1-chloro-2, 4-dinitrobenzene (CDNB) based activity assay. The present results of our molecular analysis of OV28GST should be helpful in the ongoing development of diagnostic applications for opisthorchiasis viverrini.

  8. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata (United States)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin


    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  9. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton


    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  10. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool. (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J


    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at Supplementary material is available at Bioinformatics online.

  11. Multidrug resistance in fungi: regulation of transporter-encoding gene expression. (United States)

    Paul, Sanjoy; Moye-Rowley, W Scott


    A critical risk to the continued success of antifungal chemotherapy is the acquisition of resistance; a risk exacerbated by the few classes of effective antifungal drugs. Predictably, as the use of these drugs increases in the clinic, more resistant organisms can be isolated from patients. A particularly problematic form of drug resistance that routinely emerges in the major fungal pathogens is known as multidrug resistance. Multidrug resistance refers to the simultaneous acquisition of tolerance to a range of drugs via a limited or even single genetic change. This review will focus on recent progress in understanding pathways of multidrug resistance in fungi including those of most medical relevance. Analyses of multidrug resistance in Saccharomyces cerevisiae have provided the most detailed outline of multidrug resistance in a eukaryotic microorganism. Multidrug resistant isolates of S. cerevisiae typically result from changes in the activity of a pair of related transcription factors that in turn elicit overproduction of several target genes. Chief among these is the ATP-binding cassette (ABC)-encoding gene PDR5. Interestingly, in the medically important Candida species, very similar pathways are involved in acquisition of multidrug resistance. In both C. albicans and C. glabrata, changes in the activity of transcriptional activator proteins elicits overproduction of a protein closely related to S. cerevisiae Pdr5 called Cdr1. The major filamentous fungal pathogen, Aspergillus fumigatus, was previously thought to acquire resistance to azole compounds (the principal antifungal drug class) via alterations in the azole drug target-encoding gene cyp51A. More recent data indicate that pathways in addition to changes in the cyp51A gene are important determinants in A. fumigatus azole resistance. We will discuss findings that suggest azole resistance in A. fumigatus and Candida species may share more mechanistic similarities than previously thought.

  12. Cell type-specific transcriptional regulation of the gene encoding importin-α1

    International Nuclear Information System (INIS)

    Kamikawa, Yasunao; Yasuhara, Noriko; Yoneda, Yoshihiro


    Importin-α1 belongs to a receptor family that recognizes classical nuclear localization signals. Encoded by Kpna2, this receptor subtype is highly expressed in mouse embryonic stem (ES) cells. In this study, we identified a critical promoter region in Kpna2 and showed that the expression of this gene is differentially regulated in ES cells and NIH3T3 cells. Conserved CCAAT boxes are required for Kpna2 promoter activity in both ES and NIH3T3 cells. Interestingly, deletion of the region from nucleotide position - 251 to - 179 bp resulted in a drastic reduction in Kpna2 transcriptional activity only in ES cells. This region contains Krueppel-like factor (Klf) binding sequences and is responsible for transactivation of the gene by Klf2 and Klf4. Accordingly, endogenous Kpna2 mRNA levels decreased in response to depletion of Klf2 and Klf4 in ES cells. Our results suggest that Klf2 and Klf4 function redundantly to drive high level of Kpna2 expression in ES cells. -- Research Highlights: → We showed the cell type-specific transcriptional regulation of Kpna2 encoding importin-al. → NF-Y binds the CCAAT boxes to activate Kpna2 transcription in NIH3T3 cells. → Klf2 and Klf4 redundantly activate the expression of Kpna2 in ES cells.

  13. Cloning, sequencing and expression of the gene encoding the extracellular metalloprotease of Aeromonas caviae. (United States)

    Kawakami, K; Toma, C; Honma, Y


    A gene (apk) encoding the extracellular protease of Aeromonas caviae Ae6 has been cloned and sequenced. For cloning the gene, the DNA genomic library was screened using skim milk LB agar. One clone harboring plasmid pKK3 was selected for sequencing. Nucleotide sequencing of the 3.5 kb region of pKK3 revealed a single open reading frame (ORF) of 1,785 bp encoding 595 amino acids. The deduced polypeptide contained a putative 16-amino acid signal peptide followed by a large propeptide. The N-terminal amino acid sequence of purified recombinant protein (APK) was consistent with the DNA sequence. This result suggested a mature protein of 412 amino acids with a molecular mass of 44 kDa. However, the molecular mass of purified recombinant APK revealed 34 kDa by SDS-PAGE, suggesting that further processing at the C-terminal region took place. The 2 motifs of zinc binding sites deduced are highly conserved in the APK as well as in other zinc metalloproteases including Vibrio proteolyticus neutral protease, Emp V from Vibrio vulnificus, HA/P from Vibrio cholerae, and Pseudomonas aeruginosa elastase. Proteolytic activity was inhibited by EDTA, Zincov, 1,10-phenanthroline and tetraethylenepentamine while unaffected by the other inhibitors tested. The protease showed maximum activity at pH 7.0 and was inactivated by heating at 80 C for 15 min. These results together suggest that APK belongs to the thermolysin family of metalloendopeptidases.

  14. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda


    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  15. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Suma Choorapoikayil


    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena+/−ptenb−/− or ptena−/−ptenb+/− are viable and fertile. ptena+/−ptenb−/− fish develop tumors at a relatively high incidence (10.2% and most tumors developed close to the eye (26/30. Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena−/−ptenb+/− fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena+/−ptenb−/− and ptena−/−ptenb+/− fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena+/−ptenb−/− zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  16. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants. (United States)

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José


    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  17. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma. (United States)

    Choorapoikayil, Suma; Kuiper, Raoul V; de Bruin, Alain; den Hertog, Jeroen


    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile. ptena(+/-)ptenb(-/-) fish develop tumors at a relatively high incidence (10.2%) and most tumors developed close to the eye (26/30). Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena(-/-)ptenb(+/-) fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena(+/-)ptenb(-/-) and ptena(-/-)ptenb(+/-) fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena(+/-)ptenb(-/-) zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  18. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  19. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.


    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  20. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins. (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L


    The Chloroplast 2010 Project ( identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center ( Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  1. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project ( identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center ( Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  2. Adenovirus carrying gene encoding Haliotis discus discus sialic acid binding lectin induces cancer cell apoptosis. (United States)

    Yang, Xinyan; Wu, Liqin; Duan, Xuemei; Cui, Lianzhen; Luo, Jingjing; Li, Gongchu


    Lectins exist widely in marine bioresources such as bacteria, algae, invertebrate animals and fishes. Some purified marine lectins have been found to elicit cytotoxicity to cancer cells. However, there are few reports describing the cytotoxic effect of marine lectins on cancer cells through virus-mediated gene delivery. We show here that a replication-deficient adenovirus-carrying gene encoding Haliotis discus discus sialic acid binding lectin (Ad.FLAG-HddSBL) suppressed cancer cell proliferation by inducing apoptosis, as compared to the control virus Ad.FLAG. A down-regulated level of anti-apoptosis factor Bcl-2 was suggested to be responsible for the apoptosis induced by Ad.FLAG-HddSBL infection. Further subcellular localization studies revealed that HddSBL distributed in cell membrane, ER, and the nucleus, but not in mitochondria and Golgi apparatus. In contrast, a previously reported mannose-binding lectin Pinellia pedatisecta agglutinin entered the nucleus as well, but did not distribute in inner membrane systems, suggesting differed intracellular sialylation and mannosylation, which may provide different targets for lectin binding. Further cancer-specific controlling of HddSBL expression and animal studies may help to provide insights into a novel way of anti-cancer marine lectin gene therapy. Lectins may provide a reservoir of anti-cancer genes.

  3. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon


    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  4. The Bradyrhizobium japonicum frcB Gene Encodes a Diheme Ferric Reductase ▿† (United States)

    Small, Sandra K.; O'Brian, Mark R.


    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria. PMID:21705608

  5. The Bradyrhizobium japonicum frcB gene encodes a diheme ferric reductase. (United States)

    Small, Sandra K; O'Brian, Mark R


    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria.

  6. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa


    Full Text Available The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produce a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous genes. We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters.

  7. Hypoxia-inducible genes encoding small EF-hand proteins in rice and tomato. (United States)

    Otsuka, Chie; Minami, Ikuko; Oda, Kenji


    Rice has evolved metabolic and morphological adaptations to low-oxygen stress to grow in submerged paddy fields. To characterize the molecular components that mediate the response to hypoxia in rice, we identified low-oxygen stress early response genes by microarray analysis. Among the highly responsive genes, five genes, OsHREF1 to OsHREF5, shared strong homology. They encoded small proteins harboring two EF-hands, typical Ca(2+)-binding motifs. Homologous genes were found in many land plants, including SlHREF in tomato, which is also strongly induced by hypoxia. SlHREF induction was detected in both roots and shoots of tomato plants under hypoxia. With the exception of OsHREF5, OsHREF expression was unaffected by drought, salinity, cold, or osmotic stress. Fluorescent signals of green fluorescent protein-fused OsHREFs were detected in the cytosol and nucleus. Ruthenium red, an inhibitor of intracellular Ca(2+) release, repressed induction of OsHREF1-4 under hypoxia. The HREFs may be related to the Ca(2+) response to hypoxia.

  8. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor]. (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin


    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  9. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans (United States)

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja


    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress. PMID:15115284

  10. Mitochondrial Genes of Dinoflagellates Are Transcribed by a Nuclear-Encoded Single-Subunit RNA Polymerase.

    Directory of Open Access Journals (Sweden)

    Chang Ying Teng

    Full Text Available Dinoflagellates are a large group of algae that contribute significantly to marine productivity and are essential photosynthetic symbionts of corals. Although these algae have fully-functioning mitochondria and chloroplasts, both their organelle genomes have been highly reduced and the genes fragmented and rearranged, with many aberrant transcripts. However, nothing is known about their RNA polymerases. We cloned and sequenced the gene for the nuclear-encoded mitochondrial polymerase (RpoTm of the dinoflagellate Heterocapsa triquetra and showed that the protein presequence targeted a GFP construct into yeast mitochondria. The gene belongs to a small gene family, which includes a variety of 3'-truncated copies that may have originated by retroposition. The catalytic C-terminal domain of the protein shares nine conserved sequence blocks with other single-subunit polymerases and is predicted to have the same fold as the human enzyme. However, the N-terminal (promoter binding/transcription initiation domain is not well-conserved. In conjunction with the degenerate nature of the mitochondrial genome, this suggests a requirement for novel accessory factors to ensure the accurate production of functional mRNAs.

  11. Polymorphisms in genes encoding the serotonin and dopamine pathways in two sisters with metachromatic leukodystrophy. (United States)

    Kumperscak, H G; Dolzan, V; Videtic, A; Plesnicar, B K


    Metachromatic leukodystrophy (MLD) is a metabolic disease that has recently been investigated as a model for the study of psychosis. We report on two sisters with adult-type MLD who developed psychiatric symptomatology, but differed in their expression of psychotic and depressive symptoms. Association studies have indicated that polymorphisms in genes encoding the serotonin and dopamine transporters and receptors are related to the symptomatology of schizophrenia and/or depression; hence both sisters were genotyped for some of these candidate genes. The sisters shared dopamine receptor D(2) (DRD(2)) c.1047GG (p.311Ser/Ser) and c.-141Cins/ins polymorphisms, which are significantly associated with schizophrenia, but differed in the serotonin transporter gene-linked polymorphic region and serotonin receptor 1A (5-HT(1A)) c.-1019C to G polymorphisms, which may have increased the elder sister's susceptibility to depressive symptoms. Much bigger samples would be needed to gain enough statistical power to develop any hypotheses. This is the first report on genotyping MLD patients for candidate genes for psychiatric disorders, although MLD has been proposed as a model for schizophrenia.


    Directory of Open Access Journals (Sweden)

    sri sumarsih


    Full Text Available b-Xylosidase encoding gene from G. thermoleovorans IT-08 had been expressed in the pHIS1525/ B. megaterium MS941 system. The b-xylosidase gene (xyl was inserted into plasmid pHIS1525 and propagated in E. coli DH10b. The recombinant plasmid was transformed into B. megaterium MS941 by protoplast transformation. Transformants were selected by growing the recombinant cells on solid LB medium containing tetracycline (10 µg/ ml. The expression of the b-xylosidase gene was assayed by overlaid the recombinant B. megaterium MS941 cell with agar medium containing 0.2% ethylumbelliferyl-b-D-xyloside (MUX. This research showed that the b-xylosidase gene was succesfully sub-cloned in pHIS1525 system and expressed by the recombinant B. megaterium MS941. Theaddition of 0.5% xylose into the culture medium could increase the activity of recombinantactivity of recombinant of recombinantb-xylosidase by 2.74 fold. The recombinant B. megaterium MS941 secreted 75.56% of the expressed b-xylosidase into culture medium. The crude extract b-xylosidase showed the optimum activity at 50° C and pH 6. The recombinant b-xylosidase was purified from culture supernatant by affinity chromatographic method using agarose containing Ni-NTA (Nickel-Nitrilotriacetic acid. The pure b-xylosidase showed a specific activity of 10.06 Unit/mg protein and relative molecular weight ± 58 kDa.

  13. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall


    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  14. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J


    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  15. Enhanced expression in tobacco of the gene encoding green fluorescent protein by modification of its codon usage

    NARCIS (Netherlands)

    Rouwendal, G.J.A.; Mendes, O.; Wolbert, E.J.H.; Boer, de A.D.


    The gene encoding green fluorescent protein (GFP) from Aequorea victoria was resynthesized to adapt its codon usage for expression in plants by increasing the frequency of codons with a C or a G in the third position from 32 to 60%. The strategy for constructing the synthetic gfp gene was based on

  16. Prevalence of genes encoding for members of the staphylococcal leukotoxin family among clinical isolates of Staphylococcus aureus

    NARCIS (Netherlands)

    von Eiff, Christof; Friedrich, Alexander W.; Peters, Georg; Becker, Karsten

    Well-characterized Staphylococcus aureus nasal and blood isolates (N = 429) were tested by polymerase chain reaction for the prevalence of genes that encode leukocidal toxins. The leukotoxin genes lukE+lukD were found at high prevalence, significantly more so in blood (82%) than in nasal isolates

  17. Cloning and Characterization of a Gene (mspA) Encoding the Major Sheath Protein of Treponema maltophilum ATCC 51939T (United States)

    Heuner, Klaus; Choi, Bong-Kyu; Schade, Rüdiger; Moter, Annette; Otto, Albrecht; Göbel, Ulf B.


    The major sheath protein-encoding gene (mspA) of the oral spirochete Treponema maltophilum ATCC 51939T was cloned by screening a genomic library with an anti-outer membrane fraction antibody. The mspA gene encodes a precursor protein of 575 amino acids with a predicted molecular mass of 62.3 kDa, including a signal peptide of 19 amino acids. The native MspA formed a heat-modifiable, detergent- and trypsin-stable complex which is associated with the outer membrane. Hybridization with an mspA-specific probe showed no cross-reactivity with the msp gene from Treponema denticola. PMID:9922270

  18. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters. (United States)

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H


    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s). (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar


    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  20. Demonstration of expression of a neuropeptide-encoding gene in crustacean hemocytes. (United States)

    Wu, Su-Hua; Chen, Yan-Jhou; Huang, Shao-Yen; Tsai, Wei-Shiun; Wu, Hsin-Ju; Hsu, Tsan-Ting; Lee, Chi-Ying


    Crustacean hyperglycemic hormone (CHH) was originally identified in a neuroendocrine system-the X-organ/sinus gland complex. In this study, a cDNA (Prc-CHH) encoding CHH precursor was cloned from the hemocyte of the crayfish Procambarus clarkii. Analysis of tissues by a CHH-specific enzyme-linked immunosorbent assay (ELISA) confirmed the presence of CHH in hemocytes, the levels of which were much lower than those in the sinus gland, but 2 to 10 times higher than those in the thoracic and cerebral ganglia. Total hemocytes were separated by density gradient centrifugation into layers of hyaline cell (HC), semi-granular cell (SGC), and granular cell (GC). Analysis of extracts of each layer using ELISA revealed that CHH is present in GCs (202.8±86.7 fmol/mg protein) and SGCs (497.8±49.4 fmol/mg protein), but not in HCs. Finally, CHH stimulated the membrane-bound guanylyl cyclase (GC) activity of hemocytes in a dose-dependent manner. These data for the first time confirm that a crustacean neuropeptide-encoding gene is expressed in cells essential for immunity and its expression in hemocytes is cell type-specific. Effect of CHH on the membrane-bound GC activity of hemocyte suggests that hemocyte is a target site of CHH. Possible functions of the hemocyte-derived CHH are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Lateral gene transfer of streptococcal ICE element RD2 (region of difference 2 encoding secreted proteins

    Directory of Open Access Journals (Sweden)

    Mereghetti Laurent


    Full Text Available Abstract Background The genome of serotype M28 group A Streptococcus (GAS strain MGAS6180 contains a novel genetic element named Region of Difference 2 (RD2 that encodes seven putative secreted extracellular proteins. RD2 is present in all serotype M28 strains and strains of several other GAS serotypes associated with female urogenital infections. We show here that the GAS RD2 element is present in strain MGAS6180 both as an integrative chromosomal form and a circular extrachromosomal element. RD2-like regions were identified in publicly available genome sequences of strains representing three of the five major group B streptococcal serotypes causing human disease. Ten RD2-encoded proteins have significant similarity to proteins involved in conjugative transfer of Streptococcus thermophilus integrative chromosomal elements (ICEs. Results We transferred RD2 from GAS strain MGAS6180 (serotype M28 to serotype M1 and M4 GAS strains by filter mating. The copy number of the RD2 element was rapidly and significantly increased following treatment of strain MGAS6180 with mitomycin C, a DNA damaging agent. Using a PCR-based method, we also identified RD2-like regions in multiple group C and G strains of Streptococcus dysgalactiae subsp.equisimilis cultured from invasive human infections. Conclusions Taken together, the data indicate that the RD2 element has disseminated by lateral gene transfer to genetically diverse strains of human-pathogenic streptococci.

  2. The zebrafish moonshine gene encodes transcriptional intermediary factor 1gamma, an essential regulator of hematopoiesis.

    Directory of Open Access Journals (Sweden)

    David G Ransom


    Full Text Available Hematopoiesis is precisely orchestrated by lineage-specific DNA-binding proteins that regulate transcription in concert with coactivators and corepressors. Mutations in the zebrafish moonshine (mon gene specifically disrupt both embryonic and adult hematopoiesis, resulting in severe red blood cell aplasia. We report that mon encodes the zebrafish ortholog of mammalian transcriptional intermediary factor 1gamma (TIF1gamma (or TRIM33, a member of the TIF1 family of coactivators and corepressors. During development, hematopoietic progenitor cells in mon mutants fail to express normal levels of hematopoietic transcription factors, including gata1, and undergo apoptosis. Three different mon mutant alleles each encode premature stop codons, and enforced expression of wild-type tif1gamma mRNA rescues embryonic hematopoiesis in homozygous mon mutants. Surprisingly, a high level of zygotic tif1gamma mRNA expression delineates ventral mesoderm during hematopoietic stem cell and progenitor formation prior to gata1 expression. Transplantation studies reveal that tif1gamma functions in a cell-autonomous manner during the differentiation of erythroid precursors. Studies in murine erythroid cell lines demonstrate that Tif1gamma protein is localized within novel nuclear foci, and expression decreases during erythroid cell maturation. Our results establish a major role for this transcriptional intermediary factor in the differentiation of hematopoietic cells in vertebrates.

  3. Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2.

    Directory of Open Access Journals (Sweden)

    Catherine Dodé


    Full Text Available Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2 and one of its ligands, prokineticin-2 (PROK2, respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome.

  4. Growth Characteristics of Methanomassiliicoccus luminyensis and Expression of Methyltransferase Encoding Genes

    Directory of Open Access Journals (Sweden)

    Lena Kröninger


    Full Text Available DNA sequence analysis of the human gut revealed the presence a seventh order of methanogens referred to as Methanomassiliicoccales. Methanomassiliicoccus luminyensis is the only member of this order that grows in pure culture. Here, we show that the organism has a doubling time of 1.8 d with methanol + H2 and a growth yield of 2.4 g dry weight/mol CH4. M. luminyensis also uses methylamines + H2 (monomethylamine, dimethylamine, and trimethylamine with doubling times of 2.1–2.3 d. Similar cell yields were obtained with equimolar concentrations of methanol and methylamines with respect to their methyl group contents. The transcript levels of genes encoding proteins involved in substrate utilization indicated increased amounts of mRNA from the mtaBC2 gene cluster in methanol-grown cells. When methylamines were used as substrates, mRNA of the mtb/mtt operon and of the mtmBC1 cluster were found in high abundance. The transcript level of mtaC2 was almost identical in methanol- and methylamine-grown cells, indicating that genes for methanol utilization were constitutively expressed in high amounts. The same observation was made with resting cells where methanol always yielded the highest CH4 production rate independently from the growth substrate. Hence, M. luminyensis is adapted to habitats that provide methanol + H2 as substrates.

  5. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang


    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  6. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  7. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster. (United States)

    Gilbert, Lawrence I


    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  8. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny


    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  9. Biodiversity of genes encoding anti-microbial traits within plant associated microbes (United States)

    Mousa, Walaa K.; Raizada, Manish N.


    The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produces a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins, and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous coding sequences (CDS). We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters. PMID:25914708

  10. A Mutation in the Tubulin-Encoding Gene Causes Complex Cortical Malformations and Unilateral Hypohidrosis

    Directory of Open Access Journals (Sweden)

    Shinobu Fukumura MD


    Full Text Available Recent studies have emphasized the association between tubulin gene mutations and developmental abnormalities of the cortex. In this study, the authors identified a mutation in the tubulin-encoding class III β-tubulin ( TUBB3 gene in a 4-year-old boy presenting with brain abnormalities and unilateral hypohidrosis. The patient showed a left internal strabismus, moderate developmental delay, and congenital hypohidrosis of the right side of the body. Magnetic resonance imaging disclosed gyral disorganization mainly in the left perisylvian region, dysmorphic and hypertrophic basal ganglia with fusion between the putamen and caudate nucleus without affecting the anterior limb of the internal capsule, and moderate hypoplasia of the right brain stem and cerebellum. Diffusion tensor imaging studies revealed disorganization of the pyramidal fibers. The amplitude of the sympathetic skin response was low in the right arm, which led to a diagnosis of focal autonomic neuropathy. Sequencing the TUBB3 gene revealed a de novo missense mutation, c.862G>A (p.E288K.

  11. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit. (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Weixin; Xu, Biyu; Jin, Zhiqiang


    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  12. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li


    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  13. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven


    -of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited......The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  14. A flax-retting endopolygalacturonase-encoding gene from Rhizopus oryzae. (United States)

    Xiao, Zhizhuang; Wang, Shaozhao; Bergeron, Hélène; Zhang, Jianchun; Lau, Peter C K


    A polygalacturonase from the filamentous fungus Rhizopus oryzae strain sb (NRRL 29086), previously shown to be effective in the retting of flax fibers, was shown by the analysis of its reaction products on polygalacturonic acid to be an endo-type. By zymogram analysis, the enzyme in the crude culture filtrate appeared as two active species of 37 and 40 kD. The endopolygalacturonase-encoding gene was cloned in Escherichia coli and its translated 383-amino acid sequence found to be identical to that of a presumed exopolygalacturonase found in R. oryzae strain YM9901 and 96% identical to a hypothetical protein (RO3G_04731.1) in the sequenced genome of R. oryzae strain 99-880. Phylogenetic analysis revealed the presence of an unique cluster of Rhizopus polygalacturonase sequences that are separate from other fungal polygalacturonases. Conservation of 12 cysteines appears to be a special feature of this family of Rhizopus polygalacturonase sequences.

  15. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters. (United States)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven; Jørgensen, Morten Egevang; Olsen, Carl Erik; Andersen, Jonathan Sonne; Seynnaeve, David; Verhoye, Thalia; Fulawka, Rudy; Denolf, Peter; Halkier, Barbara Ann


    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica.

  16. A Clostridioides difficile bacteriophage genome encodes functional binary toxin-associated genes. (United States)

    Riedel, Thomas; Wittmann, Johannes; Bunk, Boyke; Schober, Isabel; Spröer, Cathrin; Gronow, Sabine; Overmann, Jörg


    Pathogenic clostridia typically produce toxins as virulence factors which cause severe diseases in both humans and animals. Whereas many clostridia like e.g., Clostridium perfringens, Clostridium botulinum or Clostridium tetani were shown to contain toxin-encoding plasmids, only toxin genes located on the chromosome were detected in Clostridioides difficile so far. In this study, we determined, annotated, and analyzed the complete genome of the bacteriophage phiSemix9P1 using single-molecule real-time sequencing technology (SMRT). To our knowledge, this represents the first C. difficile-associated bacteriophage genome that carries a complete functional binary toxin locus in its genome. Copyright © 2017 Elsevier B.V. All rights reserved.


    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin


    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  18. Ty3 GAG3 and POL3 genes encode the components of intracellular particles. (United States)

    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B


    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposon. Characterization of extracts from cells in which Ty3 expression was induced showed the presence of Ty3 nucleoprotein complexes, or viruslike particles, that migrated on linear sucrose gradients with a size of 156S. These particles are composed of Ty3 RNA, full-length, linear DNA, and proteins. In this study, antibodies raised against peptides predicted from the Ty3 sequence were used to identify Ty3-encoded proteins. These include the capsid (26 kDa), nucleocapsid (9 kDa), and reverse transcriptase (55 kDa) proteins. Ty3 integrase proteins of 61 and 58 kDa were identified previously (L. J. Hansen and S. B. Sandmeyer, J. Virol. 64:2599-2607, 1990). Reverse transcriptase activity associated with the particles was measured by using exogenous and endogenous primer-templates. Immunofluorescence studies of cells overexpressing Ty3 revealed cytoplasmic clusters of immunoreactive proteins. Transmission electron microscopy showed that Ty3 viruslike particles are about 50 nm in diameter. Thus, despite the unusual position specificity of Ty3 upstream of tRNA-coding regions, aspects of the Ty3 life cycle are fundamentally similar to those of retroviruses.

  19. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  20. Gene-based neonatal immune priming potentiates a mucosal adenoviral vaccine encoding mycobacterial Ag85B. (United States)

    Dai, Guixiang; Rady, Hamada F; Huang, Weitao; Shellito, Judd E; Mason, Carol; Ramsay, Alistair J


    Tuberculosis remains a major public health hazard worldwide, with neonates and young infants potentially more susceptible to infection than adults. BCG, the only vaccine currently available, provides some protection against tuberculous meningitis in children but variable efficacy in adults, and is not safe to use in immune compromised individuals. A safe and effective vaccine that could be given early in life, and that could also potentiate subsequent booster immunization, would represent a significant advance. To test this proposition, we have generated gene-based vaccine vectors expressing Ag85B from Mycobacterium tuberculosis (Mtb) and designed experiments to test their immunogenicity and protective efficacy particularly when given in heterologous prime-boost combination, with the initial DNA vaccine component given soon after birth. Intradermal delivery of DNA vaccines elicited Th1-based immune responses against Ag85B in neonatal mice but did not protect them from subsequent aerosol challenge with virulent Mtb H37Rv. Recombinant adenovirus vectors encoding Ag85B, given via the intranasal route at six weeks of age, generated moderate immune responses and were poorly protective. However, neonatal DNA priming following by mucosal boosting with recombinant adenovirus generated strong immune responses, as evidenced by strong Ag85B-specific CD4+ and CD8+ T cell responses, both in the lung-associated lymph nodes and the spleen, by the quality of these responding cells (assessed by their capacity to secrete multiple antimicrobial factors), and by improved protection, as indicated by reduced bacterial burden in the lungs following pulmonary TB challenge. These results suggest that neonatal immunization with gene-based vaccines may create a favorable immunological environment that potentiates the pulmonary mucosal boosting effects of a subsequent heterologous vector vaccine encoding the same antigen. Our data indicate that immunization early in life with mycobacterial

  1. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)



    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  2. [Cloning of y3 gene encoding a tobacco mosaic virus inhibitor from Coprinus comatus and transformation to Nicotiana tabacum]. (United States)

    Wang, Xueren; He, Tao; Zhang, Gaina; Hao, Jianguo; Jia, Jingfen


    The protein Y3 was a TMV inhibitor which was encoded by y3 gene. The aim of this work was to clone the full length of y3 gene from Coprinus comatus and to reveal its inhibitory function to TMV in in vivo conditions. We amplified the unknown 5'- terminal cDNA sequence of y3 gene with 5'- Full RACE Core Set (TaKaRa), obtained the full length of this gene by RT-PCR, constructed the expression plasmid pCAMBIA1301-y3 via inserting gene y3 sequence, CaMV 35 S promoter, and NOS terminator at MCS and transformed it into Nicotiana tabacum via agrobacterium-mediation. The full length of y3 gene was 534 bps including one ORF encoding 130 amino acid residues (GenBank Accession No. GQ859168; EMBL FN546262). The cDNA sequence and its deduced amino acid sequence showed high similarity (94%) to the published fragment of y3 gene sequence. Northern blot analysis proved the transcription of y3 gene in transgenic tobacco plants. The transgenic plants inoculated with TMV expressed the inhibitory activity to TMV. We cloned the full length of y3 gene and obtained transgenic tobacco plants. The expression of y3 gene in transgenic plants improved the inhibitory activity to TMV. The cloning and expression analysis of y3 gene might provide background information for future studying of y3 gene.

  3. [Identification of the gene encoding transglutaminase zymogen from Streptomyces hygroscopicus and its expression in Escherichia coli]. (United States)

    Ren, Zengliang; Zhang, Dongxu; Yu, Meiying; Zhao, Qingxin; Du, Guocheng; Chen, Jian; Wu, Jing


    We identified a microbial transglutaminase (MTGase) gene from Streptomyces hygroscopicus; cloned and expressed it in Escherichia coli. We also analyzed the active sites sequence of S. hygroscopicus MTGase through homologous sequence comparison. Wild-type microbial transglutaminase zymogen (pro-MTGase) was purified from liquid culture of S. hygroscopicus (CCTCC M203062). N-terminal amino acid sequence of this pro-MTGase was determined. According to the N-terminal sequence and the corresponding nucleotide sequence of MTGase from other three Streptomyces species, PCR primers of S. hygroscopicus pro-MTGase were designed and the completed gene of pro-MTGase was amplified and sequenced. The gene was sub-cloned into pET-20b(+) vector downstream pelB signal peptide to construct the expression vector pET/pro-MTG. The nucleotide sequence showed 92% homologue with that of S. platensis and S. caniferus. Rosetta (DE3) pLysS carrying the expression vector was induced with IPTG at 24 and expressed pro-MTGase as extracellular soluble protein. SDS-PAGE showed the expressed recombinant pro-MTGase was about 44 kDa, similar to the wild-type pro-MTGase purified from S. hgroscopicus. Recombinant pro-MTGase was activated with trypsin and the enzyme activity reached to 0.24U/mL. This is the first report of the gene encoding microbial pro-transglutaminase from S. hygroscopicus, and also this is the first report of expression extracellular soluble pro-MTGase in E. coli in our country.

  4. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O


    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ...

  5. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl


    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  6. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo


    feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  7. Cloning of the mouse cDNA encoding DNA topoisomerase I and chromosomal location of the gene. (United States)

    Koiwai, O; Yasui, Y; Sakai, Y; Watanabe, T; Ishii, K; Yanagihara, S; Andoh, T


    The mouse cDNA encoding DNA topoisomerase I (TopoI) was cloned and the nucleotide sequence of 3512 bp was determined. The cDNA clone contained an open reading frame encoding a protein of 767 amino acids (aa), which is 2 aa longer than its human counterpart. Overall aa sequence homology between the mouse and human, and between the mouse and yeast (Saccharomyces cerevisiae) sequences was 96% and 42%, respectively. The mouse TopI gene was mapped at position 54.5 on chromosome 2 from linkage analyses of a three-point cross test with Geg, Ada, and a as marker genes.

  8. The Drosophila homologue of vertebrate myogenic-determination genes encodes a transiently expressed nuclear protein marking primary myogenic cells.


    Paterson, B M; Walldorf, U; Eldridge, J; Dübendorfer, A; Frasch, M; Gehring, W J


    We have isolated a cDNA clone, called Dmyd for Drosophila myogenic-determination gene, that encodes a protein with structural and functional characteristics similar to the members of the vertebrate MyoD family. Dmyd clone encodes a polypeptide of 332 amino acids with 82% identity to MyoD in the 41 amino acids of the putative helix-loop-helix region and 100% identity in the 13 amino acids of the basic domain proposed to contain the essential recognition code for muscle-specific gene activation...

  9. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication. (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J


    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  10. Novel Genes Encoding Hexadecanoic Acid Δ6-Desaturase Activity in a Rhodococcus sp. (United States)

    Araki, Hiroyuki; Hagihara, Hiroshi; Takigawa, Hirofumi; Tsujino, Yukiharu; Ozaki, Katsuya


    cis-6-Hexadecenoic acid, a major component of human sebaceous lipids, is involved in the defense mechanism against Staphylococcus aureus infection in healthy skin and closely related to atopic dermatitis. Previously, Koike et al. (Biosci Biotechnol Biochem 64:1064-1066, 2000) reported that a mutant strain of Rhodococcus sp. produced cis-6-hexadecenoate derivatives from palmitate alkyl esters. From the mutant Rhodococcus strain, we identified and sequenced two open reading frames present in an amplified 5.7-kb region; these open reading frames encoded tandemly repeated Δ6-desaturase-like genes, Rdes1 and Rdes2. A phylogenetic tree indicated that Rdes1 and Rdes2 were different from previously known Δ6-desaturase genes, and that they formed a new cluster. Rdes1 and Rdes2 were each introduced into vectors and then expressed separately in Escherichia coli, and the fatty acid composition of the transformed cells was analyzed by gas chromatography and mass spectrometry. The amount of cis-6-hexadecenoic acid was significantly higher in Rdes1- or Rdes2-transformed E. coli cells (twofold and threefold, respectively) than in vector-only control cells. These results showed that cis-6-hexadecenoic acid was produced in E. coli cells by the rhodococcal Δ6-desaturase-like proteins.

  11. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods


    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  12. Little things make big things happen: A summary of micropeptide encoding genes

    Directory of Open Access Journals (Sweden)

    Jeroen Crappé


    Full Text Available Classical bioactive peptides are cleaved from larger precursor proteins and are targeted toward the secretory pathway by means of an N-terminal signaling sequence. In contrast, micropeptides encoded from small open reading frames, lack such signaling sequence and are immediately released in the cytoplasm after translation. Over the past few years many such non-canonical genes (including open reading frames, ORFs smaller than 100 AAs have been discovered and functionally characterized in different eukaryotic organisms. Furthermore, in silico approaches enabled the prediction of the existence of many more putatively coding small ORFs in the genomes of Sacharomyces cerevisiae, Arabidopsis thaliana, Drosophila melanogaster and Mus musculus. However, questions remain as to what the functional role of this new class of eukaryotic genes might be, and how widespread they are. In the future, approaches integrating in silico, conservation-based prediction and a combination of genomic, proteomic and functional validation methods will prove to be indispensable to answer these open questions.

  13. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.


    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  14. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean. (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C


    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  15. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I. (United States)

    Roten, C A; Brandt, C; Karamata, D


    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  16. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate (United States)

    Yusuf, Y.; Hidayati, W.


    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  17. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase. (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J


    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  18. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  19. Diversity of β-lactamase-encoding genes among Gram-negative isolates from water samples in Northern Portugal


    Manageiro, Vera; Ferreira, Eugénia; Figueira, Vânia; Manaia, Célia M.; Caniça, Manuela


    Water has been recognized as a reservoir for antibiotic resistance genes (ARG), where the presence of mobile genetic elements, including plasmids, favors their dissemination. It is noteworthy that non- pathogenic environmental organisms, where plasmids encoding multiple ARG are prevalent, can provide resistance to most classes of antimicrobials including :-lactams, aminoglycosides, chloramphenicol, trimethoprim, streptomycin, fosfomycin, q...

  20. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572 (United States)

    Tomas Johansson; Per Olof Nyman; Daniel Cullen


    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  1. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther


    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  2. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning (United States)

    Mokin, Maxim; Keifer, Joyce


    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  3. Annotation and analysis of malic enzyme genes encoding for multiple isoforms in the fungus Mucor circinelloides CBS 277.49. (United States)

    Vongsangnak, Wanwipa; Zhang, Yingtong; Chen, Wei; Ratledge, Colin; Song, Yuanda


    Based on the newly-released genomic data of Mucor circinelloides CBS 277.49, we have annotated five genes encoding for malic enzyme: all code for proteins that contain conserved domains/motifs for malic acid binding, NAD(+) binding and NAD(P)(+) binding. Phylogenetic analysis for malic enzyme genes showed that genes ID 78524 and 11639 share ~80% amino acid identity and are grouped in cluster 1; genes ID 182779, 186772 and 116127 share ~66% amino acid identity are grouped in cluster 2. Genes ID 78524, 11639 and 166127 produce proteins that are localized in the mitochondrion, while the products from genes 182779 and 186772 are localized in the cytosol. Based on the comparative analysis published previously by Song et al. (Microbiology 147:1507-1515, 2001), we propose that malic enzyme genes ID 78524, 166127, 182779, 186772, 11639, respectively, represent protein isoforms I, II, III/IV, V, and VI.

  4. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin


    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  5. The life-extending gene Indy encodes an exchanger for Krebs-cycle intermediates. (United States)

    Knauf, Felix; Mohebbi, Nilufar; Teichert, Carsten; Herold, Diana; Rogina, Blanka; Helfand, Stephen; Gollasch, Maik; Luft, Friedrich C; Aronson, Peter S


    A longevity gene called Indy (for 'I'm not dead yet'), with similarity to mammalian genes encoding sodium-dicarboxylate cotransporters, was identified in Drosophila melanogaster. Functional studies in Xenopus oocytes showed that INDY mediates the flux of dicarboxylates and citrate across the plasma membrane, but the specific transport mechanism mediated by INDY was not identified. To test whether INDY functions as an anion exchanger, we examined whether substrate efflux is stimulated by transportable substrates added to the external medium. Efflux of [14C]citrate from INDY-expressing oocytes was greatly accelerated by the addition of succinate to the external medium, indicating citrate-succinate exchange. The succinate-stimulated [14C]citrate efflux was sensitive to inhibition by DIDS (4,4'-di-isothiocyano-2,2'-disulphonic stilbene), as demonstrated previously for INDY-mediated succinate uptake. INDY-mediated efflux of [14C]citrate was also stimulated by external citrate and oxaloacetate, indicating citrate-citrate and citrate-oxaloacetate exchange. Similarly, efflux of [14C]succinate from INDY-expressing oocytes was stimulated by external citrate, alpha-oxoglutarate and fumarate, indicating succinate-citrate, succinate-alpha-oxoglutarate and succinate-fumarate exchange respectively. Conversely, when INDY-expressing Xenopus oocytes were loaded with succinate and citrate, [14C]succinate uptake was markedly stimulated, confirming succinate-succinate and succinate-citrate exchange. Exchange of internal anion for external citrate was markedly pH(o)-dependent, consistent with the concept that citrate is co-transported with a proton. Anion exchange was sodium-independent. We conclude that INDY functions as an exchanger of dicarboxylate and tricarboxylate Krebs-cycle intermediates. The effect of decreasing INDY activity, as in the long-lived Indy mutants, may be to alter energy metabolism in a manner that favours lifespan extension.

  6. A novel protein encoded by the circular form of the SHPRH gene suppresses glioma tumorigenesis. (United States)

    Zhang, Maolei; Huang, Nunu; Yang, Xuesong; Luo, Jingyan; Yan, Sheng; Xiao, Feizhe; Chen, Wenping; Gao, Xinya; Zhao, Kun; Zhou, Huangkai; Li, Ziqiang; Ming, Liu; Xie, Bo; Zhang, Nu


    Circular RNAs (circRNAs) are recognized as functional non-coding transcripts in eukaryotic cells. Recent evidence has indicated that even though circRNAs are generally expressed at low levels, they may be involved in many physiological or pathological processes, such as gene regulation, tissue development and carcinogenesis. Although the 'microRNA sponge' function is well characterized, most circRNAs do not contain perfect trapping sites for microRNAs, which suggests the possibility that circRNAs have functions that have not yet been defined. In this study, we show that a circRNA containing an open reading frame (ORF) driven by the internal ribosome entry site (IRES) can translate a functional protein. The circular form of the SNF2 histone linker PHD RING helicase (SHPRH) gene encodes a novel protein that we termed SHPRH-146aa. Circular SHPRH (circ-SHPRH) uses overlapping genetic codes to generate a 'UGA' stop codon, which results in the translation of the 17 kDa SHPRH-146aa. Both circ-SHPRH and SHPRH-146aa are abundantly expressed in normal human brains and are down-regulated in glioblastoma. The overexpression of SHPRH-146aa in U251 and U373 glioblastoma cells reduces their malignant behavior and tumorigenicity in vitro and in vivo. Mechanistically, SHPRH-146aa protects full-length SHPRH from degradation by the ubiquitin proteasome. Stabilized SHPRH sequentially ubiquitinates proliferating cell nuclear antigen (PCNA) as an E3 ligase, leading to inhibited cell proliferation and tumorigenicity. Our findings provide a novel perspective regarding circRNA function in physiological and pathological processes. Specifically, SHPRH-146aa generated from overlapping genetic codes of circ-SHPRH is a tumor suppressor in human glioblastoma.

  7. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium. (United States)

    Todd, Sarah J; Moir, Arthur J G; Johnson, Matt J; Moir, Anne


    The exosporium is the outermost layer of spores of Bacillus cereus and its close relatives Bacillus anthracis and Bacillus thuringiensis. For these pathogens, it represents the surface layer that makes initial contact with the host. To date, only the BclA glycoprotein has been described as a component of the exosporium; this paper defines 10 more tightly associated proteins from the exosporium of B. cereus ATCC 10876, identified by N-terminal sequencing of proteins from purified, washed exosporium. Likely coding sequences were identified from the incomplete genome sequence of B. anthracis or B. cereus ATCC 14579, and the precise corresponding sequence from B. cereus ATCC 10876 was defined by PCR and sequencing. Eight genes encode likely structural components (exsB, exsC, exsD, exsE, exsF, exsG, exsJ, and cotE). Several proteins of the exosporium are related to morphogenetic and outer spore coat proteins of B. subtilis, but most do not have homologues in B. subtilis. ExsE is processed from a larger precursor, and the CotE homologue appears to have been C-terminally truncated. ExsJ contains a domain of GXX collagen-like repeats, like the BclA exosporium protein of B. anthracis. Although most of the exosporium genes are scattered on the genome, bclA and exsF are clustered in a region flanking the rhamnose biosynthesis operon; rhamnose is part of the sugar moiety of spore glycoproteins. Two enzymes, alanine racemase and nucleoside hydrolase, are tightly adsorbed to the exosporium layer; they could metabolize small molecule germinants and may reduce the sensitivity of spores to these, limiting premature germination.

  8. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas


    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  9. Gene encoding erythrocyte binding ligand linked to blood stage multiplication rate phenotype in Plasmodium yoelii yoelii. (United States)

    Pattaradilokrat, Sittiporn; Culleton, Richard L; Cheesman, Sandra J; Carter, Richard


    Variation in the multiplication rate of blood stage malaria parasites is often positively correlated with the severity of the disease they cause. The rodent malaria parasite Plasmodium yoelii yoelii has strains with marked differences in multiplication rate and pathogenicity in the blood. We have used genetic analysis by linkage group selection (LGS) to identify genes that determine differences in multiplication rate. Genetic crosses were generated between genetically unrelated, fast- (17XYM) and slowly multiplying (33XC) clones of P. y. yoelii. The uncloned progenies of these crosses were placed under multiplication rate selection in blood infections in mice. The selected progenies were screened for reduction in intensity of quantitative genetic markers of the slowly multiplying parent. A small number of strongly selected markers formed a linkage group on P. y. yoelii chromosome 13. Of these, that most strongly selected marked the gene encoding the P. yoelii erythrocyte binding ligand (pyebl), which has been independently identified by Otsuki and colleagues [Otsuki H, et al. (2009) Proc Natl Acad Sci USA 106:10.1073/pnas.0811313106] as a major determinant of virulence in these parasites. In an analysis of a previous genetic cross in P. y. yoelii, pyebl alleles of fast- and slowly multiplying parents segregated with the fast and slow multiplication rate phenotype in the cloned recombinant progeny, implying the involvement of the pyebl locus in determining the multiplication rate. Our genome-wide LGS analysis also indicated effects of at least 1 other locus on multiplication rate, as did the findings of Otsuki and colleagues on virulence in P. y. yoelii.

  10. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L. (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming


    Proline dehydrogenase (ProDH) (EC is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  11. A novel GDNF-inducible gene, BMZF3, encodes a transcriptional repressor associated with KAP-1

    International Nuclear Information System (INIS)

    Suzuki, Chikage; Murakumo, Yoshiki; Kawase, Yukari; Sato, Tomoko; Morinaga, Takatoshi; Fukuda, Naoyuki; Enomoto, Atsushi; Ichihara, Masatoshi; Takahashi, Masahide


    The Krueppel-associated box (KRAB)-containing zinc finger proteins (ZFPs) comprise the largest family of zinc finger transcription factors that function as transcriptional repressors. In the study of glial cell line-derived neurotrophic factor (GDNF)-RET signaling, we have identified bone marrow zinc finger 3 (BMZF3), encoding a KRAB-ZFP, as a GDNF-inducible gene by differential display analysis. The expression of BMZF3 transcripts in the human neuroblastoma cell line TGW increased 1 h after GDNF stimulation, as determined by Northern blotting and quantitative reverse-transcriptase polymerase chain reaction. The BMZF3 possesses transcriptional repressor activity in the KRAB domain. BMZF3 interacts with a co-repressor protein, KRAB-associated protein 1 (KAP-1), through the KRAB domain and siRNA-mediated knockdown of KAP-1 abolished the transcriptional repressor activity of BMZF3, indicating that KAP-1 is necessary for BMZF3 function. Furthermore, siRNA-mediated silencing of BMZF3 inhibited cell proliferation. These findings suggest that BMZF3 is a transcriptional repressor induced by GDNF that plays a role in cell proliferation

  12. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Wang, Christian W.; Mkumbaye, Sixbert I.


    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding hum...... the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction....... endothelial protein C receptor (EPCR) through the CIDRα1 domain of certain PfEMP1 were recently associated with severe malaria in children. However, it has remained unclear to which extend the EPCR-binding CIDRα1 domains epitomize PfEMP1 expressed in severe malaria. Here, we characterized the near full......-length transcripts dominating the var transcriptome in children with severe malaria and found that the only common feature of the encoded PfEMP1 was CIDRα1 domains. Such genes were highly and dominantly expressed in both children with severe malarial anaemia and cerebral malaria. These observations support...

  13. Molecular cloning and characterization of two genes encoding dihydroflavonol-4-reductase from Populus trichocarpa.

    Directory of Open Access Journals (Sweden)

    Yan Huang

    Full Text Available Dihydroflavonol 4-reductase (DFR, EC is a rate-limited enzyme in the biosynthesis of anthocyanins and condensed tannins (proanthocyanidins that catalyzes the reduction of dihydroflavonols to leucoanthocyanins. In this study, two full-length transcripts encoding for PtrDFR1 and PtrDFR2 were isolated from Populus trichocarpa. Sequence alignment of the two PtrDFRs with other known DFRs reveals the homology of these genes. The expression profile of PtrDFRs was investigated in various tissues of P. trichocarpa. To determine their functions, two PtrDFRs were overexpressed in tobacco (Nicotiana tabacum via Agrobacterium-mediated transformation. The associated color change in the flowers was observed in all 35S:PtrDFR1 lines, but not in 35S:PtrDFR2 lines. Compared to the wild-type control, a significantly higher accumulation of anthocyanins was detected in transgenic plants harboring the PtrDFR1. Furthermore, overexpressing PtrDFR1 in Chinese white poplar (P. tomentosa Carr. resulted in a higher accumulation of both anthocyanins and condensed tannins, whereas constitutively expressing PtrDFR2 only improved condensed tannin accumulation, indicating the potential regulation of condensed tannins by PtrDFR2 in the biosynthetic pathway in poplars.

  14. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E


    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  15. Effects of light fluence and wavelength on expression of the gene encoding cucumber hydroxypyruvate reductase. (United States)

    Bertoni, G P; Becker, W M


    We have investigated the regulation of cucumber (Cucumis sativus) hydroxypyruvate reductase mRNA abundance in response to white-, red-, and far-red-light treatments. Following irradiation of dark-adapted cucumber seedlings with 15 min to 4 h of either white or red light and return to darkness, the mRNA level for the gene encoding hydroxypyruvate reductase (Hpr) in cotyledons peaks in the darkness 16 to 20 h later. The response of the Hpr mRNA level to total fluence of white light depends more directly on irradiation time than on fluence rate. In addition to this time-dependent component, a phytochrome-dependent component is involved in Hpr regulation in dark-adapted green cotyledons as shown by red-light induction and partial far-red-light reversibility. Parallel measurements of mRNA levels for the ribulose bisphosphate carboxylase/oxygenase small subunit and for the chlorophyll a/b-binding protein show that Hpr is the most responsive to short (about 60 min) white- and red-light treatments and that each mRNA has a characteristic pattern of accumulation in dark-adapted cotyledons in response to light. PMID:8022942

  16. [Cloning and analysis of three genes encoding type II CHH family neuropeptides from Fennropenaeus chinensis]. (United States)

    Wang, Zai-Zhao; Xiang, Jian-Hai


    On the basis of sequence similarity, the crustean hyperglycemic hormone (CHH) family peptides have been classified into two types of hormones: type I and type II. Molt-inhibiting hormone (MIH) is a neuropeptide member of type II CHH family. Molting in shrimp is controlled by MIH and ecdysone. By inhibiting the synthesis of ecdysone in the Y-organ, MIH indirectly suppresses the molting activity of shrimp. In this study, we reported the cloning and characterization of 3 gene fragments encoding type II CHH family neuropeptides of the shrimp Fennropenaeus chinensis. According to the complementary DNA sequence of the mult-inhibiting hormone of Fennropenaeus chinensis, 3 primers were designed and synthesized. MP1 and MP2 are sense primers, and MP3 is anti-sense primer. Polymerase chain reaction was performed using genomic DNA of Fennropenaeus chinensis as template. Three PCR products were obtained using primers MP1 and MP3. Their sizes are about 600 bp, 850 bp, 1050 bp, respectively. A 580 bp PCR product was obtained using primers MP2 and MP3. All the 4 PCR products were cloned into pMD18-T vector. The recombinant clones were sequenced using ABI 310 Genetic Analyzer. After sequencing, all the DNA sequences were searched in the GenBank by Blast program to find similar gene sequences. The searching results revealed 3 DNA fragment sequences were of high similarity with CHH family neuropeptide genes from various crustean species. The 3 DNA fragments were named as NP1, NP2, and NP3. Their sizes were 540 bp, 601 bp, and 826 bp, respectively. Using the mRNA sequences with the most similarity to the 3 sequence fragments as reference, the gene structure of the 3 DNA fragment sequences was analyzed. The exons of 3 sequence fragments were aligned with their similar sequences by Clustal W program. Both NP1 and NP2 consisted of 1 intron and 2 exons. NP3 consisted of 2 introns and 3 exons. Sequence analysis suggested that these 3 products belonged to sequence fragments of neuropeptide


    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo


    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  18. The yeast ISN1 (YOR155c gene encodes a new type of IMP-specific 5'-nucleotidase

    Directory of Open Access Journals (Sweden)

    Schmitter Jean-Marie


    Full Text Available Abstract Background The purine salvage enzyme inosine 5'-monophosphate (IMP-specific 5'-nucleotidase catalyzes degradation of IMP to inosine. Although this enzymatic activity has been purified and characterized in Saccharomyces cerevisiae, the gene encoding IMP 5'-nucleotidase had not been identified. Results Mass spectrometry analysis of several peptides of this enzyme purified from yeast allowed identification of the corresponding gene as YOR155c, an open reading frame of unknown function, renamed ISN1. The deduced Isn1p sequence was clearly not homologous to 5'-nucleotidases from other species. However, significant similarities to Isn1p were found in proteins of unknown function from Neurospora crassa, Plasmodium falciparum and several yeast species. Knock-out of ISN1 resulted in the total loss of IMP-specific 5'-nucleotidase activity, thus confirming that the ISN1 gene indeed encodes the enzymatic activity purified from yeast. In vivo studies revealed that, when IMP is overproduced through constitutive activation of the IMP de novo synthesis pathway, ISN1 is required for excretion of inosine and hypoxanthine in the medium. Conclusion We have identified a new yeast gene, ISN1 (YOR155c, as encoding IMP-specific 5'-nucleotidase activity. The ISN1 gene defines a new type of 5'-nucleotidase which was demonstrated to be functional in vivo.

  19. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)


    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  20. Expression of the nucleus-encoded chloroplast division genes and proteins regulated by the algal cell cycle. (United States)

    Miyagishima, Shin-Ya; Suzuki, Kenji; Okazaki, Kumiko; Kabeya, Yukihiro


    Chloroplasts have evolved from a cyanobacterial endosymbiont and their continuity has been maintained by chloroplast division, which is performed by the constriction of a ring-like division complex at the division site. It is believed that the synchronization of the endosymbiotic and host cell division events was a critical step in establishing a permanent endosymbiotic relationship, such as is commonly seen in existing algae. In the majority of algal species, chloroplasts divide once per specific period of the host cell division cycle. In order to understand both the regulation of the timing of chloroplast division in algal cells and how the system evolved, we examined the expression of chloroplast division genes and proteins in the cell cycle of algae containing chloroplasts of cyanobacterial primary endosymbiotic origin (glaucophyte, red, green, and streptophyte algae). The results show that the nucleus-encoded chloroplast division genes and proteins of both cyanobacterial and eukaryotic host origin are expressed specifically during the S phase, except for FtsZ in one graucophyte alga. In this glaucophyte alga, FtsZ is persistently expressed throughout the cell cycle, whereas the expression of the nucleus-encoded MinD and MinE as well as FtsZ ring formation are regulated by the phases of the cell cycle. In contrast to the nucleus-encoded division genes, it has been shown that the expression of chloroplast-encoded division genes is not regulated by the host cell cycle. The endosymbiotic gene transfer of minE and minD from the chloroplast to the nuclear genome occurred independently on multiple occasions in distinct lineages, whereas the expression of nucleus-encoded MIND and MINE is regulated by the cell cycle in all lineages examined in this study. These results suggest that the timing of chloroplast division in algal cell cycle is restricted by the cell cycle-regulated expression of some but not all of the chloroplast division genes. In addition, it is

  1. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  2. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch


    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  3. Developmentally regulated expression of a human ''finger'' - containing gene encoded by the 5' half of the ret transforming gene

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, M.; Inaguma, Y.; Hiai, H.; Hirose, F.


    The authors isolated and sequenced a cDNA clone of the human gene encoded by the 5' half of the ret transforming gene. The nucleotide sequence indicates that it encodes a protein with ''finger'' structures which represent putative metal- and nucleic acid-binding domains. Transcriptions of this gene was detected at high levels in a variety of human and rodent tumor cell lines, mouse testis, and embryos. In addition, a unique transcript was observed in testis RNA. When the expression of the unique transcript was examined at different stages of spermatogenesis, a striking increase in mRNA levels accompanied progression from meiotic prophase pachytene spermatocytes to postmeiotic round spermatids. This finger-containing gene may thus function in male germ cell development.

  4. Molecular and Biochemical Characterization of Two Xylanase-Encoding Genes from Cellulomonas pachnodae (United States)

    Cazemier, Anne E.; Verdoes, Jan C.; van Ooyen, Albert J. J.; Op den Camp, Huub J. M.


    Two xylanase-encoding genes, named xyn11A and xyn10B, were isolated from a genomic library of Cellulomonas pachnodae by expression in Escherichia coli. The deduced polypeptide, Xyn11A, consists of 335 amino acids with a calculated molecular mass of 34,383 Da. Different domains could be identified in the Xyn11A protein on the basis of homology searches. Xyn11A contains a catalytic domain belonging to family 11 glycosyl hydrolases and a C-terminal xylan binding domain, which are separated from the catalytic domain by a typical linker sequence. Binding studies with native Xyn11A and a truncated derivative of Xyn11A, lacking the putative binding domain, confirmed the function of the two domains. The second xylanase, designated Xyn10B, consists of 1,183 amino acids with a calculated molecular mass of 124,136 Da. Xyn10B also appears to be a modular protein, but typical linker sequences that separate the different domains were not identified. It comprises a N-terminal signal peptide followed by a stretch of amino acids that shows homology to thermostabilizing domains. Downstream of the latter domain, a catalytic domain specific for family 10 glycosyl hydrolases was identified. A truncated derivative of Xyn10B bound tightly to Avicel, which was in accordance with the identified cellulose binding domain at the C terminus of Xyn10B on the basis of homology. C. pachnodae, a (hemi)cellulolytic bacterium that was isolated from the hindgut of herbivorous Pachnoda marginata larvae, secretes at least two xylanases in the culture fluid. Although both Xyn11A and Xyn10B had the highest homology to xylanases from Cellulomonas fimi, distinct differences in the molecular organizations of the xylanases from the two Cellulomonas species were identified. PMID:10473422

  5. Transcriptional regulation of the Rhodococcus rhodochrous J1 nitA gene encoding a nitrilase. (United States)

    Komeda, H; Hori, Y; Kobayashi, M; Shimizu, S


    The 1.4-kb downstream region from a nitrilase gene (nitA) of an actinomycete Rhodococcus rhodochrous J1, which is industrially in use, was found to be required for the isovaleronitrile-dependent induction of nitrilase synthesis in experiments using a Rhodococcus-Escherichia coli shuttle vector pK4 in a Rhodococcus strain. Sequence analysis of the 1.4-kb region revealed the existence of an open reading frame (nitR) of 957 bp, which would encode a protein with a molecular mass of 35,100. Deletion of the central and 3'-terminal portion of nitR resulted in the complete loss of nitrilase activity, demonstrating that nitR codes for a transcriptional positive regulator in nitA expression. The deduced amino acid sequence of nitR showed similarity to a positive regulator family including XylS from Pseudomonas putida and AraC from E. coli. By Northern blot analysis, the 1.4-kb transcripts for nitA were detected in R. rhodochrous J1 cells cultured in the presence of isovaleronitrile, but not those cultured in the absence of isovaleronitrile. The transcriptional start site for nitA was mapped to a C residue located 26 bp upstream of its translational start site. Deletion analysis to define the nitA promoter region suggested the possible participation of an inverted repeat sequence, centered on base pair -52, in induction of nitA transcription. Images Fig. 2 Fig. 5 Fig. 6 PMID:8855219

  6. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)


    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  7. Cloning and expression of a novel, moderately thermostable xylanase-encoding gene (Cflxyn11A) from Cellulomonas flavigena. (United States)

    Amaya-Delgado, Lorena; Mejía-Castillo, Teresa; Santiago-Hernández, Alejandro; Vega-Estrada, Jesús; Amelia, Farrés-G-S; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto; Montes-Horcasitas, María Del Carmen; Hidalgo-Lara, María Eugenia


    The Cfl xyn11A gene, encoding the endo-1,4-beta-xylanase Cfl Xyn11A from Cellulomonas flavigena, was isolated from a genomic DNA library. The open reading frame of the Cfl xyn11A gene was 999 base pairs long and encoded a polypeptide (Cfl Xyn11A) of 332 amino acids with a calculated molecular mass of 35,110Da. The Cfl xyn11A gene was expressed in Escherichia coli and the recombinant enzyme, with an estimated molecular weight of 31kDa was purified and xylanase activity was measured. Cfl Xyn11A showed optimal activity at pH 6.5 and 55 degrees C. The enzyme demonstrated moderate thermal stability as Cfl Xyn11A maintained 50% of its activity when incubated at 55 degrees C for 1h or at 45 degrees C for 6h. This is the first report describing the cloning, expression and functional characterization of an endo-1,4-beta-xylanase-encoding gene from C. flavigena. Cfl Xyn11A may be suitable for industrial applications in the food and feed industries, or in the pre-treatment of lignocellulosic biomass required to improve the yields of fermentable sugars for bioethanol production. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  8. Genome organisation and expression profiling of ABC protein-encoding genes in Heterobasidion annosum s.l. complex. (United States)

    Baral, Bikash; Kovalchuk, Andriy; Asiegbu, Fred O


    Members of Heterobasidion annosum species complex are widely regarded as the most destructive fungal pathogens of conifer trees in the boreal and temperate zones of Northern hemisphere. To invade and colonise their host trees, Heterobasidion fungi must overcome components of host chemical defence, including terpenoid oleoresin and phenolic compounds. ABC transporters may play an important role in this process participating in the export of toxic host metabolites and maintaining their intracellular concentration below the critical level. We have identified and phylogenetically classified Heterobasidion genes encoding ABC transporters and closely related ABC proteins. The number of ABC proteins in the Heterobasidion genome is one of the lowest among analysed species of Agaricomycotina. Using quantitative RT-PCR, we have analysed transcriptional response of Heterobasidion ABC transporter-encoding genes to monoterpenes as well as their expression profile during growth on pine wood in comparison to the growth on defined media. Several ABC transporters were up-regulated during growth on pine wood. The ABC-transporter encoding gene ABCG1.1 was induced both during growth of H. annosum on pine wood and upon exposure to monoterpenes. Our experimental data demonstrate the differential responses of Heterobasidion ABC genes to growth conditions and chemical stressors. The presented results suggest a potential role of Heterobasidion ABC-G transporters in the resistance to the components of conifer chemical defence. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  9. Genomic organization and chromosomal localization of the human and mouse genes encoding the {alpha} receptor component for ciliary neurotrophic factor

    Energy Technology Data Exchange (ETDEWEB)

    Valenzuela, D.M.; Rojas, E.; McClain, J. [Regeneron Pharmaceuticals, Inc., Tarrytown, NY (United States)] [and others


    Ciliary neurotrophic factor (CNTF) has recently been found to share receptor components with, and to be structurally related to, a family of broadly acting cytokines, including interleukin-6, leukemia inhibitory factor, and oncostatin M. However, the CNTF receptor complex also includes a CNTF-specific component known as CNTF receptor {alpha} (CNTFR{alpha}). Here we describe the molecular cloning of the human and mouse genes encoding CNTFR. We report that the human and mouse genes have an identical intron-exon structure that correlates well with the domain structure of CNTFR{alpha}. That is, the signal peptide and the immunoglobulin-like domain are each encoded by single exons, the cytokine receptor-like domain is distributed among 4 exons, and the C-terminal glycosyl phosphatidylinositol recognition domain in encoded by the final coding exon. The position of the introns within the cytokine receptor-like domain corresponds to those found in other members of the cytokine receptor superfamily. Confirming a recent study using radiation hybrids, we have also mapped the human CNTFR gene to chromosome band 9p13 and the mouse gene to a syntenic region of chromosome 4. 24 refs., 4 figs.

  10. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah


    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria...... in nonimmune patients tend to express a restricted subset of VSA (VSA(SM)) that differs from VSA associated with uncomplicated malaria and asymptomatic infection (VSA(UM)). We compared var gene transcription in unselected P. falciparum clone 3D7 expressing VSA(UM) to in vitro-selected sublines expressing VSA......(SM) to identify PfEMP1 responsible for the VSA(SM) phenotype. Expression of VSA(SM) was accompanied by up-regulation of Group A var genes. The most prominently up-regulated Group A gene (PFD1235w/MAL7P1.1) was translated into a protein expressed on the infected RBC surface. The proteins encoded by Group A var...

  11. Genomic cloning and characterization of a PPA gene encoding a mannose-binding lectin from Pinellia pedatisecta. (United States)

    Lin, Juan; Zhou, Xuanwei; Fei, Jiong; Liao, Zhihua; Jin, Wang; Sun, Xiaofen; Tang, Kexuan


    A gene encoding a mannose-binding lectin, Pinellia pedatisecta agglutinin (PPA), was isolated from leaves of Pinellia pedatisecta using genomic walker technology. The ppa contained an 1140-bp 5'-upstream region, a 771-bp open reading frame (ORF) and an 829-bp 3'-downstream region. The ORF encoded a precursor polypeptide of 256 amino acid residues with a 24-amino acid signal peptide. There were one putative TATA box and six possible CAAT boxes lying in the 5'-upstream region of ppa. The ppa showed significant similarity at the nucleic acid level with genes encoding mannose-binding lectins from other Araceae species such as Pinellia ternata, Arisaema hererophyllum, Colocasia esculenta and Arum maculatum. At the amino acid level, PPA also shared varying homology (ranging from 40% to 85%) with mannose-binding lectins from other plant species, such as those from Araceae, Alliaceae, Iridaceae, Lillaceae, Amaryllidaceae and Bromeliaceae. The cloning of the ppa gene not only provides a basis for further investigation of PPA's structure, expression and regulation mechanism, but also enables us to test its potential role in controlling pests and fungal diseases by transferring the gene into tobacco and rice in the future.

  12. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.


    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  13. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  14. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Lei [Los Alamos National Laboratory


    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  15. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki


    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  16. Cloning and characterization of SmZF1, a gene encoding a Schistosoma mansoni zinc finger protein

    Directory of Open Access Journals (Sweden)

    Souza Paulo R Eleutério de


    Full Text Available The zinc finger motifs (Cys2His2 are found in several proteins playing a role in the regulation of transcripton. SmZF1, a Schistosoma mansoni gene encoding a zinc finger protein was initially isolated from an adult worm cDNA library, as a partial cDNA. The full sequence of the gene was obtained by subcloning and sequencing cDNA and genomic fragments. The collated gene sequence is 2181 nt and the complete cDNA sequence is 705 bp containing the full open reading frame of the gene. Analysis of the genome sequence revealed the presence of three introns interrupting the coding region. The open reading frame theoretically encodes a protein of 164 amino acids, with a calculated molecular mass of 18,667Da. The predicted protein contains three zinc finger motifs, usually present in transcription regulatory proteins. PCR amplification with specific primers for the gene allowed for the detection of the target in egg, cercariae, schistosomulum and adult worm cDNA libraries indicating the expression of the mRNA in these life cycle stages of S. mansoni. This pattern of expression suggests the gene plays a role in vital functions of different life cycle stages of the parasite. Future research will be directed to elucidate the functional role of SmZF1.

  17. Effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells

    Directory of Open Access Journals (Sweden)

    O. H. Minchenko


    Full Text Available We have studied the effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells under the inhibition of IRE1 (inositol requiring enzyme-1, which controls cell proliferation and tumor growth as a central mediator of endoplasmic reticulum stress. It was shown that hypoxia down-regulated gene expression of malate dehydrogenase 2 (MDH2, malic enzyme 2 (ME2, mitochondrial aspartate aminotransferase (GOT2, and subunit B of succinate dehydrogenase (SDHB in control (transfected by empty vector glioma cells in a gene specific manner. At the same time, the expression level of mitochondrial NADP+-dependent isocitrate dehydrogenase 2 (IDH2 and subunit D of succinate dehydrogenase (SDHD genes in these cells does not significantly change in hypoxic conditions. It was also shown that the inhibition of ІRE1 signaling enzyme function in U87 glioma cells decreases the effect of hypoxia on the expression of ME2, GOT2, and SDHB genes and introduces the sensitivity of IDH2 gene to hypoxia. Furthermore, the expression of all studied genes depends on IRE1-mediated endoplasmic reticulum stress signaling in gene specific manner, because ІRE1 knockdown significantly decreases their expression in normoxic conditions, except for IDH2 gene, which expression level is strongly up-regulated. Therefore, changes in the expression level of nuclear genes encoding ME2, MDH2, IDH2, SDHB, SDHD, and GOT2 proteins possibly reflect metabolic reprogramming of mitochondria by hypoxia and IRE1-mediated endoplasmic reticulum stress signaling and correlate with suppression of glioma cell proliferation under inhibition of the IRE1 enzyme function.

  18. Expression of the Acc1 Gene-Encoded Acetyl-Coenzyme A Carboxylase in Developing Maize (Zea mays L.) Kernels. (United States)

    Somers, D. A.; Keith, R. A.; Egli, M. A.; Marshall, L. C.; Gengenbach, B. G.; Gronwald, J. W.; Wyse, D. L.


    A mutation (Acc1-S2) in the structural gene for maize (Zea mays L.) acetyl-coenzyme A carboxylase (ACCase) that significantly reduces sethoxydim inhibition of leaf ACCase activity was used to investigate the gene-enzyme relationship regulating ACCase activity during oil deposition in developing kernels. Mutant embryo and endosperm ACCase activities were more than 600-fold less sensitive to sethoxydim inhibition than ACCase in wild-type kernel tissues. Moreover, in vitro cultured mutant kernels developed normally in the presence of sethoxydim concentrations that inhibited wild-type kernel development. The results indicate that the Acc1-encoded ACCase accounts for the majority of ACCase activity in developing maize kernels, suggesting that Acc1-encoded ACCase functions not only during membrane biogenesis in leaves but is also the predominant form of ACCase involved in storage lipid biosynthesis in maize embryos. PMID:12231761

  19. Variation in the Gene Encoding the Serotonin Transporter is Associated with a Measure of Sociopathy in Alcoholics


    Herman, Aryeh I.; Conner, Tamlin S.; Anton, Raymond F.; Gelernter, Joel; Kranzler, Henry R.; Covault, Jonathan


    The present study examined the association between a measure of sociopathy and 5-HTTLPR genotype in a sample of individuals from Project MATCH, a multi-center alcohol treatment trial. 5-HTTLPR, an insertion/deletion polymorphism in SLC6A4, the gene encoding the serotonin transporter protein, results in functionally distinct long (L) and short (S) alleles. The S allele has been associated with a variety of psychiatric disorders and symptoms including alcohol dependence, but it is unknown wheth...

  20. Excretion of putrescine by the putrescine-ornithine antiporter encoded by the potE gene of Escherichia coli.


    Kashiwagi, K; Miyamoto, S; Suzuki, F; Kobayashi, H; Igarashi, K


    Excretion of putrescine from Escherichia coli was assessed by measuring its uptake into inside-out membrane vesicles. The vesicles were prepared from wild-type E. coli or E. coli transformed with plasmids containing one of the three polyamine transport systems. The results indicate that excretion of putrescine is catalyzed by the putrescine transport protein, encoded by the potE gene located at 16 min on the E. coli chromosome. Loading of ornithine (or lysine) inside the vesicles was essentia...

  1. ICGA-PSO-ELM approach for accurate multiclass cancer classification resulting in reduced gene sets in which genes encoding secreted proteins are highly represented. (United States)

    Saraswathi, Saras; Sundaram, Suresh; Sundararajan, Narasimhan; Zimmermann, Michael; Nilsen-Hamilton, Marit


    A combination of Integer-Coded Genetic Algorithm (ICGA) and Particle Swarm Optimization (PSO), coupled with the neural-network-based Extreme Learning Machine (ELM), is used for gene selection and cancer classification. ICGA is used with PSO-ELM to select an optimal set of genes, which is then used to build a classifier to develop an algorithm (ICGA_PSO_ELM) that can handle sparse data and sample imbalance. We evaluate the performance of ICGA-PSO-ELM and compare our results with existing methods in the literature. An investigation into the functions of the selected genes, using a systems biology approach, revealed that many of the identified genes are involved in cell signaling and proliferation. An analysis of these gene sets shows a larger representation of genes that encode secreted proteins than found in randomly selected gene sets. Secreted proteins constitute a major means by which cells interact with their surroundings. Mounting biological evidence has identified the tumor microenvironment as a critical factor that determines tumor survival and growth. Thus, the genes identified by this study that encode secreted proteins might provide important insights to the nature of the critical biological features in the microenvironment of each tumor type that allow these cells to thrive and proliferate.

  2. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn


    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  3. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M


    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  4. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M


    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  5. Mutations in the gene encoding the synaptic scaffolding protein SHANK3 are associated with autism spectrum disorders (United States)

    Durand, Christelle M.; Betancur, Catalina; Boeckers, Tobias M.; Bockmann, Juergen; Chaste, Pauline; Fauchereau, Fabien; Nygren, Gudrun; Rastam, Maria; Gillberg, I Carina; Anckarsäter, Henrik; Sponheim, Eili; Goubran-Botros, Hany; Delorme, Richard; Chabane, Nadia; Mouren-Simeoni, Marie-Christine; de Mas, Philippe; Bieth, Eric; Rogé, Bernadette; Héron, Delphine; Burglen, Lydie; Gillberg, Christopher; Leboyer, Marion; Bourgeron, Thomas


    SHANK3 (also known as ProSAP2) regulates the structural organization of dendritic spines and is a binding partner of neuroligins; genes encoding neuroligins are mutated in autism and Asperger syndrome. Here, we report that a mutation of a single copy of SHANK3 on chromosome 22q13 can result in language and/or social communication disorders. These mutations concern only a small number of individuals, but they shed light on one gene dosage-sensitive synaptic pathway that is involved in autism spectrum disorders. PMID:17173049

  6. Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development (United States)


    SIE cop AD nCloning and Expression of Genes for Dengue Virus ,4. CJ Type 2 Encoded Antigens for Rapid Diagnosis and Vaccine Development 0ANNUAL...pVVI and pVVI7 cDNA clones, synthetic peptides homologous to NS5 and NSI regions were synthesized. These peptides are being used at Walter Reed Army...NO. Frederick, MD 21701-5012 63750A 63750 D808 A i 031 11. TITLE (Include Serurity Classification) Cloning and Expression of Genes for Dengue Virus

  7. Analysis of single nucleotide polymorphisms in uridine/cytidine kinase gene encoding metabolic enzyme of 3'-ethynylcytidine. (United States)

    Hasegawa, Takako; Futagami, Michiko; Kim, Hey-Sook; Matsuda, Akira; Wataya, Yusuke


    We investigated single nucleotide polymorphisms (SNPs) in uck2 gene encoding metabolic enzyme of 3'-ethynylcytidine (ECyd) which were associated with drug response of ECyd, and the newly synthesized antitumor ribonucleoside analog. We analized that on exon-intron junction and exon region to affect the qualitative alteration of gene product directly in ECyd sensitive and resistant human cancer cell lines. As the results, cSNP and sSNP were detected in exon 4. In the promoter region, 3 SNPs were detected. Our data seem to be able to give an important knowledge, when ECyd is applied clinically.

  8. DNA inversion within the apolipoproteins AI/CIII/AIV-encoding gene cluster of certain patients with premature atherosclerosis

    International Nuclear Information System (INIS)

    Karathanasis, S.K.; Ferris, E.; Haddad, I.A.


    The genes coding for apolipoproteins (apo) AI, CIII, and AIV, designated APOA1, APOC3, and APOA4, respectively, are closely linked and tandemly organized in the long arm of the human chromosome 11. A DNA rearrangement involving the genes encoding apoAI and apoCIII in certain patients with premature atherosclerosis has been associated with deficiency of both apoAI and apoCIII in the plasma of these patients. Structural characterization of the genes for apoAI and apoCIII in one of these patients indicates that this rearrangement consists of a DNA inversion containing portions of the 3' ends of the apoAI and apoCIII genes, including the DNA region between these genes. The breakpoints of this DNA inversion are located within the fourth exon of the apoAI gene and the first intron of the apoCIII gene. Thus, this DNA inversion results in reciprocal fusion of the apoAI and apoCIII gene transcriptional units. Expression of these gene fusions in cultured mammalian cells results in stable mRNA transcripts with sequences representing fusions of the apoAI and apoCIII mRNAs. These results indicate that absence of transcripts with correct apoAI and apoCIII mRNA sequences causes apoAI and apoCIII deficiency in the plasma of these patients and suggest that these apolipoproteins are involved in cholesterol homeostasis and protection against premature atherosclerosis

  9. Molecular cloning and characterization of five genes encoding pentatricopeptide repeat proteins from Upland cotton (Gossypium hirsutum L.). (United States)

    Yang, Luming; Zhu, Huayu; Guo, Wangzhen; Zhang, Tianzhen


    The pentatricopeptide repeat (PPR) protein family is one of the largest and most complex families in plants. These proteins contain multiple 35-amino acid repeats that are proposed to form a super helix capable of binding RNA. PPR proteins have been implicated in many crucial functions broadly involving organelle biogenesis and plant development. In this study, we identified many genes encoding PPR protein in Upland cotton through an extensive survey of the database of Gossypium hirsutum. Furthermore, we isolated five full-length cDNA of PPR genes from G. hirsutum 0-613-2R which were named GhPPR1-GhPPR5. Domain analysis revealed that the deduced amino acid sequences of GhPPR1-5 contained from 5 to 10 PPR motifs and those PPR proteins were divided into two different PPR subfamilies. GhPPR1-2 belonged to the PLS subfamily and GhPPR3-5 belonged to the P subfamily. Phylogenetic analysis of the five GhPPR proteins and 18 other plant PPR proteins also revealed that the same subfamily clustered together. All five GhPPR genes were differentially but constitutively expressed in roots, stems, leaves, pollens, and fibers based on the gene expression analysis by real-time quantitative RT-PCR. This study is the first report and analysis of genes encoding PPR proteins in cotton.

  10. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  11. Distribution of genes encoding resistance to streptogramin A and related compounds among staphylococci resistant to these antibiotics. (United States)

    Allignet, J; Aubert, S; Morvan, A; el Solh, N


    The levels of resistance to pristinamycin (Pt) and to its major constituents, pristinamycin IIA and IB (PIIA and PIB, respectively; classified as streptogramins A and B, respectively) were determined for 126 staphylococcal isolates. The results suggest tentative susceptibility breakpoints of or = 4 micrograms of PIIA per ml were investigated for the presence of staphylococcal genes encoding resistance to PIIA (vga, vat, and vatB) and PIB (vgb). None of these genes was found in the 4 isolates inhibited by 4 micrograms of PIIA per ml or in 4 of the other 52 isolates tested. The remaining 48 isolates harbored plasmids carrying vatB and vga or combinations of genes (vga-vat-vgb or vga-vat). The absence of any known PIIA resistance gene from the four Staphylococcus aureus isolates inhibited by > or = 8 micrograms of PIIA per ml suggests that there is at least one PIIA resistance mechanism in staphylococci that has not yet been characterized. PMID:8913457

  12. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T


    Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent...... hybridization. The NCK locus is at chromosome region 3q21, a region involved in neoplasia-associated changes; the SHC cognate locus, SHC1, is at 1q21, and the GRB2 locus is at 17q22-qter telomeric to the HOXB and NGFR loci. Both SHC1 and GRB2 are in chromosome regions that may be duplicated in some tumor types....

  13. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre


    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  14. Mutations of the Corynebacterium glutamicum NCgl1221 Gene, Encoding a Mechanosensitive Channel Homolog, Induce l-Glutamic Acid Production▿ (United States)

    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki


    Corynebacterium glutamicum is a biotin auxotroph that secretes l-glutamic acid in response to biotin limitation; this process is employed in industrial l-glutamic acid production. Fatty acid ester surfactants and penicillin also induce l-glutamic acid secretion, even in the presence of biotin. However, the mechanism of l-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in l-glutamic acid secretion without induction. In this study, we analyzed odhA disruptants and found that those which exhibited constitutive l-glutamic acid secretion carried additional mutations in the NCgl1221 gene, which encodes a mechanosensitive channel homolog. These NCgl1221 gene mutations lead to constitutive l-glutamic acid secretion even in the absence of odhA disruption and also render cells resistant to an l-glutamic acid analog, 4-fluoroglutamic acid. Disruption of the NCgl1221 gene essentially abolishes l-glutamic acid secretion, causing an increase in the intracellular l-glutamic acid pool under biotin-limiting conditions, while amplification of the wild-type NCgl1221 gene increased l-glutamate secretion, although only in response to induction. These results suggest that the NCgl1221 gene encodes an l-glutamic acid exporter. We propose that treatments that induce l-glutamic acid secretion alter membrane tension and trigger a structural transformation of the NCgl1221 protein, enabling it to export l-glutamic acid. PMID:17513583

  15. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  16. The p10 gene of Bombyx mori nucleopolyhedrosis virus encodes a ...

    Indian Academy of Sciences (India)

    In baculovirus-based high-level expression of cloned foreign genes, the viral very late gene promoters of polyhedrin (polh) and p10 are extensively exploited. Here we report the cloning and characterization of the p10 gene from a local isolate of Bombyx mori nucleopolyhedrosis virus (BmNPV). The gene harbours a 213-bp ...

  17. The Drosophila gene brainiac encodes a glycosyltransferase putatively involved in glycosphingolipid synthesis

    DEFF Research Database (Denmark)

    Schwientek, Tilo; Keck, Birgit; Levery, Steven B


    of brainiac is less well understood. brainiac is a member of a large homologous mammalian beta3-glycosyltransferase family with diverse functions. Eleven distinct mammalian homologs have been demonstrated to encode functional enzymes forming beta1-3 glycosidic linkages with different UDP donor sugars...... and acceptor sugars. The putative mammalian homologs with highest sequence similarity to brainiac encode UDP-N-acetylglucosamine:beta1,3-N-acetylglucosaminyltransferases (beta3GlcNAc-transferases), and in the present study we show that brainiac also encodes a beta3GlcNAc-transferase that uses beta......-linked mannose as well as beta-linked galactose as acceptor sugars. The inner disaccharide core structures of glycosphingolipids in mammals (Galbeta1-4Glcbeta1-Cer) and insects (Manbeta1-4Glcbeta1-Cer) are different. Both disaccharide glycolipids served as substrates for brainiac, but glycolipids of insect cells...

  18. The bovine T cell receptor alpha/delta locus contains over 400 V genes and encodes V genes without CDR2. (United States)

    Reinink, Peter; Van Rhijn, Ildiko


    Alphabeta T cells and gammadelta T cells perform nonoverlapping immune functions. In mammalian species with a high percentage of very diverse gammadelta T cells, like ruminants and pigs, it is often assumed that alphabeta T cells are less diverse than gammadelta T cells. Based on the bovine genome, we have created a map of the bovine TRA/TRD locus and show that, in cattle, in addition to the anticipated >100 TRDV genes, there are also >300 TRAV or TRAV/DV genes. Among the V genes in the TRA/TRD locus, there are several genes that lack a CDR2 and are functionally rearranged and transcribed and, in some cases, have an extended CDR1. The number of bovine V genes is a multiple of the number in mice and humans and may encode T cell receptors that use a novel way of interacting with antigen.

  19. Genes encoding heterotrimeric G-proteins are associated with gray matter volume variations in the medial frontal cortex. (United States)

    Chavarría-Siles, Iván; Rijpkema, Mark; Lips, Esther; Arias-Vasquez, Alejandro; Verhage, Matthijs; Franke, Barbara; Fernández, Guillén; Posthuma, Danielle


    G-protein-coupled signal transduction mediates most cellular responses to hormones and neurotransmitters; this signaling system transduces a large variety of extracellular stimuli into neurons and is the most widely used mechanism for cell communication at the synaptic level. The heterotrimeric G-proteins have been well established as key regulators of neuronal growth, differentiation, and function. More recently, the heterotrimeric G-protein genes group was associated with general cognitive ability. Although heterotrimeric G-proteins are linked to both cognitive ability and neuron signaling, it is unknown whether heterotrimeric G-proteins are also important for brain structure. We tested for association between local cerebral gray matter volume and the heterotrimeric G-protein genes group in 294 subjects; a replication analysis was performed in an independent sample of 238 subjects. Voxel-based morphometry revealed a strong replicated association between 2 genes encoding heterotrimeric G-proteins with specific local increase in medial frontal cortex volume, an area known to be involved in cognitive control and negative affect. This finding suggests that heterotrimeric G-proteins might modulate medial frontal cortex gray matter volume. The differences in gray matter volume due to variations in genes encoding G-proteins may be explained by the role of G-proteins in prenatal and postnatal neocortex development.

  20. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  1. A second cistron in the CACNA1A gene encodes a transcription factor that mediates cerebellar development and SCA6 (United States)

    Du, Xiaofei; Wang, Jun; Zhu, Haipeng; Rinaldo, Lorenzo; Lamar, Kay-Marie; Palmenberg, Ann C.; Hansel, Christian; Gomez, Christopher M.


    SUMMARY The CACNA1A gene, encoding the voltage-gated calcium channel subunit α1A, is involved in pre- and postsynaptic Ca2+ signaling, gene expression, and several genetic neurological disorders. We found that CACNA1A employs a novel strategy to directly coordinate a gene expression program, using a bicistronic mRNA bearing a cryptic internal ribosomal entry site (IRES). The first cistron encodes the well-characterized α1A subunit. The second expresses a newly-recognized transcription factor, α1ACT, that coordinates expression of a program of genes involved in neural and Purkinje cell development. α1ACT also contains the polyglutamine (polyQ) tract that, when expanded, causes spinocerebellar ataxia type 6 (SCA6). When expressed as an independent polypeptide, α1ACT, bearing an expanded polyQ tract, lacks transcription factor function and neurite outgrowth properties, causes cell death in culture, and leads to ataxia and cerebellar atrophy in transgenic mice. Suppression of CACNA1A IRES function in SCA6 may be a potential therapeutic strategy. PMID:23827678

  2. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  3. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto


    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  4. The Escherichia coli Serogroup O1 and O2 Lipopolysaccharides Are Encoded by Multiple O-antigen Gene Clusters (United States)

    Delannoy, Sabine; Beutin, Lothar; Mariani-Kurkdjian, Patricia; Fleiss, Aubin; Bonacorsi, Stéphane; Fach, Patrick


    Escherichia coli strains belonging to serogroups O1 and O2 are frequently associated with human infections, especially extra-intestinal infections such as bloodstream infections or urinary tract infections. These strains can be associated with a large array of flagellar antigens. Because of their frequency and clinical importance, a reliable detection of E. coli O1 and O2 strains and also the frequently associated K1 capsule is important for diagnosis and source attribution of E. coli infections in humans and animals. By sequencing the O-antigen clusters of various O1 and O2 strains we showed that the serogroups O1 and O2 are encoded by different sets of O-antigen encoding genes and identified potentially new O-groups. We developed qPCR-assays to detect the various O1 and O2 variants and the K1-encoding gene. These qPCR assays proved to be 100% sensitive and 100% specific and could be valuable tools for the investigations of zoonotic and food-borne infection of humans with O1 and O2 extra-intestinal (ExPEC) or Shiga toxin-producing E. coli (STEC) strains. PMID:28224115

  5. Comparative genomics of the family Vibrionaceae reveals the wide distribution of genes encoding virulence-associated proteins

    Directory of Open Access Journals (Sweden)

    Cai Hong


    Full Text Available Abstract Background Species of the family Vibrionaceae are ubiquitous in marine environments. Several of these species are important pathogens of humans and marine species. Evidence indicates that genetic exchange plays an important role in the emergence of new pathogenic strains within this family. Data from the sequenced genomes of strains in this family could show how the genes encoded by all these strains, known as the pangenome, are distributed. Information about the core, accessory and panproteome of this family can show how, for example, genes encoding virulence-associated proteins are distributed and help us understand how virulence emerges. Results We deduced the complete set of orthologs for eleven strains from this family. The core proteome consists of 1,882 orthologous groups, which is 28% of the 6,629 orthologous groups in this family. There were 4,411 accessory orthologous groups (i.e., proteins that occurred in from 2 to 10 proteomes and 5,584 unique proteins (encoded once on only one of the eleven genomes. Proteins that have been associated with virulence in V. cholerae were widely distributed across the eleven genomes, but the majority was found only on the genomes of the two V. cholerae strains examined. Conclusions The proteomes are reflective of the differing evolutionary trajectories followed by different strains to similar phenotypes. The composition of the proteomes supports the notion that genetic exchange among species of the Vibrionaceae is widespread and that this exchange aids these species in adapting to their environments.

  6. Dysregulated gliotoxin biosynthesis attenuates the production of unrelated biosynthetic gene cluster-encoded metabolites in Aspergillus fumigatus. (United States)

    Doyle, Sean; Jones, Gary W; Dolan, Stephen K


    Gliotoxin is an epipolythiodioxopiperazine (ETP) class toxin, contains a disulfide bridge that mediates its toxic effects via redox cycling and is produced by the opportunistic fungal pathogen Aspergillus fumigatus. The gliotoxin bis-thiomethyltransferase, GtmA, attenuates gliotoxin biosynthesis in A. fumigatus by conversion of dithiol gliotoxin to bis-thiomethylgliotoxin (BmGT). Here we show that disruption of dithiol gliotoxin bis-thiomethylation functionality in A. fumigatus results in significant remodelling of the A. fumigatus secondary metabolome upon extended culture. RP-HPLC and LC-MS/MS analysis revealed the reduced production of a plethora of unrelated biosynthetic gene cluster-encoded metabolites, including pseurotin A, fumagillin, fumitremorgin C and tryprostatin B, occurs in A. fumigatus ΔgtmA upon extended incubation. Parallel quantitative proteomic analysis of A. fumigatus wild-type and ΔgtmA during extended culture revealed cognate abundance alteration of proteins encoded by relevant biosynthetic gene clusters, allied to multiple alterations in hypoxia-related proteins. The data presented herein reveal a previously concealed functionality of GtmA in facilitating the biosynthesis of other BGC-encoded metabolites produced by A. fumigatus. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  7. Expression of the Vibrio cholerae gene encoding aldehyde dehydrogenase is under control of ToxR, the cholera toxin transcriptional activator.


    Parsot, C; Mekalanos, J J


    The toxR gene of Vibrio cholerae encodes a transcriptional activator required for the expression of the cholera toxin genes (ctxAB) and more than 15 other genes encoding secreted or membrane proteins. The latter group includes virulence genes involved in the biogenesis of the TCP pilus, the accessory colonization factor, and such ToxR-activated genes as tagA, mutations in which cause no detectable virulence defect in the suckling mouse model. To analyze the regulation of expression and the st...

  8. Fasciola hepatica mucin-encoding gene: expression, variability and its potential relevance in host-parasite relationship. (United States)

    Cancela, Martín; Santos, Guilherme B; Carmona, Carlos; Ferreira, Henrique B; Tort, José Francisco; Zaha, Arnaldo


    Fasciola hepatica is the causative agent of fasciolosis, a zoonosis with significant impact both in human and animal health. Understanding the basic processes of parasite biology, especially those related to interactions with its host, will contribute to control F. hepatica infections and hence liver pathology. Mucins have been described as important mediators for parasite establishment within its host, due to their key roles in immune evasion. In F. hepatica, mucin expression is upregulated in the mammalian invasive newly excysted juvenile (NEJ) stage in comparison with the adult stage. Here, we performed sequencing of mucin cDNAs prepared from NEJ RNA, resulting in six different cDNAs clusters. The differences are due to the presence of a tandem repeated sequence of 66 bp encoded by different exons. Two groups of apomucins one with three and the other with four repeats, with 459 and 393 bp respectively, were identified. These cDNAs have open reading frames encoding Ser-Thr enriched proteins with an N-terminal signal peptide, characteristic of apomucin backbone. We cloned a 4470 bp gene comprising eight exons and seven introns that encodes all the cDNA variants identified in NEJs. By real time polymerase chain reaction and high-resolution melting approaches of individual flukes we infer that fhemuc-1 is a single-copy gene, with at least two different alleles. Our data suggest that both gene polymorphism and alternative splicing might account for apomucin variability in the fhemuc-1 gene that is upregulated in NEJ invasive stage. The relevance of this variation in host-parasite interplay is discussed.

  9. MfLIP1, a gene encoding an extracellular lipase of the lipid-dependent fungus Malassezia furfur. (United States)

    Brunke, Sascha; Hube, Bernhard


    Malassezia furfur is a dimorphic fungus and a member of the normal cutaneous microflora of humans. However, it is also a facultative pathogen, associated with a wide range of skin diseases. One unusual feature of M. furfur is an absolute dependency on externally provided lipids which the fungus hydrolyses by lipolytic activity to release fatty acids necessary for both growth and pathogenicity. In this study, the cloning and characterization of the first gene encoding a secreted lipase of M. furfur possibly associated with this activity are reported. The gene, MfLIP1, shows high sequence similarity to other known extracellular lipases, but is not a member of a lipase gene family in M. furfur. MfLIP1 consists of 1464 bp, encoding a protein with a molecular mass of 54.3 kDa, a conserved lipase motif and an N-terminal signal peptide of 26 aa. By using a genomic library, two other genes were identified flanking MfLIP1, one of them encoding a putative secreted catalase, the other a putative amine oxidase. The cDNA of MfLIP1 was expressed in Pichia pastoris and the biochemical properties of the recombinant lipase were analysed. MfLip1 is most active at 40 degrees C and the pH optimum was found to be 5.8. The lipase hydrolysed lipids, such as Tweens, frequently used as the source of fatty acids in M. furfur media, and had minor esterase activity. Furthermore, the lipase is inhibited by different bivalent metal ions. This is the first molecular description of a secreted lipase from M. furfur.

  10. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)



    Feb 14, 2011 ... Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to ... The lentivirus system encoding FasL induced by deoxycycline promotes apoptosis of Th1 cells. Key words: FasL ..... In the immune system, especially in lymphocytes, apoptosis functions to ...

  11. The naked endosperm genes encode duplicate INDETERMINATE domain transcription factors required for maize endosperm cell patterning and differentiation. (United States)

    Yi, Gibum; Neelakandan, Anjanasree K; Gontarek, Bryan C; Vollbrecht, Erik; Becraft, Philip W


    The aleurone is the outermost layer of cereal endosperm and functions to digest storage products accumulated in starchy endosperm cells as well as to confer important dietary health benefits. Whereas normal maize (Zea mays [Zm]) has a single aleurone layer, naked endosperm (nkd) mutants produce multiple outer cell layers of partially differentiated cells that show sporadic expression of aleurone identity markers such as a viviparous1 promoter-β-glucuronidase transgene. The 15:1 F2 segregation ratio suggested that two recessive genes were involved, and map-based cloning identified two homologous genes in duplicated regions of the genome. The nkd1 and nkd2 genes encode the INDETERMINATE1 domain (IDD) containing transcription factors ZmIDDveg9 and ZmIDD9 on chromosomes 2 and 10, respectively. Independent mutant alleles of nkd1 and nkd2, as well as nkd2-RNA interference lines in which both nkd genes were knocked down, also showed the nkd mutant phenotype, confirming the gene identities. In wild-type kernels, the nkd transcripts were most abundant around 11 to 16 d after pollination. The NKD proteins have putative nuclear localization signals, and green fluorescent protein fusion proteins showed nuclear localization. The mutant phenotype and gene identities suggest that NKD controls a gene regulatory network involved in aleurone cell fate specification and cell differentiation. © 2015 American Society of Plant Biologists. All Rights Reserved.

  12. A Blumeria graminis gene family encoding proteins with a C-terminal variable region with homologues in pathogenic fungi. (United States)

    Grell, Morten N; Mouritzen, Peter; Giese, Henriette


    In a study aimed at characterising, at the molecular level, the obligate biotrophic fungus Blumeria graminis f. sp. hordei (Bgh), we have identified a novel group of genes, the Egh16H genes, and shown that two of these are up-regulated during primary infection of barley leaves. The genes have partial homology to a previously characterised Bgh gene family, Egh16. Egh16 and Egh16H are subfamilies of a larger multigene family with presently about 15 members identified in Bgh. Egh16H has about ten members, and we show that five of these are expressed as highly conserved mRNAs that are predicted to encode proteins with a C-terminal variable region. Egh16H has high homology to sequences in Magnaporthe grisea and other plant pathogenic fungi, as well as sequences of both the insect pathogen Metarhizium anisopliae and the human pathogen Aspergillus fumigatus. No close homologues of Egh16H were found in the non-pathogenic fungi Neurospora crassa and Aspergillus nidulans. We predict that Egh16H plays a general role in the interaction between pathogenic fungi and their hosts. At present, the large number of gene family members with C-terminal variation appears to be unique for Bgh, and the Egh16/Egh16H gene family is to our knowledge the largest gene family so far characterised in this fungus.

  13. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass. (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A


    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  14. Differential Regulation of mnp2, a New Manganese Peroxidase-Encoding Gene from the Ligninolytic Fungus Trametes versicolor PRL 572 (United States)

    Johansson, Tomas; Nyman, Per Olof; Cullen, Daniel


    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased mnp2 transcript levels 250-fold. In contrast, transcript levels of an MRE-containing gene of T. versicolor, mnp1, increased only eightfold under the same conditions. Thus, the manganese peroxidase genes in T. versicolor are differentially regulated, and upstream MREs are not necessarily involved. Our results support the hypothesis that fungal and plant peroxidases arose through an ancient duplication and folding of two structural domains, since we found the mnp1 and mnp2 polypeptides to have internal homology. PMID:11916737

  15. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono


    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  16. Three genes encoding AOP2, a protein involved in aliphatic glucosinolate biosynthesis, are differentially expressed in Brassica rapa. (United States)

    Zhang, Jifang; Liu, Zhiyuan; Liang, Jianli; Wu, Jian; Cheng, Feng; Wang, Xiaowu


    The glucosinolate biosynthetic gene AOP2 encodes an enzyme that plays a crucial role in catalysing the conversion of beneficial glucosinolates into anti-nutritional ones. In Brassica rapa, three copies of BrAOP2 have been identified, but their function in establishing the glucosinolate content of B. rapa is poorly understood. Here, we used phylogenetic and gene structure analyses to show that BrAOP2 proteins have evolved via a duplication process retaining two highly conserved domains at the N-terminal and C-terminal regions, while the middle part has experienced structural divergence. Heterologous expression and in vitro enzyme assays and Arabidopsis mutant complementation studies showed that all three BrAOP2 genes encode functional BrAOP2 proteins that convert the precursor methylsulfinyl alkyl glucosinolate to the alkenyl form. Site-directed mutagenesis showed that His356, Asp310, and Arg376 residues are required for the catalytic activity of one of the BrAOP2 proteins (BrAOP2.1). Promoter-β-glucuronidase lines revealed that the BrAOP2.3 gene displayed an overlapping but distinct tissue- and cell-specific expression profile compared with that of the BrAOP2.1 and BrAOP2.2 genes. Quantitative real-time reverse transcription-PCR assays demonstrated that BrAOP2.1 showed a slightly different pattern of expression in below-ground tissue at the seedling stage and in the silique at the reproductive stage compared with BrAOP2.2 and BrAOP2.3 genes in B. rapa. Taken together, our results revealed that all three BrAOP2 paralogues are active in B. rapa but have functionally diverged. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  17. Pseudomonas aeruginosa LysR PA4203 regulator NmoR acts as a repressor of the PA4202 nmoA gene, encoding a nitronate monooxygenase

    DEFF Research Database (Denmark)

    Vercammen, Ken; Wei, Qing; Charlier, Daniel


    The PA4203 gene encodes a LysR regulator and lies between the ppgL gene (PA4204), which encodes a periplasmic gluconolactonase, and, in the opposite orientation, the PA4202 (nmoA) gene, coding for a nitronate monooxygenase, and ddlA (PA4201), encoding a d-alanine alanine ligase. The intergenic re...

  18. The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes. (United States)

    Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J


    Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of

  19. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi


    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  20. Cloning and characterization of shk2, a gene encoding a novel p21-activated protein kinase from fission yeast. (United States)

    Yang, P; Kansra, S; Pimental, R A; Gilbreth, M; Marcus, S


    We describe the characterization of a novel gene, shk2, encoding a second p21(cdc42/rac)-activated protein kinase (PAK) homolog in fission yeast. Like other known PAKs, Shk2 binds to Cdc42 in vivo and in vitro. While overexpression of either shk2 or cdc42 alone does not impair growth of wild type fission yeast cells, cooverexpression of the two genes is toxic and leads to highly aberrant cell morphology, providing evidence for functional interaction between Cdc42 and Shk2 proteins in vivo. Fission yeast shk2 null mutants are viable and exhibit no obvious phenotypic defects. Overexpression of shk2 restores viability and normal morphology but not full mating competence to fission yeast cells carrying a shk1 null mutation. Additional genetic data suggest that Shk2, like Cdc42 and Shk1, participates in Ras-dependent morphological control and mating response pathways in fission yeast. We also show that overexpression of byr2, a gene encoding a Ste11/MAPK kinase kinase homolog, suppresses the mating defect of cells partially defective for Shk1 function, providing evidence of a link between PAKs and mitogen-activated protein kinase signaling in fission yeast. Taken together, our results suggest that Shk2 is partially overlapping in function with Shk1, with Shk1 being the dominant protein in function.

  1. Identification, characterization and analysis of expression of gene encoding carboxypeptidase A in Anopheles culicifacies A (Diptera: culicidae). (United States)

    Kumar, Ashwani; Sharma, Arvind; Sharma, Richa; Gakhar, S K


    Carboxypeptidases are the digestive enzymes which cleave single amino acid residue from c-terminus of the protein. Digestive carboxypeptidase A gene regulatory elements in insects have shown their efficiency to drive midgut specific expression in transgenic mosquitoes. However no endogenous promoter has been reported for Indian malaria vector Anopheles culicifacies which is major vector in Indian subcontinent. Here we report cloning of carboxypeptidase A gene in the An. culicifacies A including its 5' upstream regions and named AcCP. In the upstream region of the gene an arthropod initiator sequence and two repeat sequences of the particular importance TTATC and GTTTT were also identified. The 1290 base pairs open reading frame encodes a protein of 48.5kDa. The coding region of the gene shares 82% and 72% similarity at nucleotide level with Anopheles gambiae and Ae. aegypti carboxypeptidase A gene, respectively. The peak expression of the gene was found to be at 3h after blood feeding and this is limited to midgut only. Based on the protein sequence, 3D structure of the AcCP was predicted and the active centre of the enzyme was predicted to consist of GLN 183, GLU 186, HIS 308 and Ser 309 amino acid residues. Comparison of the protein sequence among different genera revealed the conservation of zinc binding residues. Phylogenetically, AcCP was found most closely related to An. gambiae. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Limitations of the Echinococcus granulosus genome sequence assemblies for analysis of the gene family encoding the EG95 vaccine antigen. (United States)

    Gauci, Charles G; Alvarez Rojas, Cristian A; Chow, Conan; Lightowlers, Marshall W


    Echinococcus granulosus is an important zoonotic parasite that is distributed worldwide. The EG95 vaccine was developed to assist with control of E. granulosus transmission through the parasite's livestock intermediate hosts. The vaccine is based on a recombinant antigen encoded by a gene which is a member of a multi-gene family. With the recent availability of two E. granulosus draft genomes, we sought to map the eg95 gene family to the genomes. We were unable to map unequivocally any of the eg95 gene family members which had previously been characterized by cloning and sequencing both strands of genomic DNA fragments. Our inability to map EG95-related genes to the genomes has revealed limitations in the assembled sequence data when utilized for gene family analyses. This study contrasts with the expectations expressed in often high-profile publications describing draft genomes of parasitic organisms, highlighting deficiencies in currently available genomic resources for E. granulosus and provides a cautionary note for research which seeks to utilize these genome datasets.

  3. SOA genes encode proteins controlling lipase expression in response to triacylglycerol utilization in the yeast Yarrowia lipolytica. (United States)

    Desfougères, Thomas; Haddouche, Ramdane; Fudalej, Franck; Neuvéglise, Cécile; Nicaud, Jean-Marc


    The oleaginous yeast Yarrowia lipolytica efficiently metabolizes hydrophobic substrates such as alkanes, fatty acids or triacylglycerol. This yeast has been identified in oil-polluted water and in lipid-rich food. The enzymes involved in lipid breakdown, for use as a carbon source, are known, but the molecular mechanisms controlling the expression of the genes encoding these enzymes are still poorly understood. The study of mRNAs obtained from cells grown on oleic acid identified a new group of genes called SOA genes (specific for oleic acid). SOA1 and SOA2 are two small genes coding for proteins with no known homologs. Single- and double-disrupted strains were constructed. Wild-type and mutant strains were grown on dextrose, oleic acid and triacylglycerols. The double mutant presents a clear phenotype consisting of a growth defect on tributyrin and triolein, but not on dextrose or oleic acid media. Lipase activity was 50-fold lower in this mutant than in the wild-type strain. The impact of SOA deletion on the expression of the main extracellular lipase gene (LIP2) was monitored using a LIP2-beta-galactosidase promoter fusion protein. These data suggest that Soa proteins are components of a molecular mechanism controlling lipase gene expression in response to extracellular triacylglycerol.

  4. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L


    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  5. Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. (United States)

    Jones, Des C; Roghanian, Ali; Brown, Damien P; Chang, Chiwen; Allen, Rachel L; Trowsdale, John; Young, Neil T


    Leucocyte Ig-like receptors (LILR) are a family of innate immune receptors expressed on myeloid and lymphoid cells that influence adaptive immune responses. We identified a common mechanism of alternative mRNA splicing, which generates transcripts that encode soluble protein isoforms of the majority of human LILR. These alternative splice variants lack transmembrane and cytoplasmic encoding regions, due to the transcription of a cryptic stop codon present in an intron 5' of the transmembrane encoding exon. The alternative LILR transcripts were detected in cell types that express their membrane-associated isoforms. Expression of the alternative LILRB1 transcript in transfected cells resulted in the release of a soluble approximately 65 Kd LILRB1 protein into culture supernatants. Soluble LILRB1 protein was also detected in the culture supernatants of monocyte-derived DC. In vitro assays suggested that soluble LILRB1 could block the interaction between membrane-associated LILRB1 and HLA-class I. Soluble LILRB1 may act as a dominant negative regulator of HLA-class I-mediated LILRB1 inhibition. Soluble isoforms of the other LILR may function in a comparable way.

  6. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel


    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  7. A transcription unit at the ken and barbie gene locus encodes a novel Drosophila zinc finger protein. (United States)

    Kühnlein, R P; Chen, C K; Schuh, R


    We describe a novel Drosophila transcription unit, located in chromosome region 60A. It encodes a zinc finger protein that is expressed in distinct spatial and temporal patterns during embryogenesis. Its initial expression occurs in a stripe at the anterior and the posterior trunk boundary, respectively. The two stripes are activated and spatially controlled by gap-gene activities. The P-element of the enhancer trap line l(2)02970 is inserted in the 5'-region of the transcript and causes a ken and barbie (ken) phenotype, associated with malformation of male genital structures.

  8. Chimeric vip3Aa16TC Gene Encoding the Toxic Core of the Vegetative Insecticidal Protein Enhanced Bacillus thuringiensis Entomopathogenicity


    Sameh Sellami; Maroua Cherif; Samir Jaoua; Kaïs Jamoussi


    Vip3 insecticidal protein is produced by Bacillus thuringiensis during the vegetative stage. Its proteolysis by the midgut juice of susceptible larvae formed four major products of approximately 66, 45, 33 and 22 kDa. In this study, we cloned the vip3Aa16TC DNA encoding the “Vip3Aa16 toxic core (TC)” of 33 kDa corresponding to the Vip3Aa16 region from amino acid 200 to 456. The vip3Aa16TC chimeric gene carried by the pHT-vip3Aa16TC plasmid was under the control of the sporulation ...

  9. Expression of genes encoding F-1-ATPase results in uncoupling of glycolysis from biomass production in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.


    of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...

  10. A Drosophila gene encoding a protein resembling the human β-amyloid protein precursor

    International Nuclear Information System (INIS)

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K.


    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human β-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human β-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development

  11. Occurrence of blaNDM-1 & absence of blaKPC genes encoding carbapenem resistance in uropathogens from a tertiary care centre from north India

    Directory of Open Access Journals (Sweden)

    Balvinder Mohan


    Interpretation & conclusions: The bla NDM-1 gene was absent in our isolates obtained during 2008 but was present amongst Enterobacteriaceae isolated in 2012. The bla KPC gene was also not found. Nine isolates obtained during the two years had multiple genes encoding carbapenemases confirming the previous reports of emergence of GNB containing genes encoding multiple carbapenemases. Typing using BOX-PCR indicated that this emergence was not because of clonal expansion of a single strain, and multiple strains were circulating at a single point of time.

  12. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro. (United States)

    Pyne, C; Bognar, A L


    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  13. A new cotton SDR family gene encodes a polypeptide possessing aldehyde reductase and 3-ketoacyl-CoA reductase activities. (United States)

    Pang, Yu; Song, Wen-Qiang; Chen, Fang-Yuan; Qin, Yong-Mei


    To understand regulatory mechanisms of cotton fiber development, microarray analysis has been performed for upland cotton (Gossypium hirsutum). Based on this, a cDNA (GhKCR3) encoding a polypeptide belonging to short-chain alcohol dehydrogenase/reductase family was isolated and cloned. It contains an open reading frame of 987 bp encoding a polypeptide of 328 amino acid residues. Following its overexpression in bacterial cells, the purified recombinant protein specifically uses NADPH to reduce a variety of short-chain aldehydes. A fragment between Gly180 and Gly191 was found to be essential for its catalytic activity. Though the GhKCR3 gene shares low sequence similarities to the ortholog of Saccharomyces cerevisiae YBR159w that encodes 3-ketoacyl-CoA reductase (KCR) catalyzing the second step of fatty acid elongation, it was surprisingly able to complement the yeast ybr159wDelta mutant. Gas chromatography-mass spectrometry analysis showed that very long-chain fatty acids, especially C26:0, were produced in the ybr159wDelta mutant cells expressing GhKCR3. Applying palmitoyl-CoA and malonyl-CoA as substrates, GhKCR3 showed KCR activity in vitro. Quantitative real time-PCR analysis indicated GhKCR3 transcripts accumulated in rapidly elongating fibers, roots, and stems. Our results suggest that GhKCR3 is probably a novel KCR contributing to very long-chain fatty acid biosynthesis in plants.

  14. Cyanobacterial ribosomal RNA genes with multiple, endonuclease-encoding group I introns

    Directory of Open Access Journals (Sweden)

    Turner Seán


    Full Text Available Abstract Background Group I introns are one of the four major classes of introns as defined by their distinct splicing mechanisms. Because they catalyze their own removal from precursor transcripts, group I introns are referred to as autocatalytic introns. Group I introns are common in fungal and protist nuclear ribosomal RNA genes and in organellar genomes. In contrast, they are rare in all other organisms and genomes, including bacteria. Results Here we report five group I introns, each containing a LAGLIDADG homing endonuclease gene (HEG, in large subunit (LSU rRNA genes of cyanobacteria. Three of the introns are located in the LSU gene of Synechococcus sp. C9, and the other two are in the LSU gene of Synechococcus lividus strain C1. Phylogenetic analyses show that these introns and their HEGs are closely related to introns and HEGs located at homologous insertion sites in organellar and bacterial rDNA genes. We also present a compilation of group I introns with homing endonuclease genes in bacteria. Conclusion We have discovered multiple HEG-containing group I introns in a single bacterial gene. To our knowledge, these are the first cases of multiple group I introns in the same bacterial gene (multiple group I introns have been reported in at least one phage gene and one prophage gene. The HEGs each contain one copy of the LAGLIDADG motif and presumably function as homodimers. Phylogenetic analysis, in conjunction with their patchy taxonomic distribution, suggests that these intron-HEG elements have been transferred horizontally among organelles and bacteria. However, the mode of transfer and the nature of the biological connections among the intron-containing organisms are unknown.

  15. Characterization and expression analysis of genes encoding ubiquitin conjugating domain-containing enzymes in Carica papaya. (United States)

    Jue, Dengwei; Sang, Xuelian; Shu, Bo; Liu, Liqin; Wang, Yicheng; Jia, Zhiwei; Zou, Yu; Shi, Shengyou


    Ripening affects the quality and nutritional contents of fleshy fruits and is a crucial process of fruit development. Although several studies have suggested that ubiquitin-conjugating enzyme (E2s or UBC enzymes) are involved in the regulation of fruit ripening, little is known about the function of E2s in papaya (Carica papaya). In the present study, we searched the papaya genome and identified 34 putative UBC genes, which were clustered into 17 phylogenetic subgroups. We also analyzed the nucleotide sequences of the papaya UBC (CpUBC) genes and found that both exon-intron junctions and sequence motifs were highly conserved among the phylogenetic subgroups. Using real-time PCR analysis, we also found that all the CpUBC genes were expressed in roots, stems, leaves, male and female flowers, and mature fruit, although the expression of some of the genes was increased or decreased in one or several specific organs. We also found that the expression of 13 and two CpUBC genes were incresesd or decreased during one and two ripening stages, respectively. Expression analyses indicates possible E2s playing a more significant role in fruit ripening for further studies. To the best of our knowledge, this is the first reported genome-wide analysis of the papaya UBC gene family, and the results will facilitate further investigation of the roles of UBC genes in fruit ripening and will aide in the functional validation of UBC genes in papaya.

  16. Expression of the rgMT gene, encoding for a rice metallothionein ...

    Indian Academy of Sciences (India)

    However, the precise function of the metallothionein-like proteins such as the one coded for rgMT gene isolated from rice (Oryza sativa L.) is not completely understood. The whole genome analysis of rice (O. sativa) showed that the rgMT gene is homologue to the Os11g47809 on chromosome 11 of O. sativa sp. japonica ...

  17. CYT-21 : A nuclear gene encoding a mytochondrial ribosomal protein of Neurospora crassa

    NARCIS (Netherlands)

    Kuiper, Marius Tiemen Roelof


    The purpose of my work has been to set up a procedure to isolate specific nuclear genes that are involved in the mitochondrial biogenesis of Neurospora crassa; to study the function and expresslon of one such gene and to determine which nuclearmitochondrial interactlons are involved in the

  18. Comparative structural and functional analysis of genes encoding pectin methylesterases in Phytophthora spp. (United States)

    Mingora, Christina; Ewer, Jason; Ospina-Giraldo, Manuel


    We have scanned the Phytophthora infestans, P. ramorum, and P. sojae genomes for the presence of putative pectin methylesterase genes and conducted a sequence analysis of all gene models found. We also searched for potential regulatory motifs in the promoter region of the proposed P. infestans models, and investigated the gene expression levels throughout the course of P. infestans infection on potato plants, using in planta and detached leaf assays. We found that genes located on contiguous chromosomal regions contain similar motifs in the promoter region, indicating the possibility of a shared regulatory mechanism. Results of our investigations also suggest that, during the pathogenicity process, the expression levels of some of the analyzed genes vary considerably when compared to basal expression observed in in vitro cultures of non-sporulating mycelium. These results were observed both in planta and in detached leaf assays. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Structure and chromosomal localization of the gene encoding the human myelin protein zero (MPZ)

    Energy Technology Data Exchange (ETDEWEB)

    Hayasaka, Kiyoshi; Himoro, Masato; Takada, Goro (Akita Univ. School of Medicine, Akita (Japan)); Wang, Yimin; Takata, Mizuho; Minoshima, Shinsei; Shimizu, Nobuyoshi; Miura, Masayuki; Uyemura, Keiichi (Keio Univ. School of Medicine, Tokyo (Japan))


    The authors describe the cloning, characterization, and chromosomal mapping of the human myelin protein zero (MPZ) gene (a structural protein of myelin and an adhesive glycoprotein of the immunoglobulin superfamily). The gene is about 7 kb long and consists of six exons corresponding of the functional domains. All exon-intron junction sequences conform to the GT/AG rule. The 5[prime]-flanking region of the gene has a TA-rich element (TATA-like box), two CAAT boxes, and a single defined transcription initiation site detected by the primer extension method. The gene for human MPZ was assigned to chromosome 1q22-q23 by spot blot hybridization of flow-sorted human chromosomes and fluorescence in situ hybridization. The localization of the MPZ gene coincides with the locus for Charcot-Marie-Tooth disease type 1B, determined by linkage analysis. 20 refs., 3 figs., 1 tab.

  20. Identification and targeted disruption of the mouse gene encoding ESG1 (PH34/ECAT2/DPPA5

    Directory of Open Access Journals (Sweden)

    Ichisaka Tomoko


    Full Text Available Abstract Background Embryonic stem cell-specific gene (ESG 1, which encodes a KH-domain containing protein, is specifically expressed in early embryos, germ cells, and embryonic stem (ES cells. Previous studies identified genomic clones containing the mouse ESG1 gene and five pseudogenes. However, their chromosomal localizations or physiological functions have not been determined. Results A Blast search of mouse genomic databases failed to locate the ESG1 gene. We identified several bacterial artificial clones containing the mouse ESG1 gene and an additional ESG1-like sequence with a similar gene structure from chromosome 9. The ESG1-like sequence contained a multiple critical mutations, indicating that it was a duplicated pseudogene. The 5' flanking region of the ESG1 gene, but not that of the pseudogene, exhibited strong enhancer and promoter activity in undifferentiated ES cells by luciferase reporter assay. To study the physiological functions of the ESG1 gene, we replaced this sequence in ES cells with a β-geo cassette by homologous recombination. Despite specific expression in early embryos and germ cells, ESG1-/- mice developed normally and were fertile. We also generated ESG1-/- ES cells both by a second independent homologous recombination and directly from blastocysts derived from heterozygous intercrosses. Northern blot and western blot analyses confirmed the absence of ESG1 in these cells. These ES cells demonstrated normal morphology, proliferation, and differentiation. Conclusion The mouse ESG1 gene, together with a duplicated pseudogene, is located on chromosome 9. Despite its specific expression in pluripotent cells and germ cells, ESG1 is dispensable for self-renewal of ES cells and establishment of germcells.

  1. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil. (United States)

    Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso


    Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

  2. Expression and functional analysis of genes encoding cytokinin receptor-like histidine kinase in maize (Zea mays L.). (United States)

    Wang, Bo; Chen, Yanhong; Guo, Baojian; Kabir, Muhammad Rezaul; Yao, Yingyin; Peng, Huiru; Xie, Chaojie; Zhang, Yirong; Sun, Qixin; Ni, Zhongfu


    Cytokinin signaling is vital for plant growth and development which function via the two-component system (TCS). As one of the key component of TCS, transmembrane histidine kinases (HK) are encoded by a small gene family in plants. In this study, we focused on expression and functional analysis of cytokinin receptor-like HK genes (ZmHK) in maize. Firstly, bioinformatics analysis revealed that seven cloned ZmHK genes have different expression patterns during maize development. Secondly, ectopic expression by CaMV35S promoter in Arabidopsis further revealed that functional differentiation exists among these seven members. Among them, the ZmHK1a2-OX transgenic line has the lowest germination rate in the dark, ZmHK1-OX and ZmHK2a2-OX can delay leaf senescence, and seed size of ZmHK1-OX, ZmHK1a2-OX, ZmHK2-OX, ZmHK3b-OX and ZmHK2a2-OX was obviously reduced as compared to wild type. Additionally, ZmHK genes play opposite roles in shoot and root development; all ZmHK-OX transgenic lines display obvious shorter root length and reduced number of lateral roots, but enhanced shoot development compared with the wild type. Most notably, Arabidopsis response regulator ARR5 gene was up-regulated in ZmHK1-OX, ZmHK1a2-OX, ZmHK2-OX, ZmHK3b-OX and ZmHK2a2-OX as compared to wild type. Although the causal link between ZmHK genes and cytokinin signaling pathway is still an area to be further elucidated, these findings reflected that the diversification of ZmHK genes expression patterns and functions occurred in the course of maize evolution, indicating that some ZmHK genes might play different roles during maize development.

  3. Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus. (United States)

    Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A


    The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

  4. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  5. Cloning and characterization of F3PYC gene encoding pyruvate carboxylase in Aspergillus flavus strain (F3). (United States)

    Qayyum, Sadia; Khan, Ibrar; Bhatti, Zulfiqar Ahmad; Peng, Changsheng


    Pyruvate carboxylase is a major enzyme for biosynthesis of organic acids like; citric acid, fumeric acid, and L-malic acid. These organic acids play very important role for biological remediation of heavy metals. In this study, gene walking method was used to clone and characterize pyruvate carboxylase gene (F3PYC) from heavy metal resistant indigenous fungal isolate Aspergillus flavus (F3). 3579 bp of an open reading frame which encodes 1193 amino acid protein (isoelectric point: 6.10) with a calculated molecular weight of 131.2008 kDa was characterized. Deduced protein showed 90-95% similarity to those deduced from PYC gene from different fungal strains including; Aspergillus parasiticus, Neosartorya fischeri, Aspergillus fumigatus, Aspergillus clavatus, and Aspergillus niger. Protein generated from the PYC gene was a homotetramer (α4) and having four potential N-linked glycosylation sites and had no signal peptide. Amongst most possible N-glycosylation sites were -N-S-S-I- at 36 amino acid, -N-G-T-V- at 237 amino acid, N-G-S-S- at 517 amino acid, and N-T-S-R- at 1111 amino acid, with several functions have been proposed for the carbohydrate moiety such as thermal stability, pH, and temperature optima for activity and stabilization of the three-dimensional structure. Hence, cloning of F3PYC gene from A. flavus has important biotechnological applications.

  6. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T


    -human hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...... hybridization. The NCK locus is at chromosome region 3q21, a region involved in neoplasia-associated changes; the SHC cognate locus, SHC1, is at 1q21, and the GRB2 locus is at 17q22-qter telomeric to the HOXB and NGFR loci. Both SHC1 and GRB2 are in chromosome regions that may be duplicated in some tumor types.......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...

  7. DNA Immunization with the Gene Encoding P4 Nuclease of Leishmania amazonensis Protects Mice against Cutaneous Leishmaniasis (United States)

    Campbell, Kimberly; Diao, Hong; Ji, Jiaxiang; Soong, Lynn


    Infection with the protozoan parasite Leishmania amazonensis can cause diverse clinical forms of leishmaniasis. Immunization with purified P4 nuclease protein has been shown to elicit a protective response in mice challenged with L. amazonensis and L. pifanoi. To explore the potential of a DNA-based vaccine, we tested the L. amazonensis gene encoding P4 nuclease as well as adjuvant constructs encoding murine interleukin-12 (IL-12) and L. amazonensis HSP70. Susceptible BALB/c mice were immunized with the DNA encoding P4 alone, P4/IL-12, or P4/HSP70 prior to challenge with L. amazonensis promastigotes. Mice given P4/IL-12 exhibited no lesion development and had a 3- to 4-log reduction in tissue parasite burdens compared to controls. This protection corresponded to significant increases in gamma interferon and tumor necrosis factor alpha production and a reduction in parasite-specific immunoglobulin G1, suggesting an enhancement in Th1 responses. Moreover, we immunized mice with the L. amazonensis vaccines to determine if this vaccine regimen could provide cross-protection against a genetically diverse species, L. major. While the P4/HSP70 vaccine led to self-healing lesions, the P4/IL-12 vaccine provided negligible protection against L. major infection. This is the first report of successful use of a DNA vaccine to induce protection against L. amazonensis infection. Additionally, our results indicate that different vaccine combinations, including DNA encoding P4, HSP70, or IL-12, can provide significant protection against both Old World and New World cutaneous leishmaniasis. PMID:14573646

  8. A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation. (United States)

    Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S


    we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

  9. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang


    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  10. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S


    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  11. Structural organization of the genes encoding the small nuclear RNAs U1 to U6 of Tetrahymena thermophila is very similar to that of plant small nuclear RNA genes

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J


    We report the sequences of the genes encoding the small nuclear RNAs (snRNAs) U1 to U6 of the ciliate Tetrahymena thermophila. The genes of the individual snRNAs exist in two to six slightly different copies per haploid genome. Sequence analyses of the gene-flanking regions indicate that there ar......We report the sequences of the genes encoding the small nuclear RNAs (snRNAs) U1 to U6 of the ciliate Tetrahymena thermophila. The genes of the individual snRNAs exist in two to six slightly different copies per haploid genome. Sequence analyses of the gene-flanking regions indicate...

  12. The RFC2 gene encoding a subunit of replication factor C of Saccharomyces cerevisiae.


    Noskov, V; Maki, S; Kawasaki, Y; Leem, S H; Ono, B; Araki, H; Pavlov, Y; Sugino, A


    Replication Factor C (RF-C) of Saccharomyces cerevisiae is a complex that consists of several different polypeptides ranging from 120- to 37 kDa (Yoder and Burgers, 1991; Fien and Stillman, 1992), similar to human RF-C. We have isolated a gene, RFC2, that appears to be a component of the yeast RF-C. The RFC2 gene is located on chromosome X of S. cerevisiae and is essential for cell growth. Disruption of the RFC2 gene led to a dumbbell-shaped terminal morphology, common to mutants having a def...

  13. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  14. Monogalactosyldiacylglycerol: An abundant galactosyllipid of Cirsium brevicaule A. GRAY leaves inhibits the expression of gene encoding fatty acid synthase. (United States)

    Inafuku, Masashi; Takara, Kensaku; Taira, Naoyuki; Nugara, Ruwani N; Kamiyama, Yasuo; Oku, Hirosuke


    The leaves of Cirsium brevicaule A. GRAY (CL) significantly decreased hepatic lipid accumulation and the expression of fatty acid synthase gene (FASN) in mice. We aimed to purify and identify the active compound(s) from CL and determine the inhibitory mechanism of expression of FASN. We purified monogalactosyldiacylglycerol (MGDG) from extracts of CL (CL-MGDG) and showed that it was the active CL component through analyses of its effects on the expression of genes of human breast cancer cell line, SKBR-3. The content and fatty acid composition of CL-MGDG are distinctly different from those of other vegetable-derived MGDGs. Treatment of SKBR-3 cells with MGDG decreased the level of FASN mRNA as well as the levels of mRNA encoding other protein involved in lipogenesis. Further, MGDG treatments significantly inhibited luciferase activities of constructs containing liver X receptor response element in FASN promoter region without altering the levels of mRNA encoding transcription factors. MGDG and the FASN inhibitor C75 decreased the viabilities of SKBR-3 cells in a concentration-dependent manner. CL-MGDG more potently inhibited cell viability than a commercial MGDG preparation. CL represents a good source of glycoglycerolipids with potential as functional ingredients of food. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. Inactivation of a Pleurotus ostreatus versatile peroxidase-encoding gene (mnp2) results in reduced lignin degradation. (United States)

    Salame, Tomer M; Knop, Doriv; Levinson, Dana; Mabjeesh, Sameer J; Yarden, Oded; Hadar, Yitzhak


    Lignin biodegradation by white-rot fungi is pivotal to the earth's carbon cycle. Manganese peroxidases (MnPs), the most common extracellular ligninolytic peroxidases produced by white-rot fungi, are considered key in ligninolysis. Pleurotus ostreatus, the oyster mushroom, is a preferential lignin degrader occupying niches rich in lignocellulose such as decaying trees. Here, we provide direct, genetically based proof for the functional significance of MnP to P. ostreatus ligninolytic capacity under conditions mimicking its natural habitat. When grown on a natural lignocellulosic substrate of cotton stalks under solid-state culture conditions, gene and isoenzyme expression profiles of its short MnP and versatile peroxidase (VP)-encoding gene family revealed that mnp2 was predominately expressed. mnp2, encoding the versatile short MnP isoenzyme 2 was disrupted. Inactivation of mnp2 resulted in three interrelated phenotypes, relative to the wild-type strain: (i) reduction of 14% and 36% in lignin mineralization of stalks non-amended and amended with Mn(2+), respectively; (ii) marked reduction of the bioconverted lignocellulose sensitivity to subsequent bacterial hydrolyses; and (iii) decrease in fungal respiration rate. These results may serve as the basis to clarify the roles of the various types of fungal MnPs and VPs in their contribution to white-rot decay of wood and lignocellulose in various ecosystems. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  17. Activation of a casB gene encoding β-glucosidase of Pectobacterium carotovorum subsp. carotovorum LY34. (United States)

    Kim, Min Keun; An, Chang Long; Kang, Tae Ho; Kim, Jungho; Kim, Hoon; Yun, Han Dae


    Two cas genes were isolated from Pectobacterium carotovorum subsp. carotovorum LY34 (Pcc LY34). Sequence analysis of the 4873 bp cloned DNA fragment (accession number AY866383) revealed two open reading frames (casF and casB) that are predicted to encode 658 and 467 amino acid proteins, respectively. The CasF protein is similar to other PTS enzyme II components. casB encodes β-glucosidase, a member of the glycosyl hydrolase family 1. An inverted repeat sequence was identified in the casB promoter region, and was hypothesized to have a negative effect on casB transcription. Replacement of the casB promoter of Pcc LY34 with the bglB promoter activated the casB gene, consistent with the repeats inhibiting expression of casB. Purified CasB enzyme was estimated to be 53,000 Da by SDS-PAGE, and hydrolyzed salicin, arbutin, pNPG, and MUG. CasB exhibited maximal activity toward pNPG at pH 7.0 and 40 °C, and Mg(2+) is essential for its activity. Two conserved glutamate residues (Glu(177) and Glu(366)) were shown to be important for CasB activity. Copyright © 2012 Elsevier GmbH. All rights reserved.

  18. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.


    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  19. Identification and Analysis of a Gene from Calendula officinalis Encoding a Fatty Acid Conjugase (United States)

    Qiu, Xiao; Reed, Darwin W.; Hong, Haiping; MacKenzie, Samuel L.; Covello, Patrick S.


    Two homologous cDNAs, CoFad2 and CoFac2, were isolated from a Calendula officinalis developing seed by a polymerase chain reaction-based cloning strategy. Both sequences share similarity to FAD2 desaturases and FAD2-related enzymes. In C. officinalis plants CoFad2 was expressed in all tissues tested, whereas CoFac2 expression was specific to developing seeds. Expression of CoFad2 cDNA in yeast (Saccharomyces cerevisiae) indicated it encodes a Δ12 desaturase that introduces a double bond at the 12 position of 16:1(9Z) and 18:1(9Z). Expression of CoFac2 in yeast revealed that the encoded enzyme acts as a fatty acid conjugase converting 18:2(9Z, 12Z) to calendic acid 18:3(8E, 10E, 12Z). The enzyme also has weak activity on the mono-unsaturates 16:1(9Z) and 18:1(9Z) producing compounds with the properties of 8,10 conjugated dienes. PMID:11161042

  20. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase. (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine


    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  1. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel


    Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...... and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. Results To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (Ch......IP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression...

  2. Cloning and expression of gene encoding P23 protein from Cryptosporidium parvum

    Directory of Open Access Journals (Sweden)

    Dinh Thi Bich Lan


    Full Text Available We cloned the cp23 gene coding P23 (glycoprotein from Cryptosporidium parvum isolated from Thua Thien Hue province, Vietnam. The coding region of cp23 gene from C. parvum is 99% similar with cp23 gene deposited in NCBI (accession number: U34390. SDS-PAGE and Western blot analysis showed that the cp23 gene in E. coli BL21 StarTM (DE3 produced polypeptides with molecular weights of approximately 37, 40 and 49 kDa. These molecules may be non-glycosylated or glycosylated P23 fusion polypeptides. Recombinant P23 protein purified by GST (glutathione S-transferase affinity chromatography can be used as an antigen for C. parvum antibody production as well as to develop diagnostic kit for C. parvum.

  3. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta


    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  4. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor. (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing


    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  5. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae. Progress report, March 1993

    Energy Technology Data Exchange (ETDEWEB)

    Parke, D.; Ornston, L.N.


    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the {beta}-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate {beta}-carboxy-cis,cis-muconate. {beta}-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for {beta}-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to {beta}-carboxy-cis,cis-muconate.

  6. Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants. (United States)

    Naderian, Homayoun; Rezvani, Zahra; Atlasi, Mohammad Ali; Nikzad, Hossein; Antoine, Af de Vries


    Nonviral vector can be an attractive alternative to gene delivery in experimental study. In spite of some advantages in comparison with the viral vectors, there are still some limitations for efficiency of gene delivery in nonviral vectors. To determine the effective expression, the recombinant Escherichia coli lacZ genes were cloned into the different variants of pcDNA3.1 and then the mammalian cells were transfected. The coding sequences of cytoplasmic and nuclear variants of lacZ gene were inserted downstream of the human cytomegalovirus immediate-early gene promoter of plasmid pcDNA3.1/myc-His C. The new cytoplasmic and nuclear constricts of E. coli β-galactosidase-coding sequences were introduced into HeLa cells with the aid of linear polyethylenimine and at 2 days post-transfection the cells were stained using 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal). Restriction enzyme analyses revealed the proper insertion of E. coli β-galactosidase-coding sequences into the multiple cloning site of pcDNA3.1/myc-His C. The functionality of the resulting constructs designated pcDNA3.1-cyt.lacZ and pcDNA3.1-nls.lacZ(+) was confirmed by X-gal staining of HeLa cells transfected with these recombinant plasmids. While pcDNA3.1-cyt.lacZ directed the synthesis of cytoplasmically located β-galactosidase molecules, the β-galactosidase protein encoded by pcDNA3.1-nls.lacZ(+) was predominantly detected in the cell nucleus. The expression of cytoplasmic and nuclear variant of LacZ gene confirmed the ability of pcDNA3.1 as versatility nonviral vector for the experimental gene delivery study in mammalian cells.

  7. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii) (United States)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi


    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  8. Outsourcing the Nucleus: Nuclear Pore Complex Genes are no Longer Encoded in Nucleomorph Genomes

    Directory of Open Access Journals (Sweden)

    Nadja Neumann


    Full Text Available The nuclear pore complex (NPC facilitates transport between nucleus and cytoplasm. The protein constituents of the NPC, termed nucleoporins (Nups, are conserved across a wide diversity of eukaryotes. In apparent exception to this, no nucleoporin genes have been identified in nucleomorph genomes. Nucleomorphs, nuclear remnants of once free-living eukaryotes, took up residence as secondary endosymbionts in cryptomonad and chlorarachniophyte algae. As these genomes are highly reduced, Nup genes may have been lost, or relocated to the host nucleus. However, Nup genes are often poorly conserved between species, so absence may be an artifact of low sequence similarity. We therefore constructed an evolutionary bioinformatic screen to establish whether the apparent absence of Nup genes in nucleomorph genomes is due to genuine absence or the inability of current methods to detect homologues. We searched green plant (Arabidopsis and rice, green alga (Chlamydomonas reinhardtii and red alga (Cyanidioschyzon merolae genomes, plus two nucleomorph genomes (Bigelowiella natans and Guillardia theta with profile hidden Markov models (HMMs from curated alignments of known vertebrate/yeast Nups. Since the plant, algal and nucleomorph genomes all belong to the kingdom Plantae, and are evolutionarily distant from the outgroup (vertebrate/yeast training set, we use the plant and algal genomes as internal positive controls for the sensitivity of the searches in nucleomorph genomes. We fi nd numerous Nup homologues in all plant and free-living algal species, but none in either nucleomorph genome. BLAST searches using identified plant and algal Nups also failed to detect nucleomorph homologues. We conclude that nucleomorph Nup genes have either been lost, being replaced by host Nup genes, or, that nucleomorph Nup genes have been transferred to the host nucleus twice independently; once in the evolution of the red algal nucleomorph and once in the green algal nucleomorph.

  9. SHY1, the yeast homolog of the mammalian SURF-1 gene, encodes a mitochondrial protein required for respiration. (United States)

    Mashkevich, G; Repetto, B; Glerum, D M; Jin, C; Tzagoloff, A


    C173 and W125 are pet mutants of Saccharomyces cerevisiae, partially deficient in cytochrome oxidase but with elevated concentrations of cytochrome c. Assays of electron transport chain enzymes indicate that the mutations exert different effects on the terminal respiratory pathway, including an inefficient transfer of electrons between the bc1 and the cytochrome oxidase complexes. A cloned gene capable of restoring respiration in C173/U1 and W125 is identical to reading frame YGR112w of yeast chromosome VII (GenBank Z72897Z72897). The encoded protein is homologous to the product of the mammalian SURF-1 gene. In view of the homology, the yeast gene has been designated SHY1 (Surf Homolog of Yeast). An antibody against the carboxyl-terminal half of Shy1p has been used to localize the protein in the inner mitochondrial membrane. Deletion of part of SHY1 produces a phenotype similar to that of G91 mutants. Disruption of SHY1 at a BamHI site, located approximately 2/3 of the way into the gene, has no obvious phenotypic consequence. This evidence, together with the ability of a carboxyl-terminal coding sequence starting from the BamHI site to complement a shy1 mutant, suggests that the Shy1p contains two domains that can be separately expressed to form a functional protein.

  10. Daphnia Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: evolutionary implications. (United States)

    Rewitz, Kim F; Gilbert, Lawrence I


    In crustaceans and insects, development and reproduction are controlled by the steroid hormone, 20-hydroxyecdysone (20E). Like other steroids, 20E, is synthesized from cholesterol through reactions involving cytochrome P450s (CYPs). In insects, the CYP enzymes mediating 20E biosynthesis have been identified, but evidence of their probable presence in crustaceans is indirect, relying solely on the ability of crustaceans to synthesize 20E. To investigate the presence of these genes in crustaceans, the genome of Daphnia pulex was examined for orthologs of these genes, the Halloween genes, encoding those biosynthetic CYP enzymes. Single homologs of spook-CYP307A1, phantom-CYP306A1, disembodied-CYP302A1, shadow-CYP315A1 and shade-CYP314A1 were identified in the Daphnia data base. Phylogenetic analysis indicates an orthologous relationship between the insect and Daphnia genes. Conserved intron/exon structures and microsynteny further support the conclusion that these steroidogenic CYPs have been conserved in insects and crustaceans through some 400 million years of evolution. Although these arthropod steroidogenic CYPs are related to steroidogenic CYPs in Caenorhabditis elegans and vertebrates, the data suggest that the arthropod steroidogenic CYPs became functionally specialized in a common ancestor of arthropods and are unique to these animals.

  11. Daphnia Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: Evolutionary implications

    Directory of Open Access Journals (Sweden)

    Gilbert Lawrence I


    Full Text Available Abstract Background In crustaceans and insects, development and reproduction are controlled by the steroid hormone, 20-hydroxyecdysone (20E. Like other steroids, 20E, is synthesized from cholesterol through reactions involving cytochrome P450s (CYPs. In insects, the CYP enzymes mediating 20E biosynthesis have been identified, but evidence of their probable presence in crustaceans is indirect, relying solely on the ability of crustaceans to synthesize 20E. Results To investigate the presence of these genes in crustaceans, the genome of Daphnia pulex was examined for orthologs of these genes, the Halloween genes, encoding those biosynthetic CYP enzymes. Single homologs of spook-CYP307A1, phantom-CYP306A1, disembodied-CYP302A1, shadow-CYP315A1 and shade-CYP314A1 were identified in the Daphnia data base. Phylogenetic analysis indicates an orthologous relationship between the insect and Daphnia genes. Conserved intron/exon structures and microsynteny further support the conclusion that these steroidogenic CYPs have been conserved in insects and crustaceans through some 400 million years of evolution. Conclusion Although these arthropod steroidogenic CYPs are related to steroidogenic CYPs in Caenorhabditis elegans and vertebrates, the data suggest that the arthropod steroidogenic CYPs became functionally specialized in a common ancestor of arthropods and are unique to these animals.

  12. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis. (United States)

    Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael


    Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

  13. Gene encoding the human. beta. -hexosaminidase. beta. chain: Extensive homology of intron placement in the. alpha. - and. beta. -chain genes

    Energy Technology Data Exchange (ETDEWEB)

    Proia, R.L. (National Institute of Diabetes, Digestive and Kidney Diseases, Bethesda, MD (USA))


    Lysosomal {beta}-hexosaminidase is composed of two structurally similar chains, {alpha} and {beta}, that are the products of different genes. Mutations in either gene causing {beta}-hexosaminidase deficiency result in the lysosomal storage disease GM2-gangliosidosis. To enable the investigation of the molecular lesions in this disorder and to study the evolutionary relationship between the {alpha} and {beta} chains, the {beta}-chain gene was isolated, and its organization was characterized. The {beta}-chain coding region is divided into 14 exons distributed over {approx}40 kilobases of DNA. Comparison with the {alpha}-chain gene revealed that 12 of the 13 introns interrupt the coding regions at homologous positions. This extensive sharing of intron placement demonstrates that the {alpha} and {beta} chains evolved by way of the duplication of a common ancestor.

  14. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A


    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  15. Cloning and Expression Analysis of MEP Pathway Enzyme-encoding Genes in Osmanthus fragrans

    Directory of Open Access Journals (Sweden)

    Chen Xu


    Full Text Available The 2-C-methyl-d-erythritol 4-phosphate (MEP pathway is responsible for the biosynthesis of many crucial secondary metabolites, such as carotenoids, monoterpenes, plastoquinone, and tocopherols. In this study, we isolated and identified 10 MEP pathway genes in the important aromatic plant sweet osmanthus (Osmanthus fragrans. Multiple sequence alignments revealed that 10 MEP pathway genes shared high identities with other reported proteins. The genes showed distinctive expression profiles in various tissues, or at different flower stages and diel time points. The qRT-PCR results demonstrated that these genes were highly expressed in inflorescences, which suggested a tissue-specific transcript pattern. Our results also showed that OfDXS1, OfDXS2, and OfHDR1 had a clear diurnal oscillation pattern. The isolation and expression analysis provides a strong foundation for further research on the MEP pathway involved in gene function and molecular evolution, and improves our understanding of the molecular mechanism underlying this pathway in plants.

  16. Construction of adenovirus vectors encoding the lumican gene by gateway recombinant cloning technology. (United States)

    Wang, Gui-Fang; Qi, Bing; Tu, Lei-Lei; Liu, Lian; Yu, Guo-Cheng; Zhong, Jing-Xiang


    To construct adenovirus vectors of lumican gene by gateway recombinant cloning technology to further understand the role of lumican gene in myopia. Gateway recombinant cloning technology was used to construct adenovirus vectors. The wild-type (wt) and mutant (mut) forms of the lumican gene were synthesized and amplified by polymerase chain reaction (PCR). The lumican cDNA fragments were purified and ligated into the adenovirus shuttle vector pDown-multiple cloning site (MCS)-/internal ribozyme entry site (IRES)/enhanced green fluorescent protein (EGFP). Then the desired DNA fragments were integrated into the destination vector pAV.Des1d yielding the final expression constructs pAV.Ex1d-cytomegalovirus (CMV)>wt-lumican/IRES/EGFP and pAV.Ex1d-CMV>mut-lumican/IRES /EGFP, respectively. The adenovirus plasmids pAV.Ex1d-CMV>wt-lumican/IRES/EGFP and pAV.Ex1d-CMV>mut-lumican/IRES/EGFP were successfully constructed by gateway recombinant cloning technology. Positive clones identified by PCR and sequencing were selected and packaged into recombinant adenovirus in HEK293 cells. We construct adenovirus vectors containing the lumican gene by gateway recombinant cloning technology, which provides a basis for investigating the role of lumican gene in the pathogenesis of high myopia.

  17. Cloning and characterization of the prs gene encoding phosphoribosylpyrophosphate synthetase of Escherichia coli

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne


    by lysogenic complementation. The prs gene resided on a 5.6 kilobase-pair (kbp) DNA fragment generated by hydrolysis with restriction endonuclease BamHI. The nearby gene pth, encoding peptidyl-tRNA hydrolase, was also on this fragment. Subcloning of the fragment in the multi-copy plasmid pBR322 and subsequent...

  18. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.


    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  19. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase (United States)

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  20. Cloning and characterization of brnQ, a gene encoding a low-affinity, branched chain amino acid carrier in Lactobacillus delbruckii subsp lactis DSM7290

    NARCIS (Netherlands)

    Stucky, K; Hagting, A; Klein, J.R.; Matern, H; Henrich, B; Konings, WN; Plapp, R


    A gene (brnQ), encoding a carrier for branched-chain amino acids in Lactobacillus delbruckii subsp. lactis DSM7290 was cloned in the low-copy-number vector pLG339 by complementation of a transport-deficient Escherichia coli strain. The plasmid carrying the cloned gene restored growth of an E. coli

  1. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for

  2. Cloning and characterization of two novel β-glucosidase genes encoding isoenzymes of the cellobiase complex from Cellulomonas biazotea. (United States)

    Chan, Anthony K N; Ng, Alan K L; Ng, Kate K Y; Wong, W K R


    Enzymatic degradation of cellulosic waste to generate renewable biofuels has offered an attractive solution to the energy problem. Synergistic hydrolysis of cellulose residues requires the participation of three different types of cellulases - endoglucanases, exoglucanases, and β-glucosidases (Bgl). Our group has been interested in using Bgl of Cellulomonas biazotea in studies designed to investigate cooperative action among different cellulases. We previously have cloned bgl genes encoding Cba and Cba3, which are C. biazotea Bgl isozymes representing two different Bgl families, respectively; specifically, Glycoside Hydrolase Family 3 (GH3) and Glycoside Hydrolase Family 1 (GH1). To gain an understanding of the complexity of Bgl in C. biazotea, we analyzed E. coli clones containing plasmids into which C. biazotea DNA had been inserted; these clones could hydrolyze 4-methylumbelliferyl β-d-glucopyranoside (MUG) supplemented in solid agar media, suggesting they might contain bgl genes. Through restriction analysis and DNA sequencing, two novel bgl genes, designated cba4 and cba5 and encoding Cba4 (484 amino acids) and Cba5 (758 amino acids) were identified. Cba4 and Cba5 appear to be members of GH1 and GH3, respectively. Both Cba4 and Cba5 were concluded to be genuine cellobiases as each was found to enable their E. coli hosts to survive on media in which cellobiose was the sole carbon source. Despite lacking a typical secretory signal sequence, Cba4 and Cba5 are secretory proteins. Although they are isoenzymes, Cba, Cba3, Cba4, and Cba5 were shown to possess distinct substrate specificities. These four Bgl members may play important roles in hydrolyzing a wide variety of β-glucosides including cellobiose and non-cellulosic substrates. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima. (United States)

    Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A


    Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

  4. Korean, Japanese, and Chinese populations featured similar genes encoding drug-metabolizing enzymes and transporters: a DMET Plus microarray assessment. (United States)

    Yi, SoJeong; An, Hyungmi; Lee, Howard; Lee, Sangin; Ieiri, Ichiro; Lee, Youngjo; Cho, Joo-Youn; Hirota, Takeshi; Fukae, Masato; Yoshida, Kenji; Nagatsuka, Shinichiro; Kimura, Miyuki; Irie, Shin; Sugiyama, Yuichi; Shin, Dong Wan; Lim, Kyoung Soo; Chung, Jae-Yong; Yu, Kyung-Sang; Jang, In-Jin


    Interethnic differences in genetic polymorphism in genes encoding drug-metabolizing enzymes and transporters are one of the major factors that cause ethnic differences in drug response. This study aimed to investigate genetic polymorphisms in genes involved in drug metabolism, transport, and excretion among Korean, Japanese, and Chinese populations, the three major East Asian ethnic groups. The frequencies of 1936 variants representing 225 genes encoding drug-metabolizing enzymes and transporters were determined from 786 healthy participants (448 Korean, 208 Japanese, and 130 Chinese) using the Affymetrix Drug-Metabolizing Enzymes and Transporters Plus microarray. To compare allele or genotype frequencies in the high-dimensional data among the three East Asian ethnic groups, multiple testing, principal component analysis (PCA), and regularized multinomial logit model through least absolute shrinkage and selection operator were used. On microarray analysis, 1071 of 1936 variants (>50% of markers) were found to be monomorphic. In a large number of genetic variants, the fixation index and Pearson's correlation coefficient of minor allele frequencies were less than 0.034 and greater than 0.95, respectively, among the three ethnic groups. PCA identified 47 genetic variants with multiple testing, but was unable to discriminate ethnic groups by the first three components. Multinomial least absolute shrinkage and selection operator analysis identified 269 genetic variants that showed different frequencies among the three ethnic groups. However, none of those variants distinguished between the three ethnic groups during subsequent PCA. Korean, Japanese, and Chinese populations are not pharmacogenetically distant from one another, at least with regard to drug disposition, metabolism, and elimination.

  5. Altered Expression of Genes Encoding Neurotransmitter Receptors in GnRH Neurons of Proestrous Mice


    Vastagh, Csaba; Rodolosse, Annie; Solymosi, Norbert; Liposits, Zsolt


    Gonadotropin-releasing hormone (GnRH) neurons play a key role in the central regulation of reproduction. In proestrous female mice, estradiol triggers the pre-ovulatory GnRH surge, however, its impact on the expression of neurotransmitter receptor genes in GnRH neurons has not been explored yet. We hypothesized that proestrus is accompanied by substantial changes in the expression profile of genes coding for neurotransmitter receptors in GnRH neurons. We compared the transcriptome of GnRH neu...

  6. Altered expression of genes encoding neurotransmitter receptors in GnRH neurons of proestrous mice


    Csaba Vastagh; Annie Rodolosse; Norbert Solymosi; Zsolt Liposits; Zsolt Liposits


    Gonadotropin-releasing hormone (GnRH) neurons play a key role in the central regulation of reproduction. In proestrous female mice, estradiol triggers the pre-ovulatory GnRH surge, however, its impact on the expression of neurotransmitter receptor genes in GnRH neurons has not been explored yet. We hypothesized that proestrus is accompanied by substantial changes in the expression profile of genes coding for neurotransmitter receptors in GnRH neurons. We compared the transcriptome of GnRH neu...

  7. Biochemical activities of T-antigen proteins encoded by simian virus 40 A gene deletion mutants.


    Clark, R; Peden, K; Pipas, J M; Nathans, D; Tjian, R


    We have analyzed T antigens produced by a set of simian virus 40 (SV40) A gene deletion mutants for ATPase activity and for binding to the SV40 origin of DNA replication. Virus stocks of nonviable SV40 A gene deletion mutants were established in SV40-transformed monkey COS cells. Mutant T antigens were produced in mutant virus-infected CV1 cells. The structures of the mutant T antigens were characterized by immunoprecipitation with monoclonal antibodies directed against distinct regions of th...

  8. Identification of the naturally occurring genes encoding carbapenem-hydrolysing oxacillinases from Acinetobacter haemolyticus, Acinetobacter johnsonii, and Acinetobacter calcoaceticus. (United States)

    Figueiredo, S; Bonnin, R A; Poirel, L; Duranteau, J; Nordmann, P


    Carbapenem resistance is increasingly being reported among Acinetobacter species, and results mostly from the expression of acquired carbapenem-hydrolysing oxacillinases (CHDLs). Several Acinetobacter species intrinsically possess chromosomal CHDL genes: Acinetobacter baumannii (bla(OXA-51) ), Acinetobacter radioresistens (bla(OXA-23) ), and Acinetobacter lwoffii (bla(OXA-134) ). We aimed to identify the progenitors of novel CHDL-encoding genes for identification of potential reservoirs. We performed PCR screening using degenerated internal primers designed from a sequence alignment of the known CHDLs (OXA-23, OXA-40, OXA-51, OXA-58, OXA-134, and OXA-143) applied to a collection of 50 Acinetobacter strains belonging to 23 different species. Two strains of Acinetobacter johnsonii, one strain of Acinetobacter calcoaceticus and two strains of Acinetobacter haemolyticus were found to harbour, respectively, the totally novel bla(OXA-211) -like, bla(OXA-213) -like and bla(OXA-214) -like genes. In addition, the complete genomes of those three species available in GenBank, i.e. one A. johnsonii genome, four A. calcoaceticus genomes, and one A. haemolyticus genome, were analysed and found to be positive for the presence of bla(OXA211) -like, bla(OXA-213) -like and bla(OXA-214) -like genes, respectively. The β-lactamases OXA-211, OXA-213 and OXA-214 are diverse, with amino acid identities ranging from 53% to 76%, as compared with the naturally occurring OXA-51-like CHDL from A. baumannii. These β-lactamases showed a peculiar hydrolysis profile, including mostly penicillins and carbapenems. Regarding bla(OXA-23) in A. radioresistens and bla(OXA-134) in A. lwoffii, these genes were not expressed (or expressed at a non-significant level) in their host. Detection of these β-lactamase genes might be used as a useful tool for accurate identification of these Acinetobacter species. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical

  9. The Aspergillus niger multicopper oxidase family: analysis and overexpression of laccase-like encoding genes

    NARCIS (Netherlands)

    Tamayo Ramos, J.A.; Barends, S.; Verhaert, R.M.; Graaff, de L.H.


    BACKGROUND: Many filamentous fungal genomes contain complex groups of multicopper oxidase (MCO) coding genes that makes them a good source for new laccases with potential biotechnological interest. A bioinformatics analysis of the Aspergillus niger ATCC 1015 genome resulted in the identification of

  10. The Hansenula polymorpha PER8 gene encodes a novel peroxisomal integral membrane protein involved in proliferation

    NARCIS (Netherlands)

    Tan, X.; Waterham, H. R.; Veenhuis, M.; Cregg, J. M.


    We previously described the isolation of mutants of the methylotrophic yeast Hansenula polymorpha that are defective in peroxisome biogenesis. Here, we describe the characterization of one of these mutants, per8, and the cloning of the PER8 gene. In either methanol or methylamine medium, conditions

  11. The Hansenula polymorpha PER8 Gene Encodes a Novel Peroxisomal Integral Membrane Protein Involved in Proliferation

    NARCIS (Netherlands)

    Tan, Xuqiu; Waterham, Hans R.; Veenhuis, Marten; Cregg, James M.

    We previously described the isolation of mutants of the methylotrophic yeast Hansenula polymorpha that are defective in peroxisome biogenesis. Here, we describe the characterization of one of these mutants, per8, and the cloning of the PER8 gene. In either methanol or methylamine medium, conditions

  12. Utilization of genes encoding osmoprotectants in transgenic plants for enhanced abiotic stress tolerance

    Directory of Open Access Journals (Sweden)

    Mohammad Sayyar Khan


    Full Text Available Global agriculture in the context of growing and expanding populations is under huge pressure to provide increased food, feed, and fiber. The recent phenomenon of climate change has further added fuel to the fire. It has been practically established now that the global temperature has been on the increase with associated fluctuations in annual rainfall regimes, and the resultant drought and flood events and increasing soil and water salinization. These challenges would be met with the introduction and utilization of new technologies coupled with conventional approaches. In recent years, transgenic technology has been proved very effective in terms of production of improved varieties of crop plants, resistant to biotic stresses. The abiotic stresses such as salt and drought are more complex traits, controlled by many genes. Transgenic plant development for these stresses has utilized many single genes. However, much emphasis has been placed on genes catalyzing the biosynthetic pathways of osmoprotectants. This review focuses on the current status of research on osmoprotectant genes and their role in abiotic stress tolerance in transgenic plants.

  13. Common variants of the genes encoding erythropoietin and its receptor modulate cognitive performance in schizophrenia

    DEFF Research Database (Denmark)

    Kästner, Anne; Grube, Sabrina; El-Kordi, Ahmed


    ) genotypes with cognitive functions. To prove this hypothesis, schizophrenic patients (N > 1000) were genotyped for 5' upstream-located gene variants, EPO SNP rs1617640 (T/G) and EPORSTR(GA)(n). Associations of these variants were obtained for cognitive processing speed, fine motor skills and short...

  14. Regulation of the alpha-glucuronidase-encoding gene (aguA) from Aspergillus niger

    NARCIS (Netherlands)

    Vries, de R.P.; Vondervoort, van de P.J.I.; Hendriks, L.; Belt, van de M.; Visser, J.


    The !-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR.

  15. Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia ...

    Indian Academy of Sciences (India)

    'the king of fruits' for remarkably high vitamin C content. However, pathogen infections have lowered the yield and quality of kiwi fruit (Ferrante and Scortichini 2010; Biondi et al. 2013; Li et al. 2013). Therefore, better understanding of resistance (R) genes in kiwi fruit could provide the strategy for improving resistance to ...

  16. A Relational Database for the Discovery of Genes Encoding Amino Acid Biosynthetic Enzymes in Pathogenic Fungi

    Directory of Open Access Journals (Sweden)

    Nicholas J. Talbot


    Full Text Available Fungal phytopathogens continue to cause major economic impact, either directly, through crop losses, or due to the costs of fungicide application. Attempts to understand these organisms are hampered by a lack of fungal genome sequence data. A need exists, however, to develop specific bioinformatics tools to collate and analyse the sequence data that currently is available. A web-accessible gene discovery database ( was developed as a demonstration tool for the analysis of metabolic and signal transduction pathways in pathogenic fungi using incomplete gene inventories. Using Bayesian probability to analyse the currently available gene information from pathogenic fungi, we provide evidence that the obligate pathogen Blumeria graminis possesses all amino acid biosynthetic pathways found in free-living fungi, such as Saccharomyces cerevisiae. Phylogenetic analysis was also used to deduce a gene history of succinate-semialdehyde dehydrogenase, an enzyme in the glutamate and lysine biosynthesis pathways. The database provides a tool and methodology to researchers to direct experimentation towards predicting pathway conservation in pathogenic microorganisms.

  17. Expression of the gene encoding the PR-like protein PRms in germinating maize embryos. (United States)

    Casacuberta, J M; Raventós, D; Puigdoménech, P; San Segundo, B


    The PRms protein is a pathogenesis-related (PR)-like protein whose mRNA accumulates during germination of maize seeds. Expression of the PRms gene is induced after infection of maize seeds with the fungus Fusarium moniliforme. To further our investigations on the expression of the PRms gene we examined the accumulation of PRms mRNA in different tissues of maize seedlings infected with F. moniliforme and studied the effect of fungal elicitors, the mycotoxin moniliformin, the hormone gibberellic acid, and specific chemical agents. Our results indicate that fungal infection, and treatment either with fungal elicitors or with moniliformin, a mycotoxin produced by F. moniliforme, increase the steady-state level of PRms mRNA. PRms mRNA accumulation is also stimulated by the application of the hormone gibberellic acid or by treatment with silver nitrate, whereas acetylsalicylic acid has no effect. In situ RNA hybridization in isolated germinating embryo sections demonstrates that the PRms gene is expressed in the scutellum, particularly in a group of inner cells, and in the epithelium lying at the interface of the scutellum and the endosperm. The pattern of expression of the PRms gene closely resembles that found for hydrolytic enzymes, being confined to the scutellum and the aleurone layer of the germinating maize seed. Our results suggest that the PRms protein has a function during the normal process of seed germination that has become adapted to serve among the defence mechanisms induced in response to pathogens during maize seed germination.

  18. Structure of the gene encoding the murine protein kinase CK2 beta subunit

    DEFF Research Database (Denmark)

    Boldyreff, B; Issinger, O G


    II restriction endonuclease, and several blocks of sequence in the 5' flanking region are conserved between mouse and human. Despite all of these common features, one of the most striking differences found concerns the human CK2 alpha subunit binding domain at position -170 to -239 of the human gene. This domain...

  19. A Complementary Bioinformatics Approach to Identify Potential Plant Cell Wall Glycosyltransferase-Encoding Genes

    DEFF Research Database (Denmark)

    Egelund, Jack; Skjøt, Michael; Geshi, Naomi


    . Although much is known with regard to composition and fine structures of the plant CW, only a handful of CW biosynthetic GT genes-all classified in the CAZy system-have been characterized. In an effort to identify CW GTs that have not yet been classified in the CAZy database, a simple bioinformatics...

  20. 6-Desaturase-Like Encoding Gene Introduction in Catfish (Clarias gariepinus

    Directory of Open Access Journals (Sweden)

    Anny Hary Ayu


    Full Text Available African catfish (Clarias gariepinus is one of the economically valuable aquaculture fish species in Indonesia. This research was aimed to produce F0 transgenic catfish carrying masou salmon Δ6-desaturase-like (OmΔ6FAD gene. The Δ6-desaturase enzyme is involved in highly unsaturated fatty acid biosynthesis. Transgenic catfish was produced by sperm-mediated gene transfer using electroporation method. In this study, as the first step, sperms were electroporated with three different OmΔ6FAD concentration (25, 50, and 100 µg mL-1 to have the highest sperm viability after electroporation (125 V/cm, pulse frequency 5 times, pulse length 30 millisecond, pulse interval 0.1 second. The highest sperm viability and sperm carrying OmΔ6FAD were obtain at 100 µg mL-1. This concentration was then used to produce F0 transgenic catfish in the second step. Sperm motility, sperm viability, fertilization rate, hatching rate, and larval survival at 14 days after hatching were the same as the controls (p>0.05. Genomic DNA was extracted from caudal fin and then used as template to identify transgenic F0 by PCR method using specific primer for OmΔ6FAD gene. The PCR result showed that 53.84% of F0 carried OmΔ6FAD gene. The result of fatty acid analysis showed that EPA and DHA contents of F0 transgenic fish and non-transgenic fish were similar.   Keywords: catfish, Δ6-desaturase-like gene, fatty acids, electroporation

  1. Altered Expression of Genes Encoding Neurotransmitter Receptors in GnRH Neurons of Proestrous Mice. (United States)

    Vastagh, Csaba; Rodolosse, Annie; Solymosi, Norbert; Liposits, Zsolt


    Gonadotropin-releasing hormone (GnRH) neurons play a key role in the central regulation of reproduction. In proestrous female mice, estradiol triggers the pre-ovulatory GnRH surge, however, its impact on the expression of neurotransmitter receptor genes in GnRH neurons has not been explored yet. We hypothesized that proestrus is accompanied by substantial changes in the expression profile of genes coding for neurotransmitter receptors in GnRH neurons. We compared the transcriptome of GnRH neurons obtained from intact, proestrous, and metestrous female GnRH-GFP transgenic mice, respectively. About 1500 individual GnRH neurons were sampled from both groups and their transcriptome was analyzed using microarray hybridization and real-time PCR. In this study, changes in mRNA expression of genes involved in neurotransmitter signaling were investigated. Differential gene expression was most apparent in GABA-ergic ( Gabbr1, Gabra3, Gabrb3, Gabrb2, Gabrg2 ), glutamatergic ( Gria1, Gria2, Grin1, Grin3a, Grm1, Slc17a6 ), cholinergic ( Chrnb2, Chrm4 ) and dopaminergic ( Drd3, Drd4 ), adrenergic ( Adra1b, Adra2a, Adra2c ), adenosinergic ( Adora2a, Adora2b ), glycinergic ( Glra ), purinergic ( P2rx7 ), and serotonergic ( Htr1b ) receptors. In concert with these events, expression of genes in the signaling pathways downstream to the receptors, i.e., G-proteins ( Gnai1, Gnai2, Gnas ), adenylate-cyclases ( Adcy3, Adcy5 ), protein kinase A ( Prkaca, Prkacb ) protein kinase C ( Prkca ) and certain transporters ( Slc1a4, Slc17a6, Slc6a17 ) were also changed. The marked differences found in the expression of genes involved in neurotransmitter signaling of GnRH neurons at pro- and metestrous stages of the ovarian cycle indicate the differential contribution of these neurotransmitter systems to the induction of the pre-ovulatory GnRH surge, the known prerequisite of the subsequent hormonal cascade inducing ovulation.

  2. Altered expression of genes encoding neurotransmitter receptors in GnRH neurons of proestrous mice

    Directory of Open Access Journals (Sweden)

    Csaba Vastagh


    Full Text Available Gonadotropin-releasing hormone (GnRH neurons play a key role in the central regulation of reproduction. In proestrous female mice, estradiol triggers the pre-ovulatory GnRH surge, however, its impact on the expression of neurotransmitter receptor genes in GnRH neurons has not been explored yet. We hypothesized that proestrus is accompanied by substantial changes in the expression profile of genes coding for neurotransmitter receptors in GnRH neurons. We compared the transcriptome of GnRH neurons obtained from intact, proestrous and metestrous female GnRH-GFP transgenic mice, respectively. About 1500 individual GnRH neurons were sampled from both groups and their transcriptome was analyzed using microarray hybridization and real-time PCR. In this study, changes in mRNA expression of genes involved in neurotransmitter signaling were investigated. Differential gene expression was most apparent in GABA-ergic (Gabbr1, Gabra3, Gabrb3, Gabrb2, Gabrg2, glutamatergic (Gria1, Gria2, Grin1, Grin3a, Grm1, Slc17a6, cholinergic (Chrnb2, Chrm4 and dopaminergic (Drd3, Drd4, adrenergic (Adra1b, Adra2a, Adra2c, adenosinergic (Adora2a, Adora2b, glycinergic (Glra, purinergic (P2rx7 and serotonergic (Htr1b receptors. In concert with these events, expression of genes in the signaling pathways downstream to the receptors, i.e. G-proteins (Gnai1, Gnai2, Gnas, adenylate-cyclases (Adcy3, Adcy5, protein kinase A (Prkaca, Prkacb protein kinase C (Prkca and certain transporters (Slc1a4, Slc17a6, Slc6a17 were also changed. The marked differences found in the expression of genes involved in neurotransmitter signaling of GnRH neurons at pro- and metestrous stages of the ovarian cycle indicate the differential contribution of these neurotransmitter systems to the induction of the pre-ovulatory GnRH surge, the known prerequisite of the subsequent hormonal cascade inducing ovulation.

  3. Arabidopsis PAD3, a gene required for camalexin biosynthesis, encodes a putative cytochrome P450 monooxygenase. (United States)

    Zhou, N; Tootle, T L; Glazebrook, J


    Phytoalexins are low molecular weight antimicrobial compounds that are synthesized in response to pathogen attack. The phytoalexin camalexin, an indole derivative, is produced by Arabidopsis in response to infection with the bacterial pathogen Pseudomonas syringae. The phytoalexin deficient 3 (pad3) mutation, which causes a defect in camalexin production, has no effect on resistance to P. syringae but compromises resistance to the fungal pathogen Alternaria brassicicola. We have now isolated PAD3 by map-based cloning. The predicted PAD3 protein appears to be a cytochrome P450 monooxygenase, similar to those from maize that catalyze synthesis of the indole-derived secondary metabolite 2,4-dihydroxy-1, 4-benzoxazin-3-one. The expression of PAD3 is tightly correlated with camalexin synthesis and is regulated by PAD4 and PAD1. On the basis of these findings, we conclude that PAD3 almost certainly encodes an enzyme required for camalexin biosynthesis. Moreover, these results strongly support the idea that camalexin does not play a major role in plant resistance to P. syringae infection, although it is involved in resistance to a fungal pathogen.

  4. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar


    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  5. Identification and nucleotide sequence of a gene in equine herpesvirus 1 analogous to the herpes simplex virus gene encoding the major envelope glycoprotein gB. (United States)

    Whalley, J M; Robertson, G R; Scott, N A; Hudson, G C; Bell, C W; Woodworth, L M


    A gene in equine herpesvirus 1 (EHV-1; equine abortion virus) equivalent to the gB glycoprotein gene of herpes simplex virus (HSV) has been identified by DNA hybridization and nucleotide sequencing. A 4.3 kbp EHV-1 PstI-ClaI sequence (0.40 to 0.43 map units) contained an open reading frame flanked by appropriate control elements and was capable of encoding a polypeptide of 980 amino acids. This had 50 to 60% identity over a 617 amino acid conserved region with the gB gene products of HSV and three other alphaherpesviruses, and 20 to 30% identity with those of human cytomegalovirus and Epstein-Barr virus. Analysis of the amino acid sequence predicts a long signal peptide, hydrophobic and hydrophilic domains and N-glycosylation sites, and has identified a probable internal proteolytic cleavage site. The EHV-1 gB open reading frame appears to be overlapped at its 5' end by 135 nucleotides of the 3' end of an upstream open reading frame the potential translation product of which has approximately 50% identity with HSV gene ICP 18.5 and VZV gene 30 products.

  6. Bioinformatics analysis and characteristics of VP23 encoded by the newly identified UL18 gene of duck enteritis virus (United States)

    Chen, Xiwen; Cheng, Anchun; Wang, Mingshu; Xiang, Jun


    In this study, the predicted information about structures and functions of VP23 encoded by the newly identified DEV UL18 gene through bioinformatics softwares and tools. The DEV UL18 was predicted to encode a polypeptide with 322 amino acids, termed VP23, with a putative molecular mass of 35.250 kDa and a predicted isoelectric point (PI) of 8.37, no signal peptide and transmembrane domain in the polypeptide. The prediction of subcellular localization showed that the DEV-VP23 located at endoplasmic reticulum with 33.3%, mitochondrial with 22.2%, extracellular, including cell wall with 11.1%, vesicles of secretory system with 11.1%, Golgi with 11.1%, and plasma membrane with 11.1%. The acid sequence of analysis showed that the potential antigenic epitopes are situated in 45-47, 53-60, 102-105, 173-180, 185-189, 260-265, 267-271, and 292-299 amino acids. All the consequences inevitably provide some insights for further research about the DEV-VP23 and also provide a fundament for further study on the the new type clinical diagnosis of DEV and can be used for the development of new DEV vaccine.

  7. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus. (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon


    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  8. Identification of genes encoding critical factors regulating B-cell terminal differentiation in torafugu (Takifugu rubripes). (United States)

    Ohtani, Maki; Miyadai, Toshiaki; Hiroishi, Shingo


    Many transcription factors, and associated co-factors, are involved in the regulation of B-cell terminal differentiation in mammals. In the teleost and cartilaginous fish, although evidence has strongly suggested the existence of B-cell like lymphocytes, the mechanism of terminal differentiation of B-cells remains to be elucidated. In the present study, we searched for the nucleotide and amino acid sequences similar to the critical regulatory factors facilitating the terminal differentiation of B-cells using the fugu BLAST server. We cloned the following cDNAs from Takifugu rubripes: (1) B-lymphocyte-induced maturation protein-1 (Blimp-1), which plays a major role in promoting plasma cell differentiation by repressing the transcription of many genes that participate in maintaining the differentiation of mature B-cells; (2) Bcl-6, which facilitates germinal center formation and represses Blimp-1 expression; (3) X-box binding protein-1 (XBP-1), which operates Ig secretion by activating transcription of the ER-stress responsible genes; (4) Pax-5, which suppresses XBP-1 and enhances the expression of activation-induced cytidine deaminase (AID), an inducer of somatic hypermutation and class-switch recombination of the immunoglobulin gene; and (5) TLE-3, one of the Groucho family proteins, a co-factor for Blimp-1. We also identified other co-factors and many target genes of Blimp-1 by in silico and/or cDNA cloning. These finding indicates that the basal process of B-cell terminal differentiation in fish is controlled by factors identical to those in mammals.

  9. Prevalence of Genes Encoding Outer Membrane Virulence Factors Among Fecal Escherichia coli Isolates

    Directory of Open Access Journals (Sweden)

    Ahmad Rashki


    Full Text Available Objective: Escherichia coli is commensal bacterium of human intestine. The gut is a common pool of E. coli isolates causing urinary tract infections (UTIs. Some of fecal E. coli (FeEC by the possession of certain virulence factors is able to cause diseases in human and other mammalian models. To evaluate the health threats coordinated with a given fecal source of E. coli strains, we determined the frequency of genes expressing virulence determinants in fecal E. coli isolates collected from human feces in Zabol, southeast of Iran. Methods: Escherichia coli isolates (n = 94 were separated from the feces of patients attending teaching hospitals, and screened for various virulence genes: fimH, his, hlyA, ompT, irp2, iucD, iroN, and cnf1 by using the multiplex polymerase chain reaction (PCR method. Results: The prevalence of virulence genes was as follows: adhesins (fimH, 98% and iha, 26%, alpha-hemolysins (hlyA, 10%, outer membrane protease (ompT, 67%, aerobactin (iucD, 67%, iron-repressible protein (irp2, 91% and salmochelin (iroN, 33% and cytotoxic necrotizing factor 1 (cnf1. According to the diversity of different virulence genes, the examined isolates exhibited 29 different patterns. Conclusion: Our results demonstrated that most of the assessed isolates harbored several virulence factors. Our findings propose possibility of human feces serving as a source for pathogenic organisms, supporting the notion that fecal materials of humans play a role in the epidemiological chain of extra-intestinal pathogenic E. coli. This is the first report of the frequency of virulence factors among E. coli isolates collected from human feces in Iran.

  10. Novel mutations in genes encoding subcortical maternal complex proteins may cause human embryonic developmental arrest. (United States)

    Wang, Xueqian; Song, Di; Mykytenko, Dmytro; Kuang, Yanping; Lv, Qifeng; Li, Bin; Chen, Biaobang; Mao, Xiaoyan; Xu, Yao; Zukin, Valery; Mazur, Pavlo; Mu, Jian; Yan, Zheng; Zhou, Zhou; Li, Qiaoli; Liu, Suying; Jin, Li; He, Lin; Sang, Qing; Sun, Zhaogui; Dong, Xi; Wang, Lei


    Successful human reproduction initiates from normal gamete formation, fertilization and early embryonic development. Abnormalities in any of these steps will lead to infertility. Many infertile patients undergo several failures of IVF and intracytoplasmic sperm injection (ICSI) cycles, and embryonic developmental arrest is a common phenotype in cases of recurrent failure of IVF/ICSI attempts. However, the genetic basis for this phenotype is poorly understood. The subcortical maternal complex (SCMC) genes play important roles during embryonic development, and using whole-exome sequencing novel biallelic mutations in the SCMC genes TLE6, PADI6 and KHDC3L were identified in four patients with embryonic developmental arrest. A mutation in TLE6 was found in a patient with cleaved embryos that arrested on day 3 and failed to form blastocysts. Two patients with embryos that arrested at the cleavage stage had mutations in PADI6, and a mutation in KHDC3L was found in a patient with embryos arrested at the morula stage. No mutations were identified in these genes in an additional 80 patients. These findings provide further evidence for the important roles of TLE6, PADI6 and KHDC3L in embryonic development. This work lays the foundation for the genetic diagnosis of patients with recurrent IVF/ICSI failure. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  11. Multidrug-Resistant Escherichia albertii: Co-occurrence of β-Lactamase and MCR-1 Encoding Genes

    Directory of Open Access Journals (Sweden)

    Qun Li


    Full Text Available Escherichia albertii is an emerging member of the Enterobacteriaceae causing human and animal enteric infections. Antimicrobial resistance among enteropathogens has been reported to be increasing in the past years. The purpose of this study was to investigate antibiotic resistance and resistance genes in E. albertii isolated from Zigong city, Sichuan province, China. The susceptibility to 21 antimicrobial agents was determined by Kirby–Bauer disk diffusion method. The highest prevalence was tetracycline resistance with a rate of 62.7%, followed by resistance to nalidixic acid and streptomycin with a rate of 56.9 and 51.0%, respectively. All isolates were sensitive or intermediate susceptible to imipenem, meropenem, amoxicillin–clavulanic acid, and levofloxacin. Among 51 E. albertii isolates, 15 were extended-spectrum β-lactamase-producing as confirmed by the double disk test. The main β-lactamase gene groups, i.e., blaTEM, blaSHV, and blaCTX-M, were detected in17, 20, and 22 isolates, respectively. Furthermore, four colistin-resistant isolates with minimum inhibitory concentrations of 8 mg/L were identified. The colistin-resistant isolates all harbored mcr-1 and blaCTX-M-55. Genome sequencing showed that E. albertii strain SP140150 carried mcr-1 and blaCTX-M-55 in two different plasmids. This study provided significant information regarding antibiotic resistance profiles and identified the co-occurrence of β-lactamase and MCR-1 encoding genes in E. albertii isolates.

  12. The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier (United States)

    Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.


    Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.

  13. Characterisation of genes encoding key enzymes involved in sugar metabolism of apple fruit in controlled atmosphere storage. (United States)

    Zhu, Zhu; Liu, Ruiling; Li, Boqiang; Tian, Shiping


    Sugars are essential contributors to fruit flavour. Controlled atmosphere (CA) storage has been proved to be beneficial for maintaining harvested fruit quality. To explore regulatory mechanism of sugar metabolism in fruit stored in CA condition, we cloned several genes, encoding key enzymes, involved in sugar metabolism in apple fruit, and analyzed sugar contents, along with gene expression and enzyme activities in fruits stored in air and CA. The results indicated that CA could maintain higher contents of sugars, including sucrose, fructose and glucose. Expression levels of key genes, such as sucrose synthase (SS), sucrose phosphate synthase (SPS), fructokinase (FK) and hexokinase (HK), were shown to be correlated with the corresponding enzyme activities. We found that activities of neutral invertase (NI), vacuolar invertase (VI), FK and HK were inhibited, but SPS activity was promoted in apple fruit stored in CA, suggesting that CA storage could enhance sucrose synthesis and delay hydrolysis of sucrose and hexose. These findings provided molecular evidence to explain why higher sugar levels in harvested fruit are maintained under CA storage. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Polymorphisms in genes encoding drug metabolizing enzymes and their influence on the outcome of children with neuroblastoma. (United States)

    Ashton, Lesley J; Murray, Jayne E; Haber, Michelle; Marshall, Glenn M; Ashley, David M; Norris, Murray D


    Although several studies have shown that drug metabolizing enzyme gene polymorphisms may influence the impact of therapy in childhood leukemia, no comprehensive investigations have been carried out in children with neuroblastoma. The aim of this study was to identify polymorphisms in the genes encoding phase I and II drug metabolizing enzymes associated with the risk of relapse or death in a cohort of 209 children with neuroblastoma. Real-time PCR allelic discrimination was used to characterize the presence of polymorphisms in DNA from children with neuroblastoma. Three broad gene categories were examined: cytochrome P450, glutathione-S-transferase and N-acetyltransferase. Cumulative event-free survival was computed by the Kaplan-Meier method. The influence of selected factors on event-free survival was tested using the Cox proportional hazards model. As previously reported, amplification of MYCN (hazards ratio=4.25, 95% confidence interval=2.76-6.56, Pchildren who were GSTM1 null were more likely to relapse or die during follow-up after adjusting for MYCN amplification, stage and age at diagnosis (hazard ratio=1.6, 95% confidence interval=1.02-2.9, P=0.04). These observations suggest that the NAT1*11 variant and the GSTM1 wild-type genotype contribute to a more favorable outcome in patients treated for neuroblastoma and are the first to demonstrate a relationship between NAT1 and GSTM1 genotypes in childhood neuroblastoma.

  15. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.


    Xu, J; Johnson, R C


    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

  16. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes. (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G


    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  17. Genes encoding homologous antigens in taeniid cestode parasites: Implications for development of recombinant vaccines produced in Escherichia coli. (United States)

    Gauci, Charles; Lightowlers, Marshall W


    Recombinant vaccine antigens are being evaluated for their ability to protect livestock animals against cysticercosis and related parasitic infections. Practical use of some of these vaccines is expected to reduce parasite transmission, leading to a reduction in the incidence of neurocysticercosis and hydatid disease in humans. We recently showed that an antigen (TSOL16), expressed in Escherichia coli, confers high levels of protection against Taenia solium cysticercosis in pigs, which provides a strategy for control of T. solium parasite transmission. Here, we discuss the characteristics of this antigen that may affect the utility of TSOL16 and related antigens for development as recombinant vaccines. We also report that genes encoding antigens closely related to TSOL16 from T. solium also occur in other related species of parasites. These highly homologous antigens have the potential to be used as vaccines and may provide protection against related species of Taenia that cause infection in other hosts.

  18. Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes. (United States)

    Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan


    Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

  19. Molecular cloning and chromosomal mapping of the mouse gene encoding cyclin-dependent kinase 5 regulatory subunit p35

    Energy Technology Data Exchange (ETDEWEB)

    Ohshima, Toshio; Kozak, C.A.; Nagle, J.W. [National Institutes of Health, Bethesda, MD (United States)] [and others


    A neural-specific activating subunit, p35, of cyclin-dependent kinase 5 (Cdk5) was recently reported to differ from other mammalian cyclins, suggesting a new type of regulatory subunit for Cdk activity. The mouse gene encoding p35, Cdk5r, was isolated from a mouse 129/SvJ genomic library, and the genomic structure of Cdk5r was characterized. The most notable features of Cdk5r are the absence of introns in the amino acid coding region and the high homology of amino acid sequence among species. The 5{prime}-flanking region of Cdk5r contained no canonical TATA or CAAT box but had several putative promoter elements, including Sp1, AP2, MRE, and NGFIA. The mouse Cdk5r transcript was detected only in the brain by Northern blot analysis. Mouse Cdk5r was mapped to a position on mouse chromosome 11. 14 refs., 2 figs.

  20. A new mutation in the gene encoding mitochondrial seryl-tRNA synthetase as a cause of HUPRA syndrome. (United States)

    Rivera, Henry; Martín-Hernández, Elena; Delmiro, Aitor; García-Silva, María Teresa; Quijada-Fraile, Pilar; Muley, Rafael; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco


    HUPRA syndrome is a rare mitochondrial disease characterized by hyperuricemia, pulmonary hypertension, renal failure in infancy and alkalosis. This syndrome was previously described in three patients with a homozygous mutation c.1169A > G (p.D390G) in SARS2, encoding the mitochondrial seryl-tRNA synthetase. Here we report the clinical and genetic findings in a girl and her brother. Both patients were clinically diagnosed with the HUPRA syndrome. Analysis of the pedigree identified a new homozygous mutation c.1205G > A (p.R402H) in SARS2 gene. This mutation is very rare in the population and it is located at the C-terminal globular domain of the homodimeric enzyme very close to p.D390G. Several data support that p.R402H mutation in SARS2 is a new cause of HUPRA syndrome.

  1. Cloning, expression and characterization of a gene from earthworm Eisenia fetida encoding a blood-clot dissolving protein.

    Directory of Open Access Journals (Sweden)

    GangQiang Li

    Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.

  2. Molecular characterization of a transient expression gene encoding for 1-aminocyclopropane-1-carboxylate synthase in cotton (Gossypium hirsutum L.). (United States)

    Wang, Xia; Zhang, Ying; Zhang, Jiedao; Cheng, Cheng; Guo, Xingqi


    Ethylene performs an important function in plant growth and development. 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), the key enzyme involved in ethylene biosynthesis, has been the focus of most ethylene studies. Here, a cotton ACS gene referred to as Gossypium hirsutum ACS1 (GhACS1), was isolated. The full-length cDNA of GhACS1 encodes for a 476-amino acid protein which harbors seven conserved regions, 11 invariant amino acid residues, and the PLP binding active site, all of which characterize ACC synthases. Alignment analysis showed that GhACS1 shared a high degree of identity with other known ACC synthases from different species. Two introns were detected in the genomic DNA sequence, and the results of Southern blot analysis suggested that there might be a multi-gene family encoding for ACC synthase in cotton. From the phylogenetic tree constructed with 24 different kinds of ACC synthases, we determined that GhACS1 falls into group II, and was closely associated with the wound-inducible ACS of citrus. The analysis of the 5' flanking region of GhACS1 revealed a group of putative cis-acting elements. The results of expression analysis showed that GhACS1 displayed its transient expression nature after wounding, abscisic acid (ABA), and CuCl(2) treatments. These results indicate that GhACS1, which was transiently expressed in response to certain stimuli, may be involved in the production of ethylene for the transmission of stress signals.

  3. Expression pattern of a nuclear encoded mitochondrial arginine-ornithine translocator gene from Arabidopsis

    Directory of Open Access Journals (Sweden)

    Schneider Anja


    Full Text Available Abstract Background Arginine and citrulline serve as nitrogen storage forms, but are also involved in biosynthetic and catabolic pathways. Metabolism of arginine, citrulline and ornithine is distributed between mitochondria and cytosol. For the shuttle of intermediates between cytosol and mitochondria transporters present on the inner mitochondrial membrane are required. Yeast contains a mitochondrial translocator for ornithine and arginine, Ort1p/Arg11p. Ort1p/Arg11p is a member of the mitochondrial carrier family (MCF essential for ornithine export from mitochondria. The yeast arg11 mutant, which is deficient in Ort1p/Arg11p grows poorly on media lacking arginine. Results High-level expression of a nuclear encoded Arabidopsis thaliana homolog (AtmBAC2 of Ort1p/Arg11p was able to suppress the growth deficiency of arg11. RT-PCR analysis demonstrated expression of AtmBAC2 in all tissues with highest levels in flowers. Promoter-GUS fusions showed preferential expression in flowers, i.e. pollen, in the vasculature of siliques and in aborted seeds. Variable expression was observed in leaf vasculature. Induction of the promoter was not observed during the first two weeks in seedlings grown on media containing NH4NO3, arginine or ornithine as sole nitrogen sources. Conclusion AtmBAC2 was isolated as a mitochondrial transporter for arginine in Arabidopsis. The absence of expression in developing seeds and in cotyledons of seedlings indicates that other transporters are responsible for storage and mobilization of arginine in seeds.

  4. A gene encoding the major beta tubulin of the mitotic spindle in Physarum polycephalum plasmodia

    Energy Technology Data Exchange (ETDEWEB)

    Burland, T.G.; Paul, E.C.A.; Oetliker, M.; Dove, W.F.


    The multinucleate plasmodium of Physarum polycephalum is unusual among eucaryotic cells in that it uses tubulins only in mitotic-spindle microtubules; cytoskeletal, flagellar, and centriolar microtubules are absent in this cell type. The authors identified a ..beta..-tubulin cDNA clone, ..beta..105, which is shown to correspond to the transcript of the betC ..beta..-tubulin locus and to encode ..beta..2 tubulin, the ..beta.. tubulin expressed specifically in the plasmodium and used exclusively in the mitotic spindle. Physarum amoebae utilize tubulins in the cytoskeleton, centrioles, and flagella, in addition to the mitotic spindle. Sequence analysis shows that ..beta..2 tubulin is only 83% identical to the two ..beta.. tubulins expressed in amoebae. This compares with 70 to 83% identity between Physarum ..beta..2 tubulin and the ..beta.. tubulins of yeasts, fungi, alga, trypanosome, fruit fly, chicken, and mouse. On the other hand, Physarum ..beta..2 tubulin is no more similar to, for example, Aspergillus ..beta.. tubulins than it is to those of Drosophila melanogaster or mammals. Several eucaryotes express at least one widely diverged ..beta.. tubulin as well as one or more ..beta.. tubulins that conform more closely to a consensus ..beta..-tubulin sequence. The authors suggest that ..beta..-tubulins diverge more when their expression pattern is restricted, especially when this restriction results in their use in fewer functions. This divergence among ..beta.. tubulins could have resulted through neutral drift. For example, exclusive use of Physarum ..beta..2 tubulin in the spindle may have allowed more amino acid substitutions than would be functionally tolerable in the ..beta.. tubulins that are utilized in multiple microtubular organelles. Alternatively, restricted use of ..beta.. tubulins may allow positive selection to operate more freely to refine ..beta..-tubulin function.

  5. A Causal Gene for Seed Dormancy on Wheat Chromosome 4A Encodes a MAP Kinase Kinase. (United States)

    Torada, Atsushi; Koike, Michiya; Ogawa, Taiichi; Takenouchi, Yu; Tadamura, Kazuki; Wu, Jianzhong; Matsumoto, Takashi; Kawaura, Kanako; Ogihara, Yasunari


    Seed germination under the appropriate environmental conditions is important both for plant species survival and for successful agriculture. Seed dormancy, which controls germination time, is one of the adaptation mechanisms and domestication traits [1]. Seed dormancy is generally defined as the absence of germination of a viable seed under conditions that are favorable for germination [2]. The seed dormancy of cultivated plants has generally been reduced during domestication [3]. Bread wheat (Triticum aestivum L.) is one of the most widely grown crops in the world. Weak dormancy may be an advantage for the productivity due to uniform emergence and a disadvantage for the risks of pre-harvest sprouting (PHS), which decreases grain quality and yield [4]. A number of quantitative trait loci (QTLs) controlling natural variation of seed dormancy have been identified on various chromosomes [5]. A major QTL for seed dormancy has been consistently detected on chromosome 4A [6-13]. The QTL was designated as a major gene, Phs1, which could be precisely mapped within a 2.6 cM region [14]. Here, we identified a mitogen-activated protein kinase kinase 3 (MKK3) gene (designated TaMKK3-A) by a map-based approach as a candidate gene for the seed dormancy locus Phs1 on chromosome 4A in bread wheat. Complementation analysis showed that transformation of a dormant wheat cultivar with the TaMKK3-A allele from a nondormant cultivar clearly reduced seed dormancy. Cultivars differing in dormancy had a single nonsynonymous amino acid substitution in the kinase domain of the predicted MKK3 protein sequence, which may be associated with the length of seed dormancy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Single nucleotide polymorphism of the growth hormone (GH encoding gene in inbred and outbred domestic rabbits

    Directory of Open Access Journals (Sweden)

    Deyana Gencheva Hristova


    Full Text Available Taking into consideration that the growth hormone (GH gene in rabbits is a candidate for meat production, understanding the genetic diversity and variation in this locus is of particular relevance. The present study comprised 86 rabbits (Oryctolagus cuniculus divided into 3 groups: New Zealand White (NZW outbred rabbits; first-generation inbred rabbits (F1 and second-generation inbred rabbits (F2. They were analysed by polymerase chain reaction-based restriction fragment length polymorphism method. A 231 bp fragment of the polymorphic site of the GH gene was digested with Bsh1236 restriction enzyme. Single nucleotide polymorphisms for the studied GH locus corresponding to 3 genotypes were detected in the studied rabbit populations: CC, CT and TT. In the synthetic inbred F1 and F2 populations, the frequency of the heterozygous genotype CT was 0.696 and 0.609, respectively, while for the homozygous CC genotype the frequency was lower (0.043 and 0.000, and respective values for the homozygous TT genotype were 0.261 and 0.391. This presumed a preponderance of the T allele (0.609 and 0.696 over the C allele (0.391 and 0.304 in these groups. In outbred rabbits, the allele frequencies were 0.613 (allele C and 0.387 (allele Т; consequently, the frequency of the homozygous CC genotype was higher than that of the homozygous TT genotype (0.300 vs. 0.075. Observed heterozygosity for the GH gene was higher than expected, and the result was therefore a negative inbreeding coefficient (Fis=–0.317 for outbred NZW rabbits; –0.460 for inbred F1 and –0.438 for inbred F2, indicating a sufficient number of heterozygous forms in all studied groups of rabbits. The application of narrow inbreeding by breeding full sibs in the synthetic population did not cause a rapid increase in homozygosity.

  7. Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors. (United States)

    Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas


    Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.

  8. The Drosophila stonewall gene encodes a putative transcription factor essential for germ cell development. (United States)

    Clark, K A; McKearin, D M


    The differentiation of Drosophila germ cells is a useful model for studying mechanisms of cell specification. We report the identification of a gene, stonewall, that is required for germ cell development. Mutations in stonewall block proper oocyte differentiation and frequently cause the presumptive oocyte to develop as a nurse cell. Eventually, germ cells degenerate apoptotically. Stonewall is a germ cell nuclear protein; Stonewall has a DNA binding domain that shows similarities to the Myb and Adf-1 transcription factors and has other features that suggest that it is a transcription activating factor. We suggest that Stonewall transcriptional regulation is essential in cystocytes for maturation into specialized nurse cells and oocyte.

  9. Genes encoding antimicrobial peptides and immune-related proteins in Apis mellifera.


    Anete Pedro Lourenço


    Os insetos desenvolveram um sistema imune eficiente contra parasitas e patógenos, que compreende a resposta celular e a humoral. Os mecanismos celulares envolvem a fagocitose e a encapsulação pelos hemócitos, enquanto que as respostas humorais incluem a ativação da Profenoloxidase, e a síntese pelo corpo gorduroso dos peptídeos antimicrobianos, que são liberados na hemolinfa. Duas vias de sinalização intracelular, Toll e Imd, controlam a expressão dos genes codificadores dos peptídeos antimic...

  10. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins. (United States)

    Mitchison, A


    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  11. A tomato mutant that shows stunting, wilting, progressive necrosis and constitutive expression of defence genes contains a recombinant Hcr9 gene encoding an autoactive protein. (United States)

    Barker, Claire L; Talbot, Stephen J; Jones, Jonathan D G; Jones, David A


    The tomato Cf-9 gene confers resistance to races of the leaf mould fungus Cladosporium fulvum that carry the Avr9 avirulence gene. Cf-9 resides at a locus containing five paralogous genes and was isolated by transposon tagging using a modified maize Dissociation (Ds) element. The tagging experiment generated an allelic series of Ds-induced mutations of Cf-9, most of which were wild type in appearance. However, one mutant, designated M205, showed stunted growth, wilting, progressive leaf chlorosis and necrosis and constitutive expression of defence genes. The phenotype of M205 was caused by a semidominant, Avr9-independent mutation that co-segregated with a Ds element insertion at the Cf-9 locus. Molecular genetic analysis indicated that the Cf-9 locus of M205 had undergone recombination, generating a chimeric gene, designated Hcr9-M205, that comprised an in-frame fusion between the 5' coding region of the Cf-9 paralogue, Hcr9-9A, and the 3' coding region of Cf-9. The presence of a possible excision footprint adjacent to the junction between Hcr9-9A and Cf-9, and a Ds insertion at the homologous position in the downstream paralogue Hcr9-9D, is consistent with recombination between Hcr9-9A and Cf-9 promoted by transposition of Ds from Cf-9 into Hcr9-9D. Agrobacterium tumefaciens-mediated transient expression of Hcr9-M205 in Nicotiana tabacum caused chlorosis and the accumulation of defence gene transcripts, indicating that the protein encoded by this novel Hcr9 gene is autoactive.

  12. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger. (United States)

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J


    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  13. Metalloregulatory DNA-Binding Protein Encoded by the merR Gene: Isolation and Characterization (United States)

    O'Halloran, Thomas; Walsh, Christopher


    The MerR protein mediates the induction of the mercury resistance phenotype in bacteria; it has been isolated in order to study the effects of metal-ion induced changes in the metabolism of prokaryotic cells at the molecular level. After DNA sequences responsible for negative autoregulation were removed, the 16-kilodalton protein was overproduced and purified to more than 90 percent homogeneity by a salt extraction procedure that yields about 5 milligrams of protein per gram of cells. Complementation data, amino terminal analysis, gel filtration, and deoxyribonuclease I protection studies demonstrate that the purified merR gene product is a dimer under nondenaturing conditions and that it binds specifically to DNA, in the presence and absence of mercury, at a palindromic site which is directly between the -10 and -35 regions of the structural genes and adjacent to its own promoter. These initial results indicate that MerR is a DNA-binding metalloregulatory protein that plays a central role in this heavy metal responsive system and they delineate an operator site in the mer operon.

  14. The Dkk3 gene encodes a vital intracellular regulator of cell proliferation.

    Directory of Open Access Journals (Sweden)

    Jack L Leonard

    Full Text Available Members of the Dickkopf (Dkk family of Wnt antagonists interrupt Wnt-induced receptor assembly and participate in axial patterning and cell fate determination. One family member, DKK3, does not block Wnt receptor activation. Loss of Dkk3 expression in cancer is associated with hyperproliferation and dysregulated ß-catenin signaling, and ectopic expression of Dkk3 halts cancer growth. The molecular events mediating the DKK3-dependent arrest of ß-catenin-driven cell proliferation in cancer cells are unknown. Here we report the identification of a new intracellular gene product originating from the Dkk3 locus. This Dkk3b transcript originates from a second transcriptional start site located in intron 2 of the Dkk3 gene. It is essential for early mouse development and is a newly recognized regulator of ß-catenin signaling and cell proliferation. Dkk3b interrupts nuclear translocation ß-catenin by capturing cytoplasmic, unphosphorylated ß-catenin in an extra-nuclear complex with ß-TrCP. These data reveal a new regulator of one of the most studied signal transduction pathways in metazoans and provides a novel, completely untapped therapeutic target for silencing the aberrant ß-catenin signaling that drives hyperproliferation in many cancers.

  15. Mitochondrial DNA polymorphism in genes encoding ND1, COI and CYTB in canine malignant cancers. (United States)

    Slaska, Brygida; Grzybowska-Szatkowska, Ludmila; Nisztuk, Sylwia; Surdyka, Magdalena; Rozanska, Dorota


    The aim of the study was to identify DNA changes in mitochondrial gene fragments: NADH dehydrogenase subunit 1 (ND1), cytochrome c oxidase subunit I (COI) and cytochrome b (CYTB) in tumor tissue, normal tissue and blood, and to define their association with the tumor type in dogs. Molecular analysis included 144 tests in total. A functional effect of the non-synonymous protein coding SNP was predicted. The presence of polymorphisms in all tested gene fragments in individual tissues of dogs was observed. Heteroplasmic changes were found in ND1 and CYTB in epithelioma glandulae sebacei and in CYTB in lymphoma centroblasticum. The results of in silico analysis show the impact of these alleles (COI: 507, ND1: 450, 216, CYTB: 748) on the functioning of proteins and thus their potential role in carcinogenesis. The possible harmful effects of changes in polypeptides in positions T193N, V98M, V118M and H196P were evaluated. It seems that polymorphisms occurring in cells can have a negative impact on functioning of proteins. This promotes disorders of the energy level in cells.

  16. Bcmimp1, a Botrytis cinerea gene transiently expressed in planta, encodes a mitochondrial protein

    Directory of Open Access Journals (Sweden)

    David eBenito-Pescador


    Full Text Available Botrytis cinerea is a widespread necrotrophic fungus which infects more than 200 plant species. In an attempt to characterize the physiological status of the fungus in planta and to identify genetic factors contributing to its ability to infect the host cells, a differential gene expression analysis during the interaction B. cinerea-tomato was carried out. Gene Bcmimp1 codes for a mRNA detected by differential display in the course of this analysis. During the interaction with the host, it shows a transient expression pattern with maximal expression levels during the colonization and maceration of the infected tissues. Bioinformatic analysis suggested that BCMIMP1 is an integral membrane protein located in the mitochondrial inner membrane. Co-localization experiments with a BCMIMP1-GFP fusion protein confirmed that the protein is targeted to the mitochondria. ΔBcmimp1 mutants do not show obvious phenotypic differences during saprophytic growth and their infection ability was unaltered as compared to the wild-type. Interestingly, the mutants produced increased levels of ROS, likely as a consequence of disturbed mitochondrial function. Although Bcmimp1 expression is enhanced in planta it cannot be considered a pathogenicity factor.

  17. Prokaryotic Expression of Rice Ospgip1 Gene and Bioinformatic Analysis of Encoded Product

    Directory of Open Access Journals (Sweden)

    Xi-jun CHEN


    Full Text Available Using the reference sequences of pgip genes in GenBank, a fragment of 930 bp covering the open reading frame (ORF of rice Ospgip1 (Oryza sativa polygalacturonase-inhibiting protein 1 was amplified. The prokaryotic expression product of the gene inhibited the growth of Rhizoctonia solani, the causal agent of rice sheath blight, and reduced its polygalacturonase activity. Bioinformatic analysis showed that OsPGIP1 is a hydrophobic protein with a molecular weight of 32.8 kDa and an isoelectric point (pI of 7.26. The protein is mainly located in the cell wall of rice, and its signal peptide cleavage site is located between the 17th and 18th amino acids. There are four cysteines in both the N- and C-termini of the deduced protein, which can form three disulfide bonds (between the 56th and 63rd, the 278th and 298th, and the 300th and 308th amino acids. The protein has a typical leucine-rich repeat (LRR domain, and its secondary structure comprises α-helices, β-sheets and irregular coils. Compared with polygalacturonase-inhibiting proteins (PGIPs from other plants, the 7th LRR is absent in OsPGIP1. The nine LRRs could form a cleft that might associate with proteins from pathogenic fungi, such as polygalacturonase.

  18. Brain transcriptional stability upon prion protein-encoding gene invalidation in zygotic or adult mouse

    Directory of Open Access Journals (Sweden)

    Béringue Vincent


    Full Text Available Abstract Background The physiological function of the prion protein remains largely elusive while its key role in prion infection has been expansively documented. To potentially assess this conundrum, we performed a comparative transcriptomic analysis of the brain of wild-type mice with that of transgenic mice invalidated at this locus either at the zygotic or at the adult stages. Results Only subtle transcriptomic differences resulting from the Prnp knockout could be evidenced, beside Prnp itself, in the analyzed adult brains following microarray analysis of 24 109 mouse genes and QPCR assessment of some of the putatively marginally modulated loci. When performed at the adult stage, neuronal Prnp disruption appeared to sequentially induce a response to an oxidative stress and a remodeling of the nervous system. However, these events involved only a limited number of genes, expression levels of which were only slightly modified and not always confirmed by RT-qPCR. If not, the qPCR obtained data suggested even less pronounced differences. Conclusions These results suggest that the physiological function of PrP is redundant at the adult stage or important for only a small subset of the brain cell population under classical breeding conditions. Following its early reported embryonic developmental regulation, this lack of response could also imply that PrP has a more detrimental role during mouse embryogenesis and that potential transient compensatory mechanisms have to be searched for at the time this locus becomes transcriptionally activated.

  19. Identification and Phylogenetic Analysis of a CC-NBS-LRR Encoding Gene Assigned on Chromosome 7B of Wheat

    Directory of Open Access Journals (Sweden)

    Xiangqi Zhang


    Full Text Available Hexaploid wheat displays limited genetic variation. As a direct A and B genome donor of hexaploid wheat, tetraploid wheat represents an important gene pool for cultivated bread wheat. Many disease resistant genes express conserved domains of the nucleotide-binding site and leucine-rich repeats (NBS-LRR. In this study, we isolated a CC-NBS-LRR gene locating on chromosome 7B from durum wheat variety Italy 363, and designated it TdRGA-7Ba. Its open reading frame was 4014 bp, encoding a 1337 amino acid protein with a complete NBS domain and 18 LRR repeats, sharing 44.7% identity with the PM3B protein. TdRGA-7Ba expression was continuously seen at low levels and was highest in leaves. TdRGA-7Ba has another allele TdRGA-7Bb with a 4 bp deletion at position +1892 in other cultivars of tetraploid wheat. In Ae. speltoides, as a B genome progenitor, both TdRGA-7Ba and TdRGA-7Bb were detected. In all six species of hexaploid wheats (AABBDD, only TdRGA-7Bb existed. Phylogenic analysis showed that all TdRGA-7Bb type genes were grouped in one sub-branch. We speculate that TdRGA-7Bb was derived from a TdRGA-7Ba mutation, and it happened in Ae. speltoides. Both types of TdRGA-7B participated in tetraploid wheat formation. However, only the TdRGA-7Bb was retained in hexaploid wheat.

  20. The Aspergillus uvsH gene encodes a product homologous to yeast RAD18 and Neurospora UVS-2. (United States)

    Yoon, J H; Lee, B J; Kang, H S


    The uvsH DNA repair gene of Aspergillus nidulans has been cloned by complementation of the uvsH77 mutation with a cosmid library containing genomic DNA inserts from a wild-type strain. Methylmethane sulfonate (MMS)-resistant transformants were obtained on medium containing 0.01% MMS, to which uvsH mutants exhibit high sensitivity. Retransformation of uvsH77 mutants with the rescued cosmids from the MMS-resistant transformants resulted in restoration of both UV and MMS resistance to wild-type levels. Nucleotide sequence analysis of the genomic DNA and cDNA of the uvsH gene shows that it has an open reading frame (ORF) of 1329 bp, interrupted by two introns of 51 and 61 bp. A 2.4 kb transcript of the uvsH gene was detected by Northern blot analysis. Primer extension analysis revealed that transcription starts at 31 bp upstream from the translation initiation codon. This gene encodes a predicted polypeptide of 443 amino acids, which has two unique zinc finger motifs. The proposed polypeptide displays 39% identity to the Neurospora crassa UVS-2 protein and 24% identity to the Saccharomyces cerevisiae RAD18 protein. The sequence similarity is particularly high in three domains. One zinc finger (RING finger) motif is located in the first domain close to the N-terminus. The other zinc finger motif is in the second domain. In the third domain, the mutation sites in both the uvsH77 and uvsH304 alleles were identified.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Chloroplast-encoded chlB gene from Pinus thunbergii promotes root and early chlorophyll pigment development in Nicotiana tabaccum. (United States)

    Nazir, Shahid; Khan, Muhammad Sarwar


    Chlorophyll biosynthesis is catalyzed by two multi subunit enzymes; a light-dependent and a light-independent protochlorophyllide oxidoreductase. The light-independent enzyme consists of three subunits (ChlL, ChlN and ChlB) in photosynthetic bacteria and plastids in which the chlB gene encodes the major subunit that catalyzes the reduction of protochlorophyllide to chlorophyllide. We report here stable integration of the chlB gene from Pinus thunbergii into the chloroplast genome of tobacco. Using helium-driven biolistic gun, transplastomic clones were developed in vitro. The stable integration and homoplasmy for transgenes was confirmed by using PCR and Southern blotting techniques. Nodal cuttings of the homoplasmic transgenic and untransformed wild type shoots were cultured on MS medium in the dark. As expected, shoots developed from the cuttings of the wild type plants in the dark showed etiolated growth with no roots whereas shoots from the cuttings of the transgenic plants developed early and more roots. Upon shifting from dark to light in growth room, leaves of the transgenic shoots showed early development of chlorophyll pigments compared to the wild type shoots. Further, photosynthetically indistinguishable transgenic shoots also showed significant difference in root development from untransformed wild type shoots when cuttings were grown in the light. Therefore, it may be concluded that the chlB gene is involved, directly or indirectly, in the root development of tobacco. Further, the gene promotes early development of chlorophyll pigments, upon illumination from dark, in addition to its role in the light-independent chlorophyll formation when expressed together with subunits L&N in other organisms.

  2. Efficient procedure for transferring specific human genes into Chinese hamster cell mutants: interspecific transfer of the human genes encoding leucyl- and asparaginyl-tRNA synthetases

    International Nuclear Information System (INIS)

    Cirullo, R.E.; Dana, S.; Wasmuth, J.J.


    A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure

  3. The ken and barbie gene encoding a putative transcription factor with a BTB domain and three zinc finger motifs functions in terminalia development of Drosophila. (United States)

    Lukacsovich, Tamas; Yuge, Kazuya; Awano, Wakae; Asztalos, Zoltan; Kondo, Shunzo; Juni, Naoto; Yamamoto, Daisuke


    Mutations in the ken and barbie locus are accompanied by the malformation of terminalia in adult Drosophila. Male and female genitalia often remain inside the body, and the same portions of genitalia and analia are missing in a fraction of homozygous flies. Rotated and/or duplicated terminalia are also observed. Terminalia phenotypes are enhanced by mutations in the gap gene tailless, the homeobox gene caudal, and the decapentaplegic gene that encodes a TGFbeta-like morphogen. The ken and barbie gene encodes a protein with three CCHH-type zinc finger motifs that are conserved in several transcription factors such as Krüppel and BCL-6. All defects in ken and barbie mutants are fully rescued by the expression of a wild-type genomic construct, which establishes the causality between phenotypes and the gene. Copyright 2003 Wiley-Liss, Inc.

  4. Mutations in Three Genes Encoding Proteins Involved in Hair Shaft Formation Cause Uncombable Hair Syndrome. (United States)

    Ü Basmanav, F Buket; Cau, Laura; Tafazzoli, Aylar; Méchin, Marie-Claire; Wolf, Sabrina; Romano, Maria Teresa; Valentin, Frederic; Wiegmann, Henning; Huchenq, Anne; Kandil, Rima; Garcia Bartels, Natalie; Kilic, Arzu; George, Susannah; Ralser, Damian J; Bergner, Stefan; Ferguson, David J P; Oprisoreanu, Ana-Maria; Wehner, Maria; Thiele, Holger; Altmüller, Janine; Nürnberg, Peter; Swan, Daniel; Houniet, Darren; Büchner, Aline; Weibel, Lisa; Wagner, Nicola; Grimalt, Ramon; Bygum, Anette; Serre, Guy; Blume-Peytavi, Ulrike; Sprecher, Eli; Schoch, Susanne; Oji, Vinzenz; Hamm, Henning; Farrant, Paul; Simon, Michel; Betz, Regina C


    Uncombable hair syndrome (UHS), also known as "spun glass hair syndrome," "pili trianguli et canaliculi," or "cheveux incoiffables" is a rare anomaly of the hair shaft that occurs in children and improves with age. UHS is characterized by dry, frizzy, spangly, and often fair hair that is resistant to being combed flat. Until now, both simplex and familial UHS-affected case subjects with autosomal-dominant as well as -recessive inheritance have been reported. However, none of these case subjects were linked to a molecular genetic cause. Here, we report the identification of UHS-causative mutations located in the three genes PADI3 (peptidylarginine deiminase 3), TGM3 (transglutaminase 3), and TCHH (trichohyalin) in a total of 11 children. All of these individuals carry homozygous or compound heterozygous mutations in one of these three genes, indicating an autosomal-recessive inheritance pattern in the majority of UHS case subjects. The two enzymes PADI3 and TGM3, responsible for posttranslational protein modifications, and their target structural protein TCHH are all involved in hair shaft formation. Elucidation of the molecular outcomes of the disease-causing mutations by cell culture experiments and tridimensional protein models demonstrated clear differences in the structural organization and activity of mutant and wild-type proteins. Scanning electron microscopy observations revealed morphological alterations in hair coat of Padi3 knockout mice. All together, these findings elucidate the molecular genetic causes of UHS and shed light on its pathophysiology and hair physiology in general. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  5. Detection of Amp C genes encoding for beta-lactamases in Escherichia coli and Klebsiella pneumoniae

    Directory of Open Access Journals (Sweden)

    M Shanthi


    Full Text Available Purpose : Amp C beta-lactamase are Ambler class C enzymes that confer resistance to extended spectrum cephalosporins and are not inhibited by beta-lactamase inhibitors. Their detection is crucial, since the phenotypic tests are not standardised leading to ambiguity in interpretation of results. This study was done to detect the types of Amp C prevalent in Escherichia coli and Klebsiella pneumoniae by multiplex polymerase chain reaction (PCR. Materials and Methods : Seventy-seven consecutive cefoxitin resistant clinical isolates of E. coli (n = 25 and K. pneumoniae (n = 52 were included in the study. Antibiotic susceptibility testing to various classes of antibiotics was performed by disc diffusion using Clinical Laboratory Standards Institute (CLSI guidelines. Minimum inhibitory concentration (MIC to cefoxitin, imipenem and meropenem were determined by broth microdilution method. Isolates were screened for production of Extended Spectrum Beta-Lactamase (ESBL. Multiplex PCR was performed for the detection of Amp C genes after phenotypic testing (Hodge test and inhibitor based test. Results : Cefoxitin Hodge test was positive in 40 isolates which included 20 E. coli and 20 K. pneumoniae. There was zone enhancement with boronic acid in 55 isolates, of which 36 were K. pneumoniae and 19 were E. coli. Multiplex PCR detected Amp C in 11/25 E. coli and 12/52 K. pneumoniae isolates. The Amp C genes detected were CIT (Amp C origin - Citrobacter freundii, DHA (Dhahran Hospital, Saudi Arabia, ACC (Ambler class C, EBC (Amp C origin - Enterobacter cloacae groups. ESBL was co-produced in 54 isolates. Conclusions : Amp C was detected in 29.87% of the study isolates. Majority of them co-produced ESBL. The most common Amp C was the CIT family. Screen tests for cefoxitin resistance may be falsely positive due to production of carbapenamases.

  6. CLE peptide-encoding gene families in Medicago truncatula and Lotus japonicus, compared with those of soybean, common bean and Arabidopsis

    DEFF Research Database (Denmark)

    Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M


    these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...... in controlling legume nodulation. Here, the entire family of CLE peptide-encoding genes was identified in Medicago truncatula (52) and Lotus japonicus (53), including pseudogenes and non-functional sequences that were identified. An array of bioinformatic techniques were used to compare and contrast...

  7. The basis for rootstock resilient to Capnodis species: screening for genes encoding δ-endotoxins from Bacillus thuringiensis. (United States)

    Gindin, Galina; Mendel, Zvi; Levitin, Bella; Kumar, Pradeep; Levi, Tal; Shahi, Preeti; Khasdan, Vadim; Weinthal, Dan; Kuznetsova, Tatiana; Einav, Monica; Kushmaro, Ariel; Protasov, Alex; Zaritsky, Arieh; Ben-Dov, Eitan


    Conventional methods often fail to control the flatheaded borers Capnodis spp., major pests of stone fruit trees; the larvae are protected from insecticides and predation because they feed deep in the roots. A potential solution is transgenic trees producing in their roots toxic compounds such as Cry proteins of Bacillus thuringiensis (Bt). Toxicities against Capnodis larvae were demonstrated by exploiting a recently designed artificial larval diet and an available collection of field isolated Bt. An isolate of Bt tenebrionis (Btt) from commercial bioinsecticide (Novodor) displayed LC50 and LC95 values of 3.2 and 164 mg g(-1) , respectively, against neonates of Capnodis tenebrionis, whereas values of the most toxic field isolate K-7 were 1.9 and 25.6 mg g(-1) respectively. Weights of surviving larvae after 1 month on diets containing low concentrations of K-7 (0.1-1.0 mg g(-1) ) were lower than on Btt or untreated larvae. K-7 was also toxic against larvae of C. cariosa and C. miliaris and found to harbour genes encoding Cry9Ea-like and Cry23Aa/Cry37Aa binary toxins. Larvae of Capnodis spp. are susceptible to Bt Cry toxins. Expressing cry genes active against these pests thus seems a feasible solution towards production of transgenic rootstock trees resilient to the pest. © 2013 Society of Chemical Industry.

  8. The Type Three Secretion System 2-Encoded Regulator EtrB Modulates Enterohemorrhagic Escherichia coli Virulence Gene Expression. (United States)

    Luzader, Deborah H; Willsey, Graham G; Wargo, Matthew J; Kendall, Melissa M


    Enterohemorrhagic Escherichia coli O157:H7 (EHEC) is a foodborne pathogen that causes bloody diarrhea and hemolytic uremic syndrome throughout the world. A defining feature of EHEC pathogenesis is the formation of attaching and effacing (AE) lesions on colonic epithelial cells. Most of the genes that code for AE lesion formation, including a type three secretion system (T3SS) and effectors, are carried within a chromosomal pathogenicity island called the locus of enterocyte effacement (LEE). In this study, we report that a putative regulator, which is encoded in the cryptic E. coli type three secretion system 2 (ETT2) locus and herein renamed EtrB, plays an important role in EHEC pathogenesis. The etrB gene is expressed as a monocistronic transcript, and EtrB autoregulates expression. We provide evidence that EtrB directly interacts with the ler regulatory region to activate LEE expression and promote AE lesion formation. Additionally, we mapped the EtrB regulatory circuit in EHEC to determine a global role for EtrB. EtrB is regulated by the transcription factor QseA, suggesting that these proteins comprise a regulatory circuit important for EHEC colonization of the gastrointestinal tract. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. The milkweed pod1 gene encodes a KANADI protein that is required for abaxial/adaxial patterning in maize leaves. (United States)

    Candela, Héctor; Johnston, Robyn; Gerhold, Abigail; Foster, Toshi; Hake, Sarah


    Leaf primordia initiate from the shoot apical meristem with inherent polarity; the adaxial side faces the meristem, while the abaxial side faces away from the meristem. Adaxial/abaxial polarity is thought to be necessary for laminar growth of leaves, as mutants lacking either adaxial or abaxial cell types often develop radially symmetric lateral organs. The milkweed pod1 (mwp1) mutant of maize (Zea mays) has adaxialized sectors in the sheath, the proximal part of the leaf. Ectopic leaf flaps develop where adaxial and abaxial cell types juxtapose. Ectopic expression of the HD-ZIPIII gene rolled leaf1 (rld1) correlates with the adaxialized regions. Cloning of mwp1 showed that it encodes a KANADI transcription factor. Double mutants of mwp1-R with a microRNA-resistant allele of rld1, Rld1-N1990, show a synergistic phenotype with polarity defects in sheath and blade and a failure to differentiate vascular and photosynthetic cell types in the adaxialized sectors. The sectored phenotype and timing of the defect suggest that mwp1 is required late in leaf development to maintain abaxial cell fate. The phenotype of mwp1; Rld1 double mutants shows that both genes are also required early in leaf development to delineate leaf margins as well as to initiate vascular and photosynthetic tissues.

  10. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen


    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  11. Genome-wide identification, expression and chromosomal location of the genes encoding chitinolytic enzymes in Zea mays. (United States)

    Shoresh, Michal; Harman, Gary E


    Chitinolytic enzymes are important pathogenesis and stress related proteins. We identified 27 putative genes encoding endochitinases in the maize genome via in silico techniques and four exochitinases. Only seven of the endochitinases and segments of the exochitinases were heretofore known. The endochitinases included members of family 19 chitinases (classes I-IV of PR3, II of PR4) and members of family 18 chitinases (class III of PR8). Some similar enzymes were detected on adjacent regions of the same chromosome, and seem to result from duplication events. Most of the genes expressed were identified from EST libraries from plants exposed to biotic or abiotic stresses but also from libraries from tissues not exposed to stresses. We isolated proteins from seedlings of maize in the presence or absence of the symbiotic root colonizing fungus Trichoderma harzianum strain T22, and analyzed the activity of chitinolytic enzymes using an in-gel activity assay. The activity bands were identified by LC/MS/MS using the database from our in silico study. The identities of the enzymes changed depending on whether or not T22 was present. One activity band of about 95 kDa appeared to be a heterodimer between an exochitinase and any of several different endochitinases. The identity of the endochitinase component appeared to be dependent upon treatment.

  12. Comparative analysis of alkaline phosphatase-encoding genes (phoX) in two contrasting zones of Lake Taihu. (United States)

    Dai, Jiangyu; Chen, Dan; Wu, Shiqiang; Wu, Xiufeng; Zhou, Jie; Tang, Xiangming; Shao, Keqiang; Gao, Guang


    Limnetic habitats that are dominated by either algae or macrophytes represent the 2 dominant ecosystems in shallow lakes. We assessed seasonal variations in the diversity and abundance of alkaline phosphate-encoding genes (phoX) in these 2 zones of Lake Taihu, which is a large, shallow, eutrophic lake in China. There was no significant difference in seasonal mean phoX diversity between the 2 zones, whereas the seasonal mean phoX abundance in the macrophyte-dominated region was higher than that in the algae-dominated region. The bulk of the genotypes in the 2 regions were most similar to the alphaproteobacterial and betaproteobacterial phoX. Genotypes most similar to phoX affiliated with Betaproteobacteria were present with greater diversity in the macrophyte-dominated zone than in the algae-dominated zone. In the algae-dominated zone, the relative proportion of genotypes most similar to cyanobacterial phoX was highest (38.8%) in summer. In addition to the different genotype structures and environmental factors between the 2 stable states, the lower gene abundances and higher alkaline phosphatase activities in Meiliang Bay in summer than those in Xukou Bay reveals different organophosphate-mineralizing modes in these 2 contrasting habitats.

  13. A split and rearranged nuclear gene encoding the iron-sulfur subunit of mitochondrial succinate dehydrogenase in Euglenozoa

    Directory of Open Access Journals (Sweden)

    Gray Michael W


    Full Text Available Abstract Background Analyses based on phylogenetic and ultrastructural data have suggested that euglenids (such as Euglena gracilis, trypanosomatids and diplonemids are members of a monophyletic lineage termed Euglenozoa. However, many uncertainties are associated with phylogenetic reconstructions for ancient and rapidly evolving groups; thus, rare genomic characters become increasingly important in reinforcing inferred phylogenetic relationships. Findings We discovered that the iron-sulfur subunit (SdhB of mitochondrial succinate dehydrogenase is encoded by a split and rearranged nuclear gene in Euglena gracilis and trypanosomatids, an example of a rare genomic character. The two subgenic modules are transcribed independently and the resulting mRNAs appear to be independently translated, with the two protein products imported into mitochondria, based on the presence of predicted mitochondrial targeting peptides. Although the inferred protein sequences are in general very divergent from those of other organisms, all of the required iron-sulfur cluster-coordinating residues are present. Moreover, the discontinuity in the euglenozoan SdhB sequence occurs between the two domains of a typical, covalently continuous SdhB, consistent with the inference that the euglenozoan 'half' proteins are functional. Conclusion The discovery of this unique molecular marker provides evidence for the monophyly of Euglenozoa that is independent of evolutionary models. Our results pose questions about the origin and timing of this novel gene arrangement and the structure and function of euglenozoan SdhB.

  14. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae. (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo


    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. A recombinant rabies virus encoding two copies of the glycoprotein gene confers protection in dogs against a virulent challenge.

    Directory of Open Access Journals (Sweden)

    Xiaohui Liu

    Full Text Available The rabies virus (RABV glycoprotein (G is the principal antigen responsible for the induction of virus neutralizing antibodies (VNA and is the major modality of protective immunity in animals. A recombinant RABV HEP-Flury strain was generated by reverse genetics to encode two copies of the G-gene (referred to as HEP-dG. The biological properties of HEP-dG were compared to those of the parental virus (HEP-Flury strain. The HEP-dG recombinant virus grew 100 times more efficiently in BHK-21 cell than the parental virus, yet the virulence of the dG recombinant virus in suckling mice was lower than the parental virus. The HEP-dG virus can improve the expression of G-gene mRNA and the G protein and produce more offspring viruses in cells. The amount of G protein revealed a positive relationship with immunogenicity in mice and dogs. The inactivated HEP-dG recombinant virus induced higher levels of VNA and conferred better protection against virulent RABV in mice and dogs than the inactivated parental virus and a commercial vaccine. The protective antibody persisted for at least 12 months. These data demonstrate that the HEP-dG is stable, induces a strong VNA response and confers protective immunity more effectively than the RABV HEP-Flury strain. HEP-dG could be a potential candidate in the development of novel inactivated rabies vaccines.

  16. A recombinant rabies virus encoding two copies of the glycoprotein gene confers protection in dogs against a virulent challenge. (United States)

    Liu, Xiaohui; Yang, Youtian; Sun, Zhaojin; Chen, Jing; Ai, Jun; Dun, Can; Fu, Zhen F; Niu, Xuefeng; Guo, Xiaofeng


    The rabies virus (RABV) glycoprotein (G) is the principal antigen responsible for the induction of virus neutralizing antibodies (VNA) and is the major modality of protective immunity in animals. A recombinant RABV HEP-Flury strain was generated by reverse genetics to encode two copies of the G-gene (referred to as HEP-dG). The biological properties of HEP-dG were compared to those of the parental virus (HEP-Flury strain). The HEP-dG recombinant virus grew 100 times more efficiently in BHK-21 cell than the parental virus, yet the virulence of the dG recombinant virus in suckling mice was lower than the parental virus. The HEP-dG virus can improve the expression of G-gene mRNA and the G protein and produce more offspring viruses in cells. The amount of G protein revealed a positive relationship with immunogenicity in mice and dogs. The inactivated HEP-dG recombinant virus induced higher levels of VNA and conferred better protection against virulent RABV in mice and dogs than the inactivated parental virus and a commercial vaccine. The protective antibody persisted for at least 12 months. These data demonstrate that the HEP-dG is stable, induces a strong VNA response and confers protective immunity more effectively than the RABV HEP-Flury strain. HEP-dG could be a potential candidate in the development of novel inactivated rabies vaccines.

  17. Molecular cloning and expression profile of a Halloween gene encoding Cyp307A1 from the seabuckthorn carpenterworm, Holcocerus hippophaecolus. (United States)

    Zhou, Jiao; Zhang, Haolin; Li, Juan; Sheng, Xia; Zong, Shixiang; Luo, Youqing; Nagaoka, Kentaro; Weng, Qiang; Watanabe, Gen; Taya, Kazuyoshi


    20-Hydroxyecdyone, an active form of ecdysteroid, is the key hormone in insect growth and development. Halloween genes encode ecdysteroidogenic enzymes, including cytochrome P450 monooxygenase. CYP307A1 (spook) is accepted as an enzyme acting in the so-called 'black box' that includes a series of hypothetical and unproven reactions that finally result in the oxidation of 7-dehydrocholesterol to diketol. In this study, the Holcocerus hippophaecolus Hua (Lepidoptera: Cossidae) CYP307A1 (HhSpo) gene was identified and characterized. The obtained cDNA sequence was 2084 base pairs with an open reading frame of 537 animo acids, in which existed conserved motifs of CYP450 enzymes. The transcript profiles of HhSpo were analyzed in various tissues of final instar larvae. The highest expression was observed in the prothoracic gland, while expression level was low but significant in other tissues. These results suggest that the sequence character and expression profile of HhSpo were well conserved and provided the basic information for its functional analysis.


    Directory of Open Access Journals (Sweden)



    Full Text Available After isolation in 1970s, Campylobacter jejuni become the most commonlyrecognized cause of bacterial gastroenteritis in man. In animals is frequently foundin bovines on ovines. Publishing of the genome sequence of Campylobacter jejuni11168 (Parkhill, 2000 revealed the presence of only one cytochrome P450 in anoperon involved in sugar and cell surface biosynthesis. The gene name is Cj1411c, is1359 bp long and encodes 453 aa. The sequence is strictly conserved inCampylobacter jejuni RM221. Similarities with two cytochrome P450s, one formSilicobacter sp. and one form Poloromonas sp., were identified. These two enzymesare known to be involved in ascorbate and aldarate metabolism. The recombinantconstruct allowed the expression of active P450 enzyme with a 450 nm peak whenbinds CO. The protein was purified in proportion of ~ 70 %. By deleting the P450gene from the Campylobacter jejuni 11168 genome clear changes in cellmorphology were identified cells becoming wider and shorter. The capsular sugarprofile of the NCI strain reveals the presence of arabinose which was not found inthe wild type strain. The arabinose was identified by both High Performance LiquidChromatography (HPLC and Nuclear Magnetic Resonance (NMR.

  19. Effect of IL-22 on DNA vaccine encoding LACK gene of Leishmania major in BALB/c mice. (United States)

    Hezarjaribi, Hajar Ziaee; Ghaffarifar, Fatemeh; Dalimi, Abdolhosein; Sharifi, Zohreh; Jorjani, Ogholniaz


    In the present study, the effect of IL-22 together with the plasmid encoding LACK (Leishmania homolog of receptors for activated C-kinase) gene of Leishmania major on the trend of leishmaniasis in BALB/c mice was evaluated. Evaluation of the cellular and humoral immunity was performed by measurement of IL-4 and IFN-γ, culture of splenocytes and MTT assay, and measurement of total IgG, IgG1, and IgG2a in the control and immunized groups. Clinical evaluations were also carried out by measurement of the lesion size, survival rate, and body weight of mice. Comparison of the mean size of lesions in the LACK and LACK+IL-22 groups demonstrated that the mean size of lesions of the two groups was significantly different from week four (pLACK gene), and pcLACK+IL-22 groups were 20%, 40%, 60%, and 80%, respectively. According to the results of IFN-γ, IL-4, total IgG, IgG1, and IgG2a measurement and the MTT assay, IL-22 obviously caused an increase in IFN-γ production and a decrease in IL-4 production before and after the challenge (p<0.05). The results showed the effectiveness of IL-22 in DNA vaccine. It showed that IL-22 brought about Th1 cytokine responses and high survival rate of mice. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Cloning, Characterization, and Expression Analysis of a Gene Encoding a Putative Lysophosphatidic Acid Acyltransferase from Seeds of Paeonia rockii. (United States)

    Zhang, Qing-Yu; Niu, Li-Xin; Yu, Rui; Zhang, Xiao-Xiao; Bai, Zhang-Zhen; Duan, Ke; Gao, Qing-Hua; Zhang, Yan-Long


    Tree peony (Paeonia section Moutan DC.) is an excellent woody oil crop, and the cloning and functional analysis of genes related to fatty acid (FA) metabolism from this organism has not been reported. Lysophosphatidic acid acyltransferase (LPAAT), which converts lysophosphatidic acid (LPA) to phosphatidic acid (PA), catalyzes the addition of fatty acyl moieties to the sn-2 position of the LPA glycerol backbone in triacylglycerol (TAG) biosynthesis. This project reports a putative lysophosphatidic acid acyltransferase gene PrLPAAT1 isolated from Paeonia rockii. Our data indicated that PrLPAAT1 has 1047 nucleotides and encodes a putative 38.8 kDa protein with 348 amino acid residues. Bioinformatic analysis demonstrated that PrLPAAT1 contains two transmembrane domains (TMDs). Subcellular localization analysis confirmed that PrLPAAT1 is a plasma membrane protein. Phylogenetic analysis revealed that PrLPAAT1 shared 74.3 and 65.5% amino acid sequence identities with the LPAAT1 sequences from columbine and grape, respectively. PrLPAAT1 belongs to AGPAT family, and may have acyltransferase activity. PrLPAAT1 was ubiquitously expressed in diverse tissues, and PrLPAAT1 expression was higher in the flower and developing seed. PrLPAAT1 is probably an important component in the FA accumulation process, especially during the early stages of seed development. PrLPAAT1 overexpression using a seed-specific promoter increased total FA content and the main FA accumulation in Arabidopsis transgenic plants.

  1. [Cloning, expression and antigenic analysis of VP1-VP4 gene encoding the structural protein of Coxsackie virus A16]. (United States)

    Song, Yuanbin; He, Sijie; Yu, Nan; Chen, Xinxin; Wang, Bin; Che, Xiaoyan; Zeng, Qiyi


    To clone and express VP1-VP4 genes encoding the structural proteins of Coxsackie virus A16 and analyze the antigenicity of the expressed recombinant proteins. The VP1-VP4 cDNAs were amplified with RT-PCR from the extracted viral RNA and cloned into pMD19-T vectors. The VP1-VP4 genes were inserted to the multi-cloning sites of the plasmid pQE30a, and the protein expressions in E. coli M15 were induced by IPTG. After purification by washing with 8 mol/L urea under denaturing condition, the recombinant proteins were identified by Western blotting and ELISA for their immunogenicity against rabbit antisera of Coxsackie virus A16 and enterovirus 71, respectively. The recombinant VP1-VP4 proteins were highly expressed in E. coli M15. The purified proteins could be recognized by rabbit antiserum of Coxsackie virus A16 and showed cross reactivity with the rabbit antiserum of Enterovirus 71. The recombinant Coxsackie virus A16 VP1-VP4 proteins obtained possess good antigenicity.

  2. Using an Inducible Promoter of a Gene Encoding Penicillium verruculosum Glucoamylase for Production of Enzyme Preparations with Enhanced Cellulase Performance.

    Directory of Open Access Journals (Sweden)

    Alexander G Bulakhov

    Full Text Available Penicillium verruculosum is an efficient producer of highly active cellulase multienzyme system. One of the approaches for enhancing cellulase performance in hydrolysis of cellulosic substrates is to enrich the reaction system with β -glucosidase and/or accessory enzymes, such as lytic polysaccharide monooxygenases (LPMO displaying a synergism with cellulases.Genes bglI, encoding β-glucosidase from Aspergillus niger (AnBGL, and eglIV, encoding LPMO (formerly endoglucanase IV from Trichoderma reesei (TrLPMO, were cloned and expressed by P. verruculosum B1-537 strain under the control of the inducible gla1 gene promoter. Content of the heterologous AnBGL in the secreted multienzyme cocktails (hBGL1, hBGL2 and hBGL3 varied from 4 to 10% of the total protein, while the content of TrLPMO in the hLPMO sample was ~3%. The glucose yields in 48-h hydrolysis of Avicel and milled aspen wood by the hBGL1, hBGL2 and hBGL3 preparations increased by up to 99 and 80%, respectively, relative to control enzyme preparations without the heterologous AnBGL (at protein loading 5 mg/g substrate for all enzyme samples. The heterologous TrLPMO in the hLPMO preparation boosted the conversion of the lignocellulosic substrate by 10-43%; however, in hydrolysis of Avicel the hLPMO sample was less effective than the control preparations. The highest product yield in hydrolysis of aspen wood was obtained when the hBGL2 and hLPMO preparations were used at the ratio 1:1.The enzyme preparations produced by recombinant P. verruculosum strains, expressing the heterologous AnBGL or TrLPMO under the control of the gla1 gene promoter in a starch-containing medium, proved to be more effective in hydrolysis of a lignocellulosic substrate than control enzyme preparations without the heterologous enzymes. The enzyme composition containing both AnBGL and TrLPMO demonstrated the highest performance in lignocellulose hydrolysis, providing a background for developing a fungal strain capable

  3. Analyses of antioxidant status and nucleotide alterations in genes encoding antioxidant enzymes in patients with benign and malignant thyroid disorders

    Directory of Open Access Journals (Sweden)

    Nur Siti Fatimah Ramli


    Full Text Available Background Synthesis of thyroid hormones and regulation of their metabolism involve free radicals that may affect redox balance in the body. Thyroid disorders causing variations in the levels of thyroid hormones may alter cellular oxidative stress. The aim of this study was to measure the antioxidant activities and biomarkers of oxidative stress in serum and red blood cells (RBC of patients with benign and malignant thyroid disorders and to investigate if changes in the antioxidant activities in these patients were linked to alterations in genes encoding the antioxidant enzymes. Methods Forty-one patients with thyroid disorders from University of Malaya Medical Centre were recruited. They were categorised into four groups: multinodular goitre (MNG (n = 18, follicular thyroid adenoma (FTA (n = 7, papillary thyroid cancer (PTC (n = 10, and follicular thyroid cancer (FTC (n = 6. Serum and RBC of patients were analysed for antioxidant activities, antioxidant enzymes, and biomarkers of oxidative stress. Alterations in genes encoding the antioxidant enzymes were analysed using whole exome sequencing and PCR–DNA sequencing. Results Patients with thyroid disorders had significantly higher serum superoxide dismutase (SOD and catalase (CAT activities compared to control, but had lower activities in RBC. There were no significant changes in serum glutathione peroxidase (GPx activity. Meanwhile, GPx activity in RBC was reduced in PTC and FTC, compared to control and the respective benign groups. Antioxidant activities in serum were decreased in the thyroid disorder groups when compared to the control group. The levels of malondialdehyde (MDA were elevated in the serum of FTA group when compared to controls, while in the RBC, only the MNG and PTC groups showed higher MDA equivalents than control. Serum reactive oxygen species (ROS levels in PTC group of both serum and RBC were significantly higher than control group. Whole exome sequencing has resulted in

  4. Molecular characterization of a novel mosaic tet(S/M) gene encoding tetracycline resistance in foodborne strains of Streptococcus bovis. (United States)

    Barile, Simona; Devirgiliis, Chiara; Perozzi, Giuditta


    The presence of antibiotic-resistance (AR) genes in foodborne bacteria of enteric origin represents a relevant threat to human health in the case of opportunistic pathogens, which can reach the human gut through the food chain. Streptococcus bovis is a human opportunistic pathogen often associated with infections in immune-compromised or cancer patients, and it can also be detected in the environment, including fermented foods. We have focused on the molecular characterization of a tetracycline (Tet)-resistance gene present in 39 foodborne isolates of S. bovis phenotypically resistant to this drug. The gene was identified as a novel tet(S/M) fusion, encoding a mosaic protein composed of the N-terminal 33 amino acids of Tet(S), in-frame with the Tet(M) coding sequence. Heterologous expression of the mosaic gene was found to confer Tet resistance upon Escherichia coli recipients. Moreover, the tet(S/M) gene was found to be transcriptionally inducible by Tet under the endogenous tet(S) promoter in both S. bovis and E. coli. Nucleotide sequencing of the surrounding genomic region of 16.2 kb revealed large blocks of homology with the genomes of Streptococcus infantarius and Lactococcus lactis. A subregion of about 4 kb containing mosaic tet(S/M) was flanked by two copies of the IS1216 mobile element. PCR amplification with primers directed outwards from the tet(S/M) gene identified the presence of a 4.3 kb circular form corresponding to the intervening chromosomal region between the two IS1216 elements, but lacking a replication origin. The circular element shared extensive overall homology with a region of the multidrug-resistance plasmid pK214 from Lc. lactis, containing tet(S), as well as the IS1216 transposase-containing element and intervening non-coding sequences. Linear reconstruction of the insertion events likely to have occurred within this genomic region, inferred from sequence homology, provides further evidence of the chromosomal rearrangements that drive

  5. Molecular cloning and characterization of four genes encoding ethylene receptors associated with pineapple (Ananas comosus L. flowering

    Directory of Open Access Journals (Sweden)

    Yunhe eLi


    Full Text Available Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a and AcETR2b. The 5′ flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2 were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1. The relative expression of AcERS1b, AcETR2a and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1-9 days after ethylene treatment (DAET, whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP and flower primordia (FP appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a and AcETR2b were mainly expressed in the shoot apex at 1-4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon.

  6. Preliminary crystallographic analysis of a possible transcription factor encoded by the mimivirus L544 gene

    International Nuclear Information System (INIS)

    Ciaccafava, Alexandre; Lartigue, Audrey; Mansuelle, Pascal; Jeudy, Sandra; Abergel, Chantal


    The mimivirus L544 gene product was expressed in E. coli and crystallized; preliminary phasing of a MAD data set was performed using the selenium signal present in a crystal of recombinant selenomethionine-substituted protein. Mimivirus is the prototype of a new family (the Mimiviridae) of nucleocytoplasmic large DNA viruses (NCLDVs), which already include the Poxviridae, Iridoviridae, Phycodnaviridae and Asfarviridae. Mimivirus specifically replicates in cells from the genus Acanthamoeba. Proteomic analysis of purified mimivirus particles revealed the presence of many subunits of the DNA-directed RNA polymerase II complex. A fully functional pre-transcriptional complex appears to be loaded in the virions, allowing mimivirus to initiate transcription within the host cytoplasm immediately upon infection independently of the host nuclear apparatus. To fully understand this process, a systematic study of mimivirus proteins that are predicted (by bioinformatics) or suspected (by proteomic analysis) to be involved in transcription was initiated by cloning and expressing them in Escherichia coli in order to determine their three-dimensional structures. Here, preliminary crystallographic analysis of the recombinant L544 protein is reported. The crystals belonged to the orthorhombic space group C222 1 with one monomer per asymmetric unit. A MAD data set was used for preliminary phasing using the selenium signal present in a selenomethionine-substituted protein crystal

  7. A two-component, multimeric endolysin encoded by a single gene. (United States)

    Proença, Daniela; Velours, Christophe; Leandro, Clara; Garcia, Miguel; Pimentel, Madalena; São-José, Carlos


    Bacteriophage endolysins are bacterial cell wall degrading enzymes whose potential to fight bacterial infections has been intensively studied. Endolysins from Gram-positive systems are typically described as monomeric and as having a modular structure consisting of one or two N-terminal catalytic domains (CDs) linked to a C-terminal region responsible for cell wall binding (CWB). We show here that expression of the endolysin gene lys170 of the enterococcal phage F170/08 results in two products, the expected full length endolysin (Lys170FL) and a C-terminal fragment corresponding to the CWB domain (CWB170). The latter is produced from an in-frame, alternative translation start site. Both polypeptides interact to form the fully active endolysin. Biochemical data strongly support a model where Lys170 is made of one monomer of Lys170FL associated with up to three CWB170 subunits, which are responsible for efficient endolysin binding to its substrate. Bioinformatics analysis indicates that similar secondary translation start signals may be used to produce and add independent CWB170-like subunits to different enzymatic specificities. The particular configuration of endolysin Lys170 uncovers a new mode of increasing the number of CWB motifs associated to CD modules, as an alternative to the tandem repetition typically found in monomeric cell wall hydrolases. © 2014 John Wiley & Sons Ltd.

  8. Murine and human b locus pigmentation genes encode a glycoprotein (gp75) with catalase activity

    International Nuclear Information System (INIS)

    Halaban, R.; Moellmann, G.


    Melanogenesis is regulated in large part by tyrosinase, and defective tyrosinase leads to albinism. The mechanisms for other pigmentation determinants (e.g., those operative in tyrosinase-positive albinism and in murine coat-color mutants) are not yet known. One murine pigmentation gene, the brown (b) locus, when mutated leads to a brown (b/b) or hypopigmentated (B lt /B lt ) coat versus the wild-type black (B/B). The authors show that the b locus codes for a glycoprotein with the activity of a catalase (catalase B). Only the c locus protein is a tyrosinase. Because peroxides may be by-products of melanogenic activity and hydrogen peroxide in particular is known to destroy melanin precursors and melanin, they conclude that pigmentation is controlled not only by tyrosinase but also by a hydroperoxidase. The studies indicate that catalase B is identical with gp75, a known human melanosomal glycoprotein; that the b mutation is in a heme-associated domain; and that the B lt mutation renders the protein susceptible to rapid proteolytic degradation

  9. Identification and Characterization of MAE1, the Saccharomyces cerevisiae Structural Gene Encoding Mitochondrial Malic Enzyme (United States)

    Boles, Eckhard; de Jong-Gubbels, Patricia; Pronk, Jack T.


    Pyruvate, a precursor for several amino acids, can be synthesized from phosphoenolpyruvate by pyruvate kinase. Nevertheless, pyk1 pyk2 mutants of Saccharomyces cerevisiae devoid of pyruvate kinase activity grew normally on ethanol in defined media, indicating the presence of an alternative route for pyruvate synthesis. A candidate for this role is malic enzyme, which catalyzes the oxidative decarboxylation of malate to pyruvate. Disruption of open reading frame YKL029c, which is homologous to malic enzyme genes from other organisms, abolished malic enzyme activity in extracts of glucose-grown cells. Conversely, overexpression of YKL029c/MAE1 from the MET25 promoter resulted in an up to 33-fold increase of malic enzyme activity. Growth studies with mutants demonstrated that presence of either Pyk1p or Mae1p is required for growth on ethanol. Mutants lacking both enzymes could be rescued by addition of alanine or pyruvate to ethanol cultures. Disruption of MAE1 alone did not result in a clear phenotype. Regulation of MAE1 was studied by determining enzyme activities and MAE1 mRNA levels in wild-type cultures and by measuring β-galactosidase activities in a strain carrying a MAE1::lacZ fusion. Both in shake flask cultures and in carbon-limited chemostat cultures, MAE1 was constitutively expressed. A three- to fourfold induction was observed during anaerobic growth on glucose. Subcellular fractionation experiments indicated that malic enzyme in S. cerevisiae is a mitochondrial enzyme. Its regulation and localization suggest a role in the provision of intramitochondrial NADPH or pyruvate under anaerobic growth conditions. However, since null mutants could still grow anaerobically, this function is apparently not essential. PMID:9603875

  10. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities. (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W


    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  11. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose. (United States)

    Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc


    Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products. Copyright © 2014 John Wiley & Sons, Ltd.

  12. Gene encoding a novel invertase from a xerophilic Aspergillus niger strain and production of the enzyme in Pichia pastoris. (United States)

    Veana, Fabiola; Fuentes-Garibay, José Antonio; Aguilar, Cristóbal Noé; Rodríguez-Herrera, Raúl; Guerrero-Olazarán, Martha; Viader-Salvadó, José María


    β-Fructofuranosidases or invertases (EC are enzymes that are widely used in the food industry, where fructose is preferred over sucrose, because it is sweeter and does not crystallize easily. Since Aspergillus niger GH1, an xerophilic fungus from the Mexican semi-desert, has been reported to be an invertase producer, and because of the need for new enzymes with biotechnological applications, in this work, we describe the gene and amino acid sequence of the invertase from A. niger GH1, and the use of a synthetic gene to produce the enzyme in the methylotrophic yeast Pichia pastoris. In addition, the produced invertase was characterized biochemically. The sequence of the invertase gene had a length of 1770 bp without introns, encodes a protein of 589 amino acids, and presented an identity of 93% and 97% with invertases from Aspergillus kawachi IFO 4308 and A. niger B60, respectively. A 4.2 L culture with the constructed recombinant P. pastoris strain showed an extracellular and periplasmic invertase production at 72 h induction of 498 and 3776 invertase units (U), respectively, which corresponds to 1018 U/L of culture medium. The invertase produced had an optimum pH of 5.0, optimum temperature of 60 °C, and specific activity of 3389 U/mg protein, and after storage for 96 h at 4 °C showed 93.7% of its activity. This invertase could be suitable for producing inverted sugar used in the food industry. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Multicistronic lentiviral vectors containing the FMDV 2A cleavage factor demonstrate robust expression of encoded genes at limiting MOI

    Directory of Open Access Journals (Sweden)

    Margison Geoffrey P


    Full Text Available Abstract Background A number of gene therapy applications would benefit from vectors capable of expressing multiple genes. In this study we explored the feasibility and efficiency of expressing two or three transgenes in HIV-1 based lentiviral vector. Bicistronic and tricistronic self-inactivating lentiviral vectors were constructed employing the internal ribosomal entry site (IRES sequence of encephalomyocarditis virus (EMCV and/or foot-and-mouth disease virus (FMDV cleavage factor 2A. We employed enhanced green fluorescent protein (eGFP, O6-methylguanine-DNA-methyltransferase (MGMT, and homeobox transcription factor HOXB4 as model genes and their expression was detected by appropriate methods including fluorescence microscopy, flow cytometry, immunocytochemistry, biochemical assay, and western blotting. Results All the multigene vectors produced high titer virus and were able to simultaneously express two or three transgenes in transduced cells. However, the level of expression of individual transgenes varied depending on: the transgene itself; its position within the construct; the total number of transgenes expressed; the strategy used for multigene expression and the average copy number of pro-viral insertions. Notably, at limiting MOI, the expression of eGFP in a bicistronic vector based on 2A was ~4 times greater than that of an IRES based vector. Conclusion The small and efficient 2A sequence can be used alone or in combination with an IRES for the construction of multicistronic lentiviral vectors which can express encoded transgenes at functionally relevant levels in cells containing an average of one pro-viral insert.

  14. Silencing herpes simplex virus type 1 capsid protein encoding genes by siRNA: a promising antiviral therapeutic approach.

    Directory of Open Access Journals (Sweden)

    Fujun Jin

    Full Text Available Herpes simplex virus type 1 (HSV-1, a member of the herpesviridae, causes a variety of human viral diseases globally. Although a series of antiviral drugs are available for the treatment of infection and suppression of dissemination, HSV-1 remains highly prevalent worldwide. Therefore, the development of novel antiviral agents with different mechanisms of action is a matter of extreme urgency. During the proliferation of HSV-1, capsid assembly is essential for viral growth, and it is highly conserved in all HSV-1 strains. In this study, small interfering RNAs (siRNAs against the HSV-1 capsid protein were screened to explore the influence of silencing capsid expression on the replication of HSV-1. We designed and chemically synthesized siRNAs for the capsid gene and assessed their inhibitory effects on the expression of target mRNA and the total intracellular viral genome loads by quantitative real-time PCR, as well as on the replication of HSV-1 via plaque reduction assays and electron microscopy. Our results showed that siRNA was an effective approach to inhibit the expression of capsid protein encoding genes including UL18, UL19, UL26, UL26.5, UL35 and UL38 in vitro. Interference of capsid proteins VP23 (UL18 and VP5 (UL19 individually or jointly greatly affected the replication of clinically isolated acyclovir-resistant HSV-1 as well as HSV-1/F and HSV-2/333. Plaque numbers and intracellular virions were significantly reduced by simultaneous knockdown of UL18 and UL19. The total intracellular viral genome loads were also significantly decreased in the UL18 and UL19 knockdown groups compared with the viral control. In conclusion, interfering with UL18 and UL19 gene expression could inhibit HSV-1 replication efficiently in vitro. Our research offers new targets for an RNA interference-based therapeutic strategy against HSV-1.

  15. Silencing herpes simplex virus type 1 capsid protein encoding genes by siRNA: a promising antiviral therapeutic approach. (United States)

    Jin, Fujun; Li, Shen; Zheng, Kai; Zhuo, Cuiqin; Ma, Kaiqi; Chen, Maoyun; Wang, Qiaoli; Zhang, Peizhuo; Fan, Jianglin; Ren, Zhe; Wang, Yifei


    Herpes simplex virus type 1 (HSV-1), a member of the herpesviridae, causes a variety of human viral diseases globally. Although a series of antiviral drugs are available for the treatment of infection and suppression of dissemination, HSV-1 remains highly prevalent worldwide. Therefore, the development of novel antiviral agents with different mechanisms of action is a matter of extreme urgency. During the proliferation of HSV-1, capsid assembly is essential for viral growth, and it is highly conserved in all HSV-1 strains. In this study, small interfering RNAs (siRNAs) against the HSV-1 capsid protein were screened to explore the influence of silencing capsid expression on the replication of HSV-1. We designed and chemically synthesized siRNAs for the capsid gene and assessed their inhibitory effects on the expression of target mRNA and the total intracellular viral genome loads by quantitative real-time PCR, as well as on the replication of HSV-1 via plaque reduction assays and electron microscopy. Our results showed that siRNA was an effective approach to inhibit the expression of capsid protein encoding genes including UL18, UL19, UL26, UL26.5, UL35 and UL38 in vitro. Interference of capsid proteins VP23 (UL18) and VP5 (UL19) individually or jointly greatly affected the replication of clinically isolated acyclovir-resistant HSV-1 as well as HSV-1/F and HSV-2/333. Plaque numbers and intracellular virions were significantly reduced by simultaneous knockdown of UL18 and UL19. The total intracellular viral genome loads were also significantly decreased in the UL18 and UL19 knockdown groups compared with the viral control. In conclusion, interfering with UL18 and UL19 gene expression could inhibit HSV-1 replication efficiently in vitro. Our research offers new targets for an RNA interference-based therapeutic strategy against HSV-1.

  16. Identification and functional analysis of the erh1(+ gene encoding enhancer of rudimentary homolog from the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Marek K Krzyzanowski

    Full Text Available The ERH gene encodes a highly conserved small nuclear protein with a unique amino acid sequence and three-dimensional structure but unknown function. The gene is present in animals, plants, and protists but to date has only been found in few fungi. Here we report that ERH homologs are also present in all four species from the genus Schizosaccharomyces, S. pombe, S. octosporus, S. cryophilus, and S. japonicus, which, however, are an exception in this respect among Ascomycota and Basidiomycota. The ERH protein sequence is moderately conserved within the genus (58% identity between S. pombe and S.japonicus, but the intron-rich genes have almost identical intron-exon organizations in all four species. In S. pombe, erh1(+ is expressed at a roughly constant level during vegetative growth and adaptation to unfavorable conditions such as nutrient limitation and hyperosmotic stress caused by sorbitol. Erh1p localizes preferentially to the nucleus with the exception of the nucleolus, but is also present in the cytoplasm. Cells lacking erh1(+ have an aberrant cell morphology and a comma-like shape when cultured to the stationary phase, and exhibit a delayed recovery from this phase followed by slower growth. Loss of erh1(+ in an auxotrophic background results in enhanced arrest in the G1 phase following nutritional stress, and also leads to hypersensitivity to agents inducing hyperosmotic stress (sorbitol, inhibiting DNA replication (hydroxyurea, and destabilizing the plasma membrane (SDS; this hypersensitivity can be abolished by expression of S. pombe erh1(+ and, to a lesser extent, S. japonicus erh1(+ or human ERH. Erh1p fails to interact with the human Ciz1 and PDIP46/SKAR proteins, known molecular partners of human ERH. Our data suggest that in Schizosaccharomyces sp. erh1(+ is non-essential for normal growth and Erh1p could play a role in response to adverse environmental conditions and in cell cycle regulation.

  17. Ocular toxoplasmosis: susceptibility in respect to the genes encoding the KIR receptors and their HLA class I ligands (United States)

    Ayo, Christiane Maria; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Brandão de Mattos, Cinara de Cássia; Previato, Mariana; Barbosa, Amanda Pires; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos


    The objective of this study was to investigate the influence of the genes encoding the KIR receptors and their HLA ligands in the susceptibility of ocular toxoplasmosis. A total of 297 patients serologically-diagnosed with toxoplasmosis were selected and stratified according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping was performed by PCR-SSOP. Statistical analyses were conducted using the Chi-square test, and odds ratio with a 95% confidence interval was also calculated to evaluate the risk association. The activating KIR3DS1 gene was associated with increased susceptibility for ocular toxoplasmosis. The activating KIR together with their HLA ligands (KIR3DS1-Bw4-80Ile and KIR2DS1+/C2++ KIR3DS1+/Bw4-80Ile+) were associated with increased susceptibility for ocular toxoplasmosis and its clinical manifestations. KIR-HLA inhibitory pairs -KIR2DL3/2DL3-C1/C1 and KIR2DL3/2DL3-C1- were associated with decreased susceptibility for ocular toxoplasmosis and its clinical forms, while the KIR3DS1−/KIR3DL1+/Bw4-80Ile+ combination was associated as a protective factor against the development of ocular toxoplasmosis and, in particular, against recurrent manifestations. Our data demonstrate that activating and inhibitory KIR genes may influence the development of ocular toxoplasmosis. PMID:27827450

  18. Cloning, expression and characteristics of a novel alkalistable and thermostable xylanase encoding gene (Mxyl retrieved from compost-soil metagenome.

    Directory of Open Access Journals (Sweden)

    Digvijay Verma

    Full Text Available BACKGROUND: The alkalistable and thermostable xylanases are in high demand for pulp bleaching in paper industry and generating xylooligosaccharides by hydrolyzing xylan component of agro-residues. The compost-soil samples, one of the hot environments, are expected to be a rich source of microbes with thermostable enzymes. METHODOLOGY/PRINCIPAL FINDINGS: Metagenomic DNA from hot environmental samples could be a rich source of novel biocatalysts. While screening metagenomic library constructed from DNA extracted from the compost-soil in the p18GFP vector, a clone (TSDV-MX1 was detected that exhibited clear zone of xylan hydrolysis on RBB xylan plate. The sequencing of 6.321 kb DNA insert and its BLAST analysis detected the presence of xylanase gene that comprised 1077 bp. The deduced protein sequence (358 amino acids displayed homology with glycosyl hydrolase (GH family 11 xylanases. The gene was subcloned into pET28a vector and expressed in E. coli BL21 (DE3. The recombinant xylanase (rMxyl exhibited activity over a broad range of pH and temperature with optima at pH 9.0 and 80°C. The recombinant xylanase is highly thermostable having T1/2 of 2 h at 80°C and 15 min at 90°C. CONCLUSION/SIGNIFICANCE: This is the first report on the retrieval of xylanase gene through metagenomic approach that encodes an enzyme with alkalistability and thermostability. The recombinant xylanase has a potential application in paper and pulp industry in pulp bleaching and generating xylooligosaccharides from the abundantly available agro-residues.

  19. Allelic Diversity and Geographical Distribution of the Gene Encoding Plasmodium falciparum Merozoite Surface Protein-3 in Thailand. (United States)

    Sawaswong, Vorthon; Simpalipan, Phumin; Siripoon, Napaporn; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn


    Merozoite surface proteins (MSPs) of malaria parasites play critical roles during the erythrocyte invasion and so are potential candidates for malaria vaccine development. However, because MSPs are often under strong immune selection, they can exhibit extensive genetic diversity. The gene encoding the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum displays 2 allelic types, K1 and 3D7. In Thailand, the allelic frequency of the P. falciparum msp-3 gene was evaluated in a single P. falciparum population in Tak at the Thailand and Myanmar border. However, no study has yet looked at the extent of genetic diversity of the msp-3 gene in P. falciparum populations in other localities. Here, we genotyped the msp-3 alleles of 63 P. falciparum samples collected from 5 geographical populations along the borders of Thailand with 3 neighboring countries (Myanmar, Laos, and Cambodia). Our study indicated that the K1 and 3D7 alleles coexisted, but at different proportions in different Thai P. falciparum populations. K1 was more prevalent in populations at the Thailand-Myanmar and Thailand-Cambodia borders, whilst 3D7 was more prevalent at the Thailand-Laos border. Global analysis of the msp-3 allele frequencies revealed that proportions of K1 and 3D7 alleles of msp-3 also varied in different continents, suggesting the divergence of malaria parasite populations. In conclusion, the variation in the msp-3 allelic patterns of P. falciparum in Thailand provides fundamental knowledge for inferring the P. falciparum population structure and for the best design of msp-3 based malaria vaccines.

  20. A mutation screening of oncogenes, tumor suppressor gene TP53 and nuclear encoded mitochondrial complex I genes in oncocytic thyroid tumors. (United States)

    Evangelisti, Cecilia; de Biase, Dario; Kurelac, Ivana; Ceccarelli, Claudio; Prokisch, Holger; Meitinger, Thomas; Caria, Paola; Vanni, Roberta; Romeo, Giovanni; Tallini, Giovanni; Gasparre, Giuseppe; Bonora, Elena


    Thyroid neoplasias with oncocytic features represent a specific phenotype in non-medullary thyroid cancer, reflecting the unique biological phenomenon of mitochondrial hyperplasia in the cytoplasm. Oncocytic thyroid cells are characterized by a prominent eosinophilia (or oxyphilia) caused by mitochondrial abundance. Although disruptive mutations in the mitochondrial DNA (mtDNA) are the most significant hallmark of such tumors, oncocytomas may be envisioned as heterogeneous neoplasms, characterized by multiple nuclear and mitochondrial gene lesions. We investigated the nuclear mutational profile of oncocytic tumors to pinpoint the mutations that may trigger the early oncogenic hit. Total DNA was extracted from paraffin-embedded tissues from 45 biopsies of oncocytic tumors. High-resolution melting was used for mutation screening of mitochondrial complex I subunits genes. Specific nuclear rearrangements were investigated by RT-PCR (RET/PTC) or on isolated nuclei by interphase FISH (PAX8/PPARγ). Recurrent point mutations were analyzed by direct sequencing. In our oncocytic tumor samples, we identified rare TP53 mutations. The series of analyzed cases did not include poorly- or undifferentiated thyroid carcinomas, and none of the TP53 mutated cases had significant mitotic activity or high-grade features. Thus, the presence of disruptive TP53 mutations was completely unexpected. In addition, novel mutations in nuclear-encoded complex I genes were identified. These findings suggest that nuclear genetic lesions altering the bioenergetics competence of thyroid cells may give rise to an aberrant mitochondria-centered compensatory mechanism and ultimately to the oncocytic phenotype.

  1. Is the gene encoding Chibby implicated as a tumour suppressor in colorectal cancer ?

    International Nuclear Information System (INIS)

    Gad, Sophie; Teboul, David; Lièvre, Astrid; Goasguen, Nicolas; Berger, Anne; Beaune, Philippe; Laurent-Puig, Pierre


    A novel member of the Wnt signalling pathway, Chibby, was recently identified. This protein inhibits Wnt/β-catenin mediated transcriptional activation by competing with Lef-1 (the transcription factor and target of β-catenin) to bind to β-catenin. This suggests that Chibby could be a tumour suppressor protein. The C22orf2 gene coding Chibby is located on chromosome 22, a region recurrently lost in colorectal cancer. Activation of the Wnt pathway is a major feature of colorectal cancer and occurs through inactivation of APC or activation of β-catenin. All of this led us to analyse the possible implication of Chibby in colorectal carcinogenesis. First, 36 tumour and matched normal colonic mucosa DNA were genotyped with five microsatellite markers located on chromosome 22 to search for loss of heterozygosity. Then, mutation screening of the C22orf2 coding sequence and splice sites was performed in the 36 tumour DNA. Finally, expression of Chibby was analysed by quantitative RT-PCR on 10 patients, 4 with loss of heterozygosity (LOH) on chromosome 22. Loss of heterozygosity involving the C22orf2 region was detected in 11 out of 36 patients (30%). Sequencing analysis revealed a known variant, rs3747174, in exon 5: T321C leading to a silent amino acid polymorphism A107A. Allelic frequencies were 0.69 and 0.31 for T and C variants respectively. No other mutation was detected. Among the 10 patients studied, expression analysis revealed that Chibby is overexpressed in 2 tumours and underexpressed in 1. No correlations were found with 22q LOH status. As no somatic mutation was detected in C22orf2 in 36 colorectal tumour DNA, our results do not support the implication of Chibby as a tumour suppressor in colorectal carcinogenesis. This was supported by the absence of underexpression of Chibby among the tumour samples with 22q LOH. The implication of other Wnt pathway members remains to be identified to explain the part of colorectal tumours without mutation in APC and β-catenin

  2. The stem rust resistance gene Rpg5 encodes a protein with nucleotide-binding-site, leucine-rich, and protein kinase domains. (United States)

    Brueggeman, R; Druka, A; Nirmala, J; Cavileer, T; Drader, T; Rostoks, N; Mirlohi, A; Bennypaul, H; Gill, U; Kudrna, D; Whitelaw, C; Kilian, A; Han, F; Sun, Y; Gill, K; Steffenson, B; Kleinhofs, A


    We isolated the barley stem rust resistance genes Rpg5 and rpg4 by map-based cloning. These genes are colocalized on a 70-kb genomic region that was delimited by recombination. The Rpg5 gene consists of an unusual structure encoding three typical plant disease resistance protein domains: nucleotide-binding site, leucine-rich repeat, and serine threonine protein kinase. The predicted RPG5 protein has two putative transmembrane sites possibly involved in membrane binding. The gene is expressed at low but detectable levels. Posttranscriptional gene silencing using VIGS resulted in a compatible reaction with a normally incompatible stem rust pathogen. Allele sequencing also validated the candidate Rpg5 gene. Allele and recombinant sequencing suggested that the probable rpg4 gene encoded an actin depolymerizing factor-like protein. Involvement of actin depolymerizing factor genes in nonhost resistance has been documented, but discovery of their role in gene-for-gene interaction would be novel and needs to be further substantiated.

  3. CmBGI Gene Expression encoding β-glucosidase in melon (Cucumis melo L. under stress condition

    Directory of Open Access Journals (Sweden)

    Yuanita Rachmawati


    Full Text Available CmBGI is the enzymatic genes encoding β-glucosidase that involved in Abscisic Acid (ABA metabolism of Cucumis melo L. β-glucosidase promotes the accumulation of glucose, fructose, and sucrose, and it might act as a regulator that mediates melon fruit ripening both climacteric and nonclimacteric. ABA mediates adaptive responses to abiotic and biotic stresses. Agricultural Balitbang in 1997 showed that there were approximately 158.600 ha of degraded land scattered in three zones of agroecosystems in Yogyakarta (DIY. One of them is Dlingo Bantul area which has a karst type critical land area. Karst provides stress to the certain plant growth. One way to conserve critical land is making this area for agriculture. Cultivar TACAPA and TA were superior melons that have been developed by Genetic Laboratory of Biology Faculty UGM. This preliminary research was conducted to examine molecular characterization of CmBGI gene expression in cultivar TACAPA and TA which are planted in normal condition medium and in critical land medium treatment. Total RNA was extracted from leaf tissue then Reversed Transcriptase (RT-PCR to collect cDNA library. cDNA was amplified using specific primer. Spectrophotometry was conducted in λ260 nm and electrophoresis run in 1.5% agarose gel. Control of band chosen was Cm-Actin. CmBGI gene concentration of TACAPA and TA in normal condition medium are in succession 578.5 and 579.4 μg/ml then for critical land medium treatment 743.4 and 773.5 μg/ml. CmBGI band was showed both of TACAPA and TA as ± 1258 bp. Cm-actin was showed band of DNA as ± 445 bp. CmBGI gene concentration in critical land medium treatment which is given greater stress on melons are higher than normal condition. This suggests that the CmBGI gene is expressed more in cultivar TACAPA and TA melons when they are grown under stress condition.

  4. QRI, a retina-specific gene, encodes an extracellular matrix protein exclusively expressed during neural retina differentiation. (United States)

    Casado, F J; Pouponnot, C; Jeanny, J C; Lecoq, O; Calothy, G; Pierani, A


    Neural retina development results from growth arrest of neuroectodermal precursors and differentiation of postmitotic cells. The QRI gene is specifically expressed in Müller retinal glial cells. Its expression coincides with the stage of withdrawal from the cell cycle and establishment of differentiation and is repressed upon induction of retinal cell proliferation by the v-src gene product. In this report, we show that the QR1 gene encodes several glycosylated proteins that are secreted and can either associate with the extracellular matrix or remain diffusible in the medium. By using pulse-chase experiments, the 100-103 kDa forms seem to appear first and are specifically incorporated into the extracellular matrix, whereas the 108 and 60 kDa polypeptides appear later and are detected as soluble forms in the culture medium. We also report that expression of the QR1 gene is developmentally regulated in the chicken. Its mRNA is first detectable at embryonic day 10, reaches a maximal level at embryonic day 15 and is no longer detected at embryonic day 18. Immunolocalization of the QR1 protein in chicken retina sections during development shows that expression of the protein parallels the differentiation pattern of post-miotic cells (in particular Müller cells and rods), corresponding to the two differentiation gradients in the retina: from the ganglion cell layer to the inner nuclear layer and outer nuclear layer, and from the optic nerve to the iris. At embryonic day 10, expression of the QR1 protein(s) is restricted to the optic nerve region and the inner nuclear layer, colocalizing with Müller cell bodies. As development proceeds, QR1 protein localization spreads towards the iris and towards the outer nuclear layer, following Müller cell elongations towards the photoreceptors. Between embryonic days 16 and 18, the QR1 protein is no longer detectable in the optic nerve region and is concentrated around the basal segment of the photoreceptors in the peripheral

  5. Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

    Directory of Open Access Journals (Sweden)

    Bryan Holland

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

  6. Molecular Cloning and Nucleotide Sequence of the Gene Encoding the Major Peptidoglycan Hydrolase of Lactococcus lactis, a Muramidase Needed for Cell Separation

    NARCIS (Netherlands)

    Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.

    A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,

  7. The MAP kinase-encoding gene MgFus3 of the non-appressorium phytopathogen Mycosphaerella graminicola is required for penetration and in vitro pycnidia formation

    NARCIS (Netherlands)

    Cousin, A.; Mehrabi, R.; Guilleroux, M.; Dufresne, M.; Lee, van der T.A.J.; Waalwijk, C.; Langin, T.; Kema, G.H.J.


    In eukaryotes, a family of serine/threonine protein kinases known as mitogen-activated protein kinases (MAPKs) is involved in the transduction of a variety of extracellular signals and in the regulation of growth and development. We identified a MAPK-encoding gene in Mycosphaerella graminicola

  8. The gene encoding the melanin-concentrating hormone receptor 1 is associated with schizophrenia in a Danish case-control sample

    DEFF Research Database (Denmark)

    Demontis, Ditte; Nyegaard, Mette; Christensen, Jane Hvarregaard


    OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...

  9. Molecular and functional characterization of the kstD2 gene of Rhodococcus erythropolis SQ1 encoding a second 3-ketosteroid Δ1-dehydrogenase isoenzyme

    NARCIS (Netherlands)

    Geize, Robert van der; Hessels, Gerda I.; Dijkhuizen, Lubbert


    Previously, Rhodococcus erythropolis SQ1 kstD, encoding ketosteroid Δ1-dehydrogenase (KSTD1) was characterized. Surprisingly, a kstD gene deletion mutant (strain RG1) grew normally on steroids. UV mutagenesis of strain RG1 allowed isolation of strains (e.g. strain RG1-UV29) unable to perform the


    NARCIS (Netherlands)



    The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or

  11. C21ORF105, A chromosome 21-encoded mRNA, is nog a discriminative marker gene for prediction of Down sydrome in maternal plasma

    NARCIS (Netherlands)

    Go, A.T.J.I.; Visser, A.; Mulders, M.A.; Twisk, J.W.R.; Blankenstein, M.A.; van Vugt, J.M.G.; Oudejans, C.B.M.


    Objectives: The presence and detectability of placental mRNA in maternal plasma opens possibilities for the development of non-invasive prenatal diagnostic tests. In this study, we tested C21orf105, a chromosome 2!-encoded, placentally expressed gene, in maternal plasma of women carrying a fetus

  12. Cloning of the gene encoding Streptococcin A-FF22, a novel lantibiotic produced by Streptococcus pyogenes, and determination of its nucleotide sequence.


    Hynes, W L; Ferretti, J J; Tagg, J R


    Streptococcin A-FF22 (SA-FF22) is a lantibiotic produced by Streptococcus pyogenes FF22. The nucleotide sequence of the SA-FF22 structural gene (scnA) was determined and shown to encode a 51-amino-acid prepeptide. The proteolytic processing site of the SA-FF22 prepeptide differs from that which characterizes other type A lantibiotics.

  13. Construction of a genetically modified wine yeast strain expressing the Aspergillus aculeatus rhaA gene, encoding an -L-Rhamnosidase of enological interest

    NARCIS (Netherlands)

    Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.


    The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain

  14. The L83L ORF of African swine fever virus strain Georgia encodes for a non-essential gene that interacts with host protein IL-1ß (United States)

    African swine fever virus (ASFV) causes a contagious and frequently lethal disease of pigs that produces significant economic consequences to the swine industry. ASFV genome encodes for more than 150 genes, but only a few of them have been studied in detail. Here we report the characterization of op...

  15. The bchU gene of Chlorobium tepidum encodes the C-20 methyltransferase in bacteriochlorophyll c biosynthesis

    DEFF Research Database (Denmark)

    Maresca, Julia A; Gomez Maqueo Chew, Aline; Ponsatí, Marta Ros


    Bacteriochlorophylls (BChls) c and d, two of the major light-harvesting pigments in photosynthetic green sulfur bacteria, differ only by the presence of a methyl group at the C-20 methine bridge position in BChl c. A gene potentially encoding the C-20 methyltransferase, bchU, was identified...

  16. pEOC01: a plasmid from Pediococcus acidilactici which encodes an identical streptomycin resistance (aadE) gene to that found in Campylobacter jejuni. (United States)

    O'Connor, E B; O'Sullivan, O; Stanton, C; Danielsen, M; Simpson, P J; Callanan, M J; Ross, R P; Hill, C


    The complete nucleotide sequence of pEOC01, a plasmid (11,661 bp) from Pediococcus acidilactici NCIMB 6990 encoding resistance to clindamycin, erythromycin, and streptomycin was determined. The plasmid, which also replicates in Lactococcus and Lactobacillus species contains 16 putative open reading frames (ORFs), including regions annotated to encode replication, plasmid maintenance and multidrug resistance functions. Based on an analysis the plasmid replicates via a theta replicating mechanism closely related to those of many larger Streptococcus and Enterococcus plasmids. Interestingly, genes homologous to a toxin/antitoxin plasmid maintenance system are present and are highly similar to the omega-epsilon-zeta operon of Streptococcus plasmids. The plasmid contains two putative antibiotic resistance homologs, an ermB gene encoding erythromycin and clindamycin resistance, and a streptomycin resistance gene, aadE. Of particular note is the aadE gene which holds 100% identity to an aadE gene found in Campylobacter jejuni plasmid but which probably originated from a Gram-positive source. This observation is significant in that it provides evidence for recent horizontal transfer of streptomycin resistance from a lactic acid bacterium to a Gram-negative intestinal pathogen and as such infers a role for such plasmids for dissemination of antibiotic resistance genes possibly in the human gut.